Theoretical study of GC+/GC base pair derivatives
International Nuclear Information System (INIS)
Meng Fancui; Wang Huanjie; Xu Weiren; Liu Chengbu
2005-01-01
The geometries of R (R=CH 3 , CH 3 O, F, NO 2 ) substituted GC base pair derivatives and their cations have been optimized at B3LYP/6-31G* level and the substituent effects on the neutral and cationic geometric structures and energies have been discussed. The inner reorganization energies of various base pair derivatives and the native GC base pair have been calculated to discuss the substituent effects on the reorganization energy. NBO (natural bond orbital) analysis has been carried out on both the neutral and the cationic systems to investigate the differences of the charge distributions and the electronic structures. The outcomes indicate that 8-CH 3 O-G:C has the greatest reorganization energy and 8-NO 2 -G:C has the least, while the other substituted base pairs have a reorganization energy close to that of G:C. The one charge is mostly localized on guanine part after ionization and as high as 0.95e. The bond distances of N1-N3'andN2-O2' in the cationic base pair derivatives shortened and that of O6-N4' elongated as compared with the corresponding bond distances of the neutral GC base pair derivatives
A novel pseudo-complementary PNA G-C base pair
DEFF Research Database (Denmark)
Olsen, Anne G.; Dahl, Otto; Petersen, Asger Bjørn
2011-01-01
Pseudo-complementary oligonucleotide analogues and mimics provide novel opportunities for targeting duplex structures in RNA and DNA. Previously, a pseudo-complementary A-T base pair has been introduced. Towards sequence unrestricted targeting, a pseudo-complementary G-C base pair consisting...
DFT study on the attacking mechanisms of H and OH radicals to G-C and A-T base pairs in water
Energy Technology Data Exchange (ETDEWEB)
Okutsu, N.; Shimamura, K.; Shimizu, E.; Kurita, N., E-mail: kurita@cs.tut.ac.jp [Department of Computer Science and Engineering, Toyohashi University of Technology, Toyohashi, Aichi, 441-8580 (Japan); Shulga, S. [Institute for Food Biotechnology and Genomics, National Academy of Sciences of Ukraine, Kyiv (Ukraine); Danilov, V. I. [Institute of Molecular Biology and Genetics, National Academy of Sciences of Ukraine, Kyiv (Ukraine)
2016-02-01
To elucidate the effect of radicals on DNA base pairs, we investigated the attacking mechanism of OH and H radicals to the G-C and A-T base pairs, using the density functional theory (DFT) calculations in water approximated by the continuum solvation model. The DFT calculations revealed that the OH radical abstracts the hydrogen atom of a NH{sub 2} group of G or A base and induces a tautomeric reaction for an A-T base pair more significantly than for a G-C base pair. On the other hand, the H radical prefers to bind to the Cytosine NH{sub 2} group of G-C base pair and induce a tautomeric reaction from G-C to G*-C*, whose activation free energy is considerably small (−0.1 kcal/mol) in comparison with that (42.9 kcal/mol) for the reaction of an A-T base pair. Accordingly, our DFT calculations elucidated that OH and H radicals have a significant effect on A-T and G-C base pairs, respectively. This finding will be useful for predicting the effect of radiation on the genetic information recorded in the base sequences of DNA duplexes.
DFT study on the attacking mechanisms of H and OH radicals to G-C and A-T base pairs in water
International Nuclear Information System (INIS)
Okutsu, N.; Shimamura, K.; Shimizu, E.; Kurita, N.; Shulga, S.; Danilov, V. I.
2016-01-01
To elucidate the effect of radicals on DNA base pairs, we investigated the attacking mechanism of OH and H radicals to the G-C and A-T base pairs, using the density functional theory (DFT) calculations in water approximated by the continuum solvation model. The DFT calculations revealed that the OH radical abstracts the hydrogen atom of a NH 2 group of G or A base and induces a tautomeric reaction for an A-T base pair more significantly than for a G-C base pair. On the other hand, the H radical prefers to bind to the Cytosine NH 2 group of G-C base pair and induce a tautomeric reaction from G-C to G*-C*, whose activation free energy is considerably small (−0.1 kcal/mol) in comparison with that (42.9 kcal/mol) for the reaction of an A-T base pair. Accordingly, our DFT calculations elucidated that OH and H radicals have a significant effect on A-T and G-C base pairs, respectively. This finding will be useful for predicting the effect of radiation on the genetic information recorded in the base sequences of DNA duplexes
Brovarets', O O
2013-01-01
At the MP2/6-311++G(2df,pd)//B3LYP/6-311++G(d,p) level of theory it was established for the first time, that the Löwdin's G*.C* DNA base pair formed by the mutagenic tautomers can acquire, as the A-T Watson-Crick DNA base pair, four biologically important configurations, namely: Watson-Crick, reverse Watson-Crick, Hoogsteen and reverse Hoogsteen. This fact demonstrates rather unexpected role of the tautomerisation of the one of the Watson-Crick DNA base pairs, in particular, via double proton transfer: exactly the G.C-->G*.C* tautomerisation allows to overcome steric hindrances for the implementation of the above mentioned configurations. Geometric, electron-topological and energetic properties of the H-bonds that stabilise the studied pairs, as well as the energetic characteristics of the latters are presented.
Guerra, C.F.; van der Wijst, T.; Bickelhaupt, F.M.
2006-01-01
We have theoretically analyzed Watson–Crick guanine–cytosine (GC) base pairs in which purine-C8 and/or pyrimidine-C6 positions carry a substituent X = NH−, NH2, NH3+ (N series), O−, OH, or OH2+ (O series), using the generalized gradient approximation (GGA) of density functional theory at the
Nanoswitches based on DNA base pairs: why adenine-thymine is less suitable than guanine-cytosine
Fonseca Guerra, C.; van der Wijst, T.; Bickelhaupt, F.M.
2006-01-01
Substituted Watson-Crick guanine-cytosine (GC) base pairs were recently shown to yield robust three-state nanoswitches. Here, we address the question: Can such supramolecular switches also be based on Watson-Crick adenine-thymine (AT) base pairs? We have theoretically analyzed AT pairs in which
Chawla, Mohit
2013-10-10
The G:C reverse Watson-Crick (W:W trans) base pair, also known as Levitt base pair in the context of tRNAs, is a structurally and functionally important base pair that contributes to tertiary interactions joining distant domains in functional RNA molecules and also participates in metabolite binding in riboswitches. We previously indicated that the isolated G:C W:W trans base pair is a rather unstable geometry, and that dicationic metal binding to the Guanine base or posttranscriptional modification of the Guanine can increase its stability. Herein, we extend our survey and report on other H-bonding interactions that can increase the stability of this base pair. To this aim, we performed a bioinformatics search of the PDB to locate all the occurencies of G:C trans base pairs. Interestingly, 66% of the G:C trans base pairs in the PDB are engaged in additional H-bonding interactions with other bases, the RNA backbone or structured water molecules. High level quantum mechanical calculations on a data set of representative crystal structures were performed to shed light on the structural stability and energetics of the various crystallographic motifs. This analysis was extended to the binding of the preQ1 metabolite to a preQ1-II riboswitch. 2013 The Author(s).
Morari, Cristian; Muntean, Cristina M; Tripon, Carmen; Buimaga-Iarinca, Luiza; Calborean, Adrian
2014-04-01
The binding effects of Mg²⁺, Ca²⁺, and Cu²⁺ ions on the vibrational properties of guanine-cytosine base pairs have been performed using density functional theory investigations. Both Watson-Crick and Hoogsteen configurations of the base pairs were investigated. In Watson-Crick configuration, the metal was coordinated at N7 atom of guanine, while in the case of Hoogsteen configuration, the coordination is at N3 atom of guanine. We have pointed out the geometric properties of the metal-GC base pairs structure, as well as the vibrational bands that can be used to detect the presence of metallic ions in the Watson-Crick and Hoogsteen GC structures. For the geometric models used by us, the vibrational amplitudes of metallic atoms were stronger for wavenumbers lower than 500 cm⁻¹. This suggests that in the experimental studies on DNA the presence of the three metallic atoms (Mg, Ca, and Cu) can be explicitly detected at low frequencies.
A quantum theoretical study of reactions of methyldiazonium ion with DNA base pairs
International Nuclear Information System (INIS)
Shukla, P.K.; Ganapathy, Vinay; Mishra, P.C.
2011-01-01
Graphical abstract: Reactions of methyldiazonium ion at the different sites of the DNA bases in the Watson-Crick GC and AT base pairs were investigated employing density functional and second order Moller-Plesset (MP2) perturbation theories. Display Omitted Highlights: → Methylation of the DNA bases is important as it can cause mutation and cancer. → Methylation reactions of the GC and AT base pairs with CH 3 N 2 + were not studied earlier theoretically. → Experimental observations have been explained using theoretical methods. - Abstract: Methylation of the DNA bases in the Watson-Crick GC and AT base pairs by the methyldiazonium ion was investigated employing density functional and second order Moller-Plesset (MP2) perturbation theories. Methylation at the N3, N7 and O6 sites of guanine, N1, N3 and N7 sites of adenine, O2 and N3 sites of cytosine and the O2 and O4 sites of thymine were considered. The computed reactivities for methylation follow the order N7(guanine) > N3(adenine) > O6(guanine) which is in agreement with experiment. The base pairing in DNA is found to play a significant role with regard to reactivities of the different sites.
Dixit, Surjit B; Mezei, Mihaly; Beveridge, David L
2012-07-01
Detailed analyses of the sequence-dependent solvation and ion atmosphere of DNA are presented based on molecular dynamics (MD) simulations on all the 136 unique tetranucleotide steps obtained by the ABC consortium using the AMBER suite of programs. Significant sequence effects on solvation and ion localization were observed in these simulations. The results were compared to essentially all known experimental data on the subject. Proximity analysis was employed to highlight the sequence dependent differences in solvation and ion localization properties in the grooves of DNA. Comparison of the MD-calculated DNA structure with canonical A- and B-forms supports the idea that the G/C-rich sequences are closer to canonical A- than B-form structures, while the reverse is true for the poly A sequences, with the exception of the alternating ATAT sequence. Analysis of hydration density maps reveals that the flexibility of solute molecule has a significant effect on the nature of observed hydration. Energetic analysis of solute-solvent interactions based on proximity analysis of solvent reveals that the GC or CG base pairs interact more strongly with water molecules in the minor groove of DNA that the AT or TA base pairs, while the interactions of the AT or TA pairs in the major groove are stronger than those of the GC or CG pairs. Computation of solvent-accessible surface area of the nucleotide units in the simulated trajectories reveals that the similarity with results derived from analysis of a database of crystallographic structures is excellent. The MD trajectories tend to follow Manning's counterion condensation theory, presenting a region of condensed counterions within a radius of about 17 A from the DNA surface independent of sequence. The GC and CG pairs tend to associate with cations in the major groove of the DNA structure to a greater extent than the AT and TA pairs. Cation association is more frequent in the minor groove of AT than the GC pairs. In general, the
1000 human genomes carry widespread signatures of GC biased gene conversion.
Dutta, Rajib; Saha-Mandal, Arnab; Cheng, Xi; Qiu, Shuhao; Serpen, Jasmine; Fedorova, Larisa; Fedorov, Alexei
2018-04-16
GC-Biased Gene Conversion (gBGC) is one of the important theories put forward to explain profound long-range non-randomness in nucleotide compositions along mammalian chromosomes. Nucleotide changes due to gBGC are hard to distinguish from regular mutations. Here, we present an algorithm for analysis of millions of known SNPs that detects a subset of so-called "SNP flip-over" events representing recent gBGC nucleotide changes, which occurred in previous generations via non-crossover meiotic recombination. This algorithm has been applied in a large-scale analysis of 1092 sequenced human genomes. Altogether, 56,328 regions on all autosomes have been examined, which revealed 223,955 putative gBGC cases leading to SNP flip-overs. We detected a strong bias (11.7% ± 0.2% excess) in AT- > GC over GC- > AT base pair changes within the entire set of putative gBGC cases. On average, a human gamete acquires 7 SNP flip-over events, in which one allele is replaced by its complementary allele during the process of meiotic non-crossover recombination. In each meiosis event, on average, gBGC results in replacement of 7 AT base pairs by GC base pairs, while only 6 GC pairs are replaced by AT pairs. Therefore, every human gamete is enriched by one GC pair. Happening over millions of years of evolution, this bias may be a noticeable force in changing the nucleotide composition landscape along chromosomes.
Méndez-Arriaga, José M; Maldonado, Carmen R; Dobado, José A; Galindo, Miguel A
2018-03-26
DNA sequences comprising noncanonical 7-deazaguanine ( 7C G) and canonical cytosine (C) are capable of forming Watson-Crick base pairs via hydrogen bonds as well as silver(I)-mediated base pairs by coordination to central silver(I) ions. Duplexes I and II containing 7C G and C have been synthesized and characterized. The incorporation of silver(I) ions into these duplexes has been studied by means of temperature-dependent UV spectroscopy, circular dichroism, and DFT calculations. The results suggest the formation of DNA molecules comprising contiguous metallated 7C G-Ag I -C Watson-Crick base pairs that preserve the original B-type conformation. Furthermore, additional studies performed on duplex III indicated that, in the presence of Ag I ions, 7C G-C and 7C A-T Watson-Crick base pairs ( 7C A, 7-deazadenine; T, thymine) can be converted to metallated 7C G-Ag I -C and 7C A-Ag I -T base pairs inside the same DNA molecule whilst maintaining its initial double helix conformation. These findings are very important for the development of customized silver-DNA nanostructures based on a Watson-Crick complementarity pattern. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.
Unnatural base pair systems toward the expansion of the genetic alphabet in the central dogma.
Hirao, Ichiro; Kimoto, Michiko
2012-01-01
Toward the expansion of the genetic alphabet of DNA, several artificial third base pairs (unnatural base pairs) have been created. Synthetic DNAs containing the unnatural base pairs can be amplified faithfully by PCR, along with the natural A-T and G-C pairs, and transcribed into RNA. The unnatural base pair systems now have high potential to open the door to next generation biotechnology. The creation of unnatural base pairs is a consequence of repeating "proof of concept" experiments. In the process, initially designed base pairs were modified to address their weak points. Some of them were artificially evolved to ones with higher efficiency and selectivity in polymerase reactions, while others were eliminated from the analysis. Here, we describe the process of unnatural base pair development, as well as the tests of their applications.
Hydrogen Bonding in DNA Base Pairs: Reconciliation of Theory and Experiment
Fonseca Guerra, C.; Bickelhaupt, F.M.; Snijders, J.G.; Baerends, E.J.
2000-01-01
Up till now, there has been a significant disagreement between theory and experiment regarding hydrogen bond lengths in Watson - Crick base pairs. To investigate the possible sources of this discrepancy, we have studied numerous model systems for adenine - thymine (AT) and guanine - cytosine (GC)
Study of the red lacquer from a pair of Namban stirrups by Py-GC/MS
Directory of Open Access Journals (Sweden)
José Carlos Frade
2009-01-01
Full Text Available Oriental lacquer is a material of vegetal origin that is used in the Asian countries as a coating for the most varied kinds of religious and civil use objects. With the Portuguese arrival to the East, the Europeans started to develop a taste for the exotic and exquisite Art of Lacquer. From the 16th century onwards a lacquerware market developed with numerous lacquered objects being brought to Europe. In this work, the red lacquer from a pair of Namban stirrups was studied by Py-GC/MS (pyrolysis-gas chromatography/mass spectrometry. The results were compared with lacquer references, and the lacquer type was identified. Based on the results, the stirrups' lacquering technique and the performance of Py-CG/MS in the identification of oriental lacquers are also discussed.
Romero, Eduardo E; Hernandez, Florencio E
2018-01-03
Herein we present our results on the study of the double proton transfer (DPT) mechanism in the adenine-thymine (AT) and guanine-cytosine (GC) base pairs, both in gas phase and in solution. The latter was modeled using the polarizable continuum method (PCM) in different solvents. According to our DFT calculations, the DPT may occur for both complexes in a stepwise mechanism in condensate phase. In gas phase only the GC base pair exhibits a concerted DPT mechanism. Using the Wigner's tunneling corrections to the transition state theory we demonstrate that such corrections are important for the prediction of the rate constants of both systems in gas and in condensate phase. We also show that (i) as the polarity of the medium decreases the equilibrium constant of the DPT reaction increases in both complexes, and (ii) that the equilibrium constant in the GC complex is four orders of magnitude larger than in AT. This observation suggests that the spontaneous mutations in DNA base pairs are more probable in GC than in AT.
Imidazopyridine/Pyrrole and hydroxybenzimidazole/pyrrole pairs for DNA minor groove recognition.
Renneberg, Dorte; Dervan, Peter B
2003-05-14
The DNA binding properties of fused heterocycles imidazo[4,5-b]pyridine (Ip) and hydroxybenzimidazole (Hz) paired with pyrrole (Py) in eight-ring hairpin polyamides are reported. The recognition profile of Ip/Py and Hz/Py pairs were compared to the five-membered ring pairs Im/Py and Hp/Py on a DNA restriction fragment at four 6-base pair recognition sites which vary at a single position 5'-TGTNTA-3', where N = G, C, T, A. The Ip/Py pair distinguishes G.C from C.G, T.A, and A.T, and the Hz/Py pair distinguishes T.A from A.T, G.C, and C.G, affording a new set of heterocycle pairs to target the four Watson-Crick base pairs in the minor groove of DNA.
International Nuclear Information System (INIS)
Minoshima, Yusuke; Seki, Yusuke; Takayanagi, Toshiyuki; Shiga, Motoyuki
2016-01-01
Highlights: • Dynamics of excess electron attachment to guanine–cytosine base pair. • Ring-polymer and classical molecular dynamics simulations are performed. • Temperature and isotope substitution effects are investigated. - Abstract: The dynamical process of electron attachment to a guanine–cytosine pair in the normal (h-GC) and deuterated (d-GC) forms has been studied theoretically by semiclassical ring-polymer molecular dynamics (RPMD) simulations using the empirical valence bond model. The initially formed dipole-bound anion is converted rapidly to the valence-bound anion within about 0.1 ps in both h-GC and d-GC. However, the subsequent proton transfer in h-GC occurs with a rate five times greater than the deuteron transfer in d-GC. The change of rates with isotopic substitution and temperature variation in the RPMD simulations are quantitatively and qualitatively different from those in the classical molecular dynamics (MD) simulations, demonstrating the importance of nuclear quantum effects on the dynamics of this system.
Energy Technology Data Exchange (ETDEWEB)
Minoshima, Yusuke; Seki, Yusuke [Department of Chemistry, Saitama University, 255 Shimo-Okubo, Sakura-ku, Saitama City, Saitama 338-8570 (Japan); Takayanagi, Toshiyuki, E-mail: tako@mail.saitama-u.ac.jp [Department of Chemistry, Saitama University, 255 Shimo-Okubo, Sakura-ku, Saitama City, Saitama 338-8570 (Japan); Shiga, Motoyuki [Center for Computational Science and E-Systems, Japan Atomic Energy Agency, 148-4, Kashiwanoha Campus, 178-4 Wakashiba, Kashiwa, Chiba 277-0871 (Japan)
2016-06-15
Highlights: • Dynamics of excess electron attachment to guanine–cytosine base pair. • Ring-polymer and classical molecular dynamics simulations are performed. • Temperature and isotope substitution effects are investigated. - Abstract: The dynamical process of electron attachment to a guanine–cytosine pair in the normal (h-GC) and deuterated (d-GC) forms has been studied theoretically by semiclassical ring-polymer molecular dynamics (RPMD) simulations using the empirical valence bond model. The initially formed dipole-bound anion is converted rapidly to the valence-bound anion within about 0.1 ps in both h-GC and d-GC. However, the subsequent proton transfer in h-GC occurs with a rate five times greater than the deuteron transfer in d-GC. The change of rates with isotopic substitution and temperature variation in the RPMD simulations are quantitatively and qualitatively different from those in the classical molecular dynamics (MD) simulations, demonstrating the importance of nuclear quantum effects on the dynamics of this system.
Graphene and g-C3N4 based photocatalysts for NOx removal: A review
Nikokavoura, Aspasia; Trapalis, Christos
2018-02-01
NOx liberated into atmosphere from automobile exhausts and fossil fuel combustion, comprise the major air pollutants. They are responsible for serious environmental problems such as acid rain, ozone accumulation, haze and photochemical smog. Besides they contribute to the deterioration of human health by causing decrease of the lung function and respiratory problems. The application of photocatalytic methods in order to mitigate the presence of NOx in the atmosphere is preferable as they are environmentally friendly, mild and low cost. Therefore, in this review, the photocatalytic activity of g-C3N4 and graphene based composites towards NOx removal was discussed. NOx oxidation to non volatile nitrates on the surface of graphene and g-C3N4 based photocatalysts has attracted much interest during the last years due to their structures with unique features such as large specific surface area, thermal and chemical stability and enhanced visible light utilization. The formation of 2D-2D intimate heterojunctions between graphene or g-C3N4 and other components ensures the enhanced charge transfer, lifetime of electron/hole pairs and thus photocatalytic activity. The increased visible light harvesting also contributes to their usefulness as effective photocatalytic materials. In the present work, the advantages of these novel photocatalysts and the differences/similarities between them were exhaustively highlighted. The role of graphene as catalyst promoter, electron reservoir, support and photosensitizer in its photocatalytic composites was emphasized. The effect of g-C3N4 doping and copolymerization with metals/semiconductors on its photocatalytic activity towards NOx oxidation was thoroughly discussed. Besides, the preparation methods, photocatalytic efficiencies, type of irradiation, utilization of appropriate cocatalysts, and reaction mechanisms during the photocatalytic NOx removal by graphene and g-C3N4 composies, were summarized. It was demonstrated that in the vast
Substituent effif ects on hydrogen bonding in Watson-Crick base pairs. A theoretical study
Fonseca Guerra, C.; van der Wijst, T.; Bickelhaupt, F.M.
