Hox gene clusters in the Indonesian coelacanth, Latimeria menadoensis

Science.gov (United States)

Koh, Esther G. L.; Lam, Kevin; Christoffels, Alan; Erdmann, Mark V.; Brenner, Sydney; Venkatesh, Byrappa

2003-01-01

The Hox genes encode transcription factors that play a key role in specifying body plans of metazoans. They are organized into clusters that contain up to 13 paralogue group members. The complex morphology of vertebrates has been attributed to the duplication of Hox clusters during vertebrate evolution. In contrast to the single Hox cluster in the amphioxus (Branchiostoma floridae), an invertebrate-chordate, mammals have four clusters containing 39 Hox genes. Ray-finned fishes (Actinopterygii) such as zebrafish and fugu possess more than four Hox clusters. The coelacanth occupies a basal phylogenetic position among lobe-finned fishes (Sarcopterygii), which gave rise to the tetrapod lineage. The lobe fins of sarcopterygians are considered to be the evolutionary precursors of tetrapod limbs. Thus, the characterization of Hox genes in the coelacanth should provide insights into the origin of tetrapod limbs. We have cloned the complete second exon of 33 Hox genes from the Indonesian coelacanth, Latimeria menadoensis, by extensive PCR survey and genome walking. Phylogenetic analysis shows that 32 of these genes have orthologs in the four mammalian HOX clusters, including three genes (HoxA6, D1, and D8) that are absent in ray-finned fishes. The remaining coelacanth gene is an ortholog of hoxc1 found in zebrafish but absent in mammals. Our results suggest that coelacanths have four Hox clusters bearing a gene complement more similar to mammals than to ray-finned fishes, but with an additional gene, HoxC1, which has been lost during the evolution of mammals from lobe-finned fishes. PMID:12547909

Protein-protein association and cellular localization of four essential gene products encoded by tellurite resistance-conferring cluster "ter" from pathogenic Escherichia coli.

Science.gov (United States)

Valkovicova, Lenka; Vavrova, Silvia Minarikova; Mravec, Jozef; Grones, Jozef; Turna, Jan

2013-12-01

Gene cluster "ter" conferring high tellurite resistance has been identified in various pathogenic bacteria including Escherichia coli O157:H7. However, the precise mechanism as well as the molecular function of the respective gene products is unclear. Here we describe protein-protein association and localization analyses of four essential Ter proteins encoded by minimal resistance-conferring fragment (terBCDE) by means of recombinant expression. By using a two-plasmid complementation system we show that the overproduced single Ter proteins are not able to mediate tellurite resistance, but all Ter members play an irreplaceable role within the cluster. We identified several types of homotypic and heterotypic protein-protein associations among the Ter proteins by in vitro and in vivo pull-down assays and determined their cellular localization by cytosol/membrane fractionation. Our results strongly suggest that Ter proteins function involves their mutual association, which probably happens at the interface of the inner plasma membrane and the cytosol.

A genome-wide analysis of nonribosomal peptide synthetase gene clusters and their peptides in a Planktothrix rubescens strain

Directory of Open Access Journals (Sweden)

Nederbragt Alexander J

2009-08-01

Full Text Available Abstract Background Cyanobacteria often produce several different oligopeptides, with unknown biological functions, by nonribosomal peptide synthetases (NRPS. Although some cyanobacterial NRPS gene cluster types are well described, the entire NRPS genomic content within a single cyanobacterial strain has never been investigated. Here we have combined a genome-wide analysis using massive parallel pyrosequencing ("454" and mass spectrometry screening of oligopeptides produced in the strain Planktothrix rubescens NIVA CYA 98 in order to identify all putative gene clusters for oligopeptides. Results Thirteen types of oligopeptides were uncovered by mass spectrometry (MS analyses. Microcystin, cyanopeptolin and aeruginosin synthetases, highly similar to already characterized NRPS, were present in the genome. Two novel NRPS gene clusters were associated with production of anabaenopeptins and microginins, respectively. Sequence-depth of the genome and real-time PCR data revealed three copies of the microginin gene cluster. Since NRPS gene cluster candidates for microviridin and oscillatorin synthesis could not be found, putative (gene encoded precursor peptide sequences to microviridin and oscillatorin were found in the genes mdnA and oscA, respectively. The genes flanking the microviridin and oscillatorin precursor genes encode putative modifying enzymes of the precursor oligopeptides. We therefore propose ribosomal pathways involving modifications and cyclisation for microviridin and oscillatorin. The microviridin, anabaenopeptin and cyanopeptolin gene clusters are situated in close proximity to each other, constituting an oligopeptide island. Conclusion Altogether seven nonribosomal peptide synthetase (NRPS gene clusters and two gene clusters putatively encoding ribosomal oligopeptide biosynthetic pathways were revealed. Our results demonstrate that whole genome shotgun sequencing combined with MS-directed determination of oligopeptides successfully

Conditions for the Evolution of Gene Clusters in Bacterial Genomes

Science.gov (United States)

Ballouz, Sara; Francis, Andrew R.; Lan, Ruiting; Tanaka, Mark M.

2010-01-01

Genes encoding proteins in a common pathway are often found near each other along bacterial chromosomes. Several explanations have been proposed to account for the evolution of these structures. For instance, natural selection may directly favour gene clusters through a variety of mechanisms, such as increased efficiency of coregulation. An alternative and controversial hypothesis is the selfish operon model, which asserts that clustered arrangements of genes are more easily transferred to other species, thus improving the prospects for survival of the cluster. According to another hypothesis (the persistence model), genes that are in close proximity are less likely to be disrupted by deletions. Here we develop computational models to study the conditions under which gene clusters can evolve and persist. First, we examine the selfish operon model by re-implementing the simulation and running it under a wide range of conditions. Second, we introduce and study a Moran process in which there is natural selection for gene clustering and rearrangement occurs by genome inversion events. Finally, we develop and study a model that includes selection and inversion, which tracks the occurrence and fixation of rearrangements. Surprisingly, gene clusters fail to evolve under a wide range of conditions. Factors that promote the evolution of gene clusters include a low number of genes in the pathway, a high population size, and in the case of the selfish operon model, a high horizontal transfer rate. The computational analysis here has shown that the evolution of gene clusters can occur under both direct and indirect selection as long as certain conditions hold. Under these conditions the selfish operon model is still viable as an explanation for the evolution of gene clusters. PMID:20168992

Gene cluster statistics with gene families.

Science.gov (United States)

Raghupathy, Narayanan; Durand, Dannie

2009-05-01

Identifying genomic regions that descended from a common ancestor is important for understanding the function and evolution of genomes. In distantly related genomes, clusters of homologous gene pairs are evidence of candidate homologous regions. Demonstrating the statistical significance of such "gene clusters" is an essential component of comparative genomic analyses. However, currently there are no practical statistical tests for gene clusters that model the influence of the number of homologs in each gene family on cluster significance. In this work, we demonstrate empirically that failure to incorporate gene family size in gene cluster statistics results in overestimation of significance, leading to incorrect conclusions. We further present novel analytical methods for estimating gene cluster significance that take gene family size into account. Our methods do not require complete genome data and are suitable for testing individual clusters found in local regions, such as contigs in an unfinished assembly. We consider pairs of regions drawn from the same genome (paralogous clusters), as well as regions drawn from two different genomes (orthologous clusters). Determining cluster significance under general models of gene family size is computationally intractable. By assuming that all gene families are of equal size, we obtain analytical expressions that allow fast approximation of cluster probabilities. We evaluate the accuracy of this approximation by comparing the resulting gene cluster probabilities with cluster probabilities obtained by simulating a realistic, power-law distributed model of gene family size, with parameters inferred from genomic data. Surprisingly, despite the simplicity of the underlying assumption, our method accurately approximates the true cluster probabilities. It slightly overestimates these probabilities, yielding a conservative test. We present additional simulation results indicating the best choice of parameter values for data

Functional Genome Mining for Metabolites Encoded by Large Gene Clusters through Heterologous Expression of a Whole-Genome Bacterial Artificial Chromosome Library in Streptomyces spp.

Science.gov (United States)

Xu, Min; Wang, Yemin; Zhao, Zhilong; Gao, Guixi; Huang, Sheng-Xiong; Kang, Qianjin; He, Xinyi; Lin, Shuangjun; Pang, Xiuhua; Deng, Zixin

2016-01-01

ABSTRACT Genome sequencing projects in the last decade revealed numerous cryptic biosynthetic pathways for unknown secondary metabolites in microbes, revitalizing drug discovery from microbial metabolites by approaches called genome mining. In this work, we developed a heterologous expression and functional screening approach for genome mining from genomic bacterial artificial chromosome (BAC) libraries in Streptomyces spp. We demonstrate mining from a strain of Streptomyces rochei, which is known to produce streptothricins and borrelidin, by expressing its BAC library in the surrogate host Streptomyces lividans SBT5, and screening for antimicrobial activity. In addition to the successful capture of the streptothricin and borrelidin biosynthetic gene clusters, we discovered two novel linear lipopeptides and their corresponding biosynthetic gene cluster, as well as a novel cryptic gene cluster for an unknown antibiotic from S. rochei. This high-throughput functional genome mining approach can be easily applied to other streptomycetes, and it is very suitable for the large-scale screening of genomic BAC libraries for bioactive natural products and the corresponding biosynthetic pathways. IMPORTANCE Microbial genomes encode numerous cryptic biosynthetic gene clusters for unknown small metabolites with potential biological activities. Several genome mining approaches have been developed to activate and bring these cryptic metabolites to biological tests for future drug discovery. Previous sequence-guided procedures relied on bioinformatic analysis to predict potentially interesting biosynthetic gene clusters. In this study, we describe an efficient approach based on heterologous expression and functional screening of a whole-genome library for the mining of bioactive metabolites from Streptomyces. The usefulness of this function-driven approach was demonstrated by the capture of four large biosynthetic gene clusters for metabolites of various chemical types, including

Conditions for the evolution of gene clusters in bacterial genomes.

Directory of Open Access Journals (Sweden)

Sara Ballouz

2010-02-01

Full Text Available Genes encoding proteins in a common pathway are often found near each other along bacterial chromosomes. Several explanations have been proposed to account for the evolution of these structures. For instance, natural selection may directly favour gene clusters through a variety of mechanisms, such as increased efficiency of coregulation. An alternative and controversial hypothesis is the selfish operon model, which asserts that clustered arrangements of genes are more easily transferred to other species, thus improving the prospects for survival of the cluster. According to another hypothesis (the persistence model, genes that are in close proximity are less likely to be disrupted by deletions. Here we develop computational models to study the conditions under which gene clusters can evolve and persist. First, we examine the selfish operon model by re-implementing the simulation and running it under a wide range of conditions. Second, we introduce and study a Moran process in which there is natural selection for gene clustering and rearrangement occurs by genome inversion events. Finally, we develop and study a model that includes selection and inversion, which tracks the occurrence and fixation of rearrangements. Surprisingly, gene clusters fail to evolve under a wide range of conditions. Factors that promote the evolution of gene clusters include a low number of genes in the pathway, a high population size, and in the case of the selfish operon model, a high horizontal transfer rate. The computational analysis here has shown that the evolution of gene clusters can occur under both direct and indirect selection as long as certain conditions hold. Under these conditions the selfish operon model is still viable as an explanation for the evolution of gene clusters.

Extreme expansion of NBS-encoding genes in Rosaceae.

Science.gov (United States)

Jia, YanXiao; Yuan, Yang; Zhang, Yanchun; Yang, Sihai; Zhang, Xiaohui

2015-05-03

Nucleotide binding site leucine-rich repeats (NBS-LRR) genes encode a large class of disease resistance (R) proteins in plants. Extensive studies have been carried out to identify and investigate NBS-encoding gene families in many important plant species. However, no comprehensive research into NBS-encoding genes in the Rosaceae has been performed. In this study, five whole-genome sequenced Rosaceae species, including apple, pear, peach, mei, and strawberry, were analyzed to investigate the evolutionary pattern of NBS-encoding genes and to compare them to those of three Cucurbitaceae species, cucumber, melon, and watermelon. Considerable differences in the copy number of NBS-encoding genes were observed between Cucurbitaceae and Rosaceae species. In Rosaceae species, a large number and a high proportion of NBS-encoding genes were observed in peach (437, 1.52%), mei (475, 1.51%), strawberry (346, 1.05%) and pear (617, 1.44%), and apple contained a whopping 1303 (2.05%) NBS-encoding genes, which might be the highest number of R-genes in all of these reported diploid plant. However, no more than 100 NBS-encoding genes were identified in Cucurbitaceae. Many more species-specific gene families were classified and detected with the signature of positive selection in Rosaceae species, especially in the apple genome. Taken together, our findings indicate that NBS-encoding genes in Rosaceae, especially in apple, have undergone extreme expansion and rapid adaptive evolution. Useful information was provided for further research on the evolutionary mode of disease resistance genes in Rosaceae crops.

The Cremeomycin Biosynthetic Gene Cluster Encodes a Pathway for Diazo Formation.

Science.gov (United States)

Waldman, Abraham J; Pechersky, Yakov; Wang, Peng; Wang, Jennifer X; Balskus, Emily P

2015-10-12

Diazo groups are found in a range of natural products that possess potent biological activities. Despite longstanding interest in these metabolites, diazo group biosynthesis is not well understood, in part because of difficulties in identifying specific genes linked to diazo formation. Here we describe the discovery of the gene cluster that produces the o-diazoquinone natural product cremeomycin and its heterologous expression in Streptomyces lividans. We used stable isotope feeding experiments and in vitro characterization of biosynthetic enzymes to decipher the order of events in this pathway and establish that diazo construction involves late-stage N-N bond formation. This work represents the first successful production of a diazo-containing metabolite in a heterologous host, experimentally linking a set of genes with diazo formation. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Genetic interrelations in the actinomycin biosynthetic gene clusters of Streptomyces antibioticus IMRU 3720 and Streptomyces chrysomallus ATCC11523, producers of actinomycin X and actinomycin C

Science.gov (United States)

Crnovčić, Ivana; Rückert, Christian; Semsary, Siamak; Lang, Manuel; Kalinowski, Jörn; Keller, Ullrich

2017-01-01

Sequencing the actinomycin (acm) biosynthetic gene cluster of Streptomyces antibioticus IMRU 3720, which produces actinomycin X (Acm X), revealed 20 genes organized into a highly similar framework as in the bi-armed acm C biosynthetic gene cluster of Streptomyces chrysomallus but without an attached additional extra arm of orthologues as in the latter. Curiously, the extra arm of the S. chrysomallus gene cluster turned out to perfectly match the single arm of the S. antibioticus gene cluster in the same order of orthologues including the the presence of two pseudogenes, scacmM and scacmN, encoding a cytochrome P450 and its ferredoxin, respectively. Orthologues of the latter genes were both missing in the principal arm of the S. chrysomallus acm C gene cluster. All orthologues of the extra arm showed a G +C-contents different from that of their counterparts in the principal arm. Moreover, the similarities of translation products from the extra arm were all higher to the corresponding translation products of orthologue genes from the S. antibioticus acm X gene cluster than to those encoded by the principal arm of their own gene cluster. This suggests that the duplicated structure of the S. chrysomallus acm C biosynthetic gene cluster evolved from previous fusion between two one-armed acm gene clusters each from a different genetic background. However, while scacmM and scacmN in the extra arm of the S. chrysomallus acm C gene cluster are mutated and therefore are non-functional, their orthologues saacmM and saacmN in the S. antibioticus acm C gene cluster show no defects seemingly encoding active enzymes with functions specific for Acm X biosynthesis. Both acm biosynthetic gene clusters lack a kynurenine-3-monooxygenase gene necessary for biosynthesis of 3-hydroxy-4-methylanthranilic acid, the building block of the Acm chromophore, which suggests participation of a genome-encoded relevant monooxygenase during Acm biosynthesis in both S. chrysomallus and S

Two Gene Clusters Coordinate Galactose and Lactose Metabolism in Streptococcus gordonii

Science.gov (United States)

Zeng, Lin; Martino, Nicole C.

2012-01-01

Streptococcus gordonii is an early colonizer of the human oral cavity and an abundant constituent of oral biofilms. Two tandemly arranged gene clusters, designated lac and gal, were identified in the S. gordonii DL1 genome, which encode genes of the tagatose pathway (lacABCD) and sugar phosphotransferase system (PTS) enzyme II permeases. Genes encoding a predicted phospho-β-galactosidase (LacG), a DeoR family transcriptional regulator (LacR), and a transcriptional antiterminator (LacT) were also present in the clusters. Growth and PTS assays supported that the permease designated EIILac transports lactose and galactose, whereas EIIGal transports galactose. The expression of the gene for EIIGal was markedly upregulated in cells growing on galactose. Using promoter-cat fusions, a role for LacR in the regulation of the expressions of both gene clusters was demonstrated, and the gal cluster was also shown to be sensitive to repression by CcpA. The deletion of lacT caused an inability to grow on lactose, apparently because of its role in the regulation of the expression of the genes for EIILac, but had little effect on galactose utilization. S. gordonii maintained a selective advantage over Streptococcus mutans in a mixed-species competition assay, associated with its possession of a high-affinity galactose PTS, although S. mutans could persist better at low pHs. Collectively, these results support the concept that the galactose and lactose systems of S. gordonii are subject to complex regulation and that a high-affinity galactose PTS may be advantageous when S. gordonii is competing against the caries pathogen S. mutans in oral biofilms. PMID:22660715

Prediction of operon-like gene clusters in the Arabidopsis thaliana genome based on co-expression analysis of neighboring genes.

Science.gov (United States)

Wada, Masayoshi; Takahashi, Hiroki; Altaf-Ul-Amin, Md; Nakamura, Kensuke; Hirai, Masami Y; Ohta, Daisaku; Kanaya, Shigehiko

2012-07-15

Operon-like arrangements of genes occur in eukaryotes ranging from yeasts and filamentous fungi to nematodes, plants, and mammals. In plants, several examples of operon-like gene clusters involved in metabolic pathways have recently been characterized, e.g. the cyclic hydroxamic acid pathways in maize, the avenacin biosynthesis gene clusters in oat, the thalianol pathway in Arabidopsis thaliana, and the diterpenoid momilactone cluster in rice. Such operon-like gene clusters are defined by their co-regulation or neighboring positions within immediate vicinity of chromosomal regions. A comprehensive analysis of the expression of neighboring genes therefore accounts a crucial step to reveal the complete set of operon-like gene clusters within a genome. Genome-wide prediction of operon-like gene clusters should contribute to functional annotation efforts and provide novel insight into evolutionary aspects acquiring certain biological functions as well. We predicted co-expressed gene clusters by comparing the Pearson correlation coefficient of neighboring genes and randomly selected gene pairs, based on a statistical method that takes false discovery rate (FDR) into consideration for 1469 microarray gene expression datasets of A. thaliana. We estimated that A. thaliana contains 100 operon-like gene clusters in total. We predicted 34 statistically significant gene clusters consisting of 3 to 22 genes each, based on a stringent FDR threshold of 0.1. Functional relationships among genes in individual clusters were estimated by sequence similarity and functional annotation of genes. Duplicated gene pairs (determined based on BLAST with a cutoff of EOperon-like clusters tend to include genes encoding bio-machinery associated with ribosomes, the ubiquitin/proteasome system, secondary metabolic pathways, lipid and fatty-acid metabolism, and the lipid transfer system. Copyright © 2012 Elsevier B.V. All rights reserved.

Heterologous Reconstitution of the Intact Geodin Gene Cluster in Aspergillus nidulans through a Simple and Versatile PCR Based Approach

DEFF Research Database (Denmark)

Nielsen, Morten Thrane; Nielsen, Jakob Blæsbjerg; Anyaogu, Dianna Chinyere

2013-01-01

was transferred in a two step procedure to an expression platform in A. nidulans. The individual cluster fragments were generated by PCR and assembled via efficient USER fusion prior to ransformation and integration via re-iterative gene targeting. A total of 13 open reading frames contained in 25 kb of DNA were...... of solid methodology for genetic manipulation of most species severely hampers pathway haracterization. Here we present a simple PCR based approach for heterologous reconstitution of intact gene clusters. Specifically, the putative gene cluster responsible for geodin production from Aspergillus terreus...... successfully transferred between the two species enabling geodin synthesis in A. nidulans. Subsequently, functions of three genes in the cluster were validated by genetic and chemical analyses. Specifically, ATEG_08451 (gedC) encodes a polyketide synthase, ATEG_08453 (gedR) encodes a transcription factor...

A highly divergent gene cluster in honey bees encodes a novel silk family

OpenAIRE

Sutherland, Tara D.; Campbell, Peter M.; Weisman, Sarah; Trueman, Holly E.; Sriskantha, Alagacone; Wanjura, Wolfgang J.; Haritos, Victoria S.

2006-01-01

The pupal cocoon of the domesticated silk moth Bombyx mori is the best known and most extensively studied insect silk. It is not widely known that Apis mellifera larvae also produce silk. We have used a combination of genomic and proteomic techniques to identify four honey bee fiber genes (AmelFibroin1–4) and two silk-associated genes (AmelSA1 and 2). The four fiber genes are small, comprise a single exon each, and are clustered on a short genomic region where the open reading frames are GC-r...

Genomic organization of the rat alpha 2u-globulin gene cluster.

Science.gov (United States)

McFadyen, D A; Addison, W; Locke, J

1999-05-01

The alpha 2u-globulin are a group of similar proteins, belonging to the lipocalin superfamily of proteins, that are synthesized in a subset of secretory tissues in rats. The many alpha 2u-globulin isoforms are encoded by a multigene family that exhibits extensive homology. Despite a high degree of sequence identity, individual family members show diverse expression patterns involving complex hormonal, tissue-specific, and developmental regulation. Analysis suggests that there are approximately 20 alpha 2u-globulin genes in the rat genome. We have used fluorescence in situ hybridization (FISH) to show that the alpha 2u-globulin genes are clustered at a single site on rat Chromosome (Chr) 5 (5q22-24). Southern blots of rat genomic DNA separated by pulsed field gel electrophoresis indicated that the alpha 2u-globulin genes are contained on two NruI fragments with a total size of 880 kbp. Analysis of three P1 clones containing alpha 2u-globulin genes indicated that the alpha 2u-globulin genes are tandemly arranged in a head-to-tail fashion. The organization of the alpha 2u-globulin genes in the rat as a tandem array of single genes differs from the homologous major urinary protein genes in the mouse, which are organized as tandem arrays of divergently oriented gene pairs. The structure of these gene clusters may have consequences for the proposed function, as a pheromone transporter, for the protein products encoded by these genes.

Spatially Compact Neural Clusters in the Dorsal Striatum Encode Locomotion Relevant Information.

Science.gov (United States)

Barbera, Giovanni; Liang, Bo; Zhang, Lifeng; Gerfen, Charles R; Culurciello, Eugenio; Chen, Rong; Li, Yun; Lin, Da-Ting

2016-10-05

An influential striatal model postulates that neural activities in the striatal direct and indirect pathways promote and inhibit movement, respectively. Normal behavior requires coordinated activity in the direct pathway to facilitate intended locomotion and indirect pathway to inhibit unwanted locomotion. In this striatal model, neuronal population activity is assumed to encode locomotion relevant information. Here, we propose a novel encoding mechanism for the dorsal striatum. We identified spatially compact neural clusters in both the direct and indirect pathways. Detailed characterization revealed similar cluster organization between the direct and indirect pathways, and cluster activities from both pathways were correlated with mouse locomotion velocities. Using machine-learning algorithms, cluster activities could be used to decode locomotion relevant behavioral states and locomotion velocity. We propose that neural clusters in the dorsal striatum encode locomotion relevant information and that coordinated activities of direct and indirect pathway neural clusters are required for normal striatal controlled behavior. VIDEO ABSTRACT. Published by Elsevier Inc.

Diametrical clustering for identifying anti-correlated gene clusters.

Science.gov (United States)

Dhillon, Inderjit S; Marcotte, Edward M; Roshan, Usman

2003-09-01

Clustering genes based upon their expression patterns allows us to predict gene function. Most existing clustering algorithms cluster genes together when their expression patterns show high positive correlation. However, it has been observed that genes whose expression patterns are strongly anti-correlated can also be functionally similar. Biologically, this is not unintuitive-genes responding to the same stimuli, regardless of the nature of the response, are more likely to operate in the same pathways. We present a new diametrical clustering algorithm that explicitly identifies anti-correlated clusters of genes. Our algorithm proceeds by iteratively (i). re-partitioning the genes and (ii). computing the dominant singular vector of each gene cluster; each singular vector serving as the prototype of a 'diametric' cluster. We empirically show the effectiveness of the algorithm in identifying diametrical or anti-correlated clusters. Testing the algorithm on yeast cell cycle data, fibroblast gene expression data, and DNA microarray data from yeast mutants reveals that opposed cellular pathways can be discovered with this method. We present systems whose mRNA expression patterns, and likely their functions, oppose the yeast ribosome and proteosome, along with evidence for the inverse transcriptional regulation of a number of cellular systems.

Genetic interrelations in the actinomycin biosynthetic gene clusters of Streptomyces antibioticus IMRU 3720 and Streptomyces chrysomallus ATCC11523, producers of actinomycin X and actinomycin C

Directory of Open Access Journals (Sweden)

Crnovčić I

2017-04-01

Full Text Available Ivana Crnovčić,1 Christian Rückert,2 Siamak Semsary,1 Manuel Lang,1 Jörn Kalinowski,2 Ullrich Keller1 1Institut für Chemie, Technische Universität Berlin, Berlin-Charlottenburg, 2Technology Platform Genomics, Center for Biotechnology, Bielefeld University, Bielefeld, Germany Abstract: Sequencing the actinomycin (acm biosynthetic gene cluster of Streptomyces antibioticus IMRU 3720, which produces actinomycin X (Acm X, revealed 20 genes organized into a highly similar framework as in the bi-armed acm C biosynthetic gene cluster of Streptomyces chrysomallus but without an attached additional extra arm of orthologues as in the latter. Curiously, the extra arm of the S. chrysomallus gene cluster turned out to perfectly match the single arm of the S. antibioticus gene cluster in the same order of orthologues including the the presence of two pseudogenes, scacmM and scacmN, encoding a cytochrome P450 and its ferredoxin, respectively. Orthologues of the latter genes were both missing in the principal arm of the S. chrysomallus acm C gene cluster. All orthologues of the extra arm showed a G +C-contents different from that of their counterparts in the principal arm. Moreover, the similarities of translation products from the extra arm were all higher to the corresponding translation products of orthologue genes from the S. antibioticus acm X gene cluster than to those encoded by the principal arm of their own gene cluster. This suggests that the duplicated structure of the S. chrysomallus acm C biosynthetic gene cluster evolved from previous fusion between two one-armed acm gene clusters each from a different genetic background. However, while scacmM and scacmN in the extra arm of the S. chrysomallus acm C gene cluster are mutated and therefore are non-functional, their orthologues saacmM and saacmN in the S. antibioticus acm C gene cluster show no defects seemingly encoding active enzymes with functions specific for Acm X biosynthesis. Both acm

Heterologous reconstitution of the intact geodin gene cluster in Aspergillus nidulans through a simple and versatile PCR based approach.

Directory of Open Access Journals (Sweden)

Morten Thrane Nielsen

Full Text Available Fungal natural products are a rich resource for bioactive molecules. To fully exploit this potential it is necessary to link genes to metabolites. Genetic information for numerous putative biosynthetic pathways has become available in recent years through genome sequencing. However, the lack of solid methodology for genetic manipulation of most species severely hampers pathway characterization. Here we present a simple PCR based approach for heterologous reconstitution of intact gene clusters. Specifically, the putative gene cluster responsible for geodin production from Aspergillus terreus was transferred in a two step procedure to an expression platform in A. nidulans. The individual cluster fragments were generated by PCR and assembled via efficient USER fusion prior to transformation and integration via re-iterative gene targeting. A total of 13 open reading frames contained in 25 kb of DNA were successfully transferred between the two species enabling geodin synthesis in A. nidulans. Subsequently, functions of three genes in the cluster were validated by genetic and chemical analyses. Specifically, ATEG_08451 (gedC encodes a polyketide synthase, ATEG_08453 (gedR encodes a transcription factor responsible for activation of the geodin gene cluster and ATEG_08460 (gedL encodes a halogenase that catalyzes conversion of sulochrin to dihydrogeodin. We expect that our approach for transferring intact biosynthetic pathways to a fungus with a well developed genetic toolbox will be instrumental in characterizing the many exciting pathways for secondary metabolite production that are currently being uncovered by the fungal genome sequencing projects.

Identification of the Regulator Gene Responsible for the Acetone-Responsive Expression of the Binuclear Iron Monooxygenase Gene Cluster in Mycobacteria ▿

Science.gov (United States)

Furuya, Toshiki; Hirose, Satomi; Semba, Hisashi; Kino, Kuniki

2011-01-01

The mimABCD gene cluster encodes the binuclear iron monooxygenase that oxidizes propane and phenol in Mycobacterium smegmatis strain MC2 155 and Mycobacterium goodii strain 12523. Interestingly, expression of the mimABCD gene cluster is induced by acetone. In this study, we investigated the regulator gene responsible for this acetone-responsive expression. In the genome sequence of M. smegmatis strain MC2 155, the mimABCD gene cluster is preceded by a gene designated mimR, which is divergently transcribed. Sequence analysis revealed that MimR exhibits amino acid similarity with the NtrC family of transcriptional activators, including AcxR and AcoR, which are involved in acetone and acetoin metabolism, respectively. Unexpectedly, many homologs of the mimR gene were also found in the sequenced genomes of actinomycetes. A plasmid carrying a transcriptional fusion of the intergenic region between the mimR and mimA genes with a promoterless green fluorescent protein (GFP) gene was constructed and introduced into M. smegmatis strain MC2 155. Using a GFP reporter system, we confirmed by deletion and complementation analyses that the mimR gene product is the positive regulator of the mimABCD gene cluster expression that is responsive to acetone. M. goodii strain 12523 also utilized the same regulatory system as M. smegmatis strain MC2 155. Although transcriptional activators of the NtrC family generally control transcription using the σ54 factor, a gene encoding the σ54 factor was absent from the genome sequence of M. smegmatis strain MC2 155. These results suggest the presence of a novel regulatory system in actinomycetes, including mycobacteria. PMID:21856847

Evolution of the C-Type Lectin-Like Receptor Genes of the DECTIN-1 Cluster in the NK Gene Complex

Directory of Open Access Journals (Sweden)

Susanne Sattler

2012-01-01

Full Text Available Pattern recognition receptors are crucial in initiating and shaping innate and adaptive immune responses and often belong to families of structurally and evolutionarily related proteins. The human C-type lectin-like receptors encoded in the DECTIN-1 cluster within the NK gene complex contain prominent receptors with pattern recognition function, such as DECTIN-1 and LOX-1. All members of this cluster share significant homology and are considered to have arisen from subsequent gene duplications. Recent developments in sequencing and the availability of comprehensive sequence data comprising many species showed that the receptors of the DECTIN-1 cluster are not only homologous to each other but also highly conserved between species. Even in Caenorhabditis elegans, genes displaying homology to the mammalian C-type lectin-like receptors have been detected. In this paper, we conduct a comprehensive phylogenetic survey and give an up-to-date overview of the currently available data on the evolutionary emergence of the DECTIN-1 cluster genes.

antiSMASH 3.0—a comprehensive resource for the genome mining of biosynthetic gene clusters

DEFF Research Database (Denmark)

Weber, Tilmann; Blin, Kai; Duddela, Srikanth

2015-01-01

Microbial secondary metabolism constitutes a rich source of antibiotics, chemotherapeutics, insecticides and other high-value chemicals. Genome mining of gene clusters that encode the biosynthetic pathways for these metabolites has become a key methodology for novel compound discovery. In 2011, we...... introduced antiSMASH, a web server and stand-alone tool for the automatic genomic identification and analysis of biosynthetic gene clusters, available at http://antismash.secondarymetabolites.org. Here, we present version 3.0 of antiSMASH, which has undergone major improvements. A full integration...... of the recently published ClusterFinder algorithm now allows using this probabilistic algorithm to detect putative gene clusters of unknown types. Also, a new dereplication variant of the ClusterBlast module now identifies similarities of identified clusters to any of 1172 clusters with known end products...

VRprofile: gene-cluster-detection-based profiling of virulence and antibiotic resistance traits encoded within genome sequences of pathogenic bacteria.

Science.gov (United States)

Li, Jun; Tai, Cui; Deng, Zixin; Zhong, Weihong; He, Yongqun; Ou, Hong-Yu

2017-01-10

VRprofile is a Web server that facilitates rapid investigation of virulence and antibiotic resistance genes, as well as extends these trait transfer-related genetic contexts, in newly sequenced pathogenic bacterial genomes. The used backend database MobilomeDB was firstly built on sets of known gene cluster loci of bacterial type III/IV/VI/VII secretion systems and mobile genetic elements, including integrative and conjugative elements, prophages, class I integrons, IS elements and pathogenicity/antibiotic resistance islands. VRprofile is thus able to co-localize the homologs of these conserved gene clusters using HMMer or BLASTp searches. With the integration of the homologous gene cluster search module with a sequence composition module, VRprofile has exhibited better performance for island-like region predictions than the other widely used methods. In addition, VRprofile also provides an integrated Web interface for aligning and visualizing identified gene clusters with MobilomeDB-archived gene clusters, or a variety set of bacterial genomes. VRprofile might contribute to meet the increasing demands of re-annotations of bacterial variable regions, and aid in the real-time definitions of disease-relevant gene clusters in pathogenic bacteria of interest. VRprofile is freely available at http://bioinfo-mml.sjtu.edu.cn/VRprofile. © The Author 2017. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

Overproduction of lactimidomycin by cross-overexpression of genes encoding Streptomyces antibiotic regulatory proteins.

Science.gov (United States)

Zhang, Bo; Yang, Dong; Yan, Yijun; Pan, Guohui; Xiang, Wensheng; Shen, Ben

2016-03-01

The glutarimide-containing polyketides represent a fascinating class of natural products that exhibit a multitude of biological activities. We have recently cloned and sequenced the biosynthetic gene clusters for three members of the glutarimide-containing polyketides-iso-migrastatin (iso-MGS) from Streptomyces platensis NRRL 18993, lactimidomycin (LTM) from Streptomyces amphibiosporus ATCC 53964, and cycloheximide (CHX) from Streptomyces sp. YIM56141. Comparative analysis of the three clusters identified mgsA and chxA, from the mgs and chx gene clusters, respectively, that were predicted to encode the PimR-like Streptomyces antibiotic regulatory proteins (SARPs) but failed to reveal any regulatory gene from the ltm gene cluster. Overexpression of mgsA or chxA in S. platensis NRRL 18993, Streptomyces sp. YIM56141 or SB11024, and a recombinant strain of Streptomyces coelicolor M145 carrying the intact mgs gene cluster has no significant effect on iso-MGS or CHX production, suggesting that MgsA or ChxA regulation may not be rate-limiting for iso-MGS and CHX production in these producers. In contrast, overexpression of mgsA or chxA in S. amphibiosporus ATCC 53964 resulted in a significant increase in LTM production, with LTM titer reaching 106 mg/L, which is five-fold higher than that of the wild-type strain. These results support MgsA and ChxA as members of the SARP family of positive regulators for the iso-MGS and CHX biosynthetic machinery and demonstrate the feasibility to improve glutarimide-containing polyketide production in Streptomyces strains by exploiting common regulators.

K19 capsular polysaccharide of Acinetobacter baumannii is produced via a Wzy polymerase encoded in a small genomic island rather than the KL19 capsule gene cluster.

Science.gov (United States)

Kenyon, Johanna J; Shneider, Mikhail M; Senchenkova, Sofya N; Shashkov, Alexander S; Siniagina, Maria N; Malanin, Sergey Y; Popova, Anastasiya V; Miroshnikov, Konstantin A; Hall, Ruth M; Knirel, Yuriy A

2016-08-01

Polymerization of the oligosaccharides (K units) of complex capsular polysaccharides (CPSs) requires a Wzy polymerase, which is usually encoded in the gene cluster that directs K unit synthesis. Here, a gene cluster at the Acinetobacter K locus (KL) that lacks a wzy gene, KL19, was found in Acinetobacter baumannii ST111 isolates 28 and RBH2 recovered from hospitals in the Russian Federation and Australia, respectively. However, these isolates produced long-chain capsule, and a wzy gene was found in a 6.1 kb genomic island (GI) located adjacent to the cpn60 gene. The GI also includes an acetyltransferase gene, atr25, which is interrupted by an insertion sequence (IS) in RBH2. The capsule structure from both strains was →3)-α-d-GalpNAc-(1→4)-α-d-GalpNAcA-(1→3)-β-d-QuipNAc4NAc-(1→, determined using NMR spectroscopy. Biosynthesis of the K unit was inferred to be initiated with QuiNAc4NAc, and hence the Wzy forms the β-(1→3) linkage between QuipNAc4NAc and GalpNAc. The GalpNAc residue is 6-O-acetylated in isolate 28 only, showing that atr25 is responsible for this acetylation. The same GI with or without an IS in atr25 was found in draft genomes of other KL19 isolates, as well as ones carrying a closely related CPS gene cluster, KL39, which differs from KL19 only in a gene for an acyltransferase in the QuiNAc4NR synthesis pathway. Isolates carrying a KL1 variant with the wzy and atr genes each interrupted by an ISAba125 also have this GI. To our knowledge, this study is the first report of genes involved in capsule biosynthesis normally found at the KL located elsewhere in A. baumannii genomes.

Evolution and Diversity of Biosynthetic Gene Clusters in Fusarium

Directory of Open Access Journals (Sweden)

Koen Hoogendoorn

2018-06-01

Full Text Available Plant pathogenic fungi in the Fusarium genus cause severe damage to crops, resulting in great financial losses and health hazards. Specialized metabolites synthesized by these fungi are known to play key roles in the infection process, and to provide survival advantages inside and outside the host. However, systematic studies of the evolution of specialized metabolite-coding potential across Fusarium have been scarce. Here, we apply a combination of bioinformatic approaches to identify biosynthetic gene clusters (BGCs across publicly available genomes from Fusarium, to group them into annotated families and to study gain/loss events of BGC families throughout the history of the genus. Comparison with MIBiG reference BGCs allowed assignment of 29 gene cluster families (GCFs to pathways responsible for the production of known compounds, while for 57 GCFs, the molecular products remain unknown. Comparative analysis of BGC repertoires using ancestral state reconstruction raised several new hypotheses on how BGCs contribute to Fusarium pathogenicity or host specificity, sometimes surprisingly so: for example, a gene cluster for the biosynthesis of hexadehydro-astechrome was identified in the genome of the biocontrol strain Fusarium oxysporum Fo47, while being absent in that of the tomato pathogen F. oxysporum f.sp. lycopersici. Several BGCs were also identified on supernumerary chromosomes; heterologous expression of genes for three terpene synthases encoded on the Fusarium poae supernumerary chromosome and subsequent GC/MS analysis showed that these genes are functional and encode enzymes that each are able to synthesize koraiol; this observed functional redundancy supports the hypothesis that localization of copies of BGCs on supernumerary chromosomes provides freedom for evolutionary innovations to occur, while the original function remains conserved. Altogether, this systematic overview of biosynthetic diversity in Fusarium paves the way for

Genetic analysis of the pelA-pelE cluster encoding the acidic and basic pectate lyases in Erwinia chrysanthemi EC16.

Science.gov (United States)

Barras, F; Chatterjee, A K

1987-10-01

In Erwinia chrysanthemi (EC16) the clustered pelA and pelE genes encode an acidic (pI 4.2) and a basic (pI 10.0) pectate lyase (Pel), respectively. The pelA gene has been isolated on a 1.2 kb restriction fragment and the direction of transcription determined. DNA hybridization analysis showed that the pelE sequence shares DNA homology with pelA but not with pelB or pelC, two genes encoding other Pel species in EC16. Since Pel A and Pel E enzymes showed little similarity in terms of catalytic properties, it is proposed that pelA and pelE are duplicates which have highly diverged.

Plasmid Complement of Lactococcus lactis NCDO712 Reveals a Novel Pilus Gene Cluster.

Science.gov (United States)

Tarazanova, Mariya; Beerthuyzen, Marke; Siezen, Roland; Fernandez-Gutierrez, Marcela M; de Jong, Anne; van der Meulen, Sjoerd; Kok, Jan; Bachmann, Herwig

2016-01-01

Lactococcus lactis MG1363 is an important gram-positive model organism. It is a plasmid-free and phage-cured derivative of strain NCDO712. Plasmid-cured strains facilitate studies on molecular biological aspects, but many properties which make L. lactis an important organism in the dairy industry are plasmid encoded. We sequenced the total DNA of strain NCDO712 and, contrary to earlier reports, revealed that the strain carries 6 rather than 5 plasmids. A new 50-kb plasmid, designated pNZ712, encodes functional nisin immunity (nisCIP) and copper resistance (lcoRSABC). The copper resistance could be used as a marker for the conjugation of pNZ712 to L. lactis MG1614. A genome comparison with the plasmid cured daughter strain MG1363 showed that the number of single nucleotide polymorphisms that accumulated in the laboratory since the strains diverted more than 30 years ago is limited to 11 of which only 5 lead to amino acid changes. The 16-kb plasmid pSH74 was found to contain a novel 8-kb pilus gene cluster spaCB-spaA-srtC1-srtC2, which is predicted to encode a pilin tip protein SpaC, a pilus basal subunit SpaB, and a pilus backbone protein SpaA. The sortases SrtC1/SrtC2 are most likely involved in pilus polymerization while the chromosomally encoded SrtA could act to anchor the pilus to peptidoglycan in the cell wall. Overexpression of the pilus gene cluster from a multi-copy plasmid in L. lactis MG1363 resulted in cell chaining, aggregation, rapid sedimentation and increased conjugation efficiency of the cells. Electron microscopy showed that the over-expression of the pilus gene cluster leads to appendices on the cell surfaces. A deletion of the gene encoding the putative basal protein spaB, by truncating spaCB, led to more pilus-like structures on the cell surface, but cell aggregation and cell chaining were no longer observed. This is consistent with the prediction that spaB is involved in the anchoring of the pili to the cell.

New recombinant bacterium comprises a heterologous gene encoding glycerol dehydrogenase and/or an up-regulated native gene encoding glycerol dehydrogenase, useful for producing ethanol

DEFF Research Database (Denmark)

2010-01-01

dehydrogenase encoding region of the bacterium, or is inserted into a phosphotransacetylase encoding region of the bacterium, or is inserted into an acetate kinase encoding region of the bacterium. It is operably linked to an inducible, a regulated or a constitutive promoter. The up-regulated glycerol......TECHNOLOGY FOCUS - BIOTECHNOLOGY - Preparation (claimed): Producing recombinant bacterium having enhanced ethanol production characteristics when cultivated in growth medium comprising glycerol comprises: (a) transforming a parental bacterium by (i) the insertion of a heterologous gene encoding...... glycerol dehydrogenase; and/or (ii) up-regulating a native gene encoding glycerol dehydrogenase; and (b) obtaining the recombinant bacterium. Preferred Bacterium: In the recombinant bacterium above, the inserted heterologous gene and/or the up-regulated native gene is encoding a glycerol dehydrogenase...

Bioinformatic analysis of the nucleotide binding site-encoding disease-resistance genes in foxtail millet (Setaria italica (L.) Beauv.).

Science.gov (United States)

Zhu, Y B; Xie, X Q; Li, Z Y; Bai, H; Dong, L; Dong, Z P; Dong, J G

2014-08-28

The nucleotide-binding site (NBS) disease-resistance genes are the largest category of plant disease-resistance gene analogs. The complete set of disease-resistant candidate genes, which encode the NBS sequence, was filtered in the genomes of two varieties of foxtail millet (Yugu1 and 'Zhang gu'). This study investigated a number of characteristics of the putative NBS genes, such as structural diversity and phylogenetic relationships. A total of 269 and 281 NBS-coding sequences were identified in Yugu1 and 'Zhang gu', respectively. When the two databases were compared, 72 genes were found to be identical and 164 genes showed more than 90% similarity. Physical positioning and gene family analysis of the NBS disease-resistance genes in the genome revealed that the number of genes on each chromosome was similar in both varieties. The eighth chromosome contained the largest number of genes and the ninth chromosome contained the lowest number of genes. Exactly 34 gene clusters containing the 161 genes were found in the Yugu1 genome, with each cluster containing 4.7 genes on average. In comparison, the 'Zhang gu' genome possessed 28 gene clusters, which had 151 genes, with an average of 5.4 genes in each cluster. The largest gene cluster, located on the eighth chromosome, contained 12 genes in the Yugu1 database, whereas it contained 16 genes in the 'Zhang gu' database. The classification results showed that the CC-NBS-LRR gene made up the largest part of each chromosome in the two databases. Two TIR-NBS genes were also found in the Yugu1 genome.

Activation and clustering of a Plasmodium falciparum var gene are affected by subtelomeric sequences.

Science.gov (United States)

Duffy, Michael F; Tang, Jingyi; Sumardy, Fransisca; Nguyen, Hanh H T; Selvarajah, Shamista A; Josling, Gabrielle A; Day, Karen P; Petter, Michaela; Brown, Graham V

2017-01-01

The Plasmodium falciparum var multigene family encodes the cytoadhesive, variant antigen PfEMP1. P. falciparum antigenic variation and cytoadhesion specificity are controlled by epigenetic switching between the single, or few, simultaneously expressed var genes. Most var genes are maintained in perinuclear clusters of heterochromatic telomeres. The active var gene(s) occupy a single, perinuclear var expression site. It is unresolved whether the var expression site forms in situ at a telomeric cluster or whether it is an extant compartment to which single chromosomes travel, thus controlling var switching. Here we show that transcription of a var gene did not require decreased colocalisation with clusters of telomeres, supporting var expression site formation in situ. However following recombination within adjacent subtelomeric sequences, the same var gene was persistently activated and did colocalise less with telomeric clusters. Thus, participation in stable, heterochromatic, telomere clusters and var switching are independent but are both affected by subtelomeric sequences. The var expression site colocalised with the euchromatic mark H3K27ac to a greater extent than it did with heterochromatic H3K9me3. H3K27ac was enriched within the active var gene promoter even when the var gene was transiently repressed in mature parasites and thus H3K27ac may contribute to var gene epigenetic memory. © 2016 Federation of European Biochemical Societies.

Evolutionary history of the phl gene cluster in the plant-associated bacterium Pseudomonas fluorescens

NARCIS (Netherlands)

Moynihan, J.A.; Morrissey, J.P.; Coppoolse, E.; Stiekema, W.J.; O'Gara, F.; Boyd, E.F.

2009-01-01

Pseudomonas fluorescens is of agricultural and economic importance as a biological control agent largely because of its plant-association and production of secondary metabolites, in particular 2, 4-diacetylphloroglucinol (2, 4-DAPG). This polyketide, which is encoded by the eight gene phl cluster,

The Serratia gene cluster encoding biosynthesis of the red antibiotic, prodigiosin, shows species- and strain-dependent genome context variation

DEFF Research Database (Denmark)

Harris, Abigail K P; Williamson, Neil R; Slater, Holly

2004-01-01

The prodigiosin biosynthesis gene cluster (pig cluster) from two strains of Serratia (S. marcescens ATCC 274 and Serratia sp. ATCC 39006) has been cloned, sequenced and expressed in heterologous hosts. Sequence analysis of the respective pig clusters revealed 14 ORFs in S. marcescens ATCC 274...... and 15 ORFs in Serratia sp. ATCC 39006. In each Serratia species, predicted gene products showed similarity to polyketide synthases (PKSs), non-ribosomal peptide synthases (NRPSs) and the Red proteins of Streptomyces coelicolor A3(2). Comparisons between the two Serratia pig clusters and the red cluster...... from Str. coelicolor A3(2) revealed some important differences. A modified scheme for the biosynthesis of prodigiosin, based on the pathway recently suggested for the synthesis of undecylprodigiosin, is proposed. The distribution of the pig cluster within several Serratia sp. isolates is demonstrated...

Identification, characterization and metagenome analysis of oocyte-specific genes organized in clusters in the mouse genome

Directory of Open Access Journals (Sweden)

Vaiman Daniel

2005-05-01

Full Text Available Abstract Background Genes specifically expressed in the oocyte play key roles in oogenesis, ovarian folliculogenesis, fertilization and/or early embryonic development. In an attempt to identify novel oocyte-specific genes in the mouse, we have used an in silico subtraction methodology, and we have focused our attention on genes that are organized in genomic clusters. Results In the present work, five clusters have been studied: a cluster of thirteen genes characterized by an F-box domain localized on chromosome 9, a cluster of six genes related to T-cell leukaemia/lymphoma protein 1 (Tcl1 on chromosome 12, a cluster composed of a SPErm-associated glutamate (E-Rich (Speer protein expressed in the oocyte in the vicinity of four unknown genes specifically expressed in the testis on chromosome 14, a cluster composed of the oocyte secreted protein-1 (Oosp-1 gene and two Oosp-related genes on chromosome 19, all three being characterized by a partial N-terminal zona pellucida-like domain, and another small cluster of two genes on chromosome 19 as well, composed of a TWIK-Related spinal cord K+ channel encoding-gene, and an unknown gene predicted in silico to be testis-specific. The specificity of expression was confirmed by RT-PCR and in situ hybridization for eight and five of them, respectively. Finally, we showed by comparing all of the isolated and clustered oocyte-specific genes identified so far in the mouse genome, that the oocyte-specific clusters are significantly closer to telomeres than isolated oocyte-specific genes are. Conclusion We have studied five clusters of genes specifically expressed in female, some of them being also expressed in male germ-cells. Moreover, contrarily to non-clustered oocyte-specific genes, those that are organized in clusters tend to map near chromosome ends, suggesting that this specific near-telomere position of oocyte-clusters in rodents could constitute an evolutionary advantage. Understanding the biological

The Fdb3 transcription factor of the Fusarium Detoxification of Benzoxazolinone gene cluster is required for MBOA but not BOA degradation in Fusarium pseudograminearum.

Science.gov (United States)

Kettle, Andrew J; Carere, Jason; Batley, Jacqueline; Manners, John M; Kazan, Kemal; Gardiner, Donald M

2016-03-01

A number of cereals produce the benzoxazolinone class of phytoalexins. Fusarium species pathogenic towards these hosts can typically degrade these compounds via an aminophenol intermediate, and the ability to do so is encoded by a group of genes found in the Fusarium Detoxification of Benzoxazolinone (FDB) cluster. A zinc finger transcription factor encoded by one of the FDB cluster genes (FDB3) has been proposed to regulate the expression of other genes in the cluster and hence is potentially involved in benzoxazolinone degradation. Herein we show that Fdb3 is essential for the ability of Fusarium pseudograminearum to efficiently detoxify the predominant wheat benzoxazolinone, 6-methoxy-benzoxazolin-2-one (MBOA), but not benzoxazoline-2-one (BOA). Furthermore, additional genes thought to be part of the FDB gene cluster, based upon transcriptional response to benzoxazolinones, are regulated by Fdb3. However, deletion mutants for these latter genes remain capable of benzoxazolinone degradation, suggesting that they are not essential for this process. Crown Copyright © 2016. Published by Elsevier Inc. All rights reserved.

Bacillus caldolyticus prs gene encoding phosphoribosyldiphosphate synthase

DEFF Research Database (Denmark)

Krath, Britta N.; Hove-Jensen, Bjarne

1996-01-01

The prs gene, encoding phosphoribosyl-diphosphate (PRPP) synthase, as well as the flanking DNA sequences were cloned and sequenced from the Gram-positive thermophile, Bacillus caldolyticus. Comparison with the homologous sequences from the mesophile, Bacillus subtilis, revealed a gene (gca......D) encoding N-acetylglucosamine-l-phosphate uridyltransferase upstream of prs, and a gene homologous to ctc downstream of prs. cDNA synthesis with a B. caldolyticus gcaD-prs-ctc-specified mRNA as template, followed by amplification utilising the polymerase chain reaction indicated that the three genes are co......-transcribed. Comparison of amino acid sequences revealed a high similarity among PRPP synthases across a wide phylogenetic range. An E. coli strain harbouring the B. caldolyticus prs gene in a multicopy plasmid produced PRPP synthase activity 33-fold over the activity of a haploid B. caldolyticus strain. B. caldolyticus...

Persistence drives gene clustering in bacterial genomes

Directory of Open Access Journals (Sweden)

Rocha Eduardo PC

2008-01-01

Full Text Available Abstract Background Gene clustering plays an important role in the organization of the bacterial chromosome and several mechanisms have been proposed to explain its extent. However, the controversies raised about the validity of each of these mechanisms remind us that the cause of this gene organization remains an open question. Models proposed to explain clustering did not take into account the function of the gene products nor the likely presence or absence of a given gene in a genome. However, genomes harbor two very different categories of genes: those genes present in a majority of organisms – persistent genes – and those present in very few organisms – rare genes. Results We show that two classes of genes are significantly clustered in bacterial genomes: the highly persistent and the rare genes. The clustering of rare genes is readily explained by the selfish operon theory. Yet, genes persistently present in bacterial genomes are also clustered and we try to understand why. We propose a model accounting specifically for such clustering, and show that indispensability in a genome with frequent gene deletion and insertion leads to the transient clustering of these genes. The model describes how clusters are created via the gene flux that continuously introduces new genes while deleting others. We then test if known selective processes, such as co-transcription, physical interaction or functional neighborhood, account for the stabilization of these clusters. Conclusion We show that the strong selective pressure acting on the function of persistent genes, in a permanent state of flux of genes in bacterial genomes, maintaining their size fairly constant, that drives persistent genes clustering. A further selective stabilization process might contribute to maintaining the clustering.

