WorldWideScience

Sample records for gene cluster encodes

  1. Gene cluster encoding cholate catabolism in Rhodococcus spp.

    Science.gov (United States)

    Mohn, William W; Wilbrink, Maarten H; Casabon, Israël; Stewart, Gordon R; Liu, Jie; van der Geize, Robert; Eltis, Lindsay D

    2012-12-01

    Bile acids are highly abundant steroids with important functions in vertebrate digestion. Their catabolism by bacteria is an important component of the carbon cycle, contributes to gut ecology, and has potential commercial applications. We found that Rhodococcus jostii RHA1 grows well on cholate, as well as on its conjugates, taurocholate and glycocholate. The transcriptome of RHA1 growing on cholate revealed 39 genes upregulated on cholate, occurring in a single gene cluster. Reverse transcriptase quantitative PCR confirmed that selected genes in the cluster were upregulated 10-fold on cholate versus on cholesterol. One of these genes, kshA3, encoding a putative 3-ketosteroid-9α-hydroxylase, was deleted and found essential for growth on cholate. Two coenzyme A (CoA) synthetases encoded in the cluster, CasG and CasI, were heterologously expressed. CasG was shown to transform cholate to cholyl-CoA, thus initiating side chain degradation. CasI was shown to form CoA derivatives of steroids with isopropanoyl side chains, likely occurring as degradation intermediates. Orthologous gene clusters were identified in all available Rhodococcus genomes, as well as that of Thermomonospora curvata. Moreover, Rhodococcus equi 103S, Rhodococcus ruber Chol-4 and Rhodococcus erythropolis SQ1 each grew on cholate. In contrast, several mycolic acid bacteria lacking the gene cluster were unable to grow on cholate. Our results demonstrate that the above-mentioned gene cluster encodes cholate catabolism and is distinct from a more widely occurring gene cluster encoding cholesterol catabolism.

  2. Identification of a conserved cluster of skin-specific genes encoding secreted proteins.

    Science.gov (United States)

    Moffatt, Pierre; Salois, Patrick; St-Amant, Natalie; Gaumond, Marie-Hélène; Lanctôt, Christian

    2004-06-09

    Terminal differentiation of keratinocytes results in the formation of a cornified layer composed of cross-linked intracellular and extracellular material. Using a signal trap expression screening strategy, we have identified four cDNAs encoding secreted proteins potentially involved in this process. One of the cDNAs is identical to the short isoform of suprabasin, a recently described epidermis-specific protein, which is shown here to contain a functional secretory signal. The second cDNA, sk89, encodes a protein of 493 amino acids, rich in glycine and serine residues. The third cDNA encodes a C-terminal fragment of SK89 (amino acids 410-493). It comprises exons 13 to 18 of the sk89 locus but transcription starts at an isoform-specific exon encoding a distinct secretory signal. The fourth cDNA encodes keratinocyte differentiation-associated protein (KDAP), a precursor protein of 102 amino acids. Subcellular localization by immunofluorescence and detection of the tagged proteins by Western blotting confirmed that the four proteins are secreted. Northern analysis and in situ hybridization revealed that expression of the corresponding genes was restricted to the suprabasal keratinocytes of the epidermis. These genes encoding epidermis-specific secreted products are found in a conserved cluster on human chromosome 19q13.12 and on mouse chromosome 7A3.

  3. Expression-based clustering of CAZyme-encoding genes of Aspergillus niger.

    Science.gov (United States)

    Gruben, Birgit S; Mäkelä, Miia R; Kowalczyk, Joanna E; Zhou, Miaomiao; Benoit-Gelber, Isabelle; De Vries, Ronald P

    2017-11-23

    The Aspergillus niger genome contains a large repertoire of genes encoding carbohydrate active enzymes (CAZymes) that are targeted to plant polysaccharide degradation enabling A. niger to grow on a wide range of plant biomass substrates. Which genes need to be activated in certain environmental conditions depends on the composition of the available substrate. Previous studies have demonstrated the involvement of a number of transcriptional regulators in plant biomass degradation and have identified sets of target genes for each regulator. In this study, a broad transcriptional analysis was performed of the A. niger genes encoding (putative) plant polysaccharide degrading enzymes. Microarray data focusing on the initial response of A. niger to the presence of plant biomass related carbon sources were analyzed of a wild-type strain N402 that was grown on a large range of carbon sources and of the regulatory mutant strains ΔxlnR, ΔaraR, ΔamyR, ΔrhaR and ΔgalX that were grown on their specific inducing compounds. The cluster analysis of the expression data revealed several groups of co-regulated genes, which goes beyond the traditionally described co-regulated gene sets. Additional putative target genes of the selected regulators were identified, based on their expression profile. Notably, in several cases the expression profile puts questions on the function assignment of uncharacterized genes that was based on homology searches, highlighting the need for more extensive biochemical studies into the substrate specificity of enzymes encoded by these non-characterized genes. The data also revealed sets of genes that were upregulated in the regulatory mutants, suggesting interaction between the regulatory systems and a therefore even more complex overall regulatory network than has been reported so far. Expression profiling on a large number of substrates provides better insight in the complex regulatory systems that drive the conversion of plant biomass by fungi. In

  4. Degradation of Benzene by Pseudomonas veronii 1YdBTEX2 and 1YB2 Is Catalyzed by Enzymes Encoded in Distinct Catabolism Gene Clusters.

    Science.gov (United States)

    de Lima-Morales, Daiana; Chaves-Moreno, Diego; Wos-Oxley, Melissa L; Jáuregui, Ruy; Vilchez-Vargas, Ramiro; Pieper, Dietmar H

    2016-01-01

    Pseudomonas veronii 1YdBTEX2, a benzene and toluene degrader, and Pseudomonas veronii 1YB2, a benzene degrader, have previously been shown to be key players in a benzene-contaminated site. These strains harbor unique catabolic pathways for the degradation of benzene comprising a gene cluster encoding an isopropylbenzene dioxygenase where genes encoding downstream enzymes were interrupted by stop codons. Extradiol dioxygenases were recruited from gene clusters comprising genes encoding a 2-hydroxymuconic semialdehyde dehydrogenase necessary for benzene degradation but typically absent from isopropylbenzene dioxygenase-encoding gene clusters. The benzene dihydrodiol dehydrogenase-encoding gene was not clustered with any other aromatic degradation genes, and the encoded protein was only distantly related to dehydrogenases of aromatic degradation pathways. The involvement of the different gene clusters in the degradation pathways was suggested by real-time quantitative reverse transcription PCR. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

  5. Genes encoding Cher-TPR fusion proteins are predominantly found in gene clusters encoding chemosensory pathways with alternative cellular functions.

    Directory of Open Access Journals (Sweden)

    Francisco Muñoz-Martínez

    Full Text Available Chemosensory pathways correspond to major signal transduction mechanisms and can be classified into the functional families flagellum-mediated taxis, type four pili-mediated taxis or pathways with alternative cellular functions (ACF. CheR methyltransferases are core enzymes in all of these families. CheR proteins fused to tetratricopeptide repeat (TPR domains have been reported and we present an analysis of this uncharacterized family. We show that CheR-TPRs are widely distributed in GRAM-negative but almost absent from GRAM-positive bacteria. Most strains contain a single CheR-TPR and its abundance does not correlate with the number of chemoreceptors. The TPR domain fused to CheR is comparatively short and frequently composed of 2 repeats. The majority of CheR-TPR genes were found in gene clusters that harbor multidomain response regulators in which the REC domain is fused to different output domains like HK, GGDEF, EAL, HPT, AAA, PAS, GAF, additional REC, HTH, phosphatase or combinations thereof. The response regulator architectures coincide with those reported for the ACF family of pathways. Since the presence of multidomain response regulators is a distinctive feature of this pathway family, we conclude that CheR-TPR proteins form part of ACF type pathways. The diversity of response regulator output domains suggests that the ACF pathways form a superfamily which regroups many different regulatory mechanisms, in which all CheR-TPR proteins appear to participate. In the second part we characterize WspC of Pseudomonas putida, a representative example of CheR-TPR. The affinities of WspC-Pp for S-adenosylmethionine and S-adenosylhomocysteine were comparable to those of prototypal CheR, indicating that WspC-Pp activity is in analogy to prototypal CheRs controlled by product feed-back inhibition. The removal of the TPR domain did not impact significantly on the binding constants and consequently not on the product feed-back inhibition. WspC-Pp was

  6. Genes encoding Cher-TPR fusion proteins are predominantly found in gene clusters encoding chemosensory pathways with alternative cellular functions.

    Science.gov (United States)

    Muñoz-Martínez, Francisco; García-Fontana, Cristina; Rico-Jiménez, Miriam; Alfonso, Carlos; Krell, Tino

    2012-01-01

    Chemosensory pathways correspond to major signal transduction mechanisms and can be classified into the functional families flagellum-mediated taxis, type four pili-mediated taxis or pathways with alternative cellular functions (ACF). CheR methyltransferases are core enzymes in all of these families. CheR proteins fused to tetratricopeptide repeat (TPR) domains have been reported and we present an analysis of this uncharacterized family. We show that CheR-TPRs are widely distributed in GRAM-negative but almost absent from GRAM-positive bacteria. Most strains contain a single CheR-TPR and its abundance does not correlate with the number of chemoreceptors. The TPR domain fused to CheR is comparatively short and frequently composed of 2 repeats. The majority of CheR-TPR genes were found in gene clusters that harbor multidomain response regulators in which the REC domain is fused to different output domains like HK, GGDEF, EAL, HPT, AAA, PAS, GAF, additional REC, HTH, phosphatase or combinations thereof. The response regulator architectures coincide with those reported for the ACF family of pathways. Since the presence of multidomain response regulators is a distinctive feature of this pathway family, we conclude that CheR-TPR proteins form part of ACF type pathways. The diversity of response regulator output domains suggests that the ACF pathways form a superfamily which regroups many different regulatory mechanisms, in which all CheR-TPR proteins appear to participate. In the second part we characterize WspC of Pseudomonas putida, a representative example of CheR-TPR. The affinities of WspC-Pp for S-adenosylmethionine and S-adenosylhomocysteine were comparable to those of prototypal CheR, indicating that WspC-Pp activity is in analogy to prototypal CheRs controlled by product feed-back inhibition. The removal of the TPR domain did not impact significantly on the binding constants and consequently not on the product feed-back inhibition. WspC-Pp was found to be

  7. A highly conserved NB-LRR encoding gene cluster effective against Setosphaeria turcica in sorghum

    Directory of Open Access Journals (Sweden)

    Martin Tom

    2011-11-01

    Full Text Available Abstract Background The fungal pathogen Setosphaeria turcica causes turcicum or northern leaf blight disease on maize, sorghum and related grasses. A prevalent foliar disease found worldwide where the two host crops, maize and sorghum are grown. The aim of the present study was to find genes controlling the host defense response to this devastating plant pathogen. A cDNA-AFLP approach was taken to identify candidate sequences, which functions were further validated via virus induced gene silencing (VIGS, and real-time PCR analysis. Phylogenetic analysis was performed to address evolutionary events. Results cDNA-AFLP analysis was run on susceptible and resistant sorghum and maize genotypes to identify resistance-related sequences. One CC-NB-LRR encoding gene GRMZM2G005347 was found among the up-regulated maize transcripts after fungal challenge. The new plant resistance gene was designated as St referring to S. turcica. Genome sequence comparison revealed that the CC-NB-LRR encoding St genes are located on chromosome 2 in maize, and on chromosome 5 in sorghum. The six St sorghum genes reside in three pairs in one locus. When the sorghum St genes were silenced via VIGS, the resistance was clearly compromised, an observation that was supported by real-time PCR. Database searches and phylogenetic analysis suggest that the St genes have a common ancestor present before the grass subfamily split 50-70 million years ago. Today, 6 genes are present in sorghum, 9 in rice and foxtail millet, respectively, 3 in maize and 4 in Brachypodium distachyon. The St gene homologs have all highly conserved sequences, and commonly reside as gene pairs in the grass genomes. Conclusions Resistance genes to S. turcica, with a CC-NB-LRR protein domain architecture, have been found in maize and sorghum. VIGS analysis revealed their importance in the surveillance to S. turcica in sorghum. The St genes are highly conserved in sorghum, rice, foxtail millet, maize and

  8. Prevalence of the lmo0036-0043 gene cluster encoding arginine deiminase and agmatine deiminase systems in Listeria monocytogenes.

    Science.gov (United States)

    Chen, Jianshun; Chen, Fan; Cheng, Changyong; Fang, Weihuan

    2013-04-01

    Arginine deiminase and agmatine deiminase systems are involved in acid tolerance, and their encoding genes form the cluster lmo0036-0043 in Listeria monocytogenes. While lmo0042 and lmo0043 were conserved in all L. monocytogenes strains, the lmo0036-0041 region of this cluster was identified in all lineages I and II, and the majority of lineage IV (83.3%) strains, but absent in all lineage III and a small fraction of lineage IV (16.7%) strains, suggesting that the presence of the complete lmo0036-0043 cluster is dependent on lineages. lmo0036-0043-complete and -deficient lineage IV strains exhibit specific ascB-dapE profiles, which might represent two subpopulations with distinct genetic characteristics.

  9. Dysregulated gliotoxin biosynthesis attenuates the production of unrelated biosynthetic gene cluster-encoded metabolites in Aspergillus fumigatus.

    Science.gov (United States)

    Doyle, Sean; Jones, Gary W; Dolan, Stephen K

    2018-04-01

    Gliotoxin is an epipolythiodioxopiperazine (ETP) class toxin, contains a disulfide bridge that mediates its toxic effects via redox cycling and is produced by the opportunistic fungal pathogen Aspergillus fumigatus. The gliotoxin bis-thiomethyltransferase, GtmA, attenuates gliotoxin biosynthesis in A. fumigatus by conversion of dithiol gliotoxin to bis-thiomethylgliotoxin (BmGT). Here we show that disruption of dithiol gliotoxin bis-thiomethylation functionality in A. fumigatus results in significant remodelling of the A. fumigatus secondary metabolome upon extended culture. RP-HPLC and LC-MS/MS analysis revealed the reduced production of a plethora of unrelated biosynthetic gene cluster-encoded metabolites, including pseurotin A, fumagillin, fumitremorgin C and tryprostatin B, occurs in A. fumigatus ΔgtmA upon extended incubation. Parallel quantitative proteomic analysis of A. fumigatus wild-type and ΔgtmA during extended culture revealed cognate abundance alteration of proteins encoded by relevant biosynthetic gene clusters, allied to multiple alterations in hypoxia-related proteins. The data presented herein reveal a previously concealed functionality of GtmA in facilitating the biosynthesis of other BGC-encoded metabolites produced by A. fumigatus. Copyright © 2017 British Mycological Society. Published by Elsevier Ltd. All rights reserved.

  10. The Escherichia coli Serogroup O1 and O2 Lipopolysaccharides Are Encoded by Multiple O-antigen Gene Clusters

    Science.gov (United States)

    Delannoy, Sabine; Beutin, Lothar; Mariani-Kurkdjian, Patricia; Fleiss, Aubin; Bonacorsi, Stéphane; Fach, Patrick

    2017-01-01

    Escherichia coli strains belonging to serogroups O1 and O2 are frequently associated with human infections, especially extra-intestinal infections such as bloodstream infections or urinary tract infections. These strains can be associated with a large array of flagellar antigens. Because of their frequency and clinical importance, a reliable detection of E. coli O1 and O2 strains and also the frequently associated K1 capsule is important for diagnosis and source attribution of E. coli infections in humans and animals. By sequencing the O-antigen clusters of various O1 and O2 strains we showed that the serogroups O1 and O2 are encoded by different sets of O-antigen encoding genes and identified potentially new O-groups. We developed qPCR-assays to detect the various O1 and O2 variants and the K1-encoding gene. These qPCR assays proved to be 100% sensitive and 100% specific and could be valuable tools for the investigations of zoonotic and food-borne infection of humans with O1 and O2 extra-intestinal (ExPEC) or Shiga toxin-producing E. coli (STEC) strains. PMID:28224115

  11. The ArcD1 and ArcD2 arginine/ornithine exchangers encoded in the arginine deiminase (ADI) pathway gene cluster of Lactococcus lactis

    NARCIS (Netherlands)

    Noens, Elke E E; Kaczmarek, Michał B; Żygo, Monika; Lolkema, Juke S

    2015-01-01

    The arginine deiminase pathway (ADI) gene cluster in Lactococcus lactis contains two copies of a gene encoding an L-arginine/L-ornithine exchanger, the arcD1 and arcD2 genes. The physiological function of ArcD1 and ArcD2 was studied by deleting the two genes. Deletion of arcD1 resulted in loss of

  12. The Serratia gene cluster encoding biosynthesis of the red antibiotic, prodigiosin, shows species- and strain-dependent genome context variation

    DEFF Research Database (Denmark)

    Harris, Abigail K P; Williamson, Neil R; Slater, Holly

    2004-01-01

    The prodigiosin biosynthesis gene cluster (pig cluster) from two strains of Serratia (S. marcescens ATCC 274 and Serratia sp. ATCC 39006) has been cloned, sequenced and expressed in heterologous hosts. Sequence analysis of the respective pig clusters revealed 14 ORFs in S. marcescens ATCC 274...... from Str. coelicolor A3(2) revealed some important differences. A modified scheme for the biosynthesis of prodigiosin, based on the pathway recently suggested for the synthesis of undecylprodigiosin, is proposed. The distribution of the pig cluster within several Serratia sp. isolates is demonstrated...

  13. Lactobacillus plantarum gene clusters encoding putative cell-surface protein complexes for carbohydrate utilization are conserved in specific gram-positive bacteria

    Directory of Open Access Journals (Sweden)

    Muscariello Lidia

    2006-05-01

    Full Text Available Abstract Background Genomes of gram-positive bacteria encode many putative cell-surface proteins, of which the majority has no known function. From the rapidly increasing number of available genome sequences it has become apparent that many cell-surface proteins are conserved, and frequently encoded in gene clusters or operons, suggesting common functions, and interactions of multiple components. Results A novel gene cluster encoding exclusively cell-surface proteins was identified, which is conserved in a subgroup of gram-positive bacteria. Each gene cluster generally has one copy of four new gene families called cscA, cscB, cscC and cscD. Clusters encoding these cell-surface proteins were found only in complete genomes of Lactobacillus plantarum, Lactobacillus sakei, Enterococcus faecalis, Listeria innocua, Listeria monocytogenes, Lactococcus lactis ssp lactis and Bacillus cereus and in incomplete genomes of L. lactis ssp cremoris, Lactobacillus casei, Enterococcus faecium, Pediococcus pentosaceus, Lactobacillius brevis, Oenococcus oeni, Leuconostoc mesenteroides, and Bacillus thuringiensis. These genes are neither present in the genomes of streptococci, staphylococci and clostridia, nor in the Lactobacillus acidophilus group, suggesting a niche-specific distribution, possibly relating to association with plants. All encoded proteins have a signal peptide for secretion by the Sec-dependent pathway, while some have cell-surface anchors, novel WxL domains, and putative domains for sugar binding and degradation. Transcriptome analysis in L. plantarum shows that the cscA-D genes are co-expressed, supporting their operon organization. Many gene clusters are significantly up-regulated in a glucose-grown, ccpA-mutant derivative of L. plantarum, suggesting catabolite control. This is supported by the presence of predicted CRE-sites upstream or inside the up-regulated cscA-D gene clusters. Conclusion We propose that the CscA, CscB, CscC and Csc

  14. DNA inversion within the apolipoproteins AI/CIII/AIV-encoding gene cluster of certain patients with premature atherosclerosis

    International Nuclear Information System (INIS)

    Karathanasis, S.K.; Ferris, E.; Haddad, I.A.

    1987-01-01

    The genes coding for apolipoproteins (apo) AI, CIII, and AIV, designated APOA1, APOC3, and APOA4, respectively, are closely linked and tandemly organized in the long arm of the human chromosome 11. A DNA rearrangement involving the genes encoding apoAI and apoCIII in certain patients with premature atherosclerosis has been associated with deficiency of both apoAI and apoCIII in the plasma of these patients. Structural characterization of the genes for apoAI and apoCIII in one of these patients indicates that this rearrangement consists of a DNA inversion containing portions of the 3' ends of the apoAI and apoCIII genes, including the DNA region between these genes. The breakpoints of this DNA inversion are located within the fourth exon of the apoAI gene and the first intron of the apoCIII gene. Thus, this DNA inversion results in reciprocal fusion of the apoAI and apoCIII gene transcriptional units. Expression of these gene fusions in cultured mammalian cells results in stable mRNA transcripts with sequences representing fusions of the apoAI and apoCIII mRNAs. These results indicate that absence of transcripts with correct apoAI and apoCIII mRNA sequences causes apoAI and apoCIII deficiency in the plasma of these patients and suggest that these apolipoproteins are involved in cholesterol homeostasis and protection against premature atherosclerosis

  15. K19 capsular polysaccharide of Acinetobacter baumannii is produced via a Wzy polymerase encoded in a small genomic island rather than the KL19 capsule gene cluster.

    Science.gov (United States)

    Kenyon, Johanna J; Shneider, Mikhail M; Senchenkova, Sofya N; Shashkov, Alexander S; Siniagina, Maria N; Malanin, Sergey Y; Popova, Anastasiya V; Miroshnikov, Konstantin A; Hall, Ruth M; Knirel, Yuriy A

    2016-08-01

    Polymerization of the oligosaccharides (K units) of complex capsular polysaccharides (CPSs) requires a Wzy polymerase, which is usually encoded in the gene cluster that directs K unit synthesis. Here, a gene cluster at the Acinetobacter K locus (KL) that lacks a wzy gene, KL19, was found in Acinetobacter baumannii ST111 isolates 28 and RBH2 recovered from hospitals in the Russian Federation and Australia, respectively. However, these isolates produced long-chain capsule, and a wzy gene was found in a 6.1 kb genomic island (GI) located adjacent to the cpn60 gene. The GI also includes an acetyltransferase gene, atr25, which is interrupted by an insertion sequence (IS) in RBH2. The capsule structure from both strains was →3)-α-d-GalpNAc-(1→4)-α-d-GalpNAcA-(1→3)-β-d-QuipNAc4NAc-(1→, determined using NMR spectroscopy. Biosynthesis of the K unit was inferred to be initiated with QuiNAc4NAc, and hence the Wzy forms the β-(1→3) linkage between QuipNAc4NAc and GalpNAc. The GalpNAc residue is 6-O-acetylated in isolate 28 only, showing that atr25 is responsible for this acetylation. The same GI with or without an IS in atr25 was found in draft genomes of other KL19 isolates, as well as ones carrying a closely related CPS gene cluster, KL39, which differs from KL19 only in a gene for an acyltransferase in the QuiNAc4NR synthesis pathway. Isolates carrying a KL1 variant with the wzy and atr genes each interrupted by an ISAba125 also have this GI. To our knowledge, this study is the first report of genes involved in capsule biosynthesis normally found at the KL located elsewhere in A. baumannii genomes.

  16. A species-specific cluster of defensin-like genes encodes diffusible pollen tube attractants in Arabidopsis.

    Directory of Open Access Journals (Sweden)

    Hidenori Takeuchi

    Full Text Available Genes directly involved in male/female and host/parasite interactions are believed to be under positive selection. The flowering plant Arabidopsis thaliana has more than 300 defensin-like (DEFL genes, which are likely to be involved in both natural immunity and cell-to-cell communication including pollen-pistil interactions. However, little is known of the relationship between the molecular evolution of DEFL genes and their functions. Here, we identified a recently evolved cluster of DEFL genes in A. thaliana and demonstrated that these DEFL (cysteine-rich peptide [CRP810_1] peptides, named AtLURE1 peptides, are pollen tube attractants guiding pollen tubes to the ovular micropyle. The AtLURE1 genes formed the sole species-specific cluster among DEFL genes compared to its close relative, A. lyrata. No evidence for positive selection was detected in AtLURE1 genes and their orthologs, implying neutral evolution of AtLURE1 genes. AtLURE1 peptides were specifically expressed in egg-accompanying synergid cells and secreted toward the funicular surface through the micropyle. Genetic analyses showed that gametophytic mutants defective in micropylar guidance (myb98, magatama3, and central cell guidance do not express AtLURE1 peptides. Downregulation of the expression of these peptides impaired precise pollen tube attraction to the micropylar opening of some populations of ovules. Recombinant AtLURE1 peptides attracted A. thaliana pollen tubes at a higher frequency compared to A. lyrata pollen tubes, suggesting that these peptides are species-preferential attractants in micropylar guidance. In support of this idea, the heterologous expression of a single AtLURE1 peptide in the synergid cell of Torenia fournieri was sufficient to guide A. thaliana pollen tubes to the T. fournieri embryo sac and to permit entry into it. Our results suggest the unique evolution of AtLURE1 genes, which are directly involved in male-female interaction among the DEFL multigene

  17. A PKS/NRPS/FAS hybrid gene cluster from Serratia plymuthica RVH1 encoding the biosynthesis of three broad spectrum, zeamine-related antibiotics.

    Science.gov (United States)

    Masschelein, Joleen; Mattheus, Wesley; Gao, Ling-Jie; Moons, Pieter; Van Houdt, Rob; Uytterhoeven, Birgit; Lamberigts, Chris; Lescrinier, Eveline; Rozenski, Jef; Herdewijn, Piet; Aertsen, Abram; Michiels, Chris; Lavigne, Rob

    2013-01-01

    Serratia plymuthica strain RVH1, initially isolated from an industrial food processing environment, displays potent antimicrobial activity towards a broad spectrum of Gram-positive and Gram-negative bacterial pathogens. Isolation and subsequent structure determination of bioactive molecules led to the identification of two polyamino antibiotics with the same molecular structure as zeamine and zeamine II as well as a third, closely related analogue, designated zeamine I. The gene cluster encoding the biosynthesis of the zeamine antibiotics was cloned and sequenced and shown to encode FAS, PKS as well as NRPS related enzymes in addition to putative tailoring and export enzymes. Interestingly, several genes show strong homology to the pfa cluster of genes involved in the biosynthesis of long chain polyunsaturated fatty acids in marine bacteria. We postulate that a mixed FAS/PKS and a hybrid NRPS/PKS assembly line each synthesize parts of the backbone that are linked together post-assembly in the case of zeamine and zeamine I. This interaction reflects a unique interplay between secondary lipid and secondary metabolite biosynthesis. Most likely, the zeamine antibiotics are produced as prodrugs that undergo activation in which a nonribosomal peptide sequence is cleaved off.

  18. A PKS/NRPS/FAS hybrid gene cluster from Serratia plymuthica RVH1 encoding the biosynthesis of three broad spectrum, zeamine-related antibiotics.

    Directory of Open Access Journals (Sweden)

    Joleen Masschelein

    Full Text Available Serratia plymuthica strain RVH1, initially isolated from an industrial food processing environment, displays potent antimicrobial activity towards a broad spectrum of Gram-positive and Gram-negative bacterial pathogens. Isolation and subsequent structure determination of bioactive molecules led to the identification of two polyamino antibiotics with the same molecular structure as zeamine and zeamine II as well as a third, closely related analogue, designated zeamine I. The gene cluster encoding the biosynthesis of the zeamine antibiotics was cloned and sequenced and shown to encode FAS, PKS as well as NRPS related enzymes in addition to putative tailoring and export enzymes. Interestingly, several genes show strong homology to the pfa cluster of genes involved in the biosynthesis of long chain polyunsaturated fatty acids in marine bacteria. We postulate that a mixed FAS/PKS and a hybrid NRPS/PKS assembly line each synthesize parts of the backbone that are linked together post-assembly in the case of zeamine and zeamine I. This interaction reflects a unique interplay between secondary lipid and secondary metabolite biosynthesis. Most likely, the zeamine antibiotics are produced as prodrugs that undergo activation in which a nonribosomal peptide sequence is cleaved off.

  19. Identification of a Burkholderia mallei polysaccharide gene cluster by subtractive hybridization and demonstration that the encoded capsule is an essential virulence determinant.

    Science.gov (United States)

    DeShazer, D; Waag, D M; Fritz, D L; Woods, D E

    2001-05-01

    Little is known about the virulence factors of Burkholderia mallei, the etiologic agent of glanders. We employed subtractive hybridization to identify genetic determinants present in B. mallei but not in Burkholderia thailandensis, a non-pathogenic soil microbe. Three subtractive hybridization products were mapped to a genetic locus encoding proteins involved in the biosynthesis, export and translocation of a capsular polysaccharide. We identified an insertion sequence (IS 407 A) at one end of the capsule gene cluster and demonstrated that it was functional in B. mallei. Mutations were introduced in the B. mallei capsular gene cluster and the corresponding mutants were examined for their reactivity with antibodies raised against Burkholderia pseudomallei surface polysaccharides by immunoblotting and ELISA. Immunogold electron microscopy demonstrated the presence of a capsule on the surface of B. mallei ATCC 23344 (parental strain) but not on B. mallei DD3008 (capsule mutant) or B. thailandensis. Surprisingly, B. thailandensis also harboured a portion of the capsule gene cluster. ATCC 23344 was highly virulent in hamsters and mice, but DD3008 was avirulent in both animal models. The results presented here demonstrate that the capsular polysaccharide of B. mallei is required for production of disease in two animal models of glanders infection and is a major virulence factor. Copyright 2001 Crown Copyright.

  20. Phylogenetic analysis of a gene cluster encoding an additional, rhizobial-like type III secretion system that is narrowly distributed among Pseudomonas syringae strains

    Science.gov (United States)

    2012-01-01

    Background The central role of Type III secretion systems (T3SS) in bacteria-plant interactions is well established, yet unexpected findings are being uncovered through bacterial genome sequencing. Some Pseudomonas syringae strains possess an uncharacterized cluster of genes encoding putative components of a second T3SS (T3SS-2) in addition to the well characterized Hrc1 T3SS which is associated with disease lesions in host plants and with the triggering of hypersensitive response in non-host plants. The aim of this study is to perform an in silico analysis of T3SS-2, and to compare it with other known T3SSs. Results Based on phylogenetic analysis and gene organization comparisons, the T3SS-2 cluster of the P. syringae pv. phaseolicola strain is grouped with a second T3SS found in the pNGR234b plasmid of Rhizobium sp. These additional T3SS gene clusters define a subgroup within the Rhizobium T3SS family. Although, T3SS-2 is not distributed as widely as the Hrc1 T3SS in P. syringae strains, it was found to be constitutively expressed in P. syringae pv phaseolicola through RT-PCR experiments. Conclusions The relatedness of the P. syringae T3SS-2 to a second T3SS from the pNGR234b plasmid of Rhizobium sp., member of subgroup II of the rhizobial T3SS family, indicates common ancestry and/or possible horizontal transfer events between these species. Functional analysis and genome sequencing of more rhizobia and P. syringae pathovars may shed light into why these bacteria maintain a second T3SS gene cluster in their genome. PMID:22937899

  1. Protein-protein association and cellular localization of four essential gene products encoded by tellurite resistance-conferring cluster "ter" from pathogenic Escherichia coli.

    Science.gov (United States)

    Valkovicova, Lenka; Vavrova, Silvia Minarikova; Mravec, Jozef; Grones, Jozef; Turna, Jan

    2013-12-01

    Gene cluster "ter" conferring high tellurite resistance has been identified in various pathogenic bacteria including Escherichia coli O157:H7. However, the precise mechanism as well as the molecular function of the respective gene products is unclear. Here we describe protein-protein association and localization analyses of four essential Ter proteins encoded by minimal resistance-conferring fragment (terBCDE) by means of recombinant expression. By using a two-plasmid complementation system we show that the overproduced single Ter proteins are not able to mediate tellurite resistance, but all Ter members play an irreplaceable role within the cluster. We identified several types of homotypic and heterotypic protein-protein associations among the Ter proteins by in vitro and in vivo pull-down assays and determined their cellular localization by cytosol/membrane fractionation. Our results strongly suggest that Ter proteins function involves their mutual association, which probably happens at the interface of the inner plasma membrane and the cytosol.

  2. Haloalkane-utilizing Rhodococcus strains isolated from geographically distinct locations possess a highly conserved gene cluster encoding haloalkane catabolism

    NARCIS (Netherlands)

    Poelarends, GJ; Bosma, T; Kulakov, LA; Larkin, MJ; Marchesi, [No Value; Weightman, AJ; Janssen, DB; Kulakov, Leonid A.; Larkin, Michael J.; Marchesi, Julian R.; Weightman, Andrew J.

    The sequences of the 16S rRNA and haloalkane dehalogenase (dhaA) genes of five gram-positive haloalkane-utilizing bacteria isolated from contaminated sites in Europe, Japan, and the United States and of the archetypal haloalkane-degrading bacterium Rhodococcus sp. strain NCIMB13064 were compared.

  3. The border sequence of the balhimycin biosynthesis gene cluster from Amycolatopsis balhimycina contains bbr, encoding a StrR-like pathway-specific regulator

    NARCIS (Netherlands)

    Shawky, Riham M.; Puk, Oliver; Wietzorrek, Andreas; Pelzer, Stefan; Takano, Eriko; Wohlleben, Wolfgang; Stegmann, Efthimia

    2007-01-01

    Balhimycin, produced by the actinomycete Amycolatopsis balhimycina DSM5908, is a glycopeptide antibiotic highly similar to vancomycin, the antibiotic of 'last resort' used for the treatment of resistant Gram-positive pathogenic bacteria. Partial sequence of the balhimycin biosynthesis gene cluster

  4. Thirteen nodule-specific or nodule-enhanced genes encoding products homologous to cysteine cluster proteins or plant lipid transfer proteins are identified in Astragalus sinicus L. by suppressive subtractive hybridization.

    Science.gov (United States)

    Chou, Min-Xia; Wei, Xin-Yuan; Chen, Da-Song; Zhou, Jun-Chu

    2006-01-01

    Thirteen nodule-specific or nodule-enhanced genes have been revealed by suppressive subtractive hybridization (SSH) with two mRNA populations of infected and uninfected control roots of Astragalus sinicus. Eleven of them encode small polypeptides showing homology to cysteine cluster proteins (CCPs) that contain a putative signal peptide and conserved cysteine residues. Among these CCP-like genes, AsG257 codes for a homologue of the defensin 2 family and AsD255 contains a scorpion toxin-like domain at the C-terminus. Sequence analysis of a genomic AsD255 fragment which was isolated revealed that one intron separates the first exon encoding the signal peptide from the second exon encoding the cysteine cluster domain of this nodulin. Another two genes, AsE246 and AsIB259, encode two different products similar to lipid transfer proteins (LTPs). Virtual northern blot and reverse transcription-polymerase chain reaction (RT-PCR) analysis indicated that the other genes except AsIB259 and AsC2411 were expressed exclusively in inoculated roots and that their expression was 2-4 d later than that of the leghaemoglobin (Lb) gene during nodule development. Transcription of AsIB259 was also detected in uninfected control roots but with a significant decline in expression and a temporal expression similar to Lb. AsC2411 had a basal expression in control roots identified by RT-PCR. Sequence alignment showed that the putative proteins AsE246 and AsIB259 show lower homology with LTPs from legumes than with those from other plants.

  5. Gene cluster statistics with gene families.

    Science.gov (United States)

    Raghupathy, Narayanan; Durand, Dannie

    2009-05-01

    Identifying genomic regions that descended from a common ancestor is important for understanding the function and evolution of genomes. In distantly related genomes, clusters of homologous gene pairs are evidence of candidate homologous regions. Demonstrating the statistical significance of such "gene clusters" is an essential component of comparative genomic analyses. However, currently there are no practical statistical tests for gene clusters that model the influence of the number of homologs in each gene family on cluster significance. In this work, we demonstrate empirically that failure to incorporate gene family size in gene cluster statistics results in overestimation of significance, leading to incorrect conclusions. We further present novel analytical methods for estimating gene cluster significance that take gene family size into account. Our methods do not require complete genome data and are suitable for testing individual clusters found in local regions, such as contigs in an unfinished assembly. We consider pairs of regions drawn from the same genome (paralogous clusters), as well as regions drawn from two different genomes (orthologous clusters). Determining cluster significance under general models of gene family size is computationally intractable. By assuming that all gene families are of equal size, we obtain analytical expressions that allow fast approximation of cluster probabilities. We evaluate the accuracy of this approximation by comparing the resulting gene cluster probabilities with cluster probabilities obtained by simulating a realistic, power-law distributed model of gene family size, with parameters inferred from genomic data. Surprisingly, despite the simplicity of the underlying assumption, our method accurately approximates the true cluster probabilities. It slightly overestimates these probabilities, yielding a conservative test. We present additional simulation results indicating the best choice of parameter values for data

  6. The KL24 gene cluster and a genomic island encoding a Wzy polymerase contribute genes needed for synthesis of the K24 capsular polysaccharide by the multiply antibiotic resistant Acinetobacter baumannii isolate RCH51.

    Science.gov (United States)

    Kenyon, Johanna J; Kasimova, Anastasiya A; Shneider, Mikhail M; Shashkov, Alexander S; Arbatsky, Nikolay P; Popova, Anastasiya V; Miroshnikov, Konstantin A; Hall, Ruth M; Knirel, Yuriy A

    2017-03-01

    The whole-genome sequence of the multiply antibiotic resistant Acinetobacter baumannii isolate RCH51 belonging to sequence type ST103 (Institut Pasteur scheme) revealed that the set of genes at the capsule locus, KL24, includes four genes predicted to direct the synthesis of 3-acetamido-3,6-dideoxy-d-galactose (d-Fuc3NAc), and this sugar was found in the capsular polysaccharide (CPS). One of these genes, fdtE, encodes a novel bifunctional protein with an N-terminal FdtA 3,4-ketoisomerase domain and a C-terminal acetyltransferase domain. KL24 lacks a gene encoding a Wzy polymerase to link the oligosaccharide K units to form the CPS found associated with isolate RCH51, and a wzy gene was found in a small genomic island (GI) near the cpn60 gene. This GI is in precisely the same location as another GI carrying wzy and atr genes recently found in several A. baumannii isolates, but it does not otherwise resemble it. The CPS isolated from RCH51, studied by sugar analysis and 1D and 2D 1H and 13C NMR spectroscopy, revealed that the K unit has a branched pentasaccharide structure made up of Gal, GalNAc and GlcNAc residues with d-Fuc3NAc as a side branch, and the K units are linked via a β-d-GlcpNAc-(1→3)-β-d-Galp linkage formed by the Wzy encoded by the GI. The functions of the glycosyltransferases encoded by KL24 were assigned to formation of specific bonds. A correspondence between the order of the genes in KL24 and other KL and the order of the linkages they form was noted, and this may be useful in future predictions of glycosyltransferase specificities.

  7. Bacillus caldolyticus prs gene encoding phosphoribosyldiphosphate synthase

    DEFF Research Database (Denmark)

    Krath, Britta N.; Hove-Jensen, Bjarne

    1996-01-01

    The prs gene, encoding phosphoribosyl-diphosphate (PRPP) synthase, as well as the flanking DNA sequences were cloned and sequenced from the Gram-positive thermophile, Bacillus caldolyticus. Comparison with the homologous sequences from the mesophile, Bacillus subtilis, revealed a gene (gca......D) encoding N-acetylglucosamine-l-phosphate uridyltransferase upstream of prs, and a gene homologous to ctc downstream of prs. cDNA synthesis with a B. caldolyticus gcaD-prs-ctc-specified mRNA as template, followed by amplification utilising the polymerase chain reaction indicated that the three genes are co......-transcribed. Comparison of amino acid sequences revealed a high similarity among PRPP synthases across a wide phylogenetic range. An E. coli strain harbouring the B. caldolyticus prs gene in a multicopy plasmid produced PRPP synthase activity 33-fold over the activity of a haploid B. caldolyticus strain. B. caldolyticus...

  8. Unique nucleotide polymorphism of ankyrin gene cluster in ...

    Indian Academy of Sciences (India)

    The ankyrin (ANK) gene cluster is a part of a multigene family encoding ANK transmembrane proteins in Arabidopsis thaliana, and plays an important role in protein–protein interactions and in signal pathways. In contrast to other regions of a genome, the ANK gene cluster exhibits an extremely high level of DNA ...

  9. Bioinformatics Prediction of Polyketide Synthase Gene Clusters from Mycosphaerella fijiensis.

    Directory of Open Access Journals (Sweden)

    Roslyn D Noar

    Full Text Available Mycosphaerella fijiensis, causal agent of black Sigatoka disease of banana, is a Dothideomycete fungus closely related to fungi that produce polyketides important for plant pathogenicity. We utilized the M. fijiensis genome sequence to predict PKS genes and their gene clusters and make bioinformatics predictions about the types of compounds produced by these clusters. Eight PKS gene clusters were identified in the M. fijiensis genome, placing M. fijiensis into the 23rd percentile for the number of PKS genes compared to other Dothideomycetes. Analysis of the PKS domains identified three of the PKS enzymes as non-reducing and two as highly reducing. Gene clusters contained types of genes frequently found in PKS clusters including genes encoding transporters, oxidoreductases, methyltransferases, and non-ribosomal peptide synthases. Phylogenetic analysis identified a putative PKS cluster encoding melanin biosynthesis. None of the other clusters were closely aligned with genes encoding known polyketides, however three of the PKS genes fell into clades with clusters encoding alternapyrone, fumonisin, and solanapyrone produced by Alternaria and Fusarium species. A search for homologs among available genomic sequences from 103 Dothideomycetes identified close homologs (>80% similarity for six of the PKS sequences. One of the PKS sequences was not similar (< 60% similarity to sequences in any of the 103 genomes, suggesting that it encodes a unique compound. Comparison of the M. fijiensis PKS sequences with those of two other banana pathogens, M. musicola and M. eumusae, showed that these two species have close homologs to five of the M. fijiensis PKS sequences, but three others were not found in either species. RT-PCR and RNA-Seq analysis showed that the melanin PKS cluster was down-regulated in infected banana as compared to growth in culture. Three other clusters, however were strongly upregulated during disease development in banana, suggesting that

  10. Bioinformatics Prediction of Polyketide Synthase Gene Clusters from Mycosphaerella fijiensis.

    Science.gov (United States)

    Noar, Roslyn D; Daub, Margaret E

    2016-01-01

    Mycosphaerella fijiensis, causal agent of black Sigatoka disease of banana, is a Dothideomycete fungus closely related to fungi that produce polyketides important for plant pathogenicity. We utilized the M. fijiensis genome sequence to predict PKS genes and their gene clusters and make bioinformatics predictions about the types of compounds produced by these clusters. Eight PKS gene clusters were identified in the M. fijiensis genome, placing M. fijiensis into the 23rd percentile for the number of PKS genes compared to other Dothideomycetes. Analysis of the PKS domains identified three of the PKS enzymes as non-reducing and two as highly reducing. Gene clusters contained types of genes frequently found in PKS clusters including genes encoding transporters, oxidoreductases, methyltransferases, and non-ribosomal peptide synthases. Phylogenetic analysis identified a putative PKS cluster encoding melanin biosynthesis. None of the other clusters were closely aligned with genes encoding known polyketides, however three of the PKS genes fell into clades with clusters encoding alternapyrone, fumonisin, and solanapyrone produced by Alternaria and Fusarium species. A search for homologs among available genomic sequences from 103 Dothideomycetes identified close homologs (>80% similarity) for six of the PKS sequences. One of the PKS sequences was not similar (< 60% similarity) to sequences in any of the 103 genomes, suggesting that it encodes a unique compound. Comparison of the M. fijiensis PKS sequences with those of two other banana pathogens, M. musicola and M. eumusae, showed that these two species have close homologs to five of the M. fijiensis PKS sequences, but three others were not found in either species. RT-PCR and RNA-Seq analysis showed that the melanin PKS cluster was down-regulated in infected banana as compared to growth in culture. Three other clusters, however were strongly upregulated during disease development in banana, suggesting that they may encode

  11. The polyketide components of waxes and the Cer-cqu gene cluster encoding a novel polyketide synthase, the β-diketone synthase, DKS

    DEFF Research Database (Denmark)

    von Wettstein, Penny

    2017-01-01

    The primary function of the outermost, lipophilic layer of plant aerial surfaces, called the cuticle, is preventing non-stomatal water loss. Its exterior surface is often decorated with wax crystals, imparting a blue-grey color. Identification of the barley Cer-c, -q and -u genes forming the 101 ...

  12. FunGeneClusterS

    DEFF Research Database (Denmark)

    Vesth, Tammi Camilla; Brandl, Julian; Andersen, Mikael Rørdam

    2016-01-01

    and industrial biotechnology applications. We have previously published a method for accurate prediction of clusters from genome and transcriptome data, which could also suggest cross-chemistry, however, this method was limited both in the number of parameters which could be adjusted as well as in user......Secondary metabolites of fungi are receiving an increasing amount of interest due to their prolific bioactivities and the fact that fungal biosynthesis of secondary metabolites often occurs from co-regulated and co-located gene clusters. This makes the gene clusters attractive for synthetic biology...

  13. orf4 of the Bacillus cereus sigB gene cluster encodes a general stress-inducible Dps-like bacterioferritin.

    Science.gov (United States)

    Wang, Shin-Wei; Chen, Chien-Yen; Tseng, Joseph T; Liang, Shih-Hsiung; Chen, Ssu-Ching; Hsieh, Chienyan; Chen, Yen-hsu; Chen, Chien-Cheng

    2009-07-01

    The function of orf4 in the sigB cluster in Bacillus cereus ATCC 14579 remains to be explored. Amino-acid sequence analysis has revealed that Orf4 is homologous with bacterioferritins and Dps. In this study, we generated an orf4-null mutant and produced recombinant protein rOrf4 to establish the role of orf4. In vitro, the purified rOrf4 was found to exist in two distinct forms, a dimeric form and a polymer form, through size exclusion analysis. The latter form exhibited a unique filament structure, in contrast to the typical spherical tetracosamer structure of bacterioferritins; the former can be induced to form rOrf4 polymers immediately after the addition of FeCl(2). Catalysis of the oxidation of ferrous irons by ferroxidase activity was detected with rOrf4, and the mineralized irons were subsequently sequestered only in the rOrf4 polymer. Moreover, rOrf4 exerted DNA-protective activity against oxidative damage via DNA binding in a nonspecific manner, as is seen with Dps. In vivo, deletion of orf4 had no effect on activation of the alternative sigma factor sigma(B), and therefore, orf4 is not associated with sigma(B) regulation; however, orf4 can be significantly upregulated upon environmental stress but not H(2)O(2) treatment. B. cereus strains with constitutive Orf4 expression exhibited a viability higher than that of the orf4-null mutant, under specific oxidative stress or heat shock. Taken together, these results suggest that Orf4 functions as a Dps-like bacterioferritin in response to environmental stress and can provide cell protection from oxidative damage through iron sequestration and DNA binding.

  14. Differential Retention of Gene Functions in a Secondary Metabolite Cluster.

    Science.gov (United States)

    Reynolds, Hannah T; Slot, Jason C; Divon, Hege H; Lysøe, Erik; Proctor, Robert H; Brown, Daren W

    2017-08-01

    In fungi, distribution of secondary metabolite (SM) gene clusters is often associated with host- or environment-specific benefits provided by SMs. In the plant pathogen Alternaria brassicicola (Dothideomycetes), the DEP cluster confers an ability to synthesize the SM depudecin, a histone deacetylase inhibitor that contributes weakly to virulence. The DEP cluster includes genes encoding enzymes, a transporter, and a transcription regulator. We investigated the distribution and evolution of the DEP cluster in 585 fungal genomes and found a wide but sporadic distribution among Dothideomycetes, Sordariomycetes, and Eurotiomycetes. We confirmed DEP gene expression and depudecin production in one fungus, Fusarium langsethiae. Phylogenetic analyses suggested 6-10 horizontal gene transfers (HGTs) of the cluster, including a transfer that led to the presence of closely related cluster homologs in Alternaria and Fusarium. The analyses also indicated that HGTs were frequently followed by loss/pseudogenization of one or more DEP genes. Independent cluster inactivation was inferred in at least four fungal classes. Analyses of transitions among functional, pseudogenized, and absent states of DEP genes among Fusarium species suggest enzyme-encoding genes are lost at higher rates than the transporter (DEP3) and regulatory (DEP6) genes. The phenotype of an experimentally-induced DEP3 mutant of Fusarium did not support the hypothesis that selective retention of DEP3 and DEP6 protects fungi from exogenous depudecin. Together, the results suggest that HGT and gene loss have contributed significantly to DEP cluster distribution, and that some DEP genes provide a greater fitness benefit possibly due to a differential tendency to form network connections. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution 2017. This work is written by US Government employees and is in the public domain in the US.

  15. Two Genes Encoding Uracil Phosphoribosyltransferase Are Present in Bacillus subtilis

    DEFF Research Database (Denmark)

    Martinussen, Jan; Glaser, Philippe; Andersen, Paal S.

    1995-01-01

    Uracil phosphoribosyltransferase (UPRTase) catalyzes the key reaction in the salvage of uracil in many microorganisms. Surprisingly, two genes encoding UPRTase activity were cloned from Bacillus subtilis by complementation of an Escherichia coli mutant. The genes were sequenced, and the putative...

  16. Comparative genomics of natural killer cell receptor gene clusters.

    Directory of Open Access Journals (Sweden)

    James Kelley

    2005-08-01

    Full Text Available Many receptors on natural killer (NK cells recognize major histocompatibility complex class I molecules in order to monitor unhealthy tissues, such as cells infected with viruses, and some tumors. Genes encoding families of NK receptors and related sequences are organized into two main clusters in humans: the natural killer complex on Chromosome 12p13.1, which encodes C-type lectin molecules, and the leukocyte receptor complex on Chromosome 19q13.4, which encodes immunoglobulin superfamily molecules. The composition of these gene clusters differs markedly between closely related species, providing evidence for rapid, lineage-specific expansions or contractions of sets of loci. The choice of NK receptor genes is polarized in the two species most studied, mouse and human. In mouse, the C-type lectin-related Ly49 gene family predominates. Conversely, the single Ly49 sequence is a pseudogene in humans, and the immunoglobulin superfamily KIR gene family is extensive. These different gene sets encode proteins that are comparable in function and genetic diversity, even though they have undergone species-specific expansions. Understanding the biological significance of this curious situation may be aided by studying which NK receptor genes are used in other vertebrates, especially in relation to species-specific differences in genes for major histocompatibility complex class I molecules.

  17. Characterization of the largest effector gene cluster of Ustilago maydis.

    Directory of Open Access Journals (Sweden)

    Thomas Brefort

    2014-07-01

    Full Text Available In the genome of the biotrophic plant pathogen Ustilago maydis, many of the genes coding for secreted protein effectors modulating virulence are arranged in gene clusters. The vast majority of these genes encode novel proteins whose expression is coupled to plant colonization. The largest of these gene clusters, cluster 19A, encodes 24 secreted effectors. Deletion of the entire cluster results in severe attenuation of virulence. Here we present the functional analysis of this genomic region. We show that a 19A deletion mutant behaves like an endophyte, i.e. is still able to colonize plants and complete the infection cycle. However, tumors, the most conspicuous symptoms of maize smut disease, are only rarely formed and fungal biomass in infected tissue is significantly reduced. The generation and analysis of strains carrying sub-deletions identified several genes significantly contributing to tumor formation after seedling infection. Another of the effectors could be linked specifically to anthocyanin induction in the infected tissue. As the individual contributions of these genes to tumor formation were small, we studied the response of maize plants to the whole cluster mutant as well as to several individual mutants by array analysis. This revealed distinct plant responses, demonstrating that the respective effectors have discrete plant targets. We propose that the analysis of plant responses to effector mutant strains that lack a strong virulence phenotype may be a general way to visualize differences in effector function.

  18. Characterization of a Soil Metagenome-Derived Gene Encoding Wax Ester Synthase.

    Science.gov (United States)

    Kim, Nam Hee; Park, Ji-Hye; Chung, Eunsook; So, Hyun-Ah; Lee, Myung Hwan; Kim, Jin-Cheol; Hwang, Eul Chul; Lee, Seon-Woo

    2016-02-01

    A soil metagenome contains the genomes of all microbes included in a soil sample, including those that cannot be cultured. In this study, soil metagenome libraries were searched for microbial genes exhibiting lipolytic activity and those involved in potential lipid metabolism that could yield valuable products in microorganisms. One of the subclones derived from the original fosmid clone, pELP120, was selected for further analysis. A subclone spanning a 3.3 kb DNA fragment was found to encode for lipase/esterase and contained an additional partial open reading frame encoding a wax ester synthase (WES) motif. Consequently, both pELP120 and the full length of the gene potentially encoding WES were sequenced. To determine if the wes gene encoded a functioning WES protein that produced wax esters, gas chromatography-mass spectroscopy was conducted using ethyl acetate extract from an Escherichia coli strain that expressed the wes gene and was grown with hexadecanol. The ethyl acetate extract from this E. coli strain did indeed produce wax ester compounds of various carbon-chain lengths. DNA sequence analysis of the full-length gene revealed that the gene cluster may be derived from a member of Proteobacteria, whereas the clone does not contain any clear phylogenetic markers. These results suggest that the wes gene discovered in this study encodes a functional protein in E. coli and produces wax esters through a heterologous expression system.

  19. Distinct Patterns of Gene Gain and Loss: Diverse Evolutionary Modes of NBS-Encoding Genes in Three Solanaceae Crop Species.

    Science.gov (United States)

    Qian, Lan-Hua; Zhou, Guang-Can; Sun, Xiao-Qin; Lei, Zhao; Zhang, Yan-Mei; Xue, Jia-Yu; Hang, Yue-Yu

    2017-05-05

    Plant resistance conferred by nucleotide binding site (NBS)-encoding resistance genes plays a key role in the defense against various pathogens throughout the entire plant life cycle. However, comparative analyses for the systematic evaluation and determination of the evolutionary modes of NBS-encoding genes among Solanaceae species are rare. In this study, 447, 255, and 306 NBS-encoding genes were identified from the genomes of potato, tomato, and pepper, respectively. These genes usually clustered as tandem arrays on chromosomes; few existed as singletons. Phylogenetic analysis indicated that three subclasses [TNLs (TIR-NBS-LRR), CNLs (CC-NBS-LRR), and RNLs (RPW8-NBS-LRR)] each formed a monophyletic clade and were distinguished by unique exon/intron structures and amino acid motif sequences. By comparing phylogenetic and systematic relationships, we inferred that the NBS-encoding genes in the present genomes of potato, tomato, and pepper were derived from 150 CNL, 22 TNL, and 4 RNL ancestral genes, and underwent independent gene loss and duplication events after speciation. The NBS-encoding genes therefore exhibit diverse and dynamic evolutionary patterns in the three Solanaceae species, giving rise to the discrepant gene numbers observed today. Potato shows a "consistent expansion" pattern, tomato exhibits a pattern of "first expansion and then contraction," and pepper presents a "shrinking" pattern. The earlier expansion of CNLs in the common ancestor led to the dominance of this subclass in gene numbers. However, RNLs remained at low copy numbers due to their specific functions. Along the evolutionary process of NBS-encoding genes in Solanaceae, species-specific tandem duplications contributed the most to gene expansions. Copyright © 2017 Qian et al.

  20. AntiSMASH 4.0 - improvements in chemistry prediction and gene cluster boundary identification

    NARCIS (Netherlands)

    Blin, Kai; Wolf, Thomas; Chevrette, Marc G.; Lu, Xiaowen; Schwalen, Christopher J.; Kautsar, Satria A.; Suarez Duran, Hernando G.; Los Santos, De Emmanuel L.C.; Kim, Hyun Uk; Nave, Mariana; Dickschat, Jeroen S.; Mitchell, Douglas A.; Shelest, Ekaterina; Breitling, Rainer; Takano, Eriko; Lee, Sang Yup; Weber, Tilmann; Medema, Marnix H.

    2017-01-01

    Many antibiotics, chemotherapeutics, crop protection agents and food preservatives originate from molecules produced by bacteria, fungi or plants. In recent years, genome mining methodologies have been widely adopted to identify and characterize the biosynthetic gene clusters encoding the production

  1. Organization and differential regulation of a cluster of lignin peroxidase genes of Phanerochaete chrysosporium

    Science.gov (United States)

    Philip. Stewart; Daniel. Cullen

    1999-06-01

    The lignin peroxidases of Phanerochaete chrysosporium are encoded by a minimum of 10 closely related genes. Physical and genetic mapping of a cluster of eight lip genes revealed six genes occurring in pairs and transcriptionally convergent, suggesting that portions of the lip family arose by gene duplication events. The completed sequence of 1ipG and lipJ, together...

  2. Organization of an echinoderm Hox gene cluster

    OpenAIRE

    Martinez, Pedro; Rast, Jonathan P.; Arenas-Mena, César; Davidson, Eric H.

    1999-01-01

    The Strongylocentrotus purpuratus genome contains a single ten-gene Hox complex >0.5 megabase in length. This complex was isolated on overlapping bacterial artificial chromosome and P1 artificial chromosome genomic recombinants by using probes for individual genes and by genomic walking. Echinoderm Hox genes of Paralog Groups (PG) 1 and 2 are reported. The cluster includes genes representing all paralog groups of vertebrate Hox clusters, except that there is a sing...

  3. RNAi-based silencing of genes encoding the vacuolar- ATPase ...

    African Journals Online (AJOL)

    RNAi-based silencing of genes encoding the vacuolar- ATPase subunits a and c in pink bollworm (Pectinophora gossypiella). Ahmed M. A. Mohammed. Abstract. RNA interference is a post- transcriptional gene regulation mechanism that is predominantly found in eukaryotic organisms. RNAi demonstrated a successful ...

  4. Isolation and characterization of the rat gene encoding glutamate dehydrogenase

    NARCIS (Netherlands)

    Das, A. T.; Arnberg, A. C.; Malingré, H.; Moerer, P.; Charles, R.; Moorman, A. F.; Lamers, W. H.

    1993-01-01

    The concentration of glutamate dehydrogenase (GDH) varies strongly between different organs and between different regions within organs. To permit further studies on the regulation of GDH expression, we isolated and characterized the rat gene encoding the GDH protein. This gene contains 13 exons and

  5. Physical and genetic map of the major nif gene cluster from Azotobacter vinelandii.

    OpenAIRE

    Jacobson, M R; Brigle, K E; Bennett, L T; Setterquist, R A; Wilson, M S; Cash, V L; Beynon, J; Newton, W E; Dean, D R

    1989-01-01

    Determination of a 28,793-base-pair DNA sequence of a region from the Azotobacter vinelandii genome that includes and flanks the nitrogenase structural gene region was completed. This information was used to revise the previously proposed organization of the major nif cluster. The major nif cluster from A. vinelandii encodes 15 nif-specific genes whose products bear significant structural identity to the corresponding nif-specific gene products from Klebsiella pneumoniae. These genes include ...

  6. Bioinformatics analysis and detection of gelatinase encoded gene in Lysinibacillussphaericus

    Science.gov (United States)

    Repin, Rul Aisyah Mat; Mutalib, Sahilah Abdul; Shahimi, Safiyyah; Khalid, Rozida Mohd.; Ayob, Mohd. Khan; Bakar, Mohd. Faizal Abu; Isa, Mohd Noor Mat

    2016-11-01

    In this study, we performed bioinformatics analysis toward genome sequence of Lysinibacillussphaericus (L. sphaericus) to determine gene encoded for gelatinase. L. sphaericus was isolated from soil and gelatinase species-specific bacterium to porcine and bovine gelatin. This bacterium offers the possibility of enzymes production which is specific to both species of meat, respectively. The main focus of this research is to identify the gelatinase encoded gene within the bacteria of L. Sphaericus using bioinformatics analysis of partially sequence genome. From the research study, three candidate gene were identified which was, gelatinase candidate gene 1 (P1), NODE_71_length_93919_cov_158.931839_21 which containing 1563 base pair (bp) in size with 520 amino acids sequence; Secondly, gelatinase candidate gene 2 (P2), NODE_23_length_52851_cov_190.061386_17 which containing 1776 bp in size with 591 amino acids sequence; and Thirdly, gelatinase candidate gene 3 (P3), NODE_106_length_32943_cov_169.147919_8 containing 1701 bp in size with 566 amino acids sequence. Three pairs of oligonucleotide primers were designed and namely as, F1, R1, F2, R2, F3 and R3 were targeted short sequences of cDNA by PCR. The amplicons were reliably results in 1563 bp in size for candidate gene P1 and 1701 bp in size for candidate gene P3. Therefore, the results of bioinformatics analysis of L. Sphaericus resulting in gene encoded gelatinase were identified.

  7. Phylogenomics characterization of a highly virulent Edwardsiella strain ET080813(T) encoding two distinct T3SS and three T6SS gene clusters: Propose a novel species as Edwardsiella anguillarum sp. nov.

    Science.gov (United States)

    Shao, Shuai; Lai, Qiliang; Liu, Qin; Wu, Haizhen; Xiao, Jingfan; Shao, Zongze; Wang, Qiyao; Zhang, Yuanxing

    2015-02-01

    As important zoonotic organisms causing infections in humans, Edwardsiella bacteria are also notorious leading fish pathogens haunting worldwide aquaculture industries. However, the taxa are now widely recognized to be misclassified, which hurdled the understanding of the epidemiology and development of effective diagnostics and vaccines. Currently the genus Edwardsiella consists of three species Edwardsiella tarda, E. ictaluri, and E. hoshinae. Previous phylogenomic analysis revealed that E. tarda strains display two major highly divergent genomic types (genotypes), EdwGI and EdwGII, and the former represents a genotype of fish-pathogenic isolates and being recently proposed as a novel species E. piscicida, sp. nov. Here multiple phylogenetic analyses and the genome-level comparisons of EdwGI strains disclose that the phylogroup strains from diseased eel formed an obviously distinct cluster that could be equated with a new species status. The phylogenetic evidence for the new species assignment was also supported by corresponding DNA-DNA hybridization estimation values and by phenotypic characteristics. Interestingly, further comparative genomics reveals that these strains have acquired the locus of enterocyte effacement (LEE) genes and as a result these bacteria contain at least 2 sets of distinct T3SS and 3 sets of T6SS gene clusters, respectively. It is therefore proposed that the phylogroup strains from diseased eel should be classified as Edwardisella anguillarum sp. nov., and the type strain is ET080813(T) (=DSM27202(T)=CCUG 64215(T)=CCTCC AB2013118(T)=MCCC 1K00238(T)). These findings will contribute to development of species-specific control measures against Edwardsiella bacterium in aquatic animals, while also shedding light on the pathogenesis evolution in Edwardsiella bacterium. Copyright © 2014 Elsevier GmbH. All rights reserved.

  8. Ergot cluster-encoded catalase is required for synthesis of chanoclavine-I in Aspergillus fumigatus.

    Science.gov (United States)

    Goetz, Kerry E; Coyle, Christine M; Cheng, Johnathan Z; O'Connor, Sarah E; Panaccione, Daniel G

    2011-06-01

    Genes required for ergot alkaloid biosynthesis are clustered in the genomes of several fungi. Several conserved ergot cluster genes have been hypothesized, and in some cases demonstrated, to encode early steps of the pathway shared among fungi that ultimately make different ergot alkaloid end products. The deduced amino acid sequence of one of these conserved genes (easC) indicates a catalase as the product, but a role for a catalase in the ergot alkaloid pathway has not been established. We disrupted easC of Aspergillus fumigatus by homologous recombination with a truncated copy of that gene. The resulting mutant (ΔeasC) failed to produce the ergot alkaloids typically observed in A. fumigatus, including chanoclavine-I, festuclavine, and fumigaclavines B, A, and C. The ΔeasC mutant instead accumulated N-methyl-4-dimethylallyltryptophan (N-Me-DMAT), an intermediate recently shown to accumulate in Claviceps purpurea strains mutated at ccsA (called easE in A. fumigatus) (Lorenz et al. Appl Environ Microbiol 76:1822-1830, 2010). A ΔeasE disruption mutant of A. fumigatus also failed to accumulate chanoclavine-I and downstream ergot alkaloids and, instead, accumulated N-Me-DMAT. Feeding chanoclavine-I to the ΔeasC mutant restored ergot alkaloid production. Complementation of either ΔeasC or ΔeasE mutants with the respective wild-type allele also restored ergot alkaloid production. The easC gene was expressed in Escherichia coli, and the protein product displayed in vitro catalase activity with H(2)O(2) but did not act, in isolation, on N-Me-DMAT as substrate. The data indicate that the products of both easC (catalase) and easE (FAD-dependent oxidoreductase) are required for conversion of N-Me-DMAT to chanoclavine-I.

  9. The Fusarium graminearum genome reveals more secondary metabolite gene clusters and hints of horizontal gene transfer.

    Directory of Open Access Journals (Sweden)

    Christian M K Sieber

    Full Text Available Fungal secondary metabolite biosynthesis genes are of major interest due to the pharmacological properties of their products (like mycotoxins and antibiotics. The genome of the plant pathogenic fungus Fusarium graminearum codes for a large number of candidate enzymes involved in secondary metabolite biosynthesis. However, the chemical nature of most enzymatic products of proteins encoded by putative secondary metabolism biosynthetic genes is largely unknown. Based on our analysis we present 67 gene clusters with significant enrichment of predicted secondary metabolism related enzymatic functions. 20 gene clusters with unknown metabolites exhibit strong gene expression correlation in planta and presumably play a role in virulence. Furthermore, the identification of conserved and over-represented putative transcription factor binding sites serves as additional evidence for cluster co-regulation. Orthologous cluster search provided insight into the evolution of secondary metabolism clusters. Some clusters are characteristic for the Fusarium phylum while others show evidence of horizontal gene transfer as orthologs can be found in representatives of the Botrytis or Cochliobolus lineage. The presented candidate clusters provide valuable targets for experimental examination.

  10. A deep auto-encoder model for gene expression prediction.

    Science.gov (United States)

    Xie, Rui; Wen, Jia; Quitadamo, Andrew; Cheng, Jianlin; Shi, Xinghua

    2017-11-17

    Gene expression is a key intermediate level that genotypes lead to a particular trait. Gene expression is affected by various factors including genotypes of genetic variants. With an aim of delineating the genetic impact on gene expression, we build a deep auto-encoder model to assess how good genetic variants will contribute to gene expression changes. This new deep learning model is a regression-based predictive model based on the MultiLayer Perceptron and Stacked Denoising Auto-encoder (MLP-SAE). The model is trained using a stacked denoising auto-encoder for feature selection and a multilayer perceptron framework for backpropagation. We further improve the model by introducing dropout to prevent overfitting and improve performance. To demonstrate the usage of this model, we apply MLP-SAE to a real genomic datasets with genotypes and gene expression profiles measured in yeast. Our results show that the MLP-SAE model with dropout outperforms other models including Lasso, Random Forests and the MLP-SAE model without dropout. Using the MLP-SAE model with dropout, we show that gene expression quantifications predicted by the model solely based on genotypes, align well with true gene expression patterns. We provide a deep auto-encoder model for predicting gene expression from SNP genotypes. This study demonstrates that deep learning is appropriate for tackling another genomic problem, i.e., building predictive models to understand genotypes' contribution to gene expression. With the emerging availability of richer genomic data, we anticipate that deep learning models play a bigger role in modeling and interpreting genomics.

  11. The identification of credit card encoders by hierarchical cluster analysis of the jitters of magnetic stripes.

    Science.gov (United States)

    Leung, S C; Fung, W K; Wong, K H

    1999-01-01

    The relative bit density variation graphs of 207 specimen credit cards processed by 12 encoding machines were examined first visually, and then classified by means of hierarchical cluster analysis. Twenty-nine credit cards being treated as 'questioned' samples were tested by way of cluster analysis against 'controls' derived from known encoders. It was found that hierarchical cluster analysis provided a high accuracy of identification with all 29 'questioned' samples classified correctly. On the other hand, although visual comparison of jitter graphs was less discriminating, it was nevertheless capable of giving a reasonably accurate result.

  12. Transcriptional modulation of genes encoding nitrate reductase in ...

    African Journals Online (AJOL)

    2016-10-26

    Oct 26, 2016 ... The free aluminum (Al) content in soil can reach levels that are toxic to plants, and this has frequently limited increased productivity of cultures. Four genes encoding nitrate reductase (NR) were identified, named ZmNR1–4. With the aim of evaluating NR activity and the transcriptional modulation of the.

  13. Transcriptional modulation of genes encoding nitrate reductase in ...

    African Journals Online (AJOL)

    The free aluminum (Al) content in soil can reach levels that are toxic to plants, and this has frequently limited increased productivity of cultures. Four genes encoding nitrate reductase (NR) were identified, named ZmNR1–4. With the aim of evaluating NR activity and the transcriptional modulation of the ZmNR1, ZmNR2, ...

  14. Cloning, expression and characterisation of a novel gene encoding ...

    African Journals Online (AJOL)

    Cloning, expression and characterisation of a novel gene encoding a chemosensory protein from Bemisia tabaci Gennadius (Hemiptera: Aleyrodidae) ... The BtabCSP amino acid residues deduced from the respective full-length cDNA shares four conserved cysteine motifs with known CSPs from other insects. Homology ...

  15. RNAi-based silencing of genes encoding the vacuolar- ATPase ...

    African Journals Online (AJOL)

    2016-11-09

    Nov 9, 2016 ... Spodoptera exigua larval development by silencing chitin synthase gene with RNA interference. Bull. Entomol. Res. 98:613-619. Dow JAT (1999). The Multifunctional Drosophila melanogaster V-. ATPase is encoded by a multigene family. J. Bioenerg. Biomembr. 31:75-83. Fire A, Xu SQ, Montgomery MK, ...

  16. Molecular cloning and characterization of a gene encoding RING ...

    Indian Academy of Sciences (India)

    PRAKASH KUMAR G

    Molecular cloning and characterization of a gene encoding RING zinc finger ankyrin protein from drought-tolerant Artemisia desertorum. XIUHONG YANG, CHAO SUN, YUANLEI HU and ZHONGPING LIN. *. College of Life Sciences, National Key Laboratory of Protein Engineering and Plant Genetic Engineering, Peking.

  17. Chlorella viruses contain genes encoding a complete polyamine biosynthetic pathway

    Science.gov (United States)

    Baumann, Sascha; Sander, Adrianne; Gurnon, James R.; Yanai-Balser, Giane; VanEtten, James L.; Piotrowski, Markus

    2007-01-01

    Two genes encoding the putative polyamine biosynthetic enzymes agmatine iminohydrolase (AIH) and N-carbamoylputrescine amidohydrolase (CPA) were cloned from the chloroviruses PBCV-1, NY-2A and MT325. They were expressed in Escherichia coli to form C-terminal (His)6-tagged proteins and the recombinant proteins were purified by Ni2+- binding affinity chromatography. The biochemical properties of the two enzymes are similar to AIH and CPA enzymes from Arabidopsis thaliana and Pseudomonas aeruginosa. Together with the previously known virus genes encoding ornithine/arginine decarboxlyase (ODC/ADC) and homospermidine synthase, the chloroviruses have genes that encode a complete set of functional enzymes that synthesize the rare polyamine homospermidine from arginine via agmatine, N-carbamoylputrescine and putrescine. The PBCV-1 aih and cpa genes are expressed early during virus infection together with the odc/adc gene, suggesting that biosynthesis of putrescine is important in early stages of viral replication. The aih and cpa genes are widespread in the chlorella viruses. PMID:17101165

  18. Differential roles of two SARP-encoding regulatory genes during tylosin biosynthesis.

    Science.gov (United States)

    Bate, Neil; Stratigopoulos, George; Cundliffe, Eric

    2002-01-01

    The tylosin biosynthetic gene cluster of Streptomyces fradiae is remarkable in harbouring at least five regulatory genes, two of which (tylS and tylT) encode proteins of the Streptomyces antibiotic regulatory protein (SARP) family. The aim of the present work was to assess the respective contributions of TylS and TylT to tylosin production. A combination of targeted gene disruption, fermentation studies and gene expression analysis via reverse transcriptase-polymerase chain reaction (RT-PCR) suggests that tylS is essential for tylosin production and controls the expression of tylR (previously shown to be a global activator of the biosynthetic pathway) plus at least one other gene involved in polyketide metabolism or regulation thereof. This is the first demonstration of a SARP acting to control another regulatory gene during antibiotic biosynthesis. In contrast, tylT is not essential for tylosin production.

  19. Multiple genes encode the major surface glycoprotein of Pneumocystis carinii

    DEFF Research Database (Denmark)

    Kovacs, J A; Powell, F; Edman, J C

    1993-01-01

    this antigen is a good candidate for development as a vaccine to prevent or control P. carinii infection. We have cloned and sequenced seven related but unique genes encoding the major surface glycoprotein of rat P. carinii. Partial amino acid sequencing confirmed the identity of these genes. Based on Southern...... blot studies using chromosomal or restricted DNA, the major surface glycoproteins are the products of a multicopy family of genes. The predicted protein has an M(r) of approximately 123,000, is relatively rich in cysteine residues (5.5%) that are very strongly conserved, and contains a well conserved...

  20. Identification and use of genes encoding amatoxin and phallotoxin

    Energy Technology Data Exchange (ETDEWEB)

    Hallen, Heather E.; Walton, Jonathan D.; Luo, Hong; Scott-Craig, John S.

    2016-12-13

    The present invention relates to compositions and methods comprising genes and peptides associated with cyclic peptide toxins and toxin production in mushrooms. In particular, the present invention relates to using genes and proteins from Amanita species encoding Amanita peptides, specifically relating to amatoxins and phallotoxins. In a preferred embodiment, the present invention also relates to methods for detecting Amanita peptide toxin genes for identifying Amanita peptide-producing mushrooms and for diagnosing suspected cases of mushroom poisoning. Further, the present inventions relate to providing kits for diagnosing and monitoring suspected cases of mushroom poisoning in patients.

  1. Fuzzy clustering analysis of osteosarcoma related genes.

    Science.gov (United States)

    Chen, Kai; Wu, Dajiang; Bai, Yushu; Zhu, Xiaodong; Chen, Ziqiang; Wang, Chuanfeng; Zhao, Yingchuan; Li, Ming

    2014-07-01

    Osteosarcoma is the most common malignant bone-tumor with a peak manifestation during the second and third decade of life. In order to explore the influence of genetic factors on the mechanism of osteosarcoma by analyzing the inter relationship between osteosarcoma and its related genes, and then provide potential genetic references for the prevention, diagnosis and treatment of osteosarcoma, we collected osteosarcoma related gene sequences in Genebank of National Center for Biotechnology Information (NCBI) and local alignment analysis for a pair of sequences was carried out to identify the measurement association among related sequences. Then fuzzy clustering method was used for clustering analysis so as to contact the unknown genes through the consistent osteosarcoma related genes in one class. From the result of fuzzy clustering analysis, we could classify the osteosarcoma related genes into two groups and deduced that the genes clustered into one group had similar function. Based on this knowledge, we found more genes related to the pathogenesis of osteosarcoma and these genes could exert similar function as Runx2, a risk factor confirmed in osteosarcoma, this study may help better understand the genetic mechanism and provide new molecular markers and therapies for osteosarcoma.