2005-01-01
We have theoretically analyzed Watson-Crick AT and GC base pairs in which purine C8 and/or pyrimidine C6 positions carry a substituent X = H, F, Cl or Br, using the generalized gradient approximation (GGA) of density functional theory at BP86/TZ2P. The purpose is to study the effects on structure
Gc protein (vitamin D-binding protein): Gc genotyping and GcMAF precursor activity.
Nagasawa, Hideko; Uto, Yoshihiro; Sasaki, Hideyuki; Okamura, Natsuko; Murakami, Aya; Kubo, Shinichi; Kirk, Kenneth L; Hori, Hitoshi
2005-01-01
The Gc protein (human group-specific component (Gc), a vitamin D-binding protein or Gc globulin), has important physiological functions that include involvement in vitamin D transport and storage, scavenging of extracellular G-actin, enhancement of the chemotactic activity of C5a for neutrophils in inflammation and macrophage activation (mediated by a GalNAc-modified Gc protein (GcMAF)). In this review, the structure and function of the Gc protein is focused on especially with regard to Gc genotyping and GcMAF precursor activity. A discussion of the research strategy "GcMAF as a target for drug discovery" is included, based on our own research.
A review on g-C3N4-based photocatalysts
International Nuclear Information System (INIS)
Wen, Jiuqing; Xie, Jun; Chen, Xiaobo; Li, Xin
2017-01-01
Graphical abstract: The photocatalytic fundamentals, versatile properties, design strategies and potential applications of g-C 3 N 4 -based photocatalysts were systematically summarized and addressed. - Highlights: • The photocatalytic fundamentals of g-C 3 N 4 were systematically summarized. • The versatile properties of g-C 3 N 4 photocatalysts were highlighted. • The different design strategies of g-C 3 N 4 photocatalysts were reviewed. • The important photocatalytic applications of g-C 3 N 4 were also addressed. - Abstract: As one of the most appealing and attractive technologies, heterogeneous photocatalysis has been utilized to directly harvest, convert and store renewable solar energy for producing sustainable and green solar fuels and a broad range of environmental applications. Due to their unique physicochemical, optical and electrical properties, a wide variety of g-C 3 N 4 -based photocatalysts have been designed to drive various reduction and oxidation reactions under light irradiation with suitable wavelengths. In this review, we have systematically summarized the photocatalytic fundamentals of g-C 3 N 4 -based photocatalysts, including fundamental mechanism of heterogeneous photocatalysis, advantages, challenges and the design considerations of g-C 3 N 4 -based photocatalysts. The versatile properties of g-C 3 N 4 -based photocatalysts are highlighted, including their crystal structural, surface phisicochemical, stability, optical, adsorption, electrochemical, photoelectrochemical and electronic properties. Various design strategies are also thoroughly reviewed, including band-gap engineering, defect control, dimensionality tuning, pore texture tailoring, surface sensitization, heterojunction construction, co-catalyst and nanocarbon loading. Many important applications are also addressed, such as photocatalytic water splitting (H 2 evolution and overall water splitting), degradation of pollutants, carbon dioxide reduction, selective organic
Directory of Open Access Journals (Sweden)
Mudasir Mudasir
2010-06-01
Full Text Available A research about base-pair specificity of the DNA binding of [Fe(phen3]2+, [Fe(phen2(dip]2+ and [Fe(phen(dip2]2+ complexes and the effect of calf-thymus DNA (ct-DNA binding of these metal complexes on thermal denaturation of ct-DNA has been carried out. This research is intended to evaluate the preferential binding of the complexes to the sequence of DNA (A-T or G-C sequence and to investigate the binding strength and mode upon their interaction with DNA. Base-pair specificity of the DNA binding of the complexes was determined by comparing the equilibrium binding constant (Kb of each complex to polysynthetic DNA that contain only A-T or G-C sequence. The Kb value of the interaction was determined by spectrophotometric titration and thermal denaturation temperature (Tm was determined by monitoring the absorbance of the mixture solution of each complex and ct-DNA at λ =260 nm as temperature was elevated in the range of 25 - 100 oC. Results of the study show that in general all iron(II complexes studied exhibit a base-pair specificity in their DNA binding to prefer the relatively facile A-T sequence as compared to the G-C one. The thermal denaturation experiments have demonstrated that Fe(phen3]2+ and [Fe(phen2(dip]2+ interact weakly with double helical DNA via electrostatic interaction as indicated by insignificant changes in melting temperature, whereas [Fe(phen2(dip]2+ most probably binds to DNA in mixed modes of interaction, i.e.: intercalation and electrostatic interaction. This conclusion is based on the fact that the binding of [Fe(phen2(dip]2+ to ct-DNA moderately increase the Tm value of ct- DNA Keywords: DNA Binding, mixed-ligand complexes
Watson-Crick base pairs with thiocarbonyl groups: How sulfur changes the hydrogen bonds in DNA
Fonseca Guerra, C.; Baerends, E.J.; Bickelhaupt, F.M.
2008-01-01
We have theoretically analyzed mimics of Watson-Crick AT and GC base pairs in which N-H•••O hydrogen bonds are replaced by N-H•••S, using the generalized gradient approximation (GGA) of density functional theory at BP86/TZ2P level. The general effect of the above substitutions is an elongation and a
Berger, Or; Adler-Abramovich, Lihi; Levy-Sakin, Michal; Grunwald, Assaf; Liebes-Peer, Yael; Bachar, Mor; Buzhansky, Ludmila; Mossou, Estelle; Forsyth, V Trevor; Schwartz, Tal; Ebenstein, Yuval; Frolow, Felix; Shimon, Linda J W; Patolsky, Fernando; Gazit, Ehud
2015-04-01
The two main branches of bionanotechnology involve the self-assembly of either peptides or DNA. Peptide scaffolds offer chemical versatility, architectural flexibility and structural complexity, but they lack the precise base pairing and molecular recognition available with nucleic acid assemblies. Here, inspired by the ability of aromatic dipeptides to form ordered nanostructures with unique physical properties, we explore the assembly of peptide nucleic acids (PNAs), which are short DNA mimics that have an amide backbone. All 16 combinations of the very short di-PNA building blocks were synthesized and assayed for their ability to self-associate. Only three guanine-containing di-PNAs-CG, GC and GG-could form ordered assemblies, as observed by electron microscopy, and these di-PNAs efficiently assembled into discrete architectures within a few minutes. The X-ray crystal structure of the GC di-PNA showed the occurrence of both stacking interactions and Watson-Crick base pairing. The assemblies were also found to exhibit optical properties including voltage-dependent electroluminescence and wide-range excitation-dependent fluorescence in the visible region.
Metal-mediated DNA base pairing: alternatives to hydrogen-bonded Watson-Crick base pairs.
Takezawa, Yusuke; Shionoya, Mitsuhiko
2012-12-18
With its capacity to store and transfer the genetic information within a sequence of monomers, DNA forms its central role in chemical evolution through replication and amplification. This elegant behavior is largely based on highly specific molecular recognition between nucleobases through the specific hydrogen bonds in the Watson-Crick base pairing system. While the native base pairs have been amazingly sophisticated through the long history of evolution, synthetic chemists have devoted considerable efforts to create alternative base pairing systems in recent decades. Most of these new systems were designed based on the shape complementarity of the pairs or the rearrangement of hydrogen-bonding patterns. We wondered whether metal coordination could serve as an alternative driving force for DNA base pairing and why hydrogen bonding was selected on Earth in the course of molecular evolution. Therefore, we envisioned an alternative design strategy: we replaced hydrogen bonding with another important scheme in biological systems, metal-coordination bonding. In this Account, we provide an overview of the chemistry of metal-mediated base pairing including basic concepts, molecular design, characteristic structures and properties, and possible applications of DNA-based molecular systems. We describe several examples of artificial metal-mediated base pairs, such as Cu(2+)-mediated hydroxypyridone base pair, H-Cu(2+)-H (where H denotes a hydroxypyridone-bearing nucleoside), developed by us and other researchers. To design the metallo-base pairs we carefully chose appropriate combinations of ligand-bearing nucleosides and metal ions. As expected from their stronger bonding through metal coordination, DNA duplexes possessing metallo-base pairs exhibited higher thermal stability than natural hydrogen-bonded DNAs. Furthermore, we could also use metal-mediated base pairs to construct or induce other high-order structures. These features could lead to metal-responsive functional
Directory of Open Access Journals (Sweden)
Jimmy Boon Som Ong
Full Text Available The "classical model" for sexually transmitted infections treats partnerships as instantaneous events summarized by partner change rates, while individual-based and pair models explicitly account for time within partnerships and gaps between partnerships. We compared predictions from the classical and pair models over a range of partnership and gap combinations. While the former predicted similar or marginally higher prevalence at the shortest partnership lengths, the latter predicted self-sustaining transmission for gonorrhoea (GC and Chlamydia (CT over much broader partnership and gap combinations. Predictions on the critical level of condom use (C(c required to prevent transmission also differed substantially when using the same parameters. When calibrated to give the same disease prevalence as the pair model by adjusting the infectious duration for GC and CT, and by adjusting transmission probabilities for HIV, the classical model then predicted much higher C(c values for GC and CT, while C(c predictions for HIV were fairly close. In conclusion, the two approaches give different predictions over potentially important combinations of partnership and gap lengths. Assuming that it is more correct to explicitly model partnerships and gaps, then pair or individual-based models may be needed for GC and CT since model calibration does not resolve the differences.
Report on Pairing-based Cryptography.
Moody, Dustin; Peralta, Rene; Perlner, Ray; Regenscheid, Andrew; Roginsky, Allen; Chen, Lily
2015-01-01
This report summarizes study results on pairing-based cryptography. The main purpose of the study is to form NIST's position on standardizing and recommending pairing-based cryptography schemes currently published in research literature and standardized in other standard bodies. The report reviews the mathematical background of pairings. This includes topics such as pairing-friendly elliptic curves and how to compute various pairings. It includes a brief introduction to existing identity-based encryption (IBE) schemes and other cryptographic schemes using pairing technology. The report provides a complete study of the current status of standard activities on pairing-based cryptographic schemes. It explores different application scenarios for pairing-based cryptography schemes. As an important aspect of adopting pairing-based schemes, the report also considers the challenges inherent in validation testing of cryptographic algorithms and modules. Based on the study, the report suggests an approach for including pairing-based cryptography schemes in the NIST cryptographic toolkit. The report also outlines several questions that will require further study if this approach is followed.
Base pair probability estimates improve the prediction accuracy of RNA non-canonical base pairs.
Directory of Open Access Journals (Sweden)
Michael F Sloma
2017-11-01
Full Text Available Prediction of RNA tertiary structure from sequence is an important problem, but generating accurate structure models for even short sequences remains difficult. Predictions of RNA tertiary structure tend to be least accurate in loop regions, where non-canonical pairs are important for determining the details of structure. Non-canonical pairs can be predicted using a knowledge-based model of structure that scores nucleotide cyclic motifs, or NCMs. In this work, a partition function algorithm is introduced that allows the estimation of base pairing probabilities for both canonical and non-canonical interactions. Pairs that are predicted to be probable are more likely to be found in the true structure than pairs of lower probability. Pair probability estimates can be further improved by predicting the structure conserved across multiple homologous sequences using the TurboFold algorithm. These pairing probabilities, used in concert with prior knowledge of the canonical secondary structure, allow accurate inference of non-canonical pairs, an important step towards accurate prediction of the full tertiary structure. Software to predict non-canonical base pairs and pairing probabilities is now provided as part of the RNAstructure software package.
Base pair probability estimates improve the prediction accuracy of RNA non-canonical base pairs.
Sloma, Michael F; Mathews, David H
2017-11-01
Prediction of RNA tertiary structure from sequence is an important problem, but generating accurate structure models for even short sequences remains difficult. Predictions of RNA tertiary structure tend to be least accurate in loop regions, where non-canonical pairs are important for determining the details of structure. Non-canonical pairs can be predicted using a knowledge-based model of structure that scores nucleotide cyclic motifs, or NCMs. In this work, a partition function algorithm is introduced that allows the estimation of base pairing probabilities for both canonical and non-canonical interactions. Pairs that are predicted to be probable are more likely to be found in the true structure than pairs of lower probability. Pair probability estimates can be further improved by predicting the structure conserved across multiple homologous sequences using the TurboFold algorithm. These pairing probabilities, used in concert with prior knowledge of the canonical secondary structure, allow accurate inference of non-canonical pairs, an important step towards accurate prediction of the full tertiary structure. Software to predict non-canonical base pairs and pairing probabilities is now provided as part of the RNAstructure software package.
Directory of Open Access Journals (Sweden)
Nicole A Grieshaber
Full Text Available The non-coding small RNA, IhtA expressed by the obligate intracellular human pathogen Chlamydia trachomatis modulates the translation of HctA, a key protein involved in replicative to infectious cell type differentiation. Using a combination of bioinformatics and mutagenesis we sought to identify the base pairing requirement for functional repression of HctA protein expression, with an eye to applying our findings towards the identification of additional targets. IhtA is predicted to fold into a three stem:loop structure. We found that loop 1 occludes the initiation codon of hctA, while loop 2 and 3 are not required for function. This 7 nucleotide region forms G/C rich interactions surrounding the AUG of hctA. Two additional genes in the chlamydial genome, CTL0322 and CTL0097, contained some elements of the hctA:IhtA recognition sequence. The mRNA of both CTL0322and CTL0097 interacted with IhtA in vitro as measured by biolayer interferometry. However, using a CheZ reporter expression system, IhtA only inhibited the translation of CTL0322. The proposed IhtA recognition site in the CTL0322 message contains significant G/C base pairing on either side of the initiation codon while CTL0097 only contains G/C base pairing 3' to the AUG initiation codon. These data suggest that as the functional interacting region is only 6-7nt in length that full translation repression is dependent on the degree of G/C base pairing. Additionally our results indicate that IhtA may regulate multiple mRNAs involved in the chlamydial infectious cycle.
E. coli mismatch repair enhances AT-to-GC mutagenesis caused by alkylating agents.
Nakano, Kota; Yamada, Yoko; Takahashi, Eizo; Arimoto, Sakae; Okamoto, Keinosuke; Negishi, Kazuo; Negishi, Tomoe
2017-03-01
Alkylating agents are known to induce the formation of O 6 -alkylguanine (O 6 -alkG) and O 4 -alkylthymine (O 4 -alkT) in DNA. These lesions have been widely investigated as major sources of mutations. We previously showed that mismatch repair (MMR) facilitates the suppression of GC-to-AT mutations caused by O 6 -methylguanine more efficiently than the suppression of GC-to-AT mutations caused by O 6 -ethylguanine. However, the manner by which O 4 -alkyT lesions are repaired remains unclear. In the present study, we investigated the repair pathway involved in the repair of O 4 -alkT. The E. coli CC106 strain, which harbors Δprolac in its genomic DNA and carries the F'CC106 episome, can be used to detect AT-to-GC reverse-mutation of the gene encoding β-galactosidase. Such AT-to-GC mutations should be induced through the formation of O 4 -alkT at AT base pairs. As expected, an O 6 -alkylguanine-DNA alkyltransferase (AGT) -deficient CC106 strain, which is defective in both ada and agt genes, exhibited elevated mutant frequencies in the presence of methylating agents and ethylating agents. However, in the UvrA-deficient strain, the methylating agents were less mutagenic than in wild-type, while ethylating agents were more mutagenic than in wild-type, as observed with agents that induce O 6 -alkylguanine modifications. Unexpectedly, the mutant frequencies decreased in a MutS-deficient strain, and a similar tendency was observed in MutL- or MutH-deficient strains. Thus, MMR appears to promote mutation at AT base pairs. Similar results were obtained in experiments employing double-mutant strains harboring defects in both MMR and AGT, or MMR and NER. E. coli MMR enhances AT-to-GC mutagenesis, such as that caused by O 4 -alkylthymine. We hypothesize that the MutS protein recognizes the O 4 -alkT:A base pair more efficiently than O 4 -alkT:G. Such a distinction would result in misincorporation of G at the O 4 -alkT site, followed by higher mutation frequencies in wild
Peters, S.; Kaal, E.; Horsting, I.; Janssen, H.-G.
2012-01-01
A new method is presented for the analysis of phenolic acids in plasma based on ion-pairing ‘Micro-extraction in packed sorbent’ (MEPS) coupled on-line to in-liner derivatisation-gas chromatography-mass spectrometry (GC-MS). The ion-pairing reagent served a dual purpose. It was used both to improve
Reifenberger, Jeffrey; Dorfman, Kevin; Cao, Han
Human DNA is a not a polymer consisting of a uniform distribution of all 4 nucleic acids, but rather contains regions of high AT and high GC content. When confined, these regions could have different stretch due to the extra hydrogen bond present in the GC basepair. To measure this potential difference, human genomic DNA was nicked with NtBspQI, labeled with a cy3 like fluorophore at the nick site, stained with YOYO, loaded into a device containing an array of nanochannels, and imaged. Over 473,000 individual molecules of DNA, corresponding to roughly 30x coverage of a human genome, were collected and aligned to the human reference. Based on the known AT/GC content between aligned pairs of labels, the stretch was measured for regions of similar size but different AT/GC content. We found that regions of high GC content were consistently more stretched than regions of high AT content between pairs of labels varying in size between 2.5 kbp and 500 kbp. We measured that for every 1% increase in GC content there was roughly a 0.06% increase in stretch. While this effect is small, it is important to take into account differences in stretch between AT and GC rich regions to improve the sensitivity of detection of structural variations from genomic variations. NIH Grant: R01-HG006851.
Stability of non-Watson-Crick G-A/A-G base pair in synthetic DNA and RNA oligonucleotides.
Ito, Yuko; Sone, Yumiko; Mizutani, Takaharu
2004-03-01
A non-Watson-Crick G-A/A-G base pair is found in SECIS (selenocysteine-insertion sequence) element in the 3'-untranslated region of Se-protein mRNAs and in the functional site of the hammerhead ribozyme. We studied the stability of G-A/A-G base pair (bold) in 17mer GT(U)GACGGAAACCGGAAC synthetic DNA and RNA oligonucleotides by thermal melting experiments and gel electrophoresis. The measured Tm value of DNA oligonucleotide having G-A/A-G pair showed an intermediate value (58 degrees C) between that of Watson-Crick G-C/C-G base pair (75 degrees C) and that of G-G/A-A of non-base-pair (40 degrees C). Similar thermal melting patterns were obtained with RNA oligonucleotides. This result indicates that the secondary structure of oligonucleotide having G-A/A-G base pair is looser than that of the G-C type Watson-Crick base pair. In the comparison between RNA and DNA having G-A/A-G base pair, the Tm value of the RNA oligonucleotide was 11 degrees C lower than that of DNA, indicating that DNA has a more rigid structure than RNA. The stained pattern of oligonucleotide on polyacrylamide gel clarified that the mobility of the DNA oligonucleotide G-A/A-G base pair changed according to the urea concentration from the rigid state (near the mobility of G-C/C-G oligonucleotide) in the absence of urea to the random state (near the mobility of G-G/A-A oligonucleotide) in 7 M urea. However, the RNA oligonucleotide with G-A/A-G pair moved at an intermediate mobility between that of oligonucleotide with G-C/C-G and of the oligonucleotide with G-G/A-A, and the mobility pattern did not depend on urea concentration. Thus, DNA and RNA oligonucleotides with the G-A/A-G base pair showed a pattern indicating an intermediate structure between the rigid Watson-Crick base pair and the random structure of non-base pair. RNA with G-A/A-G base pair has the intermediate structure not influenced by urea concentration. Finally, this study indicated that the intermediate rigidity imparted by Non
Girelli Zubani, Giulia; Zivojnovic, Marija; De Smet, Annie; Albagli-Curiel, Olivier; Huetz, François; Weill, Jean-Claude; Reynaud, Claude-Agnès; Storck, Sébastien
2017-04-03
During somatic hypermutation (SHM) of immunoglobulin genes, uracils introduced by activation-induced cytidine deaminase are processed by uracil-DNA glycosylase (UNG) and mismatch repair (MMR) pathways to generate mutations at G-C and A-T base pairs, respectively. Paradoxically, the MMR-nicking complex Pms2/Mlh1 is apparently dispensable for A-T mutagenesis. Thus, how detection of U:G mismatches is translated into the single-strand nick required for error-prone synthesis is an open question. One model proposed that UNG could cooperate with MMR by excising a second uracil in the vicinity of the U:G mismatch, but it failed to explain the low impact of UNG inactivation on A-T mutagenesis. In this study, we show that uracils generated in the G1 phase in B cells can generate equal proportions of A-T and G-C mutations, which suggests that UNG and MMR can operate within the same time frame during SHM. Furthermore, we show that Ung -/- Pms2 -/- mice display a 50% reduction in mutations at A-T base pairs and that most remaining mutations at A-T bases depend on two additional uracil glycosylases, thymine-DNA glycosylase and SMUG1. These results demonstrate that Pms2/Mlh1 and multiple uracil glycosylases act jointly, each one with a distinct strand bias, to enlarge the immunoglobulin gene mutation spectrum from G-C to A-T bases. © 2017 Girelli Zubani et al.