Two Horizontally Transferred Xenobiotic Resistance Gene Clusters Associated with Detoxification of Benzoxazolinones by Fusarium Species

Science.gov (United States)

Glenn, Anthony E.; Davis, C. Britton; Gao, Minglu; Gold, Scott E.; Mitchell, Trevor R.; Proctor, Robert H.; Stewart, Jane E.; Snook, Maurice E.

2016-01-01

Microbes encounter a broad spectrum of antimicrobial compounds in their environments and often possess metabolic strategies to detoxify such xenobiotics. We have previously shown that Fusarium verticillioides, a fungal pathogen of maize known for its production of fumonisin mycotoxins, possesses two unlinked loci, FDB1 and FDB2, necessary for detoxification of antimicrobial compounds produced by maize, including the γ-lactam 2-benzoxazolinone (BOA). In support of these earlier studies, microarray analysis of F. verticillioides exposed to BOA identified the induction of multiple genes at FDB1 and FDB2, indicating the loci consist of gene clusters. One of the FDB1 cluster genes encoded a protein having domain homology to the metallo-β-lactamase (MBL) superfamily. Deletion of this gene (MBL1) rendered F. verticillioides incapable of metabolizing BOA and thus unable to grow on BOA-amended media. Deletion of other FDB1 cluster genes, in particular AMD1 and DLH1, did not affect BOA degradation. Phylogenetic analyses and topology testing of the FDB1 and FDB2 cluster genes suggested two horizontal transfer events among fungi, one being transfer of FDB1 from Fusarium to Colletotrichum, and the second being transfer of the FDB2 cluster from Fusarium to Aspergillus. Together, the results suggest that plant-derived xenobiotics have exerted evolutionary pressure on these fungi, leading to horizontal transfer of genes that enhance fitness or virulence. PMID:26808652

Rapid duplication and loss of nbs-encoding genes in eurosids II

International Nuclear Information System (INIS)

Si, W.; Gu, L.; Yang, S.; Zhang, X.; Memon, S.

2015-01-01

Eurosids basically evolved from the core Eudicots Rosids. The Rosids consist of two large assemblages, Eurosids I (Fabids) and Eurosids II (Malvids), which belong to the largest group of Angiosperms, comprising of >40,000 and ∼ 15,000 species, respectively. Although the evolutionary patterns of the largest class of disease resistance genes consisting of a nucleotide binding site (NBS) and leucine-rich repeats (LRRs) have been studied in many species, systemic research of NBS-encoding genes has not been performed in different orders of Eurosids II. Here, five Eurosids II species, Gossypium raimondii, Theobroma cacao, Carica papaya, Citrus clementina, and Arabidopsis thaliana, distributing in three orders, were used to gain insights into the evolutionary patterns of the NBS-encoding genes. Our data showed that frequent copy number variations of NBS-encoding genes were found among these species. Phylogenetic tree analysis and the numbers of the NBS-encoding genes in the common ancestor of these species showed that species-specific NBS clades, including multi-copy and single copy numbers are dominant among these genes. However, not a single clade was found with only five copies, which come from all of the five species, respectively, suggesting rapid turn-over with birth and death of the NBS-encoding genes among Eurosids II species. In addition, a strong positive correlation was observed between the Toll/interleukin receptor (TIR)) type NBS-encoding genes and species-specific genes, indicating rapid gene loss and duplication. Whereas, non- TIR type NBS-encoding genes in these five species showed two distinct evolutionary patterns. (author)

Gene co-expression analysis identifies gene clusters associated with isotropic and polarized growth in Aspergillus fumigatus conidia.

Science.gov (United States)

Baltussen, Tim J H; Coolen, Jordy P M; Zoll, Jan; Verweij, Paul E; Melchers, Willem J G

2018-04-26

Aspergillus fumigatus is a saprophytic fungus that extensively produces conidia. These microscopic asexually reproductive structures are small enough to reach the lungs. Germination of conidia followed by hyphal growth inside human lungs is a key step in the establishment of infection in immunocompromised patients. RNA-Seq was used to analyze the transcriptome of dormant and germinating A. fumigatus conidia. Construction of a gene co-expression network revealed four gene clusters (modules) correlated with a growth phase (dormant, isotropic growth, polarized growth). Transcripts levels of genes encoding for secondary metabolites were high in dormant conidia. During isotropic growth, transcript levels of genes involved in cell wall modifications increased. Two modules encoding for growth and cell cycle/DNA processing were associated with polarized growth. In addition, the co-expression network was used to identify highly connected intermodular hub genes. These genes may have a pivotal role in the respective module and could therefore be compelling therapeutic targets. Generally, cell wall remodeling is an important process during isotropic and polarized growth, characterized by an increase of transcripts coding for hyphal growth and cell cycle/DNA processing when polarized growth is initiated. Copyright © 2018 The Authors. Published by Elsevier Inc. All rights reserved.

antiSMASH 3.0-a comprehensive resource for the genome mining of biosynthetic gene clusters.

Science.gov (United States)

Weber, Tilmann; Blin, Kai; Duddela, Srikanth; Krug, Daniel; Kim, Hyun Uk; Bruccoleri, Robert; Lee, Sang Yup; Fischbach, Michael A; Müller, Rolf; Wohlleben, Wolfgang; Breitling, Rainer; Takano, Eriko; Medema, Marnix H

2015-07-01

Microbial secondary metabolism constitutes a rich source of antibiotics, chemotherapeutics, insecticides and other high-value chemicals. Genome mining of gene clusters that encode the biosynthetic pathways for these metabolites has become a key methodology for novel compound discovery. In 2011, we introduced antiSMASH, a web server and stand-alone tool for the automatic genomic identification and analysis of biosynthetic gene clusters, available at http://antismash.secondarymetabolites.org. Here, we present version 3.0 of antiSMASH, which has undergone major improvements. A full integration of the recently published ClusterFinder algorithm now allows using this probabilistic algorithm to detect putative gene clusters of unknown types. Also, a new dereplication variant of the ClusterBlast module now identifies similarities of identified clusters to any of 1172 clusters with known end products. At the enzyme level, active sites of key biosynthetic enzymes are now pinpointed through a curated pattern-matching procedure and Enzyme Commission numbers are assigned to functionally classify all enzyme-coding genes. Additionally, chemical structure prediction has been improved by incorporating polyketide reduction states. Finally, in order for users to be able to organize and analyze multiple antiSMASH outputs in a private setting, a new XML output module allows offline editing of antiSMASH annotations within the Geneious software. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

Identification and Analysis of a Novel Gene Cluster Involves in Fe2+ Oxidation in Acidithiobacillus ferrooxidans ATCC 23270, a Typical Biomining Acidophile.

Science.gov (United States)

Ai, Chenbing; Liang, Yuting; Miao, Bo; Chen, Miao; Zeng, Weimin; Qiu, Guanzhou

2018-07-01

Iron-oxidizing Acidithiobacillus spp. are applied worldwide in biomining industry to extract metals from sulfide minerals. They derive energy for survival through Fe 2+ oxidation and generate Fe 3+ for the dissolution of sulfide minerals. However, molecular mechanisms of their iron oxidation still remain elusive. A novel two-cytochrome-encoding gene cluster (named tce gene cluster) encoding a high-molecular-weight cytochrome c (AFE_1428) and a c 4 -type cytochrome c 552 (AFE_1429) in A. ferrooxidans ATCC 23270 was first identified in this study. Bioinformatic analysis together with transcriptional study showed that AFE_1428 and AFE_1429 were the corresponding paralog of Cyc2 (AFE_3153) and Cyc1 (AFE_3152) which were encoded by the extensively studied rus operon and had been proven involving in ferrous iron oxidation. Both AFE_1428 and AFE_1429 contained signal peptide and the classic heme-binding motif(s) as their corresponding paralog. The modeled structure of AFE_1429 showed high resemblance to Cyc1. AFE_1428 and AFE_1429 were preferentially transcribed as their corresponding paralogs in the presence of ferrous iron as sole energy source as compared with sulfur. The tce gene cluster is highly conserved in the genomes of four phylogenetic-related A. ferrooxidans strains that were originally isolated from different sites separated with huge geographical distance, which further implies the importance of this gene cluster. Collectively, AFE_1428 and AFE_1429 involve in Fe 2+ oxidation like their corresponding paralog by integrating with the metalloproteins encoded by rus operon. This study provides novel insights into the Fe 2+ oxidation mechanism in Fe 2+ -oxidizing A. ferrooxidans ssp.

Genome-Wide Identification and Analysis of Genes Encoding PHD-Finger Protein in Tomato

International Nuclear Information System (INIS)

Hayat, S.; Cheng, Z.; Chen, X.

2016-01-01

The PHD-finger proteins are conserved in eukaryotic organisms and are involved in a variety of important functions in different biological processes in plants. However, the function of PHD fingers are poorly known in tomato (Solanum lycopersicum L.). In current study, we identified 45 putative genes coding Phd finger protein in tomato distributed on 11 chromosomes except for chromosome 8. Some of the genes encode other conserved key domains besides Phd-finger. Phylogenetic analysis of these 45 proteins resulted in seven clusters. Most Phd finger proteins were predicted to PML body location. These PHD-finger genes displayed differential expression either in various organs, at different development stages and under stresses in tomato. Our study provides the first systematic analysis of PHD-finger genes and proteins in tomato. This preliminary study provides a very useful reference information for Phd-finger proteins in tomato. They will be helpful for cloning and functional study of tomato PHD-finger genes. (author)

Identification and analysis of the paulomycin biosynthetic gene cluster and titer improvement of the paulomycins in Streptomyces paulus NRRL 8115.

Directory of Open Access Journals (Sweden)

Jine Li

Full Text Available The paulomycins are a group of glycosylated compounds featuring a unique paulic acid moiety. To locate their biosynthetic gene clusters, the genomes of two paulomycin producers, Streptomyces paulus NRRL 8115 and Streptomyces sp. YN86, were sequenced. The paulomycin biosynthetic gene clusters were defined by comparative analyses of the two genomes together with the genome of the third paulomycin producer Streptomyces albus J1074. Subsequently, the identity of the paulomycin biosynthetic gene cluster was confirmed by inactivation of two genes involved in biosynthesis of the paulomycose branched chain (pau11 and the ring A moiety (pau18 in Streptomyces paulus NRRL 8115. After determining the gene cluster boundaries, a convergent biosynthetic model was proposed for paulomycin based on the deduced functions of the pau genes. Finally, a paulomycin high-producing strain was constructed by expressing an activator-encoding gene (pau13 in S. paulus, setting the stage for future investigations.

A functional bikaverin biosynthesis gene cluster in rare strains of Botrytis cinerea is positively controlled by VELVET.

Directory of Open Access Journals (Sweden)

Julia Schumacher

Full Text Available The gene cluster responsible for the biosynthesis of the red polyketidic pigment bikaverin has only been characterized in Fusarium ssp. so far. Recently, a highly homologous but incomplete and nonfunctional bikaverin cluster has been found in the genome of the unrelated phytopathogenic fungus Botrytis cinerea. In this study, we provided evidence that rare B. cinerea strains such as 1750 have a complete and functional cluster comprising the six genes orthologous to Fusarium fujikuroi ffbik1-ffbik6 and do produce bikaverin. Phylogenetic analysis confirmed that the whole cluster was acquired from Fusarium through a horizontal gene transfer (HGT. In the bikaverin-nonproducing strain B05.10, the genes encoding bikaverin biosynthesis enzymes are nonfunctional due to deleterious mutations (bcbik2-3 or missing (bcbik1 but interestingly, the genes encoding the regulatory proteins BcBIK4 and BcBIK5 do not harbor deleterious mutations which suggests that they may still be functional. Heterologous complementation of the F. fujikuroi Δffbik4 mutant confirmed that bcbik4 of strain B05.10 is indeed fully functional. Deletion of bcvel1 in the pink strain 1750 resulted in loss of bikaverin and overproduction of melanin indicating that the VELVET protein BcVEL1 regulates the biosynthesis of the two pigments in an opposite manner. Although strain 1750 itself expresses a truncated BcVEL1 protein (100 instead of 575 aa that is nonfunctional with regard to sclerotia formation, virulence and oxalic acid formation, it is sufficient to regulate pigment biosynthesis (bikaverin and melanin and fenhexamid HydR2 type of resistance. Finally, a genetic cross between strain 1750 and a bikaverin-nonproducing strain sensitive to fenhexamid revealed that the functional bikaverin cluster is genetically linked to the HydR2 locus.

A Cluster of Five Genes Essential for the Utilization of Dihydroxamate Xenosiderophores in Synechocystis sp. PCC 6803.

Science.gov (United States)

Obando S, Tobias A; Babykin, Michael M; Zinchenko, Vladislav V

2018-05-21

The unicellular freshwater cyanobacterium Synechocystis sp. PCC 6803 is capable of using dihydroxamate xenosiderophores, either ferric schizokinen (FeSK) or a siderophore of the filamentous cyanobacterium Anabaena variabilis ATCC 29413 (SAV), as the sole source of iron in the TonB-dependent manner. The fecCDEB1-schT gene cluster encoding a siderophore transport system that is involved in the utilization of FeSK and SAV in Synechocystis sp. PCC 6803 was identified. The gene schT encodes TonB-dependent outer membrane transporter, whereas the remaining four genes encode the ABC-type transporter FecB1CDE formed by the periplasmic binding protein FecB1, the transmembrane permease proteins FecC and FecD, and the ATPase FecE. Inactivation of any of these genes resulted in the inability of cells to utilize FeSK and SAV. Our data strongly suggest that Synechocystis sp. PCC 6803 can readily internalize Fe-siderophores via the classic TonB-dependent transport system.

A deep auto-encoder model for gene expression prediction.

Science.gov (United States)

Xie, Rui; Wen, Jia; Quitadamo, Andrew; Cheng, Jianlin; Shi, Xinghua

2017-11-17

Gene expression is a key intermediate level that genotypes lead to a particular trait. Gene expression is affected by various factors including genotypes of genetic variants. With an aim of delineating the genetic impact on gene expression, we build a deep auto-encoder model to assess how good genetic variants will contribute to gene expression changes. This new deep learning model is a regression-based predictive model based on the MultiLayer Perceptron and Stacked Denoising Auto-encoder (MLP-SAE). The model is trained using a stacked denoising auto-encoder for feature selection and a multilayer perceptron framework for backpropagation. We further improve the model by introducing dropout to prevent overfitting and improve performance. To demonstrate the usage of this model, we apply MLP-SAE to a real genomic datasets with genotypes and gene expression profiles measured in yeast. Our results show that the MLP-SAE model with dropout outperforms other models including Lasso, Random Forests and the MLP-SAE model without dropout. Using the MLP-SAE model with dropout, we show that gene expression quantifications predicted by the model solely based on genotypes, align well with true gene expression patterns. We provide a deep auto-encoder model for predicting gene expression from SNP genotypes. This study demonstrates that deep learning is appropriate for tackling another genomic problem, i.e., building predictive models to understand genotypes' contribution to gene expression. With the emerging availability of richer genomic data, we anticipate that deep learning models play a bigger role in modeling and interpreting genomics.

A novel polyketide biosynthesis gene cluster is involved in fruiting body morphogenesis in the filamentous fungi Sordaria macrospora and Neurospora crassa.

Science.gov (United States)

Nowrousian, Minou

2009-04-01

During fungal fruiting body development, hyphae aggregate to form multicellular structures that protect and disperse the sexual spores. Analysis of microarray data revealed a gene cluster strongly upregulated during fruiting body development in the ascomycete Sordaria macrospora. Real time PCR analysis showed that the genes from the orthologous cluster in Neurospora crassa are also upregulated during development. The cluster encodes putative polyketide biosynthesis enzymes, including a reducing polyketide synthase. Analysis of knockout strains of a predicted dehydrogenase gene from the cluster showed that mutants in N. crassa and S. macrospora are delayed in fruiting body formation. In addition to the upregulated cluster, the N. crassa genome comprises another cluster containing a polyketide synthase gene, and five additional reducing polyketide synthase (rpks) genes that are not part of clusters. To study the role of these genes in sexual development, expression of the predicted rpks genes in S. macrospora (five genes) and N. crassa (six genes) was analyzed; all but one are upregulated during sexual development. Analysis of knockout strains for the N. crassa rpks genes showed that one of them is essential for fruiting body formation. These data indicate that polyketides produced by RPKSs are involved in sexual development in filamentous ascomycetes.

The Genome of Tolypocladium inflatum: Evolution, Organization, and Expression of the Cyclosporin Biosynthetic Gene Cluster

Science.gov (United States)

Bushley, Kathryn E.; Raja, Rajani; Jaiswal, Pankaj; Cumbie, Jason S.; Nonogaki, Mariko; Boyd, Alexander E.; Owensby, C. Alisha; Knaus, Brian J.; Elser, Justin; Miller, Daniel; Di, Yanming; McPhail, Kerry L.; Spatafora, Joseph W.

2013-01-01

The ascomycete fungus Tolypocladium inflatum, a pathogen of beetle larvae, is best known as the producer of the immunosuppressant drug cyclosporin. The draft genome of T. inflatum strain NRRL 8044 (ATCC 34921), the isolate from which cyclosporin was first isolated, is presented along with comparative analyses of the biosynthesis of cyclosporin and other secondary metabolites in T. inflatum and related taxa. Phylogenomic analyses reveal previously undetected and complex patterns of homology between the nonribosomal peptide synthetase (NRPS) that encodes for cyclosporin synthetase (simA) and those of other secondary metabolites with activities against insects (e.g., beauvericin, destruxins, etc.), and demonstrate the roles of module duplication and gene fusion in diversification of NRPSs. The secondary metabolite gene cluster responsible for cyclosporin biosynthesis is described. In addition to genes necessary for cyclosporin biosynthesis, it harbors a gene for a cyclophilin, which is a member of a family of immunophilins known to bind cyclosporin. Comparative analyses support a lineage specific origin of the cyclosporin gene cluster rather than horizontal gene transfer from bacteria or other fungi. RNA-Seq transcriptome analyses in a cyclosporin-inducing medium delineate the boundaries of the cyclosporin cluster and reveal high levels of expression of the gene cluster cyclophilin. In medium containing insect hemolymph, weaker but significant upregulation of several genes within the cyclosporin cluster, including the highly expressed cyclophilin gene, was observed. T. inflatum also represents the first reference draft genome of Ophiocordycipitaceae, a third family of insect pathogenic fungi within the fungal order Hypocreales, and supports parallel and qualitatively distinct radiations of insect pathogens. The T. inflatum genome provides additional insight into the evolution and biosynthesis of cyclosporin and lays a foundation for further investigations of the role

The human TREM gene cluster at 6p21.1 encodes both activating and inhibitory single IgV domain receptors and includes NKp44.

Science.gov (United States)

Allcock, Richard J N; Barrow, Alexander D; Forbes, Simon; Beck, Stephan; Trowsdale, John

2003-02-01

We have characterized a cluster of single immunoglobulin variable (IgV) domain receptors centromeric of the major histocompatibility complex (MHC) on human chromosome 6. In addition to triggering receptor expressed on myeloid cells (TREM)-1 and TREM2, the cluster contains NKp44, a triggering receptor whose expression is limited to NK cells. We identified three new related genes and two gene fragments within a cluster of approximately 200 kb. Two of the three new genes lack charged residues in their transmembrane domain tails. Further, one of the genes contains two potential immunotyrosine Inhibitory motifs in its cytoplasmic tail, suggesting that it delivers inhibitory signals. The human and mouse TREM clusters appear to have diverged such that there are unique sequences in each species. Finally, each gene in the TREM cluster was expressed in a different range of cell types.

NFκB-mediated activation of the cellular FUT3, 5 and 6 gene cluster by herpes simplex virus type 1.

Science.gov (United States)

Nordén, Rickard; Samuelsson, Ebba; Nyström, Kristina

2017-11-01

Herpes simplex virus type 1 has the ability to induce expression of a human gene cluster located on chromosome 19 upon infection. This gene cluster contains three fucosyltransferases (encoded by FUT3, FUT5 and FUT6) with the ability to add a fucose to an N-acetylglucosamine residue. Little is known regarding the transcriptional activation of these three genes in human cells. Intriguingly, herpes simplex virus type 1 activates all three genes simultaneously during infection, a situation not observed in uninfected tissue, pointing towards a virus specific mechanism for transcriptional activation. The aim of this study was to define the underlying mechanism for the herpes simplex virus type 1 activation of FUT3, FUT5 and FUT6 transcription. The transcriptional activation of the FUT-gene cluster on chromosome 19 in fibroblasts was specific, not involving adjacent genes. Moreover, inhibition of NFκB signaling through panepoxydone treatment significantly decreased the induction of FUT3, FUT5 and FUT6 transcriptional activation, as did siRNA targeting of p65, in herpes simplex virus type 1 infected fibroblasts. NFκB and p65 signaling appears to play an important role in the regulation of FUT3, FUT5 and FUT6 transcriptional activation by herpes simplex virus type 1 although additional, unidentified, viral factors might account for part of the mechanism as direct interferon mediated stimulation of NFκB was not sufficient to induce the fucosyltransferase encoding gene cluster in uninfected cells. © The Author 2017. Published by Oxford University Press. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

Gene cluster analysis for the biosynthesis of elgicins, novel lantibiotics produced by paenibacillus elgii B69

Directory of Open Access Journals (Sweden)

Teng Yi

2012-03-01

Full Text Available Abstract Background The recent increase in bacterial resistance to antibiotics has promoted the exploration of novel antibacterial materials. As a result, many researchers are undertaking work to identify new lantibiotics because of their potent antimicrobial activities. The objective of this study was to provide details of a lantibiotic-like gene cluster in Paenibacillus elgii B69 and to produce the antibacterial substances coded by this gene cluster based on culture screening. Results Analysis of the P. elgii B69 genome sequence revealed the presence of a lantibiotic-like gene cluster composed of five open reading frames (elgT1, elgC, elgT2, elgB, and elgA. Screening of culture extracts for active substances possessing the predicted properties of the encoded product led to the isolation of four novel peptides (elgicins AI, AII, B, and C with a broad inhibitory spectrum. The molecular weights of these peptides were 4536, 4593, 4706, and 4820 Da, respectively. The N-terminal sequence of elgicin B was Leu-Gly-Asp-Tyr, which corresponded to the partial sequence of the peptide ElgA encoded by elgA. Edman degradation suggested that the product elgicin B is derived from ElgA. By correlating the results of electrospray ionization-mass spectrometry analyses of elgicins AI, AII, and C, these peptides are deduced to have originated from the same precursor, ElgA. Conclusions A novel lantibiotic-like gene cluster was shown to be present in P. elgii B69. Four new lantibiotics with a broad inhibitory spectrum were isolated, and these appear to be promising antibacterial agents.

Motif-independent prediction of a secondary metabolism gene cluster using comparative genomics: application to sequenced genomes of Aspergillus and ten other filamentous fungal species.

Science.gov (United States)

Takeda, Itaru; Umemura, Myco; Koike, Hideaki; Asai, Kiyoshi; Machida, Masayuki

2014-08-01

Despite their biological importance, a significant number of genes for secondary metabolite biosynthesis (SMB) remain undetected due largely to the fact that they are highly diverse and are not expressed under a variety of cultivation conditions. Several software tools including SMURF and antiSMASH have been developed to predict fungal SMB gene clusters by finding core genes encoding polyketide synthase, nonribosomal peptide synthetase and dimethylallyltryptophan synthase as well as several others typically present in the cluster. In this work, we have devised a novel comparative genomics method to identify SMB gene clusters that is independent of motif information of the known SMB genes. The method detects SMB gene clusters by searching for a similar order of genes and their presence in nonsyntenic blocks. With this method, we were able to identify many known SMB gene clusters with the core genes in the genomic sequences of 10 filamentous fungi. Furthermore, we have also detected SMB gene clusters without core genes, including the kojic acid biosynthesis gene cluster of Aspergillus oryzae. By varying the detection parameters of the method, a significant difference in the sequence characteristics was detected between the genes residing inside the clusters and those outside the clusters. © The Author 2014. Published by Oxford University Press on behalf of Kazusa DNA Research Institute.

Diverse and Abundant Secondary Metabolism Biosynthetic Gene Clusters in the Genomes of Marine Sponge Derived Streptomyces spp. Isolates

Directory of Open Access Journals (Sweden)

Stephen A. Jackson

2018-02-01

Full Text Available The genus Streptomyces produces secondary metabolic compounds that are rich in biological activity. Many of these compounds are genetically encoded by large secondary metabolism biosynthetic gene clusters (smBGCs such as polyketide synthases (PKS and non-ribosomal peptide synthetases (NRPS which are modular and can be highly repetitive. Due to the repeats, these gene clusters can be difficult to resolve using short read next generation datasets and are often quite poorly predicted using standard approaches. We have sequenced the genomes of 13 Streptomyces spp. strains isolated from shallow water and deep-sea sponges that display antimicrobial activities against a number of clinically relevant bacterial and yeast species. Draft genomes have been assembled and smBGCs have been identified using the antiSMASH (antibiotics and Secondary Metabolite Analysis Shell web platform. We have compared the smBGCs amongst strains in the search for novel sequences conferring the potential to produce novel bioactive secondary metabolites. The strains in this study recruit to four distinct clades within the genus Streptomyces. The marine strains host abundant smBGCs which encode polyketides, NRPS, siderophores, bacteriocins and lantipeptides. The deep-sea strains appear to be enriched with gene clusters encoding NRPS. Marine adaptations are evident in the sponge-derived strains which are enriched for genes involved in the biosynthesis and transport of compatible solutes and for heat-shock proteins. Streptomyces spp. from marine environments are a promising source of novel bioactive secondary metabolites as the abundance and diversity of smBGCs show high degrees of novelty. Sponge derived Streptomyces spp. isolates appear to display genomic adaptations to marine living when compared to terrestrial strains.

Genome-wide comparative analysis of NBS-encoding genes between Brassica species and Arabidopsis thaliana.

Science.gov (United States)

Yu, Jingyin; Tehrim, Sadia; Zhang, Fengqi; Tong, Chaobo; Huang, Junyan; Cheng, Xiaohui; Dong, Caihua; Zhou, Yanqiu; Qin, Rui; Hua, Wei; Liu, Shengyi

2014-01-03

Plant disease resistance (R) genes with the nucleotide binding site (NBS) play an important role in offering resistance to pathogens. The availability of complete genome sequences of Brassica oleracea and Brassica rapa provides an important opportunity for researchers to identify and characterize NBS-encoding R genes in Brassica species and to compare with analogues in Arabidopsis thaliana based on a comparative genomics approach. However, little is known about the evolutionary fate of NBS-encoding genes in the Brassica lineage after split from A. thaliana. Here we present genome-wide analysis of NBS-encoding genes in B. oleracea, B. rapa and A. thaliana. Through the employment of HMM search and manual curation, we identified 157, 206 and 167 NBS-encoding genes in B. oleracea, B. rapa and A. thaliana genomes, respectively. Phylogenetic analysis among 3 species classified NBS-encoding genes into 6 subgroups. Tandem duplication and whole genome triplication (WGT) analyses revealed that after WGT of the Brassica ancestor, NBS-encoding homologous gene pairs on triplicated regions in Brassica ancestor were deleted or lost quickly, but NBS-encoding genes in Brassica species experienced species-specific gene amplification by tandem duplication after divergence of B. rapa and B. oleracea. Expression profiling of NBS-encoding orthologous gene pairs indicated the differential expression pattern of retained orthologous gene copies in B. oleracea and B. rapa. Furthermore, evolutionary analysis of CNL type NBS-encoding orthologous gene pairs among 3 species suggested that orthologous genes in B. rapa species have undergone stronger negative selection than those in B .oleracea species. But for TNL type, there are no significant differences in the orthologous gene pairs between the two species. This study is first identification and characterization of NBS-encoding genes in B. rapa and B. oleracea based on whole genome sequences. Through tandem duplication and whole genome

Cloning of human genes encoding novel G protein-coupled receptors

Energy Technology Data Exchange (ETDEWEB)

Marchese, A.; Docherty, J.M.; Heiber, M. [Univ. of Toronto, (Canada)] [and others

1994-10-01

We report the isolation and characterization of several novel human genes encoding G protein-coupled receptors. Each of the receptors contained the familiar seven transmembrane topography and most closely resembled peptide binding receptors. Gene GPR1 encoded a receptor protein that is intronless in the coding region and that shared identity (43% in the transmembrane regions) with the opioid receptors. Northern blot analysis revealed that GPR1 transcripts were expressed in the human hippocampus, and the gene was localized to chromosome 15q21.6. Gene GPR2 encoded a protein that most closely resembled an interleukin-8 receptor (51% in the transmembrane regions), and this gene, not expressed in the six brain regions examined, was localized to chromosome 17q2.1-q21.3. A third gene, GPR3, showed identity (56% in the transmembrane regions) with a previously characterized cDNA clone from rat and was localized to chromosome 1p35-p36.1. 31 refs., 5 figs., 1 tab.

Heterogeneic dynamics of the structures of multiple gene clusters in two pathogenetically different lines originating from the same phytoplasma.

Science.gov (United States)

Arashida, Ryo; Kakizawa, Shigeyuki; Hoshi, Ayaka; Ishii, Yoshiko; Jung, Hee-Young; Kagiwada, Satoshi; Yamaji, Yasuyuki; Oshima, Kenro; Namba, Shigetou

2008-04-01

Phytoplasmas are phloem-limited plant pathogens that are transmitted by insect vectors and are associated with diseases in hundreds of plant species. Despite their small sizes, phytoplasma genomes have repeat-rich sequences, which are due to several genes that are encoded as multiple copies. These multiple genes exist in a gene cluster, the potential mobile unit (PMU). PMUs are present at several distinct regions in the phytoplasma genome. The multicopy genes encoded by PMUs (herein named mobile unit genes [MUGs]) and similar genes elsewhere in the genome (herein named fundamental genes [FUGs]) are likely to have the same function based on their annotations. In this manuscript we show evidence that MUGs and FUGs do not cluster together within the same clade. Each MUG is in a cluster with a short branch length, suggesting that MUGs are recently diverged paralogs, whereas the origin of FUGs is different from that of MUGs. We also compared the genome structures around the lplA gene in two derivative lines of the 'Candidatus Phytoplasma asteris' OY strain, the severe-symptom line W (OY-W) and the mild-symptom line M (OY-M). The gene organizations of the nucleotide sequences upstream of the lplA genes of OY-W and OY-M were dramatically different. The tra5 insertion sequence, an element of PMUs, was found only in this region in OY-W. These results suggest that transposition of entire PMUs and PMU sections has occurred frequently in the OY phytoplasma genome. The difference in the pathogenicities of OY-W and OY-M might be caused by the duplication and transposition of PMUs, followed by genome rearrangement.

The identification of credit card encoders by hierarchical cluster analysis of the jitters of magnetic stripes.

Science.gov (United States)

Leung, S C; Fung, W K; Wong, K H

1999-01-01

The relative bit density variation graphs of 207 specimen credit cards processed by 12 encoding machines were examined first visually, and then classified by means of hierarchical cluster analysis. Twenty-nine credit cards being treated as 'questioned' samples were tested by way of cluster analysis against 'controls' derived from known encoders. It was found that hierarchical cluster analysis provided a high accuracy of identification with all 29 'questioned' samples classified correctly. On the other hand, although visual comparison of jitter graphs was less discriminating, it was nevertheless capable of giving a reasonably accurate result.

Silencing of the major family of NBS-LRR-encoding genes in lettuce results in the loss of multiple resistance specificities.

Science.gov (United States)

Wroblewski, Tadeusz; Piskurewicz, Urszula; Tomczak, Anna; Ochoa, Oswaldo; Michelmore, Richard W

2007-09-01

The RGC2 gene cluster in lettuce (Lactuca sativa) is one of the largest known families of genes encoding nucleotide binding site-leucine-rich repeat (NBS-LRR) proteins. One of its members, RGC2B, encodes Dm3 which determines resistance to downy mildew caused by the oomycete Bremia lactucae carrying the cognate avirulence gene, Avr3. We developed an efficient strategy for analysis of this large family of low expressed genes using post-transcriptional gene silencing (PTGS). We transformed lettuce cv. Diana (carrying Dm3) using chimeric gene constructs designed to simultaneously silence RGC2B and the GUS reporter gene via the production of interfering hairpin RNA (ihpRNA). Transient assays of GUS expression in leaves accurately predicted silencing of both genes and were subsequently used to assay silencing in transgenic T(1) plants and their offspring. Levels of mRNA were reduced not only for RGC2B but also for all seven diverse RGC2 family members tested. We then used the same strategy to show that the resistance specificity encoded by the genetically defined Dm18 locus in lettuce cv. Mariska is the result of two resistance specificities, only one of which was silenced by ihpRNA derived from RGC2B. Analysis of progeny from crosses between transgenic, silenced tester stocks and lettuce accessions carrying other resistance genes previously mapped to the RGC2 locus indicated that two additional resistance specificities to B. lactucae, Dm14 and Dm16, as well as resistance to lettuce root aphid (Pemphigus bursarius L.), Ra, are encoded by RGC2 family members.

Characterization of the biosynthetic gene cluster for cryptic phthoxazolin A in Streptomyces avermitilis.

Directory of Open Access Journals (Sweden)

Dian Anggraini Suroto

Full Text Available Phthoxazolin A, an oxazole-containing polyketide, has a broad spectrum of anti-oomycete activity and herbicidal activity. We recently identified phthoxazolin A as a cryptic metabolite of Streptomyces avermitilis that produces the important anthelmintic agent avermectin. Even though genome data of S. avermitilis is publicly available, no plausible biosynthetic gene cluster for phthoxazolin A is apparent in the sequence data. Here, we identified and characterized the phthoxazolin A (ptx biosynthetic gene cluster through genome sequencing, comparative genomic analysis, and gene disruption. Sequence analysis uncovered that the putative ptx biosynthetic genes are laid on an extra genomic region that is not found in the public database, and 8 open reading frames in the extra genomic region could be assigned roles in the biosynthesis of the oxazole ring, triene polyketide and carbamoyl moieties. Disruption of the ptxA gene encoding a discrete acyltransferase resulted in a complete loss of phthoxazolin A production, confirming that the trans-AT type I PKS system is responsible for the phthoxazolin A biosynthesis. Based on the predicted functional domains in the ptx assembly line, we propose the biosynthetic pathway of phthoxazolin A.

Genome-wide identification of structural variants in genes encoding drug targets

DEFF Research Database (Denmark)

Rasmussen, Henrik Berg; Dahmcke, Christina Mackeprang

2012-01-01

The objective of the present study was to identify structural variants of drug target-encoding genes on a genome-wide scale. We also aimed at identifying drugs that are potentially amenable for individualization of treatments based on knowledge about structural variation in the genes encoding...

Identification and functional analysis of gene cluster involvement in biosynthesis of the cyclic lipopeptide antibiotic pelgipeptin produced by Paenibacillus elgii

Directory of Open Access Journals (Sweden)

Qian Chao-Dong

2012-09-01

Full Text Available Abstract Background Pelgipeptin, a potent antibacterial and antifungal agent, is a non-ribosomally synthesised lipopeptide antibiotic. This compound consists of a β-hydroxy fatty acid and nine amino acids. To date, there is no information about its biosynthetic pathway. Results A potential pelgipeptin synthetase gene cluster (plp was identified from Paenibacillus elgii B69 through genome analysis. The gene cluster spans 40.8 kb with eight open reading frames. Among the genes in this cluster, three large genes, plpD, plpE, and plpF, were shown to encode non-ribosomal peptide synthetases (NRPSs, with one, seven, and one module(s, respectively. Bioinformatic analysis of the substrate specificity of all nine adenylation domains indicated that the sequence of the NRPS modules is well collinear with the order of amino acids in pelgipeptin. Additional biochemical analysis of four recombinant adenylation domains (PlpD A1, PlpE A1, PlpE A3, and PlpF A1 provided further evidence that the plp gene cluster involved in pelgipeptin biosynthesis. Conclusions In this study, a gene cluster (plp responsible for the biosynthesis of pelgipeptin was identified from the genome sequence of Paenibacillus elgii B69. The identification of the plp gene cluster provides an opportunity to develop novel lipopeptide antibiotics by genetic engineering.

CAR gene cluster and transcript levels of carotenogenic genes in Rhodotorula mucilaginosa.

Science.gov (United States)

Landolfo, Sara; Ianiri, Giuseppe; Camiolo, Salvatore; Porceddu, Andrea; Mulas, Giuliana; Chessa, Rossella; Zara, Giacomo; Mannazzu, Ilaria

2018-01-01

A molecular approach was applied to the study of the carotenoid biosynthetic pathway of Rhodotorula mucilaginosa. At first, functional annotation of the genome of R. mucilaginosa C2.5t1 was carried out and gene ontology categories were assigned to 4033 predicted proteins. Then, a set of genes involved in different steps of carotenogenesis was identified and those coding for phytoene desaturase, phytoene synthase/lycopene cyclase and carotenoid dioxygenase (CAR genes) proved to be clustered within a region of ~10 kb. Quantitative PCR of the genes involved in carotenoid biosynthesis showed that genes coding for 3-hydroxy-3-methylglutharyl-CoA reductase and mevalonate kinase are induced during exponential phase while no clear trend of induction was observed for phytoene synthase/lycopene cyclase and phytoene dehydrogenase encoding genes. Thus, in R. mucilaginosa the induction of genes involved in the early steps of carotenoid biosynthesis is transient and accompanies the onset of carotenoid production, while that of CAR genes does not correlate with the amount of carotenoids produced. The transcript levels of genes coding for carotenoid dioxygenase, superoxide dismutase and catalase A increased during the accumulation of carotenoids, thus suggesting the activation of a mechanism aimed at the protection of cell structures from oxidative stress during carotenoid biosynthesis. The data presented herein, besides being suitable for the elucidation of the mechanisms that underlie carotenoid biosynthesis, will contribute to boosting the biotechnological potential of this yeast by improving the outcome of further research efforts aimed at also exploring other features of interest.

Motif analysis unveils the possible co-regulation of chloroplast genes and nuclear genes encoding chloroplast proteins.

Science.gov (United States)

Wang, Ying; Ding, Jun; Daniell, Henry; Hu, Haiyan; Li, Xiaoman

2012-09-01

Chloroplasts play critical roles in land plant cells. Despite their importance and the availability of at least 200 sequenced chloroplast genomes, the number of known DNA regulatory sequences in chloroplast genomes are limited. In this paper, we designed computational methods to systematically study putative DNA regulatory sequences in intergenic regions near chloroplast genes in seven plant species and in promoter sequences of nuclear genes in Arabidopsis and rice. We found that -35/-10 elements alone cannot explain the transcriptional regulation of chloroplast genes. We also concluded that there are unlikely motifs shared by intergenic sequences of most of chloroplast genes, indicating that these genes are regulated differently. Finally and surprisingly, we found five conserved motifs, each of which occurs in no more than six chloroplast intergenic sequences, are significantly shared by promoters of nuclear-genes encoding chloroplast proteins. By integrating information from gene function annotation, protein subcellular localization analyses, protein-protein interaction data, and gene expression data, we further showed support of the functionality of these conserved motifs. Our study implies the existence of unknown nuclear-encoded transcription factors that regulate both chloroplast genes and nuclear genes encoding chloroplast protein, which sheds light on the understanding of the transcriptional regulation of chloroplast genes.

Mouse Nkrp1-Clr gene cluster sequence and expression analyses reveal conservation of tissue-specific MHC-independent immunosurveillance.

Directory of Open Access Journals (Sweden)

Qiang Zhang

Full Text Available The Nkrp1 (Klrb1-Clr (Clec2 genes encode a receptor-ligand system utilized by NK cells as an MHC-independent immunosurveillance strategy for innate immune responses. The related Ly49 family of MHC-I receptors displays extreme allelic polymorphism and haplotype plasticity. In contrast, previous BAC-mapping and aCGH studies in the mouse suggest the neighboring and related Nkrp1-Clr cluster is evolutionarily stable. To definitively compare the relative evolutionary rate of Nkrp1-Clr vs. Ly49 gene clusters, the Nkrp1-Clr gene clusters from two Ly49 haplotype-disparate inbred mouse strains, BALB/c and 129S6, were sequenced. Both Nkrp1-Clr gene cluster sequences are highly similar to the C57BL/6 reference sequence, displaying the same gene numbers and order, complete pseudogenes, and gene fragments. The Nkrp1-Clr clusters contain a strikingly dissimilar proportion of repetitive elements compared to the Ly49 clusters, suggesting that certain elements may be partly responsible for the highly disparate Ly49 vs. Nkrp1 evolutionary rate. Focused allelic polymorphisms were found within the Nkrp1b/d (Klrb1b, Nkrp1c (Klrb1c, and Clr-c (Clec2f genes, suggestive of possible immune selection. Cell-type specific transcription of Nkrp1-Clr genes in a large panel of tissues/organs was determined. Clr-b (Clec2d and Clr-g (Clec2i showed wide expression, while other Clr genes showed more tissue-specific expression patterns. In situ hybridization revealed specific expression of various members of the Clr family in leukocytes/hematopoietic cells of immune organs, various tissue-restricted epithelial cells (including intestinal, kidney tubular, lung, and corneal progenitor epithelial cells, as well as myocytes. In summary, the Nkrp1-Clr gene cluster appears to evolve more slowly relative to the related Ly49 cluster, and likely regulates innate immunosurveillance in a tissue-specific manner.

A remarkably stable TipE gene cluster: evolution of insect Para sodium channel auxiliary subunits

Directory of Open Access Journals (Sweden)

Li Jia

2011-11-01

Full Text Available Abstract Background First identified in fruit flies with temperature-sensitive paralysis phenotypes, the Drosophila melanogaster TipE locus encodes four voltage-gated sodium (NaV channel auxiliary subunits. This cluster of TipE-like genes on chromosome 3L, and a fifth family member on chromosome 3R, are important for the optional expression and functionality of the Para NaV channel but appear quite distinct from auxiliary subunits in vertebrates. Here, we exploited available arthropod genomic resources to trace the origin of TipE-like genes by mapping their evolutionary histories and examining their genomic architectures. Results We identified a remarkably conserved synteny block of TipE-like orthologues with well-maintained local gene arrangements from 21 insect species. Homologues in the water flea, Daphnia pulex, suggest an ancestral pancrustacean repertoire of four TipE-like genes; a subsequent gene duplication may have generated functional redundancy allowing gene losses in the silk moth and mosquitoes. Intronic nesting of the insect TipE gene cluster probably occurred following the divergence from crustaceans, but in the flour beetle and silk moth genomes the clusters apparently escaped from nesting. Across Pancrustacea, TipE gene family members have experienced intronic nesting, escape from nesting, retrotransposition, translocation, and gene loss events while generally maintaining their local gene neighbourhoods. D. melanogaster TipE-like genes exhibit coordinated spatial and temporal regulation of expression distinct from their host gene but well-correlated with their regulatory target, the Para NaV channel, suggesting that functional constraints may preserve the TipE gene cluster. We identified homology between TipE-like NaV channel regulators and vertebrate Slo-beta auxiliary subunits of big-conductance calcium-activated potassium (BKCa channels, which suggests that ion channel regulatory partners have evolved distinct lineage

Bioinformatics analysis and detection of gelatinase encoded gene in Lysinibacillussphaericus

Science.gov (United States)

Repin, Rul Aisyah Mat; Mutalib, Sahilah Abdul; Shahimi, Safiyyah; Khalid, Rozida Mohd.; Ayob, Mohd. Khan; Bakar, Mohd. Faizal Abu; Isa, Mohd Noor Mat

2016-11-01

In this study, we performed bioinformatics analysis toward genome sequence of Lysinibacillussphaericus (L. sphaericus) to determine gene encoded for gelatinase. L. sphaericus was isolated from soil and gelatinase species-specific bacterium to porcine and bovine gelatin. This bacterium offers the possibility of enzymes production which is specific to both species of meat, respectively. The main focus of this research is to identify the gelatinase encoded gene within the bacteria of L. Sphaericus using bioinformatics analysis of partially sequence genome. From the research study, three candidate gene were identified which was, gelatinase candidate gene 1 (P1), NODE_71_length_93919_cov_158.931839_21 which containing 1563 base pair (bp) in size with 520 amino acids sequence; Secondly, gelatinase candidate gene 2 (P2), NODE_23_length_52851_cov_190.061386_17 which containing 1776 bp in size with 591 amino acids sequence; and Thirdly, gelatinase candidate gene 3 (P3), NODE_106_length_32943_cov_169.147919_8 containing 1701 bp in size with 566 amino acids sequence. Three pairs of oligonucleotide primers were designed and namely as, F1, R1, F2, R2, F3 and R3 were targeted short sequences of cDNA by PCR. The amplicons were reliably results in 1563 bp in size for candidate gene P1 and 1701 bp in size for candidate gene P3. Therefore, the results of bioinformatics analysis of L. Sphaericus resulting in gene encoded gelatinase were identified.

Co-evolution of secondary metabolite gene clusters and their host

DEFF Research Database (Denmark)

Kjærbølling, Inge; Vesth, Tammi Camilla; Frisvad, Jens Christian

Secondary metabolite gene cluster evolution is mainly driven by two events: gene duplication and annexation and horizontal gene transfer. Here we use comparative genomics of Aspergillus species to investigate the evolution of secondary metabolite (SM) gene clusters across a wide spectrum of speci....... We investigate the dynamic evolutionary relationship between the cluster and the host by examining the genes within the cluster and the number of homologous genes found within the host and in closely related species.......Secondary metabolite gene cluster evolution is mainly driven by two events: gene duplication and annexation and horizontal gene transfer. Here we use comparative genomics of Aspergillus species to investigate the evolution of secondary metabolite (SM) gene clusters across a wide spectrum of species...

Bacillus sp.CDB3 isolated from cattle dip-sites possesses two ars gene clusters

Institute of Scientific and Technical Information of China (English)

Somanath Bhat; Xi Luo; Zhiqiang Xu; Lixia Liu; Ren Zhang

2011-01-01

Contamination of soil and water by arsenic is a global problem.In Australia, the dipping of cattle in arsenic-containing solution to control cattle ticks in last centenary has left many sites heavily contaminated with arsenic and other toxicants.We had previously isolated five soil bacterial strains (CDB1-5) highly resistant to arsenic.To understand the resistance mechanism, molecular studies have been carried out.Two chromosome-encoded arsenic resistance (ars) gene clusters have been cloned from CDB3 (Bacillus sp.).They both function in Escherichia coli and cluster 1 exerts a much higher resistance to the toxic metalloid.Cluster 2 is smaller possessing four open reading frames (ORFs) arsRorf2BC, similar to that identified in Bacillus subtilis Skin element.Among the eight ORFs in cluster 1 five are analogs of common ars genes found in other bacteria, however, organized in a unique order arsRBCDA instead of arsRDABC.Three other putative genes are located directly downstream and designated as arsTIP based on the homologies of their theoretical translation sequences respectively to thioredoxin reductases, iron-sulphur cluster proteins and protein phosphatases.The latter two are novel of any known ars operons.The arsD gene from Bacillus species was cloned for the first time and the predict protein differs from the well studied E.coli ArsD by lacking two pairs of C-terrninal cysteine residues.Its functional involvement in arsenic resistance has been confirmed by a deletion experiment.There exists also an inverted repeat in the intergenic region between arsC and arsD implying some unknown transcription regulation.

Origin and distribution of epipolythiodioxopiperazine (ETP gene clusters in filamentous ascomycetes

Directory of Open Access Journals (Sweden)

Gardiner Donald M

2007-09-01

Full Text Available Abstract Background Genes responsible for biosynthesis of fungal secondary metabolites are usually tightly clustered in the genome and co-regulated with metabolite production. Epipolythiodioxopiperazines (ETPs are a class of secondary metabolite toxins produced by disparate ascomycete fungi and implicated in several animal and plant diseases. Gene clusters responsible for their production have previously been defined in only two fungi. Fungal genome sequence data have been surveyed for the presence of putative ETP clusters and cluster data have been generated from several fungal taxa where genome sequences are not available. Phylogenetic analysis of cluster genes has been used to investigate the assembly and heredity of these gene clusters. Results Putative ETP gene clusters are present in 14 ascomycete taxa, but absent in numerous other ascomycetes examined. These clusters are discontinuously distributed in ascomycete lineages. Gene content is not absolutely fixed, however, common genes are identified and phylogenies of six of these are separately inferred. In each phylogeny almost all cluster genes form monophyletic clades with non-cluster fungal paralogues being the nearest outgroups. This relatedness of cluster genes suggests that a progenitor ETP gene cluster assembled within an ancestral taxon. Within each of the cluster clades, the cluster genes group together in consistent subclades, however, these relationships do not always reflect the phylogeny of ascomycetes. Micro-synteny of several of the genes within the clusters provides further support for these subclades. Conclusion ETP gene clusters appear to have a single origin and have been inherited relatively intact rather than assembling independently in the different ascomycete lineages. This progenitor cluster has given rise to a small number of distinct phylogenetic classes of clusters that are represented in a discontinuous pattern throughout ascomycetes. The disjunct heredity of

Transcriptome Analysis Revealed Highly Expressed Genes Encoding Secondary Metabolite Pathways and Small Cysteine-Rich Proteins in the Sclerotium of Lignosus rhinocerotis.

Directory of Open Access Journals (Sweden)

Hui-Yeng Y Yap

Full Text Available Lignosus rhinocerotis (Cooke Ryvarden (tiger milk mushroom has long been known for its nutritional and medicinal benefits among the local communities in Southeast Asia. However, the molecular and genetic basis of its medicinal and nutraceutical properties at transcriptional level have not been investigated. In this study, the transcriptome of L. rhinocerotis sclerotium, the part with medicinal value, was analyzed using high-throughput Illumina HiSeqTM platform with good sequencing quality and alignment results. A total of 3,673, 117, and 59,649 events of alternative splicing, novel transcripts, and SNP variation were found to enrich its current genome database. A large number of transcripts were expressed and involved in the processing of gene information and carbohydrate metabolism. A few highly expressed genes encoding the cysteine-rich cerato-platanin, hydrophobins, and sugar-binding lectins were identified and their possible roles in L. rhinocerotis were discussed. Genes encoding enzymes involved in the biosynthesis of glucans, six gene clusters encoding four terpene synthases and one each of non-ribosomal peptide synthetase and polyketide synthase, and 109 transcribed cytochrome P450 sequences were also identified in the transcriptome. The data from this study forms a valuable foundation for future research in the exploitation of this mushroom in pharmacological and industrial applications.

IMG-ABC: new features for bacterial secondary metabolism analysis and targeted biosynthetic gene cluster discovery in thousands of microbial genomes.

Science.gov (United States)

Hadjithomas, Michalis; Chen, I-Min A; Chu, Ken; Huang, Jinghua; Ratner, Anna; Palaniappan, Krishna; Andersen, Evan; Markowitz, Victor; Kyrpides, Nikos C; Ivanova, Natalia N

2017-01-04

Secondary metabolites produced by microbes have diverse biological functions, which makes them a great potential source of biotechnologically relevant compounds with antimicrobial, anti-cancer and other activities. The proteins needed to synthesize these natural products are often encoded by clusters of co-located genes called biosynthetic gene clusters (BCs). In order to advance the exploration of microbial secondary metabolism, we developed the largest publically available database of experimentally verified and predicted BCs, the Integrated Microbial Genomes Atlas of Biosynthetic gene Clusters (IMG-ABC) (https://img.jgi.doe.gov/abc/). Here, we describe an update of IMG-ABC, which includes ClusterScout, a tool for targeted identification of custom biosynthetic gene clusters across 40 000 isolate microbial genomes, and a new search capability to query more than 700 000 BCs from isolate genomes for clusters with similar Pfam composition. Additional features enable fast exploration and analysis of BCs through two new interactive visualization features, a BC function heatmap and a BC similarity network graph. These new tools and features add to the value of IMG-ABC's vast body of BC data, facilitating their in-depth analysis and accelerating secondary metabolite discovery. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

In silico analysis highlights the frequency and diversity of type 1 lantibiotic gene clusters in genome sequenced bacteria

LENUS (Irish Health Repository)

Marsh, Alan J

2010-11-30

Abstract Background Lantibiotics are lanthionine-containing, post-translationally modified antimicrobial peptides. These peptides have significant, but largely untapped, potential as preservatives and chemotherapeutic agents. Type 1 lantibiotics are those in which lanthionine residues are introduced into the structural peptide (LanA) through the activity of separate lanthionine dehydratase (LanB) and lanthionine synthetase (LanC) enzymes. Here we take advantage of the conserved nature of LanC enzymes to devise an in silico approach to identify potential lantibiotic-encoding gene clusters in genome sequenced bacteria. Results In total 49 novel type 1 lantibiotic clusters were identified which unexpectedly were associated with species, genera and even phyla of bacteria which have not previously been associated with lantibiotic production. Conclusions Multiple type 1 lantibiotic gene clusters were identified at a frequency that suggests that these antimicrobials are much more widespread than previously thought. These clusters represent a rich repository which can yield a large number of valuable novel antimicrobials and biosynthetic enzymes.

[High gene conversion frequency between genes encoding 2-deoxyglucose-6-phosphate phosphatase in 3 Saccharomyces species].