  2. Pichia stipitis genomics, transcriptomics, and gene clusters

    Science.gov (United States)

    Thomas W. Jeffries; Jennifer R. Headman Van Vleet

    2009-01-01

    Genome sequencing and subsequent global gene expression studies have advanced our understanding of the lignocellulose-fermenting yeast Pichia stipitis. These studies have provided an insight into its central carbon metabolism, and analysis of its genome has revealed numerous functional gene clusters and tandem repeats. Specialized physiological traits are often the...

  3. Lichen Biosynthetic Gene Clusters Part II: Homology Mapping Suggests a Functional Diversity.

    Science.gov (United States)

    Bertrand, Robert L; Abdel-Hameed, Mona; Sorensen, John L

    2018-02-27

    Lichens are renowned for their diverse natural products though little is known of the genetic programming dictating lichen natural product biosynthesis. We sequenced the genome of Cladonia uncialis and profiled its secondary metabolite biosynthetic gene clusters. Through a homology searching approach, we can now propose specific functions for gene products as well as the biosynthetic pathways that are encoded in several of these gene clusters. This analysis revealed that the lichen genome encodes the required enzymes for patulin and betaenones A-C biosynthesis, fungal toxins not known to be produced by lichens. Within several gene clusters, some (but not all) genes are genetically similar to genes devoted to secondary metabolite biosynthesis in Fungi. These lichen clusters also contain accessory tailoring genes without such genetic similarity, suggesting that the encoded tailoring enzymes perform distinct chemical transformations. We hypothesize that C. uncialis gene clusters have evolved by shuffling components of ancestral fungal clusters to create new series of chemical steps, leading to the production of hitherto undiscovered derivatives of fungal secondary metabolites.

  4. Environmental cycle of antibiotic resistance encoded genes: A systematic review

    Directory of Open Access Journals (Sweden)

    R. ghanbari

    2017-12-01

    Full Text Available Antibiotic-resistant bacteria and genes enter the environment in different ways. The release of these factors into the environment has increased concerns related to public health. The aim of the study was to evaluate the antibiotic resistance genes (ARGs in the environmental resources. In this systematic review, the data were extracted from valid sources of information including ScienceDirect, PubMed, Google Scholar and SID. Evaluation and selection of articles were conducted on the basis of the PRISMA checklist. A total of 39 articles were included in the study, which were chosen from a total of 1249 papers. The inclusion criterion was the identification of genes encoding antibiotic resistance against the eight important groups of antibiotics determined by using the PCR technique in the environmental sources including municipal and hospital wastewater treatment plants, animal and agricultural wastes, effluents from treatment plants, natural waters, sediments, and drinking waters. In this study, 113 genes encoding antibiotic resistance to eight groups of antibiotics (beta-lactams, aminoglycosides, tetracyclines, macrolides, sulfonamides, chloramphenicol, glycopeptides and quinolones were identified in various environments. Antibiotic resistance genes were found in all the investigated environments. The investigation of microorganisms carrying these genes shows that most of the bacteria especially gram-negative bacteria are effective in the acquisition and the dissemination of these pollutants in the environment. Discharging the raw wastewaters and effluents from wastewater treatments acts as major routes in the dissemination of ARGs into environment sources and can pose hazards to public health.

  5. Bacteriophage-encoded shiga toxin gene in atypical bacterial host

    Directory of Open Access Journals (Sweden)

    Casas Veronica

    2011-07-01

    Full Text Available Abstract Background Contamination from fecal bacteria in recreational waters is a major health concern since bacteria capable of causing human disease can be found in animal feces. The Dog Beach area of Ocean Beach in San Diego, California is a beach prone to closures due to high levels of fecal indicator bacteria (FIB. A potential source of these FIB could be the canine feces left behind by owners who do not clean up after their pets. We tested this hypothesis by screening the DNA isolated from canine feces for the bacteriophage-encoded stx gene normally found in the virulent strains of the fecal bacterium Escherichia coli. Results Twenty canine fecal samples were collected, processed for total and bacterial fraction DNA, and screened by PCR for the stx gene. The stx gene was detected in the total and bacterial fraction DNA of one fecal sample. Bacterial isolates were then cultivated from the stx-positive fecal sample. Eighty nine of these canine fecal bacterial isolates were screened by PCR for the stx gene. The stx gene was detected in five of these isolates. Sequencing and phylogenetic analyses of 16S rRNA gene PCR products from the canine fecal bacterial isolates indicated that they were Enterococcus and not E. coli. Conclusions The bacteriophage-encoded stx gene was found in multiple species of bacteria cultivated from canine fecal samples gathered at the shoreline of the Dog Beach area of Ocean Beach in San Diego, California. The canine fecal bacteria carrying the stx gene were not the typical E. coli host and were instead identified through phylogenetic analyses as Enterococcus. This suggests a large degree of horizontal gene transfer of exotoxin genes in recreational waters.

  6. Multiple genes encode the major surface glycoprotein of Pneumocystis carinii

    DEFF Research Database (Denmark)

    Kovacs, J A; Powell, F; Edman, J C

    1993-01-01

    The major surface antigen of Pneumocystis carinii, a life-threatening opportunistic pathogen in human immunodeficiency virus-infected patients, is an abundant glycoprotein that functions in host-organism interactions. A monoclonal antibody to this antigen is protective in animals, and thus...... hydrophobic region at the carboxyl terminus. The presence of multiple related msg genes encoding the major surface glycoprotein of P. carinii suggests that antigenic variation is a possible mechanism for evading host defenses. Further characterization of this family of genes should allow the development...... of novel approaches to the control of this pathogen....

  7. A genomic analysis of disease-resistance genes encoding nucleotide binding sites in Sorghum bicolor

    Directory of Open Access Journals (Sweden)

    Xiao Cheng

    2010-01-01

    Full Text Available A large set of candidate nucleotide-binding site (NBS-encoding genes related to disease resistance was identified in the sorghum (Sorghum bicolor genome. These resistance (R genes were characterized based on their structural diversity, physical chromosomal location and phylogenetic relationships. Based on their N-terminal motifs and leucine-rich repeats (LRR, 50 non-regular NBS genes and 224 regular NBS genes were identified in 274 candidate NBS genes. The regular NBS genes were classified into ten types: CNL, CN, CNLX, CNX, CNXL, CXN, NX, N, NL and NLX. The vast majority (97% of NBS genes occurred in gene clusters, indicating extensive gene duplication in the evolution of S. bicolor NBS genes. Analysis of the S. bicolor NBS phylogenetic tree revealed two major clades. Most NBS genes were located at the distal tip of the long arms of the ten sorghum chromosomes, a pattern significantly different from rice and Arabidopsis, the NBS genes of which have a random chromosomal distribution.

  8. Functional clustering drives encoding improvement in a developing brain network during awake visual learning.

    Directory of Open Access Journals (Sweden)

    Kaspar Podgorski

    2012-01-01

    Full Text Available Sensory experience drives dramatic structural and functional plasticity in developing neurons. However, for single-neuron plasticity to optimally improve whole-network encoding of sensory information, changes must be coordinated between neurons to ensure a full range of stimuli is efficiently represented. Using two-photon calcium imaging to monitor evoked activity in over 100 neurons simultaneously, we investigate network-level changes in the developing Xenopus laevis tectum during visual training with motion stimuli. Training causes stimulus-specific changes in neuronal responses and interactions, resulting in improved population encoding. This plasticity is spatially structured, increasing tuning curve similarity and interactions among nearby neurons, and decreasing interactions among distant neurons. Training does not improve encoding by single clusters of similarly responding neurons, but improves encoding across clusters, indicating coordinated plasticity across the network. NMDA receptor blockade prevents coordinated plasticity, reduces clustering, and abolishes whole-network encoding improvement. We conclude that NMDA receptors support experience-dependent network self-organization, allowing efficient population coding of a diverse range of stimuli.

  9. Developmentally distinct MYB genes encode functionally equivalent proteins in Arabidopsis.

    Science.gov (United States)

    Lee, M M; Schiefelbein, J

    2001-05-01

    The duplication and divergence of developmental control genes is thought to have driven morphological diversification during the evolution of multicellular organisms. To examine the molecular basis of this process, we analyzed the functional relationship between two paralogous MYB transcription factor genes, WEREWOLF (WER) and GLABROUS1 (GL1), in Arabidopsis. The WER and GL1 genes specify distinct cell types and exhibit non-overlapping expression patterns during Arabidopsis development. Nevertheless, reciprocal complementation experiments with a series of gene fusions showed that WER and GL1 encode functionally equivalent proteins, and their unique roles in plant development are entirely due to differences in their cis-regulatory sequences. Similar experiments with a distantly related MYB gene (MYB2) showed that its product cannot functionally substitute for WER or GL1. Furthermore, an analysis of the WER and GL1 proteins shows that conserved sequences correspond to specific functional domains. These results provide new insights into the evolution of the MYB gene family in Arabidopsis, and, more generally, they demonstrate that novel developmental gene function may arise solely by the modification of cis-regulatory sequences.

  10. Multiple genes encode the major surface glycoprotein of Pneumocystis carinii

    DEFF Research Database (Denmark)

    Kovacs, J A; Powell, F; Edman, J C

    1993-01-01

    hydrophobic region at the carboxyl terminus. The presence of multiple related msg genes encoding the major surface glycoprotein of P. carinii suggests that antigenic variation is a possible mechanism for evading host defenses. Further characterization of this family of genes should allow the development......The major surface antigen of Pneumocystis carinii, a life-threatening opportunistic pathogen in human immunodeficiency virus-infected patients, is an abundant glycoprotein that functions in host-organism interactions. A monoclonal antibody to this antigen is protective in animals, and thus...... blot studies using chromosomal or restricted DNA, the major surface glycoproteins are the products of a multicopy family of genes. The predicted protein has an M(r) of approximately 123,000, is relatively rich in cysteine residues (5.5%) that are very strongly conserved, and contains a well conserved...

  11. Recombinant vectors construction for cellobiohydrolase encoding gene constitutive expression

    Directory of Open Access Journals (Sweden)

    Leontina GURGU

    2012-12-01

    Full Text Available Cellobiohydrolases (EC 3.2.1.91 are important exo enzymes involved in cellulose hydrolysis alongside endoglucanases (EC 3.2.1.4 and β-glucosidases (EC 3.2.1.21. Heterologous cellobiohydrolase gene expression under constitutive promoter control using Saccharomyces cerevisiae as host system is of great importance for a successful SSF process. From this point of view, the main objective of the work was to use Yeplac181 expression vector as a recipient for cellobiohdrolase - cbhB encoding gene expression under the control of the actin promoter, in Saccharomyces cerevisiae. Two hybridvectors, YEplac-Actp and YEplac-Actp-CbhB, were generated usingEscherichia coli XLI Blue for the cloning experiments. Constitutive cbhB gene expression was checked by proteine gel electrophoresis (SDS-PAGE after insertion of these constructs into Saccharomyces cerevisiae.

  12. Annotation and analysis of malic enzyme genes encoding for multiple isoforms in the fungus Mucor circinelloides CBS 277.49.

    Science.gov (United States)

    Vongsangnak, Wanwipa; Zhang, Yingtong; Chen, Wei; Ratledge, Colin; Song, Yuanda

    2012-05-01

    Based on the newly-released genomic data of Mucor circinelloides CBS 277.49, we have annotated five genes encoding for malic enzyme: all code for proteins that contain conserved domains/motifs for malic acid binding, NAD(+) binding and NAD(P)(+) binding. Phylogenetic analysis for malic enzyme genes showed that genes ID 78524 and 11639 share ~80% amino acid identity and are grouped in cluster 1; genes ID 182779, 186772 and 116127 share ~66% amino acid identity are grouped in cluster 2. Genes ID 78524, 11639 and 166127 produce proteins that are localized in the mitochondrion, while the products from genes 182779 and 186772 are localized in the cytosol. Based on the comparative analysis published previously by Song et al. (Microbiology 147:1507-1515, 2001), we propose that malic enzyme genes ID 78524, 166127, 182779, 186772, 11639, respectively, represent protein isoforms I, II, III/IV, V, and VI.

  13. Translating biosynthetic gene clusters into fungal armor and weaponry.

    Science.gov (United States)

    Keller, Nancy P

    2015-09-01

    Filamentous fungi are renowned for the production of a diverse array of secondary metabolites (SMs) where the genetic material required for synthesis of a SM is typically arrayed in a biosynthetic gene cluster (BGC). These natural products are valued for their bioactive properties stemming from their functions in fungal biology, key among those protection from abiotic and biotic stress and establishment of a secure niche. The producing fungus must not only avoid self-harm from endogenous SMs but also deliver specific SMs at the right time to the right tissue requiring biochemical aid. This review highlights functions of BGCs beyond the enzymatic assembly of SMs, considering the timing and location of SM production and other proteins in the clusters that control SM activity. Specifically, self-protection is provided by both BGC-encoded mechanisms and non-BGC subcellular containment of toxic SM precursors; delivery and timing is orchestrated through cellular trafficking patterns and stress- and developmental-responsive transcriptional programs.

  14. Arrangement of the Clostridium baratii F7 toxin gene cluster with identification of a σ factor that recognizes the botulinum toxin gene cluster promoters.

    Science.gov (United States)

    Dover, Nir; Barash, Jason R; Burke, Julianne N; Hill, Karen K; Detter, John C; Arnon, Stephen S

    2014-01-01

    Botulinum neurotoxin (BoNT) is the most poisonous substances known and its eight toxin types (A to H) are distinguished by the inability of polyclonal antibodies that neutralize one toxin type to neutralize any of the other seven toxin types. Infant botulism, an intestinal toxemia orphan disease, is the most common form of human botulism in the United States. It results from swallowed spores of Clostridium botulinum (or rarely, neurotoxigenic Clostridium butyricum or Clostridium baratii) that germinate and temporarily colonize the lumen of the large intestine, where, as vegetative cells, they produce botulinum toxin. Botulinum neurotoxin is encoded by the bont gene that is part of a toxin gene cluster that includes several accessory genes. We sequenced for the first time the complete botulinum neurotoxin gene cluster of nonproteolytic C. baratii type F7. Like the type E and the nonproteolytic type F6 botulinum toxin gene clusters, the C. baratii type F7 had an orfX toxin gene cluster that lacked the regulatory botR gene which is found in proteolytic C. botulinum strains and codes for an alternative σ factor. In the absence of botR, we identified a putative alternative regulatory gene located upstream of the C. baratii type F7 toxin gene cluster. This putative regulatory gene codes for a predicted σ factor that contains DNA-binding-domain homologues to the DNA-binding domains both of BotR and of other members of the TcdR-related group 5 of the σ70 family that are involved in the regulation of toxin gene expression in clostridia. We showed that this TcdR-related protein in association with RNA polymerase core enzyme specifically binds to the C. baratii type F7 botulinum toxin gene cluster promoters. This TcdR-related protein may therefore be involved in regulating the expression of the genes of the botulinum toxin gene cluster in neurotoxigenic C. baratii.

  15. Organization of the gene encoding human lysosomal beta-galactosidase.

    Science.gov (United States)

    Morreau, H; Bonten, E; Zhou, X Y; D'Azzo, A

    1991-09-01

    Human beta-galactosidase precursor mRNA is alternatively spliced into an abundant 2.5-kb transcript and a minor 2.0-kb species. These templates direct the synthesis of the classic lysosomal beta-D-galactosidase enzyme and of a beta-galactosidase-related protein with no enzymatic activity. Mutations in the beta-galactosidase gene result in the lysosomal storage disorders GM1-gangliosidosis and Morquio B syndrome. To analyze the genetic lesions underlying these syndromes we have isolated the human beta-galactosidase gene and determined its organization. The gene spans greater than 62.5 kb and contains 16 exons. Promoter activity is located on a 236-bp Pst I fragment which works in a direction-independent manner. A second Pst I fragment of 851 bp located upstream from the first negatively regulates initiation of transcription. The promoter has characteristics of a housekeeping gene with GC-rich stretches and five potential SP1 transcription elements on two strands. We identified multiple cap sites of the mRNA, the major of which maps 53 bp upstream from the translation initiation codon. The portion of the human pre-mRNA undergoing alternative splicing is encoded by exons II-VII. Sequence analysis of equivalent mouse exons showed an identical genomic organization. However, translation of the corresponding differentially spliced murine transcript is interrupted in its reading frame. Thus, the mouse gene cannot encode a beta-galactosidase-related protein in a manner similar to the human counterpart. Differential expression of the murine beta-galactosidase transcript is observed in different mouse tissues.

  16. Selection and characterization of forest soil metagenome genes encoding lipolytic enzymes.

    Science.gov (United States)

    Hong, Kyung Sik; Lim, He Kyoung; Chung, Eu Jin; Park, Eun Jin; Lee, Myung Hwan; Kim, Jin-Cheol; Choi, Gyung Ja; Cho, Kwang Yun; Lee, Seon-Woo

    2007-10-01

    A metagenome is a unique resource to search for novel microbial enzymes from the unculturable microorganisms in soil. A forest soil metagenomic library using a fosmid and soil microbial DNA from Gwangneung forest, Korea, was constructed in Escherichia coli and screened to select lipolytic genes. A total of seven unique lipolytic clones were selected by screening of the 31,000-member forest soil metagenome library based on tributyrin hydrolysis. The ORFs for lipolytic activity were subcloned in a high copy number plasmid by screening the secondary shortgun libraries from the seven clones. Since the lipolytic enzymes were well secreted in E. coli into the culture broth, the lipolytic activity of the subclones was confirmed by the hydrolysis of p-nitrophenyl butyrate using culture broth. Deduced amino acid sequence analysis of the identified ORFs for lipolytic activity revealed that 4 genes encode hormone-sensitive lipase (HSL) in lipase family IV. Phylogenetic analysis indicated that 4 proteins were clustered with HSL in the database and other metagenomic HSLs. The other 2 genes and 1 gene encode non-heme peroxidase-like enzymes of lipase family V and a GDSL family esterase/lipase in family II, respectively. The gene for the GDSL enzyme is the first description of the enzyme from metagenomic screening.

  17. Semi-supervised consensus clustering for gene expression data analysis

    OpenAIRE

    Wang, Yunli; Pan, Youlian

    2014-01-01

    Background Simple clustering methods such as hierarchical clustering and k-means are widely used for gene expression data analysis; but they are unable to deal with noise and high dimensionality associated with the microarray gene expression data. Consensus clustering appears to improve the robustness and quality of clustering results. Incorporating prior knowledge in clustering process (semi-supervised clustering) has been shown to improve the consistency between the data partitioning and do...

  18. Storage of polarization-encoded cluster states in an atomic system

    Science.gov (United States)

    Yuan, Chun-Hua; Chen, Li-Qing; Zhang, Weiping

    2009-05-01

    We present a scheme for entanglement of macroscopic atomic ensembles which are four spatially separate regions of an atomic cloud using cluster-correlated beams. We show that the cluster-type polarization-encoded entanglement could be mapped onto the long-lived collective ground state of the atomic ensembles, and the stored entanglement could be retrieved based on the technique of electromagnetically induced transparency. We also discuss the efficiency of, the lifetime of, and some quantitative restrictions to the proposed quantum memory.

  19. Discovery of Unusual Biaryl Polyketides by Activation of a Silent Streptomyces venezuelae Biosynthetic Gene Cluster.

    Science.gov (United States)

    Thanapipatsiri, Anyarat; Gomez-Escribano, Juan Pablo; Song, Lijiang; Bibb, Maureen J; Al-Bassam, Mahmoud; Chandra, Govind; Thamchaipenet, Arinthip; Challis, Gregory L; Bibb, Mervyn J

    2016-11-17

    Comparative transcriptional profiling of a ΔbldM mutant of Streptomyces venezuelae with its unmodified progenitor revealed that the expression of a cryptic biosynthetic gene cluster containing both type I and type III polyketide synthase genes is activated in the mutant. The 29.5 kb gene cluster, which was predicted to encode an unusual biaryl metabolite, which we named venemycin, and potentially halogenated derivatives, contains 16 genes including one-vemR-that encodes a transcriptional activator of the large ATP-binding LuxR-like (LAL) family. Constitutive expression of vemR in the ΔbldM mutant led to the production of sufficient venemycin for structural characterisation, confirming its unusual biaryl structure. Co-expression of the venemycin biosynthetic gene cluster and vemR in the heterologous host Streptomyces coelicolor also resulted in venemycin production. Although the gene cluster encodes two halogenases and a flavin reductase, constitutive expression of all three genes led to the accumulation only of a monohalogenated venemycin derivative, both in the native producer and the heterologous host. A competition experiment in which equimolar quantities of sodium chloride and sodium bromide were fed to the venemycin-producing strains resulted in the preferential incorporation of bromine, thus suggesting that bromide is the preferred substrate for one or both halogenases. © 2016 The Authors. Published by Wiley-VCH Verlag GmbH & Co. KGaA.

  20. Genomewide analysis of NBS-encoding genes in kiwi fruit (Actinidia ...

    Indian Academy of Sciences (India)

    YINGJUN LI

    Identification of NBS-encodings and gene family classification of kiwi fruit. Kiwi fruit (A. chinensis) assembly and annotation ... There were three criteria to classify gene family. Both the coverage (aligned sequence/gene lengths) and iden- ... Number of identified NBS-encoding genes in kiwi fruit. Predicted protein domain.

  1. A Single Gene Cluster for Chalcomycins and Aldgamycins: Genetic Basis for Bifurcation of Their Biosynthesis.

    Science.gov (United States)

    Tang, Xiao-Long; Dai, Ping; Gao, Hao; Wang, Chuan-Xi; Chen, Guo-Dong; Hong, Kui; Hu, Dan; Yao, Xin-Sheng

    2016-07-01

    Aldgamycins are 16-membered macrolide antibiotics with a rare branched-chain sugar d-aldgarose or decarboxylated d-aldgarose at C-5. In our efforts to clone the gene cluster for aldgamycins from a marine-derived Streptomyces sp. HK-2006-1 capable of producing both aldgamycins and chalcomycins, we found that both are biosynthesized from a single gene cluster. Whole-genome sequencing combined with gene disruption established the entire gene cluster of aldgamycins: nine new genes are incorporated with the previously identified chalcomycin gene cluster. Functional analysis of these genes revealed that almDI/almDII, (encoding α/β subunits of pyruvate dehydrogenase) triggers the biosynthesis of aldgamycins, whereas almCI (encoding an oxidoreductase) initiates chalcomycins biosynthesis. This is the first report that aldgamycins and chalcomycins are derived from a single gene cluster and of the genetic basis for bifurcation in their biosynthesis. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  2. A genome-wide analysis of nonribosomal peptide synthetase gene clusters and their peptides in a Planktothrix rubescens strain

    Directory of Open Access Journals (Sweden)

    Nederbragt Alexander J

    2009-08-01

    Full Text Available Abstract Background Cyanobacteria often produce several different oligopeptides, with unknown biological functions, by nonribosomal peptide synthetases (NRPS. Although some cyanobacterial NRPS gene cluster types are well described, the entire NRPS genomic content within a single cyanobacterial strain has never been investigated. Here we have combined a genome-wide analysis using massive parallel pyrosequencing ("454" and mass spectrometry screening of oligopeptides produced in the strain Planktothrix rubescens NIVA CYA 98 in order to identify all putative gene clusters for oligopeptides. Results Thirteen types of oligopeptides were uncovered by mass spectrometry (MS analyses. Microcystin, cyanopeptolin and aeruginosin synthetases, highly similar to already characterized NRPS, were present in the genome. Two novel NRPS gene clusters were associated with production of anabaenopeptins and microginins, respectively. Sequence-depth of the genome and real-time PCR data revealed three copies of the microginin gene cluster. Since NRPS gene cluster candidates for microviridin and oscillatorin synthesis could not be found, putative (gene encoded precursor peptide sequences to microviridin and oscillatorin were found in the genes mdnA and oscA, respectively. The genes flanking the microviridin and oscillatorin precursor genes encode putative modifying enzymes of the precursor oligopeptides. We therefore propose ribosomal pathways involving modifications and cyclisation for microviridin and oscillatorin. The microviridin, anabaenopeptin and cyanopeptolin gene clusters are situated in close proximity to each other, constituting an oligopeptide island. Conclusion Altogether seven nonribosomal peptide synthetase (NRPS gene clusters and two gene clusters putatively encoding ribosomal oligopeptide biosynthetic pathways were revealed. Our results demonstrate that whole genome shotgun sequencing combined with MS-directed determination of oligopeptides successfully

  3. Regulation of Three Nitrogenase Gene Clusters in the Cyanobacterium Anabaena variabilis ATCC 29413

    Directory of Open Access Journals (Sweden)

    Teresa Thiel

    2014-12-01

    Full Text Available The filamentous cyanobacterium Anabaena variabilis ATCC 29413 fixes nitrogen under aerobic conditions in specialized cells called heterocysts that form in response to an environmental deficiency in combined nitrogen. Nitrogen fixation is mediated by the enzyme nitrogenase, which is very sensitive to oxygen. Heterocysts are microxic cells that allow nitrogenase to function in a filament comprised primarily of vegetative cells that produce oxygen by photosynthesis. A. variabilis is unique among well-characterized cyanobacteria in that it has three nitrogenase gene clusters that encode different nitrogenases, which function under different environmental conditions. The nif1 genes encode a Mo-nitrogenase that functions only in heterocysts, even in filaments grown anaerobically. The nif2 genes encode a different Mo-nitrogenase that functions in vegetative cells, but only in filaments grown under anoxic conditions. An alternative V-nitrogenase is encoded by vnf genes that are expressed only in heterocysts in an environment that is deficient in Mo. Thus, these three nitrogenases are expressed differentially in response to environmental conditions. The entire nif1 gene cluster, comprising at least 15 genes, is primarily under the control of the promoter for the first gene, nifB1. Transcriptional control of many of the downstream nif1 genes occurs by a combination of weak promoters within the coding regions of some downstream genes and by RNA processing, which is associated with increased transcript stability. The vnf genes show a similar pattern of transcriptional and post-transcriptional control of expression suggesting that the complex pattern of regulation of the nif1 cluster is conserved in other cyanobacterial nitrogenase gene clusters.

  4. Gene ordering in partitive clustering using microarray expressions

    Indian Academy of Sciences (India)

    PRAKASH KUMAR

    fibroblast data and showed that our approach improves the result quality of partitive clustering solution, by identifying subclusters within big clusters, grouping functionally correlated genes within clusters, minimization of summation of gene expression distances, and the maximization of biological gene ordering using MIPS ...

  5. Yeast homologous recombination-based promoter engineering for the activation of silent natural product biosynthetic gene clusters.

    Science.gov (United States)

    Montiel, Daniel; Kang, Hahk-Soo; Chang, Fang-Yuan; Charlop-Powers, Zachary; Brady, Sean F

    2015-07-21

    Large-scale sequencing of prokaryotic (meta)genomic DNA suggests that most bacterial natural product gene clusters are not expressed under common laboratory culture conditions. Silent gene clusters represent a promising resource for natural product discovery and the development of a new generation of therapeutics. Unfortunately, the characterization of molecules encoded by these clusters is hampered owing to our inability to express these gene clusters in the laboratory. To address this bottleneck, we have developed a promoter-engineering platform to transcriptionally activate silent gene clusters in a model heterologous host. Our approach uses yeast homologous recombination, an auxotrophy complementation-based yeast selection system and sequence orthogonal promoter cassettes to exchange all native promoters in silent gene clusters with constitutively active promoters. As part of this platform, we constructed and validated a set of bidirectional promoter cassettes consisting of orthogonal promoter sequences, Streptomyces ribosome binding sites, and yeast selectable marker genes. Using these tools we demonstrate the ability to simultaneously insert multiple promoter cassettes into a gene cluster, thereby expediting the reengineering process. We apply this method to model active and silent gene clusters (rebeccamycin and tetarimycin) and to the silent, cryptic pseudogene-containing, environmental DNA-derived Lzr gene cluster. Complete promoter refactoring and targeted gene exchange in this "dead" cluster led to the discovery of potent indolotryptoline antiproliferative agents, lazarimides A and B. This potentially scalable and cost-effective promoter reengineering platform should streamline the discovery of natural products from silent natural product biosynthetic gene clusters.

  6. Phylogenetic and evolutionary analysis of NBS-encoding genes in Rosaceae fruit crops.

    Science.gov (United States)

    Xu, Qiang; Wen, Xiaopeng; Deng, Xiuxin

    2007-07-01

    Phylogenetic relationships of the nucleotide binding site (NBS)-encoding resistance gene homologues (RGHs) among 12 species in five genera of Rosaceae fruit crops were evaluated. A total of 228 Rosaceous RGHs were deeply separated into two distinct clades, designated as TIR (sequences within this clade containing a Toll Interleukin-1 Receptor domain) and NonTIR (sequences lacking a TIR domain). Most Rosaceous RGH genes were phylogenetically distinct from Arabidopsis, Rice or Pine genes, except for a few Rosaceous members which grouped closely with Arabidopsis genes. Within Rosaceae, sequences from multiple species were often phylogenetically clustered together, forming heterogenous groups, however, apple- and chestnut rose-specific groups really exist. Gene duplication followed by sequence divergence were proposed as the mode for the evolution of a large number of distantly or closely related RGH genes in Rosaceae, and this mode may play a role in the generation of new resistance specificity. Positively selected sites within NBS-coding region were detected and thus nucleotide variation within NBS domain may function in determining disease resistance specificity. This study also discusses the synteny of a genomic region that encompass powdery mildew resistance locus among Malus, Prunus and Rosa, which may have potential use for fruit tree disease breeding and important gene cloning.

  7. Evolutionary history of the phl gene cluster in the plant-associated bacterium Pseudomonas fluorescens

    NARCIS (Netherlands)

    Moynihan, J.A.; Morrissey, J.P.; Coppoolse, E.; Stiekema, W.J.; O'Gara, F.; Boyd, E.F.

    2009-01-01

    Pseudomonas fluorescens is of agricultural and economic importance as a biological control agent largely because of its plant-association and production of secondary metabolites, in particular 2, 4-diacetylphloroglucinol (2, 4-DAPG). This polyketide, which is encoded by the eight gene phl cluster,

  8. Co-transcriptional folding is encoded within RNA genes

    Directory of Open Access Journals (Sweden)

    Miklós István

    2004-08-01

    Full Text Available Abstract Background Most of the existing RNA structure prediction programs fold a completely synthesized RNA molecule. However, within the cell, RNA molecules emerge sequentially during the directed process of transcription. Dedicated experiments with individual RNA molecules have shown that RNA folds while it is being transcribed and that its correct folding can also depend on the proper speed of transcription. Methods The main aim of this work is to study if and how co-transcriptional folding is encoded within the primary and secondary structure of RNA genes. In order to achieve this, we study the known primary and secondary structures of a comprehensive data set of 361 RNA genes as well as a set of 48 RNA sequences that are known to differ from the originally transcribed sequence units. We detect co-transcriptional folding by defining two measures of directedness which quantify the extend of asymmetry between alternative helices that lie 5' and those that lie 3' of the known helices with which they compete. Results We show with statistical significance that co-transcriptional folding strongly influences RNA sequences in two ways: (1 alternative helices that would compete with the formation of the functional structure during co-transcriptional folding are suppressed and (2 the formation of transient structures which may serve as guidelines for the co-transcriptional folding pathway is encouraged. Conclusions These findings have a number of implications for RNA secondary structure prediction methods and the detection of RNA genes.

  9. Genes encoding novel secreted and transmembrane proteins are temporally and spatially regulated during Drosophila melanogaster embryogenesis

    Directory of Open Access Journals (Sweden)

    González Mauricio

    2009-09-01

    Full Text Available Abstract Background Morphogenetic events that shape the Drosophila melanogaster embryo are tightly controlled by a genetic program in which specific sets of genes are up-regulated. We used a suppressive subtractive hybridization procedure to identify a group of developmentally regulated genes during early stages of D. melanogaster embryogenesis. We studied the spatiotemporal activity of these genes in five different intervals covering 12 stages of embryogenesis. Results Microarrays were constructed to confirm induction of expression and to determine the temporal profile of isolated subtracted cDNAs during embryo development. We identified a set of 118 genes whose expression levels increased significantly in at least one developmental interval compared with a reference interval. Of these genes, 53% had a phenotype and/or molecular function reported in the literature, whereas 47% were essentially uncharacterized. Clustering analysis revealed demarcated transcript groups with maximum gene activity at distinct developmental intervals. In situ hybridization assays were carried out on 23 uncharacterized genes, 15 of which proved to have spatiotemporally restricted expression patterns. Among these 15 uncharacterized genes, 13 were found to encode putative secreted and transmembrane proteins. For three of them we validated our protein sequence predictions by expressing their cDNAs in Drosophila S2R+ cells and analyzed the subcellular distribution of recombinant proteins. We then focused on the functional characterization of the gene CG6234. Inhibition of CG6234 by RNA interference resulted in morphological defects in embryos, suggesting the involvement of this gene in germ band retraction. Conclusion Our data have yielded a list of developmentally regulated D. melanogaster genes and their expression profiles during embryogenesis and provide new information on the spatiotemporal expression patterns of several uncharacterized genes. In particular, we

  10. Genes encoding novel secreted and transmembrane proteins are temporally and spatially regulated during Drosophila melanogaster embryogenesis.

    Science.gov (United States)

    Zúñiga, Alejandro; Hödar, Christian; Hanna, Patricia; Ibáñez, Freddy; Moreno, Pablo; Pulgar, Rodrigo; Pastenes, Luis; González, Mauricio; Cambiazo, Verónica

    2009-09-22

    Morphogenetic events that shape the Drosophila melanogaster embryo are tightly controlled by a genetic program in which specific sets of genes are up-regulated. We used a suppressive subtractive hybridization procedure to identify a group of developmentally regulated genes during early stages of D. melanogaster embryogenesis. We studied the spatiotemporal activity of these genes in five different intervals covering 12 stages of embryogenesis. Microarrays were constructed to confirm induction of expression and to determine the temporal profile of isolated subtracted cDNAs during embryo development. We identified a set of 118 genes whose expression levels increased significantly in at least one developmental interval compared with a reference interval. Of these genes, 53% had a phenotype and/or molecular function reported in the literature, whereas 47% were essentially uncharacterized. Clustering analysis revealed demarcated transcript groups with maximum gene activity at distinct developmental intervals. In situ hybridization assays were carried out on 23 uncharacterized genes, 15 of which proved to have spatiotemporally restricted expression patterns. Among these 15 uncharacterized genes, 13 were found to encode putative secreted and transmembrane proteins. For three of them we validated our protein sequence predictions by expressing their cDNAs in Drosophila S2R+ cells and analyzed the subcellular distribution of recombinant proteins. We then focused on the functional characterization of the gene CG6234. Inhibition of CG6234 by RNA interference resulted in morphological defects in embryos, suggesting the involvement of this gene in germ band retraction. Our data have yielded a list of developmentally regulated D. melanogaster genes and their expression profiles during embryogenesis and provide new information on the spatiotemporal expression patterns of several uncharacterized genes. In particular, we recovered a substantial number of unknown genes encoding

  11. The immune gene repertoire encoded in the purple sea urchin genome.

    Science.gov (United States)

    Hibino, Taku; Loza-Coll, Mariano; Messier, Cynthia; Majeske, Audrey J; Cohen, Avis H; Terwilliger, David P; Buckley, Katherine M; Brockton, Virginia; Nair, Sham V; Berney, Kevin; Fugmann, Sebastian D; Anderson, Michele K; Pancer, Zeev; Cameron, R Andrew; Smith, L Courtney; Rast, Jonathan P

    2006-12-01

    Echinoderms occupy a critical and largely unexplored phylogenetic vantage point from which to infer both the early evolution of bilaterian immunity and the underpinnings of the vertebrate adaptive immune system. Here we present an initial survey of the purple sea urchin genome for genes associated with immunity. An elaborate repertoire of potential immune receptors, regulators and effectors is present, including unprecedented expansions of innate pathogen recognition genes. These include a diverse array of 222 Toll-like receptor (TLR) genes and a coordinate expansion of directly associated signaling adaptors. Notably, a subset of sea urchin TLR genes encodes receptors with structural characteristics previously identified only in protostomes. A similarly expanded set of 203 NOD/NALP-like cytoplasmic recognition proteins is present. These genes have previously been identified only in vertebrates where they are represented in much lower numbers. Genes that mediate the alternative and lectin complement pathways are described, while gene homologues of the terminal pathway are not present. We have also identified several homologues of genes that function in jawed vertebrate adaptive immunity. The most striking of these is a gene cluster with similarity to the jawed vertebrate Recombination Activating Genes 1 and 2 (RAG1/2). Sea urchins are long-lived, complex organisms and these findings reveal an innate immune system of unprecedented complexity. Whether the presumably intense selective processes that molded these gene families also gave rise to novel immune mechanisms akin to adaptive systems remains to be seen. The genome sequence provides immediate opportunities to apply the advantages of the sea urchin model toward problems in developmental and evolutionary immunobiology.

  12. Evidence for an ergot alkaloid gene cluster in Claviceps purpurea.

    Science.gov (United States)

    Tudzynski, P; Hölter, K; Correia, T; Arntz, C; Grammel, N; Keller, U

    1999-02-01

    A gene (cpd1) coding for the dimethylallyltryptophan synthase (DMATS) that catalyzes the first specific step in the biosynthesis of ergot alkaloids, was cloned from a strain of Claviceps purpurea that produces alkaloids in axenic culture. The derived gene product (CPD1) shows only 70% similarity to the corresponding gene previously isolated from Claviceps strain ATCC 26245, which is likely to be an isolate of C. fusiformis. Therefore, the related cpd1 most probably represents the first C. purpurea gene coding for an enzymatic step of the alkaloid biosynthetic pathway to be cloned. Analysis of the 3'-flanking region of cpd1 revealed a second, closely linked ergot alkaloid biosynthetic gene named cpps1, which codes for a 356-kDa polypeptide showing significant similarity to fungal modular peptide synthetases. The protein contains three amino acid-activating modules, and in the second module a sequence is found which matches that of an internal peptide (17 amino acids in length) obtained from a tryptic digest of lysergyl peptide synthetase 1 (LPS1) of C. purpurea, thus confirming that cpps1 encodes LPS1. LPS1 activates the three amino acids of the peptide portion of ergot peptide alkaloids during D-lysergyl peptide assembly. Chromosome walking revealed the presence of additional genes upstream of cpd1 which are probably also involved in ergot alkaloid biosynthesis: cpox1 probably codes for an FAD-dependent oxidoreductase (which could represent the chanoclavine cyclase), and a second putative oxidoreductase gene, cpox2, is closely linked to it in inverse orientation. RT-PCR experiments confirm that all four genes are expressed under conditions of peptide alkaloid biosynthesis. These results strongly suggest that at least some genes of ergot alkaloid biosynthesis in C. purpurea are clustered, opening the way for a detailed molecular genetic analysis of the pathway.

  13. Microarray gene cluster identification and annotation through cluster ensemble and EM-based informative textual summarization.

    Science.gov (United States)

    Hu, Xiaohua; Park, E K; Zhang, Xiaodan

    2009-09-01

    Generating high-quality gene clusters and identifying the underlying biological mechanism of the gene clusters are the important goals of clustering gene expression analysis. To get high-quality cluster results, most of the current approaches rely on choosing the best cluster algorithm, in which the design biases and assumptions meet the underlying distribution of the dataset. There are two issues for this approach: 1) usually, the underlying data distribution of the gene expression datasets is unknown and 2) there are so many clustering algorithms available and it is very challenging to choose the proper one. To provide a textual summary of the gene clusters, the most explored approach is the extractive approach that essentially builds upon techniques borrowed from the information retrieval, in which the objective is to provide terms to be used for query expansion, and not to act as a stand-alone summary for the entire document sets. Another drawback is that the clustering quality and cluster interpretation are treated as two isolated research problems and are studied separately. In this paper, we design and develop a unified system Gene Expression Miner to address these challenging issues in a principled and general manner by integrating cluster ensemble, text clustering, and multidocument summarization and provide an environment for comprehensive gene expression data analysis. We present a novel cluster ensemble approach to generate high-quality gene cluster. In our text summarization module, given a gene cluster, our expectation-maximization based algorithm can automatically identify subtopics and extract most probable terms for each topic. Then, the extracted top k topical terms from each subtopic are combined to form the biological explanation of each gene cluster. Experimental results demonstrate that our system can obtain high-quality clusters and provide informative key terms for the gene clusters.

  14. Some statistical properties of gene expression clustering for array data

    DEFF Research Database (Denmark)

    Abreu, G C G; Pinheiro, A; Drummond, R D

    2010-01-01

    DNA arrays have been a rich source of data for the study of genomic expression of a wide variety of biological systems. Gene clustering is one of the paradigms quite used to assess the significance of a gene (or group of genes). However, most of the gene clustering techniques are applied to cDNA...

  15. Isolated gene encoding an enzyme with UDP-glucose pyrophosphorylase and phosphoglucomutase activities from Cyclotella cryptica

    Science.gov (United States)

    Jarvis, Eric E.; Roessler, Paul G.

    1999-01-01

    The present invention relates to a cloned gene which encodes an enzyme, the purified enzyme, and the applications and products resulting from the use of the gene and enzyme. The gene, isolated from Cyclotella cryptica, encodes a multifunctional enzyme that has both UDP-glucose pyrophosphorylase and phosphoglucomutase activities.

  16. Growth Characteristics of Methanomassiliicoccus luminyensis and Expression of Methyltransferase Encoding Genes

    Directory of Open Access Journals (Sweden)

    Lena Kröninger

    2017-01-01

    Full Text Available DNA sequence analysis of the human gut revealed the presence a seventh order of methanogens referred to as Methanomassiliicoccales. Methanomassiliicoccus luminyensis is the only member of this order that grows in pure culture. Here, we show that the organism has a doubling time of 1.8 d with methanol + H2 and a growth yield of 2.4 g dry weight/mol CH4. M. luminyensis also uses methylamines + H2 (monomethylamine, dimethylamine, and trimethylamine with doubling times of 2.1–2.3 d. Similar cell yields were obtained with equimolar concentrations of methanol and methylamines with respect to their methyl group contents. The transcript levels of genes encoding proteins involved in substrate utilization indicated increased amounts of mRNA from the mtaBC2 gene cluster in methanol-grown cells. When methylamines were used as substrates, mRNA of the mtb/mtt operon and of the mtmBC1 cluster were found in high abundance. The transcript level of mtaC2 was almost identical in methanol- and methylamine-grown cells, indicating that genes for methanol utilization were constitutively expressed in high amounts. The same observation was made with resting cells where methanol always yielded the highest CH4 production rate independently from the growth substrate. Hence, M. luminyensis is adapted to habitats that provide methanol + H2 as substrates.

  17. Genetic interrelations in the actinomycin biosynthetic gene clusters of Streptomyces antibioticus IMRU 3720 and Streptomyces chrysomallus ATCC11523, producers of actinomycin X and actinomycin C

    Science.gov (United States)

    Crnovčić, Ivana; Rückert, Christian; Semsary, Siamak; Lang, Manuel; Kalinowski, Jörn; Keller, Ullrich

    2017-01-01

    Sequencing the actinomycin (acm) biosynthetic gene cluster of Streptomyces antibioticus IMRU 3720, which produces actinomycin X (Acm X), revealed 20 genes organized into a highly similar framework as in the bi-armed acm C biosynthetic gene cluster of Streptomyces chrysomallus but without an attached additional extra arm of orthologues as in the latter. Curiously, the extra arm of the S. chrysomallus gene cluster turned out to perfectly match the single arm of the S. antibioticus gene cluster in the same order of orthologues including the the presence of two pseudogenes, scacmM and scacmN, encoding a cytochrome P450 and its ferredoxin, respectively. Orthologues of the latter genes were both missing in the principal arm of the S. chrysomallus acm C gene cluster. All orthologues of the extra arm showed a G +C-contents different from that of their counterparts in the principal arm. Moreover, the similarities of translation products from the extra arm were all higher to the corresponding translation products of orthologue genes from the S. antibioticus acm X gene cluster than to those encoded by the principal arm of their own gene cluster. This suggests that the duplicated structure of the S. chrysomallus acm C biosynthetic gene cluster evolved from previous fusion between two one-armed acm gene clusters each from a different genetic background. However, while scacmM and scacmN in the extra arm of the S. chrysomallus acm C gene cluster are mutated and therefore are non-functional, their orthologues saacmM and saacmN in the S. antibioticus acm C gene cluster show no defects seemingly encoding active enzymes with functions specific for Acm X biosynthesis. Both acm biosynthetic gene clusters lack a kynurenine-3-monooxygenase gene necessary for biosynthesis of 3-hydroxy-4-methylanthranilic acid, the building block of the Acm chromophore, which suggests participation of a genome-encoded relevant monooxygenase during Acm biosynthesis in both S. chrysomallus and S

  18. Gene Cluster Encoding Cholate Catabolism in Rhodococcus spp.

    NARCIS (Netherlands)

    Mohn, William W.; Wilbrink, Maarten H.; Casabon, Israel; Stewart, Gordon R.; Liu, Jie; van der Geize, Robert; Eltis, Lindsay D.

    2012-01-01

    Bile acids are highly abundant steroids with important functions in vertebrate digestion. Their catabolism by bacteria is an important component of the carbon cycle, contributes to gut ecology, and has potential commercial applications. We found that Rhodococcus jostii RHA1 grows well on cholate, as

  19. The pyrH gene of Lactococcus lactis subsp. cremoris encoding UMP kinase is transcribed as part of an operon including the frr1 gene encoding ribosomal recycling factor

    DEFF Research Database (Denmark)

    Wadskov-Hansen, Steen Lüders; Martinussen, Jan; Hammer, Karin

    2000-01-01

    establishing the ability of the encoded protein to synthesize UDP. The pyrH gene in L. lactis is flanked downstream by frr1 encoding ribosomal recycling factor 1 and upstream by an open reading frame, orfA, of unknown function. The three genes were shown to constitute an operon transcribed in the direction orf......A-pyrH-frr1 from a promoter immediately in front of orfA. This operon belongs to an evolutionary highly conserved gene cluster, since the organization of pyrH on the chromosomal level in L. lactis shows a high resemblance to that found in Bacillus subtilis as well as in Escherichia coli and several other...

  20. New recombinant bacterium comprises a heterologous gene encoding glycerol dehydrogenase and/or an up-regulated native gene encoding glycerol dehydrogenase, useful for producing ethanol

    DEFF Research Database (Denmark)

    2010-01-01

    TECHNOLOGY FOCUS - BIOTECHNOLOGY - Preparation (claimed): Producing recombinant bacterium having enhanced ethanol production characteristics when cultivated in growth medium comprising glycerol comprises: (a) transforming a parental bacterium by (i) the insertion of a heterologous gene encoding...

  1. Prediction of operon-like gene clusters in the Arabidopsis thaliana genome based on co-expression analysis of neighboring genes.

    Science.gov (United States)

    Wada, Masayoshi; Takahashi, Hiroki; Altaf-Ul-Amin, Md; Nakamura, Kensuke; Hirai, Masami Y; Ohta, Daisaku; Kanaya, Shigehiko

    2012-07-15

    Operon-like arrangements of genes occur in eukaryotes ranging from yeasts and filamentous fungi to nematodes, plants, and mammals. In plants, several examples of operon-like gene clusters involved in metabolic pathways have recently been characterized, e.g. the cyclic hydroxamic acid pathways in maize, the avenacin biosynthesis gene clusters in oat, the thalianol pathway in Arabidopsis thaliana, and the diterpenoid momilactone cluster in rice. Such operon-like gene clusters are defined by their co-regulation or neighboring positions within immediate vicinity of chromosomal regions. A comprehensive analysis of the expression of neighboring genes therefore accounts a crucial step to reveal the complete set of operon-like gene clusters within a genome. Genome-wide prediction of operon-like gene clusters should contribute to functional annotation efforts and provide novel insight into evolutionary aspects acquiring certain biological functions as well. We predicted co-expressed gene clusters by comparing the Pearson correlation coefficient of neighboring genes and randomly selected gene pairs, based on a statistical method that takes false discovery rate (FDR) into consideration for 1469 microarray gene expression datasets of A. thaliana. We estimated that A. thaliana contains 100 operon-like gene clusters in total. We predicted 34 statistically significant gene clusters consisting of 3 to 22 genes each, based on a stringent FDR threshold of 0.1. Functional relationships among genes in individual clusters were estimated by sequence similarity and functional annotation of genes. Duplicated gene pairs (determined based on BLAST with a cutoff of EOperon-like clusters tend to include genes encoding bio-machinery associated with ribosomes, the ubiquitin/proteasome system, secondary metabolic pathways, lipid and fatty-acid metabolism, and the lipid transfer system. Copyright © 2012 Elsevier B.V. All rights reserved.

  2. Activation and clustering of a Plasmodium falciparum var gene are affected by subtelomeric sequences.

    Science.gov (United States)

    Duffy, Michael F; Tang, Jingyi; Sumardy, Fransisca; Nguyen, Hanh H T; Selvarajah, Shamista A; Josling, Gabrielle A; Day, Karen P; Petter, Michaela; Brown, Graham V

    2017-01-01

    The Plasmodium falciparum var multigene family encodes the cytoadhesive, variant antigen PfEMP1. P. falciparum antigenic variation and cytoadhesion specificity are controlled by epigenetic switching between the single, or few, simultaneously expressed var genes. Most var genes are maintained in perinuclear clusters of heterochromatic telomeres. The active var gene(s) occupy a single, perinuclear var expression site. It is unresolved whether the var expression site forms in situ at a telomeric cluster or whether it is an extant compartment to which single chromosomes travel, thus controlling var switching. Here we show that transcription of a var gene did not require decreased colocalisation with clusters of telomeres, supporting var expression site formation in situ. However following recombination within adjacent subtelomeric sequences, the same var gene was persistently activated and did colocalise less with telomeric clusters. Thus, participation in stable, heterochromatic, telomere clusters and var switching are independent but are both affected by subtelomeric sequences. The var expression site colocalised with the euchromatic mark H3K27ac to a greater extent than it did with heterochromatic H3K9me3. H3K27ac was enriched within the active var gene promoter even when the var gene was transiently repressed in mature parasites and thus H3K27ac may contribute to var gene epigenetic memory. © 2016 Federation of European Biochemical Societies.

  3. A flax-retting endopolygalacturonase-encoding gene from Rhizopus oryzae.

    Science.gov (United States)

    Xiao, Zhizhuang; Wang, Shaozhao; Bergeron, Hélène; Zhang, Jianchun; Lau, Peter C K

    2008-11-01

    A polygalacturonase from the filamentous fungus Rhizopus oryzae strain sb (NRRL 29086), previously shown to be effective in the retting of flax fibers, was shown by the analysis of its reaction products on polygalacturonic acid to be an endo-type. By zymogram analysis, the enzyme in the crude culture filtrate appeared as two active species of 37 and 40 kD. The endopolygalacturonase-encoding gene was cloned in Escherichia coli and its translated 383-amino acid sequence found to be identical to that of a presumed exopolygalacturonase found in R. oryzae strain YM9901 and 96% identical to a hypothetical protein (RO3G_04731.1) in the sequenced genome of R. oryzae strain 99-880. Phylogenetic analysis revealed the presence of an unique cluster of Rhizopus polygalacturonase sequences that are separate from other fungal polygalacturonases. Conservation of 12 cysteines appears to be a special feature of this family of Rhizopus polygalacturonase sequences.

  4. Shared gene structures and clusters of mutually exclusive spliced exons within the metazoan muscle myosin heavy chain genes.

    Directory of Open Access Journals (Sweden)

    Martin Kollmar

    Full Text Available Multicellular animals possess two to three different types of muscle tissues. Striated muscles have considerable ultrastructural similarity and contain a core set of proteins including the muscle myosin heavy chain (Mhc protein. The ATPase activity of this myosin motor protein largely dictates muscle performance at the molecular level. Two different solutions to adjusting myosin properties to different muscle subtypes have been identified so far: Vertebrates and nematodes contain many independent differentially expressed Mhc genes while arthropods have single Mhc genes with clusters of mutually exclusive spliced exons (MXEs. The availability of hundreds of metazoan genomes now allowed us to study whether the ancient bilateria already contained MXEs, how MXE complexity subsequently evolved, and whether additional scenarios to control contractile properties in different muscles could be proposed, By reconstructing the Mhc genes from 116 metazoans we showed that all intron positions within the motor domain coding regions are conserved in all bilateria analysed. The last common ancestor of the bilateria already contained a cluster of MXEs coding for part of the loop-2 actin-binding sequence. Subsequently the protostomes and later the arthropods gained many further clusters while MXEs got completely lost independently in several branches (vertebrates and nematodes and species (for example the annelid Helobdella robusta and the salmon louse Lepeophtheirus salmonis. Several bilateria have been found to encode multiple Mhc genes that might all or in part contain clusters of MXEs. Notable examples are a cluster of six tandemly arrayed Mhc genes, of which two contain MXEs, in the owl limpet Lottia gigantea and four Mhc genes with three encoding MXEs in the predatory mite Metaseiulus occidentalis. Our analysis showed that similar solutions to provide different myosin isoforms (multiple genes or clusters of MXEs or both have independently been developed

  5. Heterologous Reconstitution of the Intact Geodin Gene Cluster in Aspergillus nidulans through a Simple and Versatile PCR Based Approach

    DEFF Research Database (Denmark)

    Nielsen, Morten Thrane; Nielsen, Jakob Blæsbjerg; Anyaogu, Dianna Chinyere

    2013-01-01

    was transferred in a two step procedure to an expression platform in A. nidulans. The individual cluster fragments were generated by PCR and assembled via efficient USER fusion prior to ransformation and integration via re-iterative gene targeting. A total of 13 open reading frames contained in 25 kb of DNA were...... of solid methodology for genetic manipulation of most species severely hampers pathway haracterization. Here we present a simple PCR based approach for heterologous reconstitution of intact gene clusters. Specifically, the putative gene cluster responsible for geodin production from Aspergillus terreus...... successfully transferred between the two species enabling geodin synthesis in A. nidulans. Subsequently, functions of three genes in the cluster were validated by genetic and chemical analyses. Specifically, ATEG_08451 (gedC) encodes a polyketide synthase, ATEG_08453 (gedR) encodes a transcription factor...

  6. Biodiversity of genes encoding anti-microbial traits within plant associated microbes

    Directory of Open Access Journals (Sweden)

    Walaa Kamel Mousa

    2015-04-01

    Full Text Available The plant is an attractive versatile home for diverse associated microbes. A subset of these microbes produce a diversity of anti-microbial natural products including polyketides, non-ribosomal peptides, terpenoids, heterocylic nitrogenous compounds, volatile compounds, bacteriocins and lytic enzymes. In recent years, detailed molecular analysis has led to a better understanding of the underlying genetic mechanisms. New genomic and bioinformatic tools have permitted comparisons of orthologous genes between species, leading to predictions of the associated evolutionary mechanisms responsible for diversification at the genetic and corresponding biochemical levels. The purpose of this review is to describe the biodiversity of biosynthetic genes of plant-associated bacteria and fungi that encode selected examples of antimicrobial natural products. For each compound, the target pathogen and biochemical mode of action are described, in order to draw attention to the complexity of these phenomena. We review recent information of the underlying molecular diversity and draw lessons through comparative genomic analysis of the orthologous genes. We conclude by discussing emerging themes and gaps, discuss the metabolic pathways in the context of the phylogeny and ecology of their microbial hosts, and discuss potential evolutionary mechanisms that led to the diversification of biosynthetic gene clusters.

  7. Genome-wide identification of structural variants in genes encoding drug targets

    DEFF Research Database (Denmark)

    Rasmussen, Henrik Berg; Dahmcke, Christina Mackeprang

    2012-01-01

    The objective of the present study was to identify structural variants of drug target-encoding genes on a genome-wide scale. We also aimed at identifying drugs that are potentially amenable for individualization of treatments based on knowledge about structural variation in the genes encoding...

  8. Genome-wide comparative analysis of NBS-encoding genes between Brassica species and Arabidopsis thaliana.

    Science.gov (United States)

    Yu, Jingyin; Tehrim, Sadia; Zhang, Fengqi; Tong, Chaobo; Huang, Junyan; Cheng, Xiaohui; Dong, Caihua; Zhou, Yanqiu; Qin, Rui; Hua, Wei; Liu, Shengyi

    2014-01-03

    Plant disease resistance (R) genes with the nucleotide binding site (NBS) play an important role in offering resistance to pathogens. The availability of complete genome sequences of Brassica oleracea and Brassica rapa provides an important opportunity for researchers to identify and characterize NBS-encoding R genes in Brassica species and to compare with analogues in Arabidopsis thaliana based on a comparative genomics approach. However, little is known about the evolutionary fate of NBS-encoding genes in the Brassica lineage after split from A. thaliana. Here we present genome-wide analysis of NBS-encoding genes in B. oleracea, B. rapa and A. thaliana. Through the employment of HMM search and manual curation, we identified 157, 206 and 167 NBS-encoding genes in B. oleracea, B. rapa and A. thaliana genomes, respectively. Phylogenetic analysis among 3 species classified NBS-encoding genes into 6 subgroups. Tandem duplication and whole genome triplication (WGT) analyses revealed that after WGT of the Brassica ancestor, NBS-encoding homologous gene pairs on triplicated regions in Brassica ancestor were deleted or lost quickly, but NBS-encoding genes in Brassica species experienced species-specific gene amplification by tandem duplication after divergence of B. rapa and B. oleracea. Expression profiling of NBS-encoding orthologous gene pairs indicated the differential expression pattern of retained orthologous gene copies in B. oleracea and B. rapa. Furthermore, evolutionary analysis of CNL type NBS-encoding orthologous gene pairs among 3 species suggested that orthologous genes in B. rapa species have undergone stronger negative selection than those in B .oleracea species. But for TNL type, there are no significant differences in the orthologous gene pairs between the two species. This study is first identification and characterization of NBS-encoding genes in B. rapa and B. oleracea based on whole genome sequences. Through tandem duplication and whole genome

  9. Molecular cloning and functional analysis of the gene encoding ...

    African Journals Online (AJOL)

    Here we report for the first time the cloning of a full-length cDNA encoding GGPPS (Jc-GGPPS) from Jatropha curcas L. The full-length cDNA was 1414 base pair (bp), with an 1110-bp open reading frame (ORF) encoding a 370- amino-acids polypeptide. Bioinformatic analysis revealed that Jc-GGPPS is a member of the ...

  10. Structural and functional characterization of three polyketide synthase gene clusters in Bacillus amyloliquefaciens FZB 42.

    Science.gov (United States)

    Chen, Xiao-Hua; Vater, Joachim; Piel, Jörn; Franke, Peter; Scholz, Romy; Schneider, Kathrin; Koumoutsi, Alexandra; Hitzeroth, Gabriele; Grammel, Nicolas; Strittmatter, Axel W; Gottschalk, Gerhard; Süssmuth, Roderich D; Borriss, Rainer

    2006-06-01

    Although bacterial polyketides are of considerable biomedical interest, the molecular biology of polyketide biosynthesis in Bacillus spp., one of the richest bacterial sources of bioactive natural products, remains largely unexplored. Here we assign for the first time complete polyketide synthase (PKS) gene clusters to Bacillus antibiotics. Three giant modular PKS systems of the trans-acyltransferase type were identified in Bacillus amyloliquefaciens FZB 42. One of them, pks1, is an ortholog of the pksX operon with a previously unknown function in the sequenced model strain Bacillus subtilis 168, while the pks2 and pks3 clusters are novel gene clusters. Cassette mutagenesis combined with advanced mass spectrometric techniques such as matrix-assisted laser desorption ionization-time of flight mass spectrometry and liquid chromatography-electrospray ionization mass spectrometry revealed that the pks1 (bae) and pks3 (dif) gene clusters encode the biosynthesis of the polyene antibiotics bacillaene and difficidin or oxydifficidin, respectively. In addition, B. subtilis OKB105 (pheA sfp(0)), a transformant of the B. subtilis 168 derivative JH642, was shown to produce bacillaene, demonstrating that the pksX gene cluster directs the synthesis of that polyketide. The GenBank accession numbers for gene clusters pks1(bae), pks2, and pks3(dif) are AJ 634060.2, AJ 6340601.2, and AJ 6340602.2, respectively.

  11. Biodiversity of genes encoding anti-microbial traits within plant associated microbes

    Science.gov (United States)

    Mousa, Walaa K.; Raizada, Manish N.

    2015-01-01

    The plant is an attractive versatile home for diverse associated microbes. A subset of these microbes produces a diversity of anti-microbial natural products including polyketides, non-ribosomal peptides, terpenoids, heterocylic nitrogenous compounds, volatile compounds, bacteriocins, and lytic enzymes. In recent years, detailed molecular analysis has led to a better understanding of the underlying genetic mechanisms. New genomic and bioinformatic tools have permitted comparisons of orthologous genes between species, leading to predictions of the associated evolutionary mechanisms responsible for diversification at the genetic and corresponding biochemical levels. The purpose of this review is to describe the biodiversity of biosynthetic genes of plant-associated bacteria and fungi that encode selected examples of antimicrobial natural products. For each compound, the target pathogen and biochemical mode of action are described, in order to draw attention to the complexity of these phenomena. We review recent information of the underlying molecular diversity and draw lessons through comparative genomic analysis of the orthologous coding sequences (CDS). We conclude by discussing emerging themes and gaps, discuss the metabolic pathways in the context of the phylogeny and ecology of their microbial hosts, and discuss potential evolutionary mechanisms that led to the diversification of biosynthetic gene clusters. PMID:25914708

  12. plantiSMASH: automated identification, annotation and expression analysis of plant biosynthetic gene clusters

    DEFF Research Database (Denmark)

    Kautsar, Satria A.; Suarez Duran, Hernando G.; Blin, Kai

    2017-01-01

    in specific genomic loci: biosynthetic gene clusters (BGCs). Here, we introduce plantiSMASH, a versatile online analysis platform that automates the identification of candidate plant BGCs. Moreover, it allows integration of transcriptomic data to prioritize candidate BGCs based on the coexpression patterns......Plant specialized metabolites are chemically highly diverse, play key roles in host-microbe interactions, have important nutritional value in crops and are frequently applied as medicines. It has recently become clear that plant biosynthetic pathway-encoding genes are sometimes densely clustered...... of predicted biosynthetic enzyme-coding genes, and facilitates comparative genomic analysis to study the evolutionary conservation of each cluster. Applied on 48 high-quality plant genomes, plantiSMASH identifies a rich diversity of candidate plant BGCs. These results will guide further experimental...

  13. The CHRNA5-A3-B4 Gene Cluster and Smoking: From Discovery to Therapeutics.

    Science.gov (United States)

    Lassi, Glenda; Taylor, Amy E; Timpson, Nicholas J; Kenny, Paul J; Mather, Robert J; Eisen, Tim; Munafò, Marcus R

    2016-12-01

    Genome-wide association studies (GWASs) have identified associations between the CHRNA5-CHRNA3-CHRNB4 gene cluster and smoking heaviness and nicotine dependence. Studies in rodents have described the anatomical localisation and function of the nicotinic acetylcholine receptors (nAChRs) formed by the subunits encoded by this gene cluster. Further investigations that complemented these studies highlighted the variability of individuals' smoking behaviours and their ability to adjust nicotine intake. GWASs of smoking-related health outcomes have also identified this signal in the CHRNA5-CHRNA3-CHRNB4 gene cluster. This insight underpins approaches to strengthen causal inference in observational data. Combining genetic and mechanistic studies of nicotine dependence and smoking heaviness may reveal novel targets for medication development. Validated targets can inform genetic therapeutic interventions for smoking cessation and tobacco-related diseases. Copyright © 2016 The Authors. Published by Elsevier Ltd.. All rights reserved.

  14. Gene ordering in partitive clustering using microarray expressions

    Indian Academy of Sciences (India)

    PRAKASH KUMAR

    the new hybrid approach, finds comparable or sometimes superior biological gene order in less computation time than those obtained by optimal leaf ordering in hierarchical clustering solution. Ray S S, Bandyopadhyay S and Pal S K 2007 Gene ordering in partitive clustering using microarray expressions; J. Biosci.

  15. The genome of tolypocladium inflatum: evolution, organization, and expression of the cyclosporin biosynthetic gene cluster.

    Directory of Open Access Journals (Sweden)

    Kathryn E Bushley

    2013-06-01

    Full Text Available The ascomycete fungus Tolypocladium inflatum, a pathogen of beetle larvae, is best known as the producer of the immunosuppressant drug cyclosporin. The draft genome of T. inflatum strain NRRL 8044 (ATCC 34921, the isolate from which cyclosporin was first isolated, is presented along with comparative analyses of the biosynthesis of cyclosporin and other secondary metabolites in T. inflatum and related taxa. Phylogenomic analyses reveal previously undetected and complex patterns of homology between the nonribosomal peptide synthetase (NRPS that encodes for cyclosporin synthetase (simA and those of other secondary metabolites with activities against insects (e.g., beauvericin, destruxins, etc., and demonstrate the roles of module duplication and gene fusion in diversification of NRPSs. The secondary metabolite gene cluster responsible for cyclosporin biosynthesis is described. In addition to genes necessary for cyclosporin biosynthesis, it harbors a gene for a cyclophilin, which is a member of a family of immunophilins known to bind cyclosporin. Comparative analyses support a lineage specific origin of the cyclosporin gene cluster rather than horizontal gene transfer from bacteria or other fungi. RNA-Seq transcriptome analyses in a cyclosporin-inducing medium delineate the boundaries of the cyclosporin cluster and reveal high levels of expression of the gene cluster cyclophilin. In medium containing insect hemolymph, weaker but significant upregulation of several genes within the cyclosporin cluster, including the highly expressed cyclophilin gene, was observed. T. inflatum also represents the first reference draft genome of Ophiocordycipitaceae, a third family of insect pathogenic fungi within the fungal order Hypocreales, and supports parallel and qualitatively distinct radiations of insect pathogens. The T. inflatum genome provides additional insight into the evolution and biosynthesis of cyclosporin and lays a foundation for further

  16. Heterologous reconstitution of the intact geodin gene cluster in Aspergillus nidulans through a simple and versatile PCR based approach.

    Directory of Open Access Journals (Sweden)

    Morten Thrane Nielsen

    Full Text Available Fungal natural products are a rich resource for bioactive molecules. To fully exploit this potential it is necessary to link genes to metabolites. Genetic information for numerous putative biosynthetic pathways has become available in recent years through genome sequencing. However, the lack of solid methodology for genetic manipulation of most species severely hampers pathway characterization. Here we present a simple PCR based approach for heterologous reconstitution of intact gene clusters. Specifically, the putative gene cluster responsible for geodin production from Aspergillus terreus was transferred in a two step procedure to an expression platform in A. nidulans. The individual cluster fragments were generated by PCR and assembled via efficient USER fusion prior to transformation and integration via re-iterative gene targeting. A total of 13 open reading frames contained in 25 kb of DNA were successfully transferred between the two species enabling geodin synthesis in A. nidulans. Subsequently, functions of three genes in the cluster were validated by genetic and chemical analyses. Specifically, ATEG_08451 (gedC encodes a polyketide synthase, ATEG_08453 (gedR encodes a transcription factor responsible for activation of the geodin gene cluster and ATEG_08460 (gedL encodes a halogenase that catalyzes conversion of sulochrin to dihydrogeodin. We expect that our approach for transferring intact biosynthetic pathways to a fungus with a well developed genetic toolbox will be instrumental in characterizing the many exciting pathways for secondary metabolite production that are currently being uncovered by the fungal genome sequencing projects.

  17. CAR gene cluster and transcript levels of carotenogenic genes in Rhodotorula mucilaginosa.

    Science.gov (United States)

    Landolfo, Sara; Ianiri, Giuseppe; Camiolo, Salvatore; Porceddu, Andrea; Mulas, Giuliana; Chessa, Rossella; Zara, Giacomo; Mannazzu, Ilaria

    2018-01-01

    A molecular approach was applied to the study of the carotenoid biosynthetic pathway of Rhodotorula mucilaginosa. At first, functional annotation of the genome of R. mucilaginosa C2.5t1 was carried out and gene ontology categories were assigned to 4033 predicted proteins. Then, a set of genes involved in different steps of carotenogenesis was identified and those coding for phytoene desaturase, phytoene synthase/lycopene cyclase and carotenoid dioxygenase (CAR genes) proved to be clustered within a region of ~10 kb. Quantitative PCR of the genes involved in carotenoid biosynthesis showed that genes coding for 3-hydroxy-3-methylglutharyl-CoA reductase and mevalonate kinase are induced during exponential phase while no clear trend of induction was observed for phytoene synthase/lycopene cyclase and phytoene dehydrogenase encoding genes. Thus, in R. mucilaginosa the induction of genes involved in the early steps of carotenoid biosynthesis is transient and accompanies the onset of carotenoid production, while that of CAR genes does not correlate with the amount of carotenoids produced. The transcript levels of genes coding for carotenoid dioxygenase, superoxide dismutase and catalase A increased during the accumulation of carotenoids, thus suggesting the activation of a mechanism aimed at the protection of cell structures from oxidative stress during carotenoid biosynthesis. The data presented herein, besides being suitable for the elucidation of the mechanisms that underlie carotenoid biosynthesis, will contribute to boosting the biotechnological potential of this yeast by improving the outcome of further research efforts aimed at also exploring other features of interest.

  18. Ty3 GAG3 and POL3 genes encode the components of intracellular particles.

    Science.gov (United States)

    Hansen, L J; Chalker, D L; Orlinsky, K J; Sandmeyer, S B

    1992-03-01

    Ty3 is a Saccharomyces cerevisiae retrotransposon that integrates near the transcription initiation sites of polymerase III-transcribed genes. It is distinct from the copialike Ty1 and Ty2 retrotransposons of S. cerevisiae in both the sequences of encoded proteins and gene order. It is a member of the gypsylike family of retrotransposons which resemble animal retroviruses. This study was undertaken to investigate the nucleocapsid particle of a transpositionally active gypsylike retrotransposon. Characterization of extracts from cells in which Ty3 expression was induced showed the presence of Ty3 nucleoprotein complexes, or viruslike particles, that migrated on linear sucrose gradients with a size of 156S. These particles are composed of Ty3 RNA, full-length, linear DNA, and proteins. In this study, antibodies raised against peptides predicted from the Ty3 sequence were used to identify Ty3-encoded proteins. These include the capsid (26 kDa), nucleocapsid (9 kDa), and reverse transcriptase (55 kDa) proteins. Ty3 integrase proteins of 61 and 58 kDa were identified previously (L. J. Hansen and S. B. Sandmeyer, J. Virol. 64:2599-2607, 1990). Reverse transcriptase activity associated with the particles was measured by using exogenous and endogenous primer-templates. Immunofluorescence studies of cells overexpressing Ty3 revealed cytoplasmic clusters of immunoreactive proteins. Transmission electron microscopy showed that Ty3 viruslike particles are about 50 nm in diameter. Thus, despite the unusual position specificity of Ty3 upstream of tRNA-coding regions, aspects of the Ty3 life cycle are fundamentally similar to those of retroviruses.

  19. Multiplexed CRISPR/Cas9- and TAR-Mediated Promoter Engineering of Natural Product Biosynthetic Gene Clusters in Yeast.

    Science.gov (United States)

    Kang, Hahk-Soo; Charlop-Powers, Zachary; Brady, Sean F

    2016-09-16

    The use of DNA sequencing to guide the discovery of natural products has emerged as a new paradigm for revealing chemistries encoded in bacterial genomes. A major obstacle to implementing this approach to natural product discovery is the transcriptional silence of biosynthetic gene clusters under laboratory growth conditions. Here we describe an improved yeast-based promoter engineering platform (mCRISTAR) that combines CRISPR/Cas9 and TAR to enable single-marker multiplexed promoter engineering of large gene clusters. mCRISTAR highlights the first application of the CRISPR/Cas9 system to multiplexed promoter engineering of natural product biosynthetic gene clusters. In this method, CRISPR/Cas9 is used to induce DNA double-strand breaks in promoter regions of biosynthetic gene clusters, and the resulting operon fragments are reassembled by TAR using synthetic gene-cluster-specific promoter cassettes. mCRISTAR uses a CRISPR array to simplify the construction of a CRISPR plasmid for multiplex CRISPR and a single auxotrophic selection to improve the inefficiency of using a CRISPR array for multiplex gene cluster refactoring. mCRISTAR is a simple and generic method for multiplexed replacement of promoters in biosynthetic gene clusters that will facilitate the discovery of natural products from the rapidly growing collection of gene clusters found in microbial genome and metagenome sequencing projects.

  20. Molecular quantification of genes encoding for green-fluorescent proteins

    DEFF Research Database (Denmark)

    Felske, A; Vandieken, V; Pauling, B V

    2003-01-01

    A quantitative PCR approach is presented to analyze the amount of recombinant green fluorescent protein (gfp) genes in environmental DNA samples. The quantification assay is a combination of specific PCR amplification and temperature gradient gel electrophoresis (TGGE). Gene quantification...

  1. Effects of deoxycycline induced lentivirus encoding FasL gene on ...

    African Journals Online (AJOL)

    Abstract. Fas/Fas ligand (FasL)-mediated apoptosis plays a critical role in deletion of activated T cells. This study aimed to construct the lentivirus encoding FasL gene induced by deoxycycline and evaluate its effects on apoptosis of Th1 cells. A plasmid expression system encoding FasL was constructed through utilizing the ...

  2. Rapid duplication and loss of nbs-encoding genes in eurosids II

    International Nuclear Information System (INIS)

    Si, W.; Gu, L.; Yang, S.; Zhang, X.; Memon, S.

    2015-01-01

    Eurosids basically evolved from the core Eudicots Rosids. The Rosids consist of two large assemblages, Eurosids I (Fabids) and Eurosids II (Malvids), which belong to the largest group of Angiosperms, comprising of >40,000 and ∼ 15,000 species, respectively. Although the evolutionary patterns of the largest class of disease resistance genes consisting of a nucleotide binding site (NBS) and leucine-rich repeats (LRRs) have been studied in many species, systemic research of NBS-encoding genes has not been performed in different orders of Eurosids II. Here, five Eurosids II species, Gossypium raimondii, Theobroma cacao, Carica papaya, Citrus clementina, and Arabidopsis thaliana, distributing in three orders, were used to gain insights into the evolutionary patterns of the NBS-encoding genes. Our data showed that frequent copy number variations of NBS-encoding genes were found among these species. Phylogenetic tree analysis and the numbers of the NBS-encoding genes in the common ancestor of these species showed that species-specific NBS clades, including multi-copy and single copy numbers are dominant among these genes. However, not a single clade was found with only five copies, which come from all of the five species, respectively, suggesting rapid turn-over with birth and death of the NBS-encoding genes among Eurosids II species. In addition, a strong positive correlation was observed between the Toll/interleukin receptor (TIR)) type NBS-encoding genes and species-specific genes, indicating rapid gene loss and duplication. Whereas, non- TIR type NBS-encoding genes in these five species showed two distinct evolutionary patterns. (author)

  3. Molecular cloning and functional analysis of the gene encoding ...

    African Journals Online (AJOL)

    STORAGESEVER

    2010-06-07

    Jun 7, 2010 ... synthase (crtB), phytoene desaturase (crtL) and lycopene cyclase. (crtY). It also retains a chloramphenicol resistance gene. Cells of E. coli containing this plasmid produce and accumulate β-carotene, resulting in yellow colonies. The plasmid, pTrc-ATIPI, retains an ampicillin resistance gene and an IPI gene ...

