Genes regulation encoding ADP/ATP carrier in yeasts Saccharomyces cerevisiae and Candida parapsilosis

International Nuclear Information System (INIS)

Nebohacova, M.

2000-01-01

Genes encoding a mitochondrial ADP/ATP carrier (AAC) in yeast Saccharomyces cerevisiae and Candida parapsilosis were investigated. AAC2 is coding for the major AAC isoform in S. cerevisiae. We suggest that AAC2 is a member of a syn-expression group of genes encoding oxidative phosphorylation proteins. Within our previous studies on the regulation of the AAC2 transcription an UAS (-393/-268) was identified that is essential for the expression of this gene. Two functional regulatory cis-elements are located within this UAS -binding sites for an ABFl factor and for HAP2/3/4/5 heteromeric complex. We examined relative contributions and mutual interactions of the ABFl and HAP2/3/4/5 factors in the activation of transcription from the UAS of the AAC2 gene. The whole UAS was dissected into smaller sub-fragments and tested for (i) the ability to form DNA-protein complexes with cellular proteins in vitro, (ii) the ability to confer heterologous expression using AAC3 gene lacking its own promoter, and (iii) the expression of AAC3-lacZ fusion instead of intact AAC3 gene. The obtained results demonstrated that: a) The whole UAS as well as sub-fragment containing only ABF1-binding site are able to form DNA-protein complexes with cellular proteins in oxygen- and heme- dependent manner. The experiments with antibody against the ABF1 showed that the ABF1 factor is one of the proteins binding to AAC2 promoter. We have been unsuccessful to prove the binding of cellular proteins to the HAP2/3/4/5-binding site. However, the presence of HAP2/3/4/5-binding site is necessary to drive a binding of cellular proteins to the ABF1-binding site in carbon source-dependent manner. b) The presence of both ABF1- and HAP2/3/4/5-binding sites and original spacing between them is necessary to confer the growth of Aaac2 mutant strain on non- fermentable carbon source when put in front of AAC3 gene introduced on centromeric vector to Aaac2 mutant strain. c) For the activation of AAC3-lacZ expression on

Genome-wide identification of structural variants in genes encoding drug targets

DEFF Research Database (Denmark)

Rasmussen, Henrik Berg; Dahmcke, Christina Mackeprang

2012-01-01

The objective of the present study was to identify structural variants of drug target-encoding genes on a genome-wide scale. We also aimed at identifying drugs that are potentially amenable for individualization of treatments based on knowledge about structural variation in the genes encoding...

Cloning and Sequence Analysis of Vibrio halioticoli Genes Encoding Three Types of Polyguluronate Lyase.

Science.gov (United States)

Sugimura; Sawabe; Ezura

2000-01-01

The alginate lyase-coding genes of Vibrio halioticoli IAM 14596(T), which was isolated from the gut of the abalone Haliotis discus hannai, were cloned using plasmid vector pUC 18, and expressed in Escherichia coli. Three alginate lyase-positive clones, pVHB, pVHC, and pVHE, were obtained, and all clones expressed the enzyme activity specific for polyguluronate. Three genes, alyVG1, alyVG2, and alyVG3, encoding polyguluronate lyase were sequenced: alyVG1 from pVHB was composed of a 1056-bp open reading frame (ORF) encoding 352 amino acid residues; alyVG2 gene from pVHC was composed of a 993-bp ORF encoding 331 amino acid residues; and alyVG3 gene from pVHE was composed of a 705-bp ORF encoding 235 amino acid residues. Comparison of nucleotide and deduced amino acid sequences among AlyVG1, AlyVG2, and AlyVG3 revealed low homologies. The identity value between AlyVG1 and AlyVG2 was 18.7%, and that between AlyVG2 and AlyVG3 was 17.0%. A higher identity value (26.0%) was observed between AlyVG1 and AlyVG3. Sequence comparison among known polyguluronate lyases including AlyVG1, AlyVG2, and AlyVG3 also did not reveal an identical region in these sequences. However, AlyVG1 showed the highest identity value (36.2%) and the highest similarity (73.3%) to AlyA from Klebsiella pneumoniae. A consensus region comprising nine amino acid (YFKAGXYXQ) in the carboxy-terminal region previously reported by Mallisard and colleagues was observed only in AlyVG1 and AlyVG2.

Motif analysis unveils the possible co-regulation of chloroplast genes and nuclear genes encoding chloroplast proteins.

Science.gov (United States)

Wang, Ying; Ding, Jun; Daniell, Henry; Hu, Haiyan; Li, Xiaoman

2012-09-01

Chloroplasts play critical roles in land plant cells. Despite their importance and the availability of at least 200 sequenced chloroplast genomes, the number of known DNA regulatory sequences in chloroplast genomes are limited. In this paper, we designed computational methods to systematically study putative DNA regulatory sequences in intergenic regions near chloroplast genes in seven plant species and in promoter sequences of nuclear genes in Arabidopsis and rice. We found that -35/-10 elements alone cannot explain the transcriptional regulation of chloroplast genes. We also concluded that there are unlikely motifs shared by intergenic sequences of most of chloroplast genes, indicating that these genes are regulated differently. Finally and surprisingly, we found five conserved motifs, each of which occurs in no more than six chloroplast intergenic sequences, are significantly shared by promoters of nuclear-genes encoding chloroplast proteins. By integrating information from gene function annotation, protein subcellular localization analyses, protein-protein interaction data, and gene expression data, we further showed support of the functionality of these conserved motifs. Our study implies the existence of unknown nuclear-encoded transcription factors that regulate both chloroplast genes and nuclear genes encoding chloroplast protein, which sheds light on the understanding of the transcriptional regulation of chloroplast genes.

Identification of the Gene Encoding Isoprimeverose-producing Oligoxyloglucan Hydrolase in Aspergillus oryzae*

Science.gov (United States)

Matsuzawa, Tomohiko; Mitsuishi, Yasushi; Kameyama, Akihiko

2016-01-01

Aspergillus oryzae produces a unique β-glucosidase, isoprimeverose-producing oligoxyloglucan hydrolase (IPase), that recognizes and releases isoprimeverose (α-d-xylopyranose-(1→6)-d-glucopyranose) units from the non-reducing ends of oligoxyloglucans. A gene encoding A. oryzae IPase, termed ipeA, was identified and expressed in Pichia pastoris. With the exception of cellobiose, IpeA hydrolyzes a variety of oligoxyloglucans and is a member of the glycoside hydrolase family 3. Xylopyranosyl branching at the non-reducing ends was vital for IPase activity, and galactosylation at a α-1,6-linked xylopyranosyl side chain completely abolished IpeA activity. Hepta-oligoxyloglucan saccharide (Xyl3Glc4) substrate was preferred over tri- (Xyl1Glc2) and tetra- (Xyl2Glc2) oligoxyloglucan saccharides substrates. IpeA transferred isoprimeverose units to other saccharides, indicating transglycosylation activity. The ipeA gene was expressed in xylose and xyloglucan media and was strongly induced in the presence of xyloglucan endo-xyloglucanase-hydrolyzed products. This is the first study to report the identification of a gene encoding IPase in eukaryotes. PMID:26755723

Map-based cloning and characterization of Zea mays male sterility33 (ZmMs33) gene, encoding a glycerol-3-phosphate acyltransferase.

Science.gov (United States)

Xie, Ke; Wu, Suowei; Li, Ziwen; Zhou, Yan; Zhang, Danfeng; Dong, Zhenying; An, Xueli; Zhu, Taotao; Zhang, Simiao; Liu, Shuangshuang; Li, Jinping; Wan, Xiangyuan

2018-06-01

Map-based cloning of maize ms33 gene showed that ZmMs33 encodes a sn-2 glycerol-3-phosphate acyltransferase, the ortholog of rice OsGPAT3, and it is essential for male fertility in maize. Genetic male sterility has been widely studied for its biological significance and commercial value in hybrid seed production. Although many male-sterile mutants have been identified in maize (Zea mays L.), it is likely that most genes that cause male sterility are unknown. Here, we report a recessive genetic male-sterile mutant, male sterility33 (ms33), which displays small, pale yellow anthers, and complete male sterility. Using a map-based cloning approach, maize GRMZM2G070304 was identified as the ms33 gene (ZmMs33). ZmMs33 encodes a novel sn-2 glycerol-3-phosphate acyltransferase (GPAT) in maize. A functional complementation experiment showed that GRMZM2G070304 can rescue the male-sterile phenotype of the ms33-6029 mutant. GRMZM2G070304 was further confirmed to be the ms33 gene via targeted knockouts induced by the clustered regularly interspersed short palindromic repeats (CRISPR)/Cas9 system. ZmMs33 is preferentially expressed in the immature anther from the quartet to early-vacuolate microspore stages and in root tissues at the fifth leaf growth stage. Phylogenetic analysis indicated that ZmMs33 and OsGPAT3 are evolutionarily conserved for anther and pollen development in monocot species. This study reveals that the monocot-specific GPAT3 protein plays an important role in male fertility in maize, and ZmMs33 and mutants in this gene may have value in maize male-sterile line breeding and hybrid seed production.

[Divergence of paralogous growth-hormone-encoding genes and their promoters in Salmonidae].

Science.gov (United States)

Kamenskaya, D N; Pankova, M V; Atopkin, D M; Brykov, V A

2017-01-01

In many fish species, including salmonids, the growth-hormone is encoded by two duplicated paralogous genes, gh1 and gh2. Both genes were already in place at the time of divergence of species in this group. A comparison of the entire sequence of these genes of salmonids has shown that their conserved regions are associated with exons, while their most variable regions correspond to introns. Introns C and D include putative regulatory elements (sites Pit-1, CRE, and ERE), that are also conserved. In chars, the degree of polymorphism of gh2 gene is 2-3 times as large as that in gh1 gene. However, a comparison across all Salmonidae species would not extent this observation to other species. In both these chars' genes, the promoters are conserved mainly because they correspond to putative regulatory sequences (TATA box, binding sites for the pituitary transcription factor Pit-1 (F1-F4), CRE, GRE and RAR/RXR elements). The promoter of gh2 gene has a greater degree of polymorphism compared with gh1 gene promoter in all investigated species of salmonids. The observed differences in the rates of accumulation of changes in growth hormone encoding paralogs could be explained by differences in the intensity of selection.

RNAi-based silencing of genes encoding the vacuolar- ATPase ...

African Journals Online (AJOL)

RNAi-based silencing of genes encoding the vacuolar- ATPase subunits a and c in pink bollworm (Pectinophora gossypiella). Ahmed M. A. Mohammed. Abstract. RNA interference is a post- transcriptional gene regulation mechanism that is predominantly found in eukaryotic organisms. RNAi demonstrated a successful ...

Molecular characterization and expression analysis of three homoeologous Ta14S genes encoding 14-3-3 proteins in wheat (Triticum aestivum L.

Directory of Open Access Journals (Sweden)

Xinguo Wang

2016-06-01

Full Text Available The purpose of this study was to characterize Ta14S homoeologs and assess their functions in wheat seed development. The genomic and cDNA sequences of three Ta14S homoeologous genes encoding 14-3-3 proteins were isolated. Sequence analysis revealed that the three homoeologs consisted of five exons and four introns and were very highly conserved in the coding regions and in exon/intron structure, whereas the cDNA sequences were variable in the 5′ and 3′-UTR. The three genes, designated as Ta14S-2A, Ta14S-2B and Ta14S-2D, were located in homoeologous group 2 chromosomes. The polypeptide chains of the three Ta14S genes were highly similar. These genes were most homologous to Hv14A from barley. Real-time quantitative PCR indicated that the three Ta14S genes were differentially expressed in different organs at different developmental stages and all exhibited greater expression in primary roots of 1-day-old germlings than in other tissues. Comparison of the expression patterns of the three homoeologous genes at different times after pollination also revealed that their expression was developmentally regulated. The transcription of Ta14S-2B was clearly higher during seed germination, whereas expressions of Ta14S-2A and Ta14S-2D were up-regulated at the beginning of seed imbibition (0–12 h, but declined thereafter. The results suggested that the three Ta14S homoeologous genes have regulatory roles in seed development and germination.

Co-expression of an Erwinia chrysanthemi pectate lyase-encoding gene (pelE) and an E. carotovora polygalacturonase-encoding gene (peh1) in Saccharomyces cerevisiae.

Science.gov (United States)

Laing, E; Pretorius, I S

1993-05-01

A pectate lyase (PL)-encoding gene (pelE) from Erwinia chrysanthemi and a polygalacturonase (PG)-encoding gene (peh1) from E. carotovora were each inserted between a novel yeast expression-secretion cassette and a yeast gene terminator, and cloned separately into a yeast-centromeric shuttle vector (YCp50), generating recombinant plasmids pAMS12 and pAMS13. Transcription initiation signals present in the expression-secretion cassette were derived from the yeast alcohol dehydrogenase gene promoter (ADC1P), whereas the transcription termination signals were derived from the yeast tryptophan synthase gene terminator (TRP5T). Secretion of PL and PG was directed by the signal sequence of the yeast mating pheromone alpha-factor (MF alpha 1s). A pectinase cassette comprising ADC1P-MF alpha 1s-pelE-TRP5T and ADC1P-MF alpha 1s-peh1-TRP5T was subcloned into YCp50, generating plasmid pAMS14. Subsequently, the dominant selectable Geneticin G418-resistance (GtR) marker, APH1, inserted between the yeast uridine diphosphoglucose 4-epimerase gene promoter (GAL10P) and yeast orotidine-5'-phosphate carboxylase gene terminator (URA3T), was cloned into pAMS14, resulting in plasmid pAMS15. Plasmids pAMS12, pAMS13 and pAMS14 were transformed into a laboratory strain of Saccharomyces cerevisiae, whereas pAMS15 was stably introduced into two commercial wine yeast strains. DNA-DNA and DNA-RNA hybridization analyses revealed the presence of these plasmids, and the pelE and peh1 transcripts in the yeast transformants, respectively. A polypectate agarose assay indicated the extracellular production of biologically active PL and PG by the S. cerevisiae transformants and confirmed that co-expression of the pelE and peh1 genes synergistically enhanced pectate degradation.

Exome sequencing identifies variants in two genes encoding the LIM-proteins NRAP and FHL1 in an Italian patient with BAG3 myofibrillar myopathy.

Science.gov (United States)

D'Avila, Francesca; Meregalli, Mirella; Lupoli, Sara; Barcella, Matteo; Orro, Alessandro; De Santis, Francesca; Sitzia, Clementina; Farini, Andrea; D'Ursi, Pasqualina; Erratico, Silvia; Cristofani, Riccardo; Milanesi, Luciano; Braga, Daniele; Cusi, Daniele; Poletti, Angelo; Barlassina, Cristina; Torrente, Yvan

2016-06-01

Myofibrillar myopathies (MFMs) are genetically heterogeneous dystrophies characterized by the disintegration of Z-disks and myofibrils and are associated with mutations in genes encoding Z-disk or Z-disk-related proteins. The c.626 C > T (p.P209L) mutation in the BAG3 gene has been described as causative of a subtype of MFM. We report a sporadic case of a 26-year-old Italian woman, affected by MFM with axonal neuropathy, cardiomyopathy, rigid spine, who carries the c.626 C > T mutation in the BAG3 gene. The patient and her non-consanguineous healthy parents and brother were studied with whole exome sequencing (WES) to further investigate the genetic basis of this complex phenotype. In the patient, we found that the BAG3 mutation is associated with variants in the NRAP and FHL1 genes that encode muscle-specific, LIM domain containing proteins. Quantitative real time PCR, immunohistochemistry and Western blot analysis of the patient's muscular biopsy showed the absence of NRAP expression and FHL1 accumulation in aggregates in the affected skeletal muscle tissue. Molecular dynamic analysis of the mutated FHL1 domain showed a modification in its surface charge, which could affect its capability to bind its target proteins. To our knowledge this is the first study reporting, in a BAG3 MFM, the simultaneous presence of genetic variants in the BAG3 and FHL1 genes (previously described as independently associated with MFMs) and linking the NRAP gene to MFM for the first time.

Allelic Diversity and Geographical Distribution of the Gene Encoding Plasmodium falciparum Merozoite Surface Protein-3 in Thailand.

Science.gov (United States)

Sawaswong, Vorthon; Simpalipan, Phumin; Siripoon, Napaporn; Harnyuttanakorn, Pongchai; Pattaradilokrat, Sittiporn

2015-04-01

Merozoite surface proteins (MSPs) of malaria parasites play critical roles during the erythrocyte invasion and so are potential candidates for malaria vaccine development. However, because MSPs are often under strong immune selection, they can exhibit extensive genetic diversity. The gene encoding the merozoite surface protein-3 (MSP-3) of Plasmodium falciparum displays 2 allelic types, K1 and 3D7. In Thailand, the allelic frequency of the P. falciparum msp-3 gene was evaluated in a single P. falciparum population in Tak at the Thailand and Myanmar border. However, no study has yet looked at the extent of genetic diversity of the msp-3 gene in P. falciparum populations in other localities. Here, we genotyped the msp-3 alleles of 63 P. falciparum samples collected from 5 geographical populations along the borders of Thailand with 3 neighboring countries (Myanmar, Laos, and Cambodia). Our study indicated that the K1 and 3D7 alleles coexisted, but at different proportions in different Thai P. falciparum populations. K1 was more prevalent in populations at the Thailand-Myanmar and Thailand-Cambodia borders, whilst 3D7 was more prevalent at the Thailand-Laos border. Global analysis of the msp-3 allele frequencies revealed that proportions of K1 and 3D7 alleles of msp-3 also varied in different continents, suggesting the divergence of malaria parasite populations. In conclusion, the variation in the msp-3 allelic patterns of P. falciparum in Thailand provides fundamental knowledge for inferring the P. falciparum population structure and for the best design of msp-3 based malaria vaccines.

Molecular evolution of the Paramyxoviridae and Rhabdoviridae multiple-protein-encoding P gene.

Science.gov (United States)

Jordan, I K; Sutter, B A; McClure, M A

2000-01-01

Presented here is an analysis of the molecular evolutionary dynamics of the P gene among 76 representative sequences of the Paramyxoviridae and Rhabdoviridae RNA virus families. In a number of Paramyxoviridae taxa, as well as in vesicular stomatitis viruses of the Rhabdoviridae, the P gene encodes multiple proteins from a single genomic RNA sequence. These products include the phosphoprotein (P), as well as the C and V proteins. The complexity of the P gene makes it an intriguing locus to study from an evolutionary perspective. Amino acid sequence alignments of the proteins encoded at the P and N loci were used in independent phylogenetic reconstructions of the Paramyxoviridae and Rhabdoviridae families. P-gene-coding capacities were mapped onto the Paramyxoviridae phylogeny, and the most parsimonious path of multiple-coding-capacity evolution was determined. Levels of amino acid variation for Paramyxoviridae and Rhabdoviridae P-gene-encoded products were also analyzed. Proteins encoded in overlapping reading frames from the same nucleotides have different levels of amino acid variation. The nucleotide architecture that underlies the amino acid variation was determined in order to evaluate the role of selection in the evolution of the P gene overlapping reading frames. In every case, the evolution of one of the proteins encoded in the overlapping reading frames has been constrained by negative selection while the other has evolved more rapidly. The integrity of the overlapping reading frame that represents a derived state is generally maintained at the expense of the ancestral reading frame encoded by the same nucleotides. The evolution of such multicoding sequences is likely a response by RNA viruses to selective pressure to maximize genomic information content while maintaining small genome size. The ability to evolve such a complex genomic strategy is intimately related to the dynamics of the viral quasispecies, which allow enhanced exploration of the adaptive

Cloning, Expression Profiling and Functional Analysis of CnHMGS, a Gene Encoding 3-hydroxy-3-Methylglutaryl Coenzyme A Synthase from Chamaemelum nobile

Directory of Open Access Journals (Sweden)

Shuiyuan Cheng

2016-03-01

Full Text Available Roman chamomile (Chamaemelum nobile L. is renowned for its production of essential oils, which major components are sesquiterpenoids. As the important enzyme in the sesquiterpenoid biosynthesis pathway, 3-hydroxy-3-methylglutaryl coenzyme A synthase (HMGS catalyze the crucial step in the mevalonate pathway in plants. To isolate and identify the functional genes involved in the sesquiterpene biosynthesis of C. nobile L., a HMGS gene designated as CnHMGS (GenBank Accession No. KU529969 was cloned from C. nobile. The cDNA sequence of CnHMGS contained a 1377 bp open reading frame encoding a 458-amino-acid protein. The sequence of the CnHMGS protein was highly homologous to those of HMGS proteins from other plant species. Phylogenetic tree analysis revealed that CnHMGS clustered with the HMGS of Asteraceae in the dicotyledon clade. Further functional complementation of CnHMGS in the mutant yeast strain YSC6274 lacking HMGS activity demonstrated that the cloned CnHMGS cDNA encodes a functional HMGS. Transcript profile analysis indicated that CnHMGS was preferentially expressed in flowers and roots of C. nobile. The expression of CnHMGS could be upregulated by exogenous elicitors, including methyl jasmonate and salicylic acid, suggesting that CnHMGS was elicitor-responsive. The characterization and expression analysis of CnHMGS is helpful to understand the biosynthesis of sesquiterpenoid in C. nobile at the molecular level and also provides molecular wealth for the biotechnological improvement of this important medicinal plant.

Cloning, Expression Profiling and Functional Analysis of CnHMGS, a Gene Encoding 3-hydroxy-3-Methylglutaryl Coenzyme A Synthase from Chamaemelum nobile.

Science.gov (United States)

Cheng, Shuiyuan; Wang, Xiaohui; Xu, Feng; Chen, Qiangwen; Tao, Tingting; Lei, Jing; Zhang, Weiwei; Liao, Yongling; Chang, Jie; Li, Xingxiang

2016-03-08

Roman chamomile (Chamaemelum nobile L.) is renowned for its production of essential oils, which major components are sesquiterpenoids. As the important enzyme in the sesquiterpenoid biosynthesis pathway, 3-hydroxy-3-methylglutaryl coenzyme A synthase (HMGS) catalyze the crucial step in the mevalonate pathway in plants. To isolate and identify the functional genes involved in the sesquiterpene biosynthesis of C. nobile L., a HMGS gene designated as CnHMGS (GenBank Accession No. KU529969) was cloned from C. nobile. The cDNA sequence of CnHMGS contained a 1377 bp open reading frame encoding a 458-amino-acid protein. The sequence of the CnHMGS protein was highly homologous to those of HMGS proteins from other plant species. Phylogenetic tree analysis revealed that CnHMGS clustered with the HMGS of Asteraceae in the dicotyledon clade. Further functional complementation of CnHMGS in the mutant yeast strain YSC6274 lacking HMGS activity demonstrated that the cloned CnHMGS cDNA encodes a functional HMGS. Transcript profile analysis indicated that CnHMGS was preferentially expressed in flowers and roots of C. nobile. The expression of CnHMGS could be upregulated by exogenous elicitors, including methyl jasmonate and salicylic acid, suggesting that CnHMGS was elicitor-responsive. The characterization and expression analysis of CnHMGS is helpful to understand the biosynthesis of sesquiterpenoid in C. nobile at the molecular level and also provides molecular wealth for the biotechnological improvement of this important medicinal plant.

A highly divergent gene cluster in honey bees encodes a novel silk family.

Science.gov (United States)

Sutherland, Tara D; Campbell, Peter M; Weisman, Sarah; Trueman, Holly E; Sriskantha, Alagacone; Wanjura, Wolfgang J; Haritos, Victoria S

2006-11-01

The pupal cocoon of the domesticated silk moth Bombyx mori is the best known and most extensively studied insect silk. It is not widely known that Apis mellifera larvae also produce silk. We have used a combination of genomic and proteomic techniques to identify four honey bee fiber genes (AmelFibroin1-4) and two silk-associated genes (AmelSA1 and 2). The four fiber genes are small, comprise a single exon each, and are clustered on a short genomic region where the open reading frames are GC-rich amid low GC intergenic regions. The genes encode similar proteins that are highly helical and predicted to form unusually tight coiled coils. Despite the similarity in size, structure, and composition of the encoded proteins, the genes have low primary sequence identity. We propose that the four fiber genes have arisen from gene duplication events but have subsequently diverged significantly. The silk-associated genes encode proteins likely to act as a glue (AmelSA1) and involved in silk processing (AmelSA2). Although the silks of honey bees and silkmoths both originate in larval labial glands, the silk proteins are completely different in their primary, secondary, and tertiary structures as well as the genomic arrangement of the genes encoding them. This implies independent evolutionary origins for these functionally related proteins.

OVER-EXPRESSION OF GENE ENCODING FATTY ACID METABOLIC ENZYMES IN FISH

Directory of Open Access Journals (Sweden)

Alimuddin Alimuddin

2008-12-01

Full Text Available Eicosapentaenoic acid (EPA, 20:5n-3 and docosahexaenoic acid (DHA, 22:6n-3 have important nutritional benefits in humans. EPA and DHA are mainly derived from fish, but the decline in the stocks of major marine capture fishes could result in these fatty acids being consumed less. Farmed fish could serve as promising sources of EPA and DHA, but they need these fatty acids in their diets. Generation of fish strains that are capable of synthesizing enough amounts of EPA/DHA from the conversion of α-linolenic acid (LNA, 18:3n-3 rich oils can supply a new EPA/DHA source. This may be achieved by over-expression of genes encoding enzymes involved in HUFA biosynthesis. In aquaculture, the successful of this technique would open the possibility to reduce the enrichment of live food with fish oils for marine fish larvae, and to completely substitute fish oils with plant oils without reducing the quality of flesh in terms of EPA and DHA contents. Here, three genes, i.e. Δ6-desaturase-like (OmΔ6FAD, Δ5-desaturase-like (OmΔ5FAD and elongase-like (MELO encoding EPA/DHA metabolic enzymes derived from masu salmon (Oncorhynchus masou were individually transferred into zebrafish (Danio rerio as a model to increase its ability for synthesizing EPA and DHA. Fatty acid analysis showed that EPA content in whole body of the second transgenic fish generation over-expressing OmΔ6FAD gene was 1.4 fold and that of DHA was 2.1 fold higher (P<0.05 than those in non-transgenic fish. The EPA content in whole body of transgenic fish over-expressing OmΔ5FAD gene was 1.21-fold, and that of DHA was 1.24-fold higher (P<0.05 than those in nontransgenic fish. The same patterns were obtained in transgenic fish over-expressing MELO gene. EPA content was increased by 1.30-fold and DHA content by 1.33-fold higher (P<0.05 than those in non-transgenic fish. The results of studies demonstrated that fatty acid content of fish can be enhanced by over

Two Genes Encoding Uracil Phosphoribosyltransferase Are Present in Bacillus subtilis

DEFF Research Database (Denmark)

Martinussen, Jan; Glaser, Philippe; Andersen, Paal S.

1995-01-01

Uracil phosphoribosyltransferase (UPRTase) catalyzes the key reaction in the salvage of uracil in many microorganisms. Surprisingly, two genes encoding UPRTase activity were cloned from Bacillus subtilis by complementation of an Escherichia coli mutant. The genes were sequenced, and the putative...

Escherichia coli rpiA gene encoding ribose phosphate isomerase A

DEFF Research Database (Denmark)

Hove-Jensen, Bjarne; Maigaard, Marianne

1993-01-01

The rpiA gene encoding ribose phosphate isomerase A was cloned from phage 1A2(471) of the Kohara gene library. Subcloning, restriction, and complementation analyses revealed an 1,800-bp SspI-generated DNA fragment that contained the entire control and coding sequences. This DNA fragment was seque......The rpiA gene encoding ribose phosphate isomerase A was cloned from phage 1A2(471) of the Kohara gene library. Subcloning, restriction, and complementation analyses revealed an 1,800-bp SspI-generated DNA fragment that contained the entire control and coding sequences. This DNA fragment...

The porcine lymphotropic herpesvirus 1 encodes functional regulators of gene expression

International Nuclear Information System (INIS)

Lindner, I.; Ehlers, B.; Noack, S.; Dural, G.; Yasmum, N.; Bauer, C.; Goltz, M.

2007-01-01

The porcine lymphotropic herpesviruses (PLHV) are discussed as possible risk factors in xenotransplantation because of the high prevalence of PLHV-1, PLHV-2 and PLHV-3 in pig populations world-wide and the fact that PLHV-1 has been found to be associated with porcine post-transplant lymphoproliferative disease. To provide structural and functional knowledge on the PLHV immediate-early (IE) transactivator genes, the central regions of the PLHV genomes were characterized by genome walking, sequence and splicing analysis. Three spliced genes were identified (ORF50, ORFA6/BZLF1 h , ORF57) encoding putative IE transactivators, homologous to (i) ORF50 and BRLF1/Rta (ii) K8/K-bZIP and BZLF1/Zta and (iii) ORF57 and BMLF1 of HHV-8 and EBV, respectively. Expressed as myc-tag or HA-tag fusion proteins, they were located to the cellular nucleus. In reporter gene assays, several PLHV-promoters were mainly activated by PLHV-1 ORF50, to a lower level by PLHV-1 ORFA6/BZLF1 h and not by PLHV-1 ORF57. However, the ORF57-encoded protein acted synergistically on ORF50-mediated activation

Effects of deoxycycline induced lentivirus encoding FasL gene on ...

African Journals Online (AJOL)

Abstract. Fas/Fas ligand (FasL)-mediated apoptosis plays a critical role in deletion of activated T cells. This study aimed to construct the lentivirus encoding FasL gene induced by deoxycycline and evaluate its effects on apoptosis of Th1 cells. A plasmid expression system encoding FasL was constructed through utilizing the ...

AIB1 gene amplification and the instability of polyQ encoding sequence in breast cancer cell lines

Directory of Open Access Journals (Sweden)

Clarke Robert

2006-05-01

Full Text Available Abstract Background The poly Q polymorphism in AIB1 (amplified in breast cancer gene is usually assessed by fragment length analysis which does not reveal the actual sequence variation. The purpose of this study is to investigate the sequence variation of poly Q encoding region in breast cancer cell lines at single molecule level, and to determine if the sequence variation is related to AIB1 gene amplification. Methods The polymorphic poly Q encoding region of AIB1 gene was investigated at the single molecule level by PCR cloning/sequencing. The amplification of AIB1 gene in various breast cancer cell lines were studied by real-time quantitative PCR. Results Significant amplifications (5–23 folds of AIB1 gene were found in 2 out of 9 (22% ER positive cell lines (in BT-474 and MCF-7 but not in BT-20, ZR-75-1, T47D, BT483, MDA-MB-361, MDA-MB-468 and MDA-MB-330. The AIB1 gene was not amplified in any of the ER negative cell lines. Different passages of MCF-7 cell lines and their derivatives maintained the feature of AIB1 amplification. When the cells were selected for hormone independence (LCC1 and resistance to 4-hydroxy tamoxifen (4-OH TAM (LCC2 and R27, ICI 182,780 (LCC9 or 4-OH TAM, KEO and LY 117018 (LY-2, AIB1 copy number decreased but still remained highly amplified. Sequencing analysis of poly Q encoding region of AIB1 gene did not reveal specific patterns that could be correlated with AIB1 gene amplification. However, about 72% of the breast cancer cell lines had at least one under represented (3CAA(CAG9(CAACAG3(CAACAGCAG2CAA of the original cell line, a number of altered poly Q encoding sequences were found in the derivatives of MCF-7 cell lines. Conclusion These data suggest that poly Q encoding region of AIB1 gene is somatic unstable in breast cancer cell lines. The instability and the sequence characteristics, however, do not appear to be associated with the level of the gene amplification.

Expression-based clustering of CAZyme-encoding genes of Aspergillus niger.

Science.gov (United States)

Gruben, Birgit S; Mäkelä, Miia R; Kowalczyk, Joanna E; Zhou, Miaomiao; Benoit-Gelber, Isabelle; De Vries, Ronald P

2017-11-23

The Aspergillus niger genome contains a large repertoire of genes encoding carbohydrate active enzymes (CAZymes) that are targeted to plant polysaccharide degradation enabling A. niger to grow on a wide range of plant biomass substrates. Which genes need to be activated in certain environmental conditions depends on the composition of the available substrate. Previous studies have demonstrated the involvement of a number of transcriptional regulators in plant biomass degradation and have identified sets of target genes for each regulator. In this study, a broad transcriptional analysis was performed of the A. niger genes encoding (putative) plant polysaccharide degrading enzymes. Microarray data focusing on the initial response of A. niger to the presence of plant biomass related carbon sources were analyzed of a wild-type strain N402 that was grown on a large range of carbon sources and of the regulatory mutant strains ΔxlnR, ΔaraR, ΔamyR, ΔrhaR and ΔgalX that were grown on their specific inducing compounds. The cluster analysis of the expression data revealed several groups of co-regulated genes, which goes beyond the traditionally described co-regulated gene sets. Additional putative target genes of the selected regulators were identified, based on their expression profile. Notably, in several cases the expression profile puts questions on the function assignment of uncharacterized genes that was based on homology searches, highlighting the need for more extensive biochemical studies into the substrate specificity of enzymes encoded by these non-characterized genes. The data also revealed sets of genes that were upregulated in the regulatory mutants, suggesting interaction between the regulatory systems and a therefore even more complex overall regulatory network than has been reported so far. Expression profiling on a large number of substrates provides better insight in the complex regulatory systems that drive the conversion of plant biomass by fungi. In

Cloning and characterization of an epoxide hydrolase-encoding gene from Rhodotorula glutinis

NARCIS (Netherlands)

Visser, H.; Vreugdenhil, S.; Bont, de J.A.M.; Verdoes, J.C.

2000-01-01

We cloned and characterized the epoxide hydrolase gene, EPH1, from Rhodotorula glutinis. The EPH1 open reading frame of 1230 bp was interrupted by nine introns and encoded a polypeptide of 409 amino acids with a calculated molecular mass of 46.3 kDa. The amino acid sequence was similar to that of

Selenium Pretreatment Alleviated LPS-Induced Immunological Stress Via Upregulation of Several Selenoprotein Encoding Genes in Murine RAW264.7 Cells.

Science.gov (United States)

Wang, Longqiong; Jing, Jinzhong; Yan, Hui; Tang, Jiayong; Jia, Gang; Liu, Guangmang; Chen, Xiaoling; Tian, Gang; Cai, Jingyi; Shang, Haiying; Zhao, Hua

2018-04-18

This study was conducted to profile selenoprotein encoding genes in mouse RAW264.7 cells upon lipopolysaccharide (LPS) challenge and integrate their roles into immunological regulation in response to selenium (Se) pretreatment. LPS was used to develop immunological stress in macrophages. Cells were pretreated with different levels of Se (0, 0.5, 1.0, 1.5, 2.0 μmol Se/L) for 2 h, followed by LPS (100 ng/mL) stimulation for another 3 h. The mRNA expression of 24 selenoprotein encoding genes and 9 inflammation-related genes were investigated. The results showed that LPS (100 ng/mL) effectively induced immunological stress in RAW264.7 cells with induced inflammation cytokines, IL-6 and TNF-α, mRNA expression, and cellular secretion. LPS increased (P immunological stress in RAW264.7 cells accompanied with the global downregulation of selenoprotein encoding genes and Se pretreatment alleviated immunological stress via upregulation of a subset of selenoprotein encoding genes.

Characterization of Urtica dioica agglutinin isolectins and the encoding gene family.

Science.gov (United States)

Does, M P; Ng, D K; Dekker, H L; Peumans, W J; Houterman, P M; Van Damme, E J; Cornelissen, B J

1999-01-01

Urtica dioica agglutinin (UDA) has previously been found in roots and rhizomes of stinging nettles as a mixture of UDA-isolectins. Protein and cDNA sequencing have shown that mature UDA is composed of two hevein domains and is processed from a precursor protein. The precursor contains a signal peptide, two in-tandem hevein domains, a hinge region and a carboxyl-terminal chitinase domain. Genomic fragments encoding precursors for UDA-isolectins have been amplified by five independent polymerase chain reactions on genomic DNA from stinging nettle ecotype Weerselo. One amplified gene was completely sequenced. As compared to the published cDNA sequence, the genomic sequence contains, besides two basepair substitutions, two introns located at the same positions as in other plant chitinases. By partial sequence analysis of 40 amplified genes, 16 different genes were identified which encode seven putative UDA-isolectins. The deduced amino acid sequences share 78.9-98.9% identity. In extracts of roots and rhizomes of stinging nettle ecotype Weerselo six out of these seven isolectins were detected by mass spectrometry. One of them is an acidic form, which has not been identified before. Our results demonstrate that UDA is encoded by a large gene family.

Escherichia coli yjjPB genes encode a succinate transporter important for succinate production.

Science.gov (United States)

Fukui, Keita; Nanatani, Kei; Hara, Yoshihiko; Yamakami, Suguru; Yahagi, Daiki; Chinen, Akito; Tokura, Mitsunori; Abe, Keietsu

2017-09-01

Under anaerobic conditions, Escherichia coli produces succinate from glucose via the reductive tricarboxylic acid cycle. To date, however, no genes encoding succinate exporters have been established in E. coli. Therefore, we attempted to identify genes encoding succinate exporters by screening an E. coli MG1655 genome library. We identified the yjjPB genes as candidates encoding a succinate transporter, which enhanced succinate production in Pantoea ananatis under aerobic conditions. A complementation assay conducted in Corynebacterium glutamicum strain AJ110655ΔsucE1 demonstrated that both YjjP and YjjB are required for the restoration of succinate production. Furthermore, deletion of yjjPB decreased succinate production in E. coli by 70% under anaerobic conditions. Taken together, these results suggest that YjjPB constitutes a succinate transporter in E. coli and that the products of both genes are required for succinate export.

Silencing of the major family of NBS-LRR-encoding genes in lettuce results in the loss of multiple resistance specificities.

Science.gov (United States)

Wroblewski, Tadeusz; Piskurewicz, Urszula; Tomczak, Anna; Ochoa, Oswaldo; Michelmore, Richard W

2007-09-01

The RGC2 gene cluster in lettuce (Lactuca sativa) is one of the largest known families of genes encoding nucleotide binding site-leucine-rich repeat (NBS-LRR) proteins. One of its members, RGC2B, encodes Dm3 which determines resistance to downy mildew caused by the oomycete Bremia lactucae carrying the cognate avirulence gene, Avr3. We developed an efficient strategy for analysis of this large family of low expressed genes using post-transcriptional gene silencing (PTGS). We transformed lettuce cv. Diana (carrying Dm3) using chimeric gene constructs designed to simultaneously silence RGC2B and the GUS reporter gene via the production of interfering hairpin RNA (ihpRNA). Transient assays of GUS expression in leaves accurately predicted silencing of both genes and were subsequently used to assay silencing in transgenic T(1) plants and their offspring. Levels of mRNA were reduced not only for RGC2B but also for all seven diverse RGC2 family members tested. We then used the same strategy to show that the resistance specificity encoded by the genetically defined Dm18 locus in lettuce cv. Mariska is the result of two resistance specificities, only one of which was silenced by ihpRNA derived from RGC2B. Analysis of progeny from crosses between transgenic, silenced tester stocks and lettuce accessions carrying other resistance genes previously mapped to the RGC2 locus indicated that two additional resistance specificities to B. lactucae, Dm14 and Dm16, as well as resistance to lettuce root aphid (Pemphigus bursarius L.), Ra, are encoded by RGC2 family members.

Cloning, expression and characterisation of a novel gene encoding ...

African Journals Online (AJOL)

微软用户

2012-01-12

Jan 12, 2012 ... ... characterisation of a novel gene encoding a chemosensory protein from Bemisia ... The genomic DNA sequence comparisons revealed a 1490 bp intron ... have several conserved sequence motifs, including the. N-terminal ...

Composition and expression of genes encoding carbohydrate-active enzymes in the straw-degrading mushroom Volvariella volvacea.

Directory of Open Access Journals (Sweden)

Bingzhi Chen

Full Text Available Volvariella volvacea is one of a few commercial cultivated mushrooms mainly using straw as carbon source. In this study, the genome of V. volcacea was sequenced and assembled. A total of 285 genes encoding carbohydrate-active enzymes (CAZymes in V. volvacea were identified and annotated. Among 15 fungi with sequenced genomes, V. volvacea ranks seventh in the number of genes encoding CAZymes. In addition, the composition of glycoside hydrolases in V. volcacea is dramatically different from other basidiomycetes: it is particularly rich in members of the glycoside hydrolase families GH10 (hemicellulose degradation and GH43 (hemicellulose and pectin degradation, and the lyase families PL1, PL3 and PL4 (pectin degradation but lacks families GH5b, GH11, GH26, GH62, GH93, GH115, GH105, GH9, GH53, GH32, GH74 and CE12. Analysis of genome-wide gene expression profiles of 3 strains using 3'-tag digital gene expression (DGE reveals that 239 CAZyme genes were expressed even in potato destrose broth medium. Our data also showed that the formation of a heterokaryotic strain could dramatically increase the expression of a number of genes which were poorly expressed in its parental homokaryotic strains.

The mitochondrial gene encoding ribosomal protein S12 has been translocated to the nuclear genome in Oenothera.

Science.gov (United States)

Grohmann, L; Brennicke, A; Schuster, W

1992-01-01

The Oenothera mitochondrial genome contains only a gene fragment for ribosomal protein S12 (rps12), while other plants encode a functional gene in the mitochondrion. The complete Oenothera rps12 gene is located in the nucleus. The transit sequence necessary to target this protein to the mitochondrion is encoded by a 5'-extension of the open reading frame. Comparison of the amino acid sequence encoded by the nuclear gene with the polypeptides encoded by edited mitochondrial cDNA and genomic sequences of other plants suggests that gene transfer between mitochondrion and nucleus started from edited mitochondrial RNA molecules. Mechanisms and requirements of gene transfer and activation are discussed. Images PMID:1454526

The presence of two S-layer-protein-encoding genes is conserved among species related to Lactobacillus acidophilus

NARCIS (Netherlands)

Boot, H.J.; Kolen, C.P.A.M.; Pot, B.; Kersters, K.; Pouwels, P.H.

1996-01-01

Previously we have shown that the type strain of Lactobacillus acidophilus possesses two S-protein-encoding genes, one of which is silent, on a chromosomal segment of 6 kb. The S-protein-encoding gene in the expression site can be exchanged for the silent S-protein-encoding gene by inversion of this

The pyrH gene of Lactococcus lactis subsp. cremoris encoding UMP kinase is transcribed as part of an operon including the frr1 gene encoding ribosomal recycling factor

DEFF Research Database (Denmark)

Wadskov-Hansen, Steen Lüders; Martinussen, Jan; Hammer, Karin

2000-01-01

establishing the ability of the encoded protein to synthesize UDP. The pyrH gene in L. lactis is flanked downstream by frr1 encoding ribosomal recycling factor 1 and upstream by an open reading frame, orfA, of unknown function. The three genes were shown to constitute an operon transcribed in the direction orf......A-pyrH-frr1 from a promoter immediately in front of orfA. This operon belongs to an evolutionary highly conserved gene cluster, since the organization of pyrH on the chromosomal level in L. lactis shows a high resemblance to that found in Bacillus subtilis as well as in Escherichia coli and several other...

Effects of TCDD on the expression of nuclear encoded mitochondrial genes

International Nuclear Information System (INIS)

Forgacs, Agnes L.; Burgoon, Lyle D.; Lynn, Scott G.; LaPres, John J.; Zacharewski, Timothy

2010-01-01

Generation of mitochondrial reactive oxygen species (ROS) can be perturbed following exposure to environmental chemicals such as 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD). Reports indicate that the aryl hydrocarbon receptor (AhR) mediates TCDD-induced sustained hepatic oxidative stress by decreasing hepatic ATP levels and through hyperpolarization of the inner mitochondrial membrane. To further elucidate the effects of TCDD on the mitochondria, high-throughput quantitative real-time PCR (HTP-QRTPCR) was used to evaluate the expression of 90 nuclear genes encoding mitochondrial proteins involved in electron transport, oxidative phosphorylation, uncoupling, and associated chaperones. HTP-QRTPCR analysis of time course (30 μg/kg TCDD at 2, 4, 8, 12, 18, 24, 72, and 168 h) liver samples obtained from orally gavaged immature, ovariectomized C57BL/6 mice identified 54 differentially expressed genes (|fold change| > 1.5 and P-value < 0.1). Of these, 8 exhibited a sigmoidal or exponential dose-response profile (0.03 to 300 μg/kg TCDD) at 4, 24 or 72 h. Dose-responsive genes encoded proteins associated with electron transport chain (ETC) complexes I (NADH dehydrogenase), III (cytochrome c reductase), IV (cytochrome c oxidase), and V (ATP synthase) and could be generally categorized as having proton gradient, ATP synthesis, and chaperone activities. In contrast, transcript levels of ETC complex II, succinate dehydrogenase, remained unchanged. Putative dioxin response elements were computationally found in the promoter regions of all 8 dose-responsive genes. This high-throughput approach suggests that TCDD alters the expression of genes associated with mitochondrial function which may contribute to TCDD-elicited mitochondrial toxicity.

Nucleotide sequences of two genomic DNAs encoding peroxidase of Arabidopsis thaliana.

Science.gov (United States)

Intapruk, C; Higashimura, N; Yamamoto, K; Okada, N; Shinmyo, A; Takano, M

1991-02-15

The peroxidase (EC 1.11.1.7)-encoding gene of Arabidopsis thaliana was screened from a genomic library using a cDNA encoding a neutral isozyme of horseradish, Armoracia rusticana, peroxidase (HRP) as a probe, and two positive clones were isolated. From the comparison with the sequences of the HRP-encoding genes, we concluded that two clones contained peroxidase-encoding genes, and they were named prxCa and prxEa. Both genes consisted of four exons and three introns; the introns had consensus nucleotides, GT and AG, at the 5' and 3' ends, respectively. The lengths of each putative exon of the prxEa gene were the same as those of the HRP-basic-isozyme-encoding gene, prxC3, and coded for 349 amino acids (aa) with a sequence homology of 89% to that encoded by prxC3. The prxCa gene was very close to the HRP-neutral-isozyme-encoding gene, prxC1b, and coded for 354 aa with 91% homology to that encoded by prxC1b. The aa sequence homology was 64% between the two peroxidases encoded by prxCa and prxEa.

Bacteriophage-encoded shiga toxin gene in atypical bacterial host

Directory of Open Access Journals (Sweden)

Casas Veronica

2011-07-01

Full Text Available Abstract Background Contamination from fecal bacteria in recreational waters is a major health concern since bacteria capable of causing human disease can be found in animal feces. The Dog Beach area of Ocean Beach in San Diego, California is a beach prone to closures due to high levels of fecal indicator bacteria (FIB. A potential source of these FIB could be the canine feces left behind by owners who do not clean up after their pets. We tested this hypothesis by screening the DNA isolated from canine feces for the bacteriophage-encoded stx gene normally found in the virulent strains of the fecal bacterium Escherichia coli. Results Twenty canine fecal samples were collected, processed for total and bacterial fraction DNA, and screened by PCR for the stx gene. The stx gene was detected in the total and bacterial fraction DNA of one fecal sample. Bacterial isolates were then cultivated from the stx-positive fecal sample. Eighty nine of these canine fecal bacterial isolates were screened by PCR for the stx gene. The stx gene was detected in five of these isolates. Sequencing and phylogenetic analyses of 16S rRNA gene PCR products from the canine fecal bacterial isolates indicated that they were Enterococcus and not E. coli. Conclusions The bacteriophage-encoded stx gene was found in multiple species of bacteria cultivated from canine fecal samples gathered at the shoreline of the Dog Beach area of Ocean Beach in San Diego, California. The canine fecal bacteria carrying the stx gene were not the typical E. coli host and were instead identified through phylogenetic analyses as Enterococcus. This suggests a large degree of horizontal gene transfer of exotoxin genes in recreational waters.

Identification and characterization of a gene encoding a putative ...

Indian Academy of Sciences (India)

2012-10-30

Oct 30, 2012 ... Genetic Improvement of Oil Crops, Ministry of Agriculture, Wuhan 430062, China. 2Institute of ... Its encoding gene is an essential candidate for oil crops to .... higher level in leaves than in other organs (Kim and Huang. 2004) ...

Screening of the Enterocin-Encoding Genes and Antimicrobial Activity in Enterococcus Species.

Science.gov (United States)

Ogaki, Mayara Baptistucci; Rocha, Katia Real; Terra, MÁrcia Regina; Furlaneto, MÁrcia Cristina; Maia, Luciana Furlaneto

2016-06-28

In the current study, a total of 135 enterococci strains from different sources were screened for the presence of the enterocin-encoding genes entA, entP, entB, entL50A, and entL50B. The enterocin genes were present at different frequencies, with entA occurring the most frequently, followed by entP and entB; entL50A and L50B were not detected. The occurrence of single enterocin genes was higher than the occurrence of multiple enterocin gene combinations. The 80 isolates that harbor at least one enterocin-encoding gene (denoted "Gene(+) strains") were screened for antimicrobial activity. A total of 82.5% of the Gene(+) strains inhibited at least one of the indicator strains, and the isolates harboring multiple enterocin-encoding genes inhibited a larger number of indicator strains than isolates harboring a single gene. The indicator strains that exhibited growth inhibition included Listeria innocua strain CLIP 12612 (ATCC BAA-680), Listeria monocytogenes strain CDC 4555, Enterococcus faecalis ATCC 29212, Staphylococcus aureus ATCC 25923, S. aureus ATCC 29213, S. aureus ATCC 6538, Salmonella enteritidis ATCC 13076, Salmonella typhimurium strain UK-1 (ATCC 68169), and Escherichia coli BAC 49LT ETEC. Inhibition due to either bacteriophage lysis or cytolysin activity was excluded. The growth inhibition of antilisterial Gene+ strains was further tested under different culture conditions. Among the culture media formulations, the MRS agar medium supplemented with 2% (w/v) yeast extract was the best solidified medium for enterocin production. Our findings extend the current knowledge of enterocin-producing enterococci, which may have potential applications as biopreservatives in the food industry due to their capability of controlling food spoilage pathogens.

Distribution of non-LEE-encoded type 3 secretion system dependent effectors in enteropathogenic Escherichia coli

Directory of Open Access Journals (Sweden)

Fábia A. Salvador

2014-09-01

Full Text Available Enteropathogenic Escherichia coli (EPEC are important human gastroenteritis agents. The prevalence of six non-LEE genes encoding type 3 translocated effectors was investigated. The nleC, cif and nleB genes were more prevalent in typical than in atypical EPEC, although a higher diversity of genes combinations was observed in atypical EPEC.

Transcriptional modulation of genes encoding nitrate reductase in ...

African Journals Online (AJOL)

The free aluminum (Al) content in soil can reach levels that are toxic to plants, and this has frequently limited increased productivity of cultures. Four genes encoding nitrate reductase (NR) were identified, named ZmNR1–4. With the aim of evaluating NR activity and the transcriptional modulation of the ZmNR1, ZmNR2, ...

Evidence for the bacterial origin of genes encoding fermentation enzymes of the amitochondriate protozoan parasite Entamoeba histolytica.

Science.gov (United States)

Rosenthal, B; Mai, Z; Caplivski, D; Ghosh, S; de la Vega, H; Graf, T; Samuelson, J

1997-06-01

Entamoeba histolytica is an amitochondriate protozoan parasite with numerous bacterium-like fermentation enzymes including the pyruvate:ferredoxin oxidoreductase (POR), ferredoxin (FD), and alcohol dehydrogenase E (ADHE). The goal of this study was to determine whether the genes encoding these cytosolic E. histolytica fermentation enzymes might derive from a bacterium by horizontal transfer, as has previously been suggested for E. histolytica genes encoding heat shock protein 60, nicotinamide nucleotide transhydrogenase, and superoxide dismutase. In this study, the E. histolytica por gene and the adhE gene of a second amitochondriate protozoan parasite, Giardia lamblia, were sequenced, and their phylogenetic positions were estimated in relation to POR, ADHE, and FD cloned from eukaryotic and eubacterial organisms. The E. histolytica por gene encodes a 1,620-amino-acid peptide that contained conserved iron-sulfur- and thiamine pyrophosphate-binding sites. The predicted E. histolytica POR showed fewer positional identities to the POR of G. lamblia (34%) than to the POR of the enterobacterium Klebsiella pneumoniae (49%), the cyanobacterium Anabaena sp. (44%), and the protozoan Trichomonas vaginalis (46%), which targets its POR to anaerobic organelles called hydrogenosomes. Maximum-likelihood, neighbor-joining, and parsimony analyses also suggested as less likely E. histolytica POR sharing more recent common ancestry with G. lamblia POR than with POR of bacteria and the T. vaginalis hydrogenosome. The G. lamblia adhE encodes an 888-amino-acid fusion peptide with an aldehyde dehydrogenase at its amino half and an iron-dependent (class 3) ADH at its carboxy half. The predicted G. lamblia ADHE showed extensive positional identities to ADHE of Escherichia coli (49%), Clostridium acetobutylicum (44%), and E. histolytica (43%) and lesser identities to the class 3 ADH of eubacteria and yeast (19 to 36%). Phylogenetic analyses inferred a closer relationship of the E

Gene set of nuclear-encoded mitochondrial regulators is enriched for common inherited variation in obesity.

Directory of Open Access Journals (Sweden)

Nadja Knoll

Full Text Available There are hints of an altered mitochondrial function in obesity. Nuclear-encoded genes are relevant for mitochondrial function (3 gene sets of known relevant pathways: (1 16 nuclear regulators of mitochondrial genes, (2 91 genes for oxidative phosphorylation and (3 966 nuclear-encoded mitochondrial genes. Gene set enrichment analysis (GSEA showed no association with type 2 diabetes mellitus in these gene sets. Here we performed a GSEA for the same gene sets for obesity. Genome wide association study (GWAS data from a case-control approach on 453 extremely obese children and adolescents and 435 lean adult controls were used for GSEA. For independent confirmation, we analyzed 705 obesity GWAS trios (extremely obese child and both biological parents and a population-based GWAS sample (KORA F4, n = 1,743. A meta-analysis was performed on all three samples. In each sample, the distribution of significance levels between the respective gene set and those of all genes was compared using the leading-edge-fraction-comparison test (cut-offs between the 50(th and 95(th percentile of the set of all gene-wise corrected p-values as implemented in the MAGENTA software. In the case-control sample, significant enrichment of associations with obesity was observed above the 50(th percentile for the set of the 16 nuclear regulators of mitochondrial genes (p(GSEA,50 = 0.0103. This finding was not confirmed in the trios (p(GSEA,50 = 0.5991, but in KORA (p(GSEA,50 = 0.0398. The meta-analysis again indicated a trend for enrichment (p(MAGENTA,50 = 0.1052, p(MAGENTA,75 = 0.0251. The GSEA revealed that weak association signals for obesity might be enriched in the gene set of 16 nuclear regulators of mitochondrial genes.

CHARACTERIZATION OF 0.58 kb DNA STILBENE SYNTHASE ENCODING GENE FRAGMENT FROM MELINJO PLANT (Gnetum gnemon

Directory of Open Access Journals (Sweden)

Tri Joko Raharjo

2011-12-01

Full Text Available Resveratrol is a potent anticancer agent resulted as the main product of enzymatic reaction between common precursor in plants and Stilbene Synthase enzyme, which is expressed by sts gene. Characterization of internal fragment of Stilbene Synthase (STS encoding gene from melinjo plant (Gnetum gnemon L. has been carried out as part of a larger work to obtain a full length of Stilbene Synthase encoding gene of the plant. RT-PCR (Reverse Transcriptase Polymerase Chain Reaction was performed using two degenerated primers to amplify the gene fragment. Ten published STS conserved amino acid sequences from various plant species from genebank were utilized to construct a pair of GGF2 (5' GTTCCACCTGCGAAGCAGCC 3' and GGR2 (5' CTGGATCGCACATCC TGGTG 3' primers. Both designed primers were predicted to be in the position of 334-354 and 897-916 kb of the gene respectively. Total RNA isolated from melinjo leaves was used as template for the RT-PCR amplification process using two-step technique. A collection of 0.58 DNA fragments was generated from RT-PCR amplification and met the expected results. The obtained DNA fragments were subsequently isolated, refined and sequenced. A nucleotide sequence analysis was accomplished by comparing it to the existed sts genes available in genebank. Homology analysis of the DNA fragments with Arachis hypogaea L00952 sts gene showed high similarity level. Taken together, the results are evidence that the amplified fragment obtained in this study is part of melinjo sts gene

RNAi-based silencing of genes encoding the vacuolar- ATPase ...

African Journals Online (AJOL)

2016-11-09

Nov 9, 2016 ... Spodoptera exigua larval development by silencing chitin synthase gene with RNA interference. Bull. Entomol. Res. 98:613-619. Dow JAT (1999). The Multifunctional Drosophila melanogaster V-. ATPase is encoded by a multigene family. J. Bioenerg. Biomembr. 31:75-83. Fire A, Xu SQ, Montgomery MK, ...

Distribution and biosynthesis of flavan-3-ols in Camellia sinensis seedlings and expression of genes encoding biosynthetic enzymes.

Science.gov (United States)

Ashihara, Hiroshi; Deng, Wei-Wei; Mullen, William; Crozier, Alan

2010-04-01

The distribution of phenolic compounds in young and developing leaves, stems, main and lateral roots and cotyledons of 8-week-old tea (Camellia sinensis) seedlings was investigated using HPLC-MS(2). Fourteen compounds, flavan-3-ols, chlorogenic acids, and kaempferol-O-glycosides, were identified on the basis of their retention time, absorbance spectrum, and MS fragmentation pattern. The major phenolics were (-)-epigallocatechin-3-O-gallate and (-)-epicatechin-3-O-gallate, located principally in the green parts of the seedlings. Considerable amounts of radioactivity from [ring-(14)C]phenylalanine were incorporated in (-)-epicatechin, (-)-epigallocatechin, (-)-epicatechin-3-O-gallate and (-)-epigallocatechin-3-O-gallate, by tissues of young and developing leaves and stems. Expression of genes encoding enzymes involved in flavan-3-ol biosynthesis, CHS, CHI, F3H, F3'5'H, DFR, ANS, ANR and LAR was investigated. Transcripts of all genes, except LAR, were more abundant in leaves and stems than in roots and cotyledons. No significant difference was found in the amount of transcript of LAR. These findings indicate that in tea seedlings flavan-3-ols are produced by a naringenin-chalcone-->naringenin-->dihydrokaempferol pathway. Dihydrokaempferol is a branch point in the synthesis of (-)-epigallocatechin-3-O-gallate and other flavan-3-ols which can be formed by routes beginning with either a flavonoid 3'-hydroxylase mediated conversion of the flavonol to dihydroquercetin or a flavonoid 3',5'-hydroxylase-catalysed conversion to dihydromyricetin with subsequent steps involving sequential reactions catalysed by dihydroflavanol 4-reductase, anthocyanidin synthase, anthocyanidin reductase and flavan-3-ol gallate synthase. Copyright 2010 Elsevier Ltd. All rights reserved.

RAD6 gene of Saccharomyces cerevisiae encodes a protein containing a tract of 13 consecutive aspartates

International Nuclear Information System (INIS)

Reynolds, P.; Weber, S.; Prakash, L.