Science.gov (United States)

Piscopo, Sara-Pier; Drouin, Guy

2014-05-01

Gene conversions are nonreciprocal sequence exchanges between genes. They are relatively common in Saccharomyces cerevisiae, but few studies have investigated the evolutionary fate of gene conversions or their functional impacts. Here, we analyze the evolution and impact of gene conversions between the two genes encoding 2-deoxyglucose-6-phosphate phosphatase in S. cerevisiae, Saccharomyces paradoxus and Saccharomyces mikatae. Our results demonstrate that the last half of these genes are subject to gene conversions among these three species. The greater similarity and the greater percentage of GC nucleotides in the converted regions, as well as the absence of long regions of adjacent common converted sites, suggest that these gene conversions are frequent and occur independently in all three species. The high frequency of these conversions probably result from the fact that they have little impact on the protein sequences encoded by these genes.

antiSMASH 4.0-improvements in chemistry prediction and gene cluster boundary identification

DEFF Research Database (Denmark)

Blin, Kai; Wolf, Thomas; Chevrette, Marc G.

2017-01-01

Many antibiotics, chemotherapeutics, crop protection agents and food preservatives originate from molecules produced by bacteria, fungi or plants. In recent years, genome mining methodologies have been widely adopted to identify and characterize the biosynthetic gene clusters encoding...... the production of such compounds. Since 2011, the 'antibiotics and secondary metabolite analysis shell-antiSMASH' has assisted researchers in efficiently performing this, both as a web server and a standalone tool. Here, we present the thoroughly updated antiSMASH version 4, which adds several novel features...

RNAi-based silencing of genes encoding the vacuolar- ATPase ...

African Journals Online (AJOL)

RNAi-based silencing of genes encoding the vacuolar- ATPase subunits a and c in pink bollworm (Pectinophora gossypiella). Ahmed M. A. Mohammed. Abstract. RNA interference is a post- transcriptional gene regulation mechanism that is predominantly found in eukaryotic organisms. RNAi demonstrated a successful ...

Human major histocompatibility complex contains a minimum of 19 genes between the complement cluster and HLA-B

International Nuclear Information System (INIS)

Spies, T.; Bresnahan, M.; Strominger, J.L.

1989-01-01

A 600-kilobase (kb) DNA segment from the human major histocompatibility complex (MHC) class III region was isolated by extension of a previous 435-kb chromosome walk. The contiguous series of cloned overlapping cosmids contains the entire 555-kb interval between C2 in the complement gene cluster and HLA-B. This region is known to encode the tumor necrosis factors (TNFs) α and β, B144, and the major heat shock protein HSP70. Moreover, a cluster of genes, BAT1-BAT5 (HLA-B-associated transcripts) have been localized in the vicinity of the genes for TNFα and TNFβ. An additional four genes were identified by isolation of corresponding cDNA clones with cosmid DNA probes. These genes for BAT6-BAT9 were mapped near the gene for C2 within a 120-kb region that includes a HSP70 gene pair. These results, together with complementary data from a similar recent study, indicated the presence of a minimum of 19 genes within the C2-HLA-B interval of the MHC class III region. Although the functional properties of most of these genes are yet unknown, they may be involved in some aspects of immunity. This idea is supported by the genetic mapping of the hematopoietic histocompatibility locus-1 (Hh-1) in recombinant mice between TNFα and H-2S, which is homologous to the complement gene cluster in humans

Genetic variants in nuclear-encoded mitochondrial genes influence AIDS progression.

Directory of Open Access Journals (Sweden)

Sher L Hendrickson

2010-09-01

Full Text Available The human mitochondrial genome includes only 13 coding genes while nuclear-encoded genes account for 99% of proteins responsible for mitochondrial morphology, redox regulation, and energetics. Mitochondrial pathogenesis occurs in HIV patients and genetically, mitochondrial DNA haplogroups with presumed functional differences have been associated with differential AIDS progression.Here we explore whether single nucleotide polymorphisms (SNPs within 904 of the estimated 1,500 genes that specify nuclear-encoded mitochondrial proteins (NEMPs influence AIDS progression among HIV-1 infected patients. We examined NEMPs for association with the rate of AIDS progression using genotypes generated by an Affymetrix 6.0 genotyping array of 1,455 European American patients from five US AIDS cohorts. Successfully genotyped SNPs gave 50% or better haplotype coverage for 679 of known NEMP genes. With a Bonferroni adjustment for the number of genes and tests examined, multiple SNPs within two NEMP genes showed significant association with AIDS progression: acyl-CoA synthetase medium-chain family member 4 (ACSM4 on chromosome 12 and peroxisomal D3,D2-enoyl-CoA isomerase (PECI on chromosome 6.Our previous studies on mitochondrial DNA showed that European haplogroups with presumed functional differences were associated with AIDS progression and HAART mediated adverse events. The modest influences of nuclear-encoded mitochondrial genes found in the current study add support to the idea that mitochondrial function plays a role in AIDS pathogenesis.

Molecular evolution of the Paramyxoviridae and Rhabdoviridae multiple-protein-encoding P gene.

Science.gov (United States)

Jordan, I K; Sutter, B A; McClure, M A

2000-01-01

Presented here is an analysis of the molecular evolutionary dynamics of the P gene among 76 representative sequences of the Paramyxoviridae and Rhabdoviridae RNA virus families. In a number of Paramyxoviridae taxa, as well as in vesicular stomatitis viruses of the Rhabdoviridae, the P gene encodes multiple proteins from a single genomic RNA sequence. These products include the phosphoprotein (P), as well as the C and V proteins. The complexity of the P gene makes it an intriguing locus to study from an evolutionary perspective. Amino acid sequence alignments of the proteins encoded at the P and N loci were used in independent phylogenetic reconstructions of the Paramyxoviridae and Rhabdoviridae families. P-gene-coding capacities were mapped onto the Paramyxoviridae phylogeny, and the most parsimonious path of multiple-coding-capacity evolution was determined. Levels of amino acid variation for Paramyxoviridae and Rhabdoviridae P-gene-encoded products were also analyzed. Proteins encoded in overlapping reading frames from the same nucleotides have different levels of amino acid variation. The nucleotide architecture that underlies the amino acid variation was determined in order to evaluate the role of selection in the evolution of the P gene overlapping reading frames. In every case, the evolution of one of the proteins encoded in the overlapping reading frames has been constrained by negative selection while the other has evolved more rapidly. The integrity of the overlapping reading frame that represents a derived state is generally maintained at the expense of the ancestral reading frame encoded by the same nucleotides. The evolution of such multicoding sequences is likely a response by RNA viruses to selective pressure to maximize genomic information content while maintaining small genome size. The ability to evolve such a complex genomic strategy is intimately related to the dynamics of the viral quasispecies, which allow enhanced exploration of the adaptive

Semi-supervised consensus clustering for gene expression data analysis

OpenAIRE

Wang, Yunli; Pan, Youlian

2014-01-01

Background Simple clustering methods such as hierarchical clustering and k-means are widely used for gene expression data analysis; but they are unable to deal with noise and high dimensionality associated with the microarray gene expression data. Consensus clustering appears to improve the robustness and quality of clustering results. Incorporating prior knowledge in clustering process (semi-supervised clustering) has been shown to improve the consistency between the data partitioning and do...

Fast gene ontology based clustering for microarray experiments.

Science.gov (United States)

Ovaska, Kristian; Laakso, Marko; Hautaniemi, Sampsa

2008-11-21

Analysis of a microarray experiment often results in a list of hundreds of disease-associated genes. In order to suggest common biological processes and functions for these genes, Gene Ontology annotations with statistical testing are widely used. However, these analyses can produce a very large number of significantly altered biological processes. Thus, it is often challenging to interpret GO results and identify novel testable biological hypotheses. We present fast software for advanced gene annotation using semantic similarity for Gene Ontology terms combined with clustering and heat map visualisation. The methodology allows rapid identification of genes sharing the same Gene Ontology cluster. Our R based semantic similarity open-source package has a speed advantage of over 2000-fold compared to existing implementations. From the resulting hierarchical clustering dendrogram genes sharing a GO term can be identified, and their differences in the gene expression patterns can be seen from the heat map. These methods facilitate advanced annotation of genes resulting from data analysis.

Two Genes Encoding Uracil Phosphoribosyltransferase Are Present in Bacillus subtilis

DEFF Research Database (Denmark)

Martinussen, Jan; Glaser, Philippe; Andersen, Paal S.

1995-01-01

Uracil phosphoribosyltransferase (UPRTase) catalyzes the key reaction in the salvage of uracil in many microorganisms. Surprisingly, two genes encoding UPRTase activity were cloned from Bacillus subtilis by complementation of an Escherichia coli mutant. The genes were sequenced, and the putative...

Escherichia coli rpiA gene encoding ribose phosphate isomerase A

DEFF Research Database (Denmark)

Hove-Jensen, Bjarne; Maigaard, Marianne

1993-01-01

The rpiA gene encoding ribose phosphate isomerase A was cloned from phage 1A2(471) of the Kohara gene library. Subcloning, restriction, and complementation analyses revealed an 1,800-bp SspI-generated DNA fragment that contained the entire control and coding sequences. This DNA fragment was seque......The rpiA gene encoding ribose phosphate isomerase A was cloned from phage 1A2(471) of the Kohara gene library. Subcloning, restriction, and complementation analyses revealed an 1,800-bp SspI-generated DNA fragment that contained the entire control and coding sequences. This DNA fragment...

The KL24 gene cluster and a genomic island encoding a Wzy polymerase contribute genes needed for synthesis of the K24 capsular polysaccharide by the multiply antibiotic resistant Acinetobacter baumannii isolate RCH51.

Science.gov (United States)

Kenyon, Johanna J; Kasimova, Anastasiya A; Shneider, Mikhail M; Shashkov, Alexander S; Arbatsky, Nikolay P; Popova, Anastasiya V; Miroshnikov, Konstantin A; Hall, Ruth M; Knirel, Yuriy A

2017-03-01

The whole-genome sequence of the multiply antibiotic resistant Acinetobacter baumannii isolate RCH51 belonging to sequence type ST103 (Institut Pasteur scheme) revealed that the set of genes at the capsule locus, KL24, includes four genes predicted to direct the synthesis of 3-acetamido-3,6-dideoxy-d-galactose (d-Fuc3NAc), and this sugar was found in the capsular polysaccharide (CPS). One of these genes, fdtE, encodes a novel bifunctional protein with an N-terminal FdtA 3,4-ketoisomerase domain and a C-terminal acetyltransferase domain. KL24 lacks a gene encoding a Wzy polymerase to link the oligosaccharide K units to form the CPS found associated with isolate RCH51, and a wzy gene was found in a small genomic island (GI) near the cpn60 gene. This GI is in precisely the same location as another GI carrying wzy and atr genes recently found in several A. baumannii isolates, but it does not otherwise resemble it. The CPS isolated from RCH51, studied by sugar analysis and 1D and 2D 1H and 13C NMR spectroscopy, revealed that the K unit has a branched pentasaccharide structure made up of Gal, GalNAc and GlcNAc residues with d-Fuc3NAc as a side branch, and the K units are linked via a β-d-GlcpNAc-(1→3)-β-d-Galp linkage formed by the Wzy encoded by the GI. The functions of the glycosyltransferases encoded by KL24 were assigned to formation of specific bonds. A correspondence between the order of the genes in KL24 and other KL and the order of the linkages they form was noted, and this may be useful in future predictions of glycosyltransferase specificities.

Effects of deoxycycline induced lentivirus encoding FasL gene on ...

African Journals Online (AJOL)

Abstract. Fas/Fas ligand (FasL)-mediated apoptosis plays a critical role in deletion of activated T cells. This study aimed to construct the lentivirus encoding FasL gene induced by deoxycycline and evaluate its effects on apoptosis of Th1 cells. A plasmid expression system encoding FasL was constructed through utilizing the ...

Output ordering and prioritisation system (OOPS): ranking biosynthetic gene clusters to enhance bioactive metabolite discovery.

Science.gov (United States)

Peña, Alejandro; Del Carratore, Francesco; Cummings, Matthew; Takano, Eriko; Breitling, Rainer

2017-12-18

The rapid increase of publicly available microbial genome sequences has highlighted the presence of hundreds of thousands of biosynthetic gene clusters (BGCs) encoding valuable secondary metabolites. The experimental characterization of new BGCs is extremely laborious and struggles to keep pace with the in silico identification of potential BGCs. Therefore, the prioritisation of promising candidates among computationally predicted BGCs represents a pressing need. Here, we propose an output ordering and prioritisation system (OOPS) which helps sorting identified BGCs by a wide variety of custom-weighted biological and biochemical criteria in a flexible and user-friendly interface. OOPS facilitates a judicious prioritisation of BGCs using G+C content, coding sequence length, gene number, cluster self-similarity and codon bias parameters, as well as enabling the user to rank BGCs based upon BGC type, novelty, and taxonomic distribution. Effective prioritisation of BGCs will help to reduce experimental attrition rates and improve the breadth of bioactive metabolites characterized.

Mapping in an apple (Malus x domestica) F1 segregating population based on physical clustering of differentially expressed genes.

Science.gov (United States)

Jensen, Philip J; Fazio, Gennaro; Altman, Naomi; Praul, Craig; McNellis, Timothy W

2014-04-04

Apple tree breeding is slow and difficult due to long generation times, self-incompatibility, and complex genetics. The identification of molecular markers linked to traits of interest is a way to expedite the breeding process. In the present study, we aimed to identify genes whose steady-state transcript abundance was associated with inheritance of specific traits segregating in an apple (Malus × domestica) rootstock F1 breeding population, including resistance to powdery mildew (Podosphaera leucotricha) disease and woolly apple aphid (Eriosoma lanigerum). Transcription profiling was performed for 48 individual F1 apple trees from a cross of two highly heterozygous parents, using RNA isolated from healthy, actively-growing shoot tips and a custom apple DNA oligonucleotide microarray representing 26,000 unique transcripts. Genome-wide expression profiles were not clear indicators of powdery mildew or woolly apple aphid resistance phenotype. However, standard differential gene expression analysis between phenotypic groups of trees revealed relatively small sets of genes with trait-associated expression levels. For example, thirty genes were identified that were differentially expressed between trees resistant and susceptible to powdery mildew. Interestingly, the genes encoding twenty-four of these transcripts were physically clustered on chromosome 12. Similarly, seven genes were identified that were differentially expressed between trees resistant and susceptible to woolly apple aphid, and the genes encoding five of these transcripts were also clustered, this time on chromosome 17. In each case, the gene clusters were in the vicinity of previously identified major quantitative trait loci for the corresponding trait. Similar results were obtained for a series of molecular traits. Several of the differentially expressed genes were used to develop DNA polymorphism markers linked to powdery mildew disease and woolly apple aphid resistance. Gene expression profiling

Genome-scale analysis of positional clustering of mouse testis-specific genes

Directory of Open Access Journals (Sweden)

Lee Bernett TK

2005-01-01

Full Text Available Abstract Background Genes are not randomly distributed on a chromosome as they were thought even after removal of tandem repeats. The positional clustering of co-expressed genes is known in prokaryotes and recently reported in several eukaryotic organisms such as Caenorhabditis elegans, Drosophila melanogaster, and Homo sapiens. In order to further investigate the mode of tissue-specific gene clustering in higher eukaryotes, we have performed a genome-scale analysis of positional clustering of the mouse testis-specific genes. Results Our computational analysis shows that a large proportion of testis-specific genes are clustered in groups of 2 to 5 genes in the mouse genome. The number of clusters is much higher than expected by chance even after removal of tandem repeats. Conclusion Our result suggests that testis-specific genes tend to cluster on the mouse chromosomes. This provides another piece of evidence for the hypothesis that clusters of tissue-specific genes do exist.

Fast Gene Ontology based clustering for microarray experiments

Directory of Open Access Journals (Sweden)

Ovaska Kristian

2008-11-01

Full Text Available Abstract Background Analysis of a microarray experiment often results in a list of hundreds of disease-associated genes. In order to suggest common biological processes and functions for these genes, Gene Ontology annotations with statistical testing are widely used. However, these analyses can produce a very large number of significantly altered biological processes. Thus, it is often challenging to interpret GO results and identify novel testable biological hypotheses. Results We present fast software for advanced gene annotation using semantic similarity for Gene Ontology terms combined with clustering and heat map visualisation. The methodology allows rapid identification of genes sharing the same Gene Ontology cluster. Conclusion Our R based semantic similarity open-source package has a speed advantage of over 2000-fold compared to existing implementations. From the resulting hierarchical clustering dendrogram genes sharing a GO term can be identified, and their differences in the gene expression patterns can be seen from the heat map. These methods facilitate advanced annotation of genes resulting from data analysis.

Characterization of Urtica dioica agglutinin isolectins and the encoding gene family.

Science.gov (United States)

Does, M P; Ng, D K; Dekker, H L; Peumans, W J; Houterman, P M; Van Damme, E J; Cornelissen, B J

1999-01-01

Urtica dioica agglutinin (UDA) has previously been found in roots and rhizomes of stinging nettles as a mixture of UDA-isolectins. Protein and cDNA sequencing have shown that mature UDA is composed of two hevein domains and is processed from a precursor protein. The precursor contains a signal peptide, two in-tandem hevein domains, a hinge region and a carboxyl-terminal chitinase domain. Genomic fragments encoding precursors for UDA-isolectins have been amplified by five independent polymerase chain reactions on genomic DNA from stinging nettle ecotype Weerselo. One amplified gene was completely sequenced. As compared to the published cDNA sequence, the genomic sequence contains, besides two basepair substitutions, two introns located at the same positions as in other plant chitinases. By partial sequence analysis of 40 amplified genes, 16 different genes were identified which encode seven putative UDA-isolectins. The deduced amino acid sequences share 78.9-98.9% identity. In extracts of roots and rhizomes of stinging nettle ecotype Weerselo six out of these seven isolectins were detected by mass spectrometry. One of them is an acidic form, which has not been identified before. Our results demonstrate that UDA is encoded by a large gene family.

Gene duplication, modularity and adaptation in the evolution of the aflatoxin gene cluster

Directory of Open Access Journals (Sweden)

Jakobek Judy L

2007-07-01

Full Text Available Abstract Background The biosynthesis of aflatoxin (AF involves over 20 enzymatic reactions in a complex polyketide pathway that converts acetate and malonate to the intermediates sterigmatocystin (ST and O-methylsterigmatocystin (OMST, the respective penultimate and ultimate precursors of AF. Although these precursors are chemically and structurally very similar, their accumulation differs at the species level for Aspergilli. Notable examples are A. nidulans that synthesizes only ST, A. flavus that makes predominantly AF, and A. parasiticus that generally produces either AF or OMST. Whether these differences are important in the evolutionary/ecological processes of species adaptation and diversification is unknown. Equally unknown are the specific genomic mechanisms responsible for ordering and clustering of genes in the AF pathway of Aspergillus. Results To elucidate the mechanisms that have driven formation of these clusters, we performed systematic searches of aflatoxin cluster homologs across five Aspergillus genomes. We found a high level of gene duplication and identified seven modules consisting of highly correlated gene pairs (aflA/aflB, aflR/aflS, aflX/aflY, aflF/aflE, aflT/aflQ, aflC/aflW, and aflG/aflL. With the exception of A. nomius, contrasts of mean Ka/Ks values across all cluster genes showed significant differences in selective pressure between section Flavi and non-section Flavi species. A. nomius mean Ka/Ks values were more similar to partial clusters in A. fumigatus and A. terreus. Overall, mean Ka/Ks values were significantly higher for section Flavi than for non-section Flavi species. Conclusion Our results implicate several genomic mechanisms in the evolution of ST, OMST and AF cluster genes. Gene modules may arise from duplications of a single gene, whereby the function of the pre-duplication gene is retained in the copy (aflF/aflE or the copies may partition the ancestral function (aflA/aflB. In some gene modules, the

Escherichia coli yjjPB genes encode a succinate transporter important for succinate production.

Science.gov (United States)

Fukui, Keita; Nanatani, Kei; Hara, Yoshihiko; Yamakami, Suguru; Yahagi, Daiki; Chinen, Akito; Tokura, Mitsunori; Abe, Keietsu

2017-09-01

Under anaerobic conditions, Escherichia coli produces succinate from glucose via the reductive tricarboxylic acid cycle. To date, however, no genes encoding succinate exporters have been established in E. coli. Therefore, we attempted to identify genes encoding succinate exporters by screening an E. coli MG1655 genome library. We identified the yjjPB genes as candidates encoding a succinate transporter, which enhanced succinate production in Pantoea ananatis under aerobic conditions. A complementation assay conducted in Corynebacterium glutamicum strain AJ110655ΔsucE1 demonstrated that both YjjP and YjjB are required for the restoration of succinate production. Furthermore, deletion of yjjPB decreased succinate production in E. coli by 70% under anaerobic conditions. Taken together, these results suggest that YjjPB constitutes a succinate transporter in E. coli and that the products of both genes are required for succinate export.

Cloning, expression and characterisation of a novel gene encoding ...

African Journals Online (AJOL)

微软用户

2012-01-12

Jan 12, 2012 ... ... characterisation of a novel gene encoding a chemosensory protein from Bemisia ... The genomic DNA sequence comparisons revealed a 1490 bp intron ... have several conserved sequence motifs, including the. N-terminal ...

Characterization of the human laminin beta2 chain locus (LAMB2): linkage to a gene containing a nonprocessed, transcribed LAMB2-like pseudogene (LAMB2L) and to the gene encoding glutaminyl tRNA synthetase (QARS)

DEFF Research Database (Denmark)

Durkin, M E; Jäger, A C; Khurana, T S

1999-01-01

The laminin beta2 chain is an important constituent of certain kidney and muscle basement membranes. We have generated a detailed physical map of a 110-kb genomic DNA segment surrounding the human laminin beta2 chain gene (LAMB2) on chromosome 3p21.3-->p21.2, a region paralogous with the chromosome...... 7q22-->q31 region that contains the laminin beta1 chain gene locus (LAMB1). Several CpG islands and a novel polymorphic microsatellite marker (D3S4594) were identified. The 3' end of LAMB2 lies 16 kb from the 5' end of the glutaminyl tRNA synthetase gene (QARS). About 20 kb upstream of LAMB2 we...... found a gene encoding a transcribed, non-processed LAMB2-like pseudogene (LAMB2L). The sequence of 1.75 kb of genomic DNA at the 3' end of LAMB2L was similar to exons 8-12 of the laminin beta2 chain gene. The LAMB2L-LAMB2-QARS cluster lies telomeric to the gene encoding the laminin-binding protein...

The 380 kb pCMU01 plasmid encodes chloromethane utilization genes and redundant genes for vitamin B12- and tetrahydrofolate-dependent chloromethane metabolism in Methylobacterium extorquens CM4: a proteomic and bioinformatics study.

Directory of Open Access Journals (Sweden)

Sandro Roselli

Full Text Available Chloromethane (CH3Cl is the most abundant volatile halocarbon in the atmosphere and contributes to the destruction of stratospheric ozone. The only known pathway for bacterial chloromethane utilization (cmu was characterized in Methylobacterium extorquens CM4, a methylotrophic bacterium able to utilize compounds without carbon-carbon bonds such as methanol and chloromethane as the sole carbon source for growth. Previous work demonstrated that tetrahydrofolate and vitamin B12 are essential cofactors of cmuA- and cmuB-encoded methyltransferases of chloromethane dehalogenase, and that the pathway for chloromethane utilization is distinct from that for methanol. This work reports genomic and proteomic data demonstrating that cognate cmu genes are located on the 380 kb pCMU01 plasmid, which drives the previously defined pathway for tetrahydrofolate-mediated chloromethane dehalogenation. Comparison of complete genome sequences of strain CM4 and that of four other M. extorquens strains unable to grow with chloromethane showed that plasmid pCMU01 harbors unique genes without homologs in the compared genomes (bluB2, btuB, cobA, cbiD, as well as 13 duplicated genes with homologs of chromosome-borne genes involved in vitamin B12-associated biosynthesis and transport, or in tetrahydrofolate-dependent metabolism (folC2. In addition, the presence of both chromosomal and plasmid-borne genes for corrinoid salvaging pathways may ensure corrinoid coenzyme supply in challenging environments. Proteomes of M. extorquens CM4 grown with one-carbon substrates chloromethane and methanol were compared. Of the 49 proteins with differential abundance identified, only five (CmuA, CmuB, PurU, CobH2 and a PaaE-like uncharacterized putative oxidoreductase are encoded by the pCMU01 plasmid. The mainly chromosome-encoded response to chloromethane involves gene clusters associated with oxidative stress, production of reducing equivalents (PntAA, Nuo complex, conversion of

Staphylococcus aureus nasal carriage in Ukraine: antibacterial resistance and virulence factor encoding genes.

Science.gov (United States)

Netsvyetayeva, Irina; Fraczek, Mariusz; Piskorska, Katarzyna; Golas, Marlena; Sikora, Magdalena; Mlynarczyk, Andrzej; Swoboda-Kopec, Ewa; Marusza, Wojciech; Palmieri, Beniamino; Iannitti, Tommaso

2014-03-05

The number of studies regarding the incidence of multidrug resistant strains and distribution of genes encoding virulence factors, which have colonized the post-Soviet states, is considerably limited. The aim of the study was (1) to assess the Staphylococcus (S.) aureus nasal carriage rate, including Methicillin Resistant S. aureus (MRSA) strains in adult Ukrainian population, (2) to determine antibiotic resistant pattern and (3) the occurrence of Panton Valentine Leukocidine (PVL)-, Fibronectin-Binding Protein A (FnBPA)- and Exfoliative Toxin (ET)-encoding genes. Nasal samples for S. aureus culture were obtained from 245 adults. The susceptibility pattern for several classes of antibiotics was determined by disk diffusion method according to the European Committee on Antimicrobial Susceptibility Testing (EUCAST) guidelines. The virulence factor encoding genes, mecA, lukS-lukF, eta, etb, etd, fnbA, were detected by Polymerase Chain Reaction (PCR). The S. aureus nasal carriage rate was 40%. The prevalence of nasal MRSA carriage in adults was 3.7%. LukS-lukF genes were detected in over 58% of the strains. ET-encoding genes were detected in over 39% of the strains and the most prevalent was etd. The fnbA gene was detected in over 59% of the strains. All MRSA isolates tested were positive for the mecA gene. LukS-lukF genes and the etd gene were commonly co-present in MRSA, while lukS-lukF genes and the fnbA gene were commonly co-present in Methicillin Sensitive S. aureus (MSSA) isolates. No significant difference was detected between the occurrence of lukS-lukF genes (P > 0.05) and the etd gene (P > 0.05) when comparing MRSA and MSSA. The occurrence of the fnbA gene was significantly more frequent in MSSA strains (P aureus is a common cause of infection. The prevalence of S. aureus nasal carriage in our cohort of patients from Ukraine was 40.4%. We found that 9.1% of the strains were classified as MRSA and all MRSA isolates tested positive for the mecA gene

The mitochondrial gene encoding ribosomal protein S12 has been translocated to the nuclear genome in Oenothera.

Science.gov (United States)

Grohmann, L; Brennicke, A; Schuster, W

1992-01-01

The Oenothera mitochondrial genome contains only a gene fragment for ribosomal protein S12 (rps12), while other plants encode a functional gene in the mitochondrion. The complete Oenothera rps12 gene is located in the nucleus. The transit sequence necessary to target this protein to the mitochondrion is encoded by a 5'-extension of the open reading frame. Comparison of the amino acid sequence encoded by the nuclear gene with the polypeptides encoded by edited mitochondrial cDNA and genomic sequences of other plants suggests that gene transfer between mitochondrion and nucleus started from edited mitochondrial RNA molecules. Mechanisms and requirements of gene transfer and activation are discussed. Images PMID:1454526

Sequencing and Transcriptional Analysis of the Biosynthesis Gene Cluster of Putrescine-Producing Lactococcus lactis ▿ †

Science.gov (United States)

Ladero, Victor; Rattray, Fergal P.; Mayo, Baltasar; Martín, María Cruz; Fernández, María; Alvarez, Miguel A.

2011-01-01

Lactococcus lactis is a prokaryotic microorganism with great importance as a culture starter and has become the model species among the lactic acid bacteria. The long and safe history of use of L. lactis in dairy fermentations has resulted in the classification of this species as GRAS (General Regarded As Safe) or QPS (Qualified Presumption of Safety). However, our group has identified several strains of L. lactis subsp. lactis and L. lactis subsp. cremoris that are able to produce putrescine from agmatine via the agmatine deiminase (AGDI) pathway. Putrescine is a biogenic amine that confers undesirable flavor characteristics and may even have toxic effects. The AGDI cluster of L. lactis is composed of a putative regulatory gene, aguR, followed by the genes (aguB, aguD, aguA, and aguC) encoding the catabolic enzymes. These genes are transcribed as an operon that is induced in the presence of agmatine. In some strains, an insertion (IS) element interrupts the transcription of the cluster, which results in a non-putrescine-producing phenotype. Based on this knowledge, a PCR-based test was developed in order to differentiate nonproducing L. lactis strains from those with a functional AGDI cluster. The analysis of the AGDI cluster and their flanking regions revealed that the capacity to produce putrescine via the AGDI pathway could be a specific characteristic that was lost during the adaptation to the milk environment by a process of reductive genome evolution. PMID:21803900

The presence of two S-layer-protein-encoding genes is conserved among species related to Lactobacillus acidophilus

NARCIS (Netherlands)

Boot, H.J.; Kolen, C.P.A.M.; Pot, B.; Kersters, K.; Pouwels, P.H.

1996-01-01

Previously we have shown that the type strain of Lactobacillus acidophilus possesses two S-protein-encoding genes, one of which is silent, on a chromosomal segment of 6 kb. The S-protein-encoding gene in the expression site can be exchanged for the silent S-protein-encoding gene by inversion of this

Large clusters of co-expressed genes in the Drosophila genome.

Science.gov (United States)

Boutanaev, Alexander M; Kalmykova, Alla I; Shevelyov, Yuri Y; Nurminsky, Dmitry I

2002-12-12

Clustering of co-expressed, non-homologous genes on chromosomes implies their co-regulation. In lower eukaryotes, co-expressed genes are often found in pairs. Clustering of genes that share aspects of transcriptional regulation has also been reported in higher eukaryotes. To advance our understanding of the mode of coordinated gene regulation in multicellular organisms, we performed a genome-wide analysis of the chromosomal distribution of co-expressed genes in Drosophila. We identified a total of 1,661 testes-specific genes, one-third of which are clustered on chromosomes. The number of clusters of three or more genes is much higher than expected by chance. We observed a similar trend for genes upregulated in the embryo and in the adult head, although the expression pattern of individual genes cannot be predicted on the basis of chromosomal position alone. Our data suggest that the prevalent mechanism of transcriptional co-regulation in higher eukaryotes operates with extensive chromatin domains that comprise multiple genes.

Contribution of the Pmra Promoter to Expression of Genes in the Escherichia coli mra Cluster of Cell Envelope Biosynthesis and Cell Division Genes

Science.gov (United States)

Mengin-Lecreulx, Dominique; Ayala, Juan; Bouhss, Ahmed; van Heijenoort, Jean; Parquet, Claudine; Hara, Hiroshi

1998-01-01

Recently, a promoter for the essential gene ftsI, which encodes penicillin-binding protein 3 of Escherichia coli, was precisely localized 1.9 kb upstream from this gene, at the beginning of the mra cluster of cell division and cell envelope biosynthesis genes (H. Hara, S. Yasuda, K. Horiuchi, and J. T. Park, J. Bacteriol. 179:5802–5811, 1997). Disruption of this promoter (Pmra) on the chromosome and its replacement by the lac promoter (Pmra::Plac) led to isopropyl-β-d-thiogalactopyranoside (IPTG)-dependent cells that lysed in the absence of inducer, a defect which was complemented only when the whole region from Pmra to ftsW, the fifth gene downstream from ftsI, was provided in trans on a plasmid. In the present work, the levels of various proteins involved in peptidoglycan synthesis and cell division were precisely determined in cells in which Pmra::Plac promoter expression was repressed or fully induced. It was confirmed that the Pmra promoter is required for expression of the first nine genes of the mra cluster: mraZ (orfC), mraW (orfB), ftsL (mraR), ftsI, murE, murF, mraY, murD, and ftsW. Interestingly, three- to sixfold-decreased levels of MurG and MurC enzymes were observed in uninduced Pmra::Plac cells. This was correlated with an accumulation of the nucleotide precursors UDP–N-acetylglucosamine and UDP–N-acetylmuramic acid, substrates of these enzymes, and with a depletion of the pool of UDP–N-acetylmuramyl pentapeptide, resulting in decreased cell wall peptidoglycan synthesis. Moreover, the expression of ftsZ, the penultimate gene from this cluster, was significantly reduced when Pmra expression was repressed. It was concluded that the transcription of the genes located downstream from ftsW in the mra cluster, from murG to ftsZ, is also mainly (but not exclusively) dependent on the Pmra promoter. PMID:9721276

Identification and comparative analysis of the protocadherin cluster in a reptile, the green anole lizard.

Directory of Open Access Journals (Sweden)

Xiao-Juan Jiang

Full Text Available BACKGROUND: The vertebrate protocadherins are a subfamily of cell adhesion molecules that are predominantly expressed in the nervous system and are believed to play an important role in establishing the complex neural network during animal development. Genes encoding these molecules are organized into a cluster in the genome. Comparative analysis of the protocadherin subcluster organization and gene arrangements in different vertebrates has provided interesting insights into the history of vertebrate genome evolution. Among tetrapods, protocadherin clusters have been fully characterized only in mammals. In this study, we report the identification and comparative analysis of the protocadherin cluster in a reptile, the green anole lizard (Anolis carolinensis. METHODOLOGY/PRINCIPAL FINDINGS: We show that the anole protocadherin cluster spans over a megabase and encodes a total of 71 genes. The number of genes in the anole protocadherin cluster is significantly higher than that in the coelacanth (49 genes and mammalian (54-59 genes clusters. The anole protocadherin genes are organized into four subclusters: the delta, alpha, beta and gamma. This subcluster organization is identical to that of the coelacanth protocadherin cluster, but differs from the mammalian clusters which lack the delta subcluster. The gene number expansion in the anole protocadherin cluster is largely due to the extensive gene duplication in the gammab subgroup. Similar to coelacanth and elephant shark protocadherin genes, the anole protocadherin genes have experienced a low frequency of gene conversion. CONCLUSIONS/SIGNIFICANCE: Our results suggest that similar to the protocadherin clusters in other vertebrates, the evolution of anole protocadherin cluster is driven mainly by lineage-specific gene duplications and degeneration. Our analysis also shows that loss of the protocadherin delta subcluster in the mammalian lineage occurred after the divergence of mammals and reptiles

Functional clustering of time series gene expression data by Granger causality

Science.gov (United States)

2012-01-01

Background A common approach for time series gene expression data analysis includes the clustering of genes with similar expression patterns throughout time. Clustered gene expression profiles point to the joint contribution of groups of genes to a particular cellular process. However, since genes belong to intricate networks, other features, besides comparable expression patterns, should provide additional information for the identification of functionally similar genes. Results In this study we perform gene clustering through the identification of Granger causality between and within sets of time series gene expression data. Granger causality is based on the idea that the cause of an event cannot come after its consequence. Conclusions This kind of analysis can be used as a complementary approach for functional clustering, wherein genes would be clustered not solely based on their expression similarity but on their topological proximity built according to the intensity of Granger causality among them. PMID:23107425

Identification of nitrogen-fixing genes and gene clusters from metagenomic library of acid mine drainage.

Directory of Open Access Journals (Sweden)

Zhimin Dai

Full Text Available Biological nitrogen fixation is an essential function of acid mine drainage (AMD microbial communities. However, most acidophiles in AMD environments are uncultured microorganisms and little is known about the diversity of nitrogen-fixing genes and structure of nif gene cluster in AMD microbial communities. In this study, we used metagenomic sequencing to isolate nif genes in the AMD microbial community from Dexing Copper Mine, China. Meanwhile, a metagenome microarray containing 7,776 large-insertion fosmids was constructed to screen novel nif gene clusters. Metagenomic analyses revealed that 742 sequences were identified as nif genes including structural subunit genes nifH, nifD, nifK and various additional genes. The AMD community is massively dominated by the genus Acidithiobacillus. However, the phylogenetic diversity of nitrogen-fixing microorganisms is much higher than previously thought in the AMD community. Furthermore, a 32.5-kb genomic sequence harboring nif, fix and associated genes was screened by metagenome microarray. Comparative genome analysis indicated that most nif genes in this cluster are most similar to those of Herbaspirillum seropedicae, but the organization of the nif gene cluster had significant differences from H. seropedicae. Sequence analysis and reverse transcription PCR also suggested that distinct transcription units of nif genes exist in this gene cluster. nifQ gene falls into the same transcription unit with fixABCX genes, which have not been reported in other diazotrophs before. All of these results indicated that more novel diazotrophs survive in the AMD community.

Identification of nitrogen-fixing genes and gene clusters from metagenomic library of acid mine drainage.

Science.gov (United States)

Dai, Zhimin; Guo, Xue; Yin, Huaqun; Liang, Yili; Cong, Jing; Liu, Xueduan

2014-01-01

Biological nitrogen fixation is an essential function of acid mine drainage (AMD) microbial communities. However, most acidophiles in AMD environments are uncultured microorganisms and little is known about the diversity of nitrogen-fixing genes and structure of nif gene cluster in AMD microbial communities. In this study, we used metagenomic sequencing to isolate nif genes in the AMD microbial community from Dexing Copper Mine, China. Meanwhile, a metagenome microarray containing 7,776 large-insertion fosmids was constructed to screen novel nif gene clusters. Metagenomic analyses revealed that 742 sequences were identified as nif genes including structural subunit genes nifH, nifD, nifK and various additional genes. The AMD community is massively dominated by the genus Acidithiobacillus. However, the phylogenetic diversity of nitrogen-fixing microorganisms is much higher than previously thought in the AMD community. Furthermore, a 32.5-kb genomic sequence harboring nif, fix and associated genes was screened by metagenome microarray. Comparative genome analysis indicated that most nif genes in this cluster are most similar to those of Herbaspirillum seropedicae, but the organization of the nif gene cluster had significant differences from H. seropedicae. Sequence analysis and reverse transcription PCR also suggested that distinct transcription units of nif genes exist in this gene cluster. nifQ gene falls into the same transcription unit with fixABCX genes, which have not been reported in other diazotrophs before. All of these results indicated that more novel diazotrophs survive in the AMD community.

Identification of Nitrogen-Fixing Genes and Gene Clusters from Metagenomic Library of Acid Mine Drainage

Science.gov (United States)

Yin, Huaqun; Liang, Yili; Cong, Jing; Liu, Xueduan

2014-01-01

Biological nitrogen fixation is an essential function of acid mine drainage (AMD) microbial communities. However, most acidophiles in AMD environments are uncultured microorganisms and little is known about the diversity of nitrogen-fixing genes and structure of nif gene cluster in AMD microbial communities. In this study, we used metagenomic sequencing to isolate nif genes in the AMD microbial community from Dexing Copper Mine, China. Meanwhile, a metagenome microarray containing 7,776 large-insertion fosmids was constructed to screen novel nif gene clusters. Metagenomic analyses revealed that 742 sequences were identified as nif genes including structural subunit genes nifH, nifD, nifK and various additional genes. The AMD community is massively dominated by the genus Acidithiobacillus. However, the phylogenetic diversity of nitrogen-fixing microorganisms is much higher than previously thought in the AMD community. Furthermore, a 32.5-kb genomic sequence harboring nif, fix and associated genes was screened by metagenome microarray. Comparative genome analysis indicated that most nif genes in this cluster are most similar to those of Herbaspirillum seropedicae, but the organization of the nif gene cluster had significant differences from H. seropedicae. Sequence analysis and reverse transcription PCR also suggested that distinct transcription units of nif genes exist in this gene cluster. nifQ gene falls into the same transcription unit with fixABCX genes, which have not been reported in other diazotrophs before. All of these results indicated that more novel diazotrophs survive in the AMD community. PMID:24498417

A scale invariant clustering of genes on human chromosome 7

Directory of Open Access Journals (Sweden)

Kendal Wayne S

2004-01-01

Full Text Available Abstract Background Vertebrate genes often appear to cluster within the background of nontranscribed genomic DNA. Here an analysis of the physical distribution of gene structures on human chromosome 7 was performed to confirm the presence of clustering, and to elucidate possible underlying statistical and biological mechanisms. Results Clustering of genes was confirmed by virtue of a variance of the number of genes per unit physical length that exceeded the respective mean. Further evidence for clustering came from a power function relationship between the variance and mean that possessed an exponent of 1.51. This power function implied that the spatial distribution of genes on chromosome 7 was scale invariant, and that the underlying statistical distribution had a Poisson-gamma (PG form. A PG distribution for the spatial scattering of genes was validated by stringent comparisons of both the predicted variance to mean power function and its cumulative distribution function to data derived from chromosome 7. Conclusion The PG distribution was consistent with at least two different biological models: In the microrearrangement model, the number of genes per unit length of chromosome represented the contribution of a random number of smaller chromosomal segments that had originated by random breakage and reconstruction of more primitive chromosomes. Each of these smaller segments would have necessarily contained (on average a gamma distributed number of genes. In the gene cluster model, genes would be scattered randomly to begin with. Over evolutionary timescales, tandem duplication, mutation, insertion, deletion and rearrangement could act at these gene sites through a stochastic birth death and immigration process to yield a PG distribution. On the basis of the gene position data alone it was not possible to identify the biological model which best explained the observed clustering. However, the underlying PG statistical model implicated neutral

Ancient expansion of the hox cluster in lepidoptera generated four homeobox genes implicated in extra-embryonic tissue formation.

Directory of Open Access Journals (Sweden)

Laura Ferguson

2014-10-01

Full Text Available Gene duplications within the conserved Hox cluster are rare in animal evolution, but in Lepidoptera an array of divergent Hox-related genes (Shx genes has been reported between pb and zen. Here, we use genome sequencing of five lepidopteran species (Polygonia c-album, Pararge aegeria, Callimorpha dominula, Cameraria ohridella, Hepialus sylvina plus a caddisfly outgroup (Glyphotaelius pellucidus to trace the evolution of the lepidopteran Shx genes. We demonstrate that Shx genes originated by tandem duplication of zen early in the evolution of large clade Ditrysia; Shx are not found in a caddisfly and a member of the basally diverging Hepialidae (swift moths. Four distinct Shx genes were generated early in ditrysian evolution, and were stably retained in all descendent Lepidoptera except the silkmoth which has additional duplications. Despite extensive sequence divergence, molecular modelling indicates that all four Shx genes have the potential to encode stable homeodomains. The four Shx genes have distinct spatiotemporal expression patterns in early development of the Speckled Wood butterfly (Pararge aegeria, with ShxC demarcating the future sites of extraembryonic tissue formation via strikingly localised maternal RNA in the oocyte. All four genes are also expressed in presumptive serosal cells, prior to the onset of zen expression. Lepidopteran Shx genes represent an unusual example of Hox cluster expansion and integration of novel genes into ancient developmental regulatory networks.

Time-series clustering of gene expression in irradiated and bystander fibroblasts: an application of FBPA clustering

Directory of Open Access Journals (Sweden)

Markatou Marianthi

2011-01-01

Full Text Available Abstract Background The radiation bystander effect is an important component of the overall biological response of tissues and organisms to ionizing radiation, but the signaling mechanisms between irradiated and non-irradiated bystander cells are not fully understood. In this study, we measured a time-series of gene expression after α-particle irradiation and applied the Feature Based Partitioning around medoids Algorithm (FBPA, a new clustering method suitable for sparse time series, to identify signaling modules that act in concert in the response to direct irradiation and bystander signaling. We compared our results with those of an alternate clustering method, Short Time series Expression Miner (STEM. Results While computational evaluations of both clustering results were similar, FBPA provided more biological insight. After irradiation, gene clusters were enriched for signal transduction, cell cycle/cell death and inflammation/immunity processes; but only FBPA separated clusters by function. In bystanders, gene clusters were enriched for cell communication/motility, signal transduction and inflammation processes; but biological functions did not separate as clearly with either clustering method as they did in irradiated samples. Network analysis confirmed p53 and NF-κB transcription factor-regulated gene clusters in irradiated and bystander cells and suggested novel regulators, such as KDM5B/JARID1B (lysine (K-specific demethylase 5B and HDACs (histone deacetylases, which could epigenetically coordinate gene expression after irradiation. Conclusions In this study, we have shown that a new time series clustering method, FBPA, can provide new leads to the mechanisms regulating the dynamic cellular response to radiation. The findings implicate epigenetic control of gene expression in addition to transcription factor networks.

A robust approach based on Weibull distribution for clustering gene expression data

Directory of Open Access Journals (Sweden)

Gong Binsheng

2011-05-01

Full Text Available Abstract Background Clustering is a widely used technique for analysis of gene expression data. Most clustering methods group genes based on the distances, while few methods group genes according to the similarities of the distributions of the gene expression levels. Furthermore, as the biological annotation resources accumulated, an increasing number of genes have been annotated into functional categories. As a result, evaluating the performance of clustering methods in terms of the functional consistency of the resulting clusters is of great interest. Results In this paper, we proposed the WDCM (Weibull Distribution-based Clustering Method, a robust approach for clustering gene expression data, in which the gene expressions of individual genes are considered as the random variables following unique Weibull distributions. Our WDCM is based on the concept that the genes with similar expression profiles have similar distribution parameters, and thus the genes are clustered via the Weibull distribution parameters. We used the WDCM to cluster three cancer gene expression data sets from the lung cancer, B-cell follicular lymphoma and bladder carcinoma and obtained well-clustered results. We compared the performance of WDCM with k-means and Self Organizing Map (SOM using functional annotation information given by the Gene Ontology (GO. The results showed that the functional annotation ratios of WDCM are higher than those of the other methods. We also utilized the external measure Adjusted Rand Index to validate the performance of the WDCM. The comparative results demonstrate that the WDCM provides the better clustering performance compared to k-means and SOM algorithms. The merit of the proposed WDCM is that it can be applied to cluster incomplete gene expression data without imputing the missing values. Moreover, the robustness of WDCM is also evaluated on the incomplete data sets. Conclusions The results demonstrate that our WDCM produces clusters

Bacteriophage-encoded shiga toxin gene in atypical bacterial host

Directory of Open Access Journals (Sweden)

Casas Veronica

2011-07-01

Full Text Available Abstract Background Contamination from fecal bacteria in recreational waters is a major health concern since bacteria capable of causing human disease can be found in animal feces. The Dog Beach area of Ocean Beach in San Diego, California is a beach prone to closures due to high levels of fecal indicator bacteria (FIB. A potential source of these FIB could be the canine feces left behind by owners who do not clean up after their pets. We tested this hypothesis by screening the DNA isolated from canine feces for the bacteriophage-encoded stx gene normally found in the virulent strains of the fecal bacterium Escherichia coli. Results Twenty canine fecal samples were collected, processed for total and bacterial fraction DNA, and screened by PCR for the stx gene. The stx gene was detected in the total and bacterial fraction DNA of one fecal sample. Bacterial isolates were then cultivated from the stx-positive fecal sample. Eighty nine of these canine fecal bacterial isolates were screened by PCR for the stx gene. The stx gene was detected in five of these isolates. Sequencing and phylogenetic analyses of 16S rRNA gene PCR products from the canine fecal bacterial isolates indicated that they were Enterococcus and not E. coli. Conclusions The bacteriophage-encoded stx gene was found in multiple species of bacteria cultivated from canine fecal samples gathered at the shoreline of the Dog Beach area of Ocean Beach in San Diego, California. The canine fecal bacteria carrying the stx gene were not the typical E. coli host and were instead identified through phylogenetic analyses as Enterococcus. This suggests a large degree of horizontal gene transfer of exotoxin genes in recreational waters.

An original SERPINA3 gene cluster: Elucidation of genomic organization and gene expression in the Bos taurus 21q24 region

Directory of Open Access Journals (Sweden)

Ouali Ahmed

2008-04-01

Full Text Available Abstract Background The superfamily of serine proteinase inhibitors (serpins is involved in numerous fundamental biological processes as inflammation, blood coagulation and apoptosis. Our interest is focused on the SERPINA3 sub-family. The major human plasma protease inhibitor, α1-antichymotrypsin, encoded by the SERPINA3 gene, is homologous to genes organized in clusters in several mammalian species. However, although there is a similar genic organization with a high degree of sequence conservation, the reactive-centre-loop domains, which are responsible for the protease specificity, show significant divergences. Results We provide additional information by analyzing the situation of SERPINA3 in the bovine genome. A cluster of eight genes and one pseudogene sharing a high degree of identity and the same structural organization was characterized. Bovine SERPINA3 genes were localized by radiation hybrid mapping on 21q24 and only spanned over 235 Kilobases. For all these genes, we propose a new nomenclature from SERPINA3-1 to SERPINA3-8. They share approximately 70% of identity with the human SERPINA3 homologue. In the cluster, we described an original sub-group of six members with an unexpected high degree of conservation for the reactive-centre-loop domain, suggesting a similar peptidase inhibitory pattern. Preliminary expression analyses of these bovSERPINA3s showed different tissue-specific patterns and diverse states of glycosylation and phosphorylation. Finally, in the context of phylogenetic analyses, we improved our knowledge on mammalian SERPINAs evolution. Conclusion Our experimental results update data of the bovine genome sequencing, substantially increase the bovSERPINA3 sub-family and enrich the phylogenetic tree of serpins. We provide new opportunities for future investigations to approach the biological functions of this unusual subset of serine proteinase inhibitors.

A Metabolic Gene Cluster in the Wheat W1 and the Barley Cer-cqu Loci Determines β-Diketone Biosynthesis and Glaucousness.

Science.gov (United States)

Hen-Avivi, Shelly; Savin, Orna; Racovita, Radu C; Lee, Wing-Sham; Adamski, Nikolai M; Malitsky, Sergey; Almekias-Siegl, Efrat; Levy, Matan; Vautrin, Sonia; Bergès, Hélène; Friedlander, Gilgi; Kartvelishvily, Elena; Ben-Zvi, Gil; Alkan, Noam; Uauy, Cristobal; Kanyuka, Kostya; Jetter, Reinhard; Distelfeld, Assaf; Aharoni, Asaph

2016-06-01

The glaucous appearance of wheat (Triticum aestivum) and barley (Hordeum vulgare) plants, that is the light bluish-gray look of flag leaf, stem, and spike surfaces, results from deposition of cuticular β-diketone wax on their surfaces; this phenotype is associated with high yield, especially under drought conditions. Despite extensive genetic and biochemical characterization, the molecular genetic basis underlying the biosynthesis of β-diketones remains unclear. Here, we discovered that the wheat W1 locus contains a metabolic gene cluster mediating β-diketone biosynthesis. The cluster comprises genes encoding proteins of several families including type-III polyketide synthases, hydrolases, and cytochrome P450s related to known fatty acid hydroxylases. The cluster region was identified in both genetic and physical maps of glaucous and glossy tetraploid wheat, demonstrating entirely different haplotypes in these accessions. Complementary evidence obtained through gene silencing in planta and heterologous expression in bacteria supports a model for a β-diketone biosynthesis pathway involving members of these three protein families. Mutations in homologous genes were identified in the barley eceriferum mutants defective in β-diketone biosynthesis, demonstrating a gene cluster also in the β-diketone biosynthesis Cer-cqu locus in barley. Hence, our findings open new opportunities to breed major cereal crops for surface features that impact yield and stress response. © 2016 American Society of Plant Biologists. All rights reserved.

Heterologous expression of pikromycin biosynthetic gene cluster using Streptomyces artificial chromosome system.

Science.gov (United States)

Pyeon, Hye-Rim; Nah, Hee-Ju; Kang, Seung-Hoon; Choi, Si-Sun; Kim, Eung-Soo

2017-05-31

Heterologous expression of biosynthetic gene clusters of natural microbial products has become an essential strategy for titer improvement and pathway engineering of various potentially-valuable natural products. A Streptomyces artificial chromosomal conjugation vector, pSBAC, was previously successfully applied for precise cloning and tandem integration of a large polyketide tautomycetin (TMC) biosynthetic gene cluster (Nah et al. in Microb Cell Fact 14(1):1, 2015), implying that this strategy could be employed to develop a custom overexpression scheme of natural product pathway clusters present in actinomycetes. To validate the pSBAC system as a generally-applicable heterologous overexpression system for a large-sized polyketide biosynthetic gene cluster in Streptomyces, another model polyketide compound, the pikromycin biosynthetic gene cluster, was preciously cloned and heterologously expressed using the pSBAC system. A unique HindIII restriction site was precisely inserted at one of the border regions of the pikromycin biosynthetic gene cluster within the chromosome of Streptomyces venezuelae, followed by site-specific recombination of pSBAC into the flanking region of the pikromycin gene cluster. Unlike the previous cloning process, one HindIII site integration step was skipped through pSBAC modification. pPik001, a pSBAC containing the pikromycin biosynthetic gene cluster, was directly introduced into two heterologous hosts, Streptomyces lividans and Streptomyces coelicolor, resulting in the production of 10-deoxymethynolide, a major pikromycin derivative. When two entire pikromycin biosynthetic gene clusters were tandemly introduced into the S. lividans chromosome, overproduction of 10-deoxymethynolide and the presence of pikromycin, which was previously not detected, were both confirmed. Moreover, comparative qRT-PCR results confirmed that the transcription of pikromycin biosynthetic genes was significantly upregulated in S. lividans containing tandem

Clustering approaches to identifying gene expression patterns from DNA microarray data.

