WorldWideScience

Sample records for gene duplication conservation

  1. Zebrafish IGF genes: gene duplication, conservation and divergence, and novel roles in midline and notochord development.

    Directory of Open Access Journals (Sweden)

    Shuming Zou

    Full Text Available Insulin-like growth factors (IGFs are key regulators of development, growth, and longevity. In most vertebrate species including humans, there is one IGF-1 gene and one IGF-2 gene. Here we report the identification and functional characterization of 4 distinct IGF genes (termed as igf-1a, -1b, -2a, and -2b in zebrafish. These genes encode 4 structurally distinct and functional IGF peptides. IGF-1a and IGF-2a mRNAs were detected in multiple tissues in adult fish. IGF-1b mRNA was detected only in the gonad and IGF-2b mRNA only in the liver. Functional analysis showed that all 4 IGFs caused similar developmental defects but with different potencies. Many of these embryos had fully or partially duplicated notochords, suggesting that an excess of IGF signaling causes defects in the midline formation and an expansion of the notochord. IGF-2a, the most potent IGF, was analyzed in depth. IGF-2a expression caused defects in the midline formation and expansion of the notochord but it did not alter the anterior neural patterning. These results not only provide new insights into the functional conservation and divergence of the multiple igf genes but also reveal a novel role of IGF signaling in midline formation and notochord development in a vertebrate model.

  2. Duplication of the IGFBP-2 gene in teleost fish: protein structure and functionality conservation and gene expression divergence.

    Directory of Open Access Journals (Sweden)

    Jianfeng Zhou

    Full Text Available BACKGROUND: Insulin-like growth factor binding protein-2 (IGFBP-2 is a secreted protein that binds and regulates IGF actions in controlling growth, development, reproduction, and aging. Elevated expression of IGFBP-2 is often associated with progression of many types of cancers. METHODOLOGY/PRINCIPAL FINDINGS: We report the identification and characterization of two IGFBP-2 genes in zebrafish and four other teleost fish. Comparative genomics and structural analyses suggest that they are co-orthologs of the human IGFBP-2 gene. Biochemical assays show that both zebrafish igfbp-2a and -2b encode secreted proteins that bind IGFs. These two genes exhibit distinct spatiotemporal expression patterns. During embryogenesis, IGFBP-2a mRNA is initially detected in the lens, then in the brain boundary vasculature, and subsequently becomes highly expressed in the liver. In the adult stage, liver has the highest levels of IGFBP-2a mRNA, followed by the brain. Low levels of IGFBP-2a mRNA were detected in muscle and in the gonad in male adults only. IGFBP-2b mRNA is detected initially in all tissues at low levels, but later becomes abundant in the liver. In adult males, IGFBP-2b mRNA is only detected in the liver. In adult females, it is also found in the gut, kidney, ovary, and muscle. To gain insights into how the IGFBP-2 genes may have evolved through partitioning of ancestral functions, functional and mechanistic studies were carried out. Expression of zebrafish IGFBP-2a and -2b caused significant decreases in the growth and developmental rates and their effects are comparable to that of human IGFBP-2. IGFBP-2 mutants with altered IGF binding-, RGD-, and heparin-binding sites were generated and their actions examined. While mutating the RGD and heparin binding sites had little effect, altering the IGF binding site abolished its biological activity. CONCLUSIONS/SIGNIFICANCE: These results suggest that IGFBP-2 is a conserved regulatory protein and it inhibits

  3. A conserved segmental duplication within ELA.

    Science.gov (United States)

    Brinkmeyer-Langford, C L; Murphy, W J; Childers, C P; Skow, L C

    2010-12-01

    The assembled genomic sequence of the horse major histocompatibility complex (MHC) (equine lymphocyte antigen, ELA) is very similar to the homologous human HLA, with the notable exception of a large segmental duplication at the boundary of ELA class I and class III that is absent in HLA. The segmental duplication consists of a ∼ 710 kb region of at least 11 repeated blocks: 10 blocks each contain an MHC class I-like sequence and the helicase domain portion of a BAT1-like sequence, and the remaining unit contains the full-length BAT1 gene. Similar genomic features were found in other Perissodactyls, indicating an ancient origin, which is consistent with phylogenetic analyses. Reverse-transcriptase PCR (RT-PCR) of mRNA from peripheral white blood cells of healthy and chronically or acutely infected horses detected transcription from predicted open reading frames in several of the duplicated blocks. This duplication is not present in the sequenced MHCs of most other mammals, although a similar feature at the same relative position is present in the feline MHC (FLA). Striking sequence conservation throughout Perissodactyl evolution is consistent with a functional role for at least some of the genes included within this segmental duplication. © 2010 The Authors, Journal compilation © 2010 Stichting International Foundation for Animal Genetics.

  4. Single-copy genes define a conserved order between rice and wheat for understanding differences caused by duplication, deletion, and transposition of genes.

    Science.gov (United States)

    Singh, Nagendra K; Dalal, Vivek; Batra, Kamlesh; Singh, Binay K; Chitra, G; Singh, Archana; Ghazi, Irfan A; Yadav, Mahavir; Pandit, Awadhesh; Dixit, Rekha; Singh, Pradeep K; Singh, Harvinder; Koundal, Kirpa R; Gaikwad, Kishor; Mohapatra, Trilochan; Sharma, Tilak R

    2007-01-01

    The high-quality rice genome sequence is serving as a reference for comparative genome analysis in crop plants, especially cereals. However, early comparisons with bread wheat showed complex patterns of conserved synteny (gene content) and colinearity (gene order). Here, we show the presence of ancient duplicated segments in the progenitor of wheat, which were first identified in the rice genome. We also show that single-copy (SC) rice genes, those representing unique matches with wheat expressed sequence tag (EST) unigene contigs in the whole rice genome, show more than twice the proportion of genes mapping to syntenic wheat chromosome as compared to the multicopy (MC) or duplicated rice genes. While 58.7% of the 1,244 mapped SC rice genes were located in single syntenic wheat chromosome groups, the remaining 41.3% were distributed randomly to the other six non-syntenic wheat groups. This could only be explained by a background dispersal of genes in the genome through transposition or other unknown mechanism. The breakdown of rice-wheat synteny due to such transpositions was much greater near the wheat centromeres. Furthermore, the SC rice genes revealed a conserved primordial gene order that gives clues to the origin of rice and wheat chromosomes from a common ancestor through polyploidy, aneuploidy, centromeric fusions, and translocations. Apart from the bin-mapped wheat EST contigs, we also compared 56,298 predicted rice genes with 39,813 wheat EST contigs assembled from 409,765 EST sequences and identified 7,241 SC rice gene homologs of wheat. Based on the conserved colinearity of 1,063 mapped SC rice genes across the bins of individual wheat chromosomes, we predicted the wheat bin location of 6,178 unmapped SC rice gene homologs and validated the location of 213 of these in the telomeric bins of 21 wheat chromosomes with 35.4% initial success. This opens up the possibility of directed mapping of a large number of conserved SC rice gene homologs in wheat

  5. Effect of Duplicate Genes on Mouse Genetic Robustness: An Update

    Directory of Open Access Journals (Sweden)

    Zhixi Su

    2014-01-01

    Full Text Available In contrast to S. cerevisiae and C. elegans, analyses based on the current knockout (KO mouse phenotypes led to the conclusion that duplicate genes had almost no role in mouse genetic robustness. It has been suggested that the bias of mouse KO database toward ancient duplicates may possibly cause this knockout duplicate puzzle, that is, a very similar proportion of essential genes (PE between duplicate genes and singletons. In this paper, we conducted an extensive and careful analysis for the mouse KO phenotype data and corroborated a strong effect of duplicate genes on mouse genetics robustness. Moreover, the effect of duplicate genes on mouse genetic robustness is duplication-age dependent, which holds after ruling out the potential confounding effect from coding-sequence conservation, protein-protein connectivity, functional bias, or the bias of duplicates generated by whole genome duplication (WGD. Our findings suggest that two factors, the sampling bias toward ancient duplicates and very ancient duplicates with a proportion of essential genes higher than that of singletons, have caused the mouse knockout duplicate puzzle; meanwhile, the effect of genetic buffering may be correlated with sequence conservation as well as protein-protein interactivity.

  6. Duplicability of self-interacting human genes.

    LENUS (Irish Health Repository)

    Pérez-Bercoff, Asa

    2010-01-01

    BACKGROUND: There is increasing interest in the evolution of protein-protein interactions because this should ultimately be informative of the patterns of evolution of new protein functions within the cell. One model proposes that the evolution of new protein-protein interactions and protein complexes proceeds through the duplication of self-interacting genes. This model is supported by data from yeast. We examined the relationship between gene duplication and self-interaction in the human genome. RESULTS: We investigated the patterns of self-interaction and duplication among 34808 interactions encoded by 8881 human genes, and show that self-interacting proteins are encoded by genes with higher duplicability than genes whose proteins lack this type of interaction. We show that this result is robust against the system used to define duplicate genes. Finally we compared the presence of self-interactions amongst proteins whose genes have duplicated either through whole-genome duplication (WGD) or small-scale duplication (SSD), and show that the former tend to have more interactions in general. After controlling for age differences between the two sets of duplicates this result can be explained by the time since the gene duplication. CONCLUSIONS: Genes encoding self-interacting proteins tend to have higher duplicability than proteins lacking self-interactions. Moreover these duplicate genes have more often arisen through whole-genome rather than small-scale duplication. Finally, self-interacting WGD genes tend to have more interaction partners in general in the PIN, which can be explained by their overall greater age. This work adds to our growing knowledge of the importance of contextual factors in gene duplicability.

  7. The duplicated genes database: identification and functional annotation of co-localised duplicated genes across genomes.

    Directory of Open Access Journals (Sweden)

    Marion Ouedraogo

    Full Text Available BACKGROUND: There has been a surge in studies linking genome structure and gene expression, with special focus on duplicated genes. Although initially duplicated from the same sequence, duplicated genes can diverge strongly over evolution and take on different functions or regulated expression. However, information on the function and expression of duplicated genes remains sparse. Identifying groups of duplicated genes in different genomes and characterizing their expression and function would therefore be of great interest to the research community. The 'Duplicated Genes Database' (DGD was developed for this purpose. METHODOLOGY: Nine species were included in the DGD. For each species, BLAST analyses were conducted on peptide sequences corresponding to the genes mapped on a same chromosome. Groups of duplicated genes were defined based on these pairwise BLAST comparisons and the genomic location of the genes. For each group, Pearson correlations between gene expression data and semantic similarities between functional GO annotations were also computed when the relevant information was available. CONCLUSIONS: The Duplicated Gene Database provides a list of co-localised and duplicated genes for several species with the available gene co-expression level and semantic similarity value of functional annotation. Adding these data to the groups of duplicated genes provides biological information that can prove useful to gene expression analyses. The Duplicated Gene Database can be freely accessed through the DGD website at http://dgd.genouest.org.

  8. Gene duplication, silencing and expression alteration govern the molecular evolution of PRC2 genes in plants.

    Science.gov (United States)

    Furihata, Hazuka Y; Suenaga, Kazuya; Kawanabe, Takahiro; Yoshida, Takanori; Kawabe, Akira

    2016-10-13

    PRC2 genes were analyzed for their number of gene duplications, d N /d S ratios and expression patterns among Brassicaceae and Gramineae species. Although both amino acid sequences and copy number of the PRC2 genes were generally well conserved in both Brassicaceae and Gramineae species, we observed that some rapidly evolving genes experienced duplications and expression pattern changes. After multiple duplication events, all but one or two of the duplicated copies tend to be silenced. Silenced copies were reactivated in the endosperm and showed ectopic expression in developing seeds. The results indicated that rapid evolution of some PRC2 genes is initially caused by a relaxation of selective constraint following the gene duplication events. Several loci could become maternally expressed imprinted genes and acquired functional roles in the endosperm.

  9. Evolutionary Fates and Dynamic Functionalization of Young Duplicate Genes in Arabidopsis Genomes.

    Science.gov (United States)

    Wang, Jun; Tao, Feng; Marowsky, Nicholas C; Fan, Chuanzhu

    2016-09-01

    Gene duplication is a primary means to generate genomic novelties, playing an essential role in speciation and adaptation. Particularly in plants, a high abundance of duplicate genes has been maintained for significantly long periods of evolutionary time. To address the manner in which young duplicate genes were derived primarily from small-scale gene duplication and preserved in plant genomes and to determine the underlying driving mechanisms, we generated transcriptomes to produce the expression profiles of five tissues in Arabidopsis thaliana and the closely related species Arabidopsis lyrata and Capsella rubella Based on the quantitative analysis metrics, we investigated the evolutionary processes of young duplicate genes in Arabidopsis. We determined that conservation, neofunctionalization, and specialization are three main evolutionary processes for Arabidopsis young duplicate genes. We explicitly demonstrated the dynamic functionalization of duplicate genes along the evolutionary time scale. Upon origination, duplicates tend to maintain their ancestral functions; but as they survive longer, they might be likely to develop distinct and novel functions. The temporal evolutionary processes and functionalization of plant duplicate genes are associated with their ancestral functions, dynamic DNA methylation levels, and histone modification abundances. Furthermore, duplicate genes tend to be initially expressed in pollen and then to gain more interaction partners over time. Altogether, our study provides novel insights into the dynamic retention processes of young duplicate genes in plant genomes. © 2016 American Society of Plant Biologists. All rights reserved.

  10. Evolutionary Fates and Dynamic Functionalization of Young Duplicate Genes in Arabidopsis Genomes1[OPEN

    Science.gov (United States)

    Wang, Jun; Tao, Feng; Marowsky, Nicholas C.; Fan, Chuanzhu

    2016-01-01

    Gene duplication is a primary means to generate genomic novelties, playing an essential role in speciation and adaptation. Particularly in plants, a high abundance of duplicate genes has been maintained for significantly long periods of evolutionary time. To address the manner in which young duplicate genes were derived primarily from small-scale gene duplication and preserved in plant genomes and to determine the underlying driving mechanisms, we generated transcriptomes to produce the expression profiles of five tissues in Arabidopsis thaliana and the closely related species Arabidopsis lyrata and Capsella rubella. Based on the quantitative analysis metrics, we investigated the evolutionary processes of young duplicate genes in Arabidopsis. We determined that conservation, neofunctionalization, and specialization are three main evolutionary processes for Arabidopsis young duplicate genes. We explicitly demonstrated the dynamic functionalization of duplicate genes along the evolutionary time scale. Upon origination, duplicates tend to maintain their ancestral functions; but as they survive longer, they might be likely to develop distinct and novel functions. The temporal evolutionary processes and functionalization of plant duplicate genes are associated with their ancestral functions, dynamic DNA methylation levels, and histone modification abundances. Furthermore, duplicate genes tend to be initially expressed in pollen and then to gain more interaction partners over time. Altogether, our study provides novel insights into the dynamic retention processes of young duplicate genes in plant genomes. PMID:27485883

  11. The odds of duplicate gene persistence after polyploidization

    Directory of Open Access Journals (Sweden)

    Chain Frédéric JJ

    2011-12-01

    Full Text Available Abstract Background Gene duplication is an important biological phenomenon associated with genomic redundancy, degeneration, specialization, innovation, and speciation. After duplication, both copies continue functioning when natural selection favors duplicated protein function or expression, or when mutations make them functionally distinct before one copy is silenced. Results Here we quantify the degree to which genetic parameters related to gene expression, molecular evolution, and gene structure in a diploid frog - Silurana tropicalis - influence the odds of functional persistence of orthologous duplicate genes in a closely related tetraploid species - Xenopus laevis. Using public databases and 454 pyrosequencing, we obtained genetic and expression data from S. tropicalis orthologs of 3,387 X. laevis paralogs and 4,746 X. laevis singletons - the most comprehensive dataset for African clawed frogs yet analyzed. Using logistic regression, we demonstrate that the most important predictors of the odds of duplicate gene persistence in the tetraploid species are the total gene expression level and evenness of expression across tissues and development in the diploid species. Slow protein evolution and information density (fewer exons, shorter introns in the diploid are also positively correlated with duplicate gene persistence in the tetraploid. Conclusions Our findings suggest that a combination of factors contribute to duplicate gene persistence following whole genome duplication, but that the total expression level and evenness of expression across tissues and through development before duplication are most important. We speculate that these parameters are useful predictors of duplicate gene longevity after whole genome duplication in other taxa.

  12. Exon duplications in the ATP7A gene

    DEFF Research Database (Denmark)

    Mogensen, Mie; Skjørringe, Tina; Kodama, Hiroko

    2011-01-01

    the identified duplicated fragments originated from a single or from two different X-chromosomes, polymorphic markers located in the duplicated fragments were analyzed. RESULTS: Partial ATP7A gene duplication was identified in 20 unrelated patients including one patient with Occipital Horn Syndrome (OHS...

  13. Functional requirements driving the gene duplication in 12 Drosophila species.

    Science.gov (United States)

    Zhong, Yan; Jia, Yanxiao; Gao, Yang; Tian, Dacheng; Yang, Sihai; Zhang, Xiaohui

    2013-08-15

    Gene duplication supplies the raw materials for novel gene functions and many gene families arisen from duplication experience adaptive evolution. Most studies of young duplicates have focused on mammals, especially humans, whereas reports describing their genome-wide evolutionary patterns across the closely related Drosophila species are rare. The sequenced 12 Drosophila genomes provide the opportunity to address this issue. In our study, 3,647 young duplicate gene families were identified across the 12 Drosophila species and three types of expansions, species-specific, lineage-specific and complex expansions, were detected in these gene families. Our data showed that the species-specific young duplicate genes predominated (86.6%) over the other two types. Interestingly, many independent species-specific expansions in the same gene family have been observed in many species, even including 11 or 12 Drosophila species. Our data also showed that the functional bias observed in these young duplicate genes was mainly related to responses to environmental stimuli and biotic stresses. This study reveals the evolutionary patterns of young duplicates across 12 Drosophila species on a genomic scale. Our results suggest that convergent evolution acts on young duplicate genes after the species differentiation and adaptive evolution may play an important role in duplicate genes for adaption to ecological factors and environmental changes in Drosophila.

  14. Circular DNA Intermediate in the Duplication of Nile Tilapia vasa Genes

    Science.gov (United States)

    Fujimura, Koji; Conte, Matthew A.; Kocher, Thomas D.

    2011-01-01

    vasa is a highly conserved RNA helicase involved in animal germ cell development. Among vertebrate species, it is typically present as a single copy per genome. Here we report the isolation and sequencing of BAC clones for Nile tilapia vasa genes. Contrary to a previous report that Nile tilapia have a single copy of the vasa gene, we find evidence for at least three vasa gene loci. The vasa gene locus was duplicated from the original site and integrated into two distant novel sites. For one of these insertions we find evidence that the duplication was mediated by a circular DNA intermediate. This mechanism of gene duplication may explain the origin of isolated gene duplicates during the evolution of fish genomes. These data provide a foundation for studying the role of multiple vasa genes in the development of tilapia gonads, and will contribute to investigations of the molecular mechanisms of sex determination and evolution in cichlid fishes. PMID:22216289

  15. Maintenance and Loss of Duplicated Genes by Dosage Subfunctionalization.

    Science.gov (United States)

    Gout, Jean-Francois; Lynch, Michael

    2015-08-01

    Whole-genome duplications (WGDs) have contributed to gene-repertoire enrichment in many eukaryotic lineages. However, most duplicated genes are eventually lost and it is still unclear why some duplicated genes are evolutionary successful whereas others quickly turn to pseudogenes. Here, we show that dosage constraints are major factors opposing post-WGD gene loss in several Paramecium species that share a common ancestral WGD. We propose a model where a majority of WGD-derived duplicates preserve their ancestral function and are retained to produce enough of the proteins performing this same ancestral function. Under this model, the expression level of individual duplicated genes can evolve neutrally as long as they maintain a roughly constant summed expression, and this allows random genetic drift toward uneven contributions of the two copies to total expression. Our analysis suggests that once a high level of imbalance is reached, which can require substantial lengths of time, the copy with the lowest expression level contributes a small enough fraction of the total expression that selection no longer opposes its loss. Extension of our analysis to yeast species sharing a common ancestral WGD yields similar results, suggesting that duplicated-gene retention for dosage constraints followed by divergence in expression level and eventual deterministic gene loss might be a universal feature of post-WGD evolution. © The Author 2015. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  16. Local synteny and codon usage contribute to asymmetric sequence divergence of Saccharomyces cerevisiae gene duplicates

    Directory of Open Access Journals (Sweden)

    Bergthorsson Ulfar

    2011-09-01

    Full Text Available Abstract Background Duplicated genes frequently experience asymmetric rates of sequence evolution. Relaxed selective constraints and positive selection have both been invoked to explain the observation that one paralog within a gene-duplicate pair exhibits an accelerated rate of sequence evolution. In the majority of studies where asymmetric divergence has been established, there is no indication as to which gene copy, ancestral or derived, is evolving more rapidly. In this study we investigated the effect of local synteny (gene-neighborhood conservation and codon usage on the sequence evolution of gene duplicates in the S. cerevisiae genome. We further distinguish the gene duplicates into those that originated from a whole-genome duplication (WGD event (ohnologs versus small-scale duplications (SSD to determine if there exist any differences in their patterns of sequence evolution. Results For SSD pairs, the derived copy evolves faster than the ancestral copy. However, there is no relationship between rate asymmetry and synteny conservation (ancestral-like versus derived-like in ohnologs. mRNA abundance and optimal codon usage as measured by the CAI is lower in the derived SSD copies relative to ancestral paralogs. Moreover, in the case of ohnologs, the faster-evolving copy has lower CAI and lowered expression. Conclusions Together, these results suggest that relaxation of selection for codon usage and gene expression contribute to rate asymmetry in the evolution of duplicated genes and that in SSD pairs, the relaxation of selection stems from the loss of ancestral regulatory information in the derived copy.

  17. Gene Duplicability of Core Genes Is Highly Consistent across All Angiosperms.

    Science.gov (United States)

    Li, Zhen; Defoort, Jonas; Tasdighian, Setareh; Maere, Steven; Van de Peer, Yves; De Smet, Riet

    2016-02-01

    Gene duplication is an important mechanism for adding to genomic novelty. Hence, which genes undergo duplication and are preserved following duplication is an important question. It has been observed that gene duplicability, or the ability of genes to be retained following duplication, is a nonrandom process, with certain genes being more amenable to survive duplication events than others. Primarily, gene essentiality and the type of duplication (small-scale versus large-scale) have been shown in different species to influence the (long-term) survival of novel genes. However, an overarching view of "gene duplicability" is lacking, mainly due to the fact that previous studies usually focused on individual species and did not account for the influence of genomic context and the time of duplication. Here, we present a large-scale study in which we investigated duplicate retention for 9178 gene families shared between 37 flowering plant species, referred to as angiosperm core gene families. For most gene families, we observe a strikingly consistent pattern of gene duplicability across species, with gene families being either primarily single-copy or multicopy in all species. An intermediate class contains gene families that are often retained in duplicate for periods extending to tens of millions of years after whole-genome duplication, but ultimately appear to be largely restored to singleton status, suggesting that these genes may be dosage balance sensitive. The distinction between single-copy and multicopy gene families is reflected in their functional annotation, with single-copy genes being mainly involved in the maintenance of genome stability and organelle function and multicopy genes in signaling, transport, and metabolism. The intermediate class was overrepresented in regulatory genes, further suggesting that these represent putative dosage-balance-sensitive genes. © 2016 American Society of Plant Biologists. All rights reserved.

  18. Gene family size conservation is a good indicator of evolutionary rates.

    Science.gov (United States)

    Chen, Feng-Chi; Chen, Chiuan-Jung; Li, Wen-Hsiung; Chuang, Trees-Juen

    2010-08-01

    The evolution of duplicate genes has been a topic of broad interest. Here, we propose that the conservation of gene family size is a good indicator of the rate of sequence evolution and some other biological properties. By comparing the human-chimpanzee-macaque orthologous gene families with and without family size conservation, we demonstrate that genes with family size conservation evolve more slowly than those without family size conservation. Our results further demonstrate that both family expansion and contraction events may accelerate gene evolution, resulting in elevated evolutionary rates in the genes without family size conservation. In addition, we show that the duplicate genes with family size conservation evolve significantly more slowly than those without family size conservation. Interestingly, the median evolutionary rate of singletons falls in between those of the above two types of duplicate gene families. Our results thus suggest that the controversy on whether duplicate genes evolve more slowly than singletons can be resolved when family size conservation is taken into consideration. Furthermore, we also observe that duplicate genes with family size conservation have the highest level of gene expression/expression breadth, the highest proportion of essential genes, and the lowest gene compactness, followed by singletons and then by duplicate genes without family size conservation. Such a trend accords well with our observations of evolutionary rates. Our results thus point to the importance of family size conservation in the evolution of duplicate genes.

  19. Gene Duplicability of Core Genes Is Highly Consistent across All Angiosperms[OPEN

    Science.gov (United States)

    Li, Zhen; Van de Peer, Yves; De Smet, Riet

    2016-01-01

    Gene duplication is an important mechanism for adding to genomic novelty. Hence, which genes undergo duplication and are preserved following duplication is an important question. It has been observed that gene duplicability, or the ability of genes to be retained following duplication, is a nonrandom process, with certain genes being more amenable to survive duplication events than others. Primarily, gene essentiality and the type of duplication (small-scale versus large-scale) have been shown in different species to influence the (long-term) survival of novel genes. However, an overarching view of “gene duplicability” is lacking, mainly due to the fact that previous studies usually focused on individual species and did not account for the influence of genomic context and the time of duplication. Here, we present a large-scale study in which we investigated duplicate retention for 9178 gene families shared between 37 flowering plant species, referred to as angiosperm core gene families. For most gene families, we observe a strikingly consistent pattern of gene duplicability across species, with gene families being either primarily single-copy or multicopy in all species. An intermediate class contains gene families that are often retained in duplicate for periods extending to tens of millions of years after whole-genome duplication, but ultimately appear to be largely restored to singleton status, suggesting that these genes may be dosage balance sensitive. The distinction between single-copy and multicopy gene families is reflected in their functional annotation, with single-copy genes being mainly involved in the maintenance of genome stability and organelle function and multicopy genes in signaling, transport, and metabolism. The intermediate class was overrepresented in regulatory genes, further suggesting that these represent putative dosage-balance-sensitive genes. PMID:26744215

  20. Ascorbate peroxidase-related (APx-R) is not a duplicable gene.

    Science.gov (United States)

    Dunand, Christophe; Mathé, Catherine; Lazzarotto, Fernanda; Margis, Rogério; Margis-Pinheiro, Marcia

    2011-12-01

    Phylogenetic, genomic and functional analyses have allowed the identification of a new class of putative heme peroxidases, so called APx-R (APx-Related). These new class, mainly present in the green lineage (including green algae and land plants), can also be detected in other unicellular chloroplastic organisms. Except for recent polyploid organisms, only single-copy of APx-R gene was detected in each genome, suggesting that the majority of the APx-R extra-copies were lost after chromosomal or segmental duplications. In a similar way, most APx-R co-expressed genes in Arabidopsis genome do not have conserved extra-copies after chromosomal duplications and are predicted to be localized in organelles, as are the APx-R. The member of this gene network can be considered as unique gene, well conserved through the evolution due to a strong negative selection pressure and a low evolution rate. © 2011 Landes Bioscience

  1. FUNCTIONAL SPECIALIZATION OF DUPLICATED FLAVONOID BIOSYNTHESIS GENES IN WHEAT

    Directory of Open Access Journals (Sweden)

    Khlestkina E.

    2012-08-01

    Full Text Available Gene duplication followed by subfunctionalization and neofunctionalization is of a great evolutionary importance. In plant genomes, duplicated genes may result from either polyploidization (homoeologous genes or segmental chromosome duplications (paralogous genes. In allohexaploid wheat Triticum aestivum L. (2n=6x=42, genome BBAADD, both homoeologous and paralogous copies were found for the regulatory gene Myc encoding MYC-like transcriptional factor in the biosynthesis of flavonoid pigments, anthocyanins, and for the structural gene F3h encoding one of the key enzymes of flavonoid biosynthesis, flavanone 3-hydroxylase. From the 5 copies (3 homoeologous and 2 paralogous of the Myc gene found in T. aestivum, only one plays a regulatory role in anthocyanin biosynthesis, interacting complementary with another transcriptional factor (MYB-like to confer purple pigmentation of grain pericarp in wheat. The role and functionality of the other 4 copies of the Myc gene remain unknown. From the 4 functional copies of the F3h gene in T. aestivum, three homoeologues have similar function. They are expressed in wheat organs colored with anthocyanins or in the endosperm, participating there in biosynthesis of uncolored flavonoid substances. The fourth copy (the B-genomic paralogue is transcribed neither in wheat organs colored with anthocyanins nor in seeds, however, it’s expression has been noticed in roots of aluminium-stressed plants, where the three homoeologous copies are not active. Functional diversification of the duplicated flavonoid biosynthesis genes in wheat may be a reason for maintenance of the duplicated copies and preventing them from pseudogenization.The study was supported by RFBR (11-04-92707. We also thank Ms. Galina Generalova for technical assistance.

  2. Whole genome duplications and expansion of the vertebrate GATA transcription factor gene family

    Directory of Open Access Journals (Sweden)

    Bowerman Bruce

    2009-08-01

    Full Text Available Abstract Background GATA transcription factors influence many developmental processes, including the specification of embryonic germ layers. The GATA gene family has significantly expanded in many animal lineages: whereas diverse cnidarians have only one GATA transcription factor, six GATA genes have been identified in many vertebrates, five in many insects, and eleven to thirteen in Caenorhabditis nematodes. All bilaterian animal genomes have at least one member each of two classes, GATA123 and GATA456. Results We have identified one GATA123 gene and one GATA456 gene from the genomic sequence of two invertebrate deuterostomes, a cephalochordate (Branchiostoma floridae and a hemichordate (Saccoglossus kowalevskii. We also have confirmed the presence of six GATA genes in all vertebrate genomes, as well as additional GATA genes in teleost fish. Analyses of conserved sequence motifs and of changes to the exon-intron structure, and molecular phylogenetic analyses of these deuterostome GATA genes support their origin from two ancestral deuterostome genes, one GATA 123 and one GATA456. Comparison of the conserved genomic organization across vertebrates identified eighteen paralogous gene families linked to multiple vertebrate GATA genes (GATA paralogons, providing the strongest evidence yet for expansion of vertebrate GATA gene families via genome duplication events. Conclusion From our analysis, we infer the evolutionary birth order and relationships among vertebrate GATA transcription factors, and define their expansion via multiple rounds of whole genome duplication events. As the genomes of four independent invertebrate deuterostome lineages contain single copy GATA123 and GATA456 genes, we infer that the 0R (pre-genome duplication invertebrate deuterostome ancestor also had two GATA genes, one of each class. Synteny analyses identify duplications of paralogous chromosomal regions (paralogons, from single ancestral vertebrate GATA123 and GATA456

  3. Conservation, duplication, and loss of the Tor signaling pathway in the fungal kingdom

    Directory of Open Access Journals (Sweden)

    Heitman Joseph

    2010-09-01

    Full Text Available Abstract Background The nutrient-sensing Tor pathway governs cell growth and is conserved in nearly all eukaryotic organisms from unicellular yeasts to multicellular organisms, including humans. Tor is the target of the immunosuppressive drug rapamycin, which in complex with the prolyl isomerase FKBP12 inhibits Tor functions. Rapamycin is a gold standard drug for organ transplant recipients that was approved by the FDA in 1999 and is finding additional clinical indications as a chemotherapeutic and antiproliferative agent. Capitalizing on the plethora of recently sequenced genomes we have conducted comparative genomic studies to annotate the Tor pathway throughout the fungal kingdom and related unicellular opisthokonts, including Monosiga brevicollis, Salpingoeca rosetta, and Capsaspora owczarzaki. Results Interestingly, the Tor signaling cascade is absent in three microsporidian species with available genome sequences, the only known instance of a eukaryotic group lacking this conserved pathway. The microsporidia are obligate intracellular pathogens with highly reduced genomes, and we hypothesize that they lost the Tor pathway as they adapted and streamlined their genomes for intracellular growth in a nutrient-rich environment. Two TOR paralogs are present in several fungal species as a result of either a whole genome duplication or independent gene/segmental duplication events. One such event was identified in the amphibian pathogen Batrachochytrium dendrobatidis, a chytrid responsible for worldwide global amphibian declines and extinctions. Conclusions The repeated independent duplications of the TOR gene in the fungal kingdom might reflect selective pressure acting upon this kinase that populates two proteinaceous complexes with different cellular roles. These comparative genomic analyses illustrate the evolutionary trajectory of a central nutrient-sensing cascade that enables diverse eukaryotic organisms to respond to their natural

  4. A role for gene duplication and natural variation of gene expression in the evolution of metabolism.

    Directory of Open Access Journals (Sweden)

    Daniel J Kliebenstein

    Full Text Available BACKGROUND: Most eukaryotic genomes have undergone whole genome duplications during their evolutionary history. Recent studies have shown that the function of these duplicated genes can diverge from the ancestral gene via neo- or sub-functionalization within single genotypes. An additional possibility is that gene duplicates may also undergo partitioning of function among different genotypes of a species leading to genetic differentiation. Finally, the ability of gene duplicates to diverge may be limited by their biological function. METHODOLOGY/PRINCIPAL FINDINGS: To test these hypotheses, I estimated the impact of gene duplication and metabolic function upon intraspecific gene expression variation of segmental and tandem duplicated genes within Arabidopsis thaliana. In all instances, the younger tandem duplicated genes showed higher intraspecific gene expression variation than the average Arabidopsis gene. Surprisingly, the older segmental duplicates also showed evidence of elevated intraspecific gene expression variation albeit typically lower than for the tandem duplicates. The specific biological function of the gene as defined by metabolic pathway also modulated the level of intraspecific gene expression variation. The major energy metabolism and biosynthetic pathways showed decreased variation, suggesting that they are constrained in their ability to accumulate gene expression variation. In contrast, a major herbivory defense pathway showed significantly elevated intraspecific variation suggesting that it may be under pressure to maintain and/or generate diversity in response to fluctuating insect herbivory pressures. CONCLUSION: These data show that intraspecific variation in gene expression is facilitated by an interaction of gene duplication and biological activity. Further, this plays a role in controlling diversity of plant metabolism.

  5. Gene duplication as a major force in evolution

    Indian Academy of Sciences (India)

    Based on whole-genome analysis of Arabidopsis thaliana, there is compelling evidence that angiosperms underwent two whole-genome duplication events early during their evolutionary history. Recent studies have shown that these events were crucial for creation of many important developmental and regulatory genes ...

  6. Functional characterization of duplicated Suppressor of Overexpression of Constans 1-like genes in petunia.

    Science.gov (United States)

    Preston, Jill C; Jorgensen, Stacy A; Jha, Suryatapa G

    2014-01-01

    Flowering time is strictly controlled by a combination of internal and external signals that match seed set with favorable environmental conditions. In the model plant species Arabidopsis thaliana (Brassicaceae), many of the genes underlying development and evolution of flowering have been discovered. However, much remains unknown about how conserved the flowering gene networks are in plants with different growth habits, gene duplication histories, and distributions. Here we functionally characterize three homologs of the flowering gene Suppressor Of Overexpression of Constans 1 (SOC1) in the short-lived perennial Petunia hybrida (petunia, Solanaceae). Similar to A. thaliana soc1 mutants, co-silencing of duplicated petunia SOC1-like genes results in late flowering. This phenotype is most severe when all three SOC1-like genes are silenced. Furthermore, expression levels of the SOC1-like genes Unshaven (UNS) and Floral Binding Protein 21 (FBP21), but not FBP28, are positively correlated with developmental age. In contrast to A. thaliana, petunia SOC1-like gene expression did not increase with longer photoperiods, and FBP28 transcripts were actually more abundant under short days. Despite evidence of functional redundancy, differential spatio-temporal expression data suggest that SOC1-like genes might fine-tune petunia flowering in response to photoperiod and developmental stage. This likely resulted from modification of SOC1-like gene regulatory elements following recent duplication, and is a possible mechanism to ensure flowering under both inductive and non-inductive photoperiods.

  7. Functional characterization of duplicated Suppressor of Overexpression of Constans 1-like genes in petunia.

    Directory of Open Access Journals (Sweden)

    Jill C Preston

    Full Text Available Flowering time is strictly controlled by a combination of internal and external signals that match seed set with favorable environmental conditions. In the model plant species Arabidopsis thaliana (Brassicaceae, many of the genes underlying development and evolution of flowering have been discovered. However, much remains unknown about how conserved the flowering gene networks are in plants with different growth habits, gene duplication histories, and distributions. Here we functionally characterize three homologs of the flowering gene Suppressor Of Overexpression of Constans 1 (SOC1 in the short-lived perennial Petunia hybrida (petunia, Solanaceae. Similar to A. thaliana soc1 mutants, co-silencing of duplicated petunia SOC1-like genes results in late flowering. This phenotype is most severe when all three SOC1-like genes are silenced. Furthermore, expression levels of the SOC1-like genes Unshaven (UNS and Floral Binding Protein 21 (FBP21, but not FBP28, are positively correlated with developmental age. In contrast to A. thaliana, petunia SOC1-like gene expression did not increase with longer photoperiods, and FBP28 transcripts were actually more abundant under short days. Despite evidence of functional redundancy, differential spatio-temporal expression data suggest that SOC1-like genes might fine-tune petunia flowering in response to photoperiod and developmental stage. This likely resulted from modification of SOC1-like gene regulatory elements following recent duplication, and is a possible mechanism to ensure flowering under both inductive and non-inductive photoperiods.

  8. Recombination facilitates neofunctionalization of duplicate genes via originalization

    Directory of Open Access Journals (Sweden)

    Huang Ren

    2010-06-01

    Full Text Available Abstract Background Recently originalization was proposed to be an effective way of duplicate-gene preservation, in which recombination provokes the high frequency of original (or wild-type allele on both duplicated loci. Because the high frequency of wild-type allele might drive the arising and accumulating of advantageous mutation, it is hypothesized that recombination might enlarge the probability of neofunctionalization (Pneo of duplicate genes. In this article this hypothesis has been tested theoretically. Results Results show that through originalization recombination might not only shorten mean time to neofunctionalizaiton, but also enlarge Pneo. Conclusions Therefore, recombination might facilitate neofunctionalization via originalization. Several extensive applications of these results on genomic evolution have been discussed: 1. Time to nonfunctionalization can be much longer than a few million generations expected before; 2. Homogenization on duplicated loci results from not only gene conversion, but also originalization; 3. Although the rate of advantageous mutation is much small compared with that of degenerative mutation, Pneo cannot be expected to be small.

  9. Gene duplication, tissue-specific gene expression and sexual conflict in stalk-eyed flies (Diopsidae).

    Science.gov (United States)

    Baker, Richard H; Narechania, Apurva; Johns, Philip M; Wilkinson, Gerald S

    2012-08-19

    Gene duplication provides an essential source of novel genetic material to facilitate rapid morphological evolution. Traits involved in reproduction and sexual dimorphism represent some of the fastest evolving traits in nature, and gene duplication is intricately involved in the origin and evolution of these traits. Here, we review genomic research on stalk-eyed flies (Diopsidae) that has been used to examine the extent of gene duplication and its role in the genetic architecture of sexual dimorphism. Stalk-eyed flies are remarkable because of the elongation of the head into long stalks, with the eyes and antenna laterally displaced at the ends of these stalks. Many species are strongly sexually dimorphic for eyespan, and these flies have become a model system for studying sexual selection. Using both expressed sequence tag and next-generation sequencing, we have established an extensive database of gene expression in the developing eye-antennal imaginal disc, the adult head and testes. Duplicated genes exhibit narrower expression patterns than non-duplicated genes, and the testes, in particular, provide an abundant source of gene duplication. Within somatic tissue, duplicated genes are more likely to be differentially expressed between the sexes, suggesting gene duplication may provide a mechanism for resolving sexual conflict.

  10. Signals of historical interlocus gene conversion in human segmental duplications.

    Directory of Open Access Journals (Sweden)

    Beth L Dumont

    Full Text Available Standard methods of DNA sequence analysis assume that sequences evolve independently, yet this assumption may not be appropriate for segmental duplications that exchange variants via interlocus gene conversion (IGC. Here, we use high quality multiple sequence alignments from well-annotated segmental duplications to systematically identify IGC signals in the human reference genome. Our analysis combines two complementary methods: (i a paralog quartet method that uses DNA sequence simulations to identify a statistical excess of sites consistent with inter-paralog exchange, and (ii the alignment-based method implemented in the GENECONV program. One-quarter (25.4% of the paralog families in our analysis harbor clear IGC signals by the quartet approach. Using GENECONV, we identify 1477 gene conversion tracks that cumulatively span 1.54 Mb of the genome. Our analyses confirm the previously reported high rates of IGC in subtelomeric regions and Y-chromosome palindromes, and identify multiple novel IGC hotspots, including the pregnancy specific glycoproteins and the neuroblastoma breakpoint gene families. Although the duplication history of a paralog family is described by a single tree, we show that IGC has introduced incredible site-to-site variation in the evolutionary relationships among paralogs in the human genome. Our findings indicate that IGC has left significant footprints in patterns of sequence diversity across segmental duplications in the human genome, out-pacing the contributions of single base mutation by orders of magnitude. Collectively, the IGC signals we report comprise a catalog that will provide a critical reference for interpreting observed patterns of DNA sequence variation across duplicated genomic regions, including targets of recent adaptive evolution in humans.

  11. Early vertebrate chromosome duplications and the evolution of the neuropeptide Y receptor gene regions

    Directory of Open Access Journals (Sweden)

    Brenner Sydney

    2008-06-01

    Full Text Available Abstract Background One of the many gene families that expanded in early vertebrate evolution is the neuropeptide (NPY receptor family of G-protein coupled receptors. Earlier work by our lab suggested that several of the NPY receptor genes found in extant vertebrates resulted from two genome duplications before the origin of jawed vertebrates (gnathostomes and one additional genome duplication in the actinopterygian lineage, based on their location on chromosomes sharing several gene families. In this study we have investigated, in five vertebrate genomes, 45 gene families with members close to the NPY receptor genes in the compact genomes of the teleost fishes Tetraodon nigroviridis and Takifugu rubripes. These correspond to Homo sapiens chromosomes 4, 5, 8 and 10. Results Chromosome regions with conserved synteny were identified and confirmed by phylogenetic analyses in H. sapiens, M. musculus, D. rerio, T. rubripes and T. nigroviridis. 26 gene families, including the NPY receptor genes, (plus 3 described recently by other labs showed a tree topology consistent with duplications in early vertebrate evolution and in the actinopterygian lineage, thereby supporting expansion through block duplications. Eight gene families had complications that precluded analysis (such as short sequence length or variable number of repeated domains and another eight families did not support block duplications (because the paralogs in these families seem to have originated in another time window than the proposed genome duplication events. RT-PCR carried out with several tissues in T. rubripes revealed that all five NPY receptors were expressed in the brain and subtypes Y2, Y4 and Y8 were also expressed in peripheral organs. Conclusion We conclude that the phylogenetic analyses and chromosomal locations of these gene families support duplications of large blocks of genes or even entire chromosomes. Thus, these results are consistent with two early vertebrate

  12. Evolution of stress-regulated gene expression in duplicate genes of Arabidopsis thaliana.

    Directory of Open Access Journals (Sweden)

    Cheng Zou

    2009-07-01

    Full Text Available Due to the selection pressure imposed by highly variable environmental conditions, stress sensing and regulatory response mechanisms in plants are expected to evolve rapidly. One potential source of innovation in plant stress response mechanisms is gene duplication. In this study, we examined the evolution of stress-regulated gene expression among duplicated genes in the model plant Arabidopsis thaliana. Key to this analysis was reconstructing the putative ancestral stress regulation pattern. By comparing the expression patterns of duplicated genes with the patterns of their ancestors, duplicated genes likely lost and gained stress responses at a rapid rate initially, but the rate is close to zero when the synonymous substitution rate (a proxy for time is > approximately 0.8. When considering duplicated gene pairs, we found that partitioning of putative ancestral stress responses occurred more frequently compared to cases of parallel retention and loss. Furthermore, the pattern of stress response partitioning was extremely asymmetric. An analysis of putative cis-acting DNA regulatory elements in the promoters of the duplicated stress-regulated genes indicated that the asymmetric partitioning of ancestral stress responses are likely due, at least in part, to differential loss of DNA regulatory elements; the duplicated genes losing most of their stress responses were those that had lost more of the putative cis-acting elements. Finally, duplicate genes that lost most or all of the ancestral responses are more likely to have gained responses to other stresses. Therefore, the retention of duplicates that inherit few or no functions seems to be coupled to neofunctionalization. Taken together, our findings provide new insight into the patterns of evolutionary changes in gene stress responses after duplication and lay the foundation for testing the adaptive significance of stress regulatory changes under highly variable biotic and abiotic environments.

  13. Evolution of the duplicated intracellular lipid-binding protein genes of teleost fishes.

    Science.gov (United States)

    Venkatachalam, Ananda B; Parmar, Manoj B; Wright, Jonathan M

    2017-08-01

    Increasing organismal complexity during the evolution of life has been attributed to the duplication of genes and entire genomes. More recently, theoretical models have been proposed that postulate the fate of duplicated genes, among them the duplication-degeneration-complementation (DDC) model. In the DDC model, the common fate of a duplicated gene is lost from the genome owing to nonfunctionalization. Duplicated genes are retained in the genome either by subfunctionalization, where the functions of the ancestral gene are sub-divided between the sister duplicate genes, or by neofunctionalization, where one of the duplicate genes acquires a new function. Both processes occur either by loss or gain of regulatory elements in the promoters of duplicated genes. Here, we review the genomic organization, evolution, and transcriptional regulation of the multigene family of intracellular lipid-binding protein (iLBP) genes from teleost fishes. Teleost fishes possess many copies of iLBP genes owing to a whole genome duplication (WGD) early in the teleost fish radiation. Moreover, the retention of duplicated iLBP genes is substantially higher than the retention of all other genes duplicated in the teleost genome. The fatty acid-binding protein genes, a subfamily of the iLBP multigene family in zebrafish, are differentially regulated by peroxisome proliferator-activated receptor (PPAR) isoforms, which may account for the retention of iLBP genes in the zebrafish genome by the process of subfunctionalization of cis-acting regulatory elements in iLBP gene promoters.

  14. Differential retention of metabolic genes following whole-genome duplication.

    Science.gov (United States)

    Gout, Jean-François; Duret, Laurent; Kahn, Daniel

    2009-05-01

    Classical studies in Metabolic Control Theory have shown that metabolic fluxes usually exhibit little sensitivity to changes in individual enzyme activity, yet remain sensitive to global changes of all enzymes in a pathway. Therefore, little selective pressure is expected on the dosage or expression of individual metabolic genes, yet entire pathways should still be constrained. However, a direct estimate of this selective pressure had not been evaluated. Whole-genome duplications (WGDs) offer a good opportunity to address this question by analyzing the fates of metabolic genes during the massive gene losses that follow. Here, we take advantage of the successive rounds of WGD that occurred in the Paramecium lineage. We show that metabolic genes exhibit different gene retention patterns than nonmetabolic genes. Contrary to what was expected for individual genes, metabolic genes appeared more retained than other genes after the recent WGD, which was best explained by selection for gene expression operating on entire pathways. Metabolic genes also tend to be less retained when present at high copy number before WGD, contrary to other genes that show a positive correlation between gene retention and preduplication copy number. This is rationalized on the basis of the classical concave relationship relating metabolic fluxes with enzyme expression.

  15. The roles of segmental and tandem gene duplication in the evolution of large gene families in Arabidopsis thaliana

    Directory of Open Access Journals (Sweden)

    Baumgarten Andrew

    2004-06-01

    Full Text Available Abstract Background Most genes in Arabidopsis thaliana are members of gene families. How do the members of gene families arise, and how are gene family copy numbers maintained? Some gene families may evolve primarily through tandem duplication and high rates of birth and death in clusters, and others through infrequent polyploidy or large-scale segmental duplications and subsequent losses. Results Our approach to understanding the mechanisms of gene family evolution was to construct phylogenies for 50 large gene families in Arabidopsis thaliana, identify large internal segmental duplications in Arabidopsis, map gene duplications onto the segmental duplications, and use this information to identify which nodes in each phylogeny arose due to segmental or tandem duplication. Examples of six gene families exemplifying characteristic modes are described. Distributions of gene family sizes and patterns of duplication by genomic distance are also described in order to characterize patterns of local duplication and copy number for large gene families. Both gene family size and duplication by distance closely follow power-law distributions. Conclusions Combining information about genomic segmental duplications, gene family phylogenies, and gene positions provides a method to evaluate contributions of tandem duplication and segmental genome duplication in the generation and maintenance of gene families. These differences appear to correspond meaningfully to differences in functional roles of the members of the gene families.

  16. Gene Conversion in Angiosperm Genomes with an Emphasis on Genes Duplicated by Polyploidization

    Directory of Open Access Journals (Sweden)

    Xi-Yin Wang

    2011-01-01

    Full Text Available Angiosperm genomes differ from those of mammals by extensive and recursive polyploidizations. The resulting gene duplication provides opportunities both for genetic innovation, and for concerted evolution. Though most genes may escape conversion by their homologs, concerted evolution of duplicated genes can last for millions of years or longer after their origin. Indeed, paralogous genes on two rice chromosomes duplicated an estimated 60–70 million years ago have experienced gene conversion in the past 400,000 years. Gene conversion preserves similarity of paralogous genes, but appears to accelerate their divergence from orthologous genes in other species. The mutagenic nature of recombination coupled with the buffering effect provided by gene redundancy, may facilitate the evolution of novel alleles that confer functional innovations while insulating biological fitness of affected plants. A mixed evolutionary model, characterized by a primary birth-and-death process and occasional homoeologous recombination and gene conversion, may best explain the evolution of multigene families.

  17. A salmonid EST genomic study: genes, duplications, phylogeny and microarrays

    Directory of Open Access Journals (Sweden)

    Brahmbhatt Sonal

    2008-11-01

    Full Text Available Abstract Background Salmonids are of interest because of their relatively recent genome duplication, and their extensive use in wild fisheries and aquaculture. A comprehensive gene list and a comparison of genes in some of the different species provide valuable genomic information for one of the most widely studied groups of fish. Results 298,304 expressed sequence tags (ESTs from Atlantic salmon (69% of the total, 11,664 chinook, 10,813 sockeye, 10,051 brook trout, 10,975 grayling, 8,630 lake whitefish, and 3,624 northern pike ESTs were obtained in this study and have been deposited into the public databases. Contigs were built and putative full-length Atlantic salmon clones have been identified. A database containing ESTs, assemblies, consensus sequences, open reading frames, gene predictions and putative annotation is available. The overall similarity between Atlantic salmon ESTs and those of rainbow trout, chinook, sockeye, brook trout, grayling, lake whitefish, northern pike and rainbow smelt is 93.4, 94.2, 94.6, 94.4, 92.5, 91.7, 89.6, and 86.2% respectively. An analysis of 78 transcript sets show Salmo as a sister group to Oncorhynchus and Salvelinus within Salmoninae, and Thymallinae as a sister group to Salmoninae and Coregoninae within Salmonidae. Extensive gene duplication is consistent with a genome duplication in the common ancestor of salmonids. Using all of the available EST data, a new expanded salmonid cDNA microarray of 32,000 features was created. Cross-species hybridizations to this cDNA microarray indicate that this resource will be useful for studies of all 68 salmonid species. Conclusion An extensive collection and analysis of salmonid RNA putative transcripts indicate that Pacific salmon, Atlantic salmon and charr are 94–96% similar while the more distant whitefish, grayling, pike and smelt are 93, 92, 89 and 86% similar to salmon. The salmonid transcriptome reveals a complex history of gene duplication that is

  18. Genome Mutational and Transcriptional Hotspots Are Traps for Duplicated Genes and Sources of Adaptations.

    Science.gov (United States)

    Fares, Mario A; Sabater-Muñoz, Beatriz; Toft, Christina

    2017-05-01

    Gene duplication generates new genetic material, which has been shown to lead to major innovations in unicellular and multicellular organisms. A whole-genome duplication occurred in the ancestor of Saccharomyces yeast species but 92% of duplicates returned to single-copy genes shortly after duplication. The persisting duplicated genes in Saccharomyces led to the origin of major metabolic innovations, which have been the source of the unique biotechnological capabilities in the Baker's yeast Saccharomyces cerevisiae. What factors have determined the fate of duplicated genes remains unknown. Here, we report the first demonstration that the local genome mutation and transcription rates determine the fate of duplicates. We show, for the first time, a preferential location of duplicated genes in the mutational and transcriptional hotspots of S. cerevisiae genome. The mechanism of duplication matters, with whole-genome duplicates exhibiting different preservation trends compared to small-scale duplicates. Genome mutational and transcriptional hotspots are rich in duplicates with large repetitive promoter elements. Saccharomyces cerevisiae shows more tolerance to deleterious mutations in duplicates with repetitive promoter elements, which in turn exhibit higher transcriptional plasticity against environmental perturbations. Our data demonstrate that the genome traps duplicates through the accelerated regulatory and functional divergence of their gene copies providing a source of novel adaptations in yeast. © The Author 2017. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  19. Profiling of gene duplication patterns of sequenced teleost genomes: evidence for rapid lineage-specific genome expansion mediated by recent tandem duplications.

    Science.gov (United States)

    Lu, Jianguo; Peatman, Eric; Tang, Haibao; Lewis, Joshua; Liu, Zhanjiang

    2012-06-15

    Gene duplication has had a major impact on genome evolution. Localized (or tandem) duplication resulting from unequal crossing over and whole genome duplication are believed to be the two dominant mechanisms contributing to vertebrate genome evolution. While much scrutiny has been directed toward discerning patterns indicative of whole-genome duplication events in teleost species, less attention has been paid to the continuous nature of gene duplications and their impact on the size, gene content, functional diversity, and overall architecture of teleost genomes. Here, using a Markov clustering algorithm directed approach we catalogue and analyze patterns of gene duplication in the four model teleost species with chromosomal coordinates: zebrafish, medaka, stickleback, and Tetraodon. Our analyses based on set size, duplication type, synonymous substitution rate (Ks), and gene ontology emphasize shared and lineage-specific patterns of genome evolution via gene duplication. Most strikingly, our analyses highlight the extraordinary duplication and retention rate of recent duplicates in zebrafish and their likely role in the structural and functional expansion of the zebrafish genome. We find that the zebrafish genome is remarkable in its large number of duplicated genes, small duplicate set size, biased Ks distribution toward minimal mutational divergence, and proportion of tandem and intra-chromosomal duplicates when compared with the other teleost model genomes. The observed gene duplication patterns have played significant roles in shaping the architecture of teleost genomes and appear to have contributed to the recent functional diversification and divergence of important physiological processes in zebrafish. We have analyzed gene duplication patterns and duplication types among the available teleost genomes and found that a large number of genes were tandemly and intrachromosomally duplicated, suggesting their origin of independent and continuous duplication

  20. Gene duplications in prokaryotes can be associated with environmental adaptation.

    Science.gov (United States)

    Bratlie, Marit S; Johansen, Jostein; Sherman, Brad T; Huang, Da Wei; Lempicki, Richard A; Drabløs, Finn

    2010-10-20

    Gene duplication is a normal evolutionary process. If there is no selective advantage in keeping the duplicated gene, it is usually reduced to a pseudogene and disappears from the genome. However, some paralogs are retained. These gene products are likely to be beneficial to the organism, e.g. in adaptation to new environmental conditions. The aim of our analysis is to investigate the properties of paralog-forming genes in prokaryotes, and to analyse the role of these retained paralogs by relating gene properties to life style of the corresponding prokaryotes. Paralogs were identified in a number of prokaryotes, and these paralogs were compared to singletons of persistent orthologs based on functional classification. This showed that the paralogs were associated with for example energy production, cell motility, ion transport, and defence mechanisms. A statistical overrepresentation analysis of gene and protein annotations was based on paralogs of the 200 prokaryotes with the highest fraction of paralog-forming genes. Biclustering of overrepresented gene ontology terms versus species was used to identify clusters of properties associated with clusters of species. The clusters were classified using similarity scores on properties and species to identify interesting clusters, and a subset of clusters were analysed by comparison to literature data. This analysis showed that paralogs often are associated with properties that are important for survival and proliferation of the specific organisms. This includes processes like ion transport, locomotion, chemotaxis and photosynthesis. However, the analysis also showed that the gene ontology terms sometimes were too general, imprecise or even misleading for automatic analysis. Properties described by gene ontology terms identified in the overrepresentation analysis are often consistent with individual prokaryote lifestyles and are likely to give a competitive advantage to the organism. Paralogs and singletons dominate

  1. Gene duplications in prokaryotes can be associated with environmental adaptation

    Directory of Open Access Journals (Sweden)

    Lempicki Richard A

    2010-10-01

    Full Text Available Abstract Background Gene duplication is a normal evolutionary process. If there is no selective advantage in keeping the duplicated gene, it is usually reduced to a pseudogene and disappears from the genome. However, some paralogs are retained. These gene products are likely to be beneficial to the organism, e.g. in adaptation to new environmental conditions. The aim of our analysis is to investigate the properties of paralog-forming genes in prokaryotes, and to analyse the role of these retained paralogs by relating gene properties to life style of the corresponding prokaryotes. Results Paralogs were identified in a number of prokaryotes, and these paralogs were compared to singletons of persistent orthologs based on functional classification. This showed that the paralogs were associated with for example energy production, cell motility, ion transport, and defence mechanisms. A statistical overrepresentation analysis of gene and protein annotations was based on paralogs of the 200 prokaryotes with the highest fraction of paralog-forming genes. Biclustering of overrepresented gene ontology terms versus species was used to identify clusters of properties associated with clusters of species. The clusters were classified using similarity scores on properties and species to identify interesting clusters, and a subset of clusters were analysed by comparison to literature data. This analysis showed that paralogs often are associated with properties that are important for survival and proliferation of the specific organisms. This includes processes like ion transport, locomotion, chemotaxis and photosynthesis. However, the analysis also showed that the gene ontology terms sometimes were too general, imprecise or even misleading for automatic analysis. Conclusions Properties described by gene ontology terms identified in the overrepresentation analysis are often consistent with individual prokaryote lifestyles and are likely to give a competitive

  2. On Computing Breakpoint Distances for Genomes with Duplicate Genes.

    Science.gov (United States)

    Shao, Mingfu; Moret, Bernard M E

    2017-06-01

    A fundamental problem in comparative genomics is to compute the distance between two genomes in terms of its higher level organization (given by genes or syntenic blocks). For two genomes without duplicate genes, we can easily define (and almost always efficiently compute) a variety of distance measures, but the problem is NP-hard under most models when genomes contain duplicate genes. To tackle duplicate genes, three formulations (exemplar, maximum matching, and any matching) have been proposed, all of which aim to build a matching between homologous genes so as to minimize some distance measure. Of the many distance measures, the breakpoint distance (the number of nonconserved adjacencies) was the first one to be studied and remains of significant interest because of its simplicity and model-free property. The three breakpoint distance problems corresponding to the three formulations have been widely studied. Although we provided last year a solution for the exemplar problem that runs very fast on full genomes, computing optimal solutions for the other two problems has remained challenging. In this article, we describe very fast, exact algorithms for these two problems. Our algorithms rely on a compact integer-linear program that we further simplify by developing an algorithm to remove variables, based on new results on the structure of adjacencies and matchings. Through extensive experiments using both simulations and biological data sets, we show that our algorithms run very fast (in seconds) on mammalian genomes and scale well beyond. We also apply these algorithms (as well as the classic orthology tool MSOAR) to create orthology assignment, then compare their quality in terms of both accuracy and coverage. We find that our algorithm for the "any matching" formulation significantly outperforms other methods in terms of accuracy while achieving nearly maximum coverage.

  3. Evolutionary diversification of plant shikimate kinase gene duplicates.

    Directory of Open Access Journals (Sweden)

    Geoffrey Fucile

    2008-12-01

    Full Text Available Shikimate kinase (SK; EC 2.7.1.71 catalyzes the fifth reaction of the shikimate pathway, which directs carbon from the central metabolism pool to a broad range of secondary metabolites involved in plant development, growth, and stress responses. In this study, we demonstrate the role of plant SK gene duplicate evolution in the diversification of metabolic regulation and the acquisition of novel and physiologically essential function. Phylogenetic analysis of plant SK homologs resolves an orthologous cluster of plant SKs and two functionally distinct orthologous clusters. These previously undescribed genes, shikimate kinase-like 1 (SKL1 and -2 (SKL2, do not encode SK activity, are present in all major plant lineages, and apparently evolved under positive selection following SK gene duplication over 400 MYA. This is supported by functional assays using recombinant SK, SKL1, and SKL2 from Arabidopsis thaliana (At and evolutionary analyses of the diversification of SK-catalytic and -substrate binding sites based on theoretical structure models. AtSKL1 mutants yield albino and novel variegated phenotypes, which indicate SKL1 is required for chloroplast biogenesis. Extant SKL2 sequences show a strong genetic signature of positive selection, which is enriched in a protein-protein interaction module not found in other SK homologs. We also report the first kinetic characterization of plant SKs and show that gene expression diversification among the AtSK inparalogs is correlated with developmental processes and stress responses. This study examines the functional diversification of ancient and recent plant SK gene duplicates and highlights the utility of SKs as scaffolds for functional innovation.

  4. STRIDE: Species Tree Root Inference from Gene Duplication Events.

    Science.gov (United States)

    Emms, David M; Kelly, Steven

    2017-12-01

    The correct interpretation of any phylogenetic tree is dependent on that tree being correctly rooted. We present STRIDE, a fast, effective, and outgroup-free method for identification of gene duplication events and species tree root inference in large-scale molecular phylogenetic analyses. STRIDE identifies sets of well-supported in-group gene duplication events from a set of unrooted gene trees, and analyses these events to infer a probability distribution over an unrooted species tree for the location of its root. We show that STRIDE correctly identifies the root of the species tree in multiple large-scale molecular phylogenetic data sets spanning a wide range of timescales and taxonomic groups. We demonstrate that the novel probability model implemented in STRIDE can accurately represent the ambiguity in species tree root assignment for data sets where information is limited. Furthermore, application of STRIDE to outgroup-free inference of the origin of the eukaryotic tree resulted in a root probability distribution that provides additional support for leading hypotheses for the origin of the eukaryotes. © The Author 2017. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  5. Neutral and Non-Neutral Evolution of Duplicated Genes with Gene Conversion

    Directory of Open Access Journals (Sweden)

    Jeffrey A. Fawcett

    2011-02-01

    Full Text Available Gene conversion is one of the major mutational mechanisms involved in the DNA sequence evolution of duplicated genes. It contributes to create unique patters of DNA polymorphism within species and divergence between species. A typical pattern is so-called concerted evolution, in which the divergence between duplicates is maintained low for a long time because of frequent exchanges of DNA fragments. In addition, gene conversion affects the DNA evolution of duplicates in various ways especially when selection operates. Here, we review theoretical models to understand the evolution of duplicates in both neutral and non-neutral cases. We also explain how these theories contribute to interpreting real polymorphism and divergence data by using some intriguing examples.

  6. Biased exonization of transposed elements in duplicated genes: A lesson from the TIF-IA gene

    Directory of Open Access Journals (Sweden)

    Shomron Noam

    2007-11-01

    Full Text Available Abstract Background Gene duplication and exonization of intronic transposed elements are two mechanisms that enhance genomic diversity. We examined whether there is less selection against exonization of transposed elements in duplicated genes than in single-copy genes. Results Genome-wide analysis of exonization of transposed elements revealed a higher rate of exonization within duplicated genes relative to single-copy genes. The gene for TIF-IA, an RNA polymerase I transcription initiation factor, underwent a humanoid-specific triplication, all three copies of the gene are active transcriptionally, although only one copy retains the ability to generate the TIF-IA protein. Prior to TIF-IA triplication, an Alu element was inserted into the first intron. In one of the non-protein coding copies, this Alu is exonized. We identified a single point mutation leading to exonization in one of the gene duplicates. When this mutation was introduced into the TIF-IA coding copy, exonization was activated and the level of the protein-coding mRNA was reduced substantially. A very low level of exonization was detected in normal human cells. However, this exonization was abundant in most leukemia cell lines evaluated, although the genomic sequence is unchanged in these cancerous cells compared to normal cells. Conclusion The definition of the Alu element within the TIF-IA gene as an exon is restricted to certain types of cancers; the element is not exonized in normal human cells. These results further our understanding of the delicate interplay between gene duplication and alternative splicing and of the molecular evolutionary mechanisms leading to genetic innovations. This implies the existence of purifying selection against exonization in single copy genes, with duplicate genes free from such constrains.

  7. Duplication and Diversification of the Hypoxia-Inducible IGFBP-1 Gene in Zebrafish

    DEFF Research Database (Denmark)

    Kamei, Hiroyasu; Lu, Ling; Jiao, Shuang

    2008-01-01

    Background: Gene duplication is the primary force of new gene evolution. Deciphering whether a pair of duplicated genes has evolved divergent functions is often challenging. The zebrafish is uniquely positioned to provide insight into the process of functional gene evolution due to its amenabilit...

  8. Divergent Evolutionary Patterns of NAC Transcription Factors Are Associated with Diversification and Gene Duplications in Angiosperm

    Directory of Open Access Journals (Sweden)

    Xiaoli Jin

    2017-06-01

    Full Text Available NAC (NAM/ATAF/CUC proteins constitute one of the biggest plant-specific transcription factor (TF families and have crucial roles in diverse developmental programs during plant growth. Phylogenetic analyses have revealed both conserved and lineage-specific NAC subfamilies, among which various origins and distinct features were observed. It is reasonable to hypothesize that there should be divergent evolutionary patterns of NAC TFs both between dicots and monocots, and among NAC subfamilies. In this study, we compared the gene duplication and loss, evolutionary rate, and selective pattern among non-lineage specific NAC subfamilies, as well as those between dicots and monocots, through genome-wide analyses of sequence and functional data in six dicot and five grass lineages. The number of genes gained in the dicot lineages was much larger than that in the grass lineages, while fewer gene losses were observed in the grass than that in the dicots. We revealed (1 uneven constitution of Clusters of Orthologous Groups (COGs and contrasting birth/death rates among subfamilies, and (2 two distinct evolutionary scenarios of NAC TFs between dicots and grasses. Our results demonstrated that relaxed selection, resulting from concerted gene duplications, may have permitted substitutions responsible for functional divergence of NAC genes into new lineages. The underlying mechanism of distinct evolutionary fates of NAC TFs shed lights on how evolutionary divergence contributes to differences in establishing NAC gene subfamilies and thus impacts the distinct features between dicots and grasses.

  9. Molecular evolution of a Y chromosome to autosome gene duplication in Drosophila.

    Science.gov (United States)

    Dyer, Kelly A; White, Brooke E; Bray, Michael J; Piqué, Daniel G; Betancourt, Andrea J

    2011-03-01

    In contrast to the rest of the genome, the Y chromosome is restricted to males and lacks recombination. As a result, Y chromosomes are unable to respond efficiently to selection, and newly formed Y chromosomes degenerate until few genes remain. The rapid loss of genes from newly formed Y chromosomes has been well studied, but gene loss from highly degenerate Y chromosomes has only recently received attention. Here, we identify and characterize a Y to autosome duplication of the male fertility gene kl-5 that occurred during the evolution of the testacea group species of Drosophila. The duplication was likely DNA based, as other Y-linked genes remain on the Y chromosome, the locations of introns are conserved, and expression analyses suggest that regulatory elements remain linked. Genetic mapping reveals that the autosomal copy of kl-5 resides on the dot chromosome, a tiny autosome with strongly suppressed recombination. Molecular evolutionary analyses show that autosomal copies of kl-5 have reduced polymorphism and little recombination. Importantly, the rate of protein evolution of kl-5 has increased significantly in lineages where it is on the dot versus Y linked. Further analyses suggest this pattern is a consequence of relaxed purifying selection, rather than adaptive evolution. Thus, although the initial fixation of the kl-5 duplication may have been advantageous, slightly deleterious mutations have accumulated in the dot-linked copies of kl-5 faster than in the Y-linked copies. Because the dot chromosome contains seven times more genes than the Y and is exposed to selection in both males and females, these results suggest that the dot suffers the deleterious effects of genetic linkage to more selective targets compared with the Y chromosome. Thus, a highly degenerate Y chromosome may not be the worst environment in the genome, as is generally thought, but may in fact be protected from the accumulation of deleterious mutations relative to other nonrecombining

  10. Phylogenetic detection of numerous gene duplications shared by animals, fungi and plants

    OpenAIRE

    Zhou, Xiaofan; Lin, Zhenguo; Ma, Hong

    2010-01-01

    Background Gene duplication is considered a major driving force for evolution of genetic novelty, thereby facilitating functional divergence and organismal diversity, including the process of speciation. Animals, fungi and plants are major eukaryotic kingdoms and the divergences between them are some of the most significant evolutionary events. Although gene duplications in each lineage have been studied extensively in various contexts, the extent of gene duplication prior to the split of pla...

  11. Convergent evolution of gene networks by single-gene duplications in higher eukaryotes.

    Science.gov (United States)

    Amoutzias, Gregory D; Robertson, David L; Oliver, Stephen G; Bornberg-Bauer, Erich

    2004-03-01

    By combining phylogenetic, proteomic and structural information, we have elucidated the evolutionary driving forces for the gene-regulatory interaction networks of basic helix-loop-helix transcription factors. We infer that recurrent events of single-gene duplication and domain rearrangement repeatedly gave rise to distinct networks with almost identical hub-based topologies, and multiple activators and repressors. We thus provide the first empirical evidence for scale-free protein networks emerging through single-gene duplications, the dominant importance of molecular modularity in the bottom-up construction of complex biological entities, and the convergent evolution of networks.

  12. Are duplicated genes responsible for anthracnose resistance in common bean?

    Science.gov (United States)

    Costa, Larissa Carvalho; Nalin, Rafael Storto; Ramalho, Magno Antonio Patto; de Souza, Elaine Aparecida

    2017-01-01

    The race 65 of Colletotrichum lindemuthianum, etiologic agent of anthracnose in common bean, is distributed worldwide, having great importance in breeding programs for anthracnose resistance. Several resistance alleles have been identified promoting resistance to this race. However, the variability that has been detected within race has made it difficult to obtain cultivars with durable resistance, because cultivars may have different reactions to each strain of race 65. Thus, this work aimed at studying the resistance inheritance of common bean lines to different strains of C. lindemuthianum, race 65. We used six C. lindemuthianum strains previously characterized as belonging to the race 65 through the international set of differential cultivars of anthracnose and nine commercial cultivars, adapted to the Brazilian growing conditions and with potential ability to discriminate the variability within this race. To obtain information on the resistance inheritance related to nine commercial cultivars to six strains of race 65, these cultivars were crossed two by two in all possible combinations, resulting in 36 hybrids. Segregation in the F2 generations revealed that the resistance to each strain is conditioned by two independent genes with the same function, suggesting that they are duplicated genes, where the dominant allele promotes resistance. These results indicate that the specificity between host resistance genes and pathogen avirulence genes is not limited to races, it also occurs within strains of the same race. Further research may be carried out in order to establish if the alleles identified in these cultivars are different from those described in the literature.

  13. Predictions of Gene Family Distributions in Microbial Genomes: Evolution by Gene Duplication and Modification

    International Nuclear Information System (INIS)

    Yanai, Itai; Camacho, Carlos J.; DeLisi, Charles

    2000-01-01

    A universal property of microbial genomes is the considerable fraction of genes that are homologous to other genes within the same genome. The process by which these homologues are generated is not well understood, but sequence analysis of 20 microbial genomes unveils a recurrent distribution of gene family sizes. We show that a simple evolutionary model based on random gene duplication and point mutations fully accounts for these distributions and permits predictions for the number of gene families in genomes not yet complete. Our findings are consistent with the notion that a genome evolves from a set of precursor genes to a mature size by gene duplications and increasing modifications. (c) 2000 The American Physical Society

  14. Predictions of Gene Family Distributions in Microbial Genomes: Evolution by Gene Duplication and Modification

    Energy Technology Data Exchange (ETDEWEB)

    Yanai, Itai; Camacho, Carlos J.; DeLisi, Charles

    2000-09-18

    A universal property of microbial genomes is the considerable fraction of genes that are homologous to other genes within the same genome. The process by which these homologues are generated is not well understood, but sequence analysis of 20 microbial genomes unveils a recurrent distribution of gene family sizes. We show that a simple evolutionary model based on random gene duplication and point mutations fully accounts for these distributions and permits predictions for the number of gene families in genomes not yet complete. Our findings are consistent with the notion that a genome evolves from a set of precursor genes to a mature size by gene duplications and increasing modifications. (c) 2000 The American Physical Society.