  4. Identification and characterization of a gene encoding a putative ...

    Indian Academy of Sciences (India)

    2012-10-30

    Oct 30, 2012 ... Peanut Ubiquitin gene (Luo et al. 2005) was used as the internal control. Expression data of the target gene was normalized with internal control using the 2. –ΔΔCT method (Livak and Schmittgen 2001). Lysophosphatidyl acyltransferase gene from Arachis hypogaea. 1031. J. Biosci. 37(6), December 2012 ...

  5. Novel Genes Encoding Hexadecanoic Acid Δ6-Desaturase Activity in a Rhodococcus sp.

    Science.gov (United States)

    Araki, Hiroyuki; Hagihara, Hiroshi; Takigawa, Hirofumi; Tsujino, Yukiharu; Ozaki, Katsuya

    2016-11-01

    cis-6-Hexadecenoic acid, a major component of human sebaceous lipids, is involved in the defense mechanism against Staphylococcus aureus infection in healthy skin and closely related to atopic dermatitis. Previously, Koike et al. (Biosci Biotechnol Biochem 64:1064-1066, 2000) reported that a mutant strain of Rhodococcus sp. produced cis-6-hexadecenoate derivatives from palmitate alkyl esters. From the mutant Rhodococcus strain, we identified and sequenced two open reading frames present in an amplified 5.7-kb region; these open reading frames encoded tandemly repeated Δ6-desaturase-like genes, Rdes1 and Rdes2. A phylogenetic tree indicated that Rdes1 and Rdes2 were different from previously known Δ6-desaturase genes, and that they formed a new cluster. Rdes1 and Rdes2 were each introduced into vectors and then expressed separately in Escherichia coli, and the fatty acid composition of the transformed cells was analyzed by gas chromatography and mass spectrometry. The amount of cis-6-hexadecenoic acid was significantly higher in Rdes1- or Rdes2-transformed E. coli cells (twofold and threefold, respectively) than in vector-only control cells. These results showed that cis-6-hexadecenoic acid was produced in E. coli cells by the rhodococcal Δ6-desaturase-like proteins.

  6. The presence of two S-layer-protein-encoding genes is conserved among species related to Lactobacillus acidophilus

    NARCIS (Netherlands)

    Boot, H.J.; Kolen, C.P.A.M.; Pot, B.; Kersters, K.; Pouwels, P.H.

    1996-01-01

    Previously we have shown that the type strain of Lactobacillus acidophilus possesses two S-protein-encoding genes, one of which is silent, on a chromosomal segment of 6 kb. The S-protein-encoding gene in the expression site can be exchanged for the silent S-protein-encoding gene by inversion of this

  7. Enterotoxin-encoding genes in Staphylococcus spp. from bulk goat milk.

    Science.gov (United States)

    Lyra, Daniele G; Sousa, Francisca G C; Borges, Maria F; Givisiez, Patrícia E N; Queiroga, Rita C R E; Souza, Evandro L; Gebreyes, Wondwossen A; Oliveira, Celso J B

    2013-02-01

    Although Staphylococcus aureus has been implicated as the main Staphylococcus species causing human food poisoning, recent studies have shown that coagulase-negative Staphylococcus could also harbor enterotoxin-encoding genes. Such organisms are often present in goat milk and are the most important mastitis-causing agents. Therefore, this study aimed to investigate the occurrence of enterotoxin-encoding genes among coagulase-positive (CoPS) and coagulase-negative (CoNS) staphylococci isolated from raw goat milk produced in the semi-arid region of Paraiba, the most important region for goat milk production in Brazil. Enterotoxin-encoding genes were screened in 74 staphylococci isolates (30 CoPS and 44 CoNS) by polymerase chain reaction targeting the genes sea, seb, sec, sed, see, seg, seh, and sei. Enterotoxin-encoding genes were found in nine (12.2%) isolates, and four different genes (sea, sec, seg, and sei) were identified amongst the isolates. The most frequent genes were seg and sei, which were often found simultaneously in 44.5% of the isolates. The gene sec was the most frequent among the classical genes, and sea was found only in one isolate. All CoPS isolates (n=7) harboring enterotoxigenic genes were identified as S. aureus. The two coagulase-negative isolates were S. haemolyticus and S. hominis subsp. hominis and they harbored sei and sec genes, respectively. A higher frequency of enterotoxin-encoding genes was observed amongst CoPS (23.3%) than CoNS (4.5%) isolates (pgoat milk should not be ignored because it has a higher occurrence in goat milk and enterotoxin-encoding genes were detected in some isolates.

  8. In silicio search for genes encoding peroxisomal proteins in Saccharomyces cerevisiae.

    Science.gov (United States)

    Kal, A J; Hettema, E H; van den Berg, M; Koerkamp, M G; van Ijlst, L; Distel, B; Tabak, H F

    2000-01-01

    The biogenesis of peroxisomes involves the synthesis of new proteins that after, completion of translation, are targeted to the organelle by virtue of peroxisomal targeting signals (PTS). Two types of PTSs have been well characterized for import of matrix proteins (PTS1 and PTS2). Induction of the genes encoding these matrix proteins takes place in oleate-containing medium and is mediated via an oleate response element (ORE) present in the region preceding these genes. The authors have searched the yeast genome for OREs preceding open reading frames (ORFs), and for ORFs that contain either a PTS1 or PTS2. Of the ORFs containing an ORE, as well as either a PTS1 or a PTS2, many were known to encode bona fide peroxisomal matrix proteins. In addition, candidate genes were identified as encoding putative new peroxisomal proteins. For one case, subcellular location studies validated the in silicio prediction. This gene encodes a new peroxisomal thioesterase.

  9. Effect of salt stress on genes encoding translation-associated proteins in Arabidopsis thaliana.

    Science.gov (United States)

    Omidbakhshfard, Mohammad Amin; Omranian, Nooshin; Ahmadi, Farajollah Shahriari; Nikoloski, Zoran; Mueller-Roeber, Bernd

    2012-09-01

    Salinity negatively affects plant growth and disturbs chloroplast integrity. Here, we aimed at identifying salt-responsive translation-related genes in Arabidopsis thaliana with an emphasis on those encoding plastid-located proteins. We used quantitative real-time PCR to test the expression of 170 genes after short-term salt stress (up to 24 h) and identified several genes affected by the stress including: PRPL11, encoding plastid ribosomal protein L11, ATAB2, encoding a chloroplast-located RNA-binding protein presumably functioning as an activator of translation, and PDF1B, encoding a peptide deformylase involved in N-formyl group removal from nascent proteins synthesized in chloroplasts. These genes were previously shown to have important functions in chloroplast biology and may therefore represent new targets for biotechnological optimization of salinity tolerance.

  10. Sequencing and transcriptional analysis of the biosynthesis gene cluster of abscisic acid-producing Botrytis cinerea.

    Science.gov (United States)

    Gong, Tao; Shu, Dan; Yang, Jie; Ding, Zhong-Tao; Tan, Hong

    2014-09-29

    Botrytis cinerea is a model species with great importance as a pathogen of plants and has become used for biotechnological production of ABA. The ABA cluster of B. cinerea is composed of an open reading frame without significant similarities (bcaba3), followed by the genes (bcaba1 and bcaba2) encoding P450 monooxygenases and a gene probably coding for a short-chain dehydrogenase/reductase (bcaba4). In B. cinerea ATCC58025, targeted inactivation of the genes in the cluster suggested at least three genes responsible for the hydroxylation at carbon atom C-1' and C-4' or oxidation at C-4' of ABA. Our group has identified an ABA-overproducing strain, B. cinerea TB-3-H8. To differentiate TB-3-H8 from other B. cinerea strains with the functional ABA cluster, the DNA sequence of the 12.11-kb region containing the cluster of B. cinerea TB-3-H8 was determined. Full-length cDNAs were also isolated for bcaba1, bcaba2, bcaba3 and bcaba4 from B. cinerea TB-3-H8. Sequence comparison of the four genes and their flanking regions respectively derived from B. cinerea TB-3-H8, B05.10 and T4 revealed that major variations were located in intergenic sequences. In B. cinerea TB-3-H8, the expression profiles of the four function genes under ABA high-yield conditions were also analyzed by real-time PCR.

  11. Nearest Neighbor Networks: clustering expression data based on gene neighborhoods

    Directory of Open Access Journals (Sweden)

    Olszewski Kellen L

    2007-07-01

    Full Text Available Abstract Background The availability of microarrays measuring thousands of genes simultaneously across hundreds of biological conditions represents an opportunity to understand both individual biological pathways and the integrated workings of the cell. However, translating this amount of data into biological insight remains a daunting task. An important initial step in the analysis of microarray data is clustering of genes with similar behavior. A number of classical techniques are commonly used to perform this task, particularly hierarchical and K-means clustering, and many novel approaches have been suggested recently. While these approaches are useful, they are not without drawbacks; these methods can find clusters in purely random data, and even clusters enriched for biological functions can be skewed towards a small number of processes (e.g. ribosomes. Results We developed Nearest Neighbor Networks (NNN, a graph-based algorithm to generate clusters of genes with similar expression profiles. This method produces clusters based on overlapping cliques within an interaction network generated from mutual nearest neighborhoods. This focus on nearest neighbors rather than on absolute distance measures allows us to capture clusters with high connectivity even when they are spatially separated, and requiring mutual nearest neighbors allows genes with no sufficiently similar partners to remain unclustered. We compared the clusters generated by NNN with those generated by eight other clustering methods. NNN was particularly successful at generating functionally coherent clusters with high precision, and these clusters generally represented a much broader selection of biological processes than those recovered by other methods. Conclusion The Nearest Neighbor Networks algorithm is a valuable clustering method that effectively groups genes that are likely to be functionally related. It is particularly attractive due to its simplicity, its success in the

  12. Genetic interrelations in the actinomycin biosynthetic gene clusters of Streptomyces antibioticus IMRU 3720 and Streptomyces chrysomallus ATCC11523, producers of actinomycin X and actinomycin C

    Directory of Open Access Journals (Sweden)

    Crnovčić I

    2017-04-01

    Full Text Available Ivana Crnovčić,1 Christian Rückert,2 Siamak Semsary,1 Manuel Lang,1 Jörn Kalinowski,2 Ullrich Keller1 1Institut für Chemie, Technische Universität Berlin, Berlin-Charlottenburg, 2Technology Platform Genomics, Center for Biotechnology, Bielefeld University, Bielefeld, Germany Abstract: Sequencing the actinomycin (acm biosynthetic gene cluster of Streptomyces antibioticus IMRU 3720, which produces actinomycin X (Acm X, revealed 20 genes organized into a highly similar framework as in the bi-armed acm C biosynthetic gene cluster of Streptomyces chrysomallus but without an attached additional extra arm of orthologues as in the latter. Curiously, the extra arm of the S. chrysomallus gene cluster turned out to perfectly match the single arm of the S. antibioticus gene cluster in the same order of orthologues including the the presence of two pseudogenes, scacmM and scacmN, encoding a cytochrome P450 and its ferredoxin, respectively. Orthologues of the latter genes were both missing in the principal arm of the S. chrysomallus acm C gene cluster. All orthologues of the extra arm showed a G +C-contents different from that of their counterparts in the principal arm. Moreover, the similarities of translation products from the extra arm were all higher to the corresponding translation products of orthologue genes from the S. antibioticus acm X gene cluster than to those encoded by the principal arm of their own gene cluster. This suggests that the duplicated structure of the S. chrysomallus acm C biosynthetic gene cluster evolved from previous fusion between two one-armed acm gene clusters each from a different genetic background. However, while scacmM and scacmN in the extra arm of the S. chrysomallus acm C gene cluster are mutated and therefore are non-functional, their orthologues saacmM and saacmN in the S. antibioticus acm C gene cluster show no defects seemingly encoding active enzymes with functions specific for Acm X biosynthesis. Both acm

  13. Identification of toxin genes encoding Cyt proteins from standard ...

    African Journals Online (AJOL)

    Polymerase chain reaction-restriction fragment length polymorphism methods for identification of cyt subclasses from Bacillus thuringiensis were established. Eight of 68 standard and ten of 107 Argentine B. thuringiensis strains harbor at least one cyt gene. The combination of cyt1Aa/cyt2Ba genes was identified in four ...

  14. Molecular cloning and characterization of five genes encoding pentatricopeptide repeat proteins from Upland cotton (Gossypium hirsutum L.).

    Science.gov (United States)

    Yang, Luming; Zhu, Huayu; Guo, Wangzhen; Zhang, Tianzhen

    2010-02-01

    The pentatricopeptide repeat (PPR) protein family is one of the largest and most complex families in plants. These proteins contain multiple 35-amino acid repeats that are proposed to form a super helix capable of binding RNA. PPR proteins have been implicated in many crucial functions broadly involving organelle biogenesis and plant development. In this study, we identified many genes encoding PPR protein in Upland cotton through an extensive survey of the database of Gossypium hirsutum. Furthermore, we isolated five full-length cDNA of PPR genes from G. hirsutum 0-613-2R which were named GhPPR1-GhPPR5. Domain analysis revealed that the deduced amino acid sequences of GhPPR1-5 contained from 5 to 10 PPR motifs and those PPR proteins were divided into two different PPR subfamilies. GhPPR1-2 belonged to the PLS subfamily and GhPPR3-5 belonged to the P subfamily. Phylogenetic analysis of the five GhPPR proteins and 18 other plant PPR proteins also revealed that the same subfamily clustered together. All five GhPPR genes were differentially but constitutively expressed in roots, stems, leaves, pollens, and fibers based on the gene expression analysis by real-time quantitative RT-PCR. This study is the first report and analysis of genes encoding PPR proteins in cotton.

  15. Clustering Algorithms: Their Application to Gene Expression Data.

    Science.gov (United States)

    Oyelade, Jelili; Isewon, Itunuoluwa; Oladipupo, Funke; Aromolaran, Olufemi; Uwoghiren, Efosa; Ameh, Faridah; Achas, Moses; Adebiyi, Ezekiel

    2016-01-01

    Gene expression data hide vital information required to understand the biological process that takes place in a particular organism in relation to its environment. Deciphering the hidden patterns in gene expression data proffers a prodigious preference to strengthen the understanding of functional genomics. The complexity of biological networks and the volume of genes present increase the challenges of comprehending and interpretation of the resulting mass of data, which consists of millions of measurements; these data also inhibit vagueness, imprecision, and noise. Therefore, the use of clustering techniques is a first step toward addressing these challenges, which is essential in the data mining process to reveal natural structures and identify interesting patterns in the underlying data. The clustering of gene expression data has been proven to be useful in making known the natural structure inherent in gene expression data, understanding gene functions, cellular processes, and subtypes of cells, mining useful information from noisy data, and understanding gene regulation. The other benefit of clustering gene expression data is the identification of homology, which is very important in vaccine design. This review examines the various clustering algorithms applicable to the gene expression data in order to discover and provide useful knowledge of the appropriate clustering technique that will guarantee stability and high degree of accuracy in its analysis procedure.

  16. Occurrence of enterotoxin-encoding genes in Staphylococcus aureus causing mastitis in lactating goats

    Directory of Open Access Journals (Sweden)

    Daneelly H. Ferreira

    2014-07-01

    Full Text Available Staphylococcal enterotoxins are the leading cause of human food poisoning worldwide. Staphylococcus spp. are the main mastitis-causing agents in goats and frequently found in high counts in goat milk. This study aimed to investigate the occurrence of enterotoxin-encoding genes in Staphylococcus aureus associated with mastitis in lactating goats in Paraiba State, Brazil. Milk samples (n=2024 were collected from 393 farms. Staphylococcus aureus was isolated in 55 milk samples. Classical (sea, seb, sec, sed, see and novel (seg, seh, sei enterotoxin-encoding genes were investigated by means of polymerase chain reaction (PCR. From thirty-six tested isolates, enterotoxin-encoding genes were detected in 7 (19.5% S. aureus. The gene encoding enterotoxin C (seC was identified in six isolates, while seiwas observed in only one isolate. The genes sea, seb, sed, see, seg and seh were not observed amongst the S. aureus investigated in this study. In summary, S. aureus causing mastitis in goats can harbor enterotoxin-encoding genes and seC was the most frequent gene observed amongst the investigated isolates. This finding is important for surveillance purposes, since enterotoxin C should be investigated in human staphylococcal food poisoning outbreaks caused by consumption of goat milk and dairy products.

  17. Asthma and genes encoding components of the vitamin D pathway

    Directory of Open Access Journals (Sweden)

    Raby Benjamin A

    2009-10-01

    Full Text Available Abstract Background Genetic variants at the vitamin D receptor (VDR locus are associated with asthma and atopy. We hypothesized that polymorphisms in other genes of the vitamin D pathway are associated with asthma or atopy. Methods Eleven candidate genes were chosen for this study, five of which code for proteins in the vitamin D metabolism pathway (CYP27A1, CYP27B1, CYP2R1, CYP24A1, GC and six that are known to be transcriptionally regulated by vitamin D (IL10, IL1RL1, CD28, CD86, IL8, SKIIP. For each gene, we selected a maximally informative set of common SNPs (tagSNPs using the European-derived (CEU HapMap dataset. A total of 87 SNPs were genotyped in a French-Canadian family sample ascertained through asthmatic probands (388 nuclear families, 1064 individuals and evaluated using the Family Based Association Test (FBAT program. We then sought to replicate the positive findings in four independent samples: two from Western Canada, one from Australia and one from the USA (CAMP. Results A number of SNPs in the IL10, CYP24A1, CYP2R1, IL1RL1 and CD86 genes were modestly associated with asthma and atopy (p IL10 and VDR genes as well as in the IL10 and IL1RL1 genes were associated with asthma (p IL10 and CYP24A1 genes were again modestly associated with asthma and atopy (p IL10 and VDR was replicated in CAMP, but not in the other populations. Conclusion A number of genes involved in the vitamin D pathway demonstrate modest levels of association with asthma and atopy. Multilocus models testing genes in the same pathway are potentially more effective to evaluate the risk of asthma, but the effects are not uniform across populations.

  18. Molecular evolution of genes encoding ribonucleases in ruminant species.

    Science.gov (United States)

    Confalone, E; Beintema, J J; Sasso, M P; Carsana, A; Palmieri, M; Vento, M T; Furia, A

    1995-12-01

    Phylogenetic analysis, based on the primary structures of mammalian pancreatic-type ribonucleases, indicated that gene duplication events, which occurred during the evolution of ancestral ruminants, gave rise to the three paralogous enzymes present in the bovine species. Herein we report data that demonstrate the existence of the orthologues of the bovine pancreatic, seminal, and cerebral ribonucleases coding sequences in the genomes of giraffe and sheep. The "seminal" sequence is a pseudogene in both species. We also report an analysis of the transcriptional expression of ribonuclease genes in sheep tissues. The data presented support a model for positive selection acting on the molecular evolution of ruminant ribonuclease genes.

  19. Characterization of a gene encoding cellulase from uncultured soil bacteria.

    Science.gov (United States)

    Kim, Soo-Jin; Lee, Chang-Muk; Han, Bo-Ram; Kim, Min-Young; Yeo, Yun-Soo; Yoon, Sang-Hong; Koo, Bon-Sung; Jun, Hong-Ki

    2008-05-01

    To detect cellulases encoded by uncultured microorganisms, we constructed metagenomic libraries from Korean soil DNAs. Screenings of the libraries revealed a clone pCM2 that uses carboxymethyl cellulose (CMC) as a sole carbon source. Further analysis of the insert showed two consecutive ORFs (celM2 and xynM2) encoding proteins of 226 and 662 amino acids, respectively. A multiple sequence analysis with the deduced amino acid sequences of celM2 showed 36% sequence identity with cellulase from the Synechococcus sp., while xynM2 had 59% identity to endo-1,4-beta-xylanase A from Cellulomonas pachnodae. The highest enzymatic CMC hydrolysis was observable at pH 4.0 and 45 degrees C with recombinant CelM2 protein. Although the enzyme CelM2 additionally hydrolyzed avicel and xylan, no substrate hydrolysis was observed on oligosaccharides such as cellobiose, pNP-beta-cellobioside, pNP-beta-glucoside, and pNP-beta-xyloside. These results showed that CelM2 is a novel endo-type cellulase.

  20. Cloning, expression and characterisation of a novel gene encoding ...

    African Journals Online (AJOL)

    微软用户

    2012-01-12

    families. The recombinant BtabCSP was successfully expressed in Escherichia coli cells. This is the first report on the existence of chemosensory protein-coding gene in whiteflies. It will help us to elucidate the molecular.

  1. Genes encoding chimeras of Neurospora crassa erg-3 and human ...

    Indian Academy of Sciences (India)

    Unknown

    digested with SmaI and SspI and self-ligated to generate. pSAC86 which eliminated the SacI site present in the. Multiple Cloning Site (MCS). Plasmid pBH86 contains a modified version of the erg-3 gene in which the intronic. HindIII site was destroyed (Prakash et al 1999). pMOD86 contains the erg-3 gene of Neurospora in ...

  2. Organization and control of genes encoding catabolic enzymes in Rhizobiaceae

    Energy Technology Data Exchange (ETDEWEB)

    Parke, D.; Ornston, L.N.

    1993-03-01

    Rhizobiaceae, a diverse bacterial group comprising rhizobia and agrobacteria, symbiotic partnership with plants form nitrogen-fixing nodules on plant roots or are plant pathogens. Phenolic compounds produced by plants serve as inducers of rhizobial nodulation genes and agrobacterial virulence genes reflect their capacity to utilize numerous aromatics, including phenolics, as a source of carbon and energy. In many microbes the aerobic degradation of numerous aromatic compounds to tricarboxylic acid cycle intermediates is achieved by the [beta]-ketoadipate pathway. Our initial studies focused on the organization and regulation of the ketoadipate pathway in Agrobacterium tumefaciens. We have cloned, identified and characterized a novel regulatory gene that modulates expression of an adjacent pca (protocatechuate) structural gene, pcaD. Regulation of pcaD is mediated by the regulatory gene, termed pcaQ, in concert with the intermediate [beta]-carboxy-cis,cis-muconate. [beta]-carboxy-cis,cismuconate is an unstable chemical, not marketed commercially, and it is unlikely to permeate Escherichia coli cells if supplied in media. Because of these factors, characterization of pcaQ in E. coli required an in vivo delivery system for [beta]-carboxycis,cis-muconate. This was accomplished by designing an E. coli strain that expressed an Acinetobacter calcoaceticus pcaA gene for conversion of protocatechuate to [beta]-carboxy-cis,cis-muconate.

  3. Identification, characterization and metagenome analysis of oocyte-specific genes organized in clusters in the mouse genome

    Directory of Open Access Journals (Sweden)

    Vaiman Daniel

    2005-05-01

    Full Text Available Abstract Background Genes specifically expressed in the oocyte play key roles in oogenesis, ovarian folliculogenesis, fertilization and/or early embryonic development. In an attempt to identify novel oocyte-specific genes in the mouse, we have used an in silico subtraction methodology, and we have focused our attention on genes that are organized in genomic clusters. Results In the present work, five clusters have been studied: a cluster of thirteen genes characterized by an F-box domain localized on chromosome 9, a cluster of six genes related to T-cell leukaemia/lymphoma protein 1 (Tcl1 on chromosome 12, a cluster composed of a SPErm-associated glutamate (E-Rich (Speer protein expressed in the oocyte in the vicinity of four unknown genes specifically expressed in the testis on chromosome 14, a cluster composed of the oocyte secreted protein-1 (Oosp-1 gene and two Oosp-related genes on chromosome 19, all three being characterized by a partial N-terminal zona pellucida-like domain, and another small cluster of two genes on chromosome 19 as well, composed of a TWIK-Related spinal cord K+ channel encoding-gene, and an unknown gene predicted in silico to be testis-specific. The specificity of expression was confirmed by RT-PCR and in situ hybridization for eight and five of them, respectively. Finally, we showed by comparing all of the isolated and clustered oocyte-specific genes identified so far in the mouse genome, that the oocyte-specific clusters are significantly closer to telomeres than isolated oocyte-specific genes are. Conclusion We have studied five clusters of genes specifically expressed in female, some of them being also expressed in male germ-cells. Moreover, contrarily to non-clustered oocyte-specific genes, those that are organized in clusters tend to map near chromosome ends, suggesting that this specific near-telomere position of oocyte-clusters in rodents could constitute an evolutionary advantage. Understanding the biological

  4. Two Gene Clusters Coordinate Galactose and Lactose Metabolism in Streptococcus gordonii

    Science.gov (United States)

    Zeng, Lin; Martino, Nicole C.

    2012-01-01

    Streptococcus gordonii is an early colonizer of the human oral cavity and an abundant constituent of oral biofilms. Two tandemly arranged gene clusters, designated lac and gal, were identified in the S. gordonii DL1 genome, which encode genes of the tagatose pathway (lacABCD) and sugar phosphotransferase system (PTS) enzyme II permeases. Genes encoding a predicted phospho-β-galactosidase (LacG), a DeoR family transcriptional regulator (LacR), and a transcriptional antiterminator (LacT) were also present in the clusters. Growth and PTS assays supported that the permease designated EIILac transports lactose and galactose, whereas EIIGal transports galactose. The expression of the gene for EIIGal was markedly upregulated in cells growing on galactose. Using promoter-cat fusions, a role for LacR in the regulation of the expressions of both gene clusters was demonstrated, and the gal cluster was also shown to be sensitive to repression by CcpA. The deletion of lacT caused an inability to grow on lactose, apparently because of its role in the regulation of the expression of the genes for EIILac, but had little effect on galactose utilization. S. gordonii maintained a selective advantage over Streptococcus mutans in a mixed-species competition assay, associated with its possession of a high-affinity galactose PTS, although S. mutans could persist better at low pHs. Collectively, these results support the concept that the galactose and lactose systems of S. gordonii are subject to complex regulation and that a high-affinity galactose PTS may be advantageous when S. gordonii is competing against the caries pathogen S. mutans in oral biofilms. PMID:22660715

  5. ISOLATION AND CHARACTERIZATION OF THE RAT GENE ENCODING GLUTAMATE-DEHYDROGENASE

    NARCIS (Netherlands)

    DAS, AT; ARNBERG, AC; MALINGRE, H; MOERER, P; CHARLES, R; MOORMAN, AFM; LAMERS, WH

    1993-01-01

    The concentration of glutamate dehydrogenase (GDH) varies strongly between different organs and between different regions within organs. To permit further studies on the regulation of GDH expression, we isolated and characterized the rat gene encoding the GDH protein. This gene contains 13 exons and

  6. Nucleotide sequence of the Agrobacterium tumefaciens octopine Ti plasmid-encoded tmr gene

    NARCIS (Netherlands)

    Heidekamp, F.; Dirkse, W.G.; Hille, J.; Ormondt, H. van

    1983-01-01

    The nucleotide sequence of the tmr gene, encoded by the octopine Ti plasmid from Agrobacterium tumefaciens (pTiAch5), was determined. The T-DNA, which encompasses this gene, is involved in tumor formation and maintenance, and probably mediates the cytokinin-independent growth of transformed plant

  7. Isolation and characterization of the rat glutamine synthetase-encoding gene

    NARCIS (Netherlands)

    van de Zande, L.; Labruyère, W. T.; Arnberg, A. C.; Wilson, R. H.; van den Bogaert, A. J.; Das, A. T.; van Oorschot, D. A.; Frijters, C.; Charles, R.; Moorman, A. F.

    1990-01-01

    From a rat genomic library in phage lambda Charon4A, a complete glutamine synthetase-encoding gene was isolated. The gene is 9.5-10 kb long, consists of seven exons, and codes for two mRNA species of 1375 nucleotides (nt) and 2787 nt, respectively. For both mRNAs, full-length cDNAs containing a

  8. Cloning and characterization of the gsk gene encoding guanosine kinase of Escherichia coli

    DEFF Research Database (Denmark)

    Harlow, Kenneth W.; Nygaard, Per; Hove-Jensen, Bjarne

    1995-01-01

    The Escherichia coli gsk gene encoding guanosine kinase was cloned from the Kohara gene library by complementation of the E. coli gsk-1 mutant allele. The cloned DNA fragment was sequenced and shown to encode a putative polypeptide of 433 amino acids with a molecular mass of 48,113 Da. Minicell...... analysis established the subunit Mr as 43,500. Primer extension analysis indicated the presence of an adequate Pribnow box and suggested that the transcript contained a 110-base leader sequence. Strains harboring the gsk gene on multicopy plasmids overexpressed both guanosine and inosine kinase activities...

  9. Molecular characterization of a conserved archaeal copper resistance (cop) gene cluster and its copper-responsive regulator in Sulfolobus solfataricus P2

    NARCIS (Netherlands)

    Ettema, T.J.G.; Brinkman, A.B.; Lamers, P.P.; Kornet, N.; Vos, de W.M.; Oost, van der J.

    2006-01-01

    Using a comparative genomics approach, a copper resistance gene cluster has been identified in multiple archaeal genomes. The cop cluster is predicted to encode a metallochaperone (CopM), a P-type copper-exporting ATPase (CopA) and a novel, archaea-specific transcriptional regulator (CopT) which

  10. Molecular quantification of genes encoding for green-fluorescent proteins

    DEFF Research Database (Denmark)

    Felske, A; Vandieken, V; Pauling, B V

    2003-01-01

    A quantitative PCR approach is presented to analyze the amount of recombinant green fluorescent protein (gfp) genes in environmental DNA samples. The quantification assay is a combination of specific PCR amplification and temperature gradient gel electrophoresis (TGGE). Gene quantification...... is provided by a competitively coamplified DNA standard constructed by point mutation PCR. A single base difference was introduced to achieve a suitable migration difference in TGGE between the original target DNA and the modified standard without altering the PCR amplification efficiency. This competitive...... PCR strategy is a highly specific and sensitive way to monitor recombinant DNA in environments like the efflux of a biotechnological plant....

  11. Identification and characterization of the genes encoding the core histones and histone variants of Neurospora crassa.

    OpenAIRE

    Hays, Shan M; Swanson, Johanna; Selker, Eric U

    2002-01-01

    We have identified and characterized the complete complement of genes encoding the core histones of Neurospora crassa. In addition to the previously identified pair of genes that encode histones H3 and H4 (hH3 and hH4-1), we identified a second histone H4 gene (hH4-2), a divergently transcribed pair of genes that encode H2A and H2B (hH2A and hH2B), a homolog of the F/Z family of H2A variants (hH2Az), a homolog of the H3 variant CSE4 from Saccharomyces cerevisiae (hH3v), and a highly diverged ...

  12. Escherichia coli yjjPB genes encode a succinate transporter important for succinate production.

    Science.gov (United States)

    Fukui, Keita; Nanatani, Kei; Hara, Yoshihiko; Yamakami, Suguru; Yahagi, Daiki; Chinen, Akito; Tokura, Mitsunori; Abe, Keietsu

    2017-09-01

    Under anaerobic conditions, Escherichia coli produces succinate from glucose via the reductive tricarboxylic acid cycle. To date, however, no genes encoding succinate exporters have been established in E. coli. Therefore, we attempted to identify genes encoding succinate exporters by screening an E. coli MG1655 genome library. We identified the yjjPB genes as candidates encoding a succinate transporter, which enhanced succinate production in Pantoea ananatis under aerobic conditions. A complementation assay conducted in Corynebacterium glutamicum strain AJ110655ΔsucE1 demonstrated that both YjjP and YjjB are required for the restoration of succinate production. Furthermore, deletion of yjjPB decreased succinate production in E. coli by 70% under anaerobic conditions. Taken together, these results suggest that YjjPB constitutes a succinate transporter in E. coli and that the products of both genes are required for succinate export.

  13. Several genes encoding enzymes with the same activity are necessary for aerobic fungal degradation of cellulose in nature.

    Directory of Open Access Journals (Sweden)

    Peter K Busk

    Full Text Available The cellulose-degrading fungal enzymes are glycoside hydrolases of the GH families and lytic polysaccharide monooxygenases. The entanglement of glycoside hydrolase families and functions makes it difficult to predict the enzymatic activity of glycoside hydrolases based on their sequence. In the present study we further developed the method Peptide Pattern Recognition to an automatic approach not only to find all genes encoding glycoside hydrolases and lytic polysaccharide monooxygenases in fungal genomes but also to predict the function of the genes. The functional annotation is an important feature as it provides a direct route to predict function from primary sequence. Furthermore, we used Peptide Pattern Recognition to compare the cellulose-degrading enzyme activities encoded by 39 fungal genomes. The results indicated that cellobiohydrolases and AA9 lytic polysaccharide monooxygenases are hallmarks of cellulose-degrading fungi except brown rot fungi. Furthermore, a high number of AA9, endocellulase and β-glucosidase genes were identified, not in what are known to be the strongest, specialized lignocellulose degraders but in saprophytic fungi that can use a wide variety of substrates whereas only few of these genes were found in fungi that have a limited number of natural, lignocellulotic substrates. This correlation suggests that enzymes with different properties are necessary for degradation of cellulose in different complex substrates. Interestingly, clustering of the fungi based on their predicted enzymes indicated that Ascomycota and Basidiomycota use the same enzymatic activities to degrade plant cell walls.

  14. Molecular evolution of genes encoding ribonucleases in ruminant species

    NARCIS (Netherlands)

    Confalone, E; Beintema, JJ; Sasso, MP; Carsana, A; Palmieri, M; Vento, MT; Furia, A

    1995-01-01

    Phylogenetic analysis, based on the primary structures of mammalian pancreatic-type ribonucleases, indicated that gene duplication events, which occurred during the evolution of ancestral ruminants, gave rise to the three paralogous enzymes present in the bovine species. Herein we report data that

  15. Isolation and characterization of a gene encoding a polyethylene ...

    Indian Academy of Sciences (India)

    Prakash

    Environmental stresses such as drought, cold and salinity have an enormous impact on crop productivity. To survive under unfavourable conditions, plants have developed a variety of sophisticated strategies (Bray 1997; Thomashow. 1999). One of the fundamental properties of adaptive mechanisms is that a gene must be ...

  16. Gene encoding virulence markers among Escherichia coli isolates ...

    African Journals Online (AJOL)

    River water sources and diarrhoeic stools of residents in the Venda Region, Limpopo Province of South Africa were analysed for the prevalence of Escherichia coli (E. coli) and the presence of virulence genes among the isolates. A control group of 100 nondiarrhoeic stool samples was included. Escherichia coli was ...

  17. Cloning and heterologous expression of a gene encoding lycopene ...

    African Journals Online (AJOL)

    Jane

    2011-04-06

    Apr 6, 2011 ... This report describes the cloning and expression of a gene lycopene epsilon cyclase, (LCYE) from. Camellia sinensis var assamica which is a precursor of the carotenoid lutein in tea. The 1982 bp cDNA sequence with 1599 bp open reading frame of LCYE was identified from an SSH library constructed for.

  18. Association between GH encoding gene polymorphism and semen ...

    African Journals Online (AJOL)

    The objective of this present study was to investigate relationships between the growth hormone gene restriction fragment length polymorphism (RFLP) and bull sperm characteristics. A total of 89 bulls from two semen evaluation stations were genotyped for the bovine growth hormone (bGH)-AluI polymorphism by ...

  19. Isolation and characterization of a gene encoding a polyethylene ...

    Indian Academy of Sciences (India)

    Prakash

    detoxification enzymes (glutathione S-transferase, soluble epoxide hydrolase, catalase and superoxide dismutase). The second group contains protein factors involved in the regulation of signal transduction and gene expression, which probably function in stress responses such as protein kinases, transcription factors and ...

  20. Gene encoding virulence markers among Escherichia coli isolates ...

    African Journals Online (AJOL)

    Escherichia coli was isolated and identified by standard cultural and biochemical methods. Pathogenicity of environmental and human isolates was determined by amplification of genes associated with virulence of E. coli, using specific primers. Of a total of 228 water and river sediment samples screened, E. coli was ...

  1. Cloning and heterologous expression of a gene encoding lycopene ...

    African Journals Online (AJOL)

    This report describes the cloning and expression of a gene lycopene epsilon cyclase, (LCYE) from Camellia sinensis var assamica which is a precursor of the carotenoid lutein in tea. The 1982 bp cDNA sequence with 1599 bp open reading frame of LCYE was identified from an SSH library constructed for quality trait in tea.

  2. Molecular characterization of rpoB gene encoding the RNA ...

    African Journals Online (AJOL)

    Polymerase chain reaction (PCR) mediated direct DNA sequencing was evaluated for rapid detection of Rifampicin resistance (RMPr) of Mycobacterium tuberculosis. After amplification of the rpoB gene, the product was sequenced using ABI 310 Genetic Analyzer and the rifampicin resistance in M. tuberculosis were ...

  3. Motif analysis unveils the possible co-regulation of chloroplast genes and nuclear genes encoding chloroplast proteins.

    Science.gov (United States)

    Wang, Ying; Ding, Jun; Daniell, Henry; Hu, Haiyan; Li, Xiaoman

    2012-09-01

    Chloroplasts play critical roles in land plant cells. Despite their importance and the availability of at least 200 sequenced chloroplast genomes, the number of known DNA regulatory sequences in chloroplast genomes are limited. In this paper, we designed computational methods to systematically study putative DNA regulatory sequences in intergenic regions near chloroplast genes in seven plant species and in promoter sequences of nuclear genes in Arabidopsis and rice. We found that -35/-10 elements alone cannot explain the transcriptional regulation of chloroplast genes. We also concluded that there are unlikely motifs shared by intergenic sequences of most of chloroplast genes, indicating that these genes are regulated differently. Finally and surprisingly, we found five conserved motifs, each of which occurs in no more than six chloroplast intergenic sequences, are significantly shared by promoters of nuclear-genes encoding chloroplast proteins. By integrating information from gene function annotation, protein subcellular localization analyses, protein-protein interaction data, and gene expression data, we further showed support of the functionality of these conserved motifs. Our study implies the existence of unknown nuclear-encoded transcription factors that regulate both chloroplast genes and nuclear genes encoding chloroplast protein, which sheds light on the understanding of the transcriptional regulation of chloroplast genes.

  4. The biosynthetic gene cluster for the cyanogenic glucoside dhurrin in Sorghum bicolor contains its co-expressed vacuolar MATE transporter

    DEFF Research Database (Denmark)

    Darbani Shirvanehdeh, Behrooz; Motawie, Mohammed Saddik; Olsen, Carl Erik

    2016-01-01

    for the cyanogenic glucoside dhurrin in Sorghum bicolor additionally contains a gene, SbMATE2, encoding a transporter of the multidrug and toxic compound extrusion (MATE) family, which is co-expressed with the biosynthetic genes. The predicted localisation of SbMATE2 to the vacuolar membrane was demonstrated......-glucoside or the glucosinolate indol-3-yl-methyl glucosinolate. The genomic co-localisation of a transporter gene with the biosynthetic genes producing the transported compound is discussed in relation to the role self-toxicity of chemical defence compounds may play in the formation of gene clusters....

  5. The first gene in the Escherichia coli secA operon, gene X, encodes a nonessential secretory protein.

    OpenAIRE

    Rajapandi, T; Dolan, K M; Oliver, D B

    1991-01-01

    TnphoA insertions in the first gene of the Escherichia coli secA operon, gene X, were isolated and analyzed. Studies of the Gene X-PhoA fusion proteins showed that gene X encodes a secretory protein, since the fusion proteins possessed normal alkaline phosphatase activity and a substantial portion of this activity was found in the periplasm. In addition, the Gene X-PhoA fusion proteins were initially synthesized with a cleavable signal peptide. A gene X::TnphoA insertion was used to construct...

  6. Application of Gene Shaving and Mixture Models to Cluster Microarray Gene Expression Data

    Directory of Open Access Journals (Sweden)

    S. Wen

    2007-01-01

    Full Text Available Researchers are frequently faced with the analysis of microarray data of a relatively large number of genes using a small number of tissue samples. We examine the application of two statistical methods for clustering such microarray expression data: EMMIX-GENE and GeneClust. EMMIX-GENE is a mixture-model based clustering approach, designed primarily to cluster tissue samples on the basis of the genes. GeneClust is an implementation of the gene shaving methodology, motivated by research to identify distinct sets of genes for which variation in expression could be related to a biological property of the tissue samples. We illustrate the use of these two methods in the analysis of Affymetrix oligonucleotide arrays of well-known data sets from colon tissue samples with and without tumors, and of tumor tissue samples from patients with leukemia. Although the two approaches have been developed from different perspectives, the results demonstrate a clear correspondence between gene clusters produced by GeneClust and EMMIX-GENE for the colon tissue data. It is demonstrated, for the case of ribosomal proteins and smooth muscle genes in the colon data set, that both methods can classify genes into co-regulated families. It is further demonstrated that tissue types (tumor and normal can be separated on the basis of subtle distributed patterns of genes. Application to the leukemia tissue data produces a division of tissues corresponding closely to the external classification, acute myeloid leukemia (AML and acute lymphoblastic leukaemia (ALL, for both methods. In addition, we also identify genes specifi c for the subgroup of ALL-T cell samples. Overall, we find that the gene shaving method produces gene clusters at great speed; allows variable cluster sizes and can incorporate partial or full supervision; and finds clusters of genes in which the gene expression varies greatly over the tissue samples while maintaining a high level of coherence between the

  7. Multi-class clustering of cancer subtypes through SVM based ensemble of pareto-optimal solutions for gene marker identification.

    Science.gov (United States)

    Mukhopadhyay, Anirban; Bandyopadhyay, Sanghamitra; Maulik, Ujjwal

    2010-11-12

    With the advancement of microarray technology, it is now possible to study the expression profiles of thousands of genes across different experimental conditions or tissue samples simultaneously. Microarray cancer datasets, organized as samples versus genes fashion, are being used for classification of tissue samples into benign and malignant or their subtypes. They are also useful for identifying potential gene markers for each cancer subtype, which helps in successful diagnosis of particular cancer types. In this article, we have presented an unsupervised cancer classification technique based on multiobjective genetic clustering of the tissue samples. In this regard, a real-coded encoding of the cluster centers is used and cluster compactness and separation are simultaneously optimized. The resultant set of near-Pareto-optimal solutions contains a number of non-dominated solutions. A novel approach to combine the clustering information possessed by the non-dominated solutions through Support Vector Machine (SVM) classifier has been proposed. Final clustering is obtained by consensus among the clusterings yielded by different kernel functions. The performance of the proposed multiobjective clustering method has been compared with that of several other microarray clustering algorithms for three publicly available benchmark cancer datasets. Moreover, statistical significance tests have been conducted to establish the statistical superiority of the proposed clustering method. Furthermore, relevant gene markers have been identified using the clustering result produced by the proposed clustering method and demonstrated visually. Biological relationships among the gene markers are also studied based on gene ontology. The results obtained are found to be promising and can possibly have important impact in the area of unsupervised cancer classification as well as gene marker identification for multiple cancer subtypes.

  8. Genes of Bacillus cereus and Bacillus anthracis encoding proteins of the exosporium.

    Science.gov (United States)

    Todd, Sarah J; Moir, Arthur J G; Johnson, Matt J; Moir, Anne

    2003-06-01

    The exosporium is the outermost layer of spores of Bacillus cereus and its close relatives Bacillus anthracis and Bacillus thuringiensis. For these pathogens, it represents the surface layer that makes initial contact with the host. To date, only the BclA glycoprotein has been described as a component of the exosporium; this paper defines 10 more tightly associated proteins from the exosporium of B. cereus ATCC 10876, identified by N-terminal sequencing of proteins from purified, washed exosporium. Likely coding sequences were identified from the incomplete genome sequence of B. anthracis or B. cereus ATCC 14579, and the precise corresponding sequence from B. cereus ATCC 10876 was defined by PCR and sequencing. Eight genes encode likely structural components (exsB, exsC, exsD, exsE, exsF, exsG, exsJ, and cotE). Several proteins of the exosporium are related to morphogenetic and outer spore coat proteins of B. subtilis, but most do not have homologues in B. subtilis. ExsE is processed from a larger precursor, and the CotE homologue appears to have been C-terminally truncated. ExsJ contains a domain of GXX collagen-like repeats, like the BclA exosporium protein of B. anthracis. Although most of the exosporium genes are scattered on the genome, bclA and exsF are clustered in a region flanking the rhamnose biosynthesis operon; rhamnose is part of the sugar moiety of spore glycoproteins. Two enzymes, alanine racemase and nucleoside hydrolase, are tightly adsorbed to the exosporium layer; they could metabolize small molecule germinants and may reduce the sensitivity of spores to these, limiting premature germination.

  9. Comparative differential gene expression analysis of nucleus-encoded proteins for Rafflesia cantleyi against Arabidopsis thaliana

    Science.gov (United States)

    Ng, Siuk-Mun; Lee, Xin-Wei; Wan, Kiew-Lian; Firdaus-Raih, Mohd

    2015-09-01

    Regulation of functional nucleus-encoded proteins targeting the plastidial functions was comparatively studied for a plant parasite, Rafflesia cantleyi versus a photosynthetic plant, Arabidopsis thaliana. This study involved two species of different feeding modes and different developmental stages. A total of 30 nucleus-encoded proteins were found to be differentially-regulated during two stages in the parasite; whereas 17 nucleus-encoded proteins were differentially-expressed during two developmental stages in Arabidopsis thaliana. One notable finding observed for the two plants was the identification of genes involved in the regulation of photosynthesis-related processes where these processes, as expected, seem to be present only in the autotroph.

  10. A remarkably stable TipE gene cluster: evolution of insect Para sodium channel auxiliary subunits

    Directory of Open Access Journals (Sweden)

    Li Jia

    2011-11-01

    Full Text Available Abstract Background First identified in fruit flies with temperature-sensitive paralysis phenotypes, the Drosophila melanogaster TipE locus encodes four voltage-gated sodium (NaV channel auxiliary subunits. This cluster of TipE-like genes on chromosome 3L, and a fifth family member on chromosome 3R, are important for the optional expression and functionality of the Para NaV channel but appear quite distinct from auxiliary subunits in vertebrates. Here, we exploited available arthropod genomic resources to trace the origin of TipE-like genes by mapping their evolutionary histories and examining their genomic architectures. Results We identified a remarkably conserved synteny block of TipE-like orthologues with well-maintained local gene arrangements from 21 insect species. Homologues in the water flea, Daphnia pulex, suggest an ancestral pancrustacean repertoire of four TipE-like genes; a subsequent gene duplication may have generated functional redundancy allowing gene losses in the silk moth and mosquitoes. Intronic nesting of the insect TipE gene cluster probably occurred following the divergence from crustaceans, but in the flour beetle and silk moth genomes the clusters apparently escaped from nesting. Across Pancrustacea, TipE gene family members have experienced intronic nesting, escape from nesting, retrotransposition, translocation, and gene loss events while generally maintaining their local gene neighbourhoods. D. melanogaster TipE-like genes exhibit coordinated spatial and temporal regulation of expression distinct from their host gene but well-correlated with their regulatory target, the Para NaV channel, suggesting that functional constraints may preserve the TipE gene cluster. We identified homology between TipE-like NaV channel regulators and vertebrate Slo-beta auxiliary subunits of big-conductance calcium-activated potassium (BKCa channels, which suggests that ion channel regulatory partners have evolved distinct lineage

  11. Characterization of the biosynthetic gene cluster of rebeccamycin from Lechevalieria aerocolonigenes ATCC 39243.

    Science.gov (United States)

    Onaka, Hiroyasu; Taniguchi, Shin-ichi; Igarashi, Yasuhiro; Furumai, Tamotsu

    2003-01-01

    The biosynthetic gene cluster for rebeccamycin, an indolocarbazole antibiotic, from Lechevalieria aerocolonigenes ATCC 39243 has 11 ORFs. To clarify their functions, mutants with rebG, rebD, rebC, rebP, rebM, rebR, rebH, rebT, or orfD2 disrupted were constructed, and the gene products were examined. rebP disruptants produced 11,11'-dichlorochromopyrrolic acid, found to be a biosynthetic intermediate by a bioconversion experiment. Other genes encoded N-glycosyltransferase (rebG), monooxygenase (rebC), methyltransferase (rebM), a transcriptional activator (rebR), and halogenase (rebH). rebT disruptants produced rebeccamycin as much as the wild strain, so rebT was probably not involved in rebeccamycin production. Biosynthetic genes of staurosporine, an another indolocarbazole antibiotic, were cloned from Streptomyces sp. TP-A0274. staO, staD, and staP were similar to rebO, rebD, and rebP, respectively, all of which are responsible for indolocarbazole biosynthesis, But a rebC homolog, encoding a putative enzyme oxidizing the C-7 site of pyrrole rings, was not found in the staurosporine biosynthetic gene cluster. These results suggest that indolocarbazole is constructed by oxidative decarboxylation of chromopyrrolic acid (11,11'-dichlorochromopyrrolic acid in rebeccamycin) generated from two molecules of tryptophan by coupling and that the oxidation state at the C-7 position depends on the additional enzyme(s) encoded by the biosynthetic genes.

  12. The evolution of genes encoding for green fluorescent proteins: insights from cephalochordates (amphioxus)

    Science.gov (United States)

    Yue, Jia-Xing; Holland, Nicholas D.; Holland, Linda Z.; Deheyn, Dimitri D.

    2016-06-01

    Green Fluorescent Protein (GFP) was originally found in cnidarians, and later in copepods and cephalochordates (amphioxus) (Branchiostoma spp). Here, we looked for GFP-encoding genes in Asymmetron, an early-diverged cephalochordate lineage, and found two such genes closely related to some of the Branchiostoma GFPs. Dim fluorescence was found throughout the body in adults of Asymmetron lucayanum, and, as in Branchiostoma floridae, was especially intense in the ripe ovaries. Spectra of the fluorescence were similar between Asymmetron and Branchiostoma. Lineage-specific expansion of GFP-encoding genes in the genus Branchiostoma was observed, largely driven by tandem duplications. Despite such expansion, purifying selection has strongly shaped the evolution of GFP-encoding genes in cephalochordates, with apparent relaxation for highly duplicated clades. All cephalochordate GFP-encoding genes are quite different from those of copepods and cnidarians. Thus, the ancestral cephalochordates probably had GFP, but since GFP appears to be lacking in more early-diverged deuterostomes (echinoderms, hemichordates), it is uncertain whether the ancestral cephalochordates (i.e. the common ancestor of Asymmetron and Branchiostoma) acquired GFP by horizontal gene transfer (HGT) from copepods or cnidarians or inherited it from the common ancestor of copepods and deuterostomes, i.e. the ancestral bilaterians.

  13. A neurotransmitter transporter encoded by the Drosophila inebriated gene

    Science.gov (United States)

    Soehnge, Holly; Huang, Xi; Becker, Marie; Whitley, Penn; Conover, Diana; Stern, Michael

    1996-01-01

    Behavioral and electrophysiological studies on mutants defective in the Drosophila inebriated (ine) gene demonstrated increased excitability of the motor neuron. In this paper, we describe the cloning and sequence analysis of ine. Mutations in ine were localized on cloned DNA by restriction mapping and restriction fragment length polymorphism (RFLP) mapping of ine mutants. DNA from the ine region was then used to isolate an ine cDNA. In situ hybridization of ine transcripts to developing embryos revealed expression of this gene in several cell types, including the posterior hindgut, Malpighian tubules, anal plate, garland cells, and a subset of cells in the central nervous system. The ine cDNA contains an open reading frame of 658 amino acids with a high degree of sequence similarity to members of the Na+/Cl−-dependent neurotransmitter transporter family. Members of this family catalyze the rapid reuptake of neurotransmitters released into the synapse and thereby play key roles in controlling neuronal function. We conclude that ine mutations cause increased excitability of the Drosophila motor neuron by causing the defective reuptake of the substrate neurotransmitter of the ine transporter and thus overstimulation of the motor neuron by this neurotransmitter. From this observation comes a unique opportunity to perform a genetic dissection of the regulation of excitability of the Drosophila motor neuron. PMID:8917579

  14. Transient receptor potential (TRP gene superfamily encoding cation channels

    Directory of Open Access Journals (Sweden)

    Pan Zan

    2011-01-01

    Full Text Available Abstract Transient receptor potential (TRP non-selective cation channels constitute a superfamily, which contains 28 different genes. In mammals, this superfamily is divided into six subfamilies based on differences in amino acid sequence homology between the different gene products. Proteins within a subfamily aggregate to form heteromeric or homomeric tetrameric configurations. These different groupings have very variable permeability ratios for calcium versus sodium ions. TRP expression is widely distributed in neuronal tissues, as well as a host of other tissues, including epithelial and endothelial cells. They are activated by environmental stresses that include tissue injury, changes in temperature, pH and osmolarity, as well as volatile chemicals, cytokines and plant compounds. Their activation induces, via intracellular calcium signalling, a host of responses, including stimulation of cell proliferation, migration, regulatory volume behaviour and the release of a host of cytokines. Their activation is greatly potentiated by phospholipase C (PLC activation mediated by coupled GTP-binding proteins and tyrosine receptors. In addition to their importance in maintaining tissue homeostasis, some of these responses may involve various underlying diseases. Given the wealth of literature describing the multiple roles of TRP in physiology in a very wide range of different mammalian tissues, this review limits itself to the literature describing the multiple roles of TRP channels in different ocular tissues. Accordingly, their importance to the corneal, trabecular meshwork, lens, ciliary muscle, retinal, microglial and retinal pigment epithelial physiology and pathology is reviewed.

  15. Fasciola hepatica mucin-encoding gene: expression, variability and its potential relevance in host-parasite relationship.

    Science.gov (United States)

    Cancela, Martín; Santos, Guilherme B; Carmona, Carlos; Ferreira, Henrique B; Tort, José Francisco; Zaha, Arnaldo

    2015-12-01

    Fasciola hepatica is the causative agent of fasciolosis, a zoonosis with significant impact both in human and animal health. Understanding the basic processes of parasite biology, especially those related to interactions with its host, will contribute to control F. hepatica infections and hence liver pathology. Mucins have been described as important mediators for parasite establishment within its host, due to their key roles in immune evasion. In F. hepatica, mucin expression is upregulated in the mammalian invasive newly excysted juvenile (NEJ) stage in comparison with the adult stage. Here, we performed sequencing of mucin cDNAs prepared from NEJ RNA, resulting in six different cDNAs clusters. The differences are due to the presence of a tandem repeated sequence of 66 bp encoded by different exons. Two groups of apomucins one with three and the other with four repeats, with 459 and 393 bp respectively, were identified. These cDNAs have open reading frames encoding Ser-Thr enriched proteins with an N-terminal signal peptide, characteristic of apomucin backbone. We cloned a 4470 bp gene comprising eight exons and seven introns that encodes all the cDNA variants identified in NEJs. By real time polymerase chain reaction and high-resolution melting approaches of individual flukes we infer that fhemuc-1 is a single-copy gene, with at least two different alleles. Our data suggest that both gene polymorphism and alternative splicing might account for apomucin variability in the fhemuc-1 gene that is upregulated in NEJ invasive stage. The relevance of this variation in host-parasite interplay is discussed.

  16. Identification of nitrogen-fixing genes and gene clusters from metagenomic library of acid mine drainage.

    Directory of Open Access Journals (Sweden)

    Zhimin Dai

    Full Text Available Biological nitrogen fixation is an essential function of acid mine drainage (AMD microbial communities. However, most acidophiles in AMD environments are uncultured microorganisms and little is known about the diversity of nitrogen-fixing genes and structure of nif gene cluster in AMD microbial communities. In this study, we used metagenomic sequencing to isolate nif genes in the AMD microbial community from Dexing Copper Mine, China. Meanwhile, a metagenome microarray containing 7,776 large-insertion fosmids was constructed to screen novel nif gene clusters. Metagenomic analyses revealed that 742 sequences were identified as nif genes including structural subunit genes nifH, nifD, nifK and various additional genes. The AMD community is massively dominated by the genus Acidithiobacillus. However, the phylogenetic diversity of nitrogen-fixing microorganisms is much higher than previously thought in the AMD community. Furthermore, a 32.5-kb genomic sequence harboring nif, fix and associated genes was screened by metagenome microarray. Comparative genome analysis indicated that most nif genes in this cluster are most similar to those of Herbaspirillum seropedicae, but the organization of the nif gene cluster had significant differences from H. seropedicae. Sequence analysis and reverse transcription PCR also suggested that distinct transcription units of nif genes exist in this gene cluster. nifQ gene falls into the same transcription unit with fixABCX genes, which have not been reported in other diazotrophs before. All of these results indicated that more novel diazotrophs survive in the AMD community.

  17. Identification and functional analysis of gene cluster involvement in biosynthesis of the cyclic lipopeptide antibiotic pelgipeptin produced by Paenibacillus elgii

    Directory of Open Access Journals (Sweden)

    Qian Chao-Dong

    2012-09-01

    Full Text Available Abstract Background Pelgipeptin, a potent antibacterial and antifungal agent, is a non-ribosomally synthesised lipopeptide antibiotic. This compound consists of a β-hydroxy fatty acid and nine amino acids. To date, there is no information about its biosynthetic pathway. Results A potential pelgipeptin synthetase gene cluster (plp was identified from Paenibacillus elgii B69 through genome analysis. The gene cluster spans 40.8 kb with eight open reading frames. Among the genes in this cluster, three large genes, plpD, plpE, and plpF, were shown to encode non-ribosomal peptide synthetases (NRPSs, with one, seven, and one module(s, respectively. Bioinformatic analysis of the substrate specificity of all nine adenylation domains indicated that the sequence of the NRPS modules is well collinear with the order of amino acids in pelgipeptin. Additional biochemical analysis of four recombinant adenylation domains (PlpD A1, PlpE A1, PlpE A3, and PlpF A1 provided further evidence that the plp gene cluster involved in pelgipeptin biosynthesis. Conclusions In this study, a gene cluster (plp responsible for the biosynthesis of pelgipeptin was identified from the genome sequence of Paenibacillus elgii B69. The identification of the plp gene cluster provides an opportunity to develop novel lipopeptide antibiotics by genetic engineering.

  18. Genes encoding calmodulin-binding proteins in the Arabidopsis genome

    Science.gov (United States)

    Reddy, Vaka S.; Ali, Gul S.; Reddy, Anireddy S N.

    2002-01-01

    Analysis of the recently completed Arabidopsis genome sequence indicates that approximately 31% of the predicted genes could not be assigned to functional categories, as they do not show any sequence similarity with proteins of known function from other organisms. Calmodulin (CaM), a ubiquitous and multifunctional Ca(2+) sensor, interacts with a wide variety of cellular proteins and modulates their activity/function in regulating diverse cellular processes. However, the primary amino acid sequence of the CaM-binding domain in different CaM-binding proteins (CBPs) is not conserved. One way to identify most of the CBPs in the Arabidopsis genome is by protein-protein interaction-based screening of expression libraries with CaM. Here, using a mixture of radiolabeled CaM isoforms from Arabidopsis, we screened several expression libraries prepared from flower meristem, seedlings, or tissues treated with hormones, an elicitor, or a pathogen. Sequence analysis of 77 positive clones that interact with CaM in a Ca(2+)-dependent manner revealed 20 CBPs, including 14 previously unknown CBPs. In addition, by searching the Arabidopsis genome sequence with the newly identified and known plant or animal CBPs, we identified a total of 27 CBPs. Among these, 16 CBPs are represented by families with 2-20 members in each family. Gene expression analysis revealed that CBPs and CBP paralogs are expressed differentially. Our data suggest that Arabidopsis has a large number of CBPs including several plant-specific ones. Although CaM is highly conserved between plants and animals, only a few CBPs are common to both plants and animals. Analysis of Arabidopsis CBPs revealed the presence of a variety of interesting domains. Our analyses identified several hypothetical proteins in the Arabidopsis genome as CaM targets, suggesting their involvement in Ca(2+)-mediated signaling networks.

  19. Gene cluster analysis for the biosynthesis of elgicins, novel lantibiotics produced by paenibacillus elgii B69

    Directory of Open Access Journals (Sweden)

    Teng Yi

    2012-03-01

    Full Text Available Abstract Background The recent increase in bacterial resistance to antibiotics has promoted the exploration of novel antibacterial materials. As a result, many researchers are undertaking work to identify new lantibiotics because of their potent antimicrobial activities. The objective of this study was to provide details of a lantibiotic-like gene cluster in Paenibacillus elgii B69 and to produce the antibacterial substances coded by this gene cluster based on culture screening. Results Analysis of the P. elgii B69 genome sequence revealed the presence of a lantibiotic-like gene cluster composed of five open reading frames (elgT1, elgC, elgT2, elgB, and elgA. Screening of culture extracts for active substances possessing the predicted properties of the encoded product led to the isolation of four novel peptides (elgicins AI, AII, B, and C with a broad inhibitory spectrum. The molecular weights of these peptides were 4536, 4593, 4706, and 4820 Da, respectively. The N-terminal sequence of elgicin B was Leu-Gly-Asp-Tyr, which corresponded to the partial sequence of the peptide ElgA encoded by elgA. Edman degradation suggested that the product elgicin B is derived from ElgA. By correlating the results of electrospray ionization-mass spectrometry analyses of elgicins AI, AII, and C, these peptides are deduced to have originated from the same precursor, ElgA. Conclusions A novel lantibiotic-like gene cluster was shown to be present in P. elgii B69. Four new lantibiotics with a broad inhibitory spectrum were isolated, and these appear to be promising antibacterial agents.

  20. Characterization of the FKBP12-Encoding Genes in Aspergillus fumigatus.

    Directory of Open Access Journals (Sweden)

    Katie Falloon

    Full Text Available Invasive aspergillosis, largely caused by Aspergillus fumigatus, is responsible for a growing number of deaths among immunosuppressed patients. Immunosuppressants such as FK506 (tacrolimus that target calcineurin have shown promise for antifungal drug development. FK506-binding proteins (FKBPs form a complex with calcineurin in the presence of FK506 (FKBP12-FK506 and inhibit calcineurin activity. Research on FKBPs in fungi is limited, and none of the FKBPs have been previously characterized in A. fumigatus. We identified four orthologous genes of FKBP12, the human FK506 binding partner, in A. fumigatus and designated them fkbp12-1, fkbp12-2, fkbp12-3, and fkbp12-4. Deletional analysis of the four genes revealed that the Δfkbp12-1 strain was resistant to FK506, indicating FKBP12-1 as the key mediator of FK506-binding to calcineurin. The endogenously expressed FKBP12-1-EGFP fusion protein localized to the cytoplasm and nuclei under normal growth conditions but also to the hyphal septa following FK506 treatment, revealing its interaction with calcineurin. The FKBP12-1-EGFP fusion protein didn't localize at the septa in the presence of FK506 in the cnaA deletion background, confirming its interaction with calcineurin. Testing of all deletion strains in the Galleria mellonella model of aspergillosis suggested that these proteins don't play an important role in virulence. While the Δfkbp12-2 and Δfkbp12-3 strains didn't show any discernable phenotype, the Δfkbp12-4 strain displayed slight growth defect under normal growth conditions and inhibition of the caspofungin-mediated "paradoxical growth effect" at higher concentrations of the antifungal caspofungin. Together, these results indicate that while only FKBP12-1 is the bona fide binding partner of FK506, leading to the inhibition of calcineurin in A. fumigatus, FKBP12-4 may play a role in basal growth and the caspofungin-mediated paradoxical growth response. Exploitation of differences between A

  1. PREVALENCE OF TOXIN ENCODING GENES IN ESCHERICHIACOLI ISOLATES FROM URINARY TRACT INFECTIONS INSLOVENIA

    Directory of Open Access Journals (Sweden)

    Marjanca Starčič-Erjavec

    2008-06-01

    Full Text Available Methods 110 uropathogenic Escherichia coli strains (UPEC obtained from the Institute of Microbiology and Immunology of the Medical Faculty in Ljubljana were screened by PCR withprimers specific for the following toxin encoding genes: hlyA (haemolysin, cnf1 (cytotoxicnecrotising factor 1, usp (uropathogenic specific protein USP and ibeA (invasin. Dotblot hybridisation experiments were performed to validate the PCR assays.Results In 44% of the strains usp gene sequences were detected. The prevalence of hlyA and cnf1was 25% and 23%, respectively. Only 9% of the strains harbored ibeA. The majority of thetested toxin encoding genes was found in strains belonging to the B2 phylogenetic group.Conclusions The toxin encoding genes hlyA, cnf1 and usp were strongly co-associated. Further, we founda statistically significant co-association of ibeA and usp. The prevalence of the testedtoxin encoding genes in E. coli strains from urinary tract infections isolated in Slovenia iscomparable to those from studies in other geographic regions.

  2. antiSMASH 3.0—a comprehensive resource for the genome mining of biosynthetic gene clusters

    DEFF Research Database (Denmark)

    Weber, Tilmann; Blin, Kai; Duddela, Srikanth

    2015-01-01

    Microbial secondary metabolism constitutes a rich source of antibiotics, chemotherapeutics, insecticides and other high-value chemicals. Genome mining of gene clusters that encode the biosynthetic pathways for these metabolites has become a key methodology for novel compound discovery. In 2011, we...... introduced antiSMASH, a web server and stand-alone tool for the automatic genomic identification and analysis of biosynthetic gene clusters, available at http://antismash.secondarymetabolites.org. Here, we present version 3.0 of antiSMASH, which has undergone major improvements. A full integration...

  3. Effects of variations in the APOA1/C3/A4/A5 gene cluster on different parameters of postprandial lipid metabolism in healthy young men

    Science.gov (United States)

    Background: The APOA1/C3/A4/A5 gene cluster encodes important regulators of fasting lipids, but the majority of lipid metabolism takes place in the postprandial state, and knowledge about gene regulation in this state is scarce. With the aim of characterizing possible regulators of lipid metabolism...

  4. LEA (Late Embryogenesis Abundant proteins and their encoding genes in Arabidopsis thaliana

    Directory of Open Access Journals (Sweden)

    Hincha Dirk K

    2008-03-01

    Full Text Available Abstract Background LEA (late embryogenesis abundant proteins have first been described about 25 years ago as accumulating late in plant seed development. They were later found in vegetative plant tissues following environmental stress and also in desiccation tolerant bacteria and invertebrates. Although they are widely assumed to play crucial roles in cellular dehydration tolerance, their physiological and biochemical functions are largely unknown. Results We present a genome-wide analysis of LEA proteins and their encoding genes in Arabidopsis thaliana. We identified 51 LEA protein encoding genes in the Arabidopsis genome that could be classified into nine distinct groups. Expression studies were performed on all genes at different developmental stages, in different plant organs and under different stress and hormone treatments using quantitative RT-PCR. We found evidence of expression for all 51 genes. There was only little overlap between genes expressed in vegetative tissues and in seeds and expression levels were generally higher in seeds. Most genes encoding LEA proteins had abscisic acid response (ABRE and/or low temperature response (LTRE elements in their promoters and many genes containing the respective promoter elements were induced by abscisic acid, cold or drought. We also found that 33% of all Arabidopsis LEA protein encoding genes are arranged in tandem repeats and that 43% are part of homeologous pairs. The majority of LEA proteins were predicted to be highly hydrophilic and natively unstructured, but some were predicted to be folded. Conclusion The analyses indicate a wide range of sequence diversity, intracellular localizations, and expression patterns. The high fraction of retained duplicate genes and the inferred functional diversification indicate that they confer an evolutionary advantage for an organism under varying stressful environmental conditions. This comprehensive analysis will be an important starting point for

  5. Genetic variants in nuclear-encoded mitochondrial genes influence AIDS progression.

    Directory of Open Access Journals (Sweden)

    Sher L Hendrickson

    2010-09-01

    Full Text Available The human mitochondrial genome includes only 13 coding genes while nuclear-encoded genes account for 99% of proteins responsible for mitochondrial morphology, redox regulation, and energetics. Mitochondrial pathogenesis occurs in HIV patients and genetically, mitochondrial DNA haplogroups with presumed functional differences have been associated with differential AIDS progression.Here we explore whether single nucleotide polymorphisms (SNPs within 904 of the estimated 1,500 genes that specify nuclear-encoded mitochondrial proteins (NEMPs influence AIDS progression among HIV-1 infected patients. We examined NEMPs for association with the rate of AIDS progression using genotypes generated by an Affymetrix 6.0 genotyping array of 1,455 European American patients from five US AIDS cohorts. Successfully genotyped SNPs gave 50% or better haplotype coverage for 679 of known NEMP genes. With a Bonferroni adjustment for the number of genes and tests examined, multiple SNPs within two NEMP genes showed significant association with AIDS progression: acyl-CoA synthetase medium-chain family member 4 (ACSM4 on chromosome 12 and peroxisomal D3,D2-enoyl-CoA isomerase (PECI on chromosome 6.Our previous studies on mitochondrial DNA showed that European haplogroups with presumed functional differences were associated with AIDS progression and HAART mediated adverse events. The modest influences of nuclear-encoded mitochondrial genes found in the current study add support to the idea that mitochondrial function plays a role in AIDS pathogenesis.

  6. Calcitonin gene-related peptide antagonism and cluster headache

    DEFF Research Database (Denmark)

    Ashina, Håkan; Newman, Lawrence; Ashina, Sait

    2017-01-01

    Calcitonin gene-related peptide (CGRP) is a key signaling molecule involved in migraine pathophysiology. Efficacy of CGRP monoclonal antibodies and antagonists in migraine treatment has fueled an increasing interest in the prospect of treating cluster headache (CH) with CGRP antagonism. The exact...... role of CGRP and its mechanism of action in CH have not been fully clarified. A search for original studies and randomized controlled trials (RCTs) published in English was performed in PubMed and in ClinicalTrials.gov . The search term used was "cluster headache and calcitonin gene related peptide......" and "primary headaches and calcitonin gene related peptide." Reference lists of identified articles were also searched for additional relevant papers. Human experimental studies have reported elevated plasma CGRP levels during both spontaneous and glyceryl trinitrate-induced cluster attacks. CGRP may play...

  7. A Gene Selection Method for Microarray Data Based on Binary PSO Encoding Gene-to-Class Sensitivity Information.

    Science.gov (United States)

    Han, Fei; Yang, Chun; Wu, Ya-Qi; Zhu, Jian-Sheng; Ling, Qing-Hua; Song, Yu-Qing; Huang, De-Shuang

    2017-01-01

    Traditional gene selection methods for microarray data mainly considered the features' relevance by evaluating their utility for achieving accurate predication or exploiting data variance and distribution, and the selected genes were usually poorly explicable. To improve the interpretability of the selected genes as well as prediction accuracy, an improved gene selection method based on binary particle swarm optimization (BPSO) and prior information is proposed in this paper. In the proposed method, BPSO encoding gene-to-class sensitivity (GCS) information is used to perform gene selection. The gene-to-class sensitivity information, extracted from the samples by extreme learning machine (ELM), is encoded into the selection process in four aspects: initializing particles, updating the particles, modifying maximum velocity, and adopting mutation operation adaptively. Constrained by the gene-to-class sensitivity information, the new method can select functional gene subsets which are significantly sensitive to the samples' classes. With the few discriminative genes selected by the proposed method, ELM, K-nearest neighbor and support vector machine classifiers achieve much high prediction accuracy on five public microarray data, which in turn verifies the efficiency and effectiveness of the proposed gene selection method.

  8. The N‐acetylglucosamine catabolic gene cluster in Trichoderma reesei is controlled by the Ndt80‐like transcription factor RON1

    Science.gov (United States)

    Kappel, Lisa; Gaderer, Romana; Flipphi, Michel

    2015-01-01

    Summary Chitin is an important structural constituent of fungal cell walls composed of N‐acetylglucosamine (GlcNAc) monosaccharides, but catabolism of GlcNAc has not been studied in filamentous fungi so far. In the yeast C andida albicans, the genes encoding the three enzymes responsible for stepwise conversion of GlcNAc to fructose‐6‐phosphate are clustered. In this work, we analysed GlcNAc catabolism in ascomycete filamentous fungi and found that the respective genes are also clustered in these fungi. In contrast to C . albicans, the cluster often contains a gene for an Ndt80‐like transcription factor, which we named RON1 (regulator of N‐acetylglucosamine catabolism 1). Further, a gene for a glycoside hydrolase 3 protein related to bacterial N‐acetylglucosaminidases can be found in the GlcNAc gene cluster in filamentous fungi. Functional analysis in T richoderma reesei showed that the transcription factor RON1 is a key activator of the GlcNAc gene cluster and essential for GlcNAc catabolism. Furthermore, we present an evolutionary analysis of Ndt80‐like proteins in Ascomycota. All GlcNAc cluster genes, as well as the GlcNAc transporter gene ngt1, and an additional transcriptional regulator gene, csp2, encoding the homolog of N eurospora crassa  CSP2/GRHL, were functionally characterised by gene expression analysis and phenotypic characterisation of knockout strains in T . reesei. PMID:26481444

  9. DNA methylation status of nuclear-encoded mitochondrial genes underlies the tissue-dependent mitochondrial functions

    Directory of Open Access Journals (Sweden)

    Takasugi Masaki

    2010-08-01

    Full Text Available Abstract Background Mitochondria are semi-autonomous, semi-self-replicating organelles harboring their own DNA (mitochondrial DNA, mtDNA, and their dysregulation is involved in the development of various diseases. While mtDNA does not generally undergo epigenetic modifications, almost all mitochondrial proteins are encoded by nuclear DNA. However, the epigenetic regulation of nuclear-encoded mitochondrial genes (nuclear mt genes has not been comprehensively analyzed. Results We analyzed the DNA methylation status of 899 nuclear mt genes in the liver, brain, and heart tissues of mouse, and identified 636 nuclear mt genes carrying tissue-dependent and differentially methylated regions (T-DMRs. These nuclar mt genes are involved in various mitochondrial functions and they also include genes related to human diseases. T-DMRs regulate the expression of nuclear mt genes. Nuclear mt genes with tissue-specific hypomethylated T-DMRs were characterized by enrichment of the target genes of specific transcription factors such as FOXA2 in the liver, and CEBPA and STAT1 in the brain. Conclusions A substantial proportion of nuclear mt genes contained T-DMRs, and the DNA methylation status of numerous T-DMRs should underlie tissue-dependent mitochondrial functions.