Mohamad, Saharuddin Bin; Nagasawa, Hideko; Sasaki, Hideyuki; Uto, Yoshihiro; Nakagawa, Yoshinori; Kawashima, Ken; Hori, Hitoshi
2003-01-01
Gc protein is the precursor for Gc protein-derived macrophage activating factor (GcMAF), with three phenotypes: Gc1f, Gc1s and Gc2, based on its electrophoretic mobility. The difference in electrophoretic mobility is because of the difference in its posttranslational sugar moiety composition. We compared the difference between Gc protein and GcMAF electrophoretic mobility using the isoelectric focusing (IEF) method. The tumoricidal activity of GcMAF-treated macrophage was evaluated after coculture with L-929 cell. The tumoricidal mechanism was investigated using TNF bioassay and nitric oxide (NO) release. The difference in Gc protein and GcMAF electrophoretic mobility was detected. The tumoricidal activity of GcMAF-treated macrophage was detected, but no release of TNF and NO was detected. The difference of isoelectric focusing mobility in Gc protein and GcMAF would be useful to develop a GcMAF detection method. GcMAF increased macrophage tumoricidal activity but TNF and NO release were not involved in the mechanism.
Solid state radiation chemistry of co-crystallized DNA base pairs studied with EPR and ENDOR
International Nuclear Information System (INIS)
Nelson, W.H.; Nimmala, S.; Hole, E.O.; Sagstuen, E.; Close, D.M.
1995-01-01
For a number of years, the authors' group has focused on identification of radicals formed from x-irradiation of DNA components by application of EPR and ENDOR spectroscopic techniques to samples in the form of single crystals. With single crystals as samples, it is possible to use the detailed packing and structural information available from x-ray or neutron diffraction reports. This report summarizes results from two crystal systems in which DNA bases are paired by hydrogen bonding. Extensive results are available from one of these, 1-methyl-thymine:9-methyladenine (MTMA), in which the base pairing is the Hoogsteen configuration. Although this configuration is different from that found by Watson-Crick in DNA, nonetheless the hydrogen bond between T(O4) and A(NH 2 ) is present. Although MTMA crystals have been studied previously, the objective was to apply the high-resolution technique of ENDOR to crystals irradiated and studied at temperatures of 10 K or lower in the effort to obtain direct evidence for specific proton transfers. The second system, from which the results are only preliminary, is 9-ethylguanine:1-methyl-5-fluorocytosine (GFC) in which the G:C bases pair is in the Watson Crick configuration. Both crystal systems are anhydrous, so the results include no possible effects from water interactions
International Nuclear Information System (INIS)
Dizdaroglu, M.
1985-01-01
Application of GC-MS to characterization of radiation-induced base products of DNA and DNa base-amino acid crosslinks is presented. Samples of γ-irradiated DNa were hydrolyzed with formic acid, trimethylsilylated and subjected to GC-MS analysis using a fused silica capillary column. Hydrolysis conditions suitable for the simultaneous analysis of the radiation-induced products of all four DNA bases in a single run were determined. The trimethylsilyl derivatives of these products had excellent GC-properties and easily interpretable mass spectra. The complementary use of t-butyldimetylsilyl derivatives was also demonstrated. Moreover, the usefulness of this method for identification of radiation-induced DNA base-amino acid crosslinks was shown using γ-irradiated mixtures of thymine and tyrosine or phenylalanine. Because of the excellent resolving power of capillary GC and the instant and highly sensitive identification by MS, GC-MS is suggested as a suitable technique for identification of altered bases removed from DNA by base-excision repair enzymes
Radical-pair based avian magnetoreception
Procopio, Maria; Ritz, Thorsten
2014-03-01
Behavioural experiments suggest that migratory birds possess a magnetic compass sensor able to detect the direction of the geomagnetic. One hypothesis for the basis of this remarkable sensory ability is that the coherent quantum spin dynamics of photoinduced radical pair reactions transduces directional magnetic information from the geomagnetic field into changes of reaction yields, possibly involving the photoreceptor cryptochrome in the birds retina. The suggested radical-pair based avian magnetoreception has attracted attention in the field of quantum biology as an example of a biological sensor which might exploit quantum coherences for its biological function. Investigations on such a spin-based sensor have focussed on uncovering the design features for the design of a biomimetic magnetic field sensor. We study the effects of slow fluctuations in the nuclear spin environment on the directional signal. We quantitatively evaluate the robustness of signals under fluctuations on a timescale longer than the lifetime of a radical pair, utilizing two models of radical pairs. Our results suggest design principles for building a radical-pair based compass sensor that is both robust and highly directional sensitive.
Directory of Open Access Journals (Sweden)
Gunaseelan Goldsmith
Full Text Available Implications of DNA, RNA and RNA.DNA hybrid triplexes in diverse biological functions, diseases and therapeutic applications call for a thorough understanding of their structure-function relationships. Despite exhaustive studies mechanistic rationale for the discriminatory preference of parallel DNA triplexes with G*GC & T*AT triplets still remains elusive. Here, we show that the highest nonisostericity between the G*GC & T*AT triplets imposes extensive stereochemical rearrangements contributing to context dependent triplex destabilisation through selective disruption of Hoogsteen scheme of hydrogen bonds. MD simulations of nineteen DNA triplexes with an assortment of sequence milieu reveal for the first time fresh insights into the nature and extent of destabilization from a single (non-overlapping, double (overlapping and multiple pairs of nonisosteric base triplets (NIBTs. It is found that a solitary pair of NIBTs, feasible either at a G*GC/T*AT or T*AT/G*GC triplex junction, does not impinge significantly on triplex stability. But two overlapping pairs of NIBTs resulting from either a T*AT or a G*GC interruption disrupt Hoogsteen pair to a noncanonical mismatch destabilizing the triplex by ~10 to 14 kcal/mol, implying that their frequent incidence in multiples, especially, in short sequences could even hinder triplex formation. The results provide (i an unambiguous and generalised mechanistic rationale for the discriminatory trait of parallel triplexes, including those studied experimentally (ii clarity for the prevalence of antiparallel triplexes and (iii comprehensive perspectives on the sequence dependent influence of nonisosteric base triplets useful in the rational design of TFO's against potential triplex target sites.
International Nuclear Information System (INIS)
Chu, Wally; Weerasekera, Akila; Kim, Chul-Hyun
2017-01-01
Two identical 5′GACG3′ tetra-loop motifs with different stem sequences (called H2 and H3) are found in the 5′ end region of Moloney Murine Leukemia Virus (MMLV) genomic RNA. They play important roles in RNA dimerization and encapsidation through two identical tetra-loops (5′GACG3′) forming a loop-to-loop kissing complex, the smallest RNA kissing complex ever found in nature. We examined the effects of a loop-closing base pair as well as a stem sequence on the conformational stability of the kissing complex. UV melting analysis and gel electrophoresis were performed on eight RNA sequences mimicking the H2 and H3 hairpin tetra-loops with variation in loop-closing base pairs. Our results show that changing the loop-closing base pair from the wildtype (5′A·U3′ for H3, 5′U·A3′ for H2) to 5′G·C3’/5′C·G3′ has significant effect on the stability of the kissing complexes: the substitution to 5′C·G3′ significantly decreases both thermal and mechanical stability, while switching to the 5′G·C3′ significantly increases the mechanical stability only. The kissing complexes with the wildtype loop-closing base pairs (5′A·U3′ for H3 and 5′U·A3′ for H2) show different stability when attached to a different stem sequence (H2 stem vs. H3 stem). This suggests that not only the loop-closing base pair itself, but also the stem sequence, affects the conformational stability of the RNA kissing complex. - Highlights: • Thermodynamic parameters of the smallest RNA kissing interactions were measured. • The effects of loop-closing base pairs on the RNA kissing complex was investigated. • Changing the base pair to 5′CG3′ decreases the stability of the kissing complex. • Changing it to 5′GC3′ increases the mechanical resilience of the kissing complex. • Difference in its stem sequence also affects the stability of the kissing complex.
Directory of Open Access Journals (Sweden)
Cécile Philippe
2018-01-01
Full Text Available The Gluconobacter phage GC1 is a novel member of the Tectiviridae family isolated from a juice sample collected during dry white wine making. The bacteriophage infects Gluconobacter cerinus, an acetic acid bacterium which represents a spoilage microorganism during wine making, mainly because it is able to produce ethyl alcohol and transform it into acetic acid. Transmission electron microscopy revealed tail-less icosahedral particles with a diameter of ~78 nm. The linear double-stranded DNA genome of GC1 (16,523 base pairs contains terminal inverted repeats and carries 36 open reading frames, only a handful of which could be functionally annotated. These encode for the key proteins involved in DNA replication (protein-primed family B DNA polymerase as well as in virion structure and assembly (major capsid protein, genome packaging ATPase (adenosine triphosphatase and several minor capsid proteins. GC1 is the first tectivirus infecting an alphaproteobacterial host and is thus far the only temperate tectivirus of gram-negative bacteria. Based on distinctive sequence and life-style features, we propose that GC1 represents a new genus within the Tectiviridae, which we tentatively named “Gammatectivirus”. Furthermore, GC1 helps to bridge the gap in the sequence space between alphatectiviruses and betatectiviruses.
Kumar, Anil; Sevilla, Michael D.
2009-01-01
On one-electron oxidation all molecules including DNA bases become more acidic in nature. For the GC base pair experiments suggest that a facile proton transfer takes place in the G•+-C base pair from N1 of G•+ to N3 of cytosine. This intra-base pair proton transfer reaction has been extensively considered using theoretical methods for the gas phase and it is predicted that the proton transfer is slightly unfavorable in disagreement with experiment. In the present study, we consider the effect of the first hydration layer on the proton transfer reaction in G•+-C by the use of density functional theory (DFT), B3LYP/6-31+G** calculations of the G•+-C base pair in the presence of 6 and 11 water molecules. Under the influence of hydration of 11 waters, a facile proton transfer from N1 of G•+ to N3 of C is predicted. The zero point energy (ZPE) corrected forward and backward energy barriers, for the proton transfer from N1 of G•+ to N3 of C, was found to be 1.4 and 2.6 kcal/mol, respectively. The proton transferred G•-(H+)C + 11H2O was found to be 1.2 kcal/mol more stable than G•+-C + 11H2O in agreement with experiment. The present calculation demonstrates that the inclusion of the first hydration shell around G•+-C base pair has an important effect on the internal proton transfer energetics. PMID:19485319
Crespo-Hernandez, Carlos E; Close, David M; Gorb, Leonid; Leszczynski, Jerzy
2007-05-17
Redox potentials for the DNA nucleobases and nucleosides, various relevant nucleoside analogues, Watson-Crick base pairs, and seven organic dyes are presented based on DFT/B3LYP/6-31++G(d,p) and B3YLP/6-311+G(2df,p)//B3LYP/6-31+G* levels of calculations. The values are determined from an experimentally calibrated set of equations that correlate the vertical ionization (electron affinity) energy of 20 organic molecules with their experimental reversible oxidation (reduction) potential. Our results are in good agreement with those estimated experimentally for the DNA nucleosides in acetonitrile solutions (Seidel et al. J. Phys. Chem. 1996, 100, 5541). We have found that nucleosides with anti conformation exhibit lower oxidation potentials than the corresponding syn conformers. The lowering in the oxidation potential is due to the formation of an intramolecular hydrogen bonding interaction between the 5'-OH group of the sugar and the N3 of the purine bases or C2=O of the pyrimidine bases in the syn conformation. Pairing of adenine or guanine with its complementary pyrimidine base decreases its oxidation potential by 0.15 or 0.28 V, respectively. The calculated energy difference between the oxidation potential for the G.C base pair and that of the guanine base is in good agreement with the experimental value estimated recently (0.34 V: Caruso, T.; et al. J. Am. Chem. Soc. 2005, 127, 15040). The complete and consistent set of reversible redox values determined in this work for the DNA constituents is expected to be of considerable value to those studying charge and electronic energy transfer in DNA.
Synthesis of g-C3N4/Ag3PO4 heterojunction with enhanced photocatalytic performance
International Nuclear Information System (INIS)
He, Peizhi; Song, Limin; Zhang, Shujuan; Wu, Xiaoqing; Wei, Qingwu
2014-01-01
Graphical abstract: g-C 3 N 4 /Ag 3 PO 4 heterojunction photocatalyst with visible-light response was prepared by a facile coprecipitation method. The results show that g-C 3 N 4 /Ag 3 PO 4 possesses a much higher activity for the decomposition of RhB than that of the pure Ag 3 PO 4 particles. The most mechanism is that g-C 3 N 4 /Ag 3 PO 4 heterojunction photocatalyst can efficiently separate the photogenerated electron–hole pairs, enhancing the photocatalytic activity of g-C 3 N 4 /Ag 3 PO 4 composites. - Highlights: • g-C 3 N 4 /Ag 3 PO 4 heterojunction showed much higher activity than that of Ag 3 PO 4 . • The high activity could be attributed to g-C 3 N 4 for modifying Ag 3 PO 4 . • More ·OH radicals may be significant reason to improve Ag 3 PO 4 activity. - Abstract: g-C 3 N 4 /Ag 3 PO 4 heterojunction photocatalyst with visible-light response was prepared by a facile coprecipitation method. The photocatalysts were characterized by X-ray powder diffraction, transmission electron microscopy, UV–vis absorption spectroscopy and Fourier transform infrared spectroscopy. The photocatalytic activities of the obtained samples were tested by using Rhodamine B (RhB) as the degradation target under visible light irradiation. g-C 3 N 4 /Ag 3 PO 4 decomposed RhB more effectively than the pure Ag 3 PO 4 particles did, and 2 wt.% g-C 3 N 4 had the highest activity. Furthermore, 2 wt.% g-C 3 N 4 /Ag 3 PO 4 degraded high-concentration RhB more potently than unmodified Ag 3 PO 4 did, probably because g-C 3 N 4 /Ag 3 PO 4 heterojunction photocatalyst enhanced the photocatalytic activity by efficiently separating the photogenerated electron–hole pairs
Miyoshi, Daisuke; Nakamura, Kaori; Tateishi-Karimata, Hisae; Ohmichi, Tatsuo; Sugimoto, Naoki
2009-03-18
It has been revealed recently that molecular crowding, which is one of the largest differences between in vivo and in vitro conditions, is a critical factor determining the structure, stability, and function of nucleic acids. However, the effects of molecular crowding on Watson-Crick and Hoogsteen base pairs remain unclear. In order to investigate directly and quantitatively the molecular crowding effects on base pair types in nucleic acids, we designed intramolecular parallel- and antiparallel-stranded DNA duplexes consisting of Hoogsteen and Watson-Crick base pairs, respectively, as well as an intramolecular parallel-stranded triplex containing both types of base pairs. Thermodynamic analyses demonstrated that the values of free energy change at 25 degrees C for Hoogsteen base-pair formations decreased from +1.45 +/- 0.15 to +1.09 +/- 0.13 kcal mol(-1), and from -1.89 +/- 0.13 to -2.71 +/- 0.11 kcal mol(-1) in the intramolecular duplex and triplex, respectively, when the concentration of PEG 200 (polyethylene glycol with average molecular weight 200) increased from 0 to 20 wt %. However, corresponding values for Watson-Crick formation in the duplex and triplex increased from -10.2 +/- 0.2 to -8.7 +/- 0.1 kcal mol(-1), and from -10.8 +/- 0.2 to -9.2 +/- 0.2 kcal mol(-1), respectively. Furthermore, it was revealed that the opposing effects of molecular crowding on the Hoogsteen and Watson-Crick base pairs were due to different behaviors of water molecules binding to the DNA strands.
Jin, Peng; Chen, Yongsheng; Zhang, Shengbai B; Chen, Zhongfang
2012-02-01
The interactions between neutral Al(12)X(I ( h )) (X = Al, C, N and P) nanoparticles and DNA nucleobases, namely adenine (A), thymine (T), guanine (G) and cytosine (C), as well as the Watson-Crick base pairs (BPs) AT and GC, were investigated by means of density functional theory computations. The Al(12)X clusters can tightly bind to DNA bases and BPs to form stable complexes with negative binding Gibbs free energies at room temperature, and considerable charge transfers occur between the bases/BPs and the Al(12)X clusters. These strong interactions, which are also expected for larger Al nanoparticles, may have potentially adverse impacts on the structure and stability of DNA and thus cause its dysfunction.
Theoretical analysis of noncanonical base pairing interactions in ...
Indian Academy of Sciences (India)
PRAKASH KUMAR
Noncanonical base pairs in RNA have strong structural and functional implications but are currently not considered ..... Full optimizations of the systems were also carried out using ... of the individual bases in the base pair through the equation.
Directory of Open Access Journals (Sweden)
Yunping Qiu
2018-01-01
Full Text Available Identifying non-annotated peaks may have a significant impact on the understanding of biological systems. In silico methodologies have focused on ESI LC/MS/MS for identifying non-annotated MS peaks. In this study, we employed in silico methodology to develop an Isotopic Ratio Outlier Analysis (IROA workflow using enhanced mass spectrometric data acquired with the ultra-high resolution GC-Orbitrap/MS to determine the identity of non-annotated metabolites. The higher resolution of the GC-Orbitrap/MS, together with its wide dynamic range, resulted in more IROA peak pairs detected, and increased reliability of chemical formulae generation (CFG. IROA uses two different 13C-enriched carbon sources (randomized 95% 12C and 95% 13C to produce mirror image isotopologue pairs, whose mass difference reveals the carbon chain length (n, which aids in the identification of endogenous metabolites. Accurate m/z, n, and derivatization information are obtained from our GC/MS workflow for unknown metabolite identification, and aids in silico methodologies for identifying isomeric and non-annotated metabolites. We were able to mine more mass spectral information using the same Saccharomyces cerevisiae growth protocol (Qiu et al. Anal. Chem 2016 with the ultra-high resolution GC-Orbitrap/MS, using 10% ammonia in methane as the CI reagent gas. We identified 244 IROA peaks pairs, which significantly increased IROA detection capability compared with our previous report (126 IROA peak pairs using a GC-TOF/MS machine. For 55 selected metabolites identified from matched IROA CI and EI spectra, using the GC-Orbitrap/MS vs. GC-TOF/MS, the average mass deviation for GC-Orbitrap/MS was 1.48 ppm, however, the average mass deviation was 32.2 ppm for the GC-TOF/MS machine. In summary, the higher resolution and wider dynamic range of the GC-Orbitrap/MS enabled more accurate CFG, and the coupling of accurate mass GC/MS IROA methodology with in silico fragmentation has great
Qiu, Yunping; Moir, Robyn D; Willis, Ian M; Seethapathy, Suresh; Biniakewitz, Robert C; Kurland, Irwin J
2018-01-18
Identifying non-annotated peaks may have a significant impact on the understanding of biological systems. In silico methodologies have focused on ESI LC/MS/MS for identifying non-annotated MS peaks. In this study, we employed in silico methodology to develop an Isotopic Ratio Outlier Analysis (IROA) workflow using enhanced mass spectrometric data acquired with the ultra-high resolution GC-Orbitrap/MS to determine the identity of non-annotated metabolites. The higher resolution of the GC-Orbitrap/MS, together with its wide dynamic range, resulted in more IROA peak pairs detected, and increased reliability of chemical formulae generation (CFG). IROA uses two different 13 C-enriched carbon sources (randomized 95% 12 C and 95% 13 C) to produce mirror image isotopologue pairs, whose mass difference reveals the carbon chain length (n), which aids in the identification of endogenous metabolites. Accurate m/z, n, and derivatization information are obtained from our GC/MS workflow for unknown metabolite identification, and aids in silico methodologies for identifying isomeric and non-annotated metabolites. We were able to mine more mass spectral information using the same Saccharomyces cerevisiae growth protocol (Qiu et al. Anal. Chem 2016) with the ultra-high resolution GC-Orbitrap/MS, using 10% ammonia in methane as the CI reagent gas. We identified 244 IROA peaks pairs, which significantly increased IROA detection capability compared with our previous report (126 IROA peak pairs using a GC-TOF/MS machine). For 55 selected metabolites identified from matched IROA CI and EI spectra, using the GC-Orbitrap/MS vs. GC-TOF/MS, the average mass deviation for GC-Orbitrap/MS was 1.48 ppm, however, the average mass deviation was 32.2 ppm for the GC-TOF/MS machine. In summary, the higher resolution and wider dynamic range of the GC-Orbitrap/MS enabled more accurate CFG, and the coupling of accurate mass GC/MS IROA methodology with in silico fragmentation has great potential in
Analysis of Alkaloids from Physalis peruviana by Capillary GC, Capillary GC-MS, and GC-FTIR.
Kubwabo, C; Rollmann, B; Tilquin, B
1993-04-01
The alkaloid composition of the aerial parts and roots of PHYSALIS PERUVIANA was analysed by capillary GC (GC (2)), GC (2)-MS and GC (2)-FTIR. Eight alkaloids were identified, three of those alkaloids are 3beta-acetoxytropane and two N-methylpyrrolidinylhygrine isomers, which were not previously found in the genus PHYSALIS. A reproduction of the identification of alkaloids detected in the plant by the use of retention indices has been proposed.
Separation of fatty acid methyl esters by GC-online hydrogenation × GC.