  15. Recurrent Gene Duplication Leads to Diverse Repertoires of Centromeric Histones in Drosophila Species.

    Science.gov (United States)

    Kursel, Lisa E; Malik, Harmit S

    2017-06-01

    Despite their essential role in the process of chromosome segregation in most eukaryotes, centromeric histones show remarkable evolutionary lability. Not only have they been lost in multiple insect lineages, but they have also undergone gene duplication in multiple plant lineages. Based on detailed study of a handful of model organisms including Drosophila melanogaster, centromeric histone duplication is considered to be rare in animals. Using a detailed phylogenomic study, we find that Cid, the centromeric histone gene, has undergone at least four independent gene duplications during Drosophila evolution. We find duplicate Cid genes in D. eugracilis (Cid2), in the montium species subgroup (Cid3, Cid4) and in the entire Drosophila subgenus (Cid5). We show that Cid3, Cid4, and Cid5 all localize to centromeres in their respective species. Some Cid duplicates are primarily expressed in the male germline. With rare exceptions, Cid duplicates have been strictly retained after birth, suggesting that they perform nonredundant centromeric functions, independent from the ancestral Cid. Indeed, each duplicate encodes a distinct N-terminal tail, which may provide the basis for distinct protein-protein interactions. Finally, we show some Cid duplicates evolve under positive selection whereas others do not. Taken together, our results support the hypothesis that Drosophila Cid duplicates have subfunctionalized. Thus, these gene duplications provide an unprecedented opportunity to dissect the multiple roles of centromeric histones. © The Author 2017. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  16. Comparative inference of duplicated genes produced by polyploidization in soybean genome.

    Science.gov (United States)

    Yang, Yanmei; Wang, Jinpeng; Di, Jianyong

    2013-01-01

    Soybean (Glycine max) is one of the most important crop plants for providing protein and oil. It is important to investigate soybean genome for its economic and scientific value. Polyploidy is a widespread and recursive phenomenon during plant evolution, and it could generate massive duplicated genes which is an important resource for genetic innovation. Improved sequence alignment criteria and statistical analysis are used to identify and characterize duplicated genes produced by polyploidization in soybean. Based on the collinearity method, duplicated genes by whole genome duplication account for 70.3% in soybean. From the statistical analysis of the molecular distances between duplicated genes, our study indicates that the whole genome duplication event occurred more than once in the genome evolution of soybean, which is often distributed near the ends of chromosomes.

  17. Divergence of gene body DNA methylation and evolution of plant duplicate genes.

    Directory of Open Access Journals (Sweden)

    Jun Wang

    Full Text Available It has been shown that gene body DNA methylation is associated with gene expression. However, whether and how deviation of gene body DNA methylation between duplicate genes can influence their divergence remains largely unexplored. Here, we aim to elucidate the potential role of gene body DNA methylation in the fate of duplicate genes. We identified paralogous gene pairs from Arabidopsis and rice (Oryza sativa ssp. japonica genomes and reprocessed their single-base resolution methylome data. We show that methylation in paralogous genes nonlinearly correlates with several gene properties including exon number/gene length, expression level and mutation rate. Further, we demonstrated that divergence of methylation level and pattern in paralogs indeed positively correlate with their sequence and expression divergences. This result held even after controlling for other confounding factors known to influence the divergence of paralogs. We observed that methylation level divergence might be more relevant to the expression divergence of paralogs than methylation pattern divergence. Finally, we explored the mechanisms that might give rise to the divergence of gene body methylation in paralogs. We found that exonic methylation divergence more closely correlates with expression divergence than intronic methylation divergence. We show that genomic environments (e.g., flanked by transposable elements and repetitive sequences of paralogs generated by various duplication mechanisms are associated with the methylation divergence of paralogs. Overall, our results suggest that the changes in gene body DNA methylation could provide another avenue for duplicate genes to develop differential expression patterns and undergo different evolutionary fates in plant genomes.

  18. Evolution of vertebrate central nervous system is accompanied by novel expression changes of duplicate genes.

    Science.gov (United States)

    Chen, Yuan; Ding, Yun; Zhang, Zuming; Wang, Wen; Chen, Jun-Yuan; Ueno, Naoto; Mao, Bingyu

    2011-12-20

    The evolution of the central nervous system (CNS) is one of the most striking changes during the transition from invertebrates to vertebrates. As a major source of genetic novelties, gene duplication might play an important role in the functional innovation of vertebrate CNS. In this study, we focused on a group of CNS-biased genes that duplicated during early vertebrate evolution. We investigated the tempo-spatial expression patterns of 33 duplicate gene families and their orthologs during the embryonic development of the vertebrate Xenopus laevis and the cephalochordate Brachiostoma belcheri. Almost all the identified duplicate genes are differentially expressed in the CNS in Xenopus embryos, and more than 50% and 30% duplicate genes are expressed in the telencephalon and mid-hindbrain boundary, respectively, which are mostly considered as two innovations in the vertebrate CNS. Interestingly, more than 50% of the amphioxus orthologs do not show apparent expression in the CNS in amphioxus embryos as detected by in situ hybridization, indicating that some of the vertebrate CNS-biased duplicate genes might arise from non-CNS genes in invertebrates. Our data accentuate the functional contribution of gene duplication in the CNS evolution of vertebrate and uncover an invertebrate non-CNS history for some vertebrate CNS-biased duplicate genes. Copyright © 2011. Published by Elsevier Ltd.

  19. Selective Constraints on Coding Sequences of Nervous System Genes Are a Major Determinant of Duplicate Gene Retention in Vertebrates.

    Science.gov (United States)

    Roux, Julien; Liu, Jialin; Robinson-Rechavi, Marc

    2017-11-01

    The evolutionary history of vertebrates is marked by three ancient whole-genome duplications: two successive rounds in the ancestor of vertebrates, and a third one specific to teleost fishes. Biased loss of most duplicates enriched the genome for specific genes, such as slow evolving genes, but this selective retention process is not well understood. To understand what drives the long-term preservation of duplicate genes, we characterized duplicated genes in terms of their expression patterns. We used a new method of expression enrichment analysis, TopAnat, applied to in situ hybridization data from thousands of genes from zebrafish and mouse. We showed that the presence of expression in the nervous system is a good predictor of a higher rate of retention of duplicate genes after whole-genome duplication. Further analyses suggest that purifying selection against the toxic effects of misfolded or misinteracting proteins, which is particularly strong in nonrenewing neural tissues, likely constrains the evolution of coding sequences of nervous system genes, leading indirectly to the preservation of duplicate genes after whole-genome duplication. Whole-genome duplications thus greatly contributed to the expansion of the toolkit of genes available for the evolution of profound novelties of the nervous system at the base of the vertebrate radiation. © The Author 2017. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  20. Saccharomyces cerevisiae ribosomal protein L37 is encoded by duplicate genes that are differentially expressed.

    Science.gov (United States)

    Tornow, J; Santangelo, G M

    1994-06-01

    A duplicate copy of the RPL37A gene (encoding ribosomal protein L37) was cloned and sequenced. The coding region of RPL37B is very similar to that of RPL37A, with only one conservative amino-acid difference. However, the intron and flanking sequences of the two genes are extremely dissimilar. Disruption experiments indicate that the two loci are not functionally equivalent: disruption of RPL37B was insignificant, but disruption of RPL37A severely impaired the growth rate of the cell. When both RPL37 loci are disrupted, the cell is unable to grow at all, indicating that rpL37 is an essential protein. The functional disparity between the two RPL37 loci could be explained by differential gene expression. The results of two experiments support this idea: gene fusion of RPL37A to a reporter gene resulted in six-fold higher mRNA levels than was generated by the same reporter gene fused to RPL37B, and a modest increase in gene dosage of RPL37B overcame the lack of a functional RPL37A gene.

  1. Conservation and gene banking

    Science.gov (United States)

    Plant conservation has several objectives the main ones include safeguarding our food supply, preserving crop wild relatives for breeding and selection of new cultivars, providing material for industrial and pharmaceutical uses and preserving the beauty and diversity of our flora for generations to ...

  2. Gene duplication and divergence affecting drug content in Cannabis sativa.

    Science.gov (United States)

    Weiblen, George D; Wenger, Jonathan P; Craft, Kathleen J; ElSohly, Mahmoud A; Mehmedic, Zlatko; Treiber, Erin L; Marks, M David

    2015-12-01

    Cannabis sativa is an economically important source of durable fibers, nutritious seeds, and psychoactive drugs but few economic plants are so poorly understood genetically. Marijuana and hemp were crossed to evaluate competing models of cannabinoid inheritance and to explain the predominance of tetrahydrocannabinolic acid (THCA) in marijuana compared with cannabidiolic acid (CBDA) in hemp. Individuals in the resulting F2 population were assessed for differential expression of cannabinoid synthase genes and were used in linkage mapping. Genetic markers associated with divergent cannabinoid phenotypes were identified. Although phenotypic segregation and a major quantitative trait locus (QTL) for the THCA/CBDA ratio were consistent with a simple model of codominant alleles at a single locus, the diversity of THCA and CBDA synthase sequences observed in the mapping population, the position of enzyme coding loci on the map, and patterns of expression suggest multiple linked loci. Phylogenetic analysis further suggests a history of duplication and divergence affecting drug content. Marijuana is distinguished from hemp by a nonfunctional CBDA synthase that appears to have been positively selected to enhance psychoactivity. An unlinked QTL for cannabinoid quantity may also have played a role in the recent escalation of drug potency. © 2015 The Authors. New Phytologist © 2015 New Phytologist Trust.

  3. Gene duplication, modularity and adaptation in the evolution of the aflatoxin gene cluster

    Directory of Open Access Journals (Sweden)

    Jakobek Judy L

    2007-07-01

    Full Text Available Abstract Background The biosynthesis of aflatoxin (AF involves over 20 enzymatic reactions in a complex polyketide pathway that converts acetate and malonate to the intermediates sterigmatocystin (ST and O-methylsterigmatocystin (OMST, the respective penultimate and ultimate precursors of AF. Although these precursors are chemically and structurally very similar, their accumulation differs at the species level for Aspergilli. Notable examples are A. nidulans that synthesizes only ST, A. flavus that makes predominantly AF, and A. parasiticus that generally produces either AF or OMST. Whether these differences are important in the evolutionary/ecological processes of species adaptation and diversification is unknown. Equally unknown are the specific genomic mechanisms responsible for ordering and clustering of genes in the AF pathway of Aspergillus. Results To elucidate the mechanisms that have driven formation of these clusters, we performed systematic searches of aflatoxin cluster homologs across five Aspergillus genomes. We found a high level of gene duplication and identified seven modules consisting of highly correlated gene pairs (aflA/aflB, aflR/aflS, aflX/aflY, aflF/aflE, aflT/aflQ, aflC/aflW, and aflG/aflL. With the exception of A. nomius, contrasts of mean Ka/Ks values across all cluster genes showed significant differences in selective pressure between section Flavi and non-section Flavi species. A. nomius mean Ka/Ks values were more similar to partial clusters in A. fumigatus and A. terreus. Overall, mean Ka/Ks values were significantly higher for section Flavi than for non-section Flavi species. Conclusion Our results implicate several genomic mechanisms in the evolution of ST, OMST and AF cluster genes. Gene modules may arise from duplications of a single gene, whereby the function of the pre-duplication gene is retained in the copy (aflF/aflE or the copies may partition the ancestral function (aflA/aflB. In some gene modules, the

  4. Co-expression network analysis of duplicate genes in maize (Zea mays L.) reveals no subgenome bias.

    Science.gov (United States)

    Li, Lin; Briskine, Roman; Schaefer, Robert; Schnable, Patrick S; Myers, Chad L; Flagel, Lex E; Springer, Nathan M; Muehlbauer, Gary J

    2016-11-04

    Gene duplication is prevalent in many species and can result in coding and regulatory divergence. Gene duplications can be classified as whole genome duplication (WGD), tandem and inserted (non-syntenic). In maize, WGD resulted in the subgenomes maize1 and maize2, of which maize1 is considered the dominant subgenome. However, the landscape of co-expression network divergence of duplicate genes in maize is still largely uncharacterized. To address the consequence of gene duplication on co-expression network divergence, we developed a gene co-expression network from RNA-seq data derived from 64 different tissues/stages of the maize reference inbred-B73. WGD, tandem and inserted gene duplications exhibited distinct regulatory divergence. Inserted duplicate genes were more likely to be singletons in the co-expression networks, while WGD duplicate genes were likely to be co-expressed with other genes. Tandem duplicate genes were enriched in the co-expression pattern where co-expressed genes were nearly identical for the duplicates in the network. Older gene duplications exhibit more extensive co-expression variation than younger duplications. Overall, non-syntenic genes primarily from inserted duplications show more co-expression divergence. Also, such enlarged co-expression divergence is significantly related to duplication age. Moreover, subgenome dominance was not observed in the co-expression networks - maize1 and maize2 exhibit similar levels of intra subgenome correlations. Intriguingly, the level of inter subgenome co-expression was similar to the level of intra subgenome correlations, and genes from specific subgenomes were not likely to be the enriched in co-expression network modules and the hub genes were not predominantly from any specific subgenomes in maize. Our work provides a comprehensive analysis of maize co-expression network divergence for three different types of gene duplications and identifies potential relationships between duplication types

  5. Convergent evolution of gene networks by single-gene duplications in higher eukaryotes

    OpenAIRE

    Amoutzias, Gregory D; Robertson, David L; Oliver, Stephen G; Bornberg-Bauer, Erich

    2004-01-01

    By combining phylogenetic, proteomic and structural information, we have elucidated the evolutionary driving forces for the gene-regulatory interaction networks of basic helix–loop–helix transcription factors. We infer that recurrent events of single-gene duplication and domain rearrangement repeatedly gave rise to distinct networks with almost identical hub-based topologies, and multiple activators and repressors. We thus provide the first empirical evidence for scale-free protein networks e...

  6. Genome-wide analysis of the Dof transcription factor gene family reveals soybean-specific duplicable and functional characteristics.

    Directory of Open Access Journals (Sweden)

    Yong Guo

    Full Text Available The Dof domain protein family is a classic plant-specific zinc-finger transcription factor family involved in a variety of biological processes. There is great diversity in the number of Dof genes in different plants. However, there are only very limited reports on the characterization of Dof transcription factors in soybean (Glycine max. In the present study, 78 putative Dof genes were identified from the whole-genome sequence of soybean. The predicted GmDof genes were non-randomly distributed within and across 19 out of 20 chromosomes and 97.4% (38 pairs were preferentially retained duplicate paralogous genes located in duplicated regions of the genome. Soybean-specific segmental duplications contributed significantly to the expansion of the soybean Dof gene family. These Dof proteins were phylogenetically clustered into nine distinct subgroups among which the gene structure and motif compositions were considerably conserved. Comparative phylogenetic analysis of these Dof proteins revealed four major groups, similar to those reported for Arabidopsis and rice. Most of the GmDofs showed specific expression patterns based on RNA-seq data analyses. The expression patterns of some duplicate genes were partially redundant while others showed functional diversity, suggesting the occurrence of sub-functionalization during subsequent evolution. Comprehensive expression profile analysis also provided insights into the soybean-specific functional divergence among members of the Dof gene family. Cis-regulatory element analysis of these GmDof genes suggested diverse functions associated with different processes. Taken together, our results provide useful information for the functional characterization of soybean Dof genes by combining phylogenetic analysis with global gene-expression profiling.

  7. Evolutionary conservation of regulatory elements in vertebrate HOX gene clusters

    Energy Technology Data Exchange (ETDEWEB)

    Santini, Simona; Boore, Jeffrey L.; Meyer, Axel

    2003-12-31

    Due to their high degree of conservation, comparisons of DNA sequences among evolutionarily distantly-related genomes permit to identify functional regions in noncoding DNA. Hox genes are optimal candidate sequences for comparative genome analyses, because they are extremely conserved in vertebrates and occur in clusters. We aligned (Pipmaker) the nucleotide sequences of HoxA clusters of tilapia, pufferfish, striped bass, zebrafish, horn shark, human and mouse (over 500 million years of evolutionary distance). We identified several highly conserved intergenic sequences, likely to be important in gene regulation. Only a few of these putative regulatory elements have been previously described as being involved in the regulation of Hox genes, while several others are new elements that might have regulatory functions. The majority of these newly identified putative regulatory elements contain short fragments that are almost completely conserved and are identical to known binding sites for regulatory proteins (Transfac). The conserved intergenic regions located between the most rostrally expressed genes in the developing embryo are longer and better retained through evolution. We document that presumed regulatory sequences are retained differentially in either A or A clusters resulting from a genome duplication in the fish lineage. This observation supports both the hypothesis that the conserved elements are involved in gene regulation and the Duplication-Deletion-Complementation model.

  8. Prevalent Role of Gene Features in Determining Evolutionary Fates of Whole-Genome Duplication Duplicated Genes in Flowering Plants1[W][OA

    Science.gov (United States)

    Jiang, Wen-kai; Liu, Yun-long; Xia, En-hua; Gao, Li-zhi

    2013-01-01

    The evolution of genes and genomes after polyploidization has been the subject of extensive studies in evolutionary biology and plant sciences. While a significant number of duplicated genes are rapidly removed during a process called fractionation, which operates after the whole-genome duplication (WGD), another considerable number of genes are retained preferentially, leading to the phenomenon of biased gene retention. However, the evolutionary mechanisms underlying gene retention after WGD remain largely unknown. Through genome-wide analyses of sequence and functional data, we comprehensively investigated the relationships between gene features and the retention probability of duplicated genes after WGDs in six plant genomes, Arabidopsis (Arabidopsis thaliana), poplar (Populus trichocarpa), soybean (Glycine max), rice (Oryza sativa), sorghum (Sorghum bicolor), and maize (Zea mays). The results showed that multiple gene features were correlated with the probability of gene retention. Using a logistic regression model based on principal component analysis, we resolved evolutionary rate, structural complexity, and GC3 content as the three major contributors to gene retention. Cluster analysis of these features further classified retained genes into three distinct groups in terms of gene features and evolutionary behaviors. Type I genes are more prone to be selected by dosage balance; type II genes are possibly subject to subfunctionalization; and type III genes may serve as potential targets for neofunctionalization. This study highlights that gene features are able to act jointly as primary forces when determining the retention and evolution of WGD-derived duplicated genes in flowering plants. These findings thus may help to provide a resolution to the debate on different evolutionary models of gene fates after WGDs. PMID:23396833

  9. Evolution of Cis-Regulatory Elements and Regulatory Networks in Duplicated Genes of Arabidopsis.

    Science.gov (United States)

    Arsovski, Andrej A; Pradinuk, Julian; Guo, Xu Qiu; Wang, Sishuo; Adams, Keith L

    2015-12-01

    Plant genomes contain large numbers of duplicated genes that contribute to the evolution of new functions. Following duplication, genes can exhibit divergence in their coding sequence and their expression patterns. Changes in the cis-regulatory element landscape can result in changes in gene expression patterns. High-throughput methods developed recently can identify potential cis-regulatory elements on a genome-wide scale. Here, we use a recent comprehensive data set of DNase I sequencing-identified cis-regulatory binding sites (footprints) at single-base-pair resolution to compare binding sites and network connectivity in duplicated gene pairs in Arabidopsis (Arabidopsis thaliana). We found that duplicated gene pairs vary greatly in their cis-regulatory element architecture, resulting in changes in regulatory network connectivity. Whole-genome duplicates (WGDs) have approximately twice as many footprints in their promoters left by potential regulatory proteins than do tandem duplicates (TDs). The WGDs have a greater average number of footprint differences between paralogs than TDs. The footprints, in turn, result in more regulatory network connections between WGDs and other genes, forming denser, more complex regulatory networks than shown by TDs. When comparing regulatory connections between duplicates, WGDs had more pairs in which the two genes are either partially or fully diverged in their network connections, but fewer genes with no network connections than the TDs. There is evidence of younger TDs and WGDs having fewer unique connections compared with older duplicates. This study provides insights into cis-regulatory element evolution and network divergence in duplicated genes. © 2015 American Society of Plant Biologists. All Rights Reserved.

  10. Comparative study of human mitochondrial proteome reveals extensive protein subcellular relocalization after gene duplications

    Directory of Open Access Journals (Sweden)

    Huang Yong

    2009-11-01

    Full Text Available Abstract Background Gene and genome duplication is the principle creative force in evolution. Recently, protein subcellular relocalization, or neolocalization was proposed as one of the mechanisms responsible for the retention of duplicated genes. This hypothesis received support from the analysis of yeast genomes, but has not been tested thoroughly on animal genomes. In order to evaluate the importance of subcellular relocalizations for retention of duplicated genes in animal genomes, we systematically analyzed nuclear encoded mitochondrial proteins in the human genome by reconstructing phylogenies of mitochondrial multigene families. Results The 456 human mitochondrial proteins selected for this study were clustered into 305 gene families including 92 multigene families. Among the multigene families, 59 (64% consisted of both mitochondrial and cytosolic (non-mitochondrial proteins (mt-cy families while the remaining 33 (36% were composed of mitochondrial proteins (mt-mt families. Phylogenetic analyses of mt-cy families revealed three different scenarios of their neolocalization following gene duplication: 1 relocalization from mitochondria to cytosol, 2 from cytosol to mitochondria and 3 multiple subcellular relocalizations. The neolocalizations were most commonly enabled by the gain or loss of N-terminal mitochondrial targeting signals. The majority of detected subcellular relocalization events occurred early in animal evolution, preceding the evolution of tetrapods. Mt-mt protein families showed a somewhat different pattern, where gene duplication occurred more evenly in time. However, for both types of protein families, most duplication events appear to roughly coincide with two rounds of genome duplications early in vertebrate evolution. Finally, we evaluated the effects of inaccurate and incomplete annotation of mitochondrial proteins and found that our conclusion of the importance of subcellular relocalization after gene duplication on

  11. Spider Transcriptomes Identify Ancient Large-Scale Gene Duplication Event Potentially Important in Silk Gland Evolution.

    Science.gov (United States)

    Clarke, Thomas H; Garb, Jessica E; Hayashi, Cheryl Y; Arensburger, Peter; Ayoub, Nadia A

    2015-06-08

    The evolution of specialized tissues with novel functions, such as the silk synthesizing glands in spiders, is likely an influential driver of adaptive success. Large-scale gene duplication events and subsequent paralog divergence are thought to be required for generating evolutionary novelty. Such an event has been proposed for spiders, but not tested. We de novo assembled transcriptomes from three cobweb weaving spider species. Based on phylogenetic analyses of gene families with representatives from each of the three species, we found numerous duplication events indicative of a whole genome or segmental duplication. We estimated the age of the gene duplications relative to several speciation events within spiders and arachnids and found that the duplications likely occurred after the divergence of scorpions (order Scorpionida) and spiders (order Araneae), but before the divergence of the spider suborders Mygalomorphae and Araneomorphae, near the evolutionary origin of spider silk glands. Transcripts that are expressed exclusively or primarily within black widow silk glands are more likely to have a paralog descended from the ancient duplication event and have elevated amino acid replacement rates compared with other transcripts. Thus, an ancient large-scale gene duplication event within the spider lineage was likely an important source of molecular novelty during the evolution of silk gland-specific expression. This duplication event may have provided genetic material for subsequent silk gland diversification in the true spiders (Araneomorphae). © The Author(s) 2015. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  12. The natural history of class I primate alcohol dehydrogenases includes gene duplication, gene loss, and gene conversion.

    Directory of Open Access Journals (Sweden)

    Matthew A Carrigan

    Full Text Available Gene duplication is a source of molecular innovation throughout evolution. However, even with massive amounts of genome sequence data, correlating gene duplication with speciation and other events in natural history can be difficult. This is especially true in its most interesting cases, where rapid and multiple duplications are likely to reflect adaptation to rapidly changing environments and life styles. This may be so for Class I of alcohol dehydrogenases (ADH1s, where multiple duplications occurred in primate lineages in Old and New World monkeys (OWMs and NWMs and hominoids.To build a preferred model for the natural history of ADH1s, we determined the sequences of nine new ADH1 genes, finding for the first time multiple paralogs in various prosimians (lemurs, strepsirhines. Database mining then identified novel ADH1 paralogs in both macaque (an OWM and marmoset (a NWM. These were used with the previously identified human paralogs to resolve controversies relating to dates of duplication and gene conversion in the ADH1 family. Central to these controversies are differences in the topologies of trees generated from exonic (coding sequences and intronic sequences.We provide evidence that gene conversions are the primary source of difference, using molecular clock dating of duplications and analyses of microinsertions and deletions (micro-indels. The tree topology inferred from intron sequences appear to more correctly represent the natural history of ADH1s, with the ADH1 paralogs in platyrrhines (NWMs and catarrhines (OWMs and hominoids having arisen by duplications shortly predating the divergence of OWMs and NWMs. We also conclude that paralogs in lemurs arose independently. Finally, we identify errors in database interpretation as the source of controversies concerning gene conversion. These analyses provide a model for the natural history of ADH1s that posits four ADH1 paralogs in the ancestor of Catarrhine and Platyrrhine primates

  13. Biological consequences of ancient gene acquisition and duplication in the large genome soil bacterium, ""solibacter usitatus"" strain Ellin6076

    Energy Technology Data Exchange (ETDEWEB)

    Challacombe, Jean F [Los Alamos National Laboratory; Eichorst, Stephanie A [Los Alamos National Laboratory; Xie, Gary [Los Alamos National Laboratory; Kuske, Cheryl R [Los Alamos National Laboratory; Hauser, Loren [ORNL; Land, Miriam [ORNL

    2009-01-01

    Bacterial genome sizes range from ca. 0.5 to 10Mb and are influenced by gene duplication, horizontal gene transfer, gene loss and other evolutionary processes. Sequenced genomes of strains in the phylum Acidobacteria revealed that 'Solibacter usistatus' strain Ellin6076 harbors a 9.9 Mb genome. This large genome appears to have arisen by horizontal gene transfer via ancient bacteriophage and plasmid-mediated transduction, as well as widespread small-scale gene duplications. This has resulted in an increased number of paralogs that are potentially ecologically important (ecoparalogs). Low amino acid sequence identities among functional group members and lack of conserved gene order and orientation in the regions containing similar groups of paralogs suggest that most of the paralogs were not the result of recent duplication events. The genome sizes of cultured subdivision 1 and 3 strains in the phylum Acidobacteria were estimated using pulsed-field gel electrophoresis to determine the prevalence of the large genome trait within the phylum. Members of subdivision 1 were estimated to have smaller genome sizes ranging from ca. 2.0 to 4.8 Mb, whereas members of subdivision 3 had slightly larger genomes, from ca. 5.8 to 9.9 Mb. It is hypothesized that the large genome of strain Ellin6076 encodes traits that provide a selective metabolic, defensive and regulatory advantage in the variable soil environment.

  14. The prevalence of gene duplications and their ancient origin in Rhodobacter sphaeroides 2.4.1

    Directory of Open Access Journals (Sweden)

    Cho Hyuk

    2010-12-01

    Full Text Available Abstract Background Rhodobacter sphaeroides 2.4.1 is a metabolically versatile organism that belongs to α-3 subdivision of Proteobacteria. The present study was to identify the extent, history, and role of gene duplications in R. sphaeroides 2.4.1, an organism that possesses two chromosomes. Results A protein similarity search (BLASTP identified 1247 orfs (~29.4% of the total protein coding orfs that are present in 2 or more copies, 37.5% (234 gene-pairs of which exist in duplicate copies. The distribution of the duplicate gene-pairs in all Clusters of Orthologous Groups (COGs differed significantly when compared to the COG distribution across the whole genome. Location plots revealed clusters of gene duplications that possessed the same COG classification. Phylogenetic analyses were performed to determine a tree topology predicting either a Type-A or Type-B phylogenetic relationship. A Type-A phylogenetic relationship shows that a copy of the protein-pair matches more with an ortholog from a species closely related to R. sphaeroides while a Type-B relationship predicts the highest match between both copies of the R. sphaeroides protein-pair. The results revealed that ~77% of the proteins exhibited a Type-A phylogenetic relationship demonstrating the ancient origin of these gene duplications. Additional analyses on three other strains of R. sphaeroides revealed varying levels of gene loss and retention in these strains. Also, analyses on common gene pairs among the four strains revealed that these genes experience similar functional constraints and undergo purifying selection. Conclusions Although the results suggest that the level of gene duplication in organisms with complex genome structuring (more than one chromosome seems to be not markedly different from that in organisms with only a single chromosome, these duplications may have aided in genome reorganization in this group of eubacteria prior to the formation of R. sphaeroides as gene

  15. Divergence of recently duplicated M{gamma}-type MADS-box genes in Petunia.

    Science.gov (United States)

    Bemer, Marian; Gordon, Jonathan; Weterings, Koen; Angenent, Gerco C

    2010-02-01

    The MADS-box transcription factor family has expanded considerably in plants via gene and genome duplications and can be subdivided into type I and MIKC-type genes. The two gene classes show a different evolutionary history. Whereas the MIKC-type genes originated during ancient genome duplications, as well as during more recent events, the type I loci appear to experience high turnover with many recent duplications. This different mode of origin also suggests a different fate for the type I duplicates, which are thought to have a higher chance to become silenced or lost from the genome. To get more insight into the evolution of the type I MADS-box genes, we isolated nine type I genes from Petunia, which belong to the Mgamma subclass, and investigated the divergence of their coding and regulatory regions. The isolated genes could be subdivided into two categories: two genes were highly similar to Arabidopsis Mgamma-type genes, whereas the other seven genes showed less similarity to Arabidopsis genes and originated more recently. Two of the recently duplicated genes were found to contain deleterious mutations in their coding regions, and expression analysis revealed that a third paralog was silenced by mutations in its regulatory region. However, in addition to the three genes that were subjected to nonfunctionalization, we also found evidence for neofunctionalization of one of the Petunia Mgamma-type genes. Our study shows a rapid divergence of recently duplicated Mgamma-type MADS-box genes and suggests that redundancy among type I paralogs may be less common than expected.

  16. Restriction and Recruitment—Gene Duplication and the Origin and Evolution of Snake Venom Toxins

    Science.gov (United States)

    Hargreaves, Adam D.; Swain, Martin T.; Hegarty, Matthew J.; Logan, Darren W.; Mulley, John F.

    2014-01-01

    Snake venom has been hypothesized to have originated and diversified through a process that involves duplication of genes encoding body proteins with subsequent recruitment of the copy to the venom gland, where natural selection acts to develop or increase toxicity. However, gene duplication is known to be a rare event in vertebrate genomes, and the recruitment of duplicated genes to a novel expression domain (neofunctionalization) is an even rarer process that requires the evolution of novel combinations of transcription factor binding sites in upstream regulatory regions. Therefore, although this hypothesis concerning the evolution of snake venom is very unlikely and should be regarded with caution, it is nonetheless often assumed to be established fact, hindering research into the true origins of snake venom toxins. To critically evaluate this hypothesis, we have generated transcriptomic data for body tissues and salivary and venom glands from five species of venomous and nonvenomous reptiles. Our comparative transcriptomic analysis of these data reveals that snake venom does not evolve through the hypothesized process of duplication and recruitment of genes encoding body proteins. Indeed, our results show that many proposed venom toxins are in fact expressed in a wide variety of body tissues, including the salivary gland of nonvenomous reptiles and that these genes have therefore been restricted to the venom gland following duplication, not recruited. Thus, snake venom evolves through the duplication and subfunctionalization of genes encoding existing salivary proteins. These results highlight the danger of the elegant and intuitive “just-so story” in evolutionary biology. PMID:25079342

  17. Processes of fungal proteome evolution and gain of function: gene duplication and domain rearrangement

    International Nuclear Information System (INIS)

    Cohen-Gihon, Inbar; Nussinov, Ruth; Sharan, Roded

    2011-01-01

    During evolution, organisms have gained functional complexity mainly by modifying and improving existing functioning systems rather than creating new ones ab initio. Here we explore the interplay between two processes which during evolution have had major roles in the acquisition of new functions: gene duplication and protein domain rearrangements. We consider four possible evolutionary scenarios: gene families that have undergone none of these event types; only gene duplication; only domain rearrangement, or both events. We characterize each of the four evolutionary scenarios by functional attributes. Our analysis of ten fungal genomes indicates that at least for the fungi clade, species significantly appear to gain complexity by gene duplication accompanied by the expansion of existing domain architectures via rearrangements. We show that paralogs gaining new domain architectures via duplication tend to adopt new functions compared to paralogs that preserve their domain architectures. We conclude that evolution of protein families through gene duplication and domain rearrangement is correlated with their functional properties. We suggest that in general, new functions are acquired via the integration of gene duplication and domain rearrangements rather than each process acting independently

  18. The enrichment of TATA box and the scarcity of depleted proximal nucleosome in the promoters of duplicated yeast genes.

    Science.gov (United States)

    Kim, Yuseob; Lee, Jang H; Babbitt, Gregory A

    2010-01-01

    Population genetic theory of gene duplication suggests that the preservation of duplicate copies requires functional divergence upon duplication. Genes that can be readily modified to produce new gene expression patterns may thus be duplicated often. In yeast, genes exhibit dichotomous expression patterns based on their promoter architectures. The expression of genes that contain TATA box or occupied proximal nucleosome (OPN) tends to be variable and respond to external signals. On the other hand, genes without TATA box or with depleted proximal nucleosome (DPN) are expressed constitutively. We find that recent duplicates in the yeast genome are heavily biased to be TATA box containing genes and not to be DPN genes. This suggests that variably expressed genes, due to the functional organization in their promoters, have higher duplicability than constitutively expressed genes.

  19. Yeast Interspecies Comparative Proteomics Reveals Divergence in Expression Profiles and Provides Insights into Proteome Resource Allocation and Evolutionary Roles of Gene Duplication*

    Science.gov (United States)

    Kito, Keiji; Ito, Haruka; Nohara, Takehiro; Ohnishi, Mihoko; Ishibashi, Yuko; Takeda, Daisuke

    2016-01-01

    Omics analysis is a versatile approach for understanding the conservation and diversity of molecular systems across multiple taxa. In this study, we compared the proteome expression profiles of four yeast species (Saccharomyces cerevisiae, Saccharomyces mikatae, Kluyveromyces waltii, and Kluyveromyces lactis) grown on glucose- or glycerol-containing media. Conserved expression changes across all species were observed only for a small proportion of all proteins differentially expressed between the two growth conditions. Two Kluyveromyces species, both of which exhibited a high growth rate on glycerol, a nonfermentative carbon source, showed distinct species-specific expression profiles. In K. waltii grown on glycerol, proteins involved in the glyoxylate cycle and gluconeogenesis were expressed in high abundance. In K. lactis grown on glycerol, the expression of glycolytic and ethanol metabolic enzymes was unexpectedly low, whereas proteins involved in cytoplasmic translation, including ribosomal proteins and elongation factors, were highly expressed. These marked differences in the types of predominantly expressed proteins suggest that K. lactis optimizes the balance of proteome resource allocation between metabolism and protein synthesis giving priority to cellular growth. In S. cerevisiae, about 450 duplicate gene pairs were retained after whole-genome duplication. Intriguingly, we found that in the case of duplicates with conserved sequences, the total abundance of proteins encoded by a duplicate pair in S. cerevisiae was similar to that of protein encoded by nonduplicated ortholog in Kluyveromyces yeast. Given the frequency of haploinsufficiency, this observation suggests that conserved duplicate genes, even though minor cases of retained duplicates, do not exhibit a dosage effect in yeast, except for ribosomal proteins. Thus, comparative proteomic analyses across multiple species may reveal not only species-specific characteristics of metabolic processes under

  20. Tubulin evolution in insects: gene duplication and subfunctionalization provide specialized isoforms in a functionally constrained gene family

    Directory of Open Access Journals (Sweden)

    Gadagkar Sudhindra R

    2010-04-01

    with microtubule-associated proteins. CTT residues overwhelming comprise the co-evolving residues between Drosophila alpha 2 and beta 3 tubulin proteins, indicating CTT specializations can be mediated at the level of the tubulin dimer. Gene duplications post-dating separation of the insect orders are unevenly distributed, most often appearing in major alpha 1 and minor beta 2 clades. More than 40 introns are found in tubulins. Their distribution among tubulins reveals that insertion and deletion events are common, surprising given their potential for disrupting tubulin coding sequence. Compensatory evolution is found in Drosophila beta 2 tubulin cis-regulation, and reveals selective pressures acting to maintain testis expression without the use of previously identified testis cis-regulatory elements. Conclusion Tubulins have stringent structure/function relationships, indicated by strong purifying selection, the loss of many gene duplication products, alpha-beta co-evolution in the tubulin dimer, and compensatory evolution in beta 2 tubulin cis-regulation. They evolve through gene duplication, subfunctionalization in expression domain and divergence of duplication products, largely in CTT residues that mediate interactions with other proteins. This has resulted in the tissue-specific minor insect isoforms, and in particular the highly diverse α3, α4, and β2 reproductive tissue-specific tubulin isoforms, illustrating that even a highly conserved protein family can participate in the adaptive process and respond to sexual selection.

  1. Evolution dynamics of a model for gene duplication under adaptive conflict

    Science.gov (United States)

    Ancliff, Mark; Park, Jeong-Man

    2014-06-01

    We present and solve the dynamics of a model for gene duplication showing escape from adaptive conflict. We use a Crow-Kimura quasispecies model of evolution where the fitness landscape is a function of Hamming distances from two reference sequences, which are assumed to optimize two different gene functions, to describe the dynamics of a mixed population of individuals with single and double copies of a pleiotropic gene. The evolution equations are solved through a spin coherent state path integral, and we find two phases: one is an escape from an adaptive conflict phase, where each copy of a duplicated gene evolves toward subfunctionalization, and the other is a duplication loss of function phase, where one copy maintains its pleiotropic form and the other copy undergoes neutral mutation. The phase is determined by a competition between the fitness benefits of subfunctionalization and the greater mutational load associated with maintaining two gene copies. In the escape phase, we find a dynamics of an initial population of single gene sequences only which escape adaptive conflict through gene duplication and find that there are two time regimes: until a time t* single gene sequences dominate, and after t* double gene sequences outgrow single gene sequences. The time t* is identified as the time necessary for subfunctionalization to evolve and spread throughout the double gene sequences, and we show that there is an optimum mutation rate which minimizes this time scale.

  2. Partial duplication of the APBA2 gene in chromosome 15q13 corresponds to duplicon structures

    Directory of Open Access Journals (Sweden)

    Kesterson Robert A

    2003-04-01

    Full Text Available Abstract Background Chromosomal abnormalities affecting human chromosome 15q11-q13 underlie multiple genomic disorders caused by deletion, duplication and triplication of intervals in this region. These events are mediated by highly homologous segments of DNA, or duplicons, that facilitate mispairing and unequal cross-over in meiosis. The gene encoding an amyloid precursor protein-binding protein (APBA2 was previously mapped to the distal portion of the interval commonly deleted in Prader-Willi and Angelman syndromes and duplicated in cases of autism. Results We show that this gene actually maps to a more telomeric location and is partially duplicated within the broader region. Two highly homologous copies of an interval containing a large 5' exon and downstream sequence are located ~5 Mb distal to the intact locus. The duplicated copies, containing the first coding exon of APBA2, can be distinguished by single nucleotide sequence differences and are transcriptionally inactive. Adjacent to APBA2 maps a gene termed KIAA0574. The protein encoded by this gene is weakly homologous to a protein termed X123 that in turn maps adjacent to APBA1 on 9q21.12; APBA1 is highly homologous to APBA2 in the C-terminal region and is distinguished from APBA2 by the N-terminal region encoded by this duplicated exon. Conclusion The duplication of APBA2 sequences in this region adds to a complex picture of different low copy repeats present across this region and elsewhere on the chromosome.

  3. Gene duplication, loss and selection in the evolution of saxitoxin biosynthesis in alveolates.

    Science.gov (United States)

    Murray, Shauna A; Diwan, Rutuja; Orr, Russell J S; Kohli, Gurjeet S; John, Uwe

    2015-11-01

    A group of marine dinoflagellates (Alveolata, Eukaryota), consisting of ∼10 species of the genus Alexandrium, Gymnodinium catenatum and Pyrodinium bahamense, produce the toxin saxitoxin and its analogues (STX), which can accumulate in shellfish, leading to ecosystem and human health impacts. The genes, sxt, putatively involved in STX biosynthesis, have recently been identified, however, the evolution of these genes within dinoflagellates is not clear. There are two reasons for this: uncertainty over the phylogeny of dinoflagellates; and that the sxt genes of many species of Alexandrium and other dinoflagellate genera are not known. Here, we determined the phylogeny of STX-producing and other dinoflagellates based on a concatenated eight-gene alignment. We determined the presence, diversity and phylogeny of sxtA, domains A1 and A4 and sxtG in 52 strains of Alexandrium, and a further 43 species of dinoflagellates and thirteen other alveolates. We confirmed the presence and high sequence conservation of sxtA, domain A4, in 40 strains (35 Alexandrium, 1 Pyrodinium, 4 Gymnodinium) of 8 species of STX-producing dinoflagellates, and absence from non-producing species. We found three paralogs of sxtA, domain A1, and a widespread distribution of sxtA1 in non-STX producing dinoflagellates, indicating duplication events in the evolution of this gene. One paralog, clade 2, of sxtA1 may be particularly related to STX biosynthesis. Similarly, sxtG appears to be generally restricted to STX-producing species, while three amidinotransferase gene paralogs were found in dinoflagellates. We investigated the role of positive (diversifying) selection following duplication in sxtA1 and sxtG, and found negative selection in clades of sxtG and sxtA1, clade 2, suggesting they were functionally constrained. Significant episodic diversifying selection was found in some strains in clade 3 of sxtA1, a clade that may not be involved in STX biosynthesis, indicating pressure for diversification

  4. Differential transcriptional modulation of duplicated fatty acid-binding protein genes by dietary fatty acids in zebrafish (Danio rerio: evidence for subfunctionalization or neofunctionalization of duplicated genes

    Directory of Open Access Journals (Sweden)

    Denovan-Wright Eileen M

    2009-09-01

    Full Text Available Abstract Background In the Duplication-Degeneration-Complementation (DDC model, subfunctionalization and neofunctionalization have been proposed as important processes driving the retention of duplicated genes in the genome. These processes are thought to occur by gain or loss of regulatory elements in the promoters of duplicated genes. We tested the DDC model by determining the transcriptional induction of fatty acid-binding proteins (Fabps genes by dietary fatty acids (FAs in zebrafish. We chose zebrafish for this study for two reasons: extensive bioinformatics resources are available for zebrafish at zfin.org and zebrafish contains many duplicated genes owing to a whole genome duplication event that occurred early in the ray-finned fish lineage approximately 230-400 million years ago. Adult zebrafish were fed diets containing either fish oil (12% lipid, rich in highly unsaturated fatty acid, sunflower oil (12% lipid, rich in linoleic acid, linseed oil (12% lipid, rich in linolenic acid, or low fat (4% lipid, low fat diet for 10 weeks. FA profiles and the steady-state levels of fabp mRNA and heterogeneous nuclear RNA in intestine, liver, muscle and brain of zebrafish were determined. Result FA profiles assayed by gas chromatography differed in the intestine, brain, muscle and liver depending on diet. The steady-state level of mRNA for three sets of duplicated genes, fabp1a/fabp1b.1/fabp1b.2, fabp7a/fabp7b, and fabp11a/fabp11b, was determined by reverse transcription, quantitative polymerase chain reaction (RT-qPCR. In brain, the steady-state level of fabp7b mRNAs was induced in fish fed the linoleic acid-rich diet; in intestine, the transcript level of fabp1b.1 and fabp7b were elevated in fish fed the linolenic acid-rich diet; in liver, the level of fabp7a mRNAs was elevated in fish fed the low fat diet; and in muscle, the level of fabp7a and fabp11a mRNAs were elevated in fish fed the linolenic acid-rich or the low fat diets. In all cases

  5. Independent Origin and Global Distribution of Distinct Plasmodium vivax Duffy Binding Protein Gene Duplications.

    Directory of Open Access Journals (Sweden)

    Jessica B Hostetler

    2016-10-01

    Full Text Available Plasmodium vivax causes the majority of malaria episodes outside Africa, but remains a relatively understudied pathogen. The pathology of P. vivax infection depends critically on the parasite's ability to recognize and invade human erythrocytes. This invasion process involves an interaction between P. vivax Duffy Binding Protein (PvDBP in merozoites and the Duffy antigen receptor for chemokines (DARC on the erythrocyte surface. Whole-genome sequencing of clinical isolates recently established that some P. vivax genomes contain two copies of the PvDBP gene. The frequency of this duplication is particularly high in Madagascar, where there is also evidence for P. vivax infection in DARC-negative individuals. The functional significance and global prevalence of this duplication, and whether there are other copy number variations at the PvDBP locus, is unknown.Using whole-genome sequencing and PCR to study the PvDBP locus in P. vivax clinical isolates, we found that PvDBP duplication is widespread in Cambodia. The boundaries of the Cambodian PvDBP duplication differ from those previously identified in Madagascar, meaning that current molecular assays were unable to detect it. The Cambodian PvDBP duplication did not associate with parasite density or DARC genotype, and ranged in prevalence from 20% to 38% over four annual transmission seasons in Cambodia. This duplication was also present in P. vivax isolates from Brazil and Ethiopia, but not India.PvDBP duplications are much more widespread and complex than previously thought, and at least two distinct duplications are circulating globally. The same duplication boundaries were identified in parasites from three continents, and were found at high prevalence in human populations where DARC-negativity is essentially absent. It is therefore unlikely that PvDBP duplication is associated with infection of DARC-negative individuals, but functional tests will be required to confirm this hypothesis.

  6. Rapid sequence divergence rates in the 5 prime regulatory regions of young Drosophila melanogaster duplicate gene pairs

    Directory of Open Access Journals (Sweden)

    Michael H. Kohn

    2008-01-01

    Full Text Available While it remains a matter of some debate, rapid sequence evolution of the coding sequences of duplicate genes is characteristic for early phases past duplication, but long established duplicates generally evolve under constraint, much like the rest of the coding genome. As for coding sequences, it may be possible to infer evolutionary rate, selection, and constraint via contrasts between duplicate gene divergence in the 5 prime regions and in the corresponding synonymous site divergence in the coding regions. Finding elevated rates for the 5 prime regions of duplicated genes, in addition to the coding regions, would enable statements regarding the early processes of duplicate gene evolution. Here, 1 kb of each of the 5 prime regulatory regions of Drosophila melanogaster duplicate gene pairs were mapped onto one another to isolate shared sequence blocks. Genetic distances within shared sequence blocks (d5’ were found to increase as a function of synonymous (dS, and to a lesser extend, amino-acid (dA site divergence between duplicates. The rate d5’/dS was found to rapidly decay from values > 1 in young duplicate pairs (dS 0.8. Such rapid rates of 5 prime evolution exceeding 1 (~neutral predominantly were found to occur in duplicate pairs with low amino-acid site divergence and that tended to be co-regulated when assayed on microarrays. Conceivably, functional redundancy and relaxation of selective constraint facilitates subsequent positive selection on the 5 prime regions of young duplicate genes. This might promote the evolution of new functions (neofunctionalization or division of labor among duplicate genes (subfunctionalization. In contrast, similar to the vast portion of the non-coding genome, the 5 prime regions of long-established gene duplicates appear to evolve under selective constraint, indicating that these long-established gene duplicates have assumed critical functions.

  7. On the Complexity of Duplication-Transfer-Loss Reconciliation with Non-Binary Gene Trees.

    Science.gov (United States)

    Kordi, Misagh; Bansal, Mukul S

    2017-01-01

    Duplication-Transfer-Loss (DTL) reconciliation has emerged as a powerful technique for studying gene family evolution in the presence of horizontal gene transfer. DTL reconciliation takes as input a gene family phylogeny and the corresponding species phylogeny, and reconciles the two by postulating speciation, gene duplication, horizontal gene transfer, and gene loss events. Efficient algorithms exist for finding optimal DTL reconciliations when the gene tree is binary. However, gene trees are frequently non-binary. With such non-binary gene trees, the reconciliation problem seeks to find a binary resolution of the gene tree that minimizes the reconciliation cost. Given the prevalence of non-binary gene trees, many efficient algorithms have been developed for this problem in the context of the simpler Duplication-Loss (DL) reconciliation model. Yet, no efficient algorithms exist for DTL reconciliation with non-binary gene trees and the complexity of the problem remains unknown. In this work, we resolve this open question by showing that the problem is, in fact, NP-hard. Our reduction applies to both the dated and undated formulations of DTL reconciliation. By resolving this long-standing open problem, this work will spur the development of both exact and heuristic algorithms for this important problem.

  8. Three neuropeptide Y receptor genes in the spiny dogfish, Squalus acanthias, support en bloc duplications in early vertebrate evolution.

    Science.gov (United States)

    Salaneck, Erik; Ardell, David H; Larson, Earl T; Larhammar, Dan

    2003-08-01

    It has been debated whether the increase in gene number during early vertebrate evolution was due to multiple independent gene duplications or synchronous duplications of many genes. We describe here the cloning of three neuropeptide Y (NPY) receptor genes belonging to the Y1 subfamily in the spiny dogfish, Squalus acanthias, a cartilaginous fish. The three genes are orthologs of the mammalian subtypes Y1, Y4, and Y6, which are located in paralogous gene regions on different chromosomes in mammals. Thus, these genes arose by duplications of a chromosome region before the radiation of gnathostomes (jawed vertebrates). Estimates of duplication times from linearized trees together with evidence from other gene families supports two rounds of chromosome duplications or tetraploidizations early in vertebrate evolution. The anatomical distribution of mRNA was determined by reverse-transcriptase PCR and was found to differ from mammals, suggesting differential functional diversification of the new gene copies during the radiation of the vertebrate classes.

  9. Duplication and relocation of the functional DPY19L2 gene within low copy repeats

    Directory of Open Access Journals (Sweden)

    Cheung Joseph

    2006-03-01

    Full Text Available Abstract Background Low copy repeats (LCRs are thought to play an important role in recent gene evolution, especially when they facilitate gene duplications. Duplicate genes are fundamental to adaptive evolution, providing substrates for the development of new or shared gene functions. Moreover, silencing of duplicate genes can have an indirect effect on adaptive evolution by causing genomic relocation of functional genes. These changes are theorized to have been a major factor in speciation. Results Here we present a novel example showing functional gene relocation within a LCR. We characterize the genomic structure and gene content of eight related LCRs on human Chromosomes 7 and 12. Two members of a novel transmembrane gene family, DPY19L, were identified in these regions, along with six transcribed pseudogenes. One of these genes, DPY19L2, is found on Chromosome 12 and is not syntenic with its mouse orthologue. Instead, the human locus syntenic to mouse Dpy19l2 contains a pseudogene, DPY19L2P1. This indicates that the ancestral copy of this gene has been silenced, while the descendant copy has remained active. Thus, the functional copy of this gene has been relocated to a new genomic locus. We then describe the expansion and evolution of the DPY19L gene family from a single gene found in invertebrate animals. Ancient duplications have led to multiple homologues in different lineages, with three in fish, frogs and birds and four in mammals. Conclusion Our results show that the DPY19L family has expanded throughout the vertebrate lineage and has undergone recent primate-specific evolution within LCRs.

  10. Neofunctionalization of Duplicated P450 Genes Drives the Evolution of Insecticide Resistance in the Brown Planthopper.

    Science.gov (United States)

    Zimmer, Christoph T; Garrood, William T; Singh, Kumar Saurabh; Randall, Emma; Lueke, Bettina; Gutbrod, Oliver; Matthiesen, Svend; Kohler, Maxie; Nauen, Ralf; Davies, T G Emyr; Bass, Chris

    2018-01-22

    Gene duplication is a major source of genetic variation that has been shown to underpin the evolution of a wide range of adaptive traits [1, 2]. For example, duplication or amplification of genes encoding detoxification enzymes has been shown to play an important role in the evolution of insecticide resistance [3-5]. In this context, gene duplication performs an adaptive function as a result of its effects on gene dosage and not as a source of functional novelty [3, 6-8]. Here, we show that duplication and neofunctionalization of a cytochrome P450, CYP6ER1, led to the evolution of insecticide resistance in the brown planthopper. Considerable genetic variation was observed in the coding sequence of CYP6ER1 in populations of brown planthopper collected from across Asia, but just two sequence variants are highly overexpressed in resistant strains and metabolize imidacloprid. Both variants are characterized by profound amino-acid alterations in substrate recognition sites, and the introduction of these mutations into a susceptible P450 sequence is sufficient to confer resistance. CYP6ER1 is duplicated in resistant strains with individuals carrying paralogs with and without the gain-of-function mutations. Despite numerical parity in the genome, the susceptible and mutant copies exhibit marked asymmetry in their expression with the resistant paralogs overexpressed. In the primary resistance-conferring CYP6ER1 variant, this results from an extended region of novel sequence upstream of the gene that provides enhanced expression. Our findings illustrate the versatility of gene duplication in providing opportunities for functional and regulatory innovation during the evolution of an adaptive trait. Copyright © 2017 The Authors. Published by Elsevier Ltd.. All rights reserved.

  11. Duplication and diversification of the hypoxia-inducible IGFBP-1 gene in zebrafish.

    Directory of Open Access Journals (Sweden)

    Hiroyasu Kamei

    2008-08-01

    Full Text Available Gene duplication is the primary force of new gene evolution. Deciphering whether a pair of duplicated genes has evolved divergent functions is often challenging. The zebrafish is uniquely positioned to provide insight into the process of functional gene evolution due to its amenability to genetic and experimental manipulation and because it possess a large number of duplicated genes.We report the identification and characterization of two hypoxia-inducible genes in zebrafish that are co-ortholgs of human IGF binding protein-1 (IGFBP-1. IGFBP-1 is a secreted protein that binds to IGF and modulates IGF actions in somatic growth, development, and aging. Like their human and mouse counterparts, in adult zebrafish igfbp-1a and igfbp-1b are exclusively expressed in the liver. During embryogenesis, the two genes are expressed in overlapping spatial domains but with distinct temporal patterns. While zebrafish IGFBP-1a mRNA was easily detected throughout embryogenesis, IGFBP-1b mRNA was detectable only in advanced stages. Hypoxia induces igfbp-1a expression in early embryogenesis, but induces the igfbp-1b expression later in embryogenesis. Both IGFBP-1a and -b are capable of IGF binding, but IGFBP-1b has much lower affinities for IGF-I and -II because of greater dissociation rates. Overexpression of IGFBP-1a and -1b in zebrafish embryos caused significant decreases in growth and developmental rates. When tested in cultured zebrafish embryonic cells, IGFBP-1a and -1b both inhibited IGF-1-induced cell proliferation but the activity of IGFBP-1b was significantly weaker.These results indicate subfunction partitioning of the duplicated IGFBP-1 genes at the levels of gene expression, physiological regulation, protein structure, and biological actions. The duplicated IGFBP-1 may provide additional flexibility in fine-tuning IGF signaling activities under hypoxia and other catabolic conditions.

  12. Gene Duplication and Gene Expression Changes Play a Role in the Evolution of Candidate Pollen Feeding Genes in Heliconius Butterflies.

    Science.gov (United States)

    Smith, Gilbert; Macias-Muñoz, Aide; Briscoe, Adriana D

    2016-09-02

    Heliconius possess a unique ability among butterflies to feed on pollen. Pollen feeding significantly extends their lifespan, and is thought to have been important to the diversification of the genus. We used RNA sequencing to examine feeding-related gene expression in the mouthparts of four species of Heliconius and one nonpollen feeding species, Eueides isabella We hypothesized that genes involved in morphology and protein metabolism might be upregulated in Heliconius because they have longer proboscides than Eueides, and because pollen contains more protein than nectar. Using de novo transcriptome assemblies, we tested these hypotheses by comparing gene expression in mouthparts against antennae and legs. We first looked for genes upregulated in mouthparts across all five species and discovered several hundred genes, many of which had functional annotations involving metabolism of proteins (cocoonase), lipids, and carbohydrates. We then looked specifically within Heliconius where we found eleven common upregulated genes with roles in morphology (CPR cuticle proteins), behavior (takeout-like), and metabolism (luciferase-like). Closer examination of these candidates revealed that cocoonase underwent several duplications along the lineage leading to heliconiine butterflies, including two Heliconius-specific duplications. Luciferase-like genes also underwent duplication within lepidopterans, and upregulation in Heliconius mouthparts. Reverse-transcription PCR confirmed that three cocoonases, a peptidase, and one luciferase-like gene are expressed in the proboscis with little to no expression in labial palps and salivary glands. Our results suggest pollen feeding, like other dietary specializations, was likely facilitated by adaptive expansions of preexisting genes-and that the butterfly proboscis is involved in digestive enzyme production. © The Author(s) 2016. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  13. Age distribution of human gene families shows significant roles of both large- and small-scale duplications in vertebrate evolution.

    Science.gov (United States)

    Gu, Xun; Wang, Yufeng; Gu, Jianying

    2002-06-01

    The classical (two-round) hypothesis of vertebrate genome duplication proposes two successive whole-genome duplication(s) (polyploidizations) predating the origin of fishes, a view now being seriously challenged. As the debate largely concerns the relative merits of the 'big-bang mode' theory (large-scale duplication) and the 'continuous mode' theory (constant creation by small-scale duplications), we tested whether a significant proportion of paralogous genes in the contemporary human genome was indeed generated in the early stage of vertebrate evolution. After an extensive search of major databases, we dated 1,739 gene duplication events from the phylogenetic analysis of 749 vertebrate gene families. We found a pattern characterized by two waves (I, II) and an ancient component. Wave I represents a recent gene family expansion by tandem or segmental duplications, whereas wave II, a rapid paralogous gene increase in the early stage of vertebrate evolution, supports the idea of genome duplication(s) (the big-bang mode). Further analysis indicated that large- and small-scale gene duplications both make a significant contribution during the early stage of vertebrate evolution to build the current hierarchy of the human proteome.

  14. Gene duplication as a major force in evolution

    Indian Academy of Sciences (India)

    ers were developed, and the 1990s, when genome sequenc- ing became ... transposed gene copies have been maintained in the human genome over the past 63 ..... competent artificial chromosome (TAC) libraries as the pri- mary substrates ...

  15. Rapid bursts of androgen-binding protein (Abp) gene duplication occurred independently in diverse mammals.

    Science.gov (United States)

    Laukaitis, Christina M; Heger, Andreas; Blakley, Tyler D; Munclinger, Pavel; Ponting, Chris P; Karn, Robert C

    2008-02-12

    The draft mouse (Mus musculus) genome sequence revealed an unexpected proliferation of gene duplicates encoding a family of secretoglobin proteins including the androgen-binding protein (ABP) alpha, beta and gamma subunits. Further investigation of 14 alpha-like (Abpa) and 13 beta- or gamma-like (Abpbg) undisrupted gene sequences revealed a rich diversity of developmental stage-, sex- and tissue-specific expression. Despite these studies, our understanding of the evolution of this gene family remains incomplete. Questions arise from imperfections in the initial mouse genome assembly and a dearth of information about the gene family structure in other rodents and mammals. Here, we interrogate the latest 'finished' mouse (Mus musculus) genome sequence assembly to show that the Abp gene repertoire is, in fact, twice as large as reported previously, with 30 Abpa and 34 Abpbg genes and pseudogenes. All of these have arisen since the last common ancestor with rat (Rattus norvegicus). We then demonstrate, by sequencing homologs from species within the Mus genus, that this burst of gene duplication occurred very recently, within the past seven million years. Finally, we survey Abp orthologs in genomes from across the mammalian clade and show that bursts of Abp gene duplications are not specific to the murid rodents; they also occurred recently in the lagomorph (rabbit, Oryctolagus cuniculus) and ruminant (cattle, Bos taurus) lineages, although not in other mammalian taxa. We conclude that Abp genes have undergone repeated bursts of gene duplication and adaptive sequence diversification driven by these genes' participation in chemosensation and/or sexual identification.

  16. Segmental Duplication, Microinversion, and Gene Loss Associated with a Complex Inversion Breakpoint Region in Drosophila

    Science.gov (United States)

    Calvete, Oriol; González, Josefa; Betrán, Esther; Ruiz, Alfredo

    2012-01-01

    Chromosomal inversions are usually portrayed as simple two-breakpoint rearrangements changing gene order but not gene number or structure. However, increasing evidence suggests that inversion breakpoints may often have a complex structure and entail gene duplications with potential functional consequences. Here, we used a combination of different techniques to investigate the breakpoint structure and the functional consequences of a complex rearrangement fixed in Drosophila buzzatii and comprising two tandemly arranged inversions sharing the middle breakpoint: 2m and 2n. By comparing the sequence in the breakpoint regions between D. buzzatii (inverted chromosome) and D. mojavensis (noninverted chromosome), we corroborate the breakpoint reuse at the molecular level and infer that inversion 2m was associated with a duplication of a ∼13 kb segment and likely generated by staggered breaks plus repair by nonhomologous end joining. The duplicated segment contained the gene CG4673, involved in nuclear transport, and its two nested genes CG5071 and CG5079. Interestingly, we found that other than the inversion and the associated duplication, both breakpoints suffered additional rearrangements, that is, the proximal breakpoint experienced a microinversion event associated at both ends with a 121-bp long duplication that contains a promoter. As a consequence of all these different rearrangements, CG5079 has been lost from the genome, CG5071 is now a single copy nonnested gene, and CG4673 has a transcript ∼9 kb shorter and seems to have acquired a more complex gene regulation. Our results illustrate the complex effects of chromosomal rearrangements and highlight the need of complementing genomic approaches with detailed sequence-level and functional analyses of breakpoint regions if we are to fully understand genome structure, function, and evolutionary dynamics. PMID:22328714

  17. Exact Algorithms for Duplication-Transfer-Loss Reconciliation with Non-Binary Gene Trees.

    Science.gov (United States)

    Kordi, Misagh; Bansal, Mukul S

    2017-06-01

    Duplication-Transfer-Loss (DTL) reconciliation is a powerful method for studying gene family evolution in the presence of horizontal gene transfer. DTL reconciliation seeks to reconcile gene trees with species trees by postulating speciation, duplication, transfer, and loss events. Efficient algorithms exist for finding optimal DTL reconciliations when the gene tree is binary. In practice, however, gene trees are often non-binary due to uncertainty in the gene tree topologies, and DTL reconciliation with non-binary gene trees is known to be NP-hard. In this paper, we present the first exact algorithms for DTL reconciliation with non-binary gene trees. Specifically, we (i) show that the DTL reconciliation problem for non-binary gene trees is fixed-parameter tractable in the maximum degree of the gene tree, (ii) present an exponential-time, but in-practice efficient, algorithm to track and enumerate all optimal binary resolutions of a non-binary input gene tree, and (iii) apply our algorithms to a large empirical data set of over 4700 gene trees from 100 species to study the impact of gene tree uncertainty on DTL-reconciliation and to demonstrate the applicability and utility of our algorithms. The new techniques and algorithms introduced in this paper will help biologists avoid incorrect evolutionary inferences caused by gene tree uncertainty.

  18. A duplicated PLP gene causing Pelizaeus-Merzbacher disease detected by comparative multiplex PCR

    Energy Technology Data Exchange (ETDEWEB)

    Inoue, K.; Sugiyama, N.; Kawanishi, C. [Yokohama City Univ., Yokohama (Japan)] [and others

    1996-07-01

    Pelizaeus-Merzbacher disease (PMD) is an X-linked dysmyelinating disorder caused by abnormalities in the proteolipid protein (PLP) gene, which is essential for oligodendrocyte differentiation and CNS myelin formation. Although linkage analysis has shown the homogeneity at the PLP locus in patients with PMD, exonic mutations in the PLP gene have been identified in only 10% - 25% of all cases, which suggests the presence of other genetic aberrations, including gene duplication. In this study, we examined five families with PMD not carrying exonic mutations in PLP gene, using comparative multiplex PCR (CM-PCR) as a semiquantitative assay of gene dosage. PLP gene duplications were identified in four families by CM-PCR and confirmed in three families by densitometric RFLP analysis. Because a homologous myelin protein gene, PMP22, is duplicated in the majority of patients with Charcot-Marie-Tooth 1A, PLP gene overdosage may be an important genetic abnormality in PMD and affect myelin formation. 38 ref., 5 figs., 2 tabs.

  19. Multiplex Ligation-dependent Probe Amplification Identification of Deletions and Duplications of the Duchenne Muscular Dystrophy Gene in Taiwanese Subjects

    Directory of Open Access Journals (Sweden)

    Hsiao-Lin Hwa

    2007-05-01

    Conclusion: MLPA was proven to be a powerful tool for the detection of DMD gene deletions and duplications in male patients and female carriers. There was a relatively lower frequency of deletion and a higher frequency of duplication of DMD gene in this population compared to previous reports.

  20. Differential evolution of members of the rhomboid gene family with conservative and divergent patterns.

    Science.gov (United States)

    Li, Qi; Zhang, Ning; Zhang, Liangsheng; Ma, Hong

    2015-04-01

    Rhomboid proteins are intramembrane serine proteases that are involved in a plethora of biological functions, but the evolutionary history of the rhomboid gene family is not clear. We performed a comprehensive molecular evolutionary analysis of the rhomboid gene family and also investigated the organization and sequence features of plant rhomboids in different subfamilies. Our results showed that eukaryotic rhomboids could be divided into five subfamilies (RhoA-RhoD and PARL). Most orthology groups appeared to be conserved only as single or low-copy genes in all lineages in RhoB-RhoD and PARL, whereas RhoA genes underwent several duplication events, resulting in multiple gene copies. These duplication events were due to whole genome duplications in plants and animals and the duplicates might have experienced functional divergence. We also identified a novel group of plant rhomboid (RhoB1) that might have lost their enzymatic activity; their existence suggests that they might have evolved new mechanisms. Plant and animal rhomboids have similar evolutionary patterns. In addition, there are mutations affecting key active sites in RBL8, RBL9 and one of the Brassicaceae PARL duplicates. This study delineates a possible evolutionary scheme for intramembrane proteins and illustrates distinct fates and a mechanism of evolution of gene duplicates. © 2014 The Authors. New Phytologist © 2014 New Phytologist Trust.

  1. Whole-gene positive selection, elevated synonymous substitution rates, duplication, and indel evolution of the chloroplast clpP1 gene.

    Directory of Open Access Journals (Sweden)

    Per Erixon

    Full Text Available BACKGROUND: Synonymous DNA substitution rates in the plant chloroplast genome are generally relatively slow and lineage dependent. Non-synonymous rates are usually even slower due to purifying selection acting on the genes. Positive selection is expected to speed up non-synonymous substitution rates, whereas synonymous rates are expected to be unaffected. Until recently, positive selection has seldom been observed in chloroplast genes, and large-scale structural rearrangements leading to gene duplications are hitherto supposed to be rare. METHODOLOGY/PRINCIPLE FINDINGS: We found high substitution rates in the exons of the plastid clpP1 gene in Oenothera (the Evening Primrose family and three separate lineages in the tribe Sileneae (Caryophyllaceae, the Carnation family. Introns have been lost in some of the lineages, but where present, the intron sequences have substitution rates similar to those found in other introns of their genomes. The elevated substitution rates of clpP1 are associated with statistically significant whole-gene positive selection in three branches of the phylogeny. In two of the lineages we found multiple copies of the gene. Neighboring genes present in the duplicated fragments do not show signs of elevated substitution rates or positive selection. Although non-synonymous substitutions account for most of the increase in substitution rates, synonymous rates are also markedly elevated in some lineages. Whereas plant clpP1 genes experiencing negative (purifying selection are characterized by having very conserved lengths, genes under positive selection often have large insertions of more or less repetitive amino acid sequence motifs. CONCLUSIONS/SIGNIFICANCE: We found positive selection of the clpP1 gene in various plant lineages to correlated with repeated duplication of the clpP1 gene and surrounding regions, repetitive amino acid sequences, and increase in synonymous substitution rates. The present study sheds light on the

  2. A single enhancer regulating the differential expression of duplicated red-sensitive opsin genes in zebrafish.

    Directory of Open Access Journals (Sweden)

    Taro Tsujimura

    2010-12-01

    Full Text Available A fundamental step in the evolution of the visual system is the gene duplication of visual opsins and differentiation between the duplicates in absorption spectra and expression pattern in the retina. However, our understanding of the mechanism of expression differentiation is far behind that of spectral tuning of opsins. Zebrafish (Danio rerio have two red-sensitive cone opsin genes, LWS-1 and LWS-2. These genes are arrayed in a tail-to-head manner, in this order, and are both expressed in the long member of double cones (LDCs in the retina. Expression of the longer-wave sensitive LWS-1 occurs later in development and is thus confined to the peripheral, especially ventral-nasal region of the adult retina, whereas expression of LWS-2 occurs earlier and is confined to the central region of the adult retina, shifted slightly to the dorsal-temporal region. In this study, we employed a transgenic reporter assay using fluorescent proteins and P1-artificial chromosome (PAC clones encompassing the two genes and identified a 0.6-kb "LWS-activating region" (LAR upstream of LWS-1, which regulates expression of both genes. Under the 2.6-kb flanking upstream region containing the LAR, the expression pattern of LWS-1 was recapitulated by the fluorescent reporter. On the other hand, when LAR was directly conjugated to the LWS-2 upstream region, the reporter was expressed in the LDCs but also across the entire outer nuclear layer. Deletion of LAR from the PAC clones drastically lowered the reporter expression of the two genes. These results suggest that LAR regulates both LWS-1 and LWS-2 by enhancing their expression and that interaction of LAR with the promoters is competitive between the two genes in a developmentally restricted manner. Sharing a regulatory region between duplicated genes could be a general way to facilitate the expression differentiation in duplicated visual opsins.

  3. Host Mitochondrial Association Evolved in the Human Parasite Toxoplasma gondii via Neofunctionalization of a Gene Duplicate.

    Science.gov (United States)

    Adomako-Ankomah, Yaw; English, Elizabeth D; Danielson, Jeffrey J; Pernas, Lena F; Parker, Michelle L; Boulanger, Martin J; Dubey, Jitender P; Boyle, Jon P

    2016-05-01

    In Toxoplasma gondii, an intracellular parasite of humans and other animals, host mitochondrial association (HMA) is driven by a gene family that encodes multiple mitochondrial association factor 1 (MAF1) proteins. However, the importance of MAF1 gene duplication in the evolution of HMA is not understood, nor is the impact of HMA on parasite biology. Here we used within- and between-species comparative analysis to determine that the MAF1 locus is duplicated in T. gondii and its nearest extant relative Hammondia hammondi, but not another close relative, Neospora caninum Using cross-species complementation, we determined that the MAF1 locus harbors multiple distinct paralogs that differ in their ability to mediate HMA, and that only T. gondii and H. hammondi harbor HMA(+) paralogs. Additionally, we found that exogenous expression of an HMA(+) paralog in T. gondii strains that do not normally exhibit HMA provides a competitive advantage over their wild-type counterparts during a mouse infection. These data indicate that HMA likely evolved by neofunctionalization of a duplicate MAF1 copy in the common ancestor of T. gondii and H. hammondi, and that the neofunctionalized gene duplicate is selectively advantageous. Copyright © 2016 by the Genetics Society of America.

  4. Polytomy refinement for the correction of dubious duplications in gene trees.

    Science.gov (United States)

    Lafond, Manuel; Chauve, Cedric; Dondi, Riccardo; El-Mabrouk, Nadia

    2014-09-01

    Large-scale methods for inferring gene trees are error-prone. Correcting gene trees for weakly supported features often results in non-binary trees, i.e. trees with polytomies, thus raising the natural question of refining such polytomies into binary trees. A feature pointing toward potential errors in gene trees are duplications that are not supported by the presence of multiple gene copies. We introduce the problem of refining polytomies in a gene tree while minimizing the number of created non-apparent duplications in the resulting tree. We show that this problem can be described as a graph-theoretical optimization problem. We provide a bounded heuristic with guaranteed optimality for well-characterized instances. We apply our algorithm to a set of ray-finned fish gene trees from the Ensembl database to illustrate its ability to correct dubious duplications. The C++ source code for the algorithms and simulations described in the article are available at http://www-ens.iro.umontreal.ca/~lafonman/software.php. Supplementary data are available at Bioinformatics online. © The Author 2014. Published by Oxford University Press.

  5. Targeted Exon Skipping to Correct Exon Duplications in the Dystrophin Gene

    Directory of Open Access Journals (Sweden)

    Kane L Greer

    2014-01-01

    Full Text Available Duchenne muscular dystrophy is a severe muscle-wasting disease caused by mutations in the dystrophin gene that ablate functional protein expression. Although exonic deletions are the most common Duchenne muscular dystrophy lesion, duplications account for 10–15% of reported disease-causing mutations, and exon 2 is the most commonly duplicated exon. Here, we describe the in vitro evaluation of phosphorodiamidate morpholino oligomers coupled to a cell-penetrating peptide and 2′-O-methyl phosphorothioate oligonucleotides, using three distinct strategies to reframe the dystrophin transcript in patient cells carrying an exon 2 duplication. Differences in exon-skipping efficiencies in vitro were observed between oligomer analogues of the same sequence, with the phosphorodiamidate morpholino oligomer coupled to a cell-penetrating peptide proving the most effective. Differences in exon 2 excision efficiency between normal and exon 2 duplication cells, were apparent, indicating that exon context influences oligomer-induced splice switching. Skipping of a single copy of exon 2 was induced in the cells carrying an exon 2 duplication, the simplest strategy to restore the reading frame and generate a normal dystrophin transcript. In contrast, multiexon skipping of exons 2–7 to generate a Becker muscular dystrophy-like dystrophin transcript was more challenging and could only be induced efficiently with the phosphorodiamidate morpholino oligomer chemistry.