  10. Plasmid Complement of Lactococcus lactis NCDO712 Reveals a Novel Pilus Gene Cluster.

    Science.gov (United States)

    Tarazanova, Mariya; Beerthuyzen, Marke; Siezen, Roland; Fernandez-Gutierrez, Marcela M; de Jong, Anne; van der Meulen, Sjoerd; Kok, Jan; Bachmann, Herwig

    2016-01-01

    Lactococcus lactis MG1363 is an important gram-positive model organism. It is a plasmid-free and phage-cured derivative of strain NCDO712. Plasmid-cured strains facilitate studies on molecular biological aspects, but many properties which make L. lactis an important organism in the dairy industry are plasmid encoded. We sequenced the total DNA of strain NCDO712 and, contrary to earlier reports, revealed that the strain carries 6 rather than 5 plasmids. A new 50-kb plasmid, designated pNZ712, encodes functional nisin immunity (nisCIP) and copper resistance (lcoRSABC). The copper resistance could be used as a marker for the conjugation of pNZ712 to L. lactis MG1614. A genome comparison with the plasmid cured daughter strain MG1363 showed that the number of single nucleotide polymorphisms that accumulated in the laboratory since the strains diverted more than 30 years ago is limited to 11 of which only 5 lead to amino acid changes. The 16-kb plasmid pSH74 was found to contain a novel 8-kb pilus gene cluster spaCB-spaA-srtC1-srtC2, which is predicted to encode a pilin tip protein SpaC, a pilus basal subunit SpaB, and a pilus backbone protein SpaA. The sortases SrtC1/SrtC2 are most likely involved in pilus polymerization while the chromosomally encoded SrtA could act to anchor the pilus to peptidoglycan in the cell wall. Overexpression of the pilus gene cluster from a multi-copy plasmid in L. lactis MG1363 resulted in cell chaining, aggregation, rapid sedimentation and increased conjugation efficiency of the cells. Electron microscopy showed that the over-expression of the pilus gene cluster leads to appendices on the cell surfaces. A deletion of the gene encoding the putative basal protein spaB, by truncating spaCB, led to more pilus-like structures on the cell surface, but cell aggregation and cell chaining were no longer observed. This is consistent with the prediction that spaB is involved in the anchoring of the pili to the cell.

  11. The gene encoding topoisomerase I from the human malaria parasite Plasmodium falciparum.

    Science.gov (United States)

    Tosh, K; Kilbey, B

    1995-09-22

    Part of the topoisomerase I (TopoI)-encoding gene from Plasmodium falciparum (Pf) was isolated by PCR from cDNA using oligodeoxyribonucleotides modelled on the highly conserved regions of sequence from other species. The entire TopoI gene was obtained by screening a Pf K1 HindIII-EcoRI genomic library in lambda NM1149 with a random-labeled heterologous probe from the Saccharomyces cerevisiae TopoI gene. DNA sequence analysis revealed an open reading frame of 2520 nt encoding a deduced protein of 839 amino acids (aa) with no detectable introns. The Pf TopoI aa sequence has about 40% identity with most eukaryotic TopoI homologues. The gene is located as a single copy on chromosome 5 and Northern analysis identified a transcript of 3.8 kb.

  12. The N?acetylglucosamine catabolic gene cluster in Trichoderma reesei is controlled by the Ndt80?like transcription factor RON1

    OpenAIRE

    Kappel, Lisa; Gaderer, Romana; Flipphi, Michel; Seidl?Seiboth, Verena

    2015-01-01

    Summary Chitin is an important structural constituent of fungal cell walls composed of N ?acetylglucosamine (GlcNAc) monosaccharides, but catabolism of GlcNAc has not been studied in filamentous fungi so far. In the yeast C andida albicans, the genes encoding the three enzymes responsible for stepwise conversion of GlcNAc to fructose?6?phosphate are clustered. In this work, we analysed GlcNAc catabolism in ascomycete filamentous fungi and found that the respective genes are also clustered in ...

  13. TMC and EVER genes belong to a larger novel family, the TMC gene family encoding transmembrane proteins

    Directory of Open Access Journals (Sweden)

    Mutai Hideki

    2003-06-01

    Full Text Available Abstract Background Mutations in the transmembrane cochlear expressed gene 1 (TMC1 cause deafness in human and mouse. Mutations in two homologous genes, EVER1 and EVER2 increase the susceptibility to infection with certain human papillomaviruses resulting in high risk of skin carcinoma. Here we report that TMC1, EVER1 and EVER2 (now TMC6 and TMC8 belong to a larger novel gene family, which is named TMC for trans membrane channel-like gene family. Results Using a combination of iterative database searches and reverse transcriptase-polymerase chain reaction (RT-PCR experiments we assembled contigs for cDNA encoding human, murine, puffer fish, and invertebrate TMC proteins. TMC proteins of individual species can be grouped into three subfamilies A, B, and C. Vertebrates have eight TMC genes. The majority of murine TMC transcripts are expressed in most organs; some transcripts, however, in particular the three subfamily A members are rare and more restrictively expressed. Conclusion The eight vertebrate TMC genes are evolutionary conserved and encode proteins that form three subfamilies. Invertebrate TMC proteins can also be categorized into these three subfamilies. All TMC genes encode transmembrane proteins with intracellular amino- and carboxyl-termini and at least eight membrane-spanning domains. We speculate that the TMC proteins constitute a novel group of ion channels, transporters, or modifiers of such.

  14. Global expression analysis of nucleotide binding site-leucine rich repeat-encoding and related genes in Arabidopsis

    Science.gov (United States)

    Tan, Xiaoping; Meyers, Blake C; Kozik, Alexander; West, Marilyn AL; Morgante, Michele; St Clair, Dina A; Bent, Andrew F; Michelmore, Richard W

    2007-01-01

    Background Nucleotide binding site-leucine rich repeat (NBS-LRR)-encoding genes comprise the largest class of plant disease resistance genes. The 149 NBS-LRR-encoding genes and the 58 related genes that do not encode LRRs represent approximately 0.8% of all ORFs so far annotated in Arabidopsis ecotype Col-0. Despite their prevalence in the genome and functional importance, there was little information regarding expression of these genes. Results We analyzed the expression patterns of ~170 NBS-LRR-encoding and related genes in Arabidopsis Col-0 using multiple analytical approaches: expressed sequenced tag (EST) representation, massively parallel signature sequencing (MPSS), microarray analysis, rapid amplification of cDNA ends (RACE) PCR, and gene trap lines. Most of these genes were expressed at low levels with a variety of tissue specificities. Expression was detected by at least one approach for all but 10 of these genes. The expression of some but not the majority of NBS-LRR-encoding and related genes was affected by salicylic acid (SA) treatment; the response to SA varied among different accessions. An analysis of previously published microarray data indicated that ten NBS-LRR-encoding and related genes exhibited increased expression in wild-type Landsberg erecta (Ler) after flagellin treatment. Several of these ten genes also showed altered expression after SA treatment, consistent with the regulation of R gene expression during defense responses and overlap between the basal defense response and salicylic acid signaling pathways. Enhancer trap analysis indicated that neither jasmonic acid nor benzothiadiazole (BTH), a salicylic acid analog, induced detectable expression of the five NBS-LRR-encoding genes and one TIR-NBS-encoding gene tested; however, BTH did induce detectable expression of the other TIR-NBS-encoding gene analyzed. Evidence for alternative mRNA polyadenylation sites was observed for many of the tested genes. Evidence for alternative splicing

  15. Global expression analysis of nucleotide binding site-leucine rich repeat-encoding and related genes in Arabidopsis

    Directory of Open Access Journals (Sweden)

    St Clair Dina A

    2007-10-01

    Full Text Available Abstract Background Nucleotide binding site-leucine rich repeat (NBS-LRR-encoding genes comprise the largest class of plant disease resistance genes. The 149 NBS-LRR-encoding genes and the 58 related genes that do not encode LRRs represent approximately 0.8% of all ORFs so far annotated in Arabidopsis ecotype Col-0. Despite their prevalence in the genome and functional importance, there was little information regarding expression of these genes. Results We analyzed the expression patterns of ~170 NBS-LRR-encoding and related genes in Arabidopsis Col-0 using multiple analytical approaches: expressed sequenced tag (EST representation, massively parallel signature sequencing (MPSS, microarray analysis, rapid amplification of cDNA ends (RACE PCR, and gene trap lines. Most of these genes were expressed at low levels with a variety of tissue specificities. Expression was detected by at least one approach for all but 10 of these genes. The expression of some but not the majority of NBS-LRR-encoding and related genes was affected by salicylic acid (SA treatment; the response to SA varied among different accessions. An analysis of previously published microarray data indicated that ten NBS-LRR-encoding and related genes exhibited increased expression in wild-type Landsberg erecta (Ler after flagellin treatment. Several of these ten genes also showed altered expression after SA treatment, consistent with the regulation of R gene expression during defense responses and overlap between the basal defense response and salicylic acid signaling pathways. Enhancer trap analysis indicated that neither jasmonic acid nor benzothiadiazole (BTH, a salicylic acid analog, induced detectable expression of the five NBS-LRR-encoding genes and one TIR-NBS-encoding gene tested; however, BTH did induce detectable expression of the other TIR-NBS-encoding gene analyzed. Evidence for alternative mRNA polyadenylation sites was observed for many of the tested genes. Evidence for

  16. Global expression analysis of nucleotide binding site-leucine rich repeat-encoding and related genes in Arabidopsis.

    Science.gov (United States)

    Tan, Xiaoping; Meyers, Blake C; Kozik, Alexander; West, Marilyn A L; Morgante, Michele; St Clair, Dina A; Bent, Andrew F; Michelmore, Richard W

    2007-10-23

    Nucleotide binding site-leucine rich repeat (NBS-LRR)-encoding genes comprise the largest class of plant disease resistance genes. The 149 NBS-LRR-encoding genes and the 58 related genes that do not encode LRRs represent approximately 0.8% of all ORFs so far annotated in Arabidopsis ecotype Col-0. Despite their prevalence in the genome and functional importance, there was little information regarding expression of these genes. We analyzed the expression patterns of approximately 170 NBS-LRR-encoding and related genes in Arabidopsis Col-0 using multiple analytical approaches: expressed sequenced tag (EST) representation, massively parallel signature sequencing (MPSS), microarray analysis, rapid amplification of cDNA ends (RACE) PCR, and gene trap lines. Most of these genes were expressed at low levels with a variety of tissue specificities. Expression was detected by at least one approach for all but 10 of these genes. The expression of some but not the majority of NBS-LRR-encoding and related genes was affected by salicylic acid (SA) treatment; the response to SA varied among different accessions. An analysis of previously published microarray data indicated that ten NBS-LRR-encoding and related genes exhibited increased expression in wild-type Landsberg erecta (Ler) after flagellin treatment. Several of these ten genes also showed altered expression after SA treatment, consistent with the regulation of R gene expression during defense responses and overlap between the basal defense response and salicylic acid signaling pathways. Enhancer trap analysis indicated that neither jasmonic acid nor benzothiadiazole (BTH), a salicylic acid analog, induced detectable expression of the five NBS-LRR-encoding genes and one TIR-NBS-encoding gene tested; however, BTH did induce detectable expression of the other TIR-NBS-encoding gene analyzed. Evidence for alternative mRNA polyadenylation sites was observed for many of the tested genes. Evidence for alternative splicing was

  17. Ty3 GAG3 and POL3 genes encode the components of intracellular particles.

    OpenAIRE

    Hansen, L J; Chalker, D L; Orlinsky, K J; Sandmeyer, S B

    1992-01-01

    Ty3 is a Saccharomyces cerevisiae retrotransposon that integrates near the transcription initiation sites of polymerase III-transcribed genes. It is distinct from the copialike Ty1 and Ty2 retrotransposons of S. cerevisiae in both the sequences of encoded proteins and gene order. It is a member of the gypsylike family of retrotransposons which resemble animal retroviruses. This study was undertaken to investigate the nucleocapsid particle of a transpositionally active gypsylike retrotransposo...

  18. New Integron-Associated Gene Cassette Encoding a 3-N-Aminoglycoside Acetyltransferase

    OpenAIRE

    Levings, Renee S.; Partridge, Sally R.; Lightfoot, Diane; Hall, Ruth M.; Djordjevic, Steven P.

    2005-01-01

    A fifth gene cassette containing an aacC gene, aacCA5, was found in an aacCA5-aadA7 cassette array in a class 1 integron isolated from a multiply drug resistant Salmonella enterica serovar Kentucky strain. The AacC-A5 or AAC(3)-Ie acetyltransferase encoded by aacCA5 is related to other AAC(3)-I enzymes and confers resistance to gentamicin.

  19. fexA, a Novel Staphylococcus lentus Gene Encoding Resistance to Florfenicol and Chloramphenicol

    OpenAIRE

    Kehrenberg, Corinna; Schwarz, Stefan

    2004-01-01

    The Staphylococcus lentus plasmid pSCFS2 carries a novel florfenicol-chloramphenicol resistance gene, designated fexA, encoding a protein of 475 amino acids with 14 transmembrane domains. The FexA protein differs from all previously known proteins involved in the efflux of chloramphenicol and florfenicol. Induction of fexA expression by chloramphenicol and florfenicol occurs via translational attenuation.

  20. Cloning and expression of clt genes encoding milk-clotting proteases from Myxococcus xanthus 422.

    Science.gov (United States)

    Poza, M; Prieto-Alcedo, M; Sieiro, C; Villa, T G

    2004-10-01

    The screening of a gene library of the milk-clotting strain Myxococcus xanthus 422 constructed in Escherichia coli allowed the description of eight positive clones containing 26 open reading frames. Only three of them (cltA, cltB, and cltC) encoded proteins that exhibited intracellular milk-clotting ability in E. coli, Saccharomyces cerevisiae, and Pichia pastoris expression systems.

  1. Haploinsufficiency of the genes encoding the tumor suppressor Pten predisposes zebrafish to hemangiosarcoma

    NARCIS (Netherlands)

    Choorapoikayil, S.; Kuiper, R.V.; de Bruin, A.; den Hertog, J.

    2012-01-01

    PTEN is an essential tumor suppressor that antagonizes Akt/PKB signaling. The zebrafish genome encodes two Pten genes, ptena and ptenb. Here, we report that zebrafish mutants that retain a single wild-type copy of ptena or ptenb (ptena(+/-)ptenb(-/-) or ptena(-/-)ptenb(+/-)) are viable and fertile.

  2. Pentocin KCA1: a novel circular bacteriocin gene encoded in the ...

    African Journals Online (AJOL)

    We isolated and carried out comprehensive genome sequence analysis of the first Lactobacillus pentosus KCA1 of human origin encoding genes for the biosynthesis of antimicrobial bacteriocin peptide. Due to the growing number of antimicrobial resistance, the need for developing alternatives to traditional antibiotics is ...

  3. Cloning of an epoxide hydrolase encoding gene from Rhodotorula mucilaginosa and functional expresion in Yarrowia lipolytica

    CSIR Research Space (South Africa)

    Labuschagne, M

    2007-01-01

    Full Text Available for the efficient hydrolytic kinetic resolution of epoxides, which serve as high-value intermediates in the fine chemicals and pharmaceutical industries. Degenerate primers, based on data from available EH-encoding gene sequences, in conjunction with inverse PCR...

  4. IGSA: Individual Gene Sets Analysis, including Enrichment and Clustering.

    Science.gov (United States)

    Wu, Lingxiang; Chen, Xiujie; Zhang, Denan; Zhang, Wubing; Liu, Lei; Ma, Hongzhe; Yang, Jingbo; Xie, Hongbo; Liu, Bo; Jin, Qing

    2016-01-01

    Analysis of gene sets has been widely applied in various high-throughput biological studies. One weakness in the traditional methods is that they neglect the heterogeneity of genes expressions in samples which may lead to the omission of some specific and important gene sets. It is also difficult for them to reflect the severities of disease and provide expression profiles of gene sets for individuals. We developed an application software called IGSA that leverages a powerful analytical capacity in gene sets enrichment and samples clustering. IGSA calculates gene sets expression scores for each sample and takes an accumulating clustering strategy to let the samples gather into the set according to the progress of disease from mild to severe. We focus on gastric, pancreatic and ovarian cancer data sets for the performance of IGSA. We also compared the results of IGSA in KEGG pathways enrichment with David, GSEA, SPIA, ssGSEA and analyzed the results of IGSA clustering and different similarity measurement methods. Notably, IGSA is proved to be more sensitive and specific in finding significant pathways, and can indicate related changes in pathways with the severity of disease. In addition, IGSA provides with significant gene sets profile for each sample.

  5. BAGE: a new gene encoding an antigen recognized on human melanomas by cytolytic T lymphocytes.

    Science.gov (United States)

    Boël, P; Wildmann, C; Sensi, M L; Brasseur, R; Renauld, J C; Coulie, P; Boon, T; van der Bruggen, P

    1995-02-01

    Several tumor antigens are recognized by autologous cytolytic T lymphocytes (CTL) on human melanoma MZ2-MEL. Some of them are encoded by genes MAGE-1 and MAGE-3, which are not expressed in normal tissues except in testis. Here, we report the identification of a new gene that codes for another of these antigens. This gene, named BAGE, codes for a putative protein of 43 aa and seems to belong to a family of several genes. The antigen recognized by the autologous CTL consists of BAGE-encoded peptide AARAVFLAL bound to an HLA-Cw 1601 molecule. Gene BAGE is expressed in 22% of melanomas, 30% of infiltrating bladder carcinomas, 10% of mammary carcinomas, 8% of head and neck squamous cell carcinomas, and 6% of non-small cell lung carcinomas. Like the MAGE genes, it is silent in normal tissues with the exception of testis. Because of its tumor-specific expression, the BAGE-encoded antigen may prove useful for cancer immunotherapy.

  6. Characterization of Genes Encoding Key Enzymes Involved in Anthocyanin Metabolism of Kiwifruit during Storage Period.

    Science.gov (United States)

    Li, Boqiang; Xia, Yongxiu; Wang, Yuying; Qin, Guozheng; Tian, Shiping

    2017-01-01

    'Hongyang' is a red fleshed kiwifruit with high anthocyanin content. In this study, we mainly investigated effects of different temperatures (25 and 0°C) on anthocyanin biosynthesis in harvested kiwifruit, and characterized the genes encoding key enzymes involved in anthocyanin metabolism, as well as evaluated the mode of the action, by which low temperature regulates anthocyanin accumulation in 'Hongyang' kiwifruit during storage period. The results showed that low temperature could effectively enhance the anthocyanin accumulation of kiwifruit in the end of storage period (90 days), which related to the increase in mRNA levels of ANS1, ANS2, DRF1, DRF2 , and UGFT2 . Moreover, the transcript abundance of MYBA1-1 and MYB5-1 , the genes encoding an important component of MYB-bHLH-WD40 (MBW) complex, was up-regulated, possibly contributing to the induction of specific anthocyanin biosynthesis genes under the low temperature. To further investigate the roles of AcMYB5-1/5-2/A1-1 in regulation of anthocyanin biosynthesis, genes encoding the three transcription factors were transiently transformed in Nicotiana benthamiana leaves. Overexpression of AcMYB5-1/5-2/A1-1 activated the gene expression of NtANS and NtDFR in tobacco. Our results suggested that low temperature storage could stimulate the anthocyanin accumulation in harvested kiwifruit via regulating several structural and regulatory genes involved in anthocyanin biosynthesis.

  7. Mining Association Rules among Gene Functions in Clusters of Similar Gene Expression Maps.

    Science.gov (United States)

    An, Li; Obradovic, Zoran; Smith, Desmond; Bodenreider, Olivier; Megalooikonomou, Vasileios

    2009-11-01

    Association rules mining methods have been recently applied to gene expression data analysis to reveal relationships between genes and different conditions and features. However, not much effort has focused on detecting the relation between gene expression maps and related gene functions. Here we describe such an approach to mine association rules among gene functions in clusters of similar gene expression maps on mouse brain. The experimental results show that the detected association rules make sense biologically. By inspecting the obtained clusters and the genes having the gene functions of frequent itemsets, interesting clues were discovered that provide valuable insight to biological scientists. Moreover, discovered association rules can be potentially used to predict gene functions based on similarity of gene expression maps.

  8. Screening of the Enterocin-Encoding Genes and Antimicrobial Activity in Enterococcus Species.

    Science.gov (United States)

    Ogaki, Mayara Baptistucci; Rocha, Katia Real; Terra, MÁrcia Regina; Furlaneto, MÁrcia Cristina; Maia, Luciana Furlaneto

    2016-06-28

    In the current study, a total of 135 enterococci strains from different sources were screened for the presence of the enterocin-encoding genes entA, entP, entB, entL50A, and entL50B. The enterocin genes were present at different frequencies, with entA occurring the most frequently, followed by entP and entB; entL50A and L50B were not detected. The occurrence of single enterocin genes was higher than the occurrence of multiple enterocin gene combinations. The 80 isolates that harbor at least one enterocin-encoding gene (denoted "Gene(+) strains") were screened for antimicrobial activity. A total of 82.5% of the Gene(+) strains inhibited at least one of the indicator strains, and the isolates harboring multiple enterocin-encoding genes inhibited a larger number of indicator strains than isolates harboring a single gene. The indicator strains that exhibited growth inhibition included Listeria innocua strain CLIP 12612 (ATCC BAA-680), Listeria monocytogenes strain CDC 4555, Enterococcus faecalis ATCC 29212, Staphylococcus aureus ATCC 25923, S. aureus ATCC 29213, S. aureus ATCC 6538, Salmonella enteritidis ATCC 13076, Salmonella typhimurium strain UK-1 (ATCC 68169), and Escherichia coli BAC 49LT ETEC. Inhibition due to either bacteriophage lysis or cytolysin activity was excluded. The growth inhibition of antilisterial Gene+ strains was further tested under different culture conditions. Among the culture media formulations, the MRS agar medium supplemented with 2% (w/v) yeast extract was the best solidified medium for enterocin production. Our findings extend the current knowledge of enterocin-producing enterococci, which may have potential applications as biopreservatives in the food industry due to their capability of controlling food spoilage pathogens.

  9. antiSMASH 3.0-a comprehensive resource for the genome mining of biosynthetic gene clusters.

    Science.gov (United States)

    Weber, Tilmann; Blin, Kai; Duddela, Srikanth; Krug, Daniel; Kim, Hyun Uk; Bruccoleri, Robert; Lee, Sang Yup; Fischbach, Michael A; Müller, Rolf; Wohlleben, Wolfgang; Breitling, Rainer; Takano, Eriko; Medema, Marnix H

    2015-07-01

    Microbial secondary metabolism constitutes a rich source of antibiotics, chemotherapeutics, insecticides and other high-value chemicals. Genome mining of gene clusters that encode the biosynthetic pathways for these metabolites has become a key methodology for novel compound discovery. In 2011, we introduced antiSMASH, a web server and stand-alone tool for the automatic genomic identification and analysis of biosynthetic gene clusters, available at http://antismash.secondarymetabolites.org. Here, we present version 3.0 of antiSMASH, which has undergone major improvements. A full integration of the recently published ClusterFinder algorithm now allows using this probabilistic algorithm to detect putative gene clusters of unknown types. Also, a new dereplication variant of the ClusterBlast module now identifies similarities of identified clusters to any of 1172 clusters with known end products. At the enzyme level, active sites of key biosynthetic enzymes are now pinpointed through a curated pattern-matching procedure and Enzyme Commission numbers are assigned to functionally classify all enzyme-coding genes. Additionally, chemical structure prediction has been improved by incorporating polyketide reduction states. Finally, in order for users to be able to organize and analyze multiple antiSMASH outputs in a private setting, a new XML output module allows offline editing of antiSMASH annotations within the Geneious software. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

  10. Identification of the Regulator Gene Responsible for the Acetone-Responsive Expression of the Binuclear Iron Monooxygenase Gene Cluster in Mycobacteria ▿

    Science.gov (United States)

    Furuya, Toshiki; Hirose, Satomi; Semba, Hisashi; Kino, Kuniki

    2011-01-01

    The mimABCD gene cluster encodes the binuclear iron monooxygenase that oxidizes propane and phenol in Mycobacterium smegmatis strain MC2 155 and Mycobacterium goodii strain 12523. Interestingly, expression of the mimABCD gene cluster is induced by acetone. In this study, we investigated the regulator gene responsible for this acetone-responsive expression. In the genome sequence of M. smegmatis strain MC2 155, the mimABCD gene cluster is preceded by a gene designated mimR, which is divergently transcribed. Sequence analysis revealed that MimR exhibits amino acid similarity with the NtrC family of transcriptional activators, including AcxR and AcoR, which are involved in acetone and acetoin metabolism, respectively. Unexpectedly, many homologs of the mimR gene were also found in the sequenced genomes of actinomycetes. A plasmid carrying a transcriptional fusion of the intergenic region between the mimR and mimA genes with a promoterless green fluorescent protein (GFP) gene was constructed and introduced into M. smegmatis strain MC2 155. Using a GFP reporter system, we confirmed by deletion and complementation analyses that the mimR gene product is the positive regulator of the mimABCD gene cluster expression that is responsive to acetone. M. goodii strain 12523 also utilized the same regulatory system as M. smegmatis strain MC2 155. Although transcriptional activators of the NtrC family generally control transcription using the σ54 factor, a gene encoding the σ54 factor was absent from the genome sequence of M. smegmatis strain MC2 155. These results suggest the presence of a novel regulatory system in actinomycetes, including mycobacteria. PMID:21856847

  11. Gene clustering by latent semantic indexing of MEDLINE abstracts.

    Science.gov (United States)

    Homayouni, Ramin; Heinrich, Kevin; Wei, Lai; Berry, Michael W

    2005-01-01

    A major challenge in the interpretation of high-throughput genomic data is understanding the functional associations between genes. Previously, several approaches have been described to extract gene relationships from various biological databases using term-matching methods. However, more flexible automated methods are needed to identify functional relationships (both explicit and implicit) between genes from the biomedical literature. In this study, we explored the utility of Latent Semantic Indexing (LSI), a vector space model for information retrieval, to automatically identify conceptual gene relationships from titles and abstracts in MEDLINE citations. We found that LSI identified gene-to-gene and keyword-to-gene relationships with high average precision. In addition, LSI identified implicit gene relationships based on word usage patterns in the gene abstract documents. Finally, we demonstrate here that pairwise distances derived from the vector angles of gene abstract documents can be effectively used to functionally group genes by hierarchical clustering. Our results provide proof-of-principle that LSI is a robust automated method to elucidate both known (explicit) and unknown (implicit) gene relationships from the biomedical literature. These features make LSI particularly useful for the analysis of novel associations discovered in genomic experiments. The 50-gene document collection used in this study can be interactively queried at http://shad.cs.utk.edu/sgo/sgo.html.

  12. The gentle art of gene arrangement: the meaning of gene clusters

    Science.gov (United States)

    Trowsdale, John

    2002-01-01

    Genome sequence comparisons reveal that some sets of genes are in similar linkage groups in different organisms while other sets are dispersed. Are some linkage groups maintained by chance, or is there an advantage to such an arrangement? Some insights may come from large clusters of genes, such as the major histocompatibility complex which includes many genes involved in immune defense. PMID:11897017

  13. The gentle art of gene arrangement: the meaning of gene clusters

    OpenAIRE

    Trowsdale, John

    2002-01-01

    Genome sequence comparisons reveal that some sets of genes are in similar linkage groups in different organisms while other sets are dispersed. Are some linkage groups maintained by chance, or is there an advantage to such an arrangement? Some insights may come from large clusters of genes, such as the major histocompatibility complex which includes many genes involved in immune defense.

  14. Cloning and Heterologous Expression of the Grecocycline Biosynthetic Gene Cluster.

    Directory of Open Access Journals (Sweden)

    Oksana Bilyk

    Full Text Available Transformation-associated recombination (TAR in yeast is a rapid and inexpensive method for cloning and assembly of large DNA fragments, which relies on natural homologous recombination. Two vectors, based on p15a and F-factor replicons that can be maintained in yeast, E. coli and streptomycetes have been constructed. These vectors have been successfully employed for assembly of the grecocycline biosynthetic gene cluster from Streptomyces sp. Acta 1362. Fragments of the cluster were obtained by PCR and transformed together with the "capture" vector into the yeast cells, yielding a construct carrying the entire gene cluster. The obtained construct was heterologously expressed in S. albus J1074, yielding several grecocycline congeners. Grecocyclines have unique structural moieties such as a dissacharide side chain, an additional amino sugar at the C-5 position and a thiol group. Enzymes from this pathway may be used for the derivatization of known active angucyclines in order to improve their desired biological properties.

  15. Molecular cloning and chromosome mapping of the human gene encoding protein phosphotyrosyl phosphatase 1B

    International Nuclear Information System (INIS)

    Brown-Shimer, S.; Johnson, K.A.; Bruskin, A.; Green, N.R.; Hill, D.E.; Lawrence, J.B.; Johnson, C.

    1990-01-01

    The inactivation of growth suppressor genes appears to play a major role in the malignant process. To assess whether protein phosphotyrosyl phosphatases function as growth suppressors, the authors have isolated a cDNA clone encoding human protein phosphotyrosyl phosphatase 1B for structural and functional characterization. The translation product deduced from the 1,305-nucleotide open reading frame predicts a protein containing 435 amino acids and having a molecular mass of 49,966 Da. The amino-terminal 321 amino acids deduced from the cDNA sequence are identical to the empirically determined sequence of protein phosphotyrosyl phosphatase 1B. A genomic clone has been isolated and used in an in situ hybridization to banded metaphase chromosomes to determine that the gene encoding protein phosphotyrosyl phosphatase 1B maps as a single-copy gene to the long arm of chromosome 20 in the region q13.1-q13.2

  16. Variation in genes encoding eosinophil granule proteins in atopic dermatitis patients from Germany

    Directory of Open Access Journals (Sweden)

    Epplen Jörg T

    2008-11-01

    Full Text Available Abstract Background Atopic dermatitis (AD is believed to result from complex interactions between genetic and environmental factors. A main feature of AD as well as other allergic disorders is serum and tissue eosinophilia. Human eosinophils contain high amounts of cationic granule proteins, including eosinophil cationic protein (ECP, eosinophil-derived neurotoxin (EDN, eosinophil peroxidase (EPO and major basic protein (MBP. Recently, variation in genes encoding eosinophil granule proteins has been suggested to play a role in the pathogenesis of allergic disorders. We therefore genotyped selected single nucleotide polymorphisms within the ECP, EDN, EPO and MBP genes in a cohort of 361 German AD patients and 325 healthy controls. Results Genotype and allele frequencies did not differ between patients and controls for all polymorphisms investigated in this study. Haplotype analysis did not reveal any additional information. Conclusion We did not find evidence to support an influence of variation in genes encoding eosinophil granule proteins for AD pathogenesis in this German cohort.

  17. Accurate prediction of secondary metabolite gene clusters in filamentous fungi

    DEFF Research Database (Denmark)

    Andersen, Mikael Rørdam; Nielsen, Jakob Blæsbjerg; Klitgaard, Andreas

    2013-01-01

    supporting enzymes for key synthases one cluster at a time. In this study, we design and apply a DNA expression array for Aspergillus nidulans in combination with legacy data to form a comprehensive gene expression compendium. We apply a guilt-by-association-based analysis to predict the extent...

  18. The fimbrial gene cluster of Haemophilus influenzae type b

    NARCIS (Netherlands)

    van Ham, S. M.; van Alphen, L.; Mooi, F. R.; van Putten, J. P.

    1994-01-01

    Haemophilus influenzae infections are preceded by airway colonization, a process facilitated by fimbriae. Here, we identified the complete fimbrial gene cluster of H. influenzae type b. HifA forms the major subunit. HifB, a periplasmic chaperone, and HifC, an outer membrane usher, are typical

  19. The fimbria gene cluster of nonencapsulated Haemophilus influenzae

    NARCIS (Netherlands)

    Geluk, F.; Eijk, P. P.; van Ham, S. M.; Jansen, H. M.; van Alphen, L.

    1998-01-01

    The occurrence of fimbria gene clusters in nonencapsulated Haemophilus influenzae strains from chronic bronchitis patients (n = 58), patients with acute otitis media (n = 13), and healthy carriers (n = 12) was determined by DNA hybridization and PCR, based on sequences of fimbriate H. influenzae

  20. The ergot alkaloid gene cluster: Functional analyses and evolutionary aspects

    Czech Academy of Sciences Publication Activity Database

    Lorenz, N.; Haarmann, T.; Pažoutová, Sylvie; Jung, M.; Tudzynski, P.

    2009-01-01

    Roč. 70, 15-16 (2009), s. 1822-1832 ISSN 0031-9422 Institutional research plan: CEZ:AV0Z50200510 Keywords : Claviceps purpurea * Ergot fungus * Ergot alkaloid gene cluster Subject RIV: EE - Microbiology, Virology Impact factor: 3.104, year: 2009

  1. Unique nucleotide polymorphism of ankyrin gene cluster in ...

    Indian Academy of Sciences (India)

    Genomics 19, 478–493. Krumlauf R. 1992 Evolution of the vertebrate Hox homeobox genes. BioEssays 14, 245–252. Kuittinen H. and Aguadé M. 2000 Nucleotide variation at the. CHALCONE ISOMERASE locus in Arabidopsis thaliana. Ge- netics 155, 863–872. Lercher M. J., Urrutia A. O. and Hurst L. D. 2002 Clustering of.

  2. Gene ordering in partitive clustering using microarray expressions

    Indian Academy of Sciences (India)

    2007-06-28

    Jun 28, 2007 ... Two existing algorithms for optimally ordering cities in travelling salesman problem (TSP), namely, FRAG_GALK and Concorde, are hybridized individually with self organizing MAP to show the importance of gene ordering in partitive clustering framework. We validated our hybrid approach using yeast and ...

  3. Cloning of Lab Gene Encoding Bacteriocin From Pediococcus acidilactici Fil Into Escherichia coli DH5a

    OpenAIRE

    Margono, Sebastian; Wijaya, Agus; Rahayu, Endang S.

    2017-01-01

    Pediococcus acidilactici F11 is able to inhibit the growth of related species of enterobacteriaceae by secreting bacteriocin. Effort to increase bacteriocin production by transforming lab gene encoding bacteriocin from P. acidilactici Fl 1 into E. colt DH5a was carried out. Plasmid pPAF11 (encoding bacteriocin from P. acidilactici F11) and p13C19 as vector which were double-digested with Madill and BamHI, ligated, and transformed into E. colt DH5a. White colonies, as indicator of transformant...

  4. Campylobacter jejuni gene cj0511 encodes a serine peptidase essential for colonisation

    Directory of Open Access Journals (Sweden)

    A.V. Karlyshev

    2014-01-01

    Full Text Available According to MEROPS peptidase database, Campylobacter species encode 64 predicted peptidases. However, proteolytic properties of only a few of these proteins have been confirmed experimentally. In this study we identified and characterised a Campylobacter jejuni gene cj0511 encoding a novel peptidase. The proteolytic activity associated with this enzyme was demonstrated in cell lysates. Moreover, enzymatic studies conducted with a purified protein confirmed a prediction of it being a serine peptidase. Furthermore, cj0511 mutant was found to be severely attenuated in chicken colonisation model, suggesting a role of the Cj0511 protein in infection.

  5. Horse cDNA clones encoding two MHC class I genes

    Energy Technology Data Exchange (ETDEWEB)

    Barbis, D.P.; Maher, J.K.; Stanek, J.; Klaunberg, B.A.; Antczak, D.F.

    1994-12-31

    Two full-length clones encoding MHC class I genes were isolated by screening a horse cDNA library, using a probe encoding in human HLA-A2.2Y allele. The library was made in the pcDNA1 vector (Invitrogen, San Diego, CA), using mRNA from peripheral blood lymphocytes obtained from a Thoroughbred stallion (No. 0834) homozygous for a common horse MHC haplotype (ELA-A2, -B2, -D2; Antczak et al. 1984; Donaldson et al. 1988). The clones were sequenced, using SP6 and T7 universal primers and horse-specific oligonucleotides designed to extend previously determined sequences.

  6. PEACE: Parallel Environment for Assembly and Clustering of Gene Expression.

    Science.gov (United States)

    Rao, D M; Moler, J C; Ozden, M; Zhang, Y; Liang, C; Karro, J E

    2010-07-01

    We present PEACE, a stand-alone tool for high-throughput ab initio clustering of transcript fragment sequences produced by Next Generation or Sanger Sequencing technologies. It is freely available from www.peace-tools.org. Installed and managed through a downloadable user-friendly graphical user interface (GUI), PEACE can process large data sets of transcript fragments of length 50 bases or greater, grouping the fragments by gene associations with a sensitivity comparable to leading clustering tools. Once clustered, the user can employ the GUI's analysis functions, facilitating the easy collection of statistics and allowing them to single out specific clusters for more comprehensive study or assembly. Using a novel minimum spanning tree-based clustering method, PEACE is the equal of leading tools in the literature, with an interface making it accessible to any user. It produces results of quality virtually identical to those of the WCD tool when applied to Sanger sequences, significantly improved results over WCD and TGICL when applied to the products of Next Generation Sequencing Technology and significantly improved results over Cap3 in both cases. In short, PEACE provides an intuitive GUI and a feature-rich, parallel clustering engine that proves to be a valuable addition to the leading cDNA clustering tools.

  7. The Schizosaccharomyces pombe mam1 gene encodes an ABC transporter mediating secretion of M-factor

    DEFF Research Database (Denmark)

    Christensen, P U; Davey, William John; Nielsen, O

    1997-01-01

    In the fission yeast Schizosaccharomyces pombe, cells of opposite mating type communicate via diffusible peptide pheromones prior to mating. We have cloned the S. pombe mam1 gene, which encodes a 1336-amino acid protein belonging to the ATP-binding cassette (ABC) superfamily. The mam1 gene is only...... expressed in M cells and the gene product is responsible for the secretion of the mating pheromone. M-factor, a nonapeptide that is S-farnesylated and carboxy-methylated on its C-terminal cysteine residue. The predicted Mam1 protein is highly homologous to mammalian multiple drug-resistance proteins...

  8. Silencing of the major family of NBS-LRR-encoding genes in lettuce results in the loss of multiple resistance specificities.

    Science.gov (United States)

    Wroblewski, Tadeusz; Piskurewicz, Urszula; Tomczak, Anna; Ochoa, Oswaldo; Michelmore, Richard W

    2007-09-01

    The RGC2 gene cluster in lettuce (Lactuca sativa) is one of the largest known families of genes encoding nucleotide binding site-leucine-rich repeat (NBS-LRR) proteins. One of its members, RGC2B, encodes Dm3 which determines resistance to downy mildew caused by the oomycete Bremia lactucae carrying the cognate avirulence gene, Avr3. We developed an efficient strategy for analysis of this large family of low expressed genes using post-transcriptional gene silencing (PTGS). We transformed lettuce cv. Diana (carrying Dm3) using chimeric gene constructs designed to simultaneously silence RGC2B and the GUS reporter gene via the production of interfering hairpin RNA (ihpRNA). Transient assays of GUS expression in leaves accurately predicted silencing of both genes and were subsequently used to assay silencing in transgenic T(1) plants and their offspring. Levels of mRNA were reduced not only for RGC2B but also for all seven diverse RGC2 family members tested. We then used the same strategy to show that the resistance specificity encoded by the genetically defined Dm18 locus in lettuce cv. Mariska is the result of two resistance specificities, only one of which was silenced by ihpRNA derived from RGC2B. Analysis of progeny from crosses between transgenic, silenced tester stocks and lettuce accessions carrying other resistance genes previously mapped to the RGC2 locus indicated that two additional resistance specificities to B. lactucae, Dm14 and Dm16, as well as resistance to lettuce root aphid (Pemphigus bursarius L.), Ra, are encoded by RGC2 family members.

  9. Evolution and differential expression of a vertebrate vitellogenin gene cluster

    Directory of Open Access Journals (Sweden)

    Kongshaug Heidi

    2009-01-01

    Full Text Available Abstract Background The multiplicity or loss of the vitellogenin (vtg gene family in vertebrates has been argued to have broad implications for the mode of reproduction (placental or non-placental, cleavage pattern (meroblastic or holoblastic and character of the egg (pelagic or benthic. Earlier proposals for the existence of three forms of vertebrate vtgs present conflicting models for their origin and subsequent duplication. Results By integrating phylogenetics of novel vtg transcripts from old and modern teleosts with syntenic analyses of all available genomic variants of non-metatherian vertebrates we identify the gene orthologies between the Sarcopterygii (tetrapod branch and Actinopterygii (fish branch. We argue that the vertebrate vtg gene cluster originated in proto-chromosome m, but that vtg genes have subsequently duplicated and rearranged following whole genome duplications. Sequencing of a novel fourth vtg transcript in labrid species, and the presence of duplicated paralogs in certain model organisms supports the notion that lineage-specific gene duplications frequently occur in teleosts. The data show that the vtg gene cluster is more conserved between acanthomorph teleosts and tetrapods, than in ostariophysan teleosts such as the zebrafish. The differential expression of the labrid vtg genes are further consistent with the notion that neofunctionalized Aa-type vtgs are important determinants of the pelagic or benthic character of the eggs in acanthomorph teleosts. Conclusion The vertebrate vtg gene cluster existed prior to the separation of Sarcopterygii from Actinopterygii >450 million years ago, a period associated with the second round of whole genome duplication. The presence of higher copy numbers in a more highly expressed subcluster is particularly prevalent in teleosts. The differential expression and latent neofunctionalization of vtg genes in acanthomorph teleosts is an adaptive feature associated with oocyte hydration

  10. Clustered Xenopus keratin genes: A genomic, transcriptomic, and proteomic analysis.

    Science.gov (United States)

    Suzuki, Ken-Ichi T; Suzuki, Miyuki; Shigeta, Mitsuki; Fortriede, Joshua D; Takahashi, Shuji; Mawaribuchi, Shuuji; Yamamoto, Takashi; Taira, Masanori; Fukui, Akimasa

    2017-06-15

    Keratin genes belong to the intermediate filament superfamily and their expression is altered following morphological and physiological changes in vertebrate epithelial cells. Keratin genes are divided into two groups, type I and II, and are clustered on vertebrate genomes, including those of Xenopus species. Various keratin genes have been identified and characterized by their unique expression patterns throughout ontogeny in Xenopus laevis; however, compilation of previously reported and newly identified keratin genes in two Xenopus species is required for our further understanding of keratin gene evolution, not only in amphibians but also in all terrestrial vertebrates. In this study, 120 putative type I and II keratin genes in total were identified based on the genome data from two Xenopus species. We revealed that most of these genes are highly clustered on two homeologous chromosomes, XLA9_10 and XLA2 in X. laevis, and XTR10 and XTR2 in X. tropicalis, which are orthologous to those of human, showing conserved synteny among tetrapods. RNA-Seq data from various embryonic stages and adult tissues highlighted the unique expression profiles of orthologous and homeologous keratin genes in developmental stage- and tissue-specific manners. Moreover, we identified dozens of epidermal keratin proteins from the whole embryo, larval skin, tail, and adult skin using shotgun proteomics. In light of our results, we discuss the radiation, diversification, and unique expression of the clustered keratin genes, which are closely related to epidermal development and terrestrial adaptation during amphibian evolution, including Xenopus speciation. Copyright © 2016 Elsevier Inc. All rights reserved.

  11. Characterization of the biosynthetic gene cluster for cryptic phthoxazolin A in Streptomyces avermitilis.

    Directory of Open Access Journals (Sweden)

    Dian Anggraini Suroto

    Full Text Available Phthoxazolin A, an oxazole-containing polyketide, has a broad spectrum of anti-oomycete activity and herbicidal activity. We recently identified phthoxazolin A as a cryptic metabolite of Streptomyces avermitilis that produces the important anthelmintic agent avermectin. Even though genome data of S. avermitilis is publicly available, no plausible biosynthetic gene cluster for phthoxazolin A is apparent in the sequence data. Here, we identified and characterized the phthoxazolin A (ptx biosynthetic gene cluster through genome sequencing, comparative genomic analysis, and gene disruption. Sequence analysis uncovered that the putative ptx biosynthetic genes are laid on an extra genomic region that is not found in the public database, and 8 open reading frames in the extra genomic region could be assigned roles in the biosynthesis of the oxazole ring, triene polyketide and carbamoyl moieties. Disruption of the ptxA gene encoding a discrete acyltransferase resulted in a complete loss of phthoxazolin A production, confirming that the trans-AT type I PKS system is responsible for the phthoxazolin A biosynthesis. Based on the predicted functional domains in the ptx assembly line, we propose the biosynthetic pathway of phthoxazolin A.

  12. Evolutionary conservation of regulatory elements in vertebrate HOX gene clusters

    Energy Technology Data Exchange (ETDEWEB)

    Santini, Simona; Boore, Jeffrey L.; Meyer, Axel

    2003-12-31

    Due to their high degree of conservation, comparisons of DNA sequences among evolutionarily distantly-related genomes permit to identify functional regions in noncoding DNA. Hox genes are optimal candidate sequences for comparative genome analyses, because they are extremely conserved in vertebrates and occur in clusters. We aligned (Pipmaker) the nucleotide sequences of HoxA clusters of tilapia, pufferfish, striped bass, zebrafish, horn shark, human and mouse (over 500 million years of evolutionary distance). We identified several highly conserved intergenic sequences, likely to be important in gene regulation. Only a few of these putative regulatory elements have been previously described as being involved in the regulation of Hox genes, while several others are new elements that might have regulatory functions. The majority of these newly identified putative regulatory elements contain short fragments that are almost completely conserved and are identical to known binding sites for regulatory proteins (Transfac). The conserved intergenic regions located between the most rostrally expressed genes in the developing embryo are longer and better retained through evolution. We document that presumed regulatory sequences are retained differentially in either A or A clusters resulting from a genome duplication in the fish lineage. This observation supports both the hypothesis that the conserved elements are involved in gene regulation and the Duplication-Deletion-Complementation model.

  13. Human major histocompatibility complex contains a minimum of 19 genes between the complement cluster and HLA-B

    International Nuclear Information System (INIS)

    Spies, T.; Bresnahan, M.; Strominger, J.L.

    1989-01-01

    A 600-kilobase (kb) DNA segment from the human major histocompatibility complex (MHC) class III region was isolated by extension of a previous 435-kb chromosome walk. The contiguous series of cloned overlapping cosmids contains the entire 555-kb interval between C2 in the complement gene cluster and HLA-B. This region is known to encode the tumor necrosis factors (TNFs) α and β, B144, and the major heat shock protein HSP70. Moreover, a cluster of genes, BAT1-BAT5 (HLA-B-associated transcripts) have been localized in the vicinity of the genes for TNFα and TNFβ. An additional four genes were identified by isolation of corresponding cDNA clones with cosmid DNA probes. These genes for BAT6-BAT9 were mapped near the gene for C2 within a 120-kb region that includes a HSP70 gene pair. These results, together with complementary data from a similar recent study, indicated the presence of a minimum of 19 genes within the C2-HLA-B interval of the MHC class III region. Although the functional properties of most of these genes are yet unknown, they may be involved in some aspects of immunity. This idea is supported by the genetic mapping of the hematopoietic histocompatibility locus-1 (Hh-1) in recombinant mice between TNFα and H-2S, which is homologous to the complement gene cluster in humans

  14. Metagenomic Analysis of Apple Orchard Soil Reveals Antibiotic Resistance Genes Encoding Predicted Bifunctional Proteins▿

    Science.gov (United States)

    Donato, Justin J.; Moe, Luke A.; Converse, Brandon J.; Smart, Keith D.; Berklein, Flora C.; McManus, Patricia S.; Handelsman, Jo

    2010-01-01

    To gain insight into the diversity and origins of antibiotic resistance genes, we identified resistance genes in the soil in an apple orchard using functional metagenomics, which involves inserting large fragments of foreign DNA into Escherichia coli and assaying the resulting clones for expressed functions. Among 13 antibiotic-resistant clones, we found two genes that encode bifunctional proteins. One predicted bifunctional protein confers resistance to ceftazidime and contains a natural fusion between a predicted transcriptional regulator and a β-lactamase. Sequence analysis of the entire metagenomic clone encoding the predicted bifunctional β-lactamase revealed a gene potentially involved in chloramphenicol resistance as well as a predicted transposase. A second clone that encodes a predicted bifunctional protein confers resistance to kanamycin and contains an aminoglycoside acetyltransferase domain fused to a second acetyltransferase domain that, based on nucleotide sequence, was predicted not to be involved in antibiotic resistance. This is the first report of a transcriptional regulator fused to a β-lactamase and of an aminoglycoside acetyltransferase fused to an acetyltransferase not involved in antibiotic resistance. PMID:20453147

  15. Cloning and characterization of largemouth bass ( Micropterus salmoides) myostatin encoding gene and its promoter

    Science.gov (United States)

    Li, Shengjie; Bai, Junjie; Wang, Lin

    2008-08-01

    Myostatin or GDF-8, a member of the transforming growth factor-β (TGF-β) superfamily, has been demonstrated to be a negative regulator of skeletal muscle mass in mammals. In the present study, we obtained a 5.64 kb sequence of myostatin encoding gene and its promoter from largemouth bass ( Micropterus salmoides). The myostatin encoding gene consisted of three exons (488 bp, 371 bp and 1779 bp, respectively) and two introns (390 bp and 855 bp, respectively). The intron-exon boundaries were conservative in comparison with those of mammalian myostatin encoding genes, whereas the size of introns was smaller than that of mammals. Sequence analysis of 1.569 kb of the largemouth bass myostatin gene promoter region revealed that it contained two TATA boxes, one CAAT box and nine putative E-boxes. Putative muscle growth response elements for myocyte enhancer factor 2 (MEF2), serum response factor (SRF), activator protein 1 (AP1), etc., and muscle-specific Mt binding site (MTBF) were also detected. Some of the transcription factor binding sites were conserved among five teleost species. This information will be useful for studying the transcriptional regulation of myostatin in fish.

  16. Distribution of genes encoding aminoglycoside-modifying enzymes among clinical isolates of methicillin-resistant staphylococci.

    Science.gov (United States)

    Perumal, N; Murugesan, S; Krishnan, P

    2016-01-01

    The objective of this study was to determine the distribution of genes encoding aminoglycoside-modifying enzymes (AMEs) and staphylococcal cassette chromosome mec (SCCmec) elements among clinical isolates of methicillin-resistant staphylococci (MRS). Antibiotic susceptibility test was done using Kirby-Bauer disk diffusion method. The presence of SCCmec types and AME genes, namely, aac (6')-Ie-aph (2''), aph (3')-IIIa and ant (4')-Ia was determined using two different multiplex polymerase chain reaction. The most encountered AME genes were aac (6')-Ie-aph (2'') (55.4%) followed by aph (3')-IIIa (32.3%) and ant (4')-Ia gene (9%). SCCmec type I (34%) was predominant in this study. In conclusion, the aac (6')-Ie-aph (2'') was the most common AME gene and SCCmec type I was most predominant among the MRS isolates.

  17. Incorporating gene ontology into fuzzy relational clustering of microarray gene expression data.

    Science.gov (United States)

    Paul, Animesh Kumar; Shill, Pintu Chandra

    2018-01-01

    The product of gene expression works together in the cell for each living organism in order to achieve different biological processes. Many proteins are involved in different roles depending on the environment of the organism for the functioning of the cell. In this paper, we propose gene ontology (GO) annotations based semi-supervised clustering algorithm called GO fuzzy relational clustering (GO-FRC) where one gene is allowed to be assigned to multiple clusters which are the most biologically relevant behavior of genes. In the clustering process, GO-FRC utilizes useful biological knowledge which is available in the form of a gene ontology, as a prior knowledge along with the gene expression data. The prior knowledge helps to improve the coherence of the groups concerning the knowledge field. The proposed GO-FRC has been tested on the two yeast (Saccharomyces cerevisiae) expression profiles datasets (Eisen and Dream5 yeast datasets) and compared with other state-of-the-art clustering algorithms. Experimental results imply that GO-FRC is able to produce more biologically relevant clusters with the use of the small amount of GO annotations. Copyright © 2017 Elsevier B.V. All rights reserved.

  18. The insect metalloproteinase inhibitor gene of the lepidopteran Galleria mellonella encodes two distinct inhibitors.

    Science.gov (United States)

    Wedde, Marianne; Weise, Christoph; Nuck, Rolf; Altincicek, Boran; Vilcinskas, Andreas

    2007-01-01

    The insect metalloproteinase inhibitor (IMPI) from the greater wax moth, Galleria mellonella, represents the first and to date only specific inhibitor of microbial metalloproteinases reported from animals. Here, we report on the characterization including carbohydrate analysis of two recombinant constructs encoded by impi cDNA either upstream or downstream of the furin cleavage site identified. rIMPI-1, corresponding to native IMPI purified from hemolymph, is encoded by the N-terminal part of the impi sequence, whereas rIMPI-2 is encoded by its C-terminal part. rIMPI-1 is glycosylated at N48 with GlcNAc2Man3, showing fucosylation to different extents. Similarly, rIMPI-2 is glycosylated at N149 with GlcNAc2Man3, but is fully fucosylated. rIMPI-1 represents a promising template for the design of second-generation antibiotics owing to its specific activity against thermolysin-like metalloproteinases produced by human pathogenic bacteria such as Vibrio vulnificus. In contrast, rIMPI-2 does not inhibit bacterial metalloproteinases, but is moderately active against recombinant human matrix metalloproteinases (MMPs). Both microbial metalloproteinases and MMPs induce expression of the impi gene when injected into G. mellonella larvae. These findings provide evidence that the impi gene encodes two distinct inhibitors, one inhibiting microbial metalloproteinases and contributing to innate immunity, the other putatively mediating regulation of endogenous MMPs during metamorphosis.

  19. Chicken genome analysis reveals novel genes encoding biotin-binding proteins related to avidin family

    Directory of Open Access Journals (Sweden)

    Nordlund Henri R

    2005-03-01

    Full Text Available Abstract Background A chicken egg contains several biotin-binding proteins (BBPs, whose complete DNA and amino acid sequences are not known. In order to identify and characterise these genes and proteins we studied chicken cDNAs and genes available in the NCBI database and chicken genome database using the reported N-terminal amino acid sequences of chicken egg-yolk BBPs as search strings. Results Two separate hits showing significant homology for these N-terminal sequences were discovered. For one of these hits, the chromosomal location in the immediate proximity of the avidin gene family was found. Both of these hits encode proteins having high sequence similarity with avidin suggesting that chicken BBPs are paralogous to avidin family. In particular, almost all residues corresponding to biotin binding in avidin are conserved in these putative BBP proteins. One of the found DNA sequences, however, seems to encode a carboxy-terminal extension not present in avidin. Conclusion We describe here the predicted properties of the putative BBP genes and proteins. Our present observations link BBP genes together with avidin gene family and shed more light on the genetic arrangement and variability of this family. In addition, comparative modelling revealed the potential structural elements important for the functional and structural properties of the putative BBP proteins.

  20. A YAC contig spanning a cluster of human type III receptor protein tyrosine kinase genes (PDGFRA-KIT-KDR) in chromosome segment 4q12

    Energy Technology Data Exchange (ETDEWEB)

    Spritz, R.A.; Strunk, K.M.; Lee, S.T. [Univ. of Wisconsin, Madison, WI (United States)] [and others

    1994-07-15

    The authors have mapped five genes encoding protein tyrosine kinases (PTKs) to the pericentromeric region of human chromosome 4. PTK4 and TYRO4, which encode nonreceptor intracellular PTKs, are located at 4p12 and 4q13, respectively. The other three genes, PDGFRA, KIT, and KDR, encode type III transmembrane receptor PTKs for known ligands. The authors have developed a contig of 29 yeast artificial chromosomes (YACs) spanning approximately 2 Mb of DNA at 4q12 that includes PDGFRA, KIT, and KDR, and have used this YAC contig to map 12 different sequence-tagged sites in this region. PDGFRA, KIT, and KDR thus constitute a cluster of genes at 4q12 encoding closely related type III receptor PTKs. Mutations of the human KIT gene result in piebaldism, an autosomal dominant disorder of melanocyte development. 42 refs., 3 figs., 2 tabs.

  1. A multiplex PCR for detection of genes encoding exfoliative toxins from Staphylococcus hyicus

    DEFF Research Database (Denmark)

    Andresen, Lars Ole; Ahrens, Peter

    2004-01-01

    Aims: To develop a multiplex PCR for detection of genes encoding the exfoliative toxins ExhA, ExhB, ExhC and ExhD from Staphylococcus hyicus and to estimate the prevalence of exfoliative toxins among Staph. hyicus isolates from Danish pig herds with exudative epidermitis (EE). Methods and Results......: A multiplex PCR employing specific primers for each of the genes encoding four different exfoliative toxins was developed and evaluated using a collection of Staph. hyicus with known toxin type and a number of other staphylococcal species. A total of 314 Staph. hyicus isolates from pigs with EE were screened...... by multiplex PCR and the combined results of the present and previous investigations showed that ExhA, ExhB, ExhC and ExhD was found in 20, 33, 18 and 22%, respectively, of 60 cases of EE investigated. Conclusions: This study has provided a new tool for detection of toxigenic Staph. hyicus and a more...

  2. The promoter of the glucoamylase-encoding gene of Aspergillus niger functions in Ustilago maydis

    Energy Technology Data Exchange (ETDEWEB)

    Smith, T.L. (Dept. of Agriculture, Madison, WI (United States) Univ. of Wisconsin, Madison (United States)); Gaskell, J.; Cullen, D. (Dept. of Agriculture, Madison, WI (United States)); Berka, R.M.; Yang, M.; Henner, D.J. (Genentech Inc., San Francisco, CA (United States))

    1990-01-01

    Promoter sequences from the Aspergillus niger glucoamylase-encoding gene (glaA) were linked to the bacterial hygromycin (Hy) phosphotransferase-encoding gene (hph) and this chimeric marker was used to select Hy-resistant (Hy[sup R]) Ustilago maydis transformants. This is an example of an Ascomycete promoter functioning in a Basidiomycete. Hy[sup R] transformants varied with respect to copy number of integrated vector, mitotic stability, and tolerance to Hy. Only 216 bp of glaA promoter sequence is required for expression in U. maydis but this promoter is not induced by starch as it is in Aspergillus spp. The transcription start points are the same in U. maydis and A. niger.

  3. Sca1, a previously undescribed paralog from autotransporter protein-encoding genes in Rickettsia species

    Directory of Open Access Journals (Sweden)

    Raoult Didier

    2006-02-01

    Full Text Available Abstract Background Among the 17 genes encoding autotransporter proteins of the "surface cell antigen" (sca family in the currently sequenced Rickettsia genomes, ompA, sca5 (ompB and sca4 (gene D, have been extensively used for identification and phylogenetic purposes for Rickettsia species. However, none of these genes is present in all 20 currently validated Rickettsia species. Of the remaining 14 sca genes, sca1 is the only gene to be present in all nine sequenced Rickettsia genomes. To estimate whether the sca1 gene is present in all Rickettsia species and its usefulness as an identification and phylogenetic tool, we searched for sca1genes in the four published Rickettsia genomes and amplified and sequenced this gene in the remaining 16 validated Rickettsia species. Results Sca1 is the only one of the 17 rickettsial sca genes present in all 20 Rickettsia species. R. prowazekii and R. canadensis exhibit a split sca1 gene whereas the remaining species have a complete gene. Within the sca1 gene, we identified a 488-bp variable sequence fragment that can be amplified using a pair of conserved primers. Sequences of this fragment are specific for each Rickettsia species. The phylogenetic organization of Rickettsia species inferred from the comparison of sca1 sequences strengthens the classification based on the housekeeping gene gltA and is similar to those obtained from the analyses of ompA, sca5 and sca4, thus suggesting similar evolutionary constraints. We also observed that Sca1 protein sequences have evolved under a dual selection pressure: with the exception of typhus group rickettsiae, the amino-terminal part of the protein that encompasses the predicted passenger domain, has evolved under positive selection in rickettsiae. This suggests that the Sca1 protein interacts with the host. In contrast, the C-terminal portion containing the autotransporter domain has evolved under purifying selection. In addition, sca1 is transcribed in R. conorii

  4. fexA, a Novel Staphylococcus lentus Gene Encoding Resistance to Florfenicol and Chloramphenicol

    Science.gov (United States)

    Kehrenberg, Corinna; Schwarz, Stefan

    2004-01-01

    The Staphylococcus lentus plasmid pSCFS2 carries a novel florfenicol-chloramphenicol resistance gene, designated fexA, encoding a protein of 475 amino acids with 14 transmembrane domains. The FexA protein differs from all previously known proteins involved in the efflux of chloramphenicol and florfenicol. Induction of fexA expression by chloramphenicol and florfenicol occurs via translational attenuation.   PMID:14742219

  5. Sequencing the Gene Encoding Manganese-Dependent Superoxide Dismutase for Rapid Species Identification of Enterococci

    OpenAIRE

    Poyart, Claire; Quesnes, Gilles; Trieu-Cuot, Patrick

    2000-01-01

    Simple PCR and sequencing assays that utilize a single pair of degenerate primers were used to characterize a 438-bp-long DNA fragment internal (sodAint) to the sodA gene encoding the manganese-dependent superoxide dismutase in 19 enterococcal type strains (Enterococcus avium, Enterococcus casseliflavus, Enterococcus cecorum, Enterococcus columbae, Enterococcus dispar, Enterococcus durans, Enterococcus faecalis, Enterococcus faecium, Enterococcus flavescens, Enterococcus gallinarum, Enterococ...

  6. Characterization of Genes Encoding Key Enzymes Involved in Anthocyanin Metabolism of Kiwifruit during Storage Period

    OpenAIRE

    Li, Boqiang; Xia, Yongxiu; Wang, Yuying; Qin, Guozheng; Tian, Shiping

    2017-01-01

    ‘Hongyang’ is a red fleshed kiwifruit with high anthocyanin content. In this study, we mainly investigated effects of different temperatures (25 and 0°C) on anthocyanin biosynthesis in harvested kiwifruit, and characterized the genes encoding key enzymes involved in anthocyanin metabolism, as well as evaluated the mode of the action, by which low temperature regulates anthocyanin accumulation in ‘Hongyang’ kiwifruit during storage period. The results showed that low temperature could effectiv...

  7. Enterotoxin-Encoding Genes in Staphylococcus spp. from Food Handlers in a University Restaurant.

    Science.gov (United States)

    da Silva, Sabina Dos Santos Paulino; Cidral, Thiago André; Soares, Maria José dos Santos; de Melo, Maria Celeste Nunes

    2015-11-01

    Food handlers carrying enterotoxin-producing Staphylococcus are a potential source of food poisoning. The aim of this study was to analyze genes encoding enterotoxins in coagulase-positive Staphylococcus (CoPS) and coagulase-negative Staphylococcus (CoNS) isolated from the anterior nostrils and hands of food handlers at a university restaurant in the city of Natal, Northeast Brazil. Thirty food handlers were screened for the study. The isolates were subjected to Gram staining, a bacitracin sensitivity test, mannitol fermentation, and catalase and coagulase tests. CoNS and CoPS strains were subsequently identified by a Vitek 2 System (BioMerieux, France) and various biochemical tests. Polymerase chain reaction was used to detect genes for enterotoxins A, B, C, D, E, G, H, and I (sea, seb, sec, sed, see, seg, seh, and sei) and a disc-diffusion method was used to determine susceptibility to several classes of antimicrobials. All food handlers presented staphylococci on their hands and/or noses. The study found 58 Staphylococcus spp., of which 20.7% were CoPS and 79.3% were CoNS. S. epidermidis was the most prevalent species. Twenty-nine staphylococci (50%) were positive for one or more enterotoxin genes, and the most prevalent genes were seg and sei, each with a frequency of 29.3%. Indeed, CoNS encoded a high percentage of enterotoxin genes (43.5%). However, S. aureus encoded even more enterotoxin genes (75%). Most isolates showed sensitivity to the antibiotics used for testing, except for penicillin (only 35% sensitive). The results from this study reinforce that coagulase-negative as well as coagulase-positive staphylococci isolated from food handlers are capable of genotypic enterotoxigenicity.

  8. Sieve element occlusion (SEO) genes encode structural phloem proteins involved in wound sealing of the phloem.

    Science.gov (United States)

    Ernst, Antonia M; Jekat, Stephan B; Zielonka, Sascia; Müller, Boje; Neumann, Ulla; Rüping, Boris; Twyman, Richard M; Krzyzanek, Vladislav; Prüfer, Dirk; Noll, Gundula A

    2012-07-10

    The sieve element occlusion (SEO) gene family originally was delimited to genes encoding structural components of forisomes, which are specialized crystalloid phloem proteins found solely in the Fabaceae. More recently, SEO genes discovered in various non-Fabaceae plants were proposed to encode the common phloem proteins (P-proteins) that plug sieve plates after wounding. We carried out a comprehensive characterization of two tobacco (Nicotiana tabacum) SEO genes (NtSEO). Reporter genes controlled by the NtSEO promoters were expressed specifically in immature sieve elements, and GFP-SEO fusion proteins formed parietal agglomerates in intact sieve elements as well as sieve plate plugs after wounding. NtSEO proteins with and without fluorescent protein tags formed agglomerates similar in structure to native P-protein bodies when transiently coexpressed in Nicotiana benthamiana, and the analysis of these protein complexes by electron microscopy revealed ultrastructural features resembling those of native P-proteins. NtSEO-RNA interference lines were essentially devoid of P-protein structures and lost photoassimilates more rapidly after injury than control plants, thus confirming the role of P-proteins in sieve tube sealing. We therefore provide direct evidence that SEO genes in tobacco encode P-protein subunits that affect translocation. We also found that peptides recently identified in fascicular phloem P-protein plugs from squash (Cucurbita maxima) represent cucurbit members of the SEO family. Our results therefore suggest a common evolutionary origin for P-proteins found in the sieve elements of all dicotyledonous plants and demonstrate the exceptional status of extrafascicular P-proteins in cucurbits.

  9. Mutations in the gene encoding epsilon-sarcoglycan cause myoclonus-dystonia syndrome.

    Science.gov (United States)

    Zimprich, A; Grabowski, M; Asmus, F; Naumann, M; Berg, D; Bertram, M; Scheidtmann, K; Kern, P; Winkelmann, J; Müller-Myhsok, B; Riedel, L; Bauer, M; Müller, T; Castro, M; Meitinger, T; Strom, T M; Gasser, T

    2001-09-01

    The dystonias are a common clinically and genetically heterogeneous group of movement disorders. More than ten loci for inherited forms of dystonia have been mapped, but only three mutated genes have been identified so far. These are DYT1, encoding torsin A and mutant in the early-onset generalized form, GCH1 (formerly known as DYT5), encoding GTP-cyclohydrolase I and mutant in dominant dopa-responsive dystonia, and TH, encoding tyrosine hydroxylase and mutant in the recessive form of the disease. Myoclonus-dystonia syndrome (MDS; DYT11) is an autosomal dominant disorder characterized by bilateral, alcohol-sensitive myoclonic jerks involving mainly the arms and axial muscles. Dystonia, usually torticollis and/or writer's cramp, occurs in most but not all affected patients and may occasionally be the only symptom of the disease. In addition, patients often show prominent psychiatric abnormalities, including panic attacks and obsessive-compulsive behavior. In most MDS families, the disease is linked to a locus on chromosome 7q21 (refs. 11-13). Using a positional cloning approach, we have identified five different heterozygous loss-of-function mutations in the gene for epsilon-sarcoglycan (SGCE), which we mapped to a refined critical region of about 3.2 Mb. SGCE is expressed in all brain regions examined. Pedigree analysis shows a marked difference in penetrance depending on the parental origin of the disease allele. This is indicative of a maternal imprinting mechanism, which has been demonstrated in the mouse epsilon-sarcoglycan gene.

  10. Identification of Nocobactin NA Biosynthetic Gene Clusters in Nocardia farcinica▿ §

    OpenAIRE

    Hoshino, Yasutaka; Chiba, Kazuhiro; Ishino, Keiko; Fukai, Toshio; Igarashi, Yasuhiro; Yazawa, Katsukiyo; Mikami, Yuzuru; Ishikawa, Jun

    2010-01-01

    We identified the biosynthetic gene clusters of the siderophore nocobactin NA. The nbt clusters, which were discovered as genes highly homologous to the mycobactin biosynthesis genes by the genomic sequencing of Nocardia farcinica IFM 10152, consist of 10 genes separately located at two genomic regions. The gene organization of the nbt clusters and the predicted functions of the nbt genes, particularly the cyclization and epimerization domains, were in good agreement with the chemical structu...

  11. The ispB gene encoding octaprenyl diphosphate synthase is essential for growth of Escherichia coli.

    OpenAIRE

    Okada, K; Minehira, M; Zhu, X; Suzuki, K; Nakagawa, T; Matsuda, H; Kawamukai, M

    1997-01-01

    The Escherichia coli ispB gene encoding octaprenyl diphosphate synthase is responsible for the synthesis of the side chain of isoprenoid quinones. We tried to construct an E. coli ispB-disrupted mutant but could not isolate the chromosomal ispB disrupted mutant unless the ispB gene or its homolog was supplied on a plasmid. The chromosomal ispB disruptants that harbored plasmids carrying the ispB homologs from Haemophilus influenzae and Synechocystis sp. strain PCC6803 produced mainly ubiquino...

  12. PRS1 is a key member of the gene family encoding phosphoribosylpyrophosphate synthetase in Saccharomyces cerevisiae

    DEFF Research Database (Denmark)

    Carter, Andrew T.; Beiche, Flora; Hove-Jensen, Bjarne

    1997-01-01

    In Saccharomyces cerevisiae the metabolite phosphoribosyl-pyrophosphate (PRPP) is required for purine, pyrimidine, tryptophan and histidine biosynthesis. Enzymes that can synthesize PRPP can be encoded by at least four genes. We have studied 5-phospho-ribosyl-1(α)-pyrophosphate synthetases (PRS......) genetically and biochemically. Each of the four genes, all of which are transcribed, has been disrupted in haploid yeast strains of each mating type and although all disruptants are able to grow on complete medium, differences in growth rate and enzyme activity suggest that disruption of PRS1 or PRS3 has...

  13. Gene duplication, modularity and adaptation in the evolution of the aflatoxin gene cluster

    Directory of Open Access Journals (Sweden)

    Jakobek Judy L

    2007-07-01

    Full Text Available Abstract Background The biosynthesis of aflatoxin (AF involves over 20 enzymatic reactions in a complex polyketide pathway that converts acetate and malonate to the intermediates sterigmatocystin (ST and O-methylsterigmatocystin (OMST, the respective penultimate and ultimate precursors of AF. Although these precursors are chemically and structurally very similar, their accumulation differs at the species level for Aspergilli. Notable examples are A. nidulans that synthesizes only ST, A. flavus that makes predominantly AF, and A. parasiticus that generally produces either AF or OMST. Whether these differences are important in the evolutionary/ecological processes of species adaptation and diversification is unknown. Equally unknown are the specific genomic mechanisms responsible for ordering and clustering of genes in the AF pathway of Aspergillus. Results To elucidate the mechanisms that have driven formation of these clusters, we performed systematic searches of aflatoxin cluster homologs across five Aspergillus genomes. We found a high level of gene duplication and identified seven modules consisting of highly correlated gene pairs (aflA/aflB, aflR/aflS, aflX/aflY, aflF/aflE, aflT/aflQ, aflC/aflW, and aflG/aflL. With the exception of A. nomius, contrasts of mean Ka/Ks values across all cluster genes showed significant differences in selective pressure between section Flavi and non-section Flavi species. A. nomius mean Ka/Ks values were more similar to partial clusters in A. fumigatus and A. terreus. Overall, mean Ka/Ks values were significantly higher for section Flavi than for non-section Flavi species. Conclusion Our results implicate several genomic mechanisms in the evolution of ST, OMST and AF cluster genes. Gene modules may arise from duplications of a single gene, whereby the function of the pre-duplication gene is retained in the copy (aflF/aflE or the copies may partition the ancestral function (aflA/aflB. In some gene modules, the

  14. Molecular characterization of genes encoding leucoanthocyanidin reductase involved in proanthocyanidin biosynthesis in apple

    Directory of Open Access Journals (Sweden)

    Yuepeng eHan

    2015-04-01

    Full Text Available Proanthocyanidins (PAs are the major component of phenolics in apple, but mechanisms involved in PA biosynthesis remain unclear. Here, the relationship between the PA biosynthesis and the expression of genes encoding leucoanthocyanidin reductase (LAR and anthocyanidin reductase (ANR was investigated in fruit skin of one apple cultivar and three crabapples. Transcript levels of LAR1 and ANR2 genes were significantly correlated with the contents of catechin and epicatechin, respectively, which suggests their active roles in PA synthesis. Surprisingly, transcript levels for both LAR1 and LAR2 genes were almost undetectable in two crabapples that accumulated both flavan-3-ols and PAs. This contradicts the previous finding that LAR1 gene is a strong candidate regulating the accumulation of metabolites such as epicatechin and PAs in apple. Ectopic expression of apple MdLAR1 gene in tobacco suppresses expression of the late genes in anthocyanin biosynthetic pathway, resulting in loss of anthocyanin in flowers. Interestingly, a decrease in PA biosynthesis was also observed in flowers of transgenic tobacco plants overexpressing the MdLAR1 gene, which could be attributed to decreased expression of both the NtANR1 and NtANR2 genes. Our study not only confirms the in vivo function of apple LAR1 gene, but it is also helpful for understanding the mechanism of PA biosynthesis.

  15. Clustering gene expression regulators: new approach to disease subtyping.

    Directory of Open Access Journals (Sweden)

    Mikhail Pyatnitskiy

    Full Text Available One of the main challenges in modern medicine is to stratify different patient groups in terms of underlying disease molecular mechanisms as to develop more personalized approach to therapy. Here we propose novel method for disease subtyping based on analysis of activated expression regulators on a sample-by-sample basis. Our approach relies on Sub-Network Enrichment Analysis algorithm (SNEA which identifies gene subnetworks with significant concordant changes in expression between two conditions. Subnetwork consists of central regulator and downstream genes connected by relations extracted from global literature-extracted regulation database. Regulators found in each patient separately are clustered together and assigned activity scores which are used for final patients grouping. We show that our approach performs well compared to other related methods and at the same time provides researchers with complementary level of understanding of pathway-level biology behind a disease by identification of significant expression regulators. We have observed the reasonable grouping of neuromuscular disorders (triggered by structural damage vs triggered by unknown mechanisms, that was not revealed using standard expression profile clustering. For another experiment we were able to suggest the clusters of regulators, responsible for colorectal carcinoma vs adenoma discrimination and identify frequently genetically changed regulators that could be of specific importance for the individual characteristics of cancer development. Proposed approach can be regarded as biologically meaningful feature selection, reducing tens of thousands of genes down to dozens of clusters of regulators. Obtained clusters of regulators make possible to generate valuable biological hypotheses about molecular mechanisms related to a clinical outcome for individual patient.