Science.gov (United States)

Do, Jin Hwan; Choi, Dong-Kug

2008-04-30

The analysis of microarray data is essential for large amounts of gene expression data. In this review we focus on clustering techniques. The biological rationale for this approach is the fact that many co-expressed genes are co-regulated, and identifying co-expressed genes could aid in functional annotation of novel genes, de novo identification of transcription factor binding sites and elucidation of complex biological pathways. Co-expressed genes are usually identified in microarray experiments by clustering techniques. There are many such methods, and the results obtained even for the same datasets may vary considerably depending on the algorithms and metrics for dissimilarity measures used, as well as on user-selectable parameters such as desired number of clusters and initial values. Therefore, biologists who want to interpret microarray data should be aware of the weakness and strengths of the clustering methods used. In this review, we survey the basic principles of clustering of DNA microarray data from crisp clustering algorithms such as hierarchical clustering, K-means and self-organizing maps, to complex clustering algorithms like fuzzy clustering.

Several genes encoding enzymes with the same activity are necessary for aerobic fungal degradation of cellulose in nature.

Directory of Open Access Journals (Sweden)

Peter K Busk

Full Text Available The cellulose-degrading fungal enzymes are glycoside hydrolases of the GH families and lytic polysaccharide monooxygenases. The entanglement of glycoside hydrolase families and functions makes it difficult to predict the enzymatic activity of glycoside hydrolases based on their sequence. In the present study we further developed the method Peptide Pattern Recognition to an automatic approach not only to find all genes encoding glycoside hydrolases and lytic polysaccharide monooxygenases in fungal genomes but also to predict the function of the genes. The functional annotation is an important feature as it provides a direct route to predict function from primary sequence. Furthermore, we used Peptide Pattern Recognition to compare the cellulose-degrading enzyme activities encoded by 39 fungal genomes. The results indicated that cellobiohydrolases and AA9 lytic polysaccharide monooxygenases are hallmarks of cellulose-degrading fungi except brown rot fungi. Furthermore, a high number of AA9, endocellulase and β-glucosidase genes were identified, not in what are known to be the strongest, specialized lignocellulose degraders but in saprophytic fungi that can use a wide variety of substrates whereas only few of these genes were found in fungi that have a limited number of natural, lignocellulotic substrates. This correlation suggests that enzymes with different properties are necessary for degradation of cellulose in different complex substrates. Interestingly, clustering of the fungi based on their predicted enzymes indicated that Ascomycota and Basidiomycota use the same enzymatic activities to degrade plant cell walls.

Identification and characterization of a gene encoding a putative ...

Indian Academy of Sciences (India)

2012-10-30

Oct 30, 2012 ... Genetic Improvement of Oil Crops, Ministry of Agriculture, Wuhan 430062, China. 2Institute of ... Its encoding gene is an essential candidate for oil crops to .... higher level in leaves than in other organs (Kim and Huang. 2004) ...

Genes involved in translation of Mycoplasma hyopneumoniae and Mycoplasma synoviae

Directory of Open Access Journals (Sweden)

Mônica de Oliveira Santos

2007-01-01

Full Text Available This is a report on the analysis of genes involved in translation of the complete genomes of Mycoplasma hyopneumoniae strain J and 7448 and Mycoplasma synoviae. In both genomes 31 ORFs encoding large ribosomal subunit proteins and 19 ORFs encoding small ribosomal subunit proteins were found. Ten ribosomal protein gene clusters encoding 42 ribosomal proteins were found in M. synoviae, while 8 clusters encoding 39 ribosomal proteins were found in both M. hyopneumoniae strains. The L33 gene of the M. hyopneumoniae strain 7448 presented two copies in different locations. The genes encoding initiation factors (IF-1, IF-2 and IF-3, elongation factors (EF-G, EF-Tu, EF-Ts and EF-P, and the genes encoding the ribosome recycling factor (frr and one polypeptide release factor (prfA were present in the genomes of M. hyopneumoniae and M. synoviae. Nineteen aminoacyl-tRNA synthases had been previously identified in both mycoplasmas. In the two strains of M. hyopneumoniae, J and 7448, only one set of 5S, 16S and 23S rRNAs had been identified. Two sets of 16S and 23S rRNA genes and three sets of 5S rRNA genes had been identified in the M. synoviae genome.

The medaka novel immune-type receptor (NITR gene clusters reveal an extraordinary degree of divergence in variable domains

Directory of Open Access Journals (Sweden)

Litman Gary W

2008-06-01

Full Text Available Abstract Background Novel immune-type receptor (NITR genes are members of diversified multigene families that are found in bony fish and encode type I transmembrane proteins containing one or two extracellular immunoglobulin (Ig domains. The majority of NITRs can be classified as inhibitory receptors that possess cytoplasmic immunoreceptor tyrosine-based inhibition motifs (ITIMs. A much smaller number of NITRs can be classified as activating receptors by the lack of cytoplasmic ITIMs and presence of a positively charged residue within their transmembrane domain, which permits partnering with an activating adaptor protein. Results Forty-four NITR genes in medaka (Oryzias latipes are located in three gene clusters on chromosomes 10, 18 and 21 and can be organized into 24 families including inhibitory and activating forms. The particularly large dataset acquired in medaka makes direct comparison possible to another complete dataset acquired in zebrafish in which NITRs are localized in two clusters on different chromosomes. The two largest medaka NITR gene clusters share conserved synteny with the two zebrafish NITR gene clusters. Shared synteny between NITRs and CD8A/CD8B is limited but consistent with a potential common ancestry. Conclusion Comprehensive phylogenetic analyses between the complete datasets of NITRs from medaka and zebrafish indicate multiple species-specific expansions of different families of NITRs. The patterns of sequence variation among gene family members are consistent with recent birth-and-death events. Similar effects have been observed with mammalian immunoglobulin (Ig, T cell antigen receptor (TCR and killer cell immunoglobulin-like receptor (KIR genes. NITRs likely diverged along an independent pathway from that of the somatically rearranging antigen binding receptors but have undergone parallel evolution of V family diversity.

Screening of the Enterocin-Encoding Genes and Antimicrobial Activity in Enterococcus Species.

Science.gov (United States)

Ogaki, Mayara Baptistucci; Rocha, Katia Real; Terra, MÁrcia Regina; Furlaneto, MÁrcia Cristina; Maia, Luciana Furlaneto

2016-06-28

In the current study, a total of 135 enterococci strains from different sources were screened for the presence of the enterocin-encoding genes entA, entP, entB, entL50A, and entL50B. The enterocin genes were present at different frequencies, with entA occurring the most frequently, followed by entP and entB; entL50A and L50B were not detected. The occurrence of single enterocin genes was higher than the occurrence of multiple enterocin gene combinations. The 80 isolates that harbor at least one enterocin-encoding gene (denoted "Gene(+) strains") were screened for antimicrobial activity. A total of 82.5% of the Gene(+) strains inhibited at least one of the indicator strains, and the isolates harboring multiple enterocin-encoding genes inhibited a larger number of indicator strains than isolates harboring a single gene. The indicator strains that exhibited growth inhibition included Listeria innocua strain CLIP 12612 (ATCC BAA-680), Listeria monocytogenes strain CDC 4555, Enterococcus faecalis ATCC 29212, Staphylococcus aureus ATCC 25923, S. aureus ATCC 29213, S. aureus ATCC 6538, Salmonella enteritidis ATCC 13076, Salmonella typhimurium strain UK-1 (ATCC 68169), and Escherichia coli BAC 49LT ETEC. Inhibition due to either bacteriophage lysis or cytolysin activity was excluded. The growth inhibition of antilisterial Gene+ strains was further tested under different culture conditions. Among the culture media formulations, the MRS agar medium supplemented with 2% (w/v) yeast extract was the best solidified medium for enterocin production. Our findings extend the current knowledge of enterocin-producing enterococci, which may have potential applications as biopreservatives in the food industry due to their capability of controlling food spoilage pathogens.

Transcriptional modulation of genes encoding nitrate reductase in ...

African Journals Online (AJOL)

The free aluminum (Al) content in soil can reach levels that are toxic to plants, and this has frequently limited increased productivity of cultures. Four genes encoding nitrate reductase (NR) were identified, named ZmNR1–4. With the aim of evaluating NR activity and the transcriptional modulation of the ZmNR1, ZmNR2, ...

Structure of the neutral capsular polysaccharide of Acinetobacter baumannii NIPH146 that carries the KL37 capsule gene cluster.

Science.gov (United States)

Arbatsky, Nikolay P; Shneider, Mikhail M; Kenyon, Johanna J; Shashkov, Alexander S; Popova, Anastasiya V; Miroshnikov, Konstantin A; Volozhantsev, Nikolay V; Knirel, Yuriy A

2015-09-02

Capsular polysaccharide (CPS) was isolated from Acinetobacter baumannii NIPH146, and the following structure of branched pentasaccharide repeating unit was established by sugar analyses along with 1D and 2D NMR spectroscopy: In comparison to most other known capsular polysaccharides of A. baumannii, the CPS studied is neutral and lacks any specific monosaccharide component. The synthesis, assembly and export of this structure could be attributed to genes in a novel capsule biosynthesis gene cluster, designated KL37, which was found in the NIPH146 genome. The CPS of A. baumannii NIPH146 shares the α-d-Galp-(1→6)-β-d-Glcp-(1→3)-d-GalpNAc-(1→ trisaccharide fragment with the CPS units of several A. baumannii strains, including ATCC 17978 and LUH 5537 that carry the KL3 and KL22 gene clusters, respectively. KL37 contains two genes for glycosyltransferases that are related to two glycosyltransferase genes present in both KL3 and KL22, and the encoded proteins could be tentatively assigned to linkages between sugars in the CPS repeat. Copyright © 2015 Elsevier Ltd. All rights reserved.

Nearest Neighbor Networks: clustering expression data based on gene neighborhoods

Directory of Open Access Journals (Sweden)

Olszewski Kellen L

2007-07-01

Full Text Available Abstract Background The availability of microarrays measuring thousands of genes simultaneously across hundreds of biological conditions represents an opportunity to understand both individual biological pathways and the integrated workings of the cell. However, translating this amount of data into biological insight remains a daunting task. An important initial step in the analysis of microarray data is clustering of genes with similar behavior. A number of classical techniques are commonly used to perform this task, particularly hierarchical and K-means clustering, and many novel approaches have been suggested recently. While these approaches are useful, they are not without drawbacks; these methods can find clusters in purely random data, and even clusters enriched for biological functions can be skewed towards a small number of processes (e.g. ribosomes. Results We developed Nearest Neighbor Networks (NNN, a graph-based algorithm to generate clusters of genes with similar expression profiles. This method produces clusters based on overlapping cliques within an interaction network generated from mutual nearest neighborhoods. This focus on nearest neighbors rather than on absolute distance measures allows us to capture clusters with high connectivity even when they are spatially separated, and requiring mutual nearest neighbors allows genes with no sufficiently similar partners to remain unclustered. We compared the clusters generated by NNN with those generated by eight other clustering methods. NNN was particularly successful at generating functionally coherent clusters with high precision, and these clusters generally represented a much broader selection of biological processes than those recovered by other methods. Conclusion The Nearest Neighbor Networks algorithm is a valuable clustering method that effectively groups genes that are likely to be functionally related. It is particularly attractive due to its simplicity, its success in the

Unusual Gene Order and Organization of the Sea Urchin HoxCluster

Energy Technology Data Exchange (ETDEWEB)

Richardson, Paul M.; Lucas, Susan; Cameron, R. Andrew; Rowen,Lee; Nesbitt, Ryan; Bloom, Scott; Rast, Jonathan P.; Berney, Kevin; Arenas-Mena, Cesar; Martinez, Pedro; Davidson, Eric H.; Peterson, KevinJ.; Hood, Leroy

2005-05-10

The highly consistent gene order and axial colinear expression patterns found in vertebrate hox gene clusters are less well conserved across the rest of bilaterians. We report the first deuterostome instance of an intact hox cluster with a unique gene order where the paralog groups are not expressed in a sequential manner. The finished sequence from BAC clones from the genome of the sea urchin, Strongylocentrotus purpuratus, reveals a gene order wherein the anterior genes (Hox1, Hox2 and Hox3) lie nearest the posterior genes in the cluster such that the most 3' gene is Hox5. (The gene order is : 5'-Hox1,2, 3, 11/13c, 11/13b, '11/13a, 9/10, 8, 7, 6, 5 - 3)'. The finished sequence result is corroborated by restriction mapping evidence and BAC-end scaffold analyses. Comparisons with a putative ancestral deuterostome Hox gene cluster suggest that the rearrangements leading to the sea urchin gene order were many and complex.

MitoRes: a resource of nuclear-encoded mitochondrial genes and their products in Metazoa.

Science.gov (United States)

Catalano, Domenico; Licciulli, Flavio; Turi, Antonio; Grillo, Giorgio; Saccone, Cecilia; D'Elia, Domenica

2006-01-24

Mitochondria are sub-cellular organelles that have a central role in energy production and in other metabolic pathways of all eukaryotic respiring cells. In the last few years, with more and more genomes being sequenced, a huge amount of data has been generated providing an unprecedented opportunity to use the comparative analysis approach in studies of evolution and functional genomics with the aim of shedding light on molecular mechanisms regulating mitochondrial biogenesis and metabolism. In this context, the problem of the optimal extraction of representative datasets of genomic and proteomic data assumes a crucial importance. Specialised resources for nuclear-encoded mitochondria-related proteins already exist; however, no mitochondrial database is currently available with the same features of MitoRes, which is an update of the MitoNuc database extensively modified in its structure, data sources and graphical interface. It contains data on nuclear-encoded mitochondria-related products for any metazoan species for which this type of data is available and also provides comprehensive sequence datasets (gene, transcript and protein) as well as useful tools for their extraction and export. MitoRes http://www2.ba.itb.cnr.it/MitoRes/ consolidates information from publicly external sources and automatically annotates them into a relational database. Additionally, it also clusters proteins on the basis of their sequence similarity and interconnects them with genomic data. The search engine and sequence management tools allow the query/retrieval of the database content and the extraction and export of sequences (gene, transcript, protein) and related sub-sequences (intron, exon, UTR, CDS, signal peptide and gene flanking regions) ready to be used for in silico analysis. The tool we describe here has been developed to support lab scientists and bioinformaticians alike in the characterization of molecular features and evolution of mitochondrial targeting sequences. The

High GC Content Cas9-Mediated Genome-Editing and Biosynthetic Gene Cluster Activation in Saccharopolyspora erythraea.

Science.gov (United States)

Liu, Yong; Wei, Wen-Ping; Ye, Bang-Ce

2018-05-18

The overexpression of bacterial secondary metabolite biosynthetic enzymes is the basis for industrial overproducing strains. Genome editing tools can be used to further improve gene expression and yield. Saccharopolyspora erythraea produces erythromycin, which has extensive clinical applications. In this study, the CRISPR-Cas9 system was used to edit genes in the S. erythraea genome. A temperature-sensitive plasmid containing the PermE promoter, to drive Cas9 expression, and the Pj23119 and PkasO promoters, to drive sgRNAs, was designed. Erythromycin esterase, encoded by S. erythraea SACE_1765, inactivates erythromycin by hydrolyzing the macrolactone ring. Sequencing and qRT-PCR confirmed that reporter genes were successfully inserted into the SACE_1765 gene. Deletion of SACE_1765 in a high-producing strain resulted in a 12.7% increase in erythromycin levels. Subsequent PermE- egfp knock-in at the SACE_0712 locus resulted in an 80.3% increase in erythromycin production compared with that of wild type. Further investigation showed that PermE promoter knock-in activated the erythromycin biosynthetic gene clusters at the SACE_0712 locus. Additionally, deletion of indA (SACE_1229) using dual sgRNA targeting without markers increased the editing efficiency to 65%. In summary, we have successfully applied Cas9-based genome editing to a bacterial strain, S. erythraea, with a high GC content. This system has potential application for both genome-editing and biosynthetic gene cluster activation in Actinobacteria.

Phylogenetic Evidence for Lateral Gene Transfer in the Intestine of Marine Iguanas

Science.gov (United States)

Nelson, David M.; Cann, Isaac K. O.; Altermann, Eric; Mackie, Roderick I.

2010-01-01

Background Lateral gene transfer (LGT) appears to promote genotypic and phenotypic variation in microbial communities in a range of environments, including the mammalian intestine. However, the extent and mechanisms of LGT in intestinal microbial communities of non-mammalian hosts remains poorly understood. Methodology/Principal Findings We sequenced two fosmid inserts obtained from a genomic DNA library derived from an agar-degrading enrichment culture of marine iguana fecal material. The inserts harbored 16S rRNA genes that place the organism from which they originated within Clostridium cluster IV, a well documented group that habitats the mammalian intestinal tract. However, sequence analysis indicates that 52% of the protein-coding genes on the fosmids have top BLASTX hits to bacterial species that are not members of Clostridium cluster IV, and phylogenetic analysis suggests that at least 10 of 44 coding genes on the fosmids may have been transferred from Clostridium cluster XIVa to cluster IV. The fosmids encoded four transposase-encoding genes and an integrase-encoding gene, suggesting their involvement in LGT. In addition, several coding genes likely involved in sugar transport were probably acquired through LGT. Conclusion Our phylogenetic evidence suggests that LGT may be common among phylogenetically distinct members of the phylum Firmicutes inhabiting the intestinal tract of marine iguanas. PMID:20520734

Phylogenetic evidence for lateral gene transfer in the intestine of marine iguanas.

Directory of Open Access Journals (Sweden)

David M Nelson

Full Text Available BACKGROUND: Lateral gene transfer (LGT appears to promote genotypic and phenotypic variation in microbial communities in a range of environments, including the mammalian intestine. However, the extent and mechanisms of LGT in intestinal microbial communities of non-mammalian hosts remains poorly understood. METHODOLOGY/PRINCIPAL FINDINGS: We sequenced two fosmid inserts obtained from a genomic DNA library derived from an agar-degrading enrichment culture of marine iguana fecal material. The inserts harbored 16S rRNA genes that place the organism from which they originated within Clostridium cluster IV, a well documented group that habitats the mammalian intestinal tract. However, sequence analysis indicates that 52% of the protein-coding genes on the fosmids have top BLASTX hits to bacterial species that are not members of Clostridium cluster IV, and phylogenetic analysis suggests that at least 10 of 44 coding genes on the fosmids may have been transferred from Clostridium cluster XIVa to cluster IV. The fosmids encoded four transposase-encoding genes and an integrase-encoding gene, suggesting their involvement in LGT. In addition, several coding genes likely involved in sugar transport were probably acquired through LGT. CONCLUSION: Our phylogenetic evidence suggests that LGT may be common among phylogenetically distinct members of the phylum Firmicutes inhabiting the intestinal tract of marine iguanas.

Phylogenetic evidence for lateral gene transfer in the intestine of marine iguanas.

Science.gov (United States)

Nelson, David M; Cann, Isaac K O; Altermann, Eric; Mackie, Roderick I

2010-05-24

Lateral gene transfer (LGT) appears to promote genotypic and phenotypic variation in microbial communities in a range of environments, including the mammalian intestine. However, the extent and mechanisms of LGT in intestinal microbial communities of non-mammalian hosts remains poorly understood. We sequenced two fosmid inserts obtained from a genomic DNA library derived from an agar-degrading enrichment culture of marine iguana fecal material. The inserts harbored 16S rRNA genes that place the organism from which they originated within Clostridium cluster IV, a well documented group that habitats the mammalian intestinal tract. However, sequence analysis indicates that 52% of the protein-coding genes on the fosmids have top BLASTX hits to bacterial species that are not members of Clostridium cluster IV, and phylogenetic analysis suggests that at least 10 of 44 coding genes on the fosmids may have been transferred from Clostridium cluster XIVa to cluster IV. The fosmids encoded four transposase-encoding genes and an integrase-encoding gene, suggesting their involvement in LGT. In addition, several coding genes likely involved in sugar transport were probably acquired through LGT. Our phylogenetic evidence suggests that LGT may be common among phylogenetically distinct members of the phylum Firmicutes inhabiting the intestinal tract of marine iguanas.

Recursive Cluster Elimination (RCE for classification and feature selection from gene expression data

Directory of Open Access Journals (Sweden)

Showe Louise C

2007-05-01

Full Text Available Abstract Background Classification studies using gene expression datasets are usually based on small numbers of samples and tens of thousands of genes. The selection of those genes that are important for distinguishing the different sample classes being compared, poses a challenging problem in high dimensional data analysis. We describe a new procedure for selecting significant genes as recursive cluster elimination (RCE rather than recursive feature elimination (RFE. We have tested this algorithm on six datasets and compared its performance with that of two related classification procedures with RFE. Results We have developed a novel method for selecting significant genes in comparative gene expression studies. This method, which we refer to as SVM-RCE, combines K-means, a clustering method, to identify correlated gene clusters, and Support Vector Machines (SVMs, a supervised machine learning classification method, to identify and score (rank those gene clusters for the purpose of classification. K-means is used initially to group genes into clusters. Recursive cluster elimination (RCE is then applied to iteratively remove those clusters of genes that contribute the least to the classification performance. SVM-RCE identifies the clusters of correlated genes that are most significantly differentially expressed between the sample classes. Utilization of gene clusters, rather than individual genes, enhances the supervised classification accuracy of the same data as compared to the accuracy when either SVM or Penalized Discriminant Analysis (PDA with recursive feature elimination (SVM-RFE and PDA-RFE are used to remove genes based on their individual discriminant weights. Conclusion SVM-RCE provides improved classification accuracy with complex microarray data sets when it is compared to the classification accuracy of the same datasets using either SVM-RFE or PDA-RFE. SVM-RCE identifies clusters of correlated genes that when considered together

Hox gene cluster of the ascidian, Halocynthia roretzi, reveals multiple ancient steps of cluster disintegration during ascidian evolution.

Science.gov (United States)

Sekigami, Yuka; Kobayashi, Takuya; Omi, Ai; Nishitsuji, Koki; Ikuta, Tetsuro; Fujiyama, Asao; Satoh, Noriyuki; Saiga, Hidetoshi

2017-01-01

Hox gene clusters with at least 13 paralog group (PG) members are common in vertebrate genomes and in that of amphioxus. Ascidians, which belong to the subphylum Tunicata (Urochordata), are phylogenetically positioned between vertebrates and amphioxus, and traditionally divided into two groups: the Pleurogona and the Enterogona. An enterogonan ascidian, Ciona intestinalis ( Ci ), possesses nine Hox genes localized on two chromosomes; thus, the Hox gene cluster is disintegrated. We investigated the Hox gene cluster of a pleurogonan ascidian, Halocynthia roretzi ( Hr ) to investigate whether Hox gene cluster disintegration is common among ascidians, and if so, how such disintegration occurred during ascidian or tunicate evolution. Our phylogenetic analysis reveals that the Hr Hox gene complement comprises nine members, including one with a relatively divergent Hox homeodomain sequence. Eight of nine Hr Hox genes were orthologous to Ci-Hox1 , 2, 3, 4, 5, 10, 12 and 13. Following the phylogenetic classification into 13 PGs, we designated Hr Hox genes as Hox1, 2, 3, 4, 5, 10, 11/12/13.a , 11/12/13.b and HoxX . To address the chromosomal arrangement of the nine Hox genes, we performed two-color chromosomal fluorescent in situ hybridization, which revealed that the nine Hox genes are localized on a single chromosome in Hr , distinct from their arrangement in Ci . We further examined the order of the nine Hox genes on the chromosome by chromosome/scaffold walking. This analysis suggested a gene order of Hox1 , 11/12/13.b, 11/12/13.a, 10, 5, X, followed by either Hox4, 3, 2 or Hox2, 3, 4 on the chromosome. Based on the present results and those previously reported in Ci , we discuss the establishment of the Hox gene complement and disintegration of Hox gene clusters during the course of ascidian or tunicate evolution. The Hox gene cluster and the genome must have experienced extensive reorganization during the course of evolution from the ancestral tunicate to Hr and Ci

Calcitonin gene-related peptide antagonism and cluster headache

DEFF Research Database (Denmark)

Ashina, Håkan; Newman, Lawrence; Ashina, Sait

2017-01-01

Calcitonin gene-related peptide (CGRP) is a key signaling molecule involved in migraine pathophysiology. Efficacy of CGRP monoclonal antibodies and antagonists in migraine treatment has fueled an increasing interest in the prospect of treating cluster headache (CH) with CGRP antagonism. The exact...... role of CGRP and its mechanism of action in CH have not been fully clarified. A search for original studies and randomized controlled trials (RCTs) published in English was performed in PubMed and in ClinicalTrials.gov . The search term used was "cluster headache and calcitonin gene related peptide......" and "primary headaches and calcitonin gene related peptide." Reference lists of identified articles were also searched for additional relevant papers. Human experimental studies have reported elevated plasma CGRP levels during both spontaneous and glyceryl trinitrate-induced cluster attacks. CGRP may play...

RNAi-based silencing of genes encoding the vacuolar- ATPase ...

African Journals Online (AJOL)

2016-11-09

Nov 9, 2016 ... Spodoptera exigua larval development by silencing chitin synthase gene with RNA interference. Bull. Entomol. Res. 98:613-619. Dow JAT (1999). The Multifunctional Drosophila melanogaster V-. ATPase is encoded by a multigene family. J. Bioenerg. Biomembr. 31:75-83. Fire A, Xu SQ, Montgomery MK, ...

Evolution of Chemical Diversity in a Group of Non-Reduced Polyketide Gene Clusters: Using Phylogenetics to Inform the Search for Novel Fungal Natural Products

Directory of Open Access Journals (Sweden)

Kurt Throckmorton

2015-09-01

Full Text Available Fungal polyketides are a diverse class of natural products, or secondary metabolites (SMs, with a wide range of bioactivities often associated with toxicity. Here, we focus on a group of non-reducing polyketide synthases (NR-PKSs in the fungal phylum Ascomycota that lack a thioesterase domain for product release, group V. Although widespread in ascomycete taxa, this group of NR-PKSs is notably absent in the mycotoxigenic genus Fusarium and, surprisingly, found in genera not known for their secondary metabolite production (e.g., the mycorrhizal genus Oidiodendron, the powdery mildew genus Blumeria, and the causative agent of white-nose syndrome in bats, Pseudogymnoascus destructans. This group of NR-PKSs, in association with the other enzymes encoded by their gene clusters, produces a variety of different chemical classes including naphthacenediones, anthraquinones, benzophenones, grisandienes, and diphenyl ethers. We discuss the modification of and transitions between these chemical classes, the requisite enzymes, and the evolution of the SM gene clusters that encode them. Integrating this information, we predict the likely products of related but uncharacterized SM clusters, and we speculate upon the utility of these classes of SMs as virulence factors or chemical defenses to various plant, animal, and insect pathogens, as well as mutualistic fungi.

Identification and characterization of the genes encoding the core histones and histone variants of Neurospora crassa.

OpenAIRE

Hays, Shan M; Swanson, Johanna; Selker, Eric U

2002-01-01

We have identified and characterized the complete complement of genes encoding the core histones of Neurospora crassa. In addition to the previously identified pair of genes that encode histones H3 and H4 (hH3 and hH4-1), we identified a second histone H4 gene (hH4-2), a divergently transcribed pair of genes that encode H2A and H2B (hH2A and hH2B), a homolog of the F/Z family of H2A variants (hH2Az), a homolog of the H3 variant CSE4 from Saccharomyces cerevisiae (hH3v), and a highly diverged ...

A phylogenomic gene cluster resource: The phylogeneticallyinferred groups (PhlGs) database

Energy Technology Data Exchange (ETDEWEB)

Dehal, Paramvir S.; Boore, Jeffrey L.

2005-08-25

We present here the PhIGs database, a phylogenomic resource for sequenced genomes. Although many methods exist for clustering gene families, very few attempt to create truly orthologous clusters sharing descent from a single ancestral gene across a range of evolutionary depths. Although these non-phylogenetic gene family clusters have been used broadly for gene annotation, errors are known to be introduced by the artifactual association of slowly evolving paralogs and lack of annotation for those more rapidly evolving. A full phylogenetic framework is necessary for accurate inference of function and for many studies that address pattern and mechanism of the evolution of the genome. The automated generation of evolutionary gene clusters, creation of gene trees, determination of orthology and paralogy relationships, and the correlation of this information with gene annotations, expression information, and genomic context is an important resource to the scientific community.

Identification of Genes Encoding the Folate- and Thiamine-Binding Membrane Proteins in Firmicutes

NARCIS (Netherlands)

Eudes, Aymerick; Erkens, Guus B.; Slotboom, Dirk J.; Rodionov, Dmitry A.; Naponelli, Valeria; Hanson, Andrew D.

Genes encoding high-affinity folate- and thiamine-binding proteins (FolT, ThiT) were identified in the Lactobacillus casei genome, expressed in Lactococcus lactis, and functionally characterized. Similar genes occur in many Firmicutes, sometimes next to folate or thiamine salvage genes. Most thiT

Environmental cycle of antibiotic resistance encoded genes: A systematic review

Directory of Open Access Journals (Sweden)

R. ghanbari

2017-12-01

Full Text Available Antibiotic-resistant bacteria and genes enter the environment in different ways. The release of these factors into the environment has increased concerns related to public health. The aim of the study was to evaluate the antibiotic resistance genes (ARGs in the environmental resources. In this systematic review, the data were extracted from valid sources of information including ScienceDirect, PubMed, Google Scholar and SID. Evaluation and selection of articles were conducted on the basis of the PRISMA checklist. A total of 39 articles were included in the study, which were chosen from a total of 1249 papers. The inclusion criterion was the identification of genes encoding antibiotic resistance against the eight important groups of antibiotics determined by using the PCR technique in the environmental sources including municipal and hospital wastewater treatment plants, animal and agricultural wastes, effluents from treatment plants, natural waters, sediments, and drinking waters. In this study, 113 genes encoding antibiotic resistance to eight groups of antibiotics (beta-lactams, aminoglycosides, tetracyclines, macrolides, sulfonamides, chloramphenicol, glycopeptides and quinolones were identified in various environments. Antibiotic resistance genes were found in all the investigated environments. The investigation of microorganisms carrying these genes shows that most of the bacteria especially gram-negative bacteria are effective in the acquisition and the dissemination of these pollutants in the environment. Discharging the raw wastewaters and effluents from wastewater treatments acts as major routes in the dissemination of ARGs into environment sources and can pose hazards to public health.

Fungicidal activity of peptides encoded by immunoglobulin genes

OpenAIRE

Polonelli, Luciano; Ciociola, Tecla; Sperind?, Martina; Giovati, Laura; D?Adda, Tiziana; Galati, Serena; Travassos, Luiz R.; Magliani, Walter; Conti, Stefania

2017-01-01

Evidence from previous works disclosed the antimicrobial, antiviral, anti-tumour and/or immunomodulatory activity exerted, through different mechanisms of action, by peptides expressed in the complementarity-determining regions or even in the constant region of antibodies, independently from their specificity and isotype. Presently, we report the selection, from available databases, of peptide sequences encoded by immunoglobulin genes for the evaluation of their potential biological activitie...

An Effective Tri-Clustering Algorithm Combining Expression Data with Gene Regulation Information

Directory of Open Access Journals (Sweden)

Ao Li

2009-04-01

Full Text Available Motivation: Bi-clustering algorithms aim to identify sets of genes sharing similar expression patterns across a subset of conditions. However direct interpretation or prediction of gene regulatory mechanisms may be difficult as only gene expression data is used. Information about gene regulators may also be available, most commonly about which transcription factors may bind to the promoter region and thus control the expression level of a gene. Thus a method to integrate gene expression and gene regulation information is desirable for clustering and analyzing. Methods: By incorporating gene regulatory information with gene expression data, we define regulated expression values (REV as indicators of how a gene is regulated by a specific factor. Existing bi-clustering methods are extended to a three dimensional data space by developing a heuristic TRI-Clustering algorithm. An additional approach named Automatic Boundary Searching algorithm (ABS is introduced to automatically determine the boundary threshold. Results: Results based on incorporating ChIP-chip data representing transcription factor-gene interactions show that the algorithms are efficient and robust for detecting tri-clusters. Detailed analysis of the tri-cluster extracted from yeast sporulation REV data shows genes in this cluster exhibited significant differences during the middle and late stages. The implicated regulatory network was then reconstructed for further study of defined regulatory mechanisms. Topological and statistical analysis of this network demonstrated evidence of significant changes of TF activities during the different stages of yeast sporulation, and suggests this approach might be a general way to study regulatory networks undergoing transformations.

The nitrate-reduction gene cluster components exert lineage-dependent contributions to optimization of Sinorhizobium symbiosis with soybeans.

Science.gov (United States)

Liu, Li Xue; Li, Qin Qin; Zhang, Yun Zeng; Hu, Yue; Jiao, Jian; Guo, Hui Juan; Zhang, Xing Xing; Zhang, Biliang; Chen, Wen Xin; Tian, Chang Fu

2017-12-01

Receiving nodulation and nitrogen fixation genes does not guarantee rhizobia an effective symbiosis with legumes. Here, variations in gene content were determined for three Sinorhizobium species showing contrasting symbiotic efficiency on soybeans. A nitrate-reduction gene cluster absent in S. sojae was found to be essential for symbiotic adaptations of S. fredii and S. sp. III. In S. fredii, the deletion mutation of the nap (nitrate reductase), instead of nir (nitrite reductase) and nor (nitric oxide reductase), led to defects in nitrogen-fixation (Fix - ). By contrast, none of these core nitrate-reduction genes were required for the symbiosis of S. sp. III. However, within the same gene cluster, the deletion of hemN1 (encoding oxygen-independent coproporphyrinogen III oxidase) in both S. fredii and S. sp. III led to the formation of nitrogen-fixing (Fix + ) but ineffective (Eff - ) nodules. These Fix + /Eff - nodules were characterized by significantly lower enzyme activity of glutamine synthetase indicating rhizobial modulation of nitrogen-assimilation by plants. A distant homologue of HemN1 from S. sojae can complement this defect in S. fredii and S. sp. III, but exhibited a more pleotropic role in symbiosis establishment. These findings highlighted the lineage-dependent optimization of symbiotic functions in different rhizobial species associated with the same host. © 2017 Society for Applied Microbiology and John Wiley & Sons Ltd.

Acinetobacter baumannii K27 and K44 capsular polysaccharides have the same K unit but different structures due to the presence of distinct wzy genes in otherwise closely related K gene clusters.

Science.gov (United States)

Shashkov, Alexander S; Kenyon, Johanna J; Senchenkova, Sof'ya N; Shneider, Mikhail M; Popova, Anastasiya V; Arbatsky, Nikolay P; Miroshnikov, Konstantin A; Volozhantsev, Nikolay V; Hall, Ruth M; Knirel, Yuriy A

2016-05-01

Capsular polysaccharides (CPSs), from Acinetobacter baumannii isolates 1432, 4190 and NIPH 70, which have related gene content at the K locus, were examined, and the chemical structures established using 2D(1)H and(13)C NMR spectroscopy. The three isolates produce the same pentasaccharide repeat unit, which consists of 5-N-acetyl-7-N-[(S)-3-hydroxybutanoyl] (major) or 5,7-di-N-acetyl (minor) derivatives of 5,7-diamino-3,5,7,9-tetradeoxy-D-glycero-D-galacto-non-2-ulosonic (legionaminic) acid (Leg5Ac7R), D-galactose, N-acetyl-D-galactosamine and N-acetyl-D-glucosamine. However, the linkage between repeat units in NIPH 70 was different to that in 1432 and 4190, and this significantly alters the CPS structure. The KL27 gene cluster in 4190 and KL44 gene cluster in NIPH 70 are organized identically and contain lga genes for Leg5Ac7R synthesis, genes for the synthesis of the common sugars, as well as anitrA2 initiating transferase and four glycosyltransferases genes. They share high-level nucleotide sequence identity for corresponding genes, but differ in the wzy gene encoding the Wzy polymerase. The Wzy proteins, which have different lengths and share no similarity, would form the unrelated linkages in the K27 and K44 structures. The linkages formed by the four shared glycosyltransferases were predicted by comparison with gene clusters that synthesize related structures. These findings unambiguously identify the linkages formed by WzyK27 and WzyK44, and show that the presence of different wzy genes in otherwise closely related K gene clusters changes the structure of the CPS. This may affect its capacity as a protective barrier for A. baumannii. © The Author 2015. Published by Oxford University Press. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

Global Analysis of miRNA Gene Clusters and Gene Families Reveals Dynamic and Coordinated Expression

Directory of Open Access Journals (Sweden)

Li Guo

2014-01-01

Full Text Available To further understand the potential expression relationships of miRNAs in miRNA gene clusters and gene families, a global analysis was performed in 4 paired tumor (breast cancer and adjacent normal tissue samples using deep sequencing datasets. The compositions of miRNA gene clusters and families are not random, and clustered and homologous miRNAs may have close relationships with overlapped miRNA species. Members in the miRNA group always had various expression levels, and even some showed larger expression divergence. Despite the dynamic expression as well as individual difference, these miRNAs always indicated consistent or similar deregulation patterns. The consistent deregulation expression may contribute to dynamic and coordinated interaction between different miRNAs in regulatory network. Further, we found that those clustered or homologous miRNAs that were also identified as sense and antisense miRNAs showed larger expression divergence. miRNA gene clusters and families indicated important biological roles, and the specific distribution and expression further enrich and ensure the flexible and robust regulatory network.

Cloning of an epoxide hydrolase encoding gene from Rhodotorula mucilaginosa and functional expresion in Yarrowia lipolytica

CSIR Research Space (South Africa)

Labuschagne, M

2007-01-01

Full Text Available , were used to amplify the genomic EH-encoding gene from Rhodotorula mucilaginosa. The 2347 bp genomic sequence revealed a 1979 bp ORF containing nine introns. The cDNA sequence revealed an 1185 bp EH-encoding gene that translates into a 394 amino acid...

Related structures of neutral capsular polysaccharides of Acinetobacter baumannii isolates that carry related capsule gene clusters KL43, KL47, and KL88.

Science.gov (United States)

Shashkov, Alexander S; Kenyon, Johanna J; Arbatsky, Nikolay P; Shneider, Mikhail M; Popova, Anastasiya V; Miroshnikov, Konstantin A; Hall, Ruth M; Knirel, Yuriy A

2016-11-29

Capsular polysaccharides were recovered from four Acinetobacter baumannii isolates, and the following related structures of oligosaccharide repeating units were established by sugar analyses along with 1D and 2D 1 H and 13 C NMR spectroscopy: NIPH 60 and LUH5544 (K43) NIPH 601 (K47) The K locus for capsule biosynthesis in the genome sequences available for NIPH 60 and LUH5544, designated KL43, was found to be related to gene clusters KL47 in NIPH 601 and KL88 in LUH5548. The three clusters share most gene content differing in only a small portion that includes an additional glycosyltransferase genes in KL47 and KL88, as well as genes encoding distinct Wzy polymerases that were found to form the same α-d-GlcpNAc-(1 → 6)-α-d-GlcpNAc linkage in K43 and K47. Copyright © 2016 Elsevier Ltd. All rights reserved.

Co-expression of an Erwinia chrysanthemi pectate lyase-encoding gene (pelE) and an E. carotovora polygalacturonase-encoding gene (peh1) in Saccharomyces cerevisiae.

Science.gov (United States)

Laing, E; Pretorius, I S

1993-05-01

A pectate lyase (PL)-encoding gene (pelE) from Erwinia chrysanthemi and a polygalacturonase (PG)-encoding gene (peh1) from E. carotovora were each inserted between a novel yeast expression-secretion cassette and a yeast gene terminator, and cloned separately into a yeast-centromeric shuttle vector (YCp50), generating recombinant plasmids pAMS12 and pAMS13. Transcription initiation signals present in the expression-secretion cassette were derived from the yeast alcohol dehydrogenase gene promoter (ADC1P), whereas the transcription termination signals were derived from the yeast tryptophan synthase gene terminator (TRP5T). Secretion of PL and PG was directed by the signal sequence of the yeast mating pheromone alpha-factor (MF alpha 1s). A pectinase cassette comprising ADC1P-MF alpha 1s-pelE-TRP5T and ADC1P-MF alpha 1s-peh1-TRP5T was subcloned into YCp50, generating plasmid pAMS14. Subsequently, the dominant selectable Geneticin G418-resistance (GtR) marker, APH1, inserted between the yeast uridine diphosphoglucose 4-epimerase gene promoter (GAL10P) and yeast orotidine-5'-phosphate carboxylase gene terminator (URA3T), was cloned into pAMS14, resulting in plasmid pAMS15. Plasmids pAMS12, pAMS13 and pAMS14 were transformed into a laboratory strain of Saccharomyces cerevisiae, whereas pAMS15 was stably introduced into two commercial wine yeast strains. DNA-DNA and DNA-RNA hybridization analyses revealed the presence of these plasmids, and the pelE and peh1 transcripts in the yeast transformants, respectively. A polypectate agarose assay indicated the extracellular production of biologically active PL and PG by the S. cerevisiae transformants and confirmed that co-expression of the pelE and peh1 genes synergistically enhanced pectate degradation.

Lampreys, the jawless vertebrates, contain only two ParaHox gene clusters.

Science.gov (United States)

Zhang, Huixian; Ravi, Vydianathan; Tay, Boon-Hui; Tohari, Sumanty; Pillai, Nisha E; Prasad, Aravind; Lin, Qiang; Brenner, Sydney; Venkatesh, Byrappa

2017-08-22

ParaHox genes ( Gsx , Pdx , and Cdx ) are an ancient family of developmental genes closely related to the Hox genes. They play critical roles in the patterning of brain and gut. The basal chordate, amphioxus, contains a single ParaHox cluster comprising one member of each family, whereas nonteleost jawed vertebrates contain four ParaHox genomic loci with six or seven ParaHox genes. Teleosts, which have experienced an additional whole-genome duplication, contain six ParaHox genomic loci with six ParaHox genes. Jawless vertebrates, represented by lampreys and hagfish, are the most ancient group of vertebrates and are crucial for understanding the origin and evolution of vertebrate gene families. We have previously shown that lampreys contain six Hox gene loci. Here we report that lampreys contain only two ParaHox gene clusters (designated as α- and β-clusters) bearing five ParaHox genes ( Gsxα , Pdxα , Cdxα , Gsxβ , and Cdxβ ). The order and orientation of the three genes in the α-cluster are identical to that of the single cluster in amphioxus. However, the orientation of Gsxβ in the β-cluster is inverted. Interestingly, Gsxβ is expressed in the eye, unlike its homologs in jawed vertebrates, which are expressed mainly in the brain. The lamprey Pdxα is expressed in the pancreas similar to jawed vertebrate Pdx genes, indicating that the pancreatic expression of Pdx was acquired before the divergence of jawless and jawed vertebrate lineages. It is likely that the lamprey Pdxα plays a crucial role in pancreas specification and insulin production similar to the Pdx of jawed vertebrates.

Genome mining of the sordarin biosynthetic gene cluster from Sordaria araneosa Cain ATCC 36386: characterization of cycloaraneosene synthase and GDP-6-deoxyaltrose transferase.

Science.gov (United States)

Kudo, Fumitaka; Matsuura, Yasunori; Hayashi, Takaaki; Fukushima, Masayuki; Eguchi, Tadashi

2016-07-01

Sordarin is a glycoside antibiotic with a unique tetracyclic diterpene aglycone structure called sordaricin. To understand its intriguing biosynthetic pathway that may include a Diels-Alder-type [4+2]cycloaddition, genome mining of the gene cluster from the draft genome sequence of the producer strain, Sordaria araneosa Cain ATCC 36386, was carried out. A contiguous 67 kb gene cluster consisting of 20 open reading frames encoding a putative diterpene cyclase, a glycosyltransferase, a type I polyketide synthase, and six cytochrome P450 monooxygenases were identified. In vitro enzymatic analysis of the putative diterpene cyclase SdnA showed that it catalyzes the transformation of geranylgeranyl diphosphate to cycloaraneosene, a known biosynthetic intermediate of sordarin. Furthermore, a putative glycosyltransferase SdnJ was found to catalyze the glycosylation of sordaricin in the presence of GDP-6-deoxy-d-altrose to give 4'-O-demethylsordarin. These results suggest that the identified sdn gene cluster is responsible for the biosynthesis of sordarin. Based on the isolated potential biosynthetic intermediates and bioinformatics analysis, a plausible biosynthetic pathway for sordarin is proposed.

Nucleotide sequence of the Agrobacterium tumefaciens octopine Ti plasmid-encoded tmr gene

NARCIS (Netherlands)

Heidekamp, F.; Dirkse, W.G.; Hille, J.; Ormondt, H. van

1983-01-01

The nucleotide sequence of the tmr gene, encoded by the octopine Ti plasmid from Agrobacterium tumefaciens (pTiAch5), was determined. The T-DNA, which encompasses this gene, is involved in tumor formation and maintenance, and probably mediates the cytokinin-independent growth of transformed plant

[Divergence of paralogous growth-hormone-encoding genes and their promoters in Salmonidae].

Science.gov (United States)

Kamenskaya, D N; Pankova, M V; Atopkin, D M; Brykov, V A

2017-01-01

In many fish species, including salmonids, the growth-hormone is encoded by two duplicated paralogous genes, gh1 and gh2. Both genes were already in place at the time of divergence of species in this group. A comparison of the entire sequence of these genes of salmonids has shown that their conserved regions are associated with exons, while their most variable regions correspond to introns. Introns C and D include putative regulatory elements (sites Pit-1, CRE, and ERE), that are also conserved. In chars, the degree of polymorphism of gh2 gene is 2-3 times as large as that in gh1 gene. However, a comparison across all Salmonidae species would not extent this observation to other species. In both these chars' genes, the promoters are conserved mainly because they correspond to putative regulatory sequences (TATA box, binding sites for the pituitary transcription factor Pit-1 (F1-F4), CRE, GRE and RAR/RXR elements). The promoter of gh2 gene has a greater degree of polymorphism compared with gh1 gene promoter in all investigated species of salmonids. The observed differences in the rates of accumulation of changes in growth hormone encoding paralogs could be explained by differences in the intensity of selection.

Characterization and detection of a widely distributed gene cluster that predicts anaerobic choline utilization by human gut bacteria.

Science.gov (United States)

Martínez-del Campo, Ana; Bodea, Smaranda; Hamer, Hilary A; Marks, Jonathan A; Haiser, Henry J; Turnbaugh, Peter J; Balskus, Emily P

2015-04-14

choline fermentation (the cut gene cluster) have been recently identified, there has been no characterization of these genes in human gut isolates and microbial communities. In this work, we use multiple approaches to demonstrate that the pathway encoded by the cut genes is present and functional in a diverse range of human gut bacteria and is also widespread in stool metagenomes. We also developed a PCR-based strategy to detect a key functional gene (cutC) involved in this pathway and applied it to characterize newly isolated choline-utilizing strains. Both our analyses of the cut gene cluster and this molecular tool will aid efforts to further understand the role of choline metabolism in the human gut microbiota and its link to disease. Copyright © 2015 Martínez-del Campo et al.

The carB gene encoding the large subunit of carbamoylphosphate synthetase from Lactococcus lactis is transcribed monocistronically

DEFF Research Database (Denmark)

Martinussen, Jan; Hammer, Karin

1998-01-01

The biosynthesis of carbamoylphosphate is catalysed by the heterodimeric enzyme carbamoylphosphate synthetase (CPSase). The genes encoding the two subunits in procaryotes are normally transcribed as an operon, whereas in Lactococcus lactis, the gene encoding the large subunit (carB) is shown...

Comparative analysis of clustering methods for gene expression time course data

Directory of Open Access Journals (Sweden)

Ivan G. Costa

2004-01-01

Full Text Available This work performs a data driven comparative study of clustering methods used in the analysis of gene expression time courses (or time series. Five clustering methods found in the literature of gene expression analysis are compared: agglomerative hierarchical clustering, CLICK, dynamical clustering, k-means and self-organizing maps. In order to evaluate the methods, a k-fold cross-validation procedure adapted to unsupervised methods is applied. The accuracy of the results is assessed by the comparison of the partitions obtained in these experiments with gene annotation, such as protein function and series classification.

Transcriptome profiling of TDC cluster deletion mutant of Enterococcus faecalis V583

Directory of Open Access Journals (Sweden)

Marta Perez

2016-09-01

Full Text Available The species Enterococcus faecalis is able to catabolise the amino acid tyrosine into the biogenic amine tyramine by the tyrosine decarboxilase (TDC pathway Ladero et al. (2012 [1]. The TDC cluster comprises four genes: tyrS, an aminoacyl-tRNA synthetase-like gene; tdcA, which encodes the tyrosine decarboxylase; tyrP, a tyrosine/tyramine exchanger gene and nhaC-2, which encodes an Na+/H+ antiporter and whose role in the tyramine biosynthesis remains unknown [2]. In E. faecalis V583 the last three genes are co-transcribed as a single polycistronic mRNA forming the catabolic operon, while tyrS is transcribed independently of the catabolic genes as a monocistronic mRNA [2]. The catabolic operon is transcriptionally induced by tyrosine and acidic pH. On the opposite, the tyrS expression is repressed by tyrosine concentrations [2]. In this work we report the transcriptional profiling of the TDC cluster deletion mutant (E. faecalis V583 ΔTDC [2] compared to the wild-type strain, both grown in M17 medium supplemented with tyrosine. The transcriptional profile data of TDC cluster-regulated genes were deposited in the Gene Expression Omnibus (GEO database under accession no. GSE77864.

Impact of agricultural management on bacterial laccase-encoding genes with possible implications for soil carbon storage in semi-arid Mediterranean olive farming

Directory of Open Access Journals (Sweden)

Beatriz Moreno

2016-07-01

Full Text Available Background: In this work, we aimed to gain insights into the contribution of soil bacteria to carbon sequestration in Mediterranean habitats. In particular, we aimed to use bacterial laccase-encoding genes as molecular markers for soil organic C cycling. Using rainfed olive farming as an experimental model, we determined the stability and accumulation levels of humic substances and applied these data to bacterial laccase-encoding gene expression and diversity in soils under four different agricultural management systems (bare soils under tillage/no tillage and vegetation cover under chemical/mechanical management. Materials and Methods: Humic C (> 104 Da was subjected to isoelectric focusing. The GC-MS method was used to analyze aromatic hydrocarbons. Real-Time PCR quantification and denaturing gradient gel electrophoresis (DGGE for functional bacterial laccase-like multicopper oxidase (LMCO-encoding genes and transcripts were also carried out. Results: Soils under spontaneous vegetation, eliminated in springtime using mechanical methods for more than 30 years, showed the highest humic acid levels as well as the largest bacterial population rich in laccase genes and transcripts. The structure of the bacterial community based on LMCO genes also pointed to phylogenetic differences between these soils due to the impact of different management systems. Soils where herbicides were used to eliminate spontaneous vegetation once a year and those where pre-emergence herbicides resulted in bare soils clustered together for DNA-based DGGE analysis, which indicated a certain amount of microbial selection due to the application of herbicides. When LMCO-encoding gene expression was studied, soils where cover vegetation was managed either with herbicides or with mechanical methods showed less than 10% similarity, suggesting that the type of weed management strategy used can impact weed community composition and consequently laccase substrates derived from

Cloning and Characterization of upp, a Gene Encoding Uracil Phosphoribosyltransferase from Lactococcus lactis

DEFF Research Database (Denmark)

Martinussen, Jan; Hammer, Karin

1994-01-01

Uracil phosphoribosyltransferase catalyzes the key reaction in the salvage of uracil in many microorganisms. The gene encoding uracil phosphoribosyltransferase (upp) was cloned from Lactococcus lactis subsp. cremoris MG1363 by complementation of an Escherichia coli mutant. The gene was sequenced...

Horse cDNA clones encoding two MHC class I genes

Energy Technology Data Exchange (ETDEWEB)

Barbis, D.P.; Maher, J.K.; Stanek, J.; Klaunberg, B.A.; Antczak, D.F.

1994-12-31

Two full-length clones encoding MHC class I genes were isolated by screening a horse cDNA library, using a probe encoding in human HLA-A2.2Y allele. The library was made in the pcDNA1 vector (Invitrogen, San Diego, CA), using mRNA from peripheral blood lymphocytes obtained from a Thoroughbred stallion (No. 0834) homozygous for a common horse MHC haplotype (ELA-A2, -B2, -D2; Antczak et al. 1984; Donaldson et al. 1988). The clones were sequenced, using SP6 and T7 universal primers and horse-specific oligonucleotides designed to extend previously determined sequences.

Evaluation of gene-expression clustering via mutual information distance measure

Directory of Open Access Journals (Sweden)

Maimon Oded

2007-03-01

Full Text Available Abstract Background The definition of a distance measure plays a key role in the evaluation of different clustering solutions of gene expression profiles. In this empirical study we compare different clustering solutions when using the Mutual Information (MI measure versus the use of the well known Euclidean distance and Pearson correlation coefficient. Results Relying on several public gene expression datasets, we evaluate the homogeneity and separation scores of different clustering solutions. It was found that the use of the MI measure yields a more significant differentiation among erroneous clustering solutions. The proposed measure was also used to analyze the performance of several known clustering algorithms. A comparative study of these algorithms reveals that their "best solutions" are ranked almost oppositely when using different distance measures, despite the found correspondence between these measures when analysing the averaged scores of groups of solutions. Conclusion In view of the results, further attention should be paid to the selection of a proper distance measure for analyzing the clustering of gene expression data.

IGSA: Individual Gene Sets Analysis, including Enrichment and Clustering.