1985-01-01

The RAD6 gene of Saccharomyces cerevisiae is required for postreplication repair of UV-damaged DNA, for induced mutagenesis, and for sporulation. The authors have mapped the transcripts and determined the nucleotide sequence of the cloned RAD6 gene. The RAD6 gene encodes two transcripts of 0.98 and 0.86 kilobases which differ only in their 3' termini. The transcribed region contains an open reading frame of 516 nucleotides. The rad6-1 and rad6-3 mutant alleles, which the authors have cloned and sequenced, introduce amber and ochre nonsense mutations, respectively into the open reading frame, proving that it encodes the RAD6 protein. The RAD6 protein predicted by the nucleotide sequence is 172 amino acids long, has a molecular weight of 19,704, and contains 23.3% acidic and 11.6% basic residues. Its most striking feature is the highly acidic carboxyl terminus: 20 of the 23 terminal amino acids are acidic, including 13 consecutive aspartates. RAD6 protein thus resembles high mobility group proteins HMG-1 and HMG-2, which each contain a carboxyl-proximal tract of acidic amino acids. 48 references, 6 figures

Identification of Genes Encoding the Folate- and Thiamine-Binding Membrane Proteins in Firmicutes

NARCIS (Netherlands)

Eudes, Aymerick; Erkens, Guus B.; Slotboom, Dirk J.; Rodionov, Dmitry A.; Naponelli, Valeria; Hanson, Andrew D.

Genes encoding high-affinity folate- and thiamine-binding proteins (FolT, ThiT) were identified in the Lactobacillus casei genome, expressed in Lactococcus lactis, and functionally characterized. Similar genes occur in many Firmicutes, sometimes next to folate or thiamine salvage genes. Most thiT

Environmental cycle of antibiotic resistance encoded genes: A systematic review

Directory of Open Access Journals (Sweden)

R. ghanbari

2017-12-01

Full Text Available Antibiotic-resistant bacteria and genes enter the environment in different ways. The release of these factors into the environment has increased concerns related to public health. The aim of the study was to evaluate the antibiotic resistance genes (ARGs in the environmental resources. In this systematic review, the data were extracted from valid sources of information including ScienceDirect, PubMed, Google Scholar and SID. Evaluation and selection of articles were conducted on the basis of the PRISMA checklist. A total of 39 articles were included in the study, which were chosen from a total of 1249 papers. The inclusion criterion was the identification of genes encoding antibiotic resistance against the eight important groups of antibiotics determined by using the PCR technique in the environmental sources including municipal and hospital wastewater treatment plants, animal and agricultural wastes, effluents from treatment plants, natural waters, sediments, and drinking waters. In this study, 113 genes encoding antibiotic resistance to eight groups of antibiotics (beta-lactams, aminoglycosides, tetracyclines, macrolides, sulfonamides, chloramphenicol, glycopeptides and quinolones were identified in various environments. Antibiotic resistance genes were found in all the investigated environments. The investigation of microorganisms carrying these genes shows that most of the bacteria especially gram-negative bacteria are effective in the acquisition and the dissemination of these pollutants in the environment. Discharging the raw wastewaters and effluents from wastewater treatments acts as major routes in the dissemination of ARGs into environment sources and can pose hazards to public health.

Fungicidal activity of peptides encoded by immunoglobulin genes

OpenAIRE

Polonelli, Luciano; Ciociola, Tecla; Sperind?, Martina; Giovati, Laura; D?Adda, Tiziana; Galati, Serena; Travassos, Luiz R.; Magliani, Walter; Conti, Stefania

2017-01-01

Evidence from previous works disclosed the antimicrobial, antiviral, anti-tumour and/or immunomodulatory activity exerted, through different mechanisms of action, by peptides expressed in the complementarity-determining regions or even in the constant region of antibodies, independently from their specificity and isotype. Presently, we report the selection, from available databases, of peptide sequences encoded by immunoglobulin genes for the evaluation of their potential biological activitie...

Plasmids encoding PKI(1-31), a specific inhibitor of cAMP-stimulated gene expression, inhibit the basal transcriptional activity of some but not all cAMP-regulated DNA response elements in JEG-3 cells.

Science.gov (United States)

Grove, J R; Deutsch, P J; Price, D J; Habener, J F; Avruch, J

1989-11-25

Plasmids that encode a bioactive amino-terminal fragment of the heat-stable inhibitor of the cAMP-dependent protein kinase, PKI(1-31), were employed to characterize the role of this protein kinase in the control of transcriptional activity mediated by three DNA regulatory elements in the JEG-3 human placental cell line. The 5'-flanking sequence of the human collagenase gene contains the heptameric sequence, 5'-TGAGTCA-3', previously identified as a "phorbol ester" response element. Reporter genes containing either the intact 1.2-kilobase 5'-flanking sequence from the human collagenase gene or just the 7-base pair (bp) response element, when coupled to an enhancerless promoter, each exhibit both cAMP and phorbol ester-stimulated expression in JEG-3 cells. Cotransfection of either construct with plasmids encoding PKI(1-31) inhibits cAMP-stimulated but not basal- or phorbol ester-stimulated expression. Pretreatment of cells with phorbol ester for 1 or 2 days abrogates completely the response to rechallenge with phorbol ester but does not alter the basal expression of either construct; cAMP-stimulated expression, while modestly inhibited, remains vigorous. The 5'-flanking sequence of the human chorionic gonadotropin-alpha subunit (HCG alpha) gene has two copies of the sequence, 5'-TGACGTCA-3', contained in directly adjacent identical 18-bp segments, previously identified as a cAMP-response element. Reporter genes containing either the intact 1.5 kilobase of 5'-flanking sequence from the HCG alpha gene, or just the 36-bp tandem repeat cAMP response element, when coupled to an enhancerless promoter, both exhibit a vigorous cAMP stimulation of expression but no response to phorbol ester in JEG-3 cells. Cotransfection with plasmids encoding PKI(1-31) inhibits both basal and cAMP-stimulated expression in a parallel fashion. The 5'-flanking sequence of the human enkephalin gene mediates cAMP-stimulated expression of reporter genes in both JEG-3 and CV-1 cells. Plasmids

Cloning of an epoxide hydrolase encoding gene from Rhodotorula mucilaginosa and functional expresion in Yarrowia lipolytica

CSIR Research Space (South Africa)

Labuschagne, M

2007-01-01

Full Text Available , were used to amplify the genomic EH-encoding gene from Rhodotorula mucilaginosa. The 2347 bp genomic sequence revealed a 1979 bp ORF containing nine introns. The cDNA sequence revealed an 1185 bp EH-encoding gene that translates into a 394 amino acid...

Multiple ace genes encoding acetylcholinesterases of Caenorhabditis elegans have distinct tissue expression.

Science.gov (United States)

Combes, Didier; Fedon, Yann; Toutant, Jean-Pierre; Arpagaus, Martine

2003-08-01

ace-1 and ace-2 genes encoding acetylcholinesterase in the nematode Caenorhabditis elegans present 35% identity in coding sequences but no homology in noncoding regions (introns, 5'- and 3'-untranslated regions). A 5'-region of ace-2 was defined by rescue of ace-1;ace-2 mutants. When green fluorescent protein (GFP) expression was driven by this regulatory region, the resulting pattern was distinct from that of ace-1. This latter gene is expressed in all body-wall and vulval muscle cells (Culetto et al., 1999), whereas ace-2 is expressed almost exclusively in neurons. ace-3 and ace-4 genes are located in close proximity on chromosome II (Combes et al., 2000). These two genes were first transcribed in vivo as a bicistronic messenger and thus constitute an ace-3;ace-4 operon. However, there was a very low level of monocistronic mRNA of ace-4 (the upstream gene) in vivo, and no ACE-4 enzymatic activity was ever detected. GFP expression driven by a 5' upstream region of the ace-3;ace-4 operon was detected in several muscle cells of the pharynx (pm3, pm4, pm5 and pm7) and in the two canal associated neurons (CAN cells). A dorsal row of body-wall muscle cells was intensively labelled in larval stages but no longer detected in adults. The distinct tissue-specific expression of ace-1, ace-2 and ace-3 (coexpressed only in pm5 cells) indicates that ace genes are not redundant.

Overexpression of Genes Encoding Glycolytic Enzymes in Corynebacterium glutamicum Enhances Glucose Metabolism and Alanine Production under Oxygen Deprivation Conditions

Science.gov (United States)

Yamamoto, Shogo; Gunji, Wataru; Suzuki, Hiroaki; Toda, Hiroshi; Suda, Masako; Jojima, Toru; Inui, Masayuki

2012-01-01

We previously reported that Corynebacterium glutamicum strain ΔldhAΔppc+alaD+gapA, overexpressing glyceraldehyde-3-phosphate dehydrogenase-encoding gapA, shows significantly improved glucose consumption and alanine formation under oxygen deprivation conditions (T. Jojima, M. Fujii, E. Mori, M. Inui, and H. Yukawa, Appl. Microbiol. Biotechnol. 87:159–165, 2010). In this study, we employ stepwise overexpression and chromosomal integration of a total of four genes encoding glycolytic enzymes (herein referred to as glycolytic genes) to demonstrate further successive improvements in C. glutamicum glucose metabolism under oxygen deprivation. In addition to gapA, overexpressing pyruvate kinase-encoding pyk and phosphofructokinase-encoding pfk enabled strain GLY2/pCRD500 to realize respective 13% and 20% improved rates of glucose consumption and alanine formation compared to GLY1/pCRD500. Subsequent overexpression of glucose-6-phosphate isomerase-encoding gpi in strain GLY3/pCRD500 further improved its glucose metabolism. Notably, both alanine productivity and yield increased after each overexpression step. After 48 h of incubation, GLY3/pCRD500 produced 2,430 mM alanine at a yield of 91.8%. This was 6.4-fold higher productivity than that of the wild-type strain. Intracellular metabolite analysis showed that gapA overexpression led to a decreased concentration of metabolites upstream of glyceraldehyde-3-phosphate dehydrogenase, suggesting that the overexpression resolved a bottleneck in glycolysis. Changing ratios of the extracellular metabolites by overexpression of glycolytic genes resulted in reduction of the intracellular NADH/NAD+ ratio, which also plays an important role on the improvement of glucose consumption. Enhanced alanine dehydrogenase activity using a high-copy-number plasmid further accelerated the overall alanine productivity. Increase in glycolytic enzyme activities is a promising approach to make drastic progress in growth-arrested bioprocesses. PMID

Nucleotide sequence of the Agrobacterium tumefaciens octopine Ti plasmid-encoded tmr gene

NARCIS (Netherlands)

Heidekamp, F.; Dirkse, W.G.; Hille, J.; Ormondt, H. van

1983-01-01

The nucleotide sequence of the tmr gene, encoded by the octopine Ti plasmid from Agrobacterium tumefaciens (pTiAch5), was determined. The T-DNA, which encompasses this gene, is involved in tumor formation and maintenance, and probably mediates the cytokinin-independent growth of transformed plant

The KL24 gene cluster and a genomic island encoding a Wzy polymerase contribute genes needed for synthesis of the K24 capsular polysaccharide by the multiply antibiotic resistant Acinetobacter baumannii isolate RCH51.

Science.gov (United States)

Kenyon, Johanna J; Kasimova, Anastasiya A; Shneider, Mikhail M; Shashkov, Alexander S; Arbatsky, Nikolay P; Popova, Anastasiya V; Miroshnikov, Konstantin A; Hall, Ruth M; Knirel, Yuriy A

2017-03-01

The whole-genome sequence of the multiply antibiotic resistant Acinetobacter baumannii isolate RCH51 belonging to sequence type ST103 (Institut Pasteur scheme) revealed that the set of genes at the capsule locus, KL24, includes four genes predicted to direct the synthesis of 3-acetamido-3,6-dideoxy-d-galactose (d-Fuc3NAc), and this sugar was found in the capsular polysaccharide (CPS). One of these genes, fdtE, encodes a novel bifunctional protein with an N-terminal FdtA 3,4-ketoisomerase domain and a C-terminal acetyltransferase domain. KL24 lacks a gene encoding a Wzy polymerase to link the oligosaccharide K units to form the CPS found associated with isolate RCH51, and a wzy gene was found in a small genomic island (GI) near the cpn60 gene. This GI is in precisely the same location as another GI carrying wzy and atr genes recently found in several A. baumannii isolates, but it does not otherwise resemble it. The CPS isolated from RCH51, studied by sugar analysis and 1D and 2D 1H and 13C NMR spectroscopy, revealed that the K unit has a branched pentasaccharide structure made up of Gal, GalNAc and GlcNAc residues with d-Fuc3NAc as a side branch, and the K units are linked via a β-d-GlcpNAc-(1→3)-β-d-Galp linkage formed by the Wzy encoded by the GI. The functions of the glycosyltransferases encoded by KL24 were assigned to formation of specific bonds. A correspondence between the order of the genes in KL24 and other KL and the order of the linkages they form was noted, and this may be useful in future predictions of glycosyltransferase specificities.

Loss of functional K+ channels encoded by ether-à-go-go-related genes in mouse myometrium prior to labour onset

Science.gov (United States)

Greenwood, I A; Yeung, S Y; Tribe, R M; Ohya, S

2009-01-01

There is a growing appreciation that ion channels encoded by the ether-à-go-go-related gene family have a functional impact in smooth muscle in addition to their accepted role in cardiac myocytes and neurones. This study aimed to assess the expression of ERG1–3 (KCNH1–3) genes in the murine myometrium (smooth muscle layer of the uterus) and determine the functional impact of the ion channels encoded by these genes in pregnant and non-pregnant animals. Quantitative RT-PCR did not detect message for ERG2 and 3 in whole myometrial tissue extracts. In contrast, message for two isoforms of mERG1 were readily detected with mERG1a more abundant than mERG1b. In isometric tension studies of non-pregnant myometrium, the ERG channel blockers dofetilide (1 μm), E4031 (1 μm) and Be-KM1 (100 nm) increased spontaneous contractility and ERG activators (PD118057 and NS1643) inhibited spontaneous contractility. In contrast, neither ERG blockade nor activation had any effect on the inherent contractility in myometrium from late pregnant (19 days gestation) animals. Moreover, dofetilide-sensitive K+ currents with distinctive ‘hooked’ kinetics were considerably smaller in uterine myocytes from late pregnant compared to non-pregnant animals. Expression of mERG1 isoforms did not alter throughout gestation or upon delivery, but the expression of genes encoding auxillary subunits (KCNE) were up-regulated considerably. This study provides the first evidence for a regulation of ERG-encoded K+ channels as a precursor to late pregnancy physiological activity. PMID:19332483

Characterization of the human gene (TBXAS1) encoding thromboxane synthase.

Science.gov (United States)

Miyata, A; Yokoyama, C; Ihara, H; Bandoh, S; Takeda, O; Takahashi, E; Tanabe, T

1994-09-01

The gene encoding human thromboxane synthase (TBXAS1) was isolated from a human EMBL3 genomic library using human platelet thromboxane synthase cDNA as a probe. Nucleotide sequencing revealed that the human thromboxane synthase gene spans more than 75 kb and consists of 13 exons and 12 introns, of which the splice donor and acceptor sites conform to the GT/AG rule. The exon-intron boundaries of the thromboxane synthase gene were similar to those of the human cytochrome P450 nifedipine oxidase gene (CYP3A4) except for introns 9 and 10, although the primary sequences of these enzymes exhibited 35.8% identity each other. The 1.2-kb of the 5'-flanking region sequence contained potential binding sites for several transcription factors (AP-1, AP-2, GATA-1, CCAAT box, xenobiotic-response element, PEA-3, LF-A1, myb, basic transcription element and cAMP-response element). Primer-extension analysis indicated the multiple transcription-start sites, and the major start site was identified as an adenine residue located 142 bases upstream of the translation-initiation site. However, neither a typical TATA box nor a typical CAAT box is found within the 100-b upstream of the translation-initiation site. Southern-blot analysis revealed the presence of one copy of the thromboxane synthase gene per haploid genome. Furthermore, a fluorescence in situ hybridization study revealed that the human gene for thromboxane synthase is localized to band q33-q34 of the long arm of chromosome 7. A tissue-distribution study demonstrated that thromboxane synthase mRNA is widely expressed in human tissues and is particularly abundant in peripheral blood leukocyte, spleen, lung and liver. The low but significant levels of mRNA were observed in kidney, placenta and thymus.

The carB gene encoding the large subunit of carbamoylphosphate synthetase from Lactococcus lactis is transcribed monocistronically

DEFF Research Database (Denmark)

Martinussen, Jan; Hammer, Karin

1998-01-01

The biosynthesis of carbamoylphosphate is catalysed by the heterodimeric enzyme carbamoylphosphate synthetase (CPSase). The genes encoding the two subunits in procaryotes are normally transcribed as an operon, whereas in Lactococcus lactis, the gene encoding the large subunit (carB) is shown...

Increased enzyme production under liquid culture conditions in the industrial fungus Aspergillus oryzae by disruption of the genes encoding cell wall α-1,3-glucan synthase.

Science.gov (United States)

Miyazawa, Ken; Yoshimi, Akira; Zhang, Silai; Sano, Motoaki; Nakayama, Mayumi; Gomi, Katsuya; Abe, Keietsu

2016-09-01

Under liquid culture conditions, the hyphae of filamentous fungi aggregate to form pellets, which reduces cell density and fermentation productivity. Previously, we found that loss of α-1,3-glucan in the cell wall of the fungus Aspergillus nidulans increased hyphal dispersion. Therefore, here we constructed a mutant of the industrial fungus A. oryzae in which the three genes encoding α-1,3-glucan synthase were disrupted (tripleΔ). Although the hyphae of the tripleΔ mutant were not fully dispersed, the mutant strain did form smaller pellets than the wild-type strain. We next examined enzyme productivity under liquid culture conditions by transforming the cutinase-encoding gene cutL1 into A. oryzae wild-type and the tripleΔ mutant (i.e. wild-type-cutL1, tripleΔ-cutL1). A. oryzae tripleΔ-cutL1 formed smaller hyphal pellets and showed both greater biomass and increased CutL1 productivity compared with wild-type-cutL1, which might be attributable to a decrease in the number of tripleΔ-cutL1 cells under anaerobic conditions.

Effect of long-term actual spaceflight on the expression of key genes encoding serotonin and dopamine system

Science.gov (United States)

Popova, Nina; Shenkman, Boris; Naumenko, Vladimir; Kulikov, Alexander; Kondaurova, Elena; Tsybko, Anton; Kulikova, Elisabeth; Krasnov, I. B.; Bazhenova, Ekaterina; Sinyakova, Nadezhda

The effect of long-term spaceflight on the central nervous system represents important but yet undeveloped problem. The aim of our work was to study the effect of 30-days spaceflight of mice on Russian biosatellite BION-M1 on the expression in the brain regions of key genes of a) serotonin (5-HT) system (main enzymes in 5-HT metabolism - tryptophan hydroxylase-2 (TPH-2), monoamine oxydase A (MAO A), 5-HT1A, 5-HT2A and 5-HT3 receptors); b) pivotal enzymes in DA metabolism (tyrosine hydroxylase, COMT, MAO A, MAO B) and D1, D2 receptors. Decreased expression of genes encoding the 5-HT catabolism (MAO A) and 5-HT2A receptor in some brain regions was shown. There were no differences between “spaceflight” and control mice in the expression of TPH-2 and 5-HT1A, 5-HT3 receptor genes. Significant changes were found in genetic control of DA system. Long-term spaceflight decreased the expression of genes encoding the enzyme in DA synthesis (tyrosine hydroxylase in s.nigra), DA metabolism (MAO B in the midbrain and COMT in the striatum), and D1 receptor in hypothalamus. These data suggested that 1) microgravity affected genetic control of 5-HT and especially the nigrostriatal DA system implicated in the central regulation of muscular tonus and movement, 2) the decrease in the expression of genes encoding key enzyme in DA synthesis, DA degradation and D1 receptor contributes to the movement impairment and dyskinesia produced by the spaceflight. The study was supported by Russian Foundation for Basic Research grant No. 14-04-00173.

Cloning and Characterization of upp, a Gene Encoding Uracil Phosphoribosyltransferase from Lactococcus lactis

DEFF Research Database (Denmark)

Martinussen, Jan; Hammer, Karin

1994-01-01

Uracil phosphoribosyltransferase catalyzes the key reaction in the salvage of uracil in many microorganisms. The gene encoding uracil phosphoribosyltransferase (upp) was cloned from Lactococcus lactis subsp. cremoris MG1363 by complementation of an Escherichia coli mutant. The gene was sequenced...

Horse cDNA clones encoding two MHC class I genes

Energy Technology Data Exchange (ETDEWEB)

Barbis, D.P.; Maher, J.K.; Stanek, J.; Klaunberg, B.A.; Antczak, D.F.

1994-12-31

Two full-length clones encoding MHC class I genes were isolated by screening a horse cDNA library, using a probe encoding in human HLA-A2.2Y allele. The library was made in the pcDNA1 vector (Invitrogen, San Diego, CA), using mRNA from peripheral blood lymphocytes obtained from a Thoroughbred stallion (No. 0834) homozygous for a common horse MHC haplotype (ELA-A2, -B2, -D2; Antczak et al. 1984; Donaldson et al. 1988). The clones were sequenced, using SP6 and T7 universal primers and horse-specific oligonucleotides designed to extend previously determined sequences.

Isolation and sequence analysis of the Pseudomonas syringae pv. tomato gene encoding a 2,3-diphosphoglycerate-independent phosphoglyceromutase.

Science.gov (United States)

Morris, V L; Jackson, D P; Grattan, M; Ainsworth, T; Cuppels, D A

1995-01-01

Pseudomonas syringae pv. tomato DC3481, a Tn5-induced mutant of the tomato pathogen DC3000, cannot grow and elicit disease symptoms on tomato seedlings. It also cannot grow on minimal medium containing malate, citrate, or succinate, three of the major organic acids found in tomatoes. We report here that this mutant also cannot use, as a sole carbon and/or energy source, a wide variety of hexoses and intermediates of hexose catabolism. Uptake studies have shown that DC3481 is not deficient in transport. A 3.8-kb EcoRI fragment of DC3000 DNA, which complements the Tn5 mutation, has been cloned and sequenced. The deduced amino acid sequences of two of the three open reading frames (ORFs) present on this fragment, ORF2 and ORF3, had no significant homology with sequences in the GenBank databases. However, the 510-amino-acid sequence of ORF1, the site of the Tn5 insertion, strongly resembled the deduced amino acid sequences of the Bacillus subtilis and Zea mays genes encoding 2,3-diphosphoglycerate (DPG)-independent phosphoglyceromutase (PGM) (52% identity and 72% similarity and 37% identity and 57% similarity, respectively). PGMs not requiring the cofactor DPG are usually found in plants and algae. Enzyme assays confirmed that P. syringae PGM activity required an intact ORF1. Not only is DC3481 the first PGM-deficient pseudomonad mutant to be described, but the P. syringae pgm gene is the first gram-negative bacterial gene identified that appears to code for a DPG-independent PGM. PGM activity appears essential for the growth and pathogenicity of P. syringae pv. tomato on its host plant. PMID:7896694

Isolation and sequence analysis of the Pseudomonas syringae pv. tomato gene encoding a 2,3-diphosphoglycerate-independent phosphoglyceromutase.

Science.gov (United States)

Morris, V L; Jackson, D P; Grattan, M; Ainsworth, T; Cuppels, D A

1995-04-01

Pseudomonas syringae pv. tomato DC3481, a Tn5-induced mutant of the tomato pathogen DC3000, cannot grow and elicit disease symptoms on tomato seedlings. It also cannot grow on minimal medium containing malate, citrate, or succinate, three of the major organic acids found in tomatoes. We report here that this mutant also cannot use, as a sole carbon and/or energy source, a wide variety of hexoses and intermediates of hexose catabolism. Uptake studies have shown that DC3481 is not deficient in transport. A 3.8-kb EcoRI fragment of DC3000 DNA, which complements the Tn5 mutation, has been cloned and sequenced. The deduced amino acid sequences of two of the three open reading frames (ORFs) present on this fragment, ORF2 and ORF3, had no significant homology with sequences in the GenBank databases. However, the 510-amino-acid sequence of ORF1, the site of the Tn5 insertion, strongly resembled the deduced amino acid sequences of the Bacillus subtilis and Zea mays genes encoding 2,3-diphosphoglycerate (DPG)-independent phosphoglyceromutase (PGM) (52% identity and 72% similarity and 37% identity and 57% similarity, respectively). PGMs not requiring the cofactor DPG are usually found in plants and algae. Enzyme assays confirmed that P. syringae PGM activity required an intact ORF1. Not only is DC3481 the first PGM-deficient pseudomonad mutant to be described, but the P. syringae pgm gene is the first gram-negative bacterial gene identified that appears to code for a DPG-independent PGM. PGM activity appears essential for the growth and pathogenicity of P. syringae pv. tomato on its host plant.

Cellulolytic (cel) genes of Clostridium thermocellum F7 and the proteins encoded by them

International Nuclear Information System (INIS)

Piruzyan, E.S.; Mogutov, M.A.; Velikodvorskaya, G.A.; Pushkarskaya, T.A.

1988-01-01

This study is concerned with genes cell, ce12, and ce13 encoding the endoglucanase of the cellulolytic complex of the anaerobic thermophilic Clostridium thermocellum F7 bacteria, these genes having been closed by us earlier. The authors present the characteristics of proteins synthesized by the cel genes in the minicell system of the strain Escherichia coli K-12 X925. The molecular weights of the proteins encoded by genes cell, ce12, and ce13 are 30,000, 45,000, and 50,000 dalton, respectively. The study of the homology of the cloned section of the C. thermocellum DNA containing the endoglucanase genes, using Southern's blot-hybridization method, did not reveal their physical linkage in the genome. The authors detected a plasmid with a size of about 30 kb in the cells of the C. thermocellum F7 strain investigated

Identification of the gene encoding the 65-kilodalton DNA-binding protein of herpes simplex virus type 1

International Nuclear Information System (INIS)

Parris, D.S.; Cross, A.; Orr, A.; Frame, M.C.; Murphy, M.; McGeoch, D.J.; Marsden, H.S.; Haarr, L.

1988-01-01

Hybrid arrest of in vitro translation was used to localize the region of the herpes simplex virus type 1 genome encoding the 65-kilodalton DNA-binding protein (65K DBP ) to between genome coordinates 0.592 and 0.649. Knowledge of the DNA sequence of this region allowed us to identify three open reading frames as likely candidates for the gene encoding 65K DBP . Two independent approaches were used to determine which of these three open reading frames encoded the protein. For the first approach a monoclonal antibody, MAb 6898, which reacted specifically with 65K DBP , was isolated. This antibody was used, with the techniques of hybrid arrest of in vitro translation and in vitro translation of selected mRNA, to identify the gene encoding 65K DBP . The second approach involved preparation of antisera directed against oligopeptides corresponding to regions of the predicted amino acid sequence of this gene. These antisera reacted specifically with 65K DBP , thus confirming the gene assignment

The Expression of Genes Encoding Secreted Proteins in Medicago truncatula A17 Inoculated Roots

Directory of Open Access Journals (Sweden)

LUCIA KUSUMAWATI

2013-09-01

Full Text Available Subtilisin-like serine protease (MtSBT, serine carboxypeptidase (MtSCP, MtN5, non-specific lipid transfer protein (MtnsLTP, early nodulin2-like protein (MtENOD2-like, FAD-binding domain containing protein (MtFAD-BP1, and rhicadhesin receptor protein (MtRHRE1 were among 34 proteins found in the supernatant of M. truncatula 2HA and sickle cell suspension cultures. This study investigated the expression of genes encoding those proteins in roots and developing nodules. Two methods were used: quantitative real time RT-PCR and gene expression analysis (with promoter:GUS fusion in roots. Those proteins are predicted as secreted proteins which is indirectly supported by the findings that promoter:GUS fusions of six of the seven genes encoding secreted proteins were strongly expressed in the vascular bundle of transgenic hairy roots. All six genes have expressed in 14-day old nodule. The expression levels of the selected seven genes were quantified in Sinorhizobium-inoculated and control plants using quantitative real time RT-PCR. In conclusion, among seven genes encoding secreted proteins analyzed, the expression level of only one gene, MtN5, was up-regulated significantly in inoculated root segments compared to controls. The expression of MtSBT1, MtSCP1, MtnsLTP, MtFAD-BP1, MtRHRE1 and MtN5 were higher in root tip than in other tissues examined.

An evolutionarily conserved gene family encodes proton-selective ion channels.

Science.gov (United States)

Tu, Yu-Hsiang; Cooper, Alexander J; Teng, Bochuan; Chang, Rui B; Artiga, Daniel J; Turner, Heather N; Mulhall, Eric M; Ye, Wenlei; Smith, Andrew D; Liman, Emily R

2018-03-02

Ion channels form the basis for cellular electrical signaling. Despite the scores of genetically identified ion channels selective for other monatomic ions, only one type of proton-selective ion channel has been found in eukaryotic cells. By comparative transcriptome analysis of mouse taste receptor cells, we identified Otopetrin1 (OTOP1), a protein required for development of gravity-sensing otoconia in the vestibular system, as forming a proton-selective ion channel. We found that murine OTOP1 is enriched in acid-detecting taste receptor cells and is required for their zinc-sensitive proton conductance. Two related murine genes, Otop2 and Otop3 , and a Drosophila ortholog also encode proton channels. Evolutionary conservation of the gene family and its widespread tissue distribution suggest a broad role for proton channels in physiology and pathophysiology. Copyright © 2018 The Authors, some rights reserved; exclusive licensee American Association for the Advancement of Science. No claim to original U.S. Government Works.

Genome analysis and identification of gelatinase encoded gene in Enterobacter aerogenes

Science.gov (United States)

Shahimi, Safiyyah; Mutalib, Sahilah Abdul; Khalid, Rozida Abdul; Repin, Rul Aisyah Mat; Lamri, Mohd Fadly; Bakar, Mohd Faizal Abu; Isa, Mohd Noor Mat

2016-11-01

In this study, bioinformatic analysis towards genome sequence of E. aerogenes was done to determine gene encoded for gelatinase. Enterobacter aerogenes was isolated from hot spring water and gelatinase species-specific bacterium to porcine and fish gelatin. This bacterium offers the possibility of enzymes production which is specific to both species gelatine, respectively. Enterobacter aerogenes was partially genome sequenced resulting in 5.0 mega basepair (Mbp) total size of sequence. From pre-process pipeline, 87.6 Mbp of total reads, 68.8 Mbp of total high quality reads and 78.58 percent of high quality percentage was determined. Genome assembly produced 120 contigs with 67.5% of contigs over 1 kilo base pair (kbp), 124856 bp of N50 contig length and 55.17 % of GC base content percentage. About 4705 protein gene was identified from protein prediction analysis. Two candidate genes selected have highest similarity identity percentage against gelatinase enzyme available in Swiss-Prot and NCBI online database. They were NODE_9_length_26866_cov_148.013245_12 containing 1029 base pair (bp) sequence with 342 amino acid sequence and NODE_24_length_155103_cov_177.082458_62 which containing 717 bp sequence with 238 amino acid sequence, respectively. Thus, two paired of primers (forward and reverse) were designed, based on the open reading frame (ORF) of selected genes. Genome analysis of E. aerogenes resulting genes encoded gelatinase were identified.

Cloning and characterization of largemouth bass ( Micropterus salmoides) myostatin encoding gene and its promoter

Science.gov (United States)

Li, Shengjie; Bai, Junjie; Wang, Lin

2008-08-01

Myostatin or GDF-8, a member of the transforming growth factor-β (TGF-β) superfamily, has been demonstrated to be a negative regulator of skeletal muscle mass in mammals. In the present study, we obtained a 5.64 kb sequence of myostatin encoding gene and its promoter from largemouth bass ( Micropterus salmoides). The myostatin encoding gene consisted of three exons (488 bp, 371 bp and 1779 bp, respectively) and two introns (390 bp and 855 bp, respectively). The intron-exon boundaries were conservative in comparison with those of mammalian myostatin encoding genes, whereas the size of introns was smaller than that of mammals. Sequence analysis of 1.569 kb of the largemouth bass myostatin gene promoter region revealed that it contained two TATA boxes, one CAAT box and nine putative E-boxes. Putative muscle growth response elements for myocyte enhancer factor 2 (MEF2), serum response factor (SRF), activator protein 1 (AP1), etc., and muscle-specific Mt binding site (MTBF) were also detected. Some of the transcription factor binding sites were conserved among five teleost species. This information will be useful for studying the transcriptional regulation of myostatin in fish.

Relating genes to function: identifying enriched transcription factors using the ENCODE ChIP-Seq significance tool.

Science.gov (United States)

Auerbach, Raymond K; Chen, Bin; Butte, Atul J

2013-08-01

Biological analysis has shifted from identifying genes and transcripts to mapping these genes and transcripts to biological functions. The ENCODE Project has generated hundreds of ChIP-Seq experiments spanning multiple transcription factors and cell lines for public use, but tools for a biomedical scientist to analyze these data are either non-existent or tailored to narrow biological questions. We present the ENCODE ChIP-Seq Significance Tool, a flexible web application leveraging public ENCODE data to identify enriched transcription factors in a gene or transcript list for comparative analyses. The ENCODE ChIP-Seq Significance Tool is written in JavaScript on the client side and has been tested on Google Chrome, Apple Safari and Mozilla Firefox browsers. Server-side scripts are written in PHP and leverage R and a MySQL database. The tool is available at http://encodeqt.stanford.edu. abutte@stanford.edu Supplementary material is available at Bioinformatics online.

Cloning and characterization of the gsk gene encoding guanosine kinase of Escherichia coli

DEFF Research Database (Denmark)

Harlow, Kenneth W.; Nygaard, Per; Hove-Jensen, Bjarne

1995-01-01

The Escherichia coli gsk gene encoding guanosine kinase was cloned from the Kohara gene library by complementation of the E. coli gsk-1 mutant allele. The cloned DNA fragment was sequenced and shown to encode a putative polypeptide of 433 amino acids with a molecular mass of 48,113 Da. Minicell...

Isolation of Clostridium difficile and Detection of A and B Toxins Encoding Genes

Directory of Open Access Journals (Sweden)

Abbas Ali Imani Fooladi

2014-02-01

Full Text Available Background: Clostridium difficile is the most important anaerobic, gram positive, spore forming bacillus which is known as a prevalent factor leading to antibiotic associated diarrheas and is the causative agent of pseudomembrane colitis. The role of this bacterium along with the over use of antibiotics have been proved to result in colitis. The major virulence factors of these bacteria are the A and B toxins. Objectives: The purpose of this study was to isolate C. difficile from stool samples and detect A and B toxins encoding genes, in order toserve as a routine method for clinical diagnosis. Materials and Methods: Recognition of A and B toxins encoding genes by uniplex and multiplex PCR using two pairs of primers from 136 accumulated stool samples. Results: Results of the present study showed that out of 136 stool samples, three C. difficile were isolated and these strains contained A and B toxins encoding genes. Conclusions: It was concluded that although detection of C. difficile from stool samples based on PCR (polymerase chain reaction is expensive, yet this method is more sensitive and less time-consuming than culture methods and can be used as a clinical laboratory test.

Identification and Characterization of an Autolysin-Encoding Gene of Streptococcus mutans

OpenAIRE

Shibata, Yukie; Kawada, Miki; Nakano, Yoshio; Toyoshima, Kuniaki; Yamashita, Yoshihisa

2005-01-01

We identified a gene (atlA) encoding autolytic activity from Streptococcus mutans Xc. The AtlA protein predicted to be encoded by atlA is composed of 979 amino acids with a molecular weight of 107,279 and has a conserved β-1,4-N-acetylmuramidase (lysozyme) domain in the C-terminal portion. Sodium dodecyl sulfate extracts of strain Xc showed two major bacteriolytic bands with molecular masses of 107 and 79 kDa, both of which were absent from a mutant with inactivated atlA. Western blot analysi...

Detailed analysis of putative genes encoding small proteins in legume genomes

Directory of Open Access Journals (Sweden)

Gabriel eGuillén

2013-06-01

Full Text Available Diverse plant genome sequencing projects coupled with powerful bioinformatics tools have facilitated massive data analysis to construct specialized databases classified according to cellular function. However, there are still a considerable number of genes encoding proteins whose function has not yet been characterized. Included in this category are small proteins (SPs, 30-150 amino acids encoded by short open reading frames (sORFs. SPs play important roles in plant physiology, growth, and development. Unfortunately, protocols focused on the genome-wide identification and characterization of sORFs are scarce or remain poorly implemented. As a result, these genes are underrepresented in many genome annotations. In this work, we exploited publicly available genome sequences of Phaseolus vulgaris, Medicago truncatula, Glycine max and Lotus japonicus to analyze the abundance of annotated SPs in plant legumes. Our strategy to uncover bona fide sORFs at the genome level was centered in bioinformatics analysis of characteristics such as evidence of expression (transcription, presence of known protein regions or domains, and identification of orthologous genes in the genomes explored. We collected 6170, 10461, 30521, and 23599 putative sORFs from P. vulgaris, G. max, M. truncatula, and L. japonicus genomes, respectively. Expressed sequence tags (ESTs available in the DFCI Gene Index database provided evidence that ~one-third of the predicted legume sORFs are expressed. Most potential SPs have a counterpart in a different plant species and counterpart regions or domains in larger proteins. Potential functional sORFs were also classified according to a reduced set of GO categories, and the expression of 13 of them during P. vulgaris nodule ontogeny was confirmed by qPCR. This analysis provides a collection of sORFs that potentially encode for meaningful SPs, and offers the possibility of their further functional evaluation.

Cloning, Expression, and Characterization of budC Gene Encoding meso-2,3-Butanediol Dehydrogenase from Bacillus licheniformis.

Science.gov (United States)

Xu, Guo-Chao; Bian, Ya-Qian; Han, Rui-Zhi; Dong, Jin-Jun; Ni, Ye

2016-02-01

The budC gene encoding a meso-2,3-butanediol dehydrogenase (BlBDH) from Bacillus licheniformis was cloned and overexpressed in Escherichia coli BL21(DE3). Sequence analysis reveals that this BlBDH belongs to short-chain dehydrogenase/reductase (SDR) superfamily. In the presence of NADH, BlBDH catalyzes the reduction of diacetyl to (3S)-acetoin (97.3% ee), and further to (2S,3S)-2,3-butanediol (97.3% ee and 96.5% de). Similar to other meso-2,3-BDHs, it shows oxidative activity to racemic 2,3-butanediol whereas no activity toward racemic acetoin in the presence of NAD(+). For diacetyl reduction and 2,3-butanediol oxidation, the pH optimum of BlBDH is 5.0 and 10.0, respectively. Unusually, it shows relatively high activity over a wide pH range from 5.0 to 8.0 for racemic acetoin reduction. BlBDH shows lower K m and higher catalytic efficiency toward racemic acetoin (K m = 0.47 mM, k cat /K m = 432 s(-1)·mM(-1)) when compared with 2,3-butanediol (K m = 7.25 mM, k cat /K m = 81.5 s(-1)·mM(-1)), indicating its physiological role in favor of reducing racemic acetoin into 2,3-butanediol. The enzymatic characterization of BlBDH provides evidence for the directed engineering of B. licheniformis for producing enantiopure 2,3-butanediol.

Detection of β-lactamase encoding genes in feces, soil and water from a Brazilian pig farm.

Science.gov (United States)

Furlan, João Pedro Rueda; Stehling, Eliana Guedes

2018-01-10

β-lactam antibiotics are widely used for the treatment of different types of infections worldwide and the resistance to these antibiotics has grown sharply, which is of great concern. Resistance to β-lactams in gram-negative bacteria is mainly due to the production of β-lactamases, which are classified according to their functional activities. The aim of this study was to verify the presence of β-lactamases encoding genes in feces, soil, and water from a Brazilian pig farm. Different β-lactamases encoding genes were found, including bla CTX-M-Gp1 , bla CTX-M-Gp9 , bla SHV , bla OXA-1-like , bla GES , and bla VEB . The bla SHV and bla CTX-M-Gp1 genes have been detected in all types of samples, indicating the spread of β-lactam resistant bacteria among farm pigs and the environment around them. These results indicate that β-lactamase encoding genes belonging to the cloxacillinase, ESBL, and carbapenemase and they have high potential to spread in different sources, due to the fact that genes are closely related to mobile genetic elements, especially plasmids.

Bioinformatics Analysis of NBS-LRR Encoding Resistance Genes in Setaria italica.

Science.gov (United States)

Zhao, Yan; Weng, Qiaoyun; Song, Jinhui; Ma, Hailian; Yuan, Jincheng; Dong, Zhiping; Liu, Yinghui

2016-06-01

In plants, resistance (R) genes are involved in pathogen recognition and subsequent activation of innate immune responses. The nucleotide-binding site-leucine-rich repeat (NBS-LRR) genes family forms the largest R-gene family among plant genomes and play an important role in plant disease resistance. In this paper, comprehensive analysis of NBS-encoding genes is performed in the whole Setaria italica genome. A total of 96 NBS-LRR genes are identified, and comprehensive overview of the NBS-LRR genes is undertaken, including phylogenetic analysis, chromosome locations, conserved motifs of proteins, and gene expression. Based on the domain, these genes are divided into two groups and distributed in all Setaria italica chromosomes. Most NBS-LRR genes are located at the distal tip of the long arms of the chromosomes. Setaria italica NBS-LRR proteins share at least one nucleotide-biding domain and one leucine-rich repeat domain. Our results also show the duplication of NBS-LRR genes in Setaria italica is related to their gene structure.

Identification of chitinolytic bacteria isolated from shrimp pond sediment and characterization of their chitinase encoding gene

Science.gov (United States)

Triwijayani, A. U.; Puspita, I. D.; Murwantoko; Ustadi

2018-03-01

Chitinolytic bacteria are a group of bacteria owning enzymes that able to hydrolyze chitin. Previously, we isolated chitinolytic bacteria from shrimp pond sediment in Bantul, Yogyakarta, and obtained five isolates showing high chitinolytic index named as isolate PT1, PT2, PT5, PT6 and PB2. The aims of this study were to identify chitinolytic bacteria isolated from shrimp pond sediment and to characterize the chitinase encoding gene from each isolate. The molecular technique was performed by amplification of 16S rDNA, amplification of chitinase encoding gene and sequence analysis. Two chitinolytic bacteria of PT1 and PT2 were similar to Aeromonas bivalvium strain D15, PT5 to Pseudomonas stutzeri strain BD-2.2.1, PT6 to Serratia marcescens strain FZSF02 and PB2 to Streptomyces misionensis strain OsiRt-1. The comparison of chitinase encoding gene between three isolates with those in Gen Bank shows that PT1 had similar sequences with the chi1 gene in Aeromonas sp. 17m, PT2 with chi1 gene in A. caviae (CB101) and PT6 with chiB gene in S. Marcescens (BJL200).

Medicago truncatula contains a second gene encoding a plastid located glutamine synthetase exclusively expressed in developing seeds

Directory of Open Access Journals (Sweden)

Seabra Ana R

2010-08-01

Full Text Available Abstract Background Nitrogen is a crucial nutrient that is both essential and rate limiting for plant growth and seed production. Glutamine synthetase (GS, occupies a central position in nitrogen assimilation and recycling, justifying the extensive number of studies that have been dedicated to this enzyme from several plant sources. All plants species studied to date have been reported as containing a single, nuclear gene encoding a plastid located GS isoenzyme per haploid genome. This study reports the existence of a second nuclear gene encoding a plastid located GS in Medicago truncatula. Results This study characterizes a new, second gene encoding a plastid located glutamine synthetase (GS2 in M. truncatula. The gene encodes a functional GS isoenzyme with unique kinetic properties, which is exclusively expressed in developing seeds. Based on molecular data and the assumption of a molecular clock, it is estimated that the gene arose from a duplication event that occurred about 10 My ago, after legume speciation and that duplicated sequences are also present in closely related species of the Vicioide subclade. Expression analysis by RT-PCR and western blot indicate that the gene is exclusively expressed in developing seeds and its expression is related to seed filling, suggesting a specific function of the enzyme associated to legume seed metabolism. Interestingly, the gene was found to be subjected to alternative splicing over the first intron, leading to the formation of two transcripts with similar open reading frames but varying 5' UTR lengths, due to retention of the first intron. To our knowledge, this is the first report of alternative splicing on a plant GS gene. Conclusions This study shows that Medicago truncatula contains an additional GS gene encoding a plastid located isoenzyme, which is functional and exclusively expressed during seed development. Legumes produce protein-rich seeds requiring high amounts of nitrogen, we postulate

Human coronavirus 229E encodes a single ORF4 protein between the spike and the envelope genes

Directory of Open Access Journals (Sweden)

Berkhout Ben

2006-12-01

Full Text Available Abstract Background The genome of coronaviruses contains structural and non-structural genes, including several so-called accessory genes. All group 1b coronaviruses encode a single accessory protein between the spike and envelope genes, except for human coronavirus (HCoV 229E. The prototype virus has a split gene, encoding the putative ORF4a and ORF4b proteins. To determine whether primary HCoV-229E isolates exhibit this unusual genome organization, we analyzed the ORF4a/b region of five current clinical isolates from The Netherlands and three early isolates collected at the Common Cold Unit (CCU in Salisbury, UK. Results All Dutch isolates were identical in the ORF4a/b region at amino acid level. All CCU isolates are only 98% identical to the Dutch isolates at the nucleotide level, but more closely related to the prototype HCoV-229E (>98%. Remarkably, our analyses revealed that the laboratory adapted, prototype HCoV-229E has a 2-nucleotide deletion in the ORF4a/b region, whereas all clinical isolates carry a single ORF, 660 nt in size, encoding a single protein of 219 amino acids, which is a homologue of the ORF3 proteins encoded by HCoV-NL63 and PEDV. Conclusion Thus, the genome organization of the group 1b coronaviruses HCoV-NL63, PEDV and HCoV-229E is identical. It is possible that extensive culturing of the HCoV-229E laboratory strain resulted in truncation of ORF4. This may indicate that the protein is not essential in cell culture, but the highly conserved amino acid sequence of the ORF4 protein among clinical isolates suggests that the protein plays an important role in vivo.

Squamous Cell Carcinoma Antigen-encoding Genes SERPINB3/B4 as Potentially Useful Markers for the Stratification of HNSCC Tumours.

Science.gov (United States)

Saidak, Zuzana; Morisse, Mony Chenda; Chatelain, Denis; Sauzay, Chloé; Houessinon, Aline; Guilain, Nelly; Soyez, Marion; Chauffert, Bruno; Dakpé, Stéphanie; Galmiche, Antoine

2018-03-01

The squamous cell carcinoma antigen (SCCA), encoded by the genes SERPINB3/B4, is a tumour marker produced by head and neck squamous cell carcinoma (HNSCC). We aimed to examine SERPINB3/B4 mRNA levels and its clinical significance in the therapeutic context. We retrieved mRNA expression levels, clinical, pathological and genomic data for 520 HNSCC from The Cancer Genome Atlas (TCGA). HNSCC tumours express high levels of SERPINB3/B4 mRNA. SERPINB3 expression differs depending on Human papillomavirus (HPV) infection status, primary tumour location, grade and differentiation, extension to lymph nodes and extracapsular spread. Interestingly, we observed an association between SERPINB3/B4 and the presence of tumour immune infiltrate as well as the expression of the immune checkpoint regulators PD-L1/PD-L2 that depended on HPV status. Our findings point to potential interest of SERPINB3/B4 for the stratification of HNSCC patients in the therapeutic context. Copyright© 2018, International Institute of Anticancer Research (Dr. George J. Delinasios), All rights reserved.

Three genes for mitochondrial proteins suppress null-mutations in both Afg3 and Rca1 when over-expressed.

Science.gov (United States)

Rep, M; Nooy, J; Guélin, E; Grivell, L A

1996-08-01

The AFG3 gene of Saccharomyces cerevisiae encodes a mitochondrial inner membrane protein with ATP-dependent protease activity. To gain more insight into the function of this protein, multi-copy suppressors of an afg3-null mutation were isolated. Three genes were found that restored partial growth on non-fermentable carbon sources, all of which affect the biogenesis of respiratory competent mitochondria: PIM1(LON) encodes a matrix-localized ATP-dependent protease involved in the turnover of matrix proteins; OXA1(PET1402) encodes a putative mitochondrial inner membrane protein involved in the biogenesis of the respiratory chain; and MBA1 encodes a mitochondrial protein required for optimal respiratory growth. All three genes also suppressed a null mutation in a related gene, RCA1, as well as in the combination of afg3- and rca1-null.

Surfactant Protein-D-Encoding Gene Variant Polymorphisms Are Linked to Respiratory Outcome in Premature Infants

DEFF Research Database (Denmark)

Sorensen, Grith Lykke; Dahl, Marianne; Tan, Qihua

2014-01-01

OBJECTIVE: Associations between the genetic variation within or downstream of the surfactant protein-D-encoding gene (SFTPD), which encodes the collectin surfactant protein-D (SP-D) and may lead to respiratory distress syndrome or bronchopulmonary dysplasia, recently were reported. Our aim...... were used to associate genetic variation to SP-D, respiratory distress (RD), oxygen requirement, and respiratory support. RESULTS: The 5'-upstream SFTPD SNP rs1923534 and the 3 structural SNPs rs721917, rs2243639, and rs3088308 were associated with the SP-D level. The same SNPs were associated with RD......, a requirement for supplemental oxygen, and a requirement for respiratory support. Haplotype analyses identified 3 haplotypes that included the minor alleles of rs1923534, rs721917, and rs3088308 that exhibited highly significant associations with decreased SP-D levels and decreased ORs for RD, oxygen...

Autoselection of cytoplasmic yeast virus like elements encoding toxin/antitoxin systems involves a nuclear barrier for immunity gene expression.

Science.gov (United States)

Kast, Alene; Voges, Raphael; Schroth, Michael; Schaffrath, Raffael; Klassen, Roland; Meinhardt, Friedhelm

2015-05-01

Cytoplasmic virus like elements (VLEs) from Kluyveromyces lactis (Kl), Pichia acaciae (Pa) and Debaryomyces robertsiae (Dr) are extremely A/T-rich (>75%) and encode toxic anticodon nucleases (ACNases) along with specific immunity proteins. Here we show that nuclear, not cytoplasmic expression of either immunity gene (PaORF4, KlORF3 or DrORF5) results in transcript fragmentation and is insufficient to establish immunity to the cognate ACNase. Since rapid amplification of 3' ends (RACE) as well as linker ligation of immunity transcripts expressed in the nucleus revealed polyadenylation to occur along with fragmentation, ORF-internal poly(A) site cleavage due to the high A/T content is likely to prevent functional expression of the immunity genes. Consistently, lowering the A/T content of PaORF4 to 55% and KlORF3 to 46% by gene synthesis entirely prevented transcript cleavage and permitted functional nuclear expression leading to full immunity against the respective ACNase toxin. Consistent with a specific adaptation of the immunity proteins to the cognate ACNases, cross-immunity to non-cognate ACNases is neither conferred by PaOrf4 nor KlOrf3. Thus, the high A/T content of cytoplasmic VLEs minimizes the potential of functional nuclear recruitment of VLE encoded genes, in particular those involved in autoselection of the VLEs via a toxin/antitoxin principle.

Autoselection of cytoplasmic yeast virus like elements encoding toxin/antitoxin systems involves a nuclear barrier for immunity gene expression.

Directory of Open Access Journals (Sweden)

Alene Kast

2015-05-01

Full Text Available Cytoplasmic virus like elements (VLEs from Kluyveromyces lactis (Kl, Pichia acaciae (Pa and Debaryomyces robertsiae (Dr are extremely A/T-rich (>75% and encode toxic anticodon nucleases (ACNases along with specific immunity proteins. Here we show that nuclear, not cytoplasmic expression of either immunity gene (PaORF4, KlORF3 or DrORF5 results in transcript fragmentation and is insufficient to establish immunity to the cognate ACNase. Since rapid amplification of 3' ends (RACE as well as linker ligation of immunity transcripts expressed in the nucleus revealed polyadenylation to occur along with fragmentation, ORF-internal poly(A site cleavage due to the high A/T content is likely to prevent functional expression of the immunity genes. Consistently, lowering the A/T content of PaORF4 to 55% and KlORF3 to 46% by gene synthesis entirely prevented transcript cleavage and permitted functional nuclear expression leading to full immunity against the respective ACNase toxin. Consistent with a specific adaptation of the immunity proteins to the cognate ACNases, cross-immunity to non-cognate ACNases is neither conferred by PaOrf4 nor KlOrf3. Thus, the high A/T content of cytoplasmic VLEs minimizes the potential of functional nuclear recruitment of VLE encoded genes, in particular those involved in autoselection of the VLEs via a toxin/antitoxin principle.

Cloning of gene-encoded stem bromelain on system coming from Pichia pastoris as therapeutic protein candidate

Science.gov (United States)

Yusuf, Y.; Hidayati, W.

2018-01-01

The process of identifying bacterial recombination using PCR, and restriction, and then sequencing process was done after identifying the bacteria. This research aimed to get a yeast cell of Pichia pastoris which has an encoder gene of stem bromelain enzyme. The production of recombinant stem bromelain enzymes using yeast cells of P. pastoris can produce pure bromelain rod enzymes and have the same conformation with the enzyme’s conformation in pineapple plants. This recombinant stem bromelain enzyme can be used as a therapeutic protein in inflammatory, cancer and degenerative diseases. This study was an early stage of a step series to obtain bromelain rod protein derived from pineapple made with genetic engineering techniques. This research was started by isolating the RNA of pineapple stem which was continued with constructing cDNA using reserve transcriptase-PCR technique (RT-PCR), doing the amplification of bromelain enzyme encoder gene with PCR technique using a specific premiere couple which was designed. The process was continued by cloning into bacterium cells of Escherichia coli. A vector which brought the encoder gene of stem bromelain enzyme was inserted into the yeast cell of P. pastoris and was continued by identifying the yeast cell of P. pastoris which brought the encoder gene of stem bromelain enzyme. The research has not found enzyme gene of stem bromelain in yeast cell of P. pastoris yet. The next step is repeating the process by buying new reagent; RNase inhibitor, and buying liquid nitrogen.

Diversity of beetle genes encoding novel plant cell wall degrading enzymes.

Directory of Open Access Journals (Sweden)

Yannick Pauchet

Full Text Available Plant cell walls are a heterogeneous mixture of polysaccharides and proteins that require a range of different enzymes to degrade them. Plant cell walls are also the primary source of cellulose, the most abundant and useful biopolymer on the planet. Plant cell wall degrading enzymes (PCWDEs are therefore important in a wide range of biotechnological processes from the production of biofuels and food to waste processing. However, despite the fact that the last common ancestor of all deuterostomes was inferred to be able to digest, or even synthesize, cellulose using endogenous genes, all model insects whose complete genomes have been sequenced lack genes encoding such enzymes. To establish if the apparent "disappearance" of PCWDEs from insects is simply a sampling problem, we used 454 mediated pyrosequencing to scan the gut transcriptomes of beetles that feed on a variety of plant derived diets. By sequencing the transcriptome of five beetles, and surveying publicly available ESTs, we describe 167 new beetle PCWDEs belonging to eight different enzyme families. This survey proves that these enzymes are not only present in non-model insects but that the multigene families that encode them are apparently undergoing complex birth-death dynamics. This reinforces the observation that insects themselves, and not just their microbial symbionts, are a rich source of PCWDEs. Further it emphasises that the apparent absence of genes encoding PCWDEs from model organisms is indeed simply a sampling artefact. Given the huge diversity of beetles alive today, and the diversity of their lifestyles and diets, we predict that beetle guts will emerge as an important new source of enzymes for use in biotechnology.

Characterization of the human laminin beta2 chain locus (LAMB2): linkage to a gene containing a nonprocessed, transcribed LAMB2-like pseudogene (LAMB2L) and to the gene encoding glutaminyl tRNA synthetase (QARS)

DEFF Research Database (Denmark)

Durkin, M E; Jäger, A C; Khurana, T S

1999-01-01

The laminin beta2 chain is an important constituent of certain kidney and muscle basement membranes. We have generated a detailed physical map of a 110-kb genomic DNA segment surrounding the human laminin beta2 chain gene (LAMB2) on chromosome 3p21.3-->p21.2, a region paralogous with the chromosome...... 7q22-->q31 region that contains the laminin beta1 chain gene locus (LAMB1). Several CpG islands and a novel polymorphic microsatellite marker (D3S4594) were identified. The 3' end of LAMB2 lies 16 kb from the 5' end of the glutaminyl tRNA synthetase gene (QARS). About 20 kb upstream of LAMB2 we...... found a gene encoding a transcribed, non-processed LAMB2-like pseudogene (LAMB2L). The sequence of 1.75 kb of genomic DNA at the 3' end of LAMB2L was similar to exons 8-12 of the laminin beta2 chain gene. The LAMB2L-LAMB2-QARS cluster lies telomeric to the gene encoding the laminin-binding protein...

Genomic polymorphism, recombination, and linkage disequilibrium in human major histocompatibility complex-encoded antigen-processing genes.

Science.gov (United States)

van Endert, P M; Lopez, M T; Patel, S D; Monaco, J J; McDevitt, H O

1992-01-01

Recently, two subunits of a large cytosolic protease and two putative peptide transporter proteins were found to be encoded by genes within the class II region of the major histocompatibility complex (MHC). These genes have been suggested to be involved in the processing of antigenic proteins for presentation by MHC class I molecules. Because of the high degree of polymorphism in MHC genes, and previous evidence for both functional and polypeptide sequence polymorphism in the proteins encoded by the antigen-processing genes, we tested DNA from 27 consanguineous human cell lines for genomic polymorphism by restriction fragment length polymorphism (RFLP) analysis. These studies demonstrate a strong linkage disequilibrium between TAP1 and LMP2 RFLPs. Moreover, RFLPs, as well as a polymorphic stop codon in the telomeric TAP2 gene, appear to be in linkage disequilibrium with HLA-DR alleles and RFLPs in the HLA-DO gene. A high rate of recombination, however, seems to occur in the center of the complex, between the TAP1 and TAP2 genes. Images PMID:1360671

The promoter of the glucoamylase-encoding gene of Aspergillus niger functions in Ustilago maydis

Energy Technology Data Exchange (ETDEWEB)

Smith, T.L. (Dept. of Agriculture, Madison, WI (United States) Univ. of Wisconsin, Madison (United States)); Gaskell, J.; Cullen, D. (Dept. of Agriculture, Madison, WI (United States)); Berka, R.M.; Yang, M.; Henner, D.J. (Genentech Inc., San Francisco, CA (United States))

1990-01-01

Promoter sequences from the Aspergillus niger glucoamylase-encoding gene (glaA) were linked to the bacterial hygromycin (Hy) phosphotransferase-encoding gene (hph) and this chimeric marker was used to select Hy-resistant (Hy[sup R]) Ustilago maydis transformants. This is an example of an Ascomycete promoter functioning in a Basidiomycete. Hy[sup R] transformants varied with respect to copy number of integrated vector, mitotic stability, and tolerance to Hy. Only 216 bp of glaA promoter sequence is required for expression in U. maydis but this promoter is not induced by starch as it is in Aspergillus spp. The transcription start points are the same in U. maydis and A. niger.