  16. Genome analysis and identification of gelatinase encoded gene in Enterobacter aerogenes

    Science.gov (United States)

    Shahimi, Safiyyah; Mutalib, Sahilah Abdul; Khalid, Rozida Abdul; Repin, Rul Aisyah Mat; Lamri, Mohd Fadly; Bakar, Mohd Faizal Abu; Isa, Mohd Noor Mat

    2016-11-01

    In this study, bioinformatic analysis towards genome sequence of E. aerogenes was done to determine gene encoded for gelatinase. Enterobacter aerogenes was isolated from hot spring water and gelatinase species-specific bacterium to porcine and fish gelatin. This bacterium offers the possibility of enzymes production which is specific to both species gelatine, respectively. Enterobacter aerogenes was partially genome sequenced resulting in 5.0 mega basepair (Mbp) total size of sequence. From pre-process pipeline, 87.6 Mbp of total reads, 68.8 Mbp of total high quality reads and 78.58 percent of high quality percentage was determined. Genome assembly produced 120 contigs with 67.5% of contigs over 1 kilo base pair (kbp), 124856 bp of N50 contig length and 55.17 % of GC base content percentage. About 4705 protein gene was identified from protein prediction analysis. Two candidate genes selected have highest similarity identity percentage against gelatinase enzyme available in Swiss-Prot and NCBI online database. They were NODE_9_length_26866_cov_148.013245_12 containing 1029 base pair (bp) sequence with 342 amino acid sequence and NODE_24_length_155103_cov_177.082458_62 which containing 717 bp sequence with 238 amino acid sequence, respectively. Thus, two paired of primers (forward and reverse) were designed, based on the open reading frame (ORF) of selected genes. Genome analysis of E. aerogenes resulting genes encoded gelatinase were identified.

  17. Production of cyanophycin in Rhizopus oryzae through the expression of a cyanophycin synthetase encoding gene.

    Science.gov (United States)

    Meussen, Bas J; Weusthuis, Ruud A; Sanders, Johan P M; Graaff, Leo H de

    2012-02-01

    Cyanophycin or cyanophycin granule peptide is a protein that results from non-ribosomal protein synthesis in microorganisms such as cyanobacteria. The amino acids in cyanophycin can be used as a feedstock in the production of a wide range of chemicals such as acrylonitrile, polyacrylic acid, 1,4-butanediamine, and urea. In this study, an auxotrophic mutant (Rhizopus oryzae M16) of the filamentous fungus R. oryzae 99-880 was selected to express cyanophycin synthetase encoding genes. These genes originated from Synechocystis sp. strain PCC6803, Anabaena sp. strain PCC7120, and a codon optimized version of latter gene. The genes were under control of the pyruvate decarboxylase promoter and terminator elements of R. oryzae. Transformants were generated by the biolistic transformation method. In only two transformants both expressing the cyanophycin synthetase encoding gene from Synechocystis sp. strain PCC6803 was a specific enzyme activity detected of 1.5 mU/mg protein. In one of these transformants was both water-soluble and insoluble cyanophycin detected. The water-soluble fraction formed the major fraction and accounted for 0.5% of the dry weight. The water-insoluble CGP was produced in trace amounts. The amino acid composition of the water-soluble form was determined and constitutes of equimolar amounts of arginine and aspartic acid.

  18. Functional Analysis of the Fusarielin Biosynthetic Gene Cluster

    Directory of Open Access Journals (Sweden)

    Aida Droce

    2016-12-01

    Full Text Available Fusarielins are polyketides with a decalin core produced by various species of Aspergillus and Fusarium. Although the responsible gene cluster has been identified, the biosynthetic pathway remains to be elucidated. In the present study, members of the gene cluster were deleted individually in a Fusarium graminearum strain overexpressing the local transcription factor. The results suggest that a trans-acting enoyl reductase (FSL5 assists the polyketide synthase FSL1 in biosynthesis of a polyketide product, which is released by hydrolysis by a trans-acting thioesterase (FSL2. Deletion of the epimerase (FSL3 resulted in accumulation of an unstable compound, which could be the released product. A novel compound, named prefusarielin, accumulated in the deletion mutant of the cytochrome P450 monooxygenase FSL4. Unlike the known fusarielins from Fusarium, this compound does not contain oxygenized decalin rings, suggesting that FSL4 is responsible for the oxygenation.

  19. The Schizosaccharomyces pombe mam1 gene encodes an ABC transporter mediating secretion of M-factor

    DEFF Research Database (Denmark)

    Christensen, P U; Davey, William John; Nielsen, O

    1997-01-01

    In the fission yeast Schizosaccharomyces pombe, cells of opposite mating type communicate via diffusible peptide pheromones prior to mating. We have cloned the S. pombe mam1 gene, which encodes a 1336-amino acid protein belonging to the ATP-binding cassette (ABC) superfamily. The mam1 gene is only...... expressed in M cells and the gene product is responsible for the secretion of the mating pheromone. M-factor, a nonapeptide that is S-farnesylated and carboxy-methylated on its C-terminal cysteine residue. The predicted Mam1 protein is highly homologous to mammalian multiple drug-resistance proteins...... and to the Saccharomyces cerevisiae STE6 gene product, which mediates export of a-factor mating pheromone. We show that STE6 can also mediate secretion of M-factor in S. pombe....

  20. Evaluation of clustering algorithms for gene expression data using gene ontology annotations.

    Science.gov (United States)

    Ma, Ning; Zhang, Zheng-Guo

    2012-09-01

    Clustering is a useful exploratory technique for interpreting gene expression data to reveal groups of genes sharing common functional attributes. Biologists frequently face the problem of choosing an appropriate algorithm. We aimed to provide a standalone, easily accessible and biologically oriented criterion for expression data clustering evaluation. An external criterion utilizing annotation based similarities between genes is proposed in this work. Gene ontology information is employed as the annotation source. Comparisons among six widely used clustering algorithms over various types of gene expression data sets were carried out based on the criterion proposed. The rank of these algorithms given by the criterion coincides with our common knowledge. Single-linkage has significantly poorer performance, even worse than the random algorithm. Ward's method archives the best performance in most cases. The criterion proposed has a strong ability to distinguish among different clustering algorithms with different distance measurements. It is also demonstrated that analyzing main contributors of the criterion may offer some guidelines in finding local compact clusters. As an addition, we suggest using Ward's algorithm for gene expression data analysis.

  1. Transcription Factors Encoded on Core and Accessory Chromosomes of Fusarium oxysporum Induce Expression of Effector Genes

    Science.gov (United States)

    van der Does, H. Charlotte; Schmidt, Sarah M.; Langereis, Léon; Hughes, Timothy R.

    2016-01-01

    Proteins secreted by pathogens during host colonization largely determine the outcome of pathogen-host interactions and are commonly called ‘effectors’. In fungal plant pathogens, coordinated transcriptional up-regulation of effector genes is a key feature of pathogenesis and effectors are often encoded in genomic regions with distinct repeat content, histone code and rate of evolution. In the tomato pathogen Fusarium oxysporum f. sp. lycopersici (Fol), effector genes reside on one of four accessory chromosomes, known as the ‘pathogenicity’ chromosome, which can be exchanged between strains through horizontal transfer. The three other accessory chromosomes in the Fol reference strain may also be important for virulence towards tomato. Expression of effector genes in Fol is highly up-regulated upon infection and requires Sge1, a transcription factor encoded on the core genome. Interestingly, the pathogenicity chromosome itself contains 13 predicted transcription factor genes and for all except one, there is a homolog on the core genome. We determined DNA binding specificity for nine transcription factors using oligonucleotide arrays. The binding sites for homologous transcription factors were highly similar, suggesting that extensive neofunctionalization of DNA binding specificity has not occurred. Several DNA binding sites are enriched on accessory chromosomes, and expression of FTF1, its core homolog FTF2 and SGE1 from a constitutive promoter can induce expression of effector genes. The DNA binding sites of only these three transcription factors are enriched among genes up-regulated during infection. We further show that Ftf1, Ftf2 and Sge1 can activate transcription from their binding sites in yeast. RNAseq analysis revealed that in strains with constitutive expression of FTF1, FTF2 or SGE1, expression of a similar set of plant-responsive genes on the pathogenicity chromosome is induced, including most effector genes. We conclude that the Fol

  2. Ancient Expansion of the Hox Cluster in Lepidoptera Generated Four Homeobox Genes Implicated in Extra-Embryonic Tissue Formation

    Science.gov (United States)

    Taylor, William R.; Gibbs, Melanie; Breuker, Casper J.; Holland, Peter W. H.

    2014-01-01

    Gene duplications within the conserved Hox cluster are rare in animal evolution, but in Lepidoptera an array of divergent Hox-related genes (Shx genes) has been reported between pb and zen. Here, we use genome sequencing of five lepidopteran species (Polygonia c-album, Pararge aegeria, Callimorpha dominula, Cameraria ohridella, Hepialus sylvina) plus a caddisfly outgroup (Glyphotaelius pellucidus) to trace the evolution of the lepidopteran Shx genes. We demonstrate that Shx genes originated by tandem duplication of zen early in the evolution of large clade Ditrysia; Shx are not found in a caddisfly and a member of the basally diverging Hepialidae (swift moths). Four distinct Shx genes were generated early in ditrysian evolution, and were stably retained in all descendent Lepidoptera except the silkmoth which has additional duplications. Despite extensive sequence divergence, molecular modelling indicates that all four Shx genes have the potential to encode stable homeodomains. The four Shx genes have distinct spatiotemporal expression patterns in early development of the Speckled Wood butterfly (Pararge aegeria), with ShxC demarcating the future sites of extraembryonic tissue formation via strikingly localised maternal RNA in the oocyte. All four genes are also expressed in presumptive serosal cells, prior to the onset of zen expression. Lepidopteran Shx genes represent an unusual example of Hox cluster expansion and integration of novel genes into ancient developmental regulatory networks. PMID:25340822

  3. Genes regulation encoding ADP/ATP carrier in yeasts Saccharomyces cerevisiae and Candida parapsilosis

    International Nuclear Information System (INIS)

    Nebohacova, M.

    2000-01-01

    Genes encoding a mitochondrial ADP/ATP carrier (AAC) in yeast Saccharomyces cerevisiae and Candida parapsilosis were investigated. AAC2 is coding for the major AAC isoform in S. cerevisiae. We suggest that AAC2 is a member of a syn-expression group of genes encoding oxidative phosphorylation proteins. Within our previous studies on the regulation of the AAC2 transcription an UAS (-393/-268) was identified that is essential for the expression of this gene. Two functional regulatory cis-elements are located within this UAS -binding sites for an ABFl factor and for HAP2/3/4/5 heteromeric complex. We examined relative contributions and mutual interactions of the ABFl and HAP2/3/4/5 factors in the activation of transcription from the UAS of the AAC2 gene. The whole UAS was dissected into smaller sub-fragments and tested for (i) the ability to form DNA-protein complexes with cellular proteins in vitro, (ii) the ability to confer heterologous expression using AAC3 gene lacking its own promoter, and (iii) the expression of AAC3-lacZ fusion instead of intact AAC3 gene. The obtained results demonstrated that: a) The whole UAS as well as sub-fragment containing only ABF1-binding site are able to form DNA-protein complexes with cellular proteins in oxygen- and heme- dependent manner. The experiments with antibody against the ABF1 showed that the ABF1 factor is one of the proteins binding to AAC2 promoter. We have been unsuccessful to prove the binding of cellular proteins to the HAP2/3/4/5-binding site. However, the presence of HAP2/3/4/5-binding site is necessary to drive a binding of cellular proteins to the ABF1-binding site in carbon source-dependent manner. b) The presence of both ABF1- and HAP2/3/4/5-binding sites and original spacing between them is necessary to confer the growth of Aaac2 mutant strain on non- fermentable carbon source when put in front of AAC3 gene introduced on centromeric vector to Aaac2 mutant strain. c) For the activation of AAC3-lacZ expression on

  4. Mutagenesis in sequence encoding of human factor VII for gene therapy of hemophilia

    Directory of Open Access Journals (Sweden)

    B Kazemi

    2009-12-01

    Full Text Available "nBackground: Current treatment of hemophilia which is one of the most common bleeding disorders, involves replacement therapy using concentrates of FVIII and FIX .However, these concentrates have been associated with viral infections and thromboembolic complications and development of antibodies. "nThe use of recombinant human factor VII (rhFVII is effective  for the treatment of patients with  hemophilia A or B, who develop antibodies ( referred as inhibitors against  replacement therapy , because it induces coagulation independent of FVIII and FIX. However, its short half-life and high cost have limited its use. One potential solution to this problem may be the use of FVIIa gene transfer, which would attain continuing therapeutic levels of expression from a single injection. The aim of this study was to engineer a novel hFVII (human FVII gene containing a cleavage site for the intracellular protease and furin, by PCR mutagenesis "nMethods: The sequence encoding light and heavy chains of hFVII, were amplified by using hFVII/pTZ57R and specific primers, separately. The PCR products were cloned in pTZ57R vector. "nResults and discussion: Cloning was confirmed by restriction analysis or PCR amplification using specific primers and plasmid universal primers. Mutagenesis of sequence encoding light and heavy chain was confirmed by restriction enzyme. "nConclusion: In the present study, it was provided recombinant plasmids based on mutant form of DNA encoding light and heavy chains.  Joining mutant form of DNA encoding light chain with mutant heavy chain led to a new variant of hFVII. This variant can be activated by furin and an increase in the proportion of activated form of FVII. This mutant form of hFVII may be used for gene therapy of hemophilia.

  5. Dispersed Benzoxazinone Gene Cluster: Molecular Characterization and Chromosomal Localization of Glucosyltransferase and Glucosidase Genes in Wheat and Rye1[W

    Science.gov (United States)

    Sue, Masayuki; Nakamura, Chihiro; Nomura, Taiji

    2011-01-01

    Benzoxazinones (Bxs) are major defensive secondary metabolites in wheat (Triticum aestivum), rye (Secale cereale), and maize (Zea mays). Here, we identified full sets of homeologous and paralogous genes encoding Bx glucosyltransferase (GT) and Bx-glucoside glucosidase (Glu) in hexaploid wheat (2n = 6x = 42; AABBDD). Four GT loci (TaGTa–TaGTd) were mapped on chromosomes 7A, 7B (two loci), and 7D, whereas four glu1 loci (Taglu1a–Taglu1d) were on chromosomes 2A, 2B (two loci), and 2D. Transcript levels differed greatly among the four loci; B-genome loci of both TaGT and Taglu1 genes were preferentially transcribed. Catalytic properties of the enzyme encoded by each homeolog/paralog also differed despite high levels of identity among amino acid sequences. The predominant contribution of the B genome to GT and Glu reactions was revealed, as observed previously for the five Bx biosynthetic genes, TaBx1 to TaBx5, which are separately located on homeologous groups 4 and 5 chromosomes. In rye, where the ScBx1 to ScBx5 genes are dispersed to chromosomes 7R and 5R, ScGT and Scglu were located separately on chromosomes 4R and 2R, respectively. The dispersal of Bx-pathway loci to four distinct chromosomes in hexaploid wheat and rye suggests that the clustering of Bx-pathway genes, as found in maize, is not essential for coordinated transcription. On the other hand, barley (Hordeum vulgare) was found to lack the orthologous GT and glu loci like the Bx1 to Bx5 loci despite its close phylogenetic relationship with wheat and rye. These results contribute to our understanding of the evolutionary processes that the Bx-pathway loci have undergone in grasses. PMID:21875895

  6. Dispersed benzoxazinone gene cluster: molecular characterization and chromosomal localization of glucosyltransferase and glucosidase genes in wheat and rye.

    Science.gov (United States)

    Sue, Masayuki; Nakamura, Chihiro; Nomura, Taiji

    2011-11-01

    Benzoxazinones (Bxs) are major defensive secondary metabolites in wheat (Triticum aestivum), rye (Secale cereale), and maize (Zea mays). Here, we identified full sets of homeologous and paralogous genes encoding Bx glucosyltransferase (GT) and Bx-glucoside glucosidase (Glu) in hexaploid wheat (2n = 6x = 42; AABBDD). Four GT loci (TaGTa-TaGTd) were mapped on chromosomes 7A, 7B (two loci), and 7D, whereas four glu1 loci (Taglu1a-Taglu1d) were on chromosomes 2A, 2B (two loci), and 2D. Transcript levels differed greatly among the four loci; B-genome loci of both TaGT and Taglu1 genes were preferentially transcribed. Catalytic properties of the enzyme encoded by each homeolog/paralog also differed despite high levels of identity among amino acid sequences. The predominant contribution of the B genome to GT and Glu reactions was revealed, as observed previously for the five Bx biosynthetic genes, TaBx1 to TaBx5, which are separately located on homeologous groups 4 and 5 chromosomes. In rye, where the ScBx1 to ScBx5 genes are dispersed to chromosomes 7R and 5R, ScGT and Scglu were located separately on chromosomes 4R and 2R, respectively. The dispersal of Bx-pathway loci to four distinct chromosomes in hexaploid wheat and rye suggests that the clustering of Bx-pathway genes, as found in maize, is not essential for coordinated transcription. On the other hand, barley (Hordeum vulgare) was found to lack the orthologous GT and glu loci like the Bx1 to Bx5 loci despite its close phylogenetic relationship with wheat and rye. These results contribute to our understanding of the evolutionary processes that the Bx-pathway loci have undergone in grasses.

  7. Transcriptome Analysis Revealed Highly Expressed Genes Encoding Secondary Metabolite Pathways and Small Cysteine-Rich Proteins in the Sclerotium of Lignosus rhinocerotis.

    Directory of Open Access Journals (Sweden)

    Hui-Yeng Y Yap

    Full Text Available Lignosus rhinocerotis (Cooke Ryvarden (tiger milk mushroom has long been known for its nutritional and medicinal benefits among the local communities in Southeast Asia. However, the molecular and genetic basis of its medicinal and nutraceutical properties at transcriptional level have not been investigated. In this study, the transcriptome of L. rhinocerotis sclerotium, the part with medicinal value, was analyzed using high-throughput Illumina HiSeqTM platform with good sequencing quality and alignment results. A total of 3,673, 117, and 59,649 events of alternative splicing, novel transcripts, and SNP variation were found to enrich its current genome database. A large number of transcripts were expressed and involved in the processing of gene information and carbohydrate metabolism. A few highly expressed genes encoding the cysteine-rich cerato-platanin, hydrophobins, and sugar-binding lectins were identified and their possible roles in L. rhinocerotis were discussed. Genes encoding enzymes involved in the biosynthesis of glucans, six gene clusters encoding four terpene synthases and one each of non-ribosomal peptide synthetase and polyketide synthase, and 109 transcribed cytochrome P450 sequences were also identified in the transcriptome. The data from this study forms a valuable foundation for future research in the exploitation of this mushroom in pharmacological and industrial applications.

  8. Identification and characterization of a gene encoding for a nucleotidase from Phaseolus vulgaris.

    Science.gov (United States)

    Cabello-Díaz, Juan Miguel; Gálvez-Valdivieso, Gregorio; Caballo, Cristina; Lambert, Rocío; Quiles, Francisco Antonio; Pineda, Manuel; Piedras, Pedro

    2015-08-01

    Nucleotidases are phosphatases that catalyze the removal of phosphate from nucleotides, compounds with an important role in plant metabolism. A phosphatase enzyme, with high affinity for nucleotides monophosphate previously identified and purified in embryonic axes from French bean, has been analyzed by MALDI TOF/TOF and two internal peptides have been obtained. The information of these peptide sequences has been used to search in the genome database and only a candidate gene that encodes for the phosphatase was identified (PvNTD1). The putative protein contains the conserved domains (motif I-IV) for haloacid dehalogenase-like hydrolases superfamily. The residues involved in the catalytic activity are also conserved. A recombinant protein overexpressed in Escherichia coli has shown molybdate resistant phosphatase activity with nucleosides monophosphate as substrate, confirming that the identified gene encodes for the phosphatase with high affinity for nucleotides purified in French bean embryonic axes. The activity of the purified protein was inhibited by adenosine. The expression of PvNTD1 gene was induced at the specific moment of radicle protrusion in embryonic axes. The gene was also highly expressed in young leaves whereas the level of expression in mature tissues was minimal. Copyright © 2015 The Authors. Published by Elsevier GmbH.. All rights reserved.

  9. Isolation and characterization of the gene encoding the starch debranching enzyme limit dextrinase from germinating barley

    DEFF Research Database (Denmark)

    Kristensen, Michael; Lok, Finn; Planchot, Véronique

    1999-01-01

    The gene encoding the starch debranching enzyme limit dextrinase, LD, from barley (Hordeum vulgare), was isolated from a genomic phage library using a barley cDNA clone as probe. The gene encodes a protein of 904 amino acid residues with a calculated molecular mass of 98.6 kDa. This is in agreement...... with a value of 105 kDa estimated by SDS;;PAGE, The coding sequence is interrupted by 26 introns varying in length from 93 bp to 825 bp. The 27 exons vary in length from 53 bp to 197 bp. Southern blot analysis shows that the limit dextrinase gene is present as a single copy in the barley genome. Gene...... expression is high during germination and the steady state transcription level reaches a maximum at day 5 of germination. The deduced amino acid sequence corresponds to the protein sequence of limit dextrinase purified from germinating malt, as determined by automated N-terminal sequencing of tryptic...

  10. Large-scale analysis of NBS domain-encoding resistance gene analogs in Triticeae

    Directory of Open Access Journals (Sweden)

    Dhia Bouktila

    2014-09-01

    Full Text Available Proteins containing nucleotide binding sites (NBS encoded by plant resistance genes play an important role in the response of plants to a wide array of pathogens. In this paper, an in silico search was conducted in order to identify and characterize members of NBS-encoding gene family in the tribe of Triticeae. A final dataset of 199 sequences was obtained by four search methods. Motif analysis confirmed the general structural organization of the NBS domain in cereals, characterized by the presence of the six commonly conserved motifs: P-loop, RNBS-A, Kinase-2, Kinase-3a, RNBS-C and GLPL. We revealed the existence of 11 distinct distribution patterns of these motifs along the NBS domain. Four additional conserved motifs were shown to be significantly present in all 199 sequences. Phylogenetic analyses, based on genetic distance and parsimony, revealed a significant overlap between Triticeae sequences and Coiled coil-Nucleotide binding site-Leucine rich repeat (CNL-type functional genes from monocotyledons. Furthermore, several Triticeae sequences belonged to clades containing functional homologs from non Triticeae species, which has allowed for these sequences to be functionally assigned. The findings reported, in this study, will provide a strong groundwork for the isolation of candidate R-genes in Triticeae crops and the understanding of their evolution.

  11. Isolation and characterization of the gene encoding the starch debranching enzyme limit dextrinase from germinating barley

    DEFF Research Database (Denmark)

    Kristensen, Michael; Lok, Finn; Planchot, Véronique

    1999-01-01

    with a value of 105 kDa estimated by SDS;;PAGE, The coding sequence is interrupted by 26 introns varying in length from 93 bp to 825 bp. The 27 exons vary in length from 53 bp to 197 bp. Southern blot analysis shows that the limit dextrinase gene is present as a single copy in the barley genome. Gene......The gene encoding the starch debranching enzyme limit dextrinase, LD, from barley (Hordeum vulgare), was isolated from a genomic phage library using a barley cDNA clone as probe. The gene encodes a protein of 904 amino acid residues with a calculated molecular mass of 98.6 kDa. This is in agreement...... expression is high during germination and the steady state transcription level reaches a maximum at day 5 of germination. The deduced amino acid sequence corresponds to the protein sequence of limit dextrinase purified from germinating malt, as determined by automated N-terminal sequencing of tryptic...

  12. A corm-specific gene encodes tarin, a major globulin of taro (Colocasia esculenta L. Schott).

    Science.gov (United States)

    Bezerra, I C; Castro, L A; Neshich, G; de Almeida, E R; de Sá, M F; Mello, L V; Monte-Neshich, D C

    1995-04-01

    A gene encoding a globulin from a major taro (Colocasia esculenta L. Schott) corm protein family, tarin (G1, ca. 28 kDa) was isolated from a lambda Charon 35 library, using a cDNA derived from a highly abundant corm-specific mRNA, as probe. The gene, named tar1, and the corresponding cDNA were characterized and compared. No introns were found. The major transcription start site was determined by primer extension analysis. The gene has an open reading frame (ORF) of 765 bp, and the deduced amino acid sequence indicated a precursor polypeptide of 255 residues that is post-translationally processed into two subunits of about 12.5 kDa each. The deduced protein is 45% homologous to curculin, a sweet-tasting protein found in the fruit pulp of Curculigo latifolia and 40% homologous to a mannose-binding lectin from Galanthus nivalis. Significant similarity was also found at the nucleic acid sequence level with genes encoding lectins from plant species of the Amaryllidaceae and Lilliaceae families.

  13. [Cloning and structure of gene encoded alpha-latrocrustoxin from the Black widow spider venom].

    Science.gov (United States)

    Danilevich, V N; Luk'ianov, S A; Grishin, E V

    1999-07-01

    The primary structure of the crusta gene encoding alpha-latrocrustoxin (alpha-LCT), a high molecular mass neurotoxin specific to crustaceans, was determined in the black widow spider Latrodectus mactans tredicimguttatus genome. The total length of the sequenced DNA was 4693 bp. The structural part of the black widow spider chromosome gene encoding alpha-LCT does not contain introns. The sequenced DNA contains a single extended open reading frame (4185 bp) and encodes a protein precursor of alpha-LCT, comprising 1395 aa. We assume the Met residue at position -10 relative to the N-terminal residue of Glu1 of the mature toxin to be the first one in the protein precursor. The calculated molecular mass of the precursor (156147 Da) exceeds that of the mature toxin by approximately 30 kDa. These data are in agreement with the notion that over the course of maturation the protein precursor undergoes double processing--cleavage of a decapeptide from the N-terminal part and of a approximately 200-aa fragment from the C-terminal part. alpha-LCT displayed a number of imperfect ankyrin-like repeats and areas of structural homology with earlier studied latrotoxins; the highest homology degree (62%) was revealed with alpha-latroinsectotoxin (alpha-LIT).

  14. Insights into the evolutionary origins of clostridial neurotoxins from analysis of the Clostridium botulinum strain A neurotoxin gene cluster.

    Science.gov (United States)

    Doxey, Andrew C; Lynch, Michael D J; Müller, Kirsten M; Meiering, Elizabeth M; McConkey, Brendan J

    2008-11-14

    Clostridial neurotoxins (CNTs) are the most deadly toxins known and causal agents of botulism and tetanus neuroparalytic diseases. Despite considerable progress in understanding CNT structure and function, the evolutionary origins of CNTs remain a mystery as they are unique to Clostridium and possess a sequence and structural architecture distinct from other protein families. Uncovering the origins of CNTs would be a significant contribution to our understanding of how pathogens evolve and generate novel toxin families. The C. botulinum strain A genome was examined for potential homologues of CNTs. A key link was identified between the neurotoxin and the flagellin gene (CBO0798) located immediately upstream of the BoNT/A neurotoxin gene cluster. This flagellin sequence displayed the strongest sequence similarity to the neurotoxin and NTNH homologue out of all proteins encoded within C. botulinum strain A. The CBO0798 gene contains a unique hypervariable region, which in closely related flagellins encodes a collagenase-like domain. Remarkably, these collagenase-containing flagellins were found to possess the characteristic HEXXH zinc-protease motif responsible for the neurotoxin's endopeptidase activity. Additional links to collagenase-related sequences and functions were detected by further analysis of CNTs and surrounding genes, including sequence similarities to collagen-adhesion domains and collagenases. Furthermore, the neurotoxin's HCRn domain was found to exhibit both structural and sequence similarity to eukaryotic collagen jelly-roll domains. Multiple lines of evidence suggest that the neurotoxin and adjacent genes evolved from an ancestral collagenase-like gene cluster, linking CNTs to another major family of clostridial proteolytic toxins. Duplication, reshuffling and assembly of neighboring genes within the BoNT/A neurotoxin gene cluster may have lead to the neurotoxin's unique architecture. This work provides new insights into the evolution of C

  15. Clusters of orthologous genes for 41 archaeal genomes and implications for evolutionary genomics of archaea

    Directory of Open Access Journals (Sweden)

    Wolf Yuri I

    2007-11-01

    Full Text Available Abstract Background An evolutionary classification of genes from sequenced genomes that distinguishes between orthologs and paralogs is indispensable for genome annotation and evolutionary reconstruction. Shortly after multiple genome sequences of bacteria, archaea, and unicellular eukaryotes became available, an attempt on such a classification was implemented in Clusters of Orthologous Groups of proteins (COGs. Rapid accumulation of genome sequences creates opportunities for refining COGs but also represents a challenge because of error amplification. One of the practical strategies involves construction of refined COGs for phylogenetically compact subsets of genomes. Results New Archaeal Clusters of Orthologous Genes (arCOGs were constructed for 41 archaeal genomes (13 Crenarchaeota, 27 Euryarchaeota and one Nanoarchaeon using an improved procedure that employs a similarity tree between smaller, group-specific clusters, semi-automatically partitions orthology domains in multidomain proteins, and uses profile searches for identification of remote orthologs. The annotation of arCOGs is a consensus between three assignments based on the COGs, the CDD database, and the annotations of homologs in the NR database. The 7538 arCOGs, on average, cover ~88% of the genes in a genome compared to a ~76% coverage in COGs. The finer granularity of ortholog identification in the arCOGs is apparent from the fact that 4538 arCOGs correspond to 2362 COGs; ~40% of the arCOGs are new. The archaeal gene core (protein-coding genes found in all 41 genome consists of 166 arCOGs. The arCOGs were used to reconstruct gene loss and gene gain events during archaeal evolution and gene sets of ancestral forms. The Last Archaeal Common Ancestor (LACA is conservatively estimated to possess 996 genes compared to 1245 and 1335 genes for the last common ancestors of Crenarchaeota and Euryarchaeota, respectively. It is inferred that LACA was a chemoautotrophic hyperthermophile

  16. A Functional Bikaverin Biosynthesis Gene Cluster in Rare Strains of Botrytis cinerea Is Positively Controlled by VELVET

    Science.gov (United States)

    Schumacher, Julia; Gautier, Angélique; Morgant, Guillaume; Studt, Lena; Ducrot, Paul-Henri; Le Pêcheur, Pascal; Azeddine, Saad; Fillinger, Sabine; Leroux, Pierre; Tudzynski, Bettina; Viaud, Muriel

    2013-01-01

    The gene cluster responsible for the biosynthesis of the red polyketidic pigment bikaverin has only been characterized in Fusarium ssp. so far. Recently, a highly homologous but incomplete and nonfunctional bikaverin cluster has been found in the genome of the unrelated phytopathogenic fungus Botrytis cinerea. In this study, we provided evidence that rare B. cinerea strains such as 1750 have a complete and functional cluster comprising the six genes orthologous to Fusarium fujikuroi ffbik1-ffbik6 and do produce bikaverin. Phylogenetic analysis confirmed that the whole cluster was acquired from Fusarium through a horizontal gene transfer (HGT). In the bikaverin-nonproducing strain B05.10, the genes encoding bikaverin biosynthesis enzymes are nonfunctional due to deleterious mutations (bcbik2-3) or missing (bcbik1) but interestingly, the genes encoding the regulatory proteins BcBIK4 and BcBIK5 do not harbor deleterious mutations which suggests that they may still be functional. Heterologous complementation of the F. fujikuroi Δffbik4 mutant confirmed that bcbik4 of strain B05.10 is indeed fully functional. Deletion of bcvel1 in the pink strain 1750 resulted in loss of bikaverin and overproduction of melanin indicating that the VELVET protein BcVEL1 regulates the biosynthesis of the two pigments in an opposite manner. Although strain 1750 itself expresses a truncated BcVEL1 protein (100 instead of 575 aa) that is nonfunctional with regard to sclerotia formation, virulence and oxalic acid formation, it is sufficient to regulate pigment biosynthesis (bikaverin and melanin) and fenhexamid HydR2 type of resistance. Finally, a genetic cross between strain 1750 and a bikaverin-nonproducing strain sensitive to fenhexamid revealed that the functional bikaverin cluster is genetically linked to the HydR2 locus. PMID:23308280

  17. Relationships between protein-encoding gene abundance and corresponding process are commonly assumed yet rarely observed

    Science.gov (United States)

    Rocca, Jennifer D.; Hall, Edward K.; Lennon, Jay T.; Evans, Sarah E.; Waldrop, Mark P.; Cotner, James B.; Nemergut, Diana R.; Graham, Emily B.; Wallenstein, Matthew D.

    2015-01-01

    For any enzyme-catalyzed reaction to occur, the corresponding protein-encoding genes and transcripts are necessary prerequisites. Thus, a positive relationship between the abundance of gene or transcripts and corresponding process rates is often assumed. To test this assumption, we conducted a meta-analysis of the relationships between gene and/or transcript abundances and corresponding process rates. We identified 415 studies that quantified the abundance of genes or transcripts for enzymes involved in carbon or nitrogen cycling. However, in only 59 of these manuscripts did the authors report both gene or transcript abundance and rates of the appropriate process. We found that within studies there was a significant but weak positive relationship between gene abundance and the corresponding process. Correlations were not strengthened by accounting for habitat type, differences among genes or reaction products versus reactants, suggesting that other ecological and methodological factors may affect the strength of this relationship. Our findings highlight the need for fundamental research on the factors that control transcription, translation and enzyme function in natural systems to better link genomic and transcriptomic data to ecosystem processes.

  18. Atypical DNA methylation of genes encoding cysteine-rich peptides in Arabidopsis thaliana

    Directory of Open Access Journals (Sweden)

    You Wanhui

    2012-04-01

    Full Text Available Abstract Background In plants, transposons and non-protein-coding repeats are epigenetically silenced by CG and non-CG methylation. This pattern of methylation is mediated in part by small RNAs and two specialized RNA polymerases, termed Pol IV and Pol V, in a process called RNA-directed DNA methylation. By contrast, many protein-coding genes transcribed by Pol II contain in their gene bodies exclusively CG methylation that is independent of small RNAs and Pol IV/Pol V activities. It is unclear how the different methylation machineries distinguish between transposons and genes. Here we report on a group of atypical genes that display in their coding region a transposon-like methylation pattern, which is associated with gene silencing in sporophytic tissues. Results We performed a methylation-sensitive amplification polymorphism analysis to search for targets of RNA-directed DNA methylation in Arabidopsis thaliana and identified several members of a gene family encoding cysteine-rich peptides (CRPs. In leaves, the CRP genes are silent and their coding regions contain dense, transposon-like methylation in CG, CHG and CHH contexts, which depends partly on the Pol IV/Pol V pathway and small RNAs. Methylation in the coding region is reduced, however, in the synergid cells of the female gametophyte, where the CRP genes are specifically expressed. Further demonstrating that expressed CRP genes lack gene body methylation, a CRP4-GFP fusion gene under the control of the constitutive 35 S promoter remains unmethylated in leaves and is transcribed to produce a translatable mRNA. By contrast, a CRP4-GFP fusion gene under the control of a CRP4 promoter fragment acquires CG and non-CG methylation in the CRP coding region in leaves similar to the silent endogenous CRP4 gene. Conclusions Unlike CG methylation in gene bodies, which does not dramatically affect Pol II transcription, combined CG and non-CG methylation in CRP coding regions is likely to

  19. Surfactant Protein-D-Encoding Gene Variant Polymorphisms Are Linked to Respiratory Outcome in Premature Infants

    DEFF Research Database (Denmark)

    Sorensen, Grith Lykke; Dahl, Marianne; Tan, Qihua

    2014-01-01

    OBJECTIVE: Associations between the genetic variation within or downstream of the surfactant protein-D-encoding gene (SFTPD), which encodes the collectin surfactant protein-D (SP-D) and may lead to respiratory distress syndrome or bronchopulmonary dysplasia, recently were reported. Our aim...... were used to associate genetic variation to SP-D, respiratory distress (RD), oxygen requirement, and respiratory support. RESULTS: The 5'-upstream SFTPD SNP rs1923534 and the 3 structural SNPs rs721917, rs2243639, and rs3088308 were associated with the SP-D level. The same SNPs were associated with RD......, a requirement for supplemental oxygen, and a requirement for respiratory support. Haplotype analyses identified 3 haplotypes that included the minor alleles of rs1923534, rs721917, and rs3088308 that exhibited highly significant associations with decreased SP-D levels and decreased ORs for RD, oxygen...

  20. Isolation and sequence analysis of the gene encoding triose phosphate isomerase from Zygosaccharomyces bailii.

    Science.gov (United States)

    Merico, A; Rodrigues, F; Côrte-Real, M; Porro, D; Ranzi, B M; Compagno, C

    2001-06-30

    The ZbTPI1 gene encoding triose phosphate isomerase (TIM) was cloned from a Zygosaccharomyces bailii genomic library by complementation of the Saccharomyces cerevisiae tpi1 mutant strain. The nucleotide sequence of a 1.5 kb fragment showed an open reading frame (ORF) of 746 bp, encoding a protein of 248 amino acid residues. The deduced amino acid sequence shares a high degree of homology with TIMs from other yeast species, including some highly conserved regions. The analysis of the promoter sequence of the ZbTPI1 revealed the presence of putative motifs known to have regulatory functions in S. cerevisiae. The GenBank Accession No. of ZbTPI1 is AF325852. Copyright 2001 John Wiley & Sons, Ltd.

  1. Plasmodium falciparum associated with severe childhood malaria preferentially expresses PfEMP1 encoded by group A var genes.

    NARCIS (Netherlands)

    Jensen, A.; Magistrado, P.; Sharp, S.; Joergensen, L.; Lavstsen, T.; Chiucchiuini, A.; Salanti, A.; Vestergaard, L.S.; Lusingu, J.P.; Hermsen, R.; Sauerwein, R.W.; Christensen, J.; Nielsen, M.A.; Hviid, L.; Sutherland, C.J.; Staalsoe, T.; Theander, T.G.

    2004-01-01

    Parasite-encoded variant surface antigens (VSAs) like the var gene-encoded Plasmodium falciparum erythrocyte membrane protein 1 (PfEMP1) family are responsible for antigenic variation and infected red blood cell (RBC) cytoadhesion in P. falciparum malaria. Parasites causing severe malaria in

  2. Identification and characterization of the Vibrio anguillarum prtV gene encoding a new metalloprotease

    Science.gov (United States)

    Mo, Zhaolan; Guo, Dongsheng; Mao, Yunxiang; Ye, Xuhong; Zou, Yuxia; Xiao, Peng; Hao, Bin

    2010-01-01

    We cloned and sequenced a prtV-like gene from Vibrio anguillarum M3 strain. This prtV gene encodes a putative protein of 918 amino acids, and is highly homologous to the V. cholerae prtV gene. We found that a prtV insertion mutant strain displayed lower gelatinase activity on gelatin agar, lower protease activity against azocasein, and lower activity for four glycosidases. This prtV mutant strain also had increased activity for two esterases in its extracellular products, as analyzed by the API ZYM system. In addition, the prtV mutant strain exhibited decreased growth in turbot intestinal mucus and reduced hemolytic activity on turbot erythrocytes. Infection experiments showed that the LD50 of the prtV mutant strain increased by at least 1 log compared to the wild-type in turbot fish. We propose that prtV plays an important role in the pathogenesis of V. anguillarum.

  3. Genetic variability in the sable (Martes zibellina L.) with respect to genes encoding blood proteins

    Energy Technology Data Exchange (ETDEWEB)

    Kashtanov, S.N. [Vavilov Institute of General Genetics, Moscow (Russian Federation); Kazakova, T.I. [Afanas`ev Scientific Research Institute for Breeding of Fur-Bearing Animals, Moscow (Russian Federation)

    1995-02-01

    Electrophoresis of blood proteins was used to determine, for the first time, the level of genetic variability of certain loci in the sable (Martes zibellina L., Mustelidae). Variation of 23 blood proteins encoded by 25 genes was analyzed. Polymorphism was revealed in six genes. The level of heterozygosity was estimated at 0.069; the proportion of polymorphic loci was 24%. Data on the history of the sable population maintained at the farm, on geographical distribution of natural sable populations, and on the number of animals selected for reproduction in captivity is presented. The great number of animals studies and the extensive range of natural sable populations, on the basis of which the population maintained in captivity was obtained, suggest that the results of this work can be used for estimating the variability of the gene pool of sable as a species. 9 refs., 2 figs., 1 tab.

  4. A split and rearranged nuclear gene encoding the iron-sulfur subunit of mitochondrial succinate dehydrogenase in Euglenozoa

    Directory of Open Access Journals (Sweden)

    Gray Michael W

    2009-02-01

    Full Text Available Abstract Background Analyses based on phylogenetic and ultrastructural data have suggested that euglenids (such as Euglena gracilis, trypanosomatids and diplonemids are members of a monophyletic lineage termed Euglenozoa. However, many uncertainties are associated with phylogenetic reconstructions for ancient and rapidly evolving groups; thus, rare genomic characters become increasingly important in reinforcing inferred phylogenetic relationships. Findings We discovered that the iron-sulfur subunit (SdhB of mitochondrial succinate dehydrogenase is encoded by a split and rearranged nuclear gene in Euglena gracilis and trypanosomatids, an example of a rare genomic character. The two subgenic modules are transcribed independently and the resulting mRNAs appear to be independently translated, with the two protein products imported into mitochondria, based on the presence of predicted mitochondrial targeting peptides. Although the inferred protein sequences are in general very divergent from those of other organisms, all of the required iron-sulfur cluster-coordinating residues are present. Moreover, the discontinuity in the euglenozoan SdhB sequence occurs between the two domains of a typical, covalently continuous SdhB, consistent with the inference that the euglenozoan 'half' proteins are functional. Conclusion The discovery of this unique molecular marker provides evidence for the monophyly of Euglenozoa that is independent of evolutionary models. Our results pose questions about the origin and timing of this novel gene arrangement and the structure and function of euglenozoan SdhB.

  5. Human coronavirus 229E encodes a single ORF4 protein between the spike and the envelope genes

    NARCIS (Netherlands)

    Dijkman, Ronald; Jebbink, Maarten F.; Wilbrink, Berry; Pyrc, Krzysztof; Zaaijer, Hans L.; Minor, Philip D.; Franklin, Sally; Berkhout, Ben; Thiel, Volker; van der Hoek, Lia

    2006-01-01

    BACKGROUND: The genome of coronaviruses contains structural and non-structural genes, including several so-called accessory genes. All group 1b coronaviruses encode a single accessory protein between the spike and envelope genes, except for human coronavirus (HCoV) 229E. The prototype virus has a

  6. Identification of a gene cluster associated with triclosan catabolism.

    Science.gov (United States)

    Kagle, Jeanne M; Paxson, Clayton; Johnstone, Precious; Hay, Anthony G

    2015-06-01

    Aerobic degradation of bis-aryl ethers like the antimicrobial triclosan typically proceeds through oxygenase-dependent catabolic pathways. Although several studies have reported on bacteria capable of degrading triclosan aerobically, there are no reports describing the genes responsible for this process. In this study, a gene encoding the large subunit of a putative triclosan oxygenase, designated tcsA was identified in a triclosan-degrading fosmid clone from a DNA library of Sphingomonas sp. RD1. Consistent with tcsA's similarity to two-part dioxygenases, a putative FMN-dependent ferredoxin reductase, designated tcsB was found immediately downstream of tcsA. Both tcsAB were found in the midst of a putative chlorocatechol degradation operon. We show that RD1 produces hydroxytriclosan and chlorocatechols during triclosan degradation and that tcsA is induced by triclosan. This is the first study to report on the genetics of triclosan degradation.

  7. A gene encoding phosphatidylethanolamine N-methyltransferase from Acetobacter aceti and some properties of its disruptant.

    Science.gov (United States)

    Hanada, T; Kashima, Y; Kosugi, A; Koizumi, Y; Yanagida, F; Udaka, S

    2001-12-01

    Phosphatidylcholine (PC) is a major component of membranes not only in eukaryotes, but also in several bacteria, including Acetobacter. To identify the PC biosynthetic pathway and its role in Acetobacter sp., we have studied Acetobacter aceti IFO3283, which is characterized by high ethanol oxidizing ability and high resistance to acetic acid. The pmt gene of A. aceti, encoding phosphatidylethanolamine N-methyltransferase (Pmt), which catalyzes methylation of phosphatidylethanolamine (PE) to PC, has been cloned and sequenced. One recombinant plasmid that complemented the PC biosynthesis was isolated from a gene library of the genomic DNA of A. aceti. The pmt gene encodes a polypeptide with molecular mass of either 25125, 26216, or 29052 for an about 27-kDa protein. The sequence of this gene showed significant similarity (44.3% identity in the similar sequence region) with the Rhodobacter sphaeroides pmtA gene which is involved in PE N-methylation. When the pmt gene was expressed in E. coli, which lacks PC, the Pmt activity and PC formation were clearly demonstrated. A. aceti strain harboring an interrupted pmt allele, pmt::Km, was constructed. The pmt disruption was confirmed by loss of Pmt and PC, and by Southern blot analyses. The null pmt mutant contained no PC, but tenfold more PE and twofold more phosphatidylglycerol (PG). The pmt disruptant did not show any dramatic effects on growth in basal medium supplemented with ethanol, but the disruption caused slow growth in basal medium supplemented with acetate. These results suggest that the lack of PC in the A. aceti membrane may be compensated by the increases of PE and PG by an unknown mechanism, and PC in A. aceti membrane is related to its acetic acid tolerance.

  8. Cis and trans interactions between genes encoding PAF1 complex and ESCRT machinery components in yeast.

    Science.gov (United States)

    Rodrigues, Joana; Lydall, David

    2018-03-22

    Saccharomyces cerevisiae is a commonly used model organism for understanding eukaryotic gene function. However, the close proximity between yeast genes can complicate the interpretation of yeast genetic data, particularly high-throughput data. In this study, we examined the interplay between genes encoding components of the PAF1 complex and VPS36, the gene located next to CDC73 on chromosome XII. The PAF1 complex (Cdc73, Paf1, Ctr9, Leo1, and Rtf1, in yeast) affects RNA levels by affecting transcription, histone modifications, and post-transcriptional RNA processing. The human PAF1 complex is linked to cancer, and in yeast, it has been reported to play a role in telomere biology. Vps36, part of the ESCRT-II complex, is involved in sorting proteins for vacuolar/lysosomal degradation. We document a complex set of genetic interactions, which include an adjacent gene effect between CDC73 and VPS36 and synthetic sickness between vps36Δ and cdc73Δ, paf1Δ, or ctr9Δ. Importantly, paf1Δ and ctr9Δ are synthetically lethal with deletions of other components of the ESCRT-II (SNF8 and VPS25), ESCRT-I (STP22), or ESCRT-III (SNF7) complexes. We found that RNA levels of VPS36, but not other ESCRT components, are positively regulated by all components of the PAF1 complex. Finally, we show that deletion of ESCRT components decreases the telomere length in the S288C yeast genetic background, but not in the W303 background. Together, our results outline complex interactions, in cis and in trans, between genes encoding PAF1 and ESCRT-II complex components that affect telomere function and cell viability in yeast.

  9. Genes encoding novel lipid transporters and their use to increase oil production in vegetative tissues of plants

    Science.gov (United States)

    Xu, Changcheng; Fan, Jilian; Yan, Chengshi; Shanklin, John

    2017-12-26

    The present invention discloses a novel gene encoding a transporter protein trigalactosyldiacylglycerol-5 (TGD5), mutations thereof and their use to enhance TAG production and retention in plant vegetative tissue.

  10. Mutations in genes encoding antibiotic substances increase the synthesis of poly-γ-glutamic acid in Bacillus amyloliquefaciens LL3.

    Science.gov (United States)

    Gao, Weixia; Liu, Fenghong; Zhang, Wei; Quan, Yufen; Dang, Yulei; Feng, Jun; Gu, Yanyan; Wang, Shufang; Song, Cunjiang; Yang, Chao

    2017-02-01

    Poly-γ-glutamic acid (γ-PGA) is an important natural biopolymer that is used widely in fields of foods, medicine, cosmetics, and agriculture. Several B. amyloliquefaciens LL3 mutants were constructed to improve γ-PGA synthesis via single or multiple marker-less in-frame deletions of four gene clusters (itu, bae, srf, and fen) encoding antibiotic substances. γ-PGA synthesis by the Δsrf mutant showed a slight increase (4.1 g/L) compared with that of the wild-type strain (3.3 g/L). The ΔituΔsrf mutant showed increased γ-PGA yield from 3.3 to 4.5 g/L, with an increase of 36.4%. The γ-PGA yield of the ΔituΔsrfΔfen and ΔituΔsrfΔfenΔbae mutants did not show a further increase. The four gene clusters' roles in swarming motility and biofilm formation were also studied. The Δsrf and Δbae mutant strains were both significantly defective in swarming, indicating that bacillaene and surfactin are involved in swarming motility of B. amyloliquefaciens LL3. Furthermore, Δsrf and Δitu mutant strains were obviously defective in biofilm formation; therefore, iturin and surfactin must play important roles in biofilm formation in B. amyloliquefaciens LL3. © 2016 The Authors. MicrobiologyOpen published by John Wiley & Sons Ltd.

  11. Characterization and expression analysis of genes encoding ubiquitin conjugating domain-containing enzymes in Carica papaya.

    Science.gov (United States)

    Jue, Dengwei; Sang, Xuelian; Shu, Bo; Liu, Liqin; Wang, Yicheng; Jia, Zhiwei; Zou, Yu; Shi, Shengyou

    2017-01-01

    Ripening affects the quality and nutritional contents of fleshy fruits and is a crucial process of fruit development. Although several studies have suggested that ubiquitin-conjugating enzyme (E2s or UBC enzymes) are involved in the regulation of fruit ripening, little is known about the function of E2s in papaya (Carica papaya). In the present study, we searched the papaya genome and identified 34 putative UBC genes, which were clustered into 17 phylogenetic subgroups. We also analyzed the nucleotide sequences of the papaya UBC (CpUBC) genes and found that both exon-intron junctions and sequence motifs were highly conserved among the phylogenetic subgroups. Using real-time PCR analysis, we also found that all the CpUBC genes were expressed in roots, stems, leaves, male and female flowers, and mature fruit, although the expression of some of the genes was increased or decreased in one or several specific organs. We also found that the expression of 13 and two CpUBC genes were incresesd or decreased during one and two ripening stages, respectively. Expression analyses indicates possible E2s playing a more significant role in fruit ripening for further studies. To the best of our knowledge, this is the first reported genome-wide analysis of the papaya UBC gene family, and the results will facilitate further investigation of the roles of UBC genes in fruit ripening and will aide in the functional validation of UBC genes in papaya.

  12. Gene therapy for bladder pain with gene gun particle encoding pro-opiomelanocortin cDNA.

    Science.gov (United States)

    Chuang, Yao-Chi; Chou, A-K; Wu, P-C; Chiang, Po-Hui; Yu, T-J; Yang, L-C; Yoshimura, Naoki; Chancellor, Michael B

    2003-11-01

    Interstitial cystitis is a bladder hypersensitivity disease associated with bladder pain that has been a major challenge to understand and treat. We hypothesized that targeted and localized expression of endogenous opioid peptide in the bladder could be useful for the treatment of bladder pain. Pro-opiomelanocortin (POMC) is one of such precursor molecules. In this study we developed a gene gun method for the transfer of POMC cDNA in vivo and investigated its therapeutic effect on acetic acid induced bladder hyperactivity in rats. Human POMC cDNA was cloned into a modified pCMV plasmid and delivered into the bladder wall of adult female rats by direct injection or the gene gun. Three days after gene therapy continuous cystometrograms were performed using urethane anesthesia by filling the bladder (0.08 ml per minute) with saline, followed by 0.3% acetic acid. Bladder immunohistochemical testing was used to detect endorphin after POMC cDNA transfer. The intercontraction interval was decreased after intravesical instillation of acetic acid (73.1% or 68.1% decrease) in 2 control groups treated with saline or the gene gun without POMC cDNA, respectively. However, rats that received POMC cDNA via the gene gun showed a significantly decreased response (intercontraction interval 35% decreased) to acetic acid instillation, whereas this antinociceptive effect was not detected in the plasmid POMC cDNA direct injection group. This effect induced by POMC gene gun treatment was reversed by intramuscular naloxone (1 mg/kg), an opioid antagonist. Increased endorphin immunoreactivity with anti-endorphin antibodies was observed in the bladder of gene gun treated animals. The POMC gene can be transferred in the bladder using the gene gun and increased bladder expression of endorphin can suppress nociceptive responses induced by bladder irritation. Thus, POMC gene gun delivery may be useful for the treatment of interstitial cystitis and other types of visceral pain.

  13. The gene Sr33, an ortholog of barley Mla genes, encodes resistance to wheat stem rust race Ug99.

    Science.gov (United States)

    Periyannan, Sambasivam; Moore, John; Ayliffe, Michael; Bansal, Urmil; Wang, Xiaojing; Huang, Li; Deal, Karin; Luo, Mingcheng; Kong, Xiuying; Bariana, Harbans; Mago, Rohit; McIntosh, Robert; Dodds, Peter; Dvorak, Jan; Lagudah, Evans

    2013-08-16

    Wheat stem rust, caused by the fungus Puccinia graminis f. sp. tritici, afflicts bread wheat (Triticum aestivum). New virulent races collectively referred to as "Ug99" have emerged, which threaten global wheat production. The wheat gene Sr33, introgressed from the wild relative Aegilops tauschii into bread wheat, confers resistance to diverse stem rust races, including the Ug99 race group. We cloned Sr33, which encodes a coiled-coil, nucleotide-binding, leucine-rich repeat protein. Sr33 is orthologous to the barley (Hordeum vulgare) Mla mildew resistance genes that confer resistance to Blumeria graminis f. sp. hordei. The wheat Sr33 gene functions independently of RAR1, SGT1, and HSP90 chaperones. Haplotype analysis from diverse collections of Ae. tauschii placed the origin of Sr33 resistance near the southern coast of the Caspian Sea.

  14. The Lethal Toxin from Australian Funnel-Web Spiders Is Encoded by an Intronless Gene

    Science.gov (United States)

    Pineda, Sandy Steffany; Wilson, David; Mattick, John S.; King, Glenn F.

    2012-01-01

    Australian funnel-web spiders are generally considered the most dangerous spiders in the world, with envenomations from the Sydney funnel-web spider Atrax robustus resulting in at least 14 human fatalities prior to the introduction of an effective anti-venom in 1980. The clinical envenomation syndrome resulting from bites by Australian funnel-web spiders is due to a single 42-residue peptide known as δ-hexatoxin. This peptide delays the inactivation of voltage-gated sodium channels, which results in spontaneous repetitive firing and prolongation of action potentials, thereby causing massive neurotransmitter release from both somatic and autonomic nerve endings. Here we show that δ-hexatoxin from the Australian funnel-web spider Hadronyche versuta is produced from an intronless gene that encodes a prepropeptide that is post-translationally processed to yield the mature toxin. A limited sampling of genes encoding unrelated venom peptides from this spider indicated that they are all intronless. Thus, in distinct contrast to cone snails and scorpions, whose toxin genes contain introns, spiders may have developed a quite different genetic strategy for evolving their venom peptidome. PMID:22928020

  15. Cloning and characterization of a gene encoding trehalose phosphorylase (TP) from Pleurotus sajor-caju.

    Science.gov (United States)

    Han, Sang-Eun; Kwon, Hawk-Bin; Lee, Seung-Bum; Yi, Bu-Young; Murayama, Ikuo; Kitamoto, Yutaka; Byun, Myung-Ok

    2003-08-01

    Complementary DNA for a gene encoding trehalose phosphorylase (TP) that reversibly catalyzes trehalose synthesis and degradation from alpha-glucose-1-phosphate (alpha-Glc-1-P) and glucose was cloned from Pleurotus sajor-caju. The cDNA of P. sajor-caju TP (designated PsTP, GenBank Accession No. AF149777) encodes a polypeptide of 751 amino acids with a deduced molecular mass of 83.7 kDa. The PsTP gene is expressed in mycelia, pilei, and stipes of fruiting bodies. Trehalose phosphorylase PsTP was purified from PsTP-transformed Escherichia coli. The enzyme catalyzes both the phosphorolysis of trehalose to produce alpha-Glc-1-P and glucose, and the synthesis of trehalose. The apparent K(m) values for trehalose and Pi in phosphorolytic reaction at pH 7.0 were 74.8 and 5.4 mM, respectively. The PsTP gene complemented Saccharomyces cerevisiae Deltatps1, Deltatps2 double-mutant cells, allowing their growth on glucose medium. Furthermore, yeast transformed with PsTP produced 2-2.5-fold more trehalose than non-transformants or cells transformed with empty vector only.

  16. The lethal toxin from Australian funnel-web spiders is encoded by an intronless gene.

    Directory of Open Access Journals (Sweden)

    Sandy Steffany Pineda

    Full Text Available Australian funnel-web spiders are generally considered the most dangerous spiders in the world, with envenomations from the Sydney funnel-web spider Atrax robustus resulting in at least 14 human fatalities prior to the introduction of an effective anti-venom in 1980. The clinical envenomation syndrome resulting from bites by Australian funnel-web spiders is due to a single 42-residue peptide known as δ-hexatoxin. This peptide delays the inactivation of voltage-gated sodium channels, which results in spontaneous repetitive firing and prolongation of action potentials, thereby causing massive neurotransmitter release from both somatic and autonomic nerve endings. Here we show that δ-hexatoxin from the Australian funnel-web spider Hadronyche versuta is produced from an intronless gene that encodes a prepropeptide that is post-translationally processed to yield the mature toxin. A limited sampling of genes encoding unrelated venom peptides from this spider indicated that they are all intronless. Thus, in distinct contrast to cone snails and scorpions, whose toxin genes contain introns, spiders may have developed a quite different genetic strategy for evolving their venom peptidome.

  17. Identification of the Gene Encoding Isoprimeverose-producing Oligoxyloglucan Hydrolase in Aspergillus oryzae.

    Science.gov (United States)

    Matsuzawa, Tomohiko; Mitsuishi, Yasushi; Kameyama, Akihiko; Yaoi, Katsuro

    2016-03-04

    Aspergillus oryzae produces a unique β-glucosidase, isoprimeverose-producing oligoxyloglucan hydrolase (IPase), that recognizes and releases isoprimeverose (α-D-xylopyranose-(1 → 6)-D-glucopyranose) units from the non-reducing ends of oligoxyloglucans. A gene encoding A. oryzae IPase, termed ipeA, was identified and expressed in Pichia pastoris. With the exception of cellobiose, IpeA hydrolyzes a variety of oligoxyloglucans and is a member of the glycoside hydrolase family 3. Xylopyranosyl branching at the non-reducing ends was vital for IPase activity, and galactosylation at a α-1,6-linked xylopyranosyl side chain completely abolished IpeA activity. Hepta-oligoxyloglucan saccharide (Xyl3Glc4) substrate was preferred over tri- (Xyl1Glc2) and tetra- (Xyl2Glc2) oligoxyloglucan saccharides substrates. IpeA transferred isoprimeverose units to other saccharides, indicating transglycosylation activity. The ipeA gene was expressed in xylose and xyloglucan media and was strongly induced in the presence of xyloglucan endo-xyloglucanase-hydrolyzed products. This is the first study to report the identification of a gene encoding IPase in eukaryotes. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

  18. Expression of Mitochondrial-Encoded Genes in Blood Differentiate Acute Renal Allograft Rejection

    Directory of Open Access Journals (Sweden)

    Silke Roedder

    2017-11-01

    Full Text Available Despite potent immunosuppression, clinical and biopsy confirmed acute renal allograft rejection (AR still occurs in 10–15% of recipients, ~30% of patients demonstrate subclinical rejection on biopsy, and ~50% of them can show molecular inflammation, all which increase the risk of chronic dysfunction and worsened allograft outcomes. Mitochondria represent intracellular endogenous triggers of inflammation, which can regulate immune cell differentiation, and expansion and cause antigen-independent graft injury, potentially enhancing the development of acute rejection. In the present study, we investigated the role of mitochondrial DNA encoded gene expression in biopsy matched peripheral blood (PB samples from kidney transplant recipients. Quantitative PCR was performed in 155 PB samples from 115 unique pediatric (<21 years and adult (>21 years renal allograft recipients at the point of AR (n = 61 and absence of rejection (n = 94 for the expression of 11 mitochondrial DNA encoded genes. We observed increased expression of all genes in adult recipients compared to pediatric recipients; separate analyses in both cohorts demonstrated increased expression during rejection, which also differentiated borderline rejection and showed an increasing pattern in serially collected samples (0–3 months prior to and post rejection. Our results provide new insights on the role of mitochondria during rejection and potentially indicate mitochondria as targets for novel immunosuppression.

  19. The Neurospora crassa colonial temperature-sensitive 3 (cot-3) gene encodes protein elongation factor 2.

    Science.gov (United States)

    Propheta, O; Vierula, J; Toporowski, P; Gorovits, R; Yarden, O

    2001-02-01

    At elevated temperatures, the Neurospora crassa mutant colonial, temperature-sensitive 3 (cot-3) forms compact, highly branched colonies. Growth of the cot-3 strain under these conditions also results in the loss of the lower molecular weight (LMW) isoform of the Ser/Thr protein kinase encoded by the unlinked cot-1 gene, whose function is also involved in hyphal elongation. The unique cot-3 gene has been cloned by complementation and shown to encode translation elongation factor 2 (EF-2). As expected for a gene with a general role in protein synthesis, cot-3 mRNA is abundantly expressed throughout all asexual phases of the N. crassa life cycle. The molecular basis of the cot-3 mutation was determined to be an ATT to AAT transversion, which causes an Ile to Asn substitution at residue 278. Treatment with fusidic acid (a specific inhibitor of EF-2) inhibits hyphal elongation and induces hyperbranching in a manner which mimics the cot-3 phenotype, and also leads to a decrease in the abundance of the LMW isoform of COT1. This supports our conclusion that the mutation in cot-3 which results in abnormal hyphal elongation/branching impairs EF-2 function and confirms that the abundance of a LMW isoform of COT1 kinase is dependent on the function of this general translation factor.

  20. Global Analysis of miRNA Gene Clusters and Gene Families Reveals Dynamic and Coordinated Expression

    Directory of Open Access Journals (Sweden)

    Li Guo

    2014-01-01

    Full Text Available To further understand the potential expression relationships of miRNAs in miRNA gene clusters and gene families, a global analysis was performed in 4 paired tumor (breast cancer and adjacent normal tissue samples using deep sequencing datasets. The compositions of miRNA gene clusters and families are not random, and clustered and homologous miRNAs may have close relationships with overlapped miRNA species. Members in the miRNA group always had various expression levels, and even some showed larger expression divergence. Despite the dynamic expression as well as individual difference, these miRNAs always indicated consistent or similar deregulation patterns. The consistent deregulation expression may contribute to dynamic and coordinated interaction between different miRNAs in regulatory network. Further, we found that those clustered or homologous miRNAs that were also identified as sense and antisense miRNAs showed larger expression divergence. miRNA gene clusters and families indicated important biological roles, and the specific distribution and expression further enrich and ensure the flexible and robust regulatory network.

  1. Potential transfer of extended spectrum β-lactamase encoding gene, blashv18 gene, between Klebsiella pneumoniae in raw foods.

    Science.gov (United States)

    Jung, Yangjin; Matthews, Karl R

    2016-12-01

    This study investigated the transfer frequency of the extended-spectrum β-lactamase-encoding gene (blaSHV18) among Klebsiella pneumoniae in tryptic soy broth (TSB), pasteurized milk, unpasteurized milk, alfalfa sprouts and chopped lettuce at defined temperatures. All transconjugants were characterized phenotypically and genotypically. KP04(ΔKM) and KP08(ΔKM) isolated from seed sprouts and KP342 were used as recipients in mating experiments with K. pneumoniae ATCC 700603 serving as the donor. In mating experiments, no transconjugants were detected at 4 °C in liquid media or chopped lettuce, but detected in all media tested at 15 °C, 24 °C, and 37 °C. At 24 °C, the transfer of blaSHV18 gene occurred more frequently in alfalfa sprouts (5.15E-04 transconjugants per recipient) and chopped lettuce (3.85E-05) than liquid media (1.08E-05). On chopped lettuce, transconjugants were not detected at day 1 post-mating at 15 °C, but observed on day 2 (1.43E-05). Transconjugants carried the blaSHV18 gene transferred from the donor and the virulence gene harbored by recipient. More importantly, a class 1 integrase gene and resistance to tetracycline, trimethoprim/sulfamethoxazole were co-transferred during mating. These quantitative results suggest that fresh produce exposed to temperature abuse may serve as a competent vehicle for the spread of gene encoding for antibiotic resistance, having a potential negative impact on human health. Copyright © 2016 Elsevier Ltd. All rights reserved.

  2. The ROOT HAIRLESS 1 gene encodes a nuclear protein required for root hair initiation in Arabidopsis.

    Science.gov (United States)

    Schneider, K; Mathur, J; Boudonck, K; Wells, B; Dolan, L; Roberts, K

    1998-07-01

    The epidermis of Arabidopsis wild-type primary roots, in which some cells grow hairs and others remain hairless in a position-dependent manner, has become an established model system to study cell differentiation. Here we present a molecular analysis of the RHL1 (ROOT HAIRLESS 1) gene that, if mutated, prevents the formation of hairs on primary roots and causes a seedling lethal phenotype. We have cloned the RHL1 gene by use of a T-DNA-tagged mutant and found that it encodes a protein that appears to be plant specific. The predicted RHL1 gene product is a small hydrophilic protein (38.9 kD) containing putative nuclear localization signals and shows no significant homology to any known amino acid sequence. We demonstrate that a 78-amino-acid sequence at its amino terminus is capable of directing an RHL1-GFP fusion protein to the nucleus. The RHL1 transcript is present throughout the wild-type plant and in suspension culture cells, but in very low amounts, suggesting a regulatory function for the RHL1 protein. Structural evidence suggests a role for the RHL1 gene product in the nucleolus. We have examined the genetic relationship between RHL1 and GL2, an inhibitor of root hair initiation in non-hair cells. Our molecular and genetic data with double mutants, together with the expression analysis of a GL2 promoter-GUS reporter gene construct, indicate that the RHL1 gene acts independently of GL2.

  3. Regulation of dsr genes encoding proteins responsible for the oxidation of stored sulfur in Allochromatium vinosum.

    Science.gov (United States)

    Grimm, Frauke; Dobler, Nadine; Dahl, Christiane

    2010-03-01

    Sulfur globules are formed as obligatory intermediates during the oxidation of reduced sulfur compounds in many environmentally important photo- and chemolithoautotrophic bacteria. It is well established that the so-called Dsr proteins are essential for the oxidation of zero-valent sulfur accumulated in the globules; however, hardly anything is known about the regulation of dsr gene expression. Here, we present a closer look at the regulation of the dsr genes in the phototrophic sulfur bacterium Allochromatium vinosum. The dsr genes are expressed in a reduced sulfur compound-dependent manner and neither sulfite, the product of the reverse-acting dissimilatory sulfite reductase DsrAB, nor the alternative electron donor malate inhibit the gene expression. Moreover, we show the oxidation of sulfur to sulfite to be the rate-limiting step in the oxidation of sulfur to sulfate as sulfate production starts concomitantly with the upregulation of the expression of the dsr genes. Real-time RT-PCR experiments suggest that the genes dsrC and dsrS are additionally expressed from secondary internal promoters, pointing to a special function of the encoded proteins. Earlier structural analyses indicated the presence of a helix-turn-helix (HTH)-like motif in DsrC. We therefore assessed the DNA-binding capability of the protein and provide evidence for a possible regulatory function of DsrC.

  4. The Novel Gene CRNDE Encodes a Nuclear Peptide (CRNDEP Which Is Overexpressed in Highly Proliferating Tissues.

    Directory of Open Access Journals (Sweden)

    Lukasz Michal Szafron

    Full Text Available CRNDE, recently described as the lncRNA-coding gene, is overexpressed at RNA level in human malignancies. Its role in gametogenesis, cellular differentiation and pluripotency has been suggested as well. Herein, we aimed to verify our hypothesis that the CRNDE gene may encode a protein product, CRNDEP. By using bioinformatics methods, we identified the 84-amino acid ORF encoded by one of two CRNDE transcripts, previously described by our research team. This ORF was cloned into two expression vectors, subsequently utilized in localization studies in HeLa cells. We also developed a polyclonal antibody against CRNDEP. Its specificity was confirmed in immunohistochemical, cellular localization, Western blot and immunoprecipitation experiments, as well as by showing a statistically significant decrease of endogenous CRNDEP expression in the cells with transient shRNA-mediated knockdown of CRNDE. Endogenous CRNDEP localizes predominantly to the nucleus and its expression seems to be elevated in highly proliferating tissues, like the parabasal layer of the squamous epithelium, intestinal crypts or spermatocytes. After its artificial overexpression in HeLa cells, in a fusion with either the EGFP or DsRed Monomer fluorescent tag, CRNDEP seems to stimulate the formation of stress granules and localize to them. Although the exact role of CRNDEP is unknown, our preliminary results suggest that it may be involved in the regulation of the cell proliferation. Possibly, CRNDEP also participates in oxygen metabolism, considering our in silico results, and the correlation between its enforced overexpression and the formation of stress granules. This is the first report showing the existence of a peptide encoded by the CRNDE gene.

  5. Phytochrome-regulated expression of the genes encoding the small GTP-binding proteins in peas.

    OpenAIRE

    Yoshida, K; Nagano, Y; Murai, N; Sasaki, Y

    1993-01-01

    We examined the effect of light on the mRNA levels of 11 genes (pra1-pra9A, pra9B, and pra9C) encoding the small GTP-binding proteins that belong to the ras superfamily in Pisum sativum. When the dark-grown seedlings were exposed to continuous white light for 24 hr, the levels of several pra mRNAs in the pea buds decreased: pra2 and pra3 mRNAs decreased markedly; pra4, pra6, and pra9A mRNAs decreased slightly; the other 6 pra mRNAs did not decrease. We studied the kinetics of mRNA accumulatio...

  6. Effects of TCDD on the expression of nuclear encoded mitochondrial genes

    International Nuclear Information System (INIS)

    Forgacs, Agnes L.; Burgoon, Lyle D.; Lynn, Scott G.; LaPres, John J.; Zacharewski, Timothy

    2010-01-01

    Generation of mitochondrial reactive oxygen species (ROS) can be perturbed following exposure to environmental chemicals such as 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD). Reports indicate that the aryl hydrocarbon receptor (AhR) mediates TCDD-induced sustained hepatic oxidative stress by decreasing hepatic ATP levels and through hyperpolarization of the inner mitochondrial membrane. To further elucidate the effects of TCDD on the mitochondria, high-throughput quantitative real-time PCR (HTP-QRTPCR) was used to evaluate the expression of 90 nuclear genes encoding mitochondrial proteins involved in electron transport, oxidative phosphorylation, uncoupling, and associated chaperones. HTP-QRTPCR analysis of time course (30 μg/kg TCDD at 2, 4, 8, 12, 18, 24, 72, and 168 h) liver samples obtained from orally gavaged immature, ovariectomized C57BL/6 mice identified 54 differentially expressed genes (|fold change| > 1.5 and P-value < 0.1). Of these, 8 exhibited a sigmoidal or exponential dose-response profile (0.03 to 300 μg/kg TCDD) at 4, 24 or 72 h. Dose-responsive genes encoded proteins associated with electron transport chain (ETC) complexes I (NADH dehydrogenase), III (cytochrome c reductase), IV (cytochrome c oxidase), and V (ATP synthase) and could be generally categorized as having proton gradient, ATP synthesis, and chaperone activities. In contrast, transcript levels of ETC complex II, succinate dehydrogenase, remained unchanged. Putative dioxin response elements were computationally found in the promoter regions of all 8 dose-responsive genes. This high-throughput approach suggests that TCDD alters the expression of genes associated with mitochondrial function which may contribute to TCDD-elicited mitochondrial toxicity.

  7. Generating in vivo cloning vectors for parallel cloning of large gene clusters by homologous recombination.

    Directory of Open Access Journals (Sweden)

    Jeongmin Lee

    Full Text Available A robust method for the in vivo cloning of large gene clusters was developed based on homologous recombination (HR, requiring only the transformation of PCR products into Escherichia coli cells harboring a receiver plasmid. Positive clones were selected by an acquired antibiotic resistance, which was activated by the recruitment of a short ribosome-binding site plus start codon sequence from the PCR products to the upstream position of a silent antibiotic resistance gene in receiver plasmids. This selection was highly stringent and thus the cloning efficiency of the GFPuv gene (size: 0.7 kb was comparable to that of the conventional restriction-ligation method, reaching up to 4.3 × 10(4 positive clones per μg of DNA. When we attempted parallel cloning of GFPuv fusion genes (size: 2.0 kb and carotenoid biosynthesis pathway clusters (sizes: 4 kb, 6 kb, and 10 kb, the cloning efficiency was similarly high regardless of the DNA size, demonstrating that this would be useful for the cloning of large DNA sequences carrying multiple open reading frames. However, restriction analyses of the obtained plasmids showed that the selected cells may contain significant amounts of receiver plasmids without the inserts. To minimize the amount of empty plasmid in the positive selections, the sacB gene encoding a levansucrase was introduced as a counter selection marker in receiver plasmid as it converts sucrose to a toxic levan in the E. coli cells. Consequently, this method yielded completely homogeneous plasmids containing the inserts via the direct transformation of PCR products into E. coli cells.

  8. antiSMASH 4.0-improvements in chemistry prediction and gene cluster boundary identification

    DEFF Research Database (Denmark)

    Blin, Kai; Wolf, Thomas; Chevrette, Marc G.

    2017-01-01

    architectures. Additionally, several usability features have been updated and improved. Together, these improvements make antiSMASH up-to-date with the latest developments in natural product research and will further facilitate computational genome mining for the discovery of novel bioactive molecules.......Many antibiotics, chemotherapeutics, crop protection agents and food preservatives originate from molecules produced by bacteria, fungi or plants. In recent years, genome mining methodologies have been widely adopted to identify and characterize the biosynthetic gene clusters encoding...... the production of such compounds. Since 2011, the 'antibiotics and secondary metabolite analysis shell-antiSMASH' has assisted researchers in efficiently performing this, both as a web server and a standalone tool. Here, we present the thoroughly updated antiSMASH version 4, which adds several novel features...

  9. Evolution of the C-Type Lectin-Like Receptor Genes of the DECTIN-1 Cluster in the NK Gene Complex

    Directory of Open Access Journals (Sweden)

    Susanne Sattler

    2012-01-01

    Full Text Available Pattern recognition receptors are crucial in initiating and shaping innate and adaptive immune responses and often belong to families of structurally and evolutionarily related proteins. The human C-type lectin-like receptors encoded in the DECTIN-1 cluster within the NK gene complex contain prominent receptors with pattern recognition function, such as DECTIN-1 and LOX-1. All members of this cluster share significant homology and are considered to have arisen from subsequent gene duplications. Recent developments in sequencing and the availability of comprehensive sequence data comprising many species showed that the receptors of the DECTIN-1 cluster are not only homologous to each other but also highly conserved between species. Even in Caenorhabditis elegans, genes displaying homology to the mammalian C-type lectin-like receptors have been detected. In this paper, we conduct a comprehensive phylogenetic survey and give an up-to-date overview of the currently available data on the evolutionary emergence of the DECTIN-1 cluster genes.