Science.gov (United States)

Wu, Lingxiang; Chen, Xiujie; Zhang, Denan; Zhang, Wubing; Liu, Lei; Ma, Hongzhe; Yang, Jingbo; Xie, Hongbo; Liu, Bo; Jin, Qing

2016-01-01

Analysis of gene sets has been widely applied in various high-throughput biological studies. One weakness in the traditional methods is that they neglect the heterogeneity of genes expressions in samples which may lead to the omission of some specific and important gene sets. It is also difficult for them to reflect the severities of disease and provide expression profiles of gene sets for individuals. We developed an application software called IGSA that leverages a powerful analytical capacity in gene sets enrichment and samples clustering. IGSA calculates gene sets expression scores for each sample and takes an accumulating clustering strategy to let the samples gather into the set according to the progress of disease from mild to severe. We focus on gastric, pancreatic and ovarian cancer data sets for the performance of IGSA. We also compared the results of IGSA in KEGG pathways enrichment with David, GSEA, SPIA, ssGSEA and analyzed the results of IGSA clustering and different similarity measurement methods. Notably, IGSA is proved to be more sensitive and specific in finding significant pathways, and can indicate related changes in pathways with the severity of disease. In addition, IGSA provides with significant gene sets profile for each sample.

Cellulolytic (cel) genes of Clostridium thermocellum F7 and the proteins encoded by them

International Nuclear Information System (INIS)

Piruzyan, E.S.; Mogutov, M.A.; Velikodvorskaya, G.A.; Pushkarskaya, T.A.

1988-01-01

This study is concerned with genes cell, ce12, and ce13 encoding the endoglucanase of the cellulolytic complex of the anaerobic thermophilic Clostridium thermocellum F7 bacteria, these genes having been closed by us earlier. The authors present the characteristics of proteins synthesized by the cel genes in the minicell system of the strain Escherichia coli K-12 X925. The molecular weights of the proteins encoded by genes cell, ce12, and ce13 are 30,000, 45,000, and 50,000 dalton, respectively. The study of the homology of the cloned section of the C. thermocellum DNA containing the endoglucanase genes, using Southern's blot-hybridization method, did not reveal their physical linkage in the genome. The authors detected a plasmid with a size of about 30 kb in the cells of the C. thermocellum F7 strain investigated

Pichia stipitis genomics, transcriptomics, and gene clusters

Science.gov (United States)

Thomas W. Jeffries; Jennifer R. Headman Van Vleet

2009-01-01

Genome sequencing and subsequent global gene expression studies have advanced our understanding of the lignocellulose-fermenting yeast Pichia stipitis. These studies have provided an insight into its central carbon metabolism, and analysis of its genome has revealed numerous functional gene clusters and tandem repeats. Specialized physiological traits are often the...

Identification of the gene encoding the 65-kilodalton DNA-binding protein of herpes simplex virus type 1

International Nuclear Information System (INIS)

Parris, D.S.; Cross, A.; Orr, A.; Frame, M.C.; Murphy, M.; McGeoch, D.J.; Marsden, H.S.; Haarr, L.

1988-01-01

Hybrid arrest of in vitro translation was used to localize the region of the herpes simplex virus type 1 genome encoding the 65-kilodalton DNA-binding protein (65K DBP ) to between genome coordinates 0.592 and 0.649. Knowledge of the DNA sequence of this region allowed us to identify three open reading frames as likely candidates for the gene encoding 65K DBP . Two independent approaches were used to determine which of these three open reading frames encoded the protein. For the first approach a monoclonal antibody, MAb 6898, which reacted specifically with 65K DBP , was isolated. This antibody was used, with the techniques of hybrid arrest of in vitro translation and in vitro translation of selected mRNA, to identify the gene encoding 65K DBP . The second approach involved preparation of antisera directed against oligopeptides corresponding to regions of the predicted amino acid sequence of this gene. These antisera reacted specifically with 65K DBP , thus confirming the gene assignment

The Expression of Genes Encoding Secreted Proteins in Medicago truncatula A17 Inoculated Roots

Directory of Open Access Journals (Sweden)

LUCIA KUSUMAWATI

2013-09-01

Full Text Available Subtilisin-like serine protease (MtSBT, serine carboxypeptidase (MtSCP, MtN5, non-specific lipid transfer protein (MtnsLTP, early nodulin2-like protein (MtENOD2-like, FAD-binding domain containing protein (MtFAD-BP1, and rhicadhesin receptor protein (MtRHRE1 were among 34 proteins found in the supernatant of M. truncatula 2HA and sickle cell suspension cultures. This study investigated the expression of genes encoding those proteins in roots and developing nodules. Two methods were used: quantitative real time RT-PCR and gene expression analysis (with promoter:GUS fusion in roots. Those proteins are predicted as secreted proteins which is indirectly supported by the findings that promoter:GUS fusions of six of the seven genes encoding secreted proteins were strongly expressed in the vascular bundle of transgenic hairy roots. All six genes have expressed in 14-day old nodule. The expression levels of the selected seven genes were quantified in Sinorhizobium-inoculated and control plants using quantitative real time RT-PCR. In conclusion, among seven genes encoding secreted proteins analyzed, the expression level of only one gene, MtN5, was up-regulated significantly in inoculated root segments compared to controls. The expression of MtSBT1, MtSCP1, MtnsLTP, MtFAD-BP1, MtRHRE1 and MtN5 were higher in root tip than in other tissues examined.

A new sodium channel {alpha}-subunit gene (Scn9a) from Schwann cells maps to the Scn1a, Scn2a, Scn3a cluster of mouse chromosome 2

Energy Technology Data Exchange (ETDEWEB)

Beckers, M.C.; Ernst, E.; Gros, P. [McGill Univ., Montreal (Canada)

1996-08-15

We have used a total of 27 AXB/BXA recombinant inbred mouse strains to determine the chromosomal location of a newly identified gene encoding an {alpha}-subunit isoform of the sodium channel from Schwann cells, Scn9a. Linkage analysis established that Scn9a mapped to the proximal segment of mouse chromosome 2. The segregation of restriction fragment length polymorphisms in 145 progeny from a Mus spretus x C57BL/6J backcross indicates that Scn9a is very tightly linked to Scn1a (gene encoding the type I sodium channel {alpha}-subunit of the brain) and forms part of a cluster of four Scna genes located on mouse chromosome 2. 17 refs., 1 fig., 3 tabs.

Genome analysis and identification of gelatinase encoded gene in Enterobacter aerogenes

Science.gov (United States)

Shahimi, Safiyyah; Mutalib, Sahilah Abdul; Khalid, Rozida Abdul; Repin, Rul Aisyah Mat; Lamri, Mohd Fadly; Bakar, Mohd Faizal Abu; Isa, Mohd Noor Mat

2016-11-01

In this study, bioinformatic analysis towards genome sequence of E. aerogenes was done to determine gene encoded for gelatinase. Enterobacter aerogenes was isolated from hot spring water and gelatinase species-specific bacterium to porcine and fish gelatin. This bacterium offers the possibility of enzymes production which is specific to both species gelatine, respectively. Enterobacter aerogenes was partially genome sequenced resulting in 5.0 mega basepair (Mbp) total size of sequence. From pre-process pipeline, 87.6 Mbp of total reads, 68.8 Mbp of total high quality reads and 78.58 percent of high quality percentage was determined. Genome assembly produced 120 contigs with 67.5% of contigs over 1 kilo base pair (kbp), 124856 bp of N50 contig length and 55.17 % of GC base content percentage. About 4705 protein gene was identified from protein prediction analysis. Two candidate genes selected have highest similarity identity percentage against gelatinase enzyme available in Swiss-Prot and NCBI online database. They were NODE_9_length_26866_cov_148.013245_12 containing 1029 base pair (bp) sequence with 342 amino acid sequence and NODE_24_length_155103_cov_177.082458_62 which containing 717 bp sequence with 238 amino acid sequence, respectively. Thus, two paired of primers (forward and reverse) were designed, based on the open reading frame (ORF) of selected genes. Genome analysis of E. aerogenes resulting genes encoded gelatinase were identified.

Comparison of two schemes for automatic keyword extraction from MEDLINE for functional gene clustering.

Science.gov (United States)

Liu, Ying; Ciliax, Brian J; Borges, Karin; Dasigi, Venu; Ram, Ashwin; Navathe, Shamkant B; Dingledine, Ray

2004-01-01

One of the key challenges of microarray studies is to derive biological insights from the unprecedented quatities of data on gene-expression patterns. Clustering genes by functional keyword association can provide direct information about the nature of the functional links among genes within the derived clusters. However, the quality of the keyword lists extracted from biomedical literature for each gene significantly affects the clustering results. We extracted keywords from MEDLINE that describes the most prominent functions of the genes, and used the resulting weights of the keywords as feature vectors for gene clustering. By analyzing the resulting cluster quality, we compared two keyword weighting schemes: normalized z-score and term frequency-inverse document frequency (TFIDF). The best combination of background comparison set, stop list and stemming algorithm was selected based on precision and recall metrics. In a test set of four known gene groups, a hierarchical algorithm correctly assigned 25 of 26 genes to the appropriate clusters based on keywords extracted by the TDFIDF weighting scheme, but only 23 og 26 with the z-score method. To evaluate the effectiveness of the weighting schemes for keyword extraction for gene clusters from microarray profiles, 44 yeast genes that are differentially expressed during the cell cycle were used as a second test set. Using established measures of cluster quality, the results produced from TFIDF-weighted keywords had higher purity, lower entropy, and higher mutual information than those produced from normalized z-score weighted keywords. The optimized algorithms should be useful for sorting genes from microarray lists into functionally discrete clusters.

Clusters of orthologous genes for 41 archaeal genomes and implications for evolutionary genomics of archaea

Directory of Open Access Journals (Sweden)

Wolf Yuri I

2007-11-01

Full Text Available Abstract Background An evolutionary classification of genes from sequenced genomes that distinguishes between orthologs and paralogs is indispensable for genome annotation and evolutionary reconstruction. Shortly after multiple genome sequences of bacteria, archaea, and unicellular eukaryotes became available, an attempt on such a classification was implemented in Clusters of Orthologous Groups of proteins (COGs. Rapid accumulation of genome sequences creates opportunities for refining COGs but also represents a challenge because of error amplification. One of the practical strategies involves construction of refined COGs for phylogenetically compact subsets of genomes. Results New Archaeal Clusters of Orthologous Genes (arCOGs were constructed for 41 archaeal genomes (13 Crenarchaeota, 27 Euryarchaeota and one Nanoarchaeon using an improved procedure that employs a similarity tree between smaller, group-specific clusters, semi-automatically partitions orthology domains in multidomain proteins, and uses profile searches for identification of remote orthologs. The annotation of arCOGs is a consensus between three assignments based on the COGs, the CDD database, and the annotations of homologs in the NR database. The 7538 arCOGs, on average, cover ~88% of the genes in a genome compared to a ~76% coverage in COGs. The finer granularity of ortholog identification in the arCOGs is apparent from the fact that 4538 arCOGs correspond to 2362 COGs; ~40% of the arCOGs are new. The archaeal gene core (protein-coding genes found in all 41 genome consists of 166 arCOGs. The arCOGs were used to reconstruct gene loss and gene gain events during archaeal evolution and gene sets of ancestral forms. The Last Archaeal Common Ancestor (LACA is conservatively estimated to possess 996 genes compared to 1245 and 1335 genes for the last common ancestors of Crenarchaeota and Euryarchaeota, respectively. It is inferred that LACA was a chemoautotrophic hyperthermophile

GraphTeams: a method for discovering spatial gene clusters in Hi-C sequencing data.

Science.gov (United States)

Schulz, Tizian; Stoye, Jens; Doerr, Daniel

2018-05-08

Hi-C sequencing offers novel, cost-effective means to study the spatial conformation of chromosomes. We use data obtained from Hi-C experiments to provide new evidence for the existence of spatial gene clusters. These are sets of genes with associated functionality that exhibit close proximity to each other in the spatial conformation of chromosomes across several related species. We present the first gene cluster model capable of handling spatial data. Our model generalizes a popular computational model for gene cluster prediction, called δ-teams, from sequences to graphs. Following previous lines of research, we subsequently extend our model to allow for several vertices being associated with the same label. The model, called δ-teams with families, is particular suitable for our application as it enables handling of gene duplicates. We develop algorithmic solutions for both models. We implemented the algorithm for discovering δ-teams with families and integrated it into a fully automated workflow for discovering gene clusters in Hi-C data, called GraphTeams. We applied it to human and mouse data to find intra- and interchromosomal gene cluster candidates. The results include intrachromosomal clusters that seem to exhibit a closer proximity in space than on their chromosomal DNA sequence. We further discovered interchromosomal gene clusters that contain genes from different chromosomes within the human genome, but are located on a single chromosome in mouse. By identifying δ-teams with families, we provide a flexible model to discover gene cluster candidates in Hi-C data. Our analysis of Hi-C data from human and mouse reveals several known gene clusters (thus validating our approach), but also few sparsely studied or possibly unknown gene cluster candidates that could be the source of further experimental investigations.

Cloning and characterization of largemouth bass ( Micropterus salmoides) myostatin encoding gene and its promoter

Science.gov (United States)

Li, Shengjie; Bai, Junjie; Wang, Lin

2008-08-01

Myostatin or GDF-8, a member of the transforming growth factor-β (TGF-β) superfamily, has been demonstrated to be a negative regulator of skeletal muscle mass in mammals. In the present study, we obtained a 5.64 kb sequence of myostatin encoding gene and its promoter from largemouth bass ( Micropterus salmoides). The myostatin encoding gene consisted of three exons (488 bp, 371 bp and 1779 bp, respectively) and two introns (390 bp and 855 bp, respectively). The intron-exon boundaries were conservative in comparison with those of mammalian myostatin encoding genes, whereas the size of introns was smaller than that of mammals. Sequence analysis of 1.569 kb of the largemouth bass myostatin gene promoter region revealed that it contained two TATA boxes, one CAAT box and nine putative E-boxes. Putative muscle growth response elements for myocyte enhancer factor 2 (MEF2), serum response factor (SRF), activator protein 1 (AP1), etc., and muscle-specific Mt binding site (MTBF) were also detected. Some of the transcription factor binding sites were conserved among five teleost species. This information will be useful for studying the transcriptional regulation of myostatin in fish.

Clusters of Antibiotic Resistance Genes Enriched Together Stay Together in Swine Agriculture.

Science.gov (United States)

Johnson, Timothy A; Stedtfeld, Robert D; Wang, Qiong; Cole, James R; Hashsham, Syed A; Looft, Torey; Zhu, Yong-Guan; Tiedje, James M

2016-04-12

Antibiotic resistance is a worldwide health risk, but the influence of animal agriculture on the genetic context and enrichment of individual antibiotic resistance alleles remains unclear. Using quantitative PCR followed by amplicon sequencing, we quantified and sequenced 44 genes related to antibiotic resistance, mobile genetic elements, and bacterial phylogeny in microbiomes from U.S. laboratory swine and from swine farms from three Chinese regions. We identified highly abundant resistance clusters: groups of resistance and mobile genetic element alleles that cooccur. For example, the abundance of genes conferring resistance to six classes of antibiotics together with class 1 integrase and the abundance of IS6100-type transposons in three Chinese regions are directly correlated. These resistance cluster genes likely colocalize in microbial genomes in the farms. Resistance cluster alleles were dramatically enriched (up to 1 to 10% as abundant as 16S rRNA) and indicate that multidrug-resistant bacteria are likely the norm rather than an exception in these communities. This enrichment largely occurred independently of phylogenetic composition; thus, resistance clusters are likely present in many bacterial taxa. Furthermore, resistance clusters contain resistance genes that confer resistance to antibiotics independently of their particular use on the farms. Selection for these clusters is likely due to the use of only a subset of the broad range of chemicals to which the clusters confer resistance. The scale of animal agriculture and its wastes, the enrichment and horizontal gene transfer potential of the clusters, and the vicinity of large human populations suggest that managing this resistance reservoir is important for minimizing human risk. Agricultural antibiotic use results in clusters of cooccurring resistance genes that together confer resistance to multiple antibiotics. The use of a single antibiotic could select for an entire suite of resistance genes if

Relating genes to function: identifying enriched transcription factors using the ENCODE ChIP-Seq significance tool.

Science.gov (United States)

Auerbach, Raymond K; Chen, Bin; Butte, Atul J

2013-08-01

Biological analysis has shifted from identifying genes and transcripts to mapping these genes and transcripts to biological functions. The ENCODE Project has generated hundreds of ChIP-Seq experiments spanning multiple transcription factors and cell lines for public use, but tools for a biomedical scientist to analyze these data are either non-existent or tailored to narrow biological questions. We present the ENCODE ChIP-Seq Significance Tool, a flexible web application leveraging public ENCODE data to identify enriched transcription factors in a gene or transcript list for comparative analyses. The ENCODE ChIP-Seq Significance Tool is written in JavaScript on the client side and has been tested on Google Chrome, Apple Safari and Mozilla Firefox browsers. Server-side scripts are written in PHP and leverage R and a MySQL database. The tool is available at http://encodeqt.stanford.edu. abutte@stanford.edu Supplementary material is available at Bioinformatics online.

Cloning and characterization of the gsk gene encoding guanosine kinase of Escherichia coli

DEFF Research Database (Denmark)

Harlow, Kenneth W.; Nygaard, Per; Hove-Jensen, Bjarne

1995-01-01

The Escherichia coli gsk gene encoding guanosine kinase was cloned from the Kohara gene library by complementation of the E. coli gsk-1 mutant allele. The cloned DNA fragment was sequenced and shown to encode a putative polypeptide of 433 amino acids with a molecular mass of 48,113 Da. Minicell...

Isolation of Clostridium difficile and Detection of A and B Toxins Encoding Genes

Directory of Open Access Journals (Sweden)

Abbas Ali Imani Fooladi

2014-02-01

Full Text Available Background: Clostridium difficile is the most important anaerobic, gram positive, spore forming bacillus which is known as a prevalent factor leading to antibiotic associated diarrheas and is the causative agent of pseudomembrane colitis. The role of this bacterium along with the over use of antibiotics have been proved to result in colitis. The major virulence factors of these bacteria are the A and B toxins. Objectives: The purpose of this study was to isolate C. difficile from stool samples and detect A and B toxins encoding genes, in order toserve as a routine method for clinical diagnosis. Materials and Methods: Recognition of A and B toxins encoding genes by uniplex and multiplex PCR using two pairs of primers from 136 accumulated stool samples. Results: Results of the present study showed that out of 136 stool samples, three C. difficile were isolated and these strains contained A and B toxins encoding genes. Conclusions: It was concluded that although detection of C. difficile from stool samples based on PCR (polymerase chain reaction is expensive, yet this method is more sensitive and less time-consuming than culture methods and can be used as a clinical laboratory test.

Challenges in microarray class discovery: a comprehensive examination of normalization, gene selection and clustering

Directory of Open Access Journals (Sweden)

Landfors Mattias

2010-10-01

Full Text Available Abstract Background Cluster analysis, and in particular hierarchical clustering, is widely used to extract information from gene expression data. The aim is to discover new classes, or sub-classes, of either individuals or genes. Performing a cluster analysis commonly involve decisions on how to; handle missing values, standardize the data and select genes. In addition, pre-processing, involving various types of filtration and normalization procedures, can have an effect on the ability to discover biologically relevant classes. Here we consider cluster analysis in a broad sense and perform a comprehensive evaluation that covers several aspects of cluster analyses, including normalization. Result We evaluated 2780 cluster analysis methods on seven publicly available 2-channel microarray data sets with common reference designs. Each cluster analysis method differed in data normalization (5 normalizations were considered, missing value imputation (2, standardization of data (2, gene selection (19 or clustering method (11. The cluster analyses are evaluated using known classes, such as cancer types, and the adjusted Rand index. The performances of the different analyses vary between the data sets and it is difficult to give general recommendations. However, normalization, gene selection and clustering method are all variables that have a significant impact on the performance. In particular, gene selection is important and it is generally necessary to include a relatively large number of genes in order to get good performance. Selecting genes with high standard deviation or using principal component analysis are shown to be the preferred gene selection methods. Hierarchical clustering using Ward's method, k-means clustering and Mclust are the clustering methods considered in this paper that achieves the highest adjusted Rand. Normalization can have a significant positive impact on the ability to cluster individuals, and there are indications that

Challenges in microarray class discovery: a comprehensive examination of normalization, gene selection and clustering

Science.gov (United States)

2010-01-01

Background Cluster analysis, and in particular hierarchical clustering, is widely used to extract information from gene expression data. The aim is to discover new classes, or sub-classes, of either individuals or genes. Performing a cluster analysis commonly involve decisions on how to; handle missing values, standardize the data and select genes. In addition, pre-processing, involving various types of filtration and normalization procedures, can have an effect on the ability to discover biologically relevant classes. Here we consider cluster analysis in a broad sense and perform a comprehensive evaluation that covers several aspects of cluster analyses, including normalization. Result We evaluated 2780 cluster analysis methods on seven publicly available 2-channel microarray data sets with common reference designs. Each cluster analysis method differed in data normalization (5 normalizations were considered), missing value imputation (2), standardization of data (2), gene selection (19) or clustering method (11). The cluster analyses are evaluated using known classes, such as cancer types, and the adjusted Rand index. The performances of the different analyses vary between the data sets and it is difficult to give general recommendations. However, normalization, gene selection and clustering method are all variables that have a significant impact on the performance. In particular, gene selection is important and it is generally necessary to include a relatively large number of genes in order to get good performance. Selecting genes with high standard deviation or using principal component analysis are shown to be the preferred gene selection methods. Hierarchical clustering using Ward's method, k-means clustering and Mclust are the clustering methods considered in this paper that achieves the highest adjusted Rand. Normalization can have a significant positive impact on the ability to cluster individuals, and there are indications that background correction is

Identification and Characterization of an Autolysin-Encoding Gene of Streptococcus mutans

OpenAIRE

Shibata, Yukie; Kawada, Miki; Nakano, Yoshio; Toyoshima, Kuniaki; Yamashita, Yoshihisa

2005-01-01

We identified a gene (atlA) encoding autolytic activity from Streptococcus mutans Xc. The AtlA protein predicted to be encoded by atlA is composed of 979 amino acids with a molecular weight of 107,279 and has a conserved β-1,4-N-acetylmuramidase (lysozyme) domain in the C-terminal portion. Sodium dodecyl sulfate extracts of strain Xc showed two major bacteriolytic bands with molecular masses of 107 and 79 kDa, both of which were absent from a mutant with inactivated atlA. Western blot analysi...

Recombinant vectors construction for cellobiohydrolase encoding gene constitutive expression

Directory of Open Access Journals (Sweden)

Leontina GURGU

2012-12-01

Full Text Available Cellobiohydrolases (EC 3.2.1.91 are important exo enzymes involved in cellulose hydrolysis alongside endoglucanases (EC 3.2.1.4 and β-glucosidases (EC 3.2.1.21. Heterologous cellobiohydrolase gene expression under constitutive promoter control using Saccharomyces cerevisiae as host system is of great importance for a successful SSF process. From this point of view, the main objective of the work was to use Yeplac181 expression vector as a recipient for cellobiohdrolase - cbhB encoding gene expression under the control of the actin promoter, in Saccharomyces cerevisiae. Two hybridvectors, YEplac-Actp and YEplac-Actp-CbhB, were generated usingEscherichia coli XLI Blue for the cloning experiments. Constitutive cbhB gene expression was checked by proteine gel electrophoresis (SDS-PAGE after insertion of these constructs into Saccharomyces cerevisiae.

Analysis of the structural genes encoding M-factor in the fission yeast Schizosaccharomyces pombe: identification of a third gene, mfm3

DEFF Research Database (Denmark)

Kjaerulff, S; Davey, William John; Nielsen, O

1994-01-01

We previously identified two genes, mfm1 and mfm2, with the potential to encode the M-factor mating pheromone of the fission yeast Schizosaccharomyces pombe (J. Davey, EMBO J. 11:951-960, 1992), but further analysis revealed that a mutant strain lacking both genes still produced active M-factor. ......We previously identified two genes, mfm1 and mfm2, with the potential to encode the M-factor mating pheromone of the fission yeast Schizosaccharomyces pombe (J. Davey, EMBO J. 11:951-960, 1992), but further analysis revealed that a mutant strain lacking both genes still produced active M...... that is not rescued by addition of exogenous M-factor. A mutational analysis reveals that all three mfm genes contribute to the production of M-factor. Their transcription is limited to M cells and requires the mat1-Mc and ste11 gene products. Each gene is induced when the cells are starved of nitrogen and further...

Detailed analysis of putative genes encoding small proteins in legume genomes

Directory of Open Access Journals (Sweden)

Gabriel eGuillén

2013-06-01

Full Text Available Diverse plant genome sequencing projects coupled with powerful bioinformatics tools have facilitated massive data analysis to construct specialized databases classified according to cellular function. However, there are still a considerable number of genes encoding proteins whose function has not yet been characterized. Included in this category are small proteins (SPs, 30-150 amino acids encoded by short open reading frames (sORFs. SPs play important roles in plant physiology, growth, and development. Unfortunately, protocols focused on the genome-wide identification and characterization of sORFs are scarce or remain poorly implemented. As a result, these genes are underrepresented in many genome annotations. In this work, we exploited publicly available genome sequences of Phaseolus vulgaris, Medicago truncatula, Glycine max and Lotus japonicus to analyze the abundance of annotated SPs in plant legumes. Our strategy to uncover bona fide sORFs at the genome level was centered in bioinformatics analysis of characteristics such as evidence of expression (transcription, presence of known protein regions or domains, and identification of orthologous genes in the genomes explored. We collected 6170, 10461, 30521, and 23599 putative sORFs from P. vulgaris, G. max, M. truncatula, and L. japonicus genomes, respectively. Expressed sequence tags (ESTs available in the DFCI Gene Index database provided evidence that ~one-third of the predicted legume sORFs are expressed. Most potential SPs have a counterpart in a different plant species and counterpart regions or domains in larger proteins. Potential functional sORFs were also classified according to a reduced set of GO categories, and the expression of 13 of them during P. vulgaris nodule ontogeny was confirmed by qPCR. This analysis provides a collection of sORFs that potentially encode for meaningful SPs, and offers the possibility of their further functional evaluation.

Genetic analysis of the VP2-encoding gene of canine parvovirus strains from Africa.

Science.gov (United States)

Dogonyaro, Banenat B; Bosman, Anna-Mari; Sibeko, Kgomotso P; Venter, Estelle H; van Vuuren, Moritz

2013-08-30

Since the emergence of canine parvovirus type-2 (CPV-2) in the early 1970s, it has been evolving into novel genetic and antigenic variants (CPV-2a, 2b and 2c) that are unevenly distributed throughout the world. Genetic characterization of CPV-2 has not been documented in Africa since 1998 apart from the study carried out in Tunisia 2009. A total of 139 field samples were collected from South Africa and Nigeria, detected using PCR and the full length VP2-encoding gene of 27 positive samples were sequenced and genetically analyzed. Nigerian samples (n=6), South Africa (n=19) and vaccine strains (n=2) were compared with existing sequences obtained from GenBank. The results showed the presence of both CPV-2a and 2b in South Africa and only CPV-2a in Nigeria. No CPV-2c strain was detected during this study. Phylogenetic analysis showed a clustering not strictly associated with the geographical origin of the analyzed strains, although most of the South African strains tended to cluster together and the viral strains analyzed in this study were not completely distinct from CPV-2 strains from other parts of the world. Amino acid analysis showed predicted amino acid changes. Copyright © 2013 Elsevier B.V. All rights reserved.

Extensive polycistronism and antisense transcription in the mammalian Hox clusters.

Directory of Open Access Journals (Sweden)

Gaëll Mainguy

Full Text Available The Hox clusters play a crucial role in body patterning during animal development. They encode both Hox transcription factor and micro-RNA genes that are activated in a precise temporal and spatial sequence that follows their chromosomal order. These remarkable collinear properties confer functional unit status for Hox clusters. We developed the TranscriptView platform to establish high resolution transcriptional profiling and report here that transcription in the Hox clusters is far more complex than previously described in both human and mouse. Unannotated transcripts can represent up to 60% of the total transcriptional output of a cluster. In particular, we identified 14 non-coding Transcriptional Units antisense to Hox genes, 10 of which (70% have a detectable mouse homolog. Most of these Transcriptional Units in both human and mouse present conserved sizeable sequences (>40 bp overlapping Hox transcripts, suggesting that these Hox antisense transcripts are functional. Hox clusters also display at least seven polycistronic clusters, i.e., different genes being co-transcribed on long isoforms (up to 30 kb. This work provides a reevaluated framework for understanding Hox gene function and dys-function. Such extensive transcriptions may provide a structural explanation for Hox clustering.

Detection of β-lactamase encoding genes in feces, soil and water from a Brazilian pig farm.

Science.gov (United States)

Furlan, João Pedro Rueda; Stehling, Eliana Guedes

2018-01-10

β-lactam antibiotics are widely used for the treatment of different types of infections worldwide and the resistance to these antibiotics has grown sharply, which is of great concern. Resistance to β-lactams in gram-negative bacteria is mainly due to the production of β-lactamases, which are classified according to their functional activities. The aim of this study was to verify the presence of β-lactamases encoding genes in feces, soil, and water from a Brazilian pig farm. Different β-lactamases encoding genes were found, including bla CTX-M-Gp1 , bla CTX-M-Gp9 , bla SHV , bla OXA-1-like , bla GES , and bla VEB . The bla SHV and bla CTX-M-Gp1 genes have been detected in all types of samples, indicating the spread of β-lactam resistant bacteria among farm pigs and the environment around them. These results indicate that β-lactamase encoding genes belonging to the cloxacillinase, ESBL, and carbapenemase and they have high potential to spread in different sources, due to the fact that genes are closely related to mobile genetic elements, especially plasmids.

Bioinformatics Analysis of NBS-LRR Encoding Resistance Genes in Setaria italica.

Science.gov (United States)

Zhao, Yan; Weng, Qiaoyun; Song, Jinhui; Ma, Hailian; Yuan, Jincheng; Dong, Zhiping; Liu, Yinghui

2016-06-01

In plants, resistance (R) genes are involved in pathogen recognition and subsequent activation of innate immune responses. The nucleotide-binding site-leucine-rich repeat (NBS-LRR) genes family forms the largest R-gene family among plant genomes and play an important role in plant disease resistance. In this paper, comprehensive analysis of NBS-encoding genes is performed in the whole Setaria italica genome. A total of 96 NBS-LRR genes are identified, and comprehensive overview of the NBS-LRR genes is undertaken, including phylogenetic analysis, chromosome locations, conserved motifs of proteins, and gene expression. Based on the domain, these genes are divided into two groups and distributed in all Setaria italica chromosomes. Most NBS-LRR genes are located at the distal tip of the long arms of the chromosomes. Setaria italica NBS-LRR proteins share at least one nucleotide-biding domain and one leucine-rich repeat domain. Our results also show the duplication of NBS-LRR genes in Setaria italica is related to their gene structure.

Transcriptome sequencing of Mycosphaerella fijiensis during association with Musa acuminata reveals candidate pathogenicity genes.

Science.gov (United States)

Noar, Roslyn D; Daub, Margaret E

2016-08-30

Mycosphaerella fijiensis, causative agent of the black Sigatoka disease of banana, is considered the most economically damaging banana disease. Despite its importance, the genetics of pathogenicity are poorly understood. Previous studies have characterized polyketide pathways with possible roles in pathogenicity. To identify additional candidate pathogenicity genes, we compared the transcriptome of this fungus during the necrotrophic phase of infection with that during saprophytic growth in medium. Transcriptome analysis was conducted, and the functions of differentially expressed genes were predicted by identifying conserved domains, Gene Ontology (GO) annotation and GO enrichment analysis, Carbohydrate-Active EnZymes (CAZy) annotation, and identification of genes encoding effector-like proteins. The analysis showed that genes commonly involved in secondary metabolism have higher expression in infected leaf tissue, including genes encoding cytochrome P450s, short-chain dehydrogenases, and oxidoreductases in the 2-oxoglutarate and Fe(II)-dependent oxygenase superfamily. Other pathogenicity-related genes with higher expression in infected leaf tissue include genes encoding salicylate hydroxylase-like proteins, hydrophobic surface binding proteins, CFEM domain-containing proteins, and genes encoding secreted cysteine-rich proteins characteristic of effectors. More genes encoding amino acid transporters, oligopeptide transporters, peptidases, proteases, proteinases, sugar transporters, and proteins containing Domain of Unknown Function (DUF) 3328 had higher expression in infected leaf tissue, while more genes encoding inhibitors of peptidases and proteinases had higher expression in medium. Sixteen gene clusters with higher expression in leaf tissue were identified including clusters for the synthesis of a non-ribosomal peptide. A cluster encoding a novel fusicoccane was also identified. Two putative dispensable scaffolds were identified with a large proportion of

Inactivation of human α-globin gene expression by a de novo deletion located upstream of the α-globin gene cluster

International Nuclear Information System (INIS)

Liebhaber, S.A.; Weiss, I.; Cash, F.E.; Griese, E.U.; Horst, J.; Ayyub, H.; Higgs, D.R.

1990-01-01

Synthesis of normal human hemoglobin A, α 2 β 2 , is based upon balanced expression of genes in the α-globin gene cluster on chromosome 15 and the β-globin gene cluster on chromosome 11. Full levels of erythroid-specific activation of the β-globin cluster depend on sequences located at a considerable distance 5' to the β-globin gene, referred to as the locus-activating or dominant control region. The existence of an analogous element(s) upstream of the α-globin cluster has been suggested from observations on naturally occurring deletions and experimental studies. The authors have identified an individual with α-thalassemia in whom structurally normal α-globin genes have been inactivated in cis by a discrete de novo 35-kilobase deletion located ∼30 kilobases 5' from the α-globin gene cluster. They conclude that this deletion inactivates expression of the α-globin genes by removing one or more of the previously identified upstream regulatory sequences that are critical to expression of the α-globin genes

Transcriptional analysis of the jamaicamide gene cluster from the marine cyanobacterium Lyngbya majuscula and identification of possible regulatory proteins

Directory of Open Access Journals (Sweden)

Dorrestein Pieter C

2009-12-01

Full Text Available Abstract Background The marine cyanobacterium Lyngbya majuscula is a prolific producer of bioactive secondary metabolites. Although biosynthetic gene clusters encoding several of these compounds have been identified, little is known about how these clusters of genes are transcribed or regulated, and techniques targeting genetic manipulation in Lyngbya strains have not yet been developed. We conducted transcriptional analyses of the jamaicamide gene cluster from a Jamaican strain of Lyngbya majuscula, and isolated proteins that could be involved in jamaicamide regulation. Results An unusually long untranslated leader region of approximately 840 bp is located between the jamaicamide transcription start site (TSS and gene cluster start codon. All of the intergenic regions between the pathway ORFs were transcribed into RNA in RT-PCR experiments; however, a promoter prediction program indicated the possible presence of promoters in multiple intergenic regions. Because the functionality of these promoters could not be verified in vivo, we used a reporter gene assay in E. coli to show that several of these intergenic regions, as well as the primary promoter preceding the TSS, are capable of driving β-galactosidase production. A protein pulldown assay was also used to isolate proteins that may regulate the jamaicamide pathway. Pulldown experiments using the intergenic region upstream of jamA as a DNA probe isolated two proteins that were identified by LC-MS/MS. By BLAST analysis, one of these had close sequence identity to a regulatory protein in another cyanobacterial species. Protein comparisons suggest a possible correlation between secondary metabolism regulation and light dependent complementary chromatic adaptation. Electromobility shift assays were used to evaluate binding of the recombinant proteins to the jamaicamide promoter region. Conclusion Insights into natural product regulation in cyanobacteria are of significant value to drug discovery

Identification of chitinolytic bacteria isolated from shrimp pond sediment and characterization of their chitinase encoding gene

Science.gov (United States)

Triwijayani, A. U.; Puspita, I. D.; Murwantoko; Ustadi

2018-03-01

Chitinolytic bacteria are a group of bacteria owning enzymes that able to hydrolyze chitin. Previously, we isolated chitinolytic bacteria from shrimp pond sediment in Bantul, Yogyakarta, and obtained five isolates showing high chitinolytic index named as isolate PT1, PT2, PT5, PT6 and PB2. The aims of this study were to identify chitinolytic bacteria isolated from shrimp pond sediment and to characterize the chitinase encoding gene from each isolate. The molecular technique was performed by amplification of 16S rDNA, amplification of chitinase encoding gene and sequence analysis. Two chitinolytic bacteria of PT1 and PT2 were similar to Aeromonas bivalvium strain D15, PT5 to Pseudomonas stutzeri strain BD-2.2.1, PT6 to Serratia marcescens strain FZSF02 and PB2 to Streptomyces misionensis strain OsiRt-1. The comparison of chitinase encoding gene between three isolates with those in Gen Bank shows that PT1 had similar sequences with the chi1 gene in Aeromonas sp. 17m, PT2 with chi1 gene in A. caviae (CB101) and PT6 with chiB gene in S. Marcescens (BJL200).

Single Nucleotide Polymorphisms in the FADS Gene Cluster but not the ELOVL2 Gene are Associated with Serum Polyunsaturated Fatty Acid Composition and Development of Allergy (in a Swedish Birth Cohort

Directory of Open Access Journals (Sweden)

Malin Barman

2015-12-01

Full Text Available Exposure to polyunsaturated fatty acids (PUFA influences immune function and may affect the risk of allergy development. Long chain PUFAs are produced from dietary precursors catalyzed by desaturases and elongases encoded by FADS and ELOVL genes. In 211 subjects, we investigated whether polymorphisms in the FADS gene cluster and the ELOVL2 gene were associated with allergy or PUFA composition in serum phospholipids in a Swedish birth-cohort sampled at birth and at 13 years of age; allergy was diagnosed at 13 years of age. Minor allele carriers of rs102275 and rs174448 (FADS gene cluster had decreased proportions of 20:4 n-6 in cord and adolescent serum and increased proportions of 20:3 n-6 in cord serum as well as a nominally reduced risk of developing atopic eczema, but not respiratory allergy, at 13 years of age. Minor allele carriers of rs17606561 in the ELOVL2 gene had nominally decreased proportions of 20:4 n-6 in cord serum but ELOVL polymorphisms (rs2236212 and rs17606561 were not associated with allergy development. Thus, reduced capacity to desaturase n-6 PUFAs due to FADS polymorphisms was nominally associated with reduced risk for eczema development, which could indicate a pathogenic role for long-chain PUFAs in allergy development.

Medicago truncatula contains a second gene encoding a plastid located glutamine synthetase exclusively expressed in developing seeds

Directory of Open Access Journals (Sweden)

Seabra Ana R

2010-08-01

Full Text Available Abstract Background Nitrogen is a crucial nutrient that is both essential and rate limiting for plant growth and seed production. Glutamine synthetase (GS, occupies a central position in nitrogen assimilation and recycling, justifying the extensive number of studies that have been dedicated to this enzyme from several plant sources. All plants species studied to date have been reported as containing a single, nuclear gene encoding a plastid located GS isoenzyme per haploid genome. This study reports the existence of a second nuclear gene encoding a plastid located GS in Medicago truncatula. Results This study characterizes a new, second gene encoding a plastid located glutamine synthetase (GS2 in M. truncatula. The gene encodes a functional GS isoenzyme with unique kinetic properties, which is exclusively expressed in developing seeds. Based on molecular data and the assumption of a molecular clock, it is estimated that the gene arose from a duplication event that occurred about 10 My ago, after legume speciation and that duplicated sequences are also present in closely related species of the Vicioide subclade. Expression analysis by RT-PCR and western blot indicate that the gene is exclusively expressed in developing seeds and its expression is related to seed filling, suggesting a specific function of the enzyme associated to legume seed metabolism. Interestingly, the gene was found to be subjected to alternative splicing over the first intron, leading to the formation of two transcripts with similar open reading frames but varying 5' UTR lengths, due to retention of the first intron. To our knowledge, this is the first report of alternative splicing on a plant GS gene. Conclusions This study shows that Medicago truncatula contains an additional GS gene encoding a plastid located isoenzyme, which is functional and exclusively expressed during seed development. Legumes produce protein-rich seeds requiring high amounts of nitrogen, we postulate

Dominant control region of the human β- like globin gene cluster

NARCIS (Netherlands)

Blom van Assendelft, Margaretha van

1989-01-01

The structure and regulation of the human β -like globin gene cluster has been studied extensively. Genetic disorders connected with this gene cluster are responsible for human diseases associated with high levels of morbidity and mortality, such as β-thalassaemia and sickle cell anaemia. The work

The porcine lymphotropic herpesvirus 1 encodes functional regulators of gene expression

International Nuclear Information System (INIS)

Lindner, I.; Ehlers, B.; Noack, S.; Dural, G.; Yasmum, N.; Bauer, C.; Goltz, M.

2007-01-01

The porcine lymphotropic herpesviruses (PLHV) are discussed as possible risk factors in xenotransplantation because of the high prevalence of PLHV-1, PLHV-2 and PLHV-3 in pig populations world-wide and the fact that PLHV-1 has been found to be associated with porcine post-transplant lymphoproliferative disease. To provide structural and functional knowledge on the PLHV immediate-early (IE) transactivator genes, the central regions of the PLHV genomes were characterized by genome walking, sequence and splicing analysis. Three spliced genes were identified (ORF50, ORFA6/BZLF1 h , ORF57) encoding putative IE transactivators, homologous to (i) ORF50 and BRLF1/Rta (ii) K8/K-bZIP and BZLF1/Zta and (iii) ORF57 and BMLF1 of HHV-8 and EBV, respectively. Expressed as myc-tag or HA-tag fusion proteins, they were located to the cellular nucleus. In reporter gene assays, several PLHV-promoters were mainly activated by PLHV-1 ORF50, to a lower level by PLHV-1 ORFA6/BZLF1 h and not by PLHV-1 ORF57. However, the ORF57-encoded protein acted synergistically on ORF50-mediated activation

Hessian regularization based non-negative matrix factorization for gene expression data clustering.

Science.gov (United States)

Liu, Xiao; Shi, Jun; Wang, Congzhi

2015-01-01

Since a key step in the analysis of gene expression data is to detect groups of genes that have similar expression patterns, clustering technique is then commonly used to analyze gene expression data. Data representation plays an important role in clustering analysis. The non-negative matrix factorization (NMF) is a widely used data representation method with great success in machine learning. Although the traditional manifold regularization method, Laplacian regularization (LR), can improve the performance of NMF, LR still suffers from the problem of its weak extrapolating power. Hessian regularization (HR) is a newly developed manifold regularization method, whose natural properties make it more extrapolating, especially for small sample data. In this work, we propose the HR-based NMF (HR-NMF) algorithm, and then apply it to represent gene expression data for further clustering task. The clustering experiments are conducted on five commonly used gene datasets, and the results indicate that the proposed HR-NMF outperforms LR-based NMM and original NMF, which suggests the potential application of HR-NMF for gene expression data.

Multigene families encode the major enzymes of antioxidant metabolism in Eucalyptus grandis L

Directory of Open Access Journals (Sweden)

Felipe Karam Teixeira

2005-01-01

Full Text Available Antioxidant metabolism protects cells from oxidative damage caused by reactive oxygen species (ROS. In plants, several enzymes act jointly to maintain redox homeostasis. Moreover, isoform diversity contributes to the fine tuning necessary for plant responses to both exogenous and endogenous signals influencing antioxidant metabolism. This study aimed to provide a comprehensive view of the major classes of antioxidant enzymes in the woody species Eucalyptus grandis. A careful survey of the FORESTs data bank revealed 36 clusters as encoding antioxidant enzymes: six clusters encoding ascorbate peroxidase (APx isozymes, three catalase (CAT proteins, three dehydroascorbate reductase (DHAR, two glutathione reductase (GR isozymes, four monodehydroascorbate reductase (MDHAR, six phospholipid hydroperoxide glutathione peroxidases (PhGPx, and 12 encoding superoxide dismutases (SOD isozymes. Phylogenetic analysis demonstrated that all clusters (identified herein grouped with previously characterized antioxidant enzymes, corroborating the analysis performed. With respect to enzymes involved in the ascorbate-glutathione cycle, both cytosolic and chloroplastic isoforms were putatively identified. These sequences were widely distributed among the different ESTs libraries indicating a broad gene expression pattern. Overall, the data indicate the importance of antioxidant metabolism in eucalyptus.

Identification of the Gene Encoding Isoprimeverose-producing Oligoxyloglucan Hydrolase in Aspergillus oryzae*

Science.gov (United States)

Matsuzawa, Tomohiko; Mitsuishi, Yasushi; Kameyama, Akihiko

2016-01-01

Aspergillus oryzae produces a unique β-glucosidase, isoprimeverose-producing oligoxyloglucan hydrolase (IPase), that recognizes and releases isoprimeverose (α-d-xylopyranose-(1→6)-d-glucopyranose) units from the non-reducing ends of oligoxyloglucans. A gene encoding A. oryzae IPase, termed ipeA, was identified and expressed in Pichia pastoris. With the exception of cellobiose, IpeA hydrolyzes a variety of oligoxyloglucans and is a member of the glycoside hydrolase family 3. Xylopyranosyl branching at the non-reducing ends was vital for IPase activity, and galactosylation at a α-1,6-linked xylopyranosyl side chain completely abolished IpeA activity. Hepta-oligoxyloglucan saccharide (Xyl3Glc4) substrate was preferred over tri- (Xyl1Glc2) and tetra- (Xyl2Glc2) oligoxyloglucan saccharides substrates. IpeA transferred isoprimeverose units to other saccharides, indicating transglycosylation activity. The ipeA gene was expressed in xylose and xyloglucan media and was strongly induced in the presence of xyloglucan endo-xyloglucanase-hydrolyzed products. This is the first study to report the identification of a gene encoding IPase in eukaryotes. PMID:26755723

Gene Cluster Responsible for Secretion of and Immunity to Multiple Bacteriocins, the NKR-5-3 Enterocins

Science.gov (United States)

Ishibashi, Naoki; Himeno, Kohei; Masuda, Yoshimitsu; Perez, Rodney Honrada; Iwatani, Shun; Wilaipun, Pongtep; Leelawatcharamas, Vichien; Nakayama, Jiro; Sonomoto, Kenji

2014-01-01

Enterococcus faecium NKR-5-3, isolated from Thai fermented fish, is characterized by the unique ability to produce five bacteriocins, namely, enterocins NKR-5-3A, -B, -C, -D, and -Z (Ent53A, Ent53B, Ent53C, Ent53D, and Ent53Z). Genetic analysis with a genome library revealed that the bacteriocin structural genes (enkA [ent53A], enkC [ent53C], enkD [ent53D], and enkZ [ent53Z]) that encode these peptides (except for Ent53B) are located in close proximity to each other. This NKR-5-3ACDZ (Ent53ACDZ) enterocin gene cluster (approximately 13 kb long) includes certain bacteriocin biosynthetic genes such as an ABC transporter gene (enkT), two immunity genes (enkIaz and enkIc), a response regulator (enkR), and a histidine protein kinase (enkK). Heterologous-expression studies of enkT and ΔenkT mutant strains showed that enkT is responsible for the secretion of Ent53A, Ent53C, Ent53D, and Ent53Z, suggesting that EnkT is a wide-range ABC transporter that contributes to the effective production of these bacteriocins. In addition, EnkIaz and EnkIc were found to confer self-immunity to the respective bacteriocins. Furthermore, bacteriocin induction assays performed with the ΔenkRK mutant strain showed that EnkR and EnkK are regulatory proteins responsible for bacteriocin production and that, together with Ent53D, they constitute a three-component regulatory system. Thus, the Ent53ACDZ gene cluster is essential for the biosynthesis and regulation of NKR-5-3 enterocins, and this is, to our knowledge, the first report that demonstrates the secretion of multiple bacteriocins by an ABC transporter. PMID:25149515

Conservation of gene linkage in dispersed vertebrate NK homeobox clusters.

Science.gov (United States)

Wotton, Karl R; Weierud, Frida K; Juárez-Morales, José L; Alvares, Lúcia E; Dietrich, Susanne; Lewis, Katharine E

2009-10-01

Nk homeobox genes are important regulators of many different developmental processes including muscle, heart, central nervous system and sensory organ development. They are thought to have arisen as part of the ANTP megacluster, which also gave rise to Hox and ParaHox genes, and at least some NK genes remain tightly linked in all animals examined so far. The protostome-deuterostome ancestor probably contained a cluster of nine Nk genes: (Msx)-(Nk4/tinman)-(Nk3/bagpipe)-(Lbx/ladybird)-(Tlx/c15)-(Nk7)-(Nk6/hgtx)-(Nk1/slouch)-(Nk5/Hmx). Of these genes, only NKX2.6-NKX3.1, LBX1-TLX1 and LBX2-TLX2 remain tightly linked in humans. However, it is currently unclear whether this is unique to the human genome as we do not know which of these Nk genes are clustered in other vertebrates. This makes it difficult to assess whether the remaining linkages are due to selective pressures or because chance rearrangements have "missed" certain genes. In this paper, we identify all of the paralogs of these ancestrally clustered NK genes in several distinct vertebrates. We demonstrate that tight linkages of Lbx1-Tlx1, Lbx2-Tlx2 and Nkx3.1-Nkx2.6 have been widely maintained in both the ray-finned and lobe-finned fish lineages. Moreover, the recently duplicated Hmx2-Hmx3 genes are also tightly linked. Finally, we show that Lbx1-Tlx1 and Hmx2-Hmx3 are flanked by highly conserved noncoding elements, suggesting that shared regulatory regions may have resulted in evolutionary pressure to maintain these linkages. Consistent with this, these pairs of genes have overlapping expression domains. In contrast, Lbx2-Tlx2 and Nkx3.1-Nkx2.6, which do not seem to be coexpressed, are also not associated with conserved noncoding sequences, suggesting that an alternative mechanism may be responsible for the continued clustering of these genes.

Cloning of gene-encoded stem bromelain on system coming from Pichia pastoris as therapeutic protein candidate

Science.gov (United States)

Yusuf, Y.; Hidayati, W.

2018-01-01

The process of identifying bacterial recombination using PCR, and restriction, and then sequencing process was done after identifying the bacteria. This research aimed to get a yeast cell of Pichia pastoris which has an encoder gene of stem bromelain enzyme. The production of recombinant stem bromelain enzymes using yeast cells of P. pastoris can produce pure bromelain rod enzymes and have the same conformation with the enzyme’s conformation in pineapple plants. This recombinant stem bromelain enzyme can be used as a therapeutic protein in inflammatory, cancer and degenerative diseases. This study was an early stage of a step series to obtain bromelain rod protein derived from pineapple made with genetic engineering techniques. This research was started by isolating the RNA of pineapple stem which was continued with constructing cDNA using reserve transcriptase-PCR technique (RT-PCR), doing the amplification of bromelain enzyme encoder gene with PCR technique using a specific premiere couple which was designed. The process was continued by cloning into bacterium cells of Escherichia coli. A vector which brought the encoder gene of stem bromelain enzyme was inserted into the yeast cell of P. pastoris and was continued by identifying the yeast cell of P. pastoris which brought the encoder gene of stem bromelain enzyme. The research has not found enzyme gene of stem bromelain in yeast cell of P. pastoris yet. The next step is repeating the process by buying new reagent; RNase inhibitor, and buying liquid nitrogen.

Diversity of beetle genes encoding novel plant cell wall degrading enzymes.

Directory of Open Access Journals (Sweden)

Yannick Pauchet

Full Text Available Plant cell walls are a heterogeneous mixture of polysaccharides and proteins that require a range of different enzymes to degrade them. Plant cell walls are also the primary source of cellulose, the most abundant and useful biopolymer on the planet. Plant cell wall degrading enzymes (PCWDEs are therefore important in a wide range of biotechnological processes from the production of biofuels and food to waste processing. However, despite the fact that the last common ancestor of all deuterostomes was inferred to be able to digest, or even synthesize, cellulose using endogenous genes, all model insects whose complete genomes have been sequenced lack genes encoding such enzymes. To establish if the apparent "disappearance" of PCWDEs from insects is simply a sampling problem, we used 454 mediated pyrosequencing to scan the gut transcriptomes of beetles that feed on a variety of plant derived diets. By sequencing the transcriptome of five beetles, and surveying publicly available ESTs, we describe 167 new beetle PCWDEs belonging to eight different enzyme families. This survey proves that these enzymes are not only present in non-model insects but that the multigene families that encode them are apparently undergoing complex birth-death dynamics. This reinforces the observation that insects themselves, and not just their microbial symbionts, are a rich source of PCWDEs. Further it emphasises that the apparent absence of genes encoding PCWDEs from model organisms is indeed simply a sampling artefact. Given the huge diversity of beetles alive today, and the diversity of their lifestyles and diets, we predict that beetle guts will emerge as an important new source of enzymes for use in biotechnology.

Integrating Data Clustering and Visualization for the Analysis of 3D Gene Expression Data

Energy Technology Data Exchange (ETDEWEB)

Data Analysis and Visualization (IDAV) and the Department of Computer Science, University of California, Davis, One Shields Avenue, Davis CA 95616, USA,; nternational Research Training Group ``Visualization of Large and Unstructured Data Sets,' ' University of Kaiserslautern, Germany; Computational Research Division, Lawrence Berkeley National Laboratory, One Cyclotron Road, Berkeley, CA 94720, USA; Genomics Division, Lawrence Berkeley National Laboratory, One Cyclotron Road, Berkeley CA 94720, USA; Life Sciences Division, Lawrence Berkeley National Laboratory, One Cyclotron Road, Berkeley CA 94720, USA,; Computer Science Division,University of California, Berkeley, CA, USA,; Computer Science Department, University of California, Irvine, CA, USA,; All authors are with the Berkeley Drosophila Transcription Network Project, Lawrence Berkeley National Laboratory,; Rubel, Oliver; Weber, Gunther H.; Huang, Min-Yu; Bethel, E. Wes; Biggin, Mark D.; Fowlkes, Charless C.; Hendriks, Cris L. Luengo; Keranen, Soile V. E.; Eisen, Michael B.; Knowles, David W.; Malik, Jitendra; Hagen, Hans; Hamann, Bernd

2008-05-12

The recent development of methods for extracting precise measurements of spatial gene expression patterns from three-dimensional (3D) image data opens the way for new analyses of the complex gene regulatory networks controlling animal development. We present an integrated visualization and analysis framework that supports user-guided data clustering to aid exploration of these new complex datasets. The interplay of data visualization and clustering-based data classification leads to improved visualization and enables a more detailed analysis than previously possible. We discuss (i) integration of data clustering and visualization into one framework; (ii) application of data clustering to 3D gene expression data; (iii) evaluation of the number of clusters k in the context of 3D gene expression clustering; and (iv) improvement of overall analysis quality via dedicated post-processing of clustering results based on visualization. We discuss the use of this framework to objectively define spatial pattern boundaries and temporal profiles of genes and to analyze how mRNA patterns are controlled by their regulatory transcription factors.