Delmonte, Pierluigi; Fardin-Kia, Ali Reza; Rader, Jeanne I
2013-02-05
The separation of fatty acid methyl esters (FAME) provided by a 200 m × 0.25 mm SLB-IL111 capillary column is enhanced by adding a second dimension of separation ((2)D) in a GC × GC design. Rather than employing two GC columns of different polarities or using different elution temperatures, the separation in the two-dimensional space is achieved by altering the chemical structure of selected analytes between the two dimensions of separation. A capillary tube coated with palladium is added between the first dimension of separation ((1)D) column and the cryogenic modulator, providing the reduction of unsaturated FAMEs to their fully saturated forms. The (2)D separation is achieved using a 2.5 m × 0.10 mm SLB-IL111 capillary column and separates FAMEs based solely on their carbon skeleton. The two-dimensional separation can be easily interpreted based on the principle that all the saturated FAMEs lie on a straight diagonal line bisecting the separation plane, while the FAMEs with the same carbon skeleton but differing in the number, geometric configuration or position of double bonds lie on lines parallel to the (1)D time axis. This technique allows the separation of trans fatty acids (FAs) and polyunsaturated FAs (PUFAs) in a single experiment and eliminates the overlap between PUFAs with different chain lengths. To our knowledge, this the first example of GC × GC in which a chemical change is instituted between the two dimensions to alter the relative retentions of components and identify unsaturated FAMEs.
Lamping, Erwin; Niimi, Masakazu; Cannon, Richard D
2013-07-29
A large range of genetic tools has been developed for the optimal design and regulation of complex metabolic pathways in bacteria. However, fewer tools exist in yeast that can precisely tune the expression of individual enzymes in novel metabolic pathways suitable for industrial-scale production of non-natural compounds. Tuning expression levels is critical for reducing the metabolic burden of over-expressed proteins, the accumulation of toxic intermediates, and for redirecting metabolic flux from native pathways involving essential enzymes without negatively affecting the viability of the host. We have developed a yeast membrane protein hyper-expression system with critical advantages over conventional, plasmid-based, expression systems. However, expression levels are sometimes so high that they adversely affect protein targeting/folding or the growth and/or phenotype of the host. Here we describe the use of small synthetic mRNA control modules that allowed us to predictably tune protein expression levels to any desired level. Down-regulation of expression was achieved by engineering small GC-rich mRNA stem-loops into the 5' UTR that inhibited translation initiation of the yeast ribosomal 43S preinitiation complex (PIC). Exploiting the fact that the yeast 43S PIC has great difficulty scanning through GC-rich mRNA stem-loops, we created yeast strains containing 17 different RNA stem-loop modules in the 5' UTR that expressed varying amounts of the fungal multidrug efflux pump reporter Cdr1p from Candida albicans. Increasing the length of mRNA stem-loops (that contained only GC-pairs) near the AUG start-codon led to a surprisingly large decrease in Cdr1p expression; ~2.7-fold for every additional GC-pair added to the stem, while the mRNA levels remained largely unaffected. An mRNA stem-loop of seven GC-pairs (∆G = -15.8 kcal/mol) reduced Cdr1p expression levels by >99%, and even the smallest possible stem-loop of only three GC-pairs (∆G = -4.4 kcal/mol) inhibited
Volume overload cleanup: An approach for on-line SPE-GC, GPC-GC, and GPC-SPE-GC
Kerkdijk, H.; Mol, H.G.J.; Nagel, B. van der
2007-01-01
A new concept for cleanup, based on volume overloading of the cleanup column, has been developed for on-line coupling of gel permeation chromatography (GPC), solid-phase extraction (SPE), or both, to gas chromatography (GC). The principle is outlined and the applicability demonstrated by the
Changes in DNA base sequence induced by gamma-ray mutagenesis of lambda phage and prophage
Energy Technology Data Exchange (ETDEWEB)
Tindall, K.R.; Stein, J.; Hutchinson, F.
1988-04-01
Mutations in the cI (repressor) gene were induced by gamma-ray irradiation of lambda phage and of prophage, and 121 mutations were sequenced. Two-thirds of the mutations in irradiated phage assayed in recA host cells (no induction of the SOS response) were G:C to A:T transitions; it is hypothesized that these may arise during DNA replication from adenine mispairing with a cytosine product deaminated by irradiation. For irradiated phage assayed in host cells in which the SOS response had been induced, 85% of the mutations were base substitutions, and in 40 of the 41 base changes, a preexisting base pair had been replaced by an A:T pair; these might come from damaged bases acting as AP (apurinic or apyrimidinic) sites. The remaining mutations were 1 and 2 base deletions. In irradiated prophage, base change mutations involved the substitution of both A:T and of G:C pairs for the preexisting pairs; the substitution of G:C pairs shows that some base substitution mechanism acts on the cell genome but not on the phage. In the irradiated prophage, frameshifts and a significant number of gross rearrangements were also found.
Parsons, Brendon A; Marney, Luke C; Siegler, W Christopher; Hoggard, Jamin C; Wright, Bob W; Synovec, Robert E
2015-04-07
Comprehensive two-dimensional (2D) gas chromatography coupled with time-of-flight mass spectrometry (GC × GC-TOFMS) is a versatile instrumental platform capable of collecting highly informative, yet highly complex, chemical data for a variety of samples. Fisher-ratio (F-ratio) analysis applied to the supervised comparison of sample classes algorithmically reduces complex GC × GC-TOFMS data sets to find class distinguishing chemical features. F-ratio analysis, using a tile-based algorithm, significantly reduces the adverse effects of chromatographic misalignment and spurious covariance of the detected signal, enhancing the discovery of true positives while simultaneously reducing the likelihood of detecting false positives. Herein, we report a study using tile-based F-ratio analysis whereby four non-native analytes were spiked into diesel fuel at several concentrations ranging from 0 to 100 ppm. Spike level comparisons were performed in two regimes: comparing the spiked samples to the nonspiked fuel matrix and to each other at relative concentration factors of two. Redundant hits were algorithmically removed by refocusing the tiled results onto the original high resolution pixel level data. To objectively limit the tile-based F-ratio results to only features which are statistically likely to be true positives, we developed a combinatorial technique using null class comparisons, called null distribution analysis, by which we determined a statistically defensible F-ratio cutoff for the analysis of the hit list. After applying null distribution analysis, spiked analytes were reliably discovered at ∼1 to ∼10 ppm (∼5 to ∼50 pg using a 200:1 split), depending upon the degree of mass spectral selectivity and 2D chromatographic resolution, with minimal occurrence of false positives. To place the relevance of this work among other methods in this field, results are compared to those for pixel and peak table-based approaches.
2013-01-01
Background A large range of genetic tools has been developed for the optimal design and regulation of complex metabolic pathways in bacteria. However, fewer tools exist in yeast that can precisely tune the expression of individual enzymes in novel metabolic pathways suitable for industrial-scale production of non-natural compounds. Tuning expression levels is critical for reducing the metabolic burden of over-expressed proteins, the accumulation of toxic intermediates, and for redirecting metabolic flux from native pathways involving essential enzymes without negatively affecting the viability of the host. We have developed a yeast membrane protein hyper-expression system with critical advantages over conventional, plasmid-based, expression systems. However, expression levels are sometimes so high that they adversely affect protein targeting/folding or the growth and/or phenotype of the host. Here we describe the use of small synthetic mRNA control modules that allowed us to predictably tune protein expression levels to any desired level. Down-regulation of expression was achieved by engineering small GC-rich mRNA stem-loops into the 5′ UTR that inhibited translation initiation of the yeast ribosomal 43S preinitiation complex (PIC). Results Exploiting the fact that the yeast 43S PIC has great difficulty scanning through GC-rich mRNA stem-loops, we created yeast strains containing 17 different RNA stem-loop modules in the 5′ UTR that expressed varying amounts of the fungal multidrug efflux pump reporter Cdr1p from Candida albicans. Increasing the length of mRNA stem-loops (that contained only GC-pairs) near the AUG start-codon led to a surprisingly large decrease in Cdr1p expression; ~2.7-fold for every additional GC-pair added to the stem, while the mRNA levels remained largely unaffected. An mRNA stem-loop of seven GC-pairs (∆G = −15.8 kcal/mol) reduced Cdr1p expression levels by >99%, and even the smallest possible stem-loop of only three GC-pairs (
Directory of Open Access Journals (Sweden)
Zhitao Niu
2017-11-01
Full Text Available The variation of GC content is a key genome feature because it is associated with fundamental elements of genome organization. However, the reason for this variation is still an open question. Different kinds of hypotheses have been proposed to explain the variation of GC content during genome evolution. However, these hypotheses have not been explicitly investigated in whole plastome sequences. Dendrobium is one of the largest genera in the orchid species. Evolutionary studies of the plastomic organization and base composition are limited in this genus. In this study, we obtained the high-quality plastome sequences of D. loddigesii and D. devonianum. The comparison results showed a nearly identical organization in Dendrobium plastomes, indicating that the plastomic organization is highly conserved in Dendrobium genus. Furthermore, the impact of three evolutionary forces—selection, mutational biases, and GC-biased gene conversion (gBGC—on the variation of GC content in Dendrobium plastomes was evaluated. Our results revealed: (1 consistent GC content evolution trends and mutational biases in single-copy (SC and inverted repeats (IRs regions; and (2 that gBGC has influenced the plastome-wide GC content evolution. These results suggest that both mutational biases and gBGC affect GC content in the plastomes of Dendrobium genus.
Niu, Zhitao; Xue, Qingyun; Wang, Hui; Xie, Xuezhu; Zhu, Shuying; Liu, Wei; Ding, Xiaoyu
2017-01-01
The variation of GC content is a key genome feature because it is associated with fundamental elements of genome organization. However, the reason for this variation is still an open question. Different kinds of hypotheses have been proposed to explain the variation of GC content during genome evolution. However, these hypotheses have not been explicitly investigated in whole plastome sequences. Dendrobium is one of the largest genera in the orchid species. Evolutionary studies of the plastomic organization and base composition are limited in this genus. In this study, we obtained the high-quality plastome sequences of D. loddigesii and D. devonianum. The comparison results showed a nearly identical organization in Dendrobium plastomes, indicating that the plastomic organization is highly conserved in Dendrobium genus. Furthermore, the impact of three evolutionary forces—selection, mutational biases, and GC-biased gene conversion (gBGC)—on the variation of GC content in Dendrobium plastomes was evaluated. Our results revealed: (1) consistent GC content evolution trends and mutational biases in single-copy (SC) and inverted repeats (IRs) regions; and (2) that gBGC has influenced the plastome-wide GC content evolution. These results suggest that both mutational biases and gBGC affect GC content in the plastomes of Dendrobium genus. PMID:29099062
Learning preferences from paired opposite-based semantics
DEFF Research Database (Denmark)
Franco de los Ríos, Camilo; Rodríguez, J. Tinguaro; Montero, Javier
2017-01-01
Preference semantics examine the meaning of the preference predicate, according to the way that alternatives can be understood and organized for decision making purposes. Through opposite-based semantics, preference structures can be characterized by their paired decomposition of preference...... on the character of opposition, the compound meaning of preference emerges from the fuzzy reinforcement of paired opposite concepts, searching for significant evidence for affirming dominance among the decision objects. Here we propose a general model for the paired decomposition of preference, examining its...
Nanjunda, Rupesh; Wilson, W. David
2012-01-01
Compounds that bind in the DNA minor groove have provided critical information on DNA molecular recognition, they have found extensive uses in biotechnology and they are providing clinically useful drugs against diseases as diverse as cancer and sleeping sickness. This review focuses on the development of clinically useful heterocyclic diamidine minor groove binders. These compounds have shown us that the classical model for minor groove binding in AT DNA sequences must be expanded in several ways: compounds with nonstandard shapes can bind strongly to the groove, water can be directly incorporated into the minor groove complex in an interfacial interaction, and the compounds can form cooperative stacked dimers to recognize GC and mixed AT/GC base pair sequences. PMID:23255206
Widespread Transient Hoogsteen Base-Pairs in Canonical Duplex DNA with Variable Energetics
Alvey, Heidi S.; Gottardo, Federico L.; Nikolova, Evgenia N.; Al-Hashimi, Hashim M.
2015-01-01
Hoogsteen base-pairing involves a 180 degree rotation of the purine base relative to Watson-Crick base-pairing within DNA duplexes, creating alternative DNA conformations that can play roles in recognition, damage induction, and replication. Here, using Nuclear Magnetic Resonance R1ρ relaxation dispersion, we show that transient Hoogsteen base-pairs occur across more diverse sequence and positional contexts than previously anticipated. We observe sequence-specific variations in Hoogsteen base-pair energetic stabilities that are comparable to variations in Watson-Crick base-pair stability, with Hoogsteen base-pairs being more abundant for energetically less favorable Watson-Crick base-pairs. Our results suggest that the variations in Hoogsteen stabilities and rates of formation are dominated by variations in Watson-Crick base pair stability, suggesting a late transition state for the Watson-Crick to Hoogsteen conformational switch. The occurrence of sequence and position-dependent Hoogsteen base-pairs provide a new potential mechanism for achieving sequence-dependent DNA transactions. PMID:25185517
Energy Technology Data Exchange (ETDEWEB)
Neitzel, P.L.; Walther, W. [Dresden University of Technology, Institute for Groundwater Managemant, Dresden (Germany); Nestler, W. [Institute for Technology and Economics, Department of Civil Engineering and Architecture, Dresden (Germany)
1998-06-01
Strongly polar organic substances like halogenated acetic acids have been analyzed in surface water and groundwater in the catchment area of the upper Elbe river in Saxony since 1992. Coming directly from anthropogenic sources like industry, agriculture and indirectly by rainfall, their concentrations can increase up to 100 {mu}g/L in the aquatic environment of this catchment area. A new static headspace GC-MSD method without a manual pre-concentration step is presented to analyze the chlorinated acetic acids relevant to the Elbe river as their volatile methyl esters. Using an ion-pairing agent as modifier for the in-situ methylation of the analytes by dimethylsulfate, a minimal detection limit of 1 {mu}g/L can be achieved. Problems like the thermal degradation of chlorinated acetic acids to halogenated hydrocarbons and changing reaction yields during the headspace methylation, could be effectively reduced. The method has been successfully applied to monitoring bank infiltrate, surface water, groundwater and water works pumped raw water according to health provision principles. (orig.) With 3 figs., 2 tabs., 29 refs.
A novel assay of DGAT activity based on high temperature GC/MS of triacylglycerol.
Greer, Michael S; Zhou, Ting; Weselake, Randall J
2014-08-01
Diacylglycerol acyltransferase (DGAT) catalyzes the final step in the acyl-CoA-dependent biosynthesis of triacylglycerol (TAG), a high-energy compound composed of three fatty acids esterified to a glycerol backbone. In vitro DGAT assays, which are usually conducted with radiolabeled substrate using microsomal fractions, have been useful in identifying compounds and genetic modifications that affect DGAT activity. Here, we describe a high-temperature gas chromatography (GC)/mass spectrometry (MS)-based method for monitoring molecular species of TAG produced by the catalytic action of microsomal DGAT. This method circumvents the need for radiolabeled or modified substrates, and only requires a simple lipid extraction prior to GC. The utility of the method is demonstrated using a recombinant type-1 Brassica napus DGAT produced in a strain of Saccharomyces cerevisae that is deficient in TAG synthesis. The GC/MS-based assay of DGAT activity was strongly correlated with the typical in vitro assay of the enzyme using [1-(14)C] acyl-CoA as an acyl donor. In addition to determining DGAT activity, the method is also useful for determining substrate specificity and selectivity properties of the enzyme.
Guo, Yanru; Xiao, Limin; Zhang, Min; Li, Qiuye; Yang, Jianjun
2018-05-01
An oxygen-vacancy-rich Z-scheme g-C3N4/Pd/TiO2 ternary nanocomposite was fabricated using nanotubular titanic acid as precursors via a simple photo-deposition of Pd nanoparticles and calcination process. The prepared nanocomposites were investigated by X-ray diffraction, transmission electron microscopy, X-ray photoelectron spectroscopy, and UV-visible diffuse reflectance spectroscopy, respectively. For g-C3N4/TiO2 binary nanocomposites, at the optimal content of g-C3N4 (2%), the apparent photocatalytic activity of 2%g-C3N4/TiO2 was 9 times higher than that of pure TiO2 under visible-light illumination. After deposition of Pd (1 wt%) at the contact interface between g-C3N4 and TiO2, the 2%g-C3N4/Pd/TiO2 ternary nanocomposites demonstrated the highest visible-light-driven photocatalytic activity for the degradation of gaseous propylene, which was 16- and 2-fold higher activities than pure TiO2 and 2%g-C3N4/TiO2, respectively. The mechanism for the enhanced photocatalytic performance of the g-C3N4/Pd/TiO2 photo-catalyst is proposed to be based on the efficient separation of photo-generated electron-hole pairs through Z-scheme system, in which uniform dispersity of Pd nanoparticles at contact interface between g-C3N4 and TiO2 and oxygen vacancies promote charge separation.
DEFF Research Database (Denmark)
Christiansen, Maja; Jørgensen, Charlotte S; Laursen, Inga
2007-01-01
-survival of patients with fulminant hepatic failure and trauma. Here, we characterize the dominant isoforms of plasma-derived Gc globulin from Cohn fraction IV paste with respect to amino acid sequence and posttranslational modifications. Gc globulin was purified in large scale and the isoforms separated by ion...
Envisaging quantum transport phenomenon in a muddled base pair of DNA
Vohra, Rajan; Sawhney, Ravinder Singh
2018-05-01
The effect of muddled base pair on electron transfer through a deoxyribonucleic acid (DNA) molecule connected to the gold electrodes has been elucidated using tight binding model. The effect of hydrogen and nitrogen bonds on the resistance of the base pair has been minutely observed. Using the semiempirical extended Huckel approach within NEGF regime, we have determined the current and conductance vs. bias voltage for disordered base pairs of DNA made of thymine (T) and adenine (A). The asymmetrical behaviour amid five times depreciation in the current characteristics has been observed for deviated Au-AT base pair-Au devices. An interesting revelation is that the conductance of the intrinsic AT base pair configuration attains dramatically high values with the symmetrical zig-zag pattern of current, which clearly indicates the transformation of the bond length within the strands of base pair when compared with other samples. A thorough investigation of the transmission coefficients T( E) and HOMO-LUMO gap reveals the misalignment of the strands in base pairs of DNA. The observed results present an insight to extend this work to build biosensing devices to predict the abnormality with the DNA.
Szulik, Marta W; Pallan, Pradeep S; Nocek, Boguslaw; Voehler, Markus; Banerjee, Surajit; Brooks, Sonja; Joachimiak, Andrzej; Egli, Martin; Eichman, Brandt F; Stone, Michael P
2015-02-10
5-Hydroxymethylcytosine (5hmC), 5-formylcytosine (5fC), and 5-carboxylcytosine (5caC) form during active demethylation of 5-methylcytosine (5mC) and are implicated in epigenetic regulation of the genome. They are differentially processed by thymine DNA glycosylase (TDG), an enzyme involved in active demethylation of 5mC. Three modified Dickerson-Drew dodecamer (DDD) sequences, amenable to crystallographic and spectroscopic analyses and containing the 5'-CG-3' sequence associated with genomic cytosine methylation, containing 5hmC, 5fC, or 5caC placed site-specifically into the 5'-T(8)X(9)G(10)-3' sequence of the DDD, were compared. The presence of 5caC at the X(9) base increased the stability of the DDD, whereas 5hmC or 5fC did not. Both 5hmC and 5fC increased imino proton exchange rates and calculated rate constants for base pair opening at the neighboring base pair A(5):T(8), whereas 5caC did not. At the oxidized base pair G(4):X(9), 5fC exhibited an increase in the imino proton exchange rate and the calculated kop. In all cases, minimal effects to imino proton exchange rates occurred at the neighboring base pair C(3):G(10). No evidence was observed for imino tautomerization, accompanied by wobble base pairing, for 5hmC, 5fC, or 5caC when positioned at base pair G(4):X(9); each favored Watson-Crick base pairing. However, both 5fC and 5caC exhibited intranucleobase hydrogen bonding between their formyl or carboxyl oxygens, respectively, and the adjacent cytosine N(4) exocyclic amines. The lesion-specific differences observed in the DDD may be implicated in recognition of 5hmC, 5fC, or 5caC in DNA by TDG. However, they do not correlate with differential excision of 5hmC, 5fC, or 5caC by TDG, which may be mediated by differences in transition states of the enzyme-bound complexes.
2016-01-01
5-Hydroxymethylcytosine (5hmC), 5-formylcytosine (5fC), and 5-carboxylcytosine (5caC) form during active demethylation of 5-methylcytosine (5mC) and are implicated in epigenetic regulation of the genome. They are differentially processed by thymine DNA glycosylase (TDG), an enzyme involved in active demethylation of 5mC. Three modified Dickerson–Drew dodecamer (DDD) sequences, amenable to crystallographic and spectroscopic analyses and containing the 5′-CG-3′ sequence associated with genomic cytosine methylation, containing 5hmC, 5fC, or 5caC placed site-specifically into the 5′-T8X9G10-3′ sequence of the DDD, were compared. The presence of 5caC at the X9 base increased the stability of the DDD, whereas 5hmC or 5fC did not. Both 5hmC and 5fC increased imino proton exchange rates and calculated rate constants for base pair opening at the neighboring base pair A5:T8, whereas 5caC did not. At the oxidized base pair G4:X9, 5fC exhibited an increase in the imino proton exchange rate and the calculated kop. In all cases, minimal effects to imino proton exchange rates occurred at the neighboring base pair C3:G10. No evidence was observed for imino tautomerization, accompanied by wobble base pairing, for 5hmC, 5fC, or 5caC when positioned at base pair G4:X9; each favored Watson–Crick base pairing. However, both 5fC and 5caC exhibited intranucleobase hydrogen bonding between their formyl or carboxyl oxygens, respectively, and the adjacent cytosine N4 exocyclic amines. The lesion-specific differences observed in the DDD may be implicated in recognition of 5hmC, 5fC, or 5caC in DNA by TDG. However, they do not correlate with differential excision of 5hmC, 5fC, or 5caC by TDG, which may be mediated by differences in transition states of the enzyme-bound complexes. PMID:25632825
Analysis of intra-genomic GC content homogeneity within prokaryotes
DEFF Research Database (Denmark)
Bohlin, J; Snipen, L; Hardy, S.P.