Development of glyphosate-resistant alfalfa (Medicago sativa L.) upon transformation with the GR79Ms gene encoding 5-enolpyruvylshikimate-3-phosphate synthase.

Science.gov (United States)

Yi, Dengxia; Ma, Lin; Lin, Min; Li, Cong

2018-07-01

The glyphosate-resistant gene, GR79Ms, was successfully introduced into the genome of alfalfa. The transgenic events may serve as novel germplasm resources in alfalfa breeding. Weed competition can reduce the alfalfa yield, generating new alfalfa germplasm with herbicide resistance is essential. To obtain transgenic alfalfa lines with glyphosate resistance, a new synthetic glyphosate-resistant gene GR79Ms encoding 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS) was introduced into alfalfa germplasm by Agrobacterium tumefaciens-mediated transformation. In total, 67 transformants were obtained. PCR and Southern blot analyses confirmed that GR79Ms was successfully inserted into the genome of alfalfa. Reverse transcription-PCR and western blot analyses further demonstrated the expression of GR79Ms and its product, GR79Ms EPSPS. Moreover, two homozygous transgenic lines were developed in the T 2 generation by means of molecular-assisted selection. Herbicide tolerance spray tests showed that the transgenic plants T 0 -GR1, T 0 -GR2, T 0 -GR3 and two homozygous lines were able to tolerate fourfold higher commercial usage of glyphosate than non-transgenic plants.

Characterization of Genes Encoding Key Enzymes Involved in Anthocyanin Metabolism of Kiwifruit during Storage Period.

Science.gov (United States)

Li, Boqiang; Xia, Yongxiu; Wang, Yuying; Qin, Guozheng; Tian, Shiping

2017-01-01

'Hongyang' is a red fleshed kiwifruit with high anthocyanin content. In this study, we mainly investigated effects of different temperatures (25 and 0°C) on anthocyanin biosynthesis in harvested kiwifruit, and characterized the genes encoding key enzymes involved in anthocyanin metabolism, as well as evaluated the mode of the action, by which low temperature regulates anthocyanin accumulation in 'Hongyang' kiwifruit during storage period. The results showed that low temperature could effectively enhance the anthocyanin accumulation of kiwifruit in the end of storage period (90 days), which related to the increase in mRNA levels of ANS1, ANS2, DRF1, DRF2 , and UGFT2 . Moreover, the transcript abundance of MYBA1-1 and MYB5-1 , the genes encoding an important component of MYB-bHLH-WD40 (MBW) complex, was up-regulated, possibly contributing to the induction of specific anthocyanin biosynthesis genes under the low temperature. To further investigate the roles of AcMYB5-1/5-2/A1-1 in regulation of anthocyanin biosynthesis, genes encoding the three transcription factors were transiently transformed in Nicotiana benthamiana leaves. Overexpression of AcMYB5-1/5-2/A1-1 activated the gene expression of NtANS and NtDFR in tobacco. Our results suggested that low temperature storage could stimulate the anthocyanin accumulation in harvested kiwifruit via regulating several structural and regulatory genes involved in anthocyanin biosynthesis.

Analysis of essential Arabidopsis nuclear genes encoding plastid-targeted proteins.

Science.gov (United States)

Savage, Linda J; Imre, Kathleen M; Hall, David A; Last, Robert L

2013-01-01

The Chloroplast 2010 Project (http://www.plastid.msu.edu/) identified and phenotypically characterized homozygous mutants in over three thousand genes, the majority of which encode plastid-targeted proteins. Despite extensive screening by the community, no homozygous mutant alleles were available for several hundred genes, suggesting that these might be enriched for genes of essential function. Attempts were made to generate homozygotes in ~1200 of these lines and 521 of the homozygous viable lines obtained were deposited in the Arabidopsis Biological Resource Center (http://abrc.osu.edu/). Lines that did not yield a homozygote in soil were tested as potentially homozygous lethal due to defects either in seed or seedling development. Mutants were characterized at four stages of development: developing seed, mature seed, at germination, and developing seedlings. To distinguish seed development or seed pigment-defective mutants from seedling development mutants, development of seeds was assayed in siliques from heterozygous plants. Segregating seeds from heterozygous parents were sown on supplemented media in an attempt to rescue homozygous seedlings that could not germinate or survive in soil. Growth of segregating seeds in air and air enriched to 0.3% carbon dioxide was compared to discover mutants potentially impaired in photorespiration or otherwise responsive to CO2 supplementation. Chlorophyll fluorescence measurements identified CO2-responsive mutants with altered photosynthetic parameters. Examples of genes with a viable mutant allele and one or more putative homozygous-lethal alleles were documented. RT-PCR of homozygotes for potentially weak alleles revealed that essential genes may remain undiscovered because of the lack of a true null mutant allele. This work revealed 33 genes with two or more lethal alleles and 73 genes whose essentiality was not confirmed with an independent lethal mutation, although in some cases second leaky alleles were identified.

Analysis of essential Arabidopsis nuclear genes encoding plastid-targeted proteins.

Directory of Open Access Journals (Sweden)

Linda J Savage

Full Text Available The Chloroplast 2010 Project (http://www.plastid.msu.edu/ identified and phenotypically characterized homozygous mutants in over three thousand genes, the majority of which encode plastid-targeted proteins. Despite extensive screening by the community, no homozygous mutant alleles were available for several hundred genes, suggesting that these might be enriched for genes of essential function. Attempts were made to generate homozygotes in ~1200 of these lines and 521 of the homozygous viable lines obtained were deposited in the Arabidopsis Biological Resource Center (http://abrc.osu.edu/. Lines that did not yield a homozygote in soil were tested as potentially homozygous lethal due to defects either in seed or seedling development. Mutants were characterized at four stages of development: developing seed, mature seed, at germination, and developing seedlings. To distinguish seed development or seed pigment-defective mutants from seedling development mutants, development of seeds was assayed in siliques from heterozygous plants. Segregating seeds from heterozygous parents were sown on supplemented media in an attempt to rescue homozygous seedlings that could not germinate or survive in soil. Growth of segregating seeds in air and air enriched to 0.3% carbon dioxide was compared to discover mutants potentially impaired in photorespiration or otherwise responsive to CO2 supplementation. Chlorophyll fluorescence measurements identified CO2-responsive mutants with altered photosynthetic parameters. Examples of genes with a viable mutant allele and one or more putative homozygous-lethal alleles were documented. RT-PCR of homozygotes for potentially weak alleles revealed that essential genes may remain undiscovered because of the lack of a true null mutant allele. This work revealed 33 genes with two or more lethal alleles and 73 genes whose essentiality was not confirmed with an independent lethal mutation, although in some cases second leaky alleles

Opposite roles of the Arabidopsis cytokinin receptors AHK2 and AHK3 in the expression of plastid genes and genes for the plastid transcriptional machinery during senescence.

Science.gov (United States)

Danilova, Maria N; Kudryakova, Natalia V; Doroshenko, Anastasia S; Zabrodin, Dmitry A; Rakhmankulova, Zulfira F; Oelmüller, Ralf; Kusnetsov, Victor V

2017-03-01

Cytokinin membrane receptors of the Arabidopsis thaliana AHK2 and AHK3 play opposite roles in the expression of plastid genes and genes for the plastid transcriptional machinery during leaf senescence Loss-of-function mutants of Arabidopsis thaliana were used to study the role of cytokinin receptors in the expression of chloroplast genes during leaf senescence. Accumulation of transcripts of several plastid-encoded genes is dependent on the АНК2/АНК3 receptor combination. АНК2 is particularly important at the final stage of plant development and, unlike АНК3, a positive regulator of leaf senescence. Cytokinin-dependent up-regulation of the nuclear encoded genes for chloroplast RNA polymerases RPOTp and RPOTmp suggests that the hormone controls plastid gene expression, at least in part, via the expression of nuclear genes for the plastid transcription machinery. This is further supported by cytokinin dependent regulation of genes for the nuclear encoded plastid σ-factors, SIG1-6, which code for components of the transcriptional apparatus in chloroplasts.

The Kynurenine 3-Monooxygenase Encoding Gene, BcKMO, Is Involved in the Growth, Development, and Pathogenicity of Botrytis cinerea

Directory of Open Access Journals (Sweden)

Kang Zhang

2018-05-01

Full Text Available A pathogenic mutant, BCG183, was obtained by screening the T-DNA insertion library of Botrytis cinerea. A novel pathogenicity-related gene BcKMO, which encodes kynurenine 3-monooxygenase (KMO, was isolated and identified via thermal asymmetric interlaced PCR, bioinformatics analyses, and KMO activity measurement. The mutant BCG183 grew slowly, did not produce conidia and sclerotia, had slender hyphae, and presented enhanced pathogenicity. The phenotype and pathogenicity of the BcKMO-complementing mutant (BCG183/BcKMO were similar to those of the wild-type (WT strain. The activities of polymethylgalacturonase, polygalacturonase, and toxins were significantly higher, whereas acid production was significantly decreased in the mutant BCG183, when compared with those in the WT and BCG183/BcKMO. Moreover, the sensitivity of mutant BCG183 to NaCl and KCl was remarkably increased, whereas that to fluconazole, Congo Red, menadione, H2O2, and SQ22536 and U0126 [cAMP-dependent protein kinase (cAMP and mitogen-activated protein kinase (MAPK signaling pathways inhibitors, respectively] were significantly decreased compared with the other strains. Furthermore, the key genes involved in the cAMP and MAPK signaling pathways, Pka1, Pka2, PkaR, Bcg2, Bcg3, bmp1, and bmp3, were significantly upregulated or downregulated in the mutant BCG183. BcKMO expression levels were also upregulated or downregulated in the RNAi mutants of the key genes involved in the cAMP and MAPK signaling pathways. These findings indicated that BcKMO positively regulates growth and development, but negatively regulates pathogenicity of B. cinerea. Furthermore, BcKMO was found to be involved in controlling cell wall degrading enzymes activity, toxins activity, acid production, and cell wall integrity, and participate in cAMP and MAPK signaling pathways of B. cinerea.

The Kynurenine 3-Monooxygenase Encoding Gene, BcKMO, Is Involved in the Growth, Development, and Pathogenicity of Botrytis cinerea.

Science.gov (United States)

Zhang, Kang; Yuan, Xuemei; Zang, Jinping; Wang, Min; Zhao, Fuxin; Li, Peifen; Cao, Hongzhe; Han, Jianmin; Xing, Jihong; Dong, Jingao

2018-01-01

A pathogenic mutant, BCG183, was obtained by screening the T-DNA insertion library of Botrytis cinerea . A novel pathogenicity-related gene BcKMO , which encodes kynurenine 3-monooxygenase (KMO), was isolated and identified via thermal asymmetric interlaced PCR, bioinformatics analyses, and KMO activity measurement. The mutant BCG183 grew slowly, did not produce conidia and sclerotia, had slender hyphae, and presented enhanced pathogenicity. The phenotype and pathogenicity of the BcKMO -complementing mutant (BCG183/ BcKMO ) were similar to those of the wild-type (WT) strain. The activities of polymethylgalacturonase, polygalacturonase, and toxins were significantly higher, whereas acid production was significantly decreased in the mutant BCG183, when compared with those in the WT and BCG183/ BcKMO . Moreover, the sensitivity of mutant BCG183 to NaCl and KCl was remarkably increased, whereas that to fluconazole, Congo Red, menadione, H 2 O 2 , and SQ22536 and U0126 [cAMP-dependent protein kinase (cAMP) and mitogen-activated protein kinase (MAPK) signaling pathways inhibitors, respectively] were significantly decreased compared with the other strains. Furthermore, the key genes involved in the cAMP and MAPK signaling pathways, Pka1 , Pka2 , PkaR , Bcg2 , Bcg3 , bmp1 , and bmp3, were significantly upregulated or downregulated in the mutant BCG183. BcKMO expression levels were also upregulated or downregulated in the RNAi mutants of the key genes involved in the cAMP and MAPK signaling pathways. These findings indicated that BcKMO positively regulates growth and development, but negatively regulates pathogenicity of B. cinerea . Furthermore, BcKMO was found to be involved in controlling cell wall degrading enzymes activity, toxins activity, acid production, and cell wall integrity, and participate in cAMP and MAPK signaling pathways of B. cinerea .

Characterization of the Aspergillus niger prtT, a unique regulator of extracellular protease encoding genes

NARCIS (Netherlands)

Punt, P.J.; Schuren, F.H.J.; Lehmbeck, J.; Christensen, T.; Hjort, C.; Hondel, C.A.M.J.J. van den

2008-01-01

Expression of several Aspergillus niger genes encoding major secreted, but not vacuolar, protease genes including the major acid protease gene pepA, was shown to be affected in the previously isolated A. niger protease mutant, AB1.13 [Mattern, I.E., van Noort, J.M., van den Berg, P., Archer, D.A.,

Molecular cloning and expression of the gene encoding the kinetoplast-associated type II DNA topoisomerase of Crithidia fasciculata.

Science.gov (United States)

Pasion, S G; Hines, J C; Aebersold, R; Ray, D S

1992-01-01

A type II DNA topoisomerase, topoIImt, was shown previously to be associated with the kinetoplast DNA of the trypanosomatid Crithidia fasciculata. The gene encoding this kinetoplast-associated topoisomerase has been cloned by immunological screening of a Crithidia genomic expression library with monoclonal antibodies raised against the purified enzyme. The gene CfaTOP2 is a single copy gene and is expressed as a 4.8-kb polyadenylated transcript. The nucleotide sequence of CfaTOP2 has been determined and encodes a predicted polypeptide of 1239 amino acids with a molecular mass of 138,445. The identification of the cloned gene is supported by immunoblot analysis of the beta-galactosidase-CfaTOP2 fusion protein expressed in Escherichia coli and by analysis of tryptic peptide sequences derived from purified topoIImt. CfaTOP2 shares significant homology with nuclear type II DNA topoisomerases of other eukaryotes suggesting that in Crithidia both nuclear and mitochondrial forms of topoisomerase II are encoded by the same gene.

Molecular characterization of genes encoding leucoanthocyanidin reductase involved in proanthocyanidin biosynthesis in apple

Directory of Open Access Journals (Sweden)

Yuepeng eHan

2015-04-01

Full Text Available Proanthocyanidins (PAs are the major component of phenolics in apple, but mechanisms involved in PA biosynthesis remain unclear. Here, the relationship between the PA biosynthesis and the expression of genes encoding leucoanthocyanidin reductase (LAR and anthocyanidin reductase (ANR was investigated in fruit skin of one apple cultivar and three crabapples. Transcript levels of LAR1 and ANR2 genes were significantly correlated with the contents of catechin and epicatechin, respectively, which suggests their active roles in PA synthesis. Surprisingly, transcript levels for both LAR1 and LAR2 genes were almost undetectable in two crabapples that accumulated both flavan-3-ols and PAs. This contradicts the previous finding that LAR1 gene is a strong candidate regulating the accumulation of metabolites such as epicatechin and PAs in apple. Ectopic expression of apple MdLAR1 gene in tobacco suppresses expression of the late genes in anthocyanin biosynthetic pathway, resulting in loss of anthocyanin in flowers. Interestingly, a decrease in PA biosynthesis was also observed in flowers of transgenic tobacco plants overexpressing the MdLAR1 gene, which could be attributed to decreased expression of both the NtANR1 and NtANR2 genes. Our study not only confirms the in vivo function of apple LAR1 gene, but it is also helpful for understanding the mechanism of PA biosynthesis.

Expression of genes encoding multi-transmembrane proteins in specific primate taste cell populations.

Directory of Open Access Journals (Sweden)

Bryan D Moyer

Full Text Available BACKGROUND: Using fungiform (FG and circumvallate (CV taste buds isolated by laser capture microdissection and analyzed using gene arrays, we previously constructed a comprehensive database of gene expression in primates, which revealed over 2,300 taste bud-associated genes. Bioinformatics analyses identified hundreds of genes predicted to encode multi-transmembrane domain proteins with no previous association with taste function. A first step in elucidating the roles these gene products play in gustation is to identify the specific taste cell types in which they are expressed. METHODOLOGY/PRINCIPAL FINDINGS: Using double label in situ hybridization analyses, we identified seven new genes expressed in specific taste cell types, including sweet, bitter, and umami cells (TRPM5-positive, sour cells (PKD2L1-positive, as well as other taste cell populations. Transmembrane protein 44 (TMEM44, a protein with seven predicted transmembrane domains with no homology to GPCRs, is expressed in a TRPM5-negative and PKD2L1-negative population that is enriched in the bottom portion of taste buds and may represent developmentally immature taste cells. Calcium homeostasis modulator 1 (CALHM1, a component of a novel calcium channel, along with family members CALHM2 and CALHM3; multiple C2 domains; transmembrane 1 (MCTP1, a calcium-binding transmembrane protein; and anoctamin 7 (ANO7, a member of the recently identified calcium-gated chloride channel family, are all expressed in TRPM5 cells. These proteins may modulate and effect calcium signalling stemming from sweet, bitter, and umami receptor activation. Synaptic vesicle glycoprotein 2B (SV2B, a regulator of synaptic vesicle exocytosis, is expressed in PKD2L1 cells, suggesting that this taste cell population transmits tastant information to gustatory afferent nerve fibers via exocytic neurotransmitter release. CONCLUSIONS/SIGNIFICANCE: Identification of genes encoding multi-transmembrane domain proteins

Translation of the shallot virus X TGB3 gene depends on non-AUG initiation and leaky scanning.

Science.gov (United States)

Lezzhov, Alexander A; Gushchin, Vladimir A; Lazareva, Ekaterina A; Vishnichenko, Valery K; Morozov, Sergey Y; Solovyev, Andrey G

2015-10-01

Triple gene block (TGB), a conserved gene module found in the genomes of many filamentous and rod-shaped plant viruses, encodes three proteins, TGB1, TGB2 and TGB3, required for viral cell-to-cell movement through plasmodesmata and systemic transport via the phloem. The genome of Shallot virus X, the type species of the genus Allexivirus, includes TGB1 and TGB2 genes, but contains no canonical ORF for TGB3 protein. However, a TGB3-like protein-encoding sequence lacking an AUG initiator codon has been found in the shallot virus X (ShVX) genome in a position typical for TGB3 genes. This putative TGB3 gene is conserved in all allexiviruses. Here, we carried out sequence analysis to predict possible non-AUG initiator codons in the ShVX TGB3-encoding sequence. We further used an agroinfiltration assay in Nicotiana benthamiana to confirm this prediction. Site-directed mutagenesis was used to demonstrate that the ShVX TGB3 could be translated on a bicistronic mRNA template via a leaky scanning mechanism.

Multiple genes encode the major surface glycoprotein of Pneumocystis carinii

DEFF Research Database (Denmark)

Kovacs, J A; Powell, F; Edman, J C

1993-01-01

hydrophobic region at the carboxyl terminus. The presence of multiple related msg genes encoding the major surface glycoprotein of P. carinii suggests that antigenic variation is a possible mechanism for evading host defenses. Further characterization of this family of genes should allow the development......The major surface antigen of Pneumocystis carinii, a life-threatening opportunistic pathogen in human immunodeficiency virus-infected patients, is an abundant glycoprotein that functions in host-organism interactions. A monoclonal antibody to this antigen is protective in animals, and thus...... blot studies using chromosomal or restricted DNA, the major surface glycoproteins are the products of a multicopy family of genes. The predicted protein has an M(r) of approximately 123,000, is relatively rich in cysteine residues (5.5%) that are very strongly conserved, and contains a well conserved...

WRKY domain-encoding genes of a crop legume chickpea (Cicer arietinum): comparative analysis with Medicago truncatula WRKY family and characterization of group-III gene(s).

Science.gov (United States)

Kumar, Kamal; Srivastava, Vikas; Purayannur, Savithri; Kaladhar, V Chandra; Cheruvu, Purnima Jaiswal; Verma, Praveen Kumar

2016-06-01

The WRKY genes have been identified as important transcriptional modulators predominantly during the environmental stresses, but they also play critical role at various stages of plant life cycle. We report the identification of WRKY domain (WD)-encoding genes from galegoid clade legumes chickpea (Cicer arietinum L.) and barrel medic (Medicago truncatula). In total, 78 and 98 WD-encoding genes were found in chickpea and barrel medic, respectively. Comparative analysis suggests the presence of both conserved and unique WRKYs, and expansion of WRKY family in M. truncatula primarily by tandem duplication. Exclusively found in galegoid legumes, CaWRKY16 and its orthologues encode for a novel protein having a transmembrane and partial Exo70 domains flanking a group-III WD. Genomic region of galegoids, having CaWRKY16, is more dynamic when compared with millettioids. In onion cells, fused CaWRKY16-EYFP showed punctate fluorescent signals in cytoplasm. The chickpea WRKY group-III genes were further characterized for their transcript level modulation during pathogenic stress and treatments of abscisic acid, jasmonic acid, and salicylic acid (SA) by real-time PCR. Differential regulation of genes was observed during Ascochyta rabiei infection and SA treatment. Characterization of A. rabiei and SA inducible gene CaWRKY50 showed that it localizes to plant nucleus, binds to W-box, and have a C-terminal transactivation domain. Overexpression of CaWRKY50 in tobacco plants resulted in early flowering and senescence. The in-depth comparative account presented here for two legume WRKY genes will be of great utility in hastening functional characterization of crop legume WRKYs and will also help in characterization of Exo70Js. © The Author 2016. Published by Oxford University Press on behalf of Kazusa DNA Research Institute.

Absence of pepsinogen A3 gene expression in the gastric mucosa of patients with gastric cancer.

OpenAIRE

Kuipers, E J; Peña, A S; Crusius, J B; Defize, J; van der Stoop, P; Meuwissen, S G; Pals, G

1995-01-01

AIMS--To investigate the expression of pepsinogen A3 (Pg3) encoding genes in the gastric mucosa of normal controls and subjects with atrophic gastritis and gastric cancer. METHODS--One hundred and fifty nine patients underwent upper gastrointestinal endoscopy with sampling of gastric biopsy specimens and serum. Pg3 isoproteins were determined by electrophoresis in serum and gastric mucosal biopsy specimens. Pg3 encoding genes were assessed by PCR in DNA obtained from peripheral blood. RESULTS...

Two Paralogous Genes Encoding Auxin Efflux Carrier Differentially Expressed in Bitter Gourd (Momordica charantia

Directory of Open Access Journals (Sweden)

Yi-Li Li

2017-11-01

Full Text Available The phytohormone auxin regulates various developmental programs in plants, including cell growth, cell division and cell differentiation. The auxin efflux carriers are essential for the auxin transport. To show an involvement of auxin transporters in the coordination of fruit development in bitter gourd, a juicy fruit, we isolated novel cDNAs (referred as McPIN encoding putative auxin efflux carriers, including McPIN1, McPIN2 (allele of McPIN1 and McPIN3, from developing fruits of bitter gourd. Both McPIN1 and McPIN3 genes possess six exons and five introns. Hydropathy analysis revealed that both polypeptides have two hydrophobic regions with five transmembrane segments and a predominantly hydrophilic core. Phylogenetic analyses revealed that McPIN1 shared the highest homology to the group of Arabidopsis, cucumber and tomato PIN1, while McPIN3 belonged to another group, including Arabidopsis and tomato PIN3 as well as PIN4. This suggests different roles for McPIN1 and McPIN3 in auxin transport involved in the fruit development of bitter gourd. Maximum mRNA levels for both genes were detected in staminate and pistillate flowers. McPIN1 is expressed in a particular period of early fruit development but McPIN3 continues to be expressed until the last stage of fruit ripening. Moreover, these two genes are auxin-inducible and qualified as early auxin-response genes. Their expression patterns suggest that these two auxin transporter genes play a pivotal role in fruit setting and development.

Dissemination of Genes Encoding Aminoglycoside-Modifying Enzymes and armA Among Enterobacteriaceae Isolates in Northwest Iran.

Science.gov (United States)

Ghotaslou, Reza; Yeganeh Sefidan, Fatemeh; Akhi, Mohammad Taghi; Asgharzadeh, Mohammad; Mohammadzadeh Asl, Yalda

2017-10-01

Enzymatic inactivation is one of the most important mechanisms of resistance to aminoglycosides. The aim of this study was to investigate the prevalence of armA and diversity of the genes encoding aminoglycoside-modifying enzymes (AMEs) and their associations with resistance phenotypes in Enterobacteriaceae isolates. Three hundred and seven Enterobacteriaceae isolates were collected from five hospitals in northwest Iran. The disk diffusion method for amikacin, gentamicin, tobramycin, kanamycin, and streptomycin, as well as the minimum inhibitory concentration for amikacin, gentamicin, tobramycin, and kanamycin were done for susceptibility testing. Thirteen AME genes and armA methylase were screened using the PCR and sequencing assays. Two hundred and twenty (71.7%) of isolates were resistant to aminoglycosides and 155 (70.5%) of them were positive for aminoglycoside resistance genes. The most prevalent AME genes were ant(3″)-Ia and aph(3″)-Ib with the frequency 35.9% and 30.5%, respectively. Also, 21 (9.5%) of resistant isolates were positive for armA methylase gene. The prevalence of resistance to aminoglycoside is high and AME genes frequently are disseminated in Enterobacteriaceae isolates. There is an association between phenotypic resistance and the presence of some aminoglycoside genes.

A plasmid-encoded UmuD homologue regulates expression of Pseudomonas aeruginosa SOS genes.

Science.gov (United States)

Díaz-Magaña, Amada; Alva-Murillo, Nayeli; Chávez-Moctezuma, Martha P; López-Meza, Joel E; Ramírez-Díaz, Martha I; Cervantes, Carlos

2015-07-01

The Pseudomonas aeruginosa plasmid pUM505 contains the umuDC operon that encodes proteins similar to error-prone repair DNA polymerase V. The umuC gene appears to be truncated and its product is probably not functional. The umuD gene, renamed umuDpR, possesses an SOS box overlapped with a Sigma factor 70 type promoter; accordingly, transcriptional fusions revealed that the umuDpR gene promoter is activated by mitomycin C. The predicted sequence of the UmuDpR protein displays 23 % identity with the Ps. aeruginosa SOS-response LexA repressor. The umuDpR gene caused increased MMC sensitivity when transferred to the Ps. aeruginosa PAO1 strain. As expected, PAO1-derived knockout lexA-  mutant PW6037 showed resistance to MMC; however, when the umuDpR gene was transferred to PW6037, MMC resistance level was reduced. These data suggested that UmuDpR represses the expression of SOS genes, as LexA does. To test whether UmuDpR exerts regulatory functions, expression of PAO1 SOS genes was evaluated by reverse transcription quantitative PCR assays in the lexA-  mutant with or without the pUC_umuD recombinant plasmid. Expression of lexA, imuA and recA genes increased 3.4-5.3 times in the lexA-  mutant, relative to transcription of the corresponding genes in the lexA+ strain, but decreased significantly in the lexA- /umuDpR transformant. These results confirmed that the UmuDpR protein is a repressor of Ps. aeruginosa SOS genes controlled by LexA. Electrophoretic mobility shift assays, however, did not show binding of UmuDpR to 5' regions of SOS genes, suggesting an indirect mechanism of regulation.

Biosynthesis of actinorhodin and related antibiotics: discovery of alternative routes for quinone formation encoded in the act gene cluster.

Science.gov (United States)

Okamoto, Susumu; Taguchi, Takaaki; Ochi, Kozo; Ichinose, Koji

2009-02-27

All known benzoisochromanequinone (BIQ) biosynthetic gene clusters carry a set of genes encoding a two-component monooxygenase homologous to the ActVA-ORF5/ActVB system for actinorhodin biosynthesis in Streptomyces coelicolor A3(2). Here, we conducted molecular genetic and biochemical studies of this enzyme system. Inactivation of actVA-ORF5 yielded a shunt product, actinoperylone (ACPL), apparently derived from 6-deoxy-dihydrokalafungin. Similarly, deletion of actVB resulted in accumulation of ACPL, indicating a critical role for the monooxygenase system in C-6 oxygenation, a biosynthetic step common to all BIQ biosyntheses. Furthermore, in vitro, we showed a quinone-forming activity of the ActVA-ORF5/ActVB system in addition to that of a known C-6 monooxygenase, ActVA-ORF6, by using emodinanthrone as a model substrate. Our results demonstrate that the act gene cluster encodes two alternative routes for quinone formation by C-6 oxygenation in BIQ biosynthesis.

aldB, an RpoS-dependent gene in Escherichia coli encoding an aldehyde dehydrogenase that is repressed by Fis and activated by Crp.

OpenAIRE

Xu, J; Johnson, R C

1995-01-01

Escherichia coli aldB was identified as a gene that is negatively regulated by Fis but positively regulated by RpoS. The complete DNA sequence determined in this study indicates that aldB encodes a 56.3-kDa protein which shares a high degree of homology with an acetaldehyde dehydrogenase encoded by acoD of Alcaligenes eutrophus and an aldehyde dehydrogenase encoded by aldA of Vibrio cholerae and significant homology with a group of other aldehyde dehydrogenases from prokaryotes and eukaryotes...

Mutagenesis in sequence encoding of human factor VII for gene therapy of hemophilia

Directory of Open Access Journals (Sweden)

B Kazemi

2009-12-01

Full Text Available "nBackground: Current treatment of hemophilia which is one of the most common bleeding disorders, involves replacement therapy using concentrates of FVIII and FIX .However, these concentrates have been associated with viral infections and thromboembolic complications and development of antibodies. "nThe use of recombinant human factor VII (rhFVII is effective  for the treatment of patients with  hemophilia A or B, who develop antibodies ( referred as inhibitors against  replacement therapy , because it induces coagulation independent of FVIII and FIX. However, its short half-life and high cost have limited its use. One potential solution to this problem may be the use of FVIIa gene transfer, which would attain continuing therapeutic levels of expression from a single injection. The aim of this study was to engineer a novel hFVII (human FVII gene containing a cleavage site for the intracellular protease and furin, by PCR mutagenesis "nMethods: The sequence encoding light and heavy chains of hFVII, were amplified by using hFVII/pTZ57R and specific primers, separately. The PCR products were cloned in pTZ57R vector. "nResults and discussion: Cloning was confirmed by restriction analysis or PCR amplification using specific primers and plasmid universal primers. Mutagenesis of sequence encoding light and heavy chain was confirmed by restriction enzyme. "nConclusion: In the present study, it was provided recombinant plasmids based on mutant form of DNA encoding light and heavy chains.  Joining mutant form of DNA encoding light chain with mutant heavy chain led to a new variant of hFVII. This variant can be activated by furin and an increase in the proportion of activated form of FVII. This mutant form of hFVII may be used for gene therapy of hemophilia.

Chicken genome analysis reveals novel genes encoding biotin-binding proteins related to avidin family

Directory of Open Access Journals (Sweden)

Nordlund Henri R

2005-03-01

Full Text Available Abstract Background A chicken egg contains several biotin-binding proteins (BBPs, whose complete DNA and amino acid sequences are not known. In order to identify and characterise these genes and proteins we studied chicken cDNAs and genes available in the NCBI database and chicken genome database using the reported N-terminal amino acid sequences of chicken egg-yolk BBPs as search strings. Results Two separate hits showing significant homology for these N-terminal sequences were discovered. For one of these hits, the chromosomal location in the immediate proximity of the avidin gene family was found. Both of these hits encode proteins having high sequence similarity with avidin suggesting that chicken BBPs are paralogous to avidin family. In particular, almost all residues corresponding to biotin binding in avidin are conserved in these putative BBP proteins. One of the found DNA sequences, however, seems to encode a carboxy-terminal extension not present in avidin. Conclusion We describe here the predicted properties of the putative BBP genes and proteins. Our present observations link BBP genes together with avidin gene family and shed more light on the genetic arrangement and variability of this family. In addition, comparative modelling revealed the potential structural elements important for the functional and structural properties of the putative BBP proteins.

Identification of genes encoding granule-bound starch synthase involved in amylose metabolism in banana fruit.

Directory of Open Access Journals (Sweden)

Hongxia Miao

Full Text Available Granule-bound starch synthase (GBSS is responsible for amylose synthesis, but the role of GBSS genes and their encoded proteins remains poorly understood in banana. In this study, amylose content and GBSS activity gradually increased during development of the banana fruit, and decreased during storage of the mature fruit. GBSS protein in banana starch granules was approximately 55.0 kDa. The protein was up-regulated expression during development while it was down-regulated expression during storage. Six genes, designated as MaGBSSI-1, MaGBSSI-2, MaGBSSI-3, MaGBSSI-4, MaGBSSII-1, and MaGBSSII-2, were cloned and characterized from banana fruit. Among the six genes, the expression pattern of MaGBSSI-3 was the most consistent with the changes in amylose content, GBSS enzyme activity, GBSS protein levels, and the quantity or size of starch granules in banana fruit. These results suggest that MaGBSSI-3 might regulate amylose metabolism by affecting the variation of GBSS levels and the quantity or size of starch granules in banana fruit during development or storage.

Identification of Genes Encoding Granule-Bound Starch Synthase Involved in Amylose Metabolism in Banana Fruit

Science.gov (United States)

Liu, Weixin; Xu, Biyu; Jin, Zhiqiang

2014-01-01

Granule-bound starch synthase (GBSS) is responsible for amylose synthesis, but the role of GBSS genes and their encoded proteins remains poorly understood in banana. In this study, amylose content and GBSS activity gradually increased during development of the banana fruit, and decreased during storage of the mature fruit. GBSS protein in banana starch granules was approximately 55.0 kDa. The protein was up-regulated expression during development while it was down-regulated expression during storage. Six genes, designated as MaGBSSI-1, MaGBSSI-2, MaGBSSI-3, MaGBSSI-4, MaGBSSII-1, and MaGBSSII-2, were cloned and characterized from banana fruit. Among the six genes, the expression pattern of MaGBSSI-3 was the most consistent with the changes in amylose content, GBSS enzyme activity, GBSS protein levels, and the quantity or size of starch granules in banana fruit. These results suggest that MaGBSSI-3 might regulate amylose metabolism by affecting the variation of GBSS levels and the quantity or size of starch granules in banana fruit during development or storage. PMID:24505384

Cloning and sequencing of a gene encoding a 21-kilodalton outer membrane protein from Bordetella avium and expression of the gene in Salmonella typhimurium.

Science.gov (United States)

Gentry-Weeks, C R; Hultsch, A L; Kelly, S M; Keith, J M; Curtiss, R

1992-01-01

Three gene libraries of Bordetella avium 197 DNA were prepared in Escherichia coli LE392 by using the cosmid vectors pCP13 and pYA2329, a derivative of pCP13 specifying spectinomycin resistance. The cosmid libraries were screened with convalescent-phase anti-B. avium turkey sera and polyclonal rabbit antisera against B. avium 197 outer membrane proteins. One E. coli recombinant clone produced a 56-kDa protein which reacted with convalescent-phase serum from a turkey infected with B. avium 197. In addition, five E. coli recombinant clones were identified which produced B. avium outer membrane proteins with molecular masses of 21, 38, 40, 43, and 48 kDa. At least one of these E. coli clones, which encoded the 21-kDa protein, reacted with both convalescent-phase turkey sera and antibody against B. avium 197 outer membrane proteins. The gene for the 21-kDa outer membrane protein was localized by Tn5seq1 mutagenesis, and the nucleotide sequence was determined by dideoxy sequencing. DNA sequence analysis of the 21-kDa protein revealed an open reading frame of 582 bases that resulted in a predicted protein of 194 amino acids. Comparison of the predicted amino acid sequence of the gene encoding the 21-kDa outer membrane protein with protein sequences in the National Biomedical Research Foundation protein sequence data base indicated significant homology to the OmpA proteins of Shigella dysenteriae, Enterobacter aerogenes, E. coli, and Salmonella typhimurium and to Neisseria gonorrhoeae outer membrane protein III, Haemophilus influenzae protein P6, and Pseudomonas aeruginosa porin protein F. The gene (ompA) encoding the B. avium 21-kDa protein hybridized with 4.1-kb DNA fragments from EcoRI-digested, chromosomal DNA of Bordetella pertussis and Bordetella bronchiseptica and with 6.0- and 3.2-kb DNA fragments from EcoRI-digested, chromosomal DNA of B. avium and B. avium-like DNA, respectively. A 6.75-kb DNA fragment encoding the B. avium 21-kDa protein was subcloned into the

[Effect of melafen on expression of Elip1 and Elip2 genes encoding chloroplast light-induced stress proteins in barley].

Science.gov (United States)

Osipenkova, O V; Ermokhina, O V; Belkina, G G; Oleskina, Iu P; Fattakhov, S G; Iurina, N P

2008-01-01

The effect of melafen, a plant growth regulator of a new generation, on the growth, pigment composition, and expression of nuclear genes Elip1 and Elip2 encoding chloroplast light-stress proteins in barley (Hordeum vulgare L) seedlings was studied. It is shown that the height of seedlings treated with melafen at concentrations of 0.5 x 10(-10) and 0.5 x 10(-8) M increased by approximately 10 and 20%, respectively, as compared to the control. At high concentrations (10(-5) and 10(-3) M), melafen had no effect on the growth of seedlings. The content of chlorophylls and carotenoids in chloroplasts barely differed from the control at all melafen concentrations tested. Reverse transcription-polymerase chain reaction (RT-PCR) showed that melafen did not influence the expression of the nuclear gene encoding the low-molecular-weight plastid stress protein ELIP1. At the same time, the expression of the nuclear gene encoding the high-molecular-weight light-inducible stress protein ELIP2 in the plants treated with melafen at a concentration of 0.5 x 10(-8) M, increased by approximately 70 %. At higher concentrations, melafen suppressed the Elip2 gene expression. Thus, melafen affects the expression of the Elip2 gene, which is involved in the regulation of chlorophyll synthesis and chloroplast biogenesis, which, in turn, may lead to changes in the resistance of plants to light-induced stress.

Phylogenetic analysis of fungal heterotrimeric G protein-encoding genes and their expression during dimorphism in Mucor circinelloides.

Science.gov (United States)

Valle-Maldonado, Marco Iván; Jácome-Galarza, Irvin Eduardo; Díaz-Pérez, Alma Laura; Martínez-Cadena, Guadalupe; Campos-García, Jesús; Ramírez-Díaz, Martha Isela; Reyes-De la Cruz, Homero; Riveros-Rosas, Héctor; Díaz-Pérez, César; Meza-Carmen, Víctor

2015-12-01

In fungi, heterotrimeric G proteins are key regulators of biological processes such as mating, virulence, morphology, among others. Mucor circinelloides is a model organism for many biological processes, and its genome contains the largest known repertoire of genes that encode putative heterotrimeric G protein subunits in the fungal kingdom: twelve Gα (McGpa1-12), three Gβ (McGpb1-3), and three Gγ (McGpg1-3). Phylogenetic analysis of fungal Gα showed that they are divided into four distinct groups as reported previously. Fungal Gβ and Gγ are also divided into four phylogenetic groups, and to our understanding this is the first report of a phylogenetic classification for fungal Gβ and Gγ subunits. Almost all genes that encode putative heterotrimeric G subunits in M. circinelloides are differentially expressed during dimorphic growth, except for McGpg1 (Gγ) that showed very low mRNA levels at all developmental stages. Moreover, several of the subunits are expressed in a similar pattern and at the same level, suggesting that they constitute discrete complexes. For example, McGpb3 (Gβ), and McGpg2 (Gγ), are co-expressed during mycelium growth, and McGpa1, McGpb2, and McGpg2, are co-expressed during yeast development. These findings provide the conceptual framework to study the biological role of these genes during M. circinelloides morphogenesis. Copyright © 2015 The British Mycological Society. Published by Elsevier Ltd. All rights reserved.

The rgg0182 gene encodes a transcriptional regulator required for the full Streptococcus thermophilus LMG18311 thermal adaptation.

Science.gov (United States)

Henry, Romain; Bruneau, Emmanuelle; Gardan, Rozenn; Bertin, Stéphane; Fleuchot, Betty; Decaris, Bernard; Leblond-Bourget, Nathalie

2011-10-07

Streptococcus thermophilus is an important starter strain for the production of yogurt and cheeses. The analysis of sequenced genomes of four strains of S. thermophilus indicates that they contain several genes of the rgg familly potentially encoding transcriptional regulators. Some of the Rgg proteins are known to be involved in bacterial stress adaptation. In this study, we demonstrated that Streptococcus thermophilus thermal stress adaptation required the rgg0182 gene which transcription depends on the culture medium and the growth temperature. This gene encoded a protein showing similarity with members of the Rgg family transcriptional regulator. Our data confirmed that Rgg0182 is a transcriptional regulator controlling the expression of its neighboring genes as well as chaperones and proteases encoding genes. Therefore, analysis of a Δrgg0182 mutant revealed that this protein played a role in the heat shock adaptation of Streptococcus thermophilus LMG18311. These data showed the importance of the Rgg0182 transcriptional regulator on the survival of S. thermophilus during dairy processes and more specifically during changes in temperature.

The rgg0182 gene encodes a transcriptional regulator required for the full Streptococcus thermophilus LMG18311 thermal adaptation

Directory of Open Access Journals (Sweden)

Bertin Stéphane

2011-10-01

Full Text Available Abstract Background Streptococcus thermophilus is an important starter strain for the production of yogurt and cheeses. The analysis of sequenced genomes of four strains of S. thermophilus indicates that they contain several genes of the rgg familly potentially encoding transcriptional regulators. Some of the Rgg proteins are known to be involved in bacterial stress adaptation. Results In this study, we demonstrated that Streptococcus thermophilus thermal stress adaptation required the rgg0182 gene which transcription depends on the culture medium and the growth temperature. This gene encoded a protein showing similarity with members of the Rgg family transcriptional regulator. Our data confirmed that Rgg0182 is a transcriptional regulator controlling the expression of its neighboring genes as well as chaperones and proteases encoding genes. Therefore, analysis of a Δrgg0182 mutant revealed that this protein played a role in the heat shock adaptation of Streptococcus thermophilus LMG18311. Conclusions These data showed the importance of the Rgg0182 transcriptional regulator on the survival of S. thermophilus during dairy processes and more specifically during changes in temperature.

Transcriptome Analysis Revealed Highly Expressed Genes Encoding Secondary Metabolite Pathways and Small Cysteine-Rich Proteins in the Sclerotium of Lignosus rhinocerotis.

Directory of Open Access Journals (Sweden)

Hui-Yeng Y Yap

Full Text Available Lignosus rhinocerotis (Cooke Ryvarden (tiger milk mushroom has long been known for its nutritional and medicinal benefits among the local communities in Southeast Asia. However, the molecular and genetic basis of its medicinal and nutraceutical properties at transcriptional level have not been investigated. In this study, the transcriptome of L. rhinocerotis sclerotium, the part with medicinal value, was analyzed using high-throughput Illumina HiSeqTM platform with good sequencing quality and alignment results. A total of 3,673, 117, and 59,649 events of alternative splicing, novel transcripts, and SNP variation were found to enrich its current genome database. A large number of transcripts were expressed and involved in the processing of gene information and carbohydrate metabolism. A few highly expressed genes encoding the cysteine-rich cerato-platanin, hydrophobins, and sugar-binding lectins were identified and their possible roles in L. rhinocerotis were discussed. Genes encoding enzymes involved in the biosynthesis of glucans, six gene clusters encoding four terpene synthases and one each of non-ribosomal peptide synthetase and polyketide synthase, and 109 transcribed cytochrome P450 sequences were also identified in the transcriptome. The data from this study forms a valuable foundation for future research in the exploitation of this mushroom in pharmacological and industrial applications.

The euryhaline yeast Debaryomyces hansenii has two catalase genes encoding enzymes with differential activity profile.

Science.gov (United States)

Segal-Kischinevzky, Claudia; Rodarte-Murguía, Beatriz; Valdés-López, Victor; Mendoza-Hernández, Guillermo; González, Alicia; Alba-Lois, Luisa

2011-03-01

Debaryomyces hansenii is a spoilage yeast able to grow in a variety of ecological niches, from seawater to dairy products. Results presented in this article show that (i) D. hansenii has an inherent resistance to H2O2 which could be attributed to the fact that this yeast has a basal catalase activity which is several-fold higher than that observed in Saccharomyces cerevisiae under the same culture conditions, (ii) D. hansenii has two genes (DhCTA1 and DhCTT1) encoding two catalase isozymes with a differential enzymatic activity profile which is not strictly correlated with a differential expression profile of the encoding genes.

Omega-3 fatty acid desaturase gene family from two ω-3 sources, Salvia hispanica and Perilla frutescens: Cloning, characterization and expression.

Directory of Open Access Journals (Sweden)

Yufei Xue

Full Text Available Omega-3 fatty acid desaturase (ω-3 FAD, D15D is a key enzyme for α-linolenic acid (ALA biosynthesis. Both chia (Salvia hispanica and perilla (Perilla frutescens contain high levels of ALA in seeds. In this study, the ω-3 FAD gene family was systematically and comparatively cloned from chia and perilla. Perilla FAD3, FAD7, FAD8 and chia FAD7 are encoded by single-copy (but heterozygous genes, while chia FAD3 is encoded by 2 distinct genes. Only 1 chia FAD8 sequence was isolated. In these genes, there are 1 to 6 transcription start sites, 1 to 8 poly(A tailing sites, and 7 introns. The 5'UTRs of PfFAD8a/b contain 1 to 2 purine-stretches and 2 pyrimidine-stretches. An alternative splice variant of ShFAD7a/b comprises a 5'UTR intron. Their encoded proteins harbor an FA_desaturase conserved domain together with 4 trans-membrane helices and 3 histidine boxes. Phylogenetic analysis validated their identity of dicot microsomal or plastidial ω-3 FAD proteins, and revealed some important evolutionary features of plant ω-3 FAD genes such as convergent evolution across different phylums, single-copy status in algae, and duplication events in certain taxa. The qRT-PCR assay showed that the ω-3 FAD genes of two species were expressed at different levels in various organs, and they also responded to multiple stress treatments. The functionality of the ShFAD3 and PfFAD3 enzymes was confirmed by yeast expression. The systemic molecular and functional features of the ω-3 FAD gene family from chia and perilla revealed in this study will facilitate their use in future studies on genetic improvement of ALA traits in oilseed crops.

Omega-3 fatty acid desaturase gene family from two ω-3 sources, Salvia hispanica and Perilla frutescens: Cloning, characterization and expression

Science.gov (United States)

Xue, Yufei; Chen, Baojun; Win, Aung Naing; Fu, Chun; Lian, Jianping; Liu, Xue; Wang, Rui; Zhang, Xingcui

2018-01-01

Omega-3 fatty acid desaturase (ω-3 FAD, D15D) is a key enzyme for α-linolenic acid (ALA) biosynthesis. Both chia (Salvia hispanica) and perilla (Perilla frutescens) contain high levels of ALA in seeds. In this study, the ω-3 FAD gene family was systematically and comparatively cloned from chia and perilla. Perilla FAD3, FAD7, FAD8 and chia FAD7 are encoded by single-copy (but heterozygous) genes, while chia FAD3 is encoded by 2 distinct genes. Only 1 chia FAD8 sequence was isolated. In these genes, there are 1 to 6 transcription start sites, 1 to 8 poly(A) tailing sites, and 7 introns. The 5’UTRs of PfFAD8a/b contain 1 to 2 purine-stretches and 2 pyrimidine-stretches. An alternative splice variant of ShFAD7a/b comprises a 5’UTR intron. Their encoded proteins harbor an FA_desaturase conserved domain together with 4 trans-membrane helices and 3 histidine boxes. Phylogenetic analysis validated their identity of dicot microsomal or plastidial ω-3 FAD proteins, and revealed some important evolutionary features of plant ω-3 FAD genes such as convergent evolution across different phylums, single-copy status in algae, and duplication events in certain taxa. The qRT-PCR assay showed that the ω-3 FAD genes of two species were expressed at different levels in various organs, and they also responded to multiple stress treatments. The functionality of the ShFAD3 and PfFAD3 enzymes was confirmed by yeast expression. The systemic molecular and functional features of the ω-3 FAD gene family from chia and perilla revealed in this study will facilitate their use in future studies on genetic improvement of ALA traits in oilseed crops. PMID:29351555

A DNMT3B alternatively spliced exon and encoded peptide are novel biomarkers of human pluripotent stem cells.

Directory of Open Access Journals (Sweden)

Sailesh Gopalakrishna-Pillai

Full Text Available A major obstacle in human stem cell research is the limited number of reagents capable of distinguishing pluripotent stem cells from partially differentiated or incompletely reprogrammed derivatives. Although human embryonic stem cells (hESCs and induced pluripotent stem cells (iPSCs express numerous alternatively spliced transcripts, little attention has been directed at developing splice variant-encoded protein isoforms as reagents for stem cell research. In this study, several genes encoding proteins involved in important signaling pathways were screened to detect alternatively spliced transcripts that exhibited differential expression in pluripotent stem cells (PSCs relative to spontaneously differentiated cells (SDCs. Transcripts containing the alternatively spliced exon 10 of the de novo DNA methyltransferase gene, DNMT3B, were identified that are expressed in PSCs. To demonstrate the utility and superiority of splice variant specific reagents for stem cell research, a peptide encoded by DNMT3B exon 10 was used to generate an antibody, SG1. The SG1 antibody detects a single DNMT3B protein isoform that is expressed only in PSCs but not in SDCs. The SG1 antibody is also demonstrably superior to other antibodies at distinguishing PSCs from SDCs in mixed cultures containing both pluripotent stem cells and partially differentiated derivatives. The tightly controlled down regulation of DNMT3B exon 10 containing transcripts (and exon 10 encoded peptide upon spontaneous differentiation of PSCs suggests that this DNMT3B splice isoform is characteristic of the pluripotent state. Alternatively spliced exons, and the proteins they encode, represent a vast untapped reservoir of novel biomarkers that can be used to develop superior reagents for stem cell research and to gain further insight into mechanisms controlling stem cell pluripotency.

Cloning, characterization, expression analysis and inhibition studies of a novel gene encoding Bowman-Birk type protease inhibitor from rice bean

Science.gov (United States)

This paper presents the first study describing the isolation, cloning and characterization of a full length gene encoding Bowman-Birk protease inhibitor (RbTI) from rice bean (Vigna umbellata). A full-length protease inhibitor gene with complete open reading frame of 327bp encoding 109 amino acids w...

Nuclear scaffold attachment sites within ENCODE regions associate with actively transcribed genes.

Directory of Open Access Journals (Sweden)

Mignon A Keaton

2011-03-01

Full Text Available The human genome must be packaged and organized in a functional manner for the regulation of DNA replication and transcription. The nuclear scaffold/matrix, consisting of structural and functional nuclear proteins, remains after extraction of nuclei and anchors loops of DNA. In the search for cis-elements functioning as chromatin domain boundaries, we identified 453 nuclear scaffold attachment sites purified by lithium-3,5-iodosalicylate extraction of HeLa nuclei across 30 Mb of the human genome studied by the ENCODE pilot project. The scaffold attachment sites mapped predominately near expressed genes and localized near transcription start sites and the ends of genes but not to boundary elements. In addition, these regions were enriched for RNA polymerase II and transcription factor binding sites and were located in early replicating regions of the genome. We believe these sites correspond to genome-interactions mediated by transcription factors and transcriptional machinery immobilized on a nuclear substructure.

The Schizosaccharomyces pombe mam1 gene encodes an ABC transporter mediating secretion of M-factor

DEFF Research Database (Denmark)

Christensen, P U; Davey, William John; Nielsen, O

1997-01-01

In the fission yeast Schizosaccharomyces pombe, cells of opposite mating type communicate via diffusible peptide pheromones prior to mating. We have cloned the S. pombe mam1 gene, which encodes a 1336-amino acid protein belonging to the ATP-binding cassette (ABC) superfamily. The mam1 gene is onl...

Silencing of the PiAvr3a effector-encoding gene from Phytophthora infestans by transcriptional fusion to a short interspersed element.

Science.gov (United States)

Vetukuri, Ramesh R; Tian, Zhendong; Avrova, Anna O; Savenkov, Eugene I; Dixelius, Christina; Whisson, Stephen C

2011-12-01

Phytophthora infestans is the notorious oomycete causing late blight of potato and tomato. A large proportion of the P. infestans genome is composed of transposable elements, the activity of which may be controlled by RNA silencing. Accumulation of small RNAs is one of the hallmarks of RNA silencing. Here we demonstrate the presence of small RNAs corresponding to the sequence of a short interspersed retrotransposable element (SINE) suggesting that small RNAs might be involved in silencing of SINEs in P. infestans. This notion was exploited to develop novel tools for gene silencing in P. infestans by engineering transcriptional fusions of the PiAvr3a gene, encoding an RXLR avirulence effector, to the infSINEm retroelement. Transgenic P. infestans lines expressing either 5'-infSINEm::PiAvr3a-3' or 5'-PiAvr3a::SINEm-3' chimeric transcripts initially exhibited partial silencing of PiAvr3a. Over time, PiAvr3a either recovered wild type transcript levels in some lines, or became fully silenced in others. Introduction of an inverted repeat construct was also successful in yielding P. infestans transgenic lines silenced for PiAvr3a. In contrast, constructs expressing antisense or aberrant RNA transcripts failed to initiate silencing of PiAvr3a. Lines exhibiting the most effective silencing of PiAvr3a were either weakly or non-pathogenic on susceptible potato cv. Bintje. This study expands the repertoire of reverse genetics tools available for P. infestans research, and provides insights into a possible mode of variation in effector expression through spread of silencing from adjacent retroelements. Crown Copyright © 2011. Published by Elsevier Ltd. All rights reserved.

[Cloning, mutagenesis and symbiotic phenotype of three lipid transfer protein encoding genes from Mesorhizobium huakuii 7653R].

Science.gov (United States)

Li, Yanan; Zeng, Xiaobo; Zhou, Xuejuan; Li, Youguo

2016-12-04

Lipid transfer protein superfamily is involved in lipid transport and metabolism. This study aimed to construct mutants of three lipid transfer protein encoding genes in Mesorhizobium huakuii 7653R, and to study the phenotypes and function of mutations during symbiosis with Astragalus sinicus. We used bioinformatics to predict structure characteristics and biological functions of lipid transfer proteins, and conducted semi-quantitative and fluorescent quantitative real-time PCR to analyze the expression levels of target genes in free-living and symbiotic conditions. Using pK19mob insertion mutagenesis to construct mutants, we carried out pot plant experiments to observe symbiotic phenotypes. MCHK-5577, MCHK-2172 and MCHK-2779 genes encoding proteins belonged to START/RHO alpha_C/PITP/Bet_v1/CoxG/CalC (SRPBCC) superfamily, involved in lipid transport or metabolism, and were identical to M. loti at 95% level. Gene relative transcription level of the three genes all increased compared to free-living condition. We obtained three mutants. Compared with wild-type 7653R, above-ground biomass of plants and nodulenitrogenase activity induced by the three mutants significantly decreased. Results indicated that lipid transfer protein encoding genes of Mesorhizobium huakuii 7653R may play important roles in symbiotic nitrogen fixation, and the mutations significantly affected the symbiotic phenotypes. The present work provided a basis to study further symbiotic function mechanism associated with lipid transfer proteins from rhizobia.

Functions, structure, and read-through alternative splicing of feline APOBEC3 genes

Science.gov (United States)

Münk, Carsten; Beck, Thomas; Zielonka, Jörg; Hotz-Wagenblatt, Agnes; Chareza, Sarah; Battenberg, Marion; Thielebein, Jens; Cichutek, Klaus; Bravo, Ignacio G; O'Brien, Stephen J; Lochelt, Martin; Yuhki, Naoya

2008-01-01

Background Over the past years a variety of host restriction genes have been identified in human and mammals that modulate retrovirus infectivity, replication, assembly, and/or cross-species transmission. Among these host-encoded restriction factors, the APOBEC3 (A3; apolipoprotein B mRNA-editing catalytic polypeptide 3) proteins are potent inhibitors of retroviruses and retrotransposons. While primates encode seven of these genes (A3A to A3H), rodents carry only a single A3 gene. Results Here we identified and characterized several A3 genes in the genome of domestic cat (Felis catus) by analyzing the genomic A3 locus. The cat genome presents one A3H gene and three very similar A3C genes (a-c), probably generated after two consecutive gene duplications. In addition to these four one-domain A3 proteins, a fifth A3, designated A3CH, is expressed by read-through alternative splicing. Specific feline A3 proteins selectively inactivated only defined genera of feline retroviruses: Bet-deficient feline foamy virus was mainly inactivated by feA3Ca, feA3Cb, and feA3Cc, while feA3H and feA3CH were only weakly active. The infectivity of Vif-deficient feline immunodeficiency virus and feline leukemia virus was reduced only by feA3H and feA3CH, but not by any of the feA3Cs. Within Felidae, A3C sequences show significant adaptive selection, but unexpectedly, the A3H sequences present more sites that are under purifying selection. Conclusion Our data support a complex evolutionary history of expansion, divergence, selection and individual extinction of antiviral A3 genes that parallels the early evolution of Placentalia, becoming more intricate in taxa in which the arms race between host and retroviruses is harsher. PMID:18315870

The Sporothrix schenckii Gene Encoding for the Ribosomal Protein L6 Has Constitutive and Stable Expression and Works as an Endogenous Control in Gene Expression Analysis

Directory of Open Access Journals (Sweden)

Elías Trujillo-Esquivel

2017-09-01

Full Text Available Sporothrix schenckii is one of the causative agents of sporotrichosis, a worldwide-distributed mycosis that affects humans and other mammals. The interest in basic and clinical features of this organism has significantly increased in the last years, yet little progress in molecular aspects has been reported. Gene expression analysis is a set of powerful tools that helps to assess the cell response to changes in the extracellular environment, the genetic networks controlling metabolic pathways, and the adaptation to different growth conditions. Most of the quantitative methodologies used nowadays require data normalization, and this is achieved measuring the expression of endogenous control genes. Reference genes, whose expression is assumed to suffer minimal changes regardless the cell morphology, the stage of the cell cycle or the presence of harsh extracellular conditions are commonly used as controls in Northern blotting assays, microarrays, and semi-quantitative or quantitative RT-PCR. Since the biology of the organisms is usually species specific, it is difficult to find a reliable group of universal genes that can be used as controls for data normalization in experiments addressing the gene expression, regardless the taxonomic classification of the organism under study. Here, we compared the transcriptional stability of the genes encoding for elongation factor 1A, Tfc1, a protein involved in transcription initiation on Pol III promoters, ribosomal protein L6, histone H2A, β-actin, β-tubulin, glyceraldehyde 3-phosphate dehydrogenase, UAF30, the upstream activating factor 30, and the transcription initiation factor TFIID subunit 10, during the fungal growth in different culture media and cell morphologies. Our results indicated that only the gene encoding for the ribosomal protein L6 showed a stable and constant expression. Furthermore, it displayed not transcriptional changes when S. schenckii infected larvae of Galleria mellonella or

Chromosome locations of genes encoding human signal transduction adapter proteins, Nck (NCK), Shc (SHC1), and Grb2 (GRB2)

DEFF Research Database (Denmark)

Huebner, K; Kastury, K; Druck, T

1994-01-01

"adapter" proteins, which are involved in transducing signals from receptor tyrosine kinases to downstream signal recipients such as ras, because adaptor protein genes could also, logically, serve as targets of mutation, rearrangement, or other aberration in disease. Therefore, DNAs from panels of rodent-human......Abnormalities due to chromosomal aberration or point mutation in gene products of growth factor receptors or in ras gene products, which lie on the same signaling pathway, can cause disease in animals and humans. Thus, it can be important to determine chromosomal map positions of genes encoding...... hybrids carrying defined complements of human chromosomes were assayed for the presence of the cognate genes for NCK, SHC, and GRB2, three SH2 or SH2/SH3 (Src homology 2 and 3) domain-containing adapter proteins. Additionally, NCK and SHC genes were more narrowly localized by chromosomal in situ...