Evolution of homeobox genes.

Science.gov (United States)

Holland, Peter W H

2013-01-01

Many homeobox genes encode transcription factors with regulatory roles in animal and plant development. Homeobox genes are found in almost all eukaryotes, and have diversified into 11 gene classes and over 100 gene families in animal evolution, and 10 to 14 gene classes in plants. The largest group in animals is the ANTP class which includes the well-known Hox genes, plus other genes implicated in development including ParaHox (Cdx, Xlox, Gsx), Evx, Dlx, En, NK4, NK3, Msx, and Nanog. Genomic data suggest that the ANTP class diversified by extensive tandem duplication to generate a large array of genes, including an NK gene cluster and a hypothetical ProtoHox gene cluster that duplicated to generate Hox and ParaHox genes. Expression and functional data suggest that NK, Hox, and ParaHox gene clusters acquired distinct roles in patterning the mesoderm, nervous system, and gut. The PRD class is also diverse and includes Pax2/5/8, Pax3/7, Pax4/6, Gsc, Hesx, Otx, Otp, and Pitx genes. PRD genes are not generally arranged in ancient genomic clusters, although the Dux, Obox, and Rhox gene clusters arose in mammalian evolution as did several non-clustered PRD genes. Tandem duplication and genome duplication expanded the number of homeobox genes, possibly contributing to the evolution of developmental complexity, but homeobox gene loss must not be ignored. Evolutionary changes to homeobox gene expression have also been documented, including Hox gene expression patterns shifting in concert with segmental diversification in vertebrates and crustaceans, and deletion of a Pitx1 gene enhancer in pelvic-reduced sticklebacks. WIREs Dev Biol 2013, 2:31-45. doi: 10.1002/wdev.78 For further resources related to this article, please visit the WIREs website. The author declares that he has no conflicts of interest. Copyright © 2012 Wiley Periodicals, Inc.

Effects of TCDD on the expression of nuclear encoded mitochondrial genes

International Nuclear Information System (INIS)

Forgacs, Agnes L.; Burgoon, Lyle D.; Lynn, Scott G.; LaPres, John J.; Zacharewski, Timothy

2010-01-01

Generation of mitochondrial reactive oxygen species (ROS) can be perturbed following exposure to environmental chemicals such as 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD). Reports indicate that the aryl hydrocarbon receptor (AhR) mediates TCDD-induced sustained hepatic oxidative stress by decreasing hepatic ATP levels and through hyperpolarization of the inner mitochondrial membrane. To further elucidate the effects of TCDD on the mitochondria, high-throughput quantitative real-time PCR (HTP-QRTPCR) was used to evaluate the expression of 90 nuclear genes encoding mitochondrial proteins involved in electron transport, oxidative phosphorylation, uncoupling, and associated chaperones. HTP-QRTPCR analysis of time course (30 μg/kg TCDD at 2, 4, 8, 12, 18, 24, 72, and 168 h) liver samples obtained from orally gavaged immature, ovariectomized C57BL/6 mice identified 54 differentially expressed genes (|fold change| > 1.5 and P-value < 0.1). Of these, 8 exhibited a sigmoidal or exponential dose-response profile (0.03 to 300 μg/kg TCDD) at 4, 24 or 72 h. Dose-responsive genes encoded proteins associated with electron transport chain (ETC) complexes I (NADH dehydrogenase), III (cytochrome c reductase), IV (cytochrome c oxidase), and V (ATP synthase) and could be generally categorized as having proton gradient, ATP synthesis, and chaperone activities. In contrast, transcript levels of ETC complex II, succinate dehydrogenase, remained unchanged. Putative dioxin response elements were computationally found in the promoter regions of all 8 dose-responsive genes. This high-throughput approach suggests that TCDD alters the expression of genes associated with mitochondrial function which may contribute to TCDD-elicited mitochondrial toxicity.

Genomic polymorphism, recombination, and linkage disequilibrium in human major histocompatibility complex-encoded antigen-processing genes.

Science.gov (United States)

van Endert, P M; Lopez, M T; Patel, S D; Monaco, J J; McDevitt, H O

1992-01-01

Recently, two subunits of a large cytosolic protease and two putative peptide transporter proteins were found to be encoded by genes within the class II region of the major histocompatibility complex (MHC). These genes have been suggested to be involved in the processing of antigenic proteins for presentation by MHC class I molecules. Because of the high degree of polymorphism in MHC genes, and previous evidence for both functional and polypeptide sequence polymorphism in the proteins encoded by the antigen-processing genes, we tested DNA from 27 consanguineous human cell lines for genomic polymorphism by restriction fragment length polymorphism (RFLP) analysis. These studies demonstrate a strong linkage disequilibrium between TAP1 and LMP2 RFLPs. Moreover, RFLPs, as well as a polymorphic stop codon in the telomeric TAP2 gene, appear to be in linkage disequilibrium with HLA-DR alleles and RFLPs in the HLA-DO gene. A high rate of recombination, however, seems to occur in the center of the complex, between the TAP1 and TAP2 genes. Images PMID:1360671

Variation in the fumonisin biosynthetic gene cluster in fumonisin-producing and nonproducing black aspergilli.

Science.gov (United States)

Susca, Antonia; Proctor, Robert H; Butchko, Robert A E; Haidukowski, Miriam; Stea, Gaetano; Logrieco, Antonio; Moretti, Antonio

2014-12-01

The ability to produce fumonisin mycotoxins varies among members of the black aspergilli. Previously, analyses of selected genes in the fumonisin biosynthetic gene (fum) cluster in black aspergilli from California grapes indicated that fumonisin-nonproducing isolates of Aspergillus welwitschiae lack six fum genes, but nonproducing isolates of Aspergillus niger do not. In the current study, analyses of black aspergilli from grapes from the Mediterranean Basin indicate that the genomic context of the fum cluster is the same in isolates of A. niger and A. welwitschiae regardless of fumonisin-production ability and that full-length clusters occur in producing isolates of both species and nonproducing isolates of A. niger. In contrast, the cluster has undergone an eight-gene deletion in fumonisin-nonproducing isolates of A. welwitschiae. Phylogenetic analyses suggest each species consists of a mixed population of fumonisin-producing and nonproducing individuals, and that existence of both production phenotypes may provide a selective advantage to these species. Differences in gene content of fum cluster homologues and phylogenetic relationships of fum genes suggest that the mutation(s) responsible for the nonproduction phenotype differs, and therefore arose independently, in the two species. Partial fum cluster homologues were also identified in genome sequences of four other black Aspergillus species. Gene content of these partial clusters and phylogenetic relationships of fum sequences indicate that non-random partial deletion of the cluster has occurred multiple times among the species. This in turn suggests that an intact cluster and fumonisin production were once more widespread among black aspergilli. Copyright © 2014 Elsevier Inc. All rights reserved.

The promoter of the glucoamylase-encoding gene of Aspergillus niger functions in Ustilago maydis

Energy Technology Data Exchange (ETDEWEB)

Smith, T.L. (Dept. of Agriculture, Madison, WI (United States) Univ. of Wisconsin, Madison (United States)); Gaskell, J.; Cullen, D. (Dept. of Agriculture, Madison, WI (United States)); Berka, R.M.; Yang, M.; Henner, D.J. (Genentech Inc., San Francisco, CA (United States))

1990-01-01

Promoter sequences from the Aspergillus niger glucoamylase-encoding gene (glaA) were linked to the bacterial hygromycin (Hy) phosphotransferase-encoding gene (hph) and this chimeric marker was used to select Hy-resistant (Hy[sup R]) Ustilago maydis transformants. This is an example of an Ascomycete promoter functioning in a Basidiomycete. Hy[sup R] transformants varied with respect to copy number of integrated vector, mitotic stability, and tolerance to Hy. Only 216 bp of glaA promoter sequence is required for expression in U. maydis but this promoter is not induced by starch as it is in Aspergillus spp. The transcription start points are the same in U. maydis and A. niger.

HOXA genes cluster: clinical implications of the smallest deletion

OpenAIRE

Pezzani, Lidia; Milani, Donatella; Manzoni, Francesca; Baccarin, Marco; Silipigni, Rosamaria; Guerneri, Silvana; Esposito, Susanna

2015-01-01

Background HOXA genes cluster plays a fundamental role in embryologic development. Deletion of the entire cluster is known to cause a clinically recognizable syndrome with mild developmental delay, characteristic facies, small feet with unusually short and big halluces, abnormal thumbs, and urogenital malformations. The clinical manifestations may vary with different ranges of deletions of HOXA cluster and flanking regions. Case presentation We report a girl with the smallest deletion reporte...

AIB1 gene amplification and the instability of polyQ encoding sequence in breast cancer cell lines

Directory of Open Access Journals (Sweden)

Clarke Robert

2006-05-01

Full Text Available Abstract Background The poly Q polymorphism in AIB1 (amplified in breast cancer gene is usually assessed by fragment length analysis which does not reveal the actual sequence variation. The purpose of this study is to investigate the sequence variation of poly Q encoding region in breast cancer cell lines at single molecule level, and to determine if the sequence variation is related to AIB1 gene amplification. Methods The polymorphic poly Q encoding region of AIB1 gene was investigated at the single molecule level by PCR cloning/sequencing. The amplification of AIB1 gene in various breast cancer cell lines were studied by real-time quantitative PCR. Results Significant amplifications (5–23 folds of AIB1 gene were found in 2 out of 9 (22% ER positive cell lines (in BT-474 and MCF-7 but not in BT-20, ZR-75-1, T47D, BT483, MDA-MB-361, MDA-MB-468 and MDA-MB-330. The AIB1 gene was not amplified in any of the ER negative cell lines. Different passages of MCF-7 cell lines and their derivatives maintained the feature of AIB1 amplification. When the cells were selected for hormone independence (LCC1 and resistance to 4-hydroxy tamoxifen (4-OH TAM (LCC2 and R27, ICI 182,780 (LCC9 or 4-OH TAM, KEO and LY 117018 (LY-2, AIB1 copy number decreased but still remained highly amplified. Sequencing analysis of poly Q encoding region of AIB1 gene did not reveal specific patterns that could be correlated with AIB1 gene amplification. However, about 72% of the breast cancer cell lines had at least one under represented (3CAA(CAG9(CAACAG3(CAACAGCAG2CAA of the original cell line, a number of altered poly Q encoding sequences were found in the derivatives of MCF-7 cell lines. Conclusion These data suggest that poly Q encoding region of AIB1 gene is somatic unstable in breast cancer cell lines. The instability and the sequence characteristics, however, do not appear to be associated with the level of the gene amplification.

Characterization of Genes Encoding Key Enzymes Involved in Anthocyanin Metabolism of Kiwifruit during Storage Period.

Science.gov (United States)

Li, Boqiang; Xia, Yongxiu; Wang, Yuying; Qin, Guozheng; Tian, Shiping

2017-01-01

'Hongyang' is a red fleshed kiwifruit with high anthocyanin content. In this study, we mainly investigated effects of different temperatures (25 and 0°C) on anthocyanin biosynthesis in harvested kiwifruit, and characterized the genes encoding key enzymes involved in anthocyanin metabolism, as well as evaluated the mode of the action, by which low temperature regulates anthocyanin accumulation in 'Hongyang' kiwifruit during storage period. The results showed that low temperature could effectively enhance the anthocyanin accumulation of kiwifruit in the end of storage period (90 days), which related to the increase in mRNA levels of ANS1, ANS2, DRF1, DRF2 , and UGFT2 . Moreover, the transcript abundance of MYBA1-1 and MYB5-1 , the genes encoding an important component of MYB-bHLH-WD40 (MBW) complex, was up-regulated, possibly contributing to the induction of specific anthocyanin biosynthesis genes under the low temperature. To further investigate the roles of AcMYB5-1/5-2/A1-1 in regulation of anthocyanin biosynthesis, genes encoding the three transcription factors were transiently transformed in Nicotiana benthamiana leaves. Overexpression of AcMYB5-1/5-2/A1-1 activated the gene expression of NtANS and NtDFR in tobacco. Our results suggested that low temperature storage could stimulate the anthocyanin accumulation in harvested kiwifruit via regulating several structural and regulatory genes involved in anthocyanin biosynthesis.

Selenium Pretreatment Alleviated LPS-Induced Immunological Stress Via Upregulation of Several Selenoprotein Encoding Genes in Murine RAW264.7 Cells.

Science.gov (United States)

Wang, Longqiong; Jing, Jinzhong; Yan, Hui; Tang, Jiayong; Jia, Gang; Liu, Guangmang; Chen, Xiaoling; Tian, Gang; Cai, Jingyi; Shang, Haiying; Zhao, Hua

2018-04-18

This study was conducted to profile selenoprotein encoding genes in mouse RAW264.7 cells upon lipopolysaccharide (LPS) challenge and integrate their roles into immunological regulation in response to selenium (Se) pretreatment. LPS was used to develop immunological stress in macrophages. Cells were pretreated with different levels of Se (0, 0.5, 1.0, 1.5, 2.0 μmol Se/L) for 2 h, followed by LPS (100 ng/mL) stimulation for another 3 h. The mRNA expression of 24 selenoprotein encoding genes and 9 inflammation-related genes were investigated. The results showed that LPS (100 ng/mL) effectively induced immunological stress in RAW264.7 cells with induced inflammation cytokines, IL-6 and TNF-α, mRNA expression, and cellular secretion. LPS increased (P immunological stress in RAW264.7 cells accompanied with the global downregulation of selenoprotein encoding genes and Se pretreatment alleviated immunological stress via upregulation of a subset of selenoprotein encoding genes.

Characterization of the Aspergillus niger prtT, a unique regulator of extracellular protease encoding genes

NARCIS (Netherlands)

Punt, P.J.; Schuren, F.H.J.; Lehmbeck, J.; Christensen, T.; Hjort, C.; Hondel, C.A.M.J.J. van den

2008-01-01

Expression of several Aspergillus niger genes encoding major secreted, but not vacuolar, protease genes including the major acid protease gene pepA, was shown to be affected in the previously isolated A. niger protease mutant, AB1.13 [Mattern, I.E., van Noort, J.M., van den Berg, P., Archer, D.A.,

Molecular cloning and expression of the gene encoding the kinetoplast-associated type II DNA topoisomerase of Crithidia fasciculata.

Science.gov (United States)

Pasion, S G; Hines, J C; Aebersold, R; Ray, D S

1992-01-01

A type II DNA topoisomerase, topoIImt, was shown previously to be associated with the kinetoplast DNA of the trypanosomatid Crithidia fasciculata. The gene encoding this kinetoplast-associated topoisomerase has been cloned by immunological screening of a Crithidia genomic expression library with monoclonal antibodies raised against the purified enzyme. The gene CfaTOP2 is a single copy gene and is expressed as a 4.8-kb polyadenylated transcript. The nucleotide sequence of CfaTOP2 has been determined and encodes a predicted polypeptide of 1239 amino acids with a molecular mass of 138,445. The identification of the cloned gene is supported by immunoblot analysis of the beta-galactosidase-CfaTOP2 fusion protein expressed in Escherichia coli and by analysis of tryptic peptide sequences derived from purified topoIImt. CfaTOP2 shares significant homology with nuclear type II DNA topoisomerases of other eukaryotes suggesting that in Crithidia both nuclear and mitochondrial forms of topoisomerase II are encoded by the same gene.

Gene identification and protein classification in microbial metagenomic sequence data via incremental clustering

Directory of Open Access Journals (Sweden)

Li Weizhong

2008-04-01

Full Text Available Abstract Background The identification and study of proteins from metagenomic datasets can shed light on the roles and interactions of the source organisms in their communities. However, metagenomic datasets are characterized by the presence of organisms with varying GC composition, codon usage biases etc., and consequently gene identification is challenging. The vast amount of sequence data also requires faster protein family classification tools. Results We present a computational improvement to a sequence clustering approach that we developed previously to identify and classify protein coding genes in large microbial metagenomic datasets. The clustering approach can be used to identify protein coding genes in prokaryotes, viruses, and intron-less eukaryotes. The computational improvement is based on an incremental clustering method that does not require the expensive all-against-all compute that was required by the original approach, while still preserving the remote homology detection capabilities. We present evaluations of the clustering approach in protein-coding gene identification and classification, and also present the results of updating the protein clusters from our previous work with recent genomic and metagenomic sequences. The clustering results are available via CAMERA, (http://camera.calit2.net. Conclusion The clustering paradigm is shown to be a very useful tool in the analysis of microbial metagenomic data. The incremental clustering method is shown to be much faster than the original approach in identifying genes, grouping sequences into existing protein families, and also identifying novel families that have multiple members in a metagenomic dataset. These clusters provide a basis for further studies of protein families.

Comparative Genomic Analysis of Neutrophilic Iron(II Oxidizer Genomes for Candidate Genes in Extracellular Electron Transfer

Directory of Open Access Journals (Sweden)

Shaomei He

2017-08-01

Full Text Available Extracellular electron transfer (EET is recognized as a key biochemical process in circumneutral pH Fe(II-oxidizing bacteria (FeOB. In this study, we searched for candidate EET genes in 73 neutrophilic FeOB genomes, among which 43 genomes are complete or close-to-complete and the rest have estimated genome completeness ranging from 5 to 91%. These neutrophilic FeOB span members of the microaerophilic, anaerobic phototrophic, and anaerobic nitrate-reducing FeOB groups. We found that many microaerophilic and several anaerobic FeOB possess homologs of Cyc2, an outer membrane cytochrome c originally identified in Acidithiobacillus ferrooxidans. The “porin-cytochrome c complex” (PCC gene clusters homologous to MtoAB/PioAB are present in eight FeOB, accounting for 19% of complete and close-to-complete genomes examined, whereas PCC genes homologous to OmbB-OmaB-OmcB in Geobacter sulfurreducens are absent. Further, we discovered gene clusters that may potentially encode two novel PCC types. First, a cluster (tentatively named “PCC3” encodes a porin, an extracellular and a periplasmic cytochrome c with remarkably large numbers of heme-binding motifs. Second, a cluster (tentatively named “PCC4” encodes a porin and three periplasmic multiheme cytochromes c. A conserved inner membrane protein (IMP encoded in PCC3 and PCC4 gene clusters might be responsible for translocating electrons across the inner membrane. Other bacteria possessing PCC3 and PCC4 are mostly Proteobacteria isolated from environments with a potential niche for Fe(II oxidation. In addition to cytochrome c, multicopper oxidase (MCO genes potentially involved in Fe(II oxidation were also identified. Notably, candidate EET genes were not found in some FeOB, especially the anaerobic ones, probably suggesting EET genes or Fe(II oxidation mechanisms are different from the searched models. Overall, based on current EET models, the search extends our understanding of bacterial EET and

Multiple genes encode the major surface glycoprotein of Pneumocystis carinii

DEFF Research Database (Denmark)

Kovacs, J A; Powell, F; Edman, J C

1993-01-01

hydrophobic region at the carboxyl terminus. The presence of multiple related msg genes encoding the major surface glycoprotein of P. carinii suggests that antigenic variation is a possible mechanism for evading host defenses. Further characterization of this family of genes should allow the development......The major surface antigen of Pneumocystis carinii, a life-threatening opportunistic pathogen in human immunodeficiency virus-infected patients, is an abundant glycoprotein that functions in host-organism interactions. A monoclonal antibody to this antigen is protective in animals, and thus...... blot studies using chromosomal or restricted DNA, the major surface glycoproteins are the products of a multicopy family of genes. The predicted protein has an M(r) of approximately 123,000, is relatively rich in cysteine residues (5.5%) that are very strongly conserved, and contains a well conserved...

Map-based cloning and characterization of Zea mays male sterility33 (ZmMs33) gene, encoding a glycerol-3-phosphate acyltransferase.

Science.gov (United States)

Xie, Ke; Wu, Suowei; Li, Ziwen; Zhou, Yan; Zhang, Danfeng; Dong, Zhenying; An, Xueli; Zhu, Taotao; Zhang, Simiao; Liu, Shuangshuang; Li, Jinping; Wan, Xiangyuan

2018-06-01

Map-based cloning of maize ms33 gene showed that ZmMs33 encodes a sn-2 glycerol-3-phosphate acyltransferase, the ortholog of rice OsGPAT3, and it is essential for male fertility in maize. Genetic male sterility has been widely studied for its biological significance and commercial value in hybrid seed production. Although many male-sterile mutants have been identified in maize (Zea mays L.), it is likely that most genes that cause male sterility are unknown. Here, we report a recessive genetic male-sterile mutant, male sterility33 (ms33), which displays small, pale yellow anthers, and complete male sterility. Using a map-based cloning approach, maize GRMZM2G070304 was identified as the ms33 gene (ZmMs33). ZmMs33 encodes a novel sn-2 glycerol-3-phosphate acyltransferase (GPAT) in maize. A functional complementation experiment showed that GRMZM2G070304 can rescue the male-sterile phenotype of the ms33-6029 mutant. GRMZM2G070304 was further confirmed to be the ms33 gene via targeted knockouts induced by the clustered regularly interspersed short palindromic repeats (CRISPR)/Cas9 system. ZmMs33 is preferentially expressed in the immature anther from the quartet to early-vacuolate microspore stages and in root tissues at the fifth leaf growth stage. Phylogenetic analysis indicated that ZmMs33 and OsGPAT3 are evolutionarily conserved for anther and pollen development in monocot species. This study reveals that the monocot-specific GPAT3 protein plays an important role in male fertility in maize, and ZmMs33 and mutants in this gene may have value in maize male-sterile line breeding and hybrid seed production.

WRKY domain-encoding genes of a crop legume chickpea (Cicer arietinum): comparative analysis with Medicago truncatula WRKY family and characterization of group-III gene(s).

Science.gov (United States)

Kumar, Kamal; Srivastava, Vikas; Purayannur, Savithri; Kaladhar, V Chandra; Cheruvu, Purnima Jaiswal; Verma, Praveen Kumar

2016-06-01

The WRKY genes have been identified as important transcriptional modulators predominantly during the environmental stresses, but they also play critical role at various stages of plant life cycle. We report the identification of WRKY domain (WD)-encoding genes from galegoid clade legumes chickpea (Cicer arietinum L.) and barrel medic (Medicago truncatula). In total, 78 and 98 WD-encoding genes were found in chickpea and barrel medic, respectively. Comparative analysis suggests the presence of both conserved and unique WRKYs, and expansion of WRKY family in M. truncatula primarily by tandem duplication. Exclusively found in galegoid legumes, CaWRKY16 and its orthologues encode for a novel protein having a transmembrane and partial Exo70 domains flanking a group-III WD. Genomic region of galegoids, having CaWRKY16, is more dynamic when compared with millettioids. In onion cells, fused CaWRKY16-EYFP showed punctate fluorescent signals in cytoplasm. The chickpea WRKY group-III genes were further characterized for their transcript level modulation during pathogenic stress and treatments of abscisic acid, jasmonic acid, and salicylic acid (SA) by real-time PCR. Differential regulation of genes was observed during Ascochyta rabiei infection and SA treatment. Characterization of A. rabiei and SA inducible gene CaWRKY50 showed that it localizes to plant nucleus, binds to W-box, and have a C-terminal transactivation domain. Overexpression of CaWRKY50 in tobacco plants resulted in early flowering and senescence. The in-depth comparative account presented here for two legume WRKY genes will be of great utility in hastening functional characterization of crop legume WRKYs and will also help in characterization of Exo70Js. © The Author 2016. Published by Oxford University Press on behalf of Kazusa DNA Research Institute.

Cloning and Sequence Analysis of Vibrio halioticoli Genes Encoding Three Types of Polyguluronate Lyase.

Science.gov (United States)

Sugimura; Sawabe; Ezura

2000-01-01

The alginate lyase-coding genes of Vibrio halioticoli IAM 14596(T), which was isolated from the gut of the abalone Haliotis discus hannai, were cloned using plasmid vector pUC 18, and expressed in Escherichia coli. Three alginate lyase-positive clones, pVHB, pVHC, and pVHE, were obtained, and all clones expressed the enzyme activity specific for polyguluronate. Three genes, alyVG1, alyVG2, and alyVG3, encoding polyguluronate lyase were sequenced: alyVG1 from pVHB was composed of a 1056-bp open reading frame (ORF) encoding 352 amino acid residues; alyVG2 gene from pVHC was composed of a 993-bp ORF encoding 331 amino acid residues; and alyVG3 gene from pVHE was composed of a 705-bp ORF encoding 235 amino acid residues. Comparison of nucleotide and deduced amino acid sequences among AlyVG1, AlyVG2, and AlyVG3 revealed low homologies. The identity value between AlyVG1 and AlyVG2 was 18.7%, and that between AlyVG2 and AlyVG3 was 17.0%. A higher identity value (26.0%) was observed between AlyVG1 and AlyVG3. Sequence comparison among known polyguluronate lyases including AlyVG1, AlyVG2, and AlyVG3 also did not reveal an identical region in these sequences. However, AlyVG1 showed the highest identity value (36.2%) and the highest similarity (73.3%) to AlyA from Klebsiella pneumoniae. A consensus region comprising nine amino acid (YFKAGXYXQ) in the carboxy-terminal region previously reported by Mallisard and colleagues was observed only in AlyVG1 and AlyVG2.

Influence of putative exopolysaccharide genes on Pseudomonas putida KT2440 biofilm stability

DEFF Research Database (Denmark)

Nilsson, Martin; Chiang, Wen-Chi; Fazli, Mustafa

2011-01-01

We report a study of the role of putative exopolysaccharide gene clusters in the formation and stability of Pseudomonas putida KT2440 biofilm. Two novel putative exopolysaccharide gene clusters, pea and peb, were identified, and evidence is provided that they encode products that stabilize P....... putida KT2440 biofilm. The gene clusters alg and bcs, which code for proteins mediating alginate and cellulose biosynthesis, were found to play minor roles in P. putida KT2440 biofilm formation and stability under the conditions tested. A P. putida KT2440 derivative devoid of any identifiable...

Genes regulation encoding ADP/ATP carrier in yeasts Saccharomyces cerevisiae and Candida parapsilosis

International Nuclear Information System (INIS)

Nebohacova, M.

2000-01-01

Genes encoding a mitochondrial ADP/ATP carrier (AAC) in yeast Saccharomyces cerevisiae and Candida parapsilosis were investigated. AAC2 is coding for the major AAC isoform in S. cerevisiae. We suggest that AAC2 is a member of a syn-expression group of genes encoding oxidative phosphorylation proteins. Within our previous studies on the regulation of the AAC2 transcription an UAS (-393/-268) was identified that is essential for the expression of this gene. Two functional regulatory cis-elements are located within this UAS -binding sites for an ABFl factor and for HAP2/3/4/5 heteromeric complex. We examined relative contributions and mutual interactions of the ABFl and HAP2/3/4/5 factors in the activation of transcription from the UAS of the AAC2 gene. The whole UAS was dissected into smaller sub-fragments and tested for (i) the ability to form DNA-protein complexes with cellular proteins in vitro, (ii) the ability to confer heterologous expression using AAC3 gene lacking its own promoter, and (iii) the expression of AAC3-lacZ fusion instead of intact AAC3 gene. The obtained results demonstrated that: a) The whole UAS as well as sub-fragment containing only ABF1-binding site are able to form DNA-protein complexes with cellular proteins in oxygen- and heme- dependent manner. The experiments with antibody against the ABF1 showed that the ABF1 factor is one of the proteins binding to AAC2 promoter. We have been unsuccessful to prove the binding of cellular proteins to the HAP2/3/4/5-binding site. However, the presence of HAP2/3/4/5-binding site is necessary to drive a binding of cellular proteins to the ABF1-binding site in carbon source-dependent manner. b) The presence of both ABF1- and HAP2/3/4/5-binding sites and original spacing between them is necessary to confer the growth of Aaac2 mutant strain on non- fermentable carbon source when put in front of AAC3 gene introduced on centromeric vector to Aaac2 mutant strain. c) For the activation of AAC3-lacZ expression on

Molecular adaptation within the coat protein-encoding gene of Tunisian almond isolates of Prunus necrotic ringspot virus.

Science.gov (United States)

Boulila, Moncef; Ben Tiba, Sawssen; Jilani, Saoussen

2013-04-01

The sequence alignments of five Tunisian isolates of Prunus necrotic ringspot virus (PNRSV) were searched for evidence of recombination and diversifying selection. Since failing to account for recombination can elevate the false positive error rate in positive selection inference, a genetic algorithm (GARD) was used first and led to the detection of potential recombination events in the coat protein-encoding gene of that virus. The Recco algorithm confirmed these results by identifying, additionally, the potential recombinants. For neutrality testing and evaluation of nucleotide polymorphism in PNRSV CP gene, Tajima's D, and Fu and Li's D and F statistical tests were used. About selection inference, eight algorithms (SLAC, FEL, IFEL, REL, FUBAR, MEME, PARRIS, and GA branch) incorporated in HyPhy package were utilized to assess the selection pressure exerted on the expression of PNRSV capsid. Inferred phylogenies pointed out, in addition to the three classical groups (PE-5, PV-32, and PV-96), the delineation of a fourth cluster having the new proposed designation SW6, and a fifth clade comprising four Tunisian PNRSV isolates which underwent recombination and selective pressure and to which the name Tunisian outgroup was allocated.

Giant virus Megavirus chilensis encodes the biosynthetic pathway for uncommon acetamido sugars.

Science.gov (United States)

Piacente, Francesco; De Castro, Cristina; Jeudy, Sandra; Molinaro, Antonio; Salis, Annalisa; Damonte, Gianluca; Bernardi, Cinzia; Abergel, Chantal; Tonetti, Michela G

2014-08-29

Giant viruses mimicking microbes, by the sizes of their particles and the heavily glycosylated fibrils surrounding their capsids, infect Acanthamoeba sp., which are ubiquitous unicellular eukaryotes. The glycans on fibrils are produced by virally encoded enzymes, organized in gene clusters. Like Mimivirus, Megavirus glycans are mainly composed of virally synthesized N-acetylglucosamine (GlcNAc). They also contain N-acetylrhamnosamine (RhaNAc), a rare sugar; the enzymes involved in its synthesis are encoded by a gene cluster specific to Megavirus close relatives. We combined activity assays on two enzymes of the pathway with mass spectrometry and NMR studies to characterize their specificities. Mg534 is a 4,6-dehydratase 5-epimerase; its three-dimensional structure suggests that it belongs to a third subfamily of inverting dehydratases. Mg535, next in the pathway, is a bifunctional 3-epimerase 4-reductase. The sequential activity of the two enzymes leads to the formation of UDP-l-RhaNAc. This study is another example of giant viruses performing their glycan synthesis using enzymes different from their cellular counterparts, raising again the question of the origin of these pathways. © 2014 by The American Society for Biochemistry and Molecular Biology, Inc.

The pvc operon regulates the expression of the Pseudomonas aeruginosa fimbrial chaperone/usher pathway (cup genes.

Directory of Open Access Journals (Sweden)

Uzma Qaisar

Full Text Available The Pseudomonas aeruginosa fimbrial structures encoded by the cup gene clusters (cupB and cupC contribute to its attachment to abiotic surfaces and biofilm formation. The P. aeruginosa pvcABCD gene cluster encodes enzymes that synthesize a novel isonitrile functionalized cumarin, paerucumarin. Paerucumarin has already been characterized chemically, but this is the first report elucidating its role in bacterial biology. We examined the relationship between the pvc operon and the cup gene clusters in the P. aeruginosa strain MPAO1. Mutations within the pvc genes compromised biofilm development and significantly reduced the expression of cupB1-6 and cupC1-3, as well as different genes of the cupB/cupC two-component regulatory systems, roc1/roc2. Adjacent to pvc is the transcriptional regulator ptxR. A ptxR mutation in MPAO1 significantly reduced the expression of the pvc genes, the cupB/cupC genes, and the roc1/roc2 genes. Overexpression of the intact chromosomally-encoded pvc operon by a ptxR plasmid significantly enhanced cupB2, cupC2, rocS1, and rocS2 expression and biofilm development. Exogenously added paerucumarin significantly increased the expression of cupB2, cupC2, rocS1 and rocS2 in the pvcA mutant. Our results suggest that pvc influences P. aeruginosa biofilm development through the cup gene clusters in a pathway that involves paerucumarin, PtxR, and different cup regulators.

Clustering gene expression regulators: new approach to disease subtyping.

Directory of Open Access Journals (Sweden)

Mikhail Pyatnitskiy

Full Text Available One of the main challenges in modern medicine is to stratify different patient groups in terms of underlying disease molecular mechanisms as to develop more personalized approach to therapy. Here we propose novel method for disease subtyping based on analysis of activated expression regulators on a sample-by-sample basis. Our approach relies on Sub-Network Enrichment Analysis algorithm (SNEA which identifies gene subnetworks with significant concordant changes in expression between two conditions. Subnetwork consists of central regulator and downstream genes connected by relations extracted from global literature-extracted regulation database. Regulators found in each patient separately are clustered together and assigned activity scores which are used for final patients grouping. We show that our approach performs well compared to other related methods and at the same time provides researchers with complementary level of understanding of pathway-level biology behind a disease by identification of significant expression regulators. We have observed the reasonable grouping of neuromuscular disorders (triggered by structural damage vs triggered by unknown mechanisms, that was not revealed using standard expression profile clustering. For another experiment we were able to suggest the clusters of regulators, responsible for colorectal carcinoma vs adenoma discrimination and identify frequently genetically changed regulators that could be of specific importance for the individual characteristics of cancer development. Proposed approach can be regarded as biologically meaningful feature selection, reducing tens of thousands of genes down to dozens of clusters of regulators. Obtained clusters of regulators make possible to generate valuable biological hypotheses about molecular mechanisms related to a clinical outcome for individual patient.

Characterization and Heterologous Expression of the Genes Encoding Enterocin A Production, Immunity, and Regulation in Enterococcus faecium DPC1146

Science.gov (United States)

O’Keeffe, Triona; Hill, Colin; Ross, R. Paul

1999-01-01

Enterocin A is a small, heat-stable, antilisterial bacteriocin produced by Enterococcus faecium DPC1146. The sequence of a 10,879-bp chromosomal region containing at least 12 open reading frames (ORFs), 7 of which are predicted to play a role in enterocin biosynthesis, is presented. The genes entA, entI, and entF encode the enterocin A prepeptide, the putative immunity protein, and the induction factor prepeptide, respectively. The deduced proteins EntK and EntR resemble the histidine kinase and response regulator proteins of two-component signal transducing systems of the AgrC-AgrA type. The predicted proteins EntT and EntD are homologous to ABC (ATP-binding cassette) transporters and accessory factors, respectively, of several other bacteriocin systems and to proteins implicated in the signal-sequence-independent export of Escherichia coli hemolysin A. Immediately downstream of the entT and entD genes are two ORFs, the product of one of which, ORF4, is very similar to the product of the yteI gene of Bacillus subtilis and to E. coli protease IV, a signal peptide peptidase known to be involved in outer membrane lipoprotein export. Another potential bacteriocin is encoded in the opposite direction to the other genes in the enterocin cluster. This putative bacteriocin-like peptide is similar to LafX, one of the components of the lactacin F complex. A deletion which included one of two direct repeats upstream of the entA gene abolished enterocin A activity, immunity, and ability to induce bacteriocin production. Transposon insertion upstream of the entF gene also had the same effect, but this mutant could be complemented by exogenously supplied induction factor. The putative EntI peptide was shown to be involved in the immunity to enterocin A. Cloning of a 10.5-kb amplicon comprising all predicted ORFs and regulatory regions resulted in heterologous production of enterocin A and induction factor in Enterococcus faecalis, while a four-gene construct (entAITD) under the

Identification of a novel prophage-like gene cluster actively expressed in both virulent and avirulent strains of Leptospira interrogans serovar Lai.

Science.gov (United States)

Qin, Jin-Hong; Zhang, Qing; Zhang, Zhi-Ming; Zhong, Yi; Yang, Yang; Hu, Bao-Yu; Zhao, Guo-Ping; Guo, Xiao-Kui

2008-06-01

DNA microarray analysis was used to compare the differential gene expression profiles between Leptospira interrogans serovar Lai type strain 56601 and its corresponding attenuated strain IPAV. A 22-kb genomic island covering a cluster of 34 genes (i.e., genes LA0186 to LA0219) was actively expressed in both strains but concomitantly upregulated in strain 56601 in contrast to that of IPAV. Reverse transcription-PCR assays proved that the gene cluster comprised five transcripts. Gene annotation of this cluster revealed characteristics of a putative prophage-like remnant with at least 8 of 34 sequences encoding prophage-like proteins, of which the LA0195 protein is probably a putative prophage CI-like regulator. The transcription initiation activities of putative promoter-regulatory sequences of transcripts I, II, and III, all proximal to the LA0195 gene, were further analyzed in the Escherichia coli promoter probe vector pKK232-8 by assaying the reporter chloramphenicol acetyltransferase (CAT) activities. The strong promoter activities of both transcripts I and II indicated by the E. coli CAT assay were well correlated with the in vitro sequence-specific binding of the recombinant LA0195 protein to the corresponding promoter probes detected by the electrophoresis mobility shift assay. On the other hand, the promoter activity of transcript III was very low in E. coli and failed to show active binding to the LA0195 protein in vitro. These results suggested that the LA0195 protein is likely involved in the transcription of transcripts I and II. However, the identical complete DNA sequences of this prophage remnant from these two strains strongly suggests that possible regulatory factors or signal transduction systems residing outside of this region within the genome may be responsible for the differential expression profiling in these two strains.

Evolutionary conservation of regulatory elements in vertebrate HOX gene clusters

Energy Technology Data Exchange (ETDEWEB)

Santini, Simona; Boore, Jeffrey L.; Meyer, Axel

2003-12-31

Due to their high degree of conservation, comparisons of DNA sequences among evolutionarily distantly-related genomes permit to identify functional regions in noncoding DNA. Hox genes are optimal candidate sequences for comparative genome analyses, because they are extremely conserved in vertebrates and occur in clusters. We aligned (Pipmaker) the nucleotide sequences of HoxA clusters of tilapia, pufferfish, striped bass, zebrafish, horn shark, human and mouse (over 500 million years of evolutionary distance). We identified several highly conserved intergenic sequences, likely to be important in gene regulation. Only a few of these putative regulatory elements have been previously described as being involved in the regulation of Hox genes, while several others are new elements that might have regulatory functions. The majority of these newly identified putative regulatory elements contain short fragments that are almost completely conserved and are identical to known binding sites for regulatory proteins (Transfac). The conserved intergenic regions located between the most rostrally expressed genes in the developing embryo are longer and better retained through evolution. We document that presumed regulatory sequences are retained differentially in either A or A clusters resulting from a genome duplication in the fish lineage. This observation supports both the hypothesis that the conserved elements are involved in gene regulation and the Duplication-Deletion-Complementation model.

A genomics based discovery of secondary metabolite biosynthetic gene clusters in Aspergillus ustus.

Directory of Open Access Journals (Sweden)

Borui Pi

Full Text Available Secondary metabolites (SMs produced by Aspergillus have been extensively studied for their crucial roles in human health, medicine and industrial production. However, the resulting information is almost exclusively derived from a few model organisms, including A. nidulans and A. fumigatus, but little is known about rare pathogens. In this study, we performed a genomics based discovery of SM biosynthetic gene clusters in Aspergillus ustus, a rare human pathogen. A total of 52 gene clusters were identified in the draft genome of A. ustus 3.3904, such as the sterigmatocystin biosynthesis pathway that was commonly found in Aspergillus species. In addition, several SM biosynthetic gene clusters were firstly identified in Aspergillus that were possibly acquired by horizontal gene transfer, including the vrt cluster that is responsible for viridicatumtoxin production. Comparative genomics revealed that A. ustus shared the largest number of SM biosynthetic gene clusters with A. nidulans, but much fewer with other Aspergilli like A. niger and A. oryzae. These findings would help to understand the diversity and evolution of SM biosynthesis pathways in genus Aspergillus, and we hope they will also promote the development of fungal identification methodology in clinic.

A Genomics Based Discovery of Secondary Metabolite Biosynthetic Gene Clusters in Aspergillus ustus

Science.gov (United States)

Pi, Borui; Yu, Dongliang; Dai, Fangwei; Song, Xiaoming; Zhu, Congyi; Li, Hongye; Yu, Yunsong

2015-01-01

Secondary metabolites (SMs) produced by Aspergillus have been extensively studied for their crucial roles in human health, medicine and industrial production. However, the resulting information is almost exclusively derived from a few model organisms, including A. nidulans and A. fumigatus, but little is known about rare pathogens. In this study, we performed a genomics based discovery of SM biosynthetic gene clusters in Aspergillus ustus, a rare human pathogen. A total of 52 gene clusters were identified in the draft genome of A. ustus 3.3904, such as the sterigmatocystin biosynthesis pathway that was commonly found in Aspergillus species. In addition, several SM biosynthetic gene clusters were firstly identified in Aspergillus that were possibly acquired by horizontal gene transfer, including the vrt cluster that is responsible for viridicatumtoxin production. Comparative genomics revealed that A. ustus shared the largest number of SM biosynthetic gene clusters with A. nidulans, but much fewer with other Aspergilli like A. niger and A. oryzae. These findings would help to understand the diversity and evolution of SM biosynthesis pathways in genus Aspergillus, and we hope they will also promote the development of fungal identification methodology in clinic. PMID:25706180

Mutagenesis in sequence encoding of human factor VII for gene therapy of hemophilia

Directory of Open Access Journals (Sweden)

B Kazemi

2009-12-01

Full Text Available "nBackground: Current treatment of hemophilia which is one of the most common bleeding disorders, involves replacement therapy using concentrates of FVIII and FIX .However, these concentrates have been associated with viral infections and thromboembolic complications and development of antibodies. "nThe use of recombinant human factor VII (rhFVII is effective  for the treatment of patients with  hemophilia A or B, who develop antibodies ( referred as inhibitors against  replacement therapy , because it induces coagulation independent of FVIII and FIX. However, its short half-life and high cost have limited its use. One potential solution to this problem may be the use of FVIIa gene transfer, which would attain continuing therapeutic levels of expression from a single injection. The aim of this study was to engineer a novel hFVII (human FVII gene containing a cleavage site for the intracellular protease and furin, by PCR mutagenesis "nMethods: The sequence encoding light and heavy chains of hFVII, were amplified by using hFVII/pTZ57R and specific primers, separately. The PCR products were cloned in pTZ57R vector. "nResults and discussion: Cloning was confirmed by restriction analysis or PCR amplification using specific primers and plasmid universal primers. Mutagenesis of sequence encoding light and heavy chain was confirmed by restriction enzyme. "nConclusion: In the present study, it was provided recombinant plasmids based on mutant form of DNA encoding light and heavy chains.  Joining mutant form of DNA encoding light chain with mutant heavy chain led to a new variant of hFVII. This variant can be activated by furin and an increase in the proportion of activated form of FVII. This mutant form of hFVII may be used for gene therapy of hemophilia.

Chicken genome analysis reveals novel genes encoding biotin-binding proteins related to avidin family

Directory of Open Access Journals (Sweden)

Nordlund Henri R

2005-03-01

Full Text Available Abstract Background A chicken egg contains several biotin-binding proteins (BBPs, whose complete DNA and amino acid sequences are not known. In order to identify and characterise these genes and proteins we studied chicken cDNAs and genes available in the NCBI database and chicken genome database using the reported N-terminal amino acid sequences of chicken egg-yolk BBPs as search strings. Results Two separate hits showing significant homology for these N-terminal sequences were discovered. For one of these hits, the chromosomal location in the immediate proximity of the avidin gene family was found. Both of these hits encode proteins having high sequence similarity with avidin suggesting that chicken BBPs are paralogous to avidin family. In particular, almost all residues corresponding to biotin binding in avidin are conserved in these putative BBP proteins. One of the found DNA sequences, however, seems to encode a carboxy-terminal extension not present in avidin. Conclusion We describe here the predicted properties of the putative BBP genes and proteins. Our present observations link BBP genes together with avidin gene family and shed more light on the genetic arrangement and variability of this family. In addition, comparative modelling revealed the potential structural elements important for the functional and structural properties of the putative BBP proteins.

ICGE: an R package for detecting relevant clusters and atypical units in gene expression

Directory of Open Access Journals (Sweden)

Irigoien Itziar

2012-02-01

Full Text Available Abstract Background Gene expression technologies have opened up new ways to diagnose and treat cancer and other diseases. Clustering algorithms are a useful approach with which to analyze genome expression data. They attempt to partition the genes into groups exhibiting similar patterns of variation in expression level. An important problem associated with gene classification is to discern whether the clustering process can find a relevant partition as well as the identification of new genes classes. There are two key aspects to classification: the estimation of the number of clusters, and the decision as to whether a new unit (gene, tumor sample... belongs to one of these previously identified clusters or to a new group. Results ICGE is a user-friendly R package which provides many functions related to this problem: identify the number of clusters using mixed variables, usually found by applied biomedical researchers; detect whether the data have a cluster structure; identify whether a new unit belongs to one of the pre-identified clusters or to a novel group, and classify new units into the corresponding cluster. The functions in the ICGE package are accompanied by help files and easy examples to facilitate its use. Conclusions We demonstrate the utility of ICGE by analyzing simulated and real data sets. The results show that ICGE could be very useful to a broad research community.

cDNA for the human β2-adrenergic receptor: a protein with multiple membrane-spanning domains and encoded by a gene whose chromosomal location is shared with that of the receptor for platelet-derived growth factor

International Nuclear Information System (INIS)

Kobilka, B.K.; Dixon, R.A.F.; Frielle, T.

1987-01-01

The authors have isolated and sequenced a cDNA encoding the human β 2 -adrenergic receptor. The deduced amino acid sequence (413 residues) is that of a protein containing seven clusters of hydrophobic amino acids suggestive of membrane-spanning domains. While the protein is 87% identical overall with the previously cloned hamster β 2 -adrenergic receptor, the most highly conserved regions are the putative transmembrane helices (95% identical) and cytoplasmic loops (93% identical), suggesting that these regions of the molecule harbor important functional domains. Several of the transmembrane helices also share lesser degrees of identity with comparable regions of select members of the opsin family of visual pigments. They have localized the gene for the β 2 -adrenergic receptor to q31-q32 on chromosome 5. This is the same position recently determined for the gene encoding the receptor for platelet-derived growth factor and is adjacent to that for the FMS protooncogene, which encodes the receptor for the macrophage colony-stimulating factor

A Link-Based Cluster Ensemble Approach For Improved Gene Expression Data Analysis

Directory of Open Access Journals (Sweden)

P.Balaji

2015-01-01

Full Text Available Abstract It is difficult from possibilities to select a most suitable effective way of clustering algorithm and its dataset for a defined set of gene expression data because we have a huge number of ways and huge number of gene expressions. At present many researchers are preferring to use hierarchical clustering in different forms this is no more totally optimal. Cluster ensemble research can solve this type of problem by automatically merging multiple data partitions from a wide range of different clusterings of any dimensions to improve both the quality and robustness of the clustering result. But we have many existing ensemble approaches using an association matrix to condense sample-cluster and co-occurrence statistics and relations within the ensemble are encapsulated only at raw level while the existing among clusters are totally discriminated. Finding these missing associations can greatly expand the capability of those ensemble methodologies for microarray data clustering. We propose general K-means cluster ensemble approach for the clustering of general categorical data into required number of partitions.

SPINE: SParse eIgengene NEtwork linking gene expression clusters in Dehalococcoides mccartyi to perturbations in experimental conditions.

Directory of Open Access Journals (Sweden)

Cresten B Mansfeldt

Full Text Available We present a statistical model designed to identify the effect of experimental perturbations on the aggregate behavior of the transcriptome expressed by the bacterium Dehalococcoides mccartyi strain 195. Strains of Dehalococcoides are used in sub-surface bioremediation applications because they organohalorespire tetrachloroethene and trichloroethene (common chlorinated solvents that contaminate the environment to non-toxic ethene. However, the biochemical mechanism of this process remains incompletely described. Additionally, the response of Dehalococcoides to stress-inducing conditions that may be encountered at field-sites is not well understood. The constructed statistical model captured the aggregate behavior of gene expression phenotypes by modeling the distinct eigengenes of 100 transcript clusters, determining stable relationships among these clusters of gene transcripts with a sparse network-inference algorithm, and directly modeling the effect of changes in experimental conditions by constructing networks conditioned on the experimental state. Based on the model predictions, we discovered new response mechanisms for DMC, notably when the bacterium is exposed to solvent toxicity. The network identified a cluster containing thirteen gene transcripts directly connected to the solvent toxicity condition. Transcripts in this cluster include an iron-dependent regulator (DET0096-97 and a methylglyoxal synthase (DET0137. To validate these predictions, additional experiments were performed. Continuously fed cultures were exposed to saturating levels of tetrachloethene, thereby causing solvent toxicity, and transcripts that were predicted to be linked to solvent toxicity were monitored by quantitative reverse-transcription polymerase chain reaction. Twelve hours after being shocked with saturating levels of tetrachloroethene, the control transcripts (encoding for a key hydrogenase and the 16S rRNA did not significantly change. By contrast

The rgg0182 gene encodes a transcriptional regulator required for the full Streptococcus thermophilus LMG18311 thermal adaptation.

Science.gov (United States)

Henry, Romain; Bruneau, Emmanuelle; Gardan, Rozenn; Bertin, Stéphane; Fleuchot, Betty; Decaris, Bernard; Leblond-Bourget, Nathalie

2011-10-07

Streptococcus thermophilus is an important starter strain for the production of yogurt and cheeses. The analysis of sequenced genomes of four strains of S. thermophilus indicates that they contain several genes of the rgg familly potentially encoding transcriptional regulators. Some of the Rgg proteins are known to be involved in bacterial stress adaptation. In this study, we demonstrated that Streptococcus thermophilus thermal stress adaptation required the rgg0182 gene which transcription depends on the culture medium and the growth temperature. This gene encoded a protein showing similarity with members of the Rgg family transcriptional regulator. Our data confirmed that Rgg0182 is a transcriptional regulator controlling the expression of its neighboring genes as well as chaperones and proteases encoding genes. Therefore, analysis of a Δrgg0182 mutant revealed that this protein played a role in the heat shock adaptation of Streptococcus thermophilus LMG18311. These data showed the importance of the Rgg0182 transcriptional regulator on the survival of S. thermophilus during dairy processes and more specifically during changes in temperature.

The rgg0182 gene encodes a transcriptional regulator required for the full Streptococcus thermophilus LMG18311 thermal adaptation

Directory of Open Access Journals (Sweden)

Bertin Stéphane

2011-10-01

Full Text Available Abstract Background Streptococcus thermophilus is an important starter strain for the production of yogurt and cheeses. The analysis of sequenced genomes of four strains of S. thermophilus indicates that they contain several genes of the rgg familly potentially encoding transcriptional regulators. Some of the Rgg proteins are known to be involved in bacterial stress adaptation. Results In this study, we demonstrated that Streptococcus thermophilus thermal stress adaptation required the rgg0182 gene which transcription depends on the culture medium and the growth temperature. This gene encoded a protein showing similarity with members of the Rgg family transcriptional regulator. Our data confirmed that Rgg0182 is a transcriptional regulator controlling the expression of its neighboring genes as well as chaperones and proteases encoding genes. Therefore, analysis of a Δrgg0182 mutant revealed that this protein played a role in the heat shock adaptation of Streptococcus thermophilus LMG18311. Conclusions These data showed the importance of the Rgg0182 transcriptional regulator on the survival of S. thermophilus during dairy processes and more specifically during changes in temperature.

The euryhaline yeast Debaryomyces hansenii has two catalase genes encoding enzymes with differential activity profile.

Science.gov (United States)

Segal-Kischinevzky, Claudia; Rodarte-Murguía, Beatriz; Valdés-López, Victor; Mendoza-Hernández, Guillermo; González, Alicia; Alba-Lois, Luisa

2011-03-01

Debaryomyces hansenii is a spoilage yeast able to grow in a variety of ecological niches, from seawater to dairy products. Results presented in this article show that (i) D. hansenii has an inherent resistance to H2O2 which could be attributed to the fact that this yeast has a basal catalase activity which is several-fold higher than that observed in Saccharomyces cerevisiae under the same culture conditions, (ii) D. hansenii has two genes (DhCTA1 and DhCTT1) encoding two catalase isozymes with a differential enzymatic activity profile which is not strictly correlated with a differential expression profile of the encoding genes.