  10. Expression of genes encoding multi-transmembrane proteins in specific primate taste cell populations.

    Directory of Open Access Journals (Sweden)

    Bryan D Moyer

    Full Text Available BACKGROUND: Using fungiform (FG and circumvallate (CV taste buds isolated by laser capture microdissection and analyzed using gene arrays, we previously constructed a comprehensive database of gene expression in primates, which revealed over 2,300 taste bud-associated genes. Bioinformatics analyses identified hundreds of genes predicted to encode multi-transmembrane domain proteins with no previous association with taste function. A first step in elucidating the roles these gene products play in gustation is to identify the specific taste cell types in which they are expressed. METHODOLOGY/PRINCIPAL FINDINGS: Using double label in situ hybridization analyses, we identified seven new genes expressed in specific taste cell types, including sweet, bitter, and umami cells (TRPM5-positive, sour cells (PKD2L1-positive, as well as other taste cell populations. Transmembrane protein 44 (TMEM44, a protein with seven predicted transmembrane domains with no homology to GPCRs, is expressed in a TRPM5-negative and PKD2L1-negative population that is enriched in the bottom portion of taste buds and may represent developmentally immature taste cells. Calcium homeostasis modulator 1 (CALHM1, a component of a novel calcium channel, along with family members CALHM2 and CALHM3; multiple C2 domains; transmembrane 1 (MCTP1, a calcium-binding transmembrane protein; and anoctamin 7 (ANO7, a member of the recently identified calcium-gated chloride channel family, are all expressed in TRPM5 cells. These proteins may modulate and effect calcium signalling stemming from sweet, bitter, and umami receptor activation. Synaptic vesicle glycoprotein 2B (SV2B, a regulator of synaptic vesicle exocytosis, is expressed in PKD2L1 cells, suggesting that this taste cell population transmits tastant information to gustatory afferent nerve fibers via exocytic neurotransmitter release. CONCLUSIONS/SIGNIFICANCE: Identification of genes encoding multi-transmembrane domain proteins

  11. Molecular cloning and characterization of a glutathione S-transferase encoding gene from Opisthorchis viverrini.

    Science.gov (United States)

    Eursitthichai, Veerachai; Viyanant, Vithoon; Vichasri-Grams, Suksiri; Sobhon, Prasert; Tesana, Smarn; Upatham, Suchart Edward; Hofmann, Annemarie; Korge, Günter; Grams, Rudi

    2004-12-01

    An adult stage Opisthorchis viverrini cDNA library was constructed and screened for abundant transcripts. One of the isolated cDNAs was found by sequence comparison to encode a glutathione S-transferase (GST) and was further analyzed for RNA expression, encoded protein function, tissue distribution and cross-reactivity of the encoded protein with other trematode protein counterparts. The cDNA has a size of 893 bp and encodes a GST of 213 amino acids length (OV28GST). The most closely-related GST of OV28GST among those published for trematodes is a 28 kDa GST of Clonorchis sinensis as shown by multiple sequence alignment and phylogenetic analysis. Northern analysis of total RNA with a gene-specific probe revealed a 900 nucleotide OV28GST transcriptional product in the adult parasite. Through RNA in situ hybridization OV28GST RNA was detected in the parenchymal cells of adult parasites. This result was confirmed by immunolocalization of OV28GST with an antiserum generated in a mouse against bacterially-produced recombinant OV28GST. Both, purified recombinant and purified native OV28GST were resolved as 28 kDa proteins by SDS-PAGE. Using the anti-recOV28GST antiserum, no or only weak cross-reactivity was observed in an immunoblot of crude worm extracts against the GSTs of Schistosoma mansoni, S. japonicum, S. mekongi, Eurytrema spp. and Fasciola gigantica. The enzyme activity of the purified recombinant OV28GST was verified by a standard 1-chloro-2, 4-dinitrobenzene (CDNB) based activity assay. The present results of our molecular analysis of OV28GST should be helpful in the ongoing development of diagnostic applications for opisthorchiasis viverrini.

  12. Cloning and characterization of a delta-6 desaturase encoding gene from Nannochloropsis oculata

    Science.gov (United States)

    Ma, Xiaolei; Yu, Jianzhong; Zhu, Baohua; Pan, Kehou; Pan, Jin; Yang, Guanpin

    2011-03-01

    A gene ( NANOC-D6D) encoding a desaturase that removes two hydrogen atoms from fatty acids at delta 6 position was isolated from a cDNA library of Nannochloropsis oculata (Droop) D. J. Hibberd (Eustigmatophyceae). The unicellular marine microalga N. oculata synthesizes rich long chain polyunsaturated fatty acids (LCPUFAs), including eicosapentaenoic acid (20:5n-3, EPA). The deduced protein contains 474 amino acids that fold into 4 trans-membrane domains. The neighbor-joining phylogenetic tree indicates that NANOC-D6D is phylogenetically close to the delta-6 fatty acid desaturase of marine microalgae such as Glossomastix chrysoplasta, Thalassiosira pseudonana, and Phaeodactylum tricornutum. The gene was expressed in Saccharomyces cerevisiae INVScl to verify the substrate specificity of NANOC-D6D. Our results suggest that the recombinant NANOC-D6D simultaneously desaturates linoleic acid (LA) and α-linolenic acid (ALA).

  13. Nuclear scaffold attachment sites within ENCODE regions associate with actively transcribed genes.

    Directory of Open Access Journals (Sweden)

    Mignon A Keaton

    2011-03-01

    Full Text Available The human genome must be packaged and organized in a functional manner for the regulation of DNA replication and transcription. The nuclear scaffold/matrix, consisting of structural and functional nuclear proteins, remains after extraction of nuclei and anchors loops of DNA. In the search for cis-elements functioning as chromatin domain boundaries, we identified 453 nuclear scaffold attachment sites purified by lithium-3,5-iodosalicylate extraction of HeLa nuclei across 30 Mb of the human genome studied by the ENCODE pilot project. The scaffold attachment sites mapped predominately near expressed genes and localized near transcription start sites and the ends of genes but not to boundary elements. In addition, these regions were enriched for RNA polymerase II and transcription factor binding sites and were located in early replicating regions of the genome. We believe these sites correspond to genome-interactions mediated by transcription factors and transcriptional machinery immobilized on a nuclear substructure.

  14. Relating genes to function: identifying enriched transcription factors using the ENCODE ChIP-Seq significance tool.

    Science.gov (United States)

    Auerbach, Raymond K; Chen, Bin; Butte, Atul J

    2013-08-01

    Biological analysis has shifted from identifying genes and transcripts to mapping these genes and transcripts to biological functions. The ENCODE Project has generated hundreds of ChIP-Seq experiments spanning multiple transcription factors and cell lines for public use, but tools for a biomedical scientist to analyze these data are either non-existent or tailored to narrow biological questions. We present the ENCODE ChIP-Seq Significance Tool, a flexible web application leveraging public ENCODE data to identify enriched transcription factors in a gene or transcript list for comparative analyses. The ENCODE ChIP-Seq Significance Tool is written in JavaScript on the client side and has been tested on Google Chrome, Apple Safari and Mozilla Firefox browsers. Server-side scripts are written in PHP and leverage R and a MySQL database. The tool is available at http://encodeqt.stanford.edu. abutte@stanford.edu Supplementary material is available at Bioinformatics online.

  15. Evolution of C2H2-zinc finger genes and subfamilies in mammals: Species-specific duplication and loss of clusters, genes and effector domains

    Directory of Open Access Journals (Sweden)

    Aubry Muriel

    2008-06-01

    Full Text Available Abstract Background C2H2 zinc finger genes (C2H2-ZNF constitute the largest class of transcription factors in humans and one of the largest gene families in mammals. Often arranged in clusters in the genome, these genes are thought to have undergone a massive expansion in vertebrates, primarily by tandem duplication. However, this view is based on limited datasets restricted to a single chromosome or a specific subset of genes belonging to the large KRAB domain-containing C2H2-ZNF subfamily. Results Here, we present the first comprehensive study of the evolution of the C2H2-ZNF family in mammals. We assembled the complete repertoire of human C2H2-ZNF genes (718 in total, about 70% of which are organized into 81 clusters across all chromosomes. Based on an analysis of their N-terminal effector domains, we identified two new C2H2-ZNF subfamilies encoding genes with a SET or a HOMEO domain. We searched for the syntenic counterparts of the human clusters in other mammals for which complete gene data are available: chimpanzee, mouse, rat and dog. Cross-species comparisons show a large variation in the numbers of C2H2-ZNF genes within homologous mammalian clusters, suggesting differential patterns of evolution. Phylogenetic analysis of selected clusters reveals that the disparity in C2H2-ZNF gene repertoires across mammals not only originates from differential gene duplication but also from gene loss. Further, we discovered variations among orthologs in the number of zinc finger motifs and association of the effector domains, the latter often undergoing sequence degeneration. Combined with phylogenetic studies, physical maps and an analysis of the exon-intron organization of genes from the SCAN and KRAB domains-containing subfamilies, this result suggests that the SCAN subfamily emerged first, followed by the SCAN-KRAB and finally by the KRAB subfamily. Conclusion Our results are in agreement with the "birth and death hypothesis" for the evolution of

  16. Multidrug resistance in fungi: regulation of transporter-encoding gene expression.

    Science.gov (United States)

    Paul, Sanjoy; Moye-Rowley, W Scott

    2014-01-01

    A critical risk to the continued success of antifungal chemotherapy is the acquisition of resistance; a risk exacerbated by the few classes of effective antifungal drugs. Predictably, as the use of these drugs increases in the clinic, more resistant organisms can be isolated from patients. A particularly problematic form of drug resistance that routinely emerges in the major fungal pathogens is known as multidrug resistance. Multidrug resistance refers to the simultaneous acquisition of tolerance to a range of drugs via a limited or even single genetic change. This review will focus on recent progress in understanding pathways of multidrug resistance in fungi including those of most medical relevance. Analyses of multidrug resistance in Saccharomyces cerevisiae have provided the most detailed outline of multidrug resistance in a eukaryotic microorganism. Multidrug resistant isolates of S. cerevisiae typically result from changes in the activity of a pair of related transcription factors that in turn elicit overproduction of several target genes. Chief among these is the ATP-binding cassette (ABC)-encoding gene PDR5. Interestingly, in the medically important Candida species, very similar pathways are involved in acquisition of multidrug resistance. In both C. albicans and C. glabrata, changes in the activity of transcriptional activator proteins elicits overproduction of a protein closely related to S. cerevisiae Pdr5 called Cdr1. The major filamentous fungal pathogen, Aspergillus fumigatus, was previously thought to acquire resistance to azole compounds (the principal antifungal drug class) via alterations in the azole drug target-encoding gene cyp51A. More recent data indicate that pathways in addition to changes in the cyp51A gene are important determinants in A. fumigatus azole resistance. We will discuss findings that suggest azole resistance in A. fumigatus and Candida species may share more mechanistic similarities than previously thought.

  17. Gene prioritization and clustering by multi-view text mining.

    Science.gov (United States)

    Yu, Shi; Tranchevent, Leon-Charles; De Moor, Bart; Moreau, Yves

    2010-01-14

    Text mining has become a useful tool for biologists trying to understand the genetics of diseases. In particular, it can help identify the most interesting candidate genes for a disease for further experimental analysis. Many text mining approaches have been introduced, but the effect of disease-gene identification varies in different text mining models. Thus, the idea of incorporating more text mining models may be beneficial to obtain more refined and accurate knowledge. However, how to effectively combine these models still remains a challenging question in machine learning. In particular, it is a non-trivial issue to guarantee that the integrated model performs better than the best individual model. We present a multi-view approach to retrieve biomedical knowledge using different controlled vocabularies. These controlled vocabularies are selected on the basis of nine well-known bio-ontologies and are applied to index the vast amounts of gene-based free-text information available in the MEDLINE repository. The text mining result specified by a vocabulary is considered as a view and the obtained multiple views are integrated by multi-source learning algorithms. We investigate the effect of integration in two fundamental computational disease gene identification tasks: gene prioritization and gene clustering. The performance of the proposed approach is systematically evaluated and compared on real benchmark data sets. In both tasks, the multi-view approach demonstrates significantly better performance than other comparing methods. In practical research, the relevance of specific vocabulary pertaining to the task is usually unknown. In such case, multi-view text mining is a superior and promising strategy for text-based disease gene identification.

  18. Cell type-specific transcriptional regulation of the gene encoding importin-α1

    International Nuclear Information System (INIS)

    Kamikawa, Yasunao; Yasuhara, Noriko; Yoneda, Yoshihiro

    2011-01-01

    Importin-α1 belongs to a receptor family that recognizes classical nuclear localization signals. Encoded by Kpna2, this receptor subtype is highly expressed in mouse embryonic stem (ES) cells. In this study, we identified a critical promoter region in Kpna2 and showed that the expression of this gene is differentially regulated in ES cells and NIH3T3 cells. Conserved CCAAT boxes are required for Kpna2 promoter activity in both ES and NIH3T3 cells. Interestingly, deletion of the region from nucleotide position - 251 to - 179 bp resulted in a drastic reduction in Kpna2 transcriptional activity only in ES cells. This region contains Krueppel-like factor (Klf) binding sequences and is responsible for transactivation of the gene by Klf2 and Klf4. Accordingly, endogenous Kpna2 mRNA levels decreased in response to depletion of Klf2 and Klf4 in ES cells. Our results suggest that Klf2 and Klf4 function redundantly to drive high level of Kpna2 expression in ES cells. -- Research Highlights: → We showed the cell type-specific transcriptional regulation of Kpna2 encoding importin-al. → NF-Y binds the CCAAT boxes to activate Kpna2 transcription in NIH3T3 cells. → Klf2 and Klf4 redundantly activate the expression of Kpna2 in ES cells.

  19. Cloning, sequencing and expression of the gene encoding the extracellular metalloprotease of Aeromonas caviae.

    Science.gov (United States)

    Kawakami, K; Toma, C; Honma, Y

    2000-01-01

    A gene (apk) encoding the extracellular protease of Aeromonas caviae Ae6 has been cloned and sequenced. For cloning the gene, the DNA genomic library was screened using skim milk LB agar. One clone harboring plasmid pKK3 was selected for sequencing. Nucleotide sequencing of the 3.5 kb region of pKK3 revealed a single open reading frame (ORF) of 1,785 bp encoding 595 amino acids. The deduced polypeptide contained a putative 16-amino acid signal peptide followed by a large propeptide. The N-terminal amino acid sequence of purified recombinant protein (APK) was consistent with the DNA sequence. This result suggested a mature protein of 412 amino acids with a molecular mass of 44 kDa. However, the molecular mass of purified recombinant APK revealed 34 kDa by SDS-PAGE, suggesting that further processing at the C-terminal region took place. The 2 motifs of zinc binding sites deduced are highly conserved in the APK as well as in other zinc metalloproteases including Vibrio proteolyticus neutral protease, Emp V from Vibrio vulnificus, HA/P from Vibrio cholerae, and Pseudomonas aeruginosa elastase. Proteolytic activity was inhibited by EDTA, Zincov, 1,10-phenanthroline and tetraethylenepentamine while unaffected by the other inhibitors tested. The protease showed maximum activity at pH 7.0 and was inactivated by heating at 80 C for 15 min. These results together suggest that APK belongs to the thermolysin family of metalloendopeptidases.

  20. Three synonymous genes encode calmodulin in a reptile, the Japanese tortoise, Clemmys japonica

    Directory of Open Access Journals (Sweden)

    Kouji Shimoda

    2002-01-01

    Full Text Available Three distinct calmodulin (CaM-encoding cDNAs were isolated from a reptile, the Japanese tortoise (Clemmys japonica, based on degenerative primer PCR. Because of synonymous codon usages, the deduced amino acid (aa sequences were exactly the same in all three genes and identical to the aa sequence of vertebrate CaM. The three cDNAs, referred to as CaM-A, -B, and -C, seemed to belong to the same type as CaMI, CaMII, and CaMIII, respectively, based on their sequence identity with those of the mammalian cDNAs and the glutamate codon biases. Northern blot analysis detected CaM-A and -B as bands corresponding to 1.8 kb, with the most abundant levels in the brain and testis, while CaM-C was detected most abundantly in the brain as bands of 1.4 and 2.0 kb. Our results indicate that, in the tortoise, CaM protein is encoded by at least three non-allelic genes, and that the ‘multigene-one protein' principle of CaM synthesis is applicable to all classes of vertebrates, from fishes to mammals.

  1. Haploinsufficiency of the genes encoding the tumor suppressor Pten predisposes zebrafish to hemangiosarcoma

    Directory of Open Access Journals (Sweden)

    Suma Choorapoikayil

    2012-03-01

    PTEN is an essential tumor suppressor that antagonizes Akt/PKB signaling. The zebrafish genome encodes two Pten genes, ptena and ptenb. Here, we report that zebrafish mutants that retain a single wild-type copy of ptena or ptenb (ptena+/−ptenb−/− or ptena−/−ptenb+/− are viable and fertile. ptena+/−ptenb−/− fish develop tumors at a relatively high incidence (10.2% and most tumors developed close to the eye (26/30. Histopathologically, the tumor masses were associated with the retrobulbar vascular network and diagnosed as hemangiosarcomas. A single tumor was identified in 42 ptena−/−ptenb+/− fish and was also diagnosed as hemangiosarcoma. Immunohistochemistry indicated that the tumor cells in ptena+/−ptenb−/− and ptena−/−ptenb+/− fish proliferated rapidly and were of endothelial origin. Akt/PKB signaling was activated in the tumors, whereas Ptena was still detected in tumor tissue from ptena+/−ptenb−/− zebrafish. We conclude that haploinsufficiency of the genes encoding Pten predisposes to hemangiosarcoma in zebrafish.

  2. Life without putrescine: disruption of the gene-encoding polyamine oxidase in Ustilago maydis odc mutants.

    Science.gov (United States)

    Valdés-Santiago, Laura; Guzmán-de-Peña, Doralinda; Ruiz-Herrera, José

    2010-11-01

    In previous communications the essential role of spermidine in Ustilago maydis was demonstrated by means of the disruption of the genes encoding ornithine decarboxylase (ODC) and spermidine synthase (SPE). However, the assignation of specific roles to each polyamine in different cellular functions was not possible because the spermidine added to satisfy the auxotrophic requirement of odc/spe double mutants is partly back converted into putrescine. In this study, we have approached this problem through the disruption of the gene-encoding polyamine oxidase (PAO), required for the conversion of spermidine into putrescine, and the construction of odc/pao double mutants that were unable to synthesize putrescine by either ornithine decarboxylation or retroconversion from spermidine. Phenotypic analysis of the mutants provided evidence that putrescine is only an intermediary in spermidine biosynthesis, and has no direct role in cell growth, dimorphic transition, or any other vital function of U. maydis. Nevertheless, our results show that putrescine may play a role in the protection of U. maydis against salt and osmotic stress, and possibly virulence. Evidence was also obtained that the retroconversion of spermidine into putrescine is not essential for U. maydis growth but may be important for its survival under natural conditions.

  3. Haploinsufficiency of the genes encoding the tumor suppressor Pten predisposes zebrafish to hemangiosarcoma.

    Science.gov (United States)

    Choorapoikayil, Suma; Kuiper, Raoul V; de Bruin, Alain; den Hertog, Jeroen

    2012-03-01

    PTEN is an essential tumor suppressor that antagonizes Akt/PKB signaling. The zebrafish genome encodes two Pten genes, ptena and ptenb. Here, we report that zebrafish mutants that retain a single wild-type copy of ptena or ptenb (ptena(+/-)ptenb(-/-) or ptena(-/-)ptenb(+/-)) are viable and fertile. ptena(+/-)ptenb(-/-) fish develop tumors at a relatively high incidence (10.2%) and most tumors developed close to the eye (26/30). Histopathologically, the tumor masses were associated with the retrobulbar vascular network and diagnosed as hemangiosarcomas. A single tumor was identified in 42 ptena(-/-)ptenb(+/-) fish and was also diagnosed as hemangiosarcoma. Immunohistochemistry indicated that the tumor cells in ptena(+/-)ptenb(-/-) and ptena(-/-)ptenb(+/-) fish proliferated rapidly and were of endothelial origin. Akt/PKB signaling was activated in the tumors, whereas Ptena was still detected in tumor tissue from ptena(+/-)ptenb(-/-) zebrafish. We conclude that haploinsufficiency of the genes encoding Pten predisposes to hemangiosarcoma in zebrafish.

  4. Diverse and Abundant Secondary Metabolism Biosynthetic Gene Clusters in the Genomes of Marine Sponge Derived Streptomyces spp. Isolates

    Directory of Open Access Journals (Sweden)

    Stephen A. Jackson

    2018-02-01

    Full Text Available The genus Streptomyces produces secondary metabolic compounds that are rich in biological activity. Many of these compounds are genetically encoded by large secondary metabolism biosynthetic gene clusters (smBGCs such as polyketide synthases (PKS and non-ribosomal peptide synthetases (NRPS which are modular and can be highly repetitive. Due to the repeats, these gene clusters can be difficult to resolve using short read next generation datasets and are often quite poorly predicted using standard approaches. We have sequenced the genomes of 13 Streptomyces spp. strains isolated from shallow water and deep-sea sponges that display antimicrobial activities against a number of clinically relevant bacterial and yeast species. Draft genomes have been assembled and smBGCs have been identified using the antiSMASH (antibiotics and Secondary Metabolite Analysis Shell web platform. We have compared the smBGCs amongst strains in the search for novel sequences conferring the potential to produce novel bioactive secondary metabolites. The strains in this study recruit to four distinct clades within the genus Streptomyces. The marine strains host abundant smBGCs which encode polyketides, NRPS, siderophores, bacteriocins and lantipeptides. The deep-sea strains appear to be enriched with gene clusters encoding NRPS. Marine adaptations are evident in the sponge-derived strains which are enriched for genes involved in the biosynthesis and transport of compatible solutes and for heat-shock proteins. Streptomyces spp. from marine environments are a promising source of novel bioactive secondary metabolites as the abundance and diversity of smBGCs show high degrees of novelty. Sponge derived Streptomyces spp. isolates appear to display genomic adaptations to marine living when compared to terrestrial strains.

  5. Identification of a Gene Cluster Enabling Lactobacillus casei BL23 To Utilize myo-Inositol▿ †

    Science.gov (United States)

    Yebra, María Jesús; Zúñiga, Manuel; Beaufils, Sophie; Pérez-Martínez, Gaspar; Deutscher, Josef; Monedero, Vicente

    2007-01-01

    Genome analysis of Lactobacillus casei BL23 revealed that, compared to L. casei ATCC 334, it carries a 12.8-kb DNA insertion containing genes involved in the catabolism of the cyclic polyol myo-inositol (MI). Indeed, L. casei ATCC 334 does not ferment MI, whereas strain BL23 is able to utilize this carbon source. The inserted DNA consists of an iolR gene encoding a DeoR family transcriptional repressor and a divergently transcribed iolTABCDG1G2EJK operon, encoding a complete MI catabolic pathway, in which the iolK gene probably codes for a malonate semialdehyde decarboxylase. The presence of iolK suggests that L. casei has two alternative pathways for the metabolism of malonic semialdehyde: (i) the classical MI catabolic pathway in which IolA (malonate semialdehyde dehydrogenase) catalyzes the formation of acetyl-coenzyme A from malonic semialdehyde and (ii) the conversion of malonic semialdehyde to acetaldehyde catalyzed by the product of iolK. The function of the iol genes was verified by the disruption of iolA, iolT, and iolD, which provided MI-negative strains. By contrast, the disruption of iolK resulted in a strain with no obvious defect in MI utilization. Transcriptional analyses conducted with different mutant strains showed that the iolTABCDG1G2EJK cluster is regulated by substrate-specific induction mediated by the inactivation of the transcriptional repressor IolR and by carbon catabolite repression mediated by the catabolite control protein A (CcpA). This is the first example of an operon for MI utilization in lactic acid bacteria and illustrates the versatility of carbohydrate utilization in L. casei BL23. PMID:17449687

  6. Coordinated evolution of co-expressed gene clusters in the Drosophila transcriptome

    Directory of Open Access Journals (Sweden)

    Jones Corbin D

    2008-01-01

    Full Text Available Abstract Background Co-expression of genes that physically cluster together is a common characteristic of eukaryotic transcriptomes. This organization of transcriptomes suggests that coordinated evolution of gene expression for clustered genes may also be common. Clusters where expression evolution of each gene is not independent of their neighbors are important units for understanding transcriptome evolution. Results We used a common microarray platform to measure gene expression in seven closely related species in the Drosophila melanogaster subgroup, accounting for confounding effects of sequence divergence. To summarize the correlation structure among genes in a chromosomal region, we analyzed the fraction of variation along the first principal component of the correlation matrix. We analyzed the correlation for blocks of consecutive genes to assess patterns of correlation that may be manifest at different scales of coordinated expression. We find that expression of physically clustered genes does evolve in a coordinated manner in many locations throughout the genome. Our analysis shows that relatively few of these clusters are near heterochromatin regions and that these clusters tend to be over-dispersed relative to the rest of the genome. This suggests that these clusters are not the byproduct of local gene clustering. We also analyzed the pattern of co-expression among neighboring genes within a single Drosophila species: D. simulans. For the co-expression clusters identified within this species, we find an under-representation of genes displaying a signature of recurrent adaptive amino acid evolution consistent with previous findings. However, clusters displaying co-evolution of expression among species are enriched for adaptively evolving genes. This finding points to a tie between adaptive sequence evolution and evolution of the transcriptome. Conclusion Our results demonstrate that co-evolution of expression in gene clusters is

  7. Isolation and characterization of 17 different genes encoding putative endopolygalacturonase genes from Rhizopus oryzae

    Science.gov (United States)

    Polygalacturonase enzymes are a valuable aid in the retting of flax for production of linens and, more recently, production of biofuels from citrus wastes. In a search of the recently sequenced Rhizopus oryzae strain 99-880 genome database, 18 putative endopolygalacturonase genes were identified, w...

  8. The Relationship Between Transcript Expression Levels of Nuclear Encoded (TFAM, NRF1 and Mitochondrial Encoded (MT-CO1 Genes in Single Human Oocytes During Oocyte Maturation

    Directory of Open Access Journals (Sweden)

    Ghaffari Novin M.

    2015-06-01

    Full Text Available In some cases of infertility in women, human oocytes fail to mature when they reach the metaphase II (MII stage. Mitochondria plays an important role in oocyte maturation. A large number of mitochondrial DNA (mtDNA, copied in oocytes, is essential for providing adenosine triphosphate (ATP during oocyte maturation. The purpose of this study was to identify the relationship between transcript expression levels of the mitochondrial encoded gene (MT-CO1 and two nuclear encoded genes, nuclear respiratory factor 1 (NRF1 and mitochondrial transcription factor A (TFAM in various stages of human oocyte maturation. Nine consenting patients, age 21-35 years old, with male factors were selected for ovarian stimulation and intracytoplasmic sperm injection (ICSI procedures. mRNA levels of mitochondrial- related genes were performed by singlecell TaqMan® quantitative real-time polymerase chain reaction (qRT-PCR. There was no significant relationship between the relative expression levels in germinal vesicle (GV stage oocytes (p = 0.62. On the contrary, a significant relationship was seen between the relative expression levels of TFAM and NRF1 and the MT-CO1 genes at the stages of metaphase I (MI and MII (p = 0.03 and p = 0.002. A relationship exists between the transcript expression levels of TFAM and NRF1, and MT-CO1 genes in various stages of human oocyte maturation.

  9. Analysis of essential Arabidopsis nuclear genes encoding plastid-targeted proteins.

    Science.gov (United States)

    Savage, Linda J; Imre, Kathleen M; Hall, David A; Last, Robert L

    2013-01-01

    The Chloroplast 2010 Project (http://www.plastid.msu.edu/) identified and phenotypically characterized homozygous mutants in over three thousand genes, the majority of which encode plastid-targeted proteins. Despite extensive screening by the community, no homozygous mutant alleles were available for several hundred genes, suggesting that these might be enriched for genes of essential function. Attempts were made to generate homozygotes in ~1200 of these lines and 521 of the homozygous viable lines obtained were deposited in the Arabidopsis Biological Resource Center (http://abrc.osu.edu/). Lines that did not yield a homozygote in soil were tested as potentially homozygous lethal due to defects either in seed or seedling development. Mutants were characterized at four stages of development: developing seed, mature seed, at germination, and developing seedlings. To distinguish seed development or seed pigment-defective mutants from seedling development mutants, development of seeds was assayed in siliques from heterozygous plants. Segregating seeds from heterozygous parents were sown on supplemented media in an attempt to rescue homozygous seedlings that could not germinate or survive in soil. Growth of segregating seeds in air and air enriched to 0.3% carbon dioxide was compared to discover mutants potentially impaired in photorespiration or otherwise responsive to CO2 supplementation. Chlorophyll fluorescence measurements identified CO2-responsive mutants with altered photosynthetic parameters. Examples of genes with a viable mutant allele and one or more putative homozygous-lethal alleles were documented. RT-PCR of homozygotes for potentially weak alleles revealed that essential genes may remain undiscovered because of the lack of a true null mutant allele. This work revealed 33 genes with two or more lethal alleles and 73 genes whose essentiality was not confirmed with an independent lethal mutation, although in some cases second leaky alleles were identified.

  10. Analysis of essential Arabidopsis nuclear genes encoding plastid-targeted proteins.

    Directory of Open Access Journals (Sweden)

    Linda J Savage

    Full Text Available The Chloroplast 2010 Project (http://www.plastid.msu.edu/ identified and phenotypically characterized homozygous mutants in over three thousand genes, the majority of which encode plastid-targeted proteins. Despite extensive screening by the community, no homozygous mutant alleles were available for several hundred genes, suggesting that these might be enriched for genes of essential function. Attempts were made to generate homozygotes in ~1200 of these lines and 521 of the homozygous viable lines obtained were deposited in the Arabidopsis Biological Resource Center (http://abrc.osu.edu/. Lines that did not yield a homozygote in soil were tested as potentially homozygous lethal due to defects either in seed or seedling development. Mutants were characterized at four stages of development: developing seed, mature seed, at germination, and developing seedlings. To distinguish seed development or seed pigment-defective mutants from seedling development mutants, development of seeds was assayed in siliques from heterozygous plants. Segregating seeds from heterozygous parents were sown on supplemented media in an attempt to rescue homozygous seedlings that could not germinate or survive in soil. Growth of segregating seeds in air and air enriched to 0.3% carbon dioxide was compared to discover mutants potentially impaired in photorespiration or otherwise responsive to CO2 supplementation. Chlorophyll fluorescence measurements identified CO2-responsive mutants with altered photosynthetic parameters. Examples of genes with a viable mutant allele and one or more putative homozygous-lethal alleles were documented. RT-PCR of homozygotes for potentially weak alleles revealed that essential genes may remain undiscovered because of the lack of a true null mutant allele. This work revealed 33 genes with two or more lethal alleles and 73 genes whose essentiality was not confirmed with an independent lethal mutation, although in some cases second leaky alleles

  11. Gravitation field algorithm and its application in gene cluster

    Directory of Open Access Journals (Sweden)

    Zheng Ming

    2010-09-01

    Full Text Available Abstract Background Searching optima is one of the most challenging tasks in clustering genes from available experimental data or given functions. SA, GA, PSO and other similar efficient global optimization methods are used by biotechnologists. All these algorithms are based on the imitation of natural phenomena. Results This paper proposes a novel searching optimization algorithm called Gravitation Field Algorithm (GFA which is derived from the famous astronomy theory Solar Nebular Disk Model (SNDM of planetary formation. GFA simulates the Gravitation field and outperforms GA and SA in some multimodal functions optimization problem. And GFA also can be used in the forms of unimodal functions. GFA clusters the dataset well from the Gene Expression Omnibus. Conclusions The mathematical proof demonstrates that GFA could be convergent in the global optimum by probability 1 in three conditions for one independent variable mass functions. In addition to these results, the fundamental optimization concept in this paper is used to analyze how SA and GA affect the global search and the inherent defects in SA and GA. Some results and source code (in Matlab are publicly available at http://ccst.jlu.edu.cn/CSBG/GFA.

  12. Adaptive evolution of the FADS gene cluster within Africa.

    Directory of Open Access Journals (Sweden)

    Rasika A Mathias

    Full Text Available Long chain polyunsaturated fatty acids (LC-PUFAs are essential for brain structure, development, and function, and adequate dietary quantities of LC-PUFAs are thought to have been necessary for both brain expansion and the increase in brain complexity observed during modern human evolution. Previous studies conducted in largely European populations suggest that humans have limited capacity to synthesize brain LC-PUFAs such as docosahexaenoic acid (DHA from plant-based medium chain (MC PUFAs due to limited desaturase activity. Population-based differences in LC-PUFA levels and their product-to-substrate ratios can, in part, be explained by polymorphisms in the fatty acid desaturase (FADS gene cluster, which have been associated with increased conversion of MC-PUFAs to LC-PUFAs. Here, we show evidence that these high efficiency converter alleles in the FADS gene cluster were likely driven to near fixation in African populations by positive selection ∼85 kya. We hypothesize that selection at FADS variants, which increase LC-PUFA synthesis from plant-based MC-PUFAs, played an important role in allowing African populations obligatorily tethered to marine sources for LC-PUFAs in isolated geographic regions, to rapidly expand throughout the African continent 60-80 kya.

  13. Indole-Diterpene Gene Cluster from Aspergillus flavus

    Science.gov (United States)

    Zhang, Shuguang; Monahan, Brendon J.; Tkacz, Jan S.; Scott, Barry

    2004-01-01

    Aflatrem is a potent tremorgenic mycotoxin produced by the soil fungus Aspergillus flavus and is a member of a large structurally diverse group of secondary metabolites known as indole-diterpenes. By using degenerate primers for conserved domains of fungal geranylgeranyl diphosphate synthases, we cloned two genes, atmG and ggsA (an apparent pseudogene), from A. flavus. Adjacent to atmG are two other genes, atmC and atmM. These three genes have 64 to 70% amino acid sequence similarity and conserved synteny with a cluster of orthologous genes, paxG, paxC, and paxM, from Penicillium paxilli which are required for indole-diterpene biosynthesis. atmG, atmC, and atmM are coordinately expressed, with transcript levels dramatically increasing at the onset of aflatrem biosynthesis. A genomic copy of atmM can complement a paxM deletion mutant of P. paxilli, demonstrating that atmM is a functional homolog of paxM. Thus, atmG, atmC, and atmM are necessary, but not sufficient, for aflatrem biosynthesis by A. flavus. This provides the first genetic evidence for the biosynthetic pathway of aflatrem in A. flavus. PMID:15528556

  14. Identification and in silico characterization of two novel genes encoding peptidases S8 found by functional screening in a metagenomic library of Yucatán underground water.

    Science.gov (United States)

    Apolinar-Hernández, Max M; Peña-Ramírez, Yuri J; Pérez-Rueda, Ernesto; Canto-Canché, Blondy B; De Los Santos-Briones, César; O'Connor-Sánchez, Aileen

    2016-11-15

    Metagenomics is a culture-independent technology that allows access to novel and potentially useful genetic resources from a wide range of unknown microorganisms. In this study, a fosmid metagenomic library of tropical underground water was constructed, and clones were functionally screened for extracellular proteolytic activity. One of the positive clones, containing a 41,614-bp insert, had two genes with 60% and 68% identity respectively with a peptidase S8 of Chitinimonas koreensis. When these genes were individually sub-cloned, in both cases their sub-clones showed proteolytic phenotype, confirming that they both encode functional proteases. These genes -named PrAY5 and PrAY6- are next to each other. They are similar in size (1845bp and 1824bp respectively) and share 66.5% identity. An extensive in silico characterization showed that their ORFs encode complex zymogens having a signal peptide at their 5' end, followed by a pro-peptide, a catalytic region, and a PPC domain at their 3' end. Their translated sequences were classified as peptidases S8A by sequence comparisons against the non-redundant database and corroborated by Pfam and MEROPS. Phylogenetic analysis of the catalytic region showed that they encode novel proteases that clustered with the sub-family S8_13, which according to the CDD database at NCBI, is an uncharacterized subfamily. They clustered in a clade different from the other three proteases S8 found so far by functional metagenomics, and also different from proteases S8 found in sequenced environmental samples, thereby expanding the range of potentially useful proteases that have been identified by metagenomics. I-TASSER modeling corroborated that they may be subtilases, thus possibly they participate in the hydrolysis of proteins with broad specificity for peptide bonds, and have a preference for a large uncharged residue in P1. Copyright © 2016 Elsevier B.V. All rights reserved.

  15. Adenovirus carrying gene encoding Haliotis discus discus sialic acid binding lectin induces cancer cell apoptosis.

    Science.gov (United States)

    Yang, Xinyan; Wu, Liqin; Duan, Xuemei; Cui, Lianzhen; Luo, Jingjing; Li, Gongchu

    2014-06-30

    Lectins exist widely in marine bioresources such as bacteria, algae, invertebrate animals and fishes. Some purified marine lectins have been found to elicit cytotoxicity to cancer cells. However, there are few reports describing the cytotoxic effect of marine lectins on cancer cells through virus-mediated gene delivery. We show here that a replication-deficient adenovirus-carrying gene encoding Haliotis discus discus sialic acid binding lectin (Ad.FLAG-HddSBL) suppressed cancer cell proliferation by inducing apoptosis, as compared to the control virus Ad.FLAG. A down-regulated level of anti-apoptosis factor Bcl-2 was suggested to be responsible for the apoptosis induced by Ad.FLAG-HddSBL infection. Further subcellular localization studies revealed that HddSBL distributed in cell membrane, ER, and the nucleus, but not in mitochondria and Golgi apparatus. In contrast, a previously reported mannose-binding lectin Pinellia pedatisecta agglutinin entered the nucleus as well, but did not distribute in inner membrane systems, suggesting differed intracellular sialylation and mannosylation, which may provide different targets for lectin binding. Further cancer-specific controlling of HddSBL expression and animal studies may help to provide insights into a novel way of anti-cancer marine lectin gene therapy. Lectins may provide a reservoir of anti-cancer genes.

  16. Regulation of the ald Gene Encoding Alanine Dehydrogenase by AldR in Mycobacterium smegmatis

    Science.gov (United States)

    Jeong, Ji-A; Baek, Eun-Young; Kim, Si Wouk; Choi, Jong-Soon

    2013-01-01

    The regulatory gene aldR was identified 95 bp upstream of the ald gene encoding l-alanine dehydrogenase in Mycobacterium smegmatis. The AldR protein shows sequence similarity to the regulatory proteins of the Lrp/AsnC family. Using an aldR deletion mutant, we demonstrated that AldR serves as both activator and repressor for the regulation of ald gene expression, depending on the presence or absence of l-alanine. The purified AldR protein exists as a homodimer in the absence of l-alanine, while it adopts the quaternary structure of a homohexamer in the presence of l-alanine. The binding affinity of AldR for the ald control region was shown to be increased significantly by l-alanine. Two AldR binding sites (O1 and O2) with the consensus sequence GA-N2-ATC-N2-TC and one putative AldR binding site with the sequence GA-N2-GTT-N2-TC were identified upstream of the ald gene. Alanine and cysteine were demonstrated to be the effector molecules directly involved in the induction of ald expression. The cellular level of l-alanine was shown to be increased in M. smegmatis cells grown under hypoxic conditions, and the hypoxic induction of ald expression appears to be mediated by AldR, which senses the intracellular level of alanine. PMID:23749971

  17. The Bradyrhizobium japonicum frcB Gene Encodes a Diheme Ferric Reductase ▿†

    Science.gov (United States)

    Small, Sandra K.; O'Brian, Mark R.

    2011-01-01

    Iron utilization by bacteria in aerobic environments involves uptake as a ferric chelate from the environment, followed by reduction to the ferrous form. Ferric iron reduction is poorly understood in most bacterial species. Here, we identified Bradyrhizobium japonicum frcB (bll3557) as a gene adjacent to, and coregulated with, the pyoR gene (blr3555) encoding the outer membrane receptor for transport of a ferric pyoverdine. FrcB is a membrane-bound, diheme protein, characteristic of eukaryotic ferric reductases. Heme was essential for FrcB stability, as were conserved histidine residues in the protein that likely coordinate the heme moieties. Expression of the frcB gene in Escherichia coli conferred ferric reductase activity on those cells. Furthermore, reduced heme in purified FrcB was oxidized by ferric iron in vitro. B. japonicum cells showed inducible ferric reductase activity in iron-limited cells that was diminished in an frcB mutant. Steady-state levels of frcB mRNA were strongly induced under iron-limiting conditions, but transcript levels were low and unresponsive to iron in an irr mutant lacking the global iron response transcriptional regulator Irr. Thus, Irr positively controls the frcB gene. FrcB belongs to a family of previously uncharacterized proteins found in many proteobacteria and some cyanobacteria. This suggests that membrane-bound, heme-containing ferric reductase proteins are not confined to eukaryotes but may be common in bacteria. PMID:21705608

  18. The Bradyrhizobium japonicum frcB gene encodes a diheme ferric reductase.

    Science.gov (United States)

    Small, Sandra K; O'Brian, Mark R

    2011-08-01

    Iron utilization by bacteria in aerobic environments involves uptake as a ferric chelate from the environment, followed by reduction to the ferrous form. Ferric iron reduction is poorly understood in most bacterial species. Here, we identified Bradyrhizobium japonicum frcB (bll3557) as a gene adjacent to, and coregulated with, the pyoR gene (blr3555) encoding the outer membrane receptor for transport of a ferric pyoverdine. FrcB is a membrane-bound, diheme protein, characteristic of eukaryotic ferric reductases. Heme was essential for FrcB stability, as were conserved histidine residues in the protein that likely coordinate the heme moieties. Expression of the frcB gene in Escherichia coli conferred ferric reductase activity on those cells. Furthermore, reduced heme in purified FrcB was oxidized by ferric iron in vitro. B. japonicum cells showed inducible ferric reductase activity in iron-limited cells that was diminished in an frcB mutant. Steady-state levels of frcB mRNA were strongly induced under iron-limiting conditions, but transcript levels were low and unresponsive to iron in an irr mutant lacking the global iron response transcriptional regulator Irr. Thus, Irr positively controls the frcB gene. FrcB belongs to a family of previously uncharacterized proteins found in many proteobacteria and some cyanobacteria. This suggests that membrane-bound, heme-containing ferric reductase proteins are not confined to eukaryotes but may be common in bacteria.

  19. Hypoxia-inducible genes encoding small EF-hand proteins in rice and tomato.

    Science.gov (United States)

    Otsuka, Chie; Minami, Ikuko; Oda, Kenji

    2010-01-01

    Rice has evolved metabolic and morphological adaptations to low-oxygen stress to grow in submerged paddy fields. To characterize the molecular components that mediate the response to hypoxia in rice, we identified low-oxygen stress early response genes by microarray analysis. Among the highly responsive genes, five genes, OsHREF1 to OsHREF5, shared strong homology. They encoded small proteins harboring two EF-hands, typical Ca(2+)-binding motifs. Homologous genes were found in many land plants, including SlHREF in tomato, which is also strongly induced by hypoxia. SlHREF induction was detected in both roots and shoots of tomato plants under hypoxia. With the exception of OsHREF5, OsHREF expression was unaffected by drought, salinity, cold, or osmotic stress. Fluorescent signals of green fluorescent protein-fused OsHREFs were detected in the cytosol and nucleus. Ruthenium red, an inhibitor of intracellular Ca(2+) release, repressed induction of OsHREF1-4 under hypoxia. The HREFs may be related to the Ca(2+) response to hypoxia.

  20. [Cloning, prokaryotic expression and antibacterial assay of Tenecin gene encoding an antibacterial peptide from Tenebrio molitor].

    Science.gov (United States)

    Liu, Ying; Jiang, Yu-xin; Li, Chao-pin

    2011-12-01

    To clone tenecin gene, an antibacterial peptide gene, from Tenebrio molitor for its prokaryotic expression and explore the molecular mechanism for regulating the expression of antibacterial peptide in Tenebrio molitor larvae. The antibacterial peptide was induced from the larvae of Tenebrio molitor by intraperitoneal injection of Escherichia coli DH-5α (1×10(8)/ml). RT-PCR was performed 72 h after the injection to clone Tenecin gene followed by sequencing and bioinformatic analysis. The recombinant expression vector pET-28a(+)-Tenecin was constructed and transformed into E. coli BL21(DE3) cells and the expression of tenecin protein was observed after IPTG induction. Tenecin expression was detected in transformed E.coli using SDS-PAGE after 1 mmol/L IPTG induction. Tenecin gene, which was about 255 bp in length, encoded Tenecin protein with a relative molecular mass of 9 kD. Incubation of E.coli with 80, 60, 40, and 20 µg/ml tenecin for 18 h resulted in a diameter of the inhibition zone of 25.1∓0.03, 20.7∓0.06, 17.2∓0.11 and 9.3∓0.04 mm, respectively. Tenecin protein possesses strong antibacterial activity against E. coli DH-5α, which warrants further study of this protein for its potential as an antibacterial agent in clinical application.

  1. Molecular characterization of genes encoding cytosolic Hsp70s in the zygomycete fungus Rhizopus nigricans

    Science.gov (United States)

    Černila, Boštjan; Črešnar, Bronislava; Breskvar, Katja

    2003-01-01

    Previous studies have shown that some stressors, including steroid hormones 21-OH progesterone and testosterone, stimulate the accumulation of heat shock protein 70 (hsp70) messenger ribonucleic acid (mRNA) population in the zygomycete filamentous fungus Rhizopus nigricans. In this study we report the cloning of 3 R nigricans hsp70 genes (Rnhsp70-1, Rnhsp70-2, and Rnhsp70-3) encoding cytosolic Hsp70s. With a Southern blot experiment under high stringency conditions we did not detect any additional highly homologous copies of the cytosolic hsp70 genes in the R nigricans genome. Sequence analyses showed that all 3 genes contain introns within the open reading frame. The dynamics of the R nigricans molecular response to progesterone, 21-OH progesterone, and testosterone, as well as to heat shock, copper ions, hydrogen peroxide, and ethanol was studied by temporal analysis of Rnhsp70-1 and Rnhsp70-2 mRNA accumulation. Northern blot experiments revealed that the Rnhsp70-2 transcript level is not affected by testosterone, whereas mRNA levels of both genes are rapidly increased with all the other stressors studied. Moreover, the decrease of transcript levels is notably delayed in ethanol stress, and a difference is observed between the profiles of Rnhsp70-1 and Rnhsp70-2 transcripts during heat stress. PMID:15115284

  2. Mitochondrial Genes of Dinoflagellates Are Transcribed by a Nuclear-Encoded Single-Subunit RNA Polymerase.

    Directory of Open Access Journals (Sweden)

    Chang Ying Teng

    Full Text Available Dinoflagellates are a large group of algae that contribute significantly to marine productivity and are essential photosynthetic symbionts of corals. Although these algae have fully-functioning mitochondria and chloroplasts, both their organelle genomes have been highly reduced and the genes fragmented and rearranged, with many aberrant transcripts. However, nothing is known about their RNA polymerases. We cloned and sequenced the gene for the nuclear-encoded mitochondrial polymerase (RpoTm of the dinoflagellate Heterocapsa triquetra and showed that the protein presequence targeted a GFP construct into yeast mitochondria. The gene belongs to a small gene family, which includes a variety of 3'-truncated copies that may have originated by retroposition. The catalytic C-terminal domain of the protein shares nine conserved sequence blocks with other single-subunit polymerases and is predicted to have the same fold as the human enzyme. However, the N-terminal (promoter binding/transcription initiation domain is not well-conserved. In conjunction with the degenerate nature of the mitochondrial genome, this suggests a requirement for novel accessory factors to ensure the accurate production of functional mRNAs.

  3. Polymorphisms in genes encoding the serotonin and dopamine pathways in two sisters with metachromatic leukodystrophy.

    Science.gov (United States)

    Kumperscak, H G; Dolzan, V; Videtic, A; Plesnicar, B K

    2008-01-01

    Metachromatic leukodystrophy (MLD) is a metabolic disease that has recently been investigated as a model for the study of psychosis. We report on two sisters with adult-type MLD who developed psychiatric symptomatology, but differed in their expression of psychotic and depressive symptoms. Association studies have indicated that polymorphisms in genes encoding the serotonin and dopamine transporters and receptors are related to the symptomatology of schizophrenia and/or depression; hence both sisters were genotyped for some of these candidate genes. The sisters shared dopamine receptor D(2) (DRD(2)) c.1047GG (p.311Ser/Ser) and c.-141Cins/ins polymorphisms, which are significantly associated with schizophrenia, but differed in the serotonin transporter gene-linked polymorphic region and serotonin receptor 1A (5-HT(1A)) c.-1019C to G polymorphisms, which may have increased the elder sister's susceptibility to depressive symptoms. Much bigger samples would be needed to gain enough statistical power to develop any hypotheses. This is the first report on genotyping MLD patients for candidate genes for psychiatric disorders, although MLD has been proposed as a model for schizophrenia.

  4. EXPRESSION OF B-XYLOSIDASE ENCODING GENE IN PHIS/ BACILLUS MEGATERIUM MS SYSTEM

    Directory of Open Access Journals (Sweden)

    sri sumarsih

    2011-01-01

    Full Text Available b-Xylosidase encoding gene from G. thermoleovorans IT-08 had been expressed in the pHIS1525/ B. megaterium MS941 system. The b-xylosidase gene (xyl was inserted into plasmid pHIS1525 and propagated in E. coli DH10b. The recombinant plasmid was transformed into B. megaterium MS941 by protoplast transformation. Transformants were selected by growing the recombinant cells on solid LB medium containing tetracycline (10 µg/ ml. The expression of the b-xylosidase gene was assayed by overlaid the recombinant B. megaterium MS941 cell with agar medium containing 0.2% ethylumbelliferyl-b-D-xyloside (MUX. This research showed that the b-xylosidase gene was succesfully sub-cloned in pHIS1525 system and expressed by the recombinant B. megaterium MS941. Theaddition of 0.5% xylose into the culture medium could increase the activity of recombinantactivity of recombinant of recombinantb-xylosidase by 2.74 fold. The recombinant B. megaterium MS941 secreted 75.56% of the expressed b-xylosidase into culture medium. The crude extract b-xylosidase showed the optimum activity at 50° C and pH 6. The recombinant b-xylosidase was purified from culture supernatant by affinity chromatographic method using agarose containing Ni-NTA (Nickel-Nitrilotriacetic acid. The pure b-xylosidase showed a specific activity of 10.06 Unit/mg protein and relative molecular weight ± 58 kDa.

  5. Evidence of gene conversion in genes encoding the Gal/GalNac lectin complex of Entamoeba.

    Directory of Open Access Journals (Sweden)

    Gareth D Weedall

    2011-06-01

    Full Text Available The human gut parasite Entamoeba histolytica, uses a lectin complex on its cell surface to bind to mucin and to ligands on the intestinal epithelia. Binding to mucin is necessary for colonisation and binding to intestinal epithelia for invasion, therefore blocking this binding may protect against amoebiasis. Acquired protective immunity raised against the lectin complex should create a selection pressure to change the amino acid sequence of lectin genes in order to avoid future detection. We present evidence that gene conversion has occurred in lineages leading to E. histolytica strain HM1:IMSS and E. dispar strain SAW760. This evolutionary mechanism generates diversity and could contribute to immune evasion by the parasites.

  6. Regulatory elements in the promoter region of the rat gene encoding the acyl-CoA-binding protein

    DEFF Research Database (Denmark)

    Elholm, M; Bjerking, G; Knudsen, J

    1996-01-01

    Acyl-CoA-binding protein (ACBP) is an ubiquitously expressed 10-kDa protein which is present in high amounts in cells involved in solute transport or secretion. Rat ACBP is encoded by a gene containing the typical hallmarks of a housekeeping gene. Analysis of the promoter region of the rat ACBP g...

  7. Enhanced expression in tobacco of the gene encoding green fluorescent protein by modification of its codon usage

    NARCIS (Netherlands)

    Rouwendal, G.J.A.; Mendes, O.; Wolbert, E.J.H.; Boer, de A.D.

    1997-01-01

    The gene encoding green fluorescent protein (GFP) from Aequorea victoria was resynthesized to adapt its codon usage for expression in plants by increasing the frequency of codons with a C or a G in the third position from 32 to 60%. The strategy for constructing the synthetic gfp gene was based on

  8. Prevalence of genes encoding for members of the staphylococcal leukotoxin family among clinical isolates of Staphylococcus aureus

    NARCIS (Netherlands)

    von Eiff, Christof; Friedrich, Alexander W.; Peters, Georg; Becker, Karsten

    Well-characterized Staphylococcus aureus nasal and blood isolates (N = 429) were tested by polymerase chain reaction for the prevalence of genes that encode leukocidal toxins. The leukotoxin genes lukE+lukD were found at high prevalence, significantly more so in blood (82%) than in nasal isolates

  9. Cloning and Characterization of a Gene (mspA) Encoding the Major Sheath Protein of Treponema maltophilum ATCC 51939T

    Science.gov (United States)

    Heuner, Klaus; Choi, Bong-Kyu; Schade, Rüdiger; Moter, Annette; Otto, Albrecht; Göbel, Ulf B.

    1999-01-01

    The major sheath protein-encoding gene (mspA) of the oral spirochete Treponema maltophilum ATCC 51939T was cloned by screening a genomic library with an anti-outer membrane fraction antibody. The mspA gene encodes a precursor protein of 575 amino acids with a predicted molecular mass of 62.3 kDa, including a signal peptide of 19 amino acids. The native MspA formed a heat-modifiable, detergent- and trypsin-stable complex which is associated with the outer membrane. Hybridization with an mspA-specific probe showed no cross-reactivity with the msp gene from Treponema denticola. PMID:9922270

  10. Time-series clustering of gene expression in irradiated and bystander fibroblasts: an application of FBPA clustering

    Directory of Open Access Journals (Sweden)

    Markatou Marianthi

    2011-01-01

    Full Text Available Abstract Background The radiation bystander effect is an important component of the overall biological response of tissues and organisms to ionizing radiation, but the signaling mechanisms between irradiated and non-irradiated bystander cells are not fully understood. In this study, we measured a time-series of gene expression after α-particle irradiation and applied the Feature Based Partitioning around medoids Algorithm (FBPA, a new clustering method suitable for sparse time series, to identify signaling modules that act in concert in the response to direct irradiation and bystander signaling. We compared our results with those of an alternate clustering method, Short Time series Expression Miner (STEM. Results While computational evaluations of both clustering results were similar, FBPA provided more biological insight. After irradiation, gene clusters were enriched for signal transduction, cell cycle/cell death and inflammation/immunity processes; but only FBPA separated clusters by function. In bystanders, gene clusters were enriched for cell communication/motility, signal transduction and inflammation processes; but biological functions did not separate as clearly with either clustering method as they did in irradiated samples. Network analysis confirmed p53 and NF-κB transcription factor-regulated gene clusters in irradiated and bystander cells and suggested novel regulators, such as KDM5B/JARID1B (lysine (K-specific demethylase 5B and HDACs (histone deacetylases, which could epigenetically coordinate gene expression after irradiation. Conclusions In this study, we have shown that a new time series clustering method, FBPA, can provide new leads to the mechanisms regulating the dynamic cellular response to radiation. The findings implicate epigenetic control of gene expression in addition to transcription factor networks.

  11. Lampreys have a single gene cluster for the fast skeletal myosin heavy chain gene family.

    Directory of Open Access Journals (Sweden)

    Daisuke Ikeda

    Full Text Available Muscle tissues contain the most classic sarcomeric myosin, called myosin II, which consists of 2 heavy chains (MYHs and 4 light chains. In the case of humans (tetrapod, a total of 6 fast skeletal-type MYH genes (MYHs are clustered on a single chromosome. In contrast, torafugu (teleost contains at least 13 fast skeletal MYHs, which are distributed in 5 genomic regions; the MYHs are clustered in 3 of these regions. In the present study, the evolutionary relationship among fast skeletal MYHs is elucidated by comparing the MYHs of teleosts and tetrapods with those of cyclostome lampreys, one of two groups of extant jawless vertebrates (agnathans. We found that lampreys contain at least 3 fast skeletal MYHs, which are clustered in a head-to-tail manner in a single genomic region. Although there was apparent synteny in the corresponding MYH cluster regions between lampreys and tetrapods, phylogenetic analysis indicated that lamprey and tetrapod MYHs have independently duplicated and diversified. Subsequent transgenic approaches showed that the 5'-flanking sequences of Japanese lamprey fast skeletal MYHs function as a regulatory sequence to drive specific reporter gene expression in the fast skeletal muscle of zebrafish embryos. Although zebrafish MYH promoters showed apparent activity to direct reporter gene expression in myogenic cells derived from mice, promoters from Japanese lamprey MYHs had no activity. These results suggest that the muscle-specific regulatory mechanisms are partially conserved between teleosts and tetrapods but not between cyclostomes and tetrapods, despite the conserved synteny.

  12. Sequencing and Transcriptional Analysis of the Biosynthesis Gene Cluster of Putrescine-Producing Lactococcus lactis ▿ †

    Science.gov (United States)

    Ladero, Victor; Rattray, Fergal P.; Mayo, Baltasar; Martín, María Cruz; Fernández, María; Alvarez, Miguel A.

    2011-01-01

    Lactococcus lactis is a prokaryotic microorganism with great importance as a culture starter and has become the model species among the lactic acid bacteria. The long and safe history of use of L. lactis in dairy fermentations has resulted in the classification of this species as GRAS (General Regarded As Safe) or QPS (Qualified Presumption of Safety). However, our group has identified several strains of L. lactis subsp. lactis and L. lactis subsp. cremoris that are able to produce putrescine from agmatine via the agmatine deiminase (AGDI) pathway. Putrescine is a biogenic amine that confers undesirable flavor characteristics and may even have toxic effects. The AGDI cluster of L. lactis is composed of a putative regulatory gene, aguR, followed by the genes (aguB, aguD, aguA, and aguC) encoding the catabolic enzymes. These genes are transcribed as an operon that is induced in the presence of agmatine. In some strains, an insertion (IS) element interrupts the transcription of the cluster, which results in a non-putrescine-producing phenotype. Based on this knowledge, a PCR-based test was developed in order to differentiate nonproducing L. lactis strains from those with a functional AGDI cluster. The analysis of the AGDI cluster and their flanking regions revealed that the capacity to produce putrescine via the AGDI pathway could be a specific characteristic that was lost during the adaptation to the milk environment by a process of reductive genome evolution. PMID:21803900

  13. Evolution of Chromosomal Clostridium botulinum Type E Neurotoxin Gene Clusters: Evidence Provided by Their Rare Plasmid-Borne Counterparts.

    Science.gov (United States)

    Carter, Andrew T; Austin, John W; Weedmark, Kelly A; Peck, Michael W

    2016-03-02

    Analysis of more than 150 Clostridium botulinum Group II type E genomes identified a small fraction (6%) where neurotoxin-encoding genes were located on plasmids. Seven closely related (134-144 kb) neurotoxigenic plasmids of subtypes E1, E3, and E10 were characterized; all carried genes associated with plasmid mobility via conjugation. Each plasmid contained the same 24-kb neurotoxin cluster cassette (six neurotoxin cluster and six flanking genes) that had split a helicase gene, rather than the more common chromosomal rarA. The neurotoxin cluster cassettes had evolved as separate genetic units which had either exited their chromosomal rarA locus in a series of parallel events, inserting into the plasmid-borne helicase gene, or vice versa. A single intact version of the helicase gene was discovered on a nonneurotoxigenic form of this plasmid. The observed low frequency for the plasmid location may reflect one or more of the following: 1) Less efficient recombination mechanism for the helicase gene target, 2) lack of suitable target plasmids, and 3) loss of neurotoxigenic plasmids. Type E1 and E10 plasmids possessed a Clustered Regularly Interspaced Short Palindromic Repeats locus with spacers that recognized C. botulinum Group II plasmids, but not C. botulinum Group I plasmids, demonstrating their long-term separation. Clostridium botulinum Group II type E strains also carry nonneurotoxigenic plasmids closely related to C. botulinum Group II types B and F plasmids. Here, the absence of neurotoxin cassettes may be because recombination requires both a specific mechanism and specific target sequence, which are rarely found together. © The Author 2016. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  14. The medaka novel immune-type receptor (NITR gene clusters reveal an extraordinary degree of divergence in variable domains

    Directory of Open Access Journals (Sweden)

    Litman Gary W

    2008-06-01

    Full Text Available Abstract Background Novel immune-type receptor (NITR genes are members of diversified multigene families that are found in bony fish and encode type I transmembrane proteins containing one or two extracellular immunoglobulin (Ig domains. The majority of NITRs can be classified as inhibitory receptors that possess cytoplasmic immunoreceptor tyrosine-based inhibition motifs (ITIMs. A much smaller number of NITRs can be classified as activating receptors by the lack of cytoplasmic ITIMs and presence of a positively charged residue within their transmembrane domain, which permits partnering with an activating adaptor protein. Results Forty-four NITR genes in medaka (Oryzias latipes are located in three gene clusters on chromosomes 10, 18 and 21 and can be organized into 24 families including inhibitory and activating forms. The particularly large dataset acquired in medaka makes direct comparison possible to another complete dataset acquired in zebrafish in which NITRs are localized in two clusters on different chromosomes. The two largest medaka NITR gene clusters share conserved synteny with the two zebrafish NITR gene clusters. Shared synteny between NITRs and CD8A/CD8B is limited but consistent with a potential common ancestry. Conclusion Comprehensive phylogenetic analyses between the complete datasets of NITRs from medaka and zebrafish indicate multiple species-specific expansions of different families of NITRs. The patterns of sequence variation among gene family members are consistent with recent birth-and-death events. Similar effects have been observed with mammalian immunoglobulin (Ig, T cell antigen receptor (TCR and killer cell immunoglobulin-like receptor (KIR genes. NITRs likely diverged along an independent pathway from that of the somatically rearranging antigen binding receptors but have undergone parallel evolution of V family diversity.

  15. Gene expression profiling in cluster headache: a pilot microarray study.

    Science.gov (United States)

    Sjöstrand, Christina; Duvefelt, Kristina; Steinberg, Anna; Remahl, Ingela Nilsson; Waldenlind, Elisabet; Hillert, Jan

    2006-01-01

    Cluster headache (CH) is a primary neurovascular headache disorder characterized by attacks of excruciating pain accompanied by ipsilateral autonomic symptoms. CH pathophysiology is presumed to involve an activation of hypothalamic and trigeminovascular systems, but inflammation and immunological mechanisms have also been hypothesized to be of importance. To identify differentially expressed genes during different clinical phases of CH, assuming that changes of pathophysiological importance would also be seen in peripheral venous blood. Blood samples were drawn at 3 consecutive occasions from 3 episodic CH patients: during attacks, between attacks and in remission, and at 1 occasion from 3 matched controls. Global gene expression was analyzed with microarray tehnology using the Affymetrix Human Genome U133 2.0 Plus GeneChip Set, covering more than 54,000 gene transcripts, corresponding to almost 22,000 genes. Quantitative RT-PCR on S100P gene expression was analyzed in 6 patients and 14 controls. Overall, quite small differences were seen intraindividually and large differences interindividually. However, pairwise comparisons of signal values showed upregulation of several S100 calcium binding proteins; S100A8 (calgranulin A), S100A12 (calgranulin C), and S100P during active phase of the disease compared to remission. Also, annexin A3 (calcium-binding) and ICAM3 showed upregulation. BIRC1 (neuronal apoptosis inhibitory protein), CREB5, HLA-DQA1, and HLA-DQB1 were upregulated in patients compared to controls. The upregulation of S100P during attack versus remission was confirmed by quantitative RT-PCR analysis. The S100A8 and S100A12 proteins are considered markers of non-infectious inflammatory disease, while the function of S100P is still largely unknown. Furthermore, upregulation of HLA-DQ genes in CH patients may also indicate an inflammatory response. Upregulation of these pro-inflammatory genes during the active phase of CH has not formerly been reported. Data

  16. The ergot alkaloid gene cluster in Claviceps purpurea: extension of the cluster sequence and intra species evolution.

    Science.gov (United States)

    Haarmann, Thomas; Machado, Caroline; Lübbe, Yvonne; Correia, Telmo; Schardl, Christopher L; Panaccione, Daniel G; Tudzynski, Paul

    2005-06-01

    The genomic region of Claviceps purpurea strain P1 containing the ergot alkaloid gene cluster [Tudzynski, P., Hölter, K., Correia, T., Arntz, C., Grammel, N., Keller, U., 1999. Evidence for an ergot alkaloid gene cluster in Claviceps purpurea. Mol. Gen. Genet. 261, 133-141] was explored by chromosome walking, and additional genes probably involved in the ergot alkaloid biosynthesis have been identified. The putative cluster sequence (extending over 68.5kb) contains 4 different nonribosomal peptide synthetase (NRPS) genes and several putative oxidases. Northern analysis showed that most of the genes were co-regulated (repressed by high phosphate), and identified probable flanking genes by lack of co-regulation. Comparison of the cluster sequences of strain P1, an ergotamine producer, with that of strain ECC93, an ergocristine producer, showed high conservation of most of the cluster genes, but significant variation in the NRPS modules, strongly suggesting that evolution of these chemical races of C. purpurea is determined by evolution of NRPS module specificity.

  17. WRKY domain-encoding genes of a crop legume chickpea (Cicer arietinum): comparative analysis with Medicago truncatula WRKY family and characterization of group-III gene(s).

    Science.gov (United States)

    Kumar, Kamal; Srivastava, Vikas; Purayannur, Savithri; Kaladhar, V Chandra; Cheruvu, Purnima Jaiswal; Verma, Praveen Kumar

    2016-06-01

    The WRKY genes have been identified as important transcriptional modulators predominantly during the environmental stresses, but they also play critical role at various stages of plant life cycle. We report the identification of WRKY domain (WD)-encoding genes from galegoid clade legumes chickpea (Cicer arietinum L.) and barrel medic (Medicago truncatula). In total, 78 and 98 WD-encoding genes were found in chickpea and barrel medic, respectively. Comparative analysis suggests the presence of both conserved and unique WRKYs, and expansion of WRKY family in M. truncatula primarily by tandem duplication. Exclusively found in galegoid legumes, CaWRKY16 and its orthologues encode for a novel protein having a transmembrane and partial Exo70 domains flanking a group-III WD. Genomic region of galegoids, having CaWRKY16, is more dynamic when compared with millettioids. In onion cells, fused CaWRKY16-EYFP showed punctate fluorescent signals in cytoplasm. The chickpea WRKY group-III genes were further characterized for their transcript level modulation during pathogenic stress and treatments of abscisic acid, jasmonic acid, and salicylic acid (SA) by real-time PCR. Differential regulation of genes was observed during Ascochyta rabiei infection and SA treatment. Characterization of A. rabiei and SA inducible gene CaWRKY50 showed that it localizes to plant nucleus, binds to W-box, and have a C-terminal transactivation domain. Overexpression of CaWRKY50 in tobacco plants resulted in early flowering and senescence. The in-depth comparative account presented here for two legume WRKY genes will be of great utility in hastening functional characterization of crop legume WRKYs and will also help in characterization of Exo70Js. © The Author 2016. Published by Oxford University Press on behalf of Kazusa DNA Research Institute.

  18. Characterization of the human laminin beta2 chain locus (LAMB2): linkage to a gene containing a nonprocessed, transcribed LAMB2-like pseudogene (LAMB2L) and to the gene encoding glutaminyl tRNA synthetase (QARS)

    DEFF Research Database (Denmark)

    Durkin, M E; Jäger, A C; Khurana, T S

    1999-01-01

    The laminin beta2 chain is an important constituent of certain kidney and muscle basement membranes. We have generated a detailed physical map of a 110-kb genomic DNA segment surrounding the human laminin beta2 chain gene (LAMB2) on chromosome 3p21.3-->p21.2, a region paralogous with the chromosome...... 7q22-->q31 region that contains the laminin beta1 chain gene locus (LAMB1). Several CpG islands and a novel polymorphic microsatellite marker (D3S4594) were identified. The 3' end of LAMB2 lies 16 kb from the 5' end of the glutaminyl tRNA synthetase gene (QARS). About 20 kb upstream of LAMB2 we...... found a gene encoding a transcribed, non-processed LAMB2-like pseudogene (LAMB2L). The sequence of 1.75 kb of genomic DNA at the 3' end of LAMB2L was similar to exons 8-12 of the laminin beta2 chain gene. The LAMB2L-LAMB2-QARS cluster lies telomeric to the gene encoding the laminin-binding protein...

  19. Demonstration of expression of a neuropeptide-encoding gene in crustacean hemocytes.

    Science.gov (United States)

    Wu, Su-Hua; Chen, Yan-Jhou; Huang, Shao-Yen; Tsai, Wei-Shiun; Wu, Hsin-Ju; Hsu, Tsan-Ting; Lee, Chi-Ying

    2012-04-01

    Crustacean hyperglycemic hormone (CHH) was originally identified in a neuroendocrine system-the X-organ/sinus gland complex. In this study, a cDNA (Prc-CHH) encoding CHH precursor was cloned from the hemocyte of the crayfish Procambarus clarkii. Analysis of tissues by a CHH-specific enzyme-linked immunosorbent assay (ELISA) confirmed the presence of CHH in hemocytes, the levels of which were much lower than those in the sinus gland, but 2 to 10 times higher than those in the thoracic and cerebral ganglia. Total hemocytes were separated by density gradient centrifugation into layers of hyaline cell (HC), semi-granular cell (SGC), and granular cell (GC). Analysis of extracts of each layer using ELISA revealed that CHH is present in GCs (202.8±86.7 fmol/mg protein) and SGCs (497.8±49.4 fmol/mg protein), but not in HCs. Finally, CHH stimulated the membrane-bound guanylyl cyclase (GC) activity of hemocytes in a dose-dependent manner. These data for the first time confirm that a crustacean neuropeptide-encoding gene is expressed in cells essential for immunity and its expression in hemocytes is cell type-specific. Effect of CHH on the membrane-bound GC activity of hemocyte suggests that hemocyte is a target site of CHH. Possible functions of the hemocyte-derived CHH are discussed. Copyright © 2012 Elsevier Inc. All rights reserved.

  20. Lateral gene transfer of streptococcal ICE element RD2 (region of difference 2 encoding secreted proteins

    Directory of Open Access Journals (Sweden)

    Mereghetti Laurent

    2011-04-01

    Full Text Available Abstract Background The genome of serotype M28 group A Streptococcus (GAS strain MGAS6180 contains a novel genetic element named Region of Difference 2 (RD2 that encodes seven putative secreted extracellular proteins. RD2 is present in all serotype M28 strains and strains of several other GAS serotypes associated with female urogenital infections. We show here that the GAS RD2 element is present in strain MGAS6180 both as an integrative chromosomal form and a circular extrachromosomal element. RD2-like regions were identified in publicly available genome sequences of strains representing three of the five major group B streptococcal serotypes causing human disease. Ten RD2-encoded proteins have significant similarity to proteins involved in conjugative transfer of Streptococcus thermophilus integrative chromosomal elements (ICEs. Results We transferred RD2 from GAS strain MGAS6180 (serotype M28 to serotype M1 and M4 GAS strains by filter mating. The copy number of the RD2 element was rapidly and significantly increased following treatment of strain MGAS6180 with mitomycin C, a DNA damaging agent. Using a PCR-based method, we also identified RD2-like regions in multiple group C and G strains of Streptococcus dysgalactiae subsp.equisimilis cultured from invasive human infections. Conclusions Taken together, the data indicate that the RD2 element has disseminated by lateral gene transfer to genetically diverse strains of human-pathogenic streptococci.

  1. The zebrafish moonshine gene encodes transcriptional intermediary factor 1gamma, an essential regulator of hematopoiesis.

    Directory of Open Access Journals (Sweden)

    David G Ransom

    2004-08-01

    Full Text Available Hematopoiesis is precisely orchestrated by lineage-specific DNA-binding proteins that regulate transcription in concert with coactivators and corepressors. Mutations in the zebrafish moonshine (mon gene specifically disrupt both embryonic and adult hematopoiesis, resulting in severe red blood cell aplasia. We report that mon encodes the zebrafish ortholog of mammalian transcriptional intermediary factor 1gamma (TIF1gamma (or TRIM33, a member of the TIF1 family of coactivators and corepressors. During development, hematopoietic progenitor cells in mon mutants fail to express normal levels of hematopoietic transcription factors, including gata1, and undergo apoptosis. Three different mon mutant alleles each encode premature stop codons, and enforced expression of wild-type tif1gamma mRNA rescues embryonic hematopoiesis in homozygous mon mutants. Surprisingly, a high level of zygotic tif1gamma mRNA expression delineates ventral mesoderm during hematopoietic stem cell and progenitor formation prior to gata1 expression. Transplantation studies reveal that tif1gamma functions in a cell-autonomous manner during the differentiation of erythroid precursors. Studies in murine erythroid cell lines demonstrate that Tif1gamma protein is localized within novel nuclear foci, and expression decreases during erythroid cell maturation. Our results establish a major role for this transcriptional intermediary factor in the differentiation of hematopoietic cells in vertebrates.

  2. Characterization and detection of a widely distributed gene cluster that predicts anaerobic choline utilization by human gut bacteria.

    Science.gov (United States)

    Martínez-del Campo, Ana; Bodea, Smaranda; Hamer, Hilary A; Marks, Jonathan A; Haiser, Henry J; Turnbaugh, Peter J; Balskus, Emily P

    2015-04-14

    choline fermentation (the cut gene cluster) have been recently identified, there has been no characterization of these genes in human gut isolates and microbial communities. In this work, we use multiple approaches to demonstrate that the pathway encoded by the cut genes is present and functional in a diverse range of human gut bacteria and is also widespread in stool metagenomes. We also developed a PCR-based strategy to detect a key functional gene (cutC) involved in this pathway and applied it to characterize newly isolated choline-utilizing strains. Both our analyses of the cut gene cluster and this molecular tool will aid efforts to further understand the role of choline metabolism in the human gut microbiota and its link to disease. Copyright © 2015 Martínez-del Campo et al.

  3. Kallmann syndrome: mutations in the genes encoding prokineticin-2 and prokineticin receptor-2.

    Directory of Open Access Journals (Sweden)

    Catherine Dodé

    2006-10-01

    Full Text Available Kallmann syndrome combines anosmia, related to defective olfactory bulb morphogenesis, and hypogonadism due to gonadotropin-releasing hormone deficiency. Loss-of-function mutations in KAL1 and FGFR1 underlie the X chromosome-linked form and an autosomal dominant form of the disease, respectively. Mutations in these genes, however, only account for approximately 20% of all Kallmann syndrome cases. In a cohort of 192 patients we took a candidate gene strategy and identified ten and four different point mutations in the genes encoding the G protein-coupled prokineticin receptor-2 (PROKR2 and one of its ligands, prokineticin-2 (PROK2, respectively. The mutations in PROK2 were detected in the heterozygous state, whereas PROKR2 mutations were found in the heterozygous, homozygous, or compound heterozygous state. In addition, one of the patients heterozygous for a PROKR2 mutation was also carrying a missense mutation in KAL1, thus indicating a possible digenic inheritance of the disease in this individual. These findings reveal that insufficient prokineticin-signaling through PROKR2 leads to abnormal development of the olfactory system and reproductive axis in man. They also shed new light on the complex genetic transmission of Kallmann syndrome.