2010-01-01
the GC content varies within microbial genomes to assess whether this property can be associated with certain biological functions related to the organism's environment and phylogeny. We utilize a new quantity GCVAR, the intra-genomic GC content variability with respect to the average GC content......Bacterial genomes possess varying GC content (total guanines (Gs) and cytosines (Cs) per total of the four bases within the genome) but within a given genome, GC content can vary locally along the chromosome, with some regions significantly more or less GC rich than on average. We have examined how...... both aerobic and facultative microbes. Although an association has previously been found between mean genomic GC content and oxygen requirement, our analysis suggests that no such association exits when phylogenetic bias is accounted for. A significant association between GCVAR and mean GC content...
Immunotherapy for Prostate Cancer with Gc Protein-Derived Macrophage-Activating Factor, GcMAF.
Yamamoto, Nobuto; Suyama, Hirofumi; Yamamoto, Nobuyuki
2008-07-01
Serum Gc protein (known as vitamin D(3)-binding protein) is the precursor for the principal macrophage-activating factor (MAF). The MAF precursor activity of serum Gc protein of prostate cancer patients was lost or reduced because Gc protein was deglycosylated by serum alpha-N-acetylgalactosaminidase (Nagalase) secreted from cancerous cells. Therefore, macrophages of prostate cancer patients having deglycosylated Gc protein cannot be activated, leading to immunosuppression. Stepwise treatment of purified Gc protein with immobilized beta-galactosidase and sialidase generated the most potent MAF (termed GcMAF) ever discovered, which produces no adverse effect in humans. Macrophages activated by GcMAF develop a considerable variation of receptors that recognize the abnormality in malignant cell surface and are highly tumoricidal. Sixteen nonanemic prostate cancer patients received weekly administration of 100 ng of GcMAF. As the MAF precursor activity increased, their serum Nagalase activity decreased. Because serum Nagalase activity is proportional to tumor burden, the entire time course analysis for GcMAF therapy was monitored by measuring the serum Nagalase activity. After 14 to 25 weekly administrations of GcMAF (100 ng/week), all 16 patients had very low serum Nagalase levels equivalent to those of healthy control values, indicating that these patients are tumor-free. No recurrence occurred for 7 years.
Torigoe, Hidetaka; Okamoto, Itaru; Dairaku, Takenori; Tanaka, Yoshiyuki; Ono, Akira; Kozasa, Tetsuo
2012-11-01
Metal ion-nucleic acid interactions have attracted considerable interest for their involvement in structure formation and catalytic activity of nucleic acids. Although interactions between metal ion and mismatched base pair duplex are important to understand mechanism of gene mutations related to heavy metal ions, they have not been well-characterized. We recently found that the Ag(+) ion stabilized a C:C mismatched base pair duplex DNA. A C-Ag-C metal-mediated base pair was supposed to be formed by the binding between the Ag(+) ion and the C:C mismatched base pair to stabilize the duplex. Here, we examined specificity, thermodynamics and structure of possible C-Ag-C metal-mediated base pair. UV melting indicated that only the duplex with the C:C mismatched base pair, and not of the duplexes with the perfectly matched and other mismatched base pairs, was specifically stabilized on adding the Ag(+) ion. Isothermal titration calorimetry demonstrated that the Ag(+) ion specifically bound with the C:C base pair at 1:1 molar ratio with a binding constant of 10(6) M(-1), which was significantly larger than those for nonspecific metal ion-DNA interactions. Electrospray ionization mass spectrometry also supported the specific 1:1 binding between the Ag(+) ion and the C:C base pair. Circular dichroism spectroscopy and NMR revealed that the Ag(+) ion may bind with the N3 positions of the C:C base pair without distorting the higher-order structure of the duplex. We conclude that the specific formation of C-Ag-C base pair with large binding affinity would provide a binding mode of metal ion-DNA interactions, similar to that of the previously reported T-Hg-T base pair. The C-Ag-C base pair may be useful not only for understanding of molecular mechanism of gene mutations related to heavy metal ions but also for wide variety of potential applications of metal-mediated base pairs in various fields, such as material, life and environmental sciences. Copyright © 2012 Elsevier
Structure of 2,4-Diaminopyrimidine - Theobromine Alternate Base Pairs
Gengeliczki, Zsolt; Callahan, Michael P.; Kabelac, Martin; Rijs, Anouk M.; deVries, Mattanjah S.
2011-01-01
We report the structure of clusters of 2,4-diaminopyrimidine with 3,7-dimethylxanthine (theobromine) in the gas phase determined by IR-UV double resonance spectroscopy in both the near-IR and mid-IR regions in combination with ab initio computations. These clusters represent potential alternate nucleobase pairs, geometrically equivalent to guanine-cytosine. We have found the four lowest energy structures, which include the Watson-Crick base pairing motif. This Watson-Crick structure has not been observed by resonant two-photon ionization (R2PI) in the gas phase for the canonical DNA base pairs.
Hoogsteen base pairs proximal and distal to echinomycin binding sites on DNA
International Nuclear Information System (INIS)
Mendel, D.; Dervan, P.B.
1987-01-01
Forms of the DNA double helix containing non-Watson-Crick base-pairing have been discovered recently based on x-ray diffraction analysis of quionoxaline antibiotic-oligonucleotide complexes. In an effort to find evidence for Hoogsteen base-pairing at quinoxaline-binding sites in solution, chemical footprinting (differential cleavage reactivity) of echinomycin bound to DNA restriction fragments was examined. The authors report that purines (A>G) in the first and/or fourth base-pair positions of occupied echinomycin-binding sites are hyperreactive to diethyl pyrocarbonate. The correspondence of the solid-state data and the sites of diethyl pyrocarbonate hyperreactivity suggests that diethyl pyrocarbonate may be a sensitive reagent for the detection of Hoogsteen base-pairing in solution. Moreover, a 12-base-pair segment of alternating A-T DNA, which is 6 base pairs away from the nearest strong echinomycin-binding site, is also hyperreactive to diethyl pyrocarbonate in the presence of echinomycin. This hyperreactive segment may be an altered form of right-handed DNA that is entirely Hoogsteen base-paired
Directory of Open Access Journals (Sweden)
Tihana Jovanic
Full Text Available Somatic hypermutation (SHM of immunoglobulin genes is currently viewed as a two step process initiated by the deamination of deoxycytidine (C to deoxyuridine (U, catalysed by the activation induced deaminase (AID. Phase 1 mutations arise from DNA replication across the uracil residue or the abasic site, generated by the uracil-DNA glycosylase, yielding transitions or transversions at G:C pairs. Phase 2 mutations result from the recognition of the U:G mismatch by the Msh2/Msh6 complex (MutS Homologue, followed by the excision of the mismatched nucleotide and the repair, by the low fidelity DNA polymerase eta, of the gap generated by the exonuclease I. These mutations are mainly focused at A:T pairs. Whereas in activated B cells both G:C and A:T pairs are equally targeted, ectopic expression of AID was shown to trigger only G:C mutations on a stably integrated reporter gene. Here we show that when using non-replicative episomal vectors containing a GFP gene, inactivated by the introduction of stop codons at various positions, a high level of EGFP positive cells was obtained after transient expression in Jurkat cells constitutively expressing AID. We show that mutations at G:C and A:T pairs are produced. EGFP positive cells are obtained in the absence of vector replication demonstrating that the mutations are dependent only on the mismatch repair (MMR pathway. This implies that the generation of phase 1 mutations is not a prerequisite for the expression of phase 2 mutations.
Bende, Attila; Muntean, Cristina M
2014-03-01
The theoretical IR and Raman spectra of the guanine-cytosine DNA base pairs in Watson-Crick and Hoogsteen configurations were computed using DFT method with M06-2X meta-hybrid GGA exchange-correlation functional, including the anharmonic corrections and solvent effects. The results for harmonic frequencies and their anharmonic corrections were compared with our previously calculated values obtained with the B3PW91 hybrid GGA functional. Significant differences were obtained for the anharmonic corrections calculated with the two different DFT functionals, especially for the stretching modes, while the corresponding harmonic frequencies did not differ considerable. For the Hoogtseen case the H⁺ vibration between the G-C base pair can be characterized as an asymmetric Duffing oscillator and therefore unrealistic anharmonic corrections for normal modes where this proton vibration is involved have been obtained. The spectral modification due to the anharmonic corrections, solvent effects and the influence of sugar-phosphate group for the Watson-Crick and Hoogsteen base pair configurations, respectively, were also discussed. For the Watson-Crick case also the influence of the stacking interaction on the theoretical IR and Raman spectra was analyzed. Including the anharmonic correction in our normal mode analysis is essential if one wants to obtain correct assignments of the theoretical frequency values as compared with the experimental spectra.
Unstable Hoogsteen base pairs adjacent to echinomycin binding sites within a DNA duplex
International Nuclear Information System (INIS)
Gilbert, D.E.; van der Marel, G.A.; van Boom, J.H.; Feigon, J.
1989-01-01
The bisintercalation complex present between the DNA octamer [d(ACGTACGT)] 2 and the cyclic octadepsipeptide antibiotic echinomycin has been studied by one- and two-dimensional proton NMR, and the results obtained have been compared with the crystal structures of related DNA-echinomycin complexes. Two echinomycins are found to bind cooperatively to each DNA duplex at the CpG steps, with the two quinoxaline rings of each echinomycin bisintercalating between the C·G and A·T base pairs. At low temperatures, the A·T base pairs on either side of the intercalation site adopt the Hoogsteen conformation, as observed in the crystal structures. However, as the temperature is raised, the Hoogsteen base pairs in the interior of the duplex are destabilized and are observed to be exchanging between the Hoogsteen base pair and either an open or a Watson-Crick base-paired state. The terminal A·T base pairs, which are not as constrained by the helix as the internal base pairs, remain stably Hoogsteen base-paired up to at least 45 degree C. The implications of these results for the biological role of Hoogsteen base pairs in echinomycin-DNA complexes in vivo are discussed
Troppová, Ivana; Šihor, Marcel; Reli, Martin; Ritz, Michal; Praus, Petr; Kočí, Kamila
2018-02-01
The TiO2/g-C3N4 nanocomposites with the various TiO2:g-C3N4 weight ratios from 1:1 to 1:3 were prepared unconventionally by pressurized hot water processing in a flow regime. The parent TiO2 and g-C3N4 was prepared by thermal hydrolysis and thermal annealing, respectively. The nanocomposites as well as parent TiO2 and g-C3N4 were characterized using several complementary characterization methods and investigated in the photocatalytic decomposition of N2O under UVA (λ = 365 nm) irradiation. All the prepared TiO2/g-C3N4 nanocomposites showed higher photocatalytic activity in comparison with the pure g-C3N4 and chiefly pure TiO2. The photocatalytic activity of TiO2/g-C3N4 nanocomposites was decreasing in the following sequence: TiO2/g-C3N4 (1:3) > TiO2/g-C3N4 (1:2) > TiO2/g-C3N4 (1:1). In comparison with the parent TiO2 or g-C3N4, the TiO2/g-C3N4 nanocomposites' photocatalytic capability was significantly enhanced by coupling TiO2 with g-C3N4. The generation of TiO2/g-C3N4 Z-scheme photocatalyst mainly benefited from the effective separation of photoinduced electron-hole pairs and the extended optical absorption range. The TiO2/g-C3N4 (1:3) nanocomposite showed the best photocatalytic behavior in a consequence of the optimal weight ratio of TiO2:g-C3N4 and the lowest band gap energy from all nanocomposites. The N2O conversion in its presence was 70.6% after 20 h of UVA irradiation.
Analysis of Biogenic Amines by GC/FID and GC/MS
Nakovich, Laura
2003-01-01
Low levels of biogenic amines occur naturally, but high levels (FDA sets 50 ppm of histamine in fish as the maximum allowable level) can lead to scombroid poisoning. Amines in general are difficult to analyze by Gas Chromatography (GC) due to their lack of volatility and their interaction with the GC column, often leading to significant tailing and poor reproducibility. Biogenic amines need to be derivatized before both GC and HPLC analyses. The objective of this research was to devel...
Immunotherapy for Prostate Cancer with Gc Protein-Derived Macrophage-Activating Factor, GcMAF1
Yamamoto, Nobuto; Suyama, Hirofumi; Yamamoto, Nobuyuki
2008-01-01
Serum Gc protein (known as vitamin D3-binding protein) is the precursor for the principal macrophage-activating factor (MAF). The MAF precursor activity of serum Gc protein of prostate cancer patients was lost or reduced because Gc protein was deglycosylated by serum α-N-acetylgalactosaminidase (Nagalase) secreted from cancerous cells. Therefore, macrophages of prostate cancer patients having deglycosylated Gc protein cannot be activated, leading to immunosuppression. Stepwise treatment of purified Gc protein with immobilized β-galactosidase and sialidase generated the most potent MAF (termed GcMAF) ever discovered, which produces no adverse effect in humans. Macrophages activated by GcMAF develop a considerable variation of receptors that recognize the abnormality in malignant cell surface and are highly tumoricidal. Sixteen nonanemic prostate cancer patients received weekly administration of 100 ng of GcMAF. As the MAF precursor activity increased, their serum Nagalase activity decreased. Because serum Nagalase activity is proportional to tumor burden, the entire time course analysis for GcMAF therapy was monitored by measuring the serum Nagalase activity. After 14 to 25 weekly administrations of GcMAF (100 ng/week), all 16 patients had very low serum Nagalase levels equivalent to those of healthy control values, indicating that these patients are tumor-free. No recurrence occurred for 7 years. PMID:18633461
Cha, Eunju; Kim, Sohee; Kim, Ho Jun; Lee, Kang Mi; Kim, Ki Hun; Kwon, Oh-Seung; Lee, Jaeick
2015-01-01
This study compared the sensitivity of various separation and ionization methods, including gas chromatography with an electron ionization source (GC-EI), liquid chromatography with an electrospray ionization source (LC-ESI), and liquid chromatography with a silver ion coordination ion spray source (LC-Ag(+) CIS), coupled to a mass spectrometer (MS) for steroid analysis. Chromatographic conditions, mass spectrometric transitions, and ion source parameters were optimized. The majority of steroids in GC-EI/MS/MS and LC-Ag(+) CIS/MS/MS analysis showed higher sensitivities than those obtained with other analytical methods. The limits of detection (LODs) of 65 steroids by GC-EI/MS/MS, 68 steroids by LC-Ag(+) CIS/MS/MS, 56 steroids by GC-EI/MS, 54 steroids by LC-ESI/MS/MS, and 27 steroids by GC-ESI/MS/MS were below cut-off value of 2.0 ng/mL. LODs of steroids that formed protonated ions in LC-ESI/MS/MS analysis were all lower than the cut-off value. Several steroids such as unconjugated C3-hydroxyl with C17-hydroxyl structure showed higher sensitivities in GC-EI/MS/MS analysis relative to those obtained using the LC-based methods. The steroids containing 4, 9, 11-triene structures showed relatively poor sensitivities in GC-EI/MS and GC-ESI/MS/MS analysis. The results of this study provide information that may be useful for selecting suitable analytical methods for confirmatory analysis of steroids. Copyright © 2015 John Wiley & Sons, Ltd.
GC/MS-based profiling of amino acids and TCA cycle-related molecules in ulcerative colitis.
Ooi, Makoto; Nishiumi, Shin; Yoshie, Tomoo; Shiomi, Yuuki; Kohashi, Michitaka; Fukunaga, Ken; Nakamura, Shiro; Matsumoto, Takayuki; Hatano, Naoya; Shinohara, Masakazu; Irino, Yasuhiro; Takenawa, Tadaomi; Azuma, Takeshi; Yoshida, Masaru
2011-09-01
The roles that amino acids play in immunity and inflammation are well defined, and the relationship between inflammatory bowel disease (IBD) and certain amino acids has recently attracted attention. In this study, the levels of amino acids and trichloroacetic acid (TCA) cycle-related molecules in the colonic tissues and sera of patients with ulcerative colitis (UC) were profiled by gas chromatography/mass spectrometry (GC/MS), with the aim of evaluating whether the clinical state induced by UC leads to variations in the amino acid profile. Colonic biopsy samples from 22 UC patients were used, as well as serum samples from UC patients (n = 13), Crohn's disease (CD) patients (n = 21), and healthy volunteers (n = 17). In the GC/MS-based profiling of amino acids and TCA cycle-related molecules, lower levels of 16 amino acids and 5 TCA cycle-related molecules were observed in the colonic lesion tissues of the UC patients, and the serum profiles of amino acids and TCA cycle-related molecules of the UC patients were different from those of the CD patients and healthy volunteers. Our study raises the possibility that GC/MS-based profiling of amino acids and TCA cycle-related molecules is a useful early diagnostic tool for UC.
Mohamad, Saharuddin Bin; Nagasawa, Hideko; Uto, Yoshihiro; Hori, Hitoshi
2002-01-01
Gc protein has been reported to be a precursor of Gc protein-derived macrophage activation factor (GcMAF) in the inflammation-primed macrophage activation cascade. An inducible beta-galactosidase of B cells and neuraminidase of T cells convert Gc protein to GcMAF. Gc protein from human serum was purified using 25(OH)D3 affinity column chromatography and modified to GcMAF using immobilized glycosidases (beta-galactosidase and neuraminidase) The sugar moiety structure of GcMAF was characterized by lectin blotting by Helix pomatia agglutinin. The biological activities of GcMAF were evaluated by a superoxide generation assay and a phagocytosis assay. We successfully purified Gc protein from human serum. GcMAF was detected by lectin blotting and showed a high biological activity. Our results support the importance of the terminal N-acetylgalactosamine moiety in the GcMAF-mediated macrophage activation cascade, and the existence of constitutive GcMAF in human serum. These preliminary data are important for designing small molecular GcMAF mimics.
Tunnel conductance of Watson-Crick nucleoside-base pairs from telegraph noise
International Nuclear Information System (INIS)
Chang Shuai; He Jin; Lin Lisha; Zhang Peiming; Liang Feng; Huang Shuo; Lindsay, Stuart; Young, Michael
2009-01-01
The use of tunneling signals to sequence DNA is presently hampered by the small tunnel conductance of a junction spanning an entire DNA molecule. The design of a readout system that uses a shorter tunneling path requires knowledge of the absolute conductance across base pairs. We have exploited the stochastic switching of hydrogen-bonded DNA base-nucleoside pairs trapped in a tunnel junction to determine the conductance of individual molecular pairs. This conductance is found to be sensitive to the geometry of the junction, but a subset of the data appears to come from unstrained molecular pairs. The conductances determined from these pairs are within a factor of two of the predictions of density functional calculations. The experimental data reproduces the counterintuitive theoretical prediction that guanine-deoxycytidine pairs (3 H-bonds) have a smaller conductance than adenine-thymine pairs (2 H-bonds). A bimodal distribution of switching lifetimes shows that both H-bonds and molecule-metal contacts break.
Purification of equine Gc-globulin
DEFF Research Database (Denmark)
Houen, Gunnar; Pihl, Tina Holberg; Andersen, Pia Haubro
Objectives With the aim of producing antibodies for an equine Group specific component (Gc)-globulin assay, the protein was purified from normal equine plasma. Methods Equine Gc-globulin was purified from healthy horse plasma using ion exchange chromatography (Q-Sepharose, CM......-Sepharose) and preparative PAGE. Results Equine Gc-globulin has successfully been purified from healthy horse plasma and rabbits and mice are being immunized to produce specific antibodies. Conclusions Purification of equine Gc-globulin and the production of specific antibodies will make it possible to develop an assay...... to be a sensitive marker of acute tissue injury and fatal outcome in humans. Patients with a low plasma concentration of Gc-globulin due to severe tissue injury might potentially benefit from infusions with purified Gc-globulin [1]. With an equine Gc-globulin assay, future studies will investigate the concentration...
Graphitic carbon nitride based nanocomposites: a review
Zhao, Zaiwang; Sun, Yanjuan; Dong, Fan
2014-11-01
Graphitic carbon nitride (g-C3N4), as an intriguing earth-abundant visible light photocatalyst, possesses a unique two-dimensional structure, excellent chemical stability and tunable electronic structure. Pure g-C3N4 suffers from rapid recombination of photo-generated electron-hole pairs resulting in low photocatalytic activity. Because of the unique electronic structure, the g-C3N4 could act as an eminent candidate for coupling with various functional materials to enhance the performance. According to the discrepancies in the photocatalytic mechanism and process, six primary systems of g-C3N4-based nanocomposites can be classified and summarized: namely, the g-C3N4 based metal-free heterojunction, the g-C3N4/single metal oxide (metal sulfide) heterojunction, g-C3N4/composite oxide, the g-C3N4/halide heterojunction, g-C3N4/noble metal heterostructures, and the g-C3N4 based complex system. Apart from the depiction of the fabrication methods, heterojunction structure and multifunctional application of the g-C3N4-based nanocomposites, we emphasize and elaborate on the underlying mechanisms in the photocatalytic activity enhancement of g-C3N4-based nanocomposites. The unique functions of the p-n junction (semiconductor/semiconductor heterostructures), the Schottky junction (metal/semiconductor heterostructures), the surface plasmon resonance (SPR) effect, photosensitization, superconductivity, etc. are utilized in the photocatalytic processes. Furthermore, the enhanced performance of g-C3N4-based nanocomposites has been widely employed in environmental and energetic applications such as photocatalytic degradation of pollutants, photocatalytic hydrogen generation, carbon dioxide reduction, disinfection, and supercapacitors. This critical review ends with a summary and some perspectives on the challenges and new directions in exploring g-C3N4-based advanced nanomaterials.