  6. Mitochondrial Genomes of Kinorhyncha: trnM Duplication and New Gene Orders within Animals.

    Science.gov (United States)

    Popova, Olga V; Mikhailov, Kirill V; Nikitin, Mikhail A; Logacheva, Maria D; Penin, Aleksey A; Muntyan, Maria S; Kedrova, Olga S; Petrov, Nikolai B; Panchin, Yuri V; Aleoshin, Vladimir V

    2016-01-01

    Many features of mitochondrial genomes of animals, such as patterns of gene arrangement, nucleotide content and substitution rate variation are extensively used in evolutionary and phylogenetic studies. Nearly 6,000 mitochondrial genomes of animals have already been sequenced, covering the majority of animal phyla. One of the groups that escaped mitogenome sequencing is phylum Kinorhyncha-an isolated taxon of microscopic worm-like ecdysozoans. The kinorhynchs are thought to be one of the early-branching lineages of Ecdysozoa, and their mitochondrial genomes may be important for resolving evolutionary relations between major animal taxa. Here we present the results of sequencing and analysis of mitochondrial genomes from two members of Kinorhyncha, Echinoderes svetlanae (Cyclorhagida) and Pycnophyes kielensis (Allomalorhagida). Their mitochondrial genomes are circular molecules approximately 15 Kbp in size. The kinorhynch mitochondrial gene sequences are highly divergent, which precludes accurate phylogenetic inference. The mitogenomes of both species encode a typical metazoan complement of 37 genes, which are all positioned on the major strand, but the gene order is distinct and unique among Ecdysozoa or animals as a whole. We predict four types of start codons for protein-coding genes in E. svetlanae and five in P. kielensis with a consensus DTD in single letter code. The mitochondrial genomes of E. svetlanae and P. kielensis encode duplicated methionine tRNA genes that display compensatory nucleotide substitutions. Two distant species of Kinorhyncha demonstrate similar patterns of gene arrangements in their mitogenomes. Both genomes have duplicated methionine tRNA genes; the duplication predates the divergence of two species. The kinorhynchs share a few features pertaining to gene order that align them with Priapulida. Gene order analysis reveals that gene arrangement specific of Priapulida may be ancestral for Scalidophora, Ecdysozoa, and even Protostomia.

  7. Mitochondrial Genomes of Kinorhyncha: trnM Duplication and New Gene Orders within Animals.

    Directory of Open Access Journals (Sweden)

    Olga V Popova

    Full Text Available Many features of mitochondrial genomes of animals, such as patterns of gene arrangement, nucleotide content and substitution rate variation are extensively used in evolutionary and phylogenetic studies. Nearly 6,000 mitochondrial genomes of animals have already been sequenced, covering the majority of animal phyla. One of the groups that escaped mitogenome sequencing is phylum Kinorhyncha-an isolated taxon of microscopic worm-like ecdysozoans. The kinorhynchs are thought to be one of the early-branching lineages of Ecdysozoa, and their mitochondrial genomes may be important for resolving evolutionary relations between major animal taxa. Here we present the results of sequencing and analysis of mitochondrial genomes from two members of Kinorhyncha, Echinoderes svetlanae (Cyclorhagida and Pycnophyes kielensis (Allomalorhagida. Their mitochondrial genomes are circular molecules approximately 15 Kbp in size. The kinorhynch mitochondrial gene sequences are highly divergent, which precludes accurate phylogenetic inference. The mitogenomes of both species encode a typical metazoan complement of 37 genes, which are all positioned on the major strand, but the gene order is distinct and unique among Ecdysozoa or animals as a whole. We predict four types of start codons for protein-coding genes in E. svetlanae and five in P. kielensis with a consensus DTD in single letter code. The mitochondrial genomes of E. svetlanae and P. kielensis encode duplicated methionine tRNA genes that display compensatory nucleotide substitutions. Two distant species of Kinorhyncha demonstrate similar patterns of gene arrangements in their mitogenomes. Both genomes have duplicated methionine tRNA genes; the duplication predates the divergence of two species. The kinorhynchs share a few features pertaining to gene order that align them with Priapulida. Gene order analysis reveals that gene arrangement specific of Priapulida may be ancestral for Scalidophora, Ecdysozoa, and even

  8. Microevolution of Duplications and Deletions and Their Impact on Gene Expression in the Nematode Pristionchus pacificus.

    Directory of Open Access Journals (Sweden)

    Praveen Baskaran

    Full Text Available The evolution of diversity across the animal kingdom has been accompanied by tremendous gene loss and gain. While comparative genomics has been fruitful to characterize differences in gene content across highly diverged species, little is known about the microevolution of structural variations that cause these differences in the first place. In order to investigate the genomic impact of structural variations, we made use of genomic and transcriptomic data from the nematode Pristionchus pacificus, which has been established as a satellite model to Caenorhabditis elegans for comparative biology. We exploit the fact that P. pacificus is a highly diverse species for which various genomic data including the draft genome of a sister species P. exspectatus is available. Based on resequencing coverage data for two natural isolates we identified large (> 2 kb deletions and duplications relative to the reference strain. By restriction to completely syntenic regions between P. pacificus and P. exspectatus, we were able to polarize the comparison and to assess the impact of structural variations on expression levels. We found that while loss of genes correlates with lack of expression, duplication of genes has virtually no effect on gene expression. Further investigating expression of individual copies at sites that segregate between the duplicates, we found in the majority of cases only one of the copies to be expressed. Nevertheless, we still find that certain gene classes are strongly depleted in deletions as well as duplications, suggesting evolutionary constraint acting on synteny. In summary, our results are consistent with a model, where most structural variations are either deleterious or neutral and provide first insights into the microevolution of structural variations in the P. pacificus genome.

  9. Concomitant duplications of opioid peptide and receptor genes before the origin of jawed vertebrates.

    Directory of Open Access Journals (Sweden)

    Görel Sundström

    Full Text Available BACKGROUND: The opioid system is involved in reward and pain mechanisms and consists in mammals of four receptors and several peptides. The peptides are derived from four prepropeptide genes, PENK, PDYN, PNOC and POMC, encoding enkephalins, dynorphins, orphanin/nociceptin and beta-endorphin, respectively. Previously we have described how two rounds of genome doubling (2R before the origin of jawed vertebrates formed the receptor family. METHODOLOGY/PRINCIPAL FINDINGS: Opioid peptide gene family members were investigated using a combination of sequence-based phylogeny and chromosomal locations of the peptide genes in various vertebrates. Several adjacent gene families were investigated similarly. The results show that the ancestral peptide gene gave rise to two additional copies in the genome doublings. The fourth member was generated by a local gene duplication, as the genes encoding POMC and PNOC are located on the same chromosome in the chicken genome and all three teleost genomes that we have studied. A translocation has disrupted this synteny in mammals. The PDYN gene seems to have been lost in chicken, but not in zebra finch. Duplicates of some peptide genes have arisen in the teleost fishes. Within the prepropeptide precursors, peptides have been lost or gained in different lineages. CONCLUSIONS/SIGNIFICANCE: The ancestral peptide and receptor genes were located on the same chromosome and were thus duplicated concomitantly. However, subsequently genetic linkage has been lost. In conclusion, the system of opioid peptides and receptors was largely formed by the genome doublings that took place early in vertebrate evolution.

  10. Origin of a function by tandem gene duplication limits the evolutionary capability of its sister copy.

    Science.gov (United States)

    Hasselmann, Martin; Lechner, Sarah; Schulte, Christina; Beye, Martin

    2010-07-27

    The most remarkable outcome of a gene duplication event is the evolution of a novel function. Little information exists on how the rise of a novel function affects the evolution of its paralogous sister gene copy, however. We studied the evolution of the feminizer (fem) gene from which the gene complementary sex determiner (csd) recently derived by tandem duplication within the honey bee (Apis) lineage. Previous studies showed that fem retained its sex determination function, whereas the rise of csd established a new primary signal of sex determination. We observed a specific reduction of nonsynonymous to synonymous substitution ratios in Apis to non-Apis fem. We found a contrasting pattern at two other genetically linked genes, suggesting that hitchhiking effects to csd, the locus under balancing selection, is not the cause of this evolutionary pattern. We also excluded higher synonymous substitution rates by relative rate testing. These results imply that stronger purifying selection is operating at the fem gene in the presence of csd. We propose that csd's new function interferes with the function of Fem protein, resulting in molecular constraints and limited evolvability of fem in the Apis lineage. Elevated silent nucleotide polymorphism in fem relative to the genome-wide average suggests that genetic linkage to the csd gene maintained more nucleotide variation in today's population. Our findings provide evidence that csd functionally and genetically interferes with fem, suggesting that a newly evolved gene and its functions can limit the evolutionary capability of other genes in the genome.

  11. Adaptations to endosymbiosis in a cnidarian-dinoflagellate association: differential gene expression and specific gene duplications.

    Science.gov (United States)

    Ganot, Philippe; Moya, Aurélie; Magnone, Virginie; Allemand, Denis; Furla, Paola; Sabourault, Cécile

    2011-07-01

    Trophic endosymbiosis between anthozoans and photosynthetic dinoflagellates forms the key foundation of reef ecosystems. Dysfunction and collapse of symbiosis lead to bleaching (symbiont expulsion), which is responsible for the severe worldwide decline of coral reefs. Molecular signals are central to the stability of this partnership and are therefore closely related to coral health. To decipher inter-partner signaling, we developed genomic resources (cDNA library and microarrays) from the symbiotic sea anemone Anemonia viridis. Here we describe differential expression between symbiotic (also called zooxanthellate anemones) or aposymbiotic (also called bleached) A. viridis specimens, using microarray hybridizations and qPCR experiments. We mapped, for the first time, transcript abundance separately in the epidermal cell layer and the gastrodermal cells that host photosynthetic symbionts. Transcriptomic profiles showed large inter-individual variability, indicating that aposymbiosis could be induced by different pathways. We defined a restricted subset of 39 common genes that are characteristic of the symbiotic or aposymbiotic states. We demonstrated that transcription of many genes belonging to this set is specifically enhanced in the symbiotic cells (gastroderm). A model is proposed where the aposymbiotic and therefore heterotrophic state triggers vesicular trafficking, whereas the symbiotic and therefore autotrophic state favors metabolic exchanges between host and symbiont. Several genetic pathways were investigated in more detail: i) a key vitamin K-dependant process involved in the dinoflagellate-cnidarian recognition; ii) two cnidarian tissue-specific carbonic anhydrases involved in the carbon transfer from the environment to the intracellular symbionts; iii) host collagen synthesis, mostly supported by the symbiotic tissue. Further, we identified specific gene duplications and showed that the cnidarian-specific isoform was also up-regulated both in the

  12. Adaptations to endosymbiosis in a cnidarian-dinoflagellate association: differential gene expression and specific gene duplications.

    Directory of Open Access Journals (Sweden)

    Philippe Ganot

    2011-07-01

    Full Text Available Trophic endosymbiosis between anthozoans and photosynthetic dinoflagellates forms the key foundation of reef ecosystems. Dysfunction and collapse of symbiosis lead to bleaching (symbiont expulsion, which is responsible for the severe worldwide decline of coral reefs. Molecular signals are central to the stability of this partnership and are therefore closely related to coral health. To decipher inter-partner signaling, we developed genomic resources (cDNA library and microarrays from the symbiotic sea anemone Anemonia viridis. Here we describe differential expression between symbiotic (also called zooxanthellate anemones or aposymbiotic (also called bleached A. viridis specimens, using microarray hybridizations and qPCR experiments. We mapped, for the first time, transcript abundance separately in the epidermal cell layer and the gastrodermal cells that host photosynthetic symbionts. Transcriptomic profiles showed large inter-individual variability, indicating that aposymbiosis could be induced by different pathways. We defined a restricted subset of 39 common genes that are characteristic of the symbiotic or aposymbiotic states. We demonstrated that transcription of many genes belonging to this set is specifically enhanced in the symbiotic cells (gastroderm. A model is proposed where the aposymbiotic and therefore heterotrophic state triggers vesicular trafficking, whereas the symbiotic and therefore autotrophic state favors metabolic exchanges between host and symbiont. Several genetic pathways were investigated in more detail: i a key vitamin K-dependant process involved in the dinoflagellate-cnidarian recognition; ii two cnidarian tissue-specific carbonic anhydrases involved in the carbon transfer from the environment to the intracellular symbionts; iii host collagen synthesis, mostly supported by the symbiotic tissue. Further, we identified specific gene duplications and showed that the cnidarian-specific isoform was also up-regulated both

  13. The evolution of pepsinogen C genes in vertebrates: duplication, loss and functional diversification.

    Directory of Open Access Journals (Sweden)

    Luís Filipe Costa Castro

    Full Text Available BACKGROUND: Aspartic proteases comprise a large group of enzymes involved in peptide proteolysis. This collection includes prominent enzymes globally categorized as pepsins, which are derived from pepsinogen precursors. Pepsins are involved in gastric digestion, a hallmark of vertebrate physiology. An important member among the pepsinogens is pepsinogen C (Pgc. A particular aspect of Pgc is its apparent single copy status, which contrasts with the numerous gene copies found for example in pepsinogen A (Pga. Although gene sequences with similarity to Pgc have been described in some vertebrate groups, no exhaustive evolutionary framework has been considered so far. METHODOLOGY/PRINCIPAL FINDINGS: By combining phylogenetics and genomic analysis, we find an unexpected Pgc diversity in the vertebrate sub-phylum. We were able to reconstruct gene duplication timings relative to the divergence of major vertebrate clades. Before tetrapod divergence, a single Pgc gene tandemly expanded to produce two gene lineages (Pgbc and Pgc2. These have been differentially retained in various classes. Accordingly, we find Pgc2 in sauropsids, amphibians and marsupials, but not in eutherian mammals. Pgbc was retained in amphibians, but duplicated in the ancestor of amniotes giving rise to Pgb and Pgc1. The latter was retained in mammals and probably in reptiles and marsupials but not in birds. Pgb was kept in all of the amniote clade with independent episodes of loss in some mammalian species. Lineage specific expansions of Pgc2 and Pgbc have also occurred in marsupials and amphibians respectively. We find that teleost and tetrapod Pgc genes reside in distinct genomic regions hinting at a possible translocation. CONCLUSIONS: We conclude that the repertoire of Pgc genes is larger than previously reported, and that tandem duplications have modelled the history of Pgc genes. We hypothesize that gene expansion lead to functional divergence in tetrapods, coincident with the

  14. Divergence and Conservative Evolution of XTNX Genes in Land Plants

    Directory of Open Access Journals (Sweden)

    Yan-Mei Zhang

    2017-10-01

    Full Text Available The Toll-interleukin-1 receptor (TIR and Nucleotide-binding site (NBS domains are two major components of the TIR-NBS-leucine-rich repeat family plant disease resistance genes. Extensive functional and evolutionary studies have been performed on these genes; however, the characterization of a small group of genes that are composed of atypical TIR and NBS domains, namely XTNX genes, is limited. The present study investigated this specific gene family by conducting genome-wide analyses of 59 green plant genomes. A total of 143 XTNX genes were identified in 51 of the 52 land plant genomes, whereas no XTNX gene was detected in any green algae genomes, which indicated that XTNX genes originated upon emergence of land plants. Phylogenetic analysis revealed that the ancestral XTNX gene underwent two rounds of ancient duplications in land plants, which resulted in the formation of clades I/II and clades IIa/IIb successively. Although clades I and IIb have evolved conservatively in angiosperms, the motif composition difference and sequence divergence at the amino acid level suggest that functional divergence may have occurred since the separation of the two clades. In contrast, several features of the clade IIa genes, including the absence in the majority of dicots, the long branches in the tree, the frequent loss of ancestral motifs, and the loss of expression in all detected tissues of Zea mays, all suggest that the genes in this lineage might have undergone pseudogenization. This study highlights that XTNX genes are a gene family originated anciently in land plants and underwent specific conservative pattern in evolution.

  15. Genomic evidence of gene duplication and adaptive evolution of Toll like receptors (TLR2 and TLR4) in reptiles.

    Science.gov (United States)

    Shang, Shuai; Zhong, Huaming; Wu, Xiaoyang; Wei, Qinguo; Zhang, Huanxin; Chen, Jun; Chen, Yao; Tang, Xuexi; Zhang, Honghai

    2018-04-01

    Toll-like receptors (TLRs) encoded by the TLR multigene family play an important role in initial pathogen recognition in vertebrates. Among the TLRs, TLR2 and TLR4 may be of particular importance to reptiles. In order to study the evolutionary patterns and structural characteristics of TLRs, we explored the available genomes of several representative members of reptiles. 25 TLR2 genes and 19 TLR4 genes from reptiles were obtained in this study. Phylogenetic results showed that the TLR2 gene duplication occurred in several species. Evolutionary analysis by at least two methods identified 30 and 13 common positively selected codons in TLR2 and TLR4, respectively. Most positively selected sites of TLR2 and TLR4 were located in the Leucine-rich repeat (LRRs). Branch model analysis showed that TLR2 genes were under different evolutionary forces in reptiles, while the TLR4 genes showed no significant selection pressure. The different evolutionary adaptation of TLR2 and TLR4 among the reptiles might be due to their different function in recognizing bacteria. Overall, we explored the structure and evolution of TLR2 and TLR4 genes in reptiles for the first time. Our study revealed valuable information regarding TLR2 and TLR4 in reptiles, and provided novel insights into the conservation concern of natural populations. Copyright © 2017 Elsevier B.V. All rights reserved.

  16. Simulating evolution of protein complexes through gene duplication and co-option.

    Science.gov (United States)

    Haarsma, Loren; Nelesen, Serita; VanAndel, Ethan; Lamine, James; VandeHaar, Peter

    2016-06-21

    We present a model of the evolution of protein complexes with novel functions through gene duplication, mutation, and co-option. Under a wide variety of input parameters, digital organisms evolve complexes of 2-5 bound proteins which have novel functions but whose component proteins are not independently functional. Evolution of complexes with novel functions happens more quickly as gene duplication rates increase, point mutation rates increase, protein complex functional probability increases, protein complex functional strength increases, and protein family size decreases. Evolution of complexity is inhibited when the metabolic costs of making proteins exceeds the fitness gain of having functional proteins, or when point mutation rates get so large the functional proteins undergo deleterious mutations faster than new functional complexes can evolve. Copyright © 2016 Elsevier Ltd. All rights reserved.

  17. A gene duplication led to specialized gamma-aminobutyrate and beta-alanine aminotransferase in yeast

    DEFF Research Database (Denmark)

    Andersen, Gorm; Andersen, Birgit; Dobritzsch, D.

    2007-01-01

    and related yeasts have two different genes/enzymes to apparently 'distinguish' between the two reactions in a single cell. It is likely that upon duplication similar to 200 million years ago, a specialized Uga1p evolved into a 'novel' transaminase enzyme with broader substrate specificity.......In humans, beta-alanine (BAL) and the neurotransmitter gamma-aminobutyrate (GABA) are transaminated by a single aminotransferase enzyme. Apparently, yeast originally also had a single enzyme, but the corresponding gene was duplicated in the Saccharomyces kluyveri lineage. SkUGA1 encodes a homologue...... to characterize the substrate specificity and kinetic parameters of the four enzymes. It was found that the cofactor pyridoxal 5'-phosphate is needed for enzymatic activity and alpha-ketoglutarate, and not pyruvate, as the amino group acceptor. SkPyd4p preferentially uses BAL as the amino group donor (V...

  18. Approximating the edit distance for genomes with duplicate genes under DCJ, insertion and deletion

    Directory of Open Access Journals (Sweden)

    Shao Mingfu

    2012-12-01

    Full Text Available Abstract Computing the edit distance between two genomes under certain operations is a basic problem in the study of genome evolution. The double-cut-and-join (DCJ model has formed the basis for most algorithmic research on rearrangements over the last few years. The edit distance under the DCJ model can be easily computed for genomes without duplicate genes. In this paper, we study the edit distance for genomes with duplicate genes under a model that includes DCJ operations, insertions and deletions. We prove that computing the edit distance is equivalent to finding the optimal cycle decomposition of the corresponding adjacency graph, and give an approximation algorithm with an approximation ratio of 1.5 + ∈.

  19. Hypertension and Biliary Ductopenia in a Patient with Duplication of Exon 6 of the Gene

    Directory of Open Access Journals (Sweden)

    J. Uberos

    2012-01-01

    Full Text Available We describe a neonatal patient with biliary ductopenia featuring duplication of exon 6 of the JAG1 gene. Facial alterations were observed, consisting of a prominent forehead, sunken eyes, upward slanting palpebral fissures, hypertelorism, flat nasal root and prominent chin. From birth, these were accompanied by the development of haematuria and renal failure and by renal Doppler findings indicative of peripheral renal artery stenosis. JAG1 gene mutations on chromosome 20 have been associated with various anomalies, including biliary cholestasis, vertebral abnormalities, eye disorders, heart defects and facial dysmorphia. This syndrome, first described by Alagille, is an infrequent congenital disorder caused by a dominant autosomal inheritance with variable expressivity. Anatomopathological effects include the destruction and disappearance of hepatic bile ducts (ductopenia. The duplication of exon 6 of JAG1 has not previously been described as an alteration related to the Alagille syndrome with peripheral renal artery stenosis.

  20. Duplication of 7q36.3 encompassing the Sonic Hedgehog (SHH) gene is associated with congenital muscular hypertrophy

    DEFF Research Database (Denmark)

    Kristensen, Lone Krøldrup; Kjaergaard, S; Kirchhoff, Marianne

    2012-01-01

    with muscular hypertrophy and mildly retarded psychomotor development. Array-CGH identified a small duplication of 7q36.3 including the Sonic Hedgehog (SHH) gene in both the aborted foetus and the live born male sib. Neither of the parents carried the 7q36.3 duplication. The consequences of overexpression...

  1. Sox genes in grass carp (Ctenopharyngodon idella with their implications for genome duplication and evolution

    Directory of Open Access Journals (Sweden)

    Tong Jingou

    2006-11-01

    Full Text Available Abstract The Sox gene family is found in a broad range of animal taxa and encodes important gene regulatory proteins involved in a variety of developmental processes. We have obtained clones representing the HMG boxes of twelve Sox genes from grass carp (Ctenopharyngodon idella, one of the four major domestic carps in China. The cloned Sox genes belong to group B1, B2 and C. Our analyses show that whereas the human genome contains a single copy of Sox4, Sox11 and Sox14, each of these genes has two co-orthologs in grass carp, and the duplication of Sox4 and Sox11 occurred before the divergence of grass carp and zebrafish, which support the "fish-specific whole-genome duplication" theory. An estimation for the origin of grass carp based on the molecular clock using Sox1, Sox3 and Sox11 genes as markers indicates that grass carp (subfamily Leuciscinae and zebrafish (subfamily Danioninae diverged approximately 60 million years ago. The potential uses of Sox genes as markers in revealing the evolutionary history of grass carp are discussed.

  2. G-NEST: a gene neighborhood scoring tool to identify co-conserved, co-expressed genes

    Directory of Open Access Journals (Sweden)

    Lemay Danielle G

    2012-09-01

    Full Text Available Abstract Background In previous studies, gene neighborhoods—spatial clusters of co-expressed genes in the genome—have been defined using arbitrary rules such as requiring adjacency, a minimum number of genes, a fixed window size, or a minimum expression level. In the current study, we developed a Gene Neighborhood Scoring Tool (G-NEST which combines genomic location, gene expression, and evolutionary sequence conservation data to score putative gene neighborhoods across all possible window sizes simultaneously. Results Using G-NEST on atlases of mouse and human tissue expression data, we found that large neighborhoods of ten or more genes are extremely rare in mammalian genomes. When they do occur, neighborhoods are typically composed of families of related genes. Both the highest scoring and the largest neighborhoods in mammalian genomes are formed by tandem gene duplication. Mammalian gene neighborhoods contain highly and variably expressed genes. Co-localized noisy gene pairs exhibit lower evolutionary conservation of their adjacent genome locations, suggesting that their shared transcriptional background may be disadvantageous. Genes that are essential to mammalian survival and reproduction are less likely to occur in neighborhoods, although neighborhoods are enriched with genes that function in mitosis. We also found that gene orientation and protein-protein interactions are partially responsible for maintenance of gene neighborhoods. Conclusions Our experiments using G-NEST confirm that tandem gene duplication is the primary driver of non-random gene order in mammalian genomes. Non-essentiality, co-functionality, gene orientation, and protein-protein interactions are additional forces that maintain gene neighborhoods, especially those formed by tandem duplicates. We expect G-NEST to be useful for other applications such as the identification of core regulatory modules, common transcriptional backgrounds, and chromatin domains. The

  3. Dose effect of the uvsA+ gene product in duplication strains of Aspergillus nidulans

    International Nuclear Information System (INIS)

    Majerfeld, I.H.; Roper, J.A.

    1978-01-01

    Strains of Aspergillus nidulans which carry a particular segment of chromosome I in duplicate - one segment in normal position, the other translocated to chromosome II - are more resistant to uv light than are strains with a balanced haploid genome. A double dose of the uvsA + allele, carried on the duplicate segment, determines this enhanced resistance; this is shown by the descending order of resistance of duplication haploids uvsA + /uvsA + , uvsA1/uvsA + and uvsA1/uvsA1. An unbalanced diploid with three doses of the uvsA + allele also shows greater resistance than a balanced uvsA + //uvsA + diploid. However, in balanced diploids the uvsA1 allele appears to be completely recessive; uvsA + //uvsA + and uvsA + //uvsA1 diploids produce indistinguishable survival curves after uv irradiation. Thus, the uvsA + gene product is not rate-limiting in repair processes in strains with a balanced genome. The rate-limiting effect observed in these unbalanced strains presumably reflects an interaction of the uvsA + product and other functions determined by the rest of the genome. Duplication haploids and normal haploids lose photorepairable lesions at similar rates. This observation may be interpreted to indicate that differences in survival are not due to differences in the efficiency of excision of uv-induced pyrimidime dimers

  4. Dissecting a hidden gene duplication: the Arabidopsis thaliana SEC10 locus.

    Directory of Open Access Journals (Sweden)

    Nemanja Vukašinović

    Full Text Available Repetitive sequences present a challenge for genome sequence assembly, and highly similar segmental duplications may disappear from assembled genome sequences. Having found a surprising lack of observable phenotypic deviations and non-Mendelian segregation in Arabidopsis thaliana mutants in SEC10, a gene encoding a core subunit of the exocyst tethering complex, we examined whether this could be explained by a hidden gene duplication. Re-sequencing and manual assembly of the Arabidopsis thaliana SEC10 (At5g12370 locus revealed that this locus, comprising a single gene in the reference genome assembly, indeed contains two paralogous genes in tandem, SEC10a and SEC10b, and that a sequence segment of 7 kb in length is missing from the reference genome sequence. Differences between the two paralogs are concentrated in non-coding regions, while the predicted protein sequences exhibit 99% identity, differing only by substitution of five amino acid residues and an indel of four residues. Both SEC10 genes are expressed, although varying transcript levels suggest differential regulation. Homozygous T-DNA insertion mutants in either paralog exhibit a wild-type phenotype, consistent with proposed extensive functional redundancy of the two genes. By these observations we demonstrate that recently duplicated genes may remain hidden even in well-characterized genomes, such as that of A. thaliana. Moreover, we show that the use of the existing A. thaliana reference genome sequence as a guide for sequence assembly of new Arabidopsis accessions or related species has at least in some cases led to error propagation.

  5. Duplications and losses in gene families of rust pathogens highlight putative effectors

    Directory of Open Access Journals (Sweden)

    Amanda L. Pendleton

    2014-06-01

    Full Text Available Rust fungi are a group of fungal pathogens that cause some of the world’s most destructive diseases of trees and crops. A shared characteristic among rust fungi is obligate biotrophy, the inability to complete a lifecycle without a host. This dependence on a host species likely affects patterns of gene expansion, contraction, and innovation within rust pathogen genomes. The establishment of disease by biotrophic pathogens is reliant upon effector proteins that are encoded in the fungal genome and secreted from the pathogen into the host’s cell apoplast or within the cells. This study uses a comparative genomic approach to elucidate putative effectors and determine their evolutionary histories. We used OrthoMCL to identify nearly 20,000 gene families in proteomes of sixteen diverse fungal species, which include fifteen basidiomycetes and one ascomycete. We inferred patterns of duplication and loss for each gene family and identified families with distinctive patterns of expansion/contraction associated with the evolution of rust fungal genomes. To recognize potential contributors for the unique features of rust pathogens, we identified families harboring secreted proteins that: i arose or expanded in rust pathogens relative to other fungi, or ii contracted or were lost in rust fungal genomes. While the origin of rust fungi appears to be associated with considerable gene loss, there are many gene duplications associated with each sampled rust fungal genome. We also highlight two putative effector gene families that have expanded in Cqf that we hypothesize have roles in pathogenicity.

  6. Duplications and losses in gene families of rust pathogens highlight putative effectors.

    Science.gov (United States)

    Pendleton, Amanda L; Smith, Katherine E; Feau, Nicolas; Martin, Francis M; Grigoriev, Igor V; Hamelin, Richard; Nelson, C Dana; Burleigh, J Gordon; Davis, John M

    2014-01-01

    Rust fungi are a group of fungal pathogens that cause some of the world's most destructive diseases of trees and crops. A shared characteristic among rust fungi is obligate biotrophy, the inability to complete a lifecycle without a host. This dependence on a host species likely affects patterns of gene expansion, contraction, and innovation within rust pathogen genomes. The establishment of disease by biotrophic pathogens is reliant upon effector proteins that are encoded in the fungal genome and secreted from the pathogen into the host's cell apoplast or within the cells. This study uses a comparative genomic approach to elucidate putative effectors and determine their evolutionary histories. We used OrthoMCL to identify nearly 20,000 gene families in proteomes of 16 diverse fungal species, which include 15 basidiomycetes and one ascomycete. We inferred patterns of duplication and loss for each gene family and identified families with distinctive patterns of expansion/contraction associated with the evolution of rust fungal genomes. To recognize potential contributors for the unique features of rust pathogens, we identified families harboring secreted proteins that: (i) arose or expanded in rust pathogens relative to other fungi, or (ii) contracted or were lost in rust fungal genomes. While the origin of rust fungi appears to be associated with considerable gene loss, there are many gene duplications associated with each sampled rust fungal genome. We also highlight two putative effector gene families that have expanded in Cqf that we hypothesize have roles in pathogenicity.

  7. GENE-dosage effects on fitness in recent adaptive duplications: ace-1 in the mosquito Culex pipiens.

    Science.gov (United States)

    Labbé, Pierrick; Milesi, Pascal; Yébakima, André; Pasteur, Nicole; Weill, Mylène; Lenormand, Thomas

    2014-07-01

    Gene duplications have long been advocated to contribute to the evolution of new functions. The role of selection in their early spread is more controversial. Unless duplications are favored for a direct benefit of increased expression, they are likely detrimental. In this article, we investigated the case of duplications favored because they combine already functionally divergent alleles. Their gene-dosage/fitness relations are poorly known because selection may operate on both overall expression and duplicates relative dosage. Using the well-documented case of Culex pipiens resistance to insecticides, we compared strains with various ace-1 allele combinations, including two duplicated alleles carrying both susceptible and resistant copies. The overall protein activity was nearly additive, but, surprisingly, fitness correlated better with the relative proportion of susceptible and resistant copies rather than any absolute measure of activity. Gene dosage is thus crucial, duplications stabilizing a "heterozygote" phenotype. It corroborates the view that these were favored because they fix a permanent heterosis, thereby solving the irreducible trade-off between resistance and synaptic transmission. Moreover, we showed that the contrasted successes of the two duplicated alleles in natural populations depend on genetic changes unrelated to ace-1, confirming the probable implication of recessive sublethal mutations linked to structural rearrangements in some duplications. © 2014 The Author(s). Evolution © 2014 The Society for the Study of Evolution.

  8. Clinical and molecular characterization of duplications encompassing the human SHOX gene reveal a variable effect on stature.

    Science.gov (United States)

    Thomas, N Simon; Harvey, John F; Bunyan, David J; Rankin, Julia; Grigelioniene, Giedre; Bruno, Damien L; Tan, Tiong Y; Tomkins, Susan; Hastings, Robert

    2009-07-01

    Deletions of the SHOX gene are well documented and cause disproportionate short stature and variable skeletal abnormalities. In contrast interstitial SHOX duplications limited to PAR1 appear to be very rare and the clinical significance of the only case report in the literature is unclear. Mapping of this duplication has now shown that it includes the entire SHOX gene but little flanking sequence and so will not encompass any of the long-range enhancers required for SHOX transcription. We now describe the clinical and molecular characterization of three additional cases. The duplications all included the SHOX coding sequence but varied in the amount of flanking sequence involved. The probands were ascertained for a variety of reasons: hypotonia and features of Asperger syndrome, Leri-Weill dyschondrosteosis (LWD), and a family history of cleft palate. However, the presence of a duplication did not correlate with any of these features or with evidence of skeletal abnormality. Remarkably, the proband with LWD had inherited both a SHOX deletion and a duplication. The effect of the duplications on stature was variable: height appeared to be elevated in some carriers, particularly in those with the largest duplications, but was still within the normal range. SHOX duplications are likely to be under ascertained and more cases need to be identified and characterized in detail in order to accurately determine their phenotypic consequences.

  9. Extensive lineage-specific gene duplication and evolution of the spiggin multi-gene family in stickleback

    Directory of Open Access Journals (Sweden)

    Nishida Mutsumi

    2007-11-01

    Full Text Available Abstract Background The threespine stickleback (Gasterosteus aculeatus has a characteristic reproductive mode; mature males build nests using a secreted glue-like protein called spiggin. Although recent studies reported multiple occurrences of genes that encode this glue-like protein spiggin in threespine and ninespine sticklebacks, it is still unclear how many genes compose the spiggin multi-gene family. Results Genome sequence analysis of threespine stickleback showed that there are at least five spiggin genes and two pseudogenes, whereas a single spiggin homolog occurs in the genomes of other fishes. Comparative genome sequence analysis demonstrated that Muc19, a single-copy mucous gene in human and mouse, is an ortholog of spiggin. Phylogenetic and molecular evolutionary analyses of these sequences suggested that an ancestral spiggin gene originated from a member of the mucin gene family as a single gene in the common ancestor of teleosts, and gene duplications of spiggin have occurred in the stickleback lineage. There was inter-population variation in the copy number of spiggin genes and positive selection on some codons, indicating that additional gene duplication/deletion events and adaptive evolution at some amino acid sites may have occurred in each stickleback population. Conclusion A number of spiggin genes exist in the threespine stickleback genome. Our results provide insight into the origin and dynamic evolutionary process of the spiggin multi-gene family in the threespine stickleback lineage. The dramatic evolution of genes for mucous substrates may have contributed to the generation of distinct characteristics such as "bio-glue" in vertebrates.

  10. Duplications involving a conserved regulatory element downstream of BMP2 are associated with brachydactyly type A2

    DEFF Research Database (Denmark)

    Dathe, Katarina; Kjaer, Klaus W; Brehm, Anja

    2009-01-01

    Autosomal-dominant brachydactyly type A2 (BDA2), a limb malformation characterized by hypoplastic middle phalanges of the second and fifth fingers, has been shown to be due to mutations in the Bone morphogenetic protein receptor 1B (BMPR1B) or in its ligand Growth and differentiation factor 5 (GDF5......). A linkage analysis performed in a mutation-negative family identified a novel locus for BDA2 on chromosome 20p12.3 that incorporates the gene for Bone morphogenetic protein 2 (BMP2). No point mutation was identified in BMP2, so a high-density array CGH analysis covering the critical interval...... within the identified duplication. Our results reveal an additional functional mechanism for the pathogenesis of BDA2, which is duplication of a regulatory element that affects the expression of BMP2 in the developing limb....

  11. Adaptations to High Salt in a Halophilic Protist: Differential Expression and Gene Acquisitions through Duplications and Gene Transfers

    Science.gov (United States)

    Harding, Tommy; Roger, Andrew J.; Simpson, Alastair G. B.

    2017-01-01

    The capacity of halophiles to thrive in extreme hypersaline habitats derives partly from the tight regulation of ion homeostasis, the salt-dependent adjustment of plasma membrane fluidity, and the increased capability to manage oxidative stress. Halophilic bacteria, and archaea have been intensively studied, and substantial research has been conducted on halophilic fungi, and the green alga Dunaliella. By contrast, there have been very few investigations of halophiles that are phagotrophic protists, i.e., protozoa. To gather fundamental knowledge about salt adaptation in these organisms, we studied the transcriptome-level response of Halocafeteria seosinensis (Stramenopiles) grown under contrasting salinities. We provided further evolutionary context to our analysis by identifying genes that underwent recent duplications. Genes that were highly responsive to salinity variations were involved in stress response (e.g., chaperones), ion homeostasis (e.g., Na+/H+ transporter), metabolism and transport of lipids (e.g., sterol biosynthetic genes), carbohydrate metabolism (e.g., glycosidases), and signal transduction pathways (e.g., transcription factors). A significantly high proportion (43%) of duplicated genes were also differentially expressed, accentuating the importance of gene expansion in adaptation by H. seosinensis to high salt environments. Furthermore, we found two genes that were lateral acquisitions from bacteria, and were also highly up-regulated and highly expressed at high salt, suggesting that this evolutionary mechanism could also have facilitated adaptation to high salt. We propose that a transition toward high-salt adaptation in the ancestors of H. seosinensis required the acquisition of new genes via duplication, and some lateral gene transfers (LGTs), as well as the alteration of transcriptional programs, leading to increased stress resistance, proper establishment of ion gradients, and modification of cell structure properties like membrane

  12. Adaptations to High Salt in a Halophilic Protist: Differential Expression and Gene Acquisitions through Duplications and Gene Transfers

    Directory of Open Access Journals (Sweden)

    Tommy Harding

    2017-05-01

    Full Text Available The capacity of halophiles to thrive in extreme hypersaline habitats derives partly from the tight regulation of ion homeostasis, the salt-dependent adjustment of plasma membrane fluidity, and the increased capability to manage oxidative stress. Halophilic bacteria, and archaea have been intensively studied, and substantial research has been conducted on halophilic fungi, and the green alga Dunaliella. By contrast, there have been very few investigations of halophiles that are phagotrophic protists, i.e., protozoa. To gather fundamental knowledge about salt adaptation in these organisms, we studied the transcriptome-level response of Halocafeteria seosinensis (Stramenopiles grown under contrasting salinities. We provided further evolutionary context to our analysis by identifying genes that underwent recent duplications. Genes that were highly responsive to salinity variations were involved in stress response (e.g., chaperones, ion homeostasis (e.g., Na+/H+ transporter, metabolism and transport of lipids (e.g., sterol biosynthetic genes, carbohydrate metabolism (e.g., glycosidases, and signal transduction pathways (e.g., transcription factors. A significantly high proportion (43% of duplicated genes were also differentially expressed, accentuating the importance of gene expansion in adaptation by H. seosinensis to high salt environments. Furthermore, we found two genes that were lateral acquisitions from bacteria, and were also highly up-regulated and highly expressed at high salt, suggesting that this evolutionary mechanism could also have facilitated adaptation to high salt. We propose that a transition toward high-salt adaptation in the ancestors of H. seosinensis required the acquisition of new genes via duplication, and some lateral gene transfers (LGTs, as well as the alteration of transcriptional programs, leading to increased stress resistance, proper establishment of ion gradients, and modification of cell structure properties like

  13. Novel duplication mutation of the DYSF gene in a Pakistani family with Miyoshi Myopathy

    Directory of Open Access Journals (Sweden)

    Muhammad I. Ullah

    2017-12-01

    Full Text Available Objectives: To identify the underlying gene mutation in a large consanguineous Pakistani family. Methods: This is an observational descriptive study carried out at the Department of Biochemistry, Shifa International Hospital, Quaid-i-Azam University, and Atta-ur-Rahman School of Applied Biosciences, National University of Sciences and Technology, Islamabad, Pakistan from 2013-2016. Genomic DNA of all recruited family members was extracted and the Trusight one sequencing panel was used to assess genes associated with a neuro-muscular phenotype. Comparative modeling of mutated and wild-type protein was carried out by PyMOL tool. Results: Clinical investigations of an affected individual showed typical features of Miyoshi myopathy (MM like elevated serum creatine kinase (CK levels, distal muscle weakness, myopathic changes in electromyography (EMG and muscle histopathology. Sequencing with the Ilumina Trusight one sequencing panel revealed a novel 22 nucleotide duplication (CTTCAACTTGTTTGACTCTCCT in the DYSF gene (NM_001130987.1_c.897-918dup; p.Gly307Leufs5X, which results in a truncating frameshift mutation and perfectly segregated with the disease in this family. Protein modeling studies suggested a disruption in spatial configuration of the putative mutant protein. Conclusion: A novel duplication of 22 bases (c.897_918dup; p.Gly307Leufs5X in the DYSF gene was identified in a family suffering from Miyoshi myopathy. Protein homology analysis proposes a disruptive impact of this mutation on protein function.

  14. Differential contributions to the transcriptome of duplicated genes in response to abiotic stresses in natural and synthetic polyploids.

    Science.gov (United States)

    Dong, Shaowei; Adams, Keith L

    2011-06-01

    Polyploidy has occurred throughout plant evolution and can result in considerable changes to gene expression when it takes place and over evolutionary time. Little is known about the effects of abiotic stress conditions on duplicate gene expression patterns in polyploid plants. We examined the expression patterns of 60 duplicated genes in leaves, roots and cotyledons of allotetraploid Gossypium hirsutum in response to five abiotic stress treatments (heat, cold, drought, high salt and water submersion) using single-strand conformation polymorphism assays, and 20 genes in a synthetic allotetraploid. Over 70% of the genes showed stress-induced changes in the relative expression levels of the duplicates under one or more stress treatments with frequent variability among treatments. Twelve pairs showed opposite changes in expression levels in response to different abiotic stress treatments. Stress-induced expression changes occurred in the synthetic allopolyploid, but there was little correspondence in patterns between the natural and synthetic polyploids. Our results indicate that abiotic stress conditions can have considerable effects on duplicate gene expression in a polyploid, with the effects varying by gene, stress and organ type. Differential expression in response to environmental stresses may be a factor in the preservation of some duplicated genes in polyploids. © 2011 The Authors. New Phytologist © 2011 New Phytologist Trust.

  15. Gene duplication and fragmentation in the zebra finch major histocompatibility complex.

    Science.gov (United States)

    Balakrishnan, Christopher N; Ekblom, Robert; Völker, Martin; Westerdahl, Helena; Godinez, Ricardo; Kotkiewicz, Holly; Burt, David W; Graves, Tina; Griffin, Darren K; Warren, Wesley C; Edwards, Scott V

    2010-04-01

    Due to its high polymorphism and importance for disease resistance, the major histocompatibility complex (MHC) has been an important focus of many vertebrate genome projects. Avian MHC organization is of particular interest because the chicken Gallus gallus, the avian species with the best characterized MHC, possesses a highly streamlined minimal essential MHC, which is linked to resistance against specific pathogens. It remains unclear the extent to which this organization describes the situation in other birds and whether it represents a derived or ancestral condition. The sequencing of the zebra finch Taeniopygia guttata genome, in combination with targeted bacterial artificial chromosome (BAC) sequencing, has allowed us to characterize an MHC from a highly divergent and diverse avian lineage, the passerines. The zebra finch MHC exhibits a complex structure and history involving gene duplication and fragmentation. The zebra finch MHC includes multiple Class I and Class II genes, some of which appear to be pseudogenes, and spans a much more extensive genomic region than the chicken MHC, as evidenced by the presence of MHC genes on each of seven BACs spanning 739 kb. Cytogenetic (FISH) evidence and the genome assembly itself place core MHC genes on as many as four chromosomes with TAP and Class I genes mapping to different chromosomes. MHC Class II regions are further characterized by high endogenous retroviral content. Lastly, we find strong evidence of selection acting on sites within passerine MHC Class I and Class II genes. The zebra finch MHC differs markedly from that of the chicken, the only other bird species with a complete genome sequence. The apparent lack of synteny between TAP and the expressed MHC Class I locus is in fact reminiscent of a pattern seen in some mammalian lineages and may represent convergent evolution. Our analyses of the zebra finch MHC suggest a complex history involving chromosomal fission, gene duplication and translocation in the

  16. Expression response of duplicated metallothionein 3 gene to copper stress in Silene vulgaris ecotypes

    Czech Academy of Sciences Publication Activity Database

    Nevrtalová, Eva; Baloun, Jiří; Hudzieczek, Vojtěch; Čegan, Radim; Vyskot, Boris; Doležel, Jaroslav; Šafář, Jan; Milde, D.; Hobza, Roman

    2014-01-01

    Roč. 251, č. 6 (2014), s. 1427-1439 ISSN 0033-183X R&D Projects: GA ČR(CZ) GAP501/12/2220; GA ČR(CZ) GBP501/12/G090; GA ČR(CZ) GP13-34962P; GA ČR(CZ) GA522/09/0083 Institutional support: RVO:68081707 Keywords : Copper * Gene duplication * Metallothionein Subject RIV: BO - Biophysics; EF - Botanics (UEB-Q) Impact factor: 2.651, year: 2014

  17. Gene duplication and the evolution of hemoglobin isoform differentiation in birds.

    Science.gov (United States)

    Grispo, Michael T; Natarajan, Chandrasekhar; Projecto-Garcia, Joana; Moriyama, Hideaki; Weber, Roy E; Storz, Jay F

    2012-11-02

    The majority of bird species co-express two functionally distinct hemoglobin (Hb) isoforms in definitive erythrocytes as follows: HbA (the major adult Hb isoform, with α-chain subunits encoded by the α(A)-globin gene) and HbD (the minor adult Hb isoform, with α-chain subunits encoded by the α(D)-globin gene). The α(D)-globin gene originated via tandem duplication of an embryonic α-like globin gene in the stem lineage of tetrapod vertebrates, which suggests the possibility that functional differentiation between the HbA and HbD isoforms may be attributable to a retained ancestral character state in HbD that harkens back to a primordial, embryonic function. To investigate this possibility, we conducted a combined analysis of protein biochemistry and sequence evolution to characterize the structural and functional basis of Hb isoform differentiation in birds. Functional experiments involving purified HbA and HbD isoforms from 11 different bird species revealed that HbD is characterized by a consistently higher O(2) affinity in the presence of allosteric effectors such as organic phosphates and Cl(-) ions. In the case of both HbA and HbD, analyses of oxygenation properties under the two-state Monod-Wyman-Changeux allosteric model revealed that the pH dependence of Hb-O(2) affinity stems primarily from changes in the O(2) association constant of deoxy (T-state)-Hb. Ancestral sequence reconstructions revealed that the amino acid substitutions that distinguish the adult-expressed Hb isoforms are not attributable to the retention of an ancestral (pre-duplication) character state in the α(D)-globin gene that is shared with the embryonic α-like globin gene.

  18. Gene Duplication and the Evolution of Hemoglobin Isoform Differentiation in Birds*

    Science.gov (United States)

    Grispo, Michael T.; Natarajan, Chandrasekhar; Projecto-Garcia, Joana; Moriyama, Hideaki; Weber, Roy E.; Storz, Jay F.

    2012-01-01

    The majority of bird species co-express two functionally distinct hemoglobin (Hb) isoforms in definitive erythrocytes as follows: HbA (the major adult Hb isoform, with α-chain subunits encoded by the αA-globin gene) and HbD (the minor adult Hb isoform, with α-chain subunits encoded by the αD-globin gene). The αD-globin gene originated via tandem duplication of an embryonic α-like globin gene in the stem lineage of tetrapod vertebrates, which suggests the possibility that functional differentiation between the HbA and HbD isoforms may be attributable to a retained ancestral character state in HbD that harkens back to a primordial, embryonic function. To investigate this possibility, we conducted a combined analysis of protein biochemistry and sequence evolution to characterize the structural and functional basis of Hb isoform differentiation in birds. Functional experiments involving purified HbA and HbD isoforms from 11 different bird species revealed that HbD is characterized by a consistently higher O2 affinity in the presence of allosteric effectors such as organic phosphates and Cl− ions. In the case of both HbA and HbD, analyses of oxygenation properties under the two-state Monod-Wyman-Changeux allosteric model revealed that the pH dependence of Hb-O2 affinity stems primarily from changes in the O2 association constant of deoxy (T-state)-Hb. Ancestral sequence reconstructions revealed that the amino acid substitutions that distinguish the adult-expressed Hb isoforms are not attributable to the retention of an ancestral (pre-duplication) character state in the αD-globin gene that is shared with the embryonic α-like globin gene. PMID:22962007

  19. Gene pool conservation of teak in Myanmar

    International Nuclear Information System (INIS)

    Tin-Tun

    1995-01-01

    Myanmar with an area of 261, 228 Sq. miles is endowed with various types of forests which occupied nearly 50% of the country. Teak (Tectona grandis Linn. f.) is one of the most valuable timber species for its excellent wood quality and properties which are not observed with other timbers. Gene pool can be defined as a group of individual trees growing over a wide range of environmental conditions, and constituting different genetic complexes which can be transmitted to the offsprings. Topics such as: objectives of gene pool conservation, genetically improved seeds for large scale forest plantations, methodology of conservation, are discussed in the article. Myanmar teak dominates the world's teak market, and thus it is crucial to maintain the superiority in the conservation of gene complexes of teak. To some extent, the conservation of gene pools of teak and tree improvements are being undertaken by the Forest Research Institute of Myanmar. It is felt that the dissemination of the philosophy and concept of gene conservation to the personal involved in the forestry activities of the country are still inadequate

  20. An ace-1 gene duplication resorbs the fitness cost associated with resistance in Anopheles gambiae, the main malaria mosquito.

    Science.gov (United States)

    Assogba, Benoît S; Djogbénou, Luc S; Milesi, Pascal; Berthomieu, Arnaud; Perez, Julie; Ayala, Diego; Chandre, Fabrice; Makoutodé, Michel; Labbé, Pierrick; Weill, Mylène

    2015-10-05

    Widespread resistance to pyrethroids threatens malaria control in Africa. Consequently, several countries switched to carbamates and organophophates insecticides for indoor residual spraying. However, a mutation in the ace-1 gene conferring resistance to these compounds (ace-1(R) allele), is already present. Furthermore, a duplicated allele (ace-1(D)) recently appeared; characterizing its selective advantage is mandatory to evaluate the threat. Our data revealed that a unique duplication event, pairing a susceptible and a resistant copy of the ace-1 gene spread through West Africa. Further investigations revealed that, while ace-1(D) confers less resistance than ace-1(R), the high fitness cost associated with ace-1(R) is almost completely suppressed by the duplication for all traits studied. ace-1 duplication thus represents a permanent heterozygote phenotype, selected, and thus spreading, due to the mosaic nature of mosquito control. It provides malaria mosquito with a new evolutionary path that could hamper resistance management.

  1. Gene duplication and adaptive evolution of digestive proteases in Drosophila arizonae female reproductive tracts.

    Directory of Open Access Journals (Sweden)

    Erin S Kelleher

    2007-08-01

    Full Text Available It frequently has been postulated that intersexual coevolution between the male ejaculate and the female reproductive tract is a driving force in the rapid evolution of reproductive proteins. The dearth of research on female tracts, however, presents a major obstacle to empirical tests of this hypothesis. Here, we employ a comparative EST approach to identify 241 candidate female reproductive proteins in Drosophila arizonae, a repleta group species in which physiological ejaculate-female coevolution has been documented. Thirty-one of these proteins exhibit elevated amino acid substitution rates, making them candidates for molecular coevolution with the male ejaculate. Strikingly, we also discovered 12 unique digestive proteases whose expression is specific to the D. arizonae lower female reproductive tract. These enzymes belong to classes most commonly found in the gastrointestinal tracts of a diverse array of organisms. We show that these proteases are associated with recent, lineage-specific gene duplications in the Drosophila repleta species group, and exhibit strong signatures of positive selection. Observation of adaptive evolution in several female reproductive tract proteins indicates they are active players in the evolution of reproductive tract interactions. Additionally, pervasive gene duplication, adaptive evolution, and rapid acquisition of a novel digestive function by the female reproductive tract points to a novel coevolutionary mechanism of ejaculate-female interaction.

  2. Rapid duplication and loss of nbs-encoding genes in eurosids II

    International Nuclear Information System (INIS)

    Si, W.; Gu, L.; Yang, S.; Zhang, X.; Memon, S.

    2015-01-01

    Eurosids basically evolved from the core Eudicots Rosids. The Rosids consist of two large assemblages, Eurosids I (Fabids) and Eurosids II (Malvids), which belong to the largest group of Angiosperms, comprising of >40,000 and ∼ 15,000 species, respectively. Although the evolutionary patterns of the largest class of disease resistance genes consisting of a nucleotide binding site (NBS) and leucine-rich repeats (LRRs) have been studied in many species, systemic research of NBS-encoding genes has not been performed in different orders of Eurosids II. Here, five Eurosids II species, Gossypium raimondii, Theobroma cacao, Carica papaya, Citrus clementina, and Arabidopsis thaliana, distributing in three orders, were used to gain insights into the evolutionary patterns of the NBS-encoding genes. Our data showed that frequent copy number variations of NBS-encoding genes were found among these species. Phylogenetic tree analysis and the numbers of the NBS-encoding genes in the common ancestor of these species showed that species-specific NBS clades, including multi-copy and single copy numbers are dominant among these genes. However, not a single clade was found with only five copies, which come from all of the five species, respectively, suggesting rapid turn-over with birth and death of the NBS-encoding genes among Eurosids II species. In addition, a strong positive correlation was observed between the Toll/interleukin receptor (TIR)) type NBS-encoding genes and species-specific genes, indicating rapid gene loss and duplication. Whereas, non- TIR type NBS-encoding genes in these five species showed two distinct evolutionary patterns. (author)

  3. Evolutionary analysis of the kinesin light chain genes in the yellow fever mosquito Aedes aegypti: gene duplication as a source for novel early zygotic genes.

    Science.gov (United States)

    Biedler, James K; Tu, Zhijian

    2010-07-08

    The maternal zygotic transition marks the time at which transcription from the zygotic genome is initiated and a subset of maternal RNAs are progressively degraded in the developing embryo. A number of early zygotic genes have been identified in Drosophila melanogaster and comparisons to sequenced mosquito genomes suggest that some of these early zygotic genes such as bottleneck are fast-evolving or subject to turnover in dipteran insects. One objective of this study is to identify early zygotic genes from the yellow fever mosquito Aedes aegypti to study their evolution. We are also interested in obtaining early zygotic promoters that will direct transgene expression in the early embryo as part of a Medea gene drive system. Two novel early zygotic kinesin light chain genes we call AaKLC2.1 and AaKLC2.2 were identified by transcriptome sequencing of Aedes aegypti embryos at various time points. These two genes have 98% nucleotide and amino acid identity in their coding regions and show transcription confined to the early zygotic stage according to gene-specific RT-PCR analysis. These AaKLC2 genes have a paralogous gene (AaKLC1) in Ae. aegypti. Phylogenetic inference shows that an ortholog to the AaKLC2 genes is only found in the sequenced genome of Culex quinquefasciatus. In contrast, AaKLC1 gene orthologs are found in all three sequenced mosquito species including Anopheles gambiae. There is only one KLC gene in D. melanogaster and other sequenced holometabolous insects that appears to be similar to AaKLC1. Unlike AaKLC2, AaKLC1 is expressed in all life stages and tissues tested, which is consistent with the expression pattern of the An. gambiae and D. melanogaster KLC genes. Phylogenetic inference also suggests that AaKLC2 genes and their likely C. quinquefasciatus ortholog are fast-evolving genes relative to the highly conserved AaKLC1-like paralogs. Embryonic injection of a luciferase reporter under the control of a 1 kb fragment upstream of the AaKLC2.1 start

  4. Evolutionary analysis of the kinesin light chain genes in the yellow fever mosquito Aedes aegypti: gene duplication as a source for novel early zygotic genes

    Directory of Open Access Journals (Sweden)

    Tu Zhijian

    2010-07-01

    Full Text Available Abstract Background The maternal zygotic transition marks the time at which transcription from the zygotic genome is initiated and a subset of maternal RNAs are progressively degraded in the developing embryo. A number of early zygotic genes have been identified in Drosophila melanogaster and comparisons to sequenced mosquito genomes suggest that some of these early zygotic genes such as bottleneck are fast-evolving or subject to turnover in dipteran insects. One objective of this study is to identify early zygotic genes from the yellow fever mosquito Aedes aegypti to study their evolution. We are also interested in obtaining early zygotic promoters that will direct transgene expression in the early embryo as part of a Medea gene drive system. Results Two novel early zygotic kinesin light chain genes we call AaKLC2.1 and AaKLC2.2 were identified by transcriptome sequencing of Aedes aegypti embryos at various time points. These two genes have 98% nucleotide and amino acid identity in their coding regions and show transcription confined to the early zygotic stage according to gene-specific RT-PCR analysis. These AaKLC2 genes have a paralogous gene (AaKLC1 in Ae. aegypti. Phylogenetic inference shows that an ortholog to the AaKLC2 genes is only found in the sequenced genome of Culex quinquefasciatus. In contrast, AaKLC1 gene orthologs are found in all three sequenced mosquito species including Anopheles gambiae. There is only one KLC gene in D. melanogaster and other sequenced holometabolous insects that appears to be similar to AaKLC1. Unlike AaKLC2, AaKLC1 is expressed in all life stages and tissues tested, which is consistent with the expression pattern of the An. gambiae and D. melanogaster KLC genes. Phylogenetic inference also suggests that AaKLC2 genes and their likely C. quinquefasciatus ortholog are fast-evolving genes relative to the highly conserved AaKLC1-like paralogs. Embryonic injection of a luciferase reporter under the control of a

  5. TRPV5 and TRPV6 in transcellular Ca(2+) transport: regulation, gene duplication, and polymorphisms in African populations.

    Science.gov (United States)

    Peng, Ji-Bin

    2011-01-01

    TRPV5 and TRPV6 are unique members of the TRP super family. They are highly selective for Ca(2+) ions with multiple layers of Ca(2+)-dependent inactivation mechanisms, expressed at the apical membrane of Ca(2+) transporting epithelia, and robustly responsive to 1,25-dihydroxivitamin D(3). These features are well suited for their roles as Ca(2+) entry channels in the first step of transcellular Ca(2+) transport pathways, which are involved in intestinal absorption, renal reabsorption of Ca(2+), placental transfer of Ca(2+) to fetus, and many other processes. While TRPV6 is more broadly expressed in a variety of tissues such as esophagus, stomach, small intestine, colon, kidney, placenta, pancreas, prostate, uterus, salivary gland, and sweat gland, TRPV5 expression is relatively restricted to the distal convoluted tubule and connecting tubule of the kidney. There is only one TRPV6-like gene in fish and birds in comparison to both TRPV5 and TRPV6 genes in mammals, indicating TRPV5 gene was likely generated from duplication of TRPV6 gene during the evolution of mammals to meet the needs of complex renal function. TRPV5 and TRPV6 are subjected to vigorous regulations under physiological, pathological, and therapeutic conditions. The elevated TRPV6 level in malignant tumors such as prostate and breast cancers makes it a potential therapeutic target. TRPV6, and to a lesser extent TRPV5, exhibit unusually high levels of single nucleotide polymorphisms (SNPs) in African populations as compared to other populations, indicating TRPV6 gene was under selective pressure during or after humans migrated out of Africa. The SNPs of TRPV6 and TRPV5 likely contribute to the Ca(2+) conservation mechanisms in African populations.

  6. Duplication of Dio3 genes in teleost fish and their divergent expression in skin during flatfish metamorphosis.

    Science.gov (United States)

    Alves, R N; Cardoso, J C R; Harboe, T; Martins, R S T; Manchado, M; Norberg, B; Power, D M

    2017-05-15

    Deiodinase 3 (Dio3) plays an essential role during early development in vertebrates by controlling tissue thyroid hormone (TH) availability. The Atlantic halibut (Hippoglossus hippoglossus) possesses duplicate dio3 genes (dio3a and dio3b). Expression analysis indicates that dio3b levels change in abocular skin during metamorphosis and this suggests that this enzyme is associated with the divergent development of larval skin to the juvenile phenotype. In larvae exposed to MMI, a chemical that inhibits TH production, expression of dio3b in ocular skin is significantly up-regulated suggesting that THs normally modulate this genes expression during this developmental event. The molecular basis for divergent dio3a and dio3b expression and responsiveness to MMI treatment is explained by the multiple conserved TREs in the proximal promoter region of teleost dio3b and their absence from the promoter of dio3a. We propose that the divergent expression of dio3 in ocular and abocular skin during halibut metamorphosis contributes to the asymmetric pigment development in response to THs. Copyright © 2017 Elsevier Inc. All rights reserved.

  7. A 380-kb Duplication in 7p22.3 Encompassing the LFNG Gene in a Boy with Asperger Syndrome

    NARCIS (Netherlands)

    Vulto-van Silfhout, A.T.; de Brouwer, A.F.; de Leeuw, N.; Obihara, C.C.; Brunner, H.G.; Vries, L.B.A. de

    2012-01-01

    De novo genomic aberrations are considered an important cause of autism spectrum disorders. We describe a de novo 380-kb gain in band p22.3 of chromosome 7 in a patient with Asperger syndrome. This duplicated region contains 9 genes including the LNFG gene that is an important regulator of NOTCH

  8. Whole Genome and Tandem Duplicate Retention facilitated Glucosinolate Pathway Diversification in the Mustard Family.

    NARCIS (Netherlands)

    Hofberger, J.A.; Lyons, E.; Edger, P.P.; Pires, J.C.; Schranz, M.E.

    2013-01-01

    Plants share a common history of successive whole genome duplication (WGD) events retaining genomic patterns of duplicate gene copies (ohnologs) organized in conserved syntenic blocks. Duplication was often proposed to affect the origin of novel traits during evolution. However, genetic evidence

  9. The polyphenol oxidase gene family in land plants: Lineage-specific duplication and expansion

    Directory of Open Access Journals (Sweden)

    Tran Lan T

    2012-08-01

    Full Text Available Abstract Background Plant polyphenol oxidases (PPOs are enzymes that typically use molecular oxygen to oxidize ortho-diphenols to ortho-quinones. These commonly cause browning reactions following tissue damage, and may be important in plant defense. Some PPOs function as hydroxylases or in cross-linking reactions, but in most plants their physiological roles are not known. To better understand the importance of PPOs in the plant kingdom, we surveyed PPO gene families in 25 sequenced genomes from chlorophytes, bryophytes, lycophytes, and flowering plants. The PPO genes were then analyzed in silico for gene structure, phylogenetic relationships, and targeting signals. Results Many previously uncharacterized PPO genes were uncovered. The moss, Physcomitrella patens, contained 13 PPO genes and Selaginella moellendorffii (spike moss and Glycine max (soybean each had 11 genes. Populus trichocarpa (poplar contained a highly diversified gene family with 11 PPO genes, but several flowering plants had only a single PPO gene. By contrast, no PPO-like sequences were identified in several chlorophyte (green algae genomes or Arabidopsis (A. lyrata and A. thaliana. We found that many PPOs contained one or two introns often near the 3’ terminus. Furthermore, N-terminal amino acid sequence analysis using ChloroP and TargetP 1.1 predicted that several putative PPOs are synthesized via the secretory pathway, a unique finding as most PPOs are predicted to be chloroplast proteins. Phylogenetic reconstruction of these sequences revealed that large PPO gene repertoires in some species are mostly a consequence of independent bursts of gene duplication, while the lineage leading to Arabidopsis must have lost all PPO genes. Conclusion Our survey identified PPOs in gene families of varying sizes in all land plants except in the genus Arabidopsis. While we found variation in intron numbers and positions, overall PPO gene structure is congruent with the phylogenetic

  10. Gene duplication and fragmentation in the zebra finch major histocompatibility complex

    Directory of Open Access Journals (Sweden)

    Burt David W

    2010-04-01

    Full Text Available Abstract Background Due to its high polymorphism and importance for disease resistance, the major histocompatibility complex (MHC has been an important focus of many vertebrate genome projects. Avian MHC organization is of particular interest because the chicken Gallus gallus, the avian species with the best characterized MHC, possesses a highly streamlined minimal essential MHC, which is linked to resistance against specific pathogens. It remains unclear the extent to which this organization describes the situation in other birds and whether it represents a derived or ancestral condition. The sequencing of the zebra finch Taeniopygia guttata genome, in combination with targeted bacterial artificial chromosome (BAC sequencing, has allowed us to characterize an MHC from a highly divergent and diverse avian lineage, the passerines. Results The zebra finch MHC exhibits a complex structure and history involving gene duplication and fragmentation. The zebra finch MHC includes multiple Class I and Class II genes, some of which appear to be pseudogenes, and spans a much more extensive genomic region than the chicken MHC, as evidenced by the presence of MHC genes on each of seven BACs spanning 739 kb. Cytogenetic (FISH evidence and the genome assembly itself place core MHC genes on as many as four chromosomes with TAP and Class I genes mapping to different chromosomes. MHC Class II regions are further characterized by high endogenous retroviral content. Lastly, we find strong evidence of selection acting on sites within passerine MHC Class I and Class II genes. Conclusion The zebra finch MHC differs markedly from that of the chicken, the only other bird species with a complete genome sequence. The apparent lack of synteny between TAP and the expressed MHC Class I locus is in fact reminiscent of a pattern seen in some mammalian lineages and may represent convergent evolution. Our analyses of the zebra finch MHC suggest a complex history involving

  11. Spotting and validation of a genome wide oligonucleotide chip with duplicate measurement of each gene

    International Nuclear Information System (INIS)

    Thomassen, Mads; Skov, Vibe; Eiriksdottir, Freyja; Tan, Qihua; Jochumsen, Kirsten; Fritzner, Niels; Brusgaard, Klaus; Dahlgaard, Jesper; Kruse, Torben A.

    2006-01-01

    The quality of DNA microarray based gene expression data relies on the reproducibility of several steps in a microarray experiment. We have developed a spotted genome wide microarray chip with oligonucleotides printed in duplicate in order to minimise undesirable biases, thereby optimising detection of true differential expression. The validation study design consisted of an assessment of the microarray chip performance using the MessageAmp and FairPlay labelling kits. Intraclass correlation coefficient (ICC) was used to demonstrate that MessageAmp was significantly more reproducible than FairPlay. Further examinations with MessageAmp revealed the applicability of the system. The linear range of the chips was three orders of magnitude, the precision was high, as 95% of measurements deviated less than 1.24-fold from the expected value, and the coefficient of variation for relative expression was 13.6%. Relative quantitation was more reproducible than absolute quantitation and substantial reduction of variance was attained with duplicate spotting. An analysis of variance (ANOVA) demonstrated no significant day-to-day variation

  12. Conservation of gene linkage in dispersed vertebrate NK homeobox clusters.

    Science.gov (United States)

    Wotton, Karl R; Weierud, Frida K; Juárez-Morales, José L; Alvares, Lúcia E; Dietrich, Susanne; Lewis, Katharine E

    2009-10-01

    Nk homeobox genes are important regulators of many different developmental processes including muscle, heart, central nervous system and sensory organ development. They are thought to have arisen as part of the ANTP megacluster, which also gave rise to Hox and ParaHox genes, and at least some NK genes remain tightly linked in all animals examined so far. The protostome-deuterostome ancestor probably contained a cluster of nine Nk genes: (Msx)-(Nk4/tinman)-(Nk3/bagpipe)-(Lbx/ladybird)-(Tlx/c15)-(Nk7)-(Nk6/hgtx)-(Nk1/slouch)-(Nk5/Hmx). Of these genes, only NKX2.6-NKX3.1, LBX1-TLX1 and LBX2-TLX2 remain tightly linked in humans. However, it is currently unclear whether this is unique to the human genome as we do not know which of these Nk genes are clustered in other vertebrates. This makes it difficult to assess whether the remaining linkages are due to selective pressures or because chance rearrangements have "missed" certain genes. In this paper, we identify all of the paralogs of these ancestrally clustered NK genes in several distinct vertebrates. We demonstrate that tight linkages of Lbx1-Tlx1, Lbx2-Tlx2 and Nkx3.1-Nkx2.6 have been widely maintained in both the ray-finned and lobe-finned fish lineages. Moreover, the recently duplicated Hmx2-Hmx3 genes are also tightly linked. Finally, we show that Lbx1-Tlx1 and Hmx2-Hmx3 are flanked by highly conserved noncoding elements, suggesting that shared regulatory regions may have resulted in evolutionary pressure to maintain these linkages. Consistent with this, these pairs of genes have overlapping expression domains. In contrast, Lbx2-Tlx2 and Nkx3.1-Nkx2.6, which do not seem to be coexpressed, are also not associated with conserved noncoding sequences, suggesting that an alternative mechanism may be responsible for the continued clustering of these genes.

  13. XX male sex reversal with genital abnormalities associated with a de novo SOX3 gene duplication.

    Science.gov (United States)

    Moalem, Sharon; Babul-Hirji, Riyana; Stavropolous, Dmitri J; Wherrett, Diane; Bägli, Darius J; Thomas, Paul; Chitayat, David

    2012-07-01

    Differentiation of the bipotential gonad into testis is initiated by the Y chromosome-linked gene SRY (Sex-determining Region Y) through upregulation of its autosomal direct target gene SOX9 (Sry-related HMG box-containing gene 9). Sequence and chromosome homology studies have shown that SRY most probably evolved from SOX3, which in humans is located at Xq27.1. Mutations causing SOX3 loss-of-function do not affect the sex determination in mice or humans. However, transgenic mouse studies have shown that ectopic expression of Sox3 in the bipotential gonad results in upregulation of Sox9, resulting in testicular induction and XX male sex reversal. However, the mechanism by which these rearrangements cause sex reversal and the frequency with which they are associated with disorders of sex development remains unclear. Rearrangements of the SOX3 locus were identified recently in three cases of human XX male sex reversal. We report on a case of XX male sex reversal associated with a novel de novo duplication of the SOX3 gene. These data provide additional evidence that SOX3 gain-of-function in the XX bipotential gonad causes XX male sex reversal and further support the hypothesis that SOX3 is the evolutionary antecedent of SRY. Copyright © 2012 Wiley Periodicals, Inc.

  14. Structure of Mycobacterium tuberculosis Rv2714, a representative of a duplicated gene family in Actinobacteria

    International Nuclear Information System (INIS)

    Graña, Martin; Bellinzoni, Marco; Miras, Isabelle; Fiez-Vandal, Cedric; Haouz, Ahmed; Shepard, William; Buschiazzo, Alejandro; Alzari, Pedro M.

    2009-01-01

    The crystal structure of Rv2714, a protein of unknown function from M. tuberculosis, has been determined at 2.6 Å resolution using single-wavelength anomalous diffraction methods. The gene Rv2714 from Mycobacterium tuberculosis, which codes for a hypothetical protein of unknown function, is a representative member of a gene family that is largely confined to the order Actinomycetales of Actinobacteria. Sequence analysis indicates the presence of two paralogous genes in most mycobacterial genomes and suggests that gene duplication was an ancient event in bacterial evolution. The crystal structure of Rv2714 has been determined at 2.6 Å resolution, revealing a trimer in which the topology of the protomer core is similar to that observed in a functionally diverse set of enzymes, including purine nucleoside phosphorylases, some carboxypeptidases, bacterial peptidyl-tRNA hydrolases and even the plastidic form of an intron splicing factor. However, some structural elements, such as a β-hairpin insertion involved in protein oligomerization and a C-terminal α-helical domain that serves as a lid to the putative substrate-binding (or ligand-binding) site, are only found in Rv2714 bacterial homologues and represent specific signatures of this protein family

  15. Structure of Mycobacterium tuberculosis Rv2714, a representative of a duplicated gene family in Actinobacteria

    Energy Technology Data Exchange (ETDEWEB)

    Graña, Martin; Bellinzoni, Marco [Institut Pasteur, Unité de Biochimie Structurale, URA CNRS 2185, 25 Rue du Dr Roux, 75724 Paris (France); Miras, Isabelle; Fiez-Vandal, Cedric; Haouz, Ahmed; Shepard, William [Institut Pasteur, Plate-forme de Cristallogenèse et Diffraction des Rayons X, 25 Rue du Dr Roux, 75724 Paris (France); Buschiazzo, Alejandro; Alzari, Pedro M., E-mail: alzari@pasteur.fr [Institut Pasteur, Unité de Biochimie Structurale, URA CNRS 2185, 25 Rue du Dr Roux, 75724 Paris (France)

    2009-10-01

    The crystal structure of Rv2714, a protein of unknown function from M. tuberculosis, has been determined at 2.6 Å resolution using single-wavelength anomalous diffraction methods. The gene Rv2714 from Mycobacterium tuberculosis, which codes for a hypothetical protein of unknown function, is a representative member of a gene family that is largely confined to the order Actinomycetales of Actinobacteria. Sequence analysis indicates the presence of two paralogous genes in most mycobacterial genomes and suggests that gene duplication was an ancient event in bacterial evolution. The crystal structure of Rv2714 has been determined at 2.6 Å resolution, revealing a trimer in which the topology of the protomer core is similar to that observed in a functionally diverse set of enzymes, including purine nucleoside phosphorylases, some carboxypeptidases, bacterial peptidyl-tRNA hydrolases and even the plastidic form of an intron splicing factor. However, some structural elements, such as a β-hairpin insertion involved in protein oligomerization and a C-terminal α-helical domain that serves as a lid to the putative substrate-binding (or ligand-binding) site, are only found in Rv2714 bacterial homologues and represent specific signatures of this protein family.