  4. Identification of Genes Encoding Granule-Bound Starch Synthase Involved in Amylose Metabolism in Banana Fruit

    Science.gov (United States)

    Liu, Weixin; Xu, Biyu; Jin, Zhiqiang

    2014-01-01

    Granule-bound starch synthase (GBSS) is responsible for amylose synthesis, but the role of GBSS genes and their encoded proteins remains poorly understood in banana. In this study, amylose content and GBSS activity gradually increased during development of the banana fruit, and decreased during storage of the mature fruit. GBSS protein in banana starch granules was approximately 55.0 kDa. The protein was up-regulated expression during development while it was down-regulated expression during storage. Six genes, designated as MaGBSSI-1, MaGBSSI-2, MaGBSSI-3, MaGBSSI-4, MaGBSSII-1, and MaGBSSII-2, were cloned and characterized from banana fruit. Among the six genes, the expression pattern of MaGBSSI-3 was the most consistent with the changes in amylose content, GBSS enzyme activity, GBSS protein levels, and the quantity or size of starch granules in banana fruit. These results suggest that MaGBSSI-3 might regulate amylose metabolism by affecting the variation of GBSS levels and the quantity or size of starch granules in banana fruit during development or storage. PMID:24505384

  5. Identification of genes encoding granule-bound starch synthase involved in amylose metabolism in banana fruit.

    Directory of Open Access Journals (Sweden)

    Hongxia Miao

    Full Text Available Granule-bound starch synthase (GBSS is responsible for amylose synthesis, but the role of GBSS genes and their encoded proteins remains poorly understood in banana. In this study, amylose content and GBSS activity gradually increased during development of the banana fruit, and decreased during storage of the mature fruit. GBSS protein in banana starch granules was approximately 55.0 kDa. The protein was up-regulated expression during development while it was down-regulated expression during storage. Six genes, designated as MaGBSSI-1, MaGBSSI-2, MaGBSSI-3, MaGBSSI-4, MaGBSSII-1, and MaGBSSII-2, were cloned and characterized from banana fruit. Among the six genes, the expression pattern of MaGBSSI-3 was the most consistent with the changes in amylose content, GBSS enzyme activity, GBSS protein levels, and the quantity or size of starch granules in banana fruit. These results suggest that MaGBSSI-3 might regulate amylose metabolism by affecting the variation of GBSS levels and the quantity or size of starch granules in banana fruit during development or storage.

  6. Halloween genes encode P450 enzymes that mediate steroid hormone biosynthesis in Drosophila melanogaster.

    Science.gov (United States)

    Gilbert, Lawrence I

    2004-02-27

    Mutation of members of the Halloween gene family results in embryonic lethality. We have shown that two of these genes code for enzymes responsible for specific steps in the synthesis of ecdysone, a polyhydroxylated sterol that is the precursor of the major molting hormone of all arthropods, 20-hydroxyecdysone. These two mitochondrial P450 enzymes, coded for by disembodied (dib) (CYP302A1) and shadow (sad) (CYP315A1), are the C22 and C2 hydroxylases, respectively, as shown by transfection of the gene into S2 cells and subsequent biochemical analysis. These are the last two enzymes in the ecdysone biosynthetic pathway. A third enzyme, necessary for the critical conversion of ecdysone to 20-hydroxyecdysone, the 20-monooxygenase, is encoded by shade (shd) (CYP314A1). All three enzymes are mitochondrial although shade has motifs suggesting both mitochondrial and microsomal locations. By tagging these enzymes, their subcellular location has been confirmed by confocal microscopy. Shade is present in several tissues as expected while disembodied and shadow are restricted to the ring gland. The paradigm used should allow us to define the enzymes mediating the entire ecdysteroid biosynthetic pathway.

  7. The Candida albicans-specific gene EED1 encodes a key regulator of hyphal extension.

    LENUS (Irish Health Repository)

    Martin, Ronny

    2011-04-01

    The extension of germ tubes into elongated hyphae by Candida albicans is essential for damage of host cells. The C. albicans-specific gene EED1 plays a crucial role in this extension and maintenance of filamentous growth. eed1Δ cells failed to extend germ tubes into long filaments and switched back to yeast growth after 3 h of incubation during growth on plastic surfaces. Expression of EED1 is regulated by the transcription factor Efg1 and ectopic overexpression of EED1 restored filamentation in efg1Δ. Transcriptional profiling of eed1Δ during infection of oral tissue revealed down-regulation of hyphal associated genes including UME6, encoding another key transcriptional factor. Ectopic overexpression of EED1 or UME6 rescued filamentation and damage potential in eed1Δ. Transcriptional profiling during overexpression of UME6 identified subsets of genes regulated by Eed1 or Ume6. These data suggest that Eed1 and Ume6 act in a pathway regulating maintenance of hyphal growth thereby repressing hyphal-to-yeast transition and permitting dissemination of C. albicans within epithelial tissues.

  8. A Mutation in the Tubulin-Encoding Gene Causes Complex Cortical Malformations and Unilateral Hypohidrosis

    Directory of Open Access Journals (Sweden)

    Shinobu Fukumura MD

    2016-08-01

    Full Text Available Recent studies have emphasized the association between tubulin gene mutations and developmental abnormalities of the cortex. In this study, the authors identified a mutation in the tubulin-encoding class III β-tubulin ( TUBB3 gene in a 4-year-old boy presenting with brain abnormalities and unilateral hypohidrosis. The patient showed a left internal strabismus, moderate developmental delay, and congenital hypohidrosis of the right side of the body. Magnetic resonance imaging disclosed gyral disorganization mainly in the left perisylvian region, dysmorphic and hypertrophic basal ganglia with fusion between the putamen and caudate nucleus without affecting the anterior limb of the internal capsule, and moderate hypoplasia of the right brain stem and cerebellum. Diffusion tensor imaging studies revealed disorganization of the pyramidal fibers. The amplitude of the sympathetic skin response was low in the right arm, which led to a diagnosis of focal autonomic neuropathy. Sequencing the TUBB3 gene revealed a de novo missense mutation, c.862G>A (p.E288K.

  9. Identification of genes encoding granule-bound starch synthase involved in amylose metabolism in banana fruit.

    Science.gov (United States)

    Miao, Hongxia; Sun, Peiguang; Liu, Weixin; Xu, Biyu; Jin, Zhiqiang

    2014-01-01

    Granule-bound starch synthase (GBSS) is responsible for amylose synthesis, but the role of GBSS genes and their encoded proteins remains poorly understood in banana. In this study, amylose content and GBSS activity gradually increased during development of the banana fruit, and decreased during storage of the mature fruit. GBSS protein in banana starch granules was approximately 55.0 kDa. The protein was up-regulated expression during development while it was down-regulated expression during storage. Six genes, designated as MaGBSSI-1, MaGBSSI-2, MaGBSSI-3, MaGBSSI-4, MaGBSSII-1, and MaGBSSII-2, were cloned and characterized from banana fruit. Among the six genes, the expression pattern of MaGBSSI-3 was the most consistent with the changes in amylose content, GBSS enzyme activity, GBSS protein levels, and the quantity or size of starch granules in banana fruit. These results suggest that MaGBSSI-3 might regulate amylose metabolism by affecting the variation of GBSS levels and the quantity or size of starch granules in banana fruit during development or storage.

  10. Two Paralogous Genes Encoding Auxin Efflux Carrier Differentially Expressed in Bitter Gourd (Momordica charantia

    Directory of Open Access Journals (Sweden)

    Yi-Li Li

    2017-11-01

    Full Text Available The phytohormone auxin regulates various developmental programs in plants, including cell growth, cell division and cell differentiation. The auxin efflux carriers are essential for the auxin transport. To show an involvement of auxin transporters in the coordination of fruit development in bitter gourd, a juicy fruit, we isolated novel cDNAs (referred as McPIN encoding putative auxin efflux carriers, including McPIN1, McPIN2 (allele of McPIN1 and McPIN3, from developing fruits of bitter gourd. Both McPIN1 and McPIN3 genes possess six exons and five introns. Hydropathy analysis revealed that both polypeptides have two hydrophobic regions with five transmembrane segments and a predominantly hydrophilic core. Phylogenetic analyses revealed that McPIN1 shared the highest homology to the group of Arabidopsis, cucumber and tomato PIN1, while McPIN3 belonged to another group, including Arabidopsis and tomato PIN3 as well as PIN4. This suggests different roles for McPIN1 and McPIN3 in auxin transport involved in the fruit development of bitter gourd. Maximum mRNA levels for both genes were detected in staminate and pistillate flowers. McPIN1 is expressed in a particular period of early fruit development but McPIN3 continues to be expressed until the last stage of fruit ripening. Moreover, these two genes are auxin-inducible and qualified as early auxin-response genes. Their expression patterns suggest that these two auxin transporter genes play a pivotal role in fruit setting and development.

  11. Reduction of antinutritional glucosinolates in Brassica oilseeds by mutation of genes encoding transporters

    DEFF Research Database (Denmark)

    Nour-Eldin, Hussam Hassan; Madsen, Svend Roesen; Engelen, Steven

    2017-01-01

    -of-function phenotypes into Brassica crops is challenging because Brassica is polyploid. We mutated one of seven and four of 12 GTR orthologs and reduced glucosinolate levels in seeds by 60-70% in two different Brassica species (Brassica rapa and Brassica juncea). Reduction in seed glucosinolates was stably inherited......The nutritional value of Brassica seed meals is reduced by the presence of glucosinolates, which are toxic compounds involved in plant defense. Mutation of the genes encoding two glucosinolate transporters (GTRs) eliminated glucosinolates from Arabidopsis thaliana seeds, but translation of loss...... over multiple generations and maintained in field trials of two mutant populations at three locations. Successful translation of the gtr loss-of-function phenotype from model plant to two Brassica crops suggests that our transport engineering approach could be broadly applied to reduce seed...

  12. Reduction of antinutritional glucosinolates in Brassica oilseeds by mutation of genes encoding transporters.

    Science.gov (United States)

    Nour-Eldin, Hussam Hassan; Madsen, Svend Roesen; Engelen, Steven; Jørgensen, Morten Egevang; Olsen, Carl Erik; Andersen, Jonathan Sonne; Seynnaeve, David; Verhoye, Thalia; Fulawka, Rudy; Denolf, Peter; Halkier, Barbara Ann

    2017-04-01

    The nutritional value of Brassica seed meals is reduced by the presence of glucosinolates, which are toxic compounds involved in plant defense. Mutation of the genes encoding two glucosinolate transporters (GTRs) eliminated glucosinolates from Arabidopsis thaliana seeds, but translation of loss-of-function phenotypes into Brassica crops is challenging because Brassica is polyploid. We mutated one of seven and four of 12 GTR orthologs and reduced glucosinolate levels in seeds by 60-70% in two different Brassica species (Brassica rapa and Brassica juncea). Reduction in seed glucosinolates was stably inherited over multiple generations and maintained in field trials of two mutant populations at three locations. Successful translation of the gtr loss-of-function phenotype from model plant to two Brassica crops suggests that our transport engineering approach could be broadly applied to reduce seed glucosinolate content in other oilseed crops, such as Camelina sativa or Crambe abyssinica.

  13. A Clostridioides difficile bacteriophage genome encodes functional binary toxin-associated genes.

    Science.gov (United States)

    Riedel, Thomas; Wittmann, Johannes; Bunk, Boyke; Schober, Isabel; Spröer, Cathrin; Gronow, Sabine; Overmann, Jörg

    2017-05-20

    Pathogenic clostridia typically produce toxins as virulence factors which cause severe diseases in both humans and animals. Whereas many clostridia like e.g., Clostridium perfringens, Clostridium botulinum or Clostridium tetani were shown to contain toxin-encoding plasmids, only toxin genes located on the chromosome were detected in Clostridioides difficile so far. In this study, we determined, annotated, and analyzed the complete genome of the bacteriophage phiSemix9P1 using single-molecule real-time sequencing technology (SMRT). To our knowledge, this represents the first C. difficile-associated bacteriophage genome that carries a complete functional binary toxin locus in its genome. Copyright © 2017 Elsevier B.V. All rights reserved.

  14. OVER-EXPRESSION OF GENE ENCODING FATTY ACID METABOLIC ENZYMES IN FISH

    Directory of Open Access Journals (Sweden)

    Alimuddin Alimuddin

    2008-12-01

    Full Text Available Eicosapentaenoic acid (EPA, 20:5n-3 and docosahexaenoic acid (DHA, 22:6n-3 have important nutritional benefits in humans. EPA and DHA are mainly derived from fish, but the decline in the stocks of major marine capture fishes could result in these fatty acids being consumed less. Farmed fish could serve as promising sources of EPA and DHA, but they need these fatty acids in their diets. Generation of fish strains that are capable of synthesizing enough amounts of EPA/DHA from the conversion of α-linolenic acid (LNA, 18:3n-3 rich oils can supply a new EPA/DHA source. This may be achieved by over-expression of genes encoding enzymes involved in HUFA biosynthesis. In aquaculture, the successful of this technique would open the possibility to reduce the enrichment of live food with fish oils for marine fish larvae, and to completely substitute fish oils with plant oils without reducing the quality of flesh in terms of EPA and DHA contents. Here, three genes, i.e. Δ6-desaturase-like (OmΔ6FAD, Δ5-desaturase-like (OmΔ5FAD and elongase-like (MELO encoding EPA/DHA metabolic enzymes derived from masu salmon (Oncorhynchus masou were individually transferred into zebrafish (Danio rerio as a model to increase its ability for synthesizing EPA and DHA. Fatty acid analysis showed that EPA content in whole body of the second transgenic fish generation over-expressing OmΔ6FAD gene was 1.4 fold and that of DHA was 2.1 fold higher (P<0.05 than those in non-transgenic fish. The EPA content in whole body of transgenic fish over-expressing OmΔ5FAD gene was 1.21-fold, and that of DHA was 1.24-fold higher (P<0.05 than those in nontransgenic fish. The same patterns were obtained in transgenic fish over-expressing MELO gene. EPA content was increased by 1.30-fold and DHA content by 1.33-fold higher (P<0.05 than those in non-transgenic fish. The results of studies demonstrated that fatty acid content of fish can be enhanced by over

  15. Flagellin Encoded in Gene-Based Vector Vaccines Is a Route-Dependent Immune Adjuvant.

    Directory of Open Access Journals (Sweden)

    Hamada F Rady

    Full Text Available Flagellin has been tested as a protein-based vaccine adjuvant, with the majority of studies focused on antibody responses. Here, we evaluated the adjuvant activity of flagellin for both cellular and humoral immune responses in BALB/c mice in the setting of gene-based immunization, and have made several novel observations. DNA vaccines and adenovirus (Ad vectors were engineered to encode mycobacterial protein Ag85B, with or without flagellin of Salmonella typhimurium (FliC. DNA-encoded flagellin given IM enhanced splenic CD4+ and CD8+ T cell responses to co-expressed vaccine antigen, including memory responses. Boosting either IM or intranasally with Ad vectors expressing Ag85B without flagellin led to durable enhancement of Ag85B-specific antibody and CD4+ and CD8+ T cell responses in both spleen and pulmonary tissues, correlating with significantly improved protection against challenge with pathogenic aerosolized M. tuberculosis. However, inclusion of flagellin in both DNA prime and Ad booster vaccines induced localized pulmonary inflammation and transient weight loss, with route-dependent effects on vaccine-induced T cell immunity. The latter included marked reductions in levels of mucosal CD4+ and CD8+ T cell responses following IM DNA/IN Ad mucosal prime-boosting, although antibody responses were not diminished. These findings indicate that flagellin has differential and route-dependent adjuvant activity when included as a component of systemic or mucosally-delivered gene-based prime-boost immunization. Clear adjuvant activity for both T and B cell responses was observed when flagellin was included in the DNA priming vaccine, but side effects occurred when given in an Ad boosting vector, particularly via the pulmonary route.

  16. Gene-based neonatal immune priming potentiates a mucosal adenoviral vaccine encoding mycobacterial Ag85B.

    Science.gov (United States)

    Dai, Guixiang; Rady, Hamada F; Huang, Weitao; Shellito, Judd E; Mason, Carol; Ramsay, Alistair J

    2016-12-07

    Tuberculosis remains a major public health hazard worldwide, with neonates and young infants potentially more susceptible to infection than adults. BCG, the only vaccine currently available, provides some protection against tuberculous meningitis in children but variable efficacy in adults, and is not safe to use in immune compromised individuals. A safe and effective vaccine that could be given early in life, and that could also potentiate subsequent booster immunization, would represent a significant advance. To test this proposition, we have generated gene-based vaccine vectors expressing Ag85B from Mycobacterium tuberculosis (Mtb) and designed experiments to test their immunogenicity and protective efficacy particularly when given in heterologous prime-boost combination, with the initial DNA vaccine component given soon after birth. Intradermal delivery of DNA vaccines elicited Th1-based immune responses against Ag85B in neonatal mice but did not protect them from subsequent aerosol challenge with virulent Mtb H37Rv. Recombinant adenovirus vectors encoding Ag85B, given via the intranasal route at six weeks of age, generated moderate immune responses and were poorly protective. However, neonatal DNA priming following by mucosal boosting with recombinant adenovirus generated strong immune responses, as evidenced by strong Ag85B-specific CD4+ and CD8+ T cell responses, both in the lung-associated lymph nodes and the spleen, by the quality of these responding cells (assessed by their capacity to secrete multiple antimicrobial factors), and by improved protection, as indicated by reduced bacterial burden in the lungs following pulmonary TB challenge. These results suggest that neonatal immunization with gene-based vaccines may create a favorable immunological environment that potentiates the pulmonary mucosal boosting effects of a subsequent heterologous vector vaccine encoding the same antigen. Our data indicate that immunization early in life with mycobacterial

  17. Cloning and functional characterization of the gene encoding the transcription factor Acel in the basidiomycete Phanerochaete chrysosporium

    Directory of Open Access Journals (Sweden)

    RUBÉN POLANCO

    2006-01-01

    Full Text Available In this report we describe the isolation and characterization of a gene encoding the transcription factor Acel (Activation protein of cup 1 Expression in the white rot fungus Phanerochaete chrysosporium. Pc-acel encodes a predicted protein of 633 amino acids containing the copper-fist DNA binding domain typically found in fungal transcription factors such as Acel, Macl and Haal from Saccharomyces cerevisiae. The Pc-acel gene is localized in Scaffold 5, between coordinates 220841 and 222983. A S. cerevisiae acel null mutant strain unable to grow in high-copper medium was fully complemented by transformation with the cDNA of Pc-acel. Moreover, Northern blot hybridization studies indicated that Pc-acel cDNA restores copper inducibility of the yeast cup 1 gene, which encodes the metal-binding protein metallothionein implicated in copper resistance. To our knowledge, this is first report describing an Acel transcription factor in basidiomycetes

  18. Variations in CCL3L gene cluster sequence and non-specific gene copy numbers

    Directory of Open Access Journals (Sweden)

    Edberg Jeffrey C

    2010-03-01

    Full Text Available Abstract Background Copy number variations (CNVs of the gene CC chemokine ligand 3-like1 (CCL3L1 have been implicated in HIV-1 susceptibility, but the association has been inconsistent. CCL3L1 shares homology with a cluster of genes localized to chromosome 17q12, namely CCL3, CCL3L2, and, CCL3L3. These genes are involved in host defense and inflammatory processes. Several CNV assays have been developed for the CCL3L1 gene. Findings Through pairwise and multiple alignments of these genes, we have shown that the homology between these genes ranges from 50% to 99% in complete gene sequences and from 70-100% in the exonic regions, with CCL3L1 and CCL3L3 being identical. By use of MEGA 4 and BioEdit, we aligned sense primers, anti-sense primers, and probes used in several previously described assays against pre-multiple alignments of all four chemokine genes. Each set of probes and primers aligned and matched with overlapping sequences in at least two of the four genes, indicating that previously utilized RT-PCR based CNV assays are not specific for only CCL3L1. The four available assays measured median copies of 2 and 3-4 in European and African American, respectively. The concordance between the assays ranged from 0.44-0.83 suggesting individual discordant calls and inconsistencies with the assays from the expected gene coverage from the known sequence. Conclusions This indicates that some of the inconsistencies in the association studies could be due to assays that provide heterogenous results. Sequence information to determine CNV of the three genes separately would allow to test whether their association with the pathogenesis of a human disease or phenotype is affected by an individual gene or by a combination of these genes.

  19. Mapping in an apple (Malus x domestica) F1 segregating population based on physical clustering of differentially expressed genes.

    Science.gov (United States)

    Jensen, Philip J; Fazio, Gennaro; Altman, Naomi; Praul, Craig; McNellis, Timothy W

    2014-04-04

    Apple tree breeding is slow and difficult due to long generation times, self-incompatibility, and complex genetics. The identification of molecular markers linked to traits of interest is a way to expedite the breeding process. In the present study, we aimed to identify genes whose steady-state transcript abundance was associated with inheritance of specific traits segregating in an apple (Malus × domestica) rootstock F1 breeding population, including resistance to powdery mildew (Podosphaera leucotricha) disease and woolly apple aphid (Eriosoma lanigerum). Transcription profiling was performed for 48 individual F1 apple trees from a cross of two highly heterozygous parents, using RNA isolated from healthy, actively-growing shoot tips and a custom apple DNA oligonucleotide microarray representing 26,000 unique transcripts. Genome-wide expression profiles were not clear indicators of powdery mildew or woolly apple aphid resistance phenotype. However, standard differential gene expression analysis between phenotypic groups of trees revealed relatively small sets of genes with trait-associated expression levels. For example, thirty genes were identified that were differentially expressed between trees resistant and susceptible to powdery mildew. Interestingly, the genes encoding twenty-four of these transcripts were physically clustered on chromosome 12. Similarly, seven genes were identified that were differentially expressed between trees resistant and susceptible to woolly apple aphid, and the genes encoding five of these transcripts were also clustered, this time on chromosome 17. In each case, the gene clusters were in the vicinity of previously identified major quantitative trait loci for the corresponding trait. Similar results were obtained for a series of molecular traits. Several of the differentially expressed genes were used to develop DNA polymorphism markers linked to powdery mildew disease and woolly apple aphid resistance. Gene expression profiling

  20. Identification and characterization of a biosynthetic gene cluster for tryptophan dimers in deep sea-derived Streptomyces sp. SCSIO 03032.

    Science.gov (United States)

    Ma, Liang; Zhang, Wenjun; Zhu, Yiguang; Zhang, Guangtao; Zhang, Haibo; Zhang, Qingbo; Zhang, Liping; Yuan, Chengshan; Zhang, Changsheng

    2017-08-01

    Tryptophan dimers (TDs) are an important class of natural products with diverse bioactivities and share conserved biosynthetic pathways. We report the identification of a partial gene cluster (spm) responsible for the biosynthesis of a class of unusual TDs with non-planar skeletons including spiroindimicins (SPMs), indimicins (IDMs), and lynamicins (LNMs) from the deep-sea derived Streptomyces sp. SCSIO 03032. Bioinformatics analysis, targeted gene disruptions, and heterologous expression studies confirmed the involvement of the spm gene cluster in the biosynthesis of SPM/IDM/LNMs, and revealed the indispensable roles for the halogenase/reductase pair SpmHF, the amino acid oxidase SpmO, and the chromopyrrolic acid (CPA) synthase SpmD, as well as the positive regulator SpmR and the putative transporter SpmA. However, the spm gene cluster was unable to confer a heterologous host the ability to produce SPM/IDM/LNMs. In addition, the P450 enzyme SpmP and the monooxygenase SpmX2 were found to be non-relevant to the biosynthesis of SPM/IDM/LNMs. Sequence alignment and structure modeling suggested the lack of key conserved amino acid residues in the substrate-binding pocket of SpmP. Furthermore, feeding experiments in the non-producing ΔspmO mutant revealed several biosynthetic precursors en route to SPMs, indicating that key enzymes responsible for the biosynthesis of SPMs should be encoded by genes outside of the identified spm gene cluster. Finally, the biosynthetic pathways of SPM/IDM/LNMs are proposed to lay a basis for further insights into their intriguing biosynthetic machinery.

  1. [Cloning of y3 gene encoding a tobacco mosaic virus inhibitor from Coprinus comatus and transformation to Nicotiana tabacum].

    Science.gov (United States)

    Wang, Xueren; He, Tao; Zhang, Gaina; Hao, Jianguo; Jia, Jingfen

    2010-02-01

    The protein Y3 was a TMV inhibitor which was encoded by y3 gene. The aim of this work was to clone the full length of y3 gene from Coprinus comatus and to reveal its inhibitory function to TMV in in vivo conditions. We amplified the unknown 5'- terminal cDNA sequence of y3 gene with 5'- Full RACE Core Set (TaKaRa), obtained the full length of this gene by RT-PCR, constructed the expression plasmid pCAMBIA1301-y3 via inserting gene y3 sequence, CaMV 35 S promoter, and NOS terminator at MCS and transformed it into Nicotiana tabacum via agrobacterium-mediation. The full length of y3 gene was 534 bps including one ORF encoding 130 amino acid residues (GenBank Accession No. GQ859168; EMBL FN546262). The cDNA sequence and its deduced amino acid sequence showed high similarity (94%) to the published fragment of y3 gene sequence. Northern blot analysis proved the transcription of y3 gene in transgenic tobacco plants. The transgenic plants inoculated with TMV expressed the inhibitory activity to TMV. We cloned the full length of y3 gene and obtained transgenic tobacco plants. The expression of y3 gene in transgenic plants improved the inhibitory activity to TMV. The cloning and expression analysis of y3 gene might provide background information for future studying of y3 gene.

  2. [Identification of the gene encoding transglutaminase zymogen from Streptomyces hygroscopicus and its expression in Escherichia coli].

    Science.gov (United States)

    Ren, Zengliang; Zhang, Dongxu; Yu, Meiying; Zhao, Qingxin; Du, Guocheng; Chen, Jian; Wu, Jing

    2008-04-01

    We identified a microbial transglutaminase (MTGase) gene from Streptomyces hygroscopicus; cloned and expressed it in Escherichia coli. We also analyzed the active sites sequence of S. hygroscopicus MTGase through homologous sequence comparison. Wild-type microbial transglutaminase zymogen (pro-MTGase) was purified from liquid culture of S. hygroscopicus (CCTCC M203062). N-terminal amino acid sequence of this pro-MTGase was determined. According to the N-terminal sequence and the corresponding nucleotide sequence of MTGase from other three Streptomyces species, PCR primers of S. hygroscopicus pro-MTGase were designed and the completed gene of pro-MTGase was amplified and sequenced. The gene was sub-cloned into pET-20b(+) vector downstream pelB signal peptide to construct the expression vector pET/pro-MTG. The nucleotide sequence showed 92% homologue with that of S. platensis and S. caniferus. Rosetta (DE3) pLysS carrying the expression vector was induced with IPTG at 24 and expressed pro-MTGase as extracellular soluble protein. SDS-PAGE showed the expressed recombinant pro-MTGase was about 44 kDa, similar to the wild-type pro-MTGase purified from S. hgroscopicus. Recombinant pro-MTGase was activated with trypsin and the enzyme activity reached to 0.24U/mL. This is the first report of the gene encoding microbial pro-transglutaminase from S. hygroscopicus, and also this is the first report of expression extracellular soluble pro-MTGase in E. coli in our country.

  3. High presence/absence gene variability in defense-related gene clusters of Cucumis melo.

    Science.gov (United States)

    González, Víctor M; Aventín, Núria; Centeno, Emilio; Puigdomènech, Pere

    2013-11-12

    Changes in the copy number of DNA sequences are one of the main mechanisms generating genome variability in eukaryotes. These changes are often related to phenotypic effects such as genetic disorders or novel pathogen resistance. The increasing availability of genome sequences through the application of next-generation massive sequencing technologies has allowed the study of genomic polymorphisms at both the interspecific and intraspecific levels, thus helping to understand how species adapt to changing environments through genome variability. Data on gene presence/absence variation (PAV) in melon was obtained by resequencing a cultivated accession and an old-relative melon variety, and using previously obtained resequencing data from three other melon cultivars, among them DHL92, on which the current draft melon genome sequence is based. A total of 1,697 PAV events were detected, involving 4.4% of the predicted melon gene complement. In all, an average 1.5% of genes were absent from each analyzed cultivar as compared to the DHL92 reference genome. The most populated functional category among the 304 PAV genes of known function was that of stress response proteins (30% of all classified PAVs). Our results suggest that genes from multi-copy families are five times more likely to be affected by PAV than singleton genes. Also, the chance of genes present in the genome in tandem arrays being affected by PAV is double that of isolated genes, with PAV genes tending to be in longer clusters. The highest concentration of PAV events detected in the melon genome was found in a 1.1 Mb region of linkage group V, which also shows the highest density of melon stress-response genes. In particular, this region contains the longest continuous gene-containing PAV sequence so far identified in melon. The first genome-wide report of PAV variation among several melon cultivars is presented here. Multi-copy and clustered genes, especially those with putative stress-response functions

  4. Overexpression of Hoxc13 in differentiating keratinocytes results in downregulation of a novel hair keratin gene cluster and alopecia.

    Science.gov (United States)

    Tkatchenko, A V; Visconti, R P; Shang, L; Papenbrock, T; Pruett, N D; Ito, T; Ogawa, M; Awgulewitsch, A

    2001-05-01

    Studying the roles of Hox genes in normal and pathological development of skin and hair requires identification of downstream target genes in genetically defined animal models. We show that transgenic mice overexpressing Hoxc13 in differentiating keratinocytes of hair follicles develop alopecia, accompanied by a progressive pathological skin condition that resembles ichthyosis. Large-scale analysis of differential gene expression in postnatal skin of these mice identified 16 previously unknown and 13 known genes as presumptive Hoxc13 targets. The majority of these targets are downregulated and belong to a subgroup of genes that encode hair-specific keratin-associated proteins (KAPs). Genomic mapping using a mouse hamster radiation hybrid panel showed these genes to reside in a novel KAP gene cluster on mouse chromosome 16 in a region of conserved linkage with human chromosome 21q22.11. Furthermore, data obtained by Hoxc13/lacZ reporter gene analysis in mice that overexpress Hoxc13 suggest negative autoregulatory feedback control of Hoxc13 expression levels, thus providing an entry point for elucidating currently unknown mechanisms that are required for regulating quantitative levels of Hox gene expression. Combined, these results provide a framework for understanding molecular mechanisms of Hoxc13 function in hair growth and development.

  5. Molecular cloning of a novel bioH gene from an environmental metagenome encoding a carboxylesterase with exceptional tolerance to organic solvents

    DEFF Research Database (Denmark)

    Shi, Yuping; Pan, Yingjie; Li, Bailin

    2013-01-01

    ABSTRACT: BACKGROUND: BioH is one of the key enzymes to produce the precursor pimeloyl-ACP to initiate biotin biosynthesis de novo in bacteria. To date, very few bioH genes have been characterized. In this study, we cloned and identified a novel bioH gene, bioHx, from an environmental metagenome...... of an unamplified metagenomic library with a tributyrin-containing medium led to the isolation of a clone exhibiting lipolytic activity. This clone carried a 4,570-bp DNA fragment encoding for six genes, designated bioF, bioHx, fabG, bioC, orf5 and sdh, four of which were implicated in the de novo biotin...... with a strong potential in industrial applications. CONCLUSIONS: This study constituted the first investigation of a novel bioHx gene in a biotin biosynthetic gene cluster cloned from an environmental metagenome. The bioHx gene was successfully cloned, expressed and characterized. The results demonstrated...

  6. Analysis of the structural genes encoding M-factor in the fission yeast Schizosaccharomyces pombe: identification of a third gene, mfm3

    DEFF Research Database (Denmark)

    Kjaerulff, S; Davey, William John; Nielsen, O

    1994-01-01

    We previously identified two genes, mfm1 and mfm2, with the potential to encode the M-factor mating pheromone of the fission yeast Schizosaccharomyces pombe (J. Davey, EMBO J. 11:951-960, 1992), but further analysis revealed that a mutant strain lacking both genes still produced active M-factor. ...

  7. Sequence variation in the alpha-toxin encoding plc gene of Clostridium perfringens strains isolated from diseased and healthy chickens

    DEFF Research Database (Denmark)

    Abildgaard, L; Engberg, RM; Pedersen, Karl

    2009-01-01

    The aim of the present study was to analyse the genetic diversity of the alpha-toxin encoding plc gene and the variation in a-toxin production of Clostridium perfringens type A strains isolated from presumably healthy chickens and chickens suffering from either necrotic enteritis (NE) or cholangio......-hepatitis. The a-toxin encoding plc genes from 60 different pulsed-field gel electrophoresis (PFGE) types (strains) of C perfringens were sequenced and translated in silico to amino acid sequences and the a-toxin production was investigated in batch cultures of 45 of the strains using an enzyme...

  8. Several genes encoding enzymes with the same activity are necessary for aerobic fungal degradation of cellulose in nature

    DEFF Research Database (Denmark)

    Busk, Peter Kamp; Lange, Mette; Pilgaard, Bo

    2014-01-01

    feature as it provides a direct route to predict function from primary sequence. Furthermore, we used Peptide Pattern Recognition to compare the cellulose-degrading enzyme activities encoded by 39 fungal genomes. The results indicated that cellobiohydrolases and AA9 lytic polysaccharide monooxygenases....... In the present study we further developed the method Peptide Pattern Recognition to an automatic approach not only to find all genes encoding glycoside hydrolases and lytic polysaccharide monooxygenases in fungal genomes but also to predict the function of the genes. The functional annotation is an important...

  9. Cloning of the mouse cDNA encoding DNA topoisomerase I and chromosomal location of the gene.

    Science.gov (United States)

    Koiwai, O; Yasui, Y; Sakai, Y; Watanabe, T; Ishii, K; Yanagihara, S; Andoh, T

    1993-03-30

    The mouse cDNA encoding DNA topoisomerase I (TopoI) was cloned and the nucleotide sequence of 3512 bp was determined. The cDNA clone contained an open reading frame encoding a protein of 767 amino acids (aa), which is 2 aa longer than its human counterpart. Overall aa sequence homology between the mouse and human, and between the mouse and yeast (Saccharomyces cerevisiae) sequences was 96% and 42%, respectively. The mouse TopI gene was mapped at position 54.5 on chromosome 2 from linkage analyses of a three-point cross test with Geg, Ada, and a as marker genes.

  10. The Drosophila homologue of vertebrate myogenic-determination genes encodes a transiently expressed nuclear protein marking primary myogenic cells.

    OpenAIRE

    Paterson, B M; Walldorf, U; Eldridge, J; Dübendorfer, A; Frasch, M; Gehring, W J

    1991-01-01

    We have isolated a cDNA clone, called Dmyd for Drosophila myogenic-determination gene, that encodes a protein with structural and functional characteristics similar to the members of the vertebrate MyoD family. Dmyd clone encodes a polypeptide of 332 amino acids with 82% identity to MyoD in the 41 amino acids of the putative helix-loop-helix region and 100% identity in the 13 amino acids of the basic domain proposed to contain the essential recognition code for muscle-specific gene activation...

  11. Challenges in microarray class discovery: a comprehensive examination of normalization, gene selection and clustering

    Science.gov (United States)

    2010-01-01

    Background Cluster analysis, and in particular hierarchical clustering, is widely used to extract information from gene expression data. The aim is to discover new classes, or sub-classes, of either individuals or genes. Performing a cluster analysis commonly involve decisions on how to; handle missing values, standardize the data and select genes. In addition, pre-processing, involving various types of filtration and normalization procedures, can have an effect on the ability to discover biologically relevant classes. Here we consider cluster analysis in a broad sense and perform a comprehensive evaluation that covers several aspects of cluster analyses, including normalization. Result We evaluated 2780 cluster analysis methods on seven publicly available 2-channel microarray data sets with common reference designs. Each cluster analysis method differed in data normalization (5 normalizations were considered), missing value imputation (2), standardization of data (2), gene selection (19) or clustering method (11). The cluster analyses are evaluated using known classes, such as cancer types, and the adjusted Rand index. The performances of the different analyses vary between the data sets and it is difficult to give general recommendations. However, normalization, gene selection and clustering method are all variables that have a significant impact on the performance. In particular, gene selection is important and it is generally necessary to include a relatively large number of genes in order to get good performance. Selecting genes with high standard deviation or using principal component analysis are shown to be the preferred gene selection methods. Hierarchical clustering using Ward's method, k-means clustering and Mclust are the clustering methods considered in this paper that achieves the highest adjusted Rand. Normalization can have a significant positive impact on the ability to cluster individuals, and there are indications that background correction is

  12. Combining Pareto-optimal clusters using supervised learning for identifying co-expressed genes.

    Science.gov (United States)

    Maulik, Ujjwal; Mukhopadhyay, Anirban; Bandyopadhyay, Sanghamitra

    2009-01-20

    The landscape of biological and biomedical research is being changed rapidly with the invention of microarrays which enables simultaneous view on the transcription levels of a huge number of genes across different experimental conditions or time points. Using microarray data sets, clustering algorithms have been actively utilized in order to identify groups of co-expressed genes. This article poses the problem of fuzzy clustering in microarray data as a multiobjective optimization problem which simultaneously optimizes two internal fuzzy cluster validity indices to yield a set of Pareto-optimal clustering solutions. Each of these clustering solutions possesses some amount of information regarding the clustering structure of the input data. Motivated by this fact, a novel fuzzy majority voting approach is proposed to combine the clustering information from all the solutions in the resultant Pareto-optimal set. This approach first identifies the genes which are assigned to some particular cluster with high membership degree by most of the Pareto-optimal solutions. Using this set of genes as the training set, the remaining genes are classified by a supervised learning algorithm. In this work, we have used a Support Vector Machine (SVM) classifier for this purpose. The performance of the proposed clustering technique has been demonstrated on five publicly available benchmark microarray data sets, viz., Yeast Sporulation, Yeast Cell Cycle, Arabidopsis Thaliana, Human Fibroblasts Serum and Rat Central Nervous System. Comparative studies of the use of different SVM kernels and several widely used microarray clustering techniques are reported. Moreover, statistical significance tests have been carried out to establish the statistical superiority of the proposed clustering approach. Finally, biological significance tests have been carried out using a web based gene annotation tool to show that the proposed method is able to produce biologically relevant clusters of co

  13. Combining Pareto-optimal clusters using supervised learning for identifying co-expressed genes

    Directory of Open Access Journals (Sweden)

    Bandyopadhyay Sanghamitra

    2009-01-01

    Full Text Available Abstract Background The landscape of biological and biomedical research is being changed rapidly with the invention of microarrays which enables simultaneous view on the transcription levels of a huge number of genes across different experimental conditions or time points. Using microarray data sets, clustering algorithms have been actively utilized in order to identify groups of co-expressed genes. This article poses the problem of fuzzy clustering in microarray data as a multiobjective optimization problem which simultaneously optimizes two internal fuzzy cluster validity indices to yield a set of Pareto-optimal clustering solutions. Each of these clustering solutions possesses some amount of information regarding the clustering structure of the input data. Motivated by this fact, a novel fuzzy majority voting approach is proposed to combine the clustering information from all the solutions in the resultant Pareto-optimal set. This approach first identifies the genes which are assigned to some particular cluster with high membership degree by most of the Pareto-optimal solutions. Using this set of genes as the training set, the remaining genes are classified by a supervised learning algorithm. In this work, we have used a Support Vector Machine (SVM classifier for this purpose. Results The performance of the proposed clustering technique has been demonstrated on five publicly available benchmark microarray data sets, viz., Yeast Sporulation, Yeast Cell Cycle, Arabidopsis Thaliana, Human Fibroblasts Serum and Rat Central Nervous System. Comparative studies of the use of different SVM kernels and several widely used microarray clustering techniques are reported. Moreover, statistical significance tests have been carried out to establish the statistical superiority of the proposed clustering approach. Finally, biological significance tests have been carried out using a web based gene annotation tool to show that the proposed method is able to

  14. Challenges in microarray class discovery: a comprehensive examination of normalization, gene selection and clustering

    Directory of Open Access Journals (Sweden)

    Landfors Mattias

    2010-10-01

    Full Text Available Abstract Background Cluster analysis, and in particular hierarchical clustering, is widely used to extract information from gene expression data. The aim is to discover new classes, or sub-classes, of either individuals or genes. Performing a cluster analysis commonly involve decisions on how to; handle missing values, standardize the data and select genes. In addition, pre-processing, involving various types of filtration and normalization procedures, can have an effect on the ability to discover biologically relevant classes. Here we consider cluster analysis in a broad sense and perform a comprehensive evaluation that covers several aspects of cluster analyses, including normalization. Result We evaluated 2780 cluster analysis methods on seven publicly available 2-channel microarray data sets with common reference designs. Each cluster analysis method differed in data normalization (5 normalizations were considered, missing value imputation (2, standardization of data (2, gene selection (19 or clustering method (11. The cluster analyses are evaluated using known classes, such as cancer types, and the adjusted Rand index. The performances of the different analyses vary between the data sets and it is difficult to give general recommendations. However, normalization, gene selection and clustering method are all variables that have a significant impact on the performance. In particular, gene selection is important and it is generally necessary to include a relatively large number of genes in order to get good performance. Selecting genes with high standard deviation or using principal component analysis are shown to be the preferred gene selection methods. Hierarchical clustering using Ward's method, k-means clustering and Mclust are the clustering methods considered in this paper that achieves the highest adjusted Rand. Normalization can have a significant positive impact on the ability to cluster individuals, and there are indications that

  15. Molecular cloning of a novel bioH gene from an environmental metagenome encoding a carboxylesterase with exceptional tolerance to organic solvents

    Directory of Open Access Journals (Sweden)

    Shi Yuping

    2013-02-01

    Full Text Available Abstract Background BioH is one of the key enzymes to produce the precursor pimeloyl-ACP to initiate biotin biosynthesis de novo in bacteria. To date, very few bioH genes have been characterized. In this study, we cloned and identified a novel bioH gene, bioHx, from an environmental metagenome by a functional metagenomic approach. The bioHx gene, encoding an enzyme that is capable of hydrolysis of p-nitrophenyl esters of fatty acids, was expressed in Escherichia coli BL21 using the pET expression system. The biochemical property of the purified BioHx protein was also investigated. Results Screening of an unamplified metagenomic library with a tributyrin-containing medium led to the isolation of a clone exhibiting lipolytic activity. This clone carried a 4,570-bp DNA fragment encoding for six genes, designated bioF, bioHx, fabG, bioC, orf5 and sdh, four of which were implicated in the de novo biotin biosynthesis. The bioHx gene encodes a protein of 259 aa with a calculated molecular mass of 28.60 kDa, displaying 24-39% amino acid sequence identity to a few characterized bacterial BioH enzymes. It contains a pentapeptide motif (Gly76-Trp77-Ser78-Met79-Gly80 and a catalytic triad (Ser78-His230-Asp202, both of which are characteristic for lipolytic enzymes. BioHx was expressed as a recombinant protein and characterized. The purified BioHx protein displayed carboxylesterase activity, and it was most active on p-nitrophenyl esters of fatty acids substrate with a short acyl chain (C4. Comparing BioHx with other known BioH proteins revealed interesting diversity in their sensitivity to ionic and nonionic detergents and organic solvents, and BioHx exhibited exceptional resistance to organic solvents, being the most tolerant one amongst all known BioH enzymes. This ascribed BioHx as a novel carboxylesterase with a strong potential in industrial applications. Conclusions This study constituted the first investigation of a novel bioHx gene in a biotin

  16. Cysteine desulphurase-encoding gene sufS2 is required for the repressor function of RirA and oxidative resistance in Agrobacterium tumefaciens.

    Science.gov (United States)

    Bhubhanil, Sakkarin; Niamyim, Phettree; Sukchawalit, Rojana; Mongkolsuk, Skorn

    2014-01-01

    The Agrobacterium tumefaciens genome contains a cluster of genes that are predicted to encode Fe-S cluster assembly proteins, and this cluster is known as the sufS2BCDS1XA operon. sufS2 is the first gene in the operon, and it was inactivated to determine its physiological function. The sufS2 mutant exhibited a small colony phenotype, grew slower than the wild-type strain and was more sensitive to various oxidants including peroxide, organic hydroperoxide and superoxide. The sufS2 gene was negatively regulated by iron response regulator (Irr) and rhizobial iron regulator (RirA) under low and high iron conditions, respectively, and was inducible in response to oxidative stress. The oxidant-induced expression of sufS2 was controlled by Irr, RirA and an additional but not yet identified mechanism. sufS2 was required for RirA activity in the repression of a sufS2 promoter-lacZ fusion. RirA may use Fe-S as its cofactor. sufS2 disruption may cause a defect in the Fe-S supply and could thereby affect the RirA activity. The three conserved cysteine residues (C91, C99 and C105) in RirA were predicted to coordinate with the Fe-S cluster and were shown to be essential for RirA repression of the sufS2-lacZ fusion. These results suggested that sufS2 is important for the survival of A. tumefaciens.

  17. Saccharomyces cerevisiae gene ISW2 encodes a microtubule-interacting protein required for premeiotic DNA replication.

    Science.gov (United States)

    Trachtulcová, P; Janatová, I; Kohlwein, S D; Hasek, J

    2000-01-15

    A molecular genetic characterization of the ORF YOR304W (ISW2), identified in a screen of a yeast lambdagt11 library using a monoclonal antibody that reacts with a 210 kDa mammalian microtubule-interacting protein, is presented in this paper. The protein encoded by the ORF YOR304W is 50% identical to the Drosophila nucleosome remodelling factor ISWI and is therefore a new member of the SNF2 protein family and has been recently entered into SDG as ISW2. Although not essential for vegetative growth, we found that the ISW2 gene is required for early stages in sporulation. The isw2 homozygous deletant diploid strain was blocked in the G(1) phase of the cell cycle, unable to execute the premeiotic DNA replication and progress through the nuclear meiotic division cycle. ISW2 expression from a multicopy plasmid had the same effect as deletion, but ISW2 expression from a centromeric plasmid rescued the deletion phenotype. In vegetatively growing diploid cells, the Isw2 protein was preferentially found in the cytoplasm, co-localizing with microtubules. An accumulation of the Isw2 protein within the nucleus was observed in cells entering sporulation. Together with data published very recently by Tsukiyama et al. (1999), we propose a role for the Isw2 protein in facilitating chromatin accessibility for transcriptional factor(s) that positively regulate meiosis/sporulation-specific genes. Copyright 2000 John Wiley & Sons, Ltd.

  18. The you gene encodes an EGF-CUB protein essential for Hedgehog signaling in zebrafish.

    Directory of Open Access Journals (Sweden)

    Ian G Woods

    2005-03-01

    Full Text Available Hedgehog signaling is required for many aspects of development in vertebrates and invertebrates. Misregulation of the Hedgehog pathway causes developmental abnormalities and has been implicated in certain types of cancer. Large-scale genetic screens in zebrafish have identified a group of mutations, termed you-class mutations, that share common defects in somite shape and in most cases disrupt Hedgehog signaling. These mutant embryos exhibit U-shaped somites characteristic of defects in slow muscle development. In addition, Hedgehog pathway mutations disrupt spinal cord patterning. We report the positional cloning of you, one of the original you-class mutations, and show that it is required for Hedgehog signaling in the development of slow muscle and in the specification of ventral fates in the spinal cord. The you gene encodes a novel protein with conserved EGF and CUB domains and a secretory pathway signal sequence. Epistasis experiments support an extracellular role for You upstream of the Hedgehog response mechanism. Analysis of chimeras indicates that you mutant cells can appropriately respond to Hedgehog signaling in a wild-type environment. Additional chimera analysis indicates that wild-type you gene function is not required in axial Hedgehog-producing cells, suggesting that You is essential for transport or stability of Hedgehog signals in the extracellular environment. Our positional cloning and functional studies demonstrate that You is a novel extracellular component of the Hedgehog pathway in vertebrates.

  19. Little things make big things happen: A summary of micropeptide encoding genes

    Directory of Open Access Journals (Sweden)

    Jeroen Crappé

    2014-06-01

    Full Text Available Classical bioactive peptides are cleaved from larger precursor proteins and are targeted toward the secretory pathway by means of an N-terminal signaling sequence. In contrast, micropeptides encoded from small open reading frames, lack such signaling sequence and are immediately released in the cytoplasm after translation. Over the past few years many such non-canonical genes (including open reading frames, ORFs smaller than 100 AAs have been discovered and functionally characterized in different eukaryotic organisms. Furthermore, in silico approaches enabled the prediction of the existence of many more putatively coding small ORFs in the genomes of Sacharomyces cerevisiae, Arabidopsis thaliana, Drosophila melanogaster and Mus musculus. However, questions remain as to what the functional role of this new class of eukaryotic genes might be, and how widespread they are. In the future, approaches integrating in silico, conservation-based prediction and a combination of genomic, proteomic and functional validation methods will prove to be indispensable to answer these open questions.

  20. A family of related proteins is encoded by the major Drosophila heat shock gene family

    International Nuclear Information System (INIS)

    Wadsworth, S.C.

    1982-01-01

    At least four proteins of 70,000 to 75,000 molecular weight (70-75K) were synthesized from mRNA which hybridized with a cloned heat shock gene previously shown to be localized to the 87A and 87C heat shock puff sites. These in vitro-synthesized proteins were indistinguishable from in vivo-synthesized heat shock-induced proteins when analyzed on sodium dodecyl sulfate-polyacrylamide gels. A comparison of the pattern of this group of proteins synthesized in vivo during a 5-min pulse or during continuous labeling indicates that the 72-75K proteins are probably not kinetic precursors to the major 70K heat shock protein. Partial digestion products generated with V8 protease indicated that the 70-75K heat shock proteins are closely related, but that there are clear differences between them. The partial digestion patterns obtained from heat shock proteins from the Kc cell line and from the Oregon R strain of Drosophila melanogaster are very similar. Genetic analysis of the patterns of 70-75K heat shock protein synthesis indicated that the genes encoding at least two of the three 72-75K heat shock proteins are located outside of the major 87A and 87C puff sites

  1. A single gene (Eu4) encodes the tissue-ubiquitous urease of soybean.

    Science.gov (United States)

    Torisky, R S; Griffin, J D; Yenofsky, R L; Polacco, J C

    1994-02-01

    We sought to determine the genetic basis of expression of the ubiquitous (metabolic) urease of soybean. This isozyme is termed the metabolic urease because its loss, in eu4/eu4 mutants, leads to accumulation of urea, whereas loss of the embryo-specific urease isozyme does not. The eu4 lesion eliminated the expression of the ubiquitous urease in vegetative and embryonic tissues. RFLP analysis placed urease clone LC4 near, or within, the Eu4 locus. Sequence comparison of urease proteins (ubiquitous and embryo-specific) and clones (LC4 and LS1) indicated that LC4 and LS1 encode ubiquitous and embryo-specific ureases, respectively. That LC4 is transcribed into poly(A)+ RNA in all tissues was indicated by the amplification of its transcript by an LC4-specific PCR primer. (The LS1-specific primer, on the other hand, amplified poly(A)+ RNA only from developing embryos expressing the embryo-specific urease.) These observations are consistent with Eu4 being the ubiquitous urease structural gene contained in the LC4 clone. In agreement with this notion, the mutant phenotype of eu4/eu4 callus was partially corrected by the LC4 urease gene introduced by particle bombardment.

  2. Genes involved in meso-diaminopimelate synthesis in Bacillus subtilis: identification of the gene encoding aspartokinase I.

    Science.gov (United States)

    Roten, C A; Brandt, C; Karamata, D

    1991-04-01

    Thermosensitive mutants of Bacillus subtilis deficient in peptidoglycan synthesis were screened for mutations in the meso-diaminopimelate (LD-A2pm) metabolic pathway. Mutations in two out of five relevant linkage groups, lssB and lssD, were shown to induce, at the restrictive temperature, a deficiency in LD-A2pm synthesis and accumulation of UDP-MurNAc-dipeptide. Group lssB is heterogeneous; it encompasses mutations that confer deficiency in the deacylation of N-acetyl-LL-A2pm and accumulation of this precursor. Accordingly, these mutations are assigned to the previously identified locus dapE. Mutations in linkage group lssD entail a thermosensitive aspartokinase 1. Therefore, they are most likely to affect the structural gene of this enzyme, which we propose to designate dapG. Mutation pyc-1476, previously reported to affect the pyruvate carboxylase, was shown to confer a deficiency in aspartokinase 1, not in the carboxylase, and to belong to the dapG locus, dapG is closely linked to spoVF, the putative gene of dipicolinate synthase. In conclusion, mutations affecting only two out of eight steps known to be involved in LD-A2pm synthesis were uncovered in a large collection of thermosensitive mutants obtained by indirect selection. We propose that this surprisingly restricted distribution of the thermosensitive dap mutations isolated so far is due to the existence, in each step of the pathway, of isoenzymes encoded by separate genes. The biological role of different aspartokinases was investigated with mutants deficient in dapE and dapG genes. Growth characteristics of these mutants in the presence of various combinations of aspartate family amino acids allow a reassessment of a metabolic channel hypothesis, i.e. the proposed existence of multienzyme complexes, each specific for a given end product.

  3. Cloning of gene-encoded stem bromelain on system coming from Pichia pastoris as therapeutic protein candidate

    Science.gov (United States)

    Yusuf, Y.; Hidayati, W.

    2018-01-01

    The process of identifying bacterial recombination using PCR, and restriction, and then sequencing process was done after identifying the bacteria. This research aimed to get a yeast cell of Pichia pastoris which has an encoder gene of stem bromelain enzyme. The production of recombinant stem bromelain enzymes using yeast cells of P. pastoris can produce pure bromelain rod enzymes and have the same conformation with the enzyme’s conformation in pineapple plants. This recombinant stem bromelain enzyme can be used as a therapeutic protein in inflammatory, cancer and degenerative diseases. This study was an early stage of a step series to obtain bromelain rod protein derived from pineapple made with genetic engineering techniques. This research was started by isolating the RNA of pineapple stem which was continued with constructing cDNA using reserve transcriptase-PCR technique (RT-PCR), doing the amplification of bromelain enzyme encoder gene with PCR technique using a specific premiere couple which was designed. The process was continued by cloning into bacterium cells of Escherichia coli. A vector which brought the encoder gene of stem bromelain enzyme was inserted into the yeast cell of P. pastoris and was continued by identifying the yeast cell of P. pastoris which brought the encoder gene of stem bromelain enzyme. The research has not found enzyme gene of stem bromelain in yeast cell of P. pastoris yet. The next step is repeating the process by buying new reagent; RNase inhibitor, and buying liquid nitrogen.

  4. A tripartite clustering analysis on microRNA, gene and disease model.

    Science.gov (United States)

    Shen, Chengcheng; Liu, Ying

    2012-02-01

    Alteration of gene expression in response to regulatory molecules or mutations could lead to different diseases. MicroRNAs (miRNAs) have been discovered to be involved in regulation of gene expression and a wide variety of diseases. In a tripartite biological network of human miRNAs, their predicted target genes and the diseases caused by altered expressions of these genes, valuable knowledge about the pathogenicity of miRNAs, involved genes and related disease classes can be revealed by co-clustering miRNAs, target genes and diseases simultaneously. Tripartite co-clustering can lead to more informative results than traditional co-clustering with only two kinds of members and pass the hidden relational information along the relation chain by considering multi-type members. Here we report a spectral co-clustering algorithm for k-partite graph to find clusters with heterogeneous members. We use the method to explore the potential relationships among miRNAs, genes and diseases. The clusters obtained from the algorithm have significantly higher density than randomly selected clusters, which means members in the same cluster are more likely to have common connections. Results also show that miRNAs in the same family based on the hairpin sequences tend to belong to the same cluster. We also validate the clustering results by checking the correlation of enriched gene functions and disease classes in the same cluster. Finally, widely studied miR-17-92 and its paralogs are analyzed as a case study to reveal that genes and diseases co-clustered with the miRNAs are in accordance with current research findings.

  5. Recursive Cluster Elimination (RCE for classification and feature selection from gene expression data

    Directory of Open Access Journals (Sweden)

    Showe Louise C

    2007-05-01

    Full Text Available Abstract Background Classification studies using gene expression datasets are usually based on small numbers of samples and tens of thousands of genes. The selection of those genes that are important for distinguishing the different sample classes being compared, poses a challenging problem in high dimensional data analysis. We describe a new procedure for selecting significant genes as recursive cluster elimination (RCE rather than recursive feature elimination (RFE. We have tested this algorithm on six datasets and compared its performance with that of two related classification procedures with RFE. Results We have developed a novel method for selecting significant genes in comparative gene expression studies. This method, which we refer to as SVM-RCE, combines K-means, a clustering method, to identify correlated gene clusters, and Support Vector Machines (SVMs, a supervised machine learning classification method, to identify and score (rank those gene clusters for the purpose of classification. K-means is used initially to group genes into clusters. Recursive cluster elimination (RCE is then applied to iteratively remove those clusters of genes that contribute the least to the classification performance. SVM-RCE identifies the clusters of correlated genes that are most significantly differentially expressed between the sample classes. Utilization of gene clusters, rather than individual genes, enhances the supervised classification accuracy of the same data as compared to the accuracy when either SVM or Penalized Discriminant Analysis (PDA with recursive feature elimination (SVM-RFE and PDA-RFE are used to remove genes based on their individual discriminant weights. Conclusion SVM-RCE provides improved classification accuracy with complex microarray data sets when it is compared to the classification accuracy of the same datasets using either SVM-RFE or PDA-RFE. SVM-RCE identifies clusters of correlated genes that when considered together

  6. In silico analysis highlights the frequency and diversity of type 1 lantibiotic gene clusters in genome sequenced bacteria

    LENUS (Irish Health Repository)

    Marsh, Alan J

    2010-11-30

    Abstract Background Lantibiotics are lanthionine-containing, post-translationally modified antimicrobial peptides. These peptides have significant, but largely untapped, potential as preservatives and chemotherapeutic agents. Type 1 lantibiotics are those in which lanthionine residues are introduced into the structural peptide (LanA) through the activity of separate lanthionine dehydratase (LanB) and lanthionine synthetase (LanC) enzymes. Here we take advantage of the conserved nature of LanC enzymes to devise an in silico approach to identify potential lantibiotic-encoding gene clusters in genome sequenced bacteria. Results In total 49 novel type 1 lantibiotic clusters were identified which unexpectedly were associated with species, genera and even phyla of bacteria which have not previously been associated with lantibiotic production. Conclusions Multiple type 1 lantibiotic gene clusters were identified at a frequency that suggests that these antimicrobials are much more widespread than previously thought. These clusters represent a rich repository which can yield a large number of valuable novel antimicrobials and biosynthetic enzymes.

  7. Proanthocyanidin synthesis in Theobroma cacao: genes encoding anthocyanidin synthase, anthocyanidin reductase, and leucoanthocyanidin reductase.

    Science.gov (United States)

    Liu, Yi; Shi, Zi; Maximova, Siela; Payne, Mark J; Guiltinan, Mark J

    2013-12-05

    The proanthocyanidins (PAs), a subgroup of flavonoids, accumulate to levels of approximately 10% total dry weight of cacao seeds. PAs have been associated with human health benefits and also play important roles in pest and disease defense throughout the plant. To dissect the genetic basis of PA biosynthetic pathway in cacao (Theobroma cacao), we have isolated three genes encoding key PA synthesis enzymes, anthocyanidin synthase (ANS), anthocyanidin reductase (ANR) and leucoanthocyanidin reductase (LAR). We measured the expression levels of TcANR, TcANS and TcLAR and PA content in cacao leaves, flowers, pod exocarp and seeds. In all tissues examined, all three genes were abundantly expressed and well correlated with PA accumulation levels, suggesting their active roles in PA synthesis. Overexpression of TcANR in an Arabidopsis ban mutant complemented the PA deficient phenotype in seeds and resulted in reduced anthocyanidin levels in hypocotyls. Overexpression of TcANS in tobacco resulted in increased content of both anthocyanidins and PAs in flower petals. Overexpression of TcANS in an Arabidopsis ldox mutant complemented its PA deficient phenotype in seeds. Recombinant TcLAR protein converted leucoanthocyanidin to catechin in vitro. Transgenic tobacco overexpressing TcLAR had decreased amounts of anthocyanidins and increased PAs. Overexpressing TcLAR in Arabidopsis ldox mutant also resulted in elevated synthesis of not only catechin but also epicatechin. Our results confirm the in vivo function of cacao ANS and ANR predicted based on sequence homology to previously characterized enzymes from other species. In addition, our results provide a clear functional analysis of a LAR gene in vivo.

  8. Adenovirus-encoding virus-associated RNAs suppress HDGF gene expression to support efficient viral replication.

    Directory of Open Access Journals (Sweden)

    Saki Kondo

    Full Text Available Non-coding small RNAs are involved in many physiological responses including viral life cycles. Adenovirus-encoding small RNAs, known as virus-associated RNAs (VA RNAs, are transcribed throughout the replication process in the host cells, and their transcript levels depend on the copy numbers of the viral genome. Therefore, VA RNAs are abundant in infected cells after genome replication, i.e. during the late phase of viral infection. Their function during the late phase is the inhibition of interferon-inducible protein kinase R (PKR activity to prevent antiviral responses; recently, mivaRNAs, the microRNAs processed from VA RNAs, have been reported to inhibit cellular gene expression. Although VA RNA transcription starts during the early phase, little is known about its function. The reason may be because much smaller amount of VA RNAs are transcribed during the early phase than the late phase. In this study, we applied replication-deficient adenovirus vectors (AdVs and novel AdVs lacking VA RNA genes to analyze the expression changes in cellular genes mediated by VA RNAs using microarray analysis. AdVs are suitable to examine the function of VA RNAs during the early phase, since they constitutively express VA RNAs but do not replicate except in 293 cells. We found that the expression level of hepatoma-derived growth factor (HDGF significantly decreased in response to the VA RNAs under replication-deficient condition, and this suppression was also observed during the early phase under replication-competent conditions. The suppression was independent of mivaRNA-induced downregulation, suggesting that the function of VA RNAs during the early phase differs from that during the late phase. Notably, overexpression of HDGF inhibited AdV growth. This is the first report to show the function, in part, of VA RNAs during the early phase that may be contribute to efficient viral growth.

  9. Molecular Typing and Virulence Gene Profiles of Enterotoxin Gene Cluster (egc)-Positive Staphylococcus aureus Isolates Obtained from Various Food and Clinical Specimens.

    Science.gov (United States)

    Song, Minghui; Shi, Chunlei; Xu, Xuebing; Shi, Xianming

    2016-11-01

    The enterotoxin gene cluster (egc) has been proposed to contribute to the Staphylococcus aureus colonization, which highlights the need to evaluate genetic diversity and virulence gene profiles of the egc-positive population. Here, a total of 43 egc-positive isolates (16.2%) were identified from 266 S. aureus isolates that were obtained from various food and clinical specimens in Shanghai. Seven different egc profiles were found based on the polymerase chain reaction (PCR) result for egc genes. Then, these 43 egc-positive isolates were further typed by multilocus sequence typing, pulsed-field gel electrophoresis (PFGE), multiple-locus variable-number tandem-repeat analysis (MLVA), and accessory gene regulatory (agr) typing. It showed that the 43 egc-positive isolates displayed 17 sequence types, 28 PFGE patterns, 29 MLVA types, and 4 agr types, respectively. Among them, the dominant clonal lineage was CC5-agr II (48.84%). Thirty toxin and 20 adhesion-associated genes were detected by PCR in egc-positive isolates. Notably, invasive toxin genes showed a high prevalence, such as 76.7% for Panton-Valentine leukocidin encoding genes, 27.9% for sec, and 23.3% for tsst-1. Most of the examined adhesion-associated genes were found to be conserved (76.7-100%), whereas the fnbB gene was only found in 8 (18.6%) isolates. In addition, 33 toxin gene profiles and 13 adhesion gene profiles were identified, respectively. Our results imply that isolates belonging to the same clonal lineage harbored similar adhesion gene profiles but diverse toxin gene profiles. Overall, the high prevalence of invasive virulence genes increases the potential risk of egc-positive isolates in S. aureus infection.

  10. The complete coenzyme B12 biosynthesis gene cluster of Lactobacillus reuteri CRL1098

    NARCIS (Netherlands)

    Santos, F.; Vera, J.L.; van der Heijden, R.; Valdez, G.; de Vos, W.M.; Sesma, F.; Hugenholtz, J.

    2008-01-01

    The coenzyme B12 production pathway in Lactobacillus reuteri has been deduced using a combination of genetic, biochemical and bioinformatics approaches. The coenzyme B12 gene cluster of Lb. reuteri CRL1098 has the unique feature of clustering together the cbi, cob and hem genes. It consists of 29

  11. The complete coenzyme B12 biosynthesis gene cluster of Lactobacillus reuteri CRL 1098

    NARCIS (Netherlands)

    Santos, dos F.; Vera, J.L.; Heijden, van der R.; Valdez, G.F.; Vos, de W.M.; Sesma, F.; Hugenholtz, J.

    2008-01-01

    The coenzyme B12 production pathway in Lactobacillus reuteri has been deduced using a combination of genetic, biochemical and bioinformatics approaches. The coenzyme B12 gene cluster of Lb. reuteri CRL1098 has the unique feature of clustering together the cbi, cob and hem genes. It consists of 29

  12. Rough-fuzzy clustering for grouping functionally similar genes from microarray data.

    Science.gov (United States)

    Maji, Pradipta; Paul, Sushmita

    2013-01-01

    Gene expression data clustering is one of the important tasks of functional genomics as it provides a powerful tool for studying functional relationships of genes in a biological process. Identifying coexpressed groups of genes represents the basic challenge in gene clustering problem. In this regard, a gene clustering algorithm, termed as robust rough-fuzzy c-means, is proposed judiciously integrating the merits of rough sets and fuzzy sets. While the concept of lower and upper approximations of rough sets deals with uncertainty, vagueness, and incompleteness in cluster definition, the integration of probabilistic and possibilistic memberships of fuzzy sets enables efficient handling of overlapping partitions in noisy environment. The concept of possibilistic lower bound and probabilistic boundary of a cluster, introduced in robust rough-fuzzy c-means, enables efficient selection of gene clusters. An efficient method is proposed to select initial prototypes of different gene clusters, which enables the proposed c-means algorithm to converge to an optimum or near optimum solutions and helps to discover coexpressed gene clusters. The effectiveness of the algorithm, along with a comparison with other algorithms, is demonstrated both qualitatively and quantitatively on 14 yeast microarray data sets.

  13. Dominant control region of the human β- like globin gene cluster

    NARCIS (Netherlands)

    Blom van Assendelft, Margaretha van

    1989-01-01

    The structure and regulation of the human β -like globin gene cluster has been studied extensively. Genetic disorders connected with this gene cluster are responsible for human diseases associated with high levels of morbidity and mortality, such as β-thalassaemia and sickle cell anaemia. The work

  14. Serum paraoxonase activity is associated with variants in the PON gene cluster and risk of Alzheimer disease.

    Science.gov (United States)

    Erlich, Porat M; Lunetta, Kathryn L; Cupples, L Adrienne; Abraham, Carmela R; Green, Robert C; Baldwin, Clinton T; Farrer, Lindsay A

    2012-05-01

    Previous studies have shown association of single nucleotide polymorphisms (SNPs) in 3 contiguous genes (PON1, PON2, and PON3) encoding paraoxonase with risk of Alzheimer disease (AD). We evaluated the association of serum paraoxonase activity measured by phenyl acetate (PA) and thiobutyl butyrolactone (TBBL) with risk of AD and with 26 SNPs spanning the PON gene cluster in 266 AD cases and 306 sibling controls from the MIRAGE study. The odds of AD (adjusted for age, gender, and ethnicity) increased 20% for each standard deviation decrease in PA or TBBL activity. There were association signals with activity in all 3 genes. Haplotypes including SNPs spanning the PON genes were generally more significant than haplotypes comprising SNPs from 1 gene. Significant interactions were observed between SNP pairs located across the PON cluster with either serum activity measure as the outcome, and between several PON SNPs and PA activity with AD status as the outcome. Our results suggest that low serum paraoxonase activity is a risk factor for AD. Furthermore, multiple variants in PON influence serum paraoxonase activity and their effects may be synergistic. Copyright © 2012 Elsevier Inc. All rights reserved.

  15. The nitrate-reduction gene cluster components exert lineage-dependent contributions to optimization of Sinorhizobium symbiosis with soybeans.

    Science.gov (United States)

    Liu, Li Xue; Li, Qin Qin; Zhang, Yun Zeng; Hu, Yue; Jiao, Jian; Guo, Hui Juan; Zhang, Xing Xing; Zhang, Biliang; Chen, Wen Xin; Tian, Chang Fu

    2017-12-01

    Receiving nodulation and nitrogen fixation genes does not guarantee rhizobia an effective symbiosis with legumes. Here, variations in gene content were determined for three Sinorhizobium species showing contrasting symbiotic efficiency on soybeans. A nitrate-reduction gene cluster absent in S. sojae was found to be essential for symbiotic adaptations of S. fredii and S. sp. III. In S. fredii, the deletion mutation of the nap (nitrate reductase), instead of nir (nitrite reductase) and nor (nitric oxide reductase), led to defects in nitrogen-fixation (Fix - ). By contrast, none of these core nitrate-reduction genes were required for the symbiosis of S. sp. III. However, within the same gene cluster, the deletion of hemN1 (encoding oxygen-independent coproporphyrinogen III oxidase) in both S. fredii and S. sp. III led to the formation of nitrogen-fixing (Fix + ) but ineffective (Eff - ) nodules. These Fix + /Eff - nodules were characterized by significantly lower enzyme activity of glutamine synthetase indicating rhizobial modulation of nitrogen-assimilation by plants. A distant homologue of HemN1 from S. sojae can complement this defect in S. fredii and S. sp. III, but exhibited a more pleotropic role in symbiosis establishment. These findings highlighted the lineage-dependent optimization of symbiotic functions in different rhizobial species associated with the same host. © 2017 Society for Applied Microbiology and John Wiley & Sons Ltd.

  16. Structure of the neutral capsular polysaccharide of Acinetobacter baumannii NIPH146 that carries the KL37 capsule gene cluster.

    Science.gov (United States)

    Arbatsky, Nikolay P; Shneider, Mikhail M; Kenyon, Johanna J; Shashkov, Alexander S; Popova, Anastasiya V; Miroshnikov, Konstantin A; Volozhantsev, Nikolay V; Knirel, Yuriy A

    2015-09-02

    Capsular polysaccharide (CPS) was isolated from Acinetobacter baumannii NIPH146, and the following structure of branched pentasaccharide repeating unit was established by sugar analyses along with 1D and 2D NMR spectroscopy: In comparison to most other known capsular polysaccharides of A. baumannii, the CPS studied is neutral and lacks any specific monosaccharide component. The synthesis, assembly and export of this structure could be attributed to genes in a novel capsule biosynthesis gene cluster, designated KL37, which was found in the NIPH146 genome. The CPS of A. baumannii NIPH146 shares the α-d-Galp-(1→6)-β-d-Glcp-(1→3)-d-GalpNAc-(1→ trisaccharide fragment with the CPS units of several A. baumannii strains, including ATCC 17978 and LUH 5537 that carry the KL3 and KL22 gene clusters, respectively. KL37 contains two genes for glycosyltransferases that are related to two glycosyltransferase genes present in both KL3 and KL22, and the encoded proteins could be tentatively assigned to linkages between sugars in the CPS repeat. Copyright © 2015 Elsevier Ltd. All rights reserved.

  17. Clustered organization, polycistronic transcription, and evolution of modification-guide snoRNA genes in Euglena gracilis.

    Science.gov (United States)

    Moore, Ashley N; Russell, Anthony G

    2012-01-01

    Previous studies have shown that the eukaryotic microbe Euglena gracilis contains an unusually large assortment of small nucleolar RNAs (snoRNAs) and ribosomal RNA (rRNA) modification sites. However, little is known about the evolutionary mechanisms contributing to this situation. In this study, we have examined the organization and evolution of snoRNA genes in Euglena with the additional objective of determining how these properties relate to the rRNA modification pattern in this protist. We have identified and extensively characterized a clustered pattern of genes encoding previously biochemically isolated snoRNA sequences in E. gracilis. We show that polycistronic transcription is a prevalent snoRNA gene expression strategy in this organism. Further, we have identified 121 new snoRNA coding regions through sequence analysis of these clusters. We have identified an E. gracilis U14 snoRNA homolog clustered with modification-guide snoRNA genes. The U14 snoRNAs in other eukaryotic organisms examined to date typically contain both a modification and a processing domain. E. gracilis U14 lacks the modification domain but retains the processing domain. Our analysis of U14 structure and evolution in Euglena and other eukaryotes allows us to propose a model for its evolution and suggest its processing role may be its more important function, explaining its conservation in many eukaryotes. The preponderance of apparent small and larger-scale duplication events in the genomic regions we have characterized in Euglena provides a mechanism for the generation of the unusually diverse collection and abundance of snoRNAs and modified rRNA sites. Our findings provide the framework for more extensive whole genome analysis to elucidate whether these snoRNA gene clusters are spread across multiple chromosomes and/or form dense "arrays" at a limited number of chromosomal loci.

  18. Identification and Interrogation of the Herbicidin Biosynthetic Gene Cluster: First Insight into the Biosynthesis of a Rare Undecose Nucleoside Antibiotic.

    Science.gov (United States)

    Lin, Geng-Min; Romo, Anthony J; Liem, Priscilla H; Chen, Zhang; Liu, Hung-Wen

    2017-11-22

    Herbicidins are adenosine-based nucleoside antibiotics with an unusual tricyclic undecose core decorated with a (5-hydroxy)tiglyl moiety. Feeding studies are herein reported demonstrating that the tricyclic core is derived from d-glucose and d-ribose, whereas the tiglyl moiety is derived from an intermediate of l-isoleucine catabolism. Identification of the gene cluster for herbicidin A biosynthesis in Streptomyces sp. L-9-10 as well as its verification by heterologous expression in a nonproducing host are described, and the results of in vitro characterization of a carboxyl methyltransferase encoded in the cluster, Her8, are presented. Based on these observations, a biosynthetic pathway is proposed for herbicidins.

  19. A phylogenomic gene cluster resource: The phylogeneticallyinferred groups (PhlGs) database

    Energy Technology Data Exchange (ETDEWEB)

    Dehal, Paramvir S.; Boore, Jeffrey L.

    2005-08-25

    We present here the PhIGs database, a phylogenomic resource for sequenced genomes. Although many methods exist for clustering gene families, very few attempt to create truly orthologous clusters sharing descent from a single ancestral gene across a range of evolutionary depths. Although these non-phylogenetic gene family clusters have been used broadly for gene annotation, errors are known to be introduced by the artifactual association of slowly evolving paralogs and lack of annotation for those more rapidly evolving. A full phylogenetic framework is necessary for accurate inference of function and for many studies that address pattern and mechanism of the evolution of the genome. The automated generation of evolutionary gene clusters, creation of gene trees, determination of orthology and paralogy relationships, and the correlation of this information with gene annotations, expression information, and genomic context is an important resource to the scientific community.