Immunotherapy for Prostate Cancer with Gc Protein-Derived Macrophage-Activating Factor, GcMAF1
Yamamoto, Nobuto; Suyama, Hirofumi; Yamamoto, Nobuyuki
2008-01-01
Serum Gc protein (known as vitamin D3-binding protein) is the precursor for the principal macrophage-activating factor (MAF). The MAF precursor activity of serum Gc protein of prostate cancer patients was lost or reduced because Gc protein was deglycosylated by serum α-N-acetylgalactosaminidase (Nagalase) secreted from cancerous cells. Therefore, macrophages of prostate cancer patients having deglycosylated Gc protein cannot be activated, leading to immunosuppression. Stepwise treatment of pu...
Ni, Yan; Su, Mingming; Qiu, Yunping; Jia, Wei; Du, Xiuxia
2016-09-06
ADAP-GC is an automated computational pipeline for untargeted, GC/MS-based metabolomics studies. It takes raw mass spectrometry data as input and carries out a sequence of data processing steps including construction of extracted ion chromatograms, detection of chromatographic peak features, deconvolution of coeluting compounds, and alignment of compounds across samples. Despite the increased accuracy from the original version to version 2.0 in terms of extracting metabolite information for identification and quantitation, ADAP-GC 2.0 requires appropriate specification of a number of parameters and has difficulty in extracting information on compounds that are in low concentration. To overcome these two limitations, ADAP-GC 3.0 was developed to improve both the robustness and sensitivity of compound detection. In this paper, we report how these goals were achieved and compare ADAP-GC 3.0 against three other software tools including ChromaTOF, AnalyzerPro, and AMDIS that are widely used in the metabolomics community.
Ni, Yan; Su, Mingming; Qiu, Yunping; Jia, Wei
2017-01-01
ADAP-GC is an automated computational pipeline for untargeted, GC-MS-based metabolomics studies. It takes raw mass spectrometry data as input and carries out a sequence of data processing steps including construction of extracted ion chromatograms, detection of chromatographic peak features, deconvolution of co-eluting compounds, and alignment of compounds across samples. Despite the increased accuracy from the original version to version 2.0 in terms of extracting metabolite information for identification and quantitation, ADAP-GC 2.0 requires appropriate specification of a number of parameters and has difficulty in extracting information of compounds that are in low concentration. To overcome these two limitations, ADAP-GC 3.0 was developed to improve both the robustness and sensitivity of compound detection. In this paper, we report how these goals were achieved and compare ADAP-GC 3.0 against three other software tools including ChromaTOF, AnalyzerPro, and AMDIS that are widely used in the metabolomics community. PMID:27461032
Directory of Open Access Journals (Sweden)
Sergei Kuchin
2011-03-01
Full Text Available Explaining base pairing is an important element in teaching undergraduate genetics. I propose a teaching approach that aims to close the gap between the mantra “A pairs with T, and G pairs with C” and the “intimidating” chemical diagrams. The approach offers a set of simple “shorthands” for the key bases that can be used to quickly deduce all canonical and wobble pairs that the students need to know. The approach can be further developed to analyze mutagenic mismatch pairing.
Mohler, Rachel E; Dombek, Kenneth M; Hoggard, Jamin C; Pierce, Karisa M; Young, Elton T; Synovec, Robert E
2007-08-01
The first extensive study of yeast metabolite GC x GC-TOFMS data from cells grown under fermenting, R, and respiring, DR, conditions is reported. In this study, recently developed chemometric software for use with three-dimensional instrumentation data was implemented, using a statistically-based Fisher ratio method. The Fisher ratio method is fully automated and will rapidly reduce the data to pinpoint two-dimensional chromatographic peaks differentiating sample types while utilizing all the mass channels. The effect of lowering the Fisher ratio threshold on peak identification was studied. At the lowest threshold (just above the noise level), 73 metabolite peaks were identified, nearly three-fold greater than the number of previously reported metabolite peaks identified (26). In addition to the 73 identified metabolites, 81 unknown metabolites were also located. A Parallel Factor Analysis graphical user interface (PARAFAC GUI) was applied to selected mass channels to obtain a concentration ratio, for each metabolite under the two growth conditions. Of the 73 known metabolites identified by the Fisher ratio method, 54 were statistically changing to the 95% confidence limit between the DR and R conditions according to the rigorous Student's t-test. PARAFAC determined the concentration ratio and provided a fully-deconvoluted (i.e. mathematically resolved) mass spectrum for each of the metabolites. The combination of the Fisher ratio method with the PARAFAC GUI provides high-throughput software for discovery-based metabolomics research, and is novel for GC x GC-TOFMS data due to the use of the entire data set in the analysis (640 MB x 70 runs, double precision floating point).
General enumeration of RNA secondary structures based on new ...
African Journals Online (AJOL)
Crick base pairs between AU and GC. Based on the new representation, this paper also computes the number of various types of constrained secondary structures taking the minimum stack length 1 and minimum size m for each bonding loop as ...
Signature scheme based on bilinear pairs
Tong, Rui Y.; Geng, Yong J.
2013-03-01
An identity-based signature scheme is proposed by using bilinear pairs technology. The scheme uses user's identity information as public key such as email address, IP address, telephone number so that it erases the cost of forming and managing public key infrastructure and avoids the problem of user private generating center generating forgery signature by using CL-PKC framework to generate user's private key.
Case Report: GcMAF Treatment in a Patient with Multiple Sclerosis.
Inui, Toshio; Katsuura, Goro; Kubo, Kentaro; Kuchiike, Daisuke; Chenery, Leslye; Uto, Yoshihiro; Nishikata, Takahito; Mette, Martin
2016-07-01
Gc protein-derived macrophage-activating factor (GcMAF) has various functions as an immune modulator, such as macrophage activation, anti-angiogenic activity and anti-tumor activity. Clinical trials of second-generation GcMAF demonstrated remarkable clinical effects in several types of cancers. Thus, GcMAF-based immunotherapy has a wide application for use in the treatment of many diseases via macrophage activation that can be used as a supportive therapy. Multiple sclerosis (MS) is considered to be an autoimmune disorder that affects the myelinated axons in the central nervous system (CNS). This study was undertaken to examine the effects of second-generation GcMAF in a patient with MS. This case study demonstrated that treatments of GcMAF in a patient with MS have potent therapeutic actions with early beneficial responses, especially improvement of motor dysfunction. GcMAF shows therapeutic potency in the treatment of MS. Copyright© 2016 International Institute of Anticancer Research (Dr. John G. Delinassios), All rights reserved.
Triple helical DNA in a duplex context and base pair opening
Esguerra, Mauricio; Nilsson, Lennart; Villa, Alessandra
2014-01-01
It is fundamental to explore in atomic detail the behavior of DNA triple helices as a means to understand the role they might play in vivo and to better engineer their use in genetic technologies, such as antigene therapy. To this aim we have performed atomistic simulations of a purine-rich antiparallel triple helix stretch of 10 base triplets flanked by canonical Watson–Crick double helices. At the same time we have explored the thermodynamic behavior of a flipping Watson–Crick base pair in the context of the triple and double helix. The third strand can be accommodated in a B-like duplex conformation. Upon binding, the double helix changes shape, and becomes more rigid. The triple-helical region increases its major groove width mainly by oversliding in the negative direction. The resulting conformations are somewhere between the A and B conformations with base pairs remaining almost perpendicular to the helical axis. The neighboring duplex regions maintain a B DNA conformation. Base pair opening in the duplex regions is more probable than in the triplex and binding of the Hoogsteen strand does not influence base pair breathing in the neighboring duplex region. PMID:25228466
Adahchour, M.; Beens, J.; Vreuls, R.J.J.; Brinkman, U.A.T.
2006-01-01
We review the literature on comprehensive two-dimensional gas chromatography (GC × GC), emphasizing developments in the period 2003-2005. The review opens with a general introduction, the principles of the technique and the set-up of GC × GC systems. It also discusses theoretical aspects, trends in
Chen, Xinjian; Udupa, Jayaram K; Alavi, Abass; Torigian, Drew A
2013-05-01
Image segmentation methods may be classified into two categories: purely image based and model based. Each of these two classes has its own advantages and disadvantages. In this paper, we propose a novel synergistic combination of the image based graph-cut (GC) method with the model based ASM method to arrive at the GC-ASM method for medical image segmentation. A multi-object GC cost function is proposed which effectively integrates the ASM shape information into the GC framework. The proposed method consists of two phases: model building and segmentation. In the model building phase, the ASM model is built and the parameters of the GC are estimated. The segmentation phase consists of two main steps: initialization (recognition) and delineation. For initialization, an automatic method is proposed which estimates the pose (translation, orientation, and scale) of the model, and obtains a rough segmentation result which also provides the shape information for the GC method. For delineation, an iterative GC-ASM algorithm is proposed which performs finer delineation based on the initialization results. The proposed methods are implemented to operate on 2D images and evaluated on clinical chest CT, abdominal CT, and foot MRI data sets. The results show the following: (a) An overall delineation accuracy of TPVF > 96%, FPVF ASM for different objects, modalities, and body regions. (b) GC-ASM improves over ASM in its accuracy and precision to search region. (c) GC-ASM requires far fewer landmarks (about 1/3 of ASM) than ASM. (d) GC-ASM achieves full automation in the segmentation step compared to GC which requires seed specification and improves on the accuracy of GC. (e) One disadvantage of GC-ASM is its increased computational expense owing to the iterative nature of the algorithm.
Immunotherapy of HIV-infected patients with Gc protein-derived macrophage activating factor (GcMAF).
Yamamoto, Nobuto; Ushijima, Naofumi; Koga, Yoshihiko
2009-01-01
Serum Gc protein (known as vitamin D3-binding protein) is the precursor for the principal macrophage activating factor (MAF). The MAF precursor activity of serum Gc protein of HIV-infected patients was lost or reduced because Gc protein is deglycosylated by alpha-N-acetylgalactosaminidase (Nagalase) secreted from HIV-infected cells. Therefore, macrophages of HIV-infected patients having deglycosylated Gc protein cannot be activated, leading to immunosuppression. Since Nagalase is the intrinsic component of the envelope protein gp120, serum Nagalase activity is the sum of enzyme activities carried by both HIV virions and envelope proteins. These Nagalase carriers were already complexed with anti-HIV immunoglobulin G (IgG) but retained Nagalase activity that is required for infectivity. Stepwise treatment of purified Gc protein with immobilized beta-galactosidase and sialidase generated the most potent macrophage activating factor (termed GcMAF), which produces no side effects in humans. Macrophages activated by administration of 100 ng GcMAF develop a large amount of Fc-receptors as well as an enormous variation of receptors that recognize IgG-bound and unbound HIV virions. Since latently HIV-infected cells are unstable and constantly release HIV virions, the activated macrophages rapidly intercept the released HIV virions to prevent reinfection resulting in exhaustion of infected cells. After less than 18 weekly administrations of 100 ng GcMAF for nonanemic patients, they exhibited low serum Nagalase activities equivalent to healthy controls, indicating eradication of HIV-infection, which was also confirmed by no infectious center formation by provirus inducing agent-treated patient PBMCs. No recurrence occurred and their healthy CD + cell counts were maintained for 7 years.
Accurate interaction energies of base pairing and base stacking. The final chapter
Czech Academy of Sciences Publication Activity Database
Šponer, Jiří; Jurečka, Petr; Hobza, Pavel
2005-01-01
Roč. 22, č. 6 (2005), s. 767 ISSN 0739-1102. [Albany 2005. Conversation /14./. 14.06.2005-18.06.2005, Albany] Institutional research plan: CEZ:AV0Z50040507 Keywords : base pairing * base stacking * nucleic acids Subject RIV: BO - Biophysics
Uto, Yoshihiro; Yamamoto, Syota; Takeuchi, Ryota; Nakagawa, Yoshinori; Hirota, Keiji; Terada, Hiroshi; Onizuka, Shinya; Nakata, Eiji; Hori, Hitoshi
2011-07-01
The 1f1f subtype of the Gc protein (Gc(1f1f) protein) was converted into Gc-derived macrophage-activating factor (GcMAF) by enzymatic processing in the presence of β-galactosidase of an activated B-cell and sialidase of a T-cell. We hypothesized that preGc(1f1f)MAF, the only Gc(1f1f) protein lacking galactose, can be converted to GcMAF in vivo because sialic acid is cleaved by residual sialidase. Hence, we investigated the effect of preGc(1f1f)MAF on the phagocytic activation of mouse peritoneal macrophages. We examined the sugar moiety of preGc(1f1f)MAF with a Western blot using peanut agglutinin (PNA) and Helix pomatia agglutinin (HPA) lectin. We also found that preGc(1f1f)MAF significantly enhanced phagocytic activity in mouse peritoneal macrophages but only in the presence of the mouse peritoneal fluid; the level of phagocytic activity was the same as that observed for GcMAF. PreGc(1f1f)MAF can be used as an effective macrophage activator in vivo.
AudioPairBank: Towards A Large-Scale Tag-Pair-Based Audio Content Analysis
Sager, Sebastian; Elizalde, Benjamin; Borth, Damian; Schulze, Christian; Raj, Bhiksha; Lane, Ian
2016-01-01
Recently, sound recognition has been used to identify sounds, such as car and river. However, sounds have nuances that may be better described by adjective-noun pairs such as slow car, and verb-noun pairs such as flying insects, which are under explored. Therefore, in this work we investigate the relation between audio content and both adjective-noun pairs and verb-noun pairs. Due to the lack of datasets with these kinds of annotations, we collected and processed the AudioPairBank corpus cons...
Zhang, Yanqiong; Lin, Ya; Zhao, Haiyu; Guo, Qiuyan; Yan, Chen; Lin, Na
2016-01-01
Although the herbal pair of Euphorbia kansui (GS) and Glycyrrhiza (GC) is one of the so-called "eighteen antagonistic medicaments" in Chinese medicinal literature, it is prescribed in a classic Traditional Chinese Medicine (TCM) formula Gansui-Banxia-Tang for cancerous ascites, suggesting that GS and GC may exhibit synergistic or antagonistic effects in different combination designs. Here, we modeled the effects of GS/GC combination with a target interaction network and clarified the associations between the network topologies involving the drug targets and the drug combination effects. Moreover, the "edge-betweenness" values, which is defined as the frequency with which edges are placed on the shortest paths between all pairs of modules in network, were calculated, and the ADRB1-PIK3CG interaction exhibited the greatest edge-betweenness value, suggesting its crucial role in connecting the other edges in the network. Because ADRB1 and PIK3CG were putative targets of GS and GC, respectively, and both had functional interactions with AVPR2 approved as known therapeutic target for ascites, we proposed that the ADRB1-PIK3CG-AVPR2 signal axis might be involved in the effects of the GS-GC combination on ascites. This proposal was further experimentally validated in a H22 hepatocellular carcinoma (HCC) ascites model. Collectively, this systems-level investigation integrated drug target prediction and network analysis to reveal the combination principles of the herbal pair of GS and GC. Experimental validation in an in vivo system provided convincing evidence that different combination designs of GS and GC might result in synergistic or antagonistic effects on HCC ascites that might be partially related to their regulation of the ADRB1-PIK3CG-AVPR2 signal axis.
Goncharova, Iryna
2014-01-24
Ag(I)-containing compounds are attractive as antibacterial and antifungal agents. The renewed interest in the application of silver(I) compounds has led to the need for detailed knowledge of the mechanism of their action. One of the possible ways is the coordination of Ag(I) to G-C pairs of DNA, where Ag(+) ions form Ag(I)-mediated base pairs and inhibit the transcription. Herein, a systematic chiroptical study on silver(I)-mediated homo and mixed pairs of the C-G complementary-base derivatives cytidine(C) and 5'-guanosine monophosphate(G) in water is presented. Ag(I)-mediated homo and hetero pairs of G and C and their self-assembled species were studied under two pH levels (7.0 and 10.0) by vibrational (VCD) and electronic circular dichroism(ECD). VCD was used for the first time in this field and showed itself to be a powerful method for obtaining specific structural information in solution. Based on results of the VCD experiments, the different geometries of the homo pairs were proposed under pH 7.0 and 10.0. ECD was used as a diagnostic tool to characterize the studied systems and as a contact point between the previously defined structures of the metal or proton mediated pairs of nucleobases and the systems studied here. On the basis of the obtained data, the formation of the self-assembled species of cytidine with a structure similar to the i-motif structure in DNA was proposed at pH 10.0. Copyright © 2013 Elsevier B.V. All rights reserved.
Molecular dynamics study of some non-hydrogen-bonding base pair DNA strands
Tiwari, Rakesh K.; Ojha, Rajendra P.; Tiwari, Gargi; Pandey, Vishnudatt; Mall, Vijaysree
2018-05-01
In order to elucidate the structural activity of hydrophobic modified DNA, the DMMO2-D5SICS, base pair is introduced as a constituent in different set of 12-mer and 14-mer DNA sequences for the molecular dynamics (MD) simulation in explicit water solvent. AMBER 14 force field was employed for each set of duplex during the 200ns production-dynamics simulation in orthogonal-box-water solvent by the Particle-Mesh-Ewald (PME) method in infinite periodic boundary conditions (PBC) to determine conformational parameters of the complex. The force-field parameters of modified base-pair were calculated by Gaussian-code using Hartree-Fock /ab-initio methodology. RMSD Results reveal that the conformation of the duplex is sequence dependent and the binding energy of the complex depends on the position of the modified base-pair in the nucleic acid strand. We found that non-bonding energy had a significant contribution to stabilising such type of duplex in comparison to electrostatic energy. The distortion produced within strands by such type of base-pair was local and destabilised the duplex integrity near to substitution, moreover the binding energy of duplex depends on the position of substitution of hydrophobic base-pair and the DNA sequence and strongly supports the corresponding experimental study.
DFT study on metal-mediated uracil base pair complexes
Directory of Open Access Journals (Sweden)
Ayhan Üngördü
2017-11-01
Full Text Available The most stable of metal-mediated uracil base pair complexes were determined. Method was used density functional theory, B3LYP. The calculations of systems containing C, H, N, O were described by 6-311++G(d,p and cc-PVTZ basis sets and LANL2DZ and SDD basis sets was used for transition metals. Then Egap values of complexes were calculated and the electrical conductivity of the complexes for single nanowires was studied by band theory. Metal-mediated uracil base pair complexes which will be used as conductive wires in nanotechnology were predicted. In nanoworld, this study is expected to show a way for practical applications.
Energetics and dynamics of the non-natural fluorescent 4AP:DAP base pair
Chawla, Mohit
2018-01-02
The fluorescent non-natural 4-aminophthalimide (4AP) base, when paired to the complementary 2,4-diaminopyrimidine (DAP) nucleobase, is accommodated in a B-DNA duplex being efficiently recognized and incorporated by DNA polymerases. To complement the experimental studies and rationalize the impact of the above non-natural bases on the structure, stability and dynamics of nucleic acid structures, we performed quantum mechanics (QM) calculations along with classical molecular dynamics (MD) simulations. QM calculations were initially focused on the geometry and energetics of the 4AP:DAP non-natural pair and of H-bonded base pairs between 4AP and all the natural bases in their classical Watson-Crick geometries. The QM calculations indicate that the 4AP:DAP pair, despite the fact that it can form 3 H-bonds in a classic Watson-Crick geometry, has a stability comparable to the A:T pair. Then, we extended the study to reverse Watson-Crick geometries, characteristic of parallel strands. MD simulations were carried out on two 13-mer DNA duplexes, featuring a central 4AP:DAP or A:T pair, respectively. No major structural deformation of the duplex was observed during the MD simulation. Snapshots from the MD simulations were subjected to QM calculations to investigate the 4AP:DAP interaction energy when embedded into a duplex structure, and to investigate the impact of the two non-natural bases on the stacking interactions with adjacent bases in the DNA duplex. We found a slight increase in stacking interactions involving the 4AP:DAP pair, counterbalanced by a moderate decrease in H-bonding interactions of the 4AP:DAP and of the adjacent base pairs in the duplex. The results of our study are in agreement with experimental data and complement them by providing an insight into which factors contribute positively and which factors contribute negatively to the structural compatibility of the fluorescent 4AP:DAP pair with a B-DNA structure.
Narayanaswamy, Nagarjun; Kumar, Manoj; Das, Sadhan; Sharma, Rahul; Samanta, Pralok K.; Pati, Swapan K.; Dhar, Suman K.; Kundu, Tapas K.; Govindaraju, T.