The Phytophthora sojae avirulence locus Avr3c encodes a multi-copy RXLR effector with sequence polymorphisms among pathogen strains.

Directory of Open Access Journals (Sweden)

Suomeng Dong

Full Text Available Root and stem rot disease of soybean is caused by the oomycete Phytophthora sojae. The avirulence (Avr genes of P. sojae control race-cultivar compatibility. In this study, we identify the P. sojae Avr3c gene and show that it encodes a predicted RXLR effector protein of 220 amino acids. Sequence and transcriptional data were compared for predicted RXLR effectors occurring in the vicinity of Avr4/6, as genetic linkage of Avr3c and Avr4/6 was previously suggested. Mapping of DNA markers in a F(2 population was performed to determine whether selected RXLR effector genes co-segregate with the Avr3c phenotype. The results pointed to one RXLR candidate gene as likely to encode Avr3c. This was verified by testing selected genes by a co-bombardment assay on soybean plants with Rps3c, thus demonstrating functionality and confirming the identity of Avr3c. The Avr3c gene together with eight other predicted genes are part of a repetitive segment of 33.7 kb. Three near-identical copies of this segment occur in a tandem array. In P. sojae strain P6497, two identical copies of Avr3c occur within the repeated segments whereas the third copy of this RXLR effector has diverged in sequence. The Avr3c gene is expressed during the early stages of infection in all P. sojae strains examined. Virulent alleles of Avr3c that differ in amino acid sequence were identified in other strains of P. sojae. Gain of virulence was acquired through mutation and subsequent sequence exchanges between the two copies of Avr3c. The results illustrate the importance of segmental duplications and RXLR effector evolution in the control of race-cultivar compatibility in the P. sojae and soybean interaction.

Multi-species sequence comparison reveals conservation of ghrelin gene-derived splice variants encoding a truncated ghrelin peptide.

Science.gov (United States)

Seim, Inge; Jeffery, Penny L; Thomas, Patrick B; Walpole, Carina M; Maugham, Michelle; Fung, Jenny N T; Yap, Pei-Yi; O'Keeffe, Angela J; Lai, John; Whiteside, Eliza J; Herington, Adrian C; Chopin, Lisa K

2016-06-01

The peptide hormone ghrelin is a potent orexigen produced predominantly in the stomach. It has a number of other biological actions, including roles in appetite stimulation, energy balance, the stimulation of growth hormone release and the regulation of cell proliferation. Recently, several ghrelin gene splice variants have been described. Here, we attempted to identify conserved alternative splicing of the ghrelin gene by cross-species sequence comparisons. We identified a novel human exon 2-deleted variant and provide preliminary evidence that this splice variant and in1-ghrelin encode a C-terminally truncated form of the ghrelin peptide, termed minighrelin. These variants are expressed in humans and mice, demonstrating conservation of alternative splicing spanning 90 million years. Minighrelin appears to have similar actions to full-length ghrelin, as treatment with exogenous minighrelin peptide stimulates appetite and feeding in mice. Forced expression of the exon 2-deleted preproghrelin variant mirrors the effect of the canonical preproghrelin, stimulating cell proliferation and migration in the PC3 prostate cancer cell line. This is the first study to characterise an exon 2-deleted preproghrelin variant and to demonstrate sequence conservation of ghrelin gene-derived splice variants that encode a truncated ghrelin peptide. This adds further impetus for studies into the alternative splicing of the ghrelin gene and the function of novel ghrelin peptides in vertebrates.

Maternally expressed gene 3, an imprinted noncoding RNA gene, is associated with meningioma pathogenesis and progression.

Science.gov (United States)

Zhang, Xun; Gejman, Roger; Mahta, Ali; Zhong, Ying; Rice, Kimberley A; Zhou, Yunli; Cheunsuchon, Pornsuk; Louis, David N; Klibanski, Anne

2010-03-15

Meningiomas are common tumors, representing 15% to 25% of all central nervous system tumors. NF2 gene inactivation on chromosome 22 has been shown as an early event in tumorigenesis; however, few factors underlying tumor growth and progression have been identified. The chromosomal abnormalities of 14q32 are often associated with meningioma pathogenesis and progression; therefore, it has been proposed that an as yet unidentified tumor suppressor is present at this locus. Maternally expressed gene 3 (MEG3) is an imprinted gene located at 14q32 which encodes a noncoding RNA with an antiproliferative function. We found that MEG3 mRNA is highly expressed in normal arachnoidal cells. However, MEG3 is not expressed in the majority of human meningiomas or the human meningioma cell lines IOMM-Lee and CH157-MN. There is a strong association between loss of MEG3 expression and tumor grade. Allelic loss at the MEG3 locus is also observed in meningiomas, with increasing prevalence in higher grade tumors. In addition, there is an increase in CpG methylation within the promoter and the imprinting control region of MEG3 gene in meningiomas. Functionally, MEG3 suppresses DNA synthesis in both IOMM-Lee and CH157-MN cells by approximately 60% in bromodeoxyuridine incorporation assays. Colony-forming efficiency assays show that MEG3 inhibits colony formation in CH157-MN cells by approximately 80%. Furthermore, MEG3 stimulates p53-mediated transactivation in these cell lines. Therefore, these data are consistent with the hypothesis that MEG3, which encodes a noncoding RNA, may be a tumor suppressor gene at chromosome 14q32 involved in meningioma progression via a novel mechanism.

Identification and characterisation of the angiotensin converting enzyme-3 (ACE3 gene: a novel mammalian homologue of ACE

Directory of Open Access Journals (Sweden)

Phelan Anne

2007-06-01

Full Text Available Abstract Background Mammalian angiotensin converting enzyme (ACE plays a key role in blood pressure regulation. Although multiple ACE-like proteins exist in non-mammalian organisms, to date only one other ACE homologue, ACE2, has been identified in mammals. Results Here we report the identification and characterisation of the gene encoding a third homologue of ACE, termed ACE3, in several mammalian genomes. The ACE3 gene is located on the same chromosome downstream of the ACE gene. Multiple sequence alignment and molecular modelling have been employed to characterise the predicted ACE3 protein. In mouse, rat, cow and dog, the predicted protein has mutations in some of the critical residues involved in catalysis, including the catalytic Glu in the HEXXH zinc binding motif which is Gln, and ESTs or reverse-transcription PCR indicate that the gene is expressed. In humans, the predicted ACE3 protein has an intact HEXXH motif, but there are other deletions and insertions in the gene and no ESTs have been identified. Conclusion In the genomes of several mammalian species there is a gene that encodes a novel, single domain ACE-like protein, ACE3. In mouse, rat, cow and dog ACE3, the catalytic Glu is replaced by Gln in the putative zinc binding motif, indicating that in these species ACE3 would lack catalytic activity as a zinc metalloprotease. In humans, no evidence was found that the ACE3 gene is expressed and the presence of deletions and insertions in the sequence indicate that ACE3 is a pseudogene.

Coevolution between Nuclear-Encoded DNA Replication, Recombination, and Repair Genes and Plastid Genome Complexity.

Science.gov (United States)

Zhang, Jin; Ruhlman, Tracey A; Sabir, Jamal S M; Blazier, John Chris; Weng, Mao-Lun; Park, Seongjun; Jansen, Robert K

2016-02-17

Disruption of DNA replication, recombination, and repair (DNA-RRR) systems has been hypothesized to cause highly elevated nucleotide substitution rates and genome rearrangements in the plastids of angiosperms, but this theory remains untested. To investigate nuclear-plastid genome (plastome) coevolution in Geraniaceae, four different measures of plastome complexity (rearrangements, repeats, nucleotide insertions/deletions, and substitution rates) were evaluated along with substitution rates of 12 nuclear-encoded, plastid-targeted DNA-RRR genes from 27 Geraniales species. Significant correlations were detected for nonsynonymous (dN) but not synonymous (dS) substitution rates for three DNA-RRR genes (uvrB/C, why1, and gyrA) supporting a role for these genes in accelerated plastid genome evolution in Geraniaceae. Furthermore, correlation between dN of uvrB/C and plastome complexity suggests the presence of nucleotide excision repair system in plastids. Significant correlations were also detected between plastome complexity and 13 of the 90 nuclear-encoded organelle-targeted genes investigated. Comparisons revealed significant acceleration of dN in plastid-targeted genes of Geraniales relative to Brassicales suggesting this correlation may be an artifact of elevated rates in this gene set in Geraniaceae. Correlation between dN of plastid-targeted DNA-RRR genes and plastome complexity supports the hypothesis that the aberrant patterns in angiosperm plastome evolution could be caused by dysfunction in DNA-RRR systems. © The Author 2016. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

Sieve element occlusion (SEO) genes encode structural phloem proteins involved in wound sealing of the phloem.

Science.gov (United States)

Ernst, Antonia M; Jekat, Stephan B; Zielonka, Sascia; Müller, Boje; Neumann, Ulla; Rüping, Boris; Twyman, Richard M; Krzyzanek, Vladislav; Prüfer, Dirk; Noll, Gundula A

2012-07-10

The sieve element occlusion (SEO) gene family originally was delimited to genes encoding structural components of forisomes, which are specialized crystalloid phloem proteins found solely in the Fabaceae. More recently, SEO genes discovered in various non-Fabaceae plants were proposed to encode the common phloem proteins (P-proteins) that plug sieve plates after wounding. We carried out a comprehensive characterization of two tobacco (Nicotiana tabacum) SEO genes (NtSEO). Reporter genes controlled by the NtSEO promoters were expressed specifically in immature sieve elements, and GFP-SEO fusion proteins formed parietal agglomerates in intact sieve elements as well as sieve plate plugs after wounding. NtSEO proteins with and without fluorescent protein tags formed agglomerates similar in structure to native P-protein bodies when transiently coexpressed in Nicotiana benthamiana, and the analysis of these protein complexes by electron microscopy revealed ultrastructural features resembling those of native P-proteins. NtSEO-RNA interference lines were essentially devoid of P-protein structures and lost photoassimilates more rapidly after injury than control plants, thus confirming the role of P-proteins in sieve tube sealing. We therefore provide direct evidence that SEO genes in tobacco encode P-protein subunits that affect translocation. We also found that peptides recently identified in fascicular phloem P-protein plugs from squash (Cucurbita maxima) represent cucurbit members of the SEO family. Our results therefore suggest a common evolutionary origin for P-proteins found in the sieve elements of all dicotyledonous plants and demonstrate the exceptional status of extrafascicular P-proteins in cucurbits.

Heterogenic expression of genes encoding secreted proteins at the periphery of Aspergillus niger colonies.

Science.gov (United States)

Vinck, Arman; de Bekker, Charissa; Ossin, Adam; Ohm, Robin A; de Vries, Ronald P; Wösten, Han A B

2011-01-01

Colonization of a substrate by fungi starts with the invasion of exploring hyphae. These hyphae secrete enzymes that degrade the organic material into small molecules that can be taken up by the fungus to serve as nutrients. We previously showed that only part of the exploring hyphae of Aspergillus niger highly express the glucoamylase gene glaA. This was an unexpected finding since all exploring hyphae are exposed to the same environmental conditions. Using GFP as a reporter, we here demonstrate that the acid amylase gene aamA, the α-glucuronidase gene aguA, and the feruloyl esterase gene faeA of A. niger are also subject to heterogenic expression within the exploring mycelium. Coexpression studies using GFP and dTomato as reporters showed that hyphae that highly express one of these genes also highly express the other genes encoding secreted proteins. Moreover, these hyphae also highly express the amylolytic regulatory gene amyR, and the glyceraldehyde-3-phosphate dehydrogenase gene gpdA. In situ hybridization demonstrated that the high expressers are characterized by a high 18S rRNA content. Taken together, it is concluded that two subpopulations of hyphae can be distinguished within the exploring mycelium of A. niger. The experimental data indicate that these subpopulations differ in their transcriptional and translational activity. © 2010 Society for Applied Microbiology and Blackwell Publishing Ltd.

Minor abnormalities of testis development in mice lacking the gene encoding the MAPK signalling component, MAP3K1.

Directory of Open Access Journals (Sweden)

Nick Warr

2011-05-01

Full Text Available In mammals, the Y chromosome is a dominant male determinant, causing the bipotential gonad to develop as a testis. Recently, cases of familial and spontaneous 46,XY disorders of sex development (DSD have been attributed to mutations in the human gene encoding mitogen-activated protein kinase kinase kinase 1, MAP3K1, a component of the mitogen-activated protein kinase (MAPK signal transduction pathway. In individuals harbouring heterozygous mutations in MAP3K1, dysregulation of MAPK signalling was observed in lymphoblastoid cell lines, suggesting a causal role for these mutations in disrupting XY sexual development. Mice lacking the cognate gene, Map3k1, are viable and exhibit the eyes open at birth (EOB phenotype on a mixed genetic background, but on the C57BL/6J genetic background most mice die at around 14.5 dpc due to a failure of erythropoiesis in the fetal liver. However, no systematic examination of sexual development in Map3k1-deficient mice has been described, an omission that is especially relevant in the case of C57BL/6J, a genetic background that is sensitized to disruptions to testis determination. Here, we report that on a mixed genetic background mice lacking Map3k1 are fertile and exhibit no overt abnormalities of testis development. On C57BL/6J, significant non-viability is observed with very few animals surviving to adulthood. However, an examination of development in Map3k1-deficient XY embryos on this genetic background revealed no significant defects in testis determination, although minor abnormalities were observed, including an increase in gonadal length. Based on these observations, we conclude that MAP3K1 is not required for mouse testis determination. We discuss the significance of these data for the functional interpretation of sex-reversing MAP3K1 mutations in humans.

Molecular cloning and chromosome mapping of the human gene encoding protein phosphotyrosyl phosphatase 1B

International Nuclear Information System (INIS)

Brown-Shimer, S.; Johnson, K.A.; Bruskin, A.; Green, N.R.; Hill, D.E.; Lawrence, J.B.; Johnson, C.

1990-01-01

The inactivation of growth suppressor genes appears to play a major role in the malignant process. To assess whether protein phosphotyrosyl phosphatases function as growth suppressors, the authors have isolated a cDNA clone encoding human protein phosphotyrosyl phosphatase 1B for structural and functional characterization. The translation product deduced from the 1,305-nucleotide open reading frame predicts a protein containing 435 amino acids and having a molecular mass of 49,966 Da. The amino-terminal 321 amino acids deduced from the cDNA sequence are identical to the empirically determined sequence of protein phosphotyrosyl phosphatase 1B. A genomic clone has been isolated and used in an in situ hybridization to banded metaphase chromosomes to determine that the gene encoding protein phosphotyrosyl phosphatase 1B maps as a single-copy gene to the long arm of chromosome 20 in the region q13.1-q13.2

Identification and characterisation of the angiotensin converting enzyme-3 (ACE3) gene: a novel mammalian homologue of ACE

OpenAIRE

Rella, Monika; Elliot, Joann L; Revett, Timothy J; Lanfear, Jerry; Phelan, Anne; Jackson, Richard M; Turner, Anthony J; Hooper, Nigel M

2007-01-01

Abstract Background Mammalian angiotensin converting enzyme (ACE) plays a key role in blood pressure regulation. Although multiple ACE-like proteins exist in non-mammalian organisms, to date only one other ACE homologue, ACE2, has been identified in mammals. Results Here we report the identification and characterisation of the gene encoding a third homologue of ACE, termed ACE3, in several mammalian genomes. The ACE3 gene is located on the same chromosome downstream of the ACE gene. Multiple ...

Cloning and molecular characterization of the glyceraldehyde-3-phosphate dehydrogenase-encoding gene and cDNA from the plant pathogenic fungus Glomerella cingulata.

Science.gov (United States)

Templeton, M D; Rikkerink, E H; Solon, S L; Crowhurst, R N

1992-12-01

The glyceraldehyde-3-phosphate dehydrogenase gene (gpdA) has been identified from a genomic DNA library prepared from the plant pathogenic fungus Glomerella cingulata. Nucleotide sequence data revealed that this gene codes for a putative 338-amino-acid protein encoded by two exons of 129 and 885 bp, separated by an intron 216 bp long. The 5' leader sequence is also spliced by an intron of 156 bp. A cDNA clone was prepared using the polymerase chain reaction, the sequence of which was used to confirm the presence of the intron in the coding sequence and the splicing of the 5' leader sequence. The transcriptional start point (tsp) was mapped at -253 nt from the site of the initiation of translation by primer extension and is adjacent to a 42-bp pyrimidine-rich region. The general structure of the 5' flanking region shows similarities to gpdA from Aspergillus nidulans. The putative protein product is 71-86% identical at the aa level to GPDs from Aspergillus nidulans, Cryphonectria parasitica, Curvularia lunata, Podospora anserina and Ustilago maydis.

Isolation and characterization of the gene encoding the starch debranching enzyme limit dextrinase from germinating barley

DEFF Research Database (Denmark)

Kristensen, Michael; Lok, Finn; Planchot, Véronique

1999-01-01

with a value of 105 kDa estimated by SDS;;PAGE, The coding sequence is interrupted by 26 introns varying in length from 93 bp to 825 bp. The 27 exons vary in length from 53 bp to 197 bp. Southern blot analysis shows that the limit dextrinase gene is present as a single copy in the barley genome. Gene......The gene encoding the starch debranching enzyme limit dextrinase, LD, from barley (Hordeum vulgare), was isolated from a genomic phage library using a barley cDNA clone as probe. The gene encodes a protein of 904 amino acid residues with a calculated molecular mass of 98.6 kDa. This is in agreement...... expression is high during germination and the steady state transcription level reaches a maximum at day 5 of germination. The deduced amino acid sequence corresponds to the protein sequence of limit dextrinase purified from germinating malt, as determined by automated N-terminal sequencing of tryptic...

Nuclear-Cytoplasmic Conflict in Pea (Pisum sativum L.) Is Associated with Nuclear and Plastidic Candidate Genes Encoding Acetyl-CoA Carboxylase Subunits

Science.gov (United States)

Bogdanova, Vera S.; Zaytseva, Olga O.; Mglinets, Anatoliy V.; Shatskaya, Natalia V.; Kosterin, Oleg E.; Vasiliev, Gennadiy V.

2015-01-01

In crosses of wild and cultivated peas (Pisum sativum L.), nuclear-cytoplasmic incompatibility frequently occurs manifested as decreased pollen fertility, male gametophyte lethality, sporophyte lethality. High-throughput sequencing of plastid genomes of one cultivated and four wild pea accessions differing in cross-compatibility was performed. Candidate genes for involvement in the nuclear-plastid conflict were searched in the reconstructed plastid genomes. In the annotated Medicago truncatula genome, nuclear candidate genes were searched in the portion syntenic to the pea chromosome region known to harbor a locus involved in the conflict. In the plastid genomes, a substantial variability of the accD locus represented by nucleotide substitutions and indels was found to correspond to the pattern of cross-compatibility among the accessions analyzed. Amino acid substitutions in the polypeptides encoded by the alleles of a nuclear locus, designated as Bccp3, with a complementary function to accD, fitted the compatibility pattern. The accD locus in the plastid genome encoding beta subunit of the carboxyltransferase of acetyl-coA carboxylase and the nuclear locus Bccp3 encoding biotin carboxyl carrier protein of the same multi-subunit enzyme were nominated as candidate genes for main contribution to nuclear-cytoplasmic incompatibility in peas. Existence of another nuclear locus involved in the accD-mediated conflict is hypothesized. PMID:25789472

Nuclear-cytoplasmic conflict in pea (Pisum sativum L. is associated with nuclear and plastidic candidate genes encoding acetyl-CoA carboxylase subunits.

Directory of Open Access Journals (Sweden)

Vera S Bogdanova

Full Text Available In crosses of wild and cultivated peas (Pisum sativum L., nuclear-cytoplasmic incompatibility frequently occurs manifested as decreased pollen fertility, male gametophyte lethality, sporophyte lethality. High-throughput sequencing of plastid genomes of one cultivated and four wild pea accessions differing in cross-compatibility was performed. Candidate genes for involvement in the nuclear-plastid conflict were searched in the reconstructed plastid genomes. In the annotated Medicago truncatula genome, nuclear candidate genes were searched in the portion syntenic to the pea chromosome region known to harbor a locus involved in the conflict. In the plastid genomes, a substantial variability of the accD locus represented by nucleotide substitutions and indels was found to correspond to the pattern of cross-compatibility among the accessions analyzed. Amino acid substitutions in the polypeptides encoded by the alleles of a nuclear locus, designated as Bccp3, with a complementary function to accD, fitted the compatibility pattern. The accD locus in the plastid genome encoding beta subunit of the carboxyltransferase of acetyl-coA carboxylase and the nuclear locus Bccp3 encoding biotin carboxyl carrier protein of the same multi-subunit enzyme were nominated as candidate genes for main contribution to nuclear-cytoplasmic incompatibility in peas. Existence of another nuclear locus involved in the accD-mediated conflict is hypothesized.

Identifying the Viral Genes Encoding Envelope Glycoproteins for Differentiation of Cyprinid herpesvirus 3 Isolates

Directory of Open Access Journals (Sweden)

Se Chang Park

2013-01-01

Full Text Available Cyprinid herpes virus 3 (CyHV-3 diseases have been reported around the world and are associated with high mortalities of koi (Cyprinus carpio. Although little work has been conducted on the molecular analysis of this virus, glycoprotein genes identified in the present study seem to be valuable targets for genetic comparison of this virus. Three envelope glycoprotein genes (ORF25, 65 and 116 of the CyHV-3 isolates from the USA, Israel, Japan and Korea were compared, and interestingly, sequence insertions or deletions were observed in these target regions. In addition, polymorphisms were presented in microsatellite zones from two glycoprotein genes (ORF65 and 116. In phylogenetic tree analysis, the Korean isolate was remarkably distinguished from USA, Israel, Japan isolates. These findings may be suitable for many applications including isolates differentiation and phylogeny studies.

Identifying the Viral Genes Encoding Envelope Glycoproteins for Differentiation of Cyprinid herpesvirus 3 Isolates

Science.gov (United States)

Han, Jee Eun; Kim, Ji Hyung; Renault, Tristan; Choresca, Casiano; Shin, Sang Phil; Jun, Jin Woo; Park, Se Chang

2013-01-01

Cyprinid herpes virus 3 (CyHV-3) diseases have been reported around the world and are associated with high mortalities of koi (Cyprinus carpio). Although little work has been conducted on the molecular analysis of this virus, glycoprotein genes identified in the present study seem to be valuable targets for genetic comparison of this virus. Three envelope glycoprotein genes (ORF25, 65 and 116) of the CyHV-3 isolates from the USA, Israel, Japan and Korea were compared, and interestingly, sequence insertions or deletions were observed in these target regions. In addition, polymorphisms were presented in microsatellite zones from two glycoprotein genes (ORF65 and 116). In phylogenetic tree analysis, the Korean isolate was remarkably distinguished from USA, Israel, Japan isolates. These findings may be suitable for many applications including isolates differentiation and phylogeny studies. PMID:23435236

Comparative differential gene expression analysis of nucleus-encoded proteins for Rafflesia cantleyi against Arabidopsis thaliana

Science.gov (United States)

Ng, Siuk-Mun; Lee, Xin-Wei; Wan, Kiew-Lian; Firdaus-Raih, Mohd

2015-09-01

Regulation of functional nucleus-encoded proteins targeting the plastidial functions was comparatively studied for a plant parasite, Rafflesia cantleyi versus a photosynthetic plant, Arabidopsis thaliana. This study involved two species of different feeding modes and different developmental stages. A total of 30 nucleus-encoded proteins were found to be differentially-regulated during two stages in the parasite; whereas 17 nucleus-encoded proteins were differentially-expressed during two developmental stages in Arabidopsis thaliana. One notable finding observed for the two plants was the identification of genes involved in the regulation of photosynthesis-related processes where these processes, as expected, seem to be present only in the autotroph.

Typing of Panton-Valentine Leukocidin-Encoding Phages and lukSF-PV Gene Sequence Variation in Staphylococcus aureus from China.

Science.gov (United States)

Zhao, Huanqiang; Hu, Fupin; Jin, Shu; Xu, Xiaogang; Zou, Yuhan; Ding, Baixing; He, Chunyan; Gong, Fang; Liu, Qingzhong

2016-01-01

Panton-Valentine leukocidin (PVL, encoded by lukSF-PV genes), a bi-component and pore-forming toxin, is carried by different staphylococcal bacteriophages. The prevalence of PVL in Staphylococcus aureus has been reported around the globe. However, the data on PVL-encoding phage types, lukSF-PV gene variation and chromosomal phage insertion sites for PVL-positive S. aureus are limited, especially in China. In order to obtain a more complete understanding of the molecular epidemiology of PVL-positive S. aureus, an integrated and modified PCR-based scheme was applied to detect the PVL-encoding phage types. Phage insertion locus and the lukSF-PV variant were determined by PCR and sequencing. Meanwhile, the genetic background was characterized by staphylococcal cassette chromosome mec (SCCmec) typing, staphylococcal protein A (spa) gene polymorphisms typing, pulsed-field gel electrophoresis (PFGE) typing, accessory gene regulator (agr) locus typing and multilocus sequence typing (MLST). Seventy eight (78/1175, 6.6%) isolates possessed the lukSF-PV genes and 59.0% (46/78) of PVL-positive strains belonged to CC59 lineage. Eight known different PVL-encoding phage types were detected, and Φ7247PVL/ΦST5967PVL (n = 13) and ΦPVL (n = 12) were the most prevalent among them. While 25 (25/78, 32.1%) isolates, belonging to ST30, and ST59 clones, were unable to be typed by the modified PCR-based scheme. Single nucleotide polymorphisms (SNPs) were identified at five locations in the lukSF-PV genes, two of which were non-synonymous. Maximum-likelihood tree analysis of attachment sites sequences detected six SNP profiles for attR and eight for attL, respectively. In conclusion, the PVL-positive S. aureus mainly harbored Φ7247PVL/ΦST5967PVL and ΦPVL in the regions studied. lukSF-PV gene sequences, PVL-encoding phages, and phage insertion locus generally varied with lineages. Moreover, PVL-positive clones that have emerged worldwide likely carry distinct phages.

Typing of Panton-Valentine Leukocidin-encoding Phages and lukSF-PV Gene Sequence Variation in Staphylococcus aureus from China

Directory of Open Access Journals (Sweden)

Huanqiang Zhao

2016-08-01

Full Text Available Panton-Valentine leucocidin (PVL, encoded by lukSF-PV genes, a bi-component and pore-forming toxin, is carried by different staphylococcal bacteriophages. The prevalence of PVL in Staphylococcus aureus (S. aureus have been reported around the globe. However, the data on PVL-encoding phage types, lukSF-PV gene variation and chromosomal phage insertion sites for PVL-positive S. aureus are limited, especially in China. In order to obtain a more complete understanding of the molecular epidemiology of PVL-positive S. aureus, an integrated and modified PCR-based scheme was applied to detect the PVL-encoding phage types. Phage insertion locus and the lukSF-PV variant were determined by PCR and sequencing. Meanwhile, the genetic background was characterized by staphylococcal cassette chromosome mec (SCCmec typing, staphylococcal protein A (spa gene polymorphisms typing, pulsed-field gel electrophoresis (PFGE typing, accessory gene regulator (agr locus typing and multilocus sequence typing (MLST. Seventy eight (78/1175, 6.6% isolates possessed the lukSF-PV genes and 59.0% (46/78 of PVL-positive strains belonged to CC59 lineage. Eight known different PVL-encoding phage types were detected, and Φ7247PVL/ΦST5967PVL (n=13 and ΦPVL (n=12 were the most prevalent among them. While 25 (25/78, 32.1% isolates, belonging to ST30 and ST59 clones, were unable to be typed by the modified PCR-based scheme. Single nucleotide polymorphisms (SNPs were identified at five locations in the lukSF-PV genes, two of which were non-synonymous. Maximum-likelihood tree analysis of attachment sites sequences detected six SNP profiles for attR and eight for attL, respectively. In conclusion, the PVL-positive S. aureus mainly harbored Φ7247PVL/ΦST5967PVL and ΦPVL in the regions studied. lukSF-PV gene sequences, PVL-encoding phages and phage insertion locus generally varied with lineages. Moreover, PVL-positive clones that have emerged worldwide likely carry distinct phages.

Genes Encoding Aluminum-Activated Malate Transporter II and their Association with Fruit Acidity in Apple

Directory of Open Access Journals (Sweden)

Baiquan Ma

2015-11-01

Full Text Available A gene encoding aluminum-activated malate transporter (ALMT was previously reported as a candidate for the locus controlling acidity in apple ( × Borkh.. In this study, we found that apple genes can be divided into three families and the gene belongs to the family. Duplication of genes in apple is related to the polyploid origin of the apple genome. Divergence in expression has occurred between the gene and its homologs in the family and only the gene is significantly associated with malic acid content. The locus consists of two alleles, and . resides in the tonoplast and its ectopic expression in yeast was found to increase the influx of malic acid into yeast cells significantly, suggesting it may function as a vacuolar malate channel. In contrast, encodes a truncated protein because of a single nucleotide substitution of G with A in the last exon. As this truncated protein resides within the cell membrane, it is deemed to be nonfunctional as a vacuolar malate channel. The frequency of the genotype is very low in apple cultivars but is high in wild relatives, which suggests that apple domestication may be accompanied by selection for the gene. In addition, variations in the malic acid content of mature fruits were also observed between accessions with the same genotype in the locus. This suggests that the gene is not the only genetic determinant of fruit acidity in apple.

A member of a new plant gene family encoding a meprin and TRAF homology (MATH) domain-containing protein is involved in restriction of long distance movement of plant viruses

Science.gov (United States)

Cosson, Patrick; Sofer, Luc; Schurdi-Levraud, Valérie

2010-01-01

Restriction of long distance movement of several potyviruses in Arabidopsis thaliana is controlled by at least three dominant restricted TEV movement (RTM) genes, named RTM1, RTM2 and RTM3 and acts as a non-conventional resistance. RTM1 encodes a protein belonging to the jacalin family and RTM2 encodes a protein which has similarities to small heat shock proteins. The recent cloning of RTM3 which encodes a protein belonging to an unknown protein family of 29 members that has a meprin and TRAF homology (MATH) domain in its N-terminal region and a coiled-coil (CC) domain at its C-terminal end is an important breakthrough for a better understanding of this resistance process. Not only the third gene involved in this resistance has been identified and has allowed revealing a new gene family in plant but the discovery that the RTM3 protein interacts directly with RTM1 strongly suggests that the RTM proteins form a multimeric complex. However, these data also highlight striking similarities of the RTM resistance with the well known R-gene mediated resistance. PMID:20930558

The SUD1 gene encodes a putative E3 ubiquitin ligase and is a positive regulator of 3-hydroxy-3-methylglutaryl coenzyme a reductase activity in Arabidopsis.

Science.gov (United States)

Doblas, Verónica G; Amorim-Silva, Vítor; Posé, David; Rosado, Abel; Esteban, Alicia; Arró, Montserrat; Azevedo, Herlander; Bombarely, Aureliano; Borsani, Omar; Valpuesta, Victoriano; Ferrer, Albert; Tavares, Rui M; Botella, Miguel A

2013-02-01

The 3-hydroxy-3-methylglutaryl-CoA reductase (HMGR) enzyme catalyzes the major rate-limiting step of the mevalonic acid (MVA) pathway from which sterols and other isoprenoids are synthesized. In contrast with our extensive knowledge of the regulation of HMGR in yeast and animals, little is known about this process in plants. To identify regulatory components of the MVA pathway in plants, we performed a genetic screen for second-site suppressor mutations of the Arabidopsis thaliana highly drought-sensitive drought hypersensitive2 (dry2) mutant that shows decreased squalene epoxidase activity. We show that mutations in SUPPRESSOR OF DRY2 DEFECTS1 (SUD1) gene recover most developmental defects in dry2 through changes in HMGR activity. SUD1 encodes a putative E3 ubiquitin ligase that shows sequence and structural similarity to yeast Degradation of α factor (Doα10) and human TEB4, components of the endoplasmic reticulum-associated degradation C (ERAD-C) pathway. While in yeast and animals, the alternative ERAD-L/ERAD-M pathway regulates HMGR activity by controlling protein stability, SUD1 regulates HMGR activity without apparent changes in protein content. These results highlight similarities, as well as important mechanistic differences, among the components involved in HMGR regulation in plants, yeast, and animals.

The pectin lyase-encoding gene (pnl) family from Glomerella cingulata: characterization of pnlA and its expression in yeast.

Science.gov (United States)

Templeton, M D; Sharrock, K R; Bowen, J K; Crowhurst, R N; Rikkerink, E H

1994-05-03

Oligodeoxyribonucleotide primers were designed from conserved amino acid (aa) sequences between pectin lyase D (PNLD) from Aspergillus niger and pectate lyases A and E (PELA/E) from Erwinia chrysanthemi. The polymerase chain reaction (PCR) was used with these primers to amplify genomic DNA from the plant pathogenic fungus Glomerella cingulata. Three different 220-bp fragments with homology to PNL-encoding genes from A. niger, and a 320-bp fragment with homology to PEL-encoding genes from Nicotiana tabacum and E. carotovora were cloned. One of the 220-bp PCR products (designated pnlA) was used as a probe to isolate a PNL-encoding gene from a lambda genomic DNA library prepared from G. cingulata. Nucleotide (nt) sequence data revealed that this gene has seven exons and codes for a putative 380-aa protein. The nt sequence of a cDNA clone, prepared using PCR, confirmed the presence of the six introns. The positions of the introns were different from the sites of the five introns present in the three PNL-encoding genes previously sequenced from A. niger. PNLA was synthesised in yeast by cloning the cDNA into the expression vector, pEMBLYex-4, and enzymatically active protein was secreted into the culture medium. Significantly higher expression was achieved when the context of the start codon, CACCATG, was mutated to CAAAATG, a consensus sequence commonly found in highly expressed yeast genes. The produced protein had an isoelectric point (pI) of 9.4, the same as that for the G. cingulata pnlA product.(ABSTRACT TRUNCATED AT 250 WORDS)

Real-time PCR expression profiling of genes encoding potential virulence factors in Candida albicans biofilms: identification of model-dependent and -independent gene expression

Directory of Open Access Journals (Sweden)

Řičicová Markéta

2010-04-01

Full Text Available Abstract Background Candida albicans infections are often associated with biofilm formation. Previous work demonstrated that the expression of HWP1 (hyphal wall protein and of genes belonging to the ALS (agglutinin-like sequence, SAP (secreted aspartyl protease, PLB (phospholipase B and LIP (lipase gene families is associated with biofilm growth on mucosal surfaces. We investigated using real-time PCR whether genes encoding potential virulence factors are also highly expressed in biofilms associated with abiotic surfaces. For this, C. albicans biofilms were grown on silicone in microtiter plates (MTP or in the Centres for Disease Control (CDC reactor, on polyurethane in an in vivo subcutaneous catheter rat (SCR model, and on mucosal surfaces in the reconstituted human epithelium (RHE model. Results HWP1 and genes belonging to the ALS, SAP, PLB and LIP gene families were constitutively expressed in C. albicans biofilms. ALS1-5 were upregulated in all model systems, while ALS9 was mostly downregulated. ALS6 and HWP1 were overexpressed in all models except in the RHE and MTP, respectively. The expression levels of SAP1 were more pronounced in both in vitro models, while those of SAP2, SAP4 and SAP6 were higher in the in vivo model. Furthermore, SAP5 was highly upregulated in the in vivo and RHE models. For SAP9 and SAP10 similar gene expression levels were observed in all model systems. PLB genes were not considerably upregulated in biofilms, while LIP1-3, LIP5-7 and LIP9-10 were highly overexpressed in both in vitro models. Furthermore, an elevated lipase activity was detected in supernatans of biofilms grown in the MTP and RHE model. Conclusions Our findings show that HWP1 and most of the genes belonging to the ALS, SAP and LIP gene families are upregulated in C. albicans biofilms. Comparison of the fold expression between the various model systems revealed similar expression levels for some genes, while for others model-dependent expression

Identification and characterization of genes encoding polycyclic aromatic hydrocarbon dioxygenase and polycyclic aromatic hydrocarbon dihydrodiol dehydrogenase in Pseudomonas putida OUS82.

OpenAIRE

Takizawa, N; Kaida, N; Torigoe, S; Moritani, T; Sawada, T; Satoh, S; Kiyohara, H

1994-01-01

Naphthalene and phenanthrene are transformed by enzymes encoded by the pah gene cluster of Pseudomonas putida OUS82. The pahA and pahB genes, which encode the first and second enzymes, dioxygenase and cis-dihydrodiol dehydrogenase, respectively, were identified and sequenced. The DNA sequences showed that pahA and pahB were clustered and that pahA consisted of four cistrons, pahAa, pahAb, pahAc, and pahAd, which encode ferredoxin reductase, ferredoxin, and two subunits of the iron-sulfur prot...

Arabidopsis VARIEGATED 3 encodes a chloroplasttargeted, zinc-finger protein required for chloroplast and palisade cell development

DEFF Research Database (Denmark)

Næsted, Henrik; Holm, A.; Jenkins, T.

2004-01-01

The stable, recessive Arabidopsis variegated 3 (var3) mutant exhibits a variegated phenotype due to somatic areas lacking or containing developmentally retarded chloroplasts and greatly reduced numbers of palisade cells. The VAR3 gene, isolated by transposon tagging, encodes the 85.9 kDa VAR3...... that pigment profiles are qualitatively similar in wild type and var3, although var3 accumulates lower levels of chlorophylls and carotenoids. These results indicate that VAR3 is a part of a protein complex required for normal chloroplast and palisade cell development....

Lactobacillus plantarum gene clusters encoding putative cell-surface protein complexes for carbohydrate utilization are conserved in specific gram-positive bacteria

Directory of Open Access Journals (Sweden)

Muscariello Lidia

2006-05-01

Full Text Available Abstract Background Genomes of gram-positive bacteria encode many putative cell-surface proteins, of which the majority has no known function. From the rapidly increasing number of available genome sequences it has become apparent that many cell-surface proteins are conserved, and frequently encoded in gene clusters or operons, suggesting common functions, and interactions of multiple components. Results A novel gene cluster encoding exclusively cell-surface proteins was identified, which is conserved in a subgroup of gram-positive bacteria. Each gene cluster generally has one copy of four new gene families called cscA, cscB, cscC and cscD. Clusters encoding these cell-surface proteins were found only in complete genomes of Lactobacillus plantarum, Lactobacillus sakei, Enterococcus faecalis, Listeria innocua, Listeria monocytogenes, Lactococcus lactis ssp lactis and Bacillus cereus and in incomplete genomes of L. lactis ssp cremoris, Lactobacillus casei, Enterococcus faecium, Pediococcus pentosaceus, Lactobacillius brevis, Oenococcus oeni, Leuconostoc mesenteroides, and Bacillus thuringiensis. These genes are neither present in the genomes of streptococci, staphylococci and clostridia, nor in the Lactobacillus acidophilus group, suggesting a niche-specific distribution, possibly relating to association with plants. All encoded proteins have a signal peptide for secretion by the Sec-dependent pathway, while some have cell-surface anchors, novel WxL domains, and putative domains for sugar binding and degradation. Transcriptome analysis in L. plantarum shows that the cscA-D genes are co-expressed, supporting their operon organization. Many gene clusters are significantly up-regulated in a glucose-grown, ccpA-mutant derivative of L. plantarum, suggesting catabolite control. This is supported by the presence of predicted CRE-sites upstream or inside the up-regulated cscA-D gene clusters. Conclusion We propose that the CscA, CscB, CscC and Csc

The Candida albicans-specific gene EED1 encodes a key regulator of hyphal extension.

LENUS (Irish Health Repository)

Martin, Ronny

2011-04-01

The extension of germ tubes into elongated hyphae by Candida albicans is essential for damage of host cells. The C. albicans-specific gene EED1 plays a crucial role in this extension and maintenance of filamentous growth. eed1Δ cells failed to extend germ tubes into long filaments and switched back to yeast growth after 3 h of incubation during growth on plastic surfaces. Expression of EED1 is regulated by the transcription factor Efg1 and ectopic overexpression of EED1 restored filamentation in efg1Δ. Transcriptional profiling of eed1Δ during infection of oral tissue revealed down-regulation of hyphal associated genes including UME6, encoding another key transcriptional factor. Ectopic overexpression of EED1 or UME6 rescued filamentation and damage potential in eed1Δ. Transcriptional profiling during overexpression of UME6 identified subsets of genes regulated by Eed1 or Ume6. These data suggest that Eed1 and Ume6 act in a pathway regulating maintenance of hyphal growth thereby repressing hyphal-to-yeast transition and permitting dissemination of C. albicans within epithelial tissues.

Involvement of transcription factor encoded by the mouse mi locus (MITF) in apoptosis of cultured mast cells induced by removal of interleukin-3.

Science.gov (United States)

Tsujimura, T.; Hashimoto, K.; Morii, E.; Tunio, G. M.; Tsujino, K.; Kondo, T.; Kanakura, Y.; Kitamura, Y.

1997-01-01

Mast cells develop when spleen cells of mice are cultured in the medium containing interleukin (IL)-3. Cultured mast cells (CMCs) show apoptosis when they are incubated in the medium without IL-3. We obtained CMCs from tg/tg mice that did not express the transcription factor encoded by the mi gene (MITF) due to the integration of a transgene at its 5' flanking region. MITF is a member of the basic-helix-loop-helix-leucine zipper (bHLH-Zip) protein family of transcription factors. We investigated the effect of MITF on the apoptosis of CMCs after removal of IL-3. When cDNA encoding normal MITF ((+)-MITF) was introduced into tg/tg CMCs with the retroviral vector, the apoptosis of tg/tg CMCs was significantly accelerated. The mutant mi allele represents a deletion of an arginine at the basic domain of MITF. The apoptosis of tg/tg CMCs was not accelerated by the introduction of cDNA encoding mi-MITF. The overexpression of (+)-MITF was not prerequisite to the acceleration of the apoptosis, as the apoptotic process proceeded faster in +/+ CMCs than in mi/mi CMCs. The Ba/F3 lymphoid cell line is also dependent on IL-3, and Ba/F3 cells show apoptosis after removal of IL-3. The c-myc gene encodes another transcription factor of the bHLH-Zip family, and the overexpression of the c-myc gene accelerated the apoptosis of Ba/F3 cells. However, the overexpression of (+)-MITF did not accelerate the apoptosis of Ba/F3 cells. The (+)-MITF appeared to play some roles for the acceleration of the apoptosis specifically in the mast cell lineage. Images Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 PMID:9327738

The Riemerella anatipestifer AS87_01735 Gene Encodes Nicotinamidase PncA, an Important Virulence Factor.

Science.gov (United States)

Wang, Xiaolan; Liu, Beibei; Dou, Yafeng; Fan, Hongjie; Wang, Shaohui; Li, Tao; Ding, Chan; Yu, Shengqing

2016-10-01

Riemerella anatipestifer is a major bacterial pathogen that causes septicemic and exudative diseases in domestic ducks. In our previous study, we found that deletion of the AS87_01735 gene significantly decreased the bacterial virulence of R. anatipestifer strain Yb2 (mutant RA625). The AS87_01735 gene was predicted to encode a nicotinamidase (PncA), a key enzyme that catalyzes the conversion of nicotinamide to nicotinic acid, which is an important reaction in the NAD(+) salvage pathway. In this study, the AS87_01735 gene was expressed and identified as the PncA-encoding gene, using an enzymatic assay. Western blot analysis demonstrated that R. anatipestifer PncA was localized to the cytoplasm. The mutant strain RA625 (named Yb2ΔpncA in this study) showed a similar growth rate but decreased NAD(+) quantities in both the exponential and stationary phases in tryptic soy broth culture, compared with the wild-type strain Yb2. In addition, Yb2ΔpncA-infected ducks showed much lower bacterial loads in their blood, and no visible histological changes were observed in the heart, liver, and spleen. Furthermore, Yb2ΔpncA immunization of ducks conferred effective protection against challenge with the virulent wild-type strain Yb2. Our results suggest that the R. anatipestifer AS87_01735 gene encodes PncA, which is an important virulence factor, and that the Yb2ΔpncA mutant can be used as a novel live vaccine candidate. Riemerella anatipestifer is reported worldwide as a cause of septicemic and exudative diseases of domestic ducks. The pncA gene encodes a nicotinamidase (PncA), a key enzyme that catalyzes the conversion of nicotinamide to nicotinic acid, which is an important reaction in the NAD(+) salvage pathway. In this study, we identified and characterized the pncA-homologous gene AS87_01735 in R. anatipestifer strain Yb2. R. anatipestifer PncA is a cytoplasmic protein that possesses similar PncA activity, compared with other organisms. Generation of the pncA mutant Yb

The pkI gene encoding pyruvate kinase I links to the luxZ gene which enhances bioluminescence of the lux operon from Photobacterium leiognathi.

Science.gov (United States)

Lin, J W; Lu, H C; Chen, H Y; Weng, S F

1997-10-09

Partial 3'-end nucleotide sequence of the pkI gene (GenBank accession No. AF019143) from Photobacterium leiognathi ATCC 25521 has been determined, and the encoded pyruvate kinase I is deduced. Pyruvate kinase I is the key enzyme of glycolysis, which converts phosphoenol pyruvate to pyruvate. Alignment and comparison of pyruvate kinase Is from P. leiognathi, E. coli and Salmonella typhimurium show that they are homologous. Nucleotide sequence reveals that the pkI gene is linked to the luxZ gene that enhances bioluminescence of the lux operon from P. leiognathi. The gene order of the pkI and luxZ genes is-pk1-ter-->-R&R"-luxZ-ter"-->, whereas ter is transcriptional terminator for the pkI and related genes, and R&R" is the regulatory region and ter" is transcriptional terminator for the luxZ gene. It clearly elicits that the pkI gene and luxZ gene are divided to two operons. Functional analysis confirms that the potential hairpin loop omega T is the transcriptional terminator for the pkI and related genes. It infers that the pkI and related genes are simply linked to the luxZ gene in P. leiognathi genome.

Association between FOXO3A gene polymorphisms and human longevity: a meta-analysis

OpenAIRE

Bao, Ji-Ming; Song, Xian-Lu; Hong, Ying-Qia; Zhu, Hai-Li; Li, Cui; Zhang, Tao; Chen, Wei; Zhao, Shan-Chao; Chen, Qing

2014-01-01

Numerous studies have shown associations between the FOXO3A gene, encoding the forkhead box O3 transcription factor, and human or specifically male longevity. However, the associations of specific FOXO3A polymorphisms with longevity remain inconclusive. We performed a meta-analysis of existing studies to clarify these potential associations. A comprehensive search was conducted to identify studies of FOXO3A gene polymorphisms and longevity. Pooled odds ratios (ORs) and 95% confidence interval...

The frequency of genes encoding three putative group B streptococcal virulence factors among invasive and colonizing isolates

Directory of Open Access Journals (Sweden)

Borchardt Stephanie M

2006-07-01

Full Text Available Abstract Background Group B Streptococcus (GBS causes severe infections in very young infants and invasive disease in pregnant women and adults with underlying medical conditions. GBS pathogenicity varies between and within serotypes, with considerable variation in genetic content between strains. Three proteins, Rib encoded by rib, and alpha and beta C proteins encoded by bca and bac, respectively, have been suggested as potential vaccine candidates for GBS. It is not known, however, whether these genes occur more frequently in invasive versus colonizing GBS strains. Methods We screened 162 invasive and 338 colonizing GBS strains from different collections using dot blot hybridization to assess the frequency of bca, bac and rib. All strains were defined by serotyping for capsular type, and frequency differences were tested using the Chi square test. Results Genes encoding the beta C protein (bac and Rib (rib occurred at similar frequencies among invasive and colonizing isolates, bac (20% vs. 23%, and rib (28% vs. 20%, while the alpha (bca C protein was more frequently found in colonizing strains (46% vs, invasive (29%. Invasive strains were associated with specific serotype/gene combinations. Conclusion Novel virulence factors must be identified to better understand GBS disease.

Structure of genes for dermaseptins B, antimicrobial peptides from frog skin. Exon 1-encoded prepropeptide is conserved in genes for peptides of highly different structures and activities.

Science.gov (United States)

Vouille, V; Amiche, M; Nicolas, P

1997-09-01

We cloned the genes of two members of the dermaseptin family, broad-spectrum antimicrobial peptides isolated from the skin of the arboreal frog Phyllomedusa bicolor. The dermaseptin gene Drg2 has a 2-exon coding structure interrupted by a small 137-bp intron, wherein exon 1 encoded a 22-residue hydrophobic signal peptide and the first three amino acids of the acidic propiece; exon 2 contained the 18 additional acidic residues of the propiece plus a typical prohormone processing signal Lys-Arg and a 32-residue dermaseptin progenitor sequence. The dermaseptin genes Drg2 and Drg1g2 have conserved sequences at both untranslated ends and in the first and second coding exons. In contrast, Drg1g2 comprises a third coding exon for a short version of the acidic propiece and a second dermaseptin progenitor sequence. Structural conservation between the two genes suggests that Drg1g2 arose recently from an ancestral Drg2-like gene through amplification of part of the second coding exon and 3'-untranslated region. Analysis of the cDNAs coding precursors for several frog skin peptides of highly different structures and activities demonstrates that the signal peptides and part of the acidic propieces are encoded by conserved nucleotides encompassed by the first coding exon of the dermaseptin genes. The organization of the genes that belong to this family, with the signal peptide and the progenitor sequence on separate exons, permits strikingly different peptides to be directed into the secretory pathway. The recruitment of such a homologous 'secretory' exon by otherwise non-homologous genes may have been an early event in the evolution of amphibian.

Use of nfsB, encoding nitroreductase, as a reporter gene to determine the mutational spectrum of spontaneous mutations in Neisseria gonorrhoeae

Directory of Open Access Journals (Sweden)

Dunham Stephen

2009-11-01

Full Text Available Abstract Background Organisms that are sensitive to nitrofurantoin express a nitroreductase. Since bacterial resistance to this compound results primarily from mutations in the gene encoding nitroreductase, the resulting loss of function of nitroreductase results in a selectable phenotype; resistance to nitrofurantoin. We exploited this direct selection for mutation to study the frequency at which spontaneous mutations arise (transitions and transversions, insertions and deletions. Results A nitroreductase- encoding gene was identified in the N. gonorrhoeae FA1090 genome by using a bioinformatic search with the deduced amino acid sequence derived from the Escherichia coli nitroreductase gene, nfsB. Cell extracts from N. gonorrhoeae were shown to possess nitroreductase activity, and activity was shown to be the result of NfsB. Spontaneous nitrofurantoin-resistant mutants arose at a frequency of ~3 × 10-6 - 8 × 10-8 among the various strains tested. The nfsB sequence was amplified from various nitrofurantoin-resistant mutants, and the nature of the mutations determined. Transition, transversion, insertion and deletion mutations were all readily detectable with this reporter gene. Conclusion We found that nfsB is a useful reporter gene for measuring spontaneous mutation frequencies. Furthermore, we found that mutations were more likely to arise in homopolymeric runs rather than as base substitutions.

Antimicrobial resistance and detection of the mecA gene besides enterotoxin-encoding genes among coagulase-negative Staphylococci isolated from clam meat of Anomalocardia brasiliana.

Science.gov (United States)

Batista, Jacqueline Ellen Camelo; Ferreira, Ewerton Lucena; Nascimento, Danielle Cristina de Oliveira; Ventura, Roberta Ferreira; de Oliveira, Wagner Luis Mendes; Leal, Nilma Cintra; Lima-Filho, José Vitor

2013-12-01

The marine clam Anomalocardia brasiliana is a candidate as a sentinel animal to monitor the contamination levels of coliforms in shellfish-harvesting areas of Brazil's northeastern region. The aim of the present study was to search enterotoxin-encoding genes plus the mecA gene among coagulase-negative staphylococci (CNS) isolates from shellfish meats of A. brasiliana. The specimen clam (n=48; 40 clams per sample) was collected during low tide in the bay area of Mangue Seco from April through June 2009, and random samples of chilled and frozen shelled clam meat (n=33; 250 g per sample) were obtained from retail shops from January through March 2012. Seventy-nine CNS isolates were identified, including Staphylococcus xylosus, S. cohnii spp. urealyticus, S. sciuri, and S. lentus. A high percentage of isolates resistant to erythromycin (58.5%), penicillin (51.2%), and tetracycline (43.9%), and the fluoroquinolones levofloxacin (39%) and ciprofloxacin (34.1%) were recorded from those environmental samples. Isolates from retail shops were particularly resistant to oxacillin (55.3%) and penicillin (36.8%). All CNS resistant to oxacillin and/or cefoxitin were positive for the presence of the mecA gene, but phenotypically susceptible to vancomycin. Also, the enterotoxin-encoding genes seg and seh were detected through multiplex-polymerase chain reaction in 77.7% and 88.8% of the isolates from environmental samples, versus 90.5% and 100% of the isolates from retail shops, respectively. The data reveal the risk to public health due to consuming raw or undercooked shellfish containing enterotoxigenic plus methicillin-resistant CNS.

MUREIN-METABOLIZING ENZYMES FROM ESCHERICHIA-COLI - SEQUENCE-ANALYSIS AND CONTROLLED OVEREXPRESSION OF THE SLT GENE, WHICH ENCODES THE SOLUBLE LYTIC TRANSGLYCOSYLASE

NARCIS (Netherlands)

ENGEL, H; KAZEMIER, B; KECK, W

The complete nucleotide sequence of the slt gene encoding the soluble lytic transglycosylase (Slt; EC 3.2.1.-) from Escherichia coli has been determined. The largest open reading frame identified on a 2.5-kb PvuII-SalI fragment indicates that the enzyme is translated as a preprotein of either 654 or

Modulation of expression of genes encoding nuclear proteins following exposure to JANUS neutrons or γ-rays

International Nuclear Information System (INIS)

Woloschak, G.E.; Chang-Liu, Chin-Mei

1994-01-01

Previous work has shown that exposure of cells to ionizing radiations causes modulation of a variety of genes, including those encoding c-fos, interleukin-1, tumor necrosis factor, cytoskeletal elements, and many more. The experiments reported herein were designed to examine the effects of either JANUS neutron or γ-ray exposure on expression of genes encoding nucleus-associated proteins (H4-histone, c-jun, c-myc, Rb, and p53). Cycling Syrian hamster embryo cells were irradiated with varying doses and dose rates of either JANUS fission-spectrum neutrons or γ-rays; after incubation of the cell cultures for 1 h following radiation exposure, mRNA was harvested and analyzed by Northern blot. Results revealed induction of transcripts for c-jun, H4-histone, and Rb following γ-ray but not following neutron exposure. Interestingly, expression of c-myc was repressed following γ-ray but not following neutron exposure. Radiations at different doses and dose rates were compared for each of the genes studied

Existence of mutations in the homeodomain-encoding region of NKX2.5 gene in Iranian patients with tetralogy of Fallot

Science.gov (United States)

Kheirollahi, Majid; Khosravi, Fereshteh; Ashouri, Saeideh; Ahmadi, Alireza

2016-01-01

Background: Tetralogy of Fallot (TOF), the most common cyanotic heart defect and one of the most common congenital heart diseases, occurs mostly sporadically and nonsyndromically. The underlying molecular genetic mechanism is not known. Therefore, the existence of mutations in the homeodomain-encoding region of NKX2.5 gene in Iranian patients with tetralogy of Fallot is evaluated. Materials and Methods: In the present study, we analyzed the peripheral blood samples of27 patients in order to find any mutation in the 180 bp homeodomain-encoding region of NKX2.5 gene, which is known to be involved in heart development and diseases. DNA was extracted and all the samples were amplified by polymerase chain reaction (PCR) and sequenced. Results: Twenty-seven patients were included in the study. Twenty-five of them were infants and children (6 days to 11 years of age), one was a teenager (14-years of age), and another was a 33-year-old man [mean ± standard deviation (SD): 5.80 ± 3.90 years]. Thirteen patents were males (mean ± SD: 6.587077 ± 5.02 years) and 14 were females (mean ± SD: 5.0726 ± 2.81 years). One synonymous variant, i.e., c.543G>A was identified in one patient. Conclusion: Mutations in the homeodomain-encoding region of NKX2.5 gene may not have an outstanding role in etiology of tetralogy of Fallot patients in Iran. PMID:27904570

High Myopia Caused by a Mutation in LEPREL1, Encoding Prolyl 3-Hydroxylase 2

Science.gov (United States)

Mordechai, Shikma; Gradstein, Libe; Pasanen, Annika; Ofir, Rivka; El Amour, Khalil; Levy, Jaime; Belfair, Nadav; Lifshitz, Tova; Joshua, Sara; Narkis, Ginat; Elbedour, Khalil; Myllyharju, Johanna; Birk, Ohad S.

2011-01-01

Autosomal-recessive high-grade axial myopia was diagnosed in Bedouin Israeli consanguineous kindred. Some affected individuals also had variable expressivity of early-onset cataracts, peripheral vitreo-retinal degeneration, and secondary sight loss due to severe retinal detachments. Through genome-wide linkage analysis, the disease-associated gene was mapped to ∼1.7 Mb on chromosome 3q28 (the maximum LOD score was 11.5 at θ = 0 for marker D3S1314). Sequencing of the entire coding regions and intron-exon boundaries of the six genes within the defined locus identified a single mutation (c.1523G>T) in exon 10 of LEPREL1, encoding prolyl 3-hydroxylase 2 (P3H2), a 2-oxoglutarate-dependent dioxygenase that hydroxylates collagens. The mutation affects a glycine that is conserved within P3H isozymes. Analysis of wild-type and p.Gly508Val (c.1523G>T) mutant recombinant P3H2 polypeptides expressed in insect cells showed that the mutation led to complete inactivation of P3H2. PMID:21885030

AN ENCODING METHOD FOR COMPRESSING GEOGRAPHICAL COORDINATES IN 3D SPACE

Directory of Open Access Journals (Sweden)

C. Qian

2017-09-01

Full Text Available This paper proposed an encoding method for compressing geographical coordinates in 3D space. By the way of reducing the length of geographical coordinates, it helps to lessen the storage size of geometry information. In addition, the encoding algorithm subdivides the whole space according to octree rules, which enables progressive transmission and loading. Three main steps are included in this method: (1 subdividing the whole 3D geographic space based on octree structure, (2 resampling all the vertices in 3D models, (3 encoding the coordinates of vertices with a combination of Cube Index Code (CIC and Geometry Code. A series of geographical 3D models were applied to evaluate the encoding method. The results showed that this method reduced the storage size of most test data by 90 % or even more under the condition of a speed of encoding and decoding. In conclusion, this method achieved a remarkable compression rate in vertex bit size with a steerable precision loss. It shall be of positive meaning to the web 3d map storing and transmission.