OVER-EXPRESSION OF GENE ENCODING FATTY ACID METABOLIC ENZYMES IN FISH

Directory of Open Access Journals (Sweden)

Alimuddin Alimuddin

2008-12-01

Full Text Available Eicosapentaenoic acid (EPA, 20:5n-3 and docosahexaenoic acid (DHA, 22:6n-3 have important nutritional benefits in humans. EPA and DHA are mainly derived from fish, but the decline in the stocks of major marine capture fishes could result in these fatty acids being consumed less. Farmed fish could serve as promising sources of EPA and DHA, but they need these fatty acids in their diets. Generation of fish strains that are capable of synthesizing enough amounts of EPA/DHA from the conversion of α-linolenic acid (LNA, 18:3n-3 rich oils can supply a new EPA/DHA source. This may be achieved by over-expression of genes encoding enzymes involved in HUFA biosynthesis. In aquaculture, the successful of this technique would open the possibility to reduce the enrichment of live food with fish oils for marine fish larvae, and to completely substitute fish oils with plant oils without reducing the quality of flesh in terms of EPA and DHA contents. Here, three genes, i.e. Δ6-desaturase-like (OmΔ6FAD, Δ5-desaturase-like (OmΔ5FAD and elongase-like (MELO encoding EPA/DHA metabolic enzymes derived from masu salmon (Oncorhynchus masou were individually transferred into zebrafish (Danio rerio as a model to increase its ability for synthesizing EPA and DHA. Fatty acid analysis showed that EPA content in whole body of the second transgenic fish generation over-expressing OmΔ6FAD gene was 1.4 fold and that of DHA was 2.1 fold higher (P<0.05 than those in non-transgenic fish. The EPA content in whole body of transgenic fish over-expressing OmΔ5FAD gene was 1.21-fold, and that of DHA was 1.24-fold higher (P<0.05 than those in nontransgenic fish. The same patterns were obtained in transgenic fish over-expressing MELO gene. EPA content was increased by 1.30-fold and DHA content by 1.33-fold higher (P<0.05 than those in non-transgenic fish. The results of studies demonstrated that fatty acid content of fish can be enhanced by over

Cloning, characterization, expression analysis and inhibition studies of a novel gene encoding Bowman-Birk type protease inhibitor from rice bean

Science.gov (United States)

This paper presents the first study describing the isolation, cloning and characterization of a full length gene encoding Bowman-Birk protease inhibitor (RbTI) from rice bean (Vigna umbellata). A full-length protease inhibitor gene with complete open reading frame of 327bp encoding 109 amino acids w...

The Schizosaccharomyces pombe mam1 gene encodes an ABC transporter mediating secretion of M-factor

DEFF Research Database (Denmark)

Christensen, P U; Davey, William John; Nielsen, O

1997-01-01

In the fission yeast Schizosaccharomyces pombe, cells of opposite mating type communicate via diffusible peptide pheromones prior to mating. We have cloned the S. pombe mam1 gene, which encodes a 1336-amino acid protein belonging to the ATP-binding cassette (ABC) superfamily. The mam1 gene is onl...

GenClust: A genetic algorithm for clustering gene expression data

Directory of Open Access Journals (Sweden)

Raimondi Alessandra

2005-12-01

Full Text Available Abstract Background Clustering is a key step in the analysis of gene expression data, and in fact, many classical clustering algorithms are used, or more innovative ones have been designed and validated for the task. Despite the widespread use of artificial intelligence techniques in bioinformatics and, more generally, data analysis, there are very few clustering algorithms based on the genetic paradigm, yet that paradigm has great potential in finding good heuristic solutions to a difficult optimization problem such as clustering. Results GenClust is a new genetic algorithm for clustering gene expression data. It has two key features: (a a novel coding of the search space that is simple, compact and easy to update; (b it can be used naturally in conjunction with data driven internal validation methods. We have experimented with the FOM methodology, specifically conceived for validating clusters of gene expression data. The validity of GenClust has been assessed experimentally on real data sets, both with the use of validation measures and in comparison with other algorithms, i.e., Average Link, Cast, Click and K-means. Conclusion Experiments show that none of the algorithms we have used is markedly superior to the others across data sets and validation measures; i.e., in many cases the observed differences between the worst and best performing algorithm may be statistically insignificant and they could be considered equivalent. However, there are cases in which an algorithm may be better than others and therefore worthwhile. In particular, experiments for GenClust show that, although simple in its data representation, it converges very rapidly to a local optimum and that its ability to identify meaningful clusters is comparable, and sometimes superior, to that of more sophisticated algorithms. In addition, it is well suited for use in conjunction with data driven internal validation measures and, in particular, the FOM methodology.

Molecular evolution of the insect chemoreceptor gene superfamily in Drosophila melanogaster

Science.gov (United States)

Robertson, Hugh M.; Warr, Coral G.; Carlson, John R.

2003-01-01

The insect chemoreceptor superfamily in Drosophila melanogaster is predicted to consist of 62 odorant receptor (Or) and 68 gustatory receptor (Gr) proteins, encoded by families of 60 Or and 60 Gr genes through alternative splicing. We include two previously undescribed Or genes and two previously undescribed Gr genes; two previously predicted Or genes are shown to be alternative splice forms. Three polymorphic pseudogenes and one highly defective pseudogene are recognized. Phylogenetic analysis reveals deep branches connecting multiple highly divergent clades within the Gr family, and the Or family appears to be a single highly expanded lineage within the superfamily. The genes are spread throughout the Drosophila genome, with some relatively recently diverged genes still clustered in the genome. The Gr5a gene on the X chromosome, which encodes a receptor for the sugar trehalose, has transposed from one such tandem cluster of six genes at cytological location 64, as has Gr61a, and all eight of these receptors might bind sugars. Analysis of intron evolution suggests that the common ancestor consisted of a long N-terminal exon encoding transmembrane domains 1-5 followed by three exons encoding transmembrane domains 6-7. As many as 57 additional introns have been acquired idiosyncratically during the evolution of the superfamily, whereas the ancestral introns and some of the older idiosyncratic introns have been lost at least 48 times independently. Altogether, these patterns of molecular evolution suggest that this is an ancient superfamily of chemoreceptors, probably dating back at least to the origin of the arthropods. PMID:14608037

Clustering based gene expression feature selection method: A computational approach to enrich the classifier efficiency of differentially expressed genes

KAUST Repository

Abusamra, Heba

2016-07-20

The native nature of high dimension low sample size of gene expression data make the classification task more challenging. Therefore, feature (gene) selection become an apparent need. Selecting a meaningful and relevant genes for classifier not only decrease the computational time and cost, but also improve the classification performance. Among different approaches of feature selection methods, however most of them suffer from several problems such as lack of robustness, validation issues etc. Here, we present a new feature selection technique that takes advantage of clustering both samples and genes. Materials and methods We used leukemia gene expression dataset [1]. The effectiveness of the selected features were evaluated by four different classification methods; support vector machines, k-nearest neighbor, random forest, and linear discriminate analysis. The method evaluate the importance and relevance of each gene cluster by summing the expression level for each gene belongs to this cluster. The gene cluster consider important, if it satisfies conditions depend on thresholds and percentage otherwise eliminated. Results Initial analysis identified 7120 differentially expressed genes of leukemia (Fig. 15a), after applying our feature selection methodology we end up with specific 1117 genes discriminating two classes of leukemia (Fig. 15b). Further applying the same method with more stringent higher positive and lower negative threshold condition, number reduced to 58 genes have be tested to evaluate the effectiveness of the method (Fig. 15c). The results of the four classification methods are summarized in Table 11. Conclusions The feature selection method gave good results with minimum classification error. Our heat-map result shows distinct pattern of refines genes discriminating between two classes of leukemia.

Role of the pathotype-specific ACRTS1 gene encoding a hydroxylase involved in the biosynthesis of host-selective ACR-toxin in the rough lemon pathotype of Alternaria alternata.

Science.gov (United States)

Izumi, Yuriko; Kamei, Eri; Miyamoto, Yoko; Ohtani, Kouhei; Masunaka, Akira; Fukumoto, Takeshi; Gomi, Kenji; Tada, Yasuomi; Ichimura, Kazuya; Peever, Tobin L; Akimitsu, Kazuya

2012-08-01

The rough lemon pathotype of Alternaria alternata produces host-selective ACR-toxin and causes Alternaria leaf spot disease of the rootstock species rough lemon (Citrus jambhiri) and Rangpur lime (C. limonia). Genes controlling toxin production were localized to a 1.5-Mb chromosome carrying the ACR-toxin biosynthesis gene cluster (ACRT) in the genome of the rough lemon pathotype. A genomic BAC clone containing a portion of the ACRT cluster was sequenced which allowed identification of three open reading frames present only in the genomes of ACR-toxin producing isolates. We studied the functional role of one of these open reading frames, ACRTS1 encoding a putative hydroxylase, in ACR-toxin production by homologous recombination-mediated gene disruption. There are at least three copies of ACRTS1 gene in the genome and disruption of two copies of this gene significantly reduced ACR-toxin production as well as pathogenicity; however, transcription of ACRTS1 and production of ACR-toxin were not completely eliminated due to remaining functional copies of the gene. RNA-silencing was used to knock down the remaining ACRTS1 transcripts to levels undetectable by reverse transcription-polymerase chain reaction. The silenced transformants did not produce detectable ACR-toxin and were not pathogenic. These results indicate that ACRTS1 is an essential gene in ACR-toxin biosynthesis in the rough lemon pathotype of A. alternata and is required for full virulence of this fungus.

[Cloning, mutagenesis and symbiotic phenotype of three lipid transfer protein encoding genes from Mesorhizobium huakuii 7653R].

Science.gov (United States)

Li, Yanan; Zeng, Xiaobo; Zhou, Xuejuan; Li, Youguo

2016-12-04

Lipid transfer protein superfamily is involved in lipid transport and metabolism. This study aimed to construct mutants of three lipid transfer protein encoding genes in Mesorhizobium huakuii 7653R, and to study the phenotypes and function of mutations during symbiosis with Astragalus sinicus. We used bioinformatics to predict structure characteristics and biological functions of lipid transfer proteins, and conducted semi-quantitative and fluorescent quantitative real-time PCR to analyze the expression levels of target genes in free-living and symbiotic conditions. Using pK19mob insertion mutagenesis to construct mutants, we carried out pot plant experiments to observe symbiotic phenotypes. MCHK-5577, MCHK-2172 and MCHK-2779 genes encoding proteins belonged to START/RHO alpha_C/PITP/Bet_v1/CoxG/CalC (SRPBCC) superfamily, involved in lipid transport or metabolism, and were identical to M. loti at 95% level. Gene relative transcription level of the three genes all increased compared to free-living condition. We obtained three mutants. Compared with wild-type 7653R, above-ground biomass of plants and nodulenitrogenase activity induced by the three mutants significantly decreased. Results indicated that lipid transfer protein encoding genes of Mesorhizobium huakuii 7653R may play important roles in symbiotic nitrogen fixation, and the mutations significantly affected the symbiotic phenotypes. The present work provided a basis to study further symbiotic function mechanism associated with lipid transfer proteins from rhizobia.

Recombination Rate Heterogeneity within Arabidopsis Disease Resistance Genes.

Science.gov (United States)

Choi, Kyuha; Reinhard, Carsten; Serra, Heïdi; Ziolkowski, Piotr A; Underwood, Charles J; Zhao, Xiaohui; Hardcastle, Thomas J; Yelina, Nataliya E; Griffin, Catherine; Jackson, Matthew; Mézard, Christine; McVean, Gil; Copenhaver, Gregory P; Henderson, Ian R

2016-07-01

Meiotic crossover frequency varies extensively along chromosomes and is typically concentrated in hotspots. As recombination increases genetic diversity, hotspots are predicted to occur at immunity genes, where variation may be beneficial. A major component of plant immunity is recognition of pathogen Avirulence (Avr) effectors by resistance (R) genes that encode NBS-LRR domain proteins. Therefore, we sought to test whether NBS-LRR genes would overlap with meiotic crossover hotspots using experimental genetics in Arabidopsis thaliana. NBS-LRR genes tend to physically cluster in plant genomes; for example, in Arabidopsis most are located in large clusters on the south arms of chromosomes 1 and 5. We experimentally mapped 1,439 crossovers within these clusters and observed NBS-LRR gene associated hotspots, which were also detected as historical hotspots via analysis of linkage disequilibrium. However, we also observed NBS-LRR gene coldspots, which in some cases correlate with structural heterozygosity. To study recombination at the fine-scale we used high-throughput sequencing to analyze ~1,000 crossovers within the RESISTANCE TO ALBUGO CANDIDA1 (RAC1) R gene hotspot. This revealed elevated intragenic crossovers, overlapping nucleosome-occupied exons that encode the TIR, NBS and LRR domains. The highest RAC1 recombination frequency was promoter-proximal and overlapped CTT-repeat DNA sequence motifs, which have previously been associated with plant crossover hotspots. Additionally, we show a significant influence of natural genetic variation on NBS-LRR cluster recombination rates, using crosses between Arabidopsis ecotypes. In conclusion, we show that a subset of NBS-LRR genes are strong hotspots, whereas others are coldspots. This reveals a complex recombination landscape in Arabidopsis NBS-LRR genes, which we propose results from varying coevolutionary pressures exerted by host-pathogen relationships, and is influenced by structural heterozygosity.

Coevolution between Nuclear-Encoded DNA Replication, Recombination, and Repair Genes and Plastid Genome Complexity.

Science.gov (United States)

Zhang, Jin; Ruhlman, Tracey A; Sabir, Jamal S M; Blazier, John Chris; Weng, Mao-Lun; Park, Seongjun; Jansen, Robert K

2016-02-17

Disruption of DNA replication, recombination, and repair (DNA-RRR) systems has been hypothesized to cause highly elevated nucleotide substitution rates and genome rearrangements in the plastids of angiosperms, but this theory remains untested. To investigate nuclear-plastid genome (plastome) coevolution in Geraniaceae, four different measures of plastome complexity (rearrangements, repeats, nucleotide insertions/deletions, and substitution rates) were evaluated along with substitution rates of 12 nuclear-encoded, plastid-targeted DNA-RRR genes from 27 Geraniales species. Significant correlations were detected for nonsynonymous (dN) but not synonymous (dS) substitution rates for three DNA-RRR genes (uvrB/C, why1, and gyrA) supporting a role for these genes in accelerated plastid genome evolution in Geraniaceae. Furthermore, correlation between dN of uvrB/C and plastome complexity suggests the presence of nucleotide excision repair system in plastids. Significant correlations were also detected between plastome complexity and 13 of the 90 nuclear-encoded organelle-targeted genes investigated. Comparisons revealed significant acceleration of dN in plastid-targeted genes of Geraniales relative to Brassicales suggesting this correlation may be an artifact of elevated rates in this gene set in Geraniaceae. Correlation between dN of plastid-targeted DNA-RRR genes and plastome complexity supports the hypothesis that the aberrant patterns in angiosperm plastome evolution could be caused by dysfunction in DNA-RRR systems. © The Author 2016. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

The complete coenzyme B12 biosynthesis gene cluster of Lactobacillus reuteri CRL 1098

NARCIS (Netherlands)

Santos, dos F.; Vera, J.L.; Heijden, van der R.; Valdez, G.F.; Vos, de W.M.; Sesma, F.; Hugenholtz, J.

2008-01-01

The coenzyme B12 production pathway in Lactobacillus reuteri has been deduced using a combination of genetic, biochemical and bioinformatics approaches. The coenzyme B12 gene cluster of Lb. reuteri CRL1098 has the unique feature of clustering together the cbi, cob and hem genes. It consists of 29

Sieve element occlusion (SEO) genes encode structural phloem proteins involved in wound sealing of the phloem.

Science.gov (United States)

Ernst, Antonia M; Jekat, Stephan B; Zielonka, Sascia; Müller, Boje; Neumann, Ulla; Rüping, Boris; Twyman, Richard M; Krzyzanek, Vladislav; Prüfer, Dirk; Noll, Gundula A

2012-07-10

The sieve element occlusion (SEO) gene family originally was delimited to genes encoding structural components of forisomes, which are specialized crystalloid phloem proteins found solely in the Fabaceae. More recently, SEO genes discovered in various non-Fabaceae plants were proposed to encode the common phloem proteins (P-proteins) that plug sieve plates after wounding. We carried out a comprehensive characterization of two tobacco (Nicotiana tabacum) SEO genes (NtSEO). Reporter genes controlled by the NtSEO promoters were expressed specifically in immature sieve elements, and GFP-SEO fusion proteins formed parietal agglomerates in intact sieve elements as well as sieve plate plugs after wounding. NtSEO proteins with and without fluorescent protein tags formed agglomerates similar in structure to native P-protein bodies when transiently coexpressed in Nicotiana benthamiana, and the analysis of these protein complexes by electron microscopy revealed ultrastructural features resembling those of native P-proteins. NtSEO-RNA interference lines were essentially devoid of P-protein structures and lost photoassimilates more rapidly after injury than control plants, thus confirming the role of P-proteins in sieve tube sealing. We therefore provide direct evidence that SEO genes in tobacco encode P-protein subunits that affect translocation. We also found that peptides recently identified in fascicular phloem P-protein plugs from squash (Cucurbita maxima) represent cucurbit members of the SEO family. Our results therefore suggest a common evolutionary origin for P-proteins found in the sieve elements of all dicotyledonous plants and demonstrate the exceptional status of extrafascicular P-proteins in cucurbits.

Evidence for the bacterial origin of genes encoding fermentation enzymes of the amitochondriate protozoan parasite Entamoeba histolytica.

Science.gov (United States)

Rosenthal, B; Mai, Z; Caplivski, D; Ghosh, S; de la Vega, H; Graf, T; Samuelson, J

1997-06-01

Entamoeba histolytica is an amitochondriate protozoan parasite with numerous bacterium-like fermentation enzymes including the pyruvate:ferredoxin oxidoreductase (POR), ferredoxin (FD), and alcohol dehydrogenase E (ADHE). The goal of this study was to determine whether the genes encoding these cytosolic E. histolytica fermentation enzymes might derive from a bacterium by horizontal transfer, as has previously been suggested for E. histolytica genes encoding heat shock protein 60, nicotinamide nucleotide transhydrogenase, and superoxide dismutase. In this study, the E. histolytica por gene and the adhE gene of a second amitochondriate protozoan parasite, Giardia lamblia, were sequenced, and their phylogenetic positions were estimated in relation to POR, ADHE, and FD cloned from eukaryotic and eubacterial organisms. The E. histolytica por gene encodes a 1,620-amino-acid peptide that contained conserved iron-sulfur- and thiamine pyrophosphate-binding sites. The predicted E. histolytica POR showed fewer positional identities to the POR of G. lamblia (34%) than to the POR of the enterobacterium Klebsiella pneumoniae (49%), the cyanobacterium Anabaena sp. (44%), and the protozoan Trichomonas vaginalis (46%), which targets its POR to anaerobic organelles called hydrogenosomes. Maximum-likelihood, neighbor-joining, and parsimony analyses also suggested as less likely E. histolytica POR sharing more recent common ancestry with G. lamblia POR than with POR of bacteria and the T. vaginalis hydrogenosome. The G. lamblia adhE encodes an 888-amino-acid fusion peptide with an aldehyde dehydrogenase at its amino half and an iron-dependent (class 3) ADH at its carboxy half. The predicted G. lamblia ADHE showed extensive positional identities to ADHE of Escherichia coli (49%), Clostridium acetobutylicum (44%), and E. histolytica (43%) and lesser identities to the class 3 ADH of eubacteria and yeast (19 to 36%). Phylogenetic analyses inferred a closer relationship of the E

Resistance gene candidates identified by PCR with degenerate oligonucleotide primers map to clusters of resistance genes in lettuce.

Science.gov (United States)

Shen, K A; Meyers, B C; Islam-Faridi, M N; Chin, D B; Stelly, D M; Michelmore, R W

1998-08-01

The recent cloning of genes for resistance against diverse pathogens from a variety of plants has revealed that many share conserved sequence motifs. This provides the possibility of isolating numerous additional resistance genes by polymerase chain reaction (PCR) with degenerate oligonucleotide primers. We amplified resistance gene candidates (RGCs) from lettuce with multiple combinations of primers with low degeneracy designed from motifs in the nucleotide binding sites (NBSs) of RPS2 of Arabidopsis thaliana and N of tobacco. Genomic DNA, cDNA, and bacterial artificial chromosome (BAC) clones were successfully used as templates. Four families of sequences were identified that had the same similarity to each other as to resistance genes from other species. The relationship of the amplified products to resistance genes was evaluated by several sequence and genetic criteria. The amplified products contained open reading frames with additional sequences characteristic of NBSs. Hybridization of RGCs to genomic DNA and to BAC clones revealed large numbers of related sequences. Genetic analysis demonstrated the existence of clustered multigene families for each of the four RGC sequences. This parallels classical genetic data on clustering of disease resistance genes. Two of the four families mapped to known clusters of resistance genes; these two families were therefore studied in greater detail. Additional evidence that these RGCs could be resistance genes was gained by the identification of leucine-rich repeat (LRR) regions in sequences adjoining the NBS similar to those in RPM1 and RPS2 of A. thaliana. Fluorescent in situ hybridization confirmed the clustered genomic distribution of these sequences. The use of PCR with degenerate oligonucleotide primers is therefore an efficient method to identify numerous RGCs in plants.

Cloning and characterization of an epoxide hydrolase-encoding gene from Rhodotorula glutinis

NARCIS (Netherlands)

Visser, H.; Vreugdenhil, S.; Bont, de J.A.M.; Verdoes, J.C.

2000-01-01

We cloned and characterized the epoxide hydrolase gene, EPH1, from Rhodotorula glutinis. The EPH1 open reading frame of 1230 bp was interrupted by nine introns and encoded a polypeptide of 409 amino acids with a calculated molecular mass of 46.3 kDa. The amino acid sequence was similar to that of

Regulatory role of tetR gene in a novel gene cluster of Acidovorax avenae subsp. avenae RS-1 under oxidative stress

Directory of Open Access Journals (Sweden)

He eLiu

2014-10-01

Full Text Available Acidovorax avenae subsp. avenae is the causal agent of bacterial brown stripe disease in rice. In this study, we characterized a novel horizontal transfer of a gene cluster, including tetR, on the chromosome of A. avenae subsp. avenae RS-1 by genome-wide analysis. TetR acted as a repressor in this gene cluster and the oxidative stress resistance was enhanced in tetR-deletion mutant strain. Electrophoretic mobility shift assay (EMSA demonstrated that TetR regulator bound directly to the promoter of this gene cluster. Consistently, the results of quantitative real-time PCR also showed alterations in expression of associated genes. Moreover, the proteins affected by TetR under oxidative stress were revealed by comparing proteomic profiles of wild-type and mutant strains via 1D SDS-PAGE and LC-MS/MS analyses. Taken together, our results demonstrated that tetR gene in this novel gene cluster contributed to cell survival under oxidative stress, and TetR protein played an important regulatory role in growth kinetics, biofilm-forming capability, SOD and catalase activity, and oxide detoxicating ability.

Regulatory role of tetR gene in a novel gene cluster of Acidovorax avenae subsp. avenae RS-1 under oxidative stress.

Science.gov (United States)

Liu, He; Yang, Chun-Lan; Ge, Meng-Yu; Ibrahim, Muhammad; Li, Bin; Zhao, Wen-Jun; Chen, Gong-You; Zhu, Bo; Xie, Guan-Lin

2014-01-01

Acidovorax avenae subsp. avenae is the causal agent of bacterial brown stripe disease in rice. In this study, we characterized a novel horizontal transfer of a gene cluster, including tetR, on the chromosome of A. avenae subsp. avenae RS-1 by genome-wide analysis. TetR acted as a repressor in this gene cluster and the oxidative stress resistance was enhanced in tetR-deletion mutant strain. Electrophoretic mobility shift assay demonstrated that TetR regulator bound directly to the promoter of this gene cluster. Consistently, the results of quantitative real-time PCR also showed alterations in expression of associated genes. Moreover, the proteins affected by TetR under oxidative stress were revealed by comparing proteomic profiles of wild-type and mutant strains via 1D SDS-PAGE and LC-MS/MS analyses. Taken together, our results demonstrated that tetR gene in this novel gene cluster contributed to cell survival under oxidative stress, and TetR protein played an important regulatory role in growth kinetics, biofilm-forming capability, superoxide dismutase and catalase activity, and oxide detoxicating ability.

ORGANIZATION OF THE nif GENES OF THE NONHETEROCYSTOUS CYANOBACTERIUM TRICHODESMIUM SP. IMS101.

Science.gov (United States)

Dominic, Benny; Zani, Sabino; Chen, Yi-Bu; Mellon, Mark T; Zehr, Jonathan P

2000-08-26

An approximately 16-kb fragment of the Trichodesmium sp. IMS101 (a nonheterocystous filamentous cyanobacterium) "conventional"nif gene cluster was cloned and sequenced. The gene organization of the Trichodesmium and Anabaena variabilis vegetative (nif 2) nitrogenase gene clusters spanning the region from nif B to nif W are similar except for the absence of two open reading frames (ORF3 and ORF1) in Trichodesmium. The Trichodesmium nif EN genes encode a fused Nif EN polypeptide that does not appear to be processed into individual Nif E and Nif N polypeptides. Fused nif EN genes were previously found in the A. variabilis nif 2 genes, but we have found that fused nif EN genes are widespread in the nonheterocystous cyanobacteria. Although the gene organization of the nonheterocystous filamentous Trichodesmium nif gene cluster is very similar to that of the A. variabilis vegetative nif 2 gene cluster, phylogenetic analysis of nif sequences do not support close relatedness of Trichodesmium and A. variabilis vegetative (nif 2) nitrogenase genes.

Molecular cloning and chromosome mapping of the human gene encoding protein phosphotyrosyl phosphatase 1B

International Nuclear Information System (INIS)

Brown-Shimer, S.; Johnson, K.A.; Bruskin, A.; Green, N.R.; Hill, D.E.; Lawrence, J.B.; Johnson, C.

1990-01-01

The inactivation of growth suppressor genes appears to play a major role in the malignant process. To assess whether protein phosphotyrosyl phosphatases function as growth suppressors, the authors have isolated a cDNA clone encoding human protein phosphotyrosyl phosphatase 1B for structural and functional characterization. The translation product deduced from the 1,305-nucleotide open reading frame predicts a protein containing 435 amino acids and having a molecular mass of 49,966 Da. The amino-terminal 321 amino acids deduced from the cDNA sequence are identical to the empirically determined sequence of protein phosphotyrosyl phosphatase 1B. A genomic clone has been isolated and used in an in situ hybridization to banded metaphase chromosomes to determine that the gene encoding protein phosphotyrosyl phosphatase 1B maps as a single-copy gene to the long arm of chromosome 20 in the region q13.1-q13.2

QTL global meta-analysis: are trait determining genes clustered?

Directory of Open Access Journals (Sweden)

Adelson David L

2009-04-01

Full Text Available Abstract Background A key open question in biology is if genes are physically clustered with respect to their known functions or phenotypic effects. This is of particular interest for Quantitative Trait Loci (QTL where a QTL region could contain a number of genes that contribute to the trait being measured. Results We observed a significant increase in gene density within QTL regions compared to non-QTL regions and/or the entire bovine genome. By grouping QTL from the Bovine QTL Viewer database into 8 categories of non-redundant regions, we have been able to analyze gene density and gene function distribution, based on Gene Ontology (GO with relation to their location within QTL regions, outside of QTL regions and across the entire bovine genome. We identified a number of GO terms that were significantly over represented within particular QTL categories. Furthermore, select GO terms expected to be associated with the QTL category based on common biological knowledge have also proved to be significantly over represented in QTL regions. Conclusion Our analysis provides evidence of over represented GO terms in QTL regions. This increased GO term density indicates possible clustering of gene functions within QTL regions of the bovine genome. Genes with similar functions may be grouped in specific locales and could be contributing to QTL traits. Moreover, we have identified over-represented GO terminology that from a biological standpoint, makes sense with respect to QTL category type.

A Novel Complementation Assay for Quick and Specific Screen of Genes Encoding Glycerol-3-Phosphate Acyltransferases

Directory of Open Access Journals (Sweden)

Jie Lei

2018-03-01

Full Text Available The initial step in glycerolipid biosynthesis, especially in diverse allopolyploid crop species, is poorly understood, mainly due to the lack of an effective and convenient method for functional characterization of genes encoding glycerol-3-phosphate acyltransferases (GPATs catalyzing this reaction. Here we present a novel complementation assay for quick and specific characterization of GPAT-encoding genes. Its key design involves rational construction of yeast conditional lethal gat1Δgat2Δ double mutant bearing the heterologous Arabidopsis AtGPAT1 gene whose leaky expression under repressed conditions does not support any non-specific growth, thereby circumventing the false positive problem encountered with the system based on the gat1Δgat2Δ mutant harboring the native episomal GAT1 gene whose leaky expression appears to be sufficient for generating enough GPAT activities for the non-specific restoration of the mutant growth. A complementation assay developed based on this novel mutant enables quick phenotypic screen of GPAT sequences. A high degree of specificity of our assay was exemplified by its ability to differentiate effectively GPAT-encoding genes from those of other fatty acyltransferases and lipid-related sequences. Using this assay, we show that Arabidopsis AtGPAT1, AtGPAT5, and AtGPAT7 can complement the phosphatidate biosynthetic defect in the double mutants. Collectively, our assay provides a powerful tool for rapid screening, validation and optimization of GPAT sequences, aiding future engineering of the initial step of the triacylglycerol biosynthesis in oilseeds.

MADIBA: A web server toolkit for biological interpretation of Plasmodium and plant gene clusters

Directory of Open Access Journals (Sweden)

Louw Abraham I

2008-02-01

Full Text Available Abstract Background Microarray technology makes it possible to identify changes in gene expression of an organism, under various conditions. Data mining is thus essential for deducing significant biological information such as the identification of new biological mechanisms or putative drug targets. While many algorithms and software have been developed for analysing gene expression, the extraction of relevant information from experimental data is still a substantial challenge, requiring significant time and skill. Description MADIBA (MicroArray Data Interface for Biological Annotation facilitates the assignment of biological meaning to gene expression clusters by automating the post-processing stage. A relational database has been designed to store the data from gene to pathway for Plasmodium, rice and Arabidopsis. Tools within the web interface allow rapid analyses for the identification of the Gene Ontology terms relevant to each cluster; visualising the metabolic pathways where the genes are implicated, their genomic localisations, putative common transcriptional regulatory elements in the upstream sequences, and an analysis specific to the organism being studied. Conclusion MADIBA is an integrated, online tool that will assist researchers in interpreting their results and understand the meaning of the co-expression of a cluster of genes. Functionality of MADIBA was validated by analysing a number of gene clusters from several published experiments – expression profiling of the Plasmodium life cycle, and salt stress treatments of Arabidopsis and rice. In most of the cases, the same conclusions found by the authors were quickly and easily obtained after analysing the gene clusters with MADIBA.

Gene clusters involved in isethionate degradation by terrestrial and marine bacteria.

KAUST Repository

Weinitschke, Sonja; Sharma, Pia I; Stingl, Ulrich; Cook, Alasdair M; Smits, Theo H M

2010-01-01

Ubiquitous isethionate (2-hydroxyethanesulfonate) is dissimilated by diverse bacteria. Growth of Cupriavidus necator H16 with isethionate was observed, as was inducible membrane-bound isethionate dehydrogenase (IseJ) and inducible transcription of the genes predicted to encode IseJ and a transporter (IseU). Biodiversity in isethionate transport genes was observed and investigated by transcription experiments.

Statistical indicators of collective behavior and functional clusters in gene networks of yeast

Science.gov (United States)

Živković, J.; Tadić, B.; Wick, N.; Thurner, S.

2006-03-01

We analyze gene expression time-series data of yeast (S. cerevisiae) measured along two full cell-cycles. We quantify these data by using q-exponentials, gene expression ranking and a temporal mean-variance analysis. We construct gene interaction networks based on correlation coefficients and study the formation of the corresponding giant components and minimum spanning trees. By coloring genes according to their cell function we find functional clusters in the correlation networks and functional branches in the associated trees. Our results suggest that a percolation point of functional clusters can be identified on these gene expression correlation networks.

Genome-wide identification of physically clustered genes suggests chromatin-level co-regulation in male reproductive development in Arabidopsis thaliana.

Science.gov (United States)

Reimegård, Johan; Kundu, Snehangshu; Pendle, Ali; Irish, Vivian F; Shaw, Peter; Nakayama, Naomi; Sundström, Jens F; Emanuelsson, Olof

2017-04-07

Co-expression of physically linked genes occurs surprisingly frequently in eukaryotes. Such chromosomal clustering may confer a selective advantage as it enables coordinated gene regulation at the chromatin level. We studied the chromosomal organization of genes involved in male reproductive development in Arabidopsis thaliana. We developed an in-silico tool to identify physical clusters of co-regulated genes from gene expression data. We identified 17 clusters (96 genes) involved in stamen development and acting downstream of the transcriptional activator MS1 (MALE STERILITY 1), which contains a PHD domain associated with chromatin re-organization. The clusters exhibited little gene homology or promoter element similarity, and largely overlapped with reported repressive histone marks. Experiments on a subset of the clusters suggested a link between expression activation and chromatin conformation: qRT-PCR and mRNA in situ hybridization showed that the clustered genes were up-regulated within 48 h after MS1 induction; out of 14 chromatin-remodeling mutants studied, expression of clustered genes was consistently down-regulated only in hta9/hta11, previously associated with metabolic cluster activation; DNA fluorescence in situ hybridization confirmed that transcriptional activation of the clustered genes was correlated with open chromatin conformation. Stamen development thus appears to involve transcriptional activation of physically clustered genes through chromatin de-condensation. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

AutoSOME: a clustering method for identifying gene expression modules without prior knowledge of cluster number

Directory of Open Access Journals (Sweden)

Cooper James B

2010-03-01

Full Text Available Abstract Background Clustering the information content of large high-dimensional gene expression datasets has widespread application in "omics" biology. Unfortunately, the underlying structure of these natural datasets is often fuzzy, and the computational identification of data clusters generally requires knowledge about cluster number and geometry. Results We integrated strategies from machine learning, cartography, and graph theory into a new informatics method for automatically clustering self-organizing map ensembles of high-dimensional data. Our new method, called AutoSOME, readily identifies discrete and fuzzy data clusters without prior knowledge of cluster number or structure in diverse datasets including whole genome microarray data. Visualization of AutoSOME output using network diagrams and differential heat maps reveals unexpected variation among well-characterized cancer cell lines. Co-expression analysis of data from human embryonic and induced pluripotent stem cells using AutoSOME identifies >3400 up-regulated genes associated with pluripotency, and indicates that a recently identified protein-protein interaction network characterizing pluripotency was underestimated by a factor of four. Conclusions By effectively extracting important information from high-dimensional microarray data without prior knowledge or the need for data filtration, AutoSOME can yield systems-level insights from whole genome microarray expression studies. Due to its generality, this new method should also have practical utility for a variety of data-intensive applications, including the results of deep sequencing experiments. AutoSOME is available for download at http://jimcooperlab.mcdb.ucsb.edu/autosome.

Clustering gene expression data based on predicted differential effects of GV interaction.

Science.gov (United States)

Pan, Hai-Yan; Zhu, Jun; Han, Dan-Fu

2005-02-01

Microarray has become a popular biotechnology in biological and medical research. However, systematic and stochastic variabilities in microarray data are expected and unavoidable, resulting in the problem that the raw measurements have inherent "noise" within microarray experiments. Currently, logarithmic ratios are usually analyzed by various clustering methods directly, which may introduce bias interpretation in identifying groups of genes or samples. In this paper, a statistical method based on mixed model approaches was proposed for microarray data cluster analysis. The underlying rationale of this method is to partition the observed total gene expression level into various variations caused by different factors using an ANOVA model, and to predict the differential effects of GV (gene by variety) interaction using the adjusted unbiased prediction (AUP) method. The predicted GV interaction effects can then be used as the inputs of cluster analysis. We illustrated the application of our method with a gene expression dataset and elucidated the utility of our approach using an external validation.

Transcriptional regulation of gene expression clusters in motor neurons following spinal cord injury

Directory of Open Access Journals (Sweden)

Westerdahl Ann-Charlotte

2010-06-01

Full Text Available Abstract Background Spinal cord injury leads to neurological dysfunctions affecting the motor, sensory as well as the autonomic systems. Increased excitability of motor neurons has been implicated in injury-induced spasticity, where the reappearance of self-sustained plateau potentials in the absence of modulatory inputs from the brain correlates with the development of spasticity. Results Here we examine the dynamic transcriptional response of motor neurons to spinal cord injury as it evolves over time to unravel common gene expression patterns and their underlying regulatory mechanisms. For this we use a rat-tail-model with complete spinal cord transection causing injury-induced spasticity, where gene expression profiles are obtained from labeled motor neurons extracted with laser microdissection 0, 2, 7, 21 and 60 days post injury. Consensus clustering identifies 12 gene clusters with distinct time expression profiles. Analysis of these gene clusters identifies early immunological/inflammatory and late developmental responses as well as a regulation of genes relating to neuron excitability that support the development of motor neuron hyper-excitability and the reappearance of plateau potentials in the late phase of the injury response. Transcription factor motif analysis identifies differentially expressed transcription factors involved in the regulation of each gene cluster, shaping the expression of the identified biological processes and their associated genes underlying the changes in motor neuron excitability. Conclusions This analysis provides important clues to the underlying mechanisms of transcriptional regulation responsible for the increased excitability observed in motor neurons in the late chronic phase of spinal cord injury suggesting alternative targets for treatment of spinal cord injury. Several transcription factors were identified as potential regulators of gene clusters containing elements related to motor neuron hyper

Transcriptional regulation of gene expression clusters in motor neurons following spinal cord injury.

Science.gov (United States)

Ryge, Jesper; Winther, Ole; Wienecke, Jacob; Sandelin, Albin; Westerdahl, Ann-Charlotte; Hultborn, Hans; Kiehn, Ole

2010-06-09

Spinal cord injury leads to neurological dysfunctions affecting the motor, sensory as well as the autonomic systems. Increased excitability of motor neurons has been implicated in injury-induced spasticity, where the reappearance of self-sustained plateau potentials in the absence of modulatory inputs from the brain correlates with the development of spasticity. Here we examine the dynamic transcriptional response of motor neurons to spinal cord injury as it evolves over time to unravel common gene expression patterns and their underlying regulatory mechanisms. For this we use a rat-tail-model with complete spinal cord transection causing injury-induced spasticity, where gene expression profiles are obtained from labeled motor neurons extracted with laser microdissection 0, 2, 7, 21 and 60 days post injury. Consensus clustering identifies 12 gene clusters with distinct time expression profiles. Analysis of these gene clusters identifies early immunological/inflammatory and late developmental responses as well as a regulation of genes relating to neuron excitability that support the development of motor neuron hyper-excitability and the reappearance of plateau potentials in the late phase of the injury response. Transcription factor motif analysis identifies differentially expressed transcription factors involved in the regulation of each gene cluster, shaping the expression of the identified biological processes and their associated genes underlying the changes in motor neuron excitability. This analysis provides important clues to the underlying mechanisms of transcriptional regulation responsible for the increased excitability observed in motor neurons in the late chronic phase of spinal cord injury suggesting alternative targets for treatment of spinal cord injury. Several transcription factors were identified as potential regulators of gene clusters containing elements related to motor neuron hyper-excitability, the manipulation of which potentially could be

Isolation and characterization of the gene encoding the starch debranching enzyme limit dextrinase from germinating barley

DEFF Research Database (Denmark)

Kristensen, Michael; Lok, Finn; Planchot, Véronique

1999-01-01

with a value of 105 kDa estimated by SDS;;PAGE, The coding sequence is interrupted by 26 introns varying in length from 93 bp to 825 bp. The 27 exons vary in length from 53 bp to 197 bp. Southern blot analysis shows that the limit dextrinase gene is present as a single copy in the barley genome. Gene......The gene encoding the starch debranching enzyme limit dextrinase, LD, from barley (Hordeum vulgare), was isolated from a genomic phage library using a barley cDNA clone as probe. The gene encodes a protein of 904 amino acid residues with a calculated molecular mass of 98.6 kDa. This is in agreement...... expression is high during germination and the steady state transcription level reaches a maximum at day 5 of germination. The deduced amino acid sequence corresponds to the protein sequence of limit dextrinase purified from germinating malt, as determined by automated N-terminal sequencing of tryptic...

Transcriptional analysis of exopolysaccharides biosynthesis gene clusters in Lactobacillus plantarum.

Science.gov (United States)

Vastano, Valeria; Perrone, Filomena; Marasco, Rosangela; Sacco, Margherita; Muscariello, Lidia

2016-04-01

Exopolysaccharides (EPS) from lactic acid bacteria contribute to specific rheology and texture of fermented milk products and find applications also in non-dairy foods and in therapeutics. Recently, four clusters of genes (cps) associated with surface polysaccharide production have been identified in Lactobacillus plantarum WCFS1, a probiotic and food-associated lactobacillus. These clusters are involved in cell surface architecture and probably in release and/or exposure of immunomodulating bacterial molecules. Here we show a transcriptional analysis of these clusters. Indeed, RT-PCR experiments revealed that the cps loci are organized in five operons. Moreover, by reverse transcription-qPCR analysis performed on L. plantarum WCFS1 (wild type) and WCFS1-2 (ΔccpA), we demonstrated that expression of three cps clusters is under the control of the global regulator CcpA. These results, together with the identification of putative CcpA target sequences (catabolite responsive element CRE) in the regulatory region of four out of five transcriptional units, strongly suggest for the first time a role of the master regulator CcpA in EPS gene transcription among lactobacilli.

Motif-Independent De Novo Detection of Secondary Metabolite Gene Clusters – Towards Identification of Novel Secondary Metabolisms from Filamentous Fungi -

Directory of Open Access Journals (Sweden)

Myco eUmemura

2015-05-01

Full Text Available Secondary metabolites are produced mostly by clustered genes that are essential to their biosynthesis. The transcriptional expression of these genes is often cooperatively regulated by a transcription factor located inside or close to a cluster. Most of the secondary metabolism biosynthesis (SMB gene clusters identified to date contain so-called core genes with distinctive sequence features, such as polyketide synthase (PKS and non-ribosomal peptide synthetase (NRPS. Recent efforts in sequencing fungal genomes have revealed far more SMB gene clusters than expected based on the number of core genes in the genomes. Several bioinformatics tools have been developed to survey SMB gene clusters using the sequence motif information of the core genes, including SMURF and antiSMASH.More recently, accompanied by the development of sequencing techniques allowing to obtain large-scale genomic and transcriptomic data, motif-independent prediction methods of SMB gene clusters, including MIDDAS-M, have been developed. Most these methods detect the clusters in which the genes are cooperatively regulated at transcriptional levels, thus allowing the identification of novel SMB gene clusters regardless of the presence of the core genes. Another type of the method, MIPS-CG, uses the characteristics of SMB genes, which are highly enriched in non-syntenic blocks (NSBs, enabling the prediction even without transcriptome data although the results have not been evaluated in detail. Considering that large portion of SMB gene clusters might be sufficiently expressed only in limited uncommon conditions, it seems that prediction of SMB gene clusters by bioinformatics and successive experimental validation is an only way to efficiently uncover hidden SMB gene clusters. Here, we describe and discuss possible novel approaches for the determination of SMB gene clusters that have not been identified using conventional methods.

Comparative differential gene expression analysis of nucleus-encoded proteins for Rafflesia cantleyi against Arabidopsis thaliana

Science.gov (United States)

Ng, Siuk-Mun; Lee, Xin-Wei; Wan, Kiew-Lian; Firdaus-Raih, Mohd

2015-09-01

Regulation of functional nucleus-encoded proteins targeting the plastidial functions was comparatively studied for a plant parasite, Rafflesia cantleyi versus a photosynthetic plant, Arabidopsis thaliana. This study involved two species of different feeding modes and different developmental stages. A total of 30 nucleus-encoded proteins were found to be differentially-regulated during two stages in the parasite; whereas 17 nucleus-encoded proteins were differentially-expressed during two developmental stages in Arabidopsis thaliana. One notable finding observed for the two plants was the identification of genes involved in the regulation of photosynthesis-related processes where these processes, as expected, seem to be present only in the autotroph.

Burkholderia mallei tssM encodes a putative deubiquitinase that is secreted and expressed inside infected RAW 264.7 murine macrophages.

Science.gov (United States)

Shanks, John; Burtnick, Mary N; Brett, Paul J; Waag, David M; Spurgers, Kevin B; Ribot, Wilson J; Schell, Mark A; Panchal, Rekha G; Gherardini, Frank C; Wilkinson, Keith D; Deshazer, David

2009-04-01

Burkholderia mallei, a category B biothreat agent, is a facultative intracellular pathogen that causes the zoonotic disease glanders. The B. mallei VirAG two-component regulatory system activates the transcription of approximately 60 genes, including a large virulence gene cluster encoding a type VI secretion system (T6SS). The B. mallei tssM gene encodes a putative ubiquitin-specific protease that is physically linked to, and transcriptionally coregulated with, the T6SS gene cluster. Mass spectrometry and immunoblot analysis demonstrated that TssM was secreted in a virAG-dependent manner in vitro. Surprisingly, the T6SS was found to be dispensable for the secretion of TssM. The C-terminal half of TssM, which contains Cys and His box motifs conserved in eukaryotic deubiquitinases, was purified and biochemically characterized. Recombinant TssM hydrolyzed multiple ubiquitinated substrates and the cysteine at position 102 was critical for enzymatic activity. The tssM gene was expressed within 1 h after uptake of B. mallei into RAW 264.7 murine macrophages, suggesting that the TssM deubiquitinase is produced in this intracellular niche. Although the physiological substrate(s) is currently unknown, the TssM deubiquitinase may provide B. mallei a selective advantage in the intracellular environment during infection.

Typing of Panton-Valentine Leukocidin-Encoding Phages and lukSF-PV Gene Sequence Variation in Staphylococcus aureus from China.

Science.gov (United States)

Zhao, Huanqiang; Hu, Fupin; Jin, Shu; Xu, Xiaogang; Zou, Yuhan; Ding, Baixing; He, Chunyan; Gong, Fang; Liu, Qingzhong

2016-01-01

Panton-Valentine leukocidin (PVL, encoded by lukSF-PV genes), a bi-component and pore-forming toxin, is carried by different staphylococcal bacteriophages. The prevalence of PVL in Staphylococcus aureus has been reported around the globe. However, the data on PVL-encoding phage types, lukSF-PV gene variation and chromosomal phage insertion sites for PVL-positive S. aureus are limited, especially in China. In order to obtain a more complete understanding of the molecular epidemiology of PVL-positive S. aureus, an integrated and modified PCR-based scheme was applied to detect the PVL-encoding phage types. Phage insertion locus and the lukSF-PV variant were determined by PCR and sequencing. Meanwhile, the genetic background was characterized by staphylococcal cassette chromosome mec (SCCmec) typing, staphylococcal protein A (spa) gene polymorphisms typing, pulsed-field gel electrophoresis (PFGE) typing, accessory gene regulator (agr) locus typing and multilocus sequence typing (MLST). Seventy eight (78/1175, 6.6%) isolates possessed the lukSF-PV genes and 59.0% (46/78) of PVL-positive strains belonged to CC59 lineage. Eight known different PVL-encoding phage types were detected, and Φ7247PVL/ΦST5967PVL (n = 13) and ΦPVL (n = 12) were the most prevalent among them. While 25 (25/78, 32.1%) isolates, belonging to ST30, and ST59 clones, were unable to be typed by the modified PCR-based scheme. Single nucleotide polymorphisms (SNPs) were identified at five locations in the lukSF-PV genes, two of which were non-synonymous. Maximum-likelihood tree analysis of attachment sites sequences detected six SNP profiles for attR and eight for attL, respectively. In conclusion, the PVL-positive S. aureus mainly harbored Φ7247PVL/ΦST5967PVL and ΦPVL in the regions studied. lukSF-PV gene sequences, PVL-encoding phages, and phage insertion locus generally varied with lineages. Moreover, PVL-positive clones that have emerged worldwide likely carry distinct phages.

Typing of Panton-Valentine Leukocidin-encoding Phages and lukSF-PV Gene Sequence Variation in Staphylococcus aureus from China

Directory of Open Access Journals (Sweden)

Huanqiang Zhao

2016-08-01

Full Text Available Panton-Valentine leucocidin (PVL, encoded by lukSF-PV genes, a bi-component and pore-forming toxin, is carried by different staphylococcal bacteriophages. The prevalence of PVL in Staphylococcus aureus (S. aureus have been reported around the globe. However, the data on PVL-encoding phage types, lukSF-PV gene variation and chromosomal phage insertion sites for PVL-positive S. aureus are limited, especially in China. In order to obtain a more complete understanding of the molecular epidemiology of PVL-positive S. aureus, an integrated and modified PCR-based scheme was applied to detect the PVL-encoding phage types. Phage insertion locus and the lukSF-PV variant were determined by PCR and sequencing. Meanwhile, the genetic background was characterized by staphylococcal cassette chromosome mec (SCCmec typing, staphylococcal protein A (spa gene polymorphisms typing, pulsed-field gel electrophoresis (PFGE typing, accessory gene regulator (agr locus typing and multilocus sequence typing (MLST. Seventy eight (78/1175, 6.6% isolates possessed the lukSF-PV genes and 59.0% (46/78 of PVL-positive strains belonged to CC59 lineage. Eight known different PVL-encoding phage types were detected, and Φ7247PVL/ΦST5967PVL (n=13 and ΦPVL (n=12 were the most prevalent among them. While 25 (25/78, 32.1% isolates, belonging to ST30 and ST59 clones, were unable to be typed by the modified PCR-based scheme. Single nucleotide polymorphisms (SNPs were identified at five locations in the lukSF-PV genes, two of which were non-synonymous. Maximum-likelihood tree analysis of attachment sites sequences detected six SNP profiles for attR and eight for attL, respectively. In conclusion, the PVL-positive S. aureus mainly harbored Φ7247PVL/ΦST5967PVL and ΦPVL in the regions studied. lukSF-PV gene sequences, PVL-encoding phages and phage insertion locus generally varied with lineages. Moreover, PVL-positive clones that have emerged worldwide likely carry distinct phages.

Genes Encoding Aluminum-Activated Malate Transporter II and their Association with Fruit Acidity in Apple

Directory of Open Access Journals (Sweden)

Baiquan Ma

2015-11-01

Full Text Available A gene encoding aluminum-activated malate transporter (ALMT was previously reported as a candidate for the locus controlling acidity in apple ( × Borkh.. In this study, we found that apple genes can be divided into three families and the gene belongs to the family. Duplication of genes in apple is related to the polyploid origin of the apple genome. Divergence in expression has occurred between the gene and its homologs in the family and only the gene is significantly associated with malic acid content. The locus consists of two alleles, and . resides in the tonoplast and its ectopic expression in yeast was found to increase the influx of malic acid into yeast cells significantly, suggesting it may function as a vacuolar malate channel. In contrast, encodes a truncated protein because of a single nucleotide substitution of G with A in the last exon. As this truncated protein resides within the cell membrane, it is deemed to be nonfunctional as a vacuolar malate channel. The frequency of the genotype is very low in apple cultivars but is high in wild relatives, which suggests that apple domestication may be accompanied by selection for the gene. In addition, variations in the malic acid content of mature fruits were also observed between accessions with the same genotype in the locus. This suggests that the gene is not the only genetic determinant of fruit acidity in apple.

Elucidation of a carotenoid biosynthesis gene cluster encoding a novel enzyme, 2,2'-beta-hydroxylase, from Brevundimonas sp. strain SD212 and combinatorial biosynthesis of new or rare xanthophylls.

Science.gov (United States)

Nishida, Yasuhiro; Adachi, Kyoko; Kasai, Hiroaki; Shizuri, Yoshikazu; Shindo, Kazutoshi; Sawabe, Akiyoshi; Komemushi, Sadao; Miki, Wataru; Misawa, Norihiko

2005-08-01

A carotenoid biosynthesis gene cluster mediating the production of 2-hydroxyastaxanthin was isolated from the marine bacterium Brevundimonas sp. strain SD212 by using a common crtI sequence as the probe DNA. A sequence analysis revealed this cluster to contain 12 open reading frames (ORFs), including the 7 known genes, crtW, crtY, crtI, crtB, crtE, idi, and crtZ. The individual ORFs were functionally analyzed by complementation studies using Escherichia coli that accumulated various carotenoid precursors due to the presence of other bacterial crt genes. In addition to functionally identifying the known crt genes, we found that one (ORF11, named crtG) coded for a novel enzyme, carotenoid 2,2'-beta-hydroxylase, which showed intriguingly partial homology with animal sterol-C5-desaturase. When this crtG gene was introduced into E. coli accumulating zeaxanthin and canthaxanthin, the resulting transformants produced their 2-hydroxylated and 2,2'-dihydroxylated products which were structurally novel or rare xanthophylls, as determined by their nuclear magnetic resonance and high-performance liquid chromatography/photodiode array detector/atmospheric pressure chemical ionization mass spectrometry spectral data. The new carotenoid produced was suggested to have a strong inhibitory effect on lipid peroxidation.

A scan statistic to extract causal gene clusters from case-control genome-wide rare CNV data

Directory of Open Access Journals (Sweden)

Scherer Stephen W

2011-05-01

Full Text Available Abstract Background Several statistical tests have been developed for analyzing genome-wide association data by incorporating gene pathway information in terms of gene sets. Using these methods, hundreds of gene sets are typically tested, and the tested gene sets often overlap. This overlapping greatly increases the probability of generating false positives, and the results obtained are difficult to interpret, particularly when many gene sets show statistical significance. Results We propose a flexible statistical framework to circumvent these problems. Inspired by spatial scan statistics for detecting clustering of disease occurrence in the field of epidemiology, we developed a scan statistic to extract disease-associated gene clusters from a whole gene pathway. Extracting one or a few significant gene clusters from a global pathway limits the overall false positive probability, which results in increased statistical power, and facilitates the interpretation of test results. In the present study, we applied our method to genome-wide association data for rare copy-number variations, which have been strongly implicated in common diseases. Application of our method to a simulated dataset demonstrated the high accuracy of this method in detecting disease-associated gene clusters in a whole gene pathway. Conclusions The scan statistic approach proposed here shows a high level of accuracy in detecting gene clusters in a whole gene pathway. This study has provided a sound statistical framework for analyzing genome-wide rare CNV data by incorporating topological information on the gene pathway.