  16. Resolution and reconciliation of non-binary gene trees with transfers, duplications and losses.

    Science.gov (United States)

    Jacox, Edwin; Weller, Mathias; Tannier, Eric; Scornavacca, Celine

    2017-04-01

    Gene trees reconstructed from sequence alignments contain poorly supported branches when the phylogenetic signal in the sequences is insufficient to determine them all. When a species tree is available, the signal of gains and losses of genes can be used to correctly resolve the unsupported parts of the gene history. However finding a most parsimonious binary resolution of a non-binary tree obtained by contracting the unsupported branches is NP-hard if transfer events are considered as possible gene scale events, in addition to gene origination, duplication and loss. We propose an exact, parameterized algorithm to solve this problem in single-exponential time, where the parameter is the number of connected branches of the gene tree that show low support from the sequence alignment or, equivalently, the maximum number of children of any node of the gene tree once the low-support branches have been collapsed. This improves on the best known algorithm by an exponential factor. We propose a way to choose among optimal solutions based on the available information. We show the usability of this principle on several simulated and biological datasets. The results are comparable in quality to several other tested methods having similar goals, but our approach provides a lower running time and a guarantee that the produced solution is optimal. Our algorithm has been integrated into the ecceTERA phylogeny package, available at http://mbb.univ-montp2.fr/MBB/download_sources/16__ecceTERA and which can be run online at http://mbb.univ-montp2.fr/MBB/subsection/softExec.php?soft=eccetera . celine.scornavacca@umontpellier.fr. Supplementary data are available at Bioinformatics online. © The Author 2017. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com

  17. Gene Duplication Leads to Altered Membrane Topology of a Cytochrome P450 Enzyme in Seed Plants.

    Science.gov (United States)

    Renault, Hugues; De Marothy, Minttu; Jonasson, Gabriella; Lara, Patricia; Nelson, David R; Nilsson, IngMarie; André, François; von Heijne, Gunnar; Werck-Reichhart, Danièle

    2017-08-01

    Evolution of the phenolic metabolism was critical for the transition of plants from water to land. A cytochrome P450, CYP73, with cinnamate 4-hydroxylase (C4H) activity, catalyzes the first plant-specific and rate-limiting step in this pathway. The CYP73 gene is absent from green algae, and first detected in bryophytes. A CYP73 duplication occurred in the ancestor of seed plants and was retained in Taxaceae and most angiosperms. In spite of a clear divergence in primary sequence, both paralogs can fulfill comparable cinnamate hydroxylase roles both in vitro and in vivo. One of them seems dedicated to the biosynthesis of lignin precursors. Its N-terminus forms a single membrane spanning helix and its properties and length are highly constrained. The second is characterized by an elongated and variable N-terminus, reminiscent of ancestral CYP73s. Using as proxies the Brachypodium distachyon proteins, we show that the elongation of the N-terminus does not result in an altered subcellular localization, but in a distinct membrane topology. Insertion in the membrane of endoplasmic reticulum via a double-spanning open hairpin structure allows reorientation to the lumen of the catalytic domain of the protein. In agreement with participation to a different functional unit and supramolecular organization, the protein displays modified heme proximal surface. These data suggest the evolution of divergent C4H enzymes feeding different branches of the phenolic network in seed plants. It shows that specialization required for retention of gene duplicates may result from altered protein topology rather than change in enzyme activity. © The Author 2017. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  18. Functional analysis of duplicated Symbiosis Receptor Kinase (SymRK) genes during nodulation and mycorrhizal infection in soybean (Glycine max).

    Science.gov (United States)

    Indrasumunar, Arief; Wilde, Julia; Hayashi, Satomi; Li, Dongxue; Gresshoff, Peter M

    2015-03-15

    Association between legumes and rhizobia results in the formation of root nodules, where symbiotic nitrogen fixation occurs. The early stages of this association involve a complex of signalling events between the host and microsymbiont. Several genes dealing with early signal transduction have been cloned, and one of them encodes the leucine-rich repeat (LRR) receptor kinase (SymRK; also termed NORK). The Symbiosis Receptor Kinase gene is required by legumes to establish a root endosymbiosis with Rhizobium bacteria as well as mycorrhizal fungi. Using degenerate primer and BAC sequencing, we cloned duplicated SymRK homeologues in soybean called GmSymRKα and GmSymRKβ. These duplicated genes have high similarity of nucleotide (96%) and amino acid sequence (95%). Sequence analysis predicted a malectin-like domain within the extracellular domain of both genes. Several putative cis-acting elements were found in promoter regions of GmSymRKα and GmSymRKβ, suggesting a participation in lateral root development, cell division and peribacteroid membrane formation. The mutant of SymRK genes is not available in soybean; therefore, to know the functions of these genes, RNA interference (RNAi) of these duplicated genes was performed. For this purpose, RNAi construct of each gene was generated and introduced into the soybean genome by Agrobacterium rhizogenes-mediated hairy root transformation. RNAi of GmSymRKβ gene resulted in an increased reduction of nodulation and mycorrhizal infection than RNAi of GmSymRKα, suggesting it has the major activity of the duplicated gene pair. The results from the important crop legume soybean confirm the joint phenotypic action of GmSymRK genes in both mycorrhizal and rhizobial infection seen in model legumes. Copyright © 2015 Elsevier GmbH. All rights reserved.

  19. Identification of Ohnolog Genes Originating from Whole Genome Duplication in Early Vertebrates, Based on Synteny Comparison across Multiple Genomes.

    Science.gov (United States)

    Singh, Param Priya; Arora, Jatin; Isambert, Hervé

    2015-07-01

    Whole genome duplications (WGD) have now been firmly established in all major eukaryotic kingdoms. In particular, all vertebrates descend from two rounds of WGDs, that occurred in their jawless ancestor some 500 MY ago. Paralogs retained from WGD, also coined 'ohnologs' after Susumu Ohno, have been shown to be typically associated with development, signaling and gene regulation. Ohnologs, which amount to about 20 to 35% of genes in the human genome, have also been shown to be prone to dominant deleterious mutations and frequently implicated in cancer and genetic diseases. Hence, identifying ohnologs is central to better understand the evolution of vertebrates and their susceptibility to genetic diseases. Early computational analyses to identify vertebrate ohnologs relied on content-based synteny comparisons between the human genome and a single invertebrate outgroup genome or within the human genome itself. These approaches are thus limited by lineage specific rearrangements in individual genomes. We report, in this study, the identification of vertebrate ohnologs based on the quantitative assessment and integration of synteny conservation between six amniote vertebrates and six invertebrate outgroups. Such a synteny comparison across multiple genomes is shown to enhance the statistical power of ohnolog identification in vertebrates compared to earlier approaches, by overcoming lineage specific genome rearrangements. Ohnolog gene families can be browsed and downloaded for three statistical confidence levels or recompiled for specific, user-defined, significance criteria at http://ohnologs.curie.fr/. In the light of the importance of WGD on the genetic makeup of vertebrates, our analysis provides a useful resource for researchers interested in gaining further insights on vertebrate evolution and genetic diseases.

  20. Duplications of the neuropeptide receptor gene VIPR2 confer significant risk for schizophrenia.

    LENUS (Irish Health Repository)

    Vacic, Vladimir

    2011-03-24

    Rare copy number variants (CNVs) have a prominent role in the aetiology of schizophrenia and other neuropsychiatric disorders. Substantial risk for schizophrenia is conferred by large (>500-kilobase) CNVs at several loci, including microdeletions at 1q21.1 (ref. 2), 3q29 (ref. 3), 15q13.3 (ref. 2) and 22q11.2 (ref. 4) and microduplication at 16p11.2 (ref. 5). However, these CNVs collectively account for a small fraction (2-4%) of cases, and the relevant genes and neurobiological mechanisms are not well understood. Here we performed a large two-stage genome-wide scan of rare CNVs and report the significant association of copy number gains at chromosome 7q36.3 with schizophrenia. Microduplications with variable breakpoints occurred within a 362-kilobase region and were detected in 29 of 8,290 (0.35%) patients versus 2 of 7,431 (0.03%) controls in the combined sample. All duplications overlapped or were located within 89 kilobases upstream of the vasoactive intestinal peptide receptor gene VIPR2. VIPR2 transcription and cyclic-AMP signalling were significantly increased in cultured lymphocytes from patients with microduplications of 7q36.3. These findings implicate altered vasoactive intestinal peptide signalling in the pathogenesis of schizophrenia and indicate the VPAC2 receptor as a potential target for the development of new antipsychotic drugs.

  1. Ubiquitin--conserved protein or selfish gene?

    Science.gov (United States)

    Catic, André; Ploegh, Hidde L

    2005-11-01

    The posttranslational modifier ubiquitin is encoded by a multigene family containing three primary members, which yield the precursor protein polyubiquitin and two ubiquitin moieties, Ub(L40) and Ub(S27), that are fused to the ribosomal proteins L40 and S27, respectively. The gene encoding polyubiquitin is highly conserved and, until now, those encoding Ub(L40) and Ub(S27) have been generally considered to be equally invariant. The evolution of the ribosomal ubiquitin moieties is, however, proving to be more dynamic. It seems that the genes encoding Ub(L40) and Ub(S27) are actively maintained by homologous recombination with the invariant polyubiquitin locus. Failure to recombine leads to deterioration of the sequence of the ribosomal ubiquitin moieties in several phyla, although this deterioration is evidently constrained by the structural requirements of the ubiquitin fold. Only a few amino acids in ubiquitin are vital for its function, and we propose that conservation of all three ubiquitin genes is driven not only by functional properties of the ubiquitin protein, but also by the propensity of the polyubiquitin locus to act as a 'selfish gene'.

  2. Mirror-image duplication of the primary axis and heart in Xenopus embryos by the overexpression of Msx-1 gene.

    Science.gov (United States)

    Chen, Y; Solursh, M

    1995-10-01

    The Msx-1 gene (formerly known as Hox-7) is a member of a discrete subclass of homeobox-containing genes. Examination of the expression pattern of Msx-1 in murine and avian embryos suggests that this gene may be involved in the regionalization of the medio-lateral axis during earlier development. We have examined the possible functions of Xenopus Msx-1 during early Xenopus embryonic development by overexpression of the Msx-1 gene. Overexpression of Msx-1 causes a left-right mirror-image duplication of primary axial structures, including notochord, neural tube, somites, suckers, and foregut. The embryonic developing heart is also mirror-image duplicated, including looping directions and polarity. These results indicate that Msx-1 may be involved in the mesoderm formation as well as left-right patterning in the early Xenopus embryonic development.

  3. Segmental duplications and evolutionary acquisition of UV damage response in the SPATA31 gene family of primates and humans.

    Science.gov (United States)

    Bekpen, Cemalettin; Künzel, Sven; Xie, Chen; Eaaswarkhanth, Muthukrishnan; Lin, Yen-Lung; Gokcumen, Omer; Akdis, Cezmi A; Tautz, Diethard

    2017-03-06

    Segmental duplications are an abundant source for novel gene functions and evolutionary adaptations. This mechanism of generating novelty was very active during the evolution of primates particularly in the human lineage. Here, we characterize the evolution and function of the SPATA31 gene family (former designation FAM75A), which was previously shown to be among the gene families with the strongest signal of positive selection in hominoids. The mouse homologue for this gene family is a single copy gene expressed during spermatogenesis. We show that in primates, the SPATA31 gene duplicated into SPATA31A and SPATA31C types and broadened the expression into many tissues. Each type became further segmentally duplicated in the line towards humans with the largest number of full-length copies found for SPATA31A in humans. Copy number estimates of SPATA31A based on digital PCR show an average of 7.5 with a range of 5-11 copies per diploid genome among human individuals. The primate SPATA31 genes also acquired new protein domains that suggest an involvement in UV response and DNA repair. We generated antibodies and show that the protein is re-localized from the nucleolus to the whole nucleus upon UV-irradiation suggesting a UV damage response. We used CRISPR/Cas mediated mutagenesis to knockout copies of the gene in human primary fibroblast cells. We find that cell lines with reduced functional copies as well as naturally occurring low copy number HFF cells show enhanced sensitivity towards UV-irradiation. The acquisition of new SPATA31 protein functions and its broadening of expression may be related to the evolution of the diurnal life style in primates that required a higher UV tolerance. The increased segmental duplications in hominoids as well as its fast evolution suggest the acquisition of further specific functions particularly in humans.

  4. Duplication of the dystroglycan gene in most branches of teleost fish

    Directory of Open Access Journals (Sweden)

    Giardina Bruno

    2007-05-01

    Full Text Available Abstract Background The dystroglycan (DG complex is a major non-integrin cell adhesion system whose multiple biological roles involve, among others, skeletal muscle stability, embryonic development and synapse maturation. DG is composed of two subunits: α-DG, extracellular and highly glycosylated, and the transmembrane β-DG, linking the cytoskeleton to the surrounding basement membrane in a wide variety of tissues. A single copy of the DG gene (DAG1 has been identified so far in humans and other mammals, encoding for a precursor protein which is post-translationally cleaved to liberate the two DG subunits. Similarly, D. rerio (zebrafish seems to have a single copy of DAG1, whose removal was shown to cause a severe dystrophic phenotype in adult animals, although it is known that during evolution, due to a whole genome duplication (WGD event, many teleost fish acquired multiple copies of several genes (paralogues. Results Data mining of pufferfish (T. nigroviridis and T. rubripes and other teleost fish (O. latipes and G. aculeatus available nucleotide sequences revealed the presence of two functional paralogous DG sequences. RT-PCR analysis proved that both the DG sequences are transcribed in T. nigroviridis. One of the two DG sequences harbours an additional mini-intronic sequence, 137 bp long, interrupting the uncomplicated exon-intron-exon pattern displayed by DAG1 in mammals and D. rerio. A similar scenario emerged also in D. labrax (sea bass, from whose genome we have cloned and sequenced a new DG sequence that also harbours a shorter additional intronic sequence of 116 bp. Western blot analysis confirmed the presence of DG protein products in all the species analysed including two teleost Antarctic species (T. bernacchii and C. hamatus. Conclusion Our evolutionary analysis has shown that the whole-genome duplication event in the Class Actinopterygii (ray-finned fish involved also DAG1. We unravelled new important molecular genetic details

  5. Cumulative Impact of Polychlorinated Biphenyl and Large Chromosomal Duplications on DNA Methylation, Chromatin, and Expression of Autism Candidate Genes.

    Science.gov (United States)

    Dunaway, Keith W; Islam, M Saharul; Coulson, Rochelle L; Lopez, S Jesse; Vogel Ciernia, Annie; Chu, Roy G; Yasui, Dag H; Pessah, Isaac N; Lott, Paul; Mordaunt, Charles; Meguro-Horike, Makiko; Horike, Shin-Ichi; Korf, Ian; LaSalle, Janine M

    2016-12-13

    Rare variants enriched for functions in chromatin regulation and neuronal synapses have been linked to autism. How chromatin and DNA methylation interact with environmental exposures at synaptic genes in autism etiologies is currently unclear. Using whole-genome bisulfite sequencing in brain tissue and a neuronal cell culture model carrying a 15q11.2-q13.3 maternal duplication, we find that significant global DNA hypomethylation is enriched over autism candidate genes and affects gene expression. The cumulative effect of multiple chromosomal duplications and exposure to the pervasive persistent organic pollutant PCB 95 altered methylation of more than 1,000 genes. Hypomethylated genes were enriched for H2A.Z, increased maternal UBE3A in Dup15q corresponded to reduced levels of RING1B, and bivalently modified H2A.Z was altered by PCB 95 and duplication. These results demonstrate the compounding effects of genetic and environmental insults on the neuronal methylome that converge upon dysregulation of chromatin and synaptic genes. Copyright © 2016 The Author(s). Published by Elsevier Inc. All rights reserved.

  6. North Carolina macular dystrophy (MCDR1) caused by a novel tandem duplication of the PRDM13 gene.

    Science.gov (United States)

    Bowne, Sara J; Sullivan, Lori S; Wheaton, Dianna K; Locke, Kirsten G; Jones, Kaylie D; Koboldt, Daniel C; Fulton, Robert S; Wilson, Richard K; Blanton, Susan H; Birch, David G; Daiger, Stephen P

    2016-01-01

    To identify the underlying cause of disease in a large family with North Carolina macular dystrophy (NCMD). A large four-generation family (RFS355) with an autosomal dominant form of NCMD was ascertained. Family members underwent comprehensive visual function evaluations. Blood or saliva from six affected family members and three unaffected spouses was collected and DNA tested for linkage to the MCDR1 locus on chromosome 6q12. Three affected family members and two unaffected spouses underwent whole exome sequencing (WES) and subsequently, custom capture of the linkage region followed by next-generation sequencing (NGS). Standard PCR and dideoxy sequencing were used to further characterize the mutation. Of the 12 eyes examined in six affected individuals, all but two had Gass grade 3 macular degeneration features. Large central excavation of the retinal and choroid layers, referred to as a macular caldera, was seen in an age-independent manner in the grade 3 eyes. The calderas are unique to affected individuals with MCDR1. Genome-wide linkage mapping and haplotype analysis of markers from the chromosome 6q region were consistent with linkage to the MCDR1 locus. Whole exome sequencing and custom-capture NGS failed to reveal any rare coding variants segregating with the phenotype. Analysis of the custom-capture NGS sequencing data for copy number variants uncovered a tandem duplication of approximately 60 kb on chromosome 6q. This region contains two genes, CCNC and PRDM13 . The duplication creates a partial copy of CCNC and a complete copy of PRDM13 . The duplication was found in all affected members of the family and is not present in any unaffected members. The duplication was not seen in 200 ethnically matched normal chromosomes. The cause of disease in the original family with MCDR1 and several others has been recently reported to be dysregulation of the PRDM13 gene, caused by either single base substitutions in a DNase 1 hypersensitive site upstream of the CCNC

  7. Expression Pattern Similarities Support the Prediction of Orthologs Retaining Common Functions after Gene Duplication Events1[OPEN

    Science.gov (United States)

    Haberer, Georg; Panda, Arup; Das Laha, Shayani; Ghosh, Tapas Chandra; Schäffner, Anton R.

    2016-01-01

    The identification of functionally equivalent, orthologous genes (functional orthologs) across genomes is necessary for accurate transfer of experimental knowledge from well-characterized organisms to others. This frequently relies on automated, coding sequence-based approaches such as OrthoMCL, Inparanoid, and KOG, which usually work well for one-to-one homologous states. However, this strategy does not reliably work for plants due to the occurrence of extensive gene/genome duplication. Frequently, for one query gene, multiple orthologous genes are predicted in the other genome, and it is not clear a priori from sequence comparison and similarity which one preserves the ancestral function. We have studied 11 organ-dependent and stress-induced gene expression patterns of 286 Arabidopsis lyrata duplicated gene groups and compared them with the respective Arabidopsis (Arabidopsis thaliana) genes to predict putative expressologs and nonexpressologs based on gene expression similarity. Promoter sequence divergence as an additional tool to substantiate functional orthology only partially overlapped with expressolog classification. By cloning eight A. lyrata homologs and complementing them in the respective four Arabidopsis loss-of-function mutants, we experimentally proved that predicted expressologs are indeed functional orthologs, while nonexpressologs or nonfunctionalized orthologs are not. Our study demonstrates that even a small set of gene expression data in addition to sequence homologies are instrumental in the assignment of functional orthologs in the presence of multiple orthologs. PMID:27303025

  8. Rooting phylogenies using gene duplications: an empirical example from the bees (Apoidea).

    Science.gov (United States)

    Brady, Seán G; Litman, Jessica R; Danforth, Bryan N

    2011-09-01

    The placement of the root node in a phylogeny is fundamental to characterizing evolutionary relationships. The root node of bee phylogeny remains unclear despite considerable previous attention. In order to test alternative hypotheses for the location of the root node in bees, we used the F1 and F2 paralogs of elongation factor 1-alpha (EF-1α) to compare the tree topologies that result when using outgroup versus paralogous rooting. Fifty-two taxa representing each of the seven bee families were sequenced for both copies of EF-1α. Two datasets were analyzed. In the first (the "concatenated" dataset), the F1 and F2 copies for each species were concatenated and the tree was rooted using appropriate outgroups (sphecid and crabronid wasps). In the second dataset (the "duplicated" dataset), the F1 and F2 copies were aligned to each another and each copy for all taxa were treated as separate terminals. In this dataset, the root was placed between the F1 and F2 copies (e.g., paralog rooting). Bayesian analyses demonstrate that the outgroup rooting approach outperforms paralog rooting, recovering deeper clades and showing stronger support for groups well established by both morphological and other molecular data. Sequence characteristics of the two copies were compared at the amino acid level, but little evidence was found to suggest that one copy is more functionally conserved. Although neither approach yields an unambiguous root to the tree, both approaches strongly indicate that the root of bee phylogeny does not fall near Colletidae, as has been previously proposed. We discuss paralog rooting as a general strategy and why this approach performs relatively poorly with our particular dataset. Copyright © 2011 Elsevier Inc. All rights reserved.

  9. New insights into the nutritional regulation of gluconeogenesis in carnivorous rainbow trout (Oncorhynchus mykiss): a gene duplication trail.

    Science.gov (United States)

    Marandel, Lucie; Seiliez, Iban; Véron, Vincent; Skiba-Cassy, Sandrine; Panserat, Stéphane

    2015-07-01

    The rainbow trout (Oncorhynchus mykiss) is considered to be a strictly carnivorous fish species that is metabolically adapted for high catabolism of proteins and low utilization of dietary carbohydrates. This species consequently has a "glucose-intolerant" phenotype manifested by persistent hyperglycemia when fed a high-carbohydrate diet. Gluconeogenesis in adult fish is also poorly, if ever, regulated by carbohydrates, suggesting that this metabolic pathway is involved in this specific phenotype. In this study, we hypothesized that the fate of duplicated genes after the salmonid-specific 4th whole genome duplication (Ss4R) may have led to adaptive innovation and that their study might provide new elements to enhance our understanding of gluconeogenesis and poor dietary carbohydrate use in this species. Our evolutionary analysis of gluconeogenic genes revealed that pck1, pck2, fbp1a, and g6pca were retained as singletons after Ss4r, while g6pcb1, g6pcb2, and fbp1b ohnolog pairs were maintained. For all genes, duplication may have led to sub- or neofunctionalization. Expression profiles suggest that the gluconeogenesis pathway remained active in trout fed a no-carbohydrate diet. When trout were fed a high-carbohydrate diet (30%), most of the gluconeogenic genes were non- or downregulated, except for g6pbc2 ohnologs, whose RNA levels were surprisingly increased. This study demonstrates that Ss4R in trout involved adaptive innovation via gene duplication and via the outcome of the resulting ohnologs. Indeed, maintenance of ohnologous g6pcb2 pair may contribute in a significant way to the glucose-intolerant phenotype of trout and may partially explain its poor use of dietary carbohydrates. Copyright © 2015 the American Physiological Society.

  10. Directed evolution induces tributyrin hydrolysis in a virulence factor of Xylella fastidiosa using a duplicated gene as a template.

    Science.gov (United States)

    Gouran, Hossein; Chakraborty, Sandeep; Rao, Basuthkar J; Asgeirsson, Bjarni; Dandekar, Abhaya

    2014-01-01

    Duplication of genes is one of the preferred ways for natural selection to add advantageous functionality to the genome without having to reinvent the wheel with respect to catalytic efficiency and protein stability. The duplicated secretory virulence factors of Xylella fastidiosa (LesA, LesB and LesC), implicated in Pierce's disease of grape and citrus variegated chlorosis of citrus species, epitomizes the positive selection pressures exerted on advantageous genes in such pathogens. A deeper insight into the evolution of these lipases/esterases is essential to develop resistance mechanisms in transgenic plants. Directed evolution, an attempt to accelerate the evolutionary steps in the laboratory, is inherently simple when targeted for loss of function. A bigger challenge is to specify mutations that endow a new function, such as a lost functionality in a duplicated gene. Previously, we have proposed a method for enumerating candidates for mutations intended to transfer the functionality of one protein into another related protein based on the spatial and electrostatic properties of the active site residues (DECAAF). In the current work, we present in vivo validation of DECAAF by inducing tributyrin hydrolysis in LesB based on the active site similarity to LesA. The structures of these proteins have been modeled using RaptorX based on the closely related LipA protein from Xanthomonas oryzae. These mutations replicate the spatial and electrostatic conformation of LesA in the modeled structure of the mutant LesB as well, providing in silico validation before proceeding to the laborious in vivo work. Such focused mutations allows one to dissect the relevance of the duplicated genes in finer detail as compared to gene knockouts, since they do not interfere with other moonlighting functions, protein expression levels or protein-protein interaction.

  11. Evolutionary history of glucose-6-phosphatase encoding genes in vertebrate lineages: towards a better understanding of the functions of multiple duplicates.

    Science.gov (United States)

    Marandel, Lucie; Panserat, Stéphane; Plagnes-Juan, Elisabeth; Arbenoits, Eva; Soengas, José Luis; Bobe, Julien

    2017-05-02

    Glucose-6-phosphate (G6pc) is a key enzyme involved in the regulation of the glucose homeostasis. The present study aims at revisiting and clarifying the evolutionary history of g6pc genes in vertebrates. g6pc duplications happened by successive rounds of whole genome duplication that occurred during vertebrate evolution. g6pc duplicated before or around Osteichthyes/Chondrichthyes radiation, giving rise to g6pca and g6pcb as a consequence of the second vertebrate whole genome duplication. g6pca was lost after this duplication in Sarcopterygii whereas both g6pca and g6pcb then duplicated as a consequence of the teleost-specific whole genome duplication. One g6pca duplicate was lost after this duplication in teleosts. Similarly one g6pcb2 duplicate was lost at least in the ancestor of percomorpha. The analysis of the evolution of spatial expression patterns of g6pc genes in vertebrates showed that all g6pc were mainly expressed in intestine and liver whereas teleost-specific g6pcb2 genes were mainly and surprisingly expressed in brain and heart. g6pcb2b, one gene previously hypothesised to be involved in the glucose intolerant phenotype in trout, was unexpectedly up-regulated (as it was in liver) by carbohydrates in trout telencephalon without showing significant changes in other brain regions. This up-regulation is in striking contrast with expected glucosensing mechanisms suggesting that its positive response to glucose relates to specific unknown processes in this brain area. Our results suggested that the fixation and the divergence of g6pc duplicated genes during vertebrates' evolution may lead to adaptive novelty and probably to the emergence of novel phenotypes related to glucose homeostasis.

  12. FGFR3 gene mutation plus GRB10 gene duplication in a patient with achondroplasia plus growth delay with prenatal onset.

    Science.gov (United States)

    Yuan, Haiming; Huang, Linhuan; Hu, Xizi; Li, Qian; Sun, Xiaofang; Xie, Yingjun; Kong, Shu; Wang, Xiaoman

    2016-07-02

    Achondroplasia is a well-defined and common bone dysplasia. Genotype- and phenotype-level correlations have been found between the clinical symptoms of achondroplasia and achondroplasia-specific FGFR3 mutations. A 2-year-old boy with clinical features consistent with achondroplasia and Silver-Russell syndrome-like symptoms was found to carry a mutation in the fibroblast growth factor receptor-3 (FGFR3) gene at c.1138G > A (p.Gly380Arg) and a de novo 574 kb duplication at chromosome 7p12.1 that involved the entire growth-factor receptor bound protein 10 (GRB10) gene. Using quantitative real-time PCR analysis, GRB10 was over-expressed, and, using enzyme-linked immunosorbent assays for IGF1 and IGF-binding protein-3 (IGFBP3), we found that IGF1 and IGFBP3 were low-expressed in this patient. We demonstrate that a combination of uncommon, rare and exceptional molecular defects related to the molecular bases of particular birth defects can be analyzed and diagnosed to potentially explain the observed variability in the combination of molecular defects.

  13. Teleost Fish-Specific Preferential Retention of Pigmentation Gene-Containing Families After Whole Genome Duplications in Vertebrates

    Science.gov (United States)

    Lorin, Thibault; Brunet, Frédéric G.; Laudet, Vincent; Volff, Jean-Nicolas

    2018-01-01

    Vertebrate pigmentation is a highly diverse trait mainly determined by neural crest cell derivatives. It has been suggested that two rounds (1R/2R) of whole-genome duplications (WGDs) at the basis of vertebrates allowed changes in gene regulation associated with neural crest evolution. Subsequently, the teleost fish lineage experienced other WGDs, including the teleost-specific Ts3R before teleost radiation and the more recent Ss4R at the basis of salmonids. As the teleost lineage harbors the highest number of pigment cell types and pigmentation diversity in vertebrates, WGDs might have contributed to the evolution and diversification of the pigmentation gene repertoire in teleosts. We have compared the impact of the basal vertebrate 1R/2R duplications with that of the teleost-specific Ts3R and salmonid-specific Ss4R WGDs on 181 gene families containing genes involved in pigmentation. We show that pigmentation genes (PGs) have been globally more frequently retained as duplicates than other genes after Ts3R and Ss4R but not after the early 1R/2R. This is also true for non-pigmentary paralogs of PGs, suggesting that the function in pigmentation is not the sole key driver of gene retention after WGDs. On the long-term, specific categories of PGs have been repeatedly preferentially retained after ancient 1R/2R and Ts3R WGDs, possibly linked to the molecular nature of their proteins (e.g., DNA binding transcriptional regulators) and their central position in protein-protein interaction networks. Taken together, our results support a major role of WGDs in the diversification of the pigmentation gene repertoire in the teleost lineage, with a possible link with the diversity of pigment cell lineages observed in these animals compared to other vertebrates. PMID:29599177

  14. The chimeric gene CHRFAM7A, a partial duplication of the CHRNA7 gene, is a dominant negative regulator of α7*nAChR function.

    Science.gov (United States)

    Araud, Tanguy; Graw, Sharon; Berger, Ralph; Lee, Michael; Neveu, Estele; Bertrand, Daniel; Leonard, Sherry

    2011-10-15

    The human α7 neuronal nicotinic acetylcholine receptor gene (CHRNA7) is a candidate gene for schizophrenia and an important drug target for cognitive deficits in the disorder. Activation of the α7*nAChR, results in opening of the channel and entry of mono- and divalent cations, including Ca(2+), that presynaptically participates to neurotransmitter release and postsynaptically to down-stream changes in gene expression. Schizophrenic patients have low levels of α7*nAChR, as measured by binding of the ligand [(125)I]-α-bungarotoxin (I-BTX). The structure of the gene, CHRNA7, is complex. During evolution, CHRNA7 was partially duplicated as a chimeric gene (CHRFAM7A), which is expressed in the human brain and elsewhere in the body. The association between a 2bp deletion in CHRFAM7A and schizophrenia suggested that this duplicate gene might contribute to cognitive impairment. To examine the putative contribution of CHRFAM7A on receptor function, co-expression of α7 and the duplicate genes was carried out in cell lines and Xenopus oocytes. Expression of the duplicate alone yielded protein expression but no functional receptor and co-expression with α7 caused a significant reduction of the amplitude of the ACh-evoked currents. Reduced current amplitude was not correlated with a reduction of I-BTX binding, suggesting the presence of non-functional (ACh-silent) receptors. This hypothesis is supported by a larger increase of the ACh-evoked current by the allosteric modulator 1-(5-chloro-2,4-dimethoxy-phenyl)-3-(5-methyl-isoxazol-3-yl)-urea (PNU-120596) in cells expressing the duplicate than in the control. These results suggest that CHRFAM7A acts as a dominant negative modulator of CHRNA7 function and is critical for receptor regulation in humans. Copyright © 2011 Elsevier Inc. All rights reserved.

  15. Comparative genomic analysis reveals occurrence of genetic recombination in virulent Cryptosporidium hominis subtypes and telomeric gene duplications in Cryptosporidium parvum.

    Science.gov (United States)

    Guo, Yaqiong; Tang, Kevin; Rowe, Lori A; Li, Na; Roellig, Dawn M; Knipe, Kristine; Frace, Michael; Yang, Chunfu; Feng, Yaoyu; Xiao, Lihua

    2015-04-18

    Cryptosporidium hominis is a dominant species for human cryptosporidiosis. Within the species, IbA10G2 is the most virulent subtype responsible for all C. hominis-associated outbreaks in Europe and Australia, and is a dominant outbreak subtype in the United States. In recent yearsIaA28R4 is becoming a major new subtype in the United States. In this study, we sequenced the genomes of two field specimens from each of the two subtypes and conducted a comparative genomic analysis of the obtained sequences with those from the only fully sequenced Cryptosporidium parvum genome. Altogether, 8.59-9.05 Mb of Cryptosporidium sequences in 45-767 assembled contigs were obtained from the four specimens, representing 94.36-99.47% coverage of the expected genome. These genomes had complete synteny in gene organization and 96.86-97.0% and 99.72-99.83% nucleotide sequence similarities to the published genomes of C. parvum and C. hominis, respectively. Several major insertions and deletions were seen between C. hominis and C. parvum genomes, involving mostly members of multicopy gene families near telomeres. The four C. hominis genomes were highly similar to each other and divergent from the reference IaA25R3 genome in some highly polymorphic regions. Major sequence differences among the four specimens sequenced in this study were in the 5' and 3' ends of chromosome 6 and the gp60 region, largely the result of genetic recombination. The sequence similarity among specimens of the two dominant outbreak subtypes and genetic recombination in chromosome 6, especially around the putative virulence determinant gp60 region, suggest that genetic recombination plays a potential role in the emergence of hyper-transmissible C. hominis subtypes. The high sequence conservation between C. parvum and C. hominis genomes and significant differences in copy numbers of MEDLE family secreted proteins and insulinase-like proteases indicate that telomeric gene duplications could potentially contribute to

  16. Positive selection and ancient duplications in the evolution of class B floral homeotic genes of orchids and grasses

    Directory of Open Access Journals (Sweden)

    Koch Marcus A

    2009-04-01

    Full Text Available Abstract Background Positive selection is recognized as the prevalence of nonsynonymous over synonymous substitutions in a gene. Models of the functional evolution of duplicated genes consider neofunctionalization as key to the retention of paralogues. For instance, duplicate transcription factors are specifically retained in plant and animal genomes and both positive selection and transcriptional divergence appear to have played a role in their diversification. However, the relative impact of these two factors has not been systematically evaluated. Class B MADS-box genes, comprising DEF-like and GLO-like genes, encode developmental transcription factors essential for establishment of perianth and male organ identity in the flowers of angiosperms. Here, we contrast the role of positive selection and the known divergence in expression patterns of genes encoding class B-like MADS-box transcription factors from monocots, with emphasis on the family Orchidaceae and the order Poales. Although in the monocots these two groups are highly diverse and have a strongly canalized floral morphology, there is no information on the role of positive selection in the evolution of their distinctive flower morphologies. Published research shows that in Poales, class B-like genes are expressed in stamens and in lodicules, the perianth organs whose identity might also be specified by class B-like genes, like the identity of the inner tepals of their lily-like relatives. In orchids, however, the number and pattern of expression of class B-like genes have greatly diverged. Results The DEF-like genes from Orchidaceae form four well-supported, ancient clades of orthologues. In contrast, orchid GLO-like genes form a single clade of ancient orthologues and recent paralogues. DEF-like genes from orchid clade 2 (OMADS3-like genes are under less stringent purifying selection than the other orchid DEF-like and GLO-like genes. In comparison with orchids, purifying selection

  17. Rapid genome reshaping by multiple-gene loss after whole-genome duplication in teleost fish suggested by mathematical modeling

    Science.gov (United States)

    Sato, Yukuto; Tsukamoto, Katsumi; Nishida, Mutsumi

    2015-01-01

    Whole-genome duplication (WGD) is believed to be a significant source of major evolutionary innovation. Redundant genes resulting from WGD are thought to be lost or acquire new functions. However, the rates of gene loss and thus temporal process of genome reshaping after WGD remain unclear. The WGD shared by all teleost fish, one-half of all jawed vertebrates, was more recent than the two ancient WGDs that occurred before the origin of jawed vertebrates, and thus lends itself to analysis of gene loss and genome reshaping. Using a newly developed orthology identification pipeline, we inferred the post–teleost-specific WGD evolutionary histories of 6,892 protein-coding genes from nine phylogenetically representative teleost genomes on a time-calibrated tree. We found that rapid gene loss did occur in the first 60 My, with a loss of more than 70–80% of duplicated genes, and produced similar genomic gene arrangements within teleosts in that relatively short time. Mathematical modeling suggests that rapid gene loss occurred mainly by events involving simultaneous loss of multiple genes. We found that the subsequent 250 My were characterized by slow and steady loss of individual genes. Our pipeline also identified about 1,100 shared single-copy genes that are inferred to have become singletons before the divergence of clupeocephalan teleosts. Therefore, our comparative genome analysis suggests that rapid gene loss just after the WGD reshaped teleost genomes before the major divergence, and provides a useful set of marker genes for future phylogenetic analysis. PMID:26578810

  18. Exploiting a Reference Genome in Terms of Duplications: The Network of Paralogs and Single Copy Genes in Arabidopsis thaliana

    Directory of Open Access Journals (Sweden)

    Mara Sangiovanni

    2013-12-01

    Full Text Available Arabidopsis thaliana became the model organism for plant studies because of its small diploid genome, rapid lifecycle and short adult size. Its genome was the first among plants to be sequenced, becoming the reference in plant genomics. However, the Arabidopsis genome is characterized by an inherently complex organization, since it has undergone ancient whole genome duplications, followed by gene reduction, diploidization events and extended rearrangements, which relocated and split up the retained portions. These events, together with probable chromosome reductions, dramatically increased the genome complexity, limiting its role as a reference. The identification of paralogs and single copy genes within a highly duplicated genome is a prerequisite to understand its organization and evolution and to improve its exploitation in comparative genomics. This is still controversial, even in the widely studied Arabidopsis genome. This is also due to the lack of a reference bioinformatics pipeline that could exhaustively identify paralogs and singleton genes. We describe here a complete computational strategy to detect both duplicated and single copy genes in a genome, discussing all the methodological issues that may strongly affect the results, their quality and their reliability. This approach was used to analyze the organization of Arabidopsis nuclear protein coding genes, and besides classifying computationally defined paralogs into networks and single copy genes into different classes, it unraveled further intriguing aspects concerning the genome annotation and the gene relationships in this reference plant species. Since our results may be useful for comparative genomics and genome functional analyses, we organized a dedicated web interface to make them accessible to the scientific community.

  19. An ancient history of gene duplications, fusions and losses in the evolution of APOBEC3 mutators in mammals

    Science.gov (United States)

    2012-01-01

    Background The APOBEC3 (A3) genes play a key role in innate antiviral defense in mammals by introducing directed mutations in the DNA. The human genome encodes for seven A3 genes, with multiple splice alternatives. Different A3 proteins display different substrate specificity, but the very basic question on how discerning self from non-self still remains unresolved. Further, the expression of A3 activity/ies shapes the way both viral and host genomes evolve. Results We present here a detailed temporal analysis of the origin and expansion of the A3 repertoire in mammals. Our data support an evolutionary scenario where the genome of the mammalian ancestor encoded for at least one ancestral A3 gene, and where the genome of the ancestor of placental mammals (and possibly of the ancestor of all mammals) already encoded for an A3Z1-A3Z2-A3Z3 arrangement. Duplication events of the A3 genes have occurred independently in different lineages: humans, cats and horses. In all of them, gene duplication has resulted in changes in enzyme activity and/or substrate specificity, in a paradigmatic example of convergent adaptive evolution at the genomic level. Finally, our results show that evolutionary rates for the three A3Z1, A3Z2 and A3Z3 motifs have significantly decreased in the last 100 Mya. The analysis constitutes a textbook example of the evolution of a gene locus by duplication and sub/neofunctionalization in the context of virus-host arms race. Conclusions Our results provide a time framework for identifying ancestral and derived genomic arrangements in the APOBEC loci, and to date the expansion of this gene family for different lineages through time, as a response to changes in viral/retroviral/retrotransposon pressure. PMID:22640020

  20. The constancy of gene conservation across divergent bacterial orders

    Directory of Open Access Journals (Sweden)

    Ackermann Martin

    2009-01-01

    Full Text Available Abstract Background Orthologous genes are frequently presumed to perform similar functions. However, outside of model organisms, this is rarely tested. One means of inferring changes in function is if there are changes in the level of gene conservation and selective constraint. Here we compare levels of gene conservation across three bacterial groups to test for changes in gene functionality. Findings The level of gene conservation for different orthologous genes is highly correlated across clades, even for highly divergent groups of bacteria. These correlations do not arise from broad differences in gene functionality (e.g. informational genes vs. metabolic genes, but instead seem to result from very specific differences in gene function. Furthermore, these functional differences appear to be maintained over very long periods of time. Conclusion These results suggest that even over broad time scales, most bacterial genes are under a nearly constant level of purifying selection, and that bacterial evolution is thus dominated by selective and functional stasis.

  1. Duplication and Loss of Function of Genes Encoding RNA Polymerase III Subunit C4 Causes Hybrid Incompatibility in Rice

    Directory of Open Access Journals (Sweden)

    Giao Ngoc Nguyen

    2017-08-01

    Full Text Available Reproductive barriers are commonly observed in both animals and plants, in which they maintain species integrity and contribute to speciation. This report shows that a combination of loss-of-function alleles at two duplicated loci, DUPLICATED GAMETOPHYTIC STERILITY 1 (DGS1 on chromosome 4 and DGS2 on chromosome 7, causes pollen sterility in hybrid progeny derived from an interspecific cross between cultivated rice, Oryza sativa, and an Asian annual wild rice, O. nivara. Male gametes carrying the DGS1 allele from O. nivara (DGS1-nivaras and the DGS2 allele from O. sativa (DGS2-T65s were sterile, but female gametes carrying the same genotype were fertile. We isolated the causal gene, which encodes a protein homologous to DNA-dependent RNA polymerase (RNAP III subunit C4 (RPC4. RPC4 facilitates the transcription of 5S rRNAs and tRNAs. The loss-of-function alleles at DGS1-nivaras and DGS2-T65s were caused by weak or nonexpression of RPC4 and an absence of RPC4, respectively. Phylogenetic analysis demonstrated that gene duplication of RPC4 at DGS1 and DGS2 was a recent event that occurred after divergence of the ancestral population of Oryza from other Poaceae or during diversification of AA-genome species.

  2. Conservation of the abscission signaling peptide IDA during Angiosperm evolution: withstanding genome duplications and gain and loss of the receptors HAE/HSL2

    Directory of Open Access Journals (Sweden)

    Ida M. Stø

    2015-10-01

    Full Text Available The peptide INFLORESCENCE DEFICIENT IN ABSCISSION (IDA, which signals through the leucine-rich repeat receptor-like kinases HAESA (HAE and HAESA-LIKE2 (HSL2, controls different cell separation events in Arabidopsis thaliana. We hypothesize the involvement of this signaling module in abscission processes in other plant species even though they may shed other organs than A. thaliana. As the first step towards testing this hypothesis from an evolutionarily perspective we have identified genes encoding putative orthologues of IDA and its receptors by BLAST searches of publically available protein, nucleotide and genome databases for angiosperms. Genes encoding IDA or IDA-LIKE (IDL peptides and HSL proteins were found in all investigated species, which were selected as to represent each angiosperm order with available genomic sequences. The 12 amino acids representing the bioactive peptide in A. thaliana have virtually been unchanged throughout the evolution of the angiosperms; however, the number of IDL and HSL genes varies between different orders and species. The phylogenetic analyses suggest that IDA, HSL2 and the related HSL1 gene, were present in the species that gave rise to the angiosperms. HAE has arisen from HSL1 after a genome duplication that took place after the monocot - eudicots split. HSL1 has also independently been duplicated in the monocots, while HSL2 has been lost in gingers (Zingiberales and grasses (Poales. IDA has been duplicated in eudicots to give rise to functionally divergent IDL peptides. We postulate that the high number of IDL homologs present in the core eudicots is a result of multiple whole genome duplications. We substantiate the involvement of IDA and HAE/HSL2 homologs in abscission by providing gene expression data of different organ separation events from various species.

  3. Gene duplications and losses among vertebrate deoxyribonucleoside kinases of the non-TK1 Family

    DEFF Research Database (Denmark)

    Mutahir, Zeeshan; Christiansen, Louise Slot; Clausen, Anders R.

    2016-01-01

    , among vertebrates only four mammalian dNKs have been studied for their substrate specificity and kinetic properties. However, some vertebrates, such as fish, frogs, and birds, apparently possess a duplicated homolog of deoxycytidine kinase (dCK). In this study, we characterized a family of d...... substrate specificities and subcellular localization are likely the drivers behind the evolution of vertebrate dNKs...

  4. Divergence of the bZIP Gene Family in Strawberry, Peach, and Apple Suggests Multiple Modes of Gene Evolution after Duplication

    Directory of Open Access Journals (Sweden)

    Xiao-Long Wang

    2015-01-01

    Full Text Available The basic leucine zipper (bZIP transcription factors are the most diverse members of dimerizing transcription factors. In the present study, 50, 116, and 47 bZIP genes were identified in Malus domestica (apple, Prunus persica (peach, and Fragaria vesca (strawberry, respectively. Species-specific duplication was the main contributor to the large number of bZIPs observed in apple. After WGD in apple genome, orthologous bZIP genes corresponding to strawberry on duplicated regions in apple genome were retained. However, in peach ancestor, these syntenic regions were quickly lost or deleted. Maybe the positive selection contributed to the expansion of clade S to adapt to the development and environment stresses. In addition, purifying selection was mainly responsible for bZIP sequence-specific DNA binding. The analysis of orthologous pairs between chromosomes indicates that these orthologs derived from one gene duplication located on one of the nine ancient chromosomes in the Rosaceae. The comparative analysis of bZIP genes in three species provides information on the evolutionary fate of bZIP genes in apple and peach after they diverged from strawberry.

  5. An ancient duplication of exon 5 in the Snap25 gene is required for complex neuronal development/function.

    Directory of Open Access Journals (Sweden)

    Jenny U Johansson

    2008-11-01

    Full Text Available Alternative splicing is an evolutionary innovation to create functionally diverse proteins from a limited number of genes. SNAP-25 plays a central role in neuroexocytosis by bridging synaptic vesicles to the plasma membrane during regulated exocytosis. The SNAP-25 polypeptide is encoded by a single copy gene, but in higher vertebrates a duplication of exon 5 has resulted in two mutually exclusive splice variants, SNAP-25a and SNAP-25b. To address a potential physiological difference between the two SNAP-25 proteins, we generated gene targeted SNAP-25b deficient mouse mutants by replacing the SNAP-25b specific exon with a second SNAP-25a equivalent. Elimination of SNAP-25b expression resulted in developmental defects, spontaneous seizures, and impaired short-term synaptic plasticity. In adult mutants, morphological changes in hippocampus and drastically altered neuropeptide expression were accompanied by severe impairment of spatial learning. We conclude that the ancient exon duplication in the Snap25 gene provides additional SNAP-25-function required for complex neuronal processes in higher eukaryotes.

  6. Functional conservation of the Drosophila gooseberry gene and its evolutionary alleles.

    Directory of Open Access Journals (Sweden)

    Wei Liu

    Full Text Available The Drosophila Pax gene gooseberry (gsb is required for development of the larval cuticle and CNS, survival to adulthood, and male fertility. These functions can be rescued in gsb mutants by two gsb evolutionary alleles, gsb-Prd and gsb-Pax3, which express the Drosophila Paired and mouse Pax3 proteins under the control of gooseberry cis-regulatory region. Therefore, both Paired and Pax3 proteins have conserved all the Gsb functions that are required for survival of embryos to fertile adults, despite the divergent primary sequences in their C-terminal halves. As gsb-Prd and gsb-Pax3 uncover a gsb function involved in male fertility, construction of evolutionary alleles may provide a powerful strategy to dissect hitherto unknown gene functions. Our results provide further evidence for the essential role of cis-regulatory regions in the functional diversification of duplicated genes during evolution.

  7. A new resource for characterizing X-linked genes in Drosophila melanogaster: systematic coverage and subdivision of the X chromosome with nested, Y-linked duplications.

    Science.gov (United States)

    Cook, R Kimberley; Deal, Megan E; Deal, Jennifer A; Garton, Russell D; Brown, C Adam; Ward, Megan E; Andrade, Rachel S; Spana, Eric P; Kaufman, Thomas C; Cook, Kevin R

    2010-12-01

    Interchromosomal duplications are especially important for the study of X-linked genes. Males inheriting a mutation in a vital X-linked gene cannot survive unless there is a wild-type copy of the gene duplicated elsewhere in the genome. Rescuing the lethality of an X-linked mutation with a duplication allows the mutation to be used experimentally in complementation tests and other genetic crosses and it maps the mutated gene to a defined chromosomal region. Duplications can also be used to screen for dosage-dependent enhancers and suppressors of mutant phenotypes as a way to identify genes involved in the same biological process. We describe an ongoing project in Drosophila melanogaster to generate comprehensive coverage and extensive breakpoint subdivision of the X chromosome with megabase-scale X segments borne on Y chromosomes. The in vivo method involves the creation of X inversions on attached-XY chromosomes by FLP-FRT site-specific recombination technology followed by irradiation to induce large internal X deletions. The resulting chromosomes consist of the X tip, a medial X segment placed near the tip by an inversion, and a full Y. A nested set of medial duplicated segments is derived from each inversion precursor. We have constructed a set of inversions on attached-XY chromosomes that enable us to isolate nested duplicated segments from all X regions. To date, our screens have provided a minimum of 78% X coverage with duplication breakpoints spaced a median of nine genes apart. These duplication chromosomes will be valuable resources for rescuing and mapping X-linked mutations and identifying dosage-dependent modifiers of mutant phenotypes.

  8. Dissecting a Hidden Gene Duplication: The Arabidopsis thaliana SEC10 Locus

    Czech Academy of Sciences Publication Activity Database

    Vukašinović, Nemanja; Cvrčková, F.; Eliáš, M.; Cole, R.; Fowler, J.E.; Žárský, Viktor; Synek, Lukáš

    2014-01-01

    Roč. 9, č. 4 (2014) E-ISSN 1932-6203 R&D Projects: GA ČR GPP501/11/P853; GA ČR(CZ) GAP305/11/1629 Grant - others:GA MŠk ME10033 Institutional support: RVO:61389030 Keywords : WHOLE-GENOME * ARABIDOPSIS-THALIANA * RECENT SEGMENTAL DUPLICATIONS Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 3.234, year: 2014

  9. RANGER-DTL 2.0: Rigorous Reconstruction of Gene-Family Evolution by Duplication, Transfer, and Loss.

    Science.gov (United States)

    Bansal, Mukul S; Kellis, Manolis; Kordi, Misagh; Kundu, Soumya

    2018-04-24

    RANGER-DTL 2.0 is a software program for inferring gene family evolution using Duplication-Transfer-Loss reconciliation. This new software is highly scalable and easy to use, and offers many new features not currently available in any other reconciliation program. RANGER-DTL 2.0 has a particular focus on reconciliation accuracy and can account for many sources of reconciliation uncertainty including uncertain gene tree rooting, gene tree topological uncertainty, multiple optimal reconciliations, and alternative event cost assignments. RANGER-DTL 2.0 is open-source and written in C ++ and Python. Pre-compiled executables, source code (open-source under GNU GPL), and a detailed manual are freely available from http://compbio.engr.uconn.edu/software/RANGER-DTL/. mukul.bansal@uconn.edu.

  10. Selection shaped the evolution of mouse androgen-binding protein (ABP) function and promoted the duplication of Abp genes.

    Science.gov (United States)

    Karn, Robert C; Laukaitis, Christina M

    2014-08-01

    In the present article, we summarize two aspects of our work on mouse ABP (androgen-binding protein): (i) the sexual selection function producing incipient reinforcement on the European house mouse hybrid zone, and (ii) the mechanism behind the dramatic expansion of the Abp gene region in the mouse genome. Selection unifies these two components, although the ways in which selection has acted differ. At the functional level, strong positive selection has acted on key sites on the surface of one face of the ABP dimer, possibly to influence binding to a receptor. A different kind of selection has apparently driven the recent and rapid expansion of the gene region, probably by increasing the amount of Abp transcript, in one or both of two ways. We have shown previously that groups of Abp genes behave as LCRs (low-copy repeats), duplicating as relatively large blocks of genes by NAHR (non-allelic homologous recombination). The second type of selection involves the close link between the accumulation of L1 elements and the expansion of the Abp gene family by NAHR. It is probably predicated on an initial selection for increased transcription of existing Abp genes and/or an increase in Abp gene number providing more transcriptional sites. Either or both could increase initial transcript production, a quantitative change similar to increasing the volume of a radio transmission. In closing, we also provide a note on Abp gene nomenclature.

  11. Identification of a rare 17p13.3 duplication including the BHLHA9 and YWHAE genes in a family with developmental delay and behavioural problems

    Directory of Open Access Journals (Sweden)

    Capra Valeria

    2012-10-01

    Full Text Available Abstract Background Deletions and duplications of the PAFAH1B1 and YWHAE genes in 17p13.3 are associated with different clinical phenotypes. In particular, deletion of PAFAH1B1 causes isolated lissencephaly while deletions involving both PAFAH1B1 and YWHAE cause Miller-Dieker syndrome. Isolated duplications of PAFAH1B1 have been associated with mild developmental delay and hypotonia, while isolated duplications of YWHAE have been associated with autism. In particular, different dysmorphic features associated with PAFAH1B1 or YWHAE duplication have suggested the need to classify the patient clinical features in two groups according to which gene is involved in the chromosomal duplication. Methods We analyze the proband and his family by classical cytogenetic and array-CGH analyses. The putative rearrangement was confirmed by fluorescence in situ hybridization. Results We have identified a family segregating a 17p13.3 duplication extending 329.5 kilobases by FISH and array-CGH involving the YWHAE gene, but not PAFAH1B1, affected by a mild dysmorphic phenotype with associated autism and mental retardation. We propose that BHLHA9, YWHAE, and CRK genes contribute to the phenotype of our patient. The small chromosomal duplication was inherited from his mother who was affected by a bipolar and borderline disorder and was alcohol addicted. Conclusions We report an additional familial case of small 17p13.3 chromosomal duplication including only BHLHA9, YWHAE, and CRK genes. Our observation and further cases with similar microduplications are expected to be diagnosed, and will help better characterise the clinical spectrum of phenotypes associated with 17p13.3 microduplications.

  12. Gene Duplication of the zebrafish kit ligand and partitioning of melanocyte development functions to kit ligand a.

    Directory of Open Access Journals (Sweden)

    Keith A Hultman

    2007-01-01

    Full Text Available The retention of particular genes after the whole genome duplication in zebrafish has given insights into how genes may evolve through partitioning of ancestral functions. We examine the partitioning of expression patterns and functions of two zebrafish kit ligands, kit ligand a (kitla and kit ligand b (kitlb, and discuss their possible coevolution with the duplicated zebrafish kit receptors (kita and kitb. In situ hybridizations show that kitla mRNA is expressed in the trunk adjacent to the notochord in the middle of each somite during stages of melanocyte migration and later expressed in the skin, when the receptor is required for melanocyte survival. kitla is also expressed in other regions complementary to kita receptor expression, including the pineal gland, tail bud, and ear. In contrast, kitlb mRNA is expressed in brain ventricles, ear, and cardinal vein plexus, in regions generally not complementary to either zebrafish kit receptor ortholog. However, like kitla, kitlb is expressed in the skin during stages consistent with melanocyte survival. Thus, it appears that kita and kitla have maintained congruent expression patterns, while kitb and kitlb have evolved divergent expression patterns. We demonstrate the interaction of kita and kitla by morpholino knockdown analysis. kitla morphants, but not kitlb morphants, phenocopy the null allele of kita, with defects for both melanocyte migration and survival. Furthermore, kitla morpholino, but not kitlb morpholino, interacts genetically with a sensitized allele of kita, confirming that kitla is the functional ligand to kita. Last, we examine kitla overexpression in embryos, which results in hyperpigmentation caused by an increase in the number and size of melanocytes. This hyperpigmentation is dependent on kita function. We conclude that following genome duplication, kita and kitla have maintained their receptor-ligand relationship, coevolved complementary expression patterns, and that

  13. Duplication and independent selection of cell-wall invertase genes GIF1 and OsCIN1 during rice evolution and domestication

    Directory of Open Access Journals (Sweden)

    Ge Song

    2010-04-01

    Full Text Available Abstract Background Various evolutionary models have been proposed to interpret the fate of paralogous duplicates, which provides substrates on which evolution selection could act. In particular, domestication, as a special selection, has played important role in crop cultivation with divergence of many genes controlling important agronomic traits. Recent studies have indicated that a pair of duplicate genes was often sub-functionalized from their ancestral functions held by the parental genes. We previously demonstrated that the rice cell-wall invertase (CWI gene GIF1 that plays an important role in the grain-filling process was most likely subjected to domestication selection in the promoter region. Here, we report that GIF1 and another CWI gene OsCIN1 constitute a pair of duplicate genes with differentiated expression and function through independent selection. Results Through synteny analysis, we show that GIF1 and another cell-wall invertase gene OsCIN1 were paralogues derived from a segmental duplication originated during genome duplication of grasses. Results based on analyses of population genetics and gene phylogenetic tree of 25 cultivars and 25 wild rice sequences demonstrated that OsCIN1 was also artificially selected during rice domestication with a fixed mutation in the coding region, in contrast to GIF1 that was selected in the promoter region. GIF1 and OsCIN1 have evolved into different expression patterns and probable different kinetics parameters of enzymatic activity with the latter displaying less enzymatic activity. Overexpression of GIF1 and OsCIN1 also resulted in different phenotypes, suggesting that OsCIN1 might regulate other unrecognized biological process. Conclusion How gene duplication and divergence contribute to genetic novelty and morphological adaptation has been an interesting issue to geneticists and biologists. Our discovery that the duplicated pair of GIF1 and OsCIN1 has experienced sub

  14. Balanced gene losses, duplications and intensive rearrangements led to an unusual regularly sized genome in Arbutus unedo chloroplasts.

    Science.gov (United States)

    Martínez-Alberola, Fernando; Del Campo, Eva M; Lázaro-Gimeno, David; Mezquita-Claramonte, Sergio; Molins, Arantxa; Mateu-Andrés, Isabel; Pedrola-Monfort, Joan; Casano, Leonardo M; Barreno, Eva

    2013-01-01

    Completely sequenced plastomes provide a valuable source of information about the duplication, loss, and transfer events of chloroplast genes and phylogenetic data for resolving relationships among major groups of plants. Moreover, they can also be useful for exploiting chloroplast genetic engineering technology. Ericales account for approximately six per cent of eudicot diversity with 11,545 species from which only three complete plastome sequences are currently available. With the aim of increasing the number of ericalean complete plastome sequences, and to open new perspectives in understanding Mediterranean plant adaptations, a genomic study on the basis of the complete chloroplast genome sequencing of Arbutus unedo and an updated phylogenomic analysis of Asteridae was implemented. The chloroplast genome of A. unedo shows extensive rearrangements but a medium size (150,897 nt) in comparison to most of angiosperms. A number of remarkable distinct features characterize the plastome of A. unedo: five-fold dismissing of the SSC region in relation to most angiosperms; complete loss or pseudogenization of a number of essential genes; duplication of the ndhH-D operon and its location within the two IRs; presence of large tandem repeats located near highly re-arranged regions and pseudogenes. All these features outline the primary evolutionary split between Ericaceae and other ericalean families. The newly sequenced plastome of A. unedo with the available asterid sequences allowed the resolution of some uncertainties in previous phylogenies of Asteridae.

  15. Balanced gene losses, duplications and intensive rearrangements led to an unusual regularly sized genome in Arbutus unedo chloroplasts.

    Directory of Open Access Journals (Sweden)

    Fernando Martínez-Alberola

    Full Text Available Completely sequenced plastomes provide a valuable source of information about the duplication, loss, and transfer events of chloroplast genes and phylogenetic data for resolving relationships among major groups of plants. Moreover, they can also be useful for exploiting chloroplast genetic engineering technology. Ericales account for approximately six per cent of eudicot diversity with 11,545 species from which only three complete plastome sequences are currently available. With the aim of increasing the number of ericalean complete plastome sequences, and to open new perspectives in understanding Mediterranean plant adaptations, a genomic study on the basis of the complete chloroplast genome sequencing of Arbutus unedo and an updated phylogenomic analysis of Asteridae was implemented. The chloroplast genome of A. unedo shows extensive rearrangements but a medium size (150,897 nt in comparison to most of angiosperms. A number of remarkable distinct features characterize the plastome of A. unedo: five-fold dismissing of the SSC region in relation to most angiosperms; complete loss or pseudogenization of a number of essential genes; duplication of the ndhH-D operon and its location within the two IRs; presence of large tandem repeats located near highly re-arranged regions and pseudogenes. All these features outline the primary evolutionary split between Ericaceae and other ericalean families. The newly sequenced plastome of A. unedo with the available asterid sequences allowed the resolution of some uncertainties in previous phylogenies of Asteridae.

  16. Discrimination of Deletion and Duplication Subtypes of the Deleted in Azoospermia Gene Family in the Context of Frequent Interloci Gene Conversion

    Science.gov (United States)

    Vaszkó, Tibor; Papp, János; Krausz, Csilla; Casamonti, Elena; Géczi, Lajos; Olah, Edith

    2016-01-01

    Due to its palindromic setup, AZFc (Azoospermia Factor c) region of chromosome Y is one of the most unstable regions of the human genome. It contains eight gene families expressed mainly in the testes. Several types of rearrangement resulting in changes in the cumulative copy number of the gene families were reported to be associated with diseases such as male infertility and testicular germ cell tumors. The best studied AZFc rearrangement is gr/gr deletion. Its carriers show widespread phenotypic variation from azoospermia to normospermia. This phenomenon was initially attributed to different gr/gr subtypes that would eliminate distinct members of the affected gene families. However, studies conducted to confirm this hypothesis have brought controversial results, perhaps, in part, due to the shortcomings of the utilized subtyping methodology. This proof-of-concept paper is meant to introduce here a novel method aimed at subtyping AZFc rearrangements. It is able to differentiate the partial deletion and partial duplication subtypes of the Deleted in Azoospermia (DAZ) gene family. The keystone of the method is the determination of the copy number of the gene family member-specific variant(s) in a series of sequence family variant (SFV) positions. Most importantly, we present a novel approach for the correct interpretation of the variant copy number data to determine the copy number of the individual DAZ family members in the context of frequent interloci gene conversion.Besides DAZ1/DAZ2 and DAZ3/DAZ4 deletions, not yet described rearrangements such as DAZ2/DAZ4 deletion and three duplication subtypes were also found by the utilization of the novel approach. A striking feature is the extremely high concordance among the individual data pointing to a certain type of rearrangement. In addition to being able to identify DAZ deletion subtypes more reliably than the methods used previously, this approach is the first that can discriminate DAZ duplication subtypes as well

  17. A case report: Becker muscular dystrophy presenting with epilepsy and dysgnosia induced by duplication mutation of Dystrophin gene.

    Science.gov (United States)

    Miao, Jing; Feng, Jia-Chun; Zhu, Dan; Yu, Xue-Fan

    2016-12-12

    Becker muscular dystrophy (BMD), a genetic disorder of X-linked recessive inheritance, typically presents with gradually progressive muscle weakness. The condition is caused by mutations of Dystrophin gene located at Xp21.2. Epilepsy is an infrequent manifestation of BMD, while cases of BMD with dysgnosia are extremely rare. We describe a 9-year-old boy with BMD, who presented with epilepsy and dysgnosia. Serum creatine kinase level was markedly elevated (3665 U/L). Wechsler intelligence tests showed a low intelligence quotient (IQ = 65). Electromyogram showed slight myogenic changes and skeletal muscle biopsy revealed muscular dystrophy. Immunohistochemical staining showed partial positivity of sarcolemma for dystrophin-N. Multiplex ligation-dependent probe amplification revealed a duplication mutation in exons 37-44 in the Dystrophin gene. The present case report helps to better understand the clinical and genetic features of BMD.

  18. A case report of two male siblings with autism and duplication of Xq13-q21, a region including three genes predisposing for autism.

    Science.gov (United States)

    Wentz, Elisabet; Vujic, Mihailo; Kärrstedt, Ewa-Lotta; Erlandsson, Anna; Gillberg, Christopher

    2014-05-01

    Autism spectrum disorder, severe behaviour problems and duplication of the Xq12 to Xq13 region have recently been described in three male relatives. To describe the psychiatric comorbidity and dysmorphic features, including craniosynostosis, of two male siblings with autism and duplication of the Xq13 to Xq21 region, and attempt to narrow down the number of duplicated genes proposed to be leading to global developmental delay and autism. We performed DNA sequencing of certain exons of the TWIST1 gene, the FGFR2 gene and the FGFR3 gene. We also performed microarray analysis of the DNA. In addition to autism, the two male siblings exhibited severe learning disability, self-injurious behaviour, temper tantrums and hyperactivity, and had no communicative language. Chromosomal analyses were normal. Neither of the two siblings showed mutations of the sequenced exons known to produce craniosynostosis. The microarray analysis detected an extra copy of a region on the long arm of chromosome X, chromosome band Xq13.1-q21.1. Comparison of our two cases with previously described patients allowed us to identify three genes predisposing for autism in the duplicated chromosomal region. Sagittal craniosynostosis is also a new finding linked to the duplication.

  19. Deletion/duplication mutation screening of TP53 gene in patients with transitional cell carcinoma of urinary bladder using multiplex ligation-dependent probe amplification.

    Science.gov (United States)

    Bazrafshani, Mohammad Reza R; Nowshadi, Pouriaali A; Shirian, Sadegh; Daneshbod, Yahya; Nabipour, Fatemeh; Mokhtari, Maral; Hosseini, Fatemehsadat; Dehghan, Somayeh; Saeedzadeh, Abolfazl; Mosayebi, Ziba

    2016-02-01

    Bladder cancer is a molecular disease driven by the accumulation of genetic, epigenetic, and environmental factors. The aim of this study was to detect the deletions/duplication mutations in TP53 gene exons using multiplex ligation-dependent probe amplification (MLPA) method in the patients with transitional cell carcinoma (TCC). The achieved formalin-fixed paraffin-embedded tissues from 60 patients with TCC of bladder were screened for exonal deletions or duplications of every 12 TP53 gene exons using MLPA. The pathological sections were examined by three pathologists and categorized according to the WHO scoring guideline as 18 (30%) grade I, 22 (37%) grade II, 13 (22%) grade III, and 7 (11%) grade IV cases of TCC. None mutation changes of TP53 gene were detected in 24 (40%) of the patients. Furthermore, mutation changes including, 15 (25%) deletion, 17 (28%) duplication, and 4 (7%) both deletion and duplication cases were observed among 60 samples. From 12 exons of TP53 gene, exon 1 was more subjected to exonal deletion. Deletion of exon 1 of TP53 gene has occurred in 11 (35.4%) patients with TCC. In general, most mutations of TP53, either deletion or duplication, were found in exon 1, which was statistically significant. In addition, no relation between the TCC tumor grade and any type of mutation were observed in this research. MLPA is a simple and efficient method to analyze genomic deletions and duplications of all 12 exons of TP53 gene. The finding of this report that most of the mutations of TP53 occur in exon 1 is in contrast to that of the other reports suggesting that exons 5-8 are the most (frequently) mutated exons of TP53 gene. The mutations of exon 1 of TP53 gene may play an important role in the tumorogenesis of TCC. © 2015 The Authors. Cancer Medicine published by John Wiley & Sons Ltd.

  20. Unusual conservation of mitochondrial gene order in Crassostrea oysters: evidence for recent speciation in Asia

    Science.gov (United States)

    2010-01-01

    Background Oysters are morphologically plastic and hence difficult subjects for taxonomic and evolutionary studies. It is long been suspected, based on the extraordinary species diversity observed, that Asia Pacific is the epicenter of oyster speciation. To understand the species diversity and its evolutionary history, we collected five Crassostrea species from Asia and sequenced their complete mitochondrial (mt) genomes in addition to two newly released Asian oysters (C. iredalei and Saccostrea mordax) for a comprehensive analysis. Results The six Asian Crassostrea mt genomes ranged from 18,226 to 22,446 bp in size, and all coded for 39 genes (12 proteins, 2 rRNAs and 25 tRNAs) on the same strand. Their genomes contained a split of the rrnL gene and duplication of trnM, trnK and trnQ genes. They shared the same gene order that differed from an Atlantic sister species by as many as nine tRNA changes (6 transpositions and 3 duplications) and even differed significantly from S. mordax in protein-coding genes. Phylogenetic analysis indicates that the six Asian Crassostrea species emerged between 3 and 43 Myr ago, while the Atlantic species evolved 83 Myr ago. Conclusions The complete conservation of gene order in the six Asian Crassostrea species over 43 Myr is highly unusual given the remarkable rate of rearrangements in their sister species and other bivalves. It provides strong evidence for the recent speciation of the six Crassostrea species in Asia. It further indicates that changes in mt gene order may not be strictly a function of time but subject to other constraints that are presently not well understood. PMID:21189147

  1. Tandem duplication of 11p12-p13 in a child with borderline development delay and eye abnormalities: dose effect of the PAX6 gene product?

    NARCIS (Netherlands)

    Aalfs, C. M.; Fantes, J. A.; Wenniger-Prick, L. J.; Sluijter, S.; Hennekam, R. C.; van Heyningen, V.; Hoovers, J. M.

    1997-01-01

    We report on a girl with a duplication of chromosome band 11p12-->13, which includes the Wilms tumor gene (WT1) and the aniridia gene (PAX6). The girl had borderline developmental delay, mild facial anomalies, and eye abnormalities. Eye findings were also present in most of the 11 other published

  2. Evolutionary history of the alpha2,8-sialyltransferase (ST8Sia) gene family: tandem duplications in early deuterostomes explain most of the diversity found in the vertebrate ST8Sia genes.

    Science.gov (United States)

    Harduin-Lepers, Anne; Petit, Daniel; Mollicone, Rosella; Delannoy, Philippe; Petit, Jean-Michel; Oriol, Rafael

    2008-09-23

    The animal sialyltransferases, which catalyze the transfer of sialic acid to the glycan moiety of glycoconjugates, are subdivided into four families: ST3Gal, ST6Gal, ST6GalNAc and ST8Sia, based on acceptor sugar specificity and glycosidic linkage formed. Despite low overall sequence identity between each sialyltransferase family, all sialyltransferases share four conserved peptide motifs (L, S, III and VS) that serve as hallmarks for the identification of the sialyltransferases. Currently, twenty subfamilies have been described in mammals and birds. Examples of the four sialyltransferase families have also been found in invertebrates. Focusing on the ST8Sia family, we investigated the origin of the three groups of alpha2,8-sialyltransferases demonstrated in vertebrates to carry out poly-, oligo- and mono-alpha2,8-sialylation. We identified in the genome of invertebrate deuterostomes, orthologs to the common ancestor for each of the three vertebrate ST8Sia groups and a set of novel genes named ST8Sia EX, not found in vertebrates. All these ST8Sia sequences share a new conserved family-motif, named "C-term" that is involved in protein folding, via an intramolecular disulfide bridge. Interestingly, sequences from Branchiostoma floridae orthologous to the common ancestor of polysialyltransferases possess a polysialyltransferase domain (PSTD) and those orthologous to the common ancestor of oligosialyltransferases possess a new ST8Sia III-specific motif similar to the PSTD. In osteichthyans, we have identified two new subfamilies. In addition, we describe the expression profile of ST8Sia genes in Danio rerio. Polysialylation appeared early in the deuterostome lineage. The recent release of several deuterostome genome databases and paralogons combined with synteny analysis allowed us to obtain insight into events at the gene level that led to the diversification of the ST8Sia genes, with their corresponding enzymatic activities, in both invertebrates and vertebrates. The

  3. Evolutionary history of the alpha2,8-sialyltransferase (ST8Sia gene family: Tandem duplications in early deuterostomes explain most of the diversity found in the vertebrate ST8Sia genes

    Directory of Open Access Journals (Sweden)

    Petit Jean-Michel

    2008-09-01

    Full Text Available Abstract Background The animal sialyltransferases, which catalyze the transfer of sialic acid to the glycan moiety of glycoconjugates, are subdivided into four families: ST3Gal, ST6Gal, ST6GalNAc and ST8Sia, based on acceptor sugar specificity and glycosidic linkage formed. Despite low overall sequence identity between each sialyltransferase family, all sialyltransferases share four conserved peptide motifs (L, S, III and VS that serve as hallmarks for the identification of the sialyltransferases. Currently, twenty subfamilies have been described in mammals and birds. Examples of the four sialyltransferase families have also been found in invertebrates. Focusing on the ST8Sia family, we investigated the origin of the three groups of α2,8-sialyltransferases demonstrated in vertebrates to carry out poly-, oligo- and mono-α2,8-sialylation. Results We identified in the genome of invertebrate deuterostomes, orthologs to the common ancestor for each of the three vertebrate ST8Sia groups and a set of novel genes named ST8Sia EX, not found in vertebrates. All these ST8Sia sequences share a new conserved family-motif, named "C-term" that is involved in protein folding, via an intramolecular disulfide bridge. Interestingly, sequences from Branchiostoma floridae orthologous to the common ancestor of polysialyltransferases possess a polysialyltransferase domain (PSTD and those orthologous to the common ancestor of oligosialyltransferases possess a new ST8Sia III-specific motif similar to the PSTD. In osteichthyans, we have identified two new subfamilies. In addition, we describe the expression profile of ST8Sia genes in Danio rerio. Conclusion Polysialylation appeared early in the deuterostome lineage. The recent release of several deuterostome genome databases and paralogons combined with synteny analysis allowed us to obtain insight into events at the gene level that led to the diversification of the ST8Sia genes, with their corresponding enzymatic

  4. Plasticity and innovation of regulatory mechanisms underlying seed oil content mediated by duplicated genes in the palaeopolyploid soybean.