Induction of the gap-pgk operon encoding glyceraldehyde-3-phosphate dehydrogenase and 3-phosphoglycerate kinase of Xanthobacter flavus requires the LysR-type transcriptional activator CbbR

NARCIS (Netherlands)

Meijer, W.G; van den Bergh, E.R E; Smith, L.M

In a previous study, a gene (pgk) encoding phosphoglycerate kinase was isolated from a genomic labrid of Xanthobacter flavus. Although this gene is essential for autotrophic growth, it is not located within the cbb operon encoding other Calvin cycle enzymes. An analysis of the nucleotide sequence

Maternally Expressed Gene 3, an imprinted non-coding RNA gene, is associated with meningioma pathogenesis and progression

Science.gov (United States)

Zhang, Xun; Gejman, Roger; Mahta, Ali; Zhong, Ying; Rice, Kimberley A.; Zhou, Yunli; Cheunsuchon, Pornsuk; Louis, David N.; Klibanski, Anne

2010-01-01

Meningiomas are common tumors, representing 15-25% of all central nervous system tumors. NF2 gene inactivation on chromosome 22 has been shown as an early event in tumorigenesis; however, few factors underlying tumor growth and progression have been identified. Chromosomal abnormalities of 14q32 are often associated with meningioma pathogenesis and progression; therefore it has been proposed that an as yet unidentified tumor suppressor is present at this locus. MEG3 is an imprinted gene located at 14q32 that encodes a non-coding RNA with an anti-proliferative function. We found that MEG3 mRNA is highly expressed in normal arachnoidal cells. However, MEG3 is not expressed in the majority of human meningiomas or the human meningioma cell lines IOMM-Lee and CH157-MN. There is a strong association between loss of MEG3 expression and tumor grade. Allelic loss at the MEG3 locus is also observed in meningiomas, with increasing prevalence in higher grade tumors. In addition, there is an increase in CpG methylation within the promoter and the imprinting control region of MEG3 gene in meningiomas. Functionally, MEG3 suppresses DNA synthesis in both IOMM-Lee and CH157-MN cells by approximately 60% in BrdU incorporation assays. Colony-forming efficiency assays show that MEG3 inhibits colony formation in CH157-MN cells by approximately 80%. Furthermore, MEG3 stimulates p53-mediated transactivation in these cell lines. Therefore, these data are consistent with the hypothesis that MEG3, which encodes a non-coding RNA, may be a tumor suppressor gene at chromosome 14q32 involved in meningioma progression via a novel mechanism. PMID:20179190

Cloning and characterization of the gene encoding IMP dehydrogenase from Arabidopsis thaliana.

Science.gov (United States)

Collart, F R; Osipiuk, J; Trent, J; Olsen, G J; Huberman, E

1996-10-03

We have cloned and characterized the gene encoding inosine monophosphate dehydrogenase (IMPDH) from Arabidopsis thaliana (At). The transcription unit of the At gene spans approximately 1900 bp and specifies a protein of 503 amino acids with a calculated relative molecular mass (M(r)) of 54,190. The gene is comprised of a minimum of four introns and five exons with all donor and acceptor splice sequences conforming to previously proposed consensus sequences. The deduced IMPDH amino-acid sequence from At shows a remarkable similarity to other eukaryotic IMPDH sequences, with a 48% identity to human Type II enzyme. Allowing for conservative substitutions, the enzyme is 69% similar to human Type II IMPDH. The putative active-site sequence of At IMPDH conforms to the IMP dehydrogenase/guanosine monophosphate reductase motif and contains an essential active-site cysteine residue.

Prevalence of enterotoxin-encoding genes and antimicrobial resistance in coagulase-negative and coagulase-positive Staphylococcus isolates from black pudding

Directory of Open Access Journals (Sweden)

Tiane Martin de Moura

2012-10-01

Full Text Available INTRODUCTION: Staphylococcal species are pathogens that are responsible for outbreaks of foodborne diseases. The aim of this study was to investigate the prevalence of enterotoxin-genes and the antimicrobial resistance profile in staphylococcus coagulase-negative (CoNS and coagulasepositive (CoPS isolates from black pudding in southern Brazil. METHODS: Two hundred typical and atypical colonies from Baird-Parker agar were inoculated on mannitol salt agar. Eighty-two mannitol-positive staphylococci were submitted to conventional biochemical tests and antimicrobial susceptibility profiling. The presence of coagulase (coa and enterotoxin (se genes was investigated by polymerase chain reaction. RESULTS: The isolates were divided into 2 groups: 75.6% (62/82 were CoNS and 24.4% (20/82 were CoPS. The biochemical tests identified 9 species, of which Staphylococcus saprophyticus (37.8% and Staphylococcus carnosus (15.9% were the most prevalent. Antimicrobial susceptibility tests showed resistance phenotypes to antibiotics widely administered in humans, such as gentamicin, tetracycline, chloramphenicol, and erythromycin. The coa gene was detected in 19.5% (16/82 of the strains and 4 polymorphic DNA fragments were observed. Five CoNS isolates carrying the coa gene were submitted for 16S rRNA sequencing and 3 showed similarity with CoNS. Forty strains were positive for at least 1 enterotoxin-encoding gene, the genes most frequently detected were sea (28.6% and seb (27.5%. CONCLUSIONS: The presence of antimicrobial resistant and enterotoxin-encoding genes in staphylococci isolates from black pudding indicated that this fermented food may represent a potential health risk, since staphylococci present in food could cause foodborne diseases or be a possible route for the transfer of antimicrobial resistance to humans.

Cloning and analysis of the genes encoding the type IIS restriction-modification system HphI from Haemophilus parahaemolyticus.

Science.gov (United States)

Lubys, A; Lubienè, J; Kulakauskas, S; Stankevicius, K; Timinskas, A; Janulaitis, A

1996-07-15

The genomic region encoding the type IIS restriction-modification (R-M) system HphI (enzymes recognizing the asymmetric sequence 5'-GGTGA-3'/5'-TCACC-3') from Haemophilus parahaemolyticus were cloned into Escherichia coli and sequenced. Sequence analysis of the R-M HphI system revealed three adjacent genes aligned in the same orientation: a cytosine 5 methyltransferase (gene hphIMC), an adenine N6 methyltransferase (hphIMA) and the HphI restriction endonuclease (gene hphIR). Either methyltransferase is capable of protecting plasmid DNA in vivo against the action of the cognate restriction endonuclease. hphIMA methylation renders plasmid DNA resistant to R.Hindill at overlapping sites, suggesting that the adenine methyltransferase modifies the 3'-terminal A residue on the GGTGA strand. Strong homology was found between the N-terminal part of the m6A methyltransferasease and an unidentified reading frame interrupted by an incomplete gaIE gene of Neisseria meningitidis. The HphI R-M genes are flanked by a copy of a 56 bp direct nucleotide repeat on each side. Similar sequences have also been identified in the non-coding regions of H.influenzae Rd DNA. Possible involvement of the repeat sequences in the mobility of the HphI R-M system is discussed.

Zea mI, the maize homolog of the allergen-encoding Lol pI gene of rye grass.

Science.gov (United States)

Broadwater, A H; Rubinstein, A L; Chay, C H; Klapper, D G; Bedinger, P A

1993-09-15

Sequence analysis of a pollen-specific cDNA from maize has identified a homolog (Zea mI) of the gene (Lol pI) encoding the major allergen of rye-grass pollen. The protein encoded by the partial cDNA sequence is 59.3% identical and 72.7% similar to the comparable region of the reported amino acid sequence of Lol pIA. Southern analysis indicates that this cDNA represents a member of a small multigene family in maize. Northern analysis shows expression only in pollen, not in vegetative or female floral tissues. The timing of expression is developmentally regulated, occurring at a low level prior to the first pollen mitosis and at a high level after this postmeiotic division. Western analysis detects a protein in maize pollen lysates using polyclonal antiserum and monoclonal antibodies directed against purified Lolium perenne allergen.

Identification of a spliced gene from duck enteritis virus encoding a protein homologous to UL15 of herpes simplex virus 1

Directory of Open Access Journals (Sweden)

Wang Yu

2011-04-01

Full Text Available Abstract Background In herpesviruses, UL15 homologue is a subunit of terminase complex responsible for cleavage and packaging of the viral genome into pre-assembled capsids. However, for duck enteritis virus (DEV, the causative agent of duck viral enteritis (DVE, the genomic sequence was not completely determined until most recently. There is limited information of this putative spliced gene and its encoding protein. Results DEV UL15 consists of two exons with a 3.5 kilobases (kb inron and transcribes into two transcripts: the full-length UL15 and an N-terminally truncated UL15.5. The 2.9 kb UL15 transcript encodes a protein of 739 amino acids with an approximate molecular mass of 82 kiloDaltons (kDa, whereas the UL15.5 transcript is 1.3 kb in length, containing a putative 888 base pairs (bp ORF that encodes a 32 kDa product. We also demonstrated that UL15 gene belonged to the late kinetic class as its expression was sensitive to cycloheximide and phosphonoacetic acid. UL15 is highly conserved within the Herpesviridae, and contains Walker A and B motifs homologous to the catalytic subunit of the bacteriophage terminase as revealed by sequence analysis. Phylogenetic tree constructed with the amino acid sequences of 23 herpesvirus UL15 homologues suggests a close relationship of DEV to the Mardivirus genus within the Alphaherpesvirinae. Further, the UL15 and UL15.5 proteins can be detected in the infected cell lysate but not in the sucrose density gradient-purified virion when reacting with the antiserum against UL15. Within the CEF cells, the UL15 and/or UL15.5 localize(s in the cytoplasm at 6 h post infection (h p. i. and mainly in the nucleus at 12 h p. i. and at 24 h p. i., while accumulate(s in the cytoplasm in the absence of any other viral protein. Conclusions DEV UL15 is a spliced gene that encodes two products encoded by 2.9 and 1.3 kb transcripts respectively. The UL15 is expressed late during infection. The coding sequences of DEV UL15

Identification of a spliced gene from duck enteritis virus encoding a protein homologous to UL15 of herpes simplex virus 1.

Science.gov (United States)

Zhu, Hongwei; Li, Huixin; Han, Zongxi; Shao, Yuhao; Wang, Yu; Kong, Xiangang

2011-04-06

In herpesviruses, UL15 homologue is a subunit of terminase complex responsible for cleavage and packaging of the viral genome into pre-assembled capsids. However, for duck enteritis virus (DEV), the causative agent of duck viral enteritis (DVE), the genomic sequence was not completely determined until most recently. There is limited information of this putative spliced gene and its encoding protein. DEV UL15 consists of two exons with a 3.5 kilobases (kb) inron and transcribes into two transcripts: the full-length UL15 and an N-terminally truncated UL15.5. The 2.9 kb UL15 transcript encodes a protein of 739 amino acids with an approximate molecular mass of 82 kiloDaltons (kDa), whereas the UL15.5 transcript is 1.3 kb in length, containing a putative 888 base pairs (bp) ORF that encodes a 32 kDa product. We also demonstrated that UL15 gene belonged to the late kinetic class as its expression was sensitive to cycloheximide and phosphonoacetic acid. UL15 is highly conserved within the Herpesviridae, and contains Walker A and B motifs homologous to the catalytic subunit of the bacteriophage terminase as revealed by sequence analysis. Phylogenetic tree constructed with the amino acid sequences of 23 herpesvirus UL15 homologues suggests a close relationship of DEV to the Mardivirus genus within the Alphaherpesvirinae. Further, the UL15 and UL15.5 proteins can be detected in the infected cell lysate but not in the sucrose density gradient-purified virion when reacting with the antiserum against UL15. Within the CEF cells, the UL15 and/or UL15.5 localize(s) in the cytoplasm at 6 h post infection (h p. i.) and mainly in the nucleus at 12 h p. i. and at 24 h p. i., while accumulate(s) in the cytoplasm in the absence of any other viral protein. DEV UL15 is a spliced gene that encodes two products encoded by 2.9 and 1.3 kb transcripts respectively. The UL15 is expressed late during infection. The coding sequences of DEV UL15 are very similar to those of alphaherpesviruses and

An ancient history of gene duplications, fusions and losses in the evolution of APOBEC3 mutators in mammals

Science.gov (United States)

2012-01-01

Background The APOBEC3 (A3) genes play a key role in innate antiviral defense in mammals by introducing directed mutations in the DNA. The human genome encodes for seven A3 genes, with multiple splice alternatives. Different A3 proteins display different substrate specificity, but the very basic question on how discerning self from non-self still remains unresolved. Further, the expression of A3 activity/ies shapes the way both viral and host genomes evolve. Results We present here a detailed temporal analysis of the origin and expansion of the A3 repertoire in mammals. Our data support an evolutionary scenario where the genome of the mammalian ancestor encoded for at least one ancestral A3 gene, and where the genome of the ancestor of placental mammals (and possibly of the ancestor of all mammals) already encoded for an A3Z1-A3Z2-A3Z3 arrangement. Duplication events of the A3 genes have occurred independently in different lineages: humans, cats and horses. In all of them, gene duplication has resulted in changes in enzyme activity and/or substrate specificity, in a paradigmatic example of convergent adaptive evolution at the genomic level. Finally, our results show that evolutionary rates for the three A3Z1, A3Z2 and A3Z3 motifs have significantly decreased in the last 100 Mya. The analysis constitutes a textbook example of the evolution of a gene locus by duplication and sub/neofunctionalization in the context of virus-host arms race. Conclusions Our results provide a time framework for identifying ancestral and derived genomic arrangements in the APOBEC loci, and to date the expansion of this gene family for different lineages through time, as a response to changes in viral/retroviral/retrotransposon pressure. PMID:22640020

Sequence variation in the alpha-toxin encoding plc gene of Clostridium perfringens strains isolated from diseased and healthy chickens

DEFF Research Database (Denmark)

Abildgaard, L; Engberg, RM; Pedersen, Karl

2009-01-01

The aim of the present study was to analyse the genetic diversity of the alpha-toxin encoding plc gene and the variation in a-toxin production of Clostridium perfringens type A strains isolated from presumably healthy chickens and chickens suffering from either necrotic enteritis (NE) or cholangio......-hepatitis. The a-toxin encoding plc genes from 60 different pulsed-field gel electrophoresis (PFGE) types (strains) of C perfringens were sequenced and translated in silico to amino acid sequences and the a-toxin production was investigated in batch cultures of 45 of the strains using an enzyme...

Genome-Wide Identification and Analysis of Genes Encoding PHD-Finger Protein in Tomato

International Nuclear Information System (INIS)

Hayat, S.; Cheng, Z.; Chen, X.

2016-01-01

The PHD-finger proteins are conserved in eukaryotic organisms and are involved in a variety of important functions in different biological processes in plants. However, the function of PHD fingers are poorly known in tomato (Solanum lycopersicum L.). In current study, we identified 45 putative genes coding Phd finger protein in tomato distributed on 11 chromosomes except for chromosome 8. Some of the genes encode other conserved key domains besides Phd-finger. Phylogenetic analysis of these 45 proteins resulted in seven clusters. Most Phd finger proteins were predicted to PML body location. These PHD-finger genes displayed differential expression either in various organs, at different development stages and under stresses in tomato. Our study provides the first systematic analysis of PHD-finger genes and proteins in tomato. This preliminary study provides a very useful reference information for Phd-finger proteins in tomato. They will be helpful for cloning and functional study of tomato PHD-finger genes. (author)

The Relationship Between Transcript Expression Levels of Nuclear Encoded (TFAM, NRF1 and Mitochondrial Encoded (MT-CO1 Genes in Single Human Oocytes During Oocyte Maturation

Directory of Open Access Journals (Sweden)

Ghaffari Novin M.

2015-06-01

Full Text Available In some cases of infertility in women, human oocytes fail to mature when they reach the metaphase II (MII stage. Mitochondria plays an important role in oocyte maturation. A large number of mitochondrial DNA (mtDNA, copied in oocytes, is essential for providing adenosine triphosphate (ATP during oocyte maturation. The purpose of this study was to identify the relationship between transcript expression levels of the mitochondrial encoded gene (MT-CO1 and two nuclear encoded genes, nuclear respiratory factor 1 (NRF1 and mitochondrial transcription factor A (TFAM in various stages of human oocyte maturation. Nine consenting patients, age 21-35 years old, with male factors were selected for ovarian stimulation and intracytoplasmic sperm injection (ICSI procedures. mRNA levels of mitochondrial- related genes were performed by singlecell TaqMan® quantitative real-time polymerase chain reaction (qRT-PCR. There was no significant relationship between the relative expression levels in germinal vesicle (GV stage oocytes (p = 0.62. On the contrary, a significant relationship was seen between the relative expression levels of TFAM and NRF1 and the MT-CO1 genes at the stages of metaphase I (MI and MII (p = 0.03 and p = 0.002. A relationship exists between the transcript expression levels of TFAM and NRF1, and MT-CO1 genes in various stages of human oocyte maturation.

Expression analysis of the Theileria parva subtelomere-encoded variable secreted protein gene family.

Directory of Open Access Journals (Sweden)

Jacqueline Schmuckli-Maurer

Full Text Available The intracellular protozoan parasite Theileria parva transforms bovine lymphocytes inducing uncontrolled proliferation. Proteins released from the parasite are assumed to contribute to phenotypic changes of the host cell and parasite persistence. With 85 members, genes encoding subtelomeric variable secreted proteins (SVSPs form the largest gene family in T. parva. The majority of SVSPs contain predicted signal peptides, suggesting secretion into the host cell cytoplasm.We analysed SVSP expression in T. parva-transformed cell lines established in vitro by infection of T or B lymphocytes with cloned T. parva parasites. Microarray and quantitative real-time PCR analysis revealed mRNA expression for a wide range of SVSP genes. The pattern of mRNA expression was largely defined by the parasite genotype and not by host background or cell type, and found to be relatively stable in vitro over a period of two months. Interestingly, immunofluorescence analysis carried out on cell lines established from a cloned parasite showed that expression of a single SVSP encoded by TP03_0882 is limited to only a small percentage of parasites. Epitope-tagged TP03_0882 expressed in mammalian cells was found to translocate into the nucleus, a process that could be attributed to two different nuclear localisation signals.Our analysis reveals a complex pattern of Theileria SVSP mRNA expression, which depends on the parasite genotype. Whereas in cell lines established from a cloned parasite transcripts can be found corresponding to a wide range of SVSP genes, only a minority of parasites appear to express a particular SVSP protein. The fact that a number of SVSPs contain functional nuclear localisation signals suggests that proteins released from the parasite could contribute to phenotypic changes of the host cell. This initial characterisation will facilitate future studies on the regulation of SVSP gene expression and the potential biological role of these enigmatic

Transcriptional regulation of Saccharomyces cerevisiaeCYS3 encoding cystathionine γ-lyase

Science.gov (United States)

Hiraishi, Hiroyuki; Miyake, Tsuyoshi

2008-01-01

In studying the regulation of GSH11, the structural gene of the high-affinity glutathione transporter (GSH-P1) in Saccharomyces cerevisiae, a cis-acting cysteine responsive element, CCGCCACAC (CCG motif), was detected. Like GSH-P1, the cystathionine γ-lyase encoded by CYS3 is induced by sulfur starvation and repressed by addition of cysteine to the growth medium. We detected a CCG motif (−311 to −303) and a CGC motif (CGCCACAC; −193 to −186), which is one base shorter than the CCG motif, in the 5′-upstream region of CYS3. One copy of the centromere determining element 1, CDE1 (TCACGTGA; −217 to −210), being responsible for regulation of the sulfate assimilation pathway genes, was also detected. We tested the roles of these three elements in the regulation of CYS3. Using a lacZ-reporter assay system, we found that the CCG/CGC motif is required for activation of CYS3, as well as for its repression by cysteine. In contrast, the CDE1 motif was responsible for only activation of CYS3. We also found that two transcription factors, Met4 and VDE, are responsible for activation of CYS3 through the CCG/CGC and CDE1 motifs. These observations suggest a dual regulation of CYS3 by factors that interact with the CDE1 motif and the CCG/CGC motifs. PMID:18317767

Spreading of genes encoding enterotoxins, haemolysins, adhesin and biofilm among methicillin resistant Staphylococcus aureus strains with staphylococcal cassette chromosome mec type IIIA isolated from burn patients.

Science.gov (United States)

Motallebi, Mitra; Jabalameli, Fereshteh; Asadollahi, Kheirollah; Taherikalani, Morovat; Emaneini, Mohammad

2016-08-01

The emergence of antibiotic-resistant Staphylococcus aureus in particular methicillin-resistant S. aureus (MRSA) is an important concern in burn medical centers either in Iran or worldwide. A total of 128 S. aureus isolates were collected from wound infection of burn patients during June 2013 to June 2014. Multiplex-polymerase chain reaction (MPCR) assay was performed for the characterization of the staphylococcal cassette chromosome mec (SCCmec). Genes encoding virulence factors and biofilm were targeted by PCR. Of 128 S. aureus isolates, 77 (60.1%) isolates were MRSA. Fifty four (70.1%) isolates were identified as SCCmec type IIIA. The most frequently detected toxin genes among MRSA isolates with SCCmec type IIIA were sea (64.1%) and hla (51.8%). The rate of coexistence of sea with hla and sea with hla and hlb was 37% and12.9%, respectively. The sec, eta, tst, pvl, hla and hlb genes were not detected in any of the MRSA isolates. The most prevalent genes encoding biofilm was eno, found in 61.1% of isolates, followed by fib and icaA found in 48.1% and 38.8% of the isolates, respectively. The rate of coexistence of fib + eno + icaA + icaD and fib + eno was 20.3% and 9.2%, respectively. The ebps gene was not detected in any of the isolates. In conclusion, our study indicated that the sea, hla, fib and icaA were most frequent genes encoding virulence factors among MRSA with SCCmec type IIIA isolated from burn wound infection. Moreover, the results of this study shows that the rate of coexistence of genes encoding different virulence factor were high. Copyright © 2016 Elsevier Ltd. All rights reserved.

Expression analysis of two gene subfamilies encoding the plasma membrane H+-ATPase in Nicotiana plumbaginifolia reveals the major transport functions of this enzyme.

Science.gov (United States)

Moriau, L; Michelet, B; Bogaerts, P; Lambert, L; Michel, A; Oufattole, M; Boutry, M

1999-07-01

The plasma membrane H+-ATPase couples ATP hydrolysis to proton transport, thereby establishing the driving force for solute transport across the plasma membrane. In Nicotiana plumbaginifolia, this enzyme is encoded by at least nine pma (plasma membrane H+-ATPase) genes. Four of these are classified into two gene subfamilies, pma1-2-3 and pma4, which are the most highly expressed in plant species. We have isolated genomic clones for pma2 and pma4. Mapping of their transcript 5' end revealed the presence of a long leader that contained small open reading frames, regulatory features typical of other pma genes. The gusA reporter gene was then used to determine the expression of pma2, pma3 and pma4 in N. tabacum. These data, together with those obtained previously for pma1, led to the following conclusions. (i) The four pma-gusA genes were all expressed in root, stem, leaf and flower organs, but each in a cell-type specific manner. Expression in these organs was confirmed at the protein level, using subfamily-specific antibodies. (ii) pma4-gusA was expressed in many cell types and notably in root hair and epidermis, in companion cells, and in guard cells, indicating that in N. plumbaginifolia the same H+-ATPase isoform might be involved in mineral nutrition, phloem loading and control of stomata aperture. (iii) The second gene subfamily is composed, in N. plumbaginifolia, of a single gene (pma4) with a wide expression pattern and, in Arabidopsis thaliana, of three genes (aha1, aha2, aha3), at least two of them having a more restrictive expression pattern. (iv) Some cell types expressed pma2 and pma4 at the same time, which encode H+-ATPases with different enzymatic properties.

Carboxylesterase 1A2 encoding gene with increased transcription and potential rapid drug metabolism in Asian populations

DEFF Research Database (Denmark)

Rasmussen, Henrik Berg; Madsen, Majbritt Busk; Lyauk, Yassine Kamal

2017-01-01

The carboxylesterase 1 gene (CES1) encodes a hydrolase implicated in the metabolism of commonly used drugs. CES1A2, a hybrid of CES1 and a CES1-like pseudogene, has a promoter that is weak in most individuals. However, some individuals harbor a promoter haplotype of this gene with two overlapping...

Candida albicans AGE3, the ortholog of the S. cerevisiae ARF-GAP-encoding gene GCS1, is required for hyphal growth and drug resistance.

Directory of Open Access Journals (Sweden)

Thomas Lettner

Full Text Available BACKGROUND: Hyphal growth and multidrug resistance of C. albicans are important features for virulence and antifungal therapy of this pathogenic fungus. METHODOLOGY/PRINCIPAL FINDINGS: Here we show by phenotypic complementation analysis that the C. albicans gene AGE3 is the functional ortholog of the yeast ARF-GAP-encoding gene GCS1. The finding that the gene is required for efficient endocytosis points to an important functional role of Age3p in endosomal compartments. Most C. albicans age3Delta mutant cells which grew as cell clusters under yeast growth conditions showed defects in filamentation under different hyphal growth conditions and were almost completely disabled for invasive filamentous growth. Under hyphal growth conditions only a fraction of age3Delta cells shows a wild-type-like polarization pattern of the actin cytoskeleton and lipid rafts. Moreover, age3Delta cells were highly susceptible to several unrelated toxic compounds including antifungal azole drugs. Irrespective of the AGE3 genotype, C-terminal fusions of GFP to the drug efflux pumps Cdr1p and Mdr1p were predominantly localized in the plasma membrane. Moreover, the plasma membranes of wild-type and age3Delta mutant cells contained similar amounts of Cdr1p, Cdr2p and Mdr1p. CONCLUSIONS/SIGNIFICANCE: The results indicate that the defect in sustaining filament elongation is probably caused by the failure of age3Delta cells to polarize the actin cytoskeleton and possibly of inefficient endocytosis. The high susceptibility of age3Delta cells to azoles is not caused by inefficient transport of efflux pumps to the cell membrane. A possible role of a vacuolar defect of age3Delta cells in drug susceptibility is proposed and discussed. In conclusion, our study shows that the ARF-GAP Age3p is required for hyphal growth which is an important virulence factor of C. albicans and essential for detoxification of azole drugs which are routinely used for antifungal therapy. Thus, it

Three synonymous genes encode calmodulin in a reptile, the Japanese tortoise, Clemmys japonica

Directory of Open Access Journals (Sweden)

Kouji Shimoda

2002-01-01

Full Text Available Three distinct calmodulin (CaM-encoding cDNAs were isolated from a reptile, the Japanese tortoise (Clemmys japonica, based on degenerative primer PCR. Because of synonymous codon usages, the deduced amino acid (aa sequences were exactly the same in all three genes and identical to the aa sequence of vertebrate CaM. The three cDNAs, referred to as CaM-A, -B, and -C, seemed to belong to the same type as CaMI, CaMII, and CaMIII, respectively, based on their sequence identity with those of the mammalian cDNAs and the glutamate codon biases. Northern blot analysis detected CaM-A and -B as bands corresponding to 1.8 kb, with the most abundant levels in the brain and testis, while CaM-C was detected most abundantly in the brain as bands of 1.4 and 2.0 kb. Our results indicate that, in the tortoise, CaM protein is encoded by at least three non-allelic genes, and that the ‘multigene-one protein' principle of CaM synthesis is applicable to all classes of vertebrates, from fishes to mammals.

GRN2SBML: automated encoding and annotation of inferred gene regulatory networks complying with SBML.

Science.gov (United States)

Vlaic, Sebastian; Hoffmann, Bianca; Kupfer, Peter; Weber, Michael; Dräger, Andreas

2013-09-01

GRN2SBML automatically encodes gene regulatory networks derived from several inference tools in systems biology markup language. Providing a graphical user interface, the networks can be annotated via the simple object access protocol (SOAP)-based application programming interface of BioMart Central Portal and minimum information required in the annotation of models registry. Additionally, we provide an R-package, which processes the output of supported inference algorithms and automatically passes all required parameters to GRN2SBML. Therefore, GRN2SBML closes a gap in the processing pipeline between the inference of gene regulatory networks and their subsequent analysis, visualization and storage. GRN2SBML is freely available under the GNU Public License version 3 and can be downloaded from http://www.hki-jena.de/index.php/0/2/490. General information on GRN2SBML, examples and tutorials are available at the tool's web page.

Investigation of the role of genes encoding zinc exporters zntA, zitB, and fieF during Salmonella typhimurium infection

DEFF Research Database (Denmark)

Huang, Kaisong; Wang, Dan; Frederiksen, Rikki F.

2018-01-01

The transition metal zinc is involved in crucial biological processes in all living organisms and is essential for survival of Salmonella in the host. However, little is known about the role of genes encoding zinc efflux transporters during Salmonella infection. In this study, we constructed...... deletion mutants for genes encoding zinc exporters (zntA, zitB, and fieF) in the wild-type (WT) strain Salmonella enterica serovar Typhimurium (S. Typhimurium) 4/74. The mutants 4/74ΔzntA and 4/74ΔzntA/zitB exhibited a dramatic growth delay and abrogated growth ability, respectively, in Luria Bertani...... medium supplemented with 0.25 mM ZnCl2 or 1.5 mM CuSO4 compared to the WT strain. In order to investigate the role of genes encoding zinc exporters on survival of S. Typhimurium inside cells, amoeba and macrophage infection models were used. No significant differences in uptake or survival were detected...

Replacement of the folC gene, encoding folylpolyglutamate synthetase-dihydrofolate synthetase in Escherichia coli, with genes mutagenized in vitro.

Science.gov (United States)

Pyne, C; Bognar, A L

1992-03-01

The folylpolyglutamate synthetase-dihydrofolate synthetase gene (folC) in Escherichia coli was deleted from the bacterial chromosome and replaced by a selectable Kmr marker. The deletion strain required a complementing gene expressing folylpolyglutamate synthetase encoded on a plasmid for viability, indicating that folC is an essential gene in E. coli. The complementing folC gene was cloned into the vector pPM103 (pSC101, temperature sensitive for replication), which segregated spontaneously at 42 degrees C in the absence of selection. This complementing plasmid was replaced in the folC deletion strain by compatible pUC plasmids containing folC genes with mutations generated in vitro, producing strains which express only mutant folylpolyglutamate synthetase. Mutant folC genes expressing insufficient enzyme activity could not complement the chromosomal deletion, resulting in retention of the pPM103 plasmid. Some mutant genes expressing low levels of enzyme activity replaced the complementing plasmid, but the strains produced were auxotrophic for products of folate-dependent pathways. The folylpolyglutamate synthetase gene from Lactobacillus casei, which may lack dihydrofolate synthetase activity, replaced the complementing plasmid, but the strain was auxotrophic for all folate end products.

Genes encoding novel lipid transporters and their use to increase oil production in vegetative tissues of plants

Science.gov (United States)

Xu, Changcheng; Fan, Jilian; Yan, Chengshi; Shanklin, John

2017-12-26

The present invention discloses a novel gene encoding a transporter protein trigalactosyldiacylglycerol-5 (TGD5), mutations thereof and their use to enhance TAG production and retention in plant vegetative tissue.

The A581G Mutation in the Gene Encoding Plasmodium falciparum Dihydropteroate Synthetase Reduces the Effectiveness of Sulfadoxine-Pyrimethamine Preventive Therapy in Malawian Pregnant Women

NARCIS (Netherlands)

Gutman, Julie; Kalilani, Linda; Taylor, Steve; Zhou, Zhiyong; Wiegand, Ryan E.; Thwai, Kyaw L.; Mwandama, Dyson; Khairallah, Carole; Madanitsa, Mwayi; Chaluluka, Ebbie; Dzinjalamala, Fraction; Ali, Doreen; Mathanga, Don P.; Skarbinski, Jacek; Shi, Ya Ping; Meshnick, Steve; ter Kuile, Feiko O.

2015-01-01

Background. The A581G mutation in the gene encoding Plasmodium falciparum dihydropteroate synthase (dhps), in combination with the quintuple mutant involving mutations in both dhps and the gene encoding dihydrofolate reductase (dhfr), the so-called sextuple mutant, has been associated with increased

Nucleotide sequences of the genes encoding fructosebisphosphatase and phosphoribulokinase from Xanthobacter flavus H4-14

NARCIS (Netherlands)

Meijer, Wilhelmus; Enequist, H.G.; Terpstra, Peter; Dijkhuizen, L.

The genes encoding fructosebisphosphatase and phosphoribulokinase present on a 2.5 kb SalI fragment from Xanthobacter flavus H4-14 were sequenced. Two large open reading frames (ORFs) were identified, preceded by plausible ribosome-binding sites. The ORFs were transcribed in the same direction and

KCNN Genes that Encode Small-Conductance Ca2+-Activated K+ Channels Influence Alcohol and Drug Addiction.

Science.gov (United States)

Padula, Audrey E; Griffin, William C; Lopez, Marcelo F; Nimitvilai, Sudarat; Cannady, Reginald; McGuier, Natalie S; Chesler, Elissa J; Miles, Michael F; Williams, Robert W; Randall, Patrick K; Woodward, John J; Becker, Howard C; Mulholland, Patrick J

2015-07-01

Small-conductance Ca(2+)-activated K(+) (KCa2) channels control neuronal excitability and synaptic plasticity, and have been implicated in substance abuse. However, it is unknown if genes that encode KCa2 channels (KCNN1-3) influence alcohol and drug addiction. In the present study, an integrative functional genomics approach shows that genetic datasets for alcohol, nicotine, and illicit drugs contain the family of KCNN genes. Alcohol preference and dependence QTLs contain KCNN2 and KCNN3, and Kcnn3 transcript levels in the nucleus accumbens (NAc) of genetically diverse BXD strains of mice predicted voluntary alcohol consumption. Transcript levels of Kcnn3 in the NAc negatively correlated with alcohol intake levels in BXD strains, and alcohol dependence enhanced the strength of this association. Microinjections of the KCa2 channel inhibitor apamin into the NAc increased alcohol intake in control C57BL/6J mice, while spontaneous seizures developed in alcohol-dependent mice following apamin injection. Consistent with this finding, alcohol dependence enhanced the intrinsic excitability of medium spiny neurons in the NAc core and reduced the function and protein expression of KCa2 channels in the NAc. Altogether, these data implicate the family of KCNN genes in alcohol, nicotine, and drug addiction, and identify KCNN3 as a mediator of voluntary and excessive alcohol consumption. KCa2.3 channels represent a promising novel target in the pharmacogenetic treatment of alcohol and drug addiction.

NCYM, a Cis-antisense gene of MYCN, encodes a de novo evolved protein that inhibits GSK3β resulting in the stabilization of MYCN in human neuroblastomas.

Directory of Open Access Journals (Sweden)

Yusuke Suenaga

2014-01-01

Full Text Available The rearrangement of pre-existing genes has long been thought of as the major mode of new gene generation. Recently, de novo gene birth from non-genic DNA was found to be an alternative mechanism to generate novel protein-coding genes. However, its functional role in human disease remains largely unknown. Here we show that NCYM, a cis-antisense gene of the MYCN oncogene, initially thought to be a large non-coding RNA, encodes a de novo evolved protein regulating the pathogenesis of human cancers, particularly neuroblastoma. The NCYM gene is evolutionally conserved only in the taxonomic group containing humans and chimpanzees. In primary human neuroblastomas, NCYM is 100% co-amplified and co-expressed with MYCN, and NCYM mRNA expression is associated with poor clinical outcome. MYCN directly transactivates both NCYM and MYCN mRNA, whereas NCYM stabilizes MYCN protein by inhibiting the activity of GSK3β, a kinase that promotes MYCN degradation. In contrast to MYCN transgenic mice, neuroblastomas in MYCN/NCYM double transgenic mice were frequently accompanied by distant metastases, behavior reminiscent of human neuroblastomas with MYCN amplification. The NCYM protein also interacts with GSK3β, thereby stabilizing the MYCN protein in the tumors of the MYCN/NCYM double transgenic mice. Thus, these results suggest that GSK3β inhibition by NCYM stabilizes the MYCN protein both in vitro and in vivo. Furthermore, the survival of MYCN transgenic mice bearing neuroblastoma was improved by treatment with NVP-BEZ235, a dual PI3K/mTOR inhibitor shown to destabilize MYCN via GSK3β activation. In contrast, tumors caused in MYCN/NCYM double transgenic mice showed chemo-resistance to the drug. Collectively, our results show that NCYM is the first de novo evolved protein known to act as an oncopromoting factor in human cancer, and suggest that de novo evolved proteins may functionally characterize human disease.

Detection, Characterization, and In Vitro and In Vivo Expression of Genes Encoding S-Proteins in Lactobacillus gallinarum Strains Isolated from Chicken Crops

Science.gov (United States)

Hagen, Karen E.; Guan, Le Luo; Tannock, Gerald W.; Korver, Doug R.; Allison, Gwen E.

2005-01-01

Thirty-eight isolates of Lactobacillus gallinarum cultured from the crops of broiler chickens were screened for the presence of genes encoding S-layer proteins. All of the isolates had two S-protein genes, which were designated Lactobacillus gallinarum S-protein (lgs) genes. One gene in each isolate was either lgsA or lgsB. The Lactobacillus isolates were further characterized by pulsed-field gel electrophoresis of DNA digests, which grouped the isolates into 17 genotypes (strains). The second gene in each of eight representative strains was sequenced and shown to differ among strains (lgsC, lgsD, lgsE, lgsF, lgsG, lgsH, and lgsI). The genome of each strain thus encoded a common S-protein (encoded by either lgsA or lgsB) and a strain-specific S-protein. The extraction of cell surface proteins from cultures of the eight strains showed that each strain produced a single S-protein that was always encoded by the strain-specific lgs gene. Two of the strains were used to inoculate chickens maintained in a protected environment which were Lactobacillus-free prior to inoculation. DNAs and RNAs extracted from the digesta of the chickens were used for PCR and reverse transcription-PCR, respectively, to demonstrate the presence and transcription of lgs genes in vivo. In both cases, only the strain-specific gene was transcribed. Both of the strains adhered to the crop epithelium, consistent with published data predicting that S-proteins of lactobacilli are adhesins. The results of this study provide a basis for the investigation of gene duplication and sequence variation as mechanisms by which bacterial strains of the same species can share the same habitat. PMID:16269691

Cloning and expression of clt genes encoding milk-clotting proteases from Myxococcus xanthus 422.

Science.gov (United States)

Poza, M; Prieto-Alcedo, M; Sieiro, C; Villa, T G

2004-10-01

The screening of a gene library of the milk-clotting strain Myxococcus xanthus 422 constructed in Escherichia coli allowed the description of eight positive clones containing 26 open reading frames. Only three of them (cltA, cltB, and cltC) encoded proteins that exhibited intracellular milk-clotting ability in E. coli, Saccharomyces cerevisiae, and Pichia pastoris expression systems.

Holovideo: Real-time 3D range video encoding and decoding on GPU

Science.gov (United States)

Karpinsky, Nikolaus; Zhang, Song

2012-02-01

We present a 3D video-encoding technique called Holovideo that is capable of encoding high-resolution 3D videos into standard 2D videos, and then decoding the 2D videos back into 3D rapidly without significant loss of quality. Due to the nature of the algorithm, 2D video compression such as JPEG encoding with QuickTime Run Length Encoding (QTRLE) can be applied with little quality loss, resulting in an effective way to store 3D video at very small file sizes. We found that under a compression ratio of 134:1, Holovideo to OBJ file format, the 3D geometry quality drops at a negligible level. Several sets of 3D videos were captured using a structured light scanner, compressed using the Holovideo codec, and then uncompressed and displayed to demonstrate the effectiveness of the codec. With the use of OpenGL Shaders (GLSL), the 3D video codec can encode and decode in realtime. We demonstrated that for a video size of 512×512, the decoding speed is 28 frames per second (FPS) with a laptop computer using an embedded NVIDIA GeForce 9400 m graphics processing unit (GPU). Encoding can be done with this same setup at 18 FPS, making this technology suitable for applications such as interactive 3D video games and 3D video conferencing.

A Gene Encoding a DUF247 Domain Protein Cosegregates with the S Self-Incompatibility Locus in Perennial Ryegrass

DEFF Research Database (Denmark)

Manzanares, Chloe; Barth, Susanne; Thorogood, Daniel

2016-01-01

genes cosegregating with the S-locus, a highly polymorphic gene encoding for a protein containing a DUF247 was fully predictive of known S-locus genotypes at the amino acid level in the seven mapping populations. Strikingly, this gene showed a frameshift mutation in self-compatible darnel (Lolium...

Genetic and functional analysis of the gene encoding GAP-43 in schizophrenia.

Science.gov (United States)

Shen, Yu-Chih; Tsai, Ho-Min; Cheng, Min-Chih; Hsu, Shih-Hsin; Chen, Shih-Fen; Chen, Chia-Hsiang

2012-02-01

In earlier reports, growth-associated protein 43 (GAP-43) has been shown to be critical for initial establishment or reorganization of synaptic connections, a process thought to be disrupted in schizophrenia. Additionally, abnormal GAP-43 expression in different brain regions has been linked to this disorder in postmortem brain studies. In this study, we investigated the involvement of the gene encoding GAP-43 in the susceptibility to schizophrenia. We searched for genetic variants in the promoter region and 3 exons (including both UTR ends) of the GAP-43 gene using direct sequencing in a sample of patients with schizophrenia (n=586) and non-psychotic controls (n=576), both being Han Chinese from Taiwan, and conducted an association and functional study. We identified 11 common polymorphisms in the GAP-43 gene. SNP and haplotype-based analyses displayed no associations with schizophrenia. Additionally, we identified 4 rare variants in 5 out of 586 patients, including 1 variant located at the promoter region (c.-258-4722G>T) and 1 synonymous (V110V) and 2 missense (G150R and P188L) variants located at exon 2. No rare variants were found in the control subjects. The results of the reporter gene assay demonstrated that the regulatory activity of construct containing c.-258-4722T was significantly lower as compared to the wild type construct (c.-258-4722G; panalysis also demonstrated the functional relevance of other rare variants. Our study lends support to the hypothesis of multiple rare mutations in schizophrenia, and it provides genetic clues that indicate the involvement of GAP-43 in this disorder. Copyright © 2011 Elsevier B.V. All rights reserved.

Glycosulfatase-Encoding Gene Cluster in Bifidobacterium breve UCC2003.

Science.gov (United States)

Egan, Muireann; Jiang, Hao; O'Connell Motherway, Mary; Oscarson, Stefan; van Sinderen, Douwe

2016-11-15

Bifidobacteria constitute a specific group of commensal bacteria typically found in the gastrointestinal tract (GIT) of humans and other mammals. Bifidobacterium breve strains are numerically prevalent among the gut microbiota of many healthy breastfed infants. In the present study, we investigated glycosulfatase activity in a bacterial isolate from a nursling stool sample, B. breve UCC2003. Two putative sulfatases were identified on the genome of B. breve UCC2003. The sulfated monosaccharide N-acetylglucosamine-6-sulfate (GlcNAc-6-S) was shown to support the growth of B. breve UCC2003, while N-acetylglucosamine-3-sulfate, N-acetylgalactosamine-3-sulfate, and N-acetylgalactosamine-6-sulfate did not support appreciable growth. By using a combination of transcriptomic and functional genomic approaches, a gene cluster designated ats2 was shown to be specifically required for GlcNAc-6-S metabolism. Transcription of the ats2 cluster is regulated by a repressor open reading frame kinase (ROK) family transcriptional repressor. This study represents the first description of glycosulfatase activity within the Bifidobacterium genus. Bifidobacteria are saccharolytic organisms naturally found in the digestive tract of mammals and insects. Bifidobacterium breve strains utilize a variety of plant- and host-derived carbohydrates that allow them to be present as prominent members of the infant gut microbiota as well as being present in the gastrointestinal tract of adults. In this study, we introduce a previously unexplored area of carbohydrate metabolism in bifidobacteria, namely, the metabolism of sulfated carbohydrates. B. breve UCC2003 was shown to metabolize N-acetylglucosamine-6-sulfate (GlcNAc-6-S) through one of two sulfatase-encoding gene clusters identified on its genome. GlcNAc-6-S can be found in terminal or branched positions of mucin oligosaccharides, the glycoprotein component of the mucous layer that covers the digestive tract. The results of this study provide

Dissection of Resistance Genes to Pseudomonas syringae pv. phaseolicola in UI3 Common Bean Cultivar.

Science.gov (United States)

González, Ana M; Godoy, Luís; Santalla, Marta

2017-11-23

Few quantitative trait loci have been mapped for resistance to Pseudomonas syringae pv. phaseolicola in common bean. Two F₂ populations were developed from the host differential UI3 cultivar. The objective of this study was to further characterize the resistance to races 1, 5, 7 and 9 of Psp included in UI3. Using a QTL mapping approach, 16 and 11 main-effect QTLs for pod and primary leaf resistance were located on LG10, explaining up to 90% and 26% of the phenotypic variation, respectively. The homologous genomic region corresponding to primary leaf resistance QTLs detected tested positive for the presence of resistance-associated gene cluster encoding nucleotide-binding and leucine-rich repeat (NL), Natural Resistance Associated Macrophage (NRAMP) and Pentatricopeptide Repeat family (PPR) proteins. It is worth noting that the main effect QTLs for resistance in pod were located inside a 3.5 Mb genomic region that included the Phvul.010G021200 gene, which encodes a protein that has the highest sequence similarity to the RIN4 gene of Arabidopsis, and can be considered an important candidate gene for the organ-specific QTLs identified here. These results support that resistance to Psp from UI3 might result from the immune response activated by combinations of R proteins, and suggest the guard model as an important mechanism in pod resistance to halo blight. The candidate genes identified here warrant functional studies that will help in characterizing the actual defense gene(s) in UI3 genotype.

[Cloning, prokaryotic expression and antibacterial assay of Tenecin gene encoding an antibacterial peptide from Tenebrio molitor].

Science.gov (United States)

Liu, Ying; Jiang, Yu-xin; Li, Chao-pin

2011-12-01

To clone tenecin gene, an antibacterial peptide gene, from Tenebrio molitor for its prokaryotic expression and explore the molecular mechanism for regulating the expression of antibacterial peptide in Tenebrio molitor larvae. The antibacterial peptide was induced from the larvae of Tenebrio molitor by intraperitoneal injection of Escherichia coli DH-5α (1×10(8)/ml). RT-PCR was performed 72 h after the injection to clone Tenecin gene followed by sequencing and bioinformatic analysis. The recombinant expression vector pET-28a(+)-Tenecin was constructed and transformed into E. coli BL21(DE3) cells and the expression of tenecin protein was observed after IPTG induction. Tenecin expression was detected in transformed E.coli using SDS-PAGE after 1 mmol/L IPTG induction. Tenecin gene, which was about 255 bp in length, encoded Tenecin protein with a relative molecular mass of 9 kD. Incubation of E.coli with 80, 60, 40, and 20 µg/ml tenecin for 18 h resulted in a diameter of the inhibition zone of 25.1∓0.03, 20.7∓0.06, 17.2∓0.11 and 9.3∓0.04 mm, respectively. Tenecin protein possesses strong antibacterial activity against E. coli DH-5α, which warrants further study of this protein for its potential as an antibacterial agent in clinical application.

A study of Staphylococcus aureusnasal carriage, antibacterial resistance and virulence factor encoding genes in a tertiary care hospital, Kayseri, Turkey.

Science.gov (United States)

Oguzkaya-Artan, M; Artan, C; Baykan, Z; Sakalar, C; Turan, A; Aksu, H

2015-01-01

This study was to determine the virulence encoding genes, and the antibiotic resistance patterns of the Staphylococcus aureus isolates, which were isolated from the nasal samples of chest clinic patients. The nasal samples of the in-patients (431) and out-patients (1857) in Kayseri Training and Research Hospital's Chest Clinic, Kayseri, Turkey, were cultured on CHROMagar (Biolife, Italiana) S. aureus, and subcultured on sheep blood agar for the isolation of S. aureus. Disc diffusion method was used for antimicrobial susceptibility testing. The occurrence of the staphylococcal virulence encoding genes (enterotoksins [sea, seb, sec, see, seg, seh, sei, sej], fibronectin-binding proteins A, B [fnbA, fnbB], toxic shock syndrome toxin-1 [tst]) were detected by polymerase chain reaction. Forty-five of the 55 (81.8%) S. aureus isolates from inpatients, and 319 (90.6%) isolates from tested 352 out-patient's isolates were suspected to all the antibiotics tested. methicillin-resistant S. aureus (MRSA) was detected in 1.2% of S. aureus isolates. Rifampin, trimethoprim-sulfamethoxazole, clindamycin, erythromycin, gentamicin resistance rates were 1.2%, 1.7%, 2.0%, 8.8%, and 1.2%, respectively. The isolates were susceptible to teicoplanin and vancomycin. The genes most frequently found were tst (92.7%), seg (85.8%), sea (83.6%), fnbA (70.9%). There was no statistical significance detected between MRSA and mecA-negative S. aureus isolates in encoding genes distribution (P > 0.05). Our results show that virulence factor encoding genes were prevalent in patients with S. aureus carriage, whereas antibiotic resistance was low. These virulence determinants may increase the risk for subsequent invasive infections in carriers.

Linkage of the gene that encodes the alpha 1 chain of type V collagen (COL5A1) to type II Ehlers-Danlos syndrome (EDS II).

Science.gov (United States)

Loughlin, J; Irven, C; Hardwick, L J; Butcher, S; Walsh, S; Wordsworth, P; Sykes, B

1995-09-01

Ehlers-Danlos syndrome (EDS) is a group of heritable disorders of connective tissue with skin, ligaments and blood vessels being the main sites affected. The commonest variant (EDS II) exhibits an autosomal dominant mode of inheritance and is characterized by joint hypermobility, cigarette paper scars, lax skin and excessive bruising. As yet no gene has been linked to EDS II, nor has linkage been established to a specific region of the genome. However, several candidate genes encoding proteins of the extracellular matrix have been excluded. Using an intragenic simple sequence repeat polymorphism, we report linkage of the COL5A1 gene, which encodes the alpha 1(V) chain of type V collagen, to EDS II. A maximum LOD score (Zmax) for linkage of 8.3 at theta = 0.00 was generated for a single large pedigree.

Characterization and expression of genes encoding three small heat shock proteins in Sesamia inferens (Lepidoptera: Noctuidae).

Science.gov (United States)

Sun, Meng; Lu, Ming-Xing; Tang, Xiao-Tian; Du, Yu-Zhou

2014-12-12

The pink stem borer, Sesamia inferens (Walker), is a major pest of rice and is endemic in China and other parts of Asia. Small heat shock proteins (sHSPs) encompass a diverse, widespread class of stress proteins that have not been characterized in S. inferens. In the present study, we isolated and characterized three S. inferens genes that encode members of the α-crystallin/sHSP family, namely, Sihsp21.4, Sihsp20.6, and Sihsp19.6. The three cDNAs encoded proteins of 187, 183 and 174 amino acids with calculated molecular weights of 21.4, 20.6 and 19.6 kDa, respectively. The deduced amino acid sequences of the three genes showed strong similarity to sHSPs identified in other lepidopteran insects. Sihsp21.4 contained an intron, but Sihsp20.6 and Sihsp19.6 lacked introns. Real-time quantitative PCR analyses revealed that Sihsp21.4 was most strongly expressed in S. inferens heads; Whereas expression of Sihsp20.6 and Sihsp19.6 was highest in eggs. The three S. inferens sHSP genes were up-regulated during low temperature stress. In summary, our results show that S. inferens sHSP genes have distinct regulatory roles in the physiology of S. inferens.

Characterization and Expression of Genes Encoding Three Small Heat Shock Proteins in Sesamia inferens (Lepidoptera: Noctuidae

Directory of Open Access Journals (Sweden)

Meng Sun

2014-12-01

Full Text Available The pink stem borer, Sesamia inferens (Walker, is a major pest of rice and is endemic in China and other parts of Asia. Small heat shock proteins (sHSPs encompass a diverse, widespread class of stress proteins that have not been characterized in S. inferens. In the present study, we isolated and characterized three S. inferens genes that encode members of the α-crystallin/sHSP family, namely, Sihsp21.4, Sihsp20.6, and Sihsp19.6. The three cDNAs encoded proteins of 187, 183 and 174 amino acids with calculated molecular weights of 21.4, 20.6 and 19.6 kDa, respectively. The deduced amino acid sequences of the three genes showed strong similarity to sHSPs identified in other lepidopteran insects. Sihsp21.4 contained an intron, but Sihsp20.6 and Sihsp19.6 lacked introns. Real-time quantitative PCR analyses revealed that Sihsp21.4 was most strongly expressed in S. inferens heads; Whereas expression of Sihsp20.6 and Sihsp19.6 was highest in eggs. The three S. inferens sHSP genes were up-regulated during low temperature stress. In summary, our results show that S. inferens sHSP genes have distinct regulatory roles in the physiology of S. inferens.

Characterization and Expression of Genes Encoding Three Small Heat Shock Proteins in Sesamia inferens (Lepidoptera: Noctuidae)

OpenAIRE

Sun, Meng; Lu, Ming-Xing; Tang, Xiao-Tian; Du, Yu-Zhou

2014-01-01

The pink stem borer, Sesamia inferens (Walker), is a major pest of rice and is endemic in China and other parts of Asia. Small heat shock proteins (sHSPs) encompass a diverse, widespread class of stress proteins that have not been characterized in S. inferens. In the present study, we isolated and characterized three S. inferens genes that encode members of the α-crystallin/sHSP family, namely, Sihsp21.4, Sihsp20.6, and Sihsp19.6. The three cDNAs encoded proteins of 187, 183 and 174 amino a...

Impact of haloperidol and quetiapine on the expression of genes encoding antioxidant enzymes in human neuroblastoma SH-SY5Y cells.

Science.gov (United States)

Schmidt, Andreas Johannes; Hemmeter, Ulrich Michael; Krieg, Jürgen-Christian; Vedder, Helmut; Heiser, Philip

2009-05-01

Antipsychotics are known to alter antioxidant activities in vivo. Therefore, the aim of the present study was to examine in the human neuroblastoma SH-SY5Y cell line the impact of a typical (haloperidol) and an atypical (quetiapine) antipsychotic on the expression of genes encoding the key enzymes of the antioxidant metabolism (Cu, Zn superoxide dismutase; Mn superoxide dismutase; glutathione peroxidase; catalase) and enzymes of the glutathione metabolism (gamma-glutamyl cysteine synthetase, glutathione-S-transferase, gamma-glutamyltranspeptidase, glutathione reductase). The cells were incubated for 24h with 0.3, 3, 30 and 300microM haloperidol and quetiapine, respectively; mRNA levels were measured by polymerase chain reaction. In the present study, we observed mostly significant decreases of mRNA contents. With respect to the key pathways, we detected mainly effects on the mRNA levels of the hydrogen peroxide detoxifying enzymes. Among the enzymes of the glutathione metabolism, glutathione-S-transferase- and gamma-glutamyltranspeptidase-mRNA levels showed the most prominent effects. Taken together, our results demonstrate a significantly reduced expression of genes encoding for antioxidant enzymes after treatment with the antipsychotics, haloperidol and quetiapine.

A single Danio rerio hars gene encodes both cytoplasmic and mitochondrial histidyl-tRNA synthetases.

Directory of Open Access Journals (Sweden)

Ashley L Waldron

Full Text Available Histidyl tRNA Synthetase (HARS is a member of the aminoacyl tRNA synthetase (ARS family of enzymes. This family of 20 enzymes is responsible for attaching specific amino acids to their cognate tRNA molecules, a critical step in protein synthesis. However, recent work highlighting a growing number of associations between ARS genes and diverse human diseases raises the possibility of new and unexpected functions in this ancient enzyme family. For example, mutations in HARS have been linked to two different neurological disorders, Usher Syndrome Type IIIB and Charcot Marie Tooth peripheral neuropathy. These connections raise the possibility of previously undiscovered roles for HARS in metazoan development, with alterations in these functions leading to complex diseases. In an attempt to establish Danio rerio as a model for studying HARS functions in human disease, we characterized the Danio rerio hars gene and compared it to that of human HARS. Using a combination of bioinformatics, molecular biology, and cellular approaches, we found that while the human genome encodes separate genes for cytoplasmic and mitochondrial HARS protein, the Danio rerio genome encodes a single hars gene which undergoes alternative splicing to produce the respective cytoplasmic and mitochondrial versions of Hars. Nevertheless, while the HARS genes of humans and Danio differ significantly at the genomic level, we found that they are still highly conserved at the amino acid level, underscoring the potential utility of Danio rerio as a model organism for investigating HARS function and its link to human diseases in vivo.

Complementation of the amylose-free starch mutant of potato (Solanum tuberosum.) by the gene encoding granule-bound starch synthase

NARCIS (Netherlands)

van der Leij, E.R.; Visser, R.G.E.; OOSTERHAVEN, K; VANDERKOP, DAM; Jacobsen, E.; Feenstra, W.

1991-01-01

Agrobacterium rhizogenes-mediated introduction of the wild-type allele of the gene encoding granule-bound starch synthase (GBSS) into the amylose-free starch mutant amf of potato leads to restoration of GBSS activity and amylose synthesis, which demonstrates that Amf is the structural gene for GBSS.

Mapping to mouse chromosome 3 of the gene encoding latexin (Lxn) expressed in neocortical neurons in a region-specific manner

Energy Technology Data Exchange (ETDEWEB)

Jin, Ming-hao; Uratani, Yoshihiko; Arimatsu, Yasuyoshi [Mitsubishi Kasei Institute of Life Sciences, Tokyo (Japan)

1997-02-01

Latexin was first found as a 29-kDa antigen expressed in a subset of neurons in infragranular layers of lateral, but not dorsal, neocortical areas in the rat using a monoclonal antibody PC3.1. It was found that the vast majority of latexin-expressing neurons in both layers V and VI within the lateral neocortex were generated concurrently at Embryonic Day 15, demonstrating a strict correlation between the molecular identity of neurons and the time of their generation. Since neurons expressing latexin are located in the restricted part of the neocortex, latexin has been used as a useful molecular marker to elucidate the mechanism underlying cortical regional specification. The latexin cDNA isolated from a cDNA library of the rat cerebral cortex encodes a protein composed of 223-amino-acid residues containing two potential Ca{sup 2+}/calmodulin-dependent protein kinase sites and one cGMP-dependent protein kinase phosphorylation site. The absence of any signal peptide or potential transmembrane domain is consistent with the apparent cytosolic localization of latexin in the rat brain. The transcripts of latexin were expressed in not only neutral but also nonneural tissues (e.g., lung, spleen, kidney, heart, and digestive tracts). Recently, it has been demonstrated that latexin purified from the rat brain has inhibitory activity against carboxypeptidase A1, carboxypeptidase A2, and mast cell carboxypeptidase A, with less carboxypeptidase B-inhibiting activity. The amino acid sequence deduced from the rat latexin cDNA has no strict homology to any sequences so far known. Genomic Southern blot analysis using a cDNA probe of rat latexin suggested that the gene encoding latexin in the rat has homologues in other mammalian species and in the chicken, but not in the nematode, fly, or frog. 9 refs., 1 fig.

Heterologous expression and transcript analysis of gibberellin biosynthetic genes of grasses reveals novel functionality in the GA3ox family.