2014-01-01
Sequence-specific recognition of DNA by small turn-on fluorescence probes is a promising tool for bioimaging, bioanalytical and biomedical applications. Here, the authors report a novel cell-permeable and red fluorescent hemicyanine-based thiazole coumarin (TC) probe for DNA recognition, nuclear staining and cell cycle analysis. TC exhibited strong fluorescence enhancement in the presence of DNA containing AT-base pairs, but did not fluoresce with GC sequences, single-stranded DNA, RNA and proteins. The fluorescence staining of HeLa S3 and HEK 293 cells by TC followed by DNase and RNase digestion studies depicted the selective staining of DNA in the nucleus over the cytoplasmic region. Fluorescence-activated cell sorting (FACS) analysis by flow cytometry demonstrated the potential application of TC in cell cycle analysis in HEK 293 cells. Metaphase chromosome and malaria parasite DNA imaging studies further confirmed the in vivo diagnostic and therapeutic applications of probe TC. Probe TC may find multiple applications in fluorescence spectroscopy, diagnostics, bioimaging and molecular and cell biology. PMID:25252596
2012-01-01
Background Extant sauropsids (reptiles and birds) are divided into two major lineages, the lineage of Testudines (turtles) and Archosauria (crocodilians and birds) and the lineage of Lepidosauria (tuatara, lizards, worm lizards and snakes). Karyotypes of these sauropsidan groups generally consist of macrochromosomes and microchromosomes. In chicken, microchromosomes exhibit a higher GC-content than macrochromosomes. To examine the pattern of intra-genomic GC heterogeneity in lepidosaurian genomes, we constructed a cytogenetic map of the Japanese four-striped rat snake (Elaphe quadrivirgata) with 183 cDNA clones by fluorescence in situ hybridization, and examined the correlation between the GC-content of exonic third codon positions (GC3) of the genes and the size of chromosomes on which the genes were localized. Results Although GC3 distribution of snake genes was relatively homogeneous compared with those of the other amniotes, microchromosomal genes showed significantly higher GC3 than macrochromosomal genes as in chicken. Our snake cytogenetic map also identified several conserved segments between the snake macrochromosomes and the chicken microchromosomes. Cross-species comparisons revealed that GC3 of most snake orthologs in such macrochromosomal segments were GC-poor (GC3 < 50%) whereas those of chicken orthologs in microchromosomes were relatively GC-rich (GC3 ≥ 50%). Conclusion Our results suggest that the chromosome size-dependent GC heterogeneity had already occurred before the lepidosaur-archosaur split, 275 million years ago. This character was probably present in the common ancestor of lepidosaurs and but lost in the lineage leading to Anolis during the diversification of lepidosaurs. We also identified several genes whose GC-content might have been influenced by the size of the chromosomes on which they were harbored over the course of sauropsid evolution. PMID:23140509
Directory of Open Access Journals (Sweden)
Vladimir Pavan Margarido
2000-09-01
Full Text Available This is the first description of the karyotype of Leporinus desmotes. The diploid female number was 2n = 54 meta- and submetacentric chromosomes. The nucleolar organizing regions (NORs were studied by silver nitrate staining and rDNA fluorescence in situ hybridization (FISH and were found to be located in the telomeric region of the long arm of the 9th pair. C-banding revealed centromeric and telomeric heterochromatin segments in most chromosomes. Intercalar blocks of heterochromatin were observed in the long arm of six chromosome pairs. Besides a NOR-adjacent heterochromatin, all of the intercalar heterochromatic segments were brightly fluorescent by mithramycin staining. These data suggest that a unique amplification of a primordial GC-rich heterochromatin, probably NOR-associated, may have taken place in the karyotype diversification of this Leporinus species.Esta é a primeira descrição do cariótipo de Leporinus desmotes fêmea. O número diplóide encontrado foi 2n = 54 cromossomos meta- e submetacêntricos. As regiões organizadoras de nucléolos (NORs foram estudadas através da impregnação pela prata e por hibridização in situ com sondas de DNAr (FISH, e foram localizadas na região telomérica do braço longo do 9º par. Heterocromatinas centromérica e telomérica foram reveladas pelo bandamento C na maioria dos cromossomos. Adicionalmente, grande quantidade de heterocromatina intercalar ou subtelomérica foi também observada. Diferenciação composicional na maior parte da heterocromatina identificada em L. desmotes pode ser inferida através da coloração pela mitramicina, caracterizando um caso peculiar de amplificação de segmentos heterocromáticos ricos em bases GC neste grupo de peixes.
Directory of Open Access Journals (Sweden)
Mohammad R Nezami Ranjbar
Full Text Available This study evaluates changes in metabolite levels in hepatocellular carcinoma (HCC cases vs. patients with liver cirrhosis by analysis of human blood plasma using gas chromatography coupled with mass spectrometry (GC-MS. Untargeted metabolomic analysis of plasma samples from participants recruited in Egypt was performed using two GC-MS platforms: a GC coupled to single quadruple mass spectrometer (GC-qMS and a GC coupled to a time-of-flight mass spectrometer (GC-TOFMS. Analytes that showed statistically significant changes in ion intensities were selected using ANOVA models. These analytes and other candidates selected from related studies were further evaluated by targeted analysis in plasma samples from the same participants as in the untargeted metabolomic analysis. The targeted analysis was performed using the GC-qMS in selected ion monitoring (SIM mode. The method confirmed significant changes in the levels of glutamic acid, citric acid, lactic acid, valine, isoleucine, leucine, alpha tocopherol, cholesterol, and sorbose in HCC cases vs. patients with liver cirrhosis. Specifically, our findings indicate up-regulation of metabolites involved in branched-chain amino acid (BCAA metabolism. Although BCAAs are increasingly used as a treatment for cancer cachexia, others have shown that BCAA supplementation caused significant enhancement of tumor growth via activation of mTOR/AKT pathway, which is consistent with our results that BCAAs are up-regulated in HCC.
International Nuclear Information System (INIS)
Li, Juan; Liu, Enzhou; Ma, Yongning; Hu, Xiaoyun; Wan, Jun; Sun, Lin; Fan, Jun
2016-01-01
Graphical abstract: TEM image and schematic diagram of photocatalytic mechanism of 2D MoS_2/g-C_3N_4 composites. - Highlights: • g-C_3N_4 nanosheets coupled with MoS_2 nanosheets as 2D heterojunction photocatalysts were synthesized successfully. • The 2D MoS_2/g-C_3N_4 heterojunctions show higher photocatalytic activity than pure g-C_3N_4. • The photocatalytic mechanism of the 2D MoS_2/g-C_3N_4 heterojunction was described. - Abstract: g-C_3N_4 nanosheets coupled with MoS_2 nanosheets as 2D heteroconjuction were prepared via a facile impregnation and calcination method. The structure characterization clearly indicated that MoS_2 nanosheets were successfully horizontal loaded on g-C_3N_4 nanosheets. The investigation indicated that the formation of 2D heterojunction between the g-C_3N_4 nanosheets and MoS_2 nanosheets promoted the charge transfer and enhanced separation efficiency of photoinduced electron–hole pairs. Furthermore, the measurement of photocatalytic activity for the degradation of rhodamine B and methyl orange revealed that the as-prepared 2D MoS_2/g-C_3N_4 heterojunction exhibited the significantly enhanced photocatalytic activity and considerable stability under visible light irradiation. The 2D MoS_2/g-C_3N_4 heterojunction prepared with 3 wt% of MoS_2 exhibited the optimal photodegradable efficiency. The present work shows that the formation of 2D heterojunction should be a good strategy to design efficient photocatalysts.
International Nuclear Information System (INIS)
Kalnik, M.W.; Kouchakdjian, M.; Li, B.F.L.; Swann, P.F.; Patel, D.J.
1988-01-01
High-resolution two-dimensional NMR studies have been completed on the self-complementary d(C-G-C-G-A-G-C-T-T-G-C-G) duplex (designated G x T 12-mer) and the self-complementary d(C-G-C-G-A-G-C-T-O 4 meT-G-C-G) duplex (designated G x O 4 meT 12-mer) containing G x T and G x O 4 meT pairs at identical positions four base pairs in from either end of the duplex. The exchangeable and nonexchangeable proton resonances have been assigned from an analysis of two-dimensional nuclear Overhauser enhancement (NOESY) spectra for the G x T 12-mer and G x O 4 meT 12-mer duplexes in H 2 O and D 2 O solution. The guanosine and thymidine imino protons in the G x T mismatch resonate at 10.57 and 11.98 ppm, respectively, and exhibit a strong NOE between themselves and to imino protons of flanking base pairs in the G x T 12-mer duplex. The large upfield chemical shift of this proton relative to that of the imino proton resonance of G in the G x T mismatch or in G x C base pairs indicates that hydrogen bonding to O 4 meT is either very weak or absent. This guanosine imino proton has an NOE to the OCH 3 group of O 4 meT across the pair and NOEs to the imino protons of flanking base pairs. Taken together with data from the NMR of nonexchangeable protons, this shows that both G and O 4 meT have anti-glycosidic torsion angles and are stacked into the duplex. Comparison of the intensity of the NOEs between the guanosine imino proton and the OCH 3 of O 4 meT as well as other protons in its vicinity demonstrates that the OCH 3 group of O 4 meT adopts the syn orientation with respect to N3 of the methylated thymidine. The authors propose an alternate base pairing mode stabilized by one short hydrogen bond between the 2-amino group of guanosine and the 2-carbonyl group of O 4 met
Uto, Yoshihiro; Yamamoto, Syota; Mukai, Hirotaka; Ishiyama, Noriko; Takeuchi, Ryota; Nakagawa, Yoshinori; Hirota, Keiji; Terada, Hiroshi; Onizuka, Shinya; Hori, Hitoshi
2012-06-01
The 1f1f subtype of the group-specific component (Gc) protein is converted into Gc protein-derived macrophage-activating factor (GcMAF) by enzymatic processing with β-galactosidase and sialidase. We previously demonstrated that preGc(1f1f)MAF, a full Gc(1f1f) protein otherwise lacking a galactosyl moiety, can be converted to GcMAF by treatment with mouse peritoneal fluid. Here, we investigated the effects of the β-galactosidase-treated 1s1s and 22 subtypes of Gc protein (preGc(1s1s)MAF and preGc₂₂MAF) on the phagocytic activation of mouse peritoneal macrophages. We demonstrated the presence of Gal-GalNAc disaccharide sugar structures in the Gc(1s1s) protein by western blotting using peanut agglutinin and Helix pomatia agglutinin lectin. We also found that preGc(1s1s)MAF and preGc₂₂MAF significantly enhanced the phagocytic activity of mouse peritoneal macrophages in the presence and absence of mouse peritoneal fluid. We demonstrate that preGc(1s1s)MAF and preGc₂₂MAF proteins can be used as effective macrophage activators.
Admission levels of serum Gc-globulin
DEFF Research Database (Denmark)
Schiødt, F V; Bondesen, S; Petersen, I
1996-01-01
Gc-globulin scavenges actin released from necrotic hepatocytes to the extracellular space. In 77 patients with fulminant hepatic failure (FHF) (excluding patients treated with liver transplantation), admission levels of serum Gc-globulin and degree of complexing with monomeric actin (complex ratio...... in the same range as the KCH criteria. An advantage of Gc-globulin is that it gives an estimate of the outcome already on admission. Acute liver transplantation should be considered in FHF patients with Gc-globulin less than 100 mg/L....
Micromechanics of base pair unzipping in the DNA duplex
International Nuclear Information System (INIS)
Volkov, Sergey N; Paramonova, Ekaterina V; Yakubovich, Alexander V; Solov’yov, Andrey V
2012-01-01
All-atom molecular dynamics (MD) simulations of DNA duplex unzipping in a water environment were performed. The investigated DNA double helix consists of a Drew-Dickerson dodecamer sequence and a hairpin (AAG) attached to the end of the double-helix chain. The considered system is used to examine the process of DNA strand separation under the action of an external force. This process occurs in vivo and now is being intensively investigated in experiments with single molecules. The DNA dodecamer duplex is consequently unzipped pair by pair by means of the steered MD. The unzipping trajectories turn out to be similar for the duplex parts with G⋅C content and rather distinct for the parts with A⋅T content. It is shown that during the unzipping each pair experiences two types of motion: relatively quick rotation together with all the duplex and slower motion in the frame of the unzipping fork. In the course of opening, the complementary pair passes through several distinct states: (i) the closed state in the double helix, (ii) the metastable preopened state in the unzipping fork and (iii) the unbound state. The performed simulations show that water molecules participate in the stabilization of the metastable states of the preopened base pairs in the DNA unzipping fork. (paper)
G+C content dominates intrinsic nucleosome occupancy
Directory of Open Access Journals (Sweden)
Hughes Timothy R
2009-12-01
Full Text Available Abstract Background The relative preference of nucleosomes to form on individual DNA sequences plays a major role in genome packaging. A wide variety of DNA sequence features are believed to influence nucleosome formation, including periodic dinucleotide signals, poly-A stretches and other short motifs, and sequence properties that influence DNA structure, including base content. It was recently shown by Kaplan et al. that a probabilistic model using composition of all 5-mers within a nucleosome-sized tiling window accurately predicts intrinsic nucleosome occupancy across an entire genome in vitro. However, the model is complicated, and it is not clear which specific DNA sequence properties are most important for intrinsic nucleosome-forming preferences. Results We find that a simple linear combination of only 14 simple DNA sequence attributes (G+C content, two transformations of dinucleotide composition, and the frequency of eleven 4-bp sequences explains nucleosome occupancy in vitro and in vivo in a manner comparable to the Kaplan model. G+C content and frequency of AAAA are the most important features. G+C content is dominant, alone explaining ~50% of the variation in nucleosome occupancy in vitro. Conclusions Our findings provide a dramatically simplified means to predict and understand intrinsic nucleosome occupancy. G+C content may dominate because it both reduces frequency of poly-A-like stretches and correlates with many other DNA structural characteristics. Since G+C content is enriched or depleted at many types of features in diverse eukaryotic genomes, our results suggest that variation in nucleotide composition may have a widespread and direct influence on chromatin structure.
NOTE TAKING PAIRS TO IMPROVE STUDENTS‟ SENTENCE BASED WRITING ACHIEVEMENT
Directory of Open Access Journals (Sweden)
Testiana Deni Wijayatiningsih
2017-04-01
Full Text Available Students had skill to actualize their imagination and interpret their knowledge through writing which could be combined with good writing structure. Moreover, their writing skill still had low motivation and had not reached the standard writing structure. Based on the background above, this research has purpose to know the influence Note Taking Pairs in improving students‘sentence based writing achievement. The subject of this research was the second semester of English Department in Muhammadiyah University of Semarang. It also used statistic non parametric method to analyze the students‘ writing achievement. The result of this research showed that Note Taking Pairs strategy could improve students‘sentence based writing achievement. Hopefully this research is recommended into learning process to improve students‘writing skill especially in sentence-based writing subject.
AT base pair anions versus (9-methyl-A)(1-methyl-T) base pair anions.
Radisic, Dunja; Bowen, Kit H; Dabkowska, Iwona; Storoniak, Piotr; Rak, Janusz; Gutowski, Maciej
2005-05-04
The anionic base pairs of adenine and thymine, (AT)(-), and 9-methyladenine and 1-methylthymine, (MAMT)(-), have been investigated both theoretically and experimentally in a complementary, synergistic study. Calculations on (AT)(-) found that it had undergone a barrier-free proton transfer (BFPT) similar to that seen in other dimer anion systems and that its structural configuration was neither Watson-Crick (WC) nor Hoogsteen (HS). The vertical detachment energy (VDE) of (AT)(-) was determined by anion photoelectron spectroscopy and found to be in agreement with the VDE value predicted by theory for the BFPT mechanism. An AT pair in DNA is structurally immobilized into the WC configuration, in part, by being bonded to the sugars of the double helix. This circumstance was mimicked by methylating the sites on both A and T where these sugars would have been tied, viz., 9-methyladenine and 1-methylthymine. Calculations found no BFPT in (MAMT)(-) and a resulting (MAMT)(-) configuration that was either HS or WC, with the configurations differing in stability by ca. 2 kcal/mol. The photoelectron spectrum of (MAMT)(-) occurred at a completely different electron binding energy than had (AT)(-). Moreover, the VDE value of (MAMT)(-) was in agreement with that predicted by theory. The configuration of (MAMT)(-) and its lack of electron-induced proton transfer are inter-related. While there may be other pathways for electron-induced DNA alterations, BFPT in the WC/HS configurations of (AT)(-) is not feasible.
AT Base Pair Anions vs. (9-methyl-A)(1-methyl-T) Base Pair Anions
International Nuclear Information System (INIS)
Radisic, Dunja; Bowen, Kit H.; Dabkowska, Iwona; Storoniak, Piotr; Rak, Janusz; Gutowski, Maciej S.
2005-01-01
The anionic base pairs of adenine and thymine, (AT)-, and 9-methyladenine and 1-methylthymine, (MAMT)-, have been investigated both theoretically and experimentally in a complementary, synergistic study. Calculations on (AT)- found that it had undergone a barrier-free proton transfer (BFPT) similar to that seen in other dimer anion systems and that its structural configuration that was neither Watson-Crick (WC) nor Hoogsteen (HS). The vertical detachment energy (VDE) of (AT)- was determined by anion photoelectron spectroscopy and found to be in agreement with the VDE value predicted by theory for the BFPT mechanism. An AT pair in DNA is structurally immobilized into the WC configuration, in part, by being bonded to the sugars of the double helix. This circumstance was mimicked by methylating the sites on both A and T where these sugars would have been tied, viz., 9-methyladenine and 1-methylthymine. Calculations found no BFPT in (MAMT)- and a resulting (MAMT)- configuration that wa s either HS or WC, with the configurations differing in stability by ca. 2 kcal/mol. The photoelectron spectrum of (MAMT)- occurred at a completely different electron binding energy than had (AT)-. Moreover, the VDE value of (MAMT)- was in agreement with that predicted by theory. The configuration of (MAMT)- and its lack of electron-induced proton transfer are inter-related. While there may be other pathways for electron-induced damage, BFPT in the WC/HS configurations of (AT)- is not feasible
Ma, Xinguo; Wei, Yang; Wei, Zhen; He, Hua; Huang, Chuyun; Zhu, Yongfa
2017-12-15
The photoelectrochemical properties of g-C 3 N 4 sheet are modified by the π-π stacking interaction with graphene, and the corresponding role of graphene on the surface chemical reactions is investigated by density functional theory. The calculated cohesive energies and the lattice mismatch energies indicate that g-C 3 N 4 and graphene are in parallel contact and can form a stable heterojunction. According to our calculated energy band structures and work functions of g-C 3 N 4 /graphene heterojunctions, the band edge modulations by graphene are discussed and corresponding photoinduced charge transfer processes are analyzed in detail. It is found that the incorporating of graphene into g-C 3 N 4 facilitates the separation of photoinduced e - /h + pairs and the oxidation capacity enhancement of the photoinduced holes with the downshifting of the valence band edge of g-C 3 N 4 layer. It is identified that the inhomogeneous onsite energies between interlayer and the band edge modulations are induced by the inhomogeneous charge redistribution between interlayer caused by graphene. Further, the initial dynamic reaction processes of oxygen atoms in g-C 3 N 4 /graphene heterojunctions also confirm the significant role of graphene on the surface chemical reactions. Copyright © 2017 Elsevier Inc. All rights reserved.
Improvement of Ylang-Ylang Essential Oil Characterization by GC×GC-TOFMS
Directory of Open Access Journals (Sweden)
Michał Brokl
2013-01-01
Full Text Available A single fraction of essential oil can often contain hundreds of compounds. Despite of the technical improvements and the enhanced selectivity currently offered by the state-of-the-art gas chromatography (GC and mass spectrometry (MS instruments, the complexity of essential oils is frequently underestimated. Comprehensive two-dimensional GC coupled to time-of-flight MS (GC×GC-TOFMS was used to improve the chemical characterization of ylang-ylang essential oil fractions recently reported in a previous one-dimensional (1D GC study. Based on both, the enhanced chromatographic separation and the mass spectral deconvolution, 161 individual compounds were identified and labeled as potentially characteristic analytes found in both low and high boiling fractions issued from distillation of mature ylang-ylang flowers. Compared to the most recent full GC-MS characterization, this represents 75 new compounds, essentially consisting of terpenes, terpenoid esters, and alcohols.
Chawla, Mohit
2015-06-27
Posttranscriptional modifications greatly enhance the chemical information of RNA molecules, contributing to explain the diversity of their structures and functions. A significant fraction of RNA experimental structures available to date present modified nucleobases, with half of them being involved in H-bonding interactions with other bases, i.e. ‘modified base pairs’. Herein we present a systematic investigation of modified base pairs, in the context of experimental RNA structures. To this end, we first compiled an atlas of experimentally observed modified base pairs, for which we recorded occurrences and structural context. Then, for each base pair, we selected a representative for subsequent quantum mechanics calculations, to find out its optimal geometry and interaction energy. Our structural analyses show that most of the modified base pairs are non Watson–Crick like and are involved in RNA tertiary structure motifs. In addition, quantum mechanics calculations quantify and provide a rationale for the impact of the different modifications on the geometry and stability of the base pairs they participate in.
Chawla, Mohit; Oliva, R.; Bujnicki, J. M.; Cavallo, Luigi
2015-01-01
Posttranscriptional modifications greatly enhance the chemical information of RNA molecules, contributing to explain the diversity of their structures and functions. A significant fraction of RNA experimental structures available to date present modified nucleobases, with half of them being involved in H-bonding interactions with other bases, i.e. ‘modified base pairs’. Herein we present a systematic investigation of modified base pairs, in the context of experimental RNA structures. To this end, we first compiled an atlas of experimentally observed modified base pairs, for which we recorded occurrences and structural context. Then, for each base pair, we selected a representative for subsequent quantum mechanics calculations, to find out its optimal geometry and interaction energy. Our structural analyses show that most of the modified base pairs are non Watson–Crick like and are involved in RNA tertiary structure motifs. In addition, quantum mechanics calculations quantify and provide a rationale for the impact of the different modifications on the geometry and stability of the base pairs they participate in.