The pectin lyase-encoding gene (pnl) family from Glomerella cingulata: characterization of pnlA and its expression in yeast.

Science.gov (United States)

Templeton, M D; Sharrock, K R; Bowen, J K; Crowhurst, R N; Rikkerink, E H

1994-05-03

Oligodeoxyribonucleotide primers were designed from conserved amino acid (aa) sequences between pectin lyase D (PNLD) from Aspergillus niger and pectate lyases A and E (PELA/E) from Erwinia chrysanthemi. The polymerase chain reaction (PCR) was used with these primers to amplify genomic DNA from the plant pathogenic fungus Glomerella cingulata. Three different 220-bp fragments with homology to PNL-encoding genes from A. niger, and a 320-bp fragment with homology to PEL-encoding genes from Nicotiana tabacum and E. carotovora were cloned. One of the 220-bp PCR products (designated pnlA) was used as a probe to isolate a PNL-encoding gene from a lambda genomic DNA library prepared from G. cingulata. Nucleotide (nt) sequence data revealed that this gene has seven exons and codes for a putative 380-aa protein. The nt sequence of a cDNA clone, prepared using PCR, confirmed the presence of the six introns. The positions of the introns were different from the sites of the five introns present in the three PNL-encoding genes previously sequenced from A. niger. PNLA was synthesised in yeast by cloning the cDNA into the expression vector, pEMBLYex-4, and enzymatically active protein was secreted into the culture medium. Significantly higher expression was achieved when the context of the start codon, CACCATG, was mutated to CAAAATG, a consensus sequence commonly found in highly expressed yeast genes. The produced protein had an isoelectric point (pI) of 9.4, the same as that for the G. cingulata pnlA product.(ABSTRACT TRUNCATED AT 250 WORDS)

Gene set of nuclear-encoded mitochondrial regulators is enriched for common inherited variation in obesity.

Directory of Open Access Journals (Sweden)

Nadja Knoll

Full Text Available There are hints of an altered mitochondrial function in obesity. Nuclear-encoded genes are relevant for mitochondrial function (3 gene sets of known relevant pathways: (1 16 nuclear regulators of mitochondrial genes, (2 91 genes for oxidative phosphorylation and (3 966 nuclear-encoded mitochondrial genes. Gene set enrichment analysis (GSEA showed no association with type 2 diabetes mellitus in these gene sets. Here we performed a GSEA for the same gene sets for obesity. Genome wide association study (GWAS data from a case-control approach on 453 extremely obese children and adolescents and 435 lean adult controls were used for GSEA. For independent confirmation, we analyzed 705 obesity GWAS trios (extremely obese child and both biological parents and a population-based GWAS sample (KORA F4, n = 1,743. A meta-analysis was performed on all three samples. In each sample, the distribution of significance levels between the respective gene set and those of all genes was compared using the leading-edge-fraction-comparison test (cut-offs between the 50(th and 95(th percentile of the set of all gene-wise corrected p-values as implemented in the MAGENTA software. In the case-control sample, significant enrichment of associations with obesity was observed above the 50(th percentile for the set of the 16 nuclear regulators of mitochondrial genes (p(GSEA,50 = 0.0103. This finding was not confirmed in the trios (p(GSEA,50 = 0.5991, but in KORA (p(GSEA,50 = 0.0398. The meta-analysis again indicated a trend for enrichment (p(MAGENTA,50 = 0.1052, p(MAGENTA,75 = 0.0251. The GSEA revealed that weak association signals for obesity might be enriched in the gene set of 16 nuclear regulators of mitochondrial genes.

Gene structure and expression characteristic of a novel odorant receptor gene cluster in the parasitoid wasp Microplitis mediator (Hymenoptera: Braconidae).

Science.gov (United States)

Wang, S-N; Shan, S; Zheng, Y; Peng, Y; Lu, Z-Y; Yang, Y-Q; Li, R-J; Zhang, Y-J; Guo, Y-Y

2017-08-01

Odorant receptors (ORs) expressed in the antennae of parasitoid wasps are responsible for detection of various lipophilic airborne molecules. In the present study, 107 novel OR genes were identified from Microplitis mediator antennal transcriptome data. Phylogenetic analysis of the set of OR genes from M. mediator and Microplitis demolitor revealed that M. mediator OR (MmedOR) genes can be classified into different subfamilies, and the majority of MmedORs in each subfamily shared high sequence identities and clear orthologous relationships to M. demolitor ORs. Within a subfamily, six MmedOR genes, MmedOR98, 124, 125, 126, 131 and 155, shared a similar gene structure and were tightly linked in the genome. To evaluate whether the clustered MmedOR genes share common regulatory features, the transcription profile and expression characteristics of the six closely related OR genes were investigated in M. mediator. Rapid amplification of cDNA ends-PCR experiments revealed that the OR genes within the cluster were transcribed as single mRNAs, and a bicistronic mRNA for two adjacent genes (MmedOR124 and MmedOR98) was also detected in female antennae by reverse transcription PCR. In situ hybridization experiments indicated that each OR gene within the cluster was expressed in a different number of cells. Moreover, there was no co-expression of the two highly related OR genes, MmedOR124 and MmedOR98, which appeared to be individually expressed in a distinct population of neurons. Overall, there were distinct expression profiles of closely related MmedOR genes from the same cluster in M. mediator. These data provide a basic understanding of the olfactory coding in parasitoid wasps. © 2017 The Royal Entomological Society.

Variation in sequence and location of the fumonisin mycotoxin niosynthetic gene cluster in Fusarium

NARCIS (Netherlands)

Proctor, R.H.; Hove, van F.; Susca, A.; Stea, A.; Busman, M.; Lee, van der T.A.J.; Waalwijk, C.; Moretti, A.

2010-01-01

In Fusarium, the ability to produce fumonisins is governed by a 17-gene fumonisin biosynthetic gene (FUM) cluster. Here, we examined the cluster in F. oxysporum strain O-1890 and nine other species selected to represent a wide range of the genetic diversity within the GFSC.

Ancestral Variations of the PCDHG Gene Cluster Predispose to Dyslexia in a Multiplex Family

Directory of Open Access Journals (Sweden)

Teesta Naskar

2018-02-01

Full Text Available Dyslexia is a heritable neurodevelopmental disorder characterized by difficulties in reading and writing. In this study, we describe the identification of a set of 17 polymorphisms located across 1.9 Mb region on chromosome 5q31.3, encompassing genes of the PCDHG cluster, TAF7, PCDH1 and ARHGAP26, dominantly inherited with dyslexia in a multi-incident family. Strikingly, the non-risk form of seven variations of the PCDHG cluster, are preponderant in the human lineage, while risk alleles are ancestral and conserved across Neanderthals to non-human primates. Four of these seven ancestral variations (c.460A > C [p.Ile154Leu], c.541G > A [p.Ala181Thr], c.2036G > C [p.Arg679Pro] and c.2059A > G [p.Lys687Glu] result in amino acid alterations. p.Ile154Leu and p.Ala181Thr are present at EC2: EC3 interacting interface of γA3-PCDH and γA4-PCDH respectively might affect trans-homophilic interaction and hence neuronal connectivity. p.Arg679Pro and p.Lys687Glu are present within the linker region connecting trans-membrane to extracellular domain. Sequence analysis indicated the importance of p.Ile154, p.Arg679 and p.Lys687 in maintaining class specificity. Thus the observed association of PCDHG genes encoding neural adhesion proteins reinforces the hypothesis of aberrant neuronal connectivity in the pathophysiology of dyslexia. Additionally, the striking conservation of the identified variants indicates a role of PCDHG in the evolution of highly specialized cognitive skills critical to reading.

Heterologous expression of pyrroloquinoline quinone (pqq) gene cluster confers mineral phosphate solubilization ability to Herbaspirillum seropedicae Z67.

Science.gov (United States)

Wagh, Jitendra; Shah, Sonal; Bhandari, Praveena; Archana, G; Kumar, G Naresh

2014-06-01

Gluconic acid secretion mediated by the direct oxidation of glucose by pyrroloquinoline quinone (PQQ)-dependent glucose dehydrogenase (GDH) is responsible for mineral phosphate solubilization in Gram-negative bacteria. Herbaspirillum seropedicae Z67 (ATCC 35892) genome encodes GDH apoprotein but lacks genes for the biosynthesis of its cofactor PQQ. In this study, pqqE of Erwinia herbicola (in plasmid pJNK1) and pqq gene clusters of Pseudomonas fluorescens B16 (pOK53) and Acinetobacter calcoaceticus (pSS2) were over-expressed in H. seropedicae Z67. Transformants Hs (pSS2) and Hs (pOK53) secreted micromolar levels of PQQ and attained high GDH activity leading to secretion of 33.46 mM gluconic acid when grown on 50 mM glucose while Hs (pJNK1) was ineffective. Hs (pJNK1) failed to solubilize rock phosphate, while Hs (pSS2) and Hs (pOK53) liberated 125.47 μM and 168.07 μM P, respectively, in minimal medium containing 50 mM glucose under aerobic conditions. Moreover, under N-free minimal medium, Hs (pSS2) and Hs (pOK53) not only released significant P but also showed enhanced growth, biofilm formation, and exopolysaccharide (EPS) secretion. However, indole acetic acid (IAA) production was suppressed. Thus, the addition of the pqq gene cluster, but not pqqE alone, is sufficient for engineering phosphate solubilization in H. seropedicae Z67 without compromising growth under nitrogen-fixing conditions.

Cloning, Expression Profiling and Functional Analysis of CnHMGS, a Gene Encoding 3-hydroxy-3-Methylglutaryl Coenzyme A Synthase from Chamaemelum nobile

Directory of Open Access Journals (Sweden)

Shuiyuan Cheng

2016-03-01

Full Text Available Roman chamomile (Chamaemelum nobile L. is renowned for its production of essential oils, which major components are sesquiterpenoids. As the important enzyme in the sesquiterpenoid biosynthesis pathway, 3-hydroxy-3-methylglutaryl coenzyme A synthase (HMGS catalyze the crucial step in the mevalonate pathway in plants. To isolate and identify the functional genes involved in the sesquiterpene biosynthesis of C. nobile L., a HMGS gene designated as CnHMGS (GenBank Accession No. KU529969 was cloned from C. nobile. The cDNA sequence of CnHMGS contained a 1377 bp open reading frame encoding a 458-amino-acid protein. The sequence of the CnHMGS protein was highly homologous to those of HMGS proteins from other plant species. Phylogenetic tree analysis revealed that CnHMGS clustered with the HMGS of Asteraceae in the dicotyledon clade. Further functional complementation of CnHMGS in the mutant yeast strain YSC6274 lacking HMGS activity demonstrated that the cloned CnHMGS cDNA encodes a functional HMGS. Transcript profile analysis indicated that CnHMGS was preferentially expressed in flowers and roots of C. nobile. The expression of CnHMGS could be upregulated by exogenous elicitors, including methyl jasmonate and salicylic acid, suggesting that CnHMGS was elicitor-responsive. The characterization and expression analysis of CnHMGS is helpful to understand the biosynthesis of sesquiterpenoid in C. nobile at the molecular level and also provides molecular wealth for the biotechnological improvement of this important medicinal plant.

Cloning, Expression Profiling and Functional Analysis of CnHMGS, a Gene Encoding 3-hydroxy-3-Methylglutaryl Coenzyme A Synthase from Chamaemelum nobile.

Science.gov (United States)

Cheng, Shuiyuan; Wang, Xiaohui; Xu, Feng; Chen, Qiangwen; Tao, Tingting; Lei, Jing; Zhang, Weiwei; Liao, Yongling; Chang, Jie; Li, Xingxiang

2016-03-08

Roman chamomile (Chamaemelum nobile L.) is renowned for its production of essential oils, which major components are sesquiterpenoids. As the important enzyme in the sesquiterpenoid biosynthesis pathway, 3-hydroxy-3-methylglutaryl coenzyme A synthase (HMGS) catalyze the crucial step in the mevalonate pathway in plants. To isolate and identify the functional genes involved in the sesquiterpene biosynthesis of C. nobile L., a HMGS gene designated as CnHMGS (GenBank Accession No. KU529969) was cloned from C. nobile. The cDNA sequence of CnHMGS contained a 1377 bp open reading frame encoding a 458-amino-acid protein. The sequence of the CnHMGS protein was highly homologous to those of HMGS proteins from other plant species. Phylogenetic tree analysis revealed that CnHMGS clustered with the HMGS of Asteraceae in the dicotyledon clade. Further functional complementation of CnHMGS in the mutant yeast strain YSC6274 lacking HMGS activity demonstrated that the cloned CnHMGS cDNA encodes a functional HMGS. Transcript profile analysis indicated that CnHMGS was preferentially expressed in flowers and roots of C. nobile. The expression of CnHMGS could be upregulated by exogenous elicitors, including methyl jasmonate and salicylic acid, suggesting that CnHMGS was elicitor-responsive. The characterization and expression analysis of CnHMGS is helpful to understand the biosynthesis of sesquiterpenoid in C. nobile at the molecular level and also provides molecular wealth for the biotechnological improvement of this important medicinal plant.

Burkholderia mallei tssM Encodes a Putative Deubiquitinase That Is Secreted and Expressed inside Infected RAW 264.7 Murine Macrophages▿ †

Science.gov (United States)

Shanks, John; Burtnick, Mary N.; Brett, Paul J.; Waag, David M.; Spurgers, Kevin B.; Ribot, Wilson J.; Schell, Mark A.; Panchal, Rekha G.; Gherardini, Frank C.; Wilkinson, Keith D.; DeShazer, David

2009-01-01

Burkholderia mallei, a category B biothreat agent, is a facultative intracellular pathogen that causes the zoonotic disease glanders. The B. mallei VirAG two-component regulatory system activates the transcription of ∼60 genes, including a large virulence gene cluster encoding a type VI secretion system (T6SS). The B. mallei tssM gene encodes a putative ubiquitin-specific protease that is physically linked to, and transcriptionally coregulated with, the T6SS gene cluster. Mass spectrometry and immunoblot analysis demonstrated that TssM was secreted in a virAG-dependent manner in vitro. Surprisingly, the T6SS was found to be dispensable for the secretion of TssM. The C-terminal half of TssM, which contains Cys and His box motifs conserved in eukaryotic deubiquitinases, was purified and biochemically characterized. Recombinant TssM hydrolyzed multiple ubiquitinated substrates and the cysteine at position 102 was critical for enzymatic activity. The tssM gene was expressed within 1 h after uptake of B. mallei into RAW 264.7 murine macrophages, suggesting that the TssM deubiquitinase is produced in this intracellular niche. Although the physiological substrate(s) is currently unknown, the TssM deubiquitinase may provide B. mallei a selective advantage in the intracellular environment during infection. PMID:19168747

The organization of the fuc regulon specifying L-fucose dissimilation in Escherichia coli K12 as determined by gene cloning.

Science.gov (United States)

Chen, Y M; Zhu, Y; Lin, E C

1987-12-01

In Escherichia coli the six known genes specifying the utilization of L-fucose as carbon and energy source cluster at 60.2 min and constitute a regulon. These genes include fucP (encoding L-fucose permease), fucI (encoding L-fucose isomerase), fucK (encoding L-fuculose kinase), fucA (encoding L-fuculose 1-phosphate aldolase), fucO (encoding L-1,2-propanediol oxidoreductase), and fucR (encoding the regulatory protein). In this study the fuc genes were cloned and their positions on the chromosome were established by restriction endonuclease and complementation analyses. Clockwise, the gene order is: fucO-fucA-fucP-fucI-fucK-fucR. The operons comprising the structural genes and the direction of transcription were determined by complementation analysis and Southern blot hybridization. The fucPIK and fucA operons are transcribed clockwise. The fucO operon is transcribed counterclockwise. The fucR gene product activates the three structural operons in trans.

Sequencing, physical organization and kinetic expression of the patulin biosynthetic gene cluster from Penicillium expansum

International Nuclear Information System (INIS)

Tannous, J.; El Khoury, R.; El Khoury, A.; Lteif, R.; Snini, S.; Lippi, Y.; Oswald, I.; Olivier, P.; Atoui, A.

2014-01-01

Patulin is a polyketide-derived mycotoxin produced by numerous filamentous fungi. Among them, Penicillium expansum is by far the most problematic species. This fungus is a destructive phytopathogen capable of growing on fruit, provoking the blue mold decay of apples and producing significant amounts of patulin. The biosynthetic pathway of this mycotoxin is chemically well-characterized, but its genetic bases remain largely unknown with only few characterized genes in less economic relevant species. The present study consisted of the identification and positional organization of the patulin gene cluster in P. expansum strain NRRL 35695. Several amplification reactions were performed with degenerative primers that were designed based on sequences from the orthologous genes available in other species. An improved genome Walking approach was used in order to sequence the remaining adjacent genes of the cluster. RACE-PCR was also carried out from mRNAs to determine the start and stop codons of the coding sequences. The patulin gene cluster in P. expansum consists of 15 genes in the following order: patH, patG, patF, patE, patD, patC, patB, patA, patM, patN, patO, patL, patI, patJ, and patK. These genes share 60–70% of identity with orthologous genes grouped differently, within a putative patulin cluster described in a non-producing strain of Aspergillus clavatus. The kinetics of patulin cluster genes expression was studied under patulin-permissive conditions (natural apple-based medium) and patulin-restrictive conditions (Eagle's minimal essential medium), and demonstrated a significant association between gene expression and patulin production. In conclusion, the sequence of the patulin cluster in P. expansum constitutes a key step for a better understanding of themechanisms leading to patulin production in this fungus. It will allow the role of each gene to be elucidated, and help to define strategies to reduce patulin production in apple-based products

The Riemerella anatipestifer AS87_01735 Gene Encodes Nicotinamidase PncA, an Important Virulence Factor.

Science.gov (United States)

Wang, Xiaolan; Liu, Beibei; Dou, Yafeng; Fan, Hongjie; Wang, Shaohui; Li, Tao; Ding, Chan; Yu, Shengqing

2016-10-01

Riemerella anatipestifer is a major bacterial pathogen that causes septicemic and exudative diseases in domestic ducks. In our previous study, we found that deletion of the AS87_01735 gene significantly decreased the bacterial virulence of R. anatipestifer strain Yb2 (mutant RA625). The AS87_01735 gene was predicted to encode a nicotinamidase (PncA), a key enzyme that catalyzes the conversion of nicotinamide to nicotinic acid, which is an important reaction in the NAD(+) salvage pathway. In this study, the AS87_01735 gene was expressed and identified as the PncA-encoding gene, using an enzymatic assay. Western blot analysis demonstrated that R. anatipestifer PncA was localized to the cytoplasm. The mutant strain RA625 (named Yb2ΔpncA in this study) showed a similar growth rate but decreased NAD(+) quantities in both the exponential and stationary phases in tryptic soy broth culture, compared with the wild-type strain Yb2. In addition, Yb2ΔpncA-infected ducks showed much lower bacterial loads in their blood, and no visible histological changes were observed in the heart, liver, and spleen. Furthermore, Yb2ΔpncA immunization of ducks conferred effective protection against challenge with the virulent wild-type strain Yb2. Our results suggest that the R. anatipestifer AS87_01735 gene encodes PncA, which is an important virulence factor, and that the Yb2ΔpncA mutant can be used as a novel live vaccine candidate. Riemerella anatipestifer is reported worldwide as a cause of septicemic and exudative diseases of domestic ducks. The pncA gene encodes a nicotinamidase (PncA), a key enzyme that catalyzes the conversion of nicotinamide to nicotinic acid, which is an important reaction in the NAD(+) salvage pathway. In this study, we identified and characterized the pncA-homologous gene AS87_01735 in R. anatipestifer strain Yb2. R. anatipestifer PncA is a cytoplasmic protein that possesses similar PncA activity, compared with other organisms. Generation of the pncA mutant Yb

Composition and expression of genes encoding carbohydrate-active enzymes in the straw-degrading mushroom Volvariella volvacea.

Directory of Open Access Journals (Sweden)

Bingzhi Chen

Full Text Available Volvariella volvacea is one of a few commercial cultivated mushrooms mainly using straw as carbon source. In this study, the genome of V. volcacea was sequenced and assembled. A total of 285 genes encoding carbohydrate-active enzymes (CAZymes in V. volvacea were identified and annotated. Among 15 fungi with sequenced genomes, V. volvacea ranks seventh in the number of genes encoding CAZymes. In addition, the composition of glycoside hydrolases in V. volcacea is dramatically different from other basidiomycetes: it is particularly rich in members of the glycoside hydrolase families GH10 (hemicellulose degradation and GH43 (hemicellulose and pectin degradation, and the lyase families PL1, PL3 and PL4 (pectin degradation but lacks families GH5b, GH11, GH26, GH62, GH93, GH115, GH105, GH9, GH53, GH32, GH74 and CE12. Analysis of genome-wide gene expression profiles of 3 strains using 3'-tag digital gene expression (DGE reveals that 239 CAZyme genes were expressed even in potato destrose broth medium. Our data also showed that the formation of a heterokaryotic strain could dramatically increase the expression of a number of genes which were poorly expressed in its parental homokaryotic strains.

Structures of three different neutral polysaccharides of Acinetobacter baumannii, NIPH190, NIPH201, and NIPH615, assigned to K30, K45, and K48 capsule types, respectively, based on capsule biosynthesis gene clusters.

Science.gov (United States)

Shashkov, Alexander S; Kenyon, Johanna J; Arbatsky, Nikolay P; Shneider, Mikhail M; Popova, Anastasiya V; Miroshnikov, Konstantin A; Volozhantsev, Nikolay V; Knirel, Yuriy A

2015-11-19

Neutral capsular polysaccharides (CPSs) were isolated from Acinetobacter baumannii NIPH190, NIPH201, and NIPH615. The CPSs were found to contain common monosaccharides only and to be branched with a side-chain 1→3-linked β-d-glucopyranose residue. Structures of the oligosaccharide repeat units (K units) of the CPSs were elucidated by 1D and 2D (1)H and (13)C NMR spectroscopy. Novel CPS biosynthesis gene clusters, designated KL30, KL45, and KL48, were found at the K locus in the genome sequences of NIPH190, NIPH201, and NIPH615, respectively. The genetic content of each gene cluster correlated with the structure of the CPS unit established, and therefore, the capsular types of the strains studied were designated as K30, K45, and K48, respectively. The initiating sugar of each K unit was predicted, and glycosyltransferases encoded by each gene cluster were assigned to the formation of the linkages between sugars in the corresponding K unit. Copyright © 2015 Elsevier Ltd. All rights reserved.

Cloning and characterization of genes involved in nostoxanthin biosynthesis of Sphingomonas elodea ATCC 31461.

Directory of Open Access Journals (Sweden)

Liang Zhu

Full Text Available Most Sphingomonas species synthesize the yellow carotenoid nostoxanthin. However, the carotenoid biosynthetic pathway of these species remains unclear. In this study, we cloned and characterized a carotenoid biosynthesis gene cluster containing four carotenogenic genes (crtG, crtY, crtI and crtB and a β-carotene hydroxylase gene (crtZ located outside the cluster, from the gellan-gum producing bacterium Sphingomonas elodea ATCC 31461. Each of these genes was inactivated, and the biochemical function of each gene was confirmed based on chromatographic and spectroscopic analysis of the intermediates accumulated in the knockout mutants. Moreover, the crtG gene encoding the 2,2'-β-hydroxylase and the crtZ gene encoding the β-carotene hydroxylase, both responsible for hydroxylation of β-carotene, were confirmed by complementation studies using Escherichia coli producing different carotenoids. Expression of crtG in zeaxanthin and β-carotene accumulating E. coli cells resulted in the formation of nostoxanthin and 2,2'-dihydroxy-β-carotene, respectively. Based on these results, a biochemical pathway for synthesis of nostoxanthin in S. elodea ATCC 31461 is proposed.

Cloning and characterization of genes involved in nostoxanthin biosynthesis of Sphingomonas elodea ATCC 31461.

Science.gov (United States)

Zhu, Liang; Wu, Xuechang; Li, Ou; Qian, Chaodong; Gao, Haichun

2012-01-01

Most Sphingomonas species synthesize the yellow carotenoid nostoxanthin. However, the carotenoid biosynthetic pathway of these species remains unclear. In this study, we cloned and characterized a carotenoid biosynthesis gene cluster containing four carotenogenic genes (crtG, crtY, crtI and crtB) and a β-carotene hydroxylase gene (crtZ) located outside the cluster, from the gellan-gum producing bacterium Sphingomonas elodea ATCC 31461. Each of these genes was inactivated, and the biochemical function of each gene was confirmed based on chromatographic and spectroscopic analysis of the intermediates accumulated in the knockout mutants. Moreover, the crtG gene encoding the 2,2'-β-hydroxylase and the crtZ gene encoding the β-carotene hydroxylase, both responsible for hydroxylation of β-carotene, were confirmed by complementation studies using Escherichia coli producing different carotenoids. Expression of crtG in zeaxanthin and β-carotene accumulating E. coli cells resulted in the formation of nostoxanthin and 2,2'-dihydroxy-β-carotene, respectively. Based on these results, a biochemical pathway for synthesis of nostoxanthin in S. elodea ATCC 31461 is proposed.

The frequency of genes encoding three putative group B streptococcal virulence factors among invasive and colonizing isolates

Directory of Open Access Journals (Sweden)

Borchardt Stephanie M

2006-07-01

Full Text Available Abstract Background Group B Streptococcus (GBS causes severe infections in very young infants and invasive disease in pregnant women and adults with underlying medical conditions. GBS pathogenicity varies between and within serotypes, with considerable variation in genetic content between strains. Three proteins, Rib encoded by rib, and alpha and beta C proteins encoded by bca and bac, respectively, have been suggested as potential vaccine candidates for GBS. It is not known, however, whether these genes occur more frequently in invasive versus colonizing GBS strains. Methods We screened 162 invasive and 338 colonizing GBS strains from different collections using dot blot hybridization to assess the frequency of bca, bac and rib. All strains were defined by serotyping for capsular type, and frequency differences were tested using the Chi square test. Results Genes encoding the beta C protein (bac and Rib (rib occurred at similar frequencies among invasive and colonizing isolates, bac (20% vs. 23%, and rib (28% vs. 20%, while the alpha (bca C protein was more frequently found in colonizing strains (46% vs, invasive (29%. Invasive strains were associated with specific serotype/gene combinations. Conclusion Novel virulence factors must be identified to better understand GBS disease.

Horizontal transfer of a nitrate assimilation gene cluster and ecological transitions in fungi: a phylogenetic study.

Directory of Open Access Journals (Sweden)

Jason C Slot

Full Text Available High affinity nitrate assimilation genes in fungi occur in a cluster (fHANT-AC that can be coordinately regulated. The clustered genes include nrt2, which codes for a high affinity nitrate transporter; euknr, which codes for nitrate reductase; and NAD(PH-nir, which codes for nitrite reductase. Homologs of genes in the fHANT-AC occur in other eukaryotes and prokaryotes, but they have only been found clustered in the oomycete Phytophthora (heterokonts. We performed independent and concatenated phylogenetic analyses of homologs of all three genes in the fHANT-AC. Phylogenetic analyses limited to fungal sequences suggest that the fHANT-AC has been transferred horizontally from a basidiomycete (mushrooms and smuts to an ancestor of the ascomycetous mold Trichoderma reesei. Phylogenetic analyses of sequences from diverse eukaryotes and eubacteria, and cluster structure, are consistent with a hypothesis that the fHANT-AC was assembled in a lineage leading to the oomycetes and was subsequently transferred to the Dikarya (Ascomycota+Basidiomycota, which is a derived fungal clade that includes the vast majority of terrestrial fungi. We propose that the acquisition of high affinity nitrate assimilation contributed to the success of Dikarya on land by allowing exploitation of nitrate in aerobic soils, and the subsequent transfer of a complete assimilation cluster improved the fitness of T. reesei in a new niche. Horizontal transmission of this cluster of functionally integrated genes supports the "selfish operon" hypothesis for maintenance of gene clusters.

Comparison of Expression of Secondary Metabolite Biosynthesis Cluster Genes in Aspergillus flavus, A. parasiticus, and A. oryzae

OpenAIRE

Ehrlich, Kenneth C.; Mack, Brian M.

2014-01-01

Fifty six secondary metabolite biosynthesis gene clusters are predicted to be in the Aspergillus flavus genome. In spite of this, the biosyntheses of only seven metabolites, including the aflatoxins, kojic acid, cyclopiazonic acid and aflatrem, have been assigned to a particular gene cluster. We used RNA-seq to compare expression of secondary metabolite genes in gene clusters for the closely related fungi A. parasiticus, A. oryzae, and A. flavus S and L sclerotial morphotypes. The data help ...

Increasing Power by Sharing Information from Genetic Background and Treatment in Clustering of Gene Expression Time Series

OpenAIRE

Sura Zaki Alrashid; Muhammad Arifur Rahman; Nabeel H Al-Aaraji; Neil D Lawrence; Paul R Heath

2018-01-01

Clustering of gene expression time series gives insight into which genes may be co-regulated, allowing us to discern the activity of pathways in a given microarray experiment. Of particular interest is how a given group of genes varies with different conditions or genetic background. This paper develops
a new clustering method that allows each cluster to be parameterised according to whether the behaviour of the genes across conditions is correlated or anti-correlated. By specifying correlati...

MiR-17-92 cluster and immunity.

Science.gov (United States)

Kuo, George; Wu, Chao-Yi; Yang, Huang-Yu

2018-05-29

MicroRNAs (MiR, MiRNA) are small single-stranded non-coding RNAs that play an important role in the regulation of gene expression. MircoRNAs exert their effect by binding to complementary nucleotide sequences of the targeted messenger RNA, thus forming an RNA-induced silencing complex. The mircoRNA-17-92 cluster encoded by the miR-17-92 host gene is first found in malignant B-cell lymphoma. Recent research identifies the miR-17-92 cluster as a crucial player in the development of the immune system, the heart, the lung, and oncogenic events. In light of the miR-17-92 cluster's increasing role in regulating the immune system, our review will discuss the latest knowledge regarding its involvement in cells of both innate and adaptive immunity, including B cells, subsets of T cells such as Th1, Th2, T follicular helper cells, regulatory T cells, monocytes/macrophages, NK cells, and dendritic cells, and the possible targets that are regulated by its members. Copyright © 2018. Published by Elsevier B.V.

Increasing Power by Sharing Information from Genetic Background and Treatment in Clustering of Gene Expression Time Series

Directory of Open Access Journals (Sweden)

Sura Zaki Alrashid

2018-02-01

Full Text Available Clustering of gene expression time series gives insight into which genes may be co-regulated, allowing us to discern the activity of pathways in a given microarray experiment. Of particular interest is how a given group of genes varies with different conditions or genetic background. This paper develops
a new clustering method that allows each cluster to be parameterised according to whether the behaviour of the genes across conditions is correlated or anti-correlated. By specifying correlation between such genes,more information is gain within the cluster about how the genes interrelate. Amyotrophic lateral sclerosis (ALS is an irreversible neurodegenerative disorder that kills the motor neurons and results in death within 2 to 3 years from the symptom onset. Speed of progression for different patients are heterogeneous with significant variability. The SOD1G93A transgenic mice from different backgrounds (129Sv and C57 showed consistent phenotypic differences for disease progression. A hierarchy of Gaussian isused processes to model condition-specific and gene-specific temporal co-variances. This study demonstrated about finding some significant gene expression profiles and clusters of associated or co-regulated gene expressions together from four groups of data (SOD1G93A and Ntg from 129Sv and C57 backgrounds. Our study shows the effectiveness of sharing information between replicates and different model conditions when modelling gene expression time series. Further gene enrichment score analysis and ontology pathway analysis of some specified clusters for a particular group may lead toward identifying features underlying the differential speed of disease progression.

Form gene clustering method about pan-ethnic-group products based on emotional semantic

Science.gov (United States)

Chen, Dengkai; Ding, Jingjing; Gao, Minzhuo; Ma, Danping; Liu, Donghui

2016-09-01

The use of pan-ethnic-group products form knowledge primarily depends on a designer's subjective experience without user participation. The majority of studies primarily focus on the detection of the perceptual demands of consumers from the target product category. A pan-ethnic-group products form gene clustering method based on emotional semantic is constructed. Consumers' perceptual images of the pan-ethnic-group products are obtained by means of product form gene extraction and coding and computer aided product form clustering technology. A case of form gene clustering about the typical pan-ethnic-group products is investigated which indicates that the method is feasible. This paper opens up a new direction for the future development of product form design which improves the agility of product design process in the era of Industry 4.0.

Elucidation of a Carotenoid Biosynthesis Gene Cluster Encoding a Novel Enzyme, 2,2′-β-Hydroxylase, from Brevundimonas sp. Strain SD212 and Combinatorial Biosynthesis of New or Rare Xanthophylls

Science.gov (United States)

Nishida, Yasuhiro; Adachi, Kyoko; Kasai, Hiroaki; Shizuri, Yoshikazu; Shindo, Kazutoshi; Sawabe, Akiyoshi; Komemushi, Sadao; Miki, Wataru; Misawa, Norihiko

2005-01-01

A carotenoid biosynthesis gene cluster mediating the production of 2-hydroxyastaxanthin was isolated from the marine bacterium Brevundimonas sp. strain SD212 by using a common crtI sequence as the probe DNA. A sequence analysis revealed this cluster to contain 12 open reading frames (ORFs), including the 7 known genes, crtW, crtY, crtI, crtB, crtE, idi, and crtZ. The individual ORFs were functionally analyzed by complementation studies using Escherichia coli that accumulated various carotenoid precursors due to the presence of other bacterial crt genes. In addition to functionally identifying the known crt genes, we found that one (ORF11, named crtG) coded for a novel enzyme, carotenoid 2,2′-β-hydroxylase, which showed intriguingly partial homology with animal sterol-C5-desaturase. When this crtG gene was introduced into E. coli accumulating zeaxanthin and canthaxanthin, the resulting transformants produced their 2-hydroxylated and 2,2′-dihydroxylated products which were structurally novel or rare xanthophylls, as determined by their nuclear magnetic resonance and high-performance liquid chromatography/photodiode array detector/atmospheric pressure chemical ionization mass spectrometry spectral data. The new carotenoid produced was suggested to have a strong inhibitory effect on lipid peroxidation. PMID:16085816

Uncovering the functional constraints underlying the genomic organization of the odorant-binding protein genes.

Science.gov (United States)

Librado, Pablo; Rozas, Julio

2013-01-01

Animal olfactory systems have a critical role for the survival and reproduction of individuals. In insects, the odorant-binding proteins (OBPs) are encoded by a moderately sized gene family, and mediate the first steps of the olfactory processing. Most OBPs are organized in clusters of a few paralogs, which are conserved over time. Currently, the biological mechanism explaining the close physical proximity among OBPs is not yet established. Here, we conducted a comprehensive study aiming to gain insights into the mechanisms underlying the OBP genomic organization. We found that the OBP clusters are embedded within large conserved arrangements. These organizations also include other non-OBP genes, which often encode proteins integral to plasma membrane. Moreover, the conservation degree of such large clusters is related to the following: 1) the promoter architecture of the confined genes, 2) a characteristic transcriptional environment, and 3) the chromatin conformation of the chromosomal region. Our results suggest that chromatin domains may restrict the location of OBP genes to regions having the appropriate transcriptional environment, leading to the OBP cluster structure. However, the appropriate transcriptional environment for OBP and the other neighbor genes is not dominated by reduced levels of expression noise. Indeed, the stochastic fluctuations in the OBP transcript abundance may have a critical role in the combinatorial nature of the olfactory coding process.

[Cloning and expression analysis of a zinc-regulated transporters (ZRT), iron-regulated transporter (IRT)-like protein encoding gene in Dendrobium officinale].

Science.gov (United States)

Zhang, Gang; Li, Yi-Min; Li, Biao; Zhang, Da-Wei; Guo, Shun-Xing

2015-01-01

The zinc-regulated transporters (ZRT), iron-regulated transporter (IRT)-like protein (ZIP) plays an important role in the growth and development of plant. In this study, a full length cDNA of ZIP encoding gene, designed as DoZIP1 (GenBank accession KJ946203), was identified from Dendrobium officinale using RT-PCR and RACE. Bioinformatics analysis showed that DoZIP1 consisted of a 1,056 bp open reading frame (ORF) encoded a 351-aa protein with a molecular weight of 37.57 kDa and an isoelectric point (pI) of 6.09. The deduced DoZIP1 protein contained the conserved ZIP domain, and its secondary structure was composed of 50.71% alpha helix, 11.11% extended strand, 36.18% random coil, and beta turn 1.99%. DoZIP1 protein exhibited a signal peptide and eight transmembrane domains, presumably locating in cell membrane. The amino acid sequence had high homology with ZIP proteins from Arabidopsis, alfalfa and rice. A phylogenetic tree analysis demonstrated that DoZIP1 was closely related to AtZIP10 and OsZIP3, and they were clustered into one clade. Real time quantitative PCR analysis demonstrated that the transcription level of DoZIP1 in D. officinale roots was the highest (4.19 fold higher than that of stems), followed by that of leaves (1.12 fold). Molecular characters of DoZIP1 will be useful for further functional determination of the gene involving in the growth and development of D. officinale.

Comparison of expression of secondary metabolite biosynthesis cluster genes in Aspergillus flavus, A. parasiticus, and A. oryzae.

Science.gov (United States)

Ehrlich, Kenneth C; Mack, Brian M

2014-06-23

Fifty six secondary metabolite biosynthesis gene clusters are predicted to be in the Aspergillus flavus genome. In spite of this, the biosyntheses of only seven metabolites, including the aflatoxins, kojic acid, cyclopiazonic acid and aflatrem, have been assigned to a particular gene cluster. We used RNA-seq to compare expression of secondary metabolite genes in gene clusters for the closely related fungi A. parasiticus, A. oryzae, and A. flavus S and L sclerotial morphotypes. The data help to refine the identification of probable functional gene clusters within these species. Our results suggest that A. flavus, a prevalent contaminant of maize, cottonseed, peanuts and tree nuts, is capable of producing metabolites which, besides aflatoxin, could be an underappreciated contributor to its toxicity.

A recently transferred cluster of bacterial genes in Trichomonas vaginalis - lateral gene transfer and the fate of acquired genes

Science.gov (United States)

2014-01-01

Background Lateral Gene Transfer (LGT) has recently gained recognition as an important contributor to some eukaryote proteomes, but the mechanisms of acquisition and fixation in eukaryotic genomes are still uncertain. A previously defined norm for LGTs in microbial eukaryotes states that the majority are genes involved in metabolism, the LGTs are typically localized one by one, surrounded by vertically inherited genes on the chromosome, and phylogenetics shows that a broad collection of bacterial lineages have contributed to the transferome. Results A unique 34 kbp long fragment with 27 clustered genes (TvLF) of prokaryote origin was identified in the sequenced genome of the protozoan parasite Trichomonas vaginalis. Using a PCR based approach we confirmed the presence of the orthologous fragment in four additional T. vaginalis strains. Detailed sequence analyses unambiguously suggest that TvLF is the result of one single, recent LGT event. The proposed donor is a close relative to the firmicute bacterium Peptoniphilus harei. High nucleotide sequence similarity between T. vaginalis strains, as well as to P. harei, and the absence of homologs in other Trichomonas species, suggests that the transfer event took place after the radiation of the genus Trichomonas. Some genes have undergone pseudogenization and degradation, indicating that they may not be retained in the future. Functional annotations reveal that genes involved in informational processes are particularly prone to degradation. Conclusions We conclude that, although the majority of eukaryote LGTs are single gene occurrences, they may be acquired in clusters of several genes that are subsequently cleansed of evolutionarily less advantageous genes. PMID:24898731

Identification of new genes in a cell envelope-cell division gene cluster of Escherichia coli: cell envelope gene murG.

Science.gov (United States)

Salmond, G P; Lutkenhaus, J F; Donachie, W D

1980-01-01

We report the identification, cloning, and mapping of a new cell envelope gene, murG. This lies in a group of five genes of similar phenotype (in the order murE murF murG murC ddl) all concerned with peptidoglycan biosynthesis. This group is in a larger cluster of at least 10 genes, all of which are involved in some way with cell envelope growth. Images PMID:6998962

A murC gene from coryneform bacteria.

Science.gov (United States)

Wachi, M; Wijayarathna, C D; Teraoka, H; Nagai, K

1999-02-01

The upstream flanking region of the ftsQ and ftsZ genes of Brevibacterium flavum MJ233, which belongs to the coryneform bacteria, was amplified by the inverse polymerase chain reaction method and cloned in Escherichia coli. Complementation analysis of E. coli mutant with a defective cell-wall synthesis mechanism with the cloned fragment and its DNA sequencing indicated the presence of the murC gene, encoding UDP-N-acetylmuramate:L-alanine ligase involved in peptidoglycan synthesis, just upstream from the ftsQ gene. The B. flavum murC gene could encode a protein of 486 amino acid residues with a calculated molecular mass of 51 198 Da. A 50-kDa protein was synthesized by the B. flavum murC gene in an in vitro transcription/translation system using E. coli S30 lysate. These results indicate that the genes responsible for cell-wall synthesis and cell division are located as a cluster in B. flavum similar to the E. coli mra region.

Modulation of expression of genes encoding nuclear proteins following exposure to JANUS neutrons or γ-rays

International Nuclear Information System (INIS)

Woloschak, G.E.; Chang-Liu, Chin-Mei

1994-01-01

Previous work has shown that exposure of cells to ionizing radiations causes modulation of a variety of genes, including those encoding c-fos, interleukin-1, tumor necrosis factor, cytoskeletal elements, and many more. The experiments reported herein were designed to examine the effects of either JANUS neutron or γ-ray exposure on expression of genes encoding nucleus-associated proteins (H4-histone, c-jun, c-myc, Rb, and p53). Cycling Syrian hamster embryo cells were irradiated with varying doses and dose rates of either JANUS fission-spectrum neutrons or γ-rays; after incubation of the cell cultures for 1 h following radiation exposure, mRNA was harvested and analyzed by Northern blot. Results revealed induction of transcripts for c-jun, H4-histone, and Rb following γ-ray but not following neutron exposure. Interestingly, expression of c-myc was repressed following γ-ray but not following neutron exposure. Radiations at different doses and dose rates were compared for each of the genes studied

CHARACTERIZATION OF 0.58 kb DNA STILBENE SYNTHASE ENCODING GENE FRAGMENT FROM MELINJO PLANT (Gnetum gnemon

Directory of Open Access Journals (Sweden)

Tri Joko Raharjo

2011-12-01

Full Text Available Resveratrol is a potent anticancer agent resulted as the main product of enzymatic reaction between common precursor in plants and Stilbene Synthase enzyme, which is expressed by sts gene. Characterization of internal fragment of Stilbene Synthase (STS encoding gene from melinjo plant (Gnetum gnemon L. has been carried out as part of a larger work to obtain a full length of Stilbene Synthase encoding gene of the plant. RT-PCR (Reverse Transcriptase Polymerase Chain Reaction was performed using two degenerated primers to amplify the gene fragment. Ten published STS conserved amino acid sequences from various plant species from genebank were utilized to construct a pair of GGF2 (5' GTTCCACCTGCGAAGCAGCC 3' and GGR2 (5' CTGGATCGCACATCC TGGTG 3' primers. Both designed primers were predicted to be in the position of 334-354 and 897-916 kb of the gene respectively. Total RNA isolated from melinjo leaves was used as template for the RT-PCR amplification process using two-step technique. A collection of 0.58 DNA fragments was generated from RT-PCR amplification and met the expected results. The obtained DNA fragments were subsequently isolated, refined and sequenced. A nucleotide sequence analysis was accomplished by comparing it to the existed sts genes available in genebank. Homology analysis of the DNA fragments with Arachis hypogaea L00952 sts gene showed high similarity level. Taken together, the results are evidence that the amplified fragment obtained in this study is part of melinjo sts gene

Ensemble attribute profile clustering: discovering and characterizing groups of genes with similar patterns of biological features

Directory of Open Access Journals (Sweden)

Bissell MJ

2006-03-01

Full Text Available Abstract Background Ensemble attribute profile clustering is a novel, text-based strategy for analyzing a user-defined list of genes and/or proteins. The strategy exploits annotation data present in gene-centered corpora and utilizes ideas from statistical information retrieval to discover and characterize properties shared by subsets of the list. The practical utility of this method is demonstrated by employing it in a retrospective study of two non-overlapping sets of genes defined by a published investigation as markers for normal human breast luminal epithelial cells and myoepithelial cells. Results Each genetic locus was characterized using a finite set of biological properties and represented as a vector of features indicating attributes associated with the locus (a gene attribute profile. In this study, the vector space models for a pre-defined list of genes were constructed from the Gene Ontology (GO terms and the Conserved Domain Database (CDD protein domain terms assigned to the loci by the gene-centered corpus LocusLink. This data set of GO- and CDD-based gene attribute profiles, vectors of binary random variables, was used to estimate multiple finite mixture models and each ensuing model utilized to partition the profiles into clusters. The resultant partitionings were combined using a unanimous voting scheme to produce consensus clusters, sets of profiles that co-occured consistently in the same cluster. Attributes that were important in defining the genes assigned to a consensus cluster were identified. The clusters and their attributes were inspected to ascertain the GO and CDD terms most associated with subsets of genes and in conjunction with external knowledge such as chromosomal location, used to gain functional insights into human breast biology. The 52 luminal epithelial cell markers and 89 myoepithelial cell markers are disjoint sets of genes. Ensemble attribute profile clustering-based analysis indicated that both lists

Cloning and characterization of the gene encoding IMP dehydrogenase from Arabidopsis thaliana.

Science.gov (United States)

Collart, F R; Osipiuk, J; Trent, J; Olsen, G J; Huberman, E

1996-10-03

We have cloned and characterized the gene encoding inosine monophosphate dehydrogenase (IMPDH) from Arabidopsis thaliana (At). The transcription unit of the At gene spans approximately 1900 bp and specifies a protein of 503 amino acids with a calculated relative molecular mass (M(r)) of 54,190. The gene is comprised of a minimum of four introns and five exons with all donor and acceptor splice sequences conforming to previously proposed consensus sequences. The deduced IMPDH amino-acid sequence from At shows a remarkable similarity to other eukaryotic IMPDH sequences, with a 48% identity to human Type II enzyme. Allowing for conservative substitutions, the enzyme is 69% similar to human Type II IMPDH. The putative active-site sequence of At IMPDH conforms to the IMP dehydrogenase/guanosine monophosphate reductase motif and contains an essential active-site cysteine residue.

Human coronavirus 229E encodes a single ORF4 protein between the spike and the envelope genes

Directory of Open Access Journals (Sweden)

Berkhout Ben

2006-12-01

Full Text Available Abstract Background The genome of coronaviruses contains structural and non-structural genes, including several so-called accessory genes. All group 1b coronaviruses encode a single accessory protein between the spike and envelope genes, except for human coronavirus (HCoV 229E. The prototype virus has a split gene, encoding the putative ORF4a and ORF4b proteins. To determine whether primary HCoV-229E isolates exhibit this unusual genome organization, we analyzed the ORF4a/b region of five current clinical isolates from The Netherlands and three early isolates collected at the Common Cold Unit (CCU in Salisbury, UK. Results All Dutch isolates were identical in the ORF4a/b region at amino acid level. All CCU isolates are only 98% identical to the Dutch isolates at the nucleotide level, but more closely related to the prototype HCoV-229E (>98%. Remarkably, our analyses revealed that the laboratory adapted, prototype HCoV-229E has a 2-nucleotide deletion in the ORF4a/b region, whereas all clinical isolates carry a single ORF, 660 nt in size, encoding a single protein of 219 amino acids, which is a homologue of the ORF3 proteins encoded by HCoV-NL63 and PEDV. Conclusion Thus, the genome organization of the group 1b coronaviruses HCoV-NL63, PEDV and HCoV-229E is identical. It is possible that extensive culturing of the HCoV-229E laboratory strain resulted in truncation of ORF4. This may indicate that the protein is not essential in cell culture, but the highly conserved amino acid sequence of the ORF4 protein among clinical isolates suggests that the protein plays an important role in vivo.

Endophytic actinobacteria: Diversity, secondary metabolism and mechanisms to unsilence biosynthetic gene clusters.

Science.gov (United States)

Dinesh, Raghavan; Srinivasan, Veeraraghavan; T E, Sheeja; Anandaraj, Muthuswamy; Srambikkal, Hamza

2017-09-01

Endophytic actinobacteria, which reside in the inner tissues of host plants, are gaining serious attention due to their capacity to produce a plethora of secondary metabolites (e.g. antibiotics) possessing a wide variety of biological activity with diverse functions. This review encompasses the recent reports on endophytic actinobacterial species diversity, in planta habitats and mechanisms underlying their mode of entry into plants. Besides, their metabolic potential, novel bioactive compounds they produce and mechanisms to unravel their hidden metabolic repertoire by activation of cryptic or silent biosynthetic gene clusters (BGCs) for eliciting novel secondary metabolite production are discussed. The study also reviews the classical conservative techniques (chemical/biological/physical elicitation, co-culturing) as well as modern microbiology tools (e.g. next generation sequencing) that are being gainfully employed to uncover the vast hidden scaffolds for novel secondary metabolites produced by these endophytes, which would subsequently herald a revolution in drug engineering. The potential role of these endophytes in the agro-environment as promising biological candidates for inhibition of phytopathogens and the way forward to thoroughly exploit this unique microbial community by inducing expression of cryptic BGCs for encoding unseen products with novel therapeutic properties are also discussed.

Nucleotide sequences of two genomic DNAs encoding peroxidase of Arabidopsis thaliana.

Science.gov (United States)

Intapruk, C; Higashimura, N; Yamamoto, K; Okada, N; Shinmyo, A; Takano, M

1991-02-15

The peroxidase (EC 1.11.1.7)-encoding gene of Arabidopsis thaliana was screened from a genomic library using a cDNA encoding a neutral isozyme of horseradish, Armoracia rusticana, peroxidase (HRP) as a probe, and two positive clones were isolated. From the comparison with the sequences of the HRP-encoding genes, we concluded that two clones contained peroxidase-encoding genes, and they were named prxCa and prxEa. Both genes consisted of four exons and three introns; the introns had consensus nucleotides, GT and AG, at the 5' and 3' ends, respectively. The lengths of each putative exon of the prxEa gene were the same as those of the HRP-basic-isozyme-encoding gene, prxC3, and coded for 349 amino acids (aa) with a sequence homology of 89% to that encoded by prxC3. The prxCa gene was very close to the HRP-neutral-isozyme-encoding gene, prxC1b, and coded for 354 aa with 91% homology to that encoded by prxC1b. The aa sequence homology was 64% between the two peroxidases encoded by prxCa and prxEa.

Acquisition and evolution of plant pathogenesis-associated gene clusters and candidate determinants of tissue-specificity in xanthomonas.

Directory of Open Access Journals (Sweden)

Hong Lu

Full Text Available Xanthomonas is a large genus of plant-associated and plant-pathogenic bacteria. Collectively, members cause diseases on over 392 plant species. Individually, they exhibit marked host- and tissue-specificity. The determinants of this specificity are unknown.To assess potential contributions to host- and tissue-specificity, pathogenesis-associated gene clusters were compared across genomes of eight Xanthomonas strains representing vascular or non-vascular pathogens of rice, brassicas, pepper and tomato, and citrus. The gum cluster for extracellular polysaccharide is conserved except for gumN and sequences downstream. The xcs and xps clusters for type II secretion are conserved, except in the rice pathogens, in which xcs is missing. In the otherwise conserved hrp cluster, sequences flanking the core genes for type III secretion vary with respect to insertion sequence element and putative effector gene content. Variation at the rpf (regulation of pathogenicity factors cluster is more pronounced, though genes with established functional relevance are conserved. A cluster for synthesis of lipopolysaccharide varies highly, suggesting multiple horizontal gene transfers and reassortments, but this variation does not correlate with host- or tissue-specificity. Phylogenetic trees based on amino acid alignments of gum, xps, xcs, hrp, and rpf cluster products generally reflect strain phylogeny. However, amino acid residues at four positions correlate with tissue specificity, revealing hpaA and xpsD as candidate determinants. Examination of genome sequences of xanthomonads Xylella fastidiosa and Stenotrophomonas maltophilia revealed that the hrp, gum, and xcs clusters are recent acquisitions in the Xanthomonas lineage.Our results provide insight into the ancestral Xanthomonas genome and indicate that differentiation with respect to host- and tissue-specificity involved not major modifications or wholesale exchange of clusters, but subtle changes in a small

Sequence variation in the alpha-toxin encoding plc gene of Clostridium perfringens strains isolated from diseased and healthy chickens

DEFF Research Database (Denmark)

Abildgaard, L; Engberg, RM; Pedersen, Karl

2009-01-01

The aim of the present study was to analyse the genetic diversity of the alpha-toxin encoding plc gene and the variation in a-toxin production of Clostridium perfringens type A strains isolated from presumably healthy chickens and chickens suffering from either necrotic enteritis (NE) or cholangio......-hepatitis. The a-toxin encoding plc genes from 60 different pulsed-field gel electrophoresis (PFGE) types (strains) of C perfringens were sequenced and translated in silico to amino acid sequences and the a-toxin production was investigated in batch cultures of 45 of the strains using an enzyme...