Science.gov (United States)

Pearce, Stephen; Huttly, Alison K; Prosser, Ian M; Li, Yi-dan; Vaughan, Simon P; Gallova, Barbora; Patil, Archana; Coghill, Jane A; Dubcovsky, Jorge; Hedden, Peter; Phillips, Andrew L

2015-06-05

The gibberellin (GA) pathway plays a central role in the regulation of plant development, with the 2-oxoglutarate-dependent dioxygenases (2-ODDs: GA20ox, GA3ox, GA2ox) that catalyse the later steps in the biosynthetic pathway of particularly importance in regulating bioactive GA levels. Although GA has important impacts on crop yield and quality, our understanding of the regulation of GA biosynthesis during wheat and barley development remains limited. In this study we identified or assembled genes encoding the GA 2-ODDs of wheat, barley and Brachypodium distachyon and characterised the wheat genes by heterologous expression and transcript analysis. The wheat, barley and Brachypodium genomes each contain orthologous copies of the GA20ox, GA3ox and GA2ox genes identified in rice, with the exception of OsGA3ox1 and OsGA2ox5 which are absent in these species. Some additional paralogs of 2-ODD genes were identified: notably, a novel gene in the wheat B genome related to GA3ox2 was shown to encode a GA 1-oxidase, named as TaGA1ox-B1. This enzyme is likely to be responsible for the abundant 1β-hydroxylated GAs present in developing wheat grains. We also identified a related gene in barley, located in a syntenic position to TaGA1ox-B1, that encodes a GA 3,18-dihydroxylase which similarly accounts for the accumulation of unusual GAs in barley grains. Transcript analysis showed that some paralogs of the different classes of 2-ODD were expressed mainly in a single tissue or at specific developmental stages. In particular, TaGA20ox3, TaGA1ox1, TaGA3ox3 and TaGA2ox7 were predominantly expressed in developing grain. More detailed analysis of grain-specific gene expression showed that while the transcripts of biosynthetic genes were most abundant in the endosperm, genes encoding inactivation and signalling components were more highly expressed in the seed coat and pericarp. The comprehensive expression and functional characterisation of the multigene families encoding the 2-ODD

Heterogeneous genetic diversity pattern in Plasmodium vivax genes encoding merozoite surface proteins (MSP) -7E, -7F and -7L.

Science.gov (United States)

Garzón-Ospina, Diego; Forero-Rodríguez, Johanna; Patarroyo, Manuel A

2014-12-13

The msp-7 gene has become differentially expanded in the Plasmodium genus; Plasmodium vivax has the highest copy number of this gene, several of which encode antigenic proteins in merozoites. DNA sequences from thirty-six Colombian clinical isolates from P. vivax (pv) msp-7E, -7F and -7L genes were analysed for characterizing and studying the genetic diversity of these pvmsp-7 members which are expressed during the intra-erythrocyte stage; natural selection signals producing the variation pattern so observed were evaluated. The pvmsp-7E gene was highly polymorphic compared to pvmsp-7F and pvmsp-7L which were seen to have limited genetic diversity; pvmsp-7E polymorphism was seen to have been maintained by different types of positive selection. Even though these copies seemed to be species-specific duplications, a search in the Plasmodium cynomolgi genome (P. vivax sister taxon) showed that both species shared the whole msp-7 repertoire. This led to exploring the long-term effect of natural selection by comparing the orthologous sequences which led to finding signatures for lineage-specific positive selection. The results confirmed that the P. vivax msp-7 family has a heterogeneous genetic diversity pattern; some members are highly conserved whilst others are highly diverse. The results suggested that the 3'-end of these genes encode MSP-7 proteins' functional region whilst the central region of pvmsp-7E has evolved rapidly. The lineage-specific positive selection signals found suggested that mutations occurring in msp-7s genes during host switch may have succeeded in adapting the ancestral P. vivax parasite population to humans.

Functional analysis of the Phycomyces carRA gene encoding the enzymes phytoene synthase and lycopene cyclase.

Directory of Open Access Journals (Sweden)

Catalina Sanz

Full Text Available Phycomyces carRA gene encodes a protein with two domains. Domain R is characterized by red carR mutants that accumulate lycopene. Domain A is characterized by white carA mutants that do not accumulate significant amounts of carotenoids. The carRA-encoded protein was identified as the lycopene cyclase and phytoene synthase enzyme by sequence homology with other proteins. However, no direct data showing the function of this protein have been reported so far. Different Mucor circinelloides mutants altered at the phytoene synthase, the lycopene cyclase or both activities were transformed with the Phycomyces carRA gene. Fully transcribed carRA mRNA molecules were detected by Northern assays in the transformants and the correct processing of the carRA messenger was verified by RT-PCR. These results showed that Phycomyces carRA gene was correctly expressed in Mucor. Carotenoids analysis in these transformants showed the presence of ß-carotene, absent in the untransformed strains, providing functional evidence that the Phycomyces carRA gene complements the M. circinelloides mutations. Co-transformation of the carRA cDNA in E. coli with different combinations of the carotenoid structural genes from Erwinia uredovora was also performed. Newly formed carotenoids were accumulated showing that the Phycomyces CarRA protein does contain lycopene cyclase and phytoene synthase activities. The heterologous expression of the carRA gene and the functional complementation of the mentioned activities are not very efficient in E. coli. However, the simultaneous presence of both carRA and carB gene products from Phycomyces increases the efficiency of these enzymes, presumably due to an interaction mechanism.

Identification of a truncated nucleoprotein in avian metapneumovirus-infected cells encoded by a second AUG, in-frame to the full-length gene

Science.gov (United States)

Alvarez, Rene; Seal, Bruce S

2005-01-01

Background Avian metapneumoviruses (aMPV) cause an upper respiratory disease with low mortality, but high morbidity primarily in commercial turkeys. There are three types of aMPV (A, B, C) of which the C type is found only in the United States. Viruses related to aMPV include human, bovine, ovine, and caprine respiratory syncytial viruses and pneumonia virus of mice, as well as the recently identified human metapneumovirus (hMPV). The aMPV and hMPV have become the type viruses of a new genus within the Metapneumovirus. The aMPV nucleoprotein (N) amino acid sequences of serotypes A, B, and C were aligned for comparative analysis. Based on predicted antigenicity of consensus protein sequences, five aMPV-specific N peptides were synthesized for development of peptide-antigens and antisera. Results The presence of two aMPV nucleoprotein (N) gene encoded polypeptides was detected in aMPV/C/US/Co and aMPV/A/UK/3b infected Vero cells. Nucleoprotein 1 (N1) encoded from the first open reading frame (ORF) was predicted to be 394 amino acids in length for aMPV/C/US/Co and 391 amino acids in length for aMPV/A/UK/3b with approximate molecular weights of 43.3 kilodaltons and 42.7 kilodaltons, respectively. Nucleoprotein 2 (N2) was hypothesized to be encoded by a second downstream ORF in-frame with ORF1 and encoded a protein predicted to contain 328 amino acids for aMPV/C/US/Co or 259 amino acids for aMPV/A/UK/3b with approximate molecular weights of 36 kilodaltons and 28.3 kilodaltons, respectively. Peptide antibodies to the N-terminal and C-terminal portions of the aMPV N protein confirmed presence of these products in both aMPV/C/US/Co- and aMPV/A/UK/3b-infected Vero cells. N1 and N2 for aMPV/C/US/Co ORFs were molecularly cloned and expressed in Vero cells utilizing eukaryotic expression vectors to confirm identity of the aMPV encoded proteins. Conclusion This is the first reported identification of potential, accessory in-frame N2 ORF gene products among members of the

Identification of a truncated nucleoprotein in avian metapneumovirus-infected cells encoded by a second AUG, in-frame to the full-length gene

Directory of Open Access Journals (Sweden)

Alvarez Rene

2005-04-01

Full Text Available Abstract Background Avian metapneumoviruses (aMPV cause an upper respiratory disease with low mortality, but high morbidity primarily in commercial turkeys. There are three types of aMPV (A, B, C of which the C type is found only in the United States. Viruses related to aMPV include human, bovine, ovine, and caprine respiratory syncytial viruses and pneumonia virus of mice, as well as the recently identified human metapneumovirus (hMPV. The aMPV and hMPV have become the type viruses of a new genus within the Metapneumovirus. The aMPV nucleoprotein (N amino acid sequences of serotypes A, B, and C were aligned for comparative analysis. Based on predicted antigenicity of consensus protein sequences, five aMPV-specific N peptides were synthesized for development of peptide-antigens and antisera. Results The presence of two aMPV nucleoprotein (N gene encoded polypeptides was detected in aMPV/C/US/Co and aMPV/A/UK/3b infected Vero cells. Nucleoprotein 1 (N1 encoded from the first open reading frame (ORF was predicted to be 394 amino acids in length for aMPV/C/US/Co and 391 amino acids in length for aMPV/A/UK/3b with approximate molecular weights of 43.3 kilodaltons and 42.7 kilodaltons, respectively. Nucleoprotein 2 (N2 was hypothesized to be encoded by a second downstream ORF in-frame with ORF1 and encoded a protein predicted to contain 328 amino acids for aMPV/C/US/Co or 259 amino acids for aMPV/A/UK/3b with approximate molecular weights of 36 kilodaltons and 28.3 kilodaltons, respectively. Peptide antibodies to the N-terminal and C-terminal portions of the aMPV N protein confirmed presence of these products in both aMPV/C/US/Co- and aMPV/A/UK/3b-infected Vero cells. N1 and N2 for aMPV/C/US/Co ORFs were molecularly cloned and expressed in Vero cells utilizing eukaryotic expression vectors to confirm identity of the aMPV encoded proteins. Conclusion This is the first reported identification of potential, accessory in-frame N2 ORF gene products among

Isolation and expression analysis of FTZ-F1 encoding gene of black rock fish ( Sebastes schlegelii)

Science.gov (United States)

Shafi, Muhammad; Wang, Yanan; Zhou, Xiaosu; Ma, Liman; Muhammad, Faiz; Qi, Jie; Zhang, Quanqi

2013-03-01

Sex related FTZ-F1 is a transcriptional factor regulating the expression of fushi tarazu (a member of the orphan nuclear receptors) gene. In this study, FTZ-F1 gene ( FTZ-F1) was isolated from the testis of black rockfish ( Sebastes schlegeli) by homology cloning. The full-length cDNA of S. schlegeli FTZ-F1 ( ssFTZ-F1) contained a 232bp 5' UTR, a 1449bp ORF encoding FTZ-F1 (482 amino acid residules in length) with an estimated molecular weight of 5.4kD and a 105bp 3' UTR. Sequence, tissue distribution and phylogenic analysis showed that ssFTZ-F1 belonged to FTZ group, holding highly conserved regions including I, II and III FTZ-F1 boxes and an AF-2 hexamer. Relatively high expression was observed at different larva stages. In juveniles (105 days old), the transcript of ssFTZ-F1 can be detected in all tissues and the abuncance of the gene transcript in testis, ovary, spleen and brain was higher than that in other tissues. In mature fish, the abundance of gene transcript was higher in testis, ovary, spleen and brain than that in liver (trace amount), and the gene was not transcribed in other tissues. The highest abundance of gene transcript was always observed in gonads of both juvenile and mature fish. In addition, the abundance of gene transcript in male tissues were higher than that in female tissue counterparts ( P<0.05).

Plasmodium falciparum associated with severe childhood malaria preferentially expresses PfEMP1 encoded by group A var genes

DEFF Research Database (Denmark)

Jensen, Anja T R; Magistrado, Pamela; Sharp, Sarah

2004-01-01

Parasite-encoded variant surface antigens (VSAs) like the var gene-encoded Plasmodium falciparum erythrocyte membrane protein 1 (PfEMP1) family are responsible for antigenic variation and infected red blood cell (RBC) cytoadhesion in P. falciparum malaria. Parasites causing severe malaria in noni...... genes, such as PFD1235w/MAL7P1.1, appear to be involved in the pathogenesis of severe disease and are thus attractive candidates for a vaccine against life-threatening P. falciparum malaria....

Compression of surface myoelectric signals using MP3 encoding.

Science.gov (United States)

Chan, Adrian D C

2011-01-01

The potential of MP3 compression of surface myoelectric signals is explored in this paper. MP3 compression is a perceptual-based encoder scheme, used traditionally to compress audio signals. The ubiquity of MP3 compression (e.g., portable consumer electronics and internet applications) makes it an attractive option for remote monitoring and telemedicine applications. The effects of muscle site and contraction type are examined at different MP3 encoding bitrates. Results demonstrate that MP3 compression is sensitive to the myoelectric signal bandwidth, with larger signal distortion associated with myoelectric signals that have higher bandwidths. Compared to other myoelectric signal compression techniques reported previously (embedded zero-tree wavelet compression and adaptive differential pulse code modulation), MP3 compression demonstrates superior performance (i.e., lower percent residual differences for the same compression ratios).

Arabidopsis VARIEGATED 3 encodes a chloroplast-targeted, zinc-finger protein required for chloroplast and palisade cell development

DEFF Research Database (Denmark)

Næsted, Henrik; Holm, Agnethe; Jenkins, Tom

2004-01-01

The stable, recessive Arabidopsis variegated 3 (var3) mutant exhibits a variegated phenotype due to somatic areas lacking or containing developmentally retarded chloroplasts and greatly reduced numbers of palisade cells. The VAR3 gene, isolated by transposon tagging, encodes the 85.9 kDa VAR3...... that pigment profiles are qualitatively similar in wild type and var3, although var3 accumulates lower levels of chlorophylls and carotenoids. These results indicate that VAR3 is a part of a protein complex required for normal chloroplast and palisade cell development....

AtMRP1 gene of Arabidopsis encodes a glutathione S-conjugate pump: isolation and functional definition of a plant ATP-binding cassette transporter gene.

Science.gov (United States)

Lu, Y P; Li, Z S; Rea, P A

1997-07-22

Because plants produce cytotoxic compounds to which they, themselves, are susceptible and are exposed to exogenous toxins (microbial products, allelochemicals, and agrochemicals), cell survival is contingent on mechanisms for detoxifying these agents. One detoxification mechanism is the glutathione S-transferase-catalyzed glutathionation of the toxin, or an activated derivative, and transport of the conjugate out of the cytosol. We show here that a transporter responsible for the removal of glutathione S-conjugates from the cytosol, a specific Mg2+-ATPase, is encoded by the AtMRP1 gene of Arabidopsis thaliana. The sequence of AtMRP1 and the transport capabilities of membranes prepared from yeast cells transformed with plasmid-borne AtMRP1 demonstrate that this gene encodes an ATP-binding cassette transporter competent in the transport of glutathione S-conjugates of xenobiotics and endogenous substances, including herbicides and anthocyanins.

Ti plasmid-encoded genes responsible for catabolism of the crown gall opine mannopine by Agrobacterium tumefaciens are homologs of the T-region genes responsible for synthesis of this opine by the plant tumor.

Science.gov (United States)

Kim, K S; Farrand, S K

1996-06-01

Agrobacterium tumefaciens NT1 harboring pSaB4, which contains the 14-kb BamHI fragment 4 from the octopine/mannityl opine-type Ti plasmid pTi15955, grew well with agropine (AGR) but slowly with mannopine (MOP) as the sole carbon source. When a second plasmid encoding a dedicated transport system for MOP was introduced, these cells grew well with both AGR and MOP. Transposon insertion mutagenesis and subcloning identified a 5.7-kb region of BamHI fragment 4 that encodes functions required for the degradation of MOP. DNA sequence analysis revealed seven putative genes in this region: mocD (moc for mannityl opine catabolism) and mocE, oriented from right to left, and mocRCBAS, oriented from left to right. Significant identities exist at the nucleotide and derived amino acid sequence levels between these moc genes and the mas genes that are responsible for opine biosynthesis in crown gall tumors. MocD is a homolog of Mas2, the anabolic conjugase encoded by mas2'. MocE and MocC are related to the amino half and the carboxyl half, respectively, of Mas1 (MOP reductase), the second enzyme for MOP biosynthesis. These results indicate that the moc and mas genes evolved from a common origin. MocR and MocS are related to each other and to a putative repressor for the AGR degradation system encoded by the rhizogenic plasmid pRiA4. MocB and MocA are homologs of 6-phosphogluconate dehydratase and glucose-6-phosphate dehydrogenase, respectively. Mutations in mocD and mocE, but not mocC, are suppressed by functions encoded by the chromosome or the 450-kb megaplasmid present in many Agrobacterium isolates. We propose that moc genes derived from genes located elsewhere in the bacterial genome and that the tumor-expressed mas genes evolved from the bacterial moc genes.

Dissection of Resistance Genes to Pseudomonas syringae pv. phaseolicola in UI3 Common Bean Cultivar

Directory of Open Access Journals (Sweden)

Ana M. González

2017-11-01

Full Text Available Few quantitative trait loci have been mapped for resistance to Pseudomonas syringae pv. phaseolicola in common bean. Two F2 populations were developed from the host differential UI3 cultivar. The objective of this study was to further characterize the resistance to races 1, 5, 7 and 9 of Psp included in UI3. Using a QTL mapping approach, 16 and 11 main-effect QTLs for pod and primary leaf resistance were located on LG10, explaining up to 90% and 26% of the phenotypic variation, respectively. The homologous genomic region corresponding to primary leaf resistance QTLs detected tested positive for the presence of resistance-associated gene cluster encoding nucleotide-binding and leucine-rich repeat (NL, Natural Resistance Associated Macrophage (NRAMP and Pentatricopeptide Repeat family (PPR proteins. It is worth noting that the main effect QTLs for resistance in pod were located inside a 3.5 Mb genomic region that included the Phvul.010G021200 gene, which encodes a protein that has the highest sequence similarity to the RIN4 gene of Arabidopsis, and can be considered an important candidate gene for the organ-specific QTLs identified here. These results support that resistance to Psp from UI3 might result from the immune response activated by combinations of R proteins, and suggest the guard model as an important mechanism in pod resistance to halo blight. The candidate genes identified here warrant functional studies that will help in characterizing the actual defense gene(s in UI3 genotype.

EWS and FUS bind a subset of transcribed genes encoding proteins enriched in RNA regulatory functions

DEFF Research Database (Denmark)

Luo, Yonglun; Friis, Jenny Blechingberg; Fernandes, Ana Miguel

2015-01-01

at different levels. Gene Ontology analyses showed that FUS and EWS target genes preferentially encode proteins involved in regulatory processes at the RNA level. Conclusions The presented results yield new insights into gene interactions of EWS and FUS and have identified a set of FUS and EWS target genes...... involved in pathways at the RNA regulatory level with potential to mediate normal and disease-associated functions of the FUS and EWS proteins.......Background FUS (TLS) and EWS (EWSR1) belong to the FET-protein family of RNA and DNA binding proteins. FUS and EWS are structurally and functionally related and participate in transcriptional regulation and RNA processing. FUS and EWS are identified in translocation generated cancer fusion proteins...

Characterization of Bombyx mori nucleopolyhedrovirus orf68 gene that encodes a novel structural protein of budded virus.

Science.gov (United States)

Iwanaga, Masashi; Kurihara, Masaaki; Kobayashi, Masahiko; Kang, WonKyung

2002-05-25

All lepidopteran baculovirus genomes sequenced to date encode a homolog of the Bombyx mori nucleopolyhedrovirus (BmNPV) orf68 gene, suggesting that it performs an important role in the virus life cycle. In this article we describe the characterization of BmNPV orf68 gene. Northern and Western analyses demonstrated that orf68 gene was expressed as a late gene and encoded a structural protein of budded virus (BV). Immunohistochemical analysis by confocal microscopy showed that ORF68 protein was localized mainly in the nucleus of infected cells. To examine the function of orf68 gene, we constructed orf68 deletion mutant (BmD68) and characterized it in BmN cells and larvae of B. mori. BV production was delayed in BmD68-infected cells. The larval bioassays also demonstrated that deletion of orf68 did not reduce the infectivity, but mutant virus took 70 h longer to kill the host than wild-type BmNPV. In addition, dot-blot analysis showed viral DNA accumulated more slowly in mutant infected cells. Further examination suggested that BmD68 was less efficient in entry and budding from cells, although it seemed to possess normal attachment ability. These results suggest that ORF68 is a BV-associated protein involved in secondary infection from cell-to-cell. (c) 2002 Elsevier Science (USA).

Cocaine Administration and Its Withdrawal Enhance the Expression of Genes Encoding Histone-Modifying Enzymes and Histone Acetylation in the Rat Prefrontal Cortex.

Science.gov (United States)

Sadakierska-Chudy, Anna; Frankowska, Małgorzata; Jastrzębska, Joanna; Wydra, Karolina; Miszkiel, Joanna; Sanak, Marek; Filip, Małgorzata

2017-07-01

Chronic exposure to cocaine, craving, and relapse are attributed to long-lasting changes in gene expression arising through epigenetic and transcriptional mechanisms. Although several brain regions are involved in these processes, the prefrontal cortex seems to play a crucial role not only in motivation and decision-making but also in extinction and seeking behavior. In this study, we applied cocaine self-administration and extinction training procedures in rats with a yoked triad to determine differentially expressed genes in prefrontal cortex. Microarray analysis showed significant upregulation of several genes encoding histone modification enzymes during early extinction training. Subsequent real-time PCR testing of these genes following cocaine self-administration or early (third day) and late (tenth day) extinction revealed elevated levels of their transcripts. Interestingly, we found the enrichment of Brd1 messenger RNA in rats self-administering cocaine that lasted until extinction training during cocaine withdrawal with concomitant increased acetylation of H3K9 and H4K8. However, despite elevated levels of methyl- and demethyltransferase-encoded transcripts, no changes in global di- and tri-methylation of histone H3 at lysine 4, 9, 27, and 79 were observed. Surprisingly, at the end of extinction training (10 days of cocaine withdrawal), most of the analyzed genes in the rats actively and passively administering cocaine returned to the control level. Together, the alterations identified in the rat prefrontal cortex may suggest enhanced chromatin remodeling and transcriptional activity induced by early cocaine abstinence; however, to know whether they are beneficial or not for the extinction of drug-seeking behavior, further in vivo evaluation is required.

The abp gene in Geobacillus stearothermophilus T-6 encodes a GH27 β-L-arabinopyranosidase.

Science.gov (United States)

Salama, Rachel; Alalouf, Onit; Tabachnikov, Orly; Zolotnitsky, Gennady; Shoham, Gil; Shoham, Yuval

2012-07-30

In this study we demonstrate that the abp gene in Geobacillus stearothermophilus T-6 encodes a family 27 glycoside hydrolase β-L-arabinopyranosidase. The catalytic constants towards the chromogenic substrate pNP-β-L-arabinopyranoside were 0.8±0.1 mM, 6.6±0.3 s(-1), and 8.2±0.3 s(-1) mM(-1) for K(m), k(cat) and k(cat)/K(m), respectively. (13)C NMR spectroscopy unequivocally showed that Abp is capable of removing β-L-arabinopyranose residues from the natural arabino-polysaccharide, larch arabinogalactan. Most family 27 enzymes are active on galactose and contain a conserved Asp residue, whereas in Abp this residue is Ile67, which shifts the specificity of the enzyme towards arabinopyranoside. Copyright © 2012 Federation of European Biochemical Societies. Published by Elsevier B.V. All rights reserved.

Regulation of transcription of cellulases- and hemicellulases-encoding genes in Aspergillus niger and Hypocrea jecorina (Trichoderma reesei)

NARCIS (Netherlands)

Stricker, A.R.; Mach, R.L.; Graaff, de L.H.

2008-01-01

The filamentous fungi Aspergillus niger and Hypocrea jecorina (Trichoderma reesei) have been the subject of many studies investigating the mechanism of transcriptional regulation of hemicellulase- and cellulase-encoding genes. The transcriptional regulator XlnR that was initially identified in A.

Analysis of viral protein-2 encoding gene of avian encephalomyelitis virus from field specimens in Central Java region, Indonesia

Directory of Open Access Journals (Sweden)

Aris Haryanto

2016-01-01

Full Text Available Aim: Avian encephalomyelitis (AE is a viral disease which can infect various types of poultry, especially chicken. In Indonesia, the incidence of AE infection in chicken has been reported since 2009, the AE incidence tends to increase from year to year. The objective of this study was to analyze viral protein 2 (VP-2 encoding gene of AE virus (AEV from various species of birds in field specimen by reverse transcription polymerase chain reaction (RT-PCR amplification using specific nucleotides primer for confirmation of AE diagnosis. Materials and Methods: A total of 13 AEV samples are isolated from various species of poultry which are serologically diagnosed infected by AEV from some areas in central Java, Indonesia. Research stage consists of virus samples collection from field specimens, extraction of AEV RNA, amplification of VP-2 protein encoding gene by RT-PCR, separation of RT-PCR product by agarose gel electrophoresis, DNA sequencing and data analysis. Results: Amplification products of the VP-2 encoding gene of AEV by RT-PCR methods of various types of poultry from field specimens showed a positive results on sample code 499/4/12 which generated DNA fragment in the size of 619 bp. Sensitivity test of RT-PCR amplification showed that the minimum concentration of RNA template is 127.75 ng/μl. The multiple alignments of DNA sequencing product indicated that positive sample with code 499/4/12 has 92% nucleotide homology compared with AEV with accession number AV1775/07 and 85% nucleotide homology with accession number ZCHP2/0912695 from Genbank database. Analysis of VP-2 gene sequence showed that it found 46 nucleotides difference between isolate 499/4/12 compared with accession number AV1775/07 and 93 nucleotides different with accession number ZCHP2/0912695. Conclusions: Analyses of the VP-2 encoding gene of AEV with RT-PCR method from 13 samples from field specimen generated the DNA fragment in the size of 619 bp from one sample with

Mutations of 3c and spike protein genes correlate with the occurrence of feline infectious peritonitis.

Science.gov (United States)

Bank-Wolf, Barbara Regina; Stallkamp, Iris; Wiese, Svenja; Moritz, Andreas; Tekes, Gergely; Thiel, Heinz-Jürgen

2014-10-10

The genes encoding accessory proteins 3a, 3b, 3c, 7a and 7b, the S2 domain of the spike (S) protein gene and the membrane (M) protein gene of feline infectious peritonitis virus (FIPV) and feline enteric coronavirus (FECV) samples were amplified, cloned and sequenced. For this faeces and/or ascites samples from 19 cats suffering from feline infectious peritonitis (FIP) as well as from 20 FECV-infected healthy cats were used. Sequence comparisons revealed that 3c genes of animals with FIP were heavily affected by nucleotide deletions and point mutations compared to animals infected with FECV; these alterations resulted either in early termination or destruction of the translation initiation codon. Two ascites-derived samples of cats with FIP which displayed no alterations of ORF3c harboured mutations in the S2 domain of the S protein gene which resulted in amino acid exchanges or deletions. Moreover, changes in 3c were often accompanied by mutations in S2. In contrast, in samples obtained from faeces of healthy cats, the ORF3c was never affected by such mutations. Similarly ORF3c from faecal samples of the cats with FIP was mostly intact and showed only in a few cases the same mutations found in the respective ascites samples. The genes encoding 3a, 3b, 7a and 7b displayed no mutations linked to the feline coronavirus (FCoV) biotype. The M protein gene was found to be conserved between FECV and FIPV samples. Our findings suggest that mutations of 3c and spike protein genes correlate with the occurrence of FIP. Copyright © 2014 Elsevier B.V. All rights reserved.

The Novel Gene CRNDE Encodes a Nuclear Peptide (CRNDEP Which Is Overexpressed in Highly Proliferating Tissues.

Directory of Open Access Journals (Sweden)

Lukasz Michal Szafron

Full Text Available CRNDE, recently described as the lncRNA-coding gene, is overexpressed at RNA level in human malignancies. Its role in gametogenesis, cellular differentiation and pluripotency has been suggested as well. Herein, we aimed to verify our hypothesis that the CRNDE gene may encode a protein product, CRNDEP. By using bioinformatics methods, we identified the 84-amino acid ORF encoded by one of two CRNDE transcripts, previously described by our research team. This ORF was cloned into two expression vectors, subsequently utilized in localization studies in HeLa cells. We also developed a polyclonal antibody against CRNDEP. Its specificity was confirmed in immunohistochemical, cellular localization, Western blot and immunoprecipitation experiments, as well as by showing a statistically significant decrease of endogenous CRNDEP expression in the cells with transient shRNA-mediated knockdown of CRNDE. Endogenous CRNDEP localizes predominantly to the nucleus and its expression seems to be elevated in highly proliferating tissues, like the parabasal layer of the squamous epithelium, intestinal crypts or spermatocytes. After its artificial overexpression in HeLa cells, in a fusion with either the EGFP or DsRed Monomer fluorescent tag, CRNDEP seems to stimulate the formation of stress granules and localize to them. Although the exact role of CRNDEP is unknown, our preliminary results suggest that it may be involved in the regulation of the cell proliferation. Possibly, CRNDEP also participates in oxygen metabolism, considering our in silico results, and the correlation between its enforced overexpression and the formation of stress granules. This is the first report showing the existence of a peptide encoded by the CRNDE gene.

Relationships between protein-encoding gene abundance and corresponding process are commonly assumed yet rarely observed

Science.gov (United States)

Rocca, Jennifer D.; Hall, Edward K.; Lennon, Jay T.; Evans, Sarah E.; Waldrop, Mark P.; Cotner, James B.; Nemergut, Diana R.; Graham, Emily B.; Wallenstein, Matthew D.

2015-01-01

For any enzyme-catalyzed reaction to occur, the corresponding protein-encoding genes and transcripts are necessary prerequisites. Thus, a positive relationship between the abundance of gene or transcripts and corresponding process rates is often assumed. To test this assumption, we conducted a meta-analysis of the relationships between gene and/or transcript abundances and corresponding process rates. We identified 415 studies that quantified the abundance of genes or transcripts for enzymes involved in carbon or nitrogen cycling. However, in only 59 of these manuscripts did the authors report both gene or transcript abundance and rates of the appropriate process. We found that within studies there was a significant but weak positive relationship between gene abundance and the corresponding process. Correlations were not strengthened by accounting for habitat type, differences among genes or reaction products versus reactants, suggesting that other ecological and methodological factors may affect the strength of this relationship. Our findings highlight the need for fundamental research on the factors that control transcription, translation and enzyme function in natural systems to better link genomic and transcriptomic data to ecosystem processes.

A new sulfonamide resistance gene (sul3) in Escherichia coli is widespread in the pig population of Switzerland.

Science.gov (United States)

Perreten, Vincent; Boerlin, Patrick

2003-03-01

A new gene, sul3, which specifies a 263-amino-acid protein similar to a dihydropteroate synthase encoded by the 54-kb conjugative plasmid pVP440 from Escherichia coli was characterized. Expression of the cloned sul3 gene conferred resistance to sulfamethoxazole on E. coli. Two copies of the insertion element IS15Delta/26 flanked the region containing sul3. The sul3 gene was detected in one-third of the sulfonamide-resistant pathogenic E. coli isolates from pigs in Switzerland.

A New Sulfonamide Resistance Gene (sul3) in Escherichia coli Is Widespread in the Pig Population of Switzerland

OpenAIRE

Perreten, Vincent; Boerlin, Patrick

2003-01-01

A new gene, sul3, which specifies a 263-amino-acid protein similar to a dihydropteroate synthase encoded by the 54-kb conjugative plasmid pVP440 from Escherichia coli was characterized. Expression of the cloned sul3 gene conferred resistance to sulfamethoxazole on E. coli. Two copies of the insertion element IS15Δ/26 flanked the region containing sul3. The sul3 gene was detected in one-third of the sulfonamide-resistant pathogenic E. coli isolates from pigs in Switzerland.

Two potential hookworm DAF-16 target genes, SNR-3 and LPP-1: gene structure, expression profile, and implications of a cis-regulatory element in the regulation of gene expression.

Science.gov (United States)

Gao, Xin; Goggin, Kevin; Dowling, Camille; Qian, Jason; Hawdon, John M

2015-01-08

elements. Aca-snr-3 encodes a core small nuclear ribonucleoprotein, and Aca-lpp-1 encodes a lipid phosphate phosphohydrolase. Expression of both genes peaked at the late L4 stage, suggesting a role in L4 development. The 3'-terminal genomic fragment of the snr-3 gene displayed Ac-DAF-16-dependent cis-regulatory activity.

Functional characterization of viral tumor necrosis factor receptors encoded by cyprinid herpesvirus 3 (CyHV3) genome.

Science.gov (United States)

Yi, Yang; Qi, Hemei; Yuan, Jimin; Wang, Rui; Weng, Shaoping; He, Jianguo; Dong, Chuanfu

2015-08-01

Cyprinid herpesvirus 3 (CyHV3) is a large double-stranded DNA virus of Alloherpesviridae family in the order Herpesvirales. It causes significant morbidity and mortality in common carp and its ornamental koi variety, and threatens the aquaculture industries worldwide. Mimicry of cytokines and cytokine receptors is a particular strategy for large DNA viruses in modulating the host immune response. Here, we report the identification and characterization of two novel viral homologues of tumor necrosis factor receptor (TNFR) encoded by CyHV3-ORF4 and -ORF12, respectively. CyHV3-ORF4 was identified as a homologue of HVEM and CyHV3-ORF12 as a homologue of TNFRSF1. Overexpression of ORF4 and ORF12 in zebrafish embryos results in embryonic lethality, morphological defects and increased apoptosis. Although we failed to identify any interaction between the two vTNFRs and their potential ligands in zebrafish TNF superfamily by yeast two-hybrid system, the expression of some genes in TNF superfamily or TNFR superfamily were mis-regulated in ORF4 or ORF12-overexpressing embryos, especially the death receptor zHDR and its cognate ligand DL1b. Further studies showed that the apoptosis induced by the both CyHV3 vTNFRs is mainly activated through the intrinsic apoptotic pathway and requires the crosstalk between the intrinsic and extrinsic apoptotic pathway. Additionally, using RT-qPCR and Western blot assays, the expression patterns of the both vTNFRs were also analyzed during CyHV3 productive infection. Collectively, this is the first functional study of two unique vTNFRs encoded by a herpesvirus infecting non-mammalian vertebrates, which may provide novel insights into viral immune regulation mechanism and the pathogenesis of CyHV3 infection. Copyright © 2015 Elsevier Ltd. All rights reserved.

The IRC7 gene encodes cysteine desulphydrase activity and confers on yeast the ability to grow on cysteine as a nitrogen source.

Science.gov (United States)

Santiago, Margarita; Gardner, Richard C

2015-07-01

Although cysteine desulphydrase activity has been purified and characterized from Saccharomyces cerevisiae, the gene encoding this activity in vivo has never been defined. We show that the full-length IRC7 gene, encoded by the YFR055W open reading frame, encodes a protein with cysteine desulphydrase activity. Irc7p purified to homogeneity is able to utilize l-cysteine as a substrate, producing pyruvate and hydrogen sulphide as products of the reaction. Purified Irc7p also utilized l-cystine and some other cysteine conjugates, but not l-cystathionine or l-methionine, as substrates. We further show that, in vivo, the IRC7 gene is both necessary and sufficient for yeast to grow on l-cysteine as a nitrogen source, and that overexpression of the gene results in increased H2 S production. Strains overexpressing IRC7 are also hypersensitive to a toxic analogue, S-ethyl-l-cysteine. While IRC7 has been identified as playing a critical role in converting cysteine conjugates to volatile thiols that are important in wine aroma, its biological role in yeast cells is likely to involve regulation of cysteine and redox homeostasis. Copyright © 2015 John Wiley & Sons, Ltd.

Mutation analysis of COL4A3 and COL4A4 genes in a Chinese

Indian Academy of Sciences (India)

Autosomal dominant Alport syndrome (ADAS) accounts for 5% of all cases of Alport syndrome (AS), a primary basement membrane disorder arising from mutations in genes encoding the type IV collagen protein family.Mutationsin COL4A3 and COL4A4 genes were reported to be associated with ADAS. In this study, clinical ...

Characterization of cDNAs encoding human leukosialin and localization of the leukosialin gene to chromosome 16

International Nuclear Information System (INIS)

Pallant, A.; Eskenazi, A.; Frelinger, J.G.; Mattei, M.G.; Fournier, R.E.K.; Carlsson, S.R.; Fukuda, M.

1989-01-01

The authors describe the isolation and characterization of cDNA clones encoding human leukosialin, a major sialoglycoprotein of human leukocytes. Leukosialin is very closely related or identical to the sialophorin molecule, which is involved in T-cell proliferation and whose expression is altered in Wiskott-Aldrich syndrome (WAS), an X-chromosome-linked immunodeficiency disease. Using a rabbit antiserum to leukosialin, a cDNA clone was isolated from a λgt11 cDNA library constructed from human peripheral blood cells. The λgt11 clone was used to isolate longer cDNA clones that correspond to the entire coding sequence of leukosialin. DNA sequence analysis reveals three domains in the predicted mature protein. The extracellular domain is enriched for Ser, Thr, and Pro and contains four contiguous 18-amino acid repeats. The transmembrane and intracellular domains of the human leukosialin molecule are highly homologous to the rat W3/13 molecule. RNA gel blot analysis reveals two polyadenylylated species of 2.3 and 8 kilobases. Southern blot analysis suggests that human leukosialin is a single-copy gene. Analysis of monochromosomal cell hybrids indicates that the leukosialin gene is not X chromosome linked and in situ hybridization shows leukosialin is located on chromosome 16. These findings demonstrate that the primary mutation in WAS is not a defect in the structural gene for leukosialin

Mutation analysis of COL4A3 and COL4A4 genes in a Chinese ...

Indian Academy of Sciences (India)

2016-10-24

，. People's Republic of China ... mutations in COL4A3 and COL4A4 genes which encode type IV collagen α3 and α4 chainsrespectively can .... hematuria and evidence for activation of the unfolded protein response. Focal and ...

aldB, an RpoS-dependent gene in Escherichia coli encoding an aldehyde dehydrogenase that is repressed by Fis and activated by Crp.

Science.gov (United States)

Xu, J; Johnson, R C

1995-06-01

Escherichia coli aldB was identified as a gene that is negatively regulated by Fis but positively regulated by RpoS. The complete DNA sequence determined in this study indicates that aldB encodes a 56.3-kDa protein which shares a high degree of homology with an acetaldehyde dehydrogenase encoded by acoD of Alcaligenes eutrophus and an aldehyde dehydrogenase encoded by aldA of Vibrio cholerae and significant homology with a group of other aldehyde dehydrogenases from prokaryotes and eukaryotes. Expression of aldB is maximally induced during the transition from exponential phase to stationary phase. Its message levels are elevated three- to fourfold by a fis mutation and abolished by an rpoS mutation. In addition, the expression of an aldB-lacZ fusion was decreased about 20-fold in the absence of crp. DNase I footprinting analysis showed that five Fis binding sites and one Crp binding site are located within the aldB promoter region, suggesting that Fis and Crp are acting directly to control aldB transcription. AldB expression is induced by ethanol, but in contrast to that of most of the RpoS-dependent genes, the expression of aldB is not altered by an increase in medium osmolarity.

Polymorphisms in the 3' UTR in the neurocalcin delta gene affect mRNA stability, and confer susceptibility to diabetic nephropathy

DEFF Research Database (Denmark)

Kamiyama, Masumi; Kobayashi, Masaaki; Araki, Shin-ichi

2007-01-01

Using a large-scale genotyping analysis of gene-based single nucleotide polymorphisms (SNPs) in Japanese type 2 diabetic patients, we have identified a gene encoding neurocalcin delta (NCALD) as a candidate for a susceptibility gene to diabetic nephropathy; the landmark SNP was found in the 3' UT...

Embryonic expression of zebrafish MiT family genes tfe3b, tfeb, and tfec.

Science.gov (United States)

Lister, James A; Lane, Brandon M; Nguyen, Anhthu; Lunney, Katherine

2011-11-01

The MiT family comprises four genes in mammals: Mitf, Tfe3, Tfeb, and Tfec, which encode transcription factors of the basic-helix-loop-helix/leucine zipper class. Mitf is well-known for its essential role in the development of melanocytes, however the functions of the other members of this family, and of interactions between them, are less well understood. We have now characterized the complete set of MiT genes from zebrafish, which totals six instead of four. The zebrafish genome contain two mitf (mitfa and mitfb), two tfe3 (tfe3a and tfe3b), and single tfeb and tfec genes; this distribution is shared with other teleosts. We present here the sequence and embryonic expression patterns for the zebrafish tfe3b, tfeb, and tfec genes, and identify a new isoform of tfe3a. These findings will assist in elucidating the roles of the MiT gene family over the course of vertebrate evolution. Copyright © 2011 Wiley-Liss, Inc.

Atypical DNA methylation of genes encoding cysteine-rich peptides in Arabidopsis thaliana

Directory of Open Access Journals (Sweden)

You Wanhui

2012-04-01

Full Text Available Abstract Background In plants, transposons and non-protein-coding repeats are epigenetically silenced by CG and non-CG methylation. This pattern of methylation is mediated in part by small RNAs and two specialized RNA polymerases, termed Pol IV and Pol V, in a process called RNA-directed DNA methylation. By contrast, many protein-coding genes transcribed by Pol II contain in their gene bodies exclusively CG methylation that is independent of small RNAs and Pol IV/Pol V activities. It is unclear how the different methylation machineries distinguish between transposons and genes. Here we report on a group of atypical genes that display in their coding region a transposon-like methylation pattern, which is associated with gene silencing in sporophytic tissues. Results We performed a methylation-sensitive amplification polymorphism analysis to search for targets of RNA-directed DNA methylation in Arabidopsis thaliana and identified several members of a gene family encoding cysteine-rich peptides (CRPs. In leaves, the CRP genes are silent and their coding regions contain dense, transposon-like methylation in CG, CHG and CHH contexts, which depends partly on the Pol IV/Pol V pathway and small RNAs. Methylation in the coding region is reduced, however, in the synergid cells of the female gametophyte, where the CRP genes are specifically expressed. Further demonstrating that expressed CRP genes lack gene body methylation, a CRP4-GFP fusion gene under the control of the constitutive 35 S promoter remains unmethylated in leaves and is transcribed to produce a translatable mRNA. By contrast, a CRP4-GFP fusion gene under the control of a CRP4 promoter fragment acquires CG and non-CG methylation in the CRP coding region in leaves similar to the silent endogenous CRP4 gene. Conclusions Unlike CG methylation in gene bodies, which does not dramatically affect Pol II transcription, combined CG and non-CG methylation in CRP coding regions is likely to

Open reading frame 176 in the photosynthesis gene cluster of Rhodobacter capsulatus encodes idi, a gene for isopentenyl diphosphate isomerase.

OpenAIRE

Hahn, F M; Baker, J A; Poulter, C D

1996-01-01

Isopentenyl diphosphate (IPP) isomerase catalyzes an essential activation step in the isoprenoid biosynthetic pathway. A database search based on probes from the highly conserved regions in three eukaryotic IPP isomerases revealed substantial similarity with ORF176 in the photosynthesis gene cluster in Rhodobacter capsulatus. The open reading frame was cloned into an Escherichia coli expression vector. The encoded 20-kDa protein, which was purified in two steps by ion exchange and hydrophobic...

Pyramiding expression of maize genes encoding phosphoenolpyruvate carboxylase (PEPC) and pyruvate orthophosphate dikinase (PPDK) synergistically improve the photosynthetic characteristics of transgenic wheat.

Science.gov (United States)

Zhang, HuiFang; Xu, WeiGang; Wang, HuiWei; Hu, Lin; Li, Yan; Qi, XueLi; Zhang, Lei; Li, ChunXin; Hua, Xia

2014-09-01

Using particle bombardment transformation, we introduced maize pepc cDNA encoding phosphoenolpyruvate carboxylase (PEPC) and ppdk cDNA encoding pyruvate orthophosphate dikinase (PPDK) into the C3 crop wheat to generate transgenic wheat lines carrying cDNA of pepc (PC lines), ppdk (PK lines) or both (PKC lines). The integration, transcription, and expression of the foreign genes were confirmed by Southern blot, Real-time quantitative reverse transcription PCR (Q-RT-PCR), and Western blot analysis. Q-RT-PCR results indicated that the average relative expression levels of pepc and ppdk in the PKC lines reached 10 and 4.6, respectively, compared to their expressions in untransformed plants (set to 1). The enzyme activities of PEPC and PPDK in the PKC lines were 4.3- and 2.1-fold higher, respectively, than in the untransformed control. The maximum daily net photosynthetic rates of the PKC, PC, and PK lines were enhanced by 26.4, 13.3, and 4.5%, respectively, whereas the diurnal accumulations of photosynthesis were 21.3, 13.9, and 6.9%, respectively, higher than in the control. The Fv/Fm of the transgenic plants decreased less than in the control under high temperature and high light conditions (2 weeks after anthesis), suggesting that the transgenic wheat transports more absorbed light energy into a photochemical reaction. The exogenous maize C4-specific pepc gene was more effective than ppdk at improving the photosynthetic performance and yield characteristics of transgenic wheat, while the two genes showed a synergistic effect when they were transformed into the same genetic background, because the PKC lines exhibited improved photosynthetic and physiological traits.

Saccharomyces cerevisiae ribosomal protein L37 is encoded by duplicate genes that are differentially expressed.

Science.gov (United States)

Tornow, J; Santangelo, G M

1994-06-01

A duplicate copy of the RPL37A gene (encoding ribosomal protein L37) was cloned and sequenced. The coding region of RPL37B is very similar to that of RPL37A, with only one conservative amino-acid difference. However, the intron and flanking sequences of the two genes are extremely dissimilar. Disruption experiments indicate that the two loci are not functionally equivalent: disruption of RPL37B was insignificant, but disruption of RPL37A severely impaired the growth rate of the cell. When both RPL37 loci are disrupted, the cell is unable to grow at all, indicating that rpL37 is an essential protein. The functional disparity between the two RPL37 loci could be explained by differential gene expression. The results of two experiments support this idea: gene fusion of RPL37A to a reporter gene resulted in six-fold higher mRNA levels than was generated by the same reporter gene fused to RPL37B, and a modest increase in gene dosage of RPL37B overcame the lack of a functional RPL37A gene.

Promoter for the late gene encoding Vp5 of herpes simplex virus type 1 is recognized by cell extracts derived from uninfected cells

International Nuclear Information System (INIS)

Chisholm, G.E.; Summers, W.C.

1986-01-01

The ability of whole-cell extracts from unidentified HeLa cells to recognize the promoter for the herpes simplex virus type 1 late gene encoding the major capsid protein Vp5 was investigated by using both in vitro transcriptional and S1 nuclease protection analysis. This gene promoter was recognized by the cell extracts and produced abundant amounts of transcript in the absence of any other virus-encoded factors. This transcript was shown to arise, in vitro, from specific initiation at or very near the physiological mRNA start site. Thus, it appears that cell extracts from uninfected HeLa cells can efficiently recognize both early- and late-gene promoters

The Aspergillus niger faeB gene encodes a second feruloyl esterase involved in pectin and xylan degradation and is specifically induced in the presence of aromatic compounds

NARCIS (Netherlands)

Vries, de R.P.; vanKuyk, P.A.; Kester, H.C.M.; Visser, J.

2002-01-01

The faeB gene encoding a second feruloyl esterase from Aspergillus niger has been cloned and characterized. It consists of an open reading frame of 1644 bp containing one intron. The gene encodes a protein of 521 amino acids that has sequence similarity to that of an Aspergillus oryzae tannase.

Transcription Factors Encoded on Core and Accessory Chromosomes of Fusarium oxysporum Induce Expression of Effector Genes

Science.gov (United States)

van der Does, H. Charlotte; Schmidt, Sarah M.; Langereis, Léon; Hughes, Timothy R.

2016-01-01

Proteins secreted by pathogens during host colonization largely determine the outcome of pathogen-host interactions and are commonly called ‘effectors’. In fungal plant pathogens, coordinated transcriptional up-regulation of effector genes is a key feature of pathogenesis and effectors are often encoded in genomic regions with distinct repeat content, histone code and rate of evolution. In the tomato pathogen Fusarium oxysporum f. sp. lycopersici (Fol), effector genes reside on one of four accessory chromosomes, known as the ‘pathogenicity’ chromosome, which can be exchanged between strains through horizontal transfer. The three other accessory chromosomes in the Fol reference strain may also be important for virulence towards tomato. Expression of effector genes in Fol is highly up-regulated upon infection and requires Sge1, a transcription factor encoded on the core genome. Interestingly, the pathogenicity chromosome itself contains 13 predicted transcription factor genes and for all except one, there is a homolog on the core genome. We determined DNA binding specificity for nine transcription factors using oligonucleotide arrays. The binding sites for homologous transcription factors were highly similar, suggesting that extensive neofunctionalization of DNA binding specificity has not occurred. Several DNA binding sites are enriched on accessory chromosomes, and expression of FTF1, its core homolog FTF2 and SGE1 from a constitutive promoter can induce expression of effector genes. The DNA binding sites of only these three transcription factors are enriched among genes up-regulated during infection. We further show that Ftf1, Ftf2 and Sge1 can activate transcription from their binding sites in yeast. RNAseq analysis revealed that in strains with constitutive expression of FTF1, FTF2 or SGE1, expression of a similar set of plant-responsive genes on the pathogenicity chromosome is induced, including most effector genes. We conclude that the Fol

Chronic granulomatous disease caused by mutations other than the common GT deletion in NCF1, the gene encoding the p47phox component of the phagocyte NADPH oxidase

NARCIS (Netherlands)

Roos, Dirk; de Boer, Martin; Köker, M. Yavuz; Dekker, Jan; Singh-Gupta, Vinita; Ahlin, Anders; Palmblad, Jan; Sanal, Ozden; Kurenko-Deptuch, Magdalena; Jolles, Stephen; Wolach, Baruch

2006-01-01

Chronic granulomatous disease (CGD) is an inherited immunodeficiency caused by defects in any of four genes encoding components of the leukocyte nicotinamide dinucleotide phosphate, reduced (NADPH) oxidase. One of these is the autosomal neutrophil cytosolic factor 1 (NCF1) gene encoding the p47phox

A mutation in the Arabidopsis HYL1 gene encoding a dsRNA binding protein affects responses to abscisic acid, auxin, and cytokinin

Science.gov (United States)

Lu, C.; Fedoroff, N.

2000-01-01

Both physiological and genetic evidence indicate interconnections among plant responses to different hormones. We describe a pleiotropic recessive Arabidopsis transposon insertion mutation, designated hyponastic leaves (hyl1), that alters the plant's responses to several hormones. The mutant is characterized by shorter stature, delayed flowering, leaf hyponasty, reduced fertility, decreased rate of root growth, and an altered root gravitropic response. It also exhibits less sensitivity to auxin and cytokinin and hypersensitivity to abscisic acid (ABA). The auxin transport inhibitor 2,3,5-triiodobenzoic acid normalizes the mutant phenotype somewhat, whereas another auxin transport inhibitor, N-(1-naph-thyl)phthalamic acid, exacerbates the phenotype. The gene, designated HYL1, encodes a 419-amino acid protein that contains two double-stranded RNA (dsRNA) binding motifs, a nuclear localization motif, and a C-terminal repeat structure suggestive of a protein-protein interaction domain. We present evidence that the HYL1 gene is ABA-regulated and encodes a nuclear dsRNA binding protein. We hypothesize that the HYL1 protein is a regulatory protein functioning at the transcriptional or post-transcriptional level.

The 380 kb pCMU01 plasmid encodes chloromethane utilization genes and redundant genes for vitamin B12- and tetrahydrofolate-dependent chloromethane metabolism in Methylobacterium extorquens CM4: a proteomic and bioinformatics study.

Directory of Open Access Journals (Sweden)

Sandro Roselli

Full Text Available Chloromethane (CH3Cl is the most abundant volatile halocarbon in the atmosphere and contributes to the destruction of stratospheric ozone. The only known pathway for bacterial chloromethane utilization (cmu was characterized in Methylobacterium extorquens CM4, a methylotrophic bacterium able to utilize compounds without carbon-carbon bonds such as methanol and chloromethane as the sole carbon source for growth. Previous work demonstrated that tetrahydrofolate and vitamin B12 are essential cofactors of cmuA- and cmuB-encoded methyltransferases of chloromethane dehalogenase, and that the pathway for chloromethane utilization is distinct from that for methanol. This work reports genomic and proteomic data demonstrating that cognate cmu genes are located on the 380 kb pCMU01 plasmid, which drives the previously defined pathway for tetrahydrofolate-mediated chloromethane dehalogenation. Comparison of complete genome sequences of strain CM4 and that of four other M. extorquens strains unable to grow with chloromethane showed that plasmid pCMU01 harbors unique genes without homologs in the compared genomes (bluB2, btuB, cobA, cbiD, as well as 13 duplicated genes with homologs of chromosome-borne genes involved in vitamin B12-associated biosynthesis and transport, or in tetrahydrofolate-dependent metabolism (folC2. In addition, the presence of both chromosomal and plasmid-borne genes for corrinoid salvaging pathways may ensure corrinoid coenzyme supply in challenging environments. Proteomes of M. extorquens CM4 grown with one-carbon substrates chloromethane and methanol were compared. Of the 49 proteins with differential abundance identified, only five (CmuA, CmuB, PurU, CobH2 and a PaaE-like uncharacterized putative oxidoreductase are encoded by the pCMU01 plasmid. The mainly chromosome-encoded response to chloromethane involves gene clusters associated with oxidative stress, production of reducing equivalents (PntAA, Nuo complex, conversion of

Characterization of a Thioredoxin-1 Gene from Taenia solium and Its Encoding Product

Science.gov (United States)

Jiménez, Lucía; Rodríguez-Lima, Oscar; Ochoa-Sánchez, Alicia; Landa, Abraham

2015-01-01

Taenia solium thioredoxin-1 gene (TsTrx-1) has a length of 771 bp with three exons and two introns. The core promoter gene presents two putative stress transcription factor binding sites, one putative TATA box, and a transcription start site (TSS). TsTrx-1 mRNA is expressed higher in larvae than in adult. This gene encodes a protein of 107 amino acids that presents the Trx active site (CGPC), the classical secondary structure of the thioredoxin fold, and the highest degree of identity with the Echinococcus granulosus Trx. A recombinant TsTrx-1 (rTsTrx-1) was produced in Escherichia coli with redox activity. Optimal activity for rTsTrx-1 was at pH 6.5 in the range of 15 to 25°C. The enzyme conserved activity for 3 h and lost it in 24 h at 37°C. rTsTrx-1 lost 50% activity after 1 h and lost activity completely in 24 h at temperatures higher than 55°C. Best storage temperature for rTsTrx-1 was at −70°C. It was inhibited by high concentrations of H2O2 and methylglyoxal (MG), but it was inhibited neither by NaCl nor by anti-rTsTrx-1 rabbit antibodies that strongly recognized a ~12 kDa band in extracts from several parasites. These TsTrx-1 properties open the opportunity to study its role in relationship T. solium-hosts. PMID:26090410

Divergent mechanisms underlie Smad4-mediated positive regulation of the three genes encoding the basement membrane component laminin-332 (laminin-5)

International Nuclear Information System (INIS)

Zboralski, Dirk; Böckmann, Miriam; Zapatka, Marc; Hoppe, Sabine; Schöneck, Anna; Hahn, Stephan A; Schmiegel, Wolff; Schwarte-Waldhoff, Irmgard

2008-01-01

Functional inactivation of the tumor suppressor Smad4 in colorectal and pancreatic carcinogenesis occurs coincident with the transition to invasive growth. Breaking the basement membrane (BM) barrier, a prerequisite for invasive growth, can be due to tumor induced proteolytic tissue remodeling or to reduced synthesis of BM molecules by incipient tumor cells. Laminin-332 (laminin-5), a heterotrimeric BM component composed of α3-, β3- and γ2-chains, has recently been identified as a target structure of Smad4 and represents the first example for expression control of an essential BM component by a tumor and invasion suppressor. Biochemically Smad4 is a transmitter of signals of the TGFβ superfamily of cytokines. We have reported previously, that Smad4 functions as a positive transcriptional regulator of constitutive and of TGFβ-induced transcription of all three genes encoding Laminin-332, LAMA3, LAMB3 and LAMC2. Promoter-reporter constructs harboring 4 kb upstream regions, each of the three genes encoding Laminin-322 as well as deletion and mutations constructs were established. Promoter activities and TGFβ induction were assayed through transient transfections in Smad4-negative human cancer cells and their stable Smad4-positive derivatives. Functionally relevant binding sites were subsequently confirmed through chromatin immunoprecipitation. Herein, we report that Smad4 mediates transcriptional regulation through three different mechanisms, namely through Smad4 binding to a functional SBE site exclusively in the LAMA3 promoter, Smad4 binding to AP1 (and Sp1) sites presumably via interaction with AP1 family components and lastly a Smad4 impact on transcription of AP1 factors. Whereas Smad4 is essential for positive regulation of all three genes, the molecular mechanisms are significantly divergent between the LAMA3 promoter as compared to the LAMB3 and LAMC2 promoters. We hypothesize that this divergence in modular regulation of the three promoters may lay the

Construction of adiponectin-encoding plasmid DNA and gene therapy of non-obese type 2 diabetes mellitus.

Science.gov (United States)

Nan, Mei Hua; Park, Jeong-Sook; Myung, Chang-Seon

2010-01-01

Adiponectin (ADN), an insulin-sensitizing adipokine, stimulates glucose uptake, inhibits gluconeogenesis, and plays an important role in improving insulin sensitivity. Since blood levels of ADN are low in type 2 diabetes mellitus (DM), this study was designed to investigate the therapeutic effectiveness of increasing the ADN level through injection of plasmid DNA encoding ADN in type 2 DM. A non-obese type 2 DM mouse model was established via combined administration of streptozotocin with nicotinamide and exhibited significantly higher plasma glucose concentration and insulin resistance compared with normal controls according to oral glucose tolerance and insulin challenge tests. Plasmid DNA encoding mouse ADN from differentiated NIH3T3 adipocytes was constructed in pVAX1 (pVAX/ADN). Transfection of pVAX/ADN into various cell lines including HeLa, HT22, HEK293, HepG2, and SK-Hep1 cells, increased ADN mRNA expression levels in a dose-dependent manner. The administration of pVAX/ADN into non-obese type 2 DM mice via tail vein significantly increased the blood level of ADN and decreased the plasma glucose concentration. Moreover, the parameters related to insulin resistance (HOMA-IR) and insulin sensitivity (QUICKI) were significantly improved. These results suggest that ADN gene therapy could be a clinically effective tool for the treatment of type 2 DM.

The number of genes encoding repeat domain-containing proteins positively correlates with genome size in amoebal giant viruses

Science.gov (United States)

Shukla, Avi; Chatterjee, Anirvan

2018-01-01

Abstract Curiously, in viruses, the virion volume appears to be predominantly driven by genome length rather than the number of proteins it encodes or geometric constraints. With their large genome and giant particle size, amoebal viruses (AVs) are ideally suited to study the relationship between genome and virion size and explore the role of genome plasticity in their evolutionary success. Different genomic regions of AVs exhibit distinct genealogies. Although the vertically transferred core genes and their functions are universally conserved across the nucleocytoplasmic large DNA virus (NCLDV) families and are essential for their replication, the horizontally acquired genes are variable across families and are lineage-specific. When compared with other giant virus families, we observed a near–linear increase in the number of genes encoding repeat domain-containing proteins (RDCPs) with the increase in the genome size of AVs. From what is known about the functions of RDCPs in bacteria and eukaryotes and their prevalence in the AV genomes, we envisage important roles for RDCPs in the life cycle of AVs, their genome expansion, and plasticity. This observation also supports the evolution of AVs from a smaller viral ancestor by the acquisition of diverse gene families from the environment including RDCPs that might have helped in host adaption. PMID:29308275

The fosfomycin resistance gene fosB3 is located on a transferable, extrachromosomal circular intermediate in clinical Enterococcus faecium isolates.