    Science.gov (United States)

    Zhang, Dajian; Zhao, Meixia; Li, Shuai; Sun, Lianjun; Wang, Weidong; Cai, Chunmei; Dierking, Emily C; Ma, Jianxin

    2017-06-01

    Many plants have undergone whole genome duplication (WGD). However, how regulatory networks underlying a particular trait are reshaped in polyploids has not been experimentally investigated. Here we show that the regulatory pathways modulating seed oil content, which involve WRINKLED1 (WRI1), LEAFY COTYLEDON1 (LEC1), and LEC2 in Arabidopsis, have been modified in the palaeopolyploid soybean. Such modifications include functional reduction of GmWRI1b of the GmWRI1a/GmWRI1b homoeologous pair relevant to WRI1, complementary non-allelic dosage effects of the GmLEC1a/GmLEC1b homoeologous pair relevant to LEC1, pseudogenization of the singleton GmLEC2 relevant to LEC2, and the rise of the LEC2-like function of GmABI3b, contrasting to its homoeolog GmABI3a, which maintains the ABSCISIC ACID INSENSITIVE 3 (ABI3)-like function in modulating seed maturation and dormancy. The function of GmABI3b in modulating seed oil biosynthesis was fulfilled by direct binding to a RY (CATGCA) cis-regulatory element in the GmWRI1a promoter, which was absent in the GmWRI1b promoter, resulting in reduction of the GmWRI1b expression. Nevertheless, the three regulators each exhibited similar intensities of purifying selection to their respective duplicates since these pairs were formed by a WGD event that is proposed to have occurred approximately 13 million years ago (mya), suggesting that the differentiation in spatiotemporal expression between the duplicated genes is more likely to be the outcome of neutral variation in regulatory sequences. This study thus exemplifies the plasticity, dynamics, and novelty of regulatory networks mediated by WGD. © 2017 The Authors The Plant Journal © 2017 John Wiley & Sons Ltd.

  5. Study of duplication 24bp of ARX gene among patients presenting a Mental Retardation with a syndromic and non syndromic forms

    International Nuclear Information System (INIS)

    Essouissi, Imen

    2006-01-01

    Mental Retardation (MR) is the most frequent handicap. It touches 3% of the general population. The genetic causes of this handicap account for 40% of these cases. ARX gene (Aristaless related homeobox gene) belongs to the family of the genes homeobox located in Xp22.1. It is considered as the most frequently muted gene after the FMR1 gene. It is implicated in various forms of syndromic and nonsyndromic MR. Several types of mutation were identified on the level of this gene, including deletions/insertions, duplications, missense and nonsense mutations, responsible for a wide spectrum of phenotypes. The goal of this work is to seek the most frequent change of gene ARX: duplication 24pb (at the origin of an expansion of the field poly has protein ARX in the position 144-155AA) among Tunisian boys presenting in particular family forms of non specific MR, sporadic forms of non specific MR like certain patients presenting a West syndrome.To prove the duplication of 24 Pb, we used in this work the Pcr technique. The change of duplication 24pb was not found in our series, this could be explained by the low number of cases family studied (38 families) and by the absence of connection studies accusing a mode of transmission related to X chromosome in particular for the sporadic cases. (Author)

  6. Sox genes in grass carp (Ctenopharyngodon idella) with their implications for genome duplication and evolution

    OpenAIRE

    Zhong , Lei; Yu , Xiaomu; Tong , Jingou

    2006-01-01

    Abstract The Sox gene family is found in a broad range of animal taxa and encodes important gene regulatory proteins involved in a variety of developmental processes. We have obtained clones representing the HMG boxes of twelve Sox genes from grass carp (Ctenopharyngodon idella), one of the four major domestic carps in China. The cloned Sox genes belong to group B1, B2 and C. Our analyses show that whereas the human genome contains a single copy of Sox4, Sox11 and Sox14, each of these genes h...

  7. Enteric Duplication.

    Science.gov (United States)

    Jeziorczak, Paul M; Warner, Brad W

    2018-03-01

    Enteric duplications have been described throughout the entire gastrointestinal tract. The usual perinatal presentation is an abdominal mass. Duplications associated with the foregut have associated respiratory symptoms, whereas duplications in the midgut and hindgut can present with obstructive symptoms, perforation, nausea, emesis, hemorrhage, or be asymptomatic, and identified as an incidental finding. These are differentiated from other cystic lesions by the presence of a normal gastrointestinal mucosal epithelium. Enteric duplications are located on the mesenteric side of the native structures and are often singular with tubular or cystic characteristics. Management of enteric duplications often requires operative intervention with preservation of the native blood supply and intestine. These procedures are usually very well tolerated with low morbidity.

  8. Visualizing conserved gene location across microbe genomes

    Science.gov (United States)

    Shaw, Chris D.

    2009-01-01

    This paper introduces an analysis-based zoomable visualization technique for displaying the location of genes across many related species of microbes. The purpose of this visualizatiuon is to enable a biologist to examine the layout of genes in the organism of interest with respect to the gene organization of related organisms. During the genomic annotation process, the ability to observe gene organization in common with previously annotated genomes can help a biologist better confirm the structure and function of newly analyzed microbe DNA sequences. We have developed a visualization and analysis tool that enables the biologist to observe and examine gene organization among genomes, in the context of the primary sequence of interest. This paper describes the visualization and analysis steps, and presents a case study using a number of Rickettsia genomes.

  9. Phylogenetic relationships among Perissodactyla: secretoglobin 1A1 gene duplication and triplication in the Equidae family.

    Science.gov (United States)

    Côté, Olivier; Viel, Laurent; Bienzle, Dorothee

    2013-12-01

    Secretoglobin family 1A member 1 (SCGB 1A1) is a small anti-inflammatory and immunomodulatory protein that is abundantly secreted in airway surface fluids. We recently reported the existence of three distinct SCGB1A1 genes in the domestic horse genome as opposed to the single gene copy consensus present in other mammals. The origin of SCGB1A1 gene triplication and the evolutionary relationship of the three genes amongst Equidae family members are unknown. For this study, SCGB1A1 genomic data were collected from various Equus individuals including E. caballus, E. przewalskii, E. asinus, E. grevyi, and E. quagga. Three SCGB1A1 genes in E. przewalskii, two SCGB1A1 genes in E. asinus, and a single SCGB1A1 gene in E. grevyi and E. quagga were identified. Sequence analysis revealed that the non-synonymous nucleotide substitutions between the different equid genes coded for 17 amino acid changes. Most of these changes localized to the SCGB 1A1 central cavity that binds hydrophobic ligands, suggesting that this area of SCGB 1A1 evolved to accommodate diverse molecular interactions. Three-dimensional modeling of the proteins revealed that the size of the SCGB 1A1 central cavity is larger than that of SCGB 1A1A. Altogether, these findings suggest that evolution of the SCGB1A1 gene may parallel the separation of caballine and non-caballine species amongst Equidae, and may indicate an expansion of function for SCGB1A1 gene products. Copyright © 2013 Elsevier Inc. All rights reserved.

  10. Conserved genomic organisation of Group B Sox genes in insects.

    Directory of Open Access Journals (Sweden)

    Woerfel Gertrud

    2005-05-01

    Full Text Available Abstract Background Sox domain containing genes are important metazoan transcriptional regulators implicated in a wide rage of developmental processes. The vertebrate B subgroup contains the Sox1, Sox2 and Sox3 genes that have early functions in neural development. Previous studies show that Drosophila Group B genes have been functionally conserved since they play essential roles in early neural specification and mutations in the Drosophila Dichaete and SoxN genes can be rescued with mammalian Sox genes. Despite their importance, the extent and organisation of the Group B family in Drosophila has not been fully characterised, an important step in using Drosophila to examine conserved aspects of Group B Sox gene function. Results We have used the directed cDNA sequencing along with the output from the publicly-available genome sequencing projects to examine the structure of Group B Sox domain genes in Drosophila melanogaster, Drosophila pseudoobscura, Anopheles gambiae and Apis mellifora. All of the insect genomes contain four genes encoding Group B proteins, two of which are intronless, as is the case with vertebrate group B genes. As has been previously reported and unusually for Group B genes, two of the insect group B genes, Sox21a and Sox21b, contain introns within their DNA-binding domains. We find that the highly unusual multi-exon structure of the Sox21b gene is common to the insects. In addition, we find that three of the group B Sox genes are organised in a linked cluster in the insect genomes. By in situ hybridisation we show that the pattern of expression of each of the four group B genes during embryogenesis is conserved between D. melanogaster and D. pseudoobscura. Conclusion The DNA-binding domain sequences and genomic organisation of the group B genes have been conserved over 300 My of evolution since the last common ancestor of the Hymenoptera and the Diptera. Our analysis suggests insects have two Group B1 genes, SoxN and

  11. Origin, evolution, and population genetics of the selfish Segregation Distorter gene duplication in European and African populations of Drosophila melanogaster.

    Science.gov (United States)

    Brand, Cara L; Larracuente, Amanda M; Presgraves, Daven C

    2015-05-01

    Meiotic drive elements are a special class of evolutionarily "selfish genes" that subvert Mendelian segregation to gain preferential transmission at the expense of homologous loci. Many drive elements appear to be maintained in populations as stable polymorphisms, their equilibrium frequencies determined by the balance between drive (increasing frequency) and selection (decreasing frequency). Here we show that a classic, seemingly balanced, drive system is instead characterized by frequent evolutionary turnover giving rise to dynamic, rather than stable, equilibrium frequencies. The autosomal Segregation Distorter (SD) system of the fruit fly Drosophila melanogaster is a selfish coadapted meiotic drive gene complex in which the major driver corresponds to a partial duplication of the gene Ran-GTPase activating protein (RanGAP). SD chromosomes segregate at similar, low frequencies of 1-5% in natural populations worldwide, consistent with a balanced polymorphism. Surprisingly, our population genetic analyses reveal evidence for parallel, independent selective sweeps of different SD chromosomes in populations on different continents. These findings suggest that, rather than persisting at a single stable equilibrium, SD chromosomes turn over frequently within populations. © 2015 The Author(s). Evolution published by Wiley Periodicals, Inc. on behalf of The Society for the Study of Evolution.

  12. Specific duplication and dorsoventrally asymmetric expression patterns of Cycloidea-like genes in zygomorphic species of Ranunculaceae.

    Science.gov (United States)

    Jabbour, Florian; Cossard, Guillaume; Le Guilloux, Martine; Sannier, Julie; Nadot, Sophie; Damerval, Catherine

    2014-01-01

    Floral bilateral symmetry (zygomorphy) has evolved several times independently in angiosperms from radially symmetrical (actinomorphic) ancestral states. Homologs of the Antirrhinum majus Cycloidea gene (Cyc) have been shown to control floral symmetry in diverse groups in core eudicots. In the basal eudicot family Ranunculaceae, there is a single evolutionary transition from actinomorphy to zygomorphy in the stem lineage of the tribe Delphinieae. We characterized Cyc homologs in 18 genera of Ranunculaceae, including the four genera of Delphinieae, in a sampling that represents the floral morphological diversity of this tribe, and reconstructed the evolutionary history of this gene family in Ranunculaceae. Within each of the two RanaCyL (Ranunculaceae Cycloidea-like) lineages previously identified, an additional duplication possibly predating the emergence of the Delphinieae was found, resulting in up to four gene copies in zygomorphic species. Expression analyses indicate that the RanaCyL paralogs are expressed early in floral buds and that the duration of their expression varies between species and paralog class. At most one RanaCyL paralog was expressed during the late stages of floral development in the actinomorphic species studied whereas all paralogs from the zygomorphic species were expressed, composing a species-specific identity code for perianth organs. The contrasted asymmetric patterns of expression observed in the two zygomorphic species is discussed in relation to their distinct perianth architecture.

  13. Specific duplication and dorsoventrally asymmetric expression patterns of Cycloidea-like genes in zygomorphic species of Ranunculaceae.

    Directory of Open Access Journals (Sweden)

    Florian Jabbour

    Full Text Available Floral bilateral symmetry (zygomorphy has evolved several times independently in angiosperms from radially symmetrical (actinomorphic ancestral states. Homologs of the Antirrhinum majus Cycloidea gene (Cyc have been shown to control floral symmetry in diverse groups in core eudicots. In the basal eudicot family Ranunculaceae, there is a single evolutionary transition from actinomorphy to zygomorphy in the stem lineage of the tribe Delphinieae. We characterized Cyc homologs in 18 genera of Ranunculaceae, including the four genera of Delphinieae, in a sampling that represents the floral morphological diversity of this tribe, and reconstructed the evolutionary history of this gene family in Ranunculaceae. Within each of the two RanaCyL (Ranunculaceae Cycloidea-like lineages previously identified, an additional duplication possibly predating the emergence of the Delphinieae was found, resulting in up to four gene copies in zygomorphic species. Expression analyses indicate that the RanaCyL paralogs are expressed early in floral buds and that the duration of their expression varies between species and paralog class. At most one RanaCyL paralog was expressed during the late stages of floral development in the actinomorphic species studied whereas all paralogs from the zygomorphic species were expressed, composing a species-specific identity code for perianth organs. The contrasted asymmetric patterns of expression observed in the two zygomorphic species is discussed in relation to their distinct perianth architecture.

  14. Duplicated Gephyrin Genes Showing Distinct Tissue Distribution and Alternative Splicing Patterns Mediate Molybdenum Cofactor Biosynthesis, Glycine Receptor Clustering, and Escape Behavior in Zebrafish*

    Science.gov (United States)

    Ogino, Kazutoyo; Ramsden, Sarah L.; Keib, Natalie; Schwarz, Günter; Harvey, Robert J.; Hirata, Hiromi

    2011-01-01

    Gephyrin mediates the postsynaptic clustering of glycine receptors (GlyRs) and GABAA receptors at inhibitory synapses and molybdenum-dependent enzyme (molybdoenzyme) activity in non-neuronal tissues. Gephyrin knock-out mice show a phenotype resembling both defective glycinergic transmission and molybdenum cofactor (Moco) deficiency and die within 1 day of birth due to starvation and dyspnea resulting from deficits in motor and respiratory networks, respectively. To address whether gephyrin function is conserved among vertebrates and whether gephyrin deficiency affects molybdoenzyme activity and motor development, we cloned and characterized zebrafish gephyrin genes. We report here that zebrafish have two gephyrin genes, gphna and gphnb. The former is expressed in all tissues and has both C3 and C4 cassette exons, and the latter is expressed predominantly in the brain and spinal cord and harbors only C4 cassette exons. We confirmed that all of the gphna and gphnb splicing isoforms have Moco synthetic activity. Antisense morpholino knockdown of either gphna or gphnb alone did not disturb synaptic clusters of GlyRs in the spinal cord and did not affect touch-evoked escape behaviors. However, on knockdown of both gphna and gphnb, embryos showed impairments in GlyR clustering in the spinal cord and, as a consequence, demonstrated touch-evoked startle response behavior by contracting antagonistic muscles simultaneously, instead of displaying early coiling and late swimming behaviors, which are executed by side-to-side muscle contractions. These data indicate that duplicated gephyrin genes mediate Moco biosynthesis and control postsynaptic clustering of GlyRs, thereby mediating key escape behaviors in zebrafish. PMID:20843816

  15. The drug target genes show higher evolutionary conservation than non-target genes.

    Science.gov (United States)

    Lv, Wenhua; Xu, Yongdeng; Guo, Yiying; Yu, Ziqi; Feng, Guanglong; Liu, Panpan; Luan, Meiwei; Zhu, Hongjie; Liu, Guiyou; Zhang, Mingming; Lv, Hongchao; Duan, Lian; Shang, Zhenwei; Li, Jin; Jiang, Yongshuai; Zhang, Ruijie

    2016-01-26

    Although evidence indicates that drug target genes share some common evolutionary features, there have been few studies analyzing evolutionary features of drug targets from an overall level. Therefore, we conducted an analysis which aimed to investigate the evolutionary characteristics of drug target genes. We compared the evolutionary conservation between human drug target genes and non-target genes by combining both the evolutionary features and network topological properties in human protein-protein interaction network. The evolution rate, conservation score and the percentage of orthologous genes of 21 species were included in our study. Meanwhile, four topological features including the average shortest path length, betweenness centrality, clustering coefficient and degree were considered for comparison analysis. Then we got four results as following: compared with non-drug target genes, 1) drug target genes had lower evolutionary rates; 2) drug target genes had higher conservation scores; 3) drug target genes had higher percentages of orthologous genes and 4) drug target genes had a tighter network structure including higher degrees, betweenness centrality, clustering coefficients and lower average shortest path lengths. These results demonstrate that drug target genes are more evolutionarily conserved than non-drug target genes. We hope that our study will provide valuable information for other researchers who are interested in evolutionary conservation of drug targets.

  16. Tissue-specific differential induction of duplicated fatty acid-binding protein genes by the peroxisome proliferator, clofibrate, in zebrafish (Danio rerio

    Directory of Open Access Journals (Sweden)

    Venkatachalam Ananda B

    2012-07-01

    Full Text Available Abstract Background Force, Lynch and Conery proposed the duplication-degeneration-complementation (DDC model in which partitioning of ancestral functions (subfunctionalization and acquisition of novel functions (neofunctionalization were the two primary mechanisms for the retention of duplicated genes. The DDC model was tested by analyzing the transcriptional induction of the duplicated fatty acid-binding protein (fabp genes by clofibrate in zebrafish. Clofibrate is a specific ligand of the peroxisome proliferator-activated receptor (PPAR; it activates PPAR which then binds to a peroxisome proliferator response element (PPRE to induce the transcriptional initiation of genes primarily involved in lipid homeostasis. Zebrafish was chosen as our model organism as it has many duplicated genes owing to a whole genome duplication (WGD event that occurred ~230-400 million years ago in the teleost fish lineage. We assayed the steady-state levels of fabp mRNA and heterogeneous nuclear RNA (hnRNA transcripts in liver, intestine, muscle, brain and heart for four sets of duplicated fabp genes, fabp1a/fabp1b.1/fabp1b.2, fabp7a/fabp7b, fabp10a/fabp10b and fabp11a/fabp11b in zebrafish fed different concentrations of clofibrate. Result Electron microscopy showed an increase in the number of peroxisomes and mitochondria in liver and heart, respectively, in zebrafish fed clofibrate. Clofibrate also increased the steady-state level of acox1 mRNA and hnRNA transcripts in different tissues, a gene with a functional PPRE. These results demonstrate that zebrafish is responsive to clofibrate, unlike some other fishes. The levels of fabp mRNA and hnRNA transcripts for the four sets of duplicated fabp genes was determined by reverse transcription, quantitative polymerase chain reaction (RT-qPCR. The level of hnRNA coded by a gene is an indirect estimate of the rate of transcriptional initiation of that gene. Clofibrate increased the steady-state level of fabp mRNAs and hn

  17. Duplicate editorial on duplicate publication.

    Science.gov (United States)

    Corson, Stephen L; Decherney, Alan H

    2005-04-01

    The authors define and discuss the various forms taken by duplicate publications, and provide suggested remedies to help authors, editors, reviewers, and readers avoid this form of internal plagiarism.

  18. Cloning and characterization of two duplicated interleukin-17A/F2 genes in common carp (Cyprinus carpio L.): Transcripts expression and bioactivity of recombinant IL-17A/F2.

    Science.gov (United States)

    Li, Hongxia; Yu, Juhua; Li, Jianlin; Tang, Yongkai; Yu, Fan; Zhou, Jie; Yu, Wenjuan

    2016-04-01

    Interleukin-17 (IL-17) plays an important role in inflammation and host defense in mammals. In this study, we identified two duplicated IL-17A/F2 genes in the common carp (Cyprinus carpio) (ccIL-17A/F2a and ccIL-17A/F2b), putative encoded proteins contain 140 amino acids (aa) with conserved IL-17 family motifs. Expression analysis revealed high constitutive expression of ccIL-17A/F2s in mucosal tissues, including gill, skin and intestine, their expression could be induced by Aeromonas hydrophila, suggesting a potential role in mucosal immunity. Recombinant ccIL-17A/F2a protein (rccIL-17A/F2a) produced in Escherichia coli could induce the expression of proinflammatory cytokines (IL-1β) and the antimicrobial peptides S100A1, S100A10a and S100A10b in the primary kidney in a dose- and time-dependent manner. Above findings suggest that ccIL-17A/F2 plays an important role in both proinflammatory and innate immunity. Two duplicated ccIL-17A/F2s showed different expression level with ccIL-17A/F2a higher than b, comparison of two 5' regulatory regions indicated the length from anticipated promoter to transcriptional start site (TSS) and putative transcription factor binding site (TFBS) were different. Promoter activity of ccIL-17A/F2a was 2.5 times of ccIL-17A/F2b which consistent with expression results of two genes. These suggest mutations in 5'regulatory region contributed to the differentiation of duplicated genes. To our knowledge, this is the first report to analyze 5'regulatory region of piscine IL-17 family genes. Copyright © 2016 Elsevier Ltd. All rights reserved.

  19. Functional diversification of duplicated CYC2 clade genes in regulation of inflorescence development in Gerbera hybrida (Asteraceae).

    Science.gov (United States)

    Juntheikki-Palovaara, Inka; Tähtiharju, Sari; Lan, Tianying; Broholm, Suvi K; Rijpkema, Anneke S; Ruonala, Raili; Kale, Liga; Albert, Victor A; Teeri, Teemu H; Elomaa, Paula

    2014-09-01

    The complex inflorescences (capitula) of Asteraceae consist of different types of flowers. In Gerbera hybrida (gerbera), the peripheral ray flowers are bilaterally symmetrical and lack functional stamens while the central disc flowers are more radially symmetrical and hermaphroditic. Proteins of the CYC2 subclade of the CYC/TB1-like TCP domain transcription factors have been recruited several times independently for parallel evolution of bilaterally symmetrical flowers in various angiosperm plant lineages, and have also been shown to regulate flower-type identity in Asteraceae. The CYC2 subclade genes in gerbera show largely overlapping gene expression patterns. At the level of single flowers, their expression domain in petals shows a spatial shift from the dorsal pattern known so far in species with bilaterally symmetrical flowers, suggesting that this change in expression may have evolved after the origin of Asteraceae. Functional analysis indicates that GhCYC2, GhCYC3 and GhCYC4 mediate positional information at the proximal-distal axis of the inflorescence, leading to differentiation of ray flowers, but that they also regulate ray flower petal growth by affecting cell proliferation until the final size and shape of the petals is reached. Moreover, our data show functional diversification for the GhCYC5 gene. Ectopic activation of GhCYC5 increases flower density in the inflorescence, suggesting that GhCYC5 may promote the flower initiation rate during expansion of the capitulum. Our data thus indicate that modification of the ancestral network of TCP factors has, through gene duplications, led to the establishment of new expression domains and to functional diversification. © 2014 The Authors The Plant Journal © 2014 John Wiley & Sons Ltd.

  20. Gene fusions with lacZ by duplication insertion in the radioresistant bacterium Deinococcus radiodurans

    International Nuclear Information System (INIS)

    Lennon, E.; Minton, K.W.

    1990-01-01

    Deinococcus radiodurans is the most-studied species of a eubacterial family characterized by extreme resistance to DNA damage. We have focused on developing molecular biological techniques to investigate the genetics of this organism. We report construction of lacZ gene fusions by a method involving both in vitro splicing and the natural transformation of D. radiodurans. Numerous fusion strains were identified by expression of beta-galactosidase. Among these fusion strains, several were inducible by exposure to the DNA-damaging agent mitomycin C, and four of the inducible fusion constructs were cloned in Escherichia coli. Hybridization studies indicate that one of the damage-inducible genes contains a sequence reiterated throughout the D. radiodurans chromosome. Survival measurements show that two of the fusion strains have increased sensitivity to mitomycin C, suggesting that the fusions within these strains inactivate repair functions

  1. Mitochondrial Genomes of Kinorhyncha: trnM Duplication and New Gene Orders within Animals

    OpenAIRE

    Popova, Olga V.; Mikhailov, Kirill V.; Nikitin, Mikhail A.; Logacheva, Maria D.; Penin, Aleksey A.; Muntyan, Maria S.; Kedrova, Olga S.; Petrov, Nikolai B.; Panchin, Yuri V.; Aleoshin, Vladimir V.

    2016-01-01

    Many features of mitochondrial genomes of animals, such as patterns of gene arrangement, nucleotide content and substitution rate variation are extensively used in evolutionary and phylogenetic studies. Nearly 6,000 mitochondrial genomes of animals have already been sequenced, covering the majority of animal phyla. One of the groups that escaped mitogenome sequencing is phylum Kinorhyncha-an isolated taxon of microscopic worm-like ecdysozoans. The kinorhynchs are thought to be one of the earl...

  2. Rectal duplication.

    Directory of Open Access Journals (Sweden)

    Kulkarni B

    1995-04-01

    Full Text Available Duplications of the alimentary tract are of a great rarity, particularly so in the rectum. Because of its rarity, the difficulty of making a correct diagnosis and of selection of proper approach for treatment, this entity bears a special significance. The present case report deals with a female newborn who presented with imperforate anus and a rectovestibular fistula and a mass prolapsing at the introitus. Complete excision of the mass was carried out through the perineal approach and the child then underwent, a PSARP for the correction of the rectal anomaly. Histology confirmed the mass to be a rectal duplication.

  3. A search for RNA insertions and NS3 gene duplication in the genome of cytopathic isolates of bovine viral diarrhea virus

    Directory of Open Access Journals (Sweden)

    V.L. Quadros

    2006-07-01

    Full Text Available Calves born persistently infected with non-cytopathic bovine viral diarrhea virus (ncpBVDV frequently develop a fatal gastroenteric illness called mucosal disease. Both the original virus (ncpBVDV and an antigenically identical but cytopathic virus (cpBVDV can be isolated from animals affected by mucosal disease. Cytopathic BVDVs originate from their ncp counterparts by diverse genetic mechanisms, all leading to the expression of the non-structural polypeptide NS3 as a discrete protein. In contrast, ncpBVDVs express only the large precursor polypeptide, NS2-3, which contains the NS3 sequence within its carboxy-terminal half. We report here the investigation of the mechanism leading to NS3 expression in 41 cpBVDV isolates. An RT-PCR strategy was employed to detect RNA insertions within the NS2-3 gene and/or duplication of the NS3 gene, two common mechanisms of NS3 expression. RT-PCR amplification revealed insertions in the NS2-3 gene of three cp isolates, with the inserts being similar in size to that present in the cpBVDV NADL strain. Sequencing of one such insert revealed a 296-nucleotide sequence with a central core of 270 nucleotides coding for an amino acid sequence highly homologous (98% to the NADL insert, a sequence corresponding to part of the cellular J-Domain gene. One cpBVDV isolate contained a duplication of the NS3 gene downstream from the original locus. In contrast, no detectable NS2-3 insertions or NS3 gene duplications were observed in the genome of 37 cp isolates. These results demonstrate that processing of NS2-3 without bulk mRNA insertions or NS3 gene duplications seems to be a frequent mechanism leading to NS3 expression and BVDV cytopathology.

  4. Annelid Distal-less/Dlx duplications reveal varied post-duplication fates

    Directory of Open Access Journals (Sweden)

    Korchagina Natalia

    2011-08-01

    Full Text Available Abstract Background Dlx (Distal-less genes have various developmental roles and are widespread throughout the animal kingdom, usually occurring as single copy genes in non-chordates and as multiple copies in most chordate genomes. While the genomic arrangement and function of these genes is well known in vertebrates and arthropods, information about Dlx genes in other organisms is scarce. We investigate the presence of Dlx genes in several annelid species and examine Dlx gene expression in the polychaete Pomatoceros lamarckii. Results Two Dlx genes are present in P. lamarckii, Capitella teleta and Helobdella robusta. The C. teleta Dlx genes are closely linked in an inverted tail-to-tail orientation, reminiscent of the arrangement of vertebrate Dlx pairs, and gene conversion appears to have had a role in their evolution. The H. robusta Dlx genes, however, are not on the same genomic scaffold and display divergent sequences, while, if the P. lamarckii genes are linked in a tail-to-tail orientation they are a minimum of 41 kilobases apart and show no sign of gene conversion. No expression in P. lamarckii appendage development has been observed, which conflicts with the supposed conserved role of these genes in animal appendage development. These Dlx duplications do not appear to be annelid-wide, as the polychaete Platynereis dumerilii likely possesses only one Dlx gene. Conclusions On the basis of the currently accepted annelid phylogeny, we hypothesise that one Dlx duplication occurred in the annelid lineage after the divergence of P. dumerilii from the other lineages and these duplicates then had varied evolutionary fates in different species. We also propose that the ancestral role of Dlx genes is not related to appendage development.

  5. A false single nucleotide polymorphism generated by gene duplication compromises meat traceability.

    Science.gov (United States)

    Sanz, Arianne; Ordovás, Laura; Zaragoza, Pilar; Sanz, Albina; de Blas, Ignacio; Rodellar, Clementina

    2012-07-01

    Controlling meat traceability using SNPs is an effective method of ensuring food safety. We have analyzed several SNPs to create a panel for bovine genetic identification and traceability studies. One of these was the transversion g.329C>T (Genbank accession no. AJ496781) on the cytochrome P450 17A1 gene, which has been included in previously published panels. Using minisequencing reactions, we have tested 701 samples belonging to eight Spanish cattle breeds. Surprisingly, an excess of heterozygotes was detected, implying an extreme departure from Hardy-Weinberg equilibrium (PT SNP is a false positive polymorphism, which allows us to explain the inflated heterozygotic value. We recommend that this ambiguous SNP, as well as other polymorphisms located in this region, should not be used in identification, traceability or disease association studies. Annotation of these false SNPs should improve association studies and avoid misinterpretations. Copyright © 2012 Elsevier Ltd. All rights reserved.

  6. Seed collection success and failure in fraxinus gene conservation efforts

    Science.gov (United States)

    Joseph D. Zeleznik; Andrew J. David

    2017-01-01

    National seed collection and gene conservation programs have expanded in recent years, especially in response to pressure from non-native pests such as the emerald ash borer (Agrilus planipennis). Since 2008, we have been working with the U.S. Department of Agriculture Agricultural Research Service (USDA ARS) and USDA Forest Service (USDA FS) leading seed collection...

  7. Conservation of gene co-regulation in prokaryotes and eukaryotes.

    NARCIS (Netherlands)

    Snel, B.; Bork, P.; Huynen, M.A.

    2002-01-01

    We raise some issues in detecting the conservation (or absence thereof) of co-regulation using gene order; how we think the variations in the cellular network in various species can be studied; and how to determine and interpret the higher order structure in networks of functional relations.

  8. Doublesex: a conserved downstream gene controlled by diverse ...

    Indian Academy of Sciences (India)

    The Drosophila doublesex (dsx) gene at the bottom of the sex-determination cascade is the best characterized candidate so far, and is conserved from worms (mab3 of Caenorhabditis elegans) to mammals (Dmrt-1). Studies of dsx homologues from insect species belonging to different orders position them at the bottom of ...

  9. Gallbladder duplication

    Directory of Open Access Journals (Sweden)

    Yagan Pillay

    2015-01-01

    Conclusion: Duplication of the gallbladder is a rare congenital abnormality, which requires special attention to the biliary ductal and arterial anatomy. Laparoscopic cholecystectomy with intraoperative cholangiography is the appropriate treatment in a symptomatic gallbladder. The removal of an asymptomatic double gallbladder remains controversial.

  10. RNA-Mediated Gene Duplication and Retroposons: Retrogenes, LINEs, SINEs, and Sequence Specificity

    Science.gov (United States)

    2013-01-01

    A substantial number of “retrogenes” that are derived from the mRNA of various intron-containing genes have been reported. A class of mammalian retroposons, long interspersed element-1 (LINE1, L1), has been shown to be involved in the reverse transcription of retrogenes (or processed pseudogenes) and non-autonomous short interspersed elements (SINEs). The 3′-end sequences of various SINEs originated from a corresponding LINE. As the 3′-untranslated regions of several LINEs are essential for retroposition, these LINEs presumably require “stringent” recognition of the 3′-end sequence of the RNA template. However, the 3′-ends of mammalian L1s do not exhibit any similarity to SINEs, except for the presence of 3′-poly(A) repeats. Since the 3′-poly(A) repeats of L1 and Alu SINE are critical for their retroposition, L1 probably recognizes the poly(A) repeats, thereby mobilizing not only Alu SINE but also cytosolic mRNA. Many flowering plants only harbor L1-clade LINEs and a significant number of SINEs with poly(A) repeats, but no homology to the LINEs. Moreover, processed pseudogenes have also been found in flowering plants. I propose that the ancestral L1-clade LINE in the common ancestor of green plants may have recognized a specific RNA template, with stringent recognition then becoming relaxed during the course of plant evolution. PMID:23984183

  11. Genetic variability of human respiratory syncytial virus A strains circulating in Ontario: a novel genotype with a 72 nucleotide G gene duplication.

    Directory of Open Access Journals (Sweden)

    Alireza Eshaghi

    Full Text Available Human respiratory syncytial virus (HRSV is the main cause of acute lower respiratory infections in children under 2 years of age and causes repeated infections throughout life. We investigated the genetic variability of RSV-A circulating in Ontario during 2010-2011 winter season by sequencing and phylogenetic analysis of the G glycoprotein gene.Among the 201 consecutive RSV isolates studied, RSV-A (55.7% was more commonly observed than RSV-B (42.3%. 59.8% and 90.1% of RSV-A infections were among children ≤12 months and ≤5 years old, respectively. On phylogenetic analysis of the second hypervariable region of the 112 RSV-A strains, 110 (98.2% clustered within or adjacent to the NA1 genotype; two isolates were GA5 genotype. Eleven (10% NA1-related isolates clustered together phylogenetically as a novel RSV-A genotype, named ON1, containing a 72 nucleotide duplication in the C-terminal region of the attachment (G glycoprotein. The predicted polypeptide is lengthened by 24 amino acids and includes a23 amino acid duplication. Using RNA secondary structural software, a possible mechanism of duplication occurrence was derived. The 23 amino acid ON1 G gene duplication results in a repeat of 7 potential O-glycosylation sites including three O-linked sugar acceptors at residues 270, 275, and 283. Using Phylogenetic Analysis by Maximum Likelihood analysis, a total of 19 positively selected sites were observed among Ontario NA1 isolates; six were found to be codons which reverted to the previous state observed in the prototype RSV-A2 strain. The tendency of codon regression in the G-ectodomain may infer a decreased avidity of antibody to the current circulating strains. Further work is needed to document and further understand the emergence, virulence, pathogenicity and transmissibility of this novel RSV-A genotype with a72 nucleotide G gene duplication.

  12. Expansion of banana (Musa acuminata) gene families involved in ethylene biosynthesis and signalling after lineage-specific whole-genome duplications.

    Science.gov (United States)

    Jourda, Cyril; Cardi, Céline; Mbéguié-A-Mbéguié, Didier; Bocs, Stéphanie; Garsmeur, Olivier; D'Hont, Angélique; Yahiaoui, Nabila

    2014-05-01

    Whole-genome duplications (WGDs) are widespread in plants, and three lineage-specific WGDs occurred in the banana (Musa acuminata) genome. Here, we analysed the impact of WGDs on the evolution of banana gene families involved in ethylene biosynthesis and signalling, a key pathway for banana fruit ripening. Banana ethylene pathway genes were identified using comparative genomics approaches and their duplication modes and expression profiles were analysed. Seven out of 10 banana ethylene gene families evolved through WGD and four of them (1-aminocyclopropane-1-carboxylate synthase (ACS), ethylene-insensitive 3-like (EIL), ethylene-insensitive 3-binding F-box (EBF) and ethylene response factor (ERF)) were preferentially retained. Banana orthologues of AtEIN3 and AtEIL1, two major genes for ethylene signalling in Arabidopsis, were particularly expanded. This expansion was paralleled by that of EBF genes which are responsible for control of EIL protein levels. Gene expression profiles in banana fruits suggested functional redundancy for several MaEBF and MaEIL genes derived from WGD and subfunctionalization for some of them. We propose that EIL and EBF genes were co-retained after WGD in banana to maintain balanced control of EIL protein levels and thus avoid detrimental effects of constitutive ethylene signalling. In the course of evolution, subfunctionalization was favoured to promote finer control of ethylene signalling. © 2014 CIRAD New Phytologist © 2014 New Phytologist Trust.

  13. Cobalamin-Independent Methionine Synthase (MetE): A Face-to-Face Double Barrel that Evolved by Gene Duplication

    Energy Technology Data Exchange (ETDEWEB)

    Pejcha, Robert; Ludwig, Martha L. (Michigan)

    2010-03-08

    Cobalamin-independent methionine synthase (MetE) catalyzes the transfer of a methyl group from methyltetrahydrofolate to L-homocysteine (Hcy) without using an intermediate methyl carrier. Although MetE displays no detectable sequence homology with cobalamin-dependent methionine synthase (MetH), both enzymes require zinc for activation and binding of Hcy. Crystallographic analyses of MetE from T. maritima reveal an unusual dual-barrel structure in which the active site lies between the tops of the two ({beta}{alpha}){sub 8} barrels. The fold of the N-terminal barrel confirms that it has evolved from the C-terminal polypeptide by gene duplication; comparisons of the barrels provide an intriguing example of homologous domain evolution in which binding sites are obliterated. The C-terminal barrel incorporates the zinc ion that binds and activates Hcy. The zinc-binding site in MetE is distinguished from the (Cys){sub 3}Zn site in the related enzymes, MetH and betaine-homocysteine methyltransferase, by its position in the barrel and by the metal ligands, which are histidine, cysteine, glutamate, and cysteine in the resting form of MetE. Hcy associates at the face of the metal opposite glutamate, which moves away from the zinc in the binary E {center_dot} Hcy complex. The folate substrate is not intimately associated with the N-terminal barrel; instead, elements from both barrels contribute binding determinants in a binary complex in which the folate substrate is incorrectly oriented for methyl transfer. Atypical locations of the Hcy and folate sites in the C-terminal barrel presumably permit direct interaction of the substrates in a ternary complex. Structures of the binary substrate complexes imply that rearrangement of folate, perhaps accompanied by domain rearrangement, must occur before formation of a ternary complex that is competent for methyl transfer.

  14. Cobalamin-Independent Methionine Synthase (MetE): A Face-to-Face Double Barrel that Evolved by Gene Duplication

    International Nuclear Information System (INIS)

    Pejcha, Robert; Ludwig, Martha L.

    2005-01-01

    Cobalamin-independent methionine synthase (MetE) catalyzes the transfer of a methyl group from methyltetrahydrofolate to L-homocysteine (Hcy) without using an intermediate methyl carrier. Although MetE displays no detectable sequence homology with cobalamin-dependent methionine synthase (MetH), both enzymes require zinc for activation and binding of Hcy. Crystallographic analyses of MetE from T. maritima reveal an unusual dual-barrel structure in which the active site lies between the tops of the two (βα) 8 barrels. The fold of the N-terminal barrel confirms that it has evolved from the C-terminal polypeptide by gene duplication; comparisons of the barrels provide an intriguing example of homologous domain evolution in which binding sites are obliterated. The C-terminal barrel incorporates the zinc ion that binds and activates Hcy. The zinc-binding site in MetE is distinguished from the (Cys) 3 Zn site in the related enzymes, MetH and betaine-homocysteine methyltransferase, by its position in the barrel and by the metal ligands, which are histidine, cysteine, glutamate, and cysteine in the resting form of MetE. Hcy associates at the face of the metal opposite glutamate, which moves away from the zinc in the binary E · Hcy complex. The folate substrate is not intimately associated with the N-terminal barrel; instead, elements from both barrels contribute binding determinants in a binary complex in which the folate substrate is incorrectly oriented for methyl transfer. Atypical locations of the Hcy and folate sites in the C-terminal barrel presumably permit direct interaction of the substrates in a ternary complex. Structures of the binary substrate complexes imply that rearrangement of folate, perhaps accompanied by domain rearrangement, must occur before formation of a ternary complex that is competent for methyl transfer.

  15. Cobalamin-independent methionine synthase (MetE: a face-to-face double barrel that evolved by gene duplication.

    Directory of Open Access Journals (Sweden)

    Robert Pejchal

    2005-02-01

    Full Text Available Cobalamin-independent methionine synthase (MetE catalyzes the transfer of a methyl group from methyltetrahydrofolate to L-homocysteine (Hcy without using an intermediate methyl carrier. Although MetE displays no detectable sequence homology with cobalamin-dependent methionine synthase (MetH, both enzymes require zinc for activation and binding of Hcy. Crystallographic analyses of MetE from T. maritima reveal an unusual dual-barrel structure in which the active site lies between the tops of the two (betaalpha(8 barrels. The fold of the N-terminal barrel confirms that it has evolved from the C-terminal polypeptide by gene duplication; comparisons of the barrels provide an intriguing example of homologous domain evolution in which binding sites are obliterated. The C-terminal barrel incorporates the zinc ion that binds and activates Hcy. The zinc-binding site in MetE is distinguished from the (Cys(3Zn site in the related enzymes, MetH and betaine-homocysteine methyltransferase, by its position in the barrel and by the metal ligands, which are histidine, cysteine, glutamate, and cysteine in the resting form of MetE. Hcy associates at the face of the metal opposite glutamate, which moves away from the zinc in the binary E.Hcy complex. The folate substrate is not intimately associated with the N-terminal barrel; instead, elements from both barrels contribute binding determinants in a binary complex in which the folate substrate is incorrectly oriented for methyl transfer. Atypical locations of the Hcy and folate sites in the C-terminal barrel presumably permit direct interaction of the substrates in a ternary complex. Structures of the binary substrate complexes imply that rearrangement of folate, perhaps accompanied by domain rearrangement, must occur before formation of a ternary complex that is competent for methyl transfer.

  16. Human Intellectual Disability Genes Form Conserved Functional Modules in Drosophila

    Science.gov (United States)

    Oortveld, Merel A. W.; Keerthikumar, Shivakumar; Oti, Martin; Nijhof, Bonnie; Fernandes, Ana Clara; Kochinke, Korinna; Castells-Nobau, Anna; van Engelen, Eva; Ellenkamp, Thijs; Eshuis, Lilian; Galy, Anne; van Bokhoven, Hans; Habermann, Bianca; Brunner, Han G.; Zweier, Christiane; Verstreken, Patrik; Huynen, Martijn A.; Schenck, Annette

    2013-01-01

    Intellectual Disability (ID) disorders, defined by an IQ below 70, are genetically and phenotypically highly heterogeneous. Identification of common molecular pathways underlying these disorders is crucial for understanding the molecular basis of cognition and for the development of therapeutic intervention strategies. To systematically establish their functional connectivity, we used transgenic RNAi to target 270 ID gene orthologs in the Drosophila eye. Assessment of neuronal function in behavioral and electrophysiological assays and multiparametric morphological analysis identified phenotypes associated with knockdown of 180 ID gene orthologs. Most of these genotype-phenotype associations were novel. For example, we uncovered 16 genes that are required for basal neurotransmission and have not previously been implicated in this process in any system or organism. ID gene orthologs with morphological eye phenotypes, in contrast to genes without phenotypes, are relatively highly expressed in the human nervous system and are enriched for neuronal functions, suggesting that eye phenotyping can distinguish different classes of ID genes. Indeed, grouping genes by Drosophila phenotype uncovered 26 connected functional modules. Novel links between ID genes successfully predicted that MYCN, PIGV and UPF3B regulate synapse development. Drosophila phenotype groups show, in addition to ID, significant phenotypic similarity also in humans, indicating that functional modules are conserved. The combined data indicate that ID disorders, despite their extreme genetic diversity, are caused by disruption of a limited number of highly connected functional modules. PMID:24204314

  17. A synergism between adaptive effects and evolvability drives whole genome duplication to fixation.

    Science.gov (United States)

    Cuypers, Thomas D; Hogeweg, Paulien

    2014-04-01

    Whole genome duplication has shaped eukaryotic evolutionary history and has been associated with drastic environmental change and species radiation. While the most common fate of WGD duplicates is a return to single copy, retained duplicates have been found enriched for highly interacting genes. This pattern has been explained by a neutral process of subfunctionalization and more recently, dosage balance selection. However, much about the relationship between environmental change, WGD and adaptation remains unknown. Here, we study the duplicate retention pattern postWGD, by letting virtual cells adapt to environmental changes. The virtual cells have structured genomes that encode a regulatory network and simple metabolism. Populations are under selection for homeostasis and evolve by point mutations, small indels and WGD. After populations had initially adapted fully to fluctuating resource conditions re-adaptation to a broad range of novel environments was studied by tracking mutations in the line of descent. WGD was established in a minority (≈30%) of lineages, yet, these were significantly more successful at re-adaptation. Unexpectedly, WGD lineages conserved more seemingly redundant genes, yet had higher per gene mutation rates. While WGD duplicates of all functional classes were significantly over-retained compared to a model of neutral losses, duplicate retention was clearly biased towards highly connected TFs. Importantly, no subfunctionalization occurred in conserved pairs, strongly suggesting that dosage balance shaped retention. Meanwhile, singles diverged significantly. WGD, therefore, is a powerful mechanism to cope with environmental change, allowing conservation of a core machinery, while adapting the peripheral network to accommodate change.

  18. Insertional translocation leading to a 4q13 duplication including the EPHA5 gene in two siblings with attention-deficit hyperactivity disorder.

    Science.gov (United States)

    Matoso, Eunice; Melo, Joana B; Ferreira, Susana I; Jardim, Ana; Castelo, Teresa M; Weise, Anja; Carreira, Isabel M

    2013-08-01

    An insertional translocation (IT) can result in pure segmental aneusomy for the inserted genomic segment allowing to define a more accurate clinical phenotype. Here, we report on two siblings sharing an unbalanced IT inherited from the mother with a history of learning difficulty. An 8-year-old girl with developmental delay, speech disability, and attention-deficit hyperactivity disorder (ADHD), showed by GTG banding analysis a subtle interstitial alteration in 21q21. Oligonucleotide array comparative genomic hybridization (array-CGH) analysis showed a 4q13.1-q13.3 duplication spanning 8.6 Mb. Fluorescence in situ hybridization (FISH) with bacterial artificial chromosome (BAC) clones confirmed the rearrangement, a der(21)ins(21;4)(q21;q13.1q13.3). The duplication described involves 50 RefSeq genes including the EPHA5 gene that encodes for the EphA5 receptor involved in embryonic development of the brain and also in synaptic remodeling and plasticity thought to underlie learning and memory. The same rearrangement was observed in a younger brother with behavioral problems and also exhibiting ADHD. ADHD is among the most heritable of neuropsychiatric disorders. There are few reports of patients with duplications involving the proximal region of 4q and a mild phenotype. To the best of our knowledge this is the first report of a duplication restricted to band 4q13. This abnormality could be easily missed in children who have nonspecific cognitive impairment. The presence of this behavioral disorder in the two siblings reinforces the hypothesis that the region involved could include genes involved in ADHD. Copyright © 2013 Wiley Periodicals, Inc.

  19. Using paleogenomics to study the evolution of gene families: origin and duplication history of the relaxin family hormones and their receptors.

    Directory of Open Access Journals (Sweden)

    Sergey Yegorov

    Full Text Available Recent progress in the analysis of whole genome sequencing data has resulted in the emergence of paleogenomics, a field devoted to the reconstruction of ancestral genomes. Ancestral karyotype reconstructions have been used primarily to illustrate the dynamic nature of genome evolution. In this paper, we demonstrate how they can also be used to study individual gene families by examining the evolutionary history of relaxin hormones (RLN/INSL and relaxin family peptide receptors (RXFP. Relaxin family hormones are members of the insulin superfamily, and are implicated in the regulation of a variety of primarily reproductive and neuroendocrine processes. Their receptors are G-protein coupled receptors (GPCR's and include members of two distinct evolutionary groups, an unusual characteristic. Although several studies have tried to elucidate the origins of the relaxin peptide family, the evolutionary origin of their receptors and the mechanisms driving the diversification of the RLN/INSL-RXFP signaling systems in non-placental vertebrates has remained elusive. Here we show that the numerous vertebrate RLN/INSL and RXFP genes are products of an ancestral receptor-ligand system that originally consisted of three genes, two of which apparently trace their origins to invertebrates. Subsequently, diversification of the system was driven primarily by whole genome duplications (WGD, 2R and 3R followed by almost complete retention of the ligand duplicates in most vertebrates but massive loss of receptor genes in tetrapods. Interestingly, the majority of 3R duplicates retained in teleosts are potentially involved in neuroendocrine regulation. Furthermore, we infer that the ancestral AncRxfp3/4 receptor may have been syntenically linked to the AncRln-like ligand in the pre-2R genome, and show that syntenic linkages among ligands and receptors have changed dynamically in different lineages. This study ultimately shows the broad utility, with some caveats, of

  20. Assessment and Reconstruction of Novel HSP90 Genes: Duplications, Gains and Losses in Fungal and Animal Lineages

    Czech Academy of Sciences Publication Activity Database

    Pantzartzi, Chrysoula; Drosopoulou, E.; Scouras, Z.

    2013-01-01

    Roč. 8, č. 9 (2013), s. 1-11 E-ISSN 1932-6203 R&D Projects: GA MŠk(CZ) ED1.1.00/02.0109 Institutional support: RVO:68378050 Keywords : Hsp90s * Fungi * duplication events Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 3.534, year: 2013

  1. Delineation of a new chromosome 20q11.2 duplication syndrome including the ASXL1 gene

    DEFF Research Database (Denmark)

    Avila, Magali; Kirchhoff, Eva Maria; Marle, Nathalie

    2013-01-01

    We report on three males with de novo overlapping 7.5, 9.8, and 10 Mb duplication of chromosome 20q11.2. Together with another patient previously published in the literature with overlapping 20q11 microduplication, we show that such patients display common clinical features including metopic ridg...

  2. The gsdf gene locus harbors evolutionary conserved and clustered genes preferentially expressed in fish previtellogenic oocytes.

    Science.gov (United States)

    Gautier, Aude; Le Gac, Florence; Lareyre, Jean-Jacques

    2011-02-01

    The gonadal soma-derived factor (GSDF) belongs to the transforming growth factor-β superfamily and is conserved in teleostean fish species. Gsdf is specifically expressed in the gonads, and gene expression is restricted to the granulosa and Sertoli cells in trout and medaka. The gsdf gene expression is correlated to early testis differentiation in medaka and was shown to stimulate primordial germ cell and spermatogonia proliferation in trout. In the present study, we show that the gsdf gene localizes to a syntenic chromosomal fragment conserved among vertebrates although no gsdf-related gene is detected on the corresponding genomic region in tetrapods. We demonstrate using quantitative RT-PCR that most of the genes localized in the synteny are specifically expressed in medaka gonads. Gsdf is the only gene of the synteny with a much higher expression in the testis compared to the ovary. In contrast, gene expression pattern analysis of the gsdf surrounding genes (nup54, aff1, klhl8, sdad1, and ptpn13) indicates that these genes are preferentially expressed in the female gonads. The tissue distribution of these genes is highly similar in medaka and zebrafish, two teleostean species that have diverged more than 110 million years ago. The cellular localization of these genes was determined in medaka gonads using the whole-mount in situ hybridization technique. We confirm that gsdf gene expression is restricted to Sertoli and granulosa cells in contact with the premeiotic and meiotic cells. The nup54 gene is expressed in spermatocytes and previtellogenic oocytes. Transcripts corresponding to the ovary-specific genes (aff1, klhl8, and sdad1) are detected only in previtellogenic oocytes. No expression was detected in the gonocytes in 10 dpf embryos. In conclusion, we show that the gsdf gene localizes to a syntenic chromosomal fragment harboring evolutionary conserved genes in vertebrates. These genes are preferentially expressed in previtelloogenic oocytes, and thus, they

  3. Patterns of intron gain and conservation in eukaryotic genes

    Directory of Open Access Journals (Sweden)

    Wolf Yuri I

    2007-10-01

    Full Text Available Abstract Background: The presence of introns in protein-coding genes is a universal feature of eukaryotic genome organization, and the genes of multicellular eukaryotes, typically, contain multiple introns, a substantial fraction of which share position in distant taxa, such as plants and animals. Depending on the methods and data sets used, researchers have reached opposite conclusions on the causes of the high fraction of shared introns in orthologous genes from distant eukaryotes. Some studies conclude that shared intron positions reflect, almost entirely, a remarkable evolutionary conservation, whereas others attribute it to parallel gain of introns. To resolve these contradictions, it is crucial to analyze the evolution of introns by using a model that minimally relies on arbitrary assumptions. Results: We developed a probabilistic model of evolution that allows for variability of intron gain and loss rates over branches of the phylogenetic tree, individual genes, and individual sites. Applying this model to an extended set of conserved eukaryotic genes, we find that parallel gain, on average, accounts for only ~8% of the shared intron positions. However, the distribution of parallel gains over the phylogenetic tree of eukaryotes is highly non-uniform. There are, practically, no parallel gains in closely related lineages, whereas for distant lineages, such as animals and plants, parallel gains appear to contribute up to 20% of the shared intron positions. In accord with these findings, we estimated that ancestral introns have a high probability to be retained in extant genomes, and conversely, that a substantial fraction of extant introns have retained their positions since the early stages of eukaryotic evolution. In addition, the density of sites that are available for intron insertion is estimated to be, approximately, one in seven basepairs. Conclusion: We obtained robust estimates of the contribution of parallel gain to the observed

  4. Prevalence and spectrum of large deletions or duplications in the major long QT syndrome-susceptibility genes and implications for long QT syndrome genetic testing.

    Science.gov (United States)

    Tester, David J; Benton, Amber J; Train, Laura; Deal, Barbara; Baudhuin, Linnea M; Ackerman, Michael J

    2010-10-15

    Long QT syndrome (LQTS) is a cardiac channelopathy associated with syncope, seizures, and sudden death. Approximately 75% of LQTS is due to mutations in genes encoding for 3 cardiac ion channel α-subunits (LQT1 to LQT3). However, traditional mutational analyses have limited detection capabilities for atypical mutations such as large gene rearrangements. We set out to determine the prevalence and spectrum of large deletions/duplications in the major LQTS-susceptibility genes in unrelated patients who were mutation negative after point mutation analysis of LQT1- to LQT12-susceptibility genes. Forty-two unrelated, clinically strong LQTS patients were analyzed using multiplex ligation-dependent probe amplification, a quantitative fluorescent technique for detecting multiple exon deletions and duplications. The SALSA multiplex ligation-dependent probe amplification LQTS kit from MRC-Holland was used to analyze the 3 major LQTS-associated genes, KCNQ1, KCNH2, and SCN5A, and the 2 minor genes, KCNE1 and KCNE2. Overall, 2 gene rearrangements were found in 2 of 42 unrelated patients (4.8%, confidence interval 1.7 to 11). A deletion of KCNQ1 exon 3 was identified in a 10-year-old Caucasian boy with a corrected QT duration of 660 ms, a personal history of exercise-induced syncope, and a family history of syncope. A deletion of KCNQ1 exon 7 was identified in a 17-year-old Caucasian girl with a corrected QT duration of 480 ms, a personal history of exercise-induced syncope, and a family history of sudden cardiac death. In conclusion, because nearly 5% of patients with genetically elusive LQTS had large genomic rearrangements involving the canonical LQTS-susceptibility genes, reflex genetic testing to investigate genomic rearrangements may be of clinical value. Copyright © 2010 Elsevier Inc. All rights reserved.

  5. Effects of using coding potential, sequence conservation and mRNA structure conservation for predicting pyrroly-sine containing genes

    DEFF Research Database (Denmark)

    Have, Christian Theil; Zambach, Sine; Christiansen, Henning

    2013-01-01

    for prediction of pyrrolysine incorporating genes in genomes of bacteria and archaea leading to insights about the factors driving pyrrolysine translation and identification of new gene candidates. The method predicts known conserved genes with high recall and predicts several other promising candidates...... for experimental verification. The method is implemented as a computational pipeline which is available on request....

  6. Gene pool conservation and tree improvement in Serbia

    Directory of Open Access Journals (Sweden)

    Isajev Vasilije

    2009-01-01

    Full Text Available This paper presents the concepts applied in the gene pool conservation and tree improvement in Serbia. Gene pool conservation of tree species in Serbia includes a series of activities aiming at the sustainability and protection of genetic and species variability. This implies the investigation of genetic resources and their identification through the research of the genetic structure and the breeding system of individual species. Paper also includes the study of intra- and inter-population variability in experiments - provenance tests, progeny tests, half- and full-sib lines, etc. The increased use of the genetic potential in tree improvement in Serbia should be intensified by the following activities: improvement of production of normal forest seed, application of the concept of new selections directed primarily to the improvement of only one character, because in that case the result would be certain, establishment and management of seed orchards as specialized plantations for long-term production of genetically good-quality forest seeds, and the shortening of the improvement process by introducing new techniques and methods (molecular markers, somaclonal variation, genetic engineering, protoplast fusion, micropropagation, etc..

  7. A 12.3-kb Duplication Within the VWF Gene in Pigs Affected by Von Willebrand Disease Type 3

    Directory of Open Access Journals (Sweden)

    Stefanie Lehner

    2018-02-01

    Full Text Available Von Willebrand Disease (VWD type 3 is a serious and sometimes fatal hereditary bleeding disorder. In pigs, the disease has been known for decades, and affected animals are used as models for the human disease. Due to the recessive mode of inheritance of VWD type 3, severe bleeding is typically seen in homozygous individuals. We sequenced the complete porcine VWF (Von Willebrand Factor complementary DNA (cDNA and detected a tandem duplication of exons 17 and 18, causing a frameshift and a premature termination codon (p.Val814LeufsTer3 in the affected pig. Subsequent next generation sequencing on genomic DNA proved the existence of a 12.3-kb tandem duplication associated with VWD. This duplication putatively originates from porcine Short Interspersed Nuclear Elements (SINEs located within VWF introns 16 and 18 with high identity. The premature termination truncates the VWF open reading frame by a large part, resulting in an almost entire loss of the mature peptide. It is therefore supposed to account for the severe VWD type 3. Our results further indicate the presence of strong, nonsense-mediated decay in VWF messenger RNA (mRNA containing the duplication, which was supported by the almost complete absence of the complete VWF protein in immunohistochemistry analysis of the VWD-affected pig. In the past, differentiation of wild-type and heterozygous pigs in this VWD colony had to rely on clinical examinations and additional laboratory methods. The present study provides the basis to distinguish both genotypes by performing a rapid and simple genetic analysis.

  8. Genome-wide identification and comparative expression analysis reveal a rapid expansion and functional divergence of duplicated genes in the WRKY gene family of cabbage, Brassica oleracea var. capitata.

    Science.gov (United States)

    Yao, Qiu-Yang; Xia, En-Hua; Liu, Fei-Hu; Gao, Li-Zhi

    2015-02-15

    WRKY transcription factors (TFs), one of the ten largest TF families in higher plants, play important roles in regulating plant development and resistance. To date, little is known about the WRKY TF family in Brassica oleracea. Recently, the completed genome sequence of cabbage (B. oleracea var. capitata) allows us to systematically analyze WRKY genes in this species. A total of 148 WRKY genes were characterized and classified into seven subgroups that belong to three major groups. Phylogenetic and synteny analyses revealed that the repertoire of cabbage WRKY genes was derived from a common ancestor shared with Arabidopsis thaliana. The B. oleracea WRKY genes were found to be preferentially retained after the whole-genome triplication (WGT) event in its recent ancestor, suggesting that the WGT event had largely contributed to a rapid expansion of the WRKY gene family in B. oleracea. The analysis of RNA-Seq data from various tissues (i.e., roots, stems, leaves, buds, flowers and siliques) revealed that most of the identified WRKY genes were positively expressed in cabbage, and a large portion of them exhibited patterns of differential and tissue-specific expression, demonstrating that these gene members might play essential roles in plant developmental processes. Comparative analysis of the expression level among duplicated genes showed that gene expression divergence was evidently presented among cabbage WRKY paralogs, indicating functional divergence of these duplicated WRKY genes. Copyright © 2014 Elsevier B.V. All rights reserved.

  9. Neuropeptide Y receptor genes on human chromosome 4q31-q32 map to conserved linkage groups on mouse chromosomes 3 and 8

    Energy Technology Data Exchange (ETDEWEB)

    Lutz, C.M.; Frankel, W.N. [Jackson Lab., Bar Harbor, ME (United States); Richards, J.E. [Univ. of Michigan Medical School, Ann Arbor, MI (United States)] [and others

    1997-05-01

    Npy1r and Npy2r, the genes encoding mouse type 1 and type 2 neuropeptide Y receptors, have been mapped by interspecific backcross analysis. Previous studies have localized the human genes encoding these receptors to chromosome 4q31-q32. We have now assigned Npy1r and Npy2r to conserved linkage groups on mouse Chr 8 and Chr 3, respectively, which correspond to the distal region of human chromosome 4q. Using yeast artificial chromosomes, we have estimated the distance between the human genes to be approximately 6 cM. Although ancient tandem duplication events may account for some closely spaced G-protein-coupled receptor genes, the large genetic distance between the human type 1 and type 2 neuropeptide Y receptor genes raises questions about whether this mechanism accounts for their proximity. 20 refs., 1 fig.

  10. Intron-exon organization of the active human protein S gene PS. alpha. and its pseudogene PS. beta. : Duplication and silencing during primate evolution

    Energy Technology Data Exchange (ETDEWEB)

    Ploos van Amstel, H.; Reitsma, P.H.; van der Logt, C.P.; Bertina, R.M. (University Hospital, Leiden (Netherlands))

    1990-08-28

    The human protein S locus on chromosome 3 consists of two protein S genes, PS{alpha} and PS{beta}. Here the authors report the cloning and characterization of both genes. Fifteen exons of the PS{alpha} gene were identified that together code for protein S mRNA as derived from the reported protein S cDNAs. Analysis by primer extension of liver protein S mRNA, however, reveals the presence of two mRNA forms that differ in the length of their 5{prime}-noncoding region. Both transcripts contain a 5{prime}-noncoding region longer than found in the protein S cDNAs. The two products may arise from alternative splicing of an additional intron in this region or from the usage of two start sites for transcription. The intron-exon organization of the PS{alpha} gene fully supports the hypothesis that the protein S gene is the product of an evolutional assembling process in which gene modules coding for structural/functional protein units also found in other coagulation proteins have been put upstream of the ancestral gene of a steroid hormone binding protein. The PS{beta} gene is identified as a pseudogene. It contains a large variety of detrimental aberrations, viz., the absence of exon I, a splice site mutation, three stop codons, and a frame shift mutation. Overall the two genes PS{alpha} and PS{beta} show between their exonic sequences 96.5% homology. Southern analysis of primate DNA showed that the duplication of the ancestral protein S gene has occurred after the branching of the orangutan from the African apes. A nonsense mutation that is present in the pseudogene of man also could be identified in one of the two protein S genes of both chimpanzee and gorilla. This implicates that silencing of one of the two protein S genes must have taken place before the divergence of the three African apes.

  11. Conserved gene regulatory module specifies lateral neural borders across bilaterians.

    Science.gov (United States)

    Li, Yongbin; Zhao, Di; Horie, Takeo; Chen, Geng; Bao, Hongcun; Chen, Siyu; Liu, Weihong; Horie, Ryoko; Liang, Tao; Dong, Biyu; Feng, Qianqian; Tao, Qinghua; Liu, Xiao

    2017-08-01

    The lateral neural plate border (NPB), the neural part of the vertebrate neural border, is composed of central nervous system (CNS) progenitors and peripheral nervous system (PNS) progenitors. In invertebrates, PNS progenitors are also juxtaposed to the lateral boundary of the CNS. Whether there are conserved molecular mechanisms determining vertebrate and invertebrate lateral neural borders remains unclear. Using single-cell-resolution gene-expression profiling and genetic analysis, we present evidence that orthologs of the NPB specification module specify the invertebrate lateral neural border, which is composed of CNS and PNS progenitors. First, like in vertebrates, the conserved neuroectoderm lateral border specifier Msx/vab-15 specifies lateral neuroblasts in Caenorhabditis elegans Second, orthologs of the vertebrate NPB specification module ( Msx/vab-15 , Pax3/7/pax-3 , and Zic/ref-2 ) are significantly enriched in worm lateral neuroblasts. In addition, like in other bilaterians, the expression domain of Msx/vab-15 is more lateral than those of Pax3/7/pax-3 and Zic/ref- 2 in C. elegans Third, we show that Msx/vab-15 regulates the development of mechanosensory neurons derived from lateral neural progenitors in multiple invertebrate species, including C. elegans , Drosophila melanogaster , and Ciona intestinalis We also identify a novel lateral neural border specifier, ZNF703/tlp-1 , which functions synergistically with Msx/vab- 15 in both C. elegans and Xenopus laevis These data suggest a common origin of the molecular mechanism specifying lateral neural borders across bilaterians.

  12. A 20 bp Duplication in Exon 2 of the Aristaless-Like Homeobox 4 Gene (ALX4 Is the Candidate Causative Mutation for Tibial Hemimelia Syndrome in Galloway Cattle.

    Directory of Open Access Journals (Sweden)

    Bertram Brenig

    Full Text Available Aristaless-like homeobox 4 (ALX4 gene is an important transcription regulator in skull and limb development. In humans and mice ALX4 mutations or loss of function result in a number of skeletal and organ malformations, including polydactyly, tibial hemimelia, omphalocele, biparietal foramina, impaired mammary epithelial morphogenesis, alopecia, coronal craniosynostosis, hypertelorism, depressed nasal bridge and ridge, bifid nasal tip, hypogonadism, and body agenesis. Here we show that a complex skeletal malformation of the hind limb in Galloway cattle together with other developmental anomalies is a recessive autosomal disorder most likely caused by a duplication of 20 bp in exon 2 of the bovine ALX4 gene. A second duplication of 34 bp in exon 4 of the same gene has no known effect, although both duplications result in a frameshift and premature stop codon leading to a truncated protein. Genotyping of 1,688 Black/Red/Belted/Riggit Galloway (GA and 289 White Galloway (WGA cattle showed that the duplication in exon 2 has allele frequencies of 1% in GA and 6% in WGA and the duplication in exon 4 has frequencies of 23% in GA and 38% in WGA. Both duplications were not detected in 876 randomly selected German Holstein Friesian and 86 cattle of 21 other breeds. Hence, we have identified a candidate causative mutation for tibial hemimelia syndrome in Galloway cattle and selection against this mutation can be used to eliminate the mutant allele from the breed.

  13. The roles of gene duplication, gene conversion and positive selection in rodent Esp and Mup pheromone gene families with comparison to the Abp family.

    Science.gov (United States)

    Karn, Robert C; Laukaitis, Christina M

    2012-01-01

    Three proteinaceous pheromone families, the androgen-binding proteins (ABPs), the exocrine-gland secreting peptides (ESPs) and the major urinary proteins (MUPs) are encoded by large gene families in the genomes of Mus musculus and Rattus norvegicus. We studied the evolutionary histories of the Mup and Esp genes and compared them with what is known about the Abp genes. Apparently gene conversion has played little if any role in the expansion of the mouse Class A and Class B Mup genes and pseudogenes, and the rat Mups. By contrast, we found evidence of extensive gene conversion in many Esp genes although not in all of them. Our studies of selection identified at least two amino acid sites in β-sheets as having evolved under positive selection in the mouse Class A and Class B MUPs and in rat MUPs. We show that selection may have acted on the ESPs by determining K(a)/K(s) for Exon 3 sequences with and without the converted sequence segment. While it appears that purifying selection acted on the ESP signal peptides, the secreted portions of the ESPs probably have undergone much more rapid evolution. When the inner gene converted fragment sequences were removed, eleven Esp paralogs were present in two or more pairs with K(a)/K(s) >1.0 and thus we propose that positive selection is detectable by this means in at least some mouse Esp paralogs. We compare and contrast the evolutionary histories of all three mouse pheromone gene families in light of their proposed functions in mouse communication.

  14. The evolution and appearance of C3 duplications in fish originate an exclusive teleost c3 gene form with anti-inflammatory activity.

    Directory of Open Access Journals (Sweden)

    Gabriel Forn-Cuní

    Full Text Available The complement system acts as a first line of defense and promotes organism homeostasis by modulating the fates of diverse physiological processes. Multiple copies of component genes have been previously identified in fish, suggesting a key role for this system in aquatic organisms. Herein, we confirm the presence of three different previously reported complement c3 genes (c3.1, c3.2, c3.3 and identify five additional c3 genes (c3.4, c3.5, c3.6, c3.7, c3.8 in the zebrafish genome. Additionally, we evaluate the mRNA expression levels of the different c3 genes during ontogeny and in different tissues under steady-state and inflammatory conditions. Furthermore, while reconciling the phylogenetic tree with the fish species tree, we uncovered an event of c3 duplication common to all teleost fishes that gave rise to an exclusive c3 paralog (c3.7 and c3.8. These paralogs showed a distinct ability to regulate neutrophil migration in response to injury compared with the other c3 genes and may play a role in maintaining the balance between inflammatory and homeostatic processes in zebrafish.

  15. Characterization of the interferon genes in homozygous rainbow trout reveals two novel genes, alternate splicing and differential regulation of duplicated genes

    Science.gov (United States)

    Purcell, M.K.; Laing, K.J.; Woodson, J.C.; Thorgaard, G.H.; Hansen, J.D.

    2009-01-01

    The genes encoding the type I and type II interferons (IFNs) have previously been identified in rainbow trout and their proteins partially characterized. These previous studies reported a single type II IFN (rtIFN-??) and three rainbow trout type I IFN genes that are classified into either group I (rtIFN1, rtIFN2) or group II (rtIFN3). In this present study, we report the identification of a novel IFN-?? gene (rtIFN-??2) and a novel type I group II IFN (rtIFN4) in homozygous rainbow trout and predict that additional IFN genes or pseudogenes exist in the rainbow trout genome. Additionally, we provide evidence that short and long forms of rtIFN1 are actively and differentially transcribed in homozygous trout, and likely arose due to alternate splicing of the first exon. Quantitative reverse transcriptase PCR (qRT-PCR) assays were developed to systematically profile all of the rainbow trout IFN transcripts, with high specificity at an individual gene level, in na??ve fish and after stimulation with virus or viral-related molecules. Cloned PCR products were used to ensure the specificity of the qRT-PCR assays and as absolute standards to assess transcript abundance of each gene. All IFN genes were modulated in response to Infectious hematopoietic necrosis virus (IHNV), a DNA vaccine based on the IHNV glycoprotein, and poly I:C. The most inducible of the type I IFN genes, by all stimuli tested, were rtIFN3 and the short transcript form of rtIFN1. Gene expression of rtIFN-??1 and rtIFN-??2 was highly up-regulated by IHNV infection and DNA vaccination but rtIFN-??2 was induced to a greater magnitude. The specificity of the qRT-PCR assays reported here will be useful for future studies aimed at identifying which cells produce IFNs at early time points after infection. ?? 2008 Elsevier Ltd.

  16. Evolutionary history and functional divergence of the cytochrome P450 gene superfamily between Arabidopsis thaliana and Brassica species uncover effects of whole genome and tandem duplications.

    Science.gov (United States)

    Yu, Jingyin; Tehrim, Sadia; Wang, Linhai; Dossa, Komivi; Zhang, Xiurong; Ke, Tao; Liao, Boshou

    2017-09-18

    The cytochrome P450 monooxygenase (P450) superfamily is involved in the biosynthesis of various primary and secondary metabolites. However, little is known about the effects of whole genome duplication (WGD) and tandem duplication (TD) events on the evolutionary history and functional divergence of P450s in Brassica after splitting from a common ancestor with Arabidopsis thaliana. Using Hidden Markov Model search and manual curation, we detected that Brassica species have nearly 1.4-fold as many P450 members as A. thaliana. Most P450s in A. thaliana and Brassica species were located on pseudo-chromosomes. The inferred phylogeny indicated that all P450s were clustered into two different subgroups. Analysis of WGD event revealed that different P450 gene families had appeared after evolutionary events of species. For the TD event analyses, the P450s from TD events in Brassica species can be divided into ancient and recent parts. Our comparison of influence of WGD and TD events on the P450 gene superfamily between A. thaliana and Brassica species indicated that the family-specific evolution in the Brassica lineage can be attributed to both WGD and TD, whereas WGD was recognized as the major mechanism for the recent evolution of the P450 super gene family. Expression analysis of P450s from A. thaliana and Brassica species indicated that WGD-type P450s showed the same expression pattern but completely different expression with TD-type P450s across different tissues in Brassica species. Selection force analysis suggested that P450 orthologous gene pairs between A. thaliana and Brassica species underwent negative selection, but no significant differences were found between P450 orthologous gene pairs in A. thaliana-B. rapa and A. thaliana-B. oleracea lineages, as well as in different subgenomes in B. rapa or B. oleracea compared with A. thaliana. This study is the first to investigate the effects of WGD and TD on the evolutionary history and functional divergence of P450

  17. Finding all sorting tandem duplication random loss operations

    DEFF Research Database (Denmark)

    Bernt, Matthias; Chen, Kuan Yu; Chen, Ming Chiang

    2011-01-01

    A tandem duplication random loss (TDRL) operation duplicates a contiguous segment of genes, followed by the random loss of one copy of each of the duplicated genes. Although the importance of this operation is founded by several recent biological studies, it has been investigated only rarely from...

  18. Forest gene conservation from the perspective of the international community

    Science.gov (United States)

    M. Hosny El-Lakany

    2017-01-01

    conservation of forest genetic resources (FGR). After presenting internationally adopted definitions of some terms related to FGR, the characteristics of the current state of FGR conservation from a global perspective are summarized. Many international and regional organizations and institutions are engaged in the conservation of FGR at degrees ranging from...

  19. Expression of embryonic hemoglobin genes in mice heterozygous for α-thalassemia or β-duplication traits and in mice heterozygous for both traits

    International Nuclear Information System (INIS)

    Popp, R.A.; Marsh, C.L.; Skow, L.C.