  20. Ancestral Variations of the PCDHG Gene Cluster Predispose to Dyslexia in a Multiplex Family

    Directory of Open Access Journals (Sweden)

    Teesta Naskar

    2018-02-01

    Full Text Available Dyslexia is a heritable neurodevelopmental disorder characterized by difficulties in reading and writing. In this study, we describe the identification of a set of 17 polymorphisms located across 1.9 Mb region on chromosome 5q31.3, encompassing genes of the PCDHG cluster, TAF7, PCDH1 and ARHGAP26, dominantly inherited with dyslexia in a multi-incident family. Strikingly, the non-risk form of seven variations of the PCDHG cluster, are preponderant in the human lineage, while risk alleles are ancestral and conserved across Neanderthals to non-human primates. Four of these seven ancestral variations (c.460A > C [p.Ile154Leu], c.541G > A [p.Ala181Thr], c.2036G > C [p.Arg679Pro] and c.2059A > G [p.Lys687Glu] result in amino acid alterations. p.Ile154Leu and p.Ala181Thr are present at EC2: EC3 interacting interface of γA3-PCDH and γA4-PCDH respectively might affect trans-homophilic interaction and hence neuronal connectivity. p.Arg679Pro and p.Lys687Glu are present within the linker region connecting trans-membrane to extracellular domain. Sequence analysis indicated the importance of p.Ile154, p.Arg679 and p.Lys687 in maintaining class specificity. Thus the observed association of PCDHG genes encoding neural adhesion proteins reinforces the hypothesis of aberrant neuronal connectivity in the pathophysiology of dyslexia. Additionally, the striking conservation of the identified variants indicates a role of PCDHG in the evolution of highly specialized cognitive skills critical to reading.

  1. The Sound of Silence: Activating Silent Biosynthetic Gene Clusters in Marine Microorganisms

    Directory of Open Access Journals (Sweden)

    F. Jerry Reen

    2015-07-01

    Full Text Available Unlocking the rich harvest of marine microbial ecosystems has the potential to both safeguard the existence of our species for the future, while also presenting significant lifestyle benefits for commercial gain. However, while significant advances have been made in the field of marine biodiscovery, leading to the introduction of new classes of therapeutics for clinical medicine, cosmetics and industrial products, much of what this natural ecosystem has to offer is locked in, and essentially hidden from our screening methods. Releasing this silent potential represents a significant technological challenge, the key to which is a comprehensive understanding of what controls these systems. Heterologous expression systems have been successful in awakening a number of these cryptic marine biosynthetic gene clusters (BGCs. However, this approach is limited by the typically large size of the encoding sequences. More recently, focus has shifted to the regulatory proteins associated with each BGC, many of which are signal responsive raising the possibility of exogenous activation. Abundant among these are the LysR-type family of transcriptional regulators, which are known to control production of microbial aromatic systems. Although the environmental signals that activate these regulatory systems remain unknown, it offers the exciting possibility of evoking mimic molecules and synthetic expression systems to drive production of potentially novel natural products in microorganisms. Success in this field has the potential to provide a quantum leap forward in medical and industrial bio-product development. To achieve these new endpoints, it is clear that the integrated efforts of bioinformaticians and natural product chemists will be required as we strive to uncover new and potentially unique structures from silent or cryptic marine gene clusters.

  2. Ancestral Variations of the PCDHG Gene Cluster Predispose to Dyslexia in a Multiplex Family.

    Science.gov (United States)

    Naskar, Teesta; Faruq, Mohammed; Banerjee, Priyajit; Khan, Massarat; Midha, Rashi; Kumari, Renu; Devasenapathy, Subhashree; Prajapati, Bharat; Sengupta, Sanghamitra; Jain, Deepti; Mukerji, Mitali; Singh, Nandini Chatterjee; Sinha, Subrata

    2018-02-01

    Dyslexia is a heritable neurodevelopmental disorder characterized by difficulties in reading and writing. In this study, we describe the identification of a set of 17 polymorphisms located across 1.9Mb region on chromosome 5q31.3, encompassing genes of the PCDHG cluster, TAF7, PCDH1 and ARHGAP26, dominantly inherited with dyslexia in a multi-incident family. Strikingly, the non-risk form of seven variations of the PCDHG cluster, are preponderant in the human lineage, while risk alleles are ancestral and conserved across Neanderthals to non-human primates. Four of these seven ancestral variations (c.460A>C [p.Ile154Leu], c.541G>A [p.Ala181Thr], c.2036G>C [p.Arg679Pro] and c.2059A>G [p.Lys687Glu]) result in amino acid alterations. p.Ile154Leu and p.Ala181Thr are present at EC2: EC3 interacting interface of γA3-PCDH and γA4-PCDH respectively might affect trans-homophilic interaction and hence neuronal connectivity. p.Arg679Pro and p.Lys687Glu are present within the linker region connecting trans-membrane to extracellular domain. Sequence analysis indicated the importance of p.Ile154, p.Arg679 and p.Lys687 in maintaining class specificity. Thus the observed association of PCDHG genes encoding neural adhesion proteins reinforces the hypothesis of aberrant neuronal connectivity in the pathophysiology of dyslexia. Additionally, the striking conservation of the identified variants indicates a role of PCDHG in the evolution of highly specialized cognitive skills critical to reading. Copyright © 2018 The Authors. Published by Elsevier B.V. All rights reserved.

  3. An effective fuzzy kernel clustering analysis approach for gene expression data.

    Science.gov (United States)

    Sun, Lin; Xu, Jiucheng; Yin, Jiaojiao

    2015-01-01

    Fuzzy clustering is an important tool for analyzing microarray data. A major problem in applying fuzzy clustering method to microarray gene expression data is the choice of parameters with cluster number and centers. This paper proposes a new approach to fuzzy kernel clustering analysis (FKCA) that identifies desired cluster number and obtains more steady results for gene expression data. First of all, to optimize characteristic differences and estimate optimal cluster number, Gaussian kernel function is introduced to improve spectrum analysis method (SAM). By combining subtractive clustering with max-min distance mean, maximum distance method (MDM) is proposed to determine cluster centers. Then, the corresponding steps of improved SAM (ISAM) and MDM are given respectively, whose superiority and stability are illustrated through performing experimental comparisons on gene expression data. Finally, by introducing ISAM and MDM into FKCA, an effective improved FKCA algorithm is proposed. Experimental results from public gene expression data and UCI database show that the proposed algorithms are feasible for cluster analysis, and the clustering accuracy is higher than the other related clustering algorithms.

  4. Diversity of β-lactamase-encoding genes among Gram-negative isolates from water samples in Northern Portugal

    OpenAIRE

    Manageiro, Vera; Ferreira, Eugénia; Figueira, Vânia; Manaia, Célia M.; Caniça, Manuela

    2012-01-01

    Water has been recognized as a reservoir for antibiotic resistance genes (ARG), where the presence of mobile genetic elements, including plasmids, favors their dissemination. It is noteworthy that non- pathogenic environmental organisms, where plasmids encoding multiple ARG are prevalent, can provide resistance to most classes of antimicrobials including :-lactams, aminoglycosides, chloramphenicol, trimethoprim, streptomycin, fosfomycin, q...

  5. Differential regulation of mnp2, a new manganese peroxidase-encoding gene from the ligninolytic fungus Trametes versicolor PRL 572

    Science.gov (United States)

    Tomas Johansson; Per Olof Nyman; Daniel Cullen

    2002-01-01

    A peroxidase-encoding gene, mnp2, and its corresponding cDNA were characterized from the white-rot basidiomycete Trametes versicolor PRL 572. We used quantitative reverse transcriptase-mediated PCR to identify mnp2 transcripts in nutrient-limited stationary cultures. Although mnp2 lacks upstream metal response elements (MREs), addition of MnSO4 to cultures increased...

  6. Genetic association analysis of 13 nuclear-encoded mitochondrial candidate genes with type II diabetes mellitus: The DAMAGE study

    DEFF Research Database (Denmark)

    Reiling, Erwin; van Vliet-Ostaptchouk, Jana V; van 't Riet, Esther

    2009-01-01

    Mitochondria play an important role in many processes, like glucose metabolism, fatty acid oxidation and ATP synthesis. In this study, we aimed to identify association of common polymorphisms in nuclear-encoded genes involved in mitochondrial protein synthesis and biogenesis with type II diabetes...

  7. Expression of the Immediate-Early Gene-Encoded Protein Egr-1 ("zif268") during in Vitro Classical Conditioning

    Science.gov (United States)

    Mokin, Maxim; Keifer, Joyce

    2005-01-01

    Expression of the immediate-early genes (IEGs) has been shown to be induced by activity-dependent synaptic plasticity or behavioral training and is thought to play an important role in long-term memory. In the present study, we examined the induction and expression of the IEG-encoded protein Egr-1 during an in vitro neural correlate of eyeblink…

  8. The 380 kb pCMU01 plasmid encodes chloromethane utilization genes and redundant genes for vitamin B12- and tetrahydrofolate-dependent chloromethane metabolism in Methylobacterium extorquens CM4: a proteomic and bioinformatics study.

    Directory of Open Access Journals (Sweden)

    Sandro Roselli

    Full Text Available Chloromethane (CH3Cl is the most abundant volatile halocarbon in the atmosphere and contributes to the destruction of stratospheric ozone. The only known pathway for bacterial chloromethane utilization (cmu was characterized in Methylobacterium extorquens CM4, a methylotrophic bacterium able to utilize compounds without carbon-carbon bonds such as methanol and chloromethane as the sole carbon source for growth. Previous work demonstrated that tetrahydrofolate and vitamin B12 are essential cofactors of cmuA- and cmuB-encoded methyltransferases of chloromethane dehalogenase, and that the pathway for chloromethane utilization is distinct from that for methanol. This work reports genomic and proteomic data demonstrating that cognate cmu genes are located on the 380 kb pCMU01 plasmid, which drives the previously defined pathway for tetrahydrofolate-mediated chloromethane dehalogenation. Comparison of complete genome sequences of strain CM4 and that of four other M. extorquens strains unable to grow with chloromethane showed that plasmid pCMU01 harbors unique genes without homologs in the compared genomes (bluB2, btuB, cobA, cbiD, as well as 13 duplicated genes with homologs of chromosome-borne genes involved in vitamin B12-associated biosynthesis and transport, or in tetrahydrofolate-dependent metabolism (folC2. In addition, the presence of both chromosomal and plasmid-borne genes for corrinoid salvaging pathways may ensure corrinoid coenzyme supply in challenging environments. Proteomes of M. extorquens CM4 grown with one-carbon substrates chloromethane and methanol were compared. Of the 49 proteins with differential abundance identified, only five (CmuA, CmuB, PurU, CobH2 and a PaaE-like uncharacterized putative oxidoreductase are encoded by the pCMU01 plasmid. The mainly chromosome-encoded response to chloromethane involves gene clusters associated with oxidative stress, production of reducing equivalents (PntAA, Nuo complex, conversion of

  9. A robust approach based on Weibull distribution for clustering gene expression data

    Directory of Open Access Journals (Sweden)

    Gong Binsheng

    2011-05-01

    Full Text Available Abstract Background Clustering is a widely used technique for analysis of gene expression data. Most clustering methods group genes based on the distances, while few methods group genes according to the similarities of the distributions of the gene expression levels. Furthermore, as the biological annotation resources accumulated, an increasing number of genes have been annotated into functional categories. As a result, evaluating the performance of clustering methods in terms of the functional consistency of the resulting clusters is of great interest. Results In this paper, we proposed the WDCM (Weibull Distribution-based Clustering Method, a robust approach for clustering gene expression data, in which the gene expressions of individual genes are considered as the random variables following unique Weibull distributions. Our WDCM is based on the concept that the genes with similar expression profiles have similar distribution parameters, and thus the genes are clustered via the Weibull distribution parameters. We used the WDCM to cluster three cancer gene expression data sets from the lung cancer, B-cell follicular lymphoma and bladder carcinoma and obtained well-clustered results. We compared the performance of WDCM with k-means and Self Organizing Map (SOM using functional annotation information given by the Gene Ontology (GO. The results showed that the functional annotation ratios of WDCM are higher than those of the other methods. We also utilized the external measure Adjusted Rand Index to validate the performance of the WDCM. The comparative results demonstrate that the WDCM provides the better clustering performance compared to k-means and SOM algorithms. The merit of the proposed WDCM is that it can be applied to cluster incomplete gene expression data without imputing the missing values. Moreover, the robustness of WDCM is also evaluated on the incomplete data sets. Conclusions The results demonstrate that our WDCM produces clusters

  10. Cloning, Expression Profiling and Functional Analysis of CnHMGS, a Gene Encoding 3-hydroxy-3-Methylglutaryl Coenzyme A Synthase from Chamaemelum nobile.

    Science.gov (United States)

    Cheng, Shuiyuan; Wang, Xiaohui; Xu, Feng; Chen, Qiangwen; Tao, Tingting; Lei, Jing; Zhang, Weiwei; Liao, Yongling; Chang, Jie; Li, Xingxiang

    2016-03-08

    Roman chamomile (Chamaemelum nobile L.) is renowned for its production of essential oils, which major components are sesquiterpenoids. As the important enzyme in the sesquiterpenoid biosynthesis pathway, 3-hydroxy-3-methylglutaryl coenzyme A synthase (HMGS) catalyze the crucial step in the mevalonate pathway in plants. To isolate and identify the functional genes involved in the sesquiterpene biosynthesis of C. nobile L., a HMGS gene designated as CnHMGS (GenBank Accession No. KU529969) was cloned from C. nobile. The cDNA sequence of CnHMGS contained a 1377 bp open reading frame encoding a 458-amino-acid protein. The sequence of the CnHMGS protein was highly homologous to those of HMGS proteins from other plant species. Phylogenetic tree analysis revealed that CnHMGS clustered with the HMGS of Asteraceae in the dicotyledon clade. Further functional complementation of CnHMGS in the mutant yeast strain YSC6274 lacking HMGS activity demonstrated that the cloned CnHMGS cDNA encodes a functional HMGS. Transcript profile analysis indicated that CnHMGS was preferentially expressed in flowers and roots of C. nobile. The expression of CnHMGS could be upregulated by exogenous elicitors, including methyl jasmonate and salicylic acid, suggesting that CnHMGS was elicitor-responsive. The characterization and expression analysis of CnHMGS is helpful to understand the biosynthesis of sesquiterpenoid in C. nobile at the molecular level and also provides molecular wealth for the biotechnological improvement of this important medicinal plant.

  11. Effects of gene disruptions in the nisin gene cluster of Lactococcus lactis on nisin production and producer immunity

    NARCIS (Netherlands)

    Ra, Runar; Beerthuyzen, Marke M.; Vos, Willem M. de; Saris, Per E.J.; Kuipers, Oscar P.

    1999-01-01

    The lantibiotic nisin is produced by several strains of Lactococcus lactis subsp. lactis. The chromosomally located gene cluster nisABTCIPRKFEG is required for biosynthesis, development of immunity, and regulation of gene expression. In-frame deletions in the nisB and nisT genes, and disruption of

  12. The life-extending gene Indy encodes an exchanger for Krebs-cycle intermediates.

    Science.gov (United States)

    Knauf, Felix; Mohebbi, Nilufar; Teichert, Carsten; Herold, Diana; Rogina, Blanka; Helfand, Stephen; Gollasch, Maik; Luft, Friedrich C; Aronson, Peter S

    2006-07-01

    A longevity gene called Indy (for 'I'm not dead yet'), with similarity to mammalian genes encoding sodium-dicarboxylate cotransporters, was identified in Drosophila melanogaster. Functional studies in Xenopus oocytes showed that INDY mediates the flux of dicarboxylates and citrate across the plasma membrane, but the specific transport mechanism mediated by INDY was not identified. To test whether INDY functions as an anion exchanger, we examined whether substrate efflux is stimulated by transportable substrates added to the external medium. Efflux of [14C]citrate from INDY-expressing oocytes was greatly accelerated by the addition of succinate to the external medium, indicating citrate-succinate exchange. The succinate-stimulated [14C]citrate efflux was sensitive to inhibition by DIDS (4,4'-di-isothiocyano-2,2'-disulphonic stilbene), as demonstrated previously for INDY-mediated succinate uptake. INDY-mediated efflux of [14C]citrate was also stimulated by external citrate and oxaloacetate, indicating citrate-citrate and citrate-oxaloacetate exchange. Similarly, efflux of [14C]succinate from INDY-expressing oocytes was stimulated by external citrate, alpha-oxoglutarate and fumarate, indicating succinate-citrate, succinate-alpha-oxoglutarate and succinate-fumarate exchange respectively. Conversely, when INDY-expressing Xenopus oocytes were loaded with succinate and citrate, [14C]succinate uptake was markedly stimulated, confirming succinate-succinate and succinate-citrate exchange. Exchange of internal anion for external citrate was markedly pH(o)-dependent, consistent with the concept that citrate is co-transported with a proton. Anion exchange was sodium-independent. We conclude that INDY functions as an exchanger of dicarboxylate and tricarboxylate Krebs-cycle intermediates. The effect of decreasing INDY activity, as in the long-lived Indy mutants, may be to alter energy metabolism in a manner that favours lifespan extension.

  13. A novel protein encoded by the circular form of the SHPRH gene suppresses glioma tumorigenesis.

    Science.gov (United States)

    Zhang, Maolei; Huang, Nunu; Yang, Xuesong; Luo, Jingyan; Yan, Sheng; Xiao, Feizhe; Chen, Wenping; Gao, Xinya; Zhao, Kun; Zhou, Huangkai; Li, Ziqiang; Ming, Liu; Xie, Bo; Zhang, Nu

    2018-01-18

    Circular RNAs (circRNAs) are recognized as functional non-coding transcripts in eukaryotic cells. Recent evidence has indicated that even though circRNAs are generally expressed at low levels, they may be involved in many physiological or pathological processes, such as gene regulation, tissue development and carcinogenesis. Although the 'microRNA sponge' function is well characterized, most circRNAs do not contain perfect trapping sites for microRNAs, which suggests the possibility that circRNAs have functions that have not yet been defined. In this study, we show that a circRNA containing an open reading frame (ORF) driven by the internal ribosome entry site (IRES) can translate a functional protein. The circular form of the SNF2 histone linker PHD RING helicase (SHPRH) gene encodes a novel protein that we termed SHPRH-146aa. Circular SHPRH (circ-SHPRH) uses overlapping genetic codes to generate a 'UGA' stop codon, which results in the translation of the 17 kDa SHPRH-146aa. Both circ-SHPRH and SHPRH-146aa are abundantly expressed in normal human brains and are down-regulated in glioblastoma. The overexpression of SHPRH-146aa in U251 and U373 glioblastoma cells reduces their malignant behavior and tumorigenicity in vitro and in vivo. Mechanistically, SHPRH-146aa protects full-length SHPRH from degradation by the ubiquitin proteasome. Stabilized SHPRH sequentially ubiquitinates proliferating cell nuclear antigen (PCNA) as an E3 ligase, leading to inhibited cell proliferation and tumorigenicity. Our findings provide a novel perspective regarding circRNA function in physiological and pathological processes. Specifically, SHPRH-146aa generated from overlapping genetic codes of circ-SHPRH is a tumor suppressor in human glioblastoma.

  14. StAR Enhances Transcription of Genes Encoding the Mitochondrial Proteases Involved in Its Own Degradation

    Science.gov (United States)

    Bahat, Assaf; Perlberg, Shira; Melamed-Book, Naomi; Lauria, Ines; Langer, Thomas

    2014-01-01

    Steroidogenic acute regulatory protein (StAR) is essential for steroid hormone synthesis in the adrenal cortex and the gonads. StAR activity facilitates the supply of cholesterol substrate into the inner mitochondrial membranes where conversion of the sterol to a steroid is catalyzed. Mitochondrial import terminates the cholesterol mobilization activity of StAR and leads to mounting accumulation of StAR in the mitochondrial matrix. Our studies suggest that to prevent mitochondrial impairment, StAR proteolysis is executed by at least 2 mitochondrial proteases, ie, the matrix LON protease and the inner membrane complexes of the metalloproteases AFG3L2 and AFG3L2:SPG7/paraplegin. Gonadotropin administration to prepubertal rats stimulated ovarian follicular development associated with increased expression of the mitochondrial protein quality control system. In addition, enrichment of LON and AFG3L2 is evident in StAR-expressing ovarian cells examined by confocal microscopy. Furthermore, reporter studies of the protease promoters examined in the heterologous cell model suggest that StAR expression stimulates up to a 3.5-fold increase in the protease gene transcription. Such effects are StAR-specific, are independent of StAR activity, and failed to occur upon expression of StAR mutants that do not enter the matrix. Taken together, the results of this study suggest the presence of a novel regulatory loop, whereby acute accumulation of an apparent nuisance protein in the matrix provokes a mitochondria to nucleus signaling that, in turn, activates selected transcription of genes encoding the enrichment of mitochondrial proteases relevant for enhanced clearance of StAR. PMID:24422629

  15. Gene encoding erythrocyte binding ligand linked to blood stage multiplication rate phenotype in Plasmodium yoelii yoelii.

    Science.gov (United States)

    Pattaradilokrat, Sittiporn; Culleton, Richard L; Cheesman, Sandra J; Carter, Richard

    2009-04-28

    Variation in the multiplication rate of blood stage malaria parasites is often positively correlated with the severity of the disease they cause. The rodent malaria parasite Plasmodium yoelii yoelii has strains with marked differences in multiplication rate and pathogenicity in the blood. We have used genetic analysis by linkage group selection (LGS) to identify genes that determine differences in multiplication rate. Genetic crosses were generated between genetically unrelated, fast- (17XYM) and slowly multiplying (33XC) clones of P. y. yoelii. The uncloned progenies of these crosses were placed under multiplication rate selection in blood infections in mice. The selected progenies were screened for reduction in intensity of quantitative genetic markers of the slowly multiplying parent. A small number of strongly selected markers formed a linkage group on P. y. yoelii chromosome 13. Of these, that most strongly selected marked the gene encoding the P. yoelii erythrocyte binding ligand (pyebl), which has been independently identified by Otsuki and colleagues [Otsuki H, et al. (2009) Proc Natl Acad Sci USA 106:10.1073/pnas.0811313106] as a major determinant of virulence in these parasites. In an analysis of a previous genetic cross in P. y. yoelii, pyebl alleles of fast- and slowly multiplying parents segregated with the fast and slow multiplication rate phenotype in the cloned recombinant progeny, implying the involvement of the pyebl locus in determining the multiplication rate. Our genome-wide LGS analysis also indicated effects of at least 1 other locus on multiplication rate, as did the findings of Otsuki and colleagues on virulence in P. y. yoelii.

  16. Molecular cloning and expression analysis of the gene encoding proline dehydrogenase from Jatropha curcas L.

    Science.gov (United States)

    Wang, Haibo; Ao, Pingxing; Yang, Shuanglong; Zou, Zhurong; Wang, Shasha; Gong, Ming

    2015-03-01

    Proline dehydrogenase (ProDH) (EC 1.5.99.8) is a key enzyme in the catabolism of proline. The enzyme JcProDH and its complementary DNA (cDNA) were isolated from Jatropha curcas L., an important woody oil plant used as a raw material for biodiesels. It has been classified as a member of the Pro_dh superfamily based on multiple sequence alignment, phylogenetic characterization, and its role in proline catabolism. Its cDNA is 1674 bp in length with a complete open reading frame of 1485 bp, which encodes a polypeptide chain of 494 amino acids with a predicted molecular mass of 54 kD and a pI of 8.27. Phylogenetic analysis indicated that JcProDH showed high similarity with ProDH from other plants. Reverse transcription PCR (RT-PCR) analysis revealed that JcProDH was especially abundant in the seeds and flowers but scarcely present in the stems, roots, and leaves. In addition, the expression of JcProDH increased in leaves experiencing environmental stress such as cold (5 °C), heat (42 °C), salt (300 mM), and drought (30 % PEG6000). The JcProDH protein was successfully expressed in the yeast strain INVSc1 and showed high enzyme activity in proline catabolism. This result confirmed that the JcProDH gene negatively participated in the stress response.

  17. A novel GDNF-inducible gene, BMZF3, encodes a transcriptional repressor associated with KAP-1

    International Nuclear Information System (INIS)

    Suzuki, Chikage; Murakumo, Yoshiki; Kawase, Yukari; Sato, Tomoko; Morinaga, Takatoshi; Fukuda, Naoyuki; Enomoto, Atsushi; Ichihara, Masatoshi; Takahashi, Masahide

    2008-01-01

    The Krueppel-associated box (KRAB)-containing zinc finger proteins (ZFPs) comprise the largest family of zinc finger transcription factors that function as transcriptional repressors. In the study of glial cell line-derived neurotrophic factor (GDNF)-RET signaling, we have identified bone marrow zinc finger 3 (BMZF3), encoding a KRAB-ZFP, as a GDNF-inducible gene by differential display analysis. The expression of BMZF3 transcripts in the human neuroblastoma cell line TGW increased 1 h after GDNF stimulation, as determined by Northern blotting and quantitative reverse-transcriptase polymerase chain reaction. The BMZF3 possesses transcriptional repressor activity in the KRAB domain. BMZF3 interacts with a co-repressor protein, KRAB-associated protein 1 (KAP-1), through the KRAB domain and siRNA-mediated knockdown of KAP-1 abolished the transcriptional repressor activity of BMZF3, indicating that KAP-1 is necessary for BMZF3 function. Furthermore, siRNA-mediated silencing of BMZF3 inhibited cell proliferation. These findings suggest that BMZF3 is a transcriptional repressor induced by GDNF that plays a role in cell proliferation

  18. Plasmodium falciparum var genes expressed in children with severe malaria encode CIDRα1 domains

    DEFF Research Database (Denmark)

    Jespersen, Jakob S.; Wang, Christian W.; Mkumbaye, Sixbert I.

    2016-01-01

    Most severe Plasmodium falciparum infections are experienced by young children. Severe symptoms are precipitated by vascular sequestration of parasites expressing a particular subset of the polymorphic P. falciparum erythrocyte membrane protein 1 (PfEMP1) adhesion molecules. Parasites binding hum...... the hypothesis that the CIDRα1-EPCR interaction is key to the pathogenesis of severe malaria and strengthen the rationale for pursuing a vaccine or adjunctive treatment aiming at inhibiting or reducing the damaging effects of this interaction....... endothelial protein C receptor (EPCR) through the CIDRα1 domain of certain PfEMP1 were recently associated with severe malaria in children. However, it has remained unclear to which extend the EPCR-binding CIDRα1 domains epitomize PfEMP1 expressed in severe malaria. Here, we characterized the near full......-length transcripts dominating the var transcriptome in children with severe malaria and found that the only common feature of the encoded PfEMP1 was CIDRα1 domains. Such genes were highly and dominantly expressed in both children with severe malarial anaemia and cerebral malaria. These observations support...

  19. Molecular cloning and characterization of two genes encoding dihydroflavonol-4-reductase from Populus trichocarpa.

    Directory of Open Access Journals (Sweden)

    Yan Huang

    Full Text Available Dihydroflavonol 4-reductase (DFR, EC 1.1.1.219 is a rate-limited enzyme in the biosynthesis of anthocyanins and condensed tannins (proanthocyanidins that catalyzes the reduction of dihydroflavonols to leucoanthocyanins. In this study, two full-length transcripts encoding for PtrDFR1 and PtrDFR2 were isolated from Populus trichocarpa. Sequence alignment of the two PtrDFRs with other known DFRs reveals the homology of these genes. The expression profile of PtrDFRs was investigated in various tissues of P. trichocarpa. To determine their functions, two PtrDFRs were overexpressed in tobacco (Nicotiana tabacum via Agrobacterium-mediated transformation. The associated color change in the flowers was observed in all 35S:PtrDFR1 lines, but not in 35S:PtrDFR2 lines. Compared to the wild-type control, a significantly higher accumulation of anthocyanins was detected in transgenic plants harboring the PtrDFR1. Furthermore, overexpressing PtrDFR1 in Chinese white poplar (P. tomentosa Carr. resulted in a higher accumulation of both anthocyanins and condensed tannins, whereas constitutively expressing PtrDFR2 only improved condensed tannin accumulation, indicating the potential regulation of condensed tannins by PtrDFR2 in the biosynthetic pathway in poplars.

  20. Idiopathic neonatal necrotising fasciitis caused by community-acquired MSSA encoding Panton Valentine Leukocidin genes.

    LENUS (Irish Health Repository)

    Dunlop, Rebecca L E

    2012-02-01

    Neonatal necrotising fasciitis is very rare in comparison to the adult presentation of the disease and a Plastic Surgeon may only encounter one such case during his or her career. Often this is initially misdiagnosed and managed as simple cellulitis. It generally affects previously healthy babies, the site is often the lower back area and a history of minor skin trauma may be elicited. The causative organism is usually Streptococcus or polymicrobial, as is the case in the adult population. We present the case of a previously healthy 11-day-old infant with idiopathic, rapidly progressive necrotising fasciitis of the back, cause by Methicillin sensitive Staphylococcus aureus (MSSA) infection. The strain was isolated and found to encode the Panton-Valentine Leukocidin genes, which have been associated with particularly severe necrotising infections in other sites, with high mortality. These strains are the subject of specific treatment and eradication guidance in the UK but awareness of this and the importance of obtaining detailed culture typing is likely to be low amongst Plastic Surgeons.

  1. Effects of light fluence and wavelength on expression of the gene encoding cucumber hydroxypyruvate reductase.

    Science.gov (United States)

    Bertoni, G P; Becker, W M

    1993-01-01

    We have investigated the regulation of cucumber (Cucumis sativus) hydroxypyruvate reductase mRNA abundance in response to white-, red-, and far-red-light treatments. Following irradiation of dark-adapted cucumber seedlings with 15 min to 4 h of either white or red light and return to darkness, the mRNA level for the gene encoding hydroxypyruvate reductase (Hpr) in cotyledons peaks in the darkness 16 to 20 h later. The response of the Hpr mRNA level to total fluence of white light depends more directly on irradiation time than on fluence rate. In addition to this time-dependent component, a phytochrome-dependent component is involved in Hpr regulation in dark-adapted green cotyledons as shown by red-light induction and partial far-red-light reversibility. Parallel measurements of mRNA levels for the ribulose bisphosphate carboxylase/oxygenase small subunit and for the chlorophyll a/b-binding protein show that Hpr is the most responsive to short (about 60 min) white- and red-light treatments and that each mRNA has a characteristic pattern of accumulation in dark-adapted cotyledons in response to light. PMID:8022942

  2. [Cloning and analysis of three genes encoding type II CHH family neuropeptides from Fennropenaeus chinensis].

    Science.gov (United States)

    Wang, Zai-Zhao; Xiang, Jian-Hai

    2003-10-01

    On the basis of sequence similarity, the crustean hyperglycemic hormone (CHH) family peptides have been classified into two types of hormones: type I and type II. Molt-inhibiting hormone (MIH) is a neuropeptide member of type II CHH family. Molting in shrimp is controlled by MIH and ecdysone. By inhibiting the synthesis of ecdysone in the Y-organ, MIH indirectly suppresses the molting activity of shrimp. In this study, we reported the cloning and characterization of 3 gene fragments encoding type II CHH family neuropeptides of the shrimp Fennropenaeus chinensis. According to the complementary DNA sequence of the mult-inhibiting hormone of Fennropenaeus chinensis, 3 primers were designed and synthesized. MP1 and MP2 are sense primers, and MP3 is anti-sense primer. Polymerase chain reaction was performed using genomic DNA of Fennropenaeus chinensis as template. Three PCR products were obtained using primers MP1 and MP3. Their sizes are about 600 bp, 850 bp, 1050 bp, respectively. A 580 bp PCR product was obtained using primers MP2 and MP3. All the 4 PCR products were cloned into pMD18-T vector. The recombinant clones were sequenced using ABI 310 Genetic Analyzer. After sequencing, all the DNA sequences were searched in the GenBank by Blast program to find similar gene sequences. The searching results revealed 3 DNA fragment sequences were of high similarity with CHH family neuropeptide genes from various crustean species. The 3 DNA fragments were named as NP1, NP2, and NP3. Their sizes were 540 bp, 601 bp, and 826 bp, respectively. Using the mRNA sequences with the most similarity to the 3 sequence fragments as reference, the gene structure of the 3 DNA fragment sequences was analyzed. The exons of 3 sequence fragments were aligned with their similar sequences by Clustal W program. Both NP1 and NP2 consisted of 1 intron and 2 exons. NP3 consisted of 2 introns and 3 exons. Sequence analysis suggested that these 3 products belonged to sequence fragments of neuropeptide

  3. Related structures of neutral capsular polysaccharides of Acinetobacter baumannii isolates that carry related capsule gene clusters KL43, KL47, and KL88.

    Science.gov (United States)

    Shashkov, Alexander S; Kenyon, Johanna J; Arbatsky, Nikolay P; Shneider, Mikhail M; Popova, Anastasiya V; Miroshnikov, Konstantin A; Hall, Ruth M; Knirel, Yuriy A

    2016-11-29

    Capsular polysaccharides were recovered from four Acinetobacter baumannii isolates, and the following related structures of oligosaccharide repeating units were established by sugar analyses along with 1D and 2D 1 H and 13 C NMR spectroscopy: NIPH 60 and LUH5544 (K43) NIPH 601 (K47) The K locus for capsule biosynthesis in the genome sequences available for NIPH 60 and LUH5544, designated KL43, was found to be related to gene clusters KL47 in NIPH 601 and KL88 in LUH5548. The three clusters share most gene content differing in only a small portion that includes an additional glycosyltransferase genes in KL47 and KL88, as well as genes encoding distinct Wzy polymerases that were found to form the same α-d-GlcpNAc-(1 → 6)-α-d-GlcpNAc linkage in K43 and K47. Copyright © 2016 Elsevier Ltd. All rights reserved.

  4. Clustering of Drosophila melanogaster immune genes in interplay with recombination rate.

    Directory of Open Access Journals (Sweden)

    K Mathias Wegner

    Full Text Available BACKGROUND: Gene order in eukaryotic chromosomes is not random and has been linked to coordination of gene expression, chromatin structure and also recombination rate. The evolution of recombination rate is especially relevant for genes involved in immunity because host-parasite co-evolution could select for increased recombination rate (Red Queen hypothesis. To identify patterns left by the intimate interaction between hosts and parasites, I analysed the genomic parameters of the immune genes from 24 gene families/groups of Drosophila melanogaster. PRINCIPAL FINDINGS: Immune genes that directly interact with the pathogen (i.e. recognition and effector genes clustered in regions of higher recombination rates. Out of these, clustered effector genes were transcribed fastest indicating that transcriptional control might be one major cause for cluster formation. The relative position of clusters to each other, on the other hand, cannot be explained by transcriptional control per se. Drosophila immune genes that show epistatic interactions can be found at an average distance of 15.44+/-2.98 cM, which is considerably closer than genes that do not interact (30.64+/-1.95 cM. CONCLUSIONS: Epistatically interacting genes rarely belong to the same cluster, which supports recent models of optimal recombination rates between interacting genes in antagonistic host-parasite co-evolution. These patterns suggest that formation of local clusters might be a result of transcriptional control, but that in the condensed genome of D. melanogaster relative position of these clusters may be a result of selection for optimal rather than maximal recombination rates between these clusters.

  5. CHARACTERIZATION OF 0.58 kb DNA STILBENE SYNTHASE ENCODING GENE FRAGMENT FROM MELINJO PLANT (Gnetum gnemon

    Directory of Open Access Journals (Sweden)

    Tri Joko Raharjo

    2011-12-01

    Full Text Available Resveratrol is a potent anticancer agent resulted as the main product of enzymatic reaction between common precursor in plants and Stilbene Synthase enzyme, which is expressed by sts gene. Characterization of internal fragment of Stilbene Synthase (STS encoding gene from melinjo plant (Gnetum gnemon L. has been carried out as part of a larger work to obtain a full length of Stilbene Synthase encoding gene of the plant. RT-PCR (Reverse Transcriptase Polymerase Chain Reaction was performed using two degenerated primers to amplify the gene fragment. Ten published STS conserved amino acid sequences from various plant species from genebank were utilized to construct a pair of GGF2 (5' GTTCCACCTGCGAAGCAGCC 3' and GGR2 (5' CTGGATCGCACATCC TGGTG 3' primers. Both designed primers were predicted to be in the position of 334-354 and 897-916 kb of the gene respectively. Total RNA isolated from melinjo leaves was used as template for the RT-PCR amplification process using two-step technique. A collection of 0.58 DNA fragments was generated from RT-PCR amplification and met the expected results. The obtained DNA fragments were subsequently isolated, refined and sequenced. A nucleotide sequence analysis was accomplished by comparing it to the existed sts genes available in genebank. Homology analysis of the DNA fragments with Arachis hypogaea L00952 sts gene showed high similarity level. Taken together, the results are evidence that the amplified fragment obtained in this study is part of melinjo sts gene

  6. The yeast ISN1 (YOR155c gene encodes a new type of IMP-specific 5'-nucleotidase

    Directory of Open Access Journals (Sweden)

    Schmitter Jean-Marie

    2003-05-01

    Full Text Available Abstract Background The purine salvage enzyme inosine 5'-monophosphate (IMP-specific 5'-nucleotidase catalyzes degradation of IMP to inosine. Although this enzymatic activity has been purified and characterized in Saccharomyces cerevisiae, the gene encoding IMP 5'-nucleotidase had not been identified. Results Mass spectrometry analysis of several peptides of this enzyme purified from yeast allowed identification of the corresponding gene as YOR155c, an open reading frame of unknown function, renamed ISN1. The deduced Isn1p sequence was clearly not homologous to 5'-nucleotidases from other species. However, significant similarities to Isn1p were found in proteins of unknown function from Neurospora crassa, Plasmodium falciparum and several yeast species. Knock-out of ISN1 resulted in the total loss of IMP-specific 5'-nucleotidase activity, thus confirming that the ISN1 gene indeed encodes the enzymatic activity purified from yeast. In vivo studies revealed that, when IMP is overproduced through constitutive activation of the IMP de novo synthesis pathway, ISN1 is required for excretion of inosine and hypoxanthine in the medium. Conclusion We have identified a new yeast gene, ISN1 (YOR155c, as encoding IMP-specific 5'-nucleotidase activity. The ISN1 gene defines a new type of 5'-nucleotidase which was demonstrated to be functional in vivo.

  7. Changes in mitochondrial DNA alter expression of nuclear encoded genes associated with tumorigenesis

    Energy Technology Data Exchange (ETDEWEB)

    Jandova, Jana; Janda, Jaroslav [Southern Arizona VA Healthcare System, Department of Medicine, Dermatology Division and Arizona Cancer Center, University of Arizona, 1515 N Campbell Avenue, Tucson, AZ 857 24 (United States); Sligh, James E, E-mail: jsligh@azcc.arizona.edu [Southern Arizona VA Healthcare System, Department of Medicine, Dermatology Division and Arizona Cancer Center, University of Arizona, 1515 N Campbell Avenue, Tucson, AZ 857 24 (United States)

    2012-10-15

    We previously reported the presence of a mtDNA mutation hotspot in UV-induced premalignant and malignant skin tumors in hairless mice. We have modeled this change (9821insA) in murine cybrid cells and demonstrated that this alteration in mtDNA associated with mtBALB haplotype can alter the biochemical characteristics of cybrids and subsequently can contribute to significant changes in their behavioral capabilities. This study shows that changes in mtDNA can produce differences in expression levels of specific nuclear-encoded genes, which are capable of triggering the phenotypes such as seen in malignant cells. From a potential list of differentially expressed genes discovered by microarray analysis, we selected MMP-9 and Col1a1 for further studies. Real-time PCR confirmed up-regulation of MMP-9 and down-regulation of Col1a1 in cybrids harboring the mtDNA associated with the skin tumors. These cybrids also showed significantly increased migration and invasion abilities compared to wild type. The non-specific MMP inhibitor, GM6001, was able to inhibit migratory and invasive abilities of the 9821insA cybrids confirming a critical role of MMPs in cellular motility. Nuclear factor-{kappa}B (NF-{kappa}B) is a key transcription factor for production of MMPs. An inhibitor of NF-{kappa}B activation, Bay 11-7082, was able to inhibit the expression of MMP-9 and ultimately decrease migration and invasion of mutant cybrids containing 9821insA. These studies confirm a role of NF-{kappa}B in the regulation of MMP-9 expression and through this regulation modulates the migratory and invasive capabilities of cybrids with mutant mtDNA. Enhanced migration and invasion abilities caused by up-regulated MMP-9 may contribute to the tumorigenic phenotypic characteristics of mutant cybrids. -- Highlights: Black-Right-Pointing-Pointer Cybrids are useful models to study the role of mtDNA changes in cancer development. Black-Right-Pointing-Pointer mtDNA changes affect the expression of nuclear

  8. CLEAN: CLustering Enrichment ANalysis

    Science.gov (United States)

    Freudenberg, Johannes M; Joshi, Vineet K; Hu, Zhen; Medvedovic, Mario

    2009-01-01

    Background Integration of biological knowledge encoded in various lists of functionally related genes has become one of the most important aspects of analyzing genome-wide functional genomics data. In the context of cluster analysis, functional coherence of clusters established through such analyses have been used to identify biologically meaningful clusters, compare clustering algorithms and identify biological pathways associated with the biological process under investigation. Results We developed a computational framework for analytically and visually integrating knowledge-based functional categories with the cluster analysis of genomics data. The framework is based on the simple, conceptually appealing, and biologically interpretable gene-specific functional coherence score (CLEAN score). The score is derived by correlating the clustering structure as a whole with functional categories of interest. We directly demonstrate that integrating biological knowledge in this way improves the reproducibility of conclusions derived from cluster analysis. The CLEAN score differentiates between the levels of functional coherence for genes within the same cluster based on their membership in enriched functional categories. We show that this aspect results in higher reproducibility across independent datasets and produces more informative genes for distinguishing different sample types than the scores based on the traditional cluster-wide analysis. We also demonstrate the utility of the CLEAN framework in comparing clusterings produced by different algorithms. CLEAN was implemented as an add-on R package and can be downloaded at . The package integrates routines for calculating gene specific functional coherence scores and the open source interactive Java-based viewer Functional TreeView (FTreeView). Conclusion Our results indicate that using the gene-specific functional coherence score improves the reproducibility of the conclusions made about clusters of co

  9. Expression of the nucleus-encoded chloroplast division genes and proteins regulated by the algal cell cycle.

    Science.gov (United States)

    Miyagishima, Shin-Ya; Suzuki, Kenji; Okazaki, Kumiko; Kabeya, Yukihiro

    2012-10-01

    Chloroplasts have evolved from a cyanobacterial endosymbiont and their continuity has been maintained by chloroplast division, which is performed by the constriction of a ring-like division complex at the division site. It is believed that the synchronization of the endosymbiotic and host cell division events was a critical step in establishing a permanent endosymbiotic relationship, such as is commonly seen in existing algae. In the majority of algal species, chloroplasts divide once per specific period of the host cell division cycle. In order to understand both the regulation of the timing of chloroplast division in algal cells and how the system evolved, we examined the expression of chloroplast division genes and proteins in the cell cycle of algae containing chloroplasts of cyanobacterial primary endosymbiotic origin (glaucophyte, red, green, and streptophyte algae). The results show that the nucleus-encoded chloroplast division genes and proteins of both cyanobacterial and eukaryotic host origin are expressed specifically during the S phase, except for FtsZ in one graucophyte alga. In this glaucophyte alga, FtsZ is persistently expressed throughout the cell cycle, whereas the expression of the nucleus-encoded MinD and MinE as well as FtsZ ring formation are regulated by the phases of the cell cycle. In contrast to the nucleus-encoded division genes, it has been shown that the expression of chloroplast-encoded division genes is not regulated by the host cell cycle. The endosymbiotic gene transfer of minE and minD from the chloroplast to the nuclear genome occurred independently on multiple occasions in distinct lineages, whereas the expression of nucleus-encoded MIND and MINE is regulated by the cell cycle in all lineages examined in this study. These results suggest that the timing of chloroplast division in algal cell cycle is restricted by the cell cycle-regulated expression of some but not all of the chloroplast division genes. In addition, it is

  10. DNACLUST: accurate and efficient clustering of phylogenetic marker genes

    Directory of Open Access Journals (Sweden)

    Liu Bo

    2011-06-01

    Full Text Available Abstract Background Clustering is a fundamental operation in the analysis of biological sequence data. New DNA sequencing technologies have dramatically increased the rate at which we can generate data, resulting in datasets that cannot be efficiently analyzed by traditional clustering methods. This is particularly true in the context of taxonomic profiling of microbial communities through direct sequencing of phylogenetic markers (e.g. 16S rRNA - the domain that motivated the work described in this paper. Many analysis approaches rely on an initial clustering step aimed at identifying sequences that belong to the same operational taxonomic unit (OTU. When defining OTUs (which have no universally accepted definition, scientists must balance a trade-off between computational efficiency and biological accuracy, as accurately estimating an environment's phylogenetic composition requires computationally-intensive analyses. We propose that efficient and mathematically well defined clustering methods can benefit existing taxonomic profiling approaches in two ways: (i the resulting clusters can be substituted for OTUs in certain applications; and (ii the clustering effectively reduces the size of the data-sets that need to be analyzed by complex phylogenetic pipelines (e.g., only one sequence per cluster needs to be provided to downstream analyses. Results To address the challenges outlined above, we developed DNACLUST, a fast clustering tool specifically designed for clustering highly-similar DNA sequences. Given a set of sequences and a sequence similarity threshold, DNACLUST creates clusters whose radius is guaranteed not to exceed the specified threshold. Underlying DNACLUST is a greedy clustering strategy that owes its performance to novel sequence alignment and k-mer based filtering algorithms. DNACLUST can also produce multiple sequence alignments for every cluster, allowing users to manually inspect clustering results, and enabling more

  11. Cloning, characterization, expression analysis and inhibition studies of a novel gene encoding Bowman-Birk type protease inhibitor from rice bean

    Science.gov (United States)

    This paper presents the first study describing the isolation, cloning and characterization of a full length gene encoding Bowman-Birk protease inhibitor (RbTI) from rice bean (Vigna umbellata). A full-length protease inhibitor gene with complete open reading frame of 327bp encoding 109 amino acids w...

  12. Chronic granulomatous disease caused by mutations other than the common GT deletion in NCF1, the gene encoding the p47phox component of the phagocyte NADPH oxidase

    NARCIS (Netherlands)

    Roos, Dirk; de Boer, Martin; Köker, M. Yavuz; Dekker, Jan; Singh-Gupta, Vinita; Ahlin, Anders; Palmblad, Jan; Sanal, Ozden; Kurenko-Deptuch, Magdalena; Jolles, Stephen; Wolach, Baruch

    2006-01-01

    Chronic granulomatous disease (CGD) is an inherited immunodeficiency caused by defects in any of four genes encoding components of the leukocyte nicotinamide dinucleotide phosphate, reduced (NADPH) oxidase. One of these is the autosomal neutrophil cytosolic factor 1 (NCF1) gene encoding the p47phox

  13. An original SERPINA3 gene cluster: Elucidation of genomic organization and gene expression in the Bos taurus 21q24 region

    Directory of Open Access Journals (Sweden)

    Ouali Ahmed

    2008-04-01

    Full Text Available Abstract Background The superfamily of serine proteinase inhibitors (serpins is involved in numerous fundamental biological processes as inflammation, blood coagulation and apoptosis. Our interest is focused on the SERPINA3 sub-family. The major human plasma protease inhibitor, α1-antichymotrypsin, encoded by the SERPINA3 gene, is homologous to genes organized in clusters in several mammalian species. However, although there is a similar genic organization with a high degree of sequence conservation, the reactive-centre-loop domains, which are responsible for the protease specificity, show significant divergences. Results We provide additional information by analyzing the situation of SERPINA3 in the bovine genome. A cluster of eight genes and one pseudogene sharing a high degree of identity and the same structural organization was characterized. Bovine SERPINA3 genes were localized by radiation hybrid mapping on 21q24 and only spanned over 235 Kilobases. For all these genes, we propose a new nomenclature from SERPINA3-1 to SERPINA3-8. They share approximately 70% of identity with the human SERPINA3 homologue. In the cluster, we described an original sub-group of six members with an unexpected high degree of conservation for the reactive-centre-loop domain, suggesting a similar peptidase inhibitory pattern. Preliminary expression analyses of these bovSERPINA3s showed different tissue-specific patterns and diverse states of glycosylation and phosphorylation. Finally, in the context of phylogenetic analyses, we improved our knowledge on mammalian SERPINAs evolution. Conclusion Our experimental results update data of the bovine genome sequencing, substantially increase the bovSERPINA3 sub-family and enrich the phylogenetic tree of serpins. We provide new opportunities for future investigations to approach the biological functions of this unusual subset of serine proteinase inhibitors.

  14. The Paraoxonase Gene Cluster Protects Against Abdominal Aortic Aneurysm Formation.

    Science.gov (United States)

    Yan, Yun-Fei; Pei, Jian-Fei; Zhang, Yang; Zhang, Ran; Wang, Fang; Gao, Peng; Zhang, Zhu-Qin; Wang, Ting-Ting; She, Zhi-Gang; Chen, Hou-Zao; Liu, De-Pei

    2017-02-01

    Abdominal aortic aneurysm (AAA) is a life-threatening vascular pathology, the pathogenesis of which is closely related to oxidative stress. However, an effective pharmaceutical treatment is lacking because the exact cause of AAA remains unknown. Here, we aimed at delineating the role of the paraoxonases (PONs) gene cluster (PC), which prevents atherosclerosis through the detoxification of oxidized substrates, in AAA formation. PC transgenic (Tg) mice were crossed to an Apoe -/- background, and an angiotensin II-induced AAA mouse model was used to analyze the effect of the PC on AAA formation. Four weeks after angiotensin II infusion, PC-Tg Apoe -/- mice had a lower AAA incidence, smaller maximal abdominal aortic external diameter, and less medial elastin degradation than Apoe -/- mice. Importantly, PC-Tg Apoe -/- mice exhibited lower aortic reactive oxidative species production and oxidative stress than did the Apoe -/- control mice. As a consequence, the PC transgene alleviated angiotensin II-induced arterial inflammation and suppressed arterial extracellular matrix degradation. Specifically, on angiotensin II stimulation, PC-Tg vascular smooth muscle cells exhibited lower levels of reactive oxidative species production and a decrease in the activities and expression levels of matrix metalloproteinase-2 and matrix metalloproteinase-9. Moreover, PC-Tg serum also enhanced vascular smooth muscle cell oxidative stress resistance and further decreased the expression levels of matrix metalloproteinase-2 and matrix metalloproteinase-9, indicating that circulatory and vascular smooth muscle cell PC members suppress oxidative stress in a synergistic manner. Our findings reveal, for the first time, a protective role of the PC in AAA formation and suggest PONs as promising targets for AAA prevention. © 2016 American Heart Association, Inc.

  15. Developmentally regulated expression of a human ''finger'' - containing gene encoded by the 5' half of the ret transforming gene

    Energy Technology Data Exchange (ETDEWEB)

    Takahashi, M.; Inaguma, Y.; Hiai, H.; Hirose, F.

    1988-04-01

    The authors isolated and sequenced a cDNA clone of the human gene encoded by the 5' half of the ret transforming gene. The nucleotide sequence indicates that it encodes a protein with ''finger'' structures which represent putative metal- and nucleic acid-binding domains. Transcriptions of this gene was detected at high levels in a variety of human and rodent tumor cell lines, mouse testis, and embryos. In addition, a unique transcript was observed in testis RNA. When the expression of the unique transcript was examined at different stages of spermatogenesis, a striking increase in mRNA levels accompanied progression from meiotic prophase pachytene spermatocytes to postmeiotic round spermatids. This finger-containing gene may thus function in male germ cell development.

  16. An Effective Tri-Clustering Algorithm Combining Expression Data with Gene Regulation Information

    Directory of Open Access Journals (Sweden)

    Ao Li

    2009-04-01

    Full Text Available Motivation: Bi-clustering algorithms aim to identify sets of genes sharing similar expression patterns across a subset of conditions. However direct interpretation or prediction of gene regulatory mechanisms may be difficult as only gene expression data is used. Information about gene regulators may also be available, most commonly about which transcription factors may bind to the promoter region and thus control the expression level of a gene. Thus a method to integrate gene expression and gene regulation information is desirable for clustering and analyzing. Methods: By incorporating gene regulatory information with gene expression data, we define regulated expression values (REV as indicators of how a gene is regulated by a specific factor. Existing bi-clustering methods are extended to a three dimensional data space by developing a heuristic TRI-Clustering algorithm. An additional approach named Automatic Boundary Searching algorithm (ABS is introduced to automatically determine the boundary threshold. Results: Results based on incorporating ChIP-chip data representing transcription factor-gene interactions show that the algorithms are efficient and robust for detecting tri-clusters. Detailed analysis of the tri-cluster extracted from yeast sporulation REV data shows genes in this cluster exhibited significant differences during the middle and late stages. The implicated regulatory network was then reconstructed for further study of defined regulatory mechanisms. Topological and statistical analysis of this network demonstrated evidence of significant changes of TF activities during the different stages of yeast sporulation, and suggests this approach might be a general way to study regulatory networks undergoing transformations.

  17. Leveraging long sequencing reads to investigate R-gene clustering and variation in sugar beet

    Science.gov (United States)

    Host-pathogen interactions are of prime importance to modern agriculture. Plants utilize various types of resistance genes to mitigate pathogen damage. Identification of the specific gene responsible for a specific resistance can be difficult due to duplication and clustering within R-gene families....

  18. Endophytic actinobacteria: Diversity, secondary metabolism and mechanisms to unsilence biosynthetic gene clusters.

    Science.gov (United States)

    Dinesh, Raghavan; Srinivasan, Veeraraghavan; T E, Sheeja; Anandaraj, Muthuswamy; Srambikkal, Hamza

    2017-09-01

    Endophytic actinobacteria, which reside in the inner tissues of host plants, are gaining serious attention due to their capacity to produce a plethora of secondary metabolites (e.g. antibiotics) possessing a wide variety of biological activity with diverse functions. This review encompasses the recent reports on endophytic actinobacterial species diversity, in planta habitats and mechanisms underlying their mode of entry into plants. Besides, their metabolic potential, novel bioactive compounds they produce and mechanisms to unravel their hidden metabolic repertoire by activation of cryptic or silent biosynthetic gene clusters (BGCs) for eliciting novel secondary metabolite production are discussed. The study also reviews the classical conservative techniques (chemical/biological/physical elicitation, co-culturing) as well as modern microbiology tools (e.g. next generation sequencing) that are being gainfully employed to uncover the vast hidden scaffolds for novel secondary metabolites produced by these endophytes, which would subsequently herald a revolution in drug engineering. The potential role of these endophytes in the agro-environment as promising biological candidates for inhibition of phytopathogens and the way forward to thoroughly exploit this unique microbial community by inducing expression of cryptic BGCs for encoding unseen products with novel therapeutic properties are also discussed.

  19. Molecular and Biochemical Characterization of Two Xylanase-Encoding Genes from Cellulomonas pachnodae

    Science.gov (United States)

    Cazemier, Anne E.; Verdoes, Jan C.; van Ooyen, Albert J. J.; Op den Camp, Huub J. M.

    1999-01-01

    Two xylanase-encoding genes, named xyn11A and xyn10B, were isolated from a genomic library of Cellulomonas pachnodae by expression in Escherichia coli. The deduced polypeptide, Xyn11A, consists of 335 amino acids with a calculated molecular mass of 34,383 Da. Different domains could be identified in the Xyn11A protein on the basis of homology searches. Xyn11A contains a catalytic domain belonging to family 11 glycosyl hydrolases and a C-terminal xylan binding domain, which are separated from the catalytic domain by a typical linker sequence. Binding studies with native Xyn11A and a truncated derivative of Xyn11A, lacking the putative binding domain, confirmed the function of the two domains. The second xylanase, designated Xyn10B, consists of 1,183 amino acids with a calculated molecular mass of 124,136 Da. Xyn10B also appears to be a modular protein, but typical linker sequences that separate the different domains were not identified. It comprises a N-terminal signal peptide followed by a stretch of amino acids that shows homology to thermostabilizing domains. Downstream of the latter domain, a catalytic domain specific for family 10 glycosyl hydrolases was identified. A truncated derivative of Xyn10B bound tightly to Avicel, which was in accordance with the identified cellulose binding domain at the C terminus of Xyn10B on the basis of homology. C. pachnodae, a (hemi)cellulolytic bacterium that was isolated from the hindgut of herbivorous Pachnoda marginata larvae, secretes at least two xylanases in the culture fluid. Although both Xyn11A and Xyn10B had the highest homology to xylanases from Cellulomonas fimi, distinct differences in the molecular organizations of the xylanases from the two Cellulomonas species were identified. PMID:10473422

  20. Transcriptional regulation of the Rhodococcus rhodochrous J1 nitA gene encoding a nitrilase.

    Science.gov (United States)

    Komeda, H; Hori, Y; Kobayashi, M; Shimizu, S

    1996-01-01

    The 1.4-kb downstream region from a nitrilase gene (nitA) of an actinomycete Rhodococcus rhodochrous J1, which is industrially in use, was found to be required for the isovaleronitrile-dependent induction of nitrilase synthesis in experiments using a Rhodococcus-Escherichia coli shuttle vector pK4 in a Rhodococcus strain. Sequence analysis of the 1.4-kb region revealed the existence of an open reading frame (nitR) of 957 bp, which would encode a protein with a molecular mass of 35,100. Deletion of the central and 3'-terminal portion of nitR resulted in the complete loss of nitrilase activity, demonstrating that nitR codes for a transcriptional positive regulator in nitA expression. The deduced amino acid sequence of nitR showed similarity to a positive regulator family including XylS from Pseudomonas putida and AraC from E. coli. By Northern blot analysis, the 1.4-kb transcripts for nitA were detected in R. rhodochrous J1 cells cultured in the presence of isovaleronitrile, but not those cultured in the absence of isovaleronitrile. The transcriptional start site for nitA was mapped to a C residue located 26 bp upstream of its translational start site. Deletion analysis to define the nitA promoter region suggested the possible participation of an inverted repeat sequence, centered on base pair -52, in induction of nitA transcription. Images Fig. 2 Fig. 5 Fig. 6 PMID:8855219

  1. Characterization of mouse UDP-glucose pyrophosphatase, a Nudix hydrolase encoded by the Nudt14 gene

    Energy Technology Data Exchange (ETDEWEB)

    Heyen, Candy A.; Tagliabracci, Vincent S.; Zhai, Lanmin [Department of Biochemistry and Molecular Biology, Indiana University School of Medicine, Indianapolis, IN 46202 (United States); Roach, Peter J., E-mail: proach@iupui.edu [Department of Biochemistry and Molecular Biology, Indiana University School of Medicine, Indianapolis, IN 46202 (United States)

    2009-12-25

    Recombinant mouse UDP-glucose pyrophosphatase (UGPPase), encoded by the Nudt14 gene, was produced in Escherichia coli and purified close to homogeneity. The enzyme catalyzed the conversion of [{beta}-{sup 32}P]UDP-glucose to [{sup 32}P]glucose-1-P and UMP, confirming that it hydrolyzed the pyrophosphate of the nucleoside diphosphate sugar to generate glucose-1-P and UMP. The enzyme was also active toward ADP-ribose. Activity is dependent on the presence of Mg{sup 2+} and was greatest at alkaline pH above 8. Kinetic analysis indicated a K{sub m} of {approx}4 mM for UDP-glucose and {approx}0.3 mM for ADP-ribose. Based on V{sub max}/K{sub m} values, the enzyme was {approx}20-fold more active toward ADP-ribose. UGPPase behaves as a dimer in solution and can be cross-linked to generate a species of M{sub r} 54,000 from a monomer of 30,000 as judged by SDS-PAGE. The dimerization was not affected by the presence of glucose-1-P or UDP-glucose. Using antibodies raised against the recombinant protein, Western analysis indicated that UGPPase was widely expressed in mouse tissues, including skeletal muscle, liver, kidney, heart, lung, fat, heart and pancreas with a lower level in brain. It was generally present as a doublet when analyzed by SDS-PAGE, suggesting the occurrence of some form of post-translational modification. Efforts to interconvert the species by adding or inhibiting phosphatase activity were unsuccessful, leaving the nature of the modification unknown. Sequence alignments and database searches revealed related proteins in species as distant as Drosophila melanogaster and Caenorhabditis elegans.

  2. Cloning and expression of a novel, moderately thermostable xylanase-encoding gene (Cflxyn11A) from Cellulomonas flavigena.

    Science.gov (United States)

    Amaya-Delgado, Lorena; Mejía-Castillo, Teresa; Santiago-Hernández, Alejandro; Vega-Estrada, Jesús; Amelia, Farrés-G-S; Xoconostle-Cázares, Beatriz; Ruiz-Medrano, Roberto; Montes-Horcasitas, María Del Carmen; Hidalgo-Lara, María Eugenia

    2010-07-01

    The Cfl xyn11A gene, encoding the endo-1,4-beta-xylanase Cfl Xyn11A from Cellulomonas flavigena, was isolated from a genomic DNA library. The open reading frame of the Cfl xyn11A gene was 999 base pairs long and encoded a polypeptide (Cfl Xyn11A) of 332 amino acids with a calculated molecular mass of 35,110Da. The Cfl xyn11A gene was expressed in Escherichia coli and the recombinant enzyme, with an estimated molecular weight of 31kDa was purified and xylanase activity was measured. Cfl Xyn11A showed optimal activity at pH 6.5 and 55 degrees C. The enzyme demonstrated moderate thermal stability as Cfl Xyn11A maintained 50% of its activity when incubated at 55 degrees C for 1h or at 45 degrees C for 6h. This is the first report describing the cloning, expression and functional characterization of an endo-1,4-beta-xylanase-encoding gene from C. flavigena. Cfl Xyn11A may be suitable for industrial applications in the food and feed industries, or in the pre-treatment of lignocellulosic biomass required to improve the yields of fermentable sugars for bioethanol production. Copyright (c) 2010 Elsevier Ltd. All rights reserved.

  3. Genome organisation and expression profiling of ABC protein-encoding genes in Heterobasidion annosum s.l. complex.

    Science.gov (United States)

    Baral, Bikash; Kovalchuk, Andriy; Asiegbu, Fred O

    2016-03-01

    Members of Heterobasidion annosum species complex are widely regarded as the most destructive fungal pathogens of conifer trees in the boreal and temperate zones of Northern hemisphere. To invade and colonise their host trees, Heterobasidion fungi must overcome components of host chemical defence, including terpenoid oleoresin and phenolic compounds. ABC transporters may play an important role in this process participating in the export of toxic host metabolites and maintaining their intracellular concentration below the critical level. We have identified and phylogenetically classified Heterobasidion genes encoding ABC transporters and closely related ABC proteins. The number of ABC proteins in the Heterobasidion genome is one of the lowest among analysed species of Agaricomycotina. Using quantitative RT-PCR, we have analysed transcriptional response of Heterobasidion ABC transporter-encoding genes to monoterpenes as well as their expression profile during growth on pine wood in comparison to the growth on defined media. Several ABC transporters were up-regulated during growth on pine wood. The ABC-transporter encoding gene ABCG1.1 was induced both during growth of H. annosum on pine wood and upon exposure to monoterpenes. Our experimental data demonstrate the differential responses of Heterobasidion ABC genes to growth conditions and chemical stressors. The presented results suggest a potential role of Heterobasidion ABC-G transporters in the resistance to the components of conifer chemical defence. Copyright © 2015 The British Mycological Society. Published by Elsevier Ltd. All rights reserved.

  4. Genomic organization and chromosomal localization of the human and mouse genes encoding the {alpha} receptor component for ciliary neurotrophic factor

    Energy Technology Data Exchange (ETDEWEB)

    Valenzuela, D.M.; Rojas, E.; McClain, J. [Regeneron Pharmaceuticals, Inc., Tarrytown, NY (United States)] [and others

    1995-01-01

    Ciliary neurotrophic factor (CNTF) has recently been found to share receptor components with, and to be structurally related to, a family of broadly acting cytokines, including interleukin-6, leukemia inhibitory factor, and oncostatin M. However, the CNTF receptor complex also includes a CNTF-specific component known as CNTF receptor {alpha} (CNTFR{alpha}). Here we describe the molecular cloning of the human and mouse genes encoding CNTFR. We report that the human and mouse genes have an identical intron-exon structure that correlates well with the domain structure of CNTFR{alpha}. That is, the signal peptide and the immunoglobulin-like domain are each encoded by single exons, the cytokine receptor-like domain is distributed among 4 exons, and the C-terminal glycosyl phosphatidylinositol recognition domain in encoded by the final coding exon. The position of the introns within the cytokine receptor-like domain corresponds to those found in other members of the cytokine receptor superfamily. Confirming a recent study using radiation hybrids, we have also mapped the human CNTFR gene to chromosome band 9p13 and the mouse gene to a syntenic region of chromosome 4. 24 refs., 4 figs.

  5. Plasmodium falciparum associated with severe childhood malaria preferentially expresses PfEMP1 encoded by group A var genes

    DEFF Research Database (Denmark)

    Jensen, Anja T R; Magistrado, Pamela; Sharp, Sarah

    2004-01-01

    Parasite-encoded variant surface antigens (VSAs) like the var gene-encoded Plasmodium falciparum erythrocyte membrane protein 1 (PfEMP1) family are responsible for antigenic variation and infected red blood cell (RBC) cytoadhesion in P. falciparum malaria. Parasites causing severe malaria...... in nonimmune patients tend to express a restricted subset of VSA (VSA(SM)) that differs from VSA associated with uncomplicated malaria and asymptomatic infection (VSA(UM)). We compared var gene transcription in unselected P. falciparum clone 3D7 expressing VSA(UM) to in vitro-selected sublines expressing VSA......(SM) to identify PfEMP1 responsible for the VSA(SM) phenotype. Expression of VSA(SM) was accompanied by up-regulation of Group A var genes. The most prominently up-regulated Group A gene (PFD1235w/MAL7P1.1) was translated into a protein expressed on the infected RBC surface. The proteins encoded by Group A var...

  6. Genomic cloning and characterization of a PPA gene encoding a mannose-binding lectin from Pinellia pedatisecta.

    Science.gov (United States)

    Lin, Juan; Zhou, Xuanwei; Fei, Jiong; Liao, Zhihua; Jin, Wang; Sun, Xiaofen; Tang, Kexuan

    2006-04-01

    A gene encoding a mannose-binding lectin, Pinellia pedatisecta agglutinin (PPA), was isolated from leaves of Pinellia pedatisecta using genomic walker technology. The ppa contained an 1140-bp 5'-upstream region, a 771-bp open reading frame (ORF) and an 829-bp 3'-downstream region. The ORF encoded a precursor polypeptide of 256 amino acid residues with a 24-amino acid signal peptide. There were one putative TATA box and six possible CAAT boxes lying in the 5'-upstream region of ppa. The ppa showed significant similarity at the nucleic acid level with genes encoding mannose-binding lectins from other Araceae species such as Pinellia ternata, Arisaema hererophyllum, Colocasia esculenta and Arum maculatum. At the amino acid level, PPA also shared varying homology (ranging from 40% to 85%) with mannose-binding lectins from other plant species, such as those from Araceae, Alliaceae, Iridaceae, Lillaceae, Amaryllidaceae and Bromeliaceae. The cloning of the ppa gene not only provides a basis for further investigation of PPA's structure, expression and regulation mechanism, but also enables us to test its potential role in controlling pests and fungal diseases by transferring the gene into tobacco and rice in the future.

  7. Gene clusters involved in isethionate degradation by terrestrial and marine bacteria.

    KAUST Repository

    Weinitschke, Sonja

    2010-01-01

    Ubiquitous isethionate (2-hydroxyethanesulfonate) is dissimilated by diverse bacteria. Growth of Cupriavidus necator H16 with isethionate was observed, as was inducible membrane-bound isethionate dehydrogenase (IseJ) and inducible transcription of the genes predicted to encode IseJ and a transporter (IseU). Biodiversity in isethionate transport genes was observed and investigated by transcription experiments.

  8. Horizontal transfer of a nitrate assimilation gene cluster and ecological transitions in fungi: a phylogenetic study.

    Directory of Open Access Journals (Sweden)

    Jason C Slot

    Full Text Available High affinity nitrate assimilation genes in fungi occur in a cluster (fHANT-AC that can be coordinately regulated. The clustered genes include nrt2, which codes for a high affinity nitrate transporter; euknr, which codes for nitrate reductase; and NAD(PH-nir, which codes for nitrite reductase. Homologs of genes in the fHANT-AC occur in other eukaryotes and prokaryotes, but they have only been found clustered in the oomycete Phytophthora (heterokonts. We performed independent and concatenated phylogenetic analyses of homologs of all three genes in the fHANT-AC. Phylogenetic analyses limited to fungal sequences suggest that the fHANT-AC has been transferred horizontally from a basidiomycete (mushrooms and smuts to an ancestor of the ascomycetous mold Trichoderma reesei. Phylogenetic analyses of sequences from diverse eukaryotes and eubacteria, and cluster structure, are consistent with a hypothesis that the fHANT-AC was assembled in a lineage leading to the oomycetes and was subsequently transferred to the Dikarya (Ascomycota+Basidiomycota, which is a derived fungal clade that includes the vast majority of terrestrial fungi. We propose that the acquisition of high affinity nitrate assimilation contributed to the success of Dikarya on land by allowing exploitation of nitrate in aerobic soils, and the subsequent transfer of a complete assimilation cluster improved the fitness of T. reesei in a new niche. Horizontal transmission of this cluster of functionally integrated genes supports the "selfish operon" hypothesis for maintenance of gene clusters.

  9. Regulation of the pT181 encoded tetracycline resistance gene in Straphylococcus aureus

    International Nuclear Information System (INIS)

    Mojumdar, M.

    1986-01-01

    pT181 is a naturally-occurring 4437 basepair (bp) plasmid isolated from Staphylococcus aureus which encodes inducible resistance to tetracycline (Tc). The DNA sequence data has identified three open reading frames (ORFs). The largest ORF B, has been found to be responsible for the Tc resistance phenotype of pT181. Since most Tc resistance systems appear to be regulated by an effector protein and a repressor protein, several Bal 31 deletion mutants of pT181 were constructed and analyzed in an effort to identify the elements involved in Tc resistance. Two transcomplementing groups of mutants were identified within the tet gene. The mechanism of Tc resistance was studied by assaying the accumulation of [7- 3 H] Tc by Tc sensitive cells, and uninduced and induced pT181-containing cells. A sharp decrease in accumulation of the drug after an initial increase was observed in Tc induced pT181-containing cells. In vivo labeling of Bacillus subtilis minicells containing pT181 was performed with 35 S-methionine to identify the polypeptide product of the tet gene. A Tc-inducible protein having a molecular weight of approximately 50,000 daltons was detected only in B. subtilis minicells carrying pT181. Cell fractionation studies of S. aureus cells with and without pT181 showed that an approximately 28,000 daltons Tc-inducible protein was present in membranes of pT181 containing cells. The amount of TET protein in Tc induced minicells was about fifteen-fold higher than that in uninduced minicells. RNA prepared from stationary phase cells analyzed by Northern blot hybridization showed that the steady-state level of the tet mRNA in induced pT181-containing cells was bout four-fold higher than that in uninduced pT181-containing cells. When RNA synthesis was blocked with rifampicin, tet mRAN was found to be much more stable in Tc induced cells as compared to that in uninduced cells over a 30 min period

  10. NFκB-mediated activation of the cellular FUT3, 5 and 6 gene cluster by herpes simplex virus type 1.

    Science.gov (United States)

    Nordén, Rickard; Samuelsson, Ebba; Nyström, Kristina

    2017-11-01

    Herpes simplex virus type 1 has the ability to induce expression of a human gene cluster located on chromosome 19 upon infection. This gene cluster contains three fucosyltransferases (encoded by FUT3, FUT5 and FUT6) with the ability to add a fucose to an N-acetylglucosamine residue. Little is known regarding the transcriptional activation of these three genes in human cells. Intriguingly, herpes simplex virus type 1 activates all three genes simultaneously during infection, a situation not observed in uninfected tissue, pointing towards a virus specific mechanism for transcriptional activation. The aim of this study was to define the underlying mechanism for the herpes simplex virus type 1 activation of FUT3, FUT5 and FUT6 transcription. The transcriptional activation of the FUT-gene cluster on chromosome 19 in fibroblasts was specific, not involving adjacent genes. Moreover, inhibition of NFκB signaling through panepoxydone treatment significantly decreased the induction of FUT3, FUT5 and FUT6 transcriptional activation, as did siRNA targeting of p65, in herpes simplex virus type 1 infected fibroblasts. NFκB and p65 signaling appears to play an important role in the regulation of FUT3, FUT5 and FUT6 transcriptional activation by herpes simplex virus type 1 although additional, unidentified, viral factors might account for part of the mechanism as direct interferon mediated stimulation of NFκB was not sufficient to induce the fucosyltransferase encoding gene cluster in uninfected cells. © The Author 2017. Published by Oxford University Press. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  11. Transcriptional analysis of the jamaicamide gene cluster from the marine cyanobacterium Lyngbya majuscula and identification of possible regulatory proteins

    Directory of Open Access Journals (Sweden)

    Dorrestein Pieter C

    2009-12-01

    Full Text Available Abstract Background The marine cyanobacterium Lyngbya majuscula is a prolific producer of bioactive secondary metabolites. Although biosynthetic gene clusters encoding several of these compounds have been identified, little is known about how these clusters of genes are transcribed or regulated, and techniques targeting genetic manipulation in Lyngbya strains have not yet been developed. We conducted transcriptional analyses of the jamaicamide gene cluster from a Jamaican strain of Lyngbya majuscula, and isolated proteins that could be involved in jamaicamide regulation. Results An unusually long untranslated leader region of approximately 840 bp is located between the jamaicamide transcription start site (TSS and gene cluster start codon. All of the intergenic regions between the pathway ORFs were transcribed into RNA in RT-PCR experiments; however, a promoter prediction program indicated the possible presence of promoters in multiple intergenic regions. Because the functionality of these promoters could not be verified in vivo, we used a reporter gene assay in E. coli to show that several of these intergenic regions, as well as the primary promoter preceding the TSS, are capable of driving β-galactosidase production. A protein pulldown assay was also used to isolate proteins that may regulate the jamaicamide pathway. Pulldown experiments using the intergenic region upstream of jamA as a DNA probe isolated two proteins that were identified by LC-MS/MS. By BLAST analysis, one of these had close sequence identity to a regulatory protein in another cyanobacterial species. Protein comparisons suggest a possible correlation between secondary metabolism regulation and light dependent complementary chromatic adaptation. Electromobility shift assays were used to evaluate binding of the recombinant proteins to the jamaicamide promoter region. Conclusion Insights into natural product regulation in cyanobacteria are of significant value to drug discovery

  12. High or low correlation between co-occuring gene clusters and 16S rRNA gene phylogeny.

    Science.gov (United States)

    Rudi, Knut; Sekelja, Monika