Directory of Open Access Journals (Sweden)

Xiaogang Xu

Full Text Available Some VanM-type vancomycin-resistant Enterococcus faecium isolates from China are also resistant to fosfomycin. To investigate the mechanism of fosfomycin resistance in these clinical isolates, antimicrobial susceptibility testing, filter-mating, Illumina/Solexa sequencing, inverse PCR and fosfomycin resistance gene cloning were performed. Three E. faecium clinical isolates were highly resistant to fosfomycin and vancomycin with minimal inhibitory concentrations (MICs >1024 µg/ml and >256 µg/ml, respectively. The fosfomycin and vancomycin resistance of these strains could be co-transferred by conjugation. They carried a fosfomycin resistance gene fosB encoding a protein differing by one or two amino acids from FosB, which is encoded on staphylococcal plasmids. Accordingly, the gene was designated fosB3. The fosB3 gene was cloned into pMD19-T, and transformed into E. coli DH5α. The fosfomycin MIC for transformants with fosB3 was 750-fold higher than transformants without fosB3. The fosB3 gene could be transferred by an extrachromosomal circular intermediate. The results indicate that the fosB3 gene is transferable, can mediate high level fosfomycin resistance in both Gram-positive and Gram-negative bacteria, and can be located on a circular intermediate.

Ectopic overexpression of castor bean LEAFY COTYLEDON2 (LEC2 in Arabidopsis triggers the expression of genes that encode regulators of seed maturation and oil body proteins in vegetative tissues

Directory of Open Access Journals (Sweden)

Hyun Uk Kim

2014-01-01

Full Text Available The LEAFY COTYLEDON2 (LEC2 gene plays critically important regulatory roles during both early and late embryonic development. Here, we report the identification of the LEC2 gene from the castor bean plant (Ricinus communis, and characterize the effects of its overexpression on gene regulation and lipid metabolism in transgenic Arabidopsis plants. LEC2 exists as a single-copy gene in castor bean, is expressed predominantly in embryos, and encodes a protein with a conserved B3 domain, but different N- and C-terminal domains to those found in LEC2 from Arabidopsis. Ectopic overexpression of LEC2 from castor bean under the control of the cauliflower mosaic virus (CaMV 35S promoter in Arabidopsis plants induces the accumulation of transcripts that encodes five major transcription factors (the LEAFY COTYLEDON1 (LEC1, LEAFY COTYLEDON1-LIKE (L1L, FUSCA3 (FUS3, and ABSCISIC ACID INSENSITIVE 3 (ABI3 transcripts for seed maturation, and WRINKELED1 (WRI1 transcripts for fatty acid biosynthesis, as well as OLEOSIN transcripts for the formation of oil bodies in vegetative tissues. Transgenic Arabidopsis plants that express the LEC2 gene from castor bean show a range of dose-dependent morphological phenotypes and effects on the expression of LEC2-regulated genes during seedling establishment and vegetative growth. Expression of castor bean LEC2 in Arabidopsis increased the expression of fatty acid elongase 1 (FAE1 and induced the accumulation of triacylglycerols, especially those containing the seed-specific fatty acid, eicosenoic acid (20:1Δ11, in vegetative tissues.

Ectopic overexpression of castor bean LEAFY COTYLEDON2 (LEC2) in Arabidopsis triggers the expression of genes that encode regulators of seed maturation and oil body proteins in vegetative tissues.

Science.gov (United States)

Kim, Hyun Uk; Jung, Su-Jin; Lee, Kyeong-Ryeol; Kim, Eun Ha; Lee, Sang-Min; Roh, Kyung Hee; Kim, Jong-Bum

2013-01-01

The LEAFY COTYLEDON2 (LEC2) gene plays critically important regulatory roles during both early and late embryonic development. Here, we report the identification of the LEC2 gene from the castor bean plant (Ricinus communis), and characterize the effects of its overexpression on gene regulation and lipid metabolism in transgenic Arabidopsis plants. LEC2 exists as a single-copy gene in castor bean, is expressed predominantly in embryos, and encodes a protein with a conserved B3 domain, but different N- and C-terminal domains to those found in LEC2 from Arabidopsis. Ectopic overexpression of LEC2 from castor bean under the control of the cauliflower mosaic virus (CaMV) 35S promoter in Arabidopsis plants induces the accumulation of transcripts that encodes five major transcription factors (the LEAFY COTYLEDON1 (LEC1), LEAFY COTYLEDON1-LIKE (L1L), FUSCA3 (FUS3), and ABSCISIC ACID INSENSITIVE 3 (ABI3) transcripts for seed maturation, and WRINKELED1 (WRI1) transcripts for fatty acid biosynthesis), as well as OLEOSIN transcripts for the formation of oil bodies in vegetative tissues. Transgenic Arabidopsis plants that express the LEC2 gene from castor bean show a range of dose-dependent morphological phenotypes and effects on the expression of LEC2-regulated genes during seedling establishment and vegetative growth. Expression of castor bean LEC2 in Arabidopsis increased the expression of fatty acid elongase 1 (FAE1) and induced the accumulation of triacylglycerols, especially those containing the seed-specific fatty acid, eicosenoic acid (20:1(Δ11)), in vegetative tissues.

Ectopic overexpression of castor bean LEAFY COTYLEDON2 (LEC2) in Arabidopsis triggers the expression of genes that encode regulators of seed maturation and oil body proteins in vegetative tissues☆

Science.gov (United States)

Kim, Hyun Uk; Jung, Su-Jin; Lee, Kyeong-Ryeol; Kim, Eun Ha; Lee, Sang-Min; Roh, Kyung Hee; Kim, Jong-Bum

2013-01-01

The LEAFY COTYLEDON2 (LEC2) gene plays critically important regulatory roles during both early and late embryonic development. Here, we report the identification of the LEC2 gene from the castor bean plant (Ricinus communis), and characterize the effects of its overexpression on gene regulation and lipid metabolism in transgenic Arabidopsis plants. LEC2 exists as a single-copy gene in castor bean, is expressed predominantly in embryos, and encodes a protein with a conserved B3 domain, but different N- and C-terminal domains to those found in LEC2 from Arabidopsis. Ectopic overexpression of LEC2 from castor bean under the control of the cauliflower mosaic virus (CaMV) 35S promoter in Arabidopsis plants induces the accumulation of transcripts that encodes five major transcription factors (the LEAFY COTYLEDON1 (LEC1), LEAFY COTYLEDON1-LIKE (L1L), FUSCA3 (FUS3), and ABSCISIC ACID INSENSITIVE 3 (ABI3) transcripts for seed maturation, and WRINKELED1 (WRI1) transcripts for fatty acid biosynthesis), as well as OLEOSIN transcripts for the formation of oil bodies in vegetative tissues. Transgenic Arabidopsis plants that express the LEC2 gene from castor bean show a range of dose-dependent morphological phenotypes and effects on the expression of LEC2-regulated genes during seedling establishment and vegetative growth. Expression of castor bean LEC2 in Arabidopsis increased the expression of fatty acid elongase 1 (FAE1) and induced the accumulation of triacylglycerols, especially those containing the seed-specific fatty acid, eicosenoic acid (20:1Δ11), in vegetative tissues. PMID:24363987

Cloning and sequencing of cDNA encoding human DNA topoisomerase II and localization of the gene to chromosome region 17q21-22

International Nuclear Information System (INIS)

Tsai-Pflugfelder, M.; Liu, L.F.; Liu, A.A.; Tewey, K.M.; Whang-Peng, J.; Knutsen, T.; Huebner, K.; Croce, C.M.; Wang, J.C.

1988-01-01

Two overlapping cDNA clones encoding human DNA topoisomerase II were identified by two independent methods. In one, a human cDNA library in phage λ was screened by hybridization with a mixed oligonucleotide probe encoding a stretch of seven amino acids found in yeast and Drosophila DNA topoisomerase II; in the other, a different human cDNA library in a λgt11 expression vector was screened for the expression of antigenic determinants that are recognized by rabbit antibodies specific to human DNA topoisomerase II. The entire coding sequences of the human DNA topoisomerase II gene were determined from these and several additional clones, identified through the use of the cloned human TOP2 gene sequences as probes. Hybridization between the cloned sequences and mRNA and genomic DNA indicates that the human enzyme is encoded by a single-copy gene. The location of the gene was mapped to chromosome 17q21-22 by in situ hybridization of a cloned fragment to metaphase chromosomes and by hybridization analysis with a panel of mouse-human hybrid cell lines, each retaining a subset of human chromosomes

The ArcD1 and ArcD2 arginine/ornithine exchangers encoded in the arginine deiminase (ADI) pathway gene cluster of Lactococcus lactis

NARCIS (Netherlands)

Noens, Elke E E; Kaczmarek, Michał B; Żygo, Monika; Lolkema, Juke S

2015-01-01

The arginine deiminase pathway (ADI) gene cluster in Lactococcus lactis contains two copies of a gene encoding an L-arginine/L-ornithine exchanger, the arcD1 and arcD2 genes. The physiological function of ArcD1 and ArcD2 was studied by deleting the two genes. Deletion of arcD1 resulted in loss of

Bacteriophage SP6 encodes a second tailspike protein that recognizes Salmonella enterica serogroups C2 and C3

International Nuclear Information System (INIS)

Gebhart, Dana; Williams, Steven R.; Scholl, Dean

2017-01-01

SP6 is a salmonella phage closely related to coliphage K1-5. K1-5 is notable in that it encodes two polysaccharide-degrading tailspike proteins, an endosialidase that allows it to infect E. coli K1, and a lyase that enables it to infect K5 strains. SP6 is similar to K1-5 except that it encodes a P22-like endorhamnosidase tailspike, gp46, allowing it to infect group B Salmonella. We show here that SP6 can also infect Salmonella serogroups C 2 and C 3 and that a mutation in a putative second tailspike, gp47, eliminates this specificity. Gene 47 was fused to the coding region of the N-terminal portion of the Pseudomonas aeruginosa R2 pyocin tail fiber and expressed in trans such that the fusion protein becomes incorporated into pyocin particles. These pyocins, termed AvR2-SP47, killed serogroups C 2 and C 3 Salmonella. We conclude that SP6 encodes two tail proteins providing it a broad host range among Salmonella enterica. - Highlights: • SP6 is a “dual specificity” bacteriophage that encodes two different receptor binding proteins giving it a broad host range. • These receptor binding proteins can be used to re-target the spectrum of R-type bacteriocins to Salmonella enterica. • Both SP6 and the engineered R-type bacteriocins can kill the Salmonella serovars most associated with human disease making them attractive for development as antimicrobial agents.

Mutations in a novel gene with transmembrane domains underlie Usher syndrome type 3.

Science.gov (United States)

Joensuu, T; Hämäläinen, R; Yuan, B; Johnson, C; Tegelberg, S; Gasparini, P; Zelante, L; Pirvola, U; Pakarinen, L; Lehesjoki, A E; de la Chapelle, A; Sankila, E M

2001-10-01

Usher syndrome type 3 (USH3) is an autosomal recessive disorder characterized by progressive hearing loss, severe retinal degeneration, and variably present vestibular dysfunction, assigned to 3q21-q25. Here, we report on the positional cloning of the USH3 gene. By haplotype and linkage-disequilibrium analyses in Finnish carriers of a putative founder mutation, the critical region was narrowed to 250 kb, of which we sequenced, assembled, and annotated 207 kb. Two novel genes-NOPAR and UCRP-and one previously identified gene-H963-were excluded as USH3, on the basis of mutational analysis. USH3, the candidate gene that we identified, encodes a 120-amino-acid protein. Fifty-two Finnish patients were homozygous for a termination mutation, Y100X; patients in two Finnish families were compound heterozygous for Y100X and for a missense mutation, M44K, whereas patients in an Italian family were homozygous for a 3-bp deletion leading to an amino acid deletion and substitution. USH3 has two predicted transmembrane domains, and it shows no homology to known genes. As revealed by northern blotting and reverse-transcriptase PCR, it is expressed in many tissues, including the retina.

Next-generation sequencing identifies transportin 3 as the causative gene for LGMD1F.

Directory of Open Access Journals (Sweden)

Annalaura Torella

Full Text Available Limb-girdle muscular dystrophies (LGMD are genetically and clinically heterogeneous conditions. We investigated a large family with autosomal dominant transmission pattern, previously classified as LGMD1F and mapped to chromosome 7q32. Affected members are characterized by muscle weakness affecting earlier the pelvic girdle and the ileopsoas muscles. We sequenced the whole exome of four family members and identified a shared heterozygous frame-shift variant in the Transportin 3 (TNPO3 gene, encoding a member of the importin-β super-family. The TNPO3 gene is mapped within the LGMD1F critical interval and its 923-amino acid human gene product is also expressed in skeletal muscle. In addition, we identified an isolated case of LGMD with a new missense mutation in the same gene. We localized the mutant TNPO3 around the nucleus, but not inside. The involvement of gene related to the nuclear transport suggests a novel disease mechanism leading to muscular dystrophy.

Tissue-specific and pathogen-induced regulation of a Nicotiana plumbaginifolia beta-1,3-glucanase gene.

Science.gov (United States)

Castresana, C; de Carvalho, F; Gheysen, G; Habets, M; Inzé, D; Van Montagu, M

1990-01-01

The Nicotiana plumbaginifolia gn1 gene encoding a beta-1,3-glucanase isoform has been characterized. The gn1 product represents an isoform distinct from the previously identified tobacco beta-1,3-glucanases. By expressing gn1 in Escherichia coli, we have determined directly that the encoded protein does, indeed, correspond to a beta-1,3-glucanase. In N. plumbaginifolia, gn1 was found to be expressed in roots and older leaves. Transgenic tobacco plants containing the 5'-noncoding region of gn1 fused to the beta-glucuronidase (GUS) reporter gene also showed maximum levels of GUS activity in roots and older leaves. No detectable activity was present in the upper part of the transgenic plants with the exception of stem cells at the bases of emerging shoots. The expression conferred by the gn1 promoter was differentially induced in response to specific plant stress treatments. Studies of three plant-bacteria interactions showed high levels of GUS activity when infection resulted in a hypersensitive reaction. Increased gene expression was confined to cells surrounding the necrotic lesions. The observed expression pattern suggests that the characterized beta-1,3-glucanase plays a role both in plant development and in the defense response against pathogen infection. PMID:2152158

Identification and characterization of an oleate hydratase-encoding gene from Bifidobacterium breve.

Science.gov (United States)

O'Connell, Kerry Joan; Motherway, Mary O'Connell; Hennessey, Alan A; Brodhun, Florian; Ross, R Paul; Feussner, Ivo; Stanton, Catherine; Fitzgerald, Gerald F; van Sinderen, Douwe

2013-01-01

Bifidobacteria are common commensals of the mammalian gastrointestinal tract. Previous studies have suggested that a bifidobacterial myosin cross reactive antigen (MCRA) protein plays a role in bacterial stress tolerance, while this protein has also been linked to the biosynthesis of conjugated linoleic acid (CLA) in bifidobacteria. In order to increase our understanding on the role of MCRA in bifidobacteria we created and analyzed an insertion mutant of the MCRA-encoding gene of B. breve NCFB 2258. Our results demonstrate that the MCRA protein of B. breve NCFB 2258 does not appear to play a role in CLA production, yet is an oleate hydratase, which contributes to bifidobacterial solvent stress protection.

The ANGULATA7 gene encodes a DnaJ-like zinc finger-domain protein involved in chloroplast function and leaf development in Arabidopsis.

Science.gov (United States)

Muñoz-Nortes, Tamara; Pérez-Pérez, José Manuel; Ponce, María Rosa; Candela, Héctor; Micol, José Luis

2017-03-01

The characterization of mutants with altered leaf shape and pigmentation has previously allowed the identification of nuclear genes that encode plastid-localized proteins that perform essential functions in leaf growth and development. A large-scale screen previously allowed us to isolate ethyl methanesulfonate-induced mutants with small rosettes and pale green leaves with prominent marginal teeth, which were assigned to a phenotypic class that we dubbed Angulata. The molecular characterization of the 12 genes assigned to this phenotypic class should help us to advance our understanding of the still poorly understood relationship between chloroplast biogenesis and leaf morphogenesis. In this article, we report the phenotypic and molecular characterization of the angulata7-1 (anu7-1) mutant of Arabidopsis thaliana, which we found to be a hypomorphic allele of the EMB2737 gene, which was previously known only for its embryonic-lethal mutations. ANU7 encodes a plant-specific protein that contains a domain similar to the central cysteine-rich domain of DnaJ proteins. The observed genetic interaction of anu7-1 with a loss-of-function allele of GENOMES UNCOUPLED1 suggests that the anu7-1 mutation triggers a retrograde signal that leads to changes in the expression of many genes that normally function in the chloroplasts. Many such genes are expressed at higher levels in anu7-1 rosettes, with a significant overrepresentation of those required for the expression of plastid genome genes. Like in other mutants with altered expression of plastid-encoded genes, we found that anu7-1 exhibits defects in the arrangement of thylakoidal membranes, which appear locally unappressed. © 2016 The Authors The Plant Journal © 2016 John Wiley & Sons Ltd.

Cloning an artificial gene encoding angiostatic anginex: From designed peptide to functional recombinant protein

International Nuclear Information System (INIS)

Brandwijk, Ricardo J.M.G.E.; Nesmelova, Irina; Dings, Ruud P.M.; Mayo, Kevin H.; Thijssen, Victor L.J.L.; Griffioen, Arjan W.

2005-01-01

Anginex, a designed peptide 33-mer, is a potent angiogenesis inhibitor and anti-tumor agent in vivo. Anginex functions by inhibiting endothelial cell (EC) proliferation and migration leading to detachment and apoptosis of activated EC's. To better understand tumor endothelium targeting properties of anginex and enable its use in gene therapy, we constructed an artificial gene encoding the biologically exogenous peptide and produced the protein recombinantly in Pichia pastoris. Mass spectrometry shows recombinant anginex to be a dimer and circular dichroism shows the recombinant protein folds with β-strand structure like the synthetic peptide. Moreover, like parent anginex, the recombinant protein is active at inhibiting EC growth and migration, as well as inhibiting angiogenesis in vivo in the chorioallantoic membrane of the chick embryo. This study demonstrated that it is possible to produce a functionally active protein version of a rationally designed peptide, using an artificial gene and the recombinant protein approach

aes, the gene encoding the esterase B in Escherichia coli, is a powerful phylogenetic marker of the species

Directory of Open Access Journals (Sweden)

Tuffery Pierre

2009-12-01

Full Text Available Abstract Background Previous studies have established a correlation between electrophoretic polymorphism of esterase B, and virulence and phylogeny of Escherichia coli. Strains belonging to the phylogenetic group B2 are more frequently implicated in extraintestinal infections and include esterase B2 variants, whereas phylogenetic groups A, B1 and D contain less virulent strains and include esterase B1 variants. We investigated esterase B as a marker of phylogeny and/or virulence, in a thorough analysis of the esterase B-encoding gene. Results We identified the gene encoding esterase B as the acetyl-esterase gene (aes using gene disruption. The analysis of aes nucleotide sequences in a panel of 78 reference strains, including the E. coli reference (ECOR strains, demonstrated that the gene is under purifying selection. The phylogenetic tree reconstructed from aes sequences showed a strong correlation with the species phylogenetic history, based on multi-locus sequence typing using six housekeeping genes. The unambiguous distinction between variants B1 and B2 by electrophoresis was consistent with Aes amino-acid sequence analysis and protein modelling, which showed that substituted amino acids in the two esterase B variants occurred mostly at different sites on the protein surface. Studies in an experimental mouse model of septicaemia using mutant strains did not reveal a direct link between aes and extraintestinal virulence. Moreover, we did not find any genes in the chromosomal region of aes to be associated with virulence. Conclusion Our findings suggest that aes does not play a direct role in the virulence of E. coli extraintestinal infection. However, this gene acts as a powerful marker of phylogeny, illustrating the extensive divergence of B2 phylogenetic group strains from the rest of the species.

Expression profile of a Laccase2 encoding gene during the metamorphic molt in Apis mellifera (Hymenoptera,Apidae

Directory of Open Access Journals (Sweden)

Moysés Elias-Neto

2013-06-01

Full Text Available Expression profile of a Laccase2 encoding gene during the metamorphic molt in Apis mellifera (Hymenoptera, Apidae. Metamorphosis in holometabolous insects occurs through two subsequent molting cycles: pupation (metamorphic molt and adult differentiation (imaginal molt. The imaginal molt in Apis mellifera L. was recently investigated in both histological and physiological-molecular approaches. Although the metamorphic molt in this model bee is extremely important to development, it is not well-known yet. In the current study we used this stage as an ontogenetic scenario to investigate the transcriptional profile of the gene Amlac2, which encodes a laccase with an essential role in cuticle differentiation. Amlac2 expression in epidermis was contrasted with the hemolymph titer of ecdysteroid hormones and with the most evident morphological events occurring during cuticle renewal. RT-PCR semiquantitative analyses using integument samples revealed increased levels of Amlac2 transcripts right after apolysis and during the subsequent pharate period, and declining levels near pupal ecdysis. Compared with the expression of a cuticle protein gene, AmelCPR14, these results highlighted the importance of the ecdysteroid-induced apolysis as an ontogenetic marker of gene reactivation in epidermis for cuticle renewal. The obtained results strengthen the comprehension of metamorphosis in Apis mellifera. In addition, we reviewed the literature about the development of A. mellifera, and emphasize the importance of revising the terminology used to describe honey bee molting cycles.

Isolation and Cloning of cDNA Fragment of Gene Encoding for Multidrug Resistance Associated Protein from M. affine.

Directory of Open Access Journals (Sweden)

Utut Widyastuti Suharsono

2008-11-01

Full Text Available Isolation and Cloning of cDNA Fragment of Gene Encoding for Multidrug Resistance Associated Protein from M. affine. M. affine can grow well in acid soil with high level of soluble aluminum. One of the important proteins in the detoxifying xenobiotic stress including acid and Al stresses is a multidrug resistance associated protein (MRP encoded by mrp gene. The objective of this research is to isolate and clone the cDNA fragment of MaMrp encoding MRP from M. affine. By reverse transcription, total cDNA had been synthesized from the total RNA as template. The fragment of cDNA MaMrp had been successfully isolated by PCR by using total cDNA as template and mrp primer designed from A. thaliana, yeast, and human. This fragment was successfully inserted into pGEM-T Easy and the recombinant plasmid was successfully introduced into E. coli DH5α. Nucleotide sequence analysis showed that the lenght of MaMrp fragment is 633 bp encoding 208 amino acids. Local alignment analysis based on nucleotide of mRNA showed that MaMrp fragment is 69% identical to AtMrp1 and 63% to AtMrp from A. thaliana. Based on deduced amino acid sequence, MaMRP is 84% identical to part of AtMRP13, 77% to AtMRP12, and 73% to AtMRP1 from A. thaliana respectively. Alignment analysis with AtMRP1 showed that MaMRP fragment is located in TM1 and NBF1 domains and has a specific amino acid sequence QCKAQLQNMEEE.

Virulence properties of methicillin-susceptible Staphylococcus aureus food isolates encoding Panton-Valentine Leukocidin gene.

Science.gov (United States)

Sudagidan, Mert; Aydin, Ali

2010-04-15

In this study, three Panton-Valentine Leukocidin gene carrying methicillin-susceptible Staphylococcus aureus (MSSA) strains (M1-AAG42B, PY30C-b and YF1B-b) were isolated from different food samples in Kesan-Edirne, Turkey. These strains were characterized on the basis of MLST type, spa type, virulence factor gene contents, antibiotic susceptibilities against 21 antibiotics and biofilm formation. The genetic relatedness of the strains was determined by PFGE. In addition, the complete gene sequences of lukS-PV and lukF-PV were also investigated. All strains were found to be susceptible to tested antibiotics and they were mecA negative. Three strains showed the same PFGE band pattern, ST152 clonal type and t355 spa type. In the detection of virulence factor genes, sea, seb, sec, sed, see, seg, seh, sei, sej, sek, sel, sem, sen, seo, sep, seq, seu, eta, etb, set1, geh and tst genes were not detected. All strains showed the positive results for alpha- and beta-haemolysin genes (hla and hlb), protease encoding genes (sspA, sspB and aur), lukE and lukD leukocidin genes (lukED). The strains were found to be non-biofilm formers. By this study, the virulence properties of the strains were described and this is one of the first reports regarding PVL-positive MSSA strains from food. (c) 2010 Elsevier B.V. All rights reserved.

Ocular toxoplasmosis: susceptibility in respect to the genes encoding the KIR receptors and their HLA class I ligands

Science.gov (United States)

Ayo, Christiane Maria; Frederico, Fábio Batista; Siqueira, Rubens Camargo; Brandão de Mattos, Cinara de Cássia; Previato, Mariana; Barbosa, Amanda Pires; Murata, Fernando Henrique Antunes; Silveira-Carvalho, Aparecida Perpétuo; de Mattos, Luiz Carlos

2016-01-01

The objective of this study was to investigate the influence of the genes encoding the KIR receptors and their HLA ligands in the susceptibility of ocular toxoplasmosis. A total of 297 patients serologically-diagnosed with toxoplasmosis were selected and stratified according to the presence (n = 148) or absence (n = 149) of ocular scars/lesions due to toxoplasmosis. The group of patients with scars/lesions was further subdivided into two groups according to the type of ocular manifestation observed: primary (n = 120) or recurrent (n = 28). Genotyping was performed by PCR-SSOP. Statistical analyses were conducted using the Chi-square test, and odds ratio with a 95% confidence interval was also calculated to evaluate the risk association. The activating KIR3DS1 gene was associated with increased susceptibility for ocular toxoplasmosis. The activating KIR together with their HLA ligands (KIR3DS1-Bw4-80Ile and KIR2DS1+/C2++ KIR3DS1+/Bw4-80Ile+) were associated with increased susceptibility for ocular toxoplasmosis and its clinical manifestations. KIR-HLA inhibitory pairs -KIR2DL3/2DL3-C1/C1 and KIR2DL3/2DL3-C1- were associated with decreased susceptibility for ocular toxoplasmosis and its clinical forms, while the KIR3DS1−/KIR3DL1+/Bw4-80Ile+ combination was associated as a protective factor against the development of ocular toxoplasmosis and, in particular, against recurrent manifestations. Our data demonstrate that activating and inhibitory KIR genes may influence the development of ocular toxoplasmosis. PMID:27827450

MitoRes: a resource of nuclear-encoded mitochondrial genes and their products in Metazoa.

Science.gov (United States)

Catalano, Domenico; Licciulli, Flavio; Turi, Antonio; Grillo, Giorgio; Saccone, Cecilia; D'Elia, Domenica

2006-01-24

Mitochondria are sub-cellular organelles that have a central role in energy production and in other metabolic pathways of all eukaryotic respiring cells. In the last few years, with more and more genomes being sequenced, a huge amount of data has been generated providing an unprecedented opportunity to use the comparative analysis approach in studies of evolution and functional genomics with the aim of shedding light on molecular mechanisms regulating mitochondrial biogenesis and metabolism. In this context, the problem of the optimal extraction of representative datasets of genomic and proteomic data assumes a crucial importance. Specialised resources for nuclear-encoded mitochondria-related proteins already exist; however, no mitochondrial database is currently available with the same features of MitoRes, which is an update of the MitoNuc database extensively modified in its structure, data sources and graphical interface. It contains data on nuclear-encoded mitochondria-related products for any metazoan species for which this type of data is available and also provides comprehensive sequence datasets (gene, transcript and protein) as well as useful tools for their extraction and export. MitoRes http://www2.ba.itb.cnr.it/MitoRes/ consolidates information from publicly external sources and automatically annotates them into a relational database. Additionally, it also clusters proteins on the basis of their sequence similarity and interconnects them with genomic data. The search engine and sequence management tools allow the query/retrieval of the database content and the extraction and export of sequences (gene, transcript, protein) and related sub-sequences (intron, exon, UTR, CDS, signal peptide and gene flanking regions) ready to be used for in silico analysis. The tool we describe here has been developed to support lab scientists and bioinformaticians alike in the characterization of molecular features and evolution of mitochondrial targeting sequences. The

The short mRNA isoform of the immunoglobulin superfamily, member 1 gene encodes an intracellular glycoprotein.

Directory of Open Access Journals (Sweden)

Ying Wang

Full Text Available Mutations in the immunoglobulin superfamily, member 1 gene (IGSF1/Igsf1 cause an X-linked form of central hypothyroidism. The canonical form of IGSF1 is a transmembrane glycoprotein with 12 immunoglobulin (Ig loops. The protein is co-translationally cleaved into two sub-domains. The carboxyl-terminal domain (CTD, which contains the last 7 Ig loops, is trafficked to the plasma membrane. Most pathogenic mutations in IGSF1 map to the portion of the gene encoding the CTD. IGSF1/Igsf1 encodes a variety of transcripts. A little studied, but abundant splice variant encodes a truncated form of the protein, predicted to contain the first 2 Ig loops of the full-length IGSF1. The protein (hereafter referred to as IGSF1 isoform 2 or IGSF1-2 is likely retained in most individuals with IGSF1 mutations. Here, we characterized basic biochemical properties of the protein as a foray into understanding its potential function. IGSF1-2, like the IGSF1-CTD, is a glycoprotein. In both mouse and rat, the protein is N-glycosylated at a single asparagine residue in the first Ig loop. Contrary to earlier predictions, neither the murine nor rat IGSF1-2 is secreted from heterologous or homologous cells. In addition, neither protein associates with the plasma membrane. Rather, IGSF1-2 appears to be retained in the endoplasmic reticulum. Whether the protein plays intracellular functions or is trafficked through the secretory pathway under certain physiologic or pathophysiologic conditions has yet to be determined.

Cloning of araA Gene Encoding L-Arabinose Isomerase from Marine Geobacillus stearothermophilus Isolated from Tanjung Api, Poso, Indonesia

Directory of Open Access Journals (Sweden)

DEWI FITRIANI

2010-06-01

Full Text Available L-arabinose isomerase is an enzyme converting D-galactose to D-tagatose. D-tagatose is a potential sweetener-sucrose substitute which has low calorie. This research was to clone and sequence araA gene from marine bacterial strain Geobacillus stearothermophilus isolated from Tanjung Api Poso Indonesia. The amplified araA gene consisted of 1494 bp nucleotides encoding 497 amino acids. DNA alignment analysis showed that the gene had high homology with that of G. stearothermophilus T6. The enzyme had optimum activity at high temperature and alkalin condition.

Characterization of Genes Encoding Key Enzymes Involved in Anthocyanin Metabolism of Kiwifruit during Storage Period

OpenAIRE

Li, Boqiang; Xia, Yongxiu; Wang, Yuying; Qin, Guozheng; Tian, Shiping

2017-01-01

‘Hongyang’ is a red fleshed kiwifruit with high anthocyanin content. In this study, we mainly investigated effects of different temperatures (25 and 0°C) on anthocyanin biosynthesis in harvested kiwifruit, and characterized the genes encoding key enzymes involved in anthocyanin metabolism, as well as evaluated the mode of the action, by which low temperature regulates anthocyanin accumulation in ‘Hongyang’ kiwifruit during storage period. The results showed that low temperature could effectiv...

Dynein Heavy Chain, Encoded by Two Genes in Agaricomycetes, Is Required for Nuclear Migration in Schizophyllum commune.

Directory of Open Access Journals (Sweden)

Melanie Brunsch

Full Text Available The white-rot fungus Schizophyllum commune (Agaricomycetes was used to study the cell biology of microtubular trafficking during mating interactions, when the two partners exchange nuclei, which are transported along microtubule tracks. For this transport activity, the motor protein dynein is required. In S. commune, the dynein heavy chain is encoded in two parts by two separate genes, dhc1 and dhc2. The N-terminal protein Dhc1 supplies the dimerization domain, while Dhc2 encodes the motor machinery and the microtubule binding domain. This split motor protein is unique to Basidiomycota, where three different sequence patterns suggest independent split events during evolution. To investigate the function of the dynein heavy chain, the gene dhc1 and the motor domain in dhc2 were deleted. Both resulting mutants were viable, but revealed phenotypes in hyphal growth morphology and mating behavior as well as in sexual development. Viability of strain Δdhc2 is due to the higher expression of kinesin-2 and kinesin-14, which was proven via RNA sequencing.

Expression analysis of the Arabidopsis thaliana AtSpen2 gene, and its relationship with other plant genes encoding Spen proteins

OpenAIRE

Solís-Guzmán, María Gloria; Argüello-Astorga, Gerardo; López-Bucio, José; Ruiz-Herrera, León Francisco; López-Meza, Joel; Sánchez-Calderón, Lenin; Carreón-Abud, Yazmín; Martínez-Trujillo, Miguel

2017-01-01

Abstract Proteins of the Split ends (Spen) family are characterized by an N-terminal domain, with one or more RNA recognition motifs and a SPOC domain. In Arabidopsis thaliana, the Spen protein FPA is involved in the control of flowering time as a component of an autonomous pathway independent of photoperiod. The A. thaliana genome encodes another gene for a putative Spen protein at the locus At4g12640, herein named AtSpen2. Bioinformatics analysis of the AtSPEN2 SPOC domain revealed low sequ...

An operon encoding three glycolytic enzymes in Lactobacillus delbrueckii subsp. bulgaricus: glyceraldehyde-3-phosphate dehydrogenase, phosphoglycerate kinase and triosephosphate isomerase.

Science.gov (United States)

Branny, P; de la Torre, F; Garel, J R

1998-04-01

The structural genes gap, pgk and tpi encoding three glycolytic enzymes, glyceraldehyde-3-phosphate dehydrogenase (GAPDH), 3-phosphoglycerate kinase (PGK) and triosephosphate isomerase (TPI), respectively, have been cloned and sequenced from Lactobacillus delbrueckii subsp. bulgaricus (L. bulgaricus). The genes were isolated after screening genomic sublibraries with specific gap and pgk probes obtained by PCR amplification of chromosomal DNA with degenerate primers corresponding to amino acid sequences highly conserved in GAPDHs and PGKs. Nucleotide sequencing revealed that the three genes were organized in the order gap-pgk-tpi. The translation start codons of the three genes were identified by alignment of the N-terminal sequences. These genes predicted polypeptide chains of 338, 403 and 252 amino acids for GAPDH, PGK and TPI, respectively, and they were separated by 96 bp between gap and pgk, and by only 18 bp between pgk and tpi. The codon usage in gap, pgk, tpi and three other glycolytic genes from L. bulgaricus differed, noticeably from that in other chromosomal genes. The site of transcriptional initiation was located by primer extension, and a probable promoter was identified for the gap-pgk-tpi operon. Northern hybridization of total RNA with specific probes showed two transcripts, an mRNA of 1.4 kb corresponding to the gap gene, and a less abundant mRNA of 3.4 kb corresponding to the gap-pgk-tpi cluster. The absence of a visible terminator in the 3'-end of the shorter transcript and the location of this 3'-end inside the pgk gene indicated that this shorter transcript was produced by degradation of the longer one, rather than by an early termination of transcription after the gap gene.

WHITE PANICLE3, a Novel Nucleus-Encoded Mitochondrial Protein, Is Essential for Proper Development and Maintenance of Chloroplasts and Mitochondria in Rice

Directory of Open Access Journals (Sweden)

Hongchang Li

2018-06-01

Full Text Available Mitochondria and chloroplasts are interacting organelles that play important roles in plant development. In addition to a small number proteins encoded by their own genomes, the majority of mitochondrial and chloroplast proteins are encoded in the cell nucleus and imported into the organelle. As a consequence, coordination between mitochondria, chloroplasts, and the nucleus is of crucial importance to plant cells. Variegated mutants are chloroplast-defective mutants and are considered to be ideal models for studying the intercommunication between these organelles. Here, we report the isolation of WHITE PANICLE3 (WP3, a nuclear gene involved in variegation, from a naturally occurring white panicle rice mutant. Disrupted expression of WP3 in the mutant leads to severe developmental defects in both chloroplasts and mitochondria, and consequently causes the appearance of white-striped leaves and white panicles in the mutant plants. Further investigation showed that WP3 encodes a protein most likely targeted to mitochondria and is specifically expressed in rice panicles. Interestingly, we demonstrate that the recessive white-panicle phenotype in the wp3 mutant is inherited in a typical Mendelian manner, while the white-striped leaf phenotype in wp3 is maternally inherited. Our data collectively suggest that the nucleus-encoded mitochondrial protein, WP3, plays an essential role in the regulation of chloroplast development in rice panicles by maintaining functional mitochondria. Therefore, the wp3 mutant is an excellent model in which to explore the communication between the nucleus, mitochondria, and chloroplasts in plant cells.

Mutation of CDH23, encoding a new member of the cadherin gene family, causes Usher syndrome type 1D.

Science.gov (United States)

Bolz, H; von Brederlow, B; Ramírez, A; Bryda, E C; Kutsche, K; Nothwang, H G; Seeliger, M; del C-Salcedó Cabrera, M; Vila, M C; Molina, O P; Gal, A; Kubisch, C

2001-01-01

Usher syndrome type I (USH1) is an autosomal recessive disorder characterized by congenital sensorineural hearing loss, vestibular dysfunction and visual impairment due to early onset retinitis pigmentosa (RP). So far, six loci (USH1A-USH1F) have been mapped, but only two USH1 genes have been identified: MYO7A for USH1B and the gene encoding harmonin for USH1C. We identified a Cuban pedigree linked to the locus for Usher syndrome type 1D (MIM 601067) within the q2 region of chromosome 10). Affected individuals present with congenital deafness and a highly variable degree of retinal degeneration. Using a positional candidate approach, we identified a new member of the cadherin gene superfamily, CDH23. It encodes a protein of 3,354 amino acids with a single transmembrane domain and 27 cadherin repeats. In the Cuban family, we detected two different mutations: a severe course of the retinal disease was observed in individuals homozygous for what is probably a truncating splice-site mutation (c.4488G-->C), whereas mild RP is present in individuals carrying the homozygous missense mutation R1746Q. A variable expression of the retinal phenotype was seen in patients with a combination of both mutations. In addition, we identified two mutations, Delta M1281 and IVS51+5G-->A, in a German USH1 patient. Our data show that different mutations in CDH23 result in USH1D with a variable retinal phenotype. In an accompanying paper, it is shown that mutations in the mouse ortholog cause disorganization of inner ear stereocilia and deafness in the waltzer mouse.

Identification of genes expressed in cultures of E. coli lysogens carrying the Shiga toxin-encoding prophage Φ24B

Directory of Open Access Journals (Sweden)

Riley Laura M

2012-03-01

Full Text Available Abstract Background Shigatoxigenic E. coli are a global and emerging health concern. Shiga toxin, Stx, is encoded on the genome of temperate, lambdoid Stx phages. Genes essential for phage maintenance and replication are encoded on approximately 50% of the genome, while most of the remaining genes are of unknown function nor is it known if these annotated hypothetical genes are even expressed. It is hypothesized that many of the latter have been maintained due to positive selection pressure, and that some, expressed in the lysogen host, have a role in pathogenicity. This study used Change Mediated Antigen Technology (CMAT™ and 2D-PAGE, in combination with RT-qPCR, to identify Stx phage genes that are expressed in E. coli during the lysogenic cycle. Results Lysogen cultures propagated for 5-6 hours produced a high cell density with a low proportion of spontaneous prophage induction events. The expression of 26 phage genes was detected in these cultures by differential 2D-PAGE of expressed proteins and CMAT. Detailed analyses of 10 of these genes revealed that three were unequivocally expressed in the lysogen, two expressed from a known lysogenic cycle promoter and one uncoupled from the phage regulatory network. Conclusion Propagation of a lysogen culture in which no cells at all are undergoing spontaneous lysis is impossible. To overcome this, RT-qPCR was used to determine gene expression profiles associated with the growth phase of lysogens. This enabled the definitive identification of three lambdoid Stx phage genes that are expressed in the lysogen and seven that are expressed during lysis. Conservation of these genes in this phage genome, and other Stx phages where they have been identified as present, indicates their importance in the phage/lysogen life cycle, with possible implications for the biology and pathogenicity of the bacterial host.

Using an Inducible Promoter of a Gene Encoding Penicillium verruculosum Glucoamylase for Production of Enzyme Preparations with Enhanced Cellulase Performance.

Directory of Open Access Journals (Sweden)

Alexander G Bulakhov

Full Text Available Penicillium verruculosum is an efficient producer of highly active cellulase multienzyme system. One of the approaches for enhancing cellulase performance in hydrolysis of cellulosic substrates is to enrich the reaction system with β -glucosidase and/or accessory enzymes, such as lytic polysaccharide monooxygenases (LPMO displaying a synergism with cellulases.Genes bglI, encoding β-glucosidase from Aspergillus niger (AnBGL, and eglIV, encoding LPMO (formerly endoglucanase IV from Trichoderma reesei (TrLPMO, were cloned and expressed by P. verruculosum B1-537 strain under the control of the inducible gla1 gene promoter. Content of the heterologous AnBGL in the secreted multienzyme cocktails (hBGL1, hBGL2 and hBGL3 varied from 4 to 10% of the total protein, while the content of TrLPMO in the hLPMO sample was ~3%. The glucose yields in 48-h hydrolysis of Avicel and milled aspen wood by the hBGL1, hBGL2 and hBGL3 preparations increased by up to 99 and 80%, respectively, relative to control enzyme preparations without the heterologous AnBGL (at protein loading 5 mg/g substrate for all enzyme samples. The heterologous TrLPMO in the hLPMO preparation boosted the conversion of the lignocellulosic substrate by 10-43%; however, in hydrolysis of Avicel the hLPMO sample was less effective than the control preparations. The highest product yield in hydrolysis of aspen wood was obtained when the hBGL2 and hLPMO preparations were used at the ratio 1:1.The enzyme preparations produced by recombinant P. verruculosum strains, expressing the heterologous AnBGL or TrLPMO under the control of the gla1 gene promoter in a starch-containing medium, proved to be more effective in hydrolysis of a lignocellulosic substrate than control enzyme preparations without the heterologous enzymes. The enzyme composition containing both AnBGL and TrLPMO demonstrated the highest performance in lignocellulose hydrolysis, providing a background for developing a fungal strain capable

Multiplex PCR assay for detection of recombinant genes encoding fatty acid desaturases fused with lichenase reporter protein in GM plants.

Science.gov (United States)

Berdichevets, Iryna N; Shimshilashvili, Hristina R; Gerasymenko, Iryna M; Sindarovska, Yana R; Sheludko, Yuriy V; Goldenkova-Pavlova, Irina V

2010-07-01

Thermostable lichenase encoded by licB gene of Clostridium thermocellum can be used as a reporter protein in plant, bacterial, yeast, and mammalian cells. It has important advantages of high sensitivity and specificity in qualitative and quantitative assays. Deletion variants of LicB (e.g., LicBM3) retain its enzymatic activity and thermostability and can be expressed in translational fusion with target proteins without compromising with their properties. Fusion with the lichenase reporter is especially convenient for the heterologous expression of proteins whose analysis is difficult or compromised by host enzyme activities, as it is in case of fatty acid desaturases occurring in all groups of organisms. Recombinant desaturase-lichenase genes can be used for creating genetically modified (GM) plants with improved chill tolerance. Development of an analytical method for detection of fused desaturase-lichenase transgenes is necessary both for production of GM plants and for their certification. Here, we report a multiplex polymerase chain reaction method for detection of desA and desC desaturase genes of cyanobacteria Synechocystis sp. PCC6803 and Synechococcus vulcanus, respectively, fused to licBM3 reporter in GM plants.

Diversity and impact of rare variants in genes encoding the platelet G protein-coupled receptors.

Science.gov (United States)

Jones, Matthew L; Norman, Jane E; Morgan, Neil V; Mundell, Stuart J; Lordkipanidzé, Marie; Lowe, Gillian C; Daly, Martina E; Simpson, Michael A; Drake, Sian; Watson, Steve P; Mumford, Andrew D

2015-04-01

Platelet responses to activating agonists are influenced by common population variants within or near G protein-coupled receptor (GPCR) genes that affect receptor activity. However, the impact of rare GPCR gene variants is unknown. We describe the rare single nucleotide variants (SNVs) in the coding and splice regions of 18 GPCR genes in 7,595 exomes from the 1,000-genomes and Exome Sequencing Project databases and in 31 cases with inherited platelet function disorders (IPFDs). In the population databases, the GPCR gene target regions contained 740 SNVs (318 synonymous, 410 missense, 7 stop gain and 6 splice region) of which 70 % had global minor allele frequency (MAF) < 0.05 %. Functional annotation using six computational algorithms, experimental evidence and structural data identified 156/740 (21 %) SNVs as potentially damaging to GPCR function, most commonly in regions encoding the transmembrane and C-terminal intracellular receptor domains. In 31 index cases with IPFDs (Gi-pathway defect n=15; secretion defect n=11; thromboxane pathway defect n=3 and complex defect n=2) there were 256 SNVs in the target regions of 15 stimulatory platelet GPCRs (34 unique; 12 with MAF< 1 % and 22 with MAF≥ 1 %). These included rare variants predicting R122H, P258T and V207A substitutions in the P2Y12 receptor that were annotated as potentially damaging, but only partially explained the platelet function defects in each case. Our data highlight that potentially damaging variants in platelet GPCR genes have low individual frequencies, but are collectively abundant in the population. Potentially damaging variants are also present in pedigrees with IPFDs and may contribute to complex laboratory phenotypes.

Evolutionary genomics of plant genes encoding N-terminal-TM-C2 domain proteins and the similar FAM62 genes and synaptotagmin genes of metazoans

Directory of Open Access Journals (Sweden)

Craxton Molly

2007-07-01

Full Text Available Abstract Background Synaptotagmin genes are found in animal genomes and are known to function in the nervous system. Genes with a similar domain architecture as well as sequence similarity to synaptotagmin C2 domains have also been found in plant genomes. The plant genes share an additional region of sequence similarity with a group of animal genes named FAM62. FAM62 genes also have a similar domain architecture. Little is known about the functions of the plant genes and animal FAM62 genes. Indeed, many members of the large and diverse Syt gene family await functional characterization. Understanding the evolutionary relationships among these genes will help to realize the full implications of functional studies and lead to improved genome annotation. Results I collected and compared plant Syt-like sequences from the primary nucleotide sequence databases at NCBI. The collection comprises six groups of plant genes conserved in embryophytes: NTMC2Type1 to NTMC2Type6. I collected and compared metazoan FAM62 sequences and identified some similar sequences from other eukaryotic lineages. I found evidence of RNA editing and alternative splicing. I compared the intron patterns of Syt genes. I also compared Rabphilin and Doc2 genes. Conclusion Genes encoding proteins with N-terminal-transmembrane-C2 domain architectures resembling synaptotagmins, are widespread in eukaryotes. A collection of these genes is presented here. The collection provides a resource for studies of intron evolution. I have classified the collection into homologous gene families according to distinctive patterns of sequence conservation and intron position. The evolutionary histories of these gene families are traceable through the appearance of family members in different eukaryotic lineages. Assuming an intron-rich eukaryotic ancestor, the conserved intron patterns distinctive of individual gene families, indicate independent origins of Syt, FAM62 and NTMC2 genes. Resemblances

Statistical Characterization of MP3 Encoders for Steganalysis: ’CHAMP3’

Science.gov (United States)

2004-04-27

compression exceeds those of typical stegano- graphic tools (e. g., LSB image embedding), the availability of commented source codes for MP3 encoders...developed by testing the approach on known and unknown reference data. 15. SUBJECT TERMS EOARD, Steganography , Digital Watermarking...Pages kbps Kilobits per Second LGPL Lesser General Public License LSB Least Significant Bit MB Megabyte MDCT Modified Discrete Cosine Transformation MP3

Gene Disruption in Scedosporium aurantiacum: Proof of Concept with the Disruption of SODC Gene Encoding a Cytosolic Cu,Zn-Superoxide Dismutase.

Science.gov (United States)

Pateau, Victoire; Razafimandimby, Bienvenue; Vandeputte, Patrick; Thornton, Christopher R; Guillemette, Thomas; Bouchara, Jean-Philippe; Giraud, Sandrine

2018-02-01

Scedosporium species are opportunistic pathogens responsible for a large variety of infections in humans. An increasing occurrence was observed in patients with underlying conditions such as immunosuppression or cystic fibrosis. Indeed, the genus Scedosporium ranks the second among the filamentous fungi colonizing the respiratory tracts of the CF patients. To date, there is very scarce information on the pathogenic mechanisms, at least in part because of the limited genetic tools available. In the present study, we successfully developed an efficient transformation and targeted gene disruption approach on the species Scedosporium aurantiacum. The disruption cassette was constructed using double-joint PCR procedure, and resistance to hygromycin B as the selection marker. This proof of concept was performed on the functional gene SODC encoding the Cu,Zn-superoxide dismutase. Disruption of the SODC gene improved susceptibility of the fungus to oxidative stress. This technical advance should open new research areas and help to better understand the biology of Scedosporium species.

Independent losses of visual perception genes Gja10 and Rbp3 in echolocating bats (Order: Chiroptera.

Directory of Open Access Journals (Sweden)

Bin Shen

Full Text Available A trade-off between the sensory modalities of vision and hearing is likely to have occurred in echolocating bats as the sophisticated mechanism of laryngeal echolocation requires considerable neural processing and has reduced the reliance of echolocating bats on vision for perceiving the environment. If such a trade-off exists, it is reasonable to hypothesize that some genes involved in visual function may have undergone relaxed selection or even functional loss in echolocating bats. The Gap junction protein, alpha 10 (Gja10, encoded by Gja10 gene is expressed abundantly in mammal retinal horizontal cells and plays an important role in horizontal cell coupling. The interphotoreceptor retinoid-binding protein (Irbp, encoded by the Rbp3 gene is mainly expressed in interphotoreceptor matrix and is known to be critical for normal functioning of the visual cycle. We sequenced Gja10 and Rbp3 genes in a taxonomically wide range of bats with divergent auditory characteristics (35 and 18 species for Gja10 and Rbp3, respectively. Both genes have became pseudogenes in species from the families Hipposideridae and Rhinolophidae that emit constant frequency echolocation calls with Doppler shift compensation at high-duty-cycles (the most sophisticated form of biosonar known, and in some bat species that emit echolocation calls at low-duty-cycles. Our study thus provides further evidence for the hypothesis that a trade-off occurs at the genetic level between vision and echolocation in bats.

Independent losses of visual perception genes Gja10 and Rbp3 in echolocating bats (Order: Chiroptera).

Science.gov (United States)

Shen, Bin; Fang, Tao; Dai, Mengyao; Jones, Gareth; Zhang, Shuyi

2013-01-01

A trade-off between the sensory modalities of vision and hearing is likely to have occurred in echolocating bats as the sophisticated mechanism of laryngeal echolocation requires considerable neural processing and has reduced the reliance of echolocating bats on vision for perceiving the environment. If such a trade-off exists, it is reasonable to hypothesize that some genes involved in visual function may have undergone relaxed selection or even functional loss in echolocating bats. The Gap junction protein, alpha 10 (Gja10, encoded by Gja10 gene) is expressed abundantly in mammal retinal horizontal cells and plays an important role in horizontal cell coupling. The interphotoreceptor retinoid-binding protein (Irbp, encoded by the Rbp3 gene) is mainly expressed in interphotoreceptor matrix and is known to be critical for normal functioning of the visual cycle. We sequenced Gja10 and Rbp3 genes in a taxonomically wide range of bats with divergent auditory characteristics (35 and 18 species for Gja10 and Rbp3, respectively). Both genes have became pseudogenes in species from the families Hipposideridae and Rhinolophidae that emit constant frequency echolocation calls with Doppler shift compensation at high-duty-cycles (the most sophisticated form of biosonar known), and in some bat species that emit echolocation calls at low-duty-cycles. Our study thus provides further evidence for the hypothesis that a trade-off occurs at the genetic level between vision and echolocation in bats.

Mitochondrially-Encoded Adenosine Triphosphate Synthase 6 Gene Haplotype Variation among World Population during 2003-2013

OpenAIRE

Steven Steven; Yoni F Syukriani; Julius B Dewanto

2016-01-01

Background: Adaptation and natural selection serve as an important part of evolution. Adaptation in molecular level can lead to genetic drift which causes mutation of genetic material; one of which is polymorphism of mitochondrial DNA (mtDNA). The aim of this study is to verify the polymorphism of mitochondrially-encoded Adenosine Triphosphate synthase6gene (MT-ATP6) as one of mtDNA building blocks among tropic, sub-tropic, and polar areas. Methods: This descriptive quantitative research used...

Several genes encoding enzymes with the same activity are necessary for aerobic fungal degradation of cellulose in nature

DEFF Research Database (Denmark)

Busk, Peter Kamp; Lange, Mette; Pilgaard, Bo

2014-01-01

The cellulose-degrading fungal enzymes are glycoside hydrolases of the GH families and lytic polysaccharide monooxygenases. The entanglement of glycoside hydrolase families and functions makes it difficult to predict the enzymatic activity of glycoside hydrolases based on their sequence....... In the present study we further developed the method Peptide Pattern Recognition to an automatic approach not only to find all genes encoding glycoside hydrolases and lytic polysaccharide monooxygenases in fungal genomes but also to predict the function of the genes. The functional annotation is an important...

Gene ercA, encoding a putative iron-containing alcohol dehydrogenase, is involved in regulation of ethanol utilization in Pseudomonas aeruginosa.

Science.gov (United States)

Hempel, Niels; Görisch, Helmut; Mern, Demissew S

2013-09-01

Several two-component regulatory systems are known to be involved in the signal transduction pathway of the ethanol oxidation system in Pseudomonas aeruginosa ATCC 17933. These sensor kinases and response regulators are organized in a hierarchical manner. In addition, a cytoplasmic putative iron-containing alcohol dehydrogenase (Fe-ADH) encoded by ercA (PA1991) has been identified to play an essential role in this regulatory network. The gene ercA (PA1991) is located next to ercS, which encodes a sensor kinase. Inactivation of ercA (PA1991) by insertion of a kanamycin resistance cassette created mutant NH1. NH1 showed poor growth on various alcohols. On ethanol, NH1 grew only with an extremely extended lag phase. During the induction period on ethanol, transcription of structural genes exa and pqqABCDEH, encoding components of initial ethanol oxidation in P. aeruginosa, was drastically reduced in NH1, which indicates the regulatory function of ercA (PA1991). However, transcription in the extremely delayed logarithmic growth phase was comparable to that in the wild type. To date, the involvement of an Fe-ADH in signal transduction processes has not been reported.

Identification of a functional element in the promoter of the silkworm (Bombyx mori) fat body-specific gene Bmlp3.

Science.gov (United States)

Xu, Hanfu; Deng, Dangjun; Yuan, Lin; Wang, Yuancheng; Wang, Feng; Xia, Qingyou

2014-08-01

30K proteins are a group of structurally related proteins that play important roles in the life cycle of the silkworm Bombyx mori and are largely synthesized and regulated in a time-dependent manner in the fat body. Little is known about the upstream regulatory elements associated with the genes encoding these proteins. In the present study, the promoter of Bmlp3, a fat body-specific gene encoding a 30K protein family member, was characterized by joining sequences containing the Bmlp3 promoter with various amounts of 5' upstream sequences to a luciferase reporter gene. The results indicated that the sequences from -150 to -250bp and -597 to -675bp upstream of the Bmlp3 transcription start site were necessary for high levels of luciferase activity. Further analysis showed that a 21-bp sequence located between -230 and -250 was specifically recognized by nuclear factors from silkworm fat bodies and BmE cells, and could enhance luciferase reporter-gene expression 2.8-fold in BmE cells. This study provides new insights into the Bmlp3 promoter and contributes to the further clarification of the function and developmental regulation of Bmlp3. Copyright © 2014. Published by Elsevier B.V.

Impact of the Disruption of ASN3-Encoding Asparagine Synthetase on Arabidopsis Development

Directory of Open Access Journals (Sweden)

Laure Gaufichon

2016-02-01

Full Text Available The aim of this study was to investigate the role of ASN3-encoded asparagine synthetase (AS, EC 6.3.5.4 during vegetative growth, seed development and germination of Arabidopsis thaliana. Phenotypic analysis of knockout (asn3-1 and knockdown (asn3-2 T-DNA insertion mutants for the ASN3 gene (At5g10240 demonstrated wild-type contents of asparagine synthetase protein, chlorophyll and ammonium in green leaves at 35 days after sowing. In situ hybridization localized ASN3 mRNA to phloem companion cells of vasculature. Young siliques of the asn3-1 knockout line showed a decrease in asparagine but an increase in glutamate. The seeds of asn3-1 and asn3-2 displayed a wild-type nitrogen status expressed as total nitrogen content, indicating that the repression of ASN3 expression had only a limited effect on mature seeds. An analysis of amino acid labeling of seeds imbibed with (15N ammonium for 24 h revealed that asn3-1 seeds contained 20% less total asparagine while 15N-labeled asparagine ((2-15Nasparagine, (4-15Nasparagine and (2,4-15Nasparagine increased by 12% compared to wild-type seeds. The data indicate a fine regulation of asparagine synthesis and hydrolysis in Arabidopsis seeds.

Expansion of genes encoding piRNA-associated argonaute proteins in the pea aphid: diversification of expression profiles in different plastic morphs.

Directory of Open Access Journals (Sweden)

Hsiao-Ling Lu

Full Text Available Piwi-interacting RNAs (piRNAs are known to regulate transposon activity in germ cells of several animal models that propagate sexually. However, the role of piRNAs during asexual reproduction remains almost unknown. Aphids that can alternate sexual and asexual reproduction cycles in response to seasonal changes of photoperiod provide a unique opportunity to study piRNAs and the piRNA pathway in both reproductive modes. Taking advantage of the recently sequenced genome of the pea aphid Acyrthosiphon pisum, we found an unusually large lineage-specific expansion of genes encoding the Piwi sub-clade of Argonaute proteins. In situ hybridisation showed differential expressions between the duplicated piwi copies: while Api-piwi2 and Api-piwi6 are "specialised" in germ cells their most closely related copy, respectively Api-piwi5 and Api-piwi3, are expressed in the somatic cells. The differential expression was also identified in duplicated ago3: Api-ago3a in germ cells and Api-ago3b in somatic cells. Moreover, analyses of expression profiles of the expanded piwi and ago3 genes by semi-quantitative RT-PCR showed that expressions varied according to the reproductive types. These specific expression patterns suggest that expanded aphid piwi and ago3 genes have distinct roles in asexual and sexual reproduction.

EWS and FUS bind a subset of transcribed genes encoding proteins enriched in RNA regulatory functions.