    1981-01-01

    Hemoglobins of mouse embryos at 11.5 through 16.5 days of gestation were separated by electrophoresis on cellulose acetate and quantitated by a scanning densitometer to study the effects of two radiation-induced mutations on the expression of embryonic hemoglobin genes in mice. Normal mice produce three kinds of embryonic hemoglobins. In heterozygous α-thalassemic embryos, expression of EI (x 2 y 2 ) and EII (α 2 y 2 ) is deficient because the x- and α-globin genes of one of the allelic pairs of Hba on chromosome 11 was deleted or otherwise inactivated by X irradiation. Simultaneous inactivation of the x- and α-globin genes indicates that these genes must be closely linked. Reduced x- and α-chain synthesis results in an excess of y chains that associate as homotetramers. This unique y 4 hemoglobin also appears in β-duplication embryos where excess y chains are produced by the presence of three rather than two functional alleles of y- and β-globin genes. In double heterozygotes, which have a single functional allele of x- and α-globin genes and three functional alleles of y- and β-globin genes, synthesis of α and non-α chains is severely imbalanced and half of the total hemoglobin is y 4 . Mouse y 4 has a high affinity for oxygen, P 50 of less than 10 mm Hg, but it lacks cooperativity so is inefficient for oxygen transport. The death of double heterozygotes in late fetal or neonatal life may be in large part to oxygen deprivation to the tissues

  20. Life-threatening Arrhythmias in a Becker Muscular Dystrophy Family due to the Duplication of Exons 3-4 of the Dystrophin Gene.

    Science.gov (United States)

    Ishizaki, Masatoshi; Fujimoto, Akiko; Ueyama, Hidetsugu; Nishida, Yasuto; Imamura, Shigehiro; Uchino, Makoto; Ando, Yukio

    2015-01-01

    We herein present a report of three patients with Becker muscular dystrophy in the same family who developed complete atrioventricular block or ventricular tachycardia with severe cardiomyopathy. Our cases became unable to walk in their teens, and were introduced to mechanical ventilation due to respiratory muscle weakness in their twenties and thirties. In all three cases, a medical device such as a permanent cardiac pacemaker or an implantable cardiac defibrillator was considered to be necessary. The duplication of exons 3-4 in the dystrophin gene was detected in two of the patients. In patients with Becker muscular dystrophy, complete atrioventricular block or ventricular tachycardia within a family has rarely been reported. Thus attention should be paid to the possibility of severe arrhythmias in the severe phenotype of Becker muscular dystrophy.

  1. Genes with stable DNA methylation levels show higher evolutionary conservation than genes with fluctuant DNA methylation levels.

    Science.gov (United States)

    Zhang, Ruijie; Lv, Wenhua; Luan, Meiwei; Zheng, Jiajia; Shi, Miao; Zhu, Hongjie; Li, Jin; Lv, Hongchao; Zhang, Mingming; Shang, Zhenwei; Duan, Lian; Jiang, Yongshuai

    2015-11-24

    Different human genes often exhibit different degrees of stability in their DNA methylation levels between tissues, samples or cell types. This may be related to the evolution of human genome. Thus, we compared the evolutionary conservation between two types of genes: genes with stable DNA methylation levels (SM genes) and genes with fluctuant DNA methylation levels (FM genes). For long-term evolutionary characteristics between species, we compared the percentage of the orthologous genes, evolutionary rate dn/ds and protein sequence identity. We found that the SM genes had greater percentages of the orthologous genes, lower dn/ds, and higher protein sequence identities in all the 21 species. These results indicated that the SM genes were more evolutionarily conserved than the FM genes. For short-term evolutionary characteristics among human populations, we compared the single nucleotide polymorphism (SNP) density, and the linkage disequilibrium (LD) degree in HapMap populations and 1000 genomes project populations. We observed that the SM genes had lower SNP densities, and higher degrees of LD in all the 11 HapMap populations and 13 1000 genomes project populations. These results mean that the SM genes had more stable chromosome genetic structures, and were more conserved than the FM genes.

  2. Comparative genome analysis of PHB gene family reveals deep evolutionary origins and diverse gene function.

    Science.gov (United States)

    Di, Chao; Xu, Wenying; Su, Zhen; Yuan, Joshua S

    2010-10-07

    PHB (Prohibitin) gene family is involved in a variety of functions important for different biological processes. PHB genes are ubiquitously present in divergent species from prokaryotes to eukaryotes. Human PHB genes have been found to be associated with various diseases. Recent studies by our group and others have shown diverse function of PHB genes in plants for development, senescence, defence, and others. Despite the importance of the PHB gene family, no comprehensive gene family analysis has been carried to evaluate the relatedness of PHB genes across different species. In order to better guide the gene function analysis and understand the evolution of the PHB gene family, we therefore carried out the comparative genome analysis of the PHB genes across different kingdoms. The relatedness, motif distribution, and intron/exon distribution all indicated that PHB genes is a relatively conserved gene family. The PHB genes can be classified into 5 classes and each class have a very deep evolutionary origin. The PHB genes within the class maintained the same motif patterns during the evolution. With Arabidopsis as the model species, we found that PHB gene intron/exon structure and domains are also conserved during the evolution. Despite being a conserved gene family, various gene duplication events led to the expansion of the PHB genes. Both segmental and tandem gene duplication were involved in Arabidopsis PHB gene family expansion. However, segmental duplication is predominant in Arabidopsis. Moreover, most of the duplicated genes experienced neofunctionalization. The results highlighted that PHB genes might be involved in important functions so that the duplicated genes are under the evolutionary pressure to derive new function. PHB gene family is a conserved gene family and accounts for diverse but important biological functions based on the similar molecular mechanisms. The highly diverse biological function indicated that more research needs to be carried out

  3. The house spider genome reveals an ancient whole-genome duplication during arachnid evolution.

    Science.gov (United States)

    Schwager, Evelyn E; Sharma, Prashant P; Clarke, Thomas; Leite, Daniel J; Wierschin, Torsten; Pechmann, Matthias; Akiyama-Oda, Yasuko; Esposito, Lauren; Bechsgaard, Jesper; Bilde, Trine; Buffry, Alexandra D; Chao, Hsu; Dinh, Huyen; Doddapaneni, HarshaVardhan; Dugan, Shannon; Eibner, Cornelius; Extavour, Cassandra G; Funch, Peter; Garb, Jessica; Gonzalez, Luis B; Gonzalez, Vanessa L; Griffiths-Jones, Sam; Han, Yi; Hayashi, Cheryl; Hilbrant, Maarten; Hughes, Daniel S T; Janssen, Ralf; Lee, Sandra L; Maeso, Ignacio; Murali, Shwetha C; Muzny, Donna M; Nunes da Fonseca, Rodrigo; Paese, Christian L B; Qu, Jiaxin; Ronshaugen, Matthew; Schomburg, Christoph; Schönauer, Anna; Stollewerk, Angelika; Torres-Oliva, Montserrat; Turetzek, Natascha; Vanthournout, Bram; Werren, John H; Wolff, Carsten; Worley, Kim C; Bucher, Gregor; Gibbs, Richard A; Coddington, Jonathan; Oda, Hiroki; Stanke, Mario; Ayoub, Nadia A; Prpic, Nikola-Michael; Flot, Jean-François; Posnien, Nico; Richards, Stephen; McGregor, Alistair P

    2017-07-31

    The duplication of genes can occur through various mechanisms and is thought to make a major contribution to the evolutionary diversification of organisms. There is increasing evidence for a large-scale duplication of genes in some chelicerate lineages including two rounds of whole genome duplication (WGD) in horseshoe crabs. To investigate this further, we sequenced and analyzed the genome of the common house spider Parasteatoda tepidariorum. We found pervasive duplication of both coding and non-coding genes in this spider, including two clusters of Hox genes. Analysis of synteny conservation across the P. tepidariorum genome suggests that there has been an ancient WGD in spiders. Comparison with the genomes of other chelicerates, including that of the newly sequenced bark scorpion Centruroides sculpturatus, suggests that this event occurred in the common ancestor of spiders and scorpions, and is probably independent of the WGDs in horseshoe crabs. Furthermore, characterization of the sequence and expression of the Hox paralogs in P. tepidariorum suggests that many have been subject to neo-functionalization and/or sub-functionalization since their duplication. Our results reveal that spiders and scorpions are likely the descendants of a polyploid ancestor that lived more than 450 MYA. Given the extensive morphological diversity and ecological adaptations found among these animals, rivaling those of vertebrates, our study of the ancient WGD event in Arachnopulmonata provides a new comparative platform to explore common and divergent evolutionary outcomes of polyploidization events across eukaryotes.

  4. Preferential transcription of conserved rif genes in two phenotypically distinct Plasmodium falciparum parasite lines

    DEFF Research Database (Denmark)

    Wang, Christian W; Magistrado, Pamela A; Nielsen, Morten A

    2009-01-01

    transcribed in the VAR2CSA-expressing parasite line. In addition, two rif genes were found transcribed at early and late intra-erythrocyte stages independently of var gene transcription. Rif genes are organised in groups and inter-genomic conserved gene families, suggesting that RIFIN sub-groups may have......Plasmodium falciparum variant surface antigens (VSA) are targets of protective immunity to malaria. Plasmodium falciparum erythrocyte membrane protein 1 (PfEMP1) and repetitive interspersed family (RIFIN) proteins are encoded by the two variable multigene families, var and rif genes, respectively...... novel rif gene groups, rifA1 and rifA2, containing inter-genomic conserved rif genes, were identified. All rifA1 genes were orientated head-to-head with a neighbouring Group A var gene whereas rifA2 was present in all parasite genomes as a single copy gene with a unique 5' untranslated region. Rif...

  5. A synergism between adaptive effects and evolvability drives whole genome duplication to fixation.

    Directory of Open Access Journals (Sweden)

    Thomas D Cuypers

    2014-04-01

    Full Text Available Whole genome duplication has shaped eukaryotic evolutionary history and has been associated with drastic environmental change and species radiation. While the most common fate of WGD duplicates is a return to single copy, retained duplicates have been found enriched for highly interacting genes. This pattern has been explained by a neutral process of subfunctionalization and more recently, dosage balance selection. However, much about the relationship between environmental change, WGD and adaptation remains unknown. Here, we study the duplicate retention pattern postWGD, by letting virtual cells adapt to environmental changes. The virtual cells have structured genomes that encode a regulatory network and simple metabolism. Populations are under selection for homeostasis and evolve by point mutations, small indels and WGD. After populations had initially adapted fully to fluctuating resource conditions re-adaptation to a broad range of novel environments was studied by tracking mutations in the line of descent. WGD was established in a minority (≈30% of lineages, yet, these were significantly more successful at re-adaptation. Unexpectedly, WGD lineages conserved more seemingly redundant genes, yet had higher per gene mutation rates. While WGD duplicates of all functional classes were significantly over-retained compared to a model of neutral losses, duplicate retention was clearly biased towards highly connected TFs. Importantly, no subfunctionalization occurred in conserved pairs, strongly suggesting that dosage balance shaped retention. Meanwhile, singles diverged significantly. WGD, therefore, is a powerful mechanism to cope with environmental change, allowing conservation of a core machinery, while adapting the peripheral network to accommodate change.

  6. Role of the duplicated CCAAT box region in γ-globin gene regulation and hereditary persistence of fetal haemoglobin.

    NARCIS (Netherlands)

    A. Ronchi (Antonella); M. Berry (Meera); S. Raguz (Selina); A.M.A. Imam (Ali); N. Yannoutsos (Nikos); S. Ottolenghi (Sergio); F.G. Grosveld (Frank); N.O. Dillon (Niall)

    1996-01-01

    textabstractHereditary persistence of fetal haemoglobin (HPFH) is a clinically important condition in which a change in the developmental specificity of the gamma-globin genes results in varying levels of expression of fetal haemoglobin in the adult. The condition is benign and can significantly

  7. MECP2 Duplication Syndrome

    DEFF Research Database (Denmark)

    Signorini, Cinzia; De Felice, Claudio; Leoncini, Silvia

    2016-01-01

    Rett syndrome (RTT) and MECP2 duplication syndrome (MDS) are neurodevelopmental disorders caused by alterations in the methyl-CpG binding protein 2 (MECP2) gene expression. A relationship between MECP2 loss-of-function mutations and oxidative stress has been previously documented in RTT patients...... and murine models. To date, no data on oxidative stress have been reported for the MECP2 gain-of-function mutations in patients with MDS. In the present work, the pro-oxidant status and oxidative fatty acid damage in MDS was investigated (subjects n = 6) and compared to RTT (subjects n = 24) and healthy...... similar to those observed in RTT patients except for higher plasma F2-isoprostanes levels (P work shows unique data in patients affected by MDS. For the first...

  8. The fate of the duplicated androgen receptor in fishes: a late neofunctionalization event?

    Directory of Open Access Journals (Sweden)

    Haendler Bernard

    2008-12-01

    Full Text Available Abstract Background Based on the observation of an increased number of paralogous genes in teleost fishes compared with other vertebrates and on the conserved synteny between duplicated copies, it has been shown that a whole genome duplication (WGD occurred during the evolution of Actinopterygian fish. Comparative phylogenetic dating of this duplication event suggests that it occurred early on, specifically in teleosts. It has been proposed that this event might have facilitated the evolutionary radiation and the phenotypic diversification of the teleost fish, notably by allowing the sub- or neo-functionalization of many duplicated genes. Results In this paper, we studied in a wide range of Actinopterygians the duplication and fate of the androgen receptor (AR, NR3C4, a nuclear receptor known to play a key role in sex-determination in vertebrates. The pattern of AR gene duplication is consistent with an early WGD event: it has been duplicated into two genes AR-A and AR-B after the split of the Acipenseriformes from the lineage leading to teleost fish but before the divergence of Osteoglossiformes. Genomic and syntenic analyses in addition to lack of PCR amplification show that one of the duplicated copies, AR-B, was lost in several basal Clupeocephala such as Cypriniformes (including the model species zebrafish, Siluriformes, Characiformes and Salmoniformes. Interestingly, we also found that, in basal teleost fish (Osteoglossiformes and Anguilliformes, the two copies remain very similar, whereas, specifically in Percomorphs, one of the copies, AR-B, has accumulated substitutions in both the ligand binding domain (LBD and the DNA binding domain (DBD. Conclusion The comparison of the mutations present in these divergent AR-B with those known in human to be implicated in complete, partial or mild androgen insensitivity syndrome suggests that the existence of two distinct AR duplicates may be correlated to specific functional differences that may be

  9. Conservation of transcription factor binding events predicts gene expression across species

    Science.gov (United States)

    Hemberg, Martin; Kreiman, Gabriel

    2011-01-01

    Recent technological advances have made it possible to determine the genome-wide binding sites of transcription factors (TFs). Comparisons across species have suggested a relatively low degree of evolutionary conservation of experimentally defined TF binding events (TFBEs). Using binding data for six different TFs in hepatocytes and embryonic stem cells from human and mouse, we demonstrate that evolutionary conservation of TFBEs within orthologous proximal promoters is closely linked to function, defined as expression of the target genes. We show that (i) there is a significantly higher degree of conservation of TFBEs when the target gene is expressed in both species; (ii) there is increased conservation of binding events for groups of TFs compared to individual TFs; and (iii) conserved TFBEs have a greater impact on the expression of their target genes than non-conserved ones. These results link conservation of structural elements (TFBEs) to conservation of function (gene expression) and suggest a higher degree of functional conservation than implied by previous studies. PMID:21622661

  10. Disease association with two Helicobacter pylori duplicate outer membrane protein genes, homB and homA.

    Science.gov (United States)

    Oleastro, Monica; Cordeiro, Rita; Yamaoka, Yoshio; Queiroz, Dulciene; Mégraud, Francis; Monteiro, Lurdes; Ménard, Armelle

    2009-06-22

    homB encodes a Helicobacter pylori outer membrane protein. This gene was previously associated with peptic ulcer disease (PUD) and was shown to induce activation of interleukin-8 secretion in vitro, as well as contributing to bacterial adherence. Its 90%-similar gene, homA, was previously correlated with gastritis. The present study aimed to evaluate the gastric disease association with homB and homA, as well as with the H. pylori virulence factors cagA, babA and vacA, in 415 H. pylori strains isolated from patients from East Asian and Western countries. The correlation among these genotypes was also evaluated. Both homB and homA genes were heterogeneously distributed worldwide, with a marked difference between East Asian and Western strains. In Western strains (n = 234, 124 PUD and 110 non-ulcer dyspepsia (NUD), homB, cagA and vacA s1 were all significantly associated with PUD (p = 0.025, p = 0.014, p = 0.039, respectively), and homA was closely correlated with NUD (p = 0.072). In East Asian strains (n = 138, 73 PUD and 65 NUD), homB was found more frequently than homA, and none of these genes was associated with the clinical outcome. Overall, homB was associated with the presence of cagA (p = 0.043) and vacA s1 (p homA was found more frequently in cagA-negative (p = 0.062) and vacA s2 (p homA copy number were observed, with a clear geographical specificity, suggesting an involvement of these genes in host adaptation. A correlation between the homB two-copy genotype and PUD was also observed, emphasizing the role of homB in the virulence of the strain. The global results suggest that homB and homA contribute to the determination of clinical outcome.

  11. Identifying human disease genes through cross-species gene mapping of evolutionary conserved processes.

    Directory of Open Access Journals (Sweden)

    Martin Poot

    2011-05-01

    Full Text Available Understanding complex networks that modulate development in humans is hampered by genetic and phenotypic heterogeneity within and between populations. Here we present a method that exploits natural variation in highly diverse mouse genetic reference panels in which genetic and environmental factors can be tightly controlled. The aim of our study is to test a cross-species genetic mapping strategy, which compares data of gene mapping in human patients with functional data obtained by QTL mapping in recombinant inbred mouse strains in order to prioritize human disease candidate genes.We exploit evolutionary conservation of developmental phenotypes to discover gene variants that influence brain development in humans. We studied corpus callosum volume in a recombinant inbred mouse panel (C57BL/6J×DBA/2J, BXD strains using high-field strength MRI technology. We aligned mouse mapping results for this neuro-anatomical phenotype with genetic data from patients with abnormal corpus callosum (ACC development.From the 61 syndromes which involve an ACC, 51 human candidate genes have been identified. Through interval mapping, we identified a single significant QTL on mouse chromosome 7 for corpus callosum volume with a QTL peak located between 25.5 and 26.7 Mb. Comparing the genes in this mouse QTL region with those associated with human syndromes (involving ACC and those covered by copy number variations (CNV yielded a single overlap, namely HNRPU in humans and Hnrpul1 in mice. Further analysis of corpus callosum volume in BXD strains revealed that the corpus callosum was significantly larger in BXD mice with a B genotype at the Hnrpul1 locus than in BXD mice with a D genotype at Hnrpul1 (F = 22.48, p<9.87*10(-5.This approach that exploits highly diverse mouse strains provides an efficient and effective translational bridge to study the etiology of human developmental disorders, such as autism and schizophrenia.

  12. Startling mosaicism of the Y-chromosome and tandem duplication of the SRY and DAZ genes in patients with Turner Syndrome.

    Directory of Open Access Journals (Sweden)

    Sanjay Premi

    Full Text Available Presence of the human Y-chromosome in females with Turner Syndrome (TS enhances the risk of development of gonadoblastoma besides causing several other phenotypic abnormalities. In the present study, we have analyzed the Y chromosome in 15 clinically diagnosed Turner Syndrome (TS patients and detected high level of mosaicisms ranging from 45,XO:46,XY = 100:0% in 4; 45,XO:46,XY:46XX = 4:94:2 in 8; and 45,XO:46,XY:46XX = 50:30:20 cells in 3 TS patients, unlike previous reports showing 5-8% cells with Y- material. Also, no ring, marker or di-centric Y was observed in any of the cases. Of the two TS patients having intact Y chromosome in >85% cells, one was exceptionally tall. Both the patients were positive for SRY, DAZ, CDY1, DBY, UTY and AZFa, b and c specific STSs. Real Time PCR and FISH demonstrated tandem duplication/multiplication of the SRY and DAZ genes. At sequence level, the SRY was normal in 8 TS patients while the remaining 7 showed either absence of this gene or known and novel mutations within and outside of the HMG box. SNV/SFV analysis showed normal four copies of the DAZ genes in these 8 patients. All the TS patients showed aplastic uterus with no ovaries and no symptom of gonadoblastoma. Present study demonstrates new types of polymorphisms indicating that no two TS patients have identical genotype-phenotype. Thus, a comprehensive analysis of more number of samples is warranted to uncover consensus on the loci affected, to be able to use them as potential diagnostic markers.

  13. Myxococcus xanthus DK1622 Coordinates Expressions of the Duplicate groEL and Single groES Genes for Synergistic Functions of GroELs and GroES

    Directory of Open Access Journals (Sweden)

    Yue-zhong Li

    2017-04-01

    Full Text Available Chaperonin GroEL (Cpn60 requires cofactor GroES (Cpn10 for protein refolding in bacteria that possess single groEL and groES genes in a bicistronic groESL operon. Among 4,861 completely-sequenced prokaryotic genomes, 884 possess duplicate groEL genes and 770 possess groEL genes with no neighboring groES. It is unclear whether stand-alone groEL requires groES in order to function and, if required, how duplicate groEL genes and unequal groES genes balance their expressions. In Myxococcus xanthus DK1622, we determined that, while duplicate groELs were alternatively deletable, the single groES that clusters with groEL1 was essential for cell survival. Either GroEL1 or GroEL2 required interactions with GroES for in vitro and in vivo functions. Deletion of groEL1 or groEL2 resulted in decreased expressions of both groEL and groES; and ectopic complementation of groEL recovered not only the groEL but also groES expressions. The addition of an extra groES gene upstream groEL2 to form a bicistronic operon had almost no influence on groES expression and the cell survival rate, whereas over-expression of groES using a self-replicating plasmid simultaneously increased the groEL expressions. The results indicated that M. xanthus DK1622 cells coordinate expressions of the duplicate groEL and single groES genes for synergistic functions of GroELs and GroES. We proposed a potential regulation mechanism for the expression coordination.

  14. Ancestral genomic duplication of the insulin gene in tilapia: An analysis of possible implications for clinical islet xenotransplantation using donor islets from transgenic tilapia expressing a humanized insulin gene.

    Science.gov (United States)

    Hrytsenko, Olga; Pohajdak, Bill; Wright, James R

    2016-07-03

    Tilapia, a teleost fish, have multiple large anatomically discrete islets which are easy to harvest, and when transplanted into diabetic murine recipients, provide normoglycemia and mammalian-like glucose tolerance profiles. Tilapia insulin differs structurally from human insulin which could preclude their use as islet donors for xenotransplantation. Therefore, we produced transgenic tilapia with islets expressing a humanized insulin gene. It is now known that fish genomes may possess an ancestral duplication and so tilapia may have a second insulin gene. Therefore, we cloned, sequenced, and characterized the tilapia insulin 2 transcript and found that its expression is negligible in islets, is not islet-specific, and would not likely need to be silenced in our transgenic fish.

  15. Evaluation of the conserve flavin reductase gene from three ...

    African Journals Online (AJOL)

    STORAGESEVER

    2009-12-15

    Dec 15, 2009 ... means of PCR technique. The nucleic acid sequences of the PCR primers were designed using conserved nucleic acid sequences of the flavin reductase enzyme from. Rhodococcus sp. strain IGTS8. The oligonucleotide primers were as follows: 5'-GAA TTC ATG TCT GAC. AAG CCG AAT GCC-3' (forward) ...

  16. From genes to landscapes: conserving biodiversity at multiple scales.

    Science.gov (United States)

    Sally. Duncan

    2000-01-01

    Biodiversity has at last become a familiar term outside of scientific circles. Ways of measuring it and mapping it are advancing and becoming more complex, but ways of deciding how to conserve it remain mixed at best, and the resources available to manage dimishing biodiversity are themselves scarce. One significant problem is that policy decisions are frequently at...

  17. Eucaryotic operon genes can define highly conserved syntenies

    Czech Academy of Sciences Publication Activity Database

    Trachtulec, Zdeněk

    2004-01-01

    Roč. 50, - (2004), s. 1-6 ISSN 0015-5500 R&D Projects: GA ČR GA204/01/0997; GA MŠk LN00A079 Institutional research plan: CEZ:AV0Z5052915 Keywords : eukaryotic operon * conserved synteny Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 0.507, year: 2004

  18. Characterization of Conserved and Non-conserved Imprinted Genes in Swine

    Science.gov (United States)

    In order to increase our understanding of the role of imprinted genes in swine reproduction we used two complementary approaches, analysis of imprinting by pyrosequencing, and expression profiling of parthenogenetic fetuses, to carry out a comprehensive analysis of this gene family in swine. Using A...

  19. Conservation in Mammals of Genes Associated with Aggression-Related Behavioral Phenotypes in Honey Bees.

    Science.gov (United States)

    Liu, Hui; Robinson, Gene E; Jakobsson, Eric

    2016-06-01

    The emerging field of sociogenomics explores the relations between social behavior and genome structure and function. An important question is the extent to which associations between social behavior and gene expression are conserved among the Metazoa. Prior experimental work in an invertebrate model of social behavior, the honey bee, revealed distinct brain gene expression patterns in African and European honey bees, and within European honey bees with different behavioral phenotypes. The present work is a computational study of these previous findings in which we analyze, by orthology determination, the extent to which genes that are socially regulated in honey bees are conserved across the Metazoa. We found that the differentially expressed gene sets associated with alarm pheromone response, the difference between old and young bees, and the colony influence on soldier bees, are enriched in widely conserved genes, indicating that these differences have genomic bases shared with many other metazoans. By contrast, the sets of differentially expressed genes associated with the differences between African and European forager and guard bees are depleted in widely conserved genes, indicating that the genomic basis for this social behavior is relatively specific to honey bees. For the alarm pheromone response gene set, we found a particularly high degree of conservation with mammals, even though the alarm pheromone itself is bee-specific. Gene Ontology identification of human orthologs to the strongly conserved honey bee genes associated with the alarm pheromone response shows overrepresentation of protein metabolism, regulation of protein complex formation, and protein folding, perhaps associated with remodeling of critical neural circuits in response to alarm pheromone. We hypothesize that such remodeling may be an adaptation of social animals to process and respond appropriately to the complex patterns of conspecific communication essential for social organization.

  20. Conservation in Mammals of Genes Associated with Aggression-Related Behavioral Phenotypes in Honey Bees.

    Directory of Open Access Journals (Sweden)

    Hui Liu

    2016-06-01

    Full Text Available The emerging field of sociogenomics explores the relations between social behavior and genome structure and function. An important question is the extent to which associations between social behavior and gene expression are conserved among the Metazoa. Prior experimental work in an invertebrate model of social behavior, the honey bee, revealed distinct brain gene expression patterns in African and European honey bees, and within European honey bees with different behavioral phenotypes. The present work is a computational study of these previous findings in which we analyze, by orthology determination, the extent to which genes that are socially regulated in honey bees are conserved across the Metazoa. We found that the differentially expressed gene sets associated with alarm pheromone response, the difference between old and young bees, and the colony influence on soldier bees, are enriched in widely conserved genes, indicating that these differences have genomic bases shared with many other metazoans. By contrast, the sets of differentially expressed genes associated with the differences between African and European forager and guard bees are depleted in widely conserved genes, indicating that the genomic basis for this social behavior is relatively specific to honey bees. For the alarm pheromone response gene set, we found a particularly high degree of conservation with mammals, even though the alarm pheromone itself is bee-specific. Gene Ontology identification of human orthologs to the strongly conserved honey bee genes associated with the alarm pheromone response shows overrepresentation of protein metabolism, regulation of protein complex formation, and protein folding, perhaps associated with remodeling of critical neural circuits in response to alarm pheromone. We hypothesize that such remodeling may be an adaptation of social animals to process and respond appropriately to the complex patterns of conspecific communication essential for

  1. New Genome Similarity Measures based on Conserved Gene Adjacencies.

    Science.gov (United States)

    Doerr, Daniel; Kowada, Luis Antonio B; Araujo, Eloi; Deshpande, Shachi; Dantas, Simone; Moret, Bernard M E; Stoye, Jens

    2017-06-01

    Many important questions in molecular biology, evolution, and biomedicine can be addressed by comparative genomic approaches. One of the basic tasks when comparing genomes is the definition of measures of similarity (or dissimilarity) between two genomes, for example, to elucidate the phylogenetic relationships between species. The power of different genome comparison methods varies with the underlying formal model of a genome. The simplest models impose the strong restriction that each genome under study must contain the same genes, each in exactly one copy. More realistic models allow several copies of a gene in a genome. One speaks of gene families, and comparative genomic methods that allow this kind of input are called gene family-based. The most powerful-but also most complex-models avoid this preprocessing of the input data and instead integrate the family assignment within the comparative analysis. Such methods are called gene family-free. In this article, we study an intermediate approach between family-based and family-free genomic similarity measures. Introducing this simpler model, called gene connections, we focus on the combinatorial aspects of gene family-free genome comparison. While in most cases, the computational costs to the general family-free case are the same, we also find an instance where the gene connections model has lower complexity. Within the gene connections model, we define three variants of genomic similarity measures that have different expression powers. We give polynomial-time algorithms for two of them, while we show NP-hardness for the third, most powerful one. We also generalize the measures and algorithms to make them more robust against recent local disruptions in gene order. Our theoretical findings are supported by experimental results, proving the applicability and performance of our newly defined similarity measures.

  2. Implications of duplicated cis-regulatory elements in the evolution of metazoans: the DDI model or how simplicity begets novelty.

    Science.gov (United States)

    Jiménez-Delgado, Senda; Pascual-Anaya, Juan; Garcia-Fernàndez, Jordi

    2009-07-01

    The discovery that most regulatory genes were conserved among animals from distant phyla challenged the ideas that gene duplication and divergence of homologous coding sequences were the basis for major morphological changes in metazoan evolution. In recent years, however, the interest for the roles, conservation and changes of non-coding sequences grew-up in parallel with genome sequencing projects. Presently, many independent studies are highlighting the importance that subtle changes in cis-regulatory regions had in the evolution of morphology trough the Animal Kingdom. Here we will show and discuss some of these studies, and underscore the future of cis-Evo-Devo research. Nevertheless, we would also explore how gene duplication, which includes duplication of regulatory regions, may have been critical for spatial or temporal co-option of new regulatory networks, causing the deployment of new transcriptome scenarios, and how these induced morphological changes were critical for the evolution of new forms. Forty years after Susumu Ohno famous sentence 'natural selection merely modifies, while redundancy creates', we suggest the alternative: 'natural selection modifies, while redundancy of cis-regulatory elements innovates', and propose the Duplication-Degeneration-Innovation model to explain the increased evolvability of duplicated cis-regulatory regions. Paradoxically, making regulation simpler by subfunctionalization paved the path for future complexity or, in other words, 'to make it simple to make it complex'.

  3. Duplication and concerted evolution of MiSp-encoding genes underlie the material properties of minor ampullate silks of cobweb weaving spiders.

    Science.gov (United States)

    Vienneau-Hathaway, Jannelle M; Brassfield, Elizabeth R; Lane, Amanda Kelly; Collin, Matthew A; Correa-Garhwal, Sandra M; Clarke, Thomas H; Schwager, Evelyn E; Garb, Jessica E; Hayashi, Cheryl Y; Ayoub, Nadia A

    2017-03-14

    Orb-web weaving spiders and their relatives use multiple types of task-specific silks. The majority of spider silk studies have focused on the ultra-tough dragline silk synthesized in major ampullate glands, but other silk types have impressive material properties. For instance, minor ampullate silks of orb-web weaving spiders are as tough as draglines, due to their higher extensibility despite lower strength. Differences in material properties between silk types result from differences in their component proteins, particularly members of the spidroin (spider fibroin) gene family. However, the extent to which variation in material properties within a single silk type can be explained by variation in spidroin sequences is unknown. Here, we compare the minor ampullate spidroins (MiSp) of orb-weavers and cobweb weavers. Orb-web weavers use minor ampullate silk to form the auxiliary spiral of the orb-web while cobweb weavers use it to wrap prey, suggesting that selection pressures on minor ampullate spidroins (MiSp) may differ between the two groups. We report complete or nearly complete MiSp sequences from five cobweb weaving spider species and measure material properties of minor ampullate silks in a subset of these species. We also compare MiSp sequences and silk properties of our cobweb weavers to published data for orb-web weavers. We demonstrate that all our cobweb weavers possess multiple MiSp loci and that one locus is more highly expressed in at least two species. We also find that the proportion of β-spiral-forming amino acid motifs in MiSp positively correlates with minor ampullate silk extensibility across orb-web and cobweb weavers. MiSp sequences vary dramatically within and among spider species, and have likely been subject to multiple rounds of gene duplication and concerted evolution, which have contributed to the diverse material properties of minor ampullate silks. Our sequences also provide templates for recombinant silk proteins with tailored

  4. Cytogenetics, conserved synteny and evolution of chicken fucosyltransferase genes compared to human

    NARCIS (Netherlands)

    Coullin, P.; Crooijmans, R.P.M.A.; Fillon, V.; Mollicone, R.; Groenen, M.A.M.; Adrien-Dehais, C.; Bernheim, A.; Zoorob, R.; Oriol, R.; Candelier, J.J.

    2003-01-01

    Fucosyltransferases appeared early in evolution, since they are present from bacteria to primates and the genes are well conserved. The aim of this work was to study these genes in the bird group, which is particularly attractive for the comprehension of the evolution of the vertebrate genome.

  5. Gene co-regulation is highly conserved in the evolution of eukaryotes and prokaryotes.

    NARCIS (Netherlands)

    Snel, B.; Noort, V. van; Huynen, M.A.

    2004-01-01

    Differences between species have been suggested to largely reside in the network of connections among the genes. Nevertheless, the rate at which these connections evolve has not been properly quantified. Here, we measure the extent to which co-regulation between pairs of genes is conserved over

  6. Directed evolution induces tributyrin hydrolysis in a virulence factor of Xylella fastidiosa using a duplicated gene as a template [v1; ref status: indexed, http://f1000r.es/48i

    Directory of Open Access Journals (Sweden)

    Hossein Gouran

    2014-09-01

    Full Text Available Duplication of genes is one of the preferred ways for natural selection to add advantageous functionality to the genome without having to reinvent the wheel with respect to catalytic efficiency and protein stability. The duplicated secretory virulence factors of Xylella fastidiosa (LesA, LesB and LesC, implicated in Pierce's disease of grape and citrus variegated chlorosis of citrus species, epitomizes the positive selection pressures exerted on advantageous genes in such pathogens. A deeper insight into the evolution of these lipases/esterases is essential to develop resistance mechanisms in transgenic plants. Directed evolution, an attempt to accelerate the evolutionary steps in the laboratory, is inherently simple when targeted for loss of function. A bigger challenge is to specify mutations that endow a new function, such as a lost functionality in a duplicated gene. Previously, we have proposed a method for enumerating candidates for mutations intended to transfer the functionality of one protein into another related protein based on the spatial and electrostatic properties of the active site residues (DECAAF. In the current work, we present in vivo validation of DECAAF by inducing tributyrin hydrolysis in LesB based on the active site similarity to LesA. The structures of these proteins have been modeled using RaptorX based on the closely related LipA protein from Xanthomonas oryzae. These mutations replicate the spatial and electrostatic conformation of LesA in the modeled structure of the mutant LesB as well, providing in silico validation before proceeding to the laborious in vivo work. Such focused mutations allows one to dissect the relevance of the duplicated genes in finer detail as compared to gene knockouts, since they do not interfere with other moonlighting functions, protein expression levels or protein-protein interaction.

  7. Conservation

    NARCIS (Netherlands)

    Noteboom, H.P.

    1985-01-01

    The IUCN/WWF Plants Conservation Programme 1984 — 1985. World Wildlife Fund chose plants to be the subject of their fund-raising campaign in the period 1984 — 1985. The objectives were to: 1. Use information techniques to achieve the conservation objectives of the Plants Programme – to save plants;

  8. Conservation.

    Science.gov (United States)

    National Audubon Society, New York, NY.

    This set of teaching aids consists of seven Audubon Nature Bulletins, providing the teacher and student with informational reading on various topics in conservation. The bulletins have these titles: Plants as Makers of Soil, Water Pollution Control, The Ground Water Table, Conservation--To Keep This Earth Habitable, Our Threatened Air Supply,…

  9. Inferring the conservative causal core of gene regulatory networks

    Directory of Open Access Journals (Sweden)

    Emmert-Streib Frank

    2010-09-01

    Full Text Available Abstract Background Inferring gene regulatory networks from large-scale expression data is an important problem that received much attention in recent years. These networks have the potential to gain insights into causal molecular interactions of biological processes. Hence, from a methodological point of view, reliable estimation methods based on observational data are needed to approach this problem practically. Results In this paper, we introduce a novel gene regulatory network inference (GRNI algorithm, called C3NET. We compare C3NET with four well known methods, ARACNE, CLR, MRNET and RN, conducting in-depth numerical ensemble simulations and demonstrate also for biological expression data from E. coli that C3NET performs consistently better than the best known GRNI methods in the literature. In addition, it has also a low computational complexity. Since C3NET is based on estimates of mutual information values in conjunction with a maximization step, our numerical investigations demonstrate that our inference algorithm exploits causal structural information in the data efficiently. Conclusions For systems biology to succeed in the long run, it is of crucial importance to establish methods that extract large-scale gene networks from high-throughput data that reflect the underlying causal interactions among genes or gene products. Our method can contribute to this endeavor by demonstrating that an inference algorithm with a neat design permits not only a more intuitive and possibly biological interpretation of its working mechanism but can also result in superior results.

  10. Inferring the conservative causal core of gene regulatory networks.

    Science.gov (United States)

    Altay, Gökmen; Emmert-Streib, Frank

    2010-09-28

    Inferring gene regulatory networks from large-scale expression data is an important problem that received much attention in recent years. These networks have the potential to gain insights into causal molecular interactions of biological processes. Hence, from a methodological point of view, reliable estimation methods based on observational data are needed to approach this problem practically. In this paper, we introduce a novel gene regulatory network inference (GRNI) algorithm, called C3NET. We compare C3NET with four well known methods, ARACNE, CLR, MRNET and RN, conducting in-depth numerical ensemble simulations and demonstrate also for biological expression data from E. coli that C3NET performs consistently better than the best known GRNI methods in the literature. In addition, it has also a low computational complexity. Since C3NET is based on estimates of mutual information values in conjunction with a maximization step, our numerical investigations demonstrate that our inference algorithm exploits causal structural information in the data efficiently. For systems biology to succeed in the long run, it is of crucial importance to establish methods that extract large-scale gene networks from high-throughput data that reflect the underlying causal interactions among genes or gene products. Our method can contribute to this endeavor by demonstrating that an inference algorithm with a neat design permits not only a more intuitive and possibly biological interpretation of its working mechanism but can also result in superior results.

  11. Duplication of the oesophagus

    International Nuclear Information System (INIS)

    Lingg, G.; Nebel, G.

    1981-01-01

    The article reports on the authors' own observation of a patient with duplication of the oesophagus. Basing on this case, the possibilities of the evolutionary origin are discussed briefly. The significance and decisive importance of X-ray film diagnosis in gastro-intestinal duplications is underlined. (orig.) [de

  12. Duplication of the oesophagus

    Energy Technology Data Exchange (ETDEWEB)

    Lingg, G; Nebel, G

    1981-08-01

    The article reports on the authors' own observation of a patient with duplication of the oesophagus. Basing on this case, the possibilities of the evolutionary origin are discussed briefly. The significance and decisive importance of X-ray film diagnosis in gastro-intestinal duplications is underlined.

  13. Identification of a conserved set of upregulated genes in mouse skeletal muscle hypertrophy and regrowth.

    Science.gov (United States)

    Chaillou, Thomas; Jackson, Janna R; England, Jonathan H; Kirby, Tyler J; Richards-White, Jena; Esser, Karyn A; Dupont-Versteegden, Esther E; McCarthy, John J

    2015-01-01

    The purpose of this study was to compare the gene expression profile of mouse skeletal muscle undergoing two forms of growth (hypertrophy and regrowth) with the goal of identifying a conserved set of differentially expressed genes. Expression profiling by microarray was performed on the plantaris muscle subjected to 1, 3, 5, 7, 10, and 14 days of hypertrophy or regrowth following 2 wk of hind-limb suspension. We identified 97 differentially expressed genes (≥2-fold increase or ≥50% decrease compared with control muscle) that were conserved during the two forms of muscle growth. The vast majority (∼90%) of the differentially expressed genes was upregulated and occurred at a single time point (64 out of 86 genes), which most often was on the first day of the time course. Microarray analysis from the conserved upregulated genes showed a set of genes related to contractile apparatus and stress response at day 1, including three genes involved in mechanotransduction and four genes encoding heat shock proteins. Our analysis further identified three cell cycle-related genes at day and several genes associated with extracellular matrix (ECM) at both days 3 and 10. In conclusion, we have identified a core set of genes commonly upregulated in two forms of muscle growth that could play a role in the maintenance of sarcomere stability, ECM remodeling, cell proliferation, fast-to-slow fiber type transition, and the regulation of skeletal muscle growth. These findings suggest conserved regulatory mechanisms involved in the adaptation of skeletal muscle to increased mechanical loading. Copyright © 2015 the American Physiological Society.

  14. Genes involved in complex adaptive processes tend to have highly conserved upstream regions in mammalian genomes

    Directory of Open Access Journals (Sweden)

    Kohane Isaac

    2005-11-01

    Full Text Available Abstract Background Recent advances in genome sequencing suggest a remarkable conservation in gene content of mammalian organisms. The similarity in gene repertoire present in different organisms has increased interest in studying regulatory mechanisms of gene expression aimed at elucidating the differences in phenotypes. In particular, a proximal promoter region contains a large number of regulatory elements that control the expression of its downstream gene. Although many studies have focused on identification of these elements, a broader picture on the complexity of transcriptional regulation of different biological processes has not been addressed in mammals. The regulatory complexity may strongly correlate with gene function, as different evolutionary forces must act on the regulatory systems under different biological conditions. We investigate this hypothesis by comparing the conservation of promoters upstream of genes classified in different functional categories. Results By conducting a rank correlation analysis between functional annotation and upstream sequence alignment scores obtained by human-mouse and human-dog comparison, we found a significantly greater conservation of the upstream sequence of genes involved in development, cell communication, neural functions and signaling processes than those involved in more basic processes shared with unicellular organisms such as metabolism and ribosomal function. This observation persists after controlling for G+C content. Considering conservation as a functional signature, we hypothesize a higher density of cis-regulatory elements upstream of genes participating in complex and adaptive processes. Conclusion We identified a class of functions that are associated with either high or low promoter conservation in mammals. We detected a significant tendency that points to complex and adaptive processes were associated with higher promoter conservation, despite the fact that they have emerged

  15. Duplication in DNA Sequences

    Science.gov (United States)

    Ito, Masami; Kari, Lila; Kincaid, Zachary; Seki, Shinnosuke

    The duplication and repeat-deletion operations are the basis of a formal language theoretic model of errors that can occur during DNA replication. During DNA replication, subsequences of a strand of DNA may be copied several times (resulting in duplications) or skipped (resulting in repeat-deletions). As formal language operations, iterated duplication and repeat-deletion of words and languages have been well studied in the literature. However, little is known about single-step duplications and repeat-deletions. In this paper, we investigate several properties of these operations, including closure properties of language families in the Chomsky hierarchy and equations involving these operations. We also make progress toward a characterization of regular languages that are generated by duplicating a regular language.

  16. Characterization of Conserved and Nonconserved Imprinted Genes in Swine

    Science.gov (United States)

    Genomic imprinting results in the silencing of a subset of mammalian alleles due to parent-of-origin inheritance. Due to the nature of their expression patterns they play a critical role in placental and early embryonic development. In order to increase our understanding of imprinted genes specifi...

  17. Conservation and sex-specific splicing of the doublesex gene

    Indian Academy of Sciences (India)

    Genetic control of sex determination in insects has been best characterized in Drosophila melanogaster, where the master gene Sxl codes for RNA that is sex specifically spliced to produce a functional protein only in females. SXL regulates the sex-specific splicing of transformer (tra) RNA which, in turn, regulates the ...

  18. Human cytomegalovirus UL145 gene is highly conserved among ...

    Indian Academy of Sciences (India)

    PRAKASH KUMAR

    capable of causing infections that persist lifelong, and normally ... 1 Virus Laboratory, Affiliated ShengJing Hospital, China Medical University, Shenyang 110004, P. R. China. 2Department of .... Elmer, USA), and negative controls were included in each round of .... variability of the UL145 gene in field isolates. To answer this.

  19. Neofunctionalization of Duplicated Tic40 Genes Caused a Gain-of-Function Variation Related to Male Fertility in Brassica oleracea Lineages1[W][OPEN

    Science.gov (United States)

    Dun, Xiaoling; Shen, Wenhao; Hu, Kaining; Zhou, Zhengfu; Xia, Shengqian; Wen, Jing; Yi, Bin; Shen, Jinxiong; Ma, Chaozhi; Tu, Jinxing; Fu, Tingdong; Lagercrantz, Ulf

    2014-01-01

    Gene duplication followed by functional divergence in the event of polyploidization is a major contributor to evolutionary novelties. The Brassica genus evolved from a common ancestor after whole-genome triplication. Here, we studied the evolutionary and functional features of Brassica spp. homologs to Tic40 (for translocon at the inner membrane of chloroplasts with 40 kDa). Four Tic40 loci were identified in allotetraploid Brassica napus and two loci in each of three basic diploid Brassica spp. Although these Tic40 homologs share high sequence identities and similar expression patterns, they exhibit altered functional features. Complementation assays conducted on Arabidopsis thaliana tic40 and the B. napus male-sterile line 7365A suggested that all Brassica spp. Tic40 homologs retain an ancestral function similar to that of AtTic40, whereas BolC9.Tic40 in Brassica oleracea and its ortholog in B. napus, BnaC9.Tic40, in addition, evolved a novel function that can rescue the fertility of 7365A. A homologous chromosomal rearrangement placed bnac9.tic40 originating from the A genome (BraA10.Tic40) as an allele of BnaC9.Tic40 in the C genome, resulting in phenotypic variation for male sterility in the B. napus near-isogenic two-type line 7365AB. Assessment of the complementation activity of chimeric B. napus Tic40 domain-swapping constructs in 7365A suggested that amino acid replacements in the carboxyl terminus of BnaC9.Tic40 cause this functional divergence. The distribution of these amino acid replacements in 59 diverse Brassica spp. accessions demonstrated that the neofunctionalization of Tic40 is restricted to B. oleracea and its derivatives and thus occurred after the divergence of the Brassica spp. A, B, and C genomes. PMID:25185122

  20. Neofunctionalization of duplicated Tic40 genes caused a gain-of-function variation related to male fertility in Brassica oleracea lineages.

    Science.gov (United States)

    Dun, Xiaoling; Shen, Wenhao; Hu, Kaining; Zhou, Zhengfu; Xia, Shengqian; Wen, Jing; Yi, Bin; Shen, Jinxiong; Ma, Chaozhi; Tu, Jinxing; Fu, Tingdong; Lagercrantz, Ulf

    2014-11-01

    Gene duplication followed by functional divergence in the event of polyploidization is a major contributor to evolutionary novelties. The Brassica genus evolved from a common ancestor after whole-genome triplication. Here, we studied the evolutionary and functional features of Brassica spp. homologs to Tic40 (for translocon at the inner membrane of chloroplasts with 40 kDa). Four Tic40 loci were identified in allotetraploid Brassica napus and two loci in each of three basic diploid Brassica spp. Although these Tic40 homologs share high sequence identities and similar expression patterns, they exhibit altered functional features. Complementation assays conducted on Arabidopsis thaliana tic40 and the B. napus male-sterile line 7365A suggested that all Brassica spp. Tic40 homologs retain an ancestral function similar to that of AtTic40, whereas BolC9.Tic40 in Brassica oleracea and its ortholog in B. napus, BnaC9.Tic40, in addition, evolved a novel function that can rescue the fertility of 7365A. A homologous chromosomal rearrangement placed bnac9.tic40 originating from the A genome (BraA10.Tic40) as an allele of BnaC9.Tic40 in the C genome, resulting in phenotypic variation for male sterility in the B. napus near-isogenic two-type line 7365AB. Assessment of the complementation activity of chimeric B. napus Tic40 domain-swapping constructs in 7365A suggested that amino acid replacements in the carboxyl terminus of BnaC9.Tic40 cause this functional divergence. The distribution of these amino acid replacements in 59 diverse Brassica spp. accessions demonstrated that the neofunctionalization of Tic40 is restricted to B. oleracea and its derivatives and thus occurred after the divergence of the Brassica spp. A, B, and C genomes. © 2014 American Society of Plant Biologists. All Rights Reserved.

  1. Gene duplication and neo-functionalization in the evolutionary and functional divergence of the metazoan copper transporters Ctr1 and Ctr2.

    Science.gov (United States)

    Logeman, Brandon L; Wood, L Kent; Lee, Jaekwon; Thiele, Dennis J

    2017-07-07

    Copper is an essential element for proper organismal development and is involved in a range of processes, including oxidative phosphorylation, neuropeptide biogenesis, and connective tissue maturation. The copper transporter (Ctr) family of integral membrane proteins is ubiquitously found in eukaryotes and mediates the high-affinity transport of Cu + across both the plasma membrane and endomembranes. Although mammalian Ctr1 functions as a Cu + transporter for Cu acquisition and is essential for embryonic development, a homologous protein, Ctr2, has been proposed to function as a low-affinity Cu transporter, a lysosomal Cu exporter, or a regulator of Ctr1 activity, but its functional and evolutionary relationship to Ctr1 is unclear. Here we report a biochemical, genetic, and phylogenetic comparison of metazoan Ctr1 and Ctr2, suggesting that Ctr2 arose over 550 million years ago as a result of a gene duplication event followed by loss of Cu + transport activity. Using a random mutagenesis and growth selection approach, we identified amino acid substitutions in human and mouse Ctr2 proteins that support copper-dependent growth in yeast and enhance copper accumulation in Ctr1 -/- mouse embryonic fibroblasts. These mutations revert Ctr2 to a more ancestral Ctr1-like state while maintaining endogenous functions, such as stimulating Ctr1 cleavage. We suggest key structural aspects of metazoan Ctr1 and Ctr2 that discriminate between their biological roles, providing mechanistic insights into the evolutionary, biochemical, and functional relationships between these two related proteins. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

  2. Patterns of evolutionary conservation of essential genes correlate with their compensability.

    Directory of Open Access Journals (Sweden)

    Tobias Bergmiller

    2012-06-01

    Full Text Available Essential genes code for fundamental cellular functions required for the viability of an organism. For this reason, essential genes are often highly conserved across organisms. However, this is not always the case: orthologues of genes that are essential in one organism are sometimes not essential in other organisms or are absent from their genomes. This suggests that, in the course of evolution, essential genes can be rendered nonessential. How can a gene become non-essential? Here we used genetic manipulation to deplete the products of 26 different essential genes in Escherichia coli. This depletion results in a lethal phenotype, which could often be rescued by the overexpression of a non-homologous, non-essential gene, most likely through replacement of the essential function. We also show that, in a smaller number of cases, the essential genes can be fully deleted from the genome, suggesting that complete functional replacement is possible. Finally, we show that essential genes whose function can be replaced in the laboratory are more likely to be non-essential or not present in other taxa. These results are consistent with the notion that patterns of evolutionary conservation of essential genes are influenced by their compensability-that is, by how easily they can be functionally replaced, for example through increased expression of other genes.

  3. Evolutionary Conservation in Genes Underlying Human Psychiatric Disorders

    Directory of Open Access Journals (Sweden)

    Lisa Michelle Ogawa

    2014-05-01

    Full Text Available Many psychiatric diseases observed in humans have tenuous or absent analogs in other species. Most notable among these are schizophrenia and autism. One hypothesis has posited that these diseases have arisen as a consequence of human brain evolution, for example, that the same processes that led to advances in cognition, language, and executive function also resulted in novel diseases in humans when dysfunctional. Here, the molecular evolution of genes associated with these and other psychiatric disorders are compared among species. Genes associated with psychiatric disorders are drawn from the literature and orthologous sequences are collected from eleven primate species (human, chimpanzee, bonobo, gorilla, orangutan, gibbon, macaque, baboon, marmoset, squirrel monkey, and galago and thirty one non-primate mammalian species. Evolutionary parameters, including dN/dS, are calculated for each gene and compared between disease classes and among species, focusing on humans and primates compared to other mammals and on large-brained taxa (cetaceans, rhinoceros, walrus, bear, and elephant compared to their small-brained sister species. Evidence of differential selection in primates supports the hypothesis that schizophrenia and autism are a cost of higher brain function. Through this work a better understanding of the molecular evolution of the human brain, the pathophysiology of disease, and the genetic basis of human psychiatric disease is gained.

  4. Constraints on genes shape long-term conservation of macro-synteny in metazoan genomes

    Directory of Open Access Journals (Sweden)

    Putnam Nicholas H

    2011-10-01

    Full Text Available Abstract Background Many metazoan genomes conserve chromosome-scale gene linkage relationships (“macro-synteny” from the common ancestor of multicellular animal life 1234, but the biological explanation for this conservation is still unknown. Double cut and join (DCJ is a simple, well-studied model of neutral genome evolution amenable to both simulation and mathematical analysis 5, but as we show here, it is not sufficent to explain long-term macro-synteny conservation. Results We examine a family of simple (one-parameter extensions of DCJ to identify models and choices of parameters consistent with the levels of macro- and micro-synteny conservation observed among animal genomes. Our software implements a flexible strategy for incorporating genomic context into the DCJ model to incorporate various types of genomic context (“DCJ-[C]”, and is available as open source software from http://github.com/putnamlab/dcj-c. Conclusions A simple model of genome evolution, in which DCJ moves are allowed only if they maintain chromosomal linkage among a set of constrained genes, can simultaneously account for the level of macro-synteny conservation and for correlated conservation among multiple pairs of species. Simulations under this model indicate that a constraint on approximately 7% of metazoan genes is sufficient to constrain genome rearrangement to an average rate of 25 inversions and 1.7 translocations per million years.

  5. Evidence for intron length conservation in a set of mammalian genes associated with embryonic development

    LENUS (Irish Health Repository)

    2011-10-05

    Abstract Background We carried out an analysis of intron length conservation across a diverse group of nineteen mammalian species. Motivated by recent research suggesting a role for time delays associated with intron transcription in gene expression oscillations required for early embryonic patterning, we searched for examples of genes that showed the most extreme conservation of total intron content in mammals. Results Gene sets annotated as being involved in pattern specification in the early embryo or containing the homeobox DNA-binding domain, were significantly enriched among genes with highly conserved intron content. We used ancestral sequences reconstructed with probabilistic models that account for insertion and deletion mutations to distinguish insertion and deletion events on lineages leading to human and mouse from their last common ancestor. Using a randomization procedure, we show that genes containing the homeobox domain show less change in intron content than expected, given the number of insertion and deletion events within their introns. Conclusions Our results suggest selection for gene expression precision or the existence of additional development-associated genes for which transcriptional delay is functionally significant.

  6. Evolutionary conservation and network structure characterize genes of phenotypic relevance for mitosis in human.

    Directory of Open Access Journals (Sweden)

    Marek Ostaszewski

    Full Text Available The impact of gene silencing on cellular phenotypes is difficult to establish due to the complexity of interactions in the associated biological processes and pathways. A recent genome-wide RNA knock-down study both identified and phenotypically characterized a set of important genes for the cell cycle in HeLa cells. Here, we combine a molecular interaction network analysis, based on physical and functional protein interactions, in conjunction with evolutionary information, to elucidate the common biological and topological properties of these key genes. Our results show that these genes tend to be conserved with their corresponding protein interactions across several species and are key constituents of the evolutionary conserved molecular interaction network. Moreover, a group of bistable network motifs is found to be conserved within this network, which are likely to influence the network stability and therefore the robustness of cellular functioning. They form a cluster, which displays functional homogeneity and is significantly enriched in genes phenotypically relevant for mitosis. Additional results reveal a relationship between specific cellular processes and the phenotypic outcomes induced by gene silencing. This study introduces new ideas regarding the relationship between genotype and phenotype in the context of the cell cycle. We show that the analysis of molecular interaction networks can result in the identification of genes relevant to cellular processes, which is a promising avenue for future research.

  7. Typewriting: Toward Duplicating Success

    Science.gov (United States)

    Orsborn, Karen J.

    1977-01-01

    A description of two projects (secretarial handbook and memo pad and personalized stationery) for use in teaching the duplication process that will capture the interests of students in an advanced typewriting class. (HD)

  8. Divergent gene expression in the conserved dauer stage of the nematodes Pristionchus pacificus and Caenorhabditis elegans

    Directory of Open Access Journals (Sweden)

    Sinha Amit

    2012-06-01

    Full Text Available Abstract Background An organism can respond to changing environmental conditions by adjusting gene regulation and by forming alternative phenotypes. In nematodes, these mechanisms are coupled because many species will form dauer larvae, a stress-resistant and non-aging developmental stage, when exposed to unfavorable environmental conditions, and execute gene expression programs that have been selected for the survival of the animal in the wild. These dauer larvae represent an environmentally induced, homologous developmental stage across many nematode species, sharing conserved morphological and physiological properties. Hence it can be expected that some core components of the associated transcriptional program would be conserved across species, while others might diverge over the course of evolution. However, transcriptional and metabolic analysis of dauer development has been largely restricted to Caenorhabditis elegans. Here, we use a transcriptomic approach to compare the dauer stage in the evolutionary model system Pristionchus pacificus with the dauer stage in C. elegans. Results We have employed Agilent microarrays, which represent 20,446 P. pacificus and 20,143 C. elegans genes to show an unexpected divergence in the expression profiles of these two nematodes in dauer and dauer exit samples. P. pacificus and C. elegans differ in the dynamics and function of genes that are differentially expressed. We find that only a small number of orthologous gene pairs show similar expression pattern in the dauers of the two species, while the non-orthologous fraction of genes is a major contributor to the active transcriptome in dauers. Interestingly, many of the genes acquired by horizontal gene transfer and orphan genes in P. pacificus, are differentially expressed suggesting that these genes are of evolutionary and functional importance. Conclusion Our data set provides a catalog for future functional investigations and indicates novel insight

  9. Enteric and rectal duplications and duplication cysts in the adult.

    Science.gov (United States)

    Simsek, Abdurrahman; Zeybek, Nazif; Yagci, Gokhan; Kaymakcioglu, Nihat; Tas, Huseyin; Saglam, Mutlu; Cetiner, Sadettin

    2005-03-01

    Alimentary tract duplication and duplication cysts are rare congenital malformations. The ileum is the most frequently affected site. However, alimentary tract duplication and duplication cysts can occur at any point along the gastrointestinal tract. Early diagnosis and prompt surgical treatment is the best way to prevent associated morbidity. This article presents the cases of three patients admitted to Gulhane Military Medical Academy with signs of acute abdomen, intra-abdominal mass and chronic abdominal pain. These patients were found to have enteric duplication, duplication cyst and/or retro-rectal cyst. The literature on alimentary tract duplications is reviewed.

  10. The zebrafish maternal-effect gene cellular atoll encodes the centriolar component sas-6 and defects in its paternal function promote whole genome duplication.

    Science.gov (United States)

    Yabe, Taijiro; Ge, Xiaoyan; Pelegri, Francisco

    2007-12-01

    A female-sterile zebrafish maternal-effect mutation in cellular atoll (cea) results in defects in the initiation of cell division starting at the second cell division cycle. This phenomenon is caused by defects in centrosome duplication, which in turn affect the formation of a bipolar spindle. We show that cea encodes the centriolar coiled-coil protein Sas-6, and that zebrafish Cea/Sas-6 protein localizes to centrosomes. cea also has a genetic paternal contribution, which when mutated results in an arrested first cell division followed by normal cleavage. Our data supports the idea that, in zebrafish, paternally inherited centrosomes are required for the first cell division while maternally derived factors are required for centrosomal duplication and cell divisions in subsequent cell cycles. DNA synthesis ensues in the absence of centrosome duplication, and the one-cycle delay in the first cell division caused by cea mutant sperm leads to whole genome duplication. We discuss the potential implications of these findings with regards to the origin of polyploidization in animal species. In addition, the uncoupling of developmental time and cell division count caused by the cea mutation suggests the presence of a time window, normally corresponding to the first two cell cycles, which is permissive for germ plasm recruitment.

  11. Conserved intron positions in FGFR genes reflect the modular structure of FGFR and reveal stepwise addition of domains to an already complex ancestral FGFR.

    Science.gov (United States)

    Rebscher, Nicole; Deichmann, Christina; Sudhop, Stefanie; Fritzenwanker, Jens Holger; Green, Stephen; Hassel, Monika

    2009-10-01

    We have analyzed the evolution of fibroblast growth factor receptor (FGFR) tyrosine kinase genes throughout a wide range of animal phyla. No evidence for an FGFR gene was found in Porifera, but we tentatively identified an FGFR gene in the placozoan Trichoplax adhaerens. The gene encodes a protein with three immunoglobulin-like domains, a single-pass transmembrane, and a split tyrosine kinase domain. By superimposing intron positions of 20 FGFR genes from Placozoa, Cnidaria, Protostomia, and Deuterostomia over the respective protein domain structure, we identified ten ancestral introns and three conserved intron groups. Our analysis shows (1) that the position of ancestral introns correlates to the modular structure of FGFRs, (2) that the acidic domain very likely evolved in the last common ancestor of triploblasts, (3) that splicing of IgIII was enabled by a triploblast-specific insertion, and (4) that IgI is subject to substantial loss or duplication particularly in quickly evolving genomes. Moreover, intron positions in the catalytic domain of FGFRs map to the borders of protein subdomains highly conserved in other serine/threonine kinases. Nevertheless, these introns were introduced in metazoan receptor tyrosine kinases exclusively. Our data support the view that protein evolution dating back to the Cambrian explosion took place in such a short time window that only subtle changes in the domain structure are detectable in extant representatives of animal phyla. We propose that the first multidomain FGFR originated in the last common ancestor of Placozoa, Cnidaria, and Bilateria. Additional domains were introduced mainly in the ancestor of triploblasts and in the Ecdysozoa.

  12. Metazoan Remaining Genes for Essential Amino Acid Biosynthesis: Sequence Conservation and Evolutionary Analyses

    Directory of Open Access Journals (Sweden)

    Igor R. Costa

    2014-12-01

    Full Text Available Essential amino acids (EAA consist of a group of nine amino acids that animals are unable to synthesize via de novo pathways. Recently, it has been found that most metazoans lack the same set of enzymes responsible for the de novo EAA biosynthesis. Here we investigate the sequence conservation and evolution of all the metazoan remaining genes for EAA pathways. Initially, the set of all 49 enzymes responsible for the EAA de novo biosynthesis in yeast was retrieved. These enzymes were used as BLAST queries to search for similar sequences in a database containing 10 complete metazoan genomes. Eight enzymes typically attributed to EAA pathways were found to be ubiquitous in metazoan genomes, suggesting a conserved functional role. In this study, we address the question of how these genes evolved after losing their pathway partners. To do this, we compared metazoan genes with their fungal and plant orthologs. Using phylogenetic analysis with maximum likelihood, we found that acetolactate synthase (ALS and betaine-homocysteine S-methyltransferase (BHMT diverged from the expected Tree of Life (ToL relationships. High sequence conservation in the paraphyletic group Plant-Fungi was identified for these two genes using a newly developed Python algorithm. Selective pressure analysis of ALS and BHMT protein sequences showed higher non-synonymous mutation ratios in comparisons between metazoans/fungi and metazoans/plants, supporting the hypothesis that these two genes have undergone non-ToL evolution in animals.

  13. Paradoxical DNA repair and peroxide resistance gene conservation in Bacillus pumilus SAFR-032.

    Directory of Open Access Journals (Sweden)

    Jason Gioia

    Full Text Available BACKGROUND: Bacillus spores are notoriously resistant to unfavorable conditions such as UV radiation, gamma-radiation, H2O2, desiccation, chemical disinfection, or starvation. Bacillus pumilus SAFR-032 survives standard decontamination procedures of the Jet Propulsion Lab spacecraft assembly facility, and both spores and vegetative cells of this strain exhibit elevated resistance to UV radiation and H2O2 compared to other Bacillus species. PRINCIPAL FINDINGS: The genome of B. pumilus SAFR-032 was sequenced and annotated. Lists of genes relevant to DNA repair and the oxidative stress response were generated and compared to B. subtilis and B. licheniformis. Differences in conservation of genes, gene order, and protein sequences are highlighted because they potentially explain the extreme resistance phenotype of B. pumilus. The B. pumilus genome includes genes not found in B. subtilis or B. licheniformis and conserved genes with sequence divergence, but paradoxically lacks several genes that function in UV or H2O2 resistance in other Bacillus species. SIGNIFICANCE: This study identifies several candidate genes for further research into UV and H2O2 resistance. These findings will help explain the resistance of B. pumilus and are applicable to understanding sterilization survival strategies of microbes.

  14. Seed storage protein gene promoters contain conserved DNA motifs in Brassicaceae, Fabaceae and Poaceae

    Science.gov (United States)

    Fauteux, François; Strömvik, Martina V

    2009-01-01

    Background Accurate computational identification of cis-regulatory motifs is difficult, particularly in eukaryotic promoters, which typically contain multiple short and degenerate DNA sequences bound by several interacting factors. Enrichment in combinations of rare motifs in the promoter sequence of functionally or evolutionarily related genes among several species is an indicator of conserved transcriptional regulatory mechanisms. This provides a basis for the computational identification of cis-regulatory motifs. Results We have used a discriminative seeding DNA motif discovery algorithm for an in-depth analysis of 54 seed storage protein (SSP) gene promoters from three plant families, namely Brassicaceae (mustards), Fabaceae (legumes) and Poaceae (grasses) using backgrounds based on complete sets of promoters from a representative species in each family, namely Arabidopsis (Arabidopsis thaliana (L.) Heynh.), soybean (Glycine max (L.) Merr.) and rice (Oryza sativa L.) respectively. We have identified three conserved motifs (two RY-like and one ACGT-like) in Brassicaceae and Fabaceae SSP gene promoters that are similar to experimentally characterized seed-specific cis-regulatory elements. Fabaceae SSP gene promoter sequences are also enriched in a novel, seed-specific E2Fb-like motif. Conserved motifs identified in Poaceae SSP gene promoters include a GCN4-like motif, two prolamin-box-like motifs and an Skn-1-like motif. Evidence of the presence of a variant of the TATA-box is found in the SSP gene promoters from the three plant families. Motifs discovered in SSP gene promoters were used to score whole-genome sets of promoters from Arabidopsis, soybean and rice. The highest-scoring promoters are associated with genes coding for different subunits or precursors of seed storage proteins. Conclusion Seed storage protein gene promoter motifs are conserved in diverse species, and different plant families are characterized by a distinct combination of conserved motifs

  15. Seed storage protein gene promoters contain conserved DNA motifs in Brassicaceae, Fabaceae and Poaceae

    Directory of Open Access Journals (Sweden)

    Fauteux François

    2009-10-01

    Full Text Available Abstract Background Accurate computational identification of cis-regulatory motifs is difficult, particularly in eukaryotic promoters, which typically contain multiple short and degenerate DNA sequences bound by several interacting factors. Enrichment in combinations of rare motifs in the promoter sequence of functionally or evolutionarily related genes among several species is an indicator of conserved transcriptional regulatory mechanisms. This provides a basis for the computational identification of cis-regulatory motifs. Results We have used a discriminative seeding DNA motif discovery algorithm for an in-depth analysis of 54 seed storage protein (SSP gene promoters from three plant families, namely Brassicaceae (mustards, Fabaceae (legumes and Poaceae (grasses using backgrounds based on complete sets of promoters from a representative species in each family, namely Arabidopsis (Arabidopsis thaliana (L. Heynh., soybean (Glycine max (L. Merr. and rice (Oryza sativa L. respectively. We have identified three conserved motifs (two RY-like and one ACGT-like in Brassicaceae and Fabaceae SSP gene promoters that are similar to experimentally characterized seed-specific cis-regulatory elements. Fabaceae SSP gene promoter sequences are also enriched in a novel, seed-specific E2Fb-like motif. Conserved motifs identified in Poaceae SSP gene promoters include a GCN4-like motif, two prolamin-box-like motifs and an Skn-1-like motif. Evidence of the presence of a variant of the TATA-box is found in the SSP gene promoters from the three plant families. Motifs discovered in SSP gene promoters were used to score whole-genome sets of promoters from Arabidopsis, soybean and rice. The highest-scoring promoters are associated with genes coding for different subunits or precursors of seed storage proteins. Conclusion Seed storage protein gene promoter motifs are conserved in diverse species, and different plant families are characterized by a distinct combination

  16. Transcriptional dynamics of a conserved gene expression network associated with craniofacial divergence in Arctic charr.

    Science.gov (United States)

    Ahi, Ehsan Pashay; Kapralova, Kalina Hristova; Pálsson, Arnar; Maier, Valerie Helene; Gudbrandsson, Jóhannes; Snorrason, Sigurdur S; Jónsson, Zophonías O; Franzdóttir, Sigrídur Rut

    2014-01-01

    Understanding the molecular basis of craniofacial variation can provide insights into key developmental mechanisms of adaptive changes and their role in trophic divergence and speciation. Arctic charr (Salvelinus alpinus) is a polymorphic fish species, and, in Lake Thingvallavatn in Iceland, four sympatric morphs have evolved distinct craniofacial structures. We conducted a gene expression study on candidates from a conserved gene coexpression network, focusing on the development of craniofacial elements in embryos of two contrasting Arctic charr morphotypes (benthic and limnetic). Four Arctic charr morphs were studied: one limnetic and two benthic morphs from Lake Thingvallavatn and a limnetic reference aquaculture morph. The presence of morphological differences at developmental stages before the onset of feeding was verified by morphometric analysis. Following up on our previous findings that Mmp2 and Sparc were differentially expressed between morphotypes, we identified a network of genes with conserved coexpression across diverse vertebrate species. A comparative expression study of candidates from this network in developing heads of the four Arctic charr morphs verified the coexpression relationship of these genes and revealed distinct transcriptional dynamics strongly correlated with contrasting craniofacial morphologies (benthic versus limnetic). A literature review and Gene Ontology analysis indicated that a significant proportion of the network genes play a role in extracellular matrix organization and skeletogenesis, and motif enrichment analysis of conserved noncoding regions of network candidates predicted a handful of transcription factors, including Ap1 and Ets2, as potential regulators of the gene network. The expression of Ets2 itself was also found to associate with network gene expression. Genes linked to glucocorticoid signalling were also studied, as both Mmp2 and Sparc are responsive to this pathway. Among those, several transcriptional

  17. Evolutionary conservation of vertebrate notochord genes in the ascidian Ciona intestinalis.

    Science.gov (United States)

    Kugler, Jamie E; Passamaneck, Yale J; Feldman, Taya G; Beh, Jeni; Regnier, Todd W; Di Gregorio, Anna

    2008-11-01

    To reconstruct a minimum complement of notochord genes evolutionarily conserved across chordates, we scanned the Ciona intestinalis genome using the sequences of 182 genes reported to be expressed in the notochord of different vertebrates and identified 139 candidate notochord genes. For 66 of these Ciona genes expression data were already available, hence we analyzed the expression of the remaining 73 genes and found notochord expression for 20. The predicted products of the newly identified notochord genes range from the transcription factors Ci-XBPa and Ci-miER1 to extracellular matrix proteins. We examined the expression of the newly identified notochord genes in embryos ectopically expressing Ciona Brachyury (Ci-Bra) and in embryos expressing a repressor form of this transcription factor in the notochord, and we found that while a subset of the genes examined are clearly responsive to Ci-Bra, other genes are not affected by alterations in its levels. We provide a first description of notochord genes that are not evidently influenced by the ectopic expression of Ci-Bra and we propose alternative regulatory mechanisms that might control their transcription. Copyright 2008 Wiley-Liss, Inc.

  18. Similarity-based gene detection: using COGs to find evolutionarily-conserved ORFs

    Directory of Open Access Journals (Sweden)

    Hutchison Clyde A

    2006-01-01

    Full Text Available Abstract Background Experimental verification of gene products has not kept pace with the rapid growth of microbial sequence information. However, existing annotations of gene locations contain sufficient information to screen for probable errors. Furthermore, comparisons among genomes become more informative as more genomes are examined. We studied all open reading frames (ORFs of at least 30 codons from the genomes of 27 sequenced bacterial strains. We grouped the potential peptide sequences encoded from the ORFs by forming Clusters of Orthologous Groups (COGs. We used this grouping in order to find homologous relationships that would not be distinguishable from noise when using simple BLAST searches. Although COG analysis was initially developed to group annotated genes, we applied it to the task of grouping anonymous DNA sequences that may encode proteins. Results "Mixed COGs" of ORFs (clusters in which some sequences correspond to annotated genes and some do not are attractive targets when seeking errors of gene predicion. Examination of mixed COGs reveals some situations in which genes appear to have been missed in current annotations and a smaller number of regions that appear to have been annotated as gene loci erroneously. This technique can also be used to detect potential pseudogenes or sequencing errors. Our method uses an adjustable parameter for degree of conservation among the studied genomes (stringency. We detail results for one level of stringency at which we found 83 potential genes which had not previously been identified, 60 potential pseudogenes, and 7 sequences with existing gene annotations that are probably incorrect. Conclusion Systematic study of sequence conservation offers a way to improve existing annotations by identifying potentially homologous regions where the annotation of the presence or absence of a gene is inconsistent among genomes.

  19. Similarity-based gene detection: using COGs to find evolutionarily-conserved ORFs.

    Science.gov (United States)

    Powell, Bradford C; Hutchison, Clyde A

    2006-01-19

    Experimental verification of gene products has not kept pace with the rapid growth of microbial sequence information. However, existing annotations of gene locations contain sufficient information to screen for probable errors. Furthermore, comparisons among genomes become more informative as more genomes are examined. We studied all open reading frames (ORFs) of at least 30 codons from the genomes of 27 sequenced bacterial strains. We grouped the potential peptide sequences encoded from the ORFs by forming Clusters of Orthologous Groups (COGs). We used this grouping in order to find homologous relationships that would not be distinguishable from noise when using simple BLAST searches. Although COG analysis was initially developed to group annotated genes, we applied it to the task of grouping anonymous DNA sequences that may encode proteins. "Mixed COGs" of ORFs (clusters in which some sequences correspond to annotated genes and some do not) are attractive targets when seeking errors of gene prediction. Examination of mixed COGs reveals some situations in which genes appear to have been missed in current annotations and a smaller number of regions that appear to have been annotated as gene loci erroneously. This technique can also be used to detect potential pseudogenes or sequencing errors. Our method uses an adjustable parameter for degree of conservation among the studied genomes (stringency). We detail results for one level of stringency at which we found 83 potential genes which had not previously been identified, 60 potential pseudogenes, and 7 sequences with existing gene annotations that are probably incorrect. Systematic study of sequence conservation offers a way to improve existing annotations by identifying potentially homologous regions where the annotation of the presence or absence of a gene is inconsistent among genomes.

  20. Clusters of conserved beta cell marker genes for assessment of beta cell phenotype

    DEFF Research Database (Denmark)

    Martens, Geert A; Jiang, Lei; Hellemans, Karine H

    2011-01-01

    The aim of this study was to establish a gene expression blueprint of pancreatic beta cells conserved from rodents to humans and to evaluate its applicability to assess shifts in the beta cell differentiated state. Genome-wide mRNA expression profiles of isolated beta cells were compared to those...... of a large panel of other tissue and cell types, and transcripts with beta cell-abundant and -selective expression were identified. Iteration of this analysis in mouse, rat and human tissues generated a panel of conserved beta cell biomarkers. This panel was then used to compare isolated versus laser capture...

  1. Evolutionary dynamics of a conserved sequence motif in the ribosomal genes of the ciliate Paramecium

    Directory of Open Access Journals (Sweden)

    Lynch Michael

    2010-05-01

    Full Text Available Abstract Background In protozoa, the identification of preserved motifs by comparative genomics is often impeded by difficulties to generate reliable alignments for non-coding sequences. Moreover, the evolutionary dynamics of regulatory elements in 3' untranslated regions (both in protozoa and metazoa remains a virtually unexplored issue. Results By screening Paramecium tetraurelia's 3' untranslated regions for 8-mers that were previously found to be preserved in mammalian 3' UTRs, we detect and characterize a motif that is distinctly conserved in the ribosomal genes of this ciliate. The motif appears to be conserved across Paramecium aurelia species but is absent from the ribosomal genes of four additional non-Paramecium species surveyed, including another ciliate, Tetrahymena thermophila. Motif-free ribosomal genes retain fewer paralogs in the genome and appear to be lost more rapidly relative to motif-containing genes. Features associated with the discovered preserved motif are consistent with this 8-mer playing a role in post-transcriptional regulation. Conclusions Our observations 1 shed light on the evolution of a putative regulatory motif across large phylogenetic distances; 2 are expected to facilitate the understanding of the modulation of ribosomal genes expression in Paramecium; and 3 reveal a largely unexplored--and presumably not restricted to Paramecium--association between the presence/absence of a DNA motif and the evolutionary fate of its host genes.

  2. Evolutionary dynamics of a conserved sequence motif in the ribosomal genes of the ciliate Paramecium.

    Science.gov (United States)

    Catania, Francesco; Lynch, Michael

    2010-05-04

    In protozoa, the identification of preserved motifs by comparative genomics is often impeded by difficulties to generate reliable alignments for non-coding sequences. Moreover, the evolutionary dynamics of regulatory elements in 3' untranslated regions (both in protozoa and metazoa) remains a virtually unexplored issue. By screening Paramecium tetraurelia's 3' untranslated regions for 8-mers that were previously found to be preserved in mammalian 3' UTRs, we detect and characterize a motif that is distinctly conserved in the ribosomal genes of this ciliate. The motif appears to be conserved across Paramecium aurelia species but is absent from the ribosomal genes of four additional non-Paramecium species surveyed, including another ciliate, Tetrahymena thermophila. Motif-free ribosomal genes retain fewer paralogs in the genome and appear to be lost more rapidly relative to motif-containing genes. Features associated with the discovered preserved motif are consistent with this 8-mer playing a role in post-transcriptional regulation. Our observations 1) shed light on the evolution of a putative regulatory motif across large phylogenetic distances; 2) are expected to facilitate the understanding of the modulation of ribosomal genes expression in Paramecium; and 3) reveal a largely unexplored--and presumably not restricted to Paramecium--association between the presence/absence of a DNA motif and the evolutionary fate of its host genes.

  3. Phylogenetic analysis reveals conservation and diversification of micro RNA166 genes among diverse plant species.

    Science.gov (United States)

    Barik, Suvakanta; SarkarDas, Shabari; Singh, Archita; Gautam, Vibhav; Kumar, Pramod; Majee, Manoj; Sarkar, Ananda K

    2014-01-01

    Similar to the majority of the microRNAs, mature miR166s are derived from multiple members of MIR166 genes (precursors) and regulate various aspects of plant development by negatively regulating their target genes (Class III HD-ZIP). The evolutionary conservation or functional diversification of miRNA166 family members remains elusive. Here, we show the phylogenetic relationships among MIR166 precursor and mature sequences from three diverse model plant species. Despite strong conservation, some mature miR166 sequences, such as ppt-miR166m, have undergone sequence variation. Critical sequence variation in ppt-miR166m has led to functional diversification, as it targets non-HD-ZIPIII gene transcript (s). MIR166 precursor sequences have diverged in a lineage specific manner, and both precursors and mature osa-miR166i/j are highly conserved. Interestingly, polycistronic MIR166s were present in Physcomitrella and Oryza but not in Arabidopsis. The nature of cis-regulatory motifs on the upstream promoter sequences of MIR166 genes indicates their possible contribution to the functional variation observed among miR166 species. Copyright © 2013 Elsevier Inc. All rights reserved.

  4. Identification of conserved drought-adaptive genes using a cross-species meta-analysis approach.

    Science.gov (United States)

    Shaar-Moshe, Lidor; Hübner, Sariel; Peleg, Zvi

    2015-05-03

    Drought is the major environmental stress threatening crop-plant productivity worldwide. Identification of new genes and metabolic pathways involved in plant adaptation to progressive drought stress at the reproductive stage is of great interest for agricultural research. We developed a novel Cross-Species meta-Analysis of progressive Drought stress at the reproductive stage (CSA:Drought) to identify key drought adaptive genes and mechanisms and to test their evolutionary conservation. Empirically defined filtering criteria were used to facilitate a robust integration of 17 deposited microarray experiments (148 arrays) of Arabidopsis, rice, wheat and barley. By prioritizing consistency over intensity, our approach was able to identify 225 differentially expressed genes shared across studies and taxa. Gene ontology enrichment and pathway analyses classified the shared genes into functional categories involved predominantly in metabolic processes (e.g. amino acid and carbohydrate metabolism), regulatory function (e.g. protein degradation and transcription) and response to stimulus. We further investigated drought related cis-acting elements in the shared gene promoters, and the evolutionary conservation of shared genes. The universal nature of the identified drought-adaptive genes was further validated in a fifth species, Brachypodium distachyon that was not included in the meta-analysis. qPCR analysis of 27, randomly selected, shared orthologs showed similar expression pattern as was found by the CSA:Drought.In accordance, morpho-physiological characterization of progressive drought stress, in B. distachyon, highlighted the key role of osmotic adjustment as evolutionary conserved drought-adaptive mechanism. Our CSA:Drought strategy highlights major drought-adaptive genes and metabolic pathways that were only partially, if at all, reported in the original studies included in the meta-analysis. These genes include a group of unclassified genes that could be involved

  5. Conservation, Divergence, and Genome-Wide Distribution of PAL and POX A Gene Families in Plants.

    Science.gov (United States)

    Rawal, H C; Singh, N K; Sharma, T R

    2013-01-01

    Genome-wide identification and phylogenetic and syntenic comparison were performed for the genes responsible for phenylalanine ammonia lyase (PAL) and peroxidase A (POX A) enzymes in nine plant species representing very diverse groups like legumes (Glycine max and Medicago truncatula), fruits (Vitis vinifera), cereals (Sorghum bicolor, Zea mays, and Oryza sativa), trees (Populus trichocarpa), and model dicot (Arabidopsis thaliana) and monocot (Brachypodium distachyon) species. A total of 87 and 1045 genes in PAL and POX A gene families, respectively, have been identified in these species. The phylogenetic and syntenic comparison along with motif distributions shows a high degree of conservation of PAL genes, suggesting that these genes may predate monocot/eudicot divergence. The POX A family genes, present in clusters at the subtelomeric regions of chromosomes, might be evolving and expanding with higher rate than the PAL gene family. Our analysis showed that during the expansion of POX A gene family, many groups and subgroups have evolved, resulting in a high level of functional divergence among monocots and dicots. These results will act as a first step toward the understanding of monocot/eudicot evolution and functional characterization of these gene families in the future.

  6. Conservation, Divergence, and Genome-Wide Distribution of PAL and POX A Gene Families in Plants

    Directory of Open Access Journals (Sweden)

    H. C. Rawal

    2013-01-01

    Full Text Available Genome-wide identification and phylogenetic and syntenic comparison were performed for the genes responsible for phenylalanine ammonia lyase (PAL and peroxidase A (POX A enzymes in nine plant species representing very diverse groups like legumes (Glycine max and Medicago truncatula, fruits (Vitis vinifera, cereals (Sorghum bicolor, Zea mays, and Oryza sativa, trees (Populus trichocarpa, and model dicot (Arabidopsis thaliana and monocot (Brachypodium distachyon species. A total of 87 and 1045 genes in PAL and POX A gene families, respectively, have been identified in these species. The phylogenetic and syntenic comparison along with motif distributions shows a high degree of conservation of PAL genes, suggesting that these genes may predate monocot/eudicot divergence. The POX A family genes, present in clusters at the subtelomeric regions of chromosomes, might be evolving and expanding with higher rate than the PAL gene family. Our analysis showed that during the expansion of POX A gene family, many groups and subgroups have evolved, resulting in a high level of functional divergence among monocots and dicots. These results will act as a first step toward the understanding of monocot/eudicot evolution and functional characterization of these gene families in the future.

  7. The centriole duplication cycle

    Science.gov (United States)

    Fırat-Karalar, Elif Nur; Stearns, Tim

    2014-01-01

    Centrosomes are the main microtubule-organizing centre of animal cells and are important for many critical cellular and developmental processes from cell polarization to cell division. At the core of the centrosome are centrioles, which recruit pericentriolar material to form the centrosome and act as basal bodies to nucleate formation of cilia and flagella. Defects in centriole structure, function and number are associated with a variety of human diseases, including cancer, brain diseases and ciliopathies. In this review, we discuss recent advances in our understanding of how new centrioles are assembled and how centriole number is controlled. We propose a general model for centriole duplication control in which cooperative binding of duplication factors defines a centriole ‘origin of duplication’ that initiates duplication, and passage through mitosis effects changes that license the centriole for a new round of duplication in the next cell cycle. We also focus on variations on the general theme in which many centrioles are created in a single cell cycle, including the specialized structures associated with these variations, the deuterosome in animal cells and the blepharoplast in lower plant cells. PMID:25047614

  8. Domain duplication, divergence, and loss events in vertebrate Msx paralogs reveal phylogenomically informed disease markers.

    Science.gov (United States)

    Finnerty, John R; Mazza, Maureen E; Jezewski, Peter A

    2009-01-20

    Msx originated early in animal evolution and is implicated in human genetic disorders. To reconstruct the functional evolution of Msx and inform the study of human mutations, we analyzed the phylogeny and synteny of 46 metazoan Msx proteins and tracked the duplication, diversification and loss of conserved motifs. Vertebrate Msx sequences sort into distinct Msx1, Msx2 and Msx3 clades. The sister-group relationship between MSX1 and MSX2 reflects their derivation from the 4p/5q chromosomal paralogon, a derivative of the original "MetaHox" cluster. We demonstrate physical linkage between Msx and other MetaHox genes (Hmx, NK1, Emx) in a cnidarian. Seven conserved domains, including two Groucho repression domains (N- and C-terminal), were present in the ancestral Msx. In cnidarians, the Groucho domains are highly similar. In vertebrate Msx1, the N-terminal Groucho domain is conserved, while the C-terminal domain diverged substantially, implying a novel function. In vertebrate Msx2 and Msx3, the C-terminal domain was lost. MSX1 mutations associated with ectodermal dysplasia or orofacial clefting disorders map to conserved domains in a non-random fashion. Msx originated from a MetaHox ancestor that also gave rise to Tlx, Demox, NK, and possibly EHGbox, Hox and ParaHox genes. Duplication, divergence or loss of domains played a central role in the functional evolution of Msx. Duplicated domains allow pleiotropically expressed proteins to evolve new functions without disrupting existing interaction networks. Human missense sequence variants reside within evolutionarily conserved domains, likely disrupting protein function. This phylogenomic evaluation of candidate disease markers will inform clinical and functional studies.

  9. Domain duplication, divergence, and loss events in vertebrate Msx paralogs reveal phylogenomically informed disease markers

    Directory of Open Access Journals (Sweden)

    Finnerty John R

    2009-01-01

    Full Text Available Abstract Background Msx originated early in animal evolution and is implicated in human genetic disorders. To reconstruct the functional evolution of Msx and inform the study of human mutations, we analyzed the phylogeny and synteny of 46 metazoan Msx proteins and tracked the duplication, diversification and loss of conserved motifs. Results Vertebrate Msx sequences sort into distinct Msx1, Msx2 and Msx3 clades. The sister-group relationship between MSX1 and MSX2 reflects their derivation from the 4p/5q chromosomal paralogon, a derivative of the original "MetaHox" cluster. We demonstrate physical linkage between Msx and other MetaHox genes (Hmx, NK1, Emx in a cnidarian. Seven conserved domains, including two Groucho repression domains (N- and C-terminal, were present in the ancestral Msx. In cnidarians, the Groucho domains are highly similar. In vertebrate Msx1, the N-terminal Groucho domain is conserved, while the C-terminal domain diverged substantially, implying a novel function. In vertebrate Msx2 and Msx3, the C-terminal domain was lost. MSX1 mutations associated with ectodermal dysplasia or orofacial clefting disorders map to conserved domains in a non-random fashion. Conclusion Msx originated from a MetaHox ancestor that also gave rise to Tlx, Demox, NK, and possibly EHGbox, Hox and ParaHox genes. Duplication, divergence or loss of domains played a central role in the functional evolution of Msx. Duplicated domains allow pleiotropically expressed proteins to evolve new functions without disrupting existing interaction networks. Human missense sequence variants reside within evolutionarily conserved domains, likely disrupting protein function. This phylogenomic evaluation of candidate disease markers will inform clinical and functional studies.

  10. Clusters of conserved beta cell marker genes for assessment of beta cell phenotype

    DEFF Research Database (Denmark)

    Martens, Geert A; Jiang, Lei; Hellemans, Karine H

    2011-01-01

    The aim of this study was to establish a gene expression blueprint of pancreatic beta cells conserved from rodents to humans and to evaluate its applicability to assess shifts in the beta cell differentiated state. Genome-wide mRNA expression profiles of isolated beta cells were compared to those...... of a large panel of other tissue and cell types, and transcripts with beta cell-abundant and -selective expression were identified. Iteration of this analysis in mouse, rat and human tissues generated a panel of conserved beta cell biomarkers. This panel was then used to compare isolated versus laser capture...... microdissected beta cells, monitor adaptations of the beta cell phenotype to fasting, and retrieve possible conserved transcriptional regulators....

  11. Comparative Annotation of Viral Genomes with Non-Conserved Gene Structure

    DEFF Research Database (Denmark)

    de Groot, Saskia; Mailund, Thomas; Hein, Jotun

    2007-01-01

    Motivation: Detecting genes in viral genomes is a complex task. Due to the biological necessity of them being constrained in length, RNA viruses in particular tend to code in overlapping reading frames. Since one amino acid is encoded by a triplet of nucleic acids, up to three genes may be coded...... allows for coding in unidirectional nested and overlapping reading frames, to annotate two homologous aligned viral genomes. Our method does not insist on conserved gene structure between the two sequences, thus making it applicable for the pairwise comparison of more distantly related sequences. Results...... and HIV2, as well as of two different Hepatitis Viruses, attaining results of ~87% sensitivity and ~98.5% specificity. We subsequently incorporate prior knowledge by "knowing" the gene structure of one sequence and annotating the other conditional on it. Boosting accuracy close to perfect we demonstrate...

  12. Properties of Sequence Conservation in Upstream Regulatory and Protein Coding Sequences among Paralogs in Arabidopsis thaliana

    Science.gov (United States)

    Richardson, Dale N.; Wiehe, Thomas

    Whole genome duplication (WGD) has catalyzed the formation of new species, genes with novel functions, altered expression patterns, complexified signaling pathways and has provided organisms a level of genetic robustness. We studied the long-term evolution and interrelationships of 5’ upstream regulatory sequences (URSs), protein coding sequences (CDSs) and expression correlations (EC) of duplicated gene pairs in Arabidopsis. Three distinct methods revealed significant evolutionary conservation between paralogous URSs and were highly correlated with microarray-based expression correlation of the respective gene pairs. Positional information on exact matches between sequences unveiled the contribution of micro-chromosomal rearrangements on expression divergence. A three-way rank analysis of URS similarity, CDS divergence and EC uncovered specific gene functional biases. Transcription factor activity was associated with gene pairs exhibiting conserved URSs and divergent CDSs, whereas a broad array of metabolic enzymes was found to be associated with gene pairs showing diverged URSs but conserved CDSs.

  13. CORECLUST: identification of the conserved CRM grammar together with prediction of gene regulation.

    Science.gov (United States)

    Nikulova, Anna A; Favorov, Alexander V; Sutormin, Roman A; Makeev, Vsevolod J; Mironov, Andrey A

    2012-07-01

    Identification of transcriptional regulatory regions and tracing their internal organization are important for understanding the eukaryotic cell machinery. Cis-regulatory modules (CRMs) of higher eukaryotes are believed to possess a regulatory 'grammar', or preferred arrangement of binding sites, that is crucial for proper regulation and thus tends to be evolutionarily conserved. Here, we present a method CORECLUST (COnservative REgulatory CLUster STructure) that predicts CRMs based on a set of positional weight matrices. Given regulatory regions of orthologous and/or co-regulated genes, CORECLUST constructs a CRM model by revealing the conserved rules that describe the relative location of binding sites. The constructed model may be consequently used for the genome-wide prediction of similar CRMs, and thus detection of co-regulated genes, and for the investigation of the regulatory grammar of the system. Compared with related methods, CORECLUST shows better performance at identification of CRMs conferring muscle-specific gene expression in vertebrates and early-developmental CRMs in Drosophila.

  14. Two duplicated chicken-type lysozyme genes in disc abalone Haliotis discus discus: molecular aspects in relevance to structure, genomic organization, mRNA expression and bacteriolytic function.

    Science.gov (United States)

    Umasuthan, Navaneethaiyer; Bathige, S D N K; Kasthuri, Saranya Revathy; Wan, Qiang; Whang, Ilson; Lee, Jehee

    2013-08-01

    Lysozymes are crucial antibacterial proteins that are associated with catalytic cleavage of peptidoglycan and subsequent bacteriolysis. The present study describes the identification of two lysozyme genes from disc abalone Haliotis discus discus and their characterization at sequence-, genomic-, transcriptional- and functional-levels. Two cDNAs and BAC clones bearing lysozyme genes were isolated from abalone transcriptome and BAC genomic libraries, respectively and sequences were determined. Corresponding deduced amino acid sequences harbored a chicken-type lysozyme (LysC) family profile and exhibited conserved characteristics of LysC family members including active residues (Glu and Asp) and GS(S/T)DYGIFQINS motif suggested that they are LysC counterparts in disc abalone and designated as abLysC1 and abLysC2. While abLysC1 represented the homolog recently reported in Ezo abalone [1], abLysC2 shared significant identity with LysC homologs. Unlike other vertebrate LysCs, coding sequence of abLysCs were distributed within five exons interrupted by four introns. Both abLysCs revealed a broader mRNA distribution with highest levels in mantle (abLysC1) and hepatopancreas (abLysC2) suggesting their likely main role in defense and digestion, respectively. Investigation of temporal transcriptional profiles post-LPS and -pathogen challenges revealed induced-responses of abLysCs in gills and hemocytes. The in vitro muramidase activity of purified recombinant (r) abLysCs proteins was evaluated, and findings indicated that they are active in acidic pH range (3.5-6.5) and over a broad temperature range (20-60 °C) and influenced by ionic strength. When the antibacterial spectra of (r)abLysCs were examined, they displayed differential activities against both Gram positive and Gram negative strains providing evidence for their involvement in bacteriolytic function in abalone physiology. Copyright © 2013 Elsevier Ltd. All rights reserved.

  15. Sorting by Cuts, Joins, and Whole Chromosome Duplications.

    Science.gov (United States)

    Zeira, Ron; Shamir, Ron

    2017-02-01

    Genome rearrangement problems have been extensively studied due to their importance in biology. Most studied models assumed a single copy per gene. However, in reality, duplicated genes are common, most notably in cancer. In this study, we make a step toward handling duplicated genes by considering a model that allows the atomic operations of cut, join, and whole chromosome duplication. Given two linear genomes, [Formula: see text] with one copy per gene and [Formula: see text] with two copies per gene, we give a linear time algorithm for computing a shortest sequence of operations transforming [Formula: see text] into [Formula: see text] such that all intermediate genomes are linear. We also show that computing an optimal sequence with fewest duplications is NP-hard.

  16. Craniofacial duplication (diprosopus).

    Science.gov (United States)

    Turpin, I M; Furnas, D W; Amlie, R N

    1981-02-01

    No congenital malformation in infants is more profound than anterior craniofacial duplication. The precise term for this rare anomaly is diprosopus, referring to a fetus with a single trunk, normal limbs, and varying degrees of facial duplication. A search of the world literature produced only 16 cases of diprosopus since 1864. Despite the rarity of this anomaly, three such infants were born in the Southern California area during the past year, making this the largest reported series to date. The three infants were born with two distinctly formed faces. Each had four separate eyes, two mouths, two noses, and two ears with a primitive ear or sinus tract at the plane of fusion. In addition, multiple congenital aberrations existed which involved a variety of internal organs. The pathogenesis of diprosopus is not well understood, but environmental stress early in embryologic development has been suggested as a possible factor. The apparent mechanism is a slowing of pregastrulation oxidation with resultant focal developmental arrests.

  17. Centrioles: duplicating precariously.

    Science.gov (United States)

    Pelletier, Laurence

    2007-09-04

    To assemble a mitotic spindle and accurately segregate chromosomes to progeny, a cell needs to precisely regulate its centrosome number, a feat largely accomplished through the tight control of centriole duplication. Recent work showing that the overexpression of centriolar proteins can lead to the formation of multiple centrioles in the absence of pre-existing centrioles challenges the idea that it is a self-replicating organelle.

  18. Rectal duplication: a case report.

    Science.gov (United States)

    Didden, K; Masereel, B; Geyskens, P

    2013-01-01

    Gastrointestinal tract duplications are uncommon congenital abnormalities, that may occur anywhere along the alimentary tract. Most frequently they occur at the level of the small bowel tract and are symptomatic before the age of two. In our case we report the history of a 68-years old women with a colon duplication, especially a rectal duplication. This is very exceptional.

  19. Embryonic duplications in sheep.

    Science.gov (United States)

    Dennis, S M

    1975-02-01

    Twenty-seven embryonic duplications were examined during a 3-year investigation into the causes of perinatal lamb mortality. Twenty of the 27 were anomalous twins with 19 being conjoined (diplopagus 9 and heteropagus 10). The various duplications were: haloacardius acephalus 1, diprosopus 2, dicephalus 2, dipypus 3, diprosopus dipygus 1, syncephalus dipygus 1, pygopagus parasiticus 1, heteropagus dipygus 3, melodidymus 6, polyury 4, penile duplication 2, and bilateral otognathia 1. Four lambs were living and the time of death of the others was: parturient 8, and post-parturient 15. Average dry weight of the lambs was 3.35 kg (range 1.59 to 5.45 kg). Breed distribution was: Merino 77.8%, Crossbred 14.8%, Dorset Horn 3.7%, and Corriedale 3.7%. The caudal region was involved in 10 of the conjoined twins (52.6%), anterior region in 7 (36.9%), and both anterior and caudal regions in 2 (10.5%). Associated defects were present in 70.4% of the 27 lambs, the most common being atresia ani.

  20. The sequence and analysis of duplication rich human chromosome 16

    Energy Technology Data Exchange (ETDEWEB)

    Martin, Joel; Han, Cliff; Gordon, Laurie A.; Terry, Astrid; Prabhakar, Shyam; She, Xinwei; Xie, Gary; Hellsten, Uffe; Man Chan, Yee; Altherr, Michael; Couronne, Olivier; Aerts, Andrea; Bajorek, Eva; Black, Stacey; Blumer, Heather; Branscomb, Elbert; Brown, Nancy C.; Bruno, William J.; Buckingham, Judith M.; Callen, David F.; Campbell, Connie S.; Campbell, Mary L.; Campbell, Evelyn W.; Caoile, Chenier; Challacombe, Jean F.; Chasteen, Leslie A.; Chertkov, Olga; Chi, Han C.; Christensen, Mari; Clark, Lynn M.; Cohn, Judith D.; Denys, Mirian; Detter, John C.; Dickson, Mark; Dimitrijevic-Bussod, Mira; Escobar, Julio; Fawcett, Joseph J.; Flowers, Dave; Fotopulos, Dea; Glavina, Tijana; Gomez, Maria; Gonzales, Eidelyn; Goodstein, David; Goodwin, Lynne A.; Grady, Deborah L.; Grigoriev, Igor; Groza, Matthew; Hammon, Nancy; Hawkins, Trevor; Haydu, Lauren; Hildebrand, Carl E.; Huang, Wayne; Israni, Sanjay; Jett, Jamie; Jewett, Phillip E.; Kadner, Kristen; Kimball, Heather; Kobayashi, Arthur; Krawczyk, Marie-Claude; Leyba, Tina; Longmire, Jonathan L.; Lopez, Frederick; Lou, Yunian; Lowry, Steve; Ludeman, Thom; Mark, Graham A.; Mcmurray, Kimberly L.; Meincke, Linda J.; Morgan, Jenna; Moyzis, Robert K.; Mundt, Mark O.; Munk, A. Christine; Nandkeshwar, Richard D.; Pitluck, Sam; Pollard, Martin; Predki, Paul; Parson-Quintana, Beverly; Ramirez, Lucia; Rash, Sam; Retterer, James; Ricke, Darryl O.; Robinson, Donna L.; Rodriguez, Alex; Salamov, Asaf; Saunders, Elizabeth H.; Scott, Duncan; Shough, Timothy; Stallings, Raymond L.; Stalvey, Malinda; Sutherland, Robert D.; Tapia, Roxanne; Tesmer, Judith G.; Thayer, Nina; Thompson, Linda S.; Tice, Hope; Torney, David C.; Tran-Gyamfi, Mary; Tsai, Ming; Ulanovsky, Levy E.; Ustaszewska, Anna; Vo, Nu; White, P. Scott; Williams, Albert L.; Wills, Patricia L.; Wu, Jung-Rung; Wu, Kevin; Yang, Joan; DeJong, Pieter; Bruce, David; Doggett, Norman; Deaven, Larry; Schmutz, Jeremy; Grimwood, Jane; Richardson, Paul; et al.

    2004-08-01

    We report here the 78,884,754 base pairs of finished human chromosome 16 sequence, representing over 99.9 percent of its euchromatin. Manual annotation revealed 880 protein coding genes confirmed by 1,637 aligned transcripts, 19 tRNA genes, 341 pseudogenes and 3 RNA pseudogenes. These genes include metallothionein, cadherin and iroquois gene families, as well as the disease genes for polycystic kidney disease and acute myelomonocytic leukemia. Several large-scale structural polymorphisms spanning hundreds of kilobasepairs were identified and result in gene content differences across humans. One of the unique features of chromosome 16 is its high level of segmental duplication, ranked among the highest of the human autosomes. While the segmental duplications are enriched in the relatively gene poor pericentromere of the p-arm, some are involved in recent gene duplication and conversion events which are likely to have had an impact on the evolution of primates and human disease susceptibility.

  1. The Sequence and Analysis of Duplication Rich Human Chromosome 16

    Science.gov (United States)

    Martin, Joel; Han, Cliff; Gordon, Laurie A.; Terry, Astrid; Prabhakar, Shyam; She, Xinwei; Xie, Gary; Hellsten, Uffe; Man Chan, Yee; Altherr, Michael; Couronne, Olivier; Aerts, Andrea; Bajorek, Eva; Black, Stacey; Blumer, Heather; Branscomb, Elbert; Brown, Nancy C.; Bruno, William J.; Buckingham, Judith M.; Callen, David F.; Campbell, Connie S.; Campbell, Mary L.; Campbell, Evelyn W.; Caoile, Chenier; Challacombe, Jean F.; Chasteen, Leslie A.; Chertkov, Olga; Chi, Han C.; Christensen, Mari; Clark, Lynn M.; Cohn, Judith D.; Denys, Mirian; Detter, John C.; Dickson, Mark; Dimitrijevic-Bussod, Mira; Escobar, Julio; Fawcett, Joseph J.; Flowers, Dave; Fotopulos, Dea; Glavina, Tijana; Gomez, Maria; Gonzales, Eidelyn; Goodstein, David; Goodwin, Lynne A.; Grady, Deborah L.; Grigoriev, Igor; Groza, Matthew; Hammon, Nancy; Hawkins, Trevor; Haydu, Lauren; Hildebrand, Carl E.; Huang, Wayne; Israni, Sanjay; Jett, Jamie; Jewett, Phillip E.; Kadner, Kristen; Kimball, Heather; Kobayashi, Arthur; Krawczyk, Marie-Claude; Leyba, Tina; Longmire, Jonathan L.; Lopez, Frederick; Lou, Yunian; Lowry, Steve; Ludeman, Thom; Mark, Graham A.; Mcmurray, Kimberly L.; Meincke, Linda J.; Morgan, Jenna; Moyzis, Robert K.; Mundt, Mark O.; Munk, A. Christine; Nandkeshwar, Richard D.; Pitluck, Sam; Pollard, Martin; Predki, Paul; Parson-Quintana, Beverly; Ramirez, Lucia; Rash, Sam; Retterer, James; Ricke, Darryl O.; Robinson, Donna L.; Rodriguez, Alex; Salamov, Asaf; Saunders, Elizabeth H.; Scott, Duncan; Shough, Timothy; Stallings, Raymond L.; Stalvey, Malinda; Sutherland, Robert D.; Tapia, Roxanne; Tesmer, Judith G.; Thayer, Nina; Thompson, Linda S.; Tice, Hope; Torney, David C.; Tran-Gyamfi, Mary; Tsai, Ming; Ulanovsky, Levy E.; Ustaszewska, Anna; Vo, Nu; White, P. Scott; Williams, Albert L.; Wills, Patricia L.; Wu, Jung-Rung; Wu, Kevin; Yang, Joan; DeJong, Pieter; Bruce, David; Doggett, Norman; Deaven, Larry; Schmutz, Jeremy; Grimwood, Jane; Richardson, Paul; et al.

    2004-01-01

    We report here the 78,884,754 base pairs of finished human chromosome 16 sequence, representing over 99.9 percent of its euchromatin. Manual annotation revealed 880 protein coding genes confirmed by 1,637 aligned transcripts, 19 tRNA genes, 341 pseudogenes and 3 RNA pseudogenes. These genes include metallothionein, cadherin and iroquois gene families, as well as the disease genes for polycystic kidney disease and acute myelomonocytic leukemia. Several large-scale structural polymorphisms spanning hundreds of kilobasepairs were identified and result in gene content differences across humans. One of the unique features of chromosome 16 is its high level of segmental duplication, ranked among the highest of the human autosomes. While the segmental duplications are enriched in the relatively gene poor pericentromere of the p-arm, some are involved in recent gene duplication and conversion events which are likely to have had an impact on the evolution of primates and human disease susceptibility.

  2. Evolutionary conservation of essential and highly expressed genes in Pseudomonas aeruginosa

    Directory of Open Access Journals (Sweden)

    Scharfe Maren

    2010-04-01

    Full Text Available Abstract Background The constant increase in development and spread of bacterial resistance to antibiotics poses a serious threat to human health. New sequencing technologies are now on the horizon that will yield massive increases in our capacity for DNA sequencing and will revolutionize the drug discovery process. Since essential genes are promising novel antibiotic targets, the prediction of gene essentiality based on genomic information has become a major focus. Results In this study we demonstrate that pooled sequencing is applicable for the analysis of sequence variations of strain collections with more than 10 individual isolates. Pooled sequencing of 36 clinical Pseudomonas aeruginosa isolates revealed that essential and highly expressed proteins evolve at lower rates, whereas extracellular proteins evolve at higher rates. We furthermore refined the list of experimentally essential P. aeruginosa genes, and identified 980 genes that show no sequence variation at all. Among the conserved nonessential genes we found several that are involved in regulation, motility and virulence, indicating that they represent factors of evolutionary importance for the lifestyle of a successful environmental bacterium and opportunistic pathogen. Conclusion The detailed analysis of a comprehensive set of P. aeruginosa genomes in this study clearly disclosed detailed information of the genomic makeup and revealed a large set of highly conserved genes that play an important role for the lifestyle of this microorganism. Sequencing strain collections enables for a detailed and extensive identification of sequence variations as potential bacterial adaptation processes, e.g., during the development of antibiotic resistance in the clinical setting and thus may be the basis to uncover putative targets for novel treatment strategies.

  3. Fanconi anemia core complex gene promoters harbor conserved transcription regulatory elements.

    Science.gov (United States)

    Meier, Daniel; Schindler, Detlev

    2011-01-01

    The Fanconi anemia (FA) gene family is a recent addition to the complex network of proteins that respond to and repair certain types of DNA damage in the human genome. Since little is known about the regulation of this novel group of genes at the DNA level, we characterized the promoters of the eight genes (FANCA, B, C, E, F, G, L and M) that compose the FA core complex. The promoters of these genes show the characteristic attributes of housekeeping genes, such as a high GC content and CpG islands, a lack of TATA boxes and a low conservation. The promoters functioned in a monodirectional way and were, in their most active regions, comparable in strength to the SV40 promoter in our reporter plasmids. They were also marked by a distinctive transcriptional start site (TSS). In the 5' region of each promoter, we identified a region that was able to negatively regulate the promoter activity in HeLa and HEK 293 cells in isolation. The central and 3' regions of the promoter sequences harbor binding sites for several common and rare transcription factors, including STAT, SMAD, E2F, AP1 and YY1, which indicates that there may be cross-connections to several established regulatory pathways. Electrophoretic mobility shift assays and siRNA experiments confirmed the shared regulatory responses between the prominent members of the TGF-β and JAK/STAT pathways and members of the FA core complex. Although the promoters are not well conserved, they share region and sequence specific regulatory motifs and transcription factor binding sites (TBFs), and we identified a bi-partite nature to these promoters. These results support a hypothesis based on the co-evolution of the FA core complex genes that was expanded to include their promoters.

  4. Fanconi anemia core complex gene promoters harbor conserved transcription regulatory elements.

    Directory of Open Access Journals (Sweden)

    Daniel Meier

    Full Text Available The Fanconi anemia (FA gene family is a recent addition to the complex network of proteins that respond to and repair certain types of DNA damage in the human genome. Since little is known about the regulation of this novel group of genes at the DNA level, we characterized the promoters of the eight genes (FANCA, B, C, E, F, G, L and M that compose the FA core complex. The promoters of these genes show the characteristic attributes of housekeeping genes, such as a high GC content and CpG islands, a lack of TATA boxes and a low conservation. The promoters functioned in a monodirectional way and were, in their most active regions, comparable in strength to the SV40 promoter in our reporter plasmids. They were also marked by a distinctive transcriptional start site (TSS. In the 5' region of each promoter, we identified a region that was able to negatively regulate the promoter activity in HeLa and HEK 293 cells in isolation. The central and 3' regions of the promoter sequences harbor binding sites for several common and rare transcription factors, including STAT, SMAD, E2F, AP1 and YY1, which indicates that there may be cross-connections to several established regulatory pathways. Electrophoretic mobility shift assays and siRNA experiments confirmed the shared regulatory responses between the prominent members of the TGF-β and JAK/STAT pathways and members of the FA core complex. Although the promoters are not well conserved, they share region and sequence specific regulatory motifs and transcription factor binding sites (TBFs, and we identified a bi-partite nature to these promoters. These results support a hypothesis based on the co-evolution of the FA core complex genes that was expanded to include their promoters.

  5. Blueprint for a minimal photoautotrophic cell: conserved and variable genes in Synechococcus elongatus PCC 7942

    Directory of Open Access Journals (Sweden)

    Peretó Juli

    2011-01-01

    Full Text Available Abstract Background Simpler biological systems should be easier to understand and to engineer towards pre-defined goals. One way to achieve biological simplicity is through genome minimization. Here we looked for genomic islands in the fresh water cyanobacteria Synechococcus elongatus PCC 7942 (genome size 2.7 Mb that could be used as targets for deletion. We also looked for conserved genes that might be essential for cell survival. Results By using a combination of methods we identified 170 xenologs, 136 ORFans and 1401 core genes in the genome of S. elongatus PCC 7942. These represent 6.5%, 5.2% and 53.6% of the annotated genes respectively. We considered that genes in genomic islands could be found if they showed a combination of: a unusual G+C content; b unusual phylogenetic similarity; and/or c a small number of the highly iterated palindrome 1 (HIP1 motif plus an unusual codon usage. The origin of the largest genomic island by horizontal gene transfer (HGT could be corroborated by lack of coverage among metagenomic sequences from a fresh water microbialite. Evidence is also presented that xenologous genes tend to cluster in operons. Interestingly, most genes coding for proteins with a diguanylate cyclase domain are predicted to be xenologs, suggesting a role for horizontal gene transfer in the evolution of Synechococcus sensory systems. Conclusions Our estimates of genomic islands in PCC 7942 are larger than those predicted by other published methods like SIGI-HMM. Our results set a guide to non-essential genes in S. elongatus PCC 7942 indicating a path towards the engineering of a model photoautotrophic bacterial cell.

  6. Genetics Home Reference: 7q11.23 duplication syndrome

    Science.gov (United States)

    ... Duplication Syndrome. 2015 Nov 25. In: Pagon RA, Adam MP, Ardinger HH, Wallace SE, Amemiya A, Bean LJH, Bird TD, Ledbetter N, Mefford HC, Smith RJH, Stephens K, editors. GeneReviews® [Internet]. Seattle (WA): ...

  7. Remarkable sequence conservation of the last intron in the PKD1 gene.

    Science.gov (United States)

    Rodova, Marianna; Islam, M Rafiq; Peterson, Kenneth R; Calvet, James P

    2003-10-01

    The last intron of the PKD1 gene (intron 45) was found to have exceptionally high sequence conservation across four mammalian species: human, mouse, rat, and dog. This conservation did not extend to the comparable intron in pufferfish. Pairwise comparisons for intron 45 showed 91% identity (human vs. dog) to 100% identity (mouse vs. rat) for an average for all four species of 94% identity. In contrast, introns 43 and 44 of the PKD1 gene had average pairwise identities of 57% and 54%, and exons 43, 44, and 45 and the coding region of exon 46 had average pairwise identities of 80%, 84%, 82%, and 80%. Intron 45 is 90 to 95 bp in length, with the major region of sequence divergence being in a central 4-bp to 9-bp variable region. RNA secondary structure analysis of intron 45 predicts a branching stem-loop structure in which the central variable region lies in one loop and the putative branch point sequence lies in another loop, suggesting that the intron adopts a specific stem-loop structure that may be important for its removal. Although intron 45 appears to conform to the class of small, G-triplet-containing introns that are spliced by a mechanism utilizing intron definition, its high sequence conservation may be a reflection of constraints imposed by a unique mechanism that coordinates splicing of this last PKD1 intron with polyadenylation.

  8. Craniofacial duplication: a case report.

    Science.gov (United States)

    Suryawanshi, Pradeep; Deshpande, Mandar; Verma, Nitin; Mahendrakar, Vivek; Mahendrakar, Sandhya

    2013-09-01

    A craniofacial duplication or diprosopus is an unusual variant of conjoined twinning. The reported incidence is one in 180,000-15 million births and 35 cases have been reported till date. The phenotype is wide, with the partial duplication of a few facial structures to complete dicephalus. A complete duplication is associated with a high incidence of anomalies in the central nervous system, cardiovascular system, gastrointestinal system and the respiratory system, whereas no major anomalies are found in the infants with a partial duplication. A term baby with the features of a craniofacial duplication has been described, with the proposed theories on embryogenesis and a brief review of the literature.

  9. Rectal duplication with sciatic hernia.

    Science.gov (United States)

    Nosek, Marzena; Golonka, Anna; Kalińska-Lipert, Anita; Nachulewicz, Paweł

    2015-07-01

    Rectal duplications represent 5% of all duplications in the alimentary tract, and they are very rarely diagnosed during the neonatal period. The authors present the method of investigation and the results of surgical treatment of a full-term neonate with a sciatic hernia containing a rectal duplication. The procedure started with three-port laparoscopy, but excision of the tubular duplication of the rectum was possible only by a transanal endorectal pull-through approach. The sciatic hernia was closed, and plastic sutures on the buttock finished the procedure. The coincidence of sciatic hernia with rectal duplication is extremely rare, and the method of treatment depends exclusively on the anatomical conditions.

  10. TOPAZ1, a novel germ cell-specific expressed gene conserved during evolution across vertebrates.

    Directory of Open Access Journals (Sweden)

    Adrienne Baillet

    Full Text Available BACKGROUND: We had previously reported that the Suppression Subtractive Hybridization (SSH approach was relevant for the isolation of new mammalian genes involved in oogenesis and early follicle development. Some of these transcripts might be potential new oocyte and granulosa cell markers. We have now characterized one of them, named TOPAZ1 for the Testis and Ovary-specific PAZ domain gene. PRINCIPAL FINDINGS: Sheep and mouse TOPAZ1 mRNA have 4,803 bp and 4,962 bp open reading frames (20 exons, respectively, and encode putative TOPAZ1 proteins containing 1,600 and 1653 amino acids. They possess PAZ and CCCH domains. In sheep, TOPAZ1 mRNA is preferentially expressed in females during fetal life with a peak during prophase I of meiosis, and in males during adulthood. In the mouse, Topaz1 is a germ cell-specific gene. TOPAZ1 protein is highly conserved in vertebrates and specifically expressed in mouse and sheep gonads. It is localized in the cytoplasm of germ cells from the sheep fetal ovary and mouse adult testis. CONCLUSIONS: We have identified a novel PAZ-domain protein that is abundantly expressed in the gonads during germ cell meiosis. The expression pattern of TOPAZ1, and its high degree of conservation, suggests that it may play an important role in germ cell development. Further characterization of TOPAZ1 may elucidate the mechanisms involved in gametogenesis, and particularly in the RNA silencing process in the germ line.

  11. Gene expression in chicken reveals correlation with structural genomic features and conserved patterns of transcription in the terrestrial vertebrates.

    Directory of Open Access Journals (Sweden)

    Haisheng Nie

    Full Text Available BACKGROUND: The chicken is an important agricultural and avian-model species. A survey of gene expression in a range of different tissues will provide a benchmark for understanding expression levels under normal physiological conditions in birds. With expression data for birds being very scant, this benchmark is of particular interest for comparative expression analysis among various terrestrial vertebrates. METHODOLOGY/PRINCIPAL FINDINGS: We carried out a gene expression survey in eight major chicken tissues using whole genome microarrays. A global picture of gene expression is presented for the eight tissues, and tissue specific as well as common gene expression were identified. A Gene Ontology (GO term enrichment analysis showed that tissue-specific genes are enriched with GO terms reflecting the physiological functions of the specific tissue, and housekeeping genes are enriched with GO terms related to essential biological functions. Comparisons of structural genomic features between tissue-specific genes and housekeeping genes show that housekeeping genes are more compact. Specifically, coding sequence and particularly introns are shorter than genes that display more variation in expression between tissues, and in addition intergenic space was also shorter. Meanwhile, housekeeping genes are more likely to co-localize with other abundantly or highly expressed genes on the same chromosomal regions. Furthermore, comparisons of gene expression in a panel of five common tissues between birds, mammals and amphibians showed that the expression patterns across tissues are highly similar for orthologous genes compared to random gene pairs within each pair-wise comparison, indicating a high degree of functional conservation in gene expression among terrestrial vertebrates. CONCLUSIONS: The housekeeping genes identified in this study have shorter gene length, shorter coding sequence length, shorter introns, and shorter intergenic regions, there seems

  12. A synergism between adaptive effects and evolvability drives whole genome duplication to fixation

    NARCIS (Netherlands)

    Cuypers, Thomas D; Hogeweg, Paulien; Hogeweg, P.

    Whole genome duplication has shaped eukaryotic evolutionary history and has been associated with drastic environmental change and species radiation. While the most common fate of WGD duplicates is a return to single copy, retained duplicates have been found enriched for highly interacting genes.

  13. Comparative genomics of Mycoplasma: analysis of conserved essential genes and diversity of the pan-genome.

    Directory of Open Access Journals (Sweden)

    Wei Liu

    Full Text Available Mycoplasma, the smallest self-replicating organism with a minimal metabolism and little genomic redundancy, is expected to be a close approximation to the minimal set of genes needed to sustain bacterial life. This study employs comparative evolutionary analysis of twenty Mycoplasma genomes to gain an improved understanding of essential genes. By analyzing the core genome of mycoplasmas, we finally revealed the conserved essential genes set for mycoplasma survival. Further analysis showed that the core genome set has many characteristics in common with experimentally identified essential genes. Several key genes, which are related to DNA replication and repair and can be disrupted in transposon mutagenesis studies, may be critical for bacteria survival especially over long period natural selection. Phylogenomic reconstructions based on 3,355 homologous groups allowed robust estimation of phylogenetic relatedness among mycoplasma strains. To obtain deeper insight into the relative roles of molecular evolution in pathogen adaptation to their hosts, we also analyzed the positive selection pressures on particular sites and lineages. There appears to be an approximate correlation between the divergence of species and the level of positive selection detected in corresponding lineages.

  14. Conserved syntenic clusters of protein coding genes are missing in birds.

    Science.gov (United States)

    Lovell, Peter V; Wirthlin, Morgan; Wilhelm, Larry; Minx, Patrick; Lazar, Nathan H; Carbone, Lucia; Warren, Wesley C; Mello, Claudio V

    2014-01-01

    Birds are one of the most highly successful and diverse groups of vertebrates, having evolved a number of distinct characteristics, including feathers and wings, a sturdy lightweight skeleton and unique respiratory and urinary/excretion systems. However, the genetic basis of these traits is poorly understood. Using comparative genomics based on extensive searches of 60 avian genomes, we have found that birds lack approximately 274 protein coding genes that are present in the genomes of most vertebrate lineages and are for the most part organized in conserved syntenic clusters in non-avian sauropsids and in humans. These genes are located in regions associated with chromosomal rearrangements, and are largely present in crocodiles, suggesting that their loss occurred subsequent to the split of dinosaurs/birds from crocodilians. Many of these genes are associated with lethality in rodents, human genetic disorders, or biological functions targeting various tissues. Functional enrichment analysis combined with orthogroup analysis and paralog searches revealed enrichments that were shared by non-avian species, present only in birds, or shared between all species. Together these results provide a clearer definition of the genetic background of extant birds, extend the findings of previous studies on missing avian genes, and provide clues about molecular events that shaped avian evolution. They also have implications for fields that largely benefit from avian studies, including development, immune system, oncogenesis, and brain function and cognition. With regards to the missing genes, birds can be considered ‘natural knockouts’ that may become invaluable model organisms for several human diseases.

  15. Conservation of gene cassettes among diverse viruses of the human gut.

    Directory of Open Access Journals (Sweden)

    Samuel Minot

    Full Text Available Viruses are a crucial component of the human microbiome, but large population sizes, high sequence diversity, and high frequencies of novel genes have hindered genomic analysis by high-throughput sequencing. Here we investigate approaches to metagenomic assembly to probe genome structure in a sample of 5.6 Gb of gut viral DNA sequence from six individuals. Tests showed that a new pipeline based on DeBruijn graph assembly yielded longer contigs that were able to recruit more reads than the equivalent non-optimized, single-pass approach. To characterize gene content, the database of viral RefSeq proteins was compared to the assembled viral contigs, generating a bipartite graph with functional cassettes linking together viral contigs, which revealed a high degree of connectivity between diverse genomes involving multiple genes of the same functional class. In a second step, open reading frames were grouped by their co-occurrence on contigs in a database-independent manner, revealing conserved cassettes of co-oriented ORFs. These methods reveal that free-living bacteriophages, while usually dissimilar at the nucleotide level, often have significant similarity at the level of encoded amino acid motifs, gene order, and gene orientation. These findings thus connect contemporary metagenomic analysis with classical studies of bacteriophage genomic cassettes. Software is available at https://sourceforge.net/projects/optitdba/.

  16. Conservation of the rad21 Schizosaccharomyces pombe DNA double-strand break repair gene in mammals

    International Nuclear Information System (INIS)

    McKay, Michael J.; Spek, Peter van der; Kanaar, Roland; Smit, Bep; Bootsma, Dirk; Hoeijmakers, Jan H. J.

    1996-01-01

    Purpose/Objective: Genetic factors are likely to be major determinants of human cellular ionizing radiation sensitivity. DNA double strand breaks (dsbs) are significant ionizing radiation-induced lesions; cellular DNA dsb processing is also important in a number of other contexts. To further the understanding of DNA dsb processing in mammalian cells, we cloned and sequenced mammalian homologs of the rad21 Schizosaccharomyces pombe DNA dsb repair gene. Materials and Methods: The genes were cloned by evolutionary walking, exploiting sequence homology between the yeast and mammalian genes. Results: No major motifs indicative of a particular function were present in the predicted amino acid sequences of the mammalian genes. Alignment of the Rad21 amino acid sequence with its putative homologs showed that similarity was distributed across the length of the proteins, with more highly conserved regions at both termini. The mHR21 sp (mouse homolog ofR ad21, S. pombe) and hHR21 sp (humanh omolog of Rad21, S. pombe) predicted proteins were 96% identical, whereas the human and S. pombe proteins were 25% identical and 47% similar. RNA blot analysis showed that mHR21 sp mRNA was abundant in all adult mouse tissues examined, with highest expression in testis and thymus. In addition to a 3.1kb mRNA transcript in all tissues, an additional 2.2kb transcript was present at a high level in post-meiotic spermatids, white expression of the 3.1kb mRNA in testis was confined to the meiotic compartment. hHR21 sp mRNA was cell cycle regulated in human cells, increasing in late S phase to a peak in G2 phase. The level of hHR21 sp transcripts was not altered by exposure of normal diploid fibroblasts to 10 Gy ionizing radiation. In situ hybridization showed mHR21 sp resided on chromosome 15D3, whereashHR21 sp localized to the syntenic 8q24 region. Conclusion: Cloning these novel mammalian genes and characterization of their protein products should contribute to the understanding of cellular

  17. EST analysis in Ginkgo biloba: an assessment of conserved developmental regulators and gymnosperm specific genes

    Directory of Open Access Journals (Sweden)

    Runko Suzan J

    2005-10-01

    Full Text Available Abstract Background Ginkgo biloba L. is the only surviving member of one of the oldest living seed plant groups with medicinal, spiritual and horticultural importance worldwide. As an evolutionary relic, it displays many characters found in the early, extinct seed plants and extant cycads. To establish a molecular base to understand the evolution of seeds and pollen, we created a cDNA library and EST dataset from the reproductive structures of male (microsporangiate, female (megasporangiate, and vegetative organs (leaves of Ginkgo biloba. Results RNA from newly emerged male and female reproductive organs and immature leaves was used to create three distinct cDNA libraries from which 6,434 ESTs were generated. These 6,434 ESTs from Ginkgo biloba were clustered into 3,830 unigenes. A comparison of our Ginkgo unigene set against the fully annotated genomes of rice and Arabidopsis, and all available ESTs in Genbank revealed that 256 Ginkgo unigenes match only genes among the gymnosperms and non-seed plants – many with multiple matches to genes in non-angiosperm plants. Conversely, another group of unigenes in Gingko had highly significant homology to transcription factors in angiosperms involved in development, including MADS box genes as well as post-transcriptional regulators. Several of the conserved developmental genes found in Ginkgo had top BLAST homology to cycad genes. We also note here the presence of ESTs in G. biloba similar to genes that to date have only been found in gymnosperms and an additional 22 Ginkgo genes common only to genes from cycads. Conclusion Our analysis of an EST dataset from G. biloba revealed genes potentially unique to gymnosperms. Many of these genes showed homology to fully sequenced clones from our cycad EST dataset found in common only with gymnosperms. Other Ginkgo ESTs are similar to developmental regulators in higher plants. This work sets the stage for future studies on Ginkgo to better understand seed and

  18. Analysis of MADS-Box Gene Family Reveals Conservation in Floral Organ ABCDE Model of Moso Bamboo (Phyllostachys edulis

    Directory of Open Access Journals (Sweden)

    Zhanchao Cheng

    2017-05-01

    Full Text Available Mini chromosome maintenance 1, agamous, deficiens, and serum response factor (MADS-box genes are transcription factors which play fundamental roles in flower development and regulation of floral organ identity. However, till date, identification and functions of MADS-box genes remain largely unclear in Phyllostachys edulis. In view of this, we performed a whole-genome survey and identified 34 MADS-box genes in P. edulis, and based on phylogeny, they were classified as MIKCC, MIKC∗, Mα, and Mβ. The detailed analysis about gene structure and motifs, phylogenetic classification, comparison of gene divergence and duplication are provided. Interestingly, expression patterns for most genes were found similar to those of Arabidopsis and rice, indicating that the well-established ABCDE model can be applied to P. edulis. Moreover, we overexpressed PheMADS15, an AP1-like gene, in Arabidopsis, and found that the transgenic plants have early flowering phenotype, suggesting that PheMADS15 might be a regulator of flowering transition in P. edulis. Taken together, this study provides not only insightful comprehension but also useful information for understanding the functions of MADS-box genes in P. edulis.

  19. Differential conservation and divergence of fertility genes boule and dazl in the rainbow trout.

    Directory of Open Access Journals (Sweden)

    Mingyou Li

    Full Text Available BACKGROUND: The genes boule and dazl are members of the DAZ (Deleted in Azoospermia family encoding RNA binding proteins essential for germ cell development. Although dazl exhibits bisexual expression in mitotic and meiotic germ cells in diverse animals, boule shows unisexual meiotic expression in invertebrates and mammals but a bisexual mitotic and meiotic expression in medaka. How boule and dazl have evolved different expression patterns in diverse organisms has remained unknown. METHODOLOGY AND PRINCIPAL FINDINGS: Here we chose the fish rainbow trout (Oncorhynchus mykiss as a second lower vertebrate model to investigate the expression of boule and dazl. By molecular cloning and sequence comparison, we identified cDNAs encoding the trout Boule and Dazl proteins, which have a conserved RNA-recognition motif and a maximal similarity to their homologs. By RT-PCR analysis, adult RNA expression of trout boule and dazl is restricted to the gonads of both sexes. By chromogenic and two-color fluorescence in situ hybridization, we revealed bisexual and germline-specific expression of boule and dazl. We found that dazl displays conserved expression throughout gametogenesis and concentrates in the Balbinani's body of early oocytes and the chromatoid body of sperm. Surprisingly, boule exhibits mitotic and meiotic expression in the male but meiosis-specific expression in the female. CONCLUSIONS: Our data underscores differential conservation and divergence of DAZ family genes during vertebrate evolution. We propose a model in which the diversity of boule expression in sex and stage specificity might have resulted from selective loss or gain of its expression in one sex and mitotic germ cells.

  20. Genes of the most conserved WOX clade in plants affect root and flower development in Arabidopsis

    Directory of Open Access Journals (Sweden)

    Moreau Hervé

    2008-10-01

    Full Text Available Abstract Background The Wuschel related homeobox (WOX family proteins are key regulators implicated in the determination of cell fate in plants by preventing cell differentiation. A recent WOX phylogeny, based on WOX homeodomains, showed that all of the Physcomitrella patens and Selaginella moellendorffii WOX proteins clustered into a single orthologous group. We hypothesized that members of this group might preferentially share a significant part of their function in phylogenetically distant organisms. Hence, we first validated the limits of the WOX13 orthologous group (WOX13 OG using the occurrence of other clade specific signatures and conserved intron insertion sites. Secondly, a functional analysis using expression data and mutants was undertaken. Results The WOX13 OG contained the most conserved plant WOX proteins including the only WOX detected in the highly proliferating basal unicellular and photosynthetic organism Ostreococcus tauri. A large expansion of the WOX family was observed after the separation of mosses from other land plants and before monocots and dicots have arisen. In Arabidopsis thaliana, AtWOX13 was dynamically expressed during primary and lateral root initiation and development, in gynoecium and during embryo development. AtWOX13 appeared to affect the floral transition. An intriguing clade, represented by the functional AtWOX14 gene inside the WOX13 OG, was only found in the Brassicaceae. Compared to AtWOX13, the gene expression profile of AtWOX14 was restricted to the early stages of lateral root formation and specific to developing anthers. A mutational insertion upstream of the AtWOX14 homeodomain sequence led to abnormal root development, a delay in the floral transition and premature anther differentiation. Conclusion Our data provide evidence in favor of the WOX13 OG as the clade containing the most conserved WOX genes and established a functional link to organ initiation and development in Arabidopsis, most

  1. Duplicated middle cerebral artery

    Science.gov (United States)

    Perez, Jesus; Machado, Calixto; Scherle, Claudio; Hierro, Daniel

    2009-01-01

    Duplicated middle cerebral artery (DMCA) is an anomalous vessel arising from the internal carotid artery. The incidence DMCA is relatively law, and an association between this anomaly and cerebral aneurysms has been documented. There is a controversy whether DMCA may have perforating arteries. This is an important fact to consider in aneurysm surgery. We report the case of a 34-year-old black woman who suffered a subarachnoid hemorrhage and the angiography a left DMCA, and an aneurysm in an inferior branch of the main MCA. The DMCA and the MCA had perforating arteries. The aneurysm was clipped without complications. The observation of perforating arteries in our patient confirms that the DMCA may have perforating arteries. This is very important to be considered in cerebral aneurysms surgery. Moreover, the DMCA may potentially serve as a collateral blood supply to the MCA territory in cases of MCA occlusion. PMID:22140405

  2. Duplication at Xq28 involving IKBKG is associated with progressive macrocephaly, recurrent infections, ectodermal dysplasia, benign tumors, and neuropathy

    NARCIS (Netherlands)

    Asbeck, E. Van; Ramalingam, A.; Dvorak, C.; Chen, T.J.; Morava, E.

    2014-01-01

    Duplications on Xq28 are common, although quite variable in size, but usually include the MECP2 gene. Here, we present a patient with a unique, small, 167-kb duplication at Xq28, not including MECP2. The most important gene in the duplicated region was IKBKG, mutations in which can cause a variety

  3. Genomic Imprinting Was Evolutionarily Conserved during Wheat Polyploidization.

    Science.gov (United States)

    Yang, Guanghui; Liu, Zhenshan; Gao, Lulu; Yu, Kuohai; Feng, Man; Yao, Yingyin; Peng, Huiru; Hu, Zhaorong; Sun, Qixin; Ni, Zhongfu; Xin, Mingming

    2018-01-01

    Genomic imprinting is an epigenetic phenomenon that causes genes to be differentially expressed depending on their parent of origin. To evaluate the evolutionary conservation of genomic imprinting and the effects of ploidy on this process, we investigated parent-of-origin-specific gene expression patterns in the endosperm of diploid ( Aegilops spp), tetraploid, and hexaploid wheat ( Triticum spp) at various stages of development via high-throughput transcriptome sequencing. We identified 91, 135, and 146 maternally or paternally expressed genes (MEGs or PEGs, respectively) in diploid, tetraploid, and hexaploid wheat, respectively, 52.7% of which exhibited dynamic expression patterns at different developmental stages. Gene Ontology enrichment analysis suggested that MEGs and PEGs were involved in metabolic processes and DNA-dependent transcription, respectively. Nearly half of the imprinted genes exhibited conserved expression patterns during wheat hexaploidization. In addition, 40% of the homoeolog pairs originating from whole-genome duplication were consistently maternally or paternally biased in the different subgenomes of hexaploid wheat. Furthermore, imprinted expression was found for 41.2% and 50.0% of homolog pairs that evolved by tandem duplication after genome duplication in tetraploid and hexaploid wheat, respectively. These results suggest that genomic imprinting was evolutionarily conserved between closely related Triticum and Aegilops species and in the face of polyploid hybridization between species in these genera. © 2018 American Society of Plant Biologists. All rights reserved.

  4. Functional conservation of coenzyme Q biosynthetic genes among yeasts, plants, and humans.

    Directory of Open Access Journals (Sweden)

    Kazuhiro Hayashi

    Full Text Available Coenzyme Q (CoQ is an essential factor for aerobic growth and oxidative phosphorylation in the electron transport system. The biosynthetic pathway for CoQ has been proposed mainly from biochemical and genetic analyses of Escherichia coli and Saccharomyces cerevisiae; however, the biosynthetic pathway in higher eukaryotes has been explored in only a limited number of studies. We previously reported the roles of several genes involved in CoQ synthesis in the fission yeast Schizosaccharomyces pombe. Here, we expand these findings by identifying ten genes (dps1, dlp1, ppt1, and coq3-9 that are required for CoQ synthesis. CoQ10-deficient S. pombe coq deletion strains were generated and characterized. All mutant fission yeast strains were sensitive to oxidative stress, produced a large amount of sulfide, required an antioxidant to grow on minimal medium, and did not survive at the stationary phase. To compare the biosynthetic pathway of CoQ in fission yeast with that in higher eukaryotes, the ability of CoQ biosynthetic genes from humans and plants (Arabidopsis thaliana to functionally complement the S. pombe coq deletion strains was determined. With the exception of COQ9, expression of all other human and plant COQ genes recovered CoQ10 production by the fission yeast coq deletion strains, although the addition of a mitochondrial targeting sequence was required for human COQ3 and COQ7, as well as A. thaliana COQ6. In summary, this study describes the functional conservation of CoQ biosynthetic genes between yeasts, humans, and plants.

  5. Pleiotropic Regulation of Virulence Genes in Streptococcus mutans by the Conserved Small Protein SprV.

    Science.gov (United States)

    Shankar, Manoharan; Hossain, Mohammad S; Biswas, Indranil

    2017-04-15

    Streptococcus mutans , an oral pathogen associated with dental caries, colonizes tooth surfaces as polymicrobial biofilms known as dental plaque. S. mutans expresses several virulence factors that allow the organism to tolerate environmental fluctuations and compete with other microorganisms. We recently identified a small hypothetical protein (90 amino acids) essential for the normal growth of the bacterium. Inactivation of the gene, SMU.2137, encoding this protein caused a significant growth defect and loss of various virulence-associated functions. An S. mutans strain lacking this gene was more sensitive to acid, temperature, osmotic, oxidative, and DNA damage-inducing stresses. In addition, we observed an altered protein profile and defects in biofilm formation, bacteriocin production, and natural competence development, possibly due to the fitness defect associated with SMU.2137 deletion. Transcriptome sequencing revealed that nearly 20% of the S. mutans genes were differentially expressed upon SMU.2137 deletion, thereby suggesting a pleiotropic effect. Therefore, we have renamed this hitherto uncharacterized gene as sprV ( s treptococcal p leiotropic r egulator of v irulence). The transcript levels of several relevant genes in the sprV mutant corroborated the phenotypes observed upon sprV deletion. Owing to its highly conserved nature, inactivation of the sprV ortholog in Streptococcus gordonii also resulted in poor growth and defective UV tolerance and competence development as in the case of S. mutans Our experiments suggest that SprV is functionally distinct from its homologs identified by structure and sequence homology. Nonetheless, our current work is aimed at understanding the importance of SprV in the S. mutans biology. IMPORTANCE Streptococcus mutans employs several virulence factors and stress resistance mechanisms to colonize tooth surfaces and cause dental caries. Bacterial pathogenesis is generally controlled by regulators of fitness that are

  6. Colonic duplication in an adult

    International Nuclear Information System (INIS)

    Baro, P.; Dario Casas, J.; Sanchez, D.

    1988-01-01

    A case of colonic duplication that was diagnosed radiologically in an adult is reported. A long duplicated segment below the normal transverse colon, with a wide anastomosis at the hepatic flexure level, was observed on barium enema. The rarity of this anomaly unassociated with other malformations is emphasized. (orig.)

  7. Complete colonic duplication in children.

    Science.gov (United States)

    Khaleghnejad Tabari, Ahmad; Mirshemirani, Alireza; Khaleghnejad Tabari, Nasibeh

    2012-01-01

    Complete colonic duplication is a very rare congenital anomaly that may have different presentations according to its location and size. Complete colonic duplication can occur in 15% of gastrointestinal duplication. We report two cases of complete colonic duplications, and their characteristics. We present two patients with complete colonic duplication with different types and presentations. Case 1: A 2- year old boy presented to the clinic with abdominal protrusion, difficulty to defecate, chronic constipation and mucosal prolaps covered bulging (rectocele) since he was 6 months old. The patient had palpable pelvic mass with doughy consistency. Rectal exam confirmed perirectal mass with soft consistency. The patient underwent a surgical operation that had total tubular colorectal duplication with one blind end and was treated with simple fenestration of distal end, and was discharged without complication. After two years follow up, he had normal defecation and good weight gain. Case 2: A 2 -day old infant was referred with imperforate anus and complete duplication of recto-sigmoid colon, diphallus, double bladder, and hypospadiasis. After clinical and paraclinical investigations, he underwent operations in several stages in different periods, and was discharged without complications. After four years follow up, he led a normal life. The patients with complete duplication have to be examined carefully because of the high incidence of other systemic anomalies. Treatment includes simple resection of distal common wall, fenestration, and repair other associated anomalies.

  8. A survey of innovation through duplication in the reduced genomes of twelve parasites.

    Directory of Open Access Journals (Sweden)

    Jeremy D DeBarry

    Full Text Available We characterize the prevalence, distribution, divergence, and putative functions of detectable two-copy paralogs and segmental duplications in the Apicomplexa, a phylum of parasitic protists. Apicomplexans are mostly obligate intracellular parasites responsible for human and animal diseases (e.g. malaria and toxoplasmosis. Gene loss is a major force in the phylum. Genomes are small and protein-encoding gene repertoires are reduced. Despite this genomic streamlining, duplications and gene family amplifications are present. The potential for innovation introduced by duplications is of particular interest. We compared genomes of twelve apicomplexans across four lineages and used orthology and genome cartography to map distributions of duplications against genome architectures. Segmental duplications appear limited to five species. Where present, they correspond to regions enriched for multi-copy and species-specific genes, pointing toward roles in adaptation and innovation. We found a phylum-wide association of duplications with dynamic chromosome regions and syntenic breakpoints. Trends in the distribution of duplicated genes indicate that recent, species-specific duplicates are often tandem while most others have been dispersed by genome rearrangements. These trends show a relationship between genome architecture and gene duplication. Functional analysis reveals: proteases, which are vital to a parasitic lifecycle, to be prominent in putative recent duplications; a pair of paralogous genes in Toxoplasma gondii previously shown to produce the rate-limiting step in dopamine synthesis in mammalian cells, a possible link to the modification of host behavior; and phylum-wide differences in expression and subcellular localization, indicative of modes of divergence. We have uncovered trends in multiple modes of duplicate divergence including sequence, intron content, expression, subcellular localization, and functions of putative recent duplicates that

  9. Rectal duplication presenting as colonic subocclusion.

    Science.gov (United States)

    Vuilleumier, H; Maternini, M

    2006-04-01

    Rectal duplication cyst is a rare congenital lesion which is known to be associated with other congenital defects, especially genitourinary and vertebral anomalies. Infections with fistulization, bleeding, and malignant degeneration are the major complications of developmental cysts. The case of an 83-year-old woman referred for acute constipation associated with abdominal distension is reported. CT and MRI showed a large cystic mass of the pelvis with extrinsic compression of the rectum. Surgical excision would have been the treatment of choice. In this case, the patient was unfortunately not eligible for surgery due to her poor general condition but responded well to conservative treatment.

  10. Conservation of lipid metabolic gene transcriptional regulatory networks in fish and mammals.

    Science.gov (United States)

    Carmona-Antoñanzas, Greta; Tocher, Douglas R; Martinez-Rubio, Laura; Leaver, Michael J

    2014-01-15

    Lipid content and composition in aquafeeds have changed rapidly as a result of the recent drive to replace ecologically limited marine ingredients, fishmeal and fish oil (FO). Terrestrial plant products are the most economic and sustainable alternative; however, plant meals and oils are devoid of physiologically important cholesterol and long-chain polyunsaturated fatty acids (LC-PUFA), eicosapentaenoic (EPA), docosahexaenoic (DHA) and arachidonic (ARA) acids. Although replacement of dietary FO with vegetable oil (VO) has little effect on growth in Atlantic salmon (Salmo salar), several studies have shown major effects on the activity and expression of genes involved in lipid homeostasis. In vertebrates, sterols and LC-PUFA play crucial roles in lipid metabolism by direct interaction with lipid-sensing transcription factors (TFs) and consequent regulation of target genes. The primary aim of the present study was to elucidate the role of key TFs in the transcriptional regulation of lipid metabolism in fish by transfection and overexpression of TFs. The results show that the expression of genes of LC-PUFA biosynthesis (elovl and fads2) and cholesterol metabolism (abca1) are regulated by Lxr and Srebp TFs in salmon, indicating highly conserved regulatory mechanism across vertebrates. In addition, srebp1 and srebp2 mRNA respond to replacement of dietary FO with VO. Thus, Atlantic salmon adjust lipid metabolism in response to dietary lipid composition through the transcriptional regulation of gene expression. It may be possible to further increase efficient and effective use of sustainable alternatives to marine products in aquaculture by considering these important molecular interactions when formulating diets. © 2013.

  11. Conservation, spillover and gene flow within a network of Northern European marine protected areas.

    Directory of Open Access Journals (Sweden)

    Mats Brockstedt Olsen Huserbråten

    Full Text Available To ensure that marine protected areas (MPAs benefit conservation and fisheries, the effectiveness of MPA designs has to be evaluated in field studies. Using an interdisciplinary approach, we empirically assessed the design of a network of northern MPAs where fishing for European lobster (Homarusgammarus is prohibited. First, we demonstrate a high level of residency and survival (50% for almost a year (363 days within MPAs, despite small MPA sizes (0.5-1 km(2. Second, we demonstrate limited export (4.7% of lobsters tagged within MPAs (N = 1810 to neighbouring fished areas, over a median distance of 1.6 km out to maximum 21 km away from MPA centres. In comparison, median movement distance of lobsters recaptured within MPAs was 164 m, and recapture rate was high (40%. Third, we demonstrate a high level of gene flow within the study region, with an estimated F ST of less than 0.0001 over a ≈ 400 km coastline. Thus, the restricted movement of older life stages, combined with a high level of gene flow suggests that connectivity is primarily driven by larval drift. Larval export from the MPAs can most likely affect areas far beyond their borders. Our findings are of high importance for the design of MPA networks for sedentary species with pelagic early life stages.

  12. An evolutionarily conserved gene family encodes proton-selective ion channels.

    Science.gov (United States)

    Tu, Yu-Hsiang; Cooper, Alexander J; Teng, Bochuan; Chang, Rui B; Artiga, Daniel J; Turner, Heather N; Mulhall, Eric M; Ye, Wenlei; Smith, Andrew D; Liman, Emily R

    2018-03-02

    Ion channels form the basis for cellular electrical signaling. Despite the scores of genetically identified ion channels selective for other monatomic ions, only one type of proton-selective ion channel has been found in eukaryotic cells. By comparative transcriptome analysis of mouse taste receptor cells, we identified Otopetrin1 (OTOP1), a protein required for development of gravity-sensing otoconia in the vestibular system, as forming a proton-selective ion channel. We found that murine OTOP1 is enriched in acid-detecting taste receptor cells and is required for their zinc-sensitive proton conductance. Two related murine genes, Otop2 and Otop3 , and a Drosophila ortholog also encode proton channels. Evolutionary conservation of the gene family and its widespread tissue distribution suggest a broad role for proton channels in physiology and pathophysiology. Copyright © 2018 The Authors, some rights reserved; exclusive licensee American Association for the Advancement of Science. No claim to original U.S. Government Works.