Science.gov (United States)

Luo, Yonglun; Blechingberg, Jenny; Fernandes, Ana Miguel; Li, Shengting; Fryland, Tue; Børglum, Anders D; Bolund, Lars; Nielsen, Anders Lade

2015-11-14

FUS (TLS) and EWS (EWSR1) belong to the FET-protein family of RNA and DNA binding proteins. FUS and EWS are structurally and functionally related and participate in transcriptional regulation and RNA processing. FUS and EWS are identified in translocation generated cancer fusion proteins and involved in the human neurological diseases amyotrophic lateral sclerosis and fronto-temporal lobar degeneration. To determine the gene regulatory functions of FUS and EWS at the level of chromatin, we have performed chromatin immunoprecipitation followed by next generation sequencing (ChIP-seq). Our results show that FUS and EWS bind to a subset of actively transcribed genes, that binding often is downstream the poly(A)-signal, and that binding overlaps with RNA polymerase II. Functional examinations of selected target genes identified that FUS and EWS can regulate gene expression at different levels. Gene Ontology analyses showed that FUS and EWS target genes preferentially encode proteins involved in regulatory processes at the RNA level. The presented results yield new insights into gene interactions of EWS and FUS and have identified a set of FUS and EWS target genes involved in pathways at the RNA regulatory level with potential to mediate normal and disease-associated functions of the FUS and EWS proteins.

Impact of agricultural management on bacterial laccase-encoding genes with possible implications for soil carbon storage in semi-arid Mediterranean olive farming

Directory of Open Access Journals (Sweden)

Beatriz Moreno

2016-07-01

Full Text Available Background: In this work, we aimed to gain insights into the contribution of soil bacteria to carbon sequestration in Mediterranean habitats. In particular, we aimed to use bacterial laccase-encoding genes as molecular markers for soil organic C cycling. Using rainfed olive farming as an experimental model, we determined the stability and accumulation levels of humic substances and applied these data to bacterial laccase-encoding gene expression and diversity in soils under four different agricultural management systems (bare soils under tillage/no tillage and vegetation cover under chemical/mechanical management. Materials and Methods: Humic C (> 104 Da was subjected to isoelectric focusing. The GC-MS method was used to analyze aromatic hydrocarbons. Real-Time PCR quantification and denaturing gradient gel electrophoresis (DGGE for functional bacterial laccase-like multicopper oxidase (LMCO-encoding genes and transcripts were also carried out. Results: Soils under spontaneous vegetation, eliminated in springtime using mechanical methods for more than 30 years, showed the highest humic acid levels as well as the largest bacterial population rich in laccase genes and transcripts. The structure of the bacterial community based on LMCO genes also pointed to phylogenetic differences between these soils due to the impact of different management systems. Soils where herbicides were used to eliminate spontaneous vegetation once a year and those where pre-emergence herbicides resulted in bare soils clustered together for DNA-based DGGE analysis, which indicated a certain amount of microbial selection due to the application of herbicides. When LMCO-encoding gene expression was studied, soils where cover vegetation was managed either with herbicides or with mechanical methods showed less than 10% similarity, suggesting that the type of weed management strategy used can impact weed community composition and consequently laccase substrates derived from

Gene encoding a deubiquitinating enzyme is mutated in artesunate- and chloroquine-resistant rodent malaria parasites.

Science.gov (United States)

Hunt, Paul; Afonso, Ana; Creasey, Alison; Culleton, Richard; Sidhu, Amar Bir Singh; Logan, John; Valderramos, Stephanie G; McNae, Iain; Cheesman, Sandra; do Rosario, Virgilio; Carter, Richard; Fidock, David A; Cravo, Pedro

2007-07-01

Artemisinin- and artesunate-resistant Plasmodium chabaudi mutants, AS-ART and AS-ATN, were previously selected from chloroquine-resistant clones AS-30CQ and AS-15CQ respectively. Now, a genetic cross between AS-ART and the artemisinin-sensitive clone AJ has been analysed by Linkage Group Selection. A genetic linkage group on chromosome 2 was selected under artemisinin treatment. Within this locus, we identified two different mutations in a gene encoding a deubiquitinating enzyme. A distinct mutation occurred in each of the clones AS-30CQ and AS-ATN, relative to their respective progenitors in the AS lineage. The mutations occurred independently in different clones under drug selection with chloroquine (high concentration) or artesunate. Each mutation maps to a critical residue in a homologous human deubiquitinating protein structure. Although one mutation could theoretically account for the resistance of AS-ATN to artemisinin derivates, the other cannot account solely for the resistance of AS-ART, relative to the responses of its sensitive progenitor AS-30CQ. Two lines of Plasmodium falciparum with decreased susceptibility to artemisinin were also selected. Their drug-response phenotype was not genetically stable. No mutations in the UBP-1 gene encoding the P. falciparum orthologue of the deubiquitinating enzyme were observed. The possible significance of these mutations in parasite responses to chloroquine or artemisinin is discussed.

Prevalence of the lmo0036-0043 gene cluster encoding arginine deiminase and agmatine deiminase systems in Listeria monocytogenes.

Science.gov (United States)

Chen, Jianshun; Chen, Fan; Cheng, Changyong; Fang, Weihuan

2013-04-01

Arginine deiminase and agmatine deiminase systems are involved in acid tolerance, and their encoding genes form the cluster lmo0036-0043 in Listeria monocytogenes. While lmo0042 and lmo0043 were conserved in all L. monocytogenes strains, the lmo0036-0041 region of this cluster was identified in all lineages I and II, and the majority of lineage IV (83.3%) strains, but absent in all lineage III and a small fraction of lineage IV (16.7%) strains, suggesting that the presence of the complete lmo0036-0043 cluster is dependent on lineages. lmo0036-0043-complete and -deficient lineage IV strains exhibit specific ascB-dapE profiles, which might represent two subpopulations with distinct genetic characteristics.

α/sub i/-3 cDNA encodes the α subunit of G/sub k/, the stimulatory G protein of receptor-regulated K+ channels

International Nuclear Information System (INIS)

Codina, J.; Olate, J.; Abramowitz, J.; Mattera, R.; Cook, R.G.; Birnbaumer, L.

1988-01-01

cDNA cloning has identified the presence in the human genome of three genes encoding α subunits of pertussis toxin substrates, generically called G/sub i/. They are named α/sub i/-1, α/sub i/-2 and α/sub i/-3. However, none of these genes has been functionally identified with any of the α subunits of several possible G proteins, including pertussis toxin-sensitive G/sub p/'s, stimulatory to phospholipase C or A 2 , G/sub i/, inhibitory to adenylyl cyclase, or G/sub k/, stimulatory to a type of K + channels. The authors now report the nucleotide sequence and the complete predicted amino acid sequence of human liver α/sub i/-3 and the partial amino acid sequence of proteolytic fragments of the α subunit of human erythrocyte G/sub k/. The amino acid sequence of the proteolytic fragment is uniquely encoded by the cDNA of α/sub i/-3, thus identifying it as α/sub k/. The probable identity of α/sub i/-1 with α/sub p/ and possible roles for α/sub i/-2, as well as additional roles for α/sub i/-1 and α/sub i/-3 (α/sub k/) are discussed

Several genes encoding enzymes with the same activity are necessary for aerobic fungal degradation of cellulose in nature.

Directory of Open Access Journals (Sweden)

Peter K Busk

Full Text Available The cellulose-degrading fungal enzymes are glycoside hydrolases of the GH families and lytic polysaccharide monooxygenases. The entanglement of glycoside hydrolase families and functions makes it difficult to predict the enzymatic activity of glycoside hydrolases based on their sequence. In the present study we further developed the method Peptide Pattern Recognition to an automatic approach not only to find all genes encoding glycoside hydrolases and lytic polysaccharide monooxygenases in fungal genomes but also to predict the function of the genes. The functional annotation is an important feature as it provides a direct route to predict function from primary sequence. Furthermore, we used Peptide Pattern Recognition to compare the cellulose-degrading enzyme activities encoded by 39 fungal genomes. The results indicated that cellobiohydrolases and AA9 lytic polysaccharide monooxygenases are hallmarks of cellulose-degrading fungi except brown rot fungi. Furthermore, a high number of AA9, endocellulase and β-glucosidase genes were identified, not in what are known to be the strongest, specialized lignocellulose degraders but in saprophytic fungi that can use a wide variety of substrates whereas only few of these genes were found in fungi that have a limited number of natural, lignocellulotic substrates. This correlation suggests that enzymes with different properties are necessary for degradation of cellulose in different complex substrates. Interestingly, clustering of the fungi based on their predicted enzymes indicated that Ascomycota and Basidiomycota use the same enzymatic activities to degrade plant cell walls.

Identification of functional elements and regulatory circuits by Drosophila modENCODE

Energy Technology Data Exchange (ETDEWEB)

Roy, Sushmita; Ernst, Jason; Kharchenko, Peter V.; Kheradpour, Pouya; Negre, Nicolas; Eaton, Matthew L.; Landolin, Jane M.; Bristow, Christopher A.; Ma, Lijia; Lin, Michael F.; Washietl, Stefan; Arshinoff, Bradley I.; Ay, Ferhat; Meyer, Patrick E.; Robine, Nicolas; Washington, Nicole L.; Stefano, Luisa Di; Berezikov, Eugene; Brown, Christopher D.; Candeias, Rogerio; Carlson, Joseph W.; Carr, Adrian; Jungreis, Irwin; Marbach, Daniel; Sealfon, Rachel; Tolstorukov, Michael Y.; Will, Sebastian; Alekseyenko, Artyom A.; Artieri, Carlo; Booth, Benjamin W.; Brooks, Angela N.; Dai, Qi; Davis, Carrie A.; Duff, Michael O.; Feng, Xin; Gorchakov, Andrey A.; Gu, Tingting; Henikoff, Jorja G.; Kapranov, Philipp; Li, Renhua; MacAlpine, Heather K.; Malone, John; Minoda, Aki; Nordman, Jared; Okamura, Katsutomo; Perry, Marc; Powell, Sara K.; Riddle, Nicole C.; Sakai, Akiko; Samsonova, Anastasia; Sandler, Jeremy E.; Schwartz, Yuri B.; Sher, Noa; Spokony, Rebecca; Sturgill, David; van Baren, Marijke; Wan, Kenneth H.; Yang, Li; Yu, Charles; Feingold, Elise; Good, Peter; Guyer, Mark; Lowdon, Rebecca; Ahmad, Kami; Andrews, Justen; Berger, Bonnie; Brenner, Steven E.; Brent, Michael R.; Cherbas, Lucy; Elgin, Sarah C. R.; Gingeras, Thomas R.; Grossman, Robert; Hoskins, Roger A.; Kaufman, Thomas C.; Kent, William; Kuroda, Mitzi I.; Orr-Weaver, Terry; Perrimon, Norbert; Pirrotta, Vincenzo; Posakony, James W.; Ren, Bing; Russell, Steven; Cherbas, Peter; Graveley, Brenton R.; Lewis, Suzanna; Micklem, Gos; Oliver, Brian; Park, Peter J.; Celniker, Susan E.; Henikoff, Steven; Karpen, Gary H.; Lai, Eric C.; MacAlpine, David M.; Stein, Lincoln D.; White, Kevin P.; Kellis, Manolis

2010-12-22

To gain insight into how genomic information is translated into cellular and developmental programs, the Drosophila model organism Encyclopedia of DNA Elements (modENCODE) project is comprehensively mapping transcripts, histone modifications, chromosomal proteins, transcription factors, replication proteins and intermediates, and nucleosome properties across a developmental time course and in multiple cell lines. We have generated more than 700 data sets and discovered protein-coding, noncoding, RNA regulatory, replication, and chromatin elements, more than tripling the annotated portion of the Drosophila genome. Correlated activity patterns of these elements reveal a functional regulatory network, which predicts putative new functions for genes, reveals stage- and tissue-specific regulators, and enables gene-expression prediction. Our results provide a foundation for directed experimental and computational studies in Drosophila and related species and also a model for systematic data integration toward comprehensive genomic and functional annotation. Several years after the complete genetic sequencing of many species, it is still unclear how to translate genomic information into a functional map of cellular and developmental programs. The Encyclopedia of DNA Elements (ENCODE) (1) and model organism ENCODE (modENCODE) (2) projects use diverse genomic assays to comprehensively annotate the Homo sapiens (human), Drosophila melanogaster (fruit fly), and Caenorhabditis elegans (worm) genomes, through systematic generation and computational integration of functional genomic data sets. Previous genomic studies in flies have made seminal contributions to our understanding of basic biological mechanisms and genome functions, facilitated by genetic, experimental, computational, and manual annotation of the euchromatic and heterochromatic genome (3), small genome size, short life cycle, and a deep knowledge of development, gene function, and chromosome biology. The functions

Molecular cloning and functional analysis of the gene encoding ...

African Journals Online (AJOL)

Here we report for the first time the cloning of a full-length cDNA encoding GGPPS (Jc-GGPPS) from Jatropha curcas L. The full-length cDNA was 1414 base pair (bp), with an 1110-bp open reading frame (ORF) encoding a 370- amino-acids polypeptide. Bioinformatic analysis revealed that Jc-GGPPS is a member of the ...

StAR Enhances Transcription of Genes Encoding the Mitochondrial Proteases Involved in Its Own Degradation

Science.gov (United States)

Bahat, Assaf; Perlberg, Shira; Melamed-Book, Naomi; Lauria, Ines; Langer, Thomas

2014-01-01

Steroidogenic acute regulatory protein (StAR) is essential for steroid hormone synthesis in the adrenal cortex and the gonads. StAR activity facilitates the supply of cholesterol substrate into the inner mitochondrial membranes where conversion of the sterol to a steroid is catalyzed. Mitochondrial import terminates the cholesterol mobilization activity of StAR and leads to mounting accumulation of StAR in the mitochondrial matrix. Our studies suggest that to prevent mitochondrial impairment, StAR proteolysis is executed by at least 2 mitochondrial proteases, ie, the matrix LON protease and the inner membrane complexes of the metalloproteases AFG3L2 and AFG3L2:SPG7/paraplegin. Gonadotropin administration to prepubertal rats stimulated ovarian follicular development associated with increased expression of the mitochondrial protein quality control system. In addition, enrichment of LON and AFG3L2 is evident in StAR-expressing ovarian cells examined by confocal microscopy. Furthermore, reporter studies of the protease promoters examined in the heterologous cell model suggest that StAR expression stimulates up to a 3.5-fold increase in the protease gene transcription. Such effects are StAR-specific, are independent of StAR activity, and failed to occur upon expression of StAR mutants that do not enter the matrix. Taken together, the results of this study suggest the presence of a novel regulatory loop, whereby acute accumulation of an apparent nuisance protein in the matrix provokes a mitochondria to nucleus signaling that, in turn, activates selected transcription of genes encoding the enrichment of mitochondrial proteases relevant for enhanced clearance of StAR. PMID:24422629

Genes involved in meso-diaminopimelate synthesis in Bacillus subtilis: identification of the gene encoding aspartokinase I.

Science.gov (United States)

Roten, C A; Brandt, C; Karamata, D

1991-04-01

Thermosensitive mutants of Bacillus subtilis deficient in peptidoglycan synthesis were screened for mutations in the meso-diaminopimelate (LD-A2pm) metabolic pathway. Mutations in two out of five relevant linkage groups, lssB and lssD, were shown to induce, at the restrictive temperature, a deficiency in LD-A2pm synthesis and accumulation of UDP-MurNAc-dipeptide. Group lssB is heterogeneous; it encompasses mutations that confer deficiency in the deacylation of N-acetyl-LL-A2pm and accumulation of this precursor. Accordingly, these mutations are assigned to the previously identified locus dapE. Mutations in linkage group lssD entail a thermosensitive aspartokinase 1. Therefore, they are most likely to affect the structural gene of this enzyme, which we propose to designate dapG. Mutation pyc-1476, previously reported to affect the pyruvate carboxylase, was shown to confer a deficiency in aspartokinase 1, not in the carboxylase, and to belong to the dapG locus, dapG is closely linked to spoVF, the putative gene of dipicolinate synthase. In conclusion, mutations affecting only two out of eight steps known to be involved in LD-A2pm synthesis were uncovered in a large collection of thermosensitive mutants obtained by indirect selection. We propose that this surprisingly restricted distribution of the thermosensitive dap mutations isolated so far is due to the existence, in each step of the pathway, of isoenzymes encoded by separate genes. The biological role of different aspartokinases was investigated with mutants deficient in dapE and dapG genes. Growth characteristics of these mutants in the presence of various combinations of aspartate family amino acids allow a reassessment of a metabolic channel hypothesis, i.e. the proposed existence of multienzyme complexes, each specific for a given end product.

The Pseudomonas aeruginosa pirA gene encodes a second receptor for ferrienterobactin and synthetic catecholate analogues.

Science.gov (United States)

Ghysels, Bart; Ochsner, Urs; Möllman, Ute; Heinisch, Lothar; Vasil, Michael; Cornelis, Pierre; Matthijs, Sandra

2005-05-15

Actively secreted iron chelating agents termed siderophores play an important role in the virulence and rhizosphere competence of fluorescent pseudomonads, including Pseudomonas aeruginosa which secretes a high affinity siderophore, pyoverdine, and the low affinity siderophore, pyochelin. Uptake of the iron-siderophore complexes is an active process that requires specific outer membrane located receptors, which are dependent of the inner membrane-associated protein TonB and two other inner membrane proteins, ExbB and ExbC. P. aeruginosa is also capable of using a remarkable variety of heterologous siderophores as sources of iron, apparently by expressing their cognate receptors. Illustrative of this feature are the 32 (of which 28 putative) siderophore receptor genes observed in the P. aeruginosa PAO1 genome. However, except for a few (pyoverdine, pyochelin, enterobactin), the vast majority of P. aeruginosa siderophore receptor genes still remain to be characterized. Ten synthetic iron chelators of catecholate type stimulated growth of a pyoverdine/pyochelin deficient P. aeruginosa PAO1 mutant under condition of severe iron limitation. Null mutants of the 32 putative TonB-dependent siderophore receptor encoding genes engineered in the same genetic background were screened for obvious deficiencies in uptake of the synthetic siderophores, but none showed decreased growth stimulation in the presence of the different siderophores. However, a double knock-out mutant of ferrienterobactin receptor encoding gene pfeA (PA 2688) and pirA (PA0931) failed to be stimulated by 4 of the tested synthetic catecholate siderophores whose chemical structures resemble enterobactin. Ferric-enterobactin also failed to stimulate growth of the double pfeA-pirA mutant although, like its synthetic analogues, it stimulated growth of the corresponding single mutants. Hence, we confirmed that pirA represents a second P. aeruginosa ferric-enterobactin receptor. The example of these two

Extensive diversification of IgD-, IgY-, and truncated IgY(δFc)-encoding genes in the red-eared turtle (Trachemys scripta elegans).

Science.gov (United States)

Li, Lingxiao; Wang, Tao; Sun, Yi; Cheng, Gang; Yang, Hui; Wei, Zhiguo; Wang, Ping; Hu, Xiaoxiang; Ren, Liming; Meng, Qingyong; Zhang, Ran; Guo, Ying; Hammarström, Lennart; Li, Ning; Zhao, Yaofeng

2012-10-15

IgY(ΔFc), containing only CH1 and CH2 domains, is expressed in the serum of some birds and reptiles, such as ducks and turtles. The duck IgY(ΔFc) is produced by the same υ gene that expresses the intact IgY form (CH1-4) using different transcriptional termination sites. In this study, we show that intact IgY and IgY(ΔFc) are encoded by distinct genes in the red-eared turtle (Trachemys scripta elegans). At least eight IgY and five IgY(ΔFc) transcripts were found in a single turtle. Together with Southern blotting, our data suggest that multiple genes encoding both IgY forms are present in the turtle genome. Both of the IgY forms were detected in the serum using rabbit polyclonal Abs. In addition, we show that multiple copies of the turtle δ gene are present in the genome and that alternative splicing is extensively involved in the generation of both the secretory and membrane-bound forms of the IgD H chain transcripts. Although a single μ gene was identified, the α gene was not identified in this species.

Composting-Like Conditions Are More Efficient for Enrichment and Diversity of Organisms Containing Cellulase-Encoding Genes than Submerged Cultures.

Directory of Open Access Journals (Sweden)

Senta Heiss-Blanquet

Full Text Available Cost-effective biofuel production from lignocellulosic biomass depends on efficient degradation of the plant cell wall. One of the major obstacles for the development of a cost-efficient process is the lack of resistance of currently used fungal enzymes to harsh conditions such as high temperature. Adapted, thermophilic microbial communities provide a huge reservoir of potentially interesting lignocellulose-degrading enzymes for improvement of the cellulose hydrolysis step. In order to identify such enzymes, a leaf and wood chip compost was enriched on a mixture of thermo-chemically pretreated wheat straw, poplar and Miscanthus under thermophile conditions, but in two different set-ups. Unexpectedly, metagenome sequencing revealed that incubation of the lignocellulosic substrate with compost as inoculum in a suspension culture resulted in an impoverishment of putative cellulase- and hemicellulase-encoding genes. However, mimicking composting conditions without liquid phase yielded a high number and diversity of glycoside hydrolase genes and an enrichment of genes encoding cellulose binding domains. These identified genes were most closely related to species from Actinobacteria, which seem to constitute important players of lignocellulose degradation under the applied conditions. The study highlights that subtle changes in an enrichment set-up can have an important impact on composition and functions of the microcosm. Composting-like conditions were found to be the most successful method for enrichment in species with high biomass degrading capacity.

A common FGFR3 gene mutation is present in achondroplasia but not in hypochondroplasia

Energy Technology Data Exchange (ETDEWEB)

Stoilov, I.; Kilpatrick, M.W.; Tsipouras, P. [Univ. of Connecticut Health Center, Farmington, CT (United States)

1995-01-02

Achondroplasia is the most common type of genetic dwarfism. It is characterized by disproportionate short stature and other skeletal anomalies resulting from a defect in the maturation of the chondrocytes in the growth plate of the cartilage. Recent studies mapped the achondroplasia gene on chromosome region 4p16.3 and identified a common mutation in the gene encoding the fibroblast growth factor receptor 3 (FGFR3). In an analysis of 19 achondroplasia families from a variety of ethnic backgrounds we confirmed the presence of the G380R mutation in 21 of 23 achondroplasia chromosomes studied. In contrast, the G380R mutation was not found in any of the 8 hypochondroplasia chromosomes studied. Futhermore, linkage studies in a 3-generation family with hypochondroplasia show discordant segregation with markers in the 4p16.3 region suggesting that at least some cases of hypochondroplasia are caused by mutations in a gene other than FGFR3. 27 refs., 2 figs.

Differential evolution of antiretroviral restriction factors in pteropid bats as revealed by APOBEC3 gene complexity.

Science.gov (United States)

Hayward, Joshua A; Tachedjian, Mary; Cui, Jie; Cheng, Adam Z; Johnson, Adam; Baker, Michelle; Harris, Reuben S; Wang, Lin-Fa; Tachedjian, Gilda

2018-03-29

Bats have attracted attention in recent years as important reservoirs of viruses deadly to humans and other mammals. These infections are typically nonpathogenic in bats raising questions about innate immune differences that might exist between bats and other mammals. The APOBEC3 gene family encodes antiviral DNA cytosine deaminases with important roles in the suppression of diverse viruses and genomic parasites. Here we characterize pteropid APOBEC3 genes and show that species within the genus Pteropus possess the largest and most diverse array of APOBEC3 genes identified in any mammal reported to date. Several bat APOBEC3 proteins are antiviral as demonstrated by restriction of retroviral infectivity using HIV-1 as a model, and recombinant A3Z1 subtypes possess strong DNA deaminase activity. These genes represent the first group of antiviral restriction factors identified in bats with extensive diversification relative to homologues in other mammals.

The Fdb3 transcription factor of the Fusarium Detoxification of Benzoxazolinone gene cluster is required for MBOA but not BOA degradation in Fusarium pseudograminearum.

Science.gov (United States)

Kettle, Andrew J; Carere, Jason; Batley, Jacqueline; Manners, John M; Kazan, Kemal; Gardiner, Donald M

2016-03-01

A number of cereals produce the benzoxazolinone class of phytoalexins. Fusarium species pathogenic towards these hosts can typically degrade these compounds via an aminophenol intermediate, and the ability to do so is encoded by a group of genes found in the Fusarium Detoxification of Benzoxazolinone (FDB) cluster. A zinc finger transcription factor encoded by one of the FDB cluster genes (FDB3) has been proposed to regulate the expression of other genes in the cluster and hence is potentially involved in benzoxazolinone degradation. Herein we show that Fdb3 is essential for the ability of Fusarium pseudograminearum to efficiently detoxify the predominant wheat benzoxazolinone, 6-methoxy-benzoxazolin-2-one (MBOA), but not benzoxazoline-2-one (BOA). Furthermore, additional genes thought to be part of the FDB gene cluster, based upon transcriptional response to benzoxazolinones, are regulated by Fdb3. However, deletion mutants for these latter genes remain capable of benzoxazolinone degradation, suggesting that they are not essential for this process. Crown Copyright © 2016. Published by Elsevier Inc. All rights reserved.

Mitochondrial and cytoplasmic isoleucyl-, glutamyl- and arginyl-tRNA synthetases of yeast are encoded by separate genes.

Science.gov (United States)

Tzagoloff, A; Shtanko, A

1995-06-01

Three complementation groups of a pet mutant collection have been found to be composed of respiratory-deficient deficient mutants with lesions in mitochondrial protein synthesis. Recombinant plasmids capable of restoring respiration were cloned by transformation of representatives of each complementation group with a yeast genomic library. The plasmids were used to characterize the complementing genes and to institute disruption of the chromosomal copies of each gene in respiratory-proficient yeast. The sequences of the cloned genes indicate that they code for isoleucyl-, arginyl- and glutamyl-tRNA synthetases. The properties of the mutants used to obtain the genes and of strains with the disrupted genes indicate that all three aminoacyl-tRNA synthetases function exclusively in mitochondrial proteins synthesis. The ISM1 gene for mitochondrial isoleucyl-tRNA synthetase has been localized to chromosome XVI next to UME5. The MSR1 gene for the arginyl-tRNA synthetase was previously located on yeast chromosome VIII. The third gene MSE1 for the mitochondrial glutamyl-tRNA synthetase has not been localized. The identification of three new genes coding for mitochondrial-specific aminoacyl-tRNA synthetases indicates that in Saccharomyces cerevisiae at least 11 members of this protein family are encoded by genes distinct from those coding for the homologous cytoplasmic enzymes.

The L locus, one of complementary genes required for anthocyanin production in onions (Allium cepa), encodes anthocyanidin synthase.

Science.gov (United States)

Kim, Sunggil; Jones, Rick; Yoo, Kil-Sun; Pike, Leonard M

2005-06-01

Bulb color in onions (Allium cepa) is an important trait, but its complex, unclear mechanism of inheritance has been a limiting factor in onion cultivar improvement. The identity of the L locus, which is involved in the color difference between Brazilian yellow and red onions, is revealed in this study. A cross was made between a US-type yellow breeding line and a Brazilian yellow cultivar. The segregation ratio of nine red to seven yellow onions in the F(2) population supports the involvement of two complementary genes in anthocyanin production in the F(1) hybrids. The high-performance liquid chromatography (HPLC) and reverse-transcriptase (RT)-PCR analysis of the Brazilian yellow onions indicated that the genes are involved late in the anthocyanin synthesis pathway. The genomic sequence of the anthocyanidin synthase (ANS) gene in Brazilian yellow onions showed a point mutation, which results in an amino acid change of a glycine to an arginine at residue 229. Because this residue is located adjacent to a highly conserved iron-binding active site, this mutation is likely responsible for the inactivation of the ANS gene in Brazilian yellow onions. Following the isolation of the promoter sequence of the mutant allele, a PCR-based marker for allelic selection of the ANS gene was designed. This assay is based on an insertion (larger than 3 kb) mutation. The marker perfectly co-segregated with the color phenotypes in the F(2) populations, thereby indicating that the L locus encodes ANS.

Hypermutability of CpG dinucleotides in the propeptide-encoding sequence of the human albumin gene

International Nuclear Information System (INIS)

Brennan, S.O.; Peach, R.; Myles, T.; George, P.; Arai, Kunio; Madison, J.; Watkins, S.; Putnam, F.W.; Laurell, C.B.; Galliano, M.

1990-01-01

An electrophoretically slow albumin variant was detected with a phenotype frequency of about 1:1,000 in Sweden and was also found in a family of Scottish descent from Kaikoura, New Zealand, and in five families in Tradate, Italy. Structural study established that the major variant component was arginyl-albumin, in which arginine at the -1 position of the propeptide is still attached to the processed albumin. A minor component with the amino-terminal sequence of proalbumin was also present as 3-6% of the total albumin. After amplification of the gene segment encoding the prepro sequence of albumin, specific hybridization of DNA to an oligonucleotide probe encoding cysteine at position -2 indicated the mutation of arginine at the -2 position to cysteine (-2 Arg → Cys). This produced the propeptide sequence Arg-Gly-Val-Phe-Cys-Arg. This was confirmed by sequence analysis after pyridylethylation of the cysteine. This mutation produces an alternate signal peptidase cleavage site in the variant proalbumin precursor of arginyl-albumin giving rise to two possible products, arginyl-albumin and the variant proalbumin. Another plasma from Bremen had an alloalbumin with a previously described substitution (1 Asp → Val), which also affects propeptide cleavage. Hypermutability of two CpG dinucleotides in the codons for the diarginyl sequence may account for the frequency of mutations in the propeptide. Mutation at these two sites results in a series of recurrent proalbumin variants that have arisen independently in diverse populations

Overproduction of lactimidomycin by cross-overexpression of genes encoding Streptomyces antibiotic regulatory proteins.

Science.gov (United States)

Zhang, Bo; Yang, Dong; Yan, Yijun; Pan, Guohui; Xiang, Wensheng; Shen, Ben

2016-03-01

The glutarimide-containing polyketides represent a fascinating class of natural products that exhibit a multitude of biological activities. We have recently cloned and sequenced the biosynthetic gene clusters for three members of the glutarimide-containing polyketides-iso-migrastatin (iso-MGS) from Streptomyces platensis NRRL 18993, lactimidomycin (LTM) from Streptomyces amphibiosporus ATCC 53964, and cycloheximide (CHX) from Streptomyces sp. YIM56141. Comparative analysis of the three clusters identified mgsA and chxA, from the mgs and chx gene clusters, respectively, that were predicted to encode the PimR-like Streptomyces antibiotic regulatory proteins (SARPs) but failed to reveal any regulatory gene from the ltm gene cluster. Overexpression of mgsA or chxA in S. platensis NRRL 18993, Streptomyces sp. YIM56141 or SB11024, and a recombinant strain of Streptomyces coelicolor M145 carrying the intact mgs gene cluster has no significant effect on iso-MGS or CHX production, suggesting that MgsA or ChxA regulation may not be rate-limiting for iso-MGS and CHX production in these producers. In contrast, overexpression of mgsA or chxA in S. amphibiosporus ATCC 53964 resulted in a significant increase in LTM production, with LTM titer reaching 106 mg/L, which is five-fold higher than that of the wild-type strain. These results support MgsA and ChxA as members of the SARP family of positive regulators for the iso-MGS and CHX biosynthetic machinery and demonstrate the feasibility to improve glutarimide-containing polyketide production in Streptomyces strains by exploiting common regulators.

DNA sequence variants in PPARGC1A, a gene encoding a coactivator of the ω-3 LCPUFA sensing PPAR-RXR transcription complex, are associated with NV AMD and AMD-associated loci in genes of complement and VEGF signaling pathways.

Directory of Open Access Journals (Sweden)

John Paul SanGiovanni

Full Text Available Increased intake of ω-3 long-chain polyunsaturated fatty acids (LCPUFAs and use of peroxisome proliferator activator receptor (PPAR-activating drugs are associated with attenuation of pathologic retinal angiogenesis. ω-3 LCPUFAs are endogenous agonists of PPARs. We postulated that DNA sequence variation in PPAR gamma (PPARG co-activator 1 alpha (PPARGC1A, a gene encoding a co-activator of the LCPUFA-sensing PPARG-retinoid X receptor (RXR transcription complex, may influence neovascularization (NV in age-related macular degeneration (AMD.We applied exact testing methods to examine distributions of DNA sequence variants in PPARGC1A for association with NV AMD and interaction of AMD-associated loci in genes of complement, lipid metabolism, and VEGF signaling systems. Our sample contained 1858 people from 3 elderly cohorts of western European ancestry. We concurrently investigated retinal gene expression profiles in 17-day-old neonatal mice on a 2% LCPUFA feeding paradigm to identify LCPUFA-regulated genes both associated with pathologic retinal angiogenesis and known to interact with PPARs or PPARGC1A.A DNA coding variant (rs3736265 and a 3'UTR-resident regulatory variant (rs3774923 in PPARGC1A were independently associated with NV AMD (exact P = 0.003, both SNPs. SNP-SNP interactions existed for NV AMD (P<0.005 with rs3736265 and a AMD-associated variant in complement factor B (CFB, rs512559. PPARGC1A influences activation of the AMD-associated complement component 3 (C3 promoter fragment and CFB influences activation and proteolysis of C3. We observed interaction (P ≤ 0.003 of rs3736265 with a variant in vascular endothelial growth factor A (VEGFA, rs3025033, a key molecule in retinal angiogenesis. Another PPARGC1A coding variant (rs8192678 showed statistical interaction with a SNP in the VEGFA receptor fms-related tyrosine kinase 1 (FLT1, rs10507386; P ≤ 0.003. C3 expression was down-regulated 2-fold in retinas of ω-3 LCPUFA-fed mice

DNA sequence variants in PPARGC1A, a gene encoding a coactivator of the ω-3 LCPUFA sensing PPAR-RXR transcription complex, are associated with NV AMD and AMD-associated loci in genes of complement and VEGF signaling pathways.

Science.gov (United States)

SanGiovanni, John Paul; Chen, Jing; Sapieha, Przemyslaw; Aderman, Christopher M; Stahl, Andreas; Clemons, Traci E; Chew, Emily Y; Smith, Lois E H

2013-01-01

Increased intake of ω-3 long-chain polyunsaturated fatty acids (LCPUFAs) and use of peroxisome proliferator activator receptor (PPAR)-activating drugs are associated with attenuation of pathologic retinal angiogenesis. ω-3 LCPUFAs are endogenous agonists of PPARs. We postulated that DNA sequence variation in PPAR gamma (PPARG) co-activator 1 alpha (PPARGC1A), a gene encoding a co-activator of the LCPUFA-sensing PPARG-retinoid X receptor (RXR) transcription complex, may influence neovascularization (NV) in age-related macular degeneration (AMD). We applied exact testing methods to examine distributions of DNA sequence variants in PPARGC1A for association with NV AMD and interaction of AMD-associated loci in genes of complement, lipid metabolism, and VEGF signaling systems. Our sample contained 1858 people from 3 elderly cohorts of western European ancestry. We concurrently investigated retinal gene expression profiles in 17-day-old neonatal mice on a 2% LCPUFA feeding paradigm to identify LCPUFA-regulated genes both associated with pathologic retinal angiogenesis and known to interact with PPARs or PPARGC1A. A DNA coding variant (rs3736265) and a 3'UTR-resident regulatory variant (rs3774923) in PPARGC1A were independently associated with NV AMD (exact P = 0.003, both SNPs). SNP-SNP interactions existed for NV AMD (Pcomplement factor B (CFB, rs512559). PPARGC1A influences activation of the AMD-associated complement component 3 (C3) promoter fragment and CFB influences activation and proteolysis of C3. We observed interaction (P ≤ 0.003) of rs3736265 with a variant in vascular endothelial growth factor A (VEGFA, rs3025033), a key molecule in retinal angiogenesis. Another PPARGC1A coding variant (rs8192678) showed statistical interaction with a SNP in the VEGFA receptor fms-related tyrosine kinase 1 (FLT1, rs10507386; P ≤ 0.003). C3 expression was down-regulated 2-fold in retinas of ω-3 LCPUFA-fed mice - these animals also showed 70% reduction in retinal NV (P �

The Aspergillus niger faeB gene encodes a second feruloyl esterase involved in pectin and xylan degradation and is specifically induced in the presence of aromatic compounds.

Science.gov (United States)

de Vries, Ronald P; vanKuyk, Patricia A; Kester, Harry C M; Visser, Jaap

2002-04-15

The faeB gene encoding a second feruloyl esterase from Aspergillus niger has been cloned and characterized. It consists of an open reading frame of 1644 bp containing one intron. The gene encodes a protein of 521 amino acids that has sequence similarity to that of an Aspergillus oryzae tannase. However, the encoded enzyme, feruloyl esterase B (FAEB), does not have tannase activity. Comparison of the physical characteristics and substrate specificity of FAEB with those of a cinnamoyl esterase from A. niger [Kroon, Faulds and Williamson (1996) Biotechnol. Appl. Biochem. 23, 255-262] suggests that they are in fact the same enzyme. The expression of faeB is specifically induced in the presence of certain aromatic compounds, but not in the presence of other constituents present in plant-cell-wall polysaccharides such as arabinoxylan or pectin. The expression profile of faeB in the presence of aromatic compounds was compared with the expression of A. niger faeA, encoding feruloyl esterase A (FAEA), and A. niger bphA, the gene encoding a benzoate-p-hydroxylase. All three genes have different subsets of aromatic compounds that induce their expression, indicating the presence of different transcription activating systems in A. niger that respond to aromatic compounds. Comparison of the activity of FAEA and FAEB on sugar-beet pectin and wheat arabinoxylan demonstrated that they are both involved in the degradation of both polysaccharides, but have opposite preferences for these substrates. FAEA is more active than FAEB towards wheat arabinoxylan, whereas FAEB is more active than FAEA towards sugar-beet pectin.

CLAVATA3-like genes are differentially expressed in grape vine (Vitis vinifera) tissues.

Science.gov (United States)

Tominaga-Wada, Rumi; Nukumizu, Yuka; Wada, Takuji; Sawa, Shinichiro; Tetsumura, Takuya

2013-10-15

The CLAVATA3 (CLV3)/endosperm surrounding region [(ESR) CLE] peptides function as intercellular signaling molecules that regulate various physiological and developmental processes in diverse plant species. We identified five CLV3-like genes from grape vine (Vitis vinifera var. Pinot Noir): VvCLE 6, VvCLE 25-1, VvCLE 25-2, VvCLE 43 and VvCLE TDIF. These CLV3-like genes encode short proteins containing 43-128 amino acids. Except VvCLE TDIF, grape vine CLV3-like proteins possess a consensus amino acid sequence known as the CLE domain. Phylogenic analysis suggests that the VvCLE 6, VvCLE25-1, VvCLE25-2 and VvCLE43 genes have evolved from a single common ancestor to the Arabidopsis CLV3 gene. Expression analyses showed that the five grape CLV3-like genes are expressed in leaves, stems, roots and axillary buds with significant differences in their levels of expression. For example, while all of them were strongly expressed in axillary buds, VvCLE6 and VvCLE43 expression prevailed in roots, and VvCLE25-1, VvCLE25-2 and VvCLE TDIF expression in stems. The differential expression of the five grape CLV3-like peptides suggests that they play different roles in different organs and developmental stages. Copyright © 2013 Elsevier GmbH. All rights reserved.

Determination of ploidy level and isolation of genes encoding acetyl-CoA carboxylase in Japanese Foxtail (Alopecurus japonicus.

Directory of Open Access Journals (Sweden)

Hongle Xu

Full Text Available Ploidy level is important in biodiversity studies and in developing strategies for isolating important plant genes. Many herbicide-resistant weed species are polyploids, but our understanding of these polyploid weeds is limited. Japanese foxtail, a noxious agricultural grass weed, has evolved herbicide resistance. However, most studies on this weed have ignored the fact that there are multiple copies of target genes. This may complicate the study of resistance mechanisms. Japanese foxtail was found to be a tetraploid by flow cytometer and chromosome counting, two commonly used methods in the determination of ploidy levels. We found that there are two copies of the gene encoding plastidic acetyl-CoA carboxylase (ACCase in Japanese foxtail and all the homologous genes are expressed. Additionally, no difference in ploidy levels or ACCase gene copy numbers was observed between an ACCase-inhibiting herbicide-resistant and a herbicide-sensitive population in this study.

Replication of alfalfa mosaic virus RNA 3 with movement and coat protein genes replaced by corresponding genes of Prunus necrotic ringspot ilarvirus.

Science.gov (United States)

Sánchez-Navarro, J A; Reusken, C B; Bol, J F; Pallás, V

1997-12-01

Alfalfa mosaic virus (AMV) and Prunus necrotic ringspot virus (PNRSV) are tripartite positive-strand RNA plant viruses that encode functionally similar translation products. Although the two viruses are phylogenetically closely related, they infect a very different range of natural hosts. The coat protein (CP) gene, the movement protein (MP) gene or both genes in AMV RNA 3 were replaced by the corresponding genes of PNRSV. The chimeric viruses were tested for heterologous encapsidation, replication in protoplasts from plants transformed with AMV replicase genes P1 and P2 (P12 plants) and for cell-to-cell transport in P12 plants. The chimeric viruses exhibited basic competence for encapsidation and replication in P12 protoplasts and for a low level of cell-to-cell movement in P12 plants. The potential involvement of the MP gene in determining host specificity in ilarviruses is discussed.

Structural and functional diversity of CLAVATA3/ESR (CLE)-like genes from the potato cyst nematode Globodera rostochiensis.

Science.gov (United States)

Lu, Shun-Wen; Chen, Shiyan; Wang, Jianying; Yu, Hang; Chronis, Demosthenis; Mitchum, Melissa G; Wang, Xiaohong

2009-09-01

Plant CLAVATA3/ESR-related (CLE) peptides have diverse roles in plant growth and development. Here, we report the isolation and functional characterization of five new CLE genes from the potato cyst nematode Globodera rostochiensis. Unlike typical plant CLE peptides that contain a single CLE motif, four of the five Gr-CLE genes encode CLE proteins with multiple CLE motifs. These Gr-CLE genes were found to be specifically expressed within the dorsal esophageal gland cell of nematode parasitic stages, suggesting a role for their encoded proteins in plant parasitism. Overexpression phenotypes of Gr-CLE genes in Arabidopsis mimicked those of plant CLE genes, and Gr-CLE proteins could rescue the Arabidopsis clv3-2 mutant phenotype when expressed within meristems. A short root phenotype was observed when synthetic GrCLE peptides were exogenously applied to roots of Arabidopsis or potato similar to the overexpression of Gr-CLE genes in Arabidopsis and potato hairy roots. These results reveal that G. rostochiensis CLE proteins with either single or multiple CLE motifs function similarly to plant CLE proteins and that CLE signaling components are conserved in both Arabidopsis and potato roots. Furthermore, our results provide evidence to suggest that the evolution of multiple CLE motifs may be an important mechanism for generating functional diversity in nematode CLE proteins to facilitate parasitism.

The gene encoding the melanin-concentrating hormone receptor 1 is associated with schizophrenia in a Danish case-control sample

DEFF Research Database (Denmark)

Demontis, Ditte; Nyegaard, Mette; Christensen, Jane H

2012-01-01

OBJECTIVE: The MCHR1 gene encoding the melanin-concentrating hormone receptor 1 is located on chromosome 22q13.2 and has previously been associated with schizophrenia in a study of cases and controls from the Faroe Islands and Scotland. Herein we report an association between variations in the MCHR...

Gene encoding gamma-carbonic anhydrase is cotranscribed with argC and induced in response to stationary phase and high CO2 in Azospirillum brasilense Sp7.

Science.gov (United States)

Kaur, Simarjot; Mishra, Mukti N; Tripathi, Anil K

2010-07-04

Carbonic anhydrase (CA) is a ubiquitous enzyme catalyzing the reversible hydration of CO2 to bicarbonate, a reaction underlying diverse biochemical and physiological processes. Gamma class carbonic anhydrases (gamma-CAs) are widespread in prokaryotes but their physiological roles remain elusive. At present, only gamma-CA of Methanosarcina thermophila (Cam) has been shown to have CA activity. Genome analysis of a rhizobacterium Azospirillum brasilense, revealed occurrence of ORFs encoding one beta-CA and two gamma-CAs. One of the putative gamma-CA encoding genes of A. brasilense was cloned and overexpressed in E. coli. Electrometric assays for CA activity of the whole cell extracts overexpressing recombinant GCA1 did not show CO2 hydration activity. Reverse transcription-PCR analysis indicated that gca1 in A. brasilense is co-transcribed with its upstream gene annotated as argC, which encodes a putative N-acetyl-gamma-glutamate-phosphate reductase. 5'-RACE also demonstrated that there was no transcription start site between argC and gca1, and the transcription start site located upstream of argC transcribed both the genes (argC-gca1). Using transcriptional fusions of argC-gca1 upstream region with promoterless lacZ, we further demonstrated that gca1 upstream region did not have any promoter and its transcription occurred from a promoter located in the argC upstream region. The transcription of argC-gca1 operon was upregulated in stationary phase and at elevated CO2 atmosphere. This study shows lack of CO2 hydration activity in a recombinant protein expressed from a gene predicted to encode a gamma-carbonic anhydrase in A. brasilense although it cross reacts with anti-Cam antibody raised against a well characterized gamma-CA. The organization and regulation of this gene along with the putative argC gene suggests its involvement in arginine biosynthetic pathway instead of the predicted CO2 hydration.

Isolation and characterization of the human parathyroid hormone-like peptide gene

International Nuclear Information System (INIS)

Mangin, M.; Ikeda, K.; Dreyer, B.E.; Broadus, A.E.

1989-01-01

A parathyroid hormone-like peptide (PTH-LP) has recently been identified in human tumors associated with the syndrome of humoral hypercalcemia of malignancy. The peptide appears to be encoded by a single-copy gene that gives rise to multiple mRNAs that are heterogeneous at both their 5' and their 3' ends. Alternative RNA splicing is responsible for the 3' heterogeneity and results in mRNAs encoding three different peptides, each with a unique C terminus. The authors have isolated and characterized the human PTHLP gene. The gene is a complex transcriptional unit spanning more than 12 kilobases of DNA and containing six exons. Two 5' exons encode distinct 5' untranslated regions and are separated by a putative promoter element, indicating that the gene either has two promoters or is alternatively spliced from a single promoter upstream of the first exon. The middle portion of the PTHLP gene, comprising exons 2-4, has an organizational pattern of introns and exons identical to that of the parathyroid hormone gene, consistent with a common ancestral origin of these two genes. Exon 4 of the PTHLP gene encodes the region common to all three peptides and the C terminus of the shortest peptide, and exons 5 and 6 encode the unique C termini of the other two peptides. Northern analysis of mRNAs from four human tumors of different histological types reveals the preferential use of 3' splicing patterns of individual tumors

Safety profile, efficacy, and biodistribution of a bicistronic high-capacity adenovirus vector encoding a combined immunostimulation and cytotoxic gene therapy as a prelude to a phase I clinical trial for glioblastoma

Energy Technology Data Exchange (ETDEWEB)

Puntel, Mariana [Department of Neurosurgery, The University of Michigan School of Medicine, MSRB II, RM 4570C, 1150 West Medical Center Drive, Ann Arbor, MI 48109-5689 (United States); Department of Cell and Developmental Biology, The University of Michigan School of Medicine, MSRB II, RM 4570C, 1150 West Medical Center Drive, Ann Arbor, MI 48109-5689 (United States); Gene Therapeutics Research Institute, Cedars-Sinai Medical Center, Los Angeles, CA 90048 (United States); Ghulam, Muhammad A.K.M. [Gene Therapeutics Research Institute, Cedars-Sinai Medical Center, Los Angeles, CA 90048 (United States); Farrokhi, Catherine [Department of Psychiatry and Behavioral Neurosciences, Cedars Sinai Medical Center, Los Angeles, CA 90048 (United States); VanderVeen, Nathan; Paran, Christopher; Appelhans, Ashley [Department of Neurosurgery, The University of Michigan School of Medicine, MSRB II, RM 4570C, 1150 West Medical Center Drive, Ann Arbor, MI 48109-5689 (United States); Department of Cell and Developmental Biology, The University of Michigan School of Medicine, MSRB II, RM 4570C, 1150 West Medical Center Drive, Ann Arbor, MI 48109-5689 (United States); Kroeger, Kurt M.; Salem, Alireza [Gene Therapeutics Research Institute, Cedars-Sinai Medical Center, Los Angeles, CA 90048 (United States); Lacayo, Liliana [Department of Psychiatry and Behavioral Neurosciences, Cedars Sinai Medical Center, Los Angeles, CA 90048 (United States); Pechnick, Robert N. [Department of Psychiatry and Behavioral Neurosciences, Cedars Sinai Medical Center, Los Angeles, CA 90048 (United States); Department of Psychiatry and Behavioral Neurosciences, David Geffen School of Medicine, University of California, Los Angeles, CA (United States); Kelson, Kyle R.; Kaur, Sukhpreet; Kennedy, Sean [Gene Therapeutics Research Institute, Cedars-Sinai Medical Center, Los Angeles, CA 90048 (United States); Palmer, Donna; Ng, Philip [Department of Molecular and Human Genetics, Baylor College of Medicine, Houston, TX 77030 (United States); and others

2013-05-01

Adenoviral vectors (Ads) are promising gene delivery vehicles due to their high transduction efficiency; however, their clinical usefulness has been hampered by their immunogenicity and the presence of anti-Ad immunity in humans. We reported the efficacy of a gene therapy approach for glioma consisting of intratumoral injection of Ads encoding conditionally cytotoxic herpes simplex type 1 thymidine kinase (Ad-TK) and the immunostimulatory cytokine fms-like tyrosine kinase ligand 3 (Ad-Flt3L). Herein, we report the biodistribution, efficacy, and neurological and systemic effects of a bicistronic high-capacity Ad, i.e., HC-Ad-TK/TetOn-Flt3L. HC-Ads elicit sustained transgene expression, even in the presence of anti-Ad immunity, and can encode large therapeutic cassettes, including regulatory elements to enable turning gene expression “on” or “off” according to clinical need. The inclusion of two therapeutic transgenes within a single vector enables a reduction of the total vector load without adversely impacting efficacy. Because clinically the vectors will be delivered into the surgical cavity, normal regions of the brain parenchyma are likely to be transduced. Thus, we assessed any potential toxicities elicited by escalating doses of HC-Ad-TK/TetOn-Flt3L (1 × 10{sup 8}, 1 × 10{sup 9}, or 1 × 10{sup 10} viral particles [vp]) delivered into the rat brain parenchyma. We assessed neuropathology, biodistribution, transgene expression, systemic toxicity, and behavioral impact at acute and chronic time points. The results indicate that doses up to 1 × 10{sup 9} vp of HC-Ad-TK/TetOn-Flt3L can be safely delivered into the normal rat brain and underpin further developments for its implementation in a phase I clinical trial for glioma. - Highlights: ► High capacity Ad vectors elicit sustained therapeutic gene expression in the brain. ► HC-Ad-TK/TetOn-Flt3L encodes two therapeutic genes and a transcriptional switch. ► We performed a dose escalation study at

Chromosomal locations of three human nuclear genes (RPSM12, TUFM, and AFG3L1) specifying putative components of the mitochondrial gene expression apparatus.

Science.gov (United States)

Shah, Z H; Migliosi, V; Miller, S C; Wang, A; Friedman, T B; Jacobs, H T

1998-03-15

We have mapped the chromosomal locations of three human nuclear genes for putative components of the apparatus of mitochondrial gene expression, using a combination of in situ hybridization and interspecies hybrid mapping. The genes RPMS12 (mitoribosomal protein S12, a conserved protein component of the mitoribosomal accuracy center), TUFM (mitochondrial elongation factor EF-Tu), and AFG3L1 (similar to the yeast genes Afg3 and Rca1 involved in the turnover of mistranslated or misfolded mtDNA-encoded polypeptides) were initially characterized by a combination of database sequence analysis, PCR, cloning, and DNA sequencing. RPMS12 maps to chromosome 19q13.1, close to the previously mapped gene for autosomal dominant hearing loss DFNA4. The TUFM gene is located on chromosome 16p11.2, with a putative pseudogene or variant (TUFML) located very close to the centromere of chromosome 17. AFG3L1 is located on chromosome 16q24, very close to the telomere. By virtue of their inferred functions in mitochondria, these genes should be regarded as candidates of disorders sharing features with mitochondrial disease syndromes, such as sensorineural deafness, diabetes, and retinopathy.

Cloning, expression and characterization of a gene from earthworm Eisenia fetida encoding a blood-clot dissolving protein.

Directory of Open Access Journals (Sweden)

GangQiang Li

Full Text Available A lumbrokinase gene encoding a blood-clot dissolving protein was cloned from earthworm (Eisenia fetida by RT-PCR amplification. The gene designated as CST1 (GenBank No. AY840996 was sequence analyzed. The cDNA consists of 888 bp with an open reading frame of 729 bp, which encodes 242 amino acid residues. Multiple sequence alignments revealed that CST1 shares similarities and conserved amino acids with other reported lumbrokinases. The amino acid sequence of CST1 exhibits structural features similar to those found in other serine proteases, including human tissue-type (tPA, urokinase (uPA, and vampire bat (DSPAα1 plasminogen activators. CST1 has a conserved catalytic triad, found in the active sites of protease enzymes, which are important residues involved in polypeptide catalysis. CST1 was expressed as inclusion bodies in Escherichia coli BL21(DE3. The molecular mass of recombinant CST1 (rCST was 25 kDa as estimated by SDS-PAGE, and further confirmed by Western Blot analysis. His-tagged rCST1 was purified and renatured using nickel-chelating resin with a recovery rate of 50% and a purity of 95%. The purified, renatured rCST1 showed fibrinolytic activity evaluated by both a fibrin plate and a blood clot lysis assay. rCST1 degraded fibrin on the fibrin plate. A significant percentage (65.7% of blood clot lysis was observed when blood clot was treated with 80 mg/mL of rCST1 in vitro. The antithrombotic activity of rCST1 was 912 units/mg calculated by comparison with the activity of a lumbrokinase standard. These findings indicate that rCST1 has potential as a potent blood-clot treatment. Therefore, the expression and purification of a single lumbrokinase represents an important improvement in the use of lumbrokinases.

Molecular cloning and expression of the human homologue of the murine gene encoding myeloid leukemia-inhibitory factor

International Nuclear Information System (INIS)

Gough, N.M.; Gearing, D.P.; King, J.A.; Willson, T.A.; Hilton, D.J.; Nicola, N.A.; Metcalf, D.

1988-01-01

A human homologue of the recently cloned murine leukemia-inhibitory factor (LIF) gene was isolated from a genomic library by using the marine cDNA as a hybridization probe. The nucleotide sequence of the human gene indicated that human LIF has 78% amino acid sequence identity with murine LIF, with no insertions or deletions, and that the region of the human gene encoding the mature protein has one intervening sequence. After oligonucleotide-mediated mutagenesis, the mature protein-coding region of the LIF gene was introduced into the yeast expression vector YEpsec1. Yeast cells transformed with the resulting recombinant could be induced with galactose to produce high levels of a factor that induced the differentiation of murine M1 leukemic cells in a manner analogous to murine LIF. This factor competed with 125 I-labeled native murine LIF for binding to specific cellular receptors on murine cells, compatible with a high degree of structural similarity between the murine and human factors

Stress tolerances of nullmutants of function-unknown genes encoding menadione stress-responsive proteins in Aspergillus nidulans.

Science.gov (United States)

Leiter, Éva; Bálint, Mihály; Miskei, Márton; Orosz, Erzsébet; Szabó, Zsuzsa; Pócsi, István

2016-07-01

A group of menadione stress-responsive function-unkown genes of Aspergillus nidulans (Locus IDs ANID_03987.1, ANID_06058.1, ANID_10219.1, and ANID_10260.1) was deleted and phenotypically characterized. Importantly, comparative and phylogenetic analyses of the tested A. nidulans genes and their orthologs shed light only on the presence of a TANGO2 domain with NRDE protein motif in the translated ANID_06058.1 gene but did not reveal any recognizable protein-encoding domains in other protein sequences. The gene deletion strains were subjected to oxidative, osmotic, and metal ion stress and, surprisingly, only the ΔANID_10219.1 mutant showed an increased sensitivity to 0.12 mmol l(-1) menadione sodium bisulfite. The gene deletions affected the stress sensitivities (tolerances) irregularly, for example, some strains grew more slowly when exposed to various oxidants and/or osmotic stress generating agents, meanwhile the ΔANID_10260.1 mutant possessed a wild-type tolerance to all stressors tested. Our results are in line with earlier studies demonstrating that the deletions of stress-responsive genes do not confer necessarily any stress-sensitivity phenotypes, which can be attributed to compensatory mechanisms based on other elements of the stress response system with overlapping functions. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

A conserved gene family encodes transmembrane proteins with fibronectin, immunoglobulin and leucine-rich repeat domains (FIGLER

Directory of Open Access Journals (Sweden)

Haga Christopher L

2007-09-01

Full Text Available Abstract Background In mouse the cytokine interleukin-7 (IL-7 is required for generation of B lymphocytes, but human IL-7 does not appear to have this function. A bioinformatics approach was therefore used to identify IL-7 receptor related genes in the hope of identifying the elusive human cytokine. Results Our database search identified a family of nine gene candidates, which we have provisionally named fibronectin immunoglobulin leucine-rich repeat (FIGLER. The FIGLER 1–9 genes are predicted to encode type I transmembrane glycoproteins with 6–12 leucine-rich repeats (LRR, a C2 type Ig domain, a fibronectin type III domain, a hydrophobic transmembrane domain, and a cytoplasmic domain containing one to four tyrosine residues. Members of this multichromosomal gene family possess 20–47% overall amino acid identity and are differentially expressed in cell lines and primary hematopoietic lineage cells. Genes for FIGLER homologs were identified in macaque, orangutan, chimpanzee, mouse, rat, dog, chicken, toad, and puffer fish databases. The non-human FIGLER homologs share 38–99% overall amino acid identity with their human counterpart. Conclusion The extracellular domain structure and absence of recognizable cytoplasmic signaling motifs in members of the highly conserved FIGLER gene family suggest a trophic or cell adhesion function for these molecules.

Putative recombination events and evolutionary history of five economically important viruses of fruit trees based on coat protein-encoding gene sequence analysis.

Science.gov (United States)

Boulila, Moncef

2010-06-01

To enhance the knowledge of recombination as an evolutionary process, 267 accessions retrieved from GenBank were investigated, all belonging to five economically important viruses infecting fruit crops (Plum pox, Apple chlorotic leaf spot, Apple mosaic, Prune dwarf, and Prunus necrotic ringspot viruses). Putative recombinational events were detected in the coat protein (CP)-encoding gene using RECCO and RDP version 3.31beta algorithms. Based on RECCO results, all five viruses were shown to contain potential recombination signals in the CP gene. Reconstructed trees with modified topologies were proposed. Furthermore, RECCO performed better than the RDP package in detecting recombination events and exhibiting their evolution rate along the sequences of the five viruses. RDP, however, provided the possible major and minor parents of the recombinants. Thus, the two methods should be considered complementary.

CLE peptide-encoding gene families in Medicago truncatula and Lotus japonicus, compared with those of soybean, common bean and Arabidopsis

DEFF Research Database (Denmark)