  13. Approaches to gene pool conservation of medicinal plant Oxytropis lanata (Pall. DC. (Fabaceae

    Directory of Open Access Journals (Sweden)

    A. B. Kholina

    2015-05-01

    Full Text Available In order to preserve the gene pool of medicinal plant Oxytropis lanata (Pall. DC. we analyzed allozyme polymorphism and identified reliable and informative marker enzyme systems of this species; also we studied the response of seeds to deep freezing in liquid nitrogen (–196 ºС. Population has an average level of polymorphism (P95 = 41,2 %, P99 = 52,9 %, A = 1,58, Ho = 0,158, He = 0,171 in general typical for herbaceous legumes, and can serve as a source of material for gene pool conservation of the species. Deep freezing has not led to the death of the seeds; it was marked stimulatory effect of ultralow temperatures, expressed as an acceleration of germination and sharp increase of germinability (98,6 ± 2,3 % compared to the control (12,0 ± 3,5 % that is associated with overcoming physical dormancy. There were no abnormalities in the development of seedlings from seeds passed cryopreservation.

  14. Comprehensive analysis of coding-lncRNA gene co-expression network uncovers conserved functional lncRNAs in zebrafish.

    Science.gov (United States)

    Chen, Wen; Zhang, Xuan; Li, Jing; Huang, Shulan; Xiang, Shuanglin; Hu, Xiang; Liu, Changning

    2018-05-09

    Zebrafish is a full-developed model system for studying development processes and human disease. Recent studies of deep sequencing had discovered a large number of long non-coding RNAs (lncRNAs) in zebrafish. However, only few of them had been functionally characterized. Therefore, how to take advantage of the mature zebrafish system to deeply investigate the lncRNAs' function and conservation is really intriguing. We systematically collected and analyzed a series of zebrafish RNA-seq data, then combined them with resources from known database and literatures. As a result, we obtained by far the most complete dataset of zebrafish lncRNAs, containing 13,604 lncRNA genes (21,128 transcripts) in total. Based on that, a co-expression network upon zebrafish coding and lncRNA genes was constructed and analyzed, and used to predict the Gene Ontology (GO) and the KEGG annotation of lncRNA. Meanwhile, we made a conservation analysis on zebrafish lncRNA, identifying 1828 conserved zebrafish lncRNA genes (1890 transcripts) that have their putative mammalian orthologs. We also found that zebrafish lncRNAs play important roles in regulation of the development and function of nervous system; these conserved lncRNAs present a significant sequential and functional conservation, with their mammalian counterparts. By integrative data analysis and construction of coding-lncRNA gene co-expression network, we gained the most comprehensive dataset of zebrafish lncRNAs up to present, as well as their systematic annotations and comprehensive analyses on function and conservation. Our study provides a reliable zebrafish-based platform to deeply explore lncRNA function and mechanism, as well as the lncRNA commonality between zebrafish and human.

  15. The importance of immune gene variability (MHC in evolutionary ecology and conservation

    Directory of Open Access Journals (Sweden)

    Sommer Simone

    2005-10-01

    Full Text Available Abstract Genetic studies have typically inferred the effects of human impact by documenting patterns of genetic differentiation and levels of genetic diversity among potentially isolated populations using selective neutral markers such as mitochondrial control region sequences, microsatellites or single nucleotide polymorphism (SNPs. However, evolutionary relevant and adaptive processes within and between populations can only be reflected by coding genes. In vertebrates, growing evidence suggests that genetic diversity is particularly important at the level of the major histocompatibility complex (MHC. MHC variants influence many important biological traits, including immune recognition, susceptibility to infectious and autoimmune diseases, individual odours, mating preferences, kin recognition, cooperation and pregnancy outcome. These diverse functions and characteristics place genes of the MHC among the best candidates for studies of mechanisms and significance of molecular adaptation in vertebrates. MHC variability is believed to be maintained by pathogen-driven selection, mediated either through heterozygote advantage or frequency-dependent selection. Up to now, most of our knowledge has derived from studies in humans or from model organisms under experimental, laboratory conditions. Empirical support for selective mechanisms in free-ranging animal populations in their natural environment is rare. In this review, I first introduce general information about the structure and function of MHC genes, as well as current hypotheses and concepts concerning the role of selection in the maintenance of MHC polymorphism. The evolutionary forces acting on the genetic diversity in coding and non-coding markers are compared. Then, I summarise empirical support for the functional importance of MHC variability in parasite resistance with emphasis on the evidence derived from free-ranging animal populations investigated in their natural habitat. Finally, I

  16. The zebrafish genome: a review and msx gene case study.

    Science.gov (United States)

    Postlethwait, J H

    2006-01-01

    Zebrafish is one of several important teleost models for understanding principles of vertebrate developmental, molecular, organismal, genetic, evolutionary, and genomic biology. Efficient investigation of the molecular genetic basis of induced mutations depends on knowledge of the zebrafish genome. Principles of zebrafish genomic analysis, including gene mapping, ortholog identification, conservation of syntenies, genome duplication, and evolution of duplicate gene function are discussed here using as a case study the zebrafish msxa, msxb, msxc, msxd, and msxe genes, which together constitute zebrafish orthologs of tetrapod Msx1, Msx2, and Msx3. Genomic analysis suggests orthologs for this difficult to understand group of paralogs.

  17. Conserved repertoire of orthologous vomeronasal type 1 receptor genes in ruminant species

    Directory of Open Access Journals (Sweden)

    Okamura Hiroaki

    2009-09-01

    Full Text Available Abstract Background In mammals, pheromones play an important role in social and innate reproductive behavior within species. In rodents, vomeronasal receptor type 1 (V1R, which is specifically expressed in the vomeronasal organ, is thought to detect pheromones. The V1R gene repertoire differs dramatically between mammalian species, and the presence of species-specific V1R subfamilies in mouse and rat suggests that V1R plays a profound role in species-specific recognition of pheromones. In ruminants, however, the molecular mechanism(s for pheromone perception is not well understood. Interestingly, goat male pheromone, which can induce out-of-season ovulation in anestrous females, causes the same pheromone response in sheep, and vice versa, suggesting that there may be mechanisms for detecting "inter-species" pheromones among ruminant species. Results We isolated 23 goat and 21 sheep intact V1R genes based on sequence similarity with 32 cow V1R genes in the cow genome database. We found that all of the goat and sheep V1R genes have orthologs in their cross-species counterparts among these three ruminant species and that the sequence identity of V1R orthologous pairs among these ruminants is much higher than that of mouse-rat V1R orthologous pairs. Furthermore, all goat V1Rs examined thus far are expressed not only in the vomeronasal organ but also in the main olfactory epithelium. Conclusion Our results suggest that, compared with rodents, the repertoire of orthologous V1R genes is remarkably conserved among the ruminants cow, sheep and goat. We predict that these orthologous V1Rs can detect the same or closely related chemical compound(s within each orthologous set/pair. Furthermore, all identified goat V1Rs are expressed in the vomeronasal organ and the main olfactory epithelium, suggesting that V1R-mediated ligand information can be detected and processed by both the main and accessory olfactory systems. The fact that ruminant and rodent V1Rs

  18. An evolutionarily conserved gene, FUWA, plays a role in determining panicle architecture, grain shape and grain weight in rice.

    Science.gov (United States)

    Chen, Jun; Gao, He; Zheng, Xiao-Ming; Jin, Mingna; Weng, Jian-Feng; Ma, Jin; Ren, Yulong; Zhou, Kunneng; Wang, Qi; Wang, Jie; Wang, Jiu-Lin; Zhang, Xin; Cheng, Zhijun; Wu, Chuanyin; Wang, Haiyang; Wan, Jian-Min

    2015-08-01

    Plant breeding relies on creation of novel allelic combinations for desired traits. Identification and utilization of beneficial alleles, rare alleles and evolutionarily conserved genes in the germplasm (referred to as 'hidden' genes) provide an effective approach to achieve this goal. Here we show that a chemically induced null mutation in an evolutionarily conserved gene, FUWA, alters multiple important agronomic traits in rice, including panicle architecture, grain shape and grain weight. FUWA encodes an NHL domain-containing protein, with preferential expression in the root meristem, shoot apical meristem and inflorescences, where it restricts excessive cell division. Sequence analysis revealed that FUWA has undergone a bottleneck effect, and become fixed in landraces and modern cultivars during domestication and breeding. We further confirm a highly conserved role of FUWA homologs in determining panicle architecture and grain development in rice, maize and sorghum through genetic transformation. Strikingly, knockdown of the FUWA transcription level by RNA interference results in an erect panicle and increased grain size in both indica and japonica genetic backgrounds. This study illustrates an approach to create new germplasm with improved agronomic traits for crop breeding by tapping into evolutionary conserved genes. © 2015 The Authors The Plant Journal © 2015 John Wiley & Sons Ltd.

  19. p53 protects against genome instability following centriole duplication failure

    Science.gov (United States)

    Lambrus, Bramwell G.; Uetake, Yumi; Clutario, Kevin M.; Daggubati, Vikas; Snyder, Michael; Sluder, Greenfield

    2015-01-01

    Centriole function has been difficult to study because of a lack of specific tools that allow persistent and reversible centriole depletion. Here we combined gene targeting with an auxin-inducible degradation system to achieve rapid, titratable, and reversible control of Polo-like kinase 4 (Plk4), a master regulator of centriole biogenesis. Depletion of Plk4 led to a failure of centriole duplication that produced an irreversible cell cycle arrest within a few divisions. This arrest was not a result of a prolonged mitosis, chromosome segregation errors, or cytokinesis failure. Depleting p53 allowed cells that fail centriole duplication to proliferate indefinitely. Washout of auxin and restoration of endogenous Plk4 levels in cells that lack centrioles led to the penetrant formation of de novo centrioles that gained the ability to organize microtubules and duplicate. In summary, we uncover a p53-dependent surveillance mechanism that protects against genome instability by preventing cell growth after centriole duplication failure. PMID:26150389

  20. The duplication 17p13.3 phenotype

    DEFF Research Database (Denmark)

    Curry, Cynthia J; Rosenfeld, Jill A; Grant, Erica

    2013-01-01

    . Older patients were often overweight. Three variant phenotypes included cleft lip/palate (CLP), split hand/foot with long bone deficiency (SHFLD), and a connective tissue phenotype resembling Marfan syndrome. The duplications in patients with clefts appear to disrupt ABR, while the SHFLD phenotype......Chromosome 17p13.3 is a gene rich region that when deleted is associated with the well-known Miller-Dieker syndrome. A recently described duplication syndrome involving this region has been associated with intellectual impairment, autism and occasional brain MRI abnormalities. We report 34...... was associated with duplication of BHLHA9 as noted in two recent reports. The connective tissue phenotype did not have a convincing critical region. Our experience with this large cohort expands knowledge of this diverse duplication syndrome....

  1. In silico reversal of repeat-induced point mutation (RIP identifies the origins of repeat families and uncovers obscured duplicated genes

    Directory of Open Access Journals (Sweden)

    Hane James K

    2010-11-01

    Full Text Available Abstract Background Repeat-induced point mutation (RIP is a fungal genome defence mechanism guarding against transposon invasion. RIP mutates the sequence of repeated DNA and over time renders the affected regions unrecognisable by similarity search tools such as BLAST. Results DeRIP is a new software tool developed to predict the original sequence of a RIP-mutated region prior to the occurrence of RIP. In this study, we apply deRIP to the genome of the wheat pathogen Stagonospora nodorum SN15 and predict the origin of several previously uncharacterised classes of repetitive DNA. Conclusions Five new classes of transposon repeats and four classes of endogenous gene repeats were identified after deRIP. The deRIP process is a new tool for fungal genomics that facilitates the identification and understanding of the role and origin of fungal repetitive DNA. DeRIP is open-source and is available as part of the RIPCAL suite at http://www.sourceforge.net/projects/ripcal.

  2. Dynamic Gene-Resource Landscape Management of Norway Spruce: Combining Utilization and Conservation

    Directory of Open Access Journals (Sweden)

    Milan Lstibůrek

    2017-10-01

    Full Text Available Traditional gene-resource management programs for forest trees are long-term endeavors requiring sustained organizational commitment covering extensive landscapes. While successful in maintaining adaptation, genetic diversity and capturing traditional growth attributes gains, these programs are dependent on rigid methods requiring elaborate mating schemes, thus making them slow in coping with climate change challenges. Here, we review the significance of Norway spruce in the boreal region and its current management practices. Next, we discuss opportunities offered by novel technologies and, with the use of computer simulations, we propose and evaluate a dynamic landscape gene-resource management in Norway. Our suggested long-term management approach capitalizes on: (1 existing afforestation activities, natural crosses, and DNA-based pedigree assembly to create structured pedigree for evaluation, thus traditional laborious control crosses are avoided and (2 landscape level genetic evaluation, rather than localized traditional progeny trials, allowing for screening of adapted individuals across multiple environmental gradients under changing climate. These advantages lead to greater genetic response to selection in adaptive traits without the traditional breeding and testing scheme, facilitating conservation of genetic resources within the breeding population of the most important forest tree species in Norway. The use of in situ selection from proven material exposed to realistic conditions over vast territories has not been conducted in forestry before. Our proposed approach is in contrast to worldwide current programs, where genetic evaluation is constrained by the range of environments where testing is conducted, which may be insufficient to capture the broad environmental variation necessary to tackle adaptation under changing climate.

  3. Variable gene dispersal conditions and spatial deforestation patterns can interact to affect tropical tree conservation outcomes.

    Directory of Open Access Journals (Sweden)

    Yamini Kashimshetty

    Full Text Available Tropical lowland rain forest (TLRF biodiversity is under threat from anthropogenic factors including deforestation which creates forest fragments of different sizes that can further undergo various internal patterns of logging. Such interventions can modify previous equilibrium abundance and spatial distribution patterns of offspring recruitment and/or pollen dispersal. Little is known about how these aspects of deforestation and fragmentation might synergistically affect TLRF tree recovery demographics and population genetics in newly formed forest fragments. To investigate these TLRF anthropogenic disturbance processes we used the computer program NEWGARDEN (NG, which models spatially-explicit, individual-based plant populations, to simulate 10% deforestation in six different spatial logging patterns for the plant functional type of a long-lived TLRF canopy tree species. Further, each logging pattern was analyzed under nine varying patterns of offspring versus pollen dispersal distances that could have arisen post-fragmentation. Results indicated that gene dispersal condition (especially via offspring had a greater effect on population growth and genetic diversity retention (explaining 98.5% and 88.8% of the variance respectively than spatial logging pattern (0.2% and 4.7% respectively, with 'Near' distance dispersal maximizing population growth and genetic diversity relative to distant dispersal. Within logged regions of the fragment, deforestation patterns closer to fragment borders more often exhibited lower population recovery rates and founding genetic diversity retention relative to more centrally located logging. These results suggest newly isolated fragments have populations that are more sensitive to the way in which their offspring and pollen dispersers are affected than the spatial pattern in which subsequent logging occurs, and that large variation in the recovery rates of different TLRF tree species attributable to altered gene

  4. Variable gene dispersal conditions and spatial deforestation patterns can interact to affect tropical tree conservation outcomes.

    Science.gov (United States)

    Kashimshetty, Yamini; Pelikan, Stephan; Rogstad, Steven H

    2015-01-01

    Tropical lowland rain forest (TLRF) biodiversity is under threat from anthropogenic factors including deforestation which creates forest fragments of different sizes that can further undergo various internal patterns of logging. Such interventions can modify previous equilibrium abundance and spatial distribution patterns of offspring recruitment and/or pollen dispersal. Little is known about how these aspects of deforestation and fragmentation might synergistically affect TLRF tree recovery demographics and population genetics in newly formed forest fragments. To investigate these TLRF anthropogenic disturbance processes we used the computer program NEWGARDEN (NG), which models spatially-explicit, individual-based plant populations, to simulate 10% deforestation in six different spatial logging patterns for the plant functional type of a long-lived TLRF canopy tree species. Further, each logging pattern was analyzed under nine varying patterns of offspring versus pollen dispersal distances that could have arisen post-fragmentation. Results indicated that gene dispersal condition (especially via offspring) had a greater effect on population growth and genetic diversity retention (explaining 98.5% and 88.8% of the variance respectively) than spatial logging pattern (0.2% and 4.7% respectively), with 'Near' distance dispersal maximizing population growth and genetic diversity relative to distant dispersal. Within logged regions of the fragment, deforestation patterns closer to fragment borders more often exhibited lower population recovery rates and founding genetic diversity retention relative to more centrally located logging. These results suggest newly isolated fragments have populations that are more sensitive to the way in which their offspring and pollen dispersers are affected than the spatial pattern in which subsequent logging occurs, and that large variation in the recovery rates of different TLRF tree species attributable to altered gene dispersal

  5. Primary structure and promoter analysis of leghemoglobin genes of the stem-nodulated tropical legume Sesbania rostrata: conserved coding sequences, cis-elements and trans-acting factors

    DEFF Research Database (Denmark)

    Metz, B A; Welters, P; Hoffmann, H J

    1988-01-01

    The primary structure of a leghemoglobin (lb) gene from the stem-nodulated, tropical legume Sesbania rostrata and two lb gene promoter regions was analysed. The S. rostrata lb gene structure and Lb amino acid composition were found to be highly conserved with previously described lb genes and Lb ...

  6. Structure of genes for dermaseptins B, antimicrobial peptides from frog skin. Exon 1-encoded prepropeptide is conserved in genes for peptides of highly different structures and activities.

    Science.gov (United States)

    Vouille, V; Amiche, M; Nicolas, P

    1997-09-01

    We cloned the genes of two members of the dermaseptin family, broad-spectrum antimicrobial peptides isolated from the skin of the arboreal frog Phyllomedusa bicolor. The dermaseptin gene Drg2 has a 2-exon coding structure interrupted by a small 137-bp intron, wherein exon 1 encoded a 22-residue hydrophobic signal peptide and the first three amino acids of the acidic propiece; exon 2 contained the 18 additional acidic residues of the propiece plus a typical prohormone processing signal Lys-Arg and a 32-residue dermaseptin progenitor sequence. The dermaseptin genes Drg2 and Drg1g2 have conserved sequences at both untranslated ends and in the first and second coding exons. In contrast, Drg1g2 comprises a third coding exon for a short version of the acidic propiece and a second dermaseptin progenitor sequence. Structural conservation between the two genes suggests that Drg1g2 arose recently from an ancestral Drg2-like gene through amplification of part of the second coding exon and 3'-untranslated region. Analysis of the cDNAs coding precursors for several frog skin peptides of highly different structures and activities demonstrates that the signal peptides and part of the acidic propieces are encoded by conserved nucleotides encompassed by the first coding exon of the dermaseptin genes. The organization of the genes that belong to this family, with the signal peptide and the progenitor sequence on separate exons, permits strikingly different peptides to be directed into the secretory pathway. The recruitment of such a homologous 'secretory' exon by otherwise non-homologous genes may have been an early event in the evolution of amphibian.

  7. Horizontal transfer, not duplication, drives the expansion of protein families in prokaryotes.

    Directory of Open Access Journals (Sweden)

    Todd J Treangen

    2011-01-01

    Full Text Available Gene duplication followed by neo- or sub-functionalization deeply impacts the evolution of protein families and is regarded as the main source of adaptive functional novelty in eukaryotes. While there is ample evidence of adaptive gene duplication in prokaryotes, it is not clear whether duplication outweighs the contribution of horizontal gene transfer in the expansion of protein families. We analyzed closely related prokaryote strains or species with small genomes (Helicobacter, Neisseria, Streptococcus, Sulfolobus, average-sized genomes (Bacillus, Enterobacteriaceae, and large genomes (Pseudomonas, Bradyrhizobiaceae to untangle the effects of duplication and horizontal transfer. After removing the effects of transposable elements and phages, we show that the vast majority of expansions of protein families are due to transfer, even among large genomes. Transferred genes--xenologs--persist longer in prokaryotic lineages possibly due to a higher/longer adaptive role. On the other hand, duplicated genes--paralogs--are expressed more, and, when persistent, they evolve slower. This suggests that gene transfer and gene duplication have very different roles in shaping the evolution of biological systems: transfer allows the acquisition of new functions and duplication leads to higher gene dosage. Accordingly, we show that paralogs share most protein-protein interactions and genetic regulators, whereas xenologs share very few of them. Prokaryotes invented most of life's biochemical diversity. Therefore, the study of the evolution of biology systems should explicitly account for the predominant role of horizontal gene transfer in the diversification of protein families.

  8. G-NEST: A gene neighborhood scoring tool to identify co-conserved, co-expressed genes

    Science.gov (United States)

    In previous studies, gene neighborhoods--spatial clusters of co-expressed genes in the genome--have been defined using arbitrary rules such as requiring adjacency, a minimum number of genes, a fixed window size, or a minimum expression level. In the current study, we developed a Gene Neighborhood Sc...

  9. Discovery of Conservation and Diversification of miR171 Genes by Phylogenetic Analysis based on Global Genomes

    Directory of Open Access Journals (Sweden)

    Xudong Zhu

    2015-07-01

    Full Text Available The microRNA171 (miR171 family is widely distributed and highly conserved in a range of species and plays critical roles in regulating plant growth and development through repressing expression of ( transcription factors. However, information on the evolutionary conservation and functional diversification of the miRNA171 family members remains scanty. We reconstructed the phylogenetic relationships among miR171 precursor and mature sequences so as to investigate the extent and degree of evolutionary conservation of miR171 in (L. Heynh. (ath, grape ( L. (vvi, poplar ( Torr. & A.Gray ex Hook. (ptc, and rice ( L. (osa. Despite strong conservation of over 80%, some mature miR171 sequences, such as , and and , -, and -, have undergone critical sequence variation, leading to functional diversification, since they target non gene transcript(s. Phylogenetic analyses revealed a combination of old ancestral relationships and recent lineage-specific diversification in the miR171 family within the four model plants. The -regulatory motifs on the upstream promoter sequences of genes were highly divergent and shared some similar elements, indicating their possible contribution to the functional variation observed within the miR171 family. This study will buttress our understanding of the functional differentiation of miRNAs and the relationships of miRNA–target pairs based on the evolutionary history of genes.

  10. The First Myriapod Genome Sequence Reveals Conservative Arthropod Gene Content and Genome Organisation in the Centipede Strigamia maritima

    Science.gov (United States)

    Chipman, Ariel D.; Ferrier, David E. K.; Brena, Carlo; Qu, Jiaxin; Hughes, Daniel S. T.; Schröder, Reinhard; Torres-Oliva, Montserrat; Znassi, Nadia; Jiang, Huaiyang; Almeida, Francisca C.; Alonso, Claudio R.; Apostolou, Zivkos; Aqrawi, Peshtewani; Arthur, Wallace; Barna, Jennifer C. J.; Blankenburg, Kerstin P.; Brites, Daniela; Capella-Gutiérrez, Salvador; Coyle, Marcus; Dearden, Peter K.; Du Pasquier, Louis; Duncan, Elizabeth J.; Ebert, Dieter; Eibner, Cornelius; Erikson, Galina; Evans, Peter D.; Extavour, Cassandra G.; Francisco, Liezl; Gabaldón, Toni; Gillis, William J.; Goodwin-Horn, Elizabeth A.; Green, Jack E.; Griffiths-Jones, Sam; Grimmelikhuijzen, Cornelis J. P.; Gubbala, Sai; Guigó, Roderic; Han, Yi; Hauser, Frank; Havlak, Paul; Hayden, Luke; Helbing, Sophie; Holder, Michael; Hui, Jerome H. L.; Hunn, Julia P.; Hunnekuhl, Vera S.; Jackson, LaRonda; Javaid, Mehwish; Jhangiani, Shalini N.; Jiggins, Francis M.; Jones, Tamsin E.; Kaiser, Tobias S.; Kalra, Divya; Kenny, Nathan J.; Korchina, Viktoriya; Kovar, Christie L.; Kraus, F. Bernhard; Lapraz, François; Lee, Sandra L.; Lv, Jie; Mandapat, Christigale; Manning, Gerard; Mariotti, Marco; Mata, Robert; Mathew, Tittu; Neumann, Tobias; Newsham, Irene; Ngo, Dinh N.; Ninova, Maria; Okwuonu, Geoffrey; Ongeri, Fiona; Palmer, William J.; Patil, Shobha; Patraquim, Pedro; Pham, Christopher; Pu, Ling-Ling; Putman, Nicholas H.; Rabouille, Catherine; Ramos, Olivia Mendivil; Rhodes, Adelaide C.; Robertson, Helen E.; Robertson, Hugh M.; Ronshaugen, Matthew; Rozas, Julio; Saada, Nehad; Sánchez-Gracia, Alejandro; Scherer, Steven E.; Schurko, Andrew M.; Siggens, Kenneth W.; Simmons, DeNard; Stief, Anna; Stolle, Eckart; Telford, Maximilian J.; Tessmar-Raible, Kristin; Thornton, Rebecca; van der Zee, Maurijn; von Haeseler, Arndt; Williams, James M.; Willis, Judith H.; Wu, Yuanqing; Zou, Xiaoyan; Lawson, Daniel; Muzny, Donna M.; Worley, Kim C.; Gibbs, Richard A.; Akam, Michael; Richards, Stephen

    2014-01-01

    Myriapods (e.g., centipedes and millipedes) display a simple homonomous body plan relative to other arthropods. All members of the class are terrestrial, but they attained terrestriality independently of insects. Myriapoda is the only arthropod class not represented by a sequenced genome. We present an analysis of the genome of the centipede Strigamia maritima. It retains a compact genome that has undergone less gene loss and shuffling than previously sequenced arthropods, and many orthologues of genes conserved from the bilaterian ancestor that have been lost in insects. Our analysis locates many genes in conserved macro-synteny contexts, and many small-scale examples of gene clustering. We describe several examples where S. maritima shows different solutions from insects to similar problems. The insect olfactory receptor gene family is absent from S. maritima, and olfaction in air is likely effected by expansion of other receptor gene families. For some genes S. maritima has evolved paralogues to generate coding sequence diversity, where insects use alternate splicing. This is most striking for the Dscam gene, which in Drosophila generates more than 100,000 alternate splice forms, but in S. maritima is encoded by over 100 paralogues. We see an intriguing linkage between the absence of any known photosensory proteins in a blind organism and the additional absence of canonical circadian clock genes. The phylogenetic position of myriapods allows us to identify where in arthropod phylogeny several particular molecular mechanisms and traits emerged. For example, we conclude that juvenile hormone signalling evolved with the emergence of the exoskeleton in the arthropods and that RR-1 containing cuticle proteins evolved in the lineage leading to Mandibulata. We also identify when various gene expansions and losses occurred. The genome of S. maritima offers us a unique glimpse into the ancestral arthropod genome, while also displaying many adaptations to its specific

  11. The vertebrate ancestral repertoire of visual opsins, transducin alpha subunits and oxytocin/vasopressin receptors was established by duplication of their shared genomic region in the two rounds of early vertebrate genome duplications.

    Science.gov (United States)

    Lagman, David; Ocampo Daza, Daniel; Widmark, Jenny; Abalo, Xesús M; Sundström, Görel; Larhammar, Dan

    2013-11-02

    Vertebrate color vision is dependent on four major color opsin subtypes: RH2 (green opsin), SWS1 (ultraviolet opsin), SWS2 (blue opsin), and LWS (red opsin). Together with the dim-light receptor rhodopsin (RH1), these form the family of vertebrate visual opsins. Vertebrate genomes contain many multi-membered gene families that can largely be explained by the two rounds of whole genome duplication (WGD) in the vertebrate ancestor (2R) followed by a third round in the teleost ancestor (3R). Related chromosome regions resulting from WGD or block duplications are said to form a paralogon. We describe here a paralogon containing the genes for visual opsins, the G-protein alpha subunit families for transducin (GNAT) and adenylyl cyclase inhibition (GNAI), the oxytocin and vasopressin receptors (OT/VP-R), and the L-type voltage-gated calcium channels (CACNA1-L). Sequence-based phylogenies and analyses of conserved synteny show that the above-mentioned gene families, and many neighboring gene families, expanded in the early vertebrate WGDs. This allows us to deduce the following evolutionary scenario: The vertebrate ancestor had a chromosome containing the genes for two visual opsins, one GNAT, one GNAI, two OT/VP-Rs and one CACNA1-L gene. This chromosome was quadrupled in 2R. Subsequent gene losses resulted in a set of five visual opsin genes, three GNAT and GNAI genes, six OT/VP-R genes and four CACNA1-L genes. These regions were duplicated again in 3R resulting in additional teleost genes for some of the families. Major chromosomal rearrangements have taken place in the teleost genomes. By comparison with the corresponding chromosomal regions in the spotted gar, which diverged prior to 3R, we could time these rearrangements to post-3R. We present an extensive analysis of the paralogon housing the visual opsin, GNAT and GNAI, OT/VP-R, and CACNA1-L gene families. The combined data imply that the early vertebrate WGD events contributed to the evolution of vision and the

  12. Landscape genetics as a tool for conservation planning: predicting the effects of landscape change on gene flow.

    Science.gov (United States)

    van Strien, Maarten J; Keller, Daniela; Holderegger, Rolf; Ghazoul, Jaboury; Kienast, Felix; Bolliger, Janine

    2014-03-01

    For conservation managers, it is important to know whether landscape changes lead to increasing or decreasing gene flow. Although the discipline of landscape genetics assesses the influence of landscape elements on gene flow, no studies have yet used landscape-genetic models to predict gene flow resulting from landscape change. A species that has already been severely affected by landscape change is the large marsh grasshopper (Stethophyma grossum), which inhabits moist areas in fragmented agricultural landscapes in Switzerland. From transects drawn between all population pairs within maximum dispersal distance (landscape composition as well as some measures of habitat configuration. Additionally, a complete sampling of all populations in our study area allowed incorporating measures of population topology. These measures together with the landscape metrics formed the predictor variables in linear models with gene flow as response variable (F(ST) and mean pairwise assignment probability). With a modified leave-one-out cross-validation approach, we selected the model with the highest predictive accuracy. With this model, we predicted gene flow under several landscape-change scenarios, which simulated construction, rezoning or restoration projects, and the establishment of a new population. For some landscape-change scenarios, significant increase or decrease in gene flow was predicted, while for others little change was forecast. Furthermore, we found that the measures of population topology strongly increase model fit in landscape genetic analysis. This study demonstrates the use of predictive landscape-genetic models in conservation and landscape planning.

  13. Multi-species sequence comparison reveals conservation of ghrelin gene-derived splice variants encoding a truncated ghrelin peptide.

    Science.gov (United States)

    Seim, Inge; Jeffery, Penny L; Thomas, Patrick B; Walpole, Carina M; Maugham, Michelle; Fung, Jenny N T; Yap, Pei-Yi; O'Keeffe, Angela J; Lai, John; Whiteside, Eliza J; Herington, Adrian C; Chopin, Lisa K

    2016-06-01

    The peptide hormone ghrelin is a potent orexigen produced predominantly in the stomach. It has a number of other biological actions, including roles in appetite stimulation, energy balance, the stimulation of growth hormone release and the regulation of cell proliferation. Recently, several ghrelin gene splice variants have been described. Here, we attempted to identify conserved alternative splicing of the ghrelin gene by cross-species sequence comparisons. We identified a novel human exon 2-deleted variant and provide preliminary evidence that this splice variant and in1-ghrelin encode a C-terminally truncated form of the ghrelin peptide, termed minighrelin. These variants are expressed in humans and mice, demonstrating conservation of alternative splicing spanning 90 million years. Minighrelin appears to have similar actions to full-length ghrelin, as treatment with exogenous minighrelin peptide stimulates appetite and feeding in mice. Forced expression of the exon 2-deleted preproghrelin variant mirrors the effect of the canonical preproghrelin, stimulating cell proliferation and migration in the PC3 prostate cancer cell line. This is the first study to characterise an exon 2-deleted preproghrelin variant and to demonstrate sequence conservation of ghrelin gene-derived splice variants that encode a truncated ghrelin peptide. This adds further impetus for studies into the alternative splicing of the ghrelin gene and the function of novel ghrelin peptides in vertebrates.

  14. Anterior colorectal duplication presenting as rectal prolapse.

    Science.gov (United States)

    Ramirez-Resendiz, Amador; Asz, Jose; Medina-Vega, F Antonio; Ortega-Salgado, J Arturo

    2007-09-01

    Duplications of the gastrointestinal (GI) tract are rare. Only 5% of them are rectal and there are very few reports of rectal prolapse (RP) caused by a duplication. An 11 month-old female presented with a RP caused by a blind-ended anterior tubular colorectal duplication. The duplication was successfully opened and connected to the normal rectum without complications. Although infrequent, a rectal duplication should be considered in the differential diagnosis of RP.

  15. An evolutionary conserved region (ECR in the human dopamine receptor D4 gene supports reporter gene expression in primary cultures derived from the rat cortex

    Directory of Open Access Journals (Sweden)

    Haddley Kate

    2011-05-01

    Full Text Available Abstract Background Detecting functional variants contributing to diversity of behaviour is crucial for dissecting genetics of complex behaviours. At a molecular level, characterisation of variation in exons has been studied as they are easily identified in the current genome annotation although the functional consequences are less well understood; however, it has been difficult to prioritise regions of non-coding DNA in which genetic variation could also have significant functional consequences. Comparison of multiple vertebrate genomes has allowed the identification of non-coding evolutionary conserved regions (ECRs, in which the degree of conservation can be comparable with exonic regions suggesting functional significance. Results We identified ECRs at the dopamine receptor D4 gene locus, an important gene for human behaviours. The most conserved non-coding ECR (D4ECR1 supported high reporter gene expression in primary cultures derived from neonate rat frontal cortex. Computer aided analysis of the sequence of the D4ECR1 indicated the potential transcription factors that could modulate its function. D4ECR1 contained multiple consensus sequences for binding the transcription factor Sp1, a factor previously implicated in DRD4 expression. Co-transfection experiments demonstrated that overexpression of Sp1 significantly decreased the activity of the D4ECR1 in vitro. Conclusion Bioinformatic analysis complemented by functional analysis of the DRD4 gene locus has identified a a strong enhancer that functions in neurons and b a transcription factor that may modulate the function of that enhancer.

  16. Duplicate retention in signalling proteins and constraints from network dynamics.

    Science.gov (United States)

    Soyer, O S; Creevey, C J

    2010-11-01

    Duplications are a major driving force behind evolution. Most duplicates are believed to fix through genetic drift, but it is not clear whether this process affects all duplications equally or whether there are certain gene families that are expected to show neutral expansions under certain circumstances. Here, we analyse the neutrality of duplications in different functional classes of signalling proteins based on their effects on response dynamics. We find that duplications involving intermediary proteins in a signalling network are neutral more often than those involving receptors. Although the fraction of neutral duplications in all functional classes increase with decreasing population size and selective pressure on dynamics, this effect is most pronounced for receptors, indicating a possible expansion of receptors in species with small population size. In line with such an expectation, we found a statistically significant increase in the number of receptors as a fraction of genome size in eukaryotes compared with prokaryotes. Although not confirmative, these results indicate that neutral processes can be a significant factor in shaping signalling networks and affect proteins from different functional classes differently. © 2010 The Authors. Journal Compilation © 2010 European Society For Evolutionary Biology.

  17. A synergism between adaptive effects and evolvability drives whole genome duplication to fixation

    OpenAIRE

    Cuypers, Thomas D; Hogeweg, Paulien; Hogeweg, P.

    2014-01-01

    Whole genome duplication has shaped eukaryotic evolutionary history and has been associated with drastic environmental change and species radiation. While the most common fate of WGD duplicates is a return to single copy, retained duplicates have been found enriched for highly interacting genes. This pattern has been explained by a neutral process of subfunctionalization and more recently, dosage balance selection. However, much about the relationship between environmental change, WGD and ada...

  18. A synergism between adaptive effects and evolvability drives whole genome duplication to fixation.

    OpenAIRE

    Thomas D Cuypers; Paulien Hogeweg

    2014-01-01

    Whole genome duplication has shaped eukaryotic evolutionary history and has been associated with drastic environmental change and species radiation. While the most common fate of WGD duplicates is a return to single copy, retained duplicates have been found enriched for highly interacting genes. This pattern has been explained by a neutral process of subfunctionalization and more recently, dosage balance selection. However, much about the relationship between environmental change, WGD and ada...

  19. External cystic rectal duplication: an unusual presentation of rectal duplication cyst.

    Science.gov (United States)

    Karaman, I; Karaman, A; Arda, N; Cakmak, O

    2007-11-01

    Duplications of gastrointestinal tract are rare anomalies, and rectal duplications account for five percent of the alimentary tract duplications. We present an unusual case of rectal duplication, which was located externally in a newborn female, and discuss the types of distal hindgut duplications.

  20. Combining Human Epigenetics and Sleep Studies in Caenorhabditis elegans: A Cross-Species Approach for Finding Conserved Genes Regulating Sleep.

    Science.gov (United States)

    Huang, Huiyan; Zhu, Yong; Eliot, Melissa N; Knopik, Valerie S; McGeary, John E; Carskadon, Mary A; Hart, Anne C

    2017-06-01

    We aimed to test a combined approach to identify conserved genes regulating sleep and to explore the association between DNA methylation and sleep length. We identified candidate genes associated with shorter versus longer sleep duration in college students based on DNA methylation using Illumina Infinium HumanMethylation450 BeadChip arrays. Orthologous genes in Caenorhabditis elegans were identified, and we examined whether their loss of function affected C. elegans sleep. For genes whose perturbation affected C. elegans sleep, we subsequently undertook a small pilot study to re-examine DNA methylation in an independent set of human participants with shorter versus longer sleep durations. Eighty-seven out of 485,577 CpG sites had significant differential methylation in young adults with shorter versus longer sleep duration, corresponding to 52 candidate genes. We identified 34 C. elegans orthologs, including NPY/flp-18 and flp-21, which are known to affect sleep. Loss of five additional genes alters developmentally timed C. elegans sleep (B4GALT6/bre-4, DOCK180/ced-5, GNB2L1/rack-1, PTPRN2/ida-1, ZFYVE28/lst-2). For one of these genes, ZFYVE28 (also known as hLst2), the pilot replication study again found decreased DNA methylation associated with shorter sleep duration at the same two CpG sites in the first intron of ZFYVE28. Using an approach that combines human epigenetics and C. elegans sleep studies, we identified five genes that play previously unidentified roles in C. elegans sleep. We suggest sleep duration in humans may be associated with differential DNA methylation at specific sites and that the conserved genes identified here likely play roles in C. elegans sleep and in other species. © Sleep Research Society 2017. Published by Oxford University Press on behalf of the Sleep Research Society. All rights reserved. For permissions, please e-mail journals.permissions@oup.com.

  1. Integrating gene flow, crop biology, and farm management in on-farm conservation of avocado (Persea americana, Lauraceae).

    Science.gov (United States)

    Birnbaum, Kenneth; Desalle, Rob; Peters, Charles M; Benfey, Philip N

    2003-11-01

    Maintaining crop diversity on farms where cultivars can evolve is a conservation goal, but few tools are available to assess the long-term maintenance of genetic diversity on farms. One important issue for on-farm conservation is gene flow from crops with a narrow genetic base into related populations that are genetically diverse. In a case study of avocado (Persea americana var. americana) in one of its centers of diversity (San Jerónimo, Costa Rica), we used 10 DNA microsatellite markers in a parentage analysis to estimate gene flow from commercialized varieties into a traditional crop population. Five commercialized genotypes comprised nearly 40% of orchard trees, but they contributed only about 14.5% of the gametes to the youngest cohort of trees. Although commercialized varieties and the diverse population were often planted on the same farm, planting patterns appeared to keep the two types of trees separated on small scales, possibly explaining the limited gene flow. In a simulation that combined gene flow estimates, crop biology, and graft tree management, loss of allelic diversity was less than 10% over 150 yr, and selection was effective in retaining desirable alleles in the diverse subpopulation. Simulations also showed that, in addition to gene flow, managing the genetic makeup and life history traits of the invasive commercialized varieties could have a significant impact on genetic diversity in the target population. The results support the feasibility of on-farm crop conservation, but simulations also showed that higher levels of gene flow could lead to severe losses of genetic diversity even if farmers continue to plant diverse varieties.

  2. Evolutionary mechanisms driving the evolution of a large polydnavirus gene family coding for protein tyrosine phosphatases

    Directory of Open Access Journals (Sweden)

    Serbielle Céline

    2012-12-01

    Full Text Available Abstract Background Gene duplications have been proposed to be the main mechanism involved in genome evolution and in acquisition of new functions. Polydnaviruses (PDVs, symbiotic viruses associated with parasitoid wasps, are ideal model systems to study mechanisms of gene duplications given that PDV genomes consist of virulence genes organized into multigene families. In these systems the viral genome is integrated in a wasp chromosome as a provirus and virus particles containing circular double-stranded DNA are injected into the parasitoids’ hosts and are essential for parasitism success. The viral virulence factors, organized in gene families, are required collectively to induce host immune suppression and developmental arrest. The gene family which encodes protein tyrosine phosphatases (PTPs has undergone spectacular expansion in several PDV genomes with up to 42 genes. Results Here, we present strong indications that PTP gene family expansion occurred via classical mechanisms: by duplication of large segments of the chromosomally integrated form of the virus sequences (segmental duplication, by tandem duplications within this form and by dispersed duplications. We also propose a novel duplication mechanism specific to PDVs that involves viral circle reintegration into the wasp genome. The PTP copies produced were shown to undergo conservative evolution along with episodes of adaptive evolution. In particular recently produced copies have undergone positive selection in sites most likely involved in defining substrate selectivity. Conclusion The results provide evidence about the dynamic nature of polydnavirus proviral genomes. Classical and PDV-specific duplication mechanisms have been involved in the production of new gene copies. Selection pressures associated with antagonistic interactions with parasitized hosts have shaped these genes used to manipulate lepidopteran physiology with evidence for positive selection involved in

  3. Conservation and Sex-Specific Splicing of the transformer Gene in the Calliphorids Cochliomyia hominivorax, Cochliomyia macellaria and Lucilia sericata

    Science.gov (United States)

    Li, Fang; Vensko, Steven P.; Belikoff, Esther J.; Scott, Maxwell J.

    2013-01-01

    Transformer (TRA) promotes female development in several dipteran species including the Australian sheep blowfly Lucilia cuprina, the Mediterranean fruit fly, housefly and Drosophila melanogaster. tra transcripts are sex-specifically spliced such that only the female form encodes full length functional protein. The presence of six predicted TRA/TRA2 binding sites in the sex-specific female intron of the L. cuprina gene suggested that tra splicing is auto-regulated as in medfly and housefly. With the aim of identifying conserved motifs that may play a role in tra sex-specific splicing, here we have isolated and characterized the tra gene from three additional blowfly species, L. sericata, Cochliomyia hominivorax and C. macellaria. The blowfly adult male and female transcripts differ in the choice of splice donor site in the first intron, with males using a site downstream of the site used in females. The tra genes all contain a single TRA/TRA2 site in the male exon and a cluster of four to five sites in the male intron. However, overall the sex-specific intron sequences are poorly conserved in closely related blowflies. The most conserved regions are around the exon/intron junctions, the 3′ end of the intron and near the cluster of TRA/TRA2 sites. We propose a model for sex specific regulation of tra splicing that incorporates the conserved features identified in this study. In L. sericata embryos, the male tra transcript was first detected at around the time of cellular blastoderm formation. RNAi experiments showed that tra is required for female development in L. sericata and C. macellaria. The isolation of the tra gene from the New World screwworm fly C. hominivorax, a major livestock pest, will facilitate the development of a “male-only” strain for genetic control programs. PMID:23409170

  4. Drosophila duplication hotspots are associated with late-replicating regions of the genome.

    Directory of Open Access Journals (Sweden)

    Margarida Cardoso-Moreira

    2011-11-01

    Full Text Available Duplications play a significant role in both extremes of the phenotypic spectrum of newly arising mutations: they can have severe deleterious effects (e.g. duplications underlie a variety of diseases but can also be highly advantageous. The phenotypic potential of newly arisen duplications has stimulated wide interest in both the mutational and selective processes shaping these variants in the genome. Here we take advantage of the Drosophila simulans-Drosophila melanogaster genetic system to further our understanding of both processes. Regarding mutational processes, the study of two closely related species allows investigation of the potential existence of shared duplication hotspots, and the similarities and differences between the two genomes can be used to dissect its underlying causes. Regarding selection, the difference in the effective population size between the two species can be leveraged to ask questions about the strength of selection acting on different classes of duplications. In this study, we conducted a survey of duplication polymorphisms in 14 different lines of D. simulans using tiling microarrays and combined it with an analogous survey for the D. melanogaster genome. By integrating the two datasets, we identified duplication hotspots conserved between the two species. However, unlike the duplication hotspots identified in mammalian genomes, Drosophila duplication hotspots are not associated with sequences of high sequence identity capable of mediating non-allelic homologous recombination. Instead, Drosophila duplication hotspots are associated with late-replicating regions of the genome, suggesting a link between DNA replication and duplication rates. We also found evidence supporting a higher effectiveness of selection on duplications in D. simulans than in D. melanogaster. This is also true for duplications segregating at high frequency, where we find evidence in D. simulans that a sizeable fraction of these mutations is

  5. Variation in MHC class II B genes in marbled murrelets: implications for delineating conservation units

    Science.gov (United States)

    C. Vásquez-Carrillo; V. Friesen; L. Hall; M.Z. Peery

    2013-01-01

    Conserving genetic variation is critical for maintaining the evolutionary potential and viability of a species. Genetic studies seeking to delineate conservation units, however, typically focus on characterizing neutral genetic variation and may not identify populations harboring local adaptations. Here, variation at two major histocompatibility complex (MHC) class II...

  6. Intragenic duplication: a novel mutational mechanism in hereditary pancreatitis

    DEFF Research Database (Denmark)

    Joergensen, Maiken T; Geisz, Andrea; Brusgaard, Klaus

    2011-01-01

    In a hereditary pancreatitis family from Denmark, we identified a novel intragenic duplication of 9 nucleotides in exon-2 of the human cationic trypsinogen (PRSS1) gene (c.63_71dup) which at the amino-acid level resulted in the insertion of 3 amino acids within the activation peptide of cationic...

  7. The hidden duplication past of the plant pathogen Phytophthora and its consequences for infection

    Directory of Open Access Journals (Sweden)

    Martens Cindy

    2010-06-01

    Full Text Available Abstract Background Oomycetes of the genus Phytophthora are pathogens that infect a wide range of plant species. For dicot hosts such as tomato, potato and soybean, Phytophthora is even the most important pathogen. Previous analyses of Phytophthora genomes uncovered many genes, large gene families and large genome sizes that can partially be explained by significant repeat expansion patterns. Results Analysis of the complete genomes of three different Phytophthora species, using a newly developed approach, unveiled a large number of small duplicated blocks, mainly consisting of two or three consecutive genes. Further analysis of these duplicated genes and comparison with the known gene and genome duplication history of ten other eukaryotes including parasites, algae, plants, fungi, vertebrates and invertebrates, suggests that the ancestor of P. infestans, P. sojae and P. ramorum most likely underwent a whole genome duplication (WGD. Genes that have survived in duplicate are mainly genes that are known to be preferentially retained following WGDs, but also genes important for pathogenicity and infection of the different hosts seem to have been retained in excess. As a result, the WGD might have contributed to the evolutionary and pathogenic success of Phytophthora. Conclusions The fact that we find many small blocks of duplicated genes indicates that the genomes of Phytophthora species have been heavily rearranged following the WGD. Most likely, the high repeat content in these genomes have played an important role in this rearrangement process. As a consequence, the paucity of retained larger duplicated blocks has greatly complicated previous attempts to detect remnants of a large-scale duplication event in Phytophthora. However, as we show here, our newly developed strategy to identify very small duplicated blocks might be a useful approach to uncover ancient polyploidy events, in particular for heavily rearranged genomes.

  8. Radiological findings of male urethral duplication associated with bladder duplication: case report

    International Nuclear Information System (INIS)

    Kim, Hyoung Jung; Lim, Joo Won; Lee, Dong Ho; Ko, Young Tae

    2004-01-01

    Urethral duplication or accessory urethra is a rare congenital anomaly. Even rarer, is its association with bladder duplication. We report a case of urethral duplication associated with bladder duplication in a seven-year-old boy who underwent retrograde urethrography, sonography and magnetic resonance (MR) imaging. WhiIe retrograde urethrography can demonstrate the extent of the duplicated urethra, MR imaging and sonography can provide detailed information on the anatomy of the adjacent tissues as well as urethral duplication

  9. Evaluation of contrast in duplicated radiographs

    International Nuclear Information System (INIS)

    Thunthy, K.H.; Weinberg, R.

    1982-01-01

    This investigation evaluated changes in the contrast of duplicated radiographs made at different ultraviolet light exposures. Increasing ultraviolet light exposure had different effects on the duplicates of originals of different background densities. When correctly exposed, a duplicate radiograph enhanced contrast. When originals had the same contrast but different background densities, their duplicates did not have the same contrast. It was not possible to duplicate accurately all the different contrasts measured on an original. It was possible, however, to produce duplicates with all contrasts greater than those of the original

  10. Transcriptome profiling in conifers and the PiceaGenExpress database show patterns of diversification within gene families and interspecific conservation in vascular gene expression

    Directory of Open Access Journals (Sweden)

    Raherison Elie

    2012-08-01

    Full Text Available Abstract Background Conifers have very large genomes (13 to 30 Gigabases that are mostly uncharacterized although extensive cDNA resources have recently become available. This report presents a global overview of transcriptome variation in a conifer tree and documents conservation and diversity of gene expression patterns among major vegetative tissues. Results An oligonucleotide microarray was developed from Picea glauca and P. sitchensis cDNA datasets. It represents 23,853 unique genes and was shown to be suitable for transcriptome profiling in several species. A comparison of secondary xylem and phelloderm tissues showed that preferential expression in these vascular tissues was highly conserved among Picea spp. RNA-Sequencing strongly confirmed tissue preferential expression and provided a robust validation of the microarray design. A small database of transcription profiles called PiceaGenExpress was developed from over 150 hybridizations spanning eight major tissue types. In total, transcripts were detected for 92% of the genes on the microarray, in at least one tissue. Non-annotated genes were predominantly expressed at low levels in fewer tissues than genes of known or predicted function. Diversity of expression within gene families may be rapidly assessed from PiceaGenExpress. In conifer trees, dehydrins and late embryogenesis abundant (LEA osmotic regulation proteins occur in large gene families compared to angiosperms. Strong contrasts and low diversity was observed in the dehydrin family, while diverse patterns suggested a greater degree of diversification among LEAs. Conclusion Together, the oligonucleotide microarray and the PiceaGenExpress database represent the first resource of this kind for gymnosperm plants. The spruce transcriptome analysis reported here is expected to accelerate genetic studies in the large and important group comprised of conifer trees.

  11. Conserving marine biodiversity: insights from life-history trait candidate genes in Atlantic cod (Gadus morhua)

    DEFF Research Database (Denmark)

    Hansen, Jakob Hemmer; Therkildsen, Nina Overgaard; Meldrup, Dorte

    2014-01-01

    Recent technological developments have facilitated an increased focus on identifying genomic regions underlying adaptive trait variation in natural populations, and it has been advocated that this information should be important for designating population units for conservation. In marine fishes...... are under selection in natural populations of Atlantic cod. Furthermore, we find that patterns of variation in outlier markers do not align with those observed at selectively neutral markers, and that outlier markers identify conservation units on finer geographical scales than those revealed when analysing...... only neutral markers. Accordingly, results also suggest that information about adaptive genetic variation will be useful for targeted conservation and management in this and other marine species...

  12. Targeted tandem duplication of a large chromosomal segment in Aspergillus oryzae.

    Science.gov (United States)

    Takahashi, Tadashi; Sato, Atsushi; Ogawa, Masahiro; Hanya, Yoshiki; Oguma, Tetsuya

    2014-08-01

    We describe here the first successful construction of a targeted tandem duplication of a large chromosomal segment in Aspergillus oryzae. The targeted tandem chromosomal duplication was achieved by using strains that had a 5'-deleted pyrG upstream of the region targeted for tandem chromosomal duplication and a 3'-deleted pyrG downstream of the target region. Consequently,strains bearing a 210-kb targeted tandem chromosomal duplication near the centromeric region of chromosome 8 and strains bearing a targeted tandem chromosomal duplication of a 700-kb region of chromosome 2 were successfully constructed. The strains bearing the tandem chromosomal duplication were efficiently obtained from the regenerated protoplast of the parental strains. However, the generation of the chromosomal duplication did not depend on the introduction of double-stranded breaks(DSBs) by I-SceI. The chromosomal duplications of these strains were stably maintained after five generations of culture under nonselective conditions. The strains bearing the tandem chromosomal duplication in the 700-kb region of chromosome 2 showed highly increased protease activity in solid-state culture, indicating that the duplication of large chromosomal segments could be a useful new breeding technology and gene analysis method.

  13. Nuclear cGMP-dependent kinase regulates gene expression via activity-dependent recruitment of a conserved histone deacetylase complex.

    Directory of Open Access Journals (Sweden)

    Yan Hao

    2011-05-01

    Full Text Available Elevation of the second messenger cGMP by nitric oxide (NO activates the cGMP-dependent protein kinase PKG, which is key in regulating cardiovascular, intestinal, and neuronal functions in mammals. The NO-cGMP-PKG signaling pathway is also a major therapeutic target for cardiovascular and male reproductive diseases. Despite widespread effects of PKG activation, few molecular targets of PKG are known. We study how EGL-4, the Caenorhabditis elegans PKG ortholog, modulates foraging behavior and egg-laying and seeks the downstream effectors of EGL-4 activity. Using a combination of unbiased forward genetic screen and proteomic analysis, we have identified a conserved SAEG-1/SAEG-2/HDA-2 histone deacetylase complex that is specifically recruited by activated nuclear EGL-4. Gene expression profiling by microarrays revealed >40 genes that are sensitive to EGL-4 activity in a SAEG-1-dependent manner. We present evidence that EGL-4 controls egg laying via one of these genes, Y45F10C.2, which encodes a novel protein that is expressed exclusively in the uterine epithelium. Our results indicate that, in addition to cytoplasmic functions, active EGL-4/PKG acts in the nucleus via a conserved Class I histone deacetylase complex to regulate gene expression pertinent to behavioral and physiological responses to cGMP. We also identify transcriptional targets of EGL-4 that carry out discrete components of the physiological response.

  14. Conservation of transcription factor binding events predicts gene expression across species

    OpenAIRE

    Hemberg, Martin; Kreiman, Gabriel

    2011-01-01

    Recent technological advances have made it possible to determine the genome-wide binding sites of transcription factors (TFs). Comparisons across species have suggested a relatively low degree of evolutionary conservation of experimentally defined TF binding events (TFBEs). Using binding data for six different TFs in hepatocytes and embryonic stem cells from human and mouse, we demonstrate that evolutionary conservation of TFBEs within orthologous proximal promoters is closely linked to funct...

  15. Facial duplication: case, review, and embryogenesis.

    Science.gov (United States)

    Barr, M

    1982-04-01

    The craniofacial anatomy of an infant with facial duplication is described. There were four eyes, two noses, two maxillae, and one mandible. Anterior to the single pituitary the brain was duplicated and there was bilateral arhinencephaly. Portions of the brain were extruded into a large frontal encephalocele. Cases of symmetrical facial duplication reported in the literature range from two complete faces on a single head (diprosopus) to simple nasal duplication. The variety of patterns of duplication suggests that the doubling of facial components arises in several different ways: Forking of the notochord, duplication of the prosencephalon, duplication of the olfactory placodes, and duplication of maxillary and/or mandibular growth centers around the margins of the stomatodeal plate. Among reported cases, the female:male ratio is 2:1.

  16. Conserved-peptide upstream open reading frames (CPuORFs are associated with regulatory genes in angiosperms

    Directory of Open Access Journals (Sweden)

    Richard A Jorgensen

    2012-08-01

    Full Text Available Upstream open reading frames (uORFs are common in eukaryotic transcripts, but those that encode conserved peptides (CPuORFs occur in less than 1% of transcripts. The peptides encoded by three plant CPuORF families are known to control translation of the downstream ORF in response to a small signal molecule (sucrose, polyamines and phosphocholine. In flowering plants, transcription factors are statistically over-represented among genes that possess CPuORFs, and in general it appeared that many CPuORF genes also had other regulatory functions, though the significance of this suggestion was uncertain (Hayden and Jorgensen, 2007. Five years later the literature provides much more information on the functions of many CPuORF genes. Here we reassess the functions of 27 known CPuORF gene families and find that 22 of these families play a variety of different regulatory roles, from transcriptional control to protein turnover, and from small signal molecules to signal transduction kinases. Clearly then, there is indeed a strong association of CPuORFs with regulatory genes. In addition, 16 of these families play key roles in a variety of different biological processes. Most strikingly, the core sucrose response network includes three different CPuORFs, creating the potential for sophisticated balancing of the network in response to three different molecular inputs. We propose that the function of most CPuORFs is to modulate translation of a downstream major ORF (mORF in response to a signal molecule recognized by the conserved peptide and that because the mORFs of CPuORF genes generally encode regulatory proteins, many of them centrally important in the biology of plants, CPuORFs play key roles in balancing such regulatory networks.

  17. Patterns of genetic differentiation at MHC class I genes and microsatellites identify conservation units in the giant panda.

    Science.gov (United States)

    Zhu, Ying; Wan, Qiu-Hong; Yu, Bin; Ge, Yun-Fa; Fang, Sheng-Guo

    2013-10-22

    Evaluating patterns of genetic variation is important to identify conservation units (i.e., evolutionarily significant units [ESUs], management units [MUs], and adaptive units [AUs]) in endangered species. While neutral markers could be used to infer population history, their application in the estimation of adaptive variation is limited. The capacity to adapt to various environments is vital for the long-term survival of endangered species. Hence, analysis of adaptive loci, such as the major histocompatibility complex (MHC) genes, is critical for conservation genetics studies. Here, we investigated 4 classical MHC class I genes (Aime-C, Aime-F, Aime-I, and Aime-L) and 8 microsatellites to infer patterns of genetic variation in the giant panda (Ailuropoda melanoleuca) and to further define conservation units. Overall, we identified 24 haplotypes (9 for Aime-C, 1 for Aime-F, 7 for Aime-I, and 7 for Aime-L) from 218 individuals obtained from 6 populations of giant panda. We found that the Xiaoxiangling population had the highest genetic variation at microsatellites among the 6 giant panda populations and higher genetic variation at Aime-MHC class I genes than other larger populations (Qinling, Qionglai, and Minshan populations). Differentiation index (FST)-based phylogenetic and Bayesian clustering analyses for Aime-MHC-I and microsatellite loci both supported that most populations were highly differentiated. The Qinling population was the most genetically differentiated. The giant panda showed a relatively higher level of genetic diversity at MHC class I genes compared with endangered felids. Using all of the loci, we found that the 6 giant panda populations fell into 2 ESUs: Qinling and non-Qinling populations. We defined 3 MUs based on microsatellites: Qinling, Minshan-Qionglai, and Daxiangling-Xiaoxiangling-Liangshan. We also recommended 3 possible AUs based on MHC loci: Qinling, Minshan-Qionglai, and Daxiangling-Xiaoxiangling-Liangshan. Furthermore, we recommend

  18. A conserved gene family encodes transmembrane proteins with fibronectin, immunoglobulin and leucine-rich repeat domains (FIGLER

    Directory of Open Access Journals (Sweden)

    Haga Christopher L

    2007-09-01

    Full Text Available Abstract Background In mouse the cytokine interleukin-7 (IL-7 is required for generation of B lymphocytes, but human IL-7 does not appear to have this function. A bioinformatics approach was therefore used to identify IL-7 receptor related genes in the hope of identifying the elusive human cytokine. Results Our database search identified a family of nine gene candidates, which we have provisionally named fibronectin immunoglobulin leucine-rich repeat (FIGLER. The FIGLER 1–9 genes are predicted to encode type I transmembrane glycoproteins with 6–12 leucine-rich repeats (LRR, a C2 type Ig domain, a fibronectin type III domain, a hydrophobic transmembrane domain, and a cytoplasmic domain containing one to four tyrosine residues. Members of this multichromosomal gene family possess 20–47% overall amino acid identity and are differentially expressed in cell lines and primary hematopoietic lineage cells. Genes for FIGLER homologs were identified in macaque, orangutan, chimpanzee, mouse, rat, dog, chicken, toad, and puffer fish databases. The non-human FIGLER homologs share 38–99% overall amino acid identity with their human counterpart. Conclusion The extracellular domain structure and absence of recognizable cytoplasmic signaling motifs in members of the highly conserved FIGLER gene family suggest a trophic or cell adhesion function for these molecules.

  19. Biliary tract duplication cyst with gastric heterotopia

    Energy Technology Data Exchange (ETDEWEB)

    Grumbach, K.; Baker, D.H.; Weigert, J.; Altman, R.P.

    1988-05-01

    Cystic duplications of the biliary tract are rare anomalies, easily mistaken for choledochal cysts. Surgical drainage is the preferred therapy for choledochal cyst, but cystic duplication necessitates surgical excision as duplications may contain heterotopic gastric mucosa leading to peptic ulceration of the biliary tract. We report a case of biliary tract duplication cyst containing heterotopic alimentary mucosa which had initially been diagnosed and surgically treated as a choledochal cyst.

  20. Biliary tract duplication cyst with gastric heterotopia

    International Nuclear Information System (INIS)

    Grumbach, K.; Baker, D.H.; Weigert, J.; Altman, R.P.

    1988-01-01

    Cystic duplications of the biliary tract are rare anomalies, easily mistaken for choledochal cysts. Surgical drainage is the preferred therapy for choledochal cyst, but cystic duplication necessitates surgical excision as duplications may contain heterotopic gastric mucosa leading to peptic ulceration of the biliary tract. We report a case of biliary tract duplication cyst containing heterotopic alimentary mucosa which had initially been diagnosed and surgically treated as a choledochal cyst. (orig.)

  1. Preliminary experiments of electronic duplication

    International Nuclear Information System (INIS)

    Fay, Bernard

    1974-01-01

    Systems of electron sputtering (at the unit scale) use as master mask a photocathode with localized emitting zones. Emitted electrons are accelerated and focussed on a silicon substrate covered with an electrosensitive resin. The very high definition associated with electron masking is obtained whatever the complexity of the master mask is, for a printing duration of the order of the minute. This is a duplication method without any contact that prevents the master mask from any mechanical erosion. Alignment of the successive masks is obtained from an electric signal directly usable through an automatic alignment system. Experiments using the apparatus for reproducing masks through an electronic image or ''electronic duplicator'' developed in Thomson-CSF Laboratory at Corbeville, are presented [fr

  2. MicroRNA genes preferentially expressed in dendritic cells contain sites for conserved transcription factor binding motifs in their promoters

    Directory of Open Access Journals (Sweden)

    Huynen Martijn A

    2011-06-01

    Full Text Available Abstract Background MicroRNAs (miRNAs play a fundamental role in the regulation of gene expression by translational repression or target mRNA degradation. Regulatory elements in miRNA promoters are less well studied, but may reveal a link between their expression and a specific cell type. Results To explore this link in myeloid cells, miRNA expression profiles were generated from monocytes and dendritic cells (DCs. Differences in miRNA expression among monocytes, DCs and their stimulated progeny were observed. Furthermore, putative promoter regions of miRNAs that are significantly up-regulated in DCs were screened for Transcription Factor Binding Sites (TFBSs based on TFBS motif matching score, the degree to which those TFBSs are over-represented in the promoters of the up-regulated miRNAs, and the extent of conservation of the TFBSs in mammals. Conclusions Analysis of evolutionarily conserved TFBSs in DC promoters revealed preferential clustering of sites within 500 bp upstream of the precursor miRNAs and that many mRNAs of cognate TFs of the conserved TFBSs were indeed expressed in the DCs. Taken together, our data provide evidence that selected miRNAs expressed in DCs have evolutionarily conserved TFBSs relevant to DC biology in their promoters.

  3. Noncommunicating Isolated Enteric Duplication Cyst in the ...

    African Journals Online (AJOL)

    Noncommunicating isolated enteric duplications in the abdomen are an extremely rare variant of enteric duplications with their own blood supply. We report a case of a noncommunicating isolated ileal duplication in a 10-month-old boy. He was admitted because of severe abdominal distension and developed irritability ...

  4. Genome-Wide Identification and Evolution of HECT Genes in Soybean

    Directory of Open Access Journals (Sweden)

    Xianwen Meng

    2015-04-01

    Full Text Available Proteins containing domains homologous to the E6-associated protein (E6-AP carboxyl terminus (HECT are an important class of E3 ubiquitin ligases involved in the ubiquitin proteasome pathway. HECT-type E3s play crucial roles in plant growth and development. However, current understanding of plant HECT genes and their evolution is very limited. In this study, we performed a genome-wide analysis of the HECT domain-containing genes in soybean. Using high-quality genome sequences, we identified 19 soybean HECT genes. The predicted HECT genes were distributed unevenly across 15 of 20 chromosomes. Nineteen of these genes were inferred to be segmentally duplicated gene pairs, suggesting that in soybean, segmental duplications have made a significant contribution to the expansion of the HECT gene family. Phylogenetic analysis showed that these HECT genes can be divided into seven groups, among which gene structure and domain architecture was relatively well-conserved. The Ka/Ks ratios show that after the duplication events, duplicated HECT genes underwent purifying selection. Moreover, expression analysis reveals that 15 of the HECT genes in soybean are differentially expressed in 14 tissues, and are often highly expressed in the flowers and roots. In summary, this work provides useful information on which further functional studies of soybean HECT genes can be based.

  5. Identification of conserved drought stress responsive gene-network across tissues and developmental stages in rice.

    Science.gov (United States)

    Smita, Shuchi; Katiyar, Amit; Pandey, Dev Mani; Chinnusamy, Viswanathan; Archak, Sunil; Bansal, Kailash Chander

    2013-01-01

    Identification of genes that are coexpressed across various tissues and environmental stresses is biologically interesting, since they may play coordinated role in similar biological processes. Genes with correlated expression patterns can be best identified by using coexpression network analysis of transcriptome data. In the present study, we analyzed the temporal-spatial coordination of gene expression in root, leaf and panicle of rice under drought stress and constructed network using WGCNA and Cytoscape. Total of 2199 differentially expressed genes (DEGs) were identified in at least three or more tissues, wherein 88 genes have coordinated expression profile among all the six tissues under drought stress. These 88 highly coordinated genes were further subjected to module identification in the coexpression network. Based on chief topological properties we identified 18 hub genes such as ABC transporter, ATP-binding protein, dehydrin, protein phosphatase 2C, LTPL153 - Protease inhibitor, phosphatidylethanolaminebinding protein, lactose permease-related, NADP-dependent malic enzyme, etc. Motif enrichment analysis showed the presence of ABRE cis-elements in the promoters of > 62% of the coordinately expressed genes. Our results suggest that drought stress mediated upregulated gene expression was coordinated through an ABA-dependent signaling pathway across tissues, at least for the subset of genes identified in this study, while down regulation appears to be regulated by tissue specific pathways in rice.

  6. Overexpression screens identify conserved dosage chromosome instability genes in yeast and human cancer

    Science.gov (United States)

    Duffy, Supipi; Fam, Hok Khim; Wang, Yi Kan; Styles, Erin B.; Kim, Jung-Hyun; Ang, J. Sidney; Singh, Tejomayee; Larionov, Vladimir; Shah, Sohrab P.; Andrews, Brenda; Boerkoel, Cornelius F.; Hieter, Philip

    2016-01-01

    Somatic copy number amplification and gene overexpression are common features of many cancers. To determine the role of gene overexpression on chromosome instability (CIN), we performed genome-wide screens in the budding yeast for yeast genes that cause CIN when overexpressed, a phenotype we refer to as dosage CIN (dCIN), and identified 245 dCIN genes. This catalog of genes reveals human orthologs known to be recurrently overexpressed and/or amplified in tumors. We show that two genes, TDP1, a tyrosyl-DNA-phosphdiesterase, and TAF12, an RNA polymerase II TATA-box binding factor, cause CIN when overexpressed in human cells. Rhabdomyosarcoma lines with elevated human Tdp1 levels also exhibit CIN that can be partially rescued by siRNA-mediated knockdown of TDP1. Overexpression of dCIN genes represents a genetic vulnerability that could be leveraged for selective killing of cancer cells through targeting of an unlinked synthetic dosage lethal (SDL) partner. Using SDL screens in yeast, we identified a set of genes that when deleted specifically kill cells with high levels of Tdp1. One gene was the histone deacetylase RPD3, for which there are known inhibitors. Both HT1080 cells overexpressing hTDP1 and rhabdomyosarcoma cells with elevated levels of hTdp1 were more sensitive to histone deacetylase inhibitors valproic acid (VPA) and trichostatin A (TSA), recapitulating the SDL interaction in human cells and suggesting VPA and TSA as potential therapeutic agents for tumors with elevated levels of hTdp1. The catalog of dCIN genes presented here provides a candidate list to identify genes that cause CIN when overexpressed in cancer, which can then be leveraged through SDL to selectively target tumors. PMID:27551064

  7. Evolutionary history of the recruitment of conserved developmental genes in association to the formation and diversification of a novel trait

    Directory of Open Access Journals (Sweden)

    Shirai Leila T

    2012-02-01

    Full Text Available Abstract Background The origin and modification of novel traits are important aspects of biological diversification. Studies combining concepts and approaches of developmental genetics and evolutionary biology have uncovered many examples of the recruitment, or co-option, of genes conserved across lineages for the formation of novel, lineage-restricted traits. However, little is known about the evolutionary history of the recruitment of those genes, and of the relationship between them -for example, whether the co-option involves whole or parts of existing networks, or whether it occurs by redeployment of individual genes with de novo rewiring. We use a model novel trait, color pattern elements on butterfly wings called eyespots, to explore these questions. Eyespots have greatly diversified under natural and sexual selection, and their formation involves genetic circuitries shared across insects. Results We investigated the evolutionary history of the recruitment and co-recruitment of four conserved transcription regulators to the larval wing disc region where circular pattern elements develop. The co-localization of Antennapedia, Notch, Distal-less, and Spalt with presumptive (eyespot organizers was examined in 13 butterfly species, providing the largest comparative dataset available for the system. We found variation between families, between subfamilies, and between tribes. Phylogenetic reconstructions by parsimony and maximum likelihood methods revealed an unambiguous evolutionary history only for Antennapedia, with a resolved single origin of eyespot-associated expression, and many homoplastic events for Notch, Distal-less, and Spalt. The flexibility in the (co-recruitment of the targeted genes includes cases where different gene combinations are associated with morphologically similar eyespots, as well as cases where identical protein combinations are associated with very different phenotypes. Conclusions The evolutionary history of gene

  8. Conservation of the response regulator gene gacA in Pseudomonas species

    NARCIS (Netherlands)

    Souza, J.T.; Mazzola, M.; Raaijmakers, J.M.

    2003-01-01

    The response regulator gene gacA influences the production of several secondary metabolites in both pathogenic and beneficial Pseudomonas spp. In this study, we developed primers and a probe for the gacA gene of Pseudomonas species and sequenced a 425 bp fragment of gacA from ten Pseudomonas strains

  9. Associating transcription factors and conserved RNA structures with gene regulation in the human brain

    DEFF Research Database (Denmark)

    Hecker, Nikolai; Seemann, Stefan E.; Silahtaroglu, Asli

    2017-01-01

    Anatomical subdivisions of the human brain can be associated with different neuronal functions. This functional diversification is reflected by differences in gene expression. By analyzing post-mortem gene expression data from the Allen Brain Atlas, we investigated the impact of transcription fac...

  10. Genome Wide Identification, Phylogeny, and Expression of Aquaporin Genes in Common Carp (Cyprinus carpio.

    Directory of Open Access Journals (Sweden)

    Chuanju Dong

    Full Text Available Aquaporins (Aqps are integral membrane proteins that facilitate the transport of water and small solutes across cell membranes. Among vertebrate species, Aqps are highly conserved in both gene structure and amino acid sequence. These proteins are vital for maintaining water homeostasis in living organisms, especially for aquatic animals such as teleost fish. Studies on teleost Aqps are mainly limited to several model species with diploid genomes. Common carp, which has a tetraploidized genome, is one of the most common aquaculture species being adapted to a wide range of aquatic environments. The complete common carp genome has recently been released, providing us the possibility for gene evolution of aqp gene family after whole genome duplication.In this study, we identified a total of 37 aqp genes from common carp genome. Phylogenetic analysis revealed that most of aqps are highly conserved. Comparative analysis was performed across five typical vertebrate genomes. We found that almost all of the aqp genes in common carp were duplicated in the evolution of the gene family. We postulated that the expansion of the aqp gene family in common carp was the result of an additional whole genome duplication event and that the aqp gene family in other teleosts has been lost in their evolution history with the reason that the functions of genes are redundant and conservation. Expression patterns were assessed in various tissues, including brain, heart, spleen, liver, intestine, gill, muscle, and skin, which demonstrated the comprehensive expression profiles of aqp genes in the tetraploidized genome. Significant gene expression divergences have been observed, revealing substantial expression divergences or functional divergences in those duplicated aqp genes post the latest WGD event.To some extent, the gene families are also considered as a unique source for evolutionary studies. Moreover, the whole set of common carp aqp gene family provides an

  11. The Drosophila wings apart gene anchors a novel, evolutionarily conserved pathway of neuromuscular development.

    Science.gov (United States)

    Morriss, Ginny R; Jaramillo, Carmelita T; Mikolajczak, Crystal M; Duong, Sandy; Jaramillo, Maryann S; Cripps, Richard M

    2013-11-01

    wings apart (wap) is a recessive, semilethal gene located on the X chromosome in Drosophila melanogaster, which is required for normal wing-vein patterning. We show that the wap mutation also results in loss of the adult jump muscle. We use complementation mapping and gene-specific RNA interference to localize