McCoy, A B; Wright, A; Krousel-Wood, M; Thomas, E J; McCoy, J A; Sittig, D F
2015-01-01
Clinical knowledge bases of problem-medication pairs are necessary for many informatics solutions that improve patient safety, such as clinical summarization. However, developing these knowledge bases can be challenging. We sought to validate a previously developed crowdsourcing approach for generating a knowledge base of problem-medication pairs in a large, non-university health care system with a widely used, commercially available electronic health record. We first retrieved medications and problems entered in the electronic health record by clinicians during routine care during a six month study period. Following the previously published approach, we calculated the link frequency and link ratio for each pair then identified a threshold cutoff for estimated problem-medication pair appropriateness through clinician review; problem-medication pairs meeting the threshold were included in the resulting knowledge base. We selected 50 medications and their gold standard indications to compare the resulting knowledge base to the pilot knowledge base developed previously and determine its recall and precision. The resulting knowledge base contained 26,912 pairs, had a recall of 62.3% and a precision of 87.5%, and outperformed the pilot knowledge base containing 11,167 pairs from the previous study, which had a recall of 46.9% and a precision of 83.3%. We validated the crowdsourcing approach for generating a knowledge base of problem-medication pairs in a large non-university health care system with a widely used, commercially available electronic health record, indicating that the approach may be generalizable across healthcare settings and clinical systems. Further research is necessary to better evaluate the knowledge, to compare crowdsourcing with other approaches, and to evaluate if incorporating the knowledge into electronic health records improves patient outcomes.
Estimating the Per-Base-Pair Mutation Rate in the Yeast Saccharomyces cerevisiae
Lang, Gregory I.; Murray, Andrew W.
2008-01-01
Although mutation rates are a key determinant of the rate of evolution they are difficult to measure precisely and global mutations rates (mutations per genome per generation) are often extrapolated from the per-base-pair mutation rate assuming that mutation rate is uniform across the genome. Using budding yeast, we describe an improved method for the accurate calculation of mutation rates based on the fluctuation assay. Our analysis suggests that the per-base-pair mutation rates at two genes...
Ruggiero, Marco; Reinwald, Heinz; Pacini, Stefania
2016-09-01
We hypothesize that a plasma glycosaminoglycan, chondroitin sulfate, may be responsible for the biological and clinical effects attributed to the Gc protein-derived Macrophage Activating Factor (GcMAF), a protein that is extracted from human blood. Thus, Gc protein binds chondroitin sulfate on the cell surface and such an interaction may occur also in blood, colostrum and milk. This interpretation would solve the inconsistencies encountered in explaining the effects of GcMAF in vitro and in vivo. According to our model, the Gc protein or the GcMAF bind to chondroitin sulfate both on the cell surface and in bodily fluids, and the resulting multimolecular complexes, under the form of oligomers trigger a transmembrane signal or, alternatively, are internalized and convey the signal directly to the nucleus thus eliciting the diverse biological effects observed for both GcMAF and chondroitin sulfate. Copyright © 2016 Elsevier Ltd. All rights reserved.
The extension of a DNA double helix by an additional Watson-Crick base pair on the same backbone
DEFF Research Database (Denmark)
Kumar, P.; Sharma, P. K.; Madsen, Charlotte S.
2013-01-01
Additional base pair: The DNA duplex can be extended with an additional Watson-Crick base pair on the same backbone by the use of double-headed nucleotides. These also work as compressed dinucleotides and form two base pairs with cognate nucleobases on the opposite strand.......Additional base pair: The DNA duplex can be extended with an additional Watson-Crick base pair on the same backbone by the use of double-headed nucleotides. These also work as compressed dinucleotides and form two base pairs with cognate nucleobases on the opposite strand....
Shankar, Akshaya; Jagota, Anand; Mittal, Jeetain
2012-10-11
Single- and double-stranded DNA are increasingly being paired with surfaces and nanoparticles for numerous applications, such as sensing, imaging, and drug delivery. Unlike the majority of DNA structures in bulk that are stabilized by canonical Watson-Crick pairing between Ade-Thy and Gua-Cyt, those adsorbed on surfaces are often stabilized by noncanonical base pairing, quartet formation, and base-surface stacking. Not much is known about these kinds of interactions. To build an understanding of the role of non-Watson-Crick pairing on DNA behavior near surfaces, one requires basic information on DNA base pair stacking and hydrogen-bonding interactions. All-atom molecular simulations of DNA bases in two cases--in bulk water and strongly adsorbed on a graphite surface--are conducted to study the relative strengths of stacking and hydrogen bond interactions for each of the 10 possible combinations of base pairs. The key information obtained from these simulations is the free energy as a function of distance between two bases in a pair. We find that stacking interactions exert the dominant influence on the stability of DNA base pairs in bulk water as expected. The strength of stability for these stacking interactions is found to decrease in the order Gua-Gua > Ade-Gua > Ade-Ade > Gua-Thy > Gua-Cyt > Ade-Thy > Ade-Cyt > Thy-Thy > Cyt-Thy > Cyt-Cyt. On the other hand, mutual interactions of surface-adsorbed base pairs are stabilized mostly by hydrogen-bonding interactions in the order Gua-Cyt > Ade-Gua > Ade-Thy > Ade-Ade > Cyt-Thy > Gua-Gua > Cyt-Cyt > Ade-Cyt > Thy-Thy > Gua-Thy. Interestingly, several non-Watson-Crick base pairings, which are commonly ignored, have similar stabilization free energies due to interbase hydrogen bonding as Watson-Crick pairs. This clearly highlights the importance of non-Watson-Crick base pairing in the development of secondary structures of oligonucleotides near surfaces.
Wright, A.; Krousel-Wood, M.; Thomas, E. J.; McCoy, J. A.; Sittig, D. F.
2015-01-01
Summary Background Clinical knowledge bases of problem-medication pairs are necessary for many informatics solutions that improve patient safety, such as clinical summarization. However, developing these knowledge bases can be challenging. Objective We sought to validate a previously developed crowdsourcing approach for generating a knowledge base of problem-medication pairs in a large, non-university health care system with a widely used, commercially available electronic health record. Methods We first retrieved medications and problems entered in the electronic health record by clinicians during routine care during a six month study period. Following the previously published approach, we calculated the link frequency and link ratio for each pair then identified a threshold cutoff for estimated problem-medication pair appropriateness through clinician review; problem-medication pairs meeting the threshold were included in the resulting knowledge base. We selected 50 medications and their gold standard indications to compare the resulting knowledge base to the pilot knowledge base developed previously and determine its recall and precision. Results The resulting knowledge base contained 26,912 pairs, had a recall of 62.3% and a precision of 87.5%, and outperformed the pilot knowledge base containing 11,167 pairs from the previous study, which had a recall of 46.9% and a precision of 83.3%. Conclusions We validated the crowdsourcing approach for generating a knowledge base of problem-medication pairs in a large non-university health care system with a widely used, commercially available electronic health record, indicating that the approach may be generalizable across healthcare settings and clinical systems. Further research is necessary to better evaluate the knowledge, to compare crowdsourcing with other approaches, and to evaluate if incorporating the knowledge into electronic health records improves patient outcomes. PMID:26171079
Zhang, Yuetao
2012-01-01
Classical and frustrated Lewis pairs (LPs) of the strong Lewis acid (LA) Al(C 6F 5) 3 with several Lewis base (LB) classes have been found to exhibit exceptional activity in the Lewis pair polymerization (LPP) of conjugated polar alkenes such as methyl methacrylate (MMA) as well as renewable α-methylene-γ-butyrolactone (MBL) and γ-methyl- α-methylene-γ-butyrolactone (γ-MMBL), leading to high molecular weight polymers, often with narrow molecular weight distributions. This study has investigated a large number of LPs, consisting of 11 LAs as well as 10 achiral and 4 chiral LBs, for LPP of 12 monomers of several different types. Although some more common LAs can also be utilized for LPP, Al(C 6F 5) 3-based LPs are far more active and effective than other LA-based LPs. On the other hand, several classes of LBs, when paired with Al(C 6F 5) 3, can render highly active and effective LPP of MMA and γ-MMBL; such LBs include phosphines (e.g., P tBu 3), chiral chelating diphosphines, N-heterocyclic carbenes (NHCs), and phosphazene superbases (e.g., P 4- tBu). The P 4- tBu/Al(C 6F 5) 3 pair exhibits the highest activity of the LP series, with a remarkably high turn-over frequency of 9.6 × 10 4 h -1 (0.125 mol% catalyst, 100% MMA conversion in 30 s, M n = 2.12 × 10 5 g mol -1, PDI = 1.34). The polymers produced by LPs at RT are typically atactic (P γMMBL with ∼47% mr) or syndio-rich (PMMA with ∼70-75% rr), but highly syndiotactic PMMA with rr ∼91% can be produced by chiral or achiral LPs at -78 °C. Mechanistic studies have identified and structurally characterized zwitterionic phosphonium and imidazolium enolaluminates as the active species of the current LPP system, which are formed by the reaction of the monomer·Al(C 6F 5) 3 adduct with P tBu 3 and NHC bases, respectively. Kinetic studies have revealed that the MMA polymerization by the tBu 3P/ Al(C 6F 5) 3 pair is zero-order in monomer concentration after an initial induction period, and the polymerization
Dänicke, S; Böttcher, W; Simon, O; Jeroch, H
2001-01-01
An experiment was carried out to measure fractional muscle protein synthesis rates (k(s)) in broilers with injection of a flooding dose of phenylalanine (1 ml/100 g body weight of 150 mM phenylalanine; 38 atom percent excess (APE) [15N]phenylalanine). K(s) was calculated from the [15N] enrichment in phenylalanine of tissue-free and protein-bound phenylalanine using both gas chromatography mass spectrometry (GC-MS) and gas chromatography combustion isotope ratio mass spectrometry (GC-C-IRMS) for measurements after a 10 min isotope incorporation period. The tertiary-butyldimethylsilyl (t-BDMS) derivatives of phenylalanine were used for gas chromatographic separation in both systems. GC-MS and GC-C-IRMS were calibrated for a range of 7 to 37 [15N]APE and 0 to 0.62 [15N]APE, respectively, and for sample sizes of 0.45 to 4.5 nmol phenylalanine and 7 to 40 nmol phenylalanine, respectively. Reproducibility of standards as a measure of precision varied from 0.06 to 0.29 [15N]APE and from 0.0004 to 0.0018 [15N]APE in GC-MS and GC-C-IRMS, respectively. K(s) was measured in the m. pectoralis major of broilers fed rye based diets (56%) which were provided either unsupplemented (-) or supplemented (+) with an enzyme preparation containing xylanase. K(s) in breast muscles was significantly increased from 21.8%/d to 23.9%/d due to enzyme supplementation. It can be concluded from the study that the measurement of protein synthesis in broilers with the flooding dose technique can be carried out by using [15N]phenylalanine, GC-MS and GC-C-IRMS.
Predicting the Mechanism and Kinetics of the Watson-Crick to Hoogsteen Base Pairing Transition
Vreede, J.; Bolhuis, P.G.; Swenson, D.W.H.
2016-01-01
DNA duplexes predominantly contain Watson-Crick (WC) base pairs. Yet, a non-negligible number of base pairs converts to the Hoogsteen (HG) hydrogen bonding pattern, involving a 180° rotation of the purine base relative to Watson-Crick. These WC to HG conversions alter the conformation of DNA, and
On-line LC-GC and comprehensive two-dimensional LCxGC-ToF MS for the analysis of complex samples
Energy Technology Data Exchange (ETDEWEB)
Janssen, Hans-Gerd [Central Analytical Science, Unilever Research and Development, P.O. Box 114, 3130 AC, Vlaardingen (Netherlands); Koning, Sjaak de [Separation Science Group, LECO Instrumente GmbH, Marie-Bernays-Ring 31, 41199, Moenchengladbach (Germany); Brinkman, Udo A.Th. [Department of Analytical Chemistry and Applied Spectroscopy, Free University, De Boelelaan 1083, 1081 HV, Amsterdam (Netherlands)
2004-04-01
LC x GC is a logical extension of LC-GC. Unlike LC-GC, which only allows detailed analysis of one group of analytes from a complex sample, LC x GC enables detailed mapping of the entire sample. Due to the high degree of orthogonality and the complementary nature of the two dimensions, the method has a very high resolving power. Comprehensive LC x GC chromatograms often show ordered structures which allow group-wise integration as well as detailed target compound analysis. Hyphenation with mass spectrometry is straightforward, which further widens the application range of the technique. (orig.)
Base Pair Opening in a Deoxynucleotide Duplex Containing a cis-syn Thymine Cyclobutane Dimer Lesion
Wenke, Belinda B.; Huiting, Leah N.; Frankel, Elisa B.; Lane, Benjamin F.; Núñez, Megan E.
2014-01-01
The cis-syn thymine cyclobutane dimer is a DNA photoproduct implicated in skin cancer. We compared the stability of individual base pairs in thymine dimer-containing duplexes to undamaged parent 10-mer duplexes. UV melting thermodynamic measurements, CD spectroscopy, and 2D NOESY NMR spectroscopy confirm that the thymine dimer lesion is locally and moderately destabilizing within an overall B-form duplex conformation. We measured the rates of exchange of individual imino protons by NMR using magnetization transfer from water and determined the equilibrium constant for the opening of each base pair Kop. In the normal duplex Kop decreases from the frayed ends of the duplex toward the center, such that the central TA pair is the most stable with a Kop of 8×10−7. In contrast, base pair opening at the 5’T of the thymine dimer is facile. The 5’T of the dimer has the largest equilibrium constant (Kop =3×10−4) in its duplex, considerably larger than even the frayed penultimate base pairs. Notably, base pairing by the 3’T of the dimer is much more stable than by the 5’T, indicating that the predominant opening mechanism for the thymine dimer lesion is not likely to be flipping out into solution as a single unit. The dimer asymmetrically affects the stability of the duplex in its vicinity, destabilizing base pairing on its 5’ side more than on the 3’ side. The striking differences in base pair opening between parent and dimer duplexes occur independently of the duplex-single strand melting transitions. PMID:24328089
Tateishi-Karimata, Hisae; Nakano, Miki; Sugimoto, Naoki
2014-01-08
The instability of Hoogsteen base pairs relative to Watson-Crick base pairs has limited biological applications of triplex-forming oligonucleotides. Hydrated ionic liquids (ILs) provide favourable environments for a wide range of chemical reactions and are known to impact the stabilities of Watson-Crick base pairs. We found that DNA triplex formation was significantly stabilized in hydrated choline dihydrogen phosphate as compared with an aqueous buffer at neutral pH. Interestingly, the stability of Hoogsteen base pairs was found to be comparable with that of Watson-Crick base pairs in the hydrated IL. Molecular dynamics simulations of a DNA triplex in the presence of choline ions revealed that the DNA triplex was stabilized because of the binding of choline ion around the third strand in the grooves. Our finding will facilitate the development of new DNA materials. Our data also indicate that triplex formation may be stabilized inside cells where choline ions and their derivatives are abundant in vivo.
Tateishi-Karimata, Hisae; Nakano, Miki; Sugimoto, Naoki
2014-01-01
The instability of Hoogsteen base pairs relative to Watson–Crick base pairs has limited biological applications of triplex-forming oligonucleotides. Hydrated ionic liquids (ILs) provide favourable environments for a wide range of chemical reactions and are known to impact the stabilities of Watson–Crick base pairs. We found that DNA triplex formation was significantly stabilized in hydrated choline dihydrogen phosphate as compared with an aqueous buffer at neutral pH. Interestingly, the stability of Hoogsteen base pairs was found to be comparable with that of Watson–Crick base pairs in the hydrated IL. Molecular dynamics simulations of a DNA triplex in the presence of choline ions revealed that the DNA triplex was stabilized because of the binding of choline ion around the third strand in the grooves. Our finding will facilitate the development of new DNA materials. Our data also indicate that triplex formation may be stabilized inside cells where choline ions and their derivatives are abundant in vivo. PMID:24399194
Gas chromatography coupled to atmospheric pressure ionization mass spectrometry (GC-API-MS): Review
International Nuclear Information System (INIS)
Li, Du-Xin; Gan, Lin; Bronja, Amela; Schmitz, Oliver J.
2015-01-01
Although the coupling of GC/MS with atmospheric pressure ionization (API) has been reported in 1970s, the interest in coupling GC with atmospheric pressure ion source was expanded in the last decade. The demand of a “soft” ion source for preserving highly diagnostic molecular ion is desirable, as compared to the “hard” ionization technique such as electron ionization (EI) in traditional GC/MS, which fragments the molecule in an extensive way. These API sources include atmospheric pressure chemical ionization (APCI), atmospheric pressure photoionization (APPI), atmospheric pressure laser ionization (APLI), electrospray ionization (ESI) and low temperature plasma (LTP). This review discusses the advantages and drawbacks of this analytical platform. After an introduction in atmospheric pressure ionization the review gives an overview about the history and explains the mechanisms of various atmospheric pressure ionization techniques used in combination with GC such as APCI, APPI, APLI, ESI and LTP. Also new developments made in ion source geometry, ion source miniaturization and multipurpose ion source constructions are discussed and a comparison between GC-FID, GC-EI-MS and GC-API-MS shows the advantages and drawbacks of these techniques. The review ends with an overview of applications realized with GC-API-MS. - Highlights: • Atmospheric pressure ion sources (APCI, ESI, APPI, APLC etc) enable the coupling of LC-based high-end MS to GC. • APIs show advantages in selectivity and sensitivity compared with EI in GC-MS. • Accurate mass database in GC-APCI/MS is emerging as an alternative to GC-EI/MS database.
Gas chromatography coupled to atmospheric pressure ionization mass spectrometry (GC-API-MS): Review
Energy Technology Data Exchange (ETDEWEB)
Li, Du-Xin; Gan, Lin; Bronja, Amela [University of Duisburg-Essen, Applied Analytical Chemistry, Universitaetsstr. 5-7, 45141 Essen (Germany); Schmitz, Oliver J., E-mail: oliver.schmitz@uni-due.de [University of Duisburg-Essen, Applied Analytical Chemistry, Universitaetsstr. 5-7, 45141 Essen (Germany)
2015-09-03
Although the coupling of GC/MS with atmospheric pressure ionization (API) has been reported in 1970s, the interest in coupling GC with atmospheric pressure ion source was expanded in the last decade. The demand of a “soft” ion source for preserving highly diagnostic molecular ion is desirable, as compared to the “hard” ionization technique such as electron ionization (EI) in traditional GC/MS, which fragments the molecule in an extensive way. These API sources include atmospheric pressure chemical ionization (APCI), atmospheric pressure photoionization (APPI), atmospheric pressure laser ionization (APLI), electrospray ionization (ESI) and low temperature plasma (LTP). This review discusses the advantages and drawbacks of this analytical platform. After an introduction in atmospheric pressure ionization the review gives an overview about the history and explains the mechanisms of various atmospheric pressure ionization techniques used in combination with GC such as APCI, APPI, APLI, ESI and LTP. Also new developments made in ion source geometry, ion source miniaturization and multipurpose ion source constructions are discussed and a comparison between GC-FID, GC-EI-MS and GC-API-MS shows the advantages and drawbacks of these techniques. The review ends with an overview of applications realized with GC-API-MS. - Highlights: • Atmospheric pressure ion sources (APCI, ESI, APPI, APLC etc) enable the coupling of LC-based high-end MS to GC. • APIs show advantages in selectivity and sensitivity compared with EI in GC-MS. • Accurate mass database in GC-APCI/MS is emerging as an alternative to GC-EI/MS database.
Charge transfer in DNA: role of base pairing
Czech Academy of Sciences Publication Activity Database
Kratochvílová, Irena; Bunček, M.; Schneider, Bohdan
2009-01-01
Roč. 38, Suppl. (2009), S123-S123 ISSN 0175-7571. [EBSA European Biophysics Congress /7./. Genoa, 11.07.2009-15.07.2009] Institutional research plan: CEZ:AV0Z10100520; CEZ:AV0Z50520701 Keywords : DNA * charge transport * base pairing Subject RIV: CF - Physical ; Theoretical Chemistry Impact factor: 2.437, year: 2009
Modern methods of sample preparation for GC analysis
de Koning, S.; Janssen, H.-G.; Brinkman, U.A.Th.
2009-01-01
Today, a wide variety of techniques is available for the preparation of (semi-) solid, liquid and gaseous samples, prior to their instrumental analysis by means of capillary gas chromatography (GC) or, increasingly, comprehensive two-dimensional GC (GC × GC). In the past two decades, a large number
Photochemical selectivity in guanine-cytosine base-pair structures
Czech Academy of Sciences Publication Activity Database
Abo-Riziq, A.; Grace, L.; Nir, E.; Kabeláč, Martin; Hobza, Pavel; Vries de, M. S.
2005-01-01
Roč. 102, č. 1 (2005), s. 20-23 ISSN 0027-8424 R&D Projects: GA ČR(CZ) GA203/05/0009 Grant - others:NSF(US) CHE-0244341 Institutional research plan: CEZ:AV0Z40550506 Keywords : DNA base pairs * IR-UV spectroscopy * phytochemistry Subject RIV: CF - Physical ; Theoretical Chemistry Impact factor: 10.231, year: 2005
Measurement and theory of hydrogen bonding contribution to isosteric DNA base pairs.
Khakshoor, Omid; Wheeler, Steven E; Houk, K N; Kool, Eric T
2012-02-15
We address the recent debate surrounding the ability of 2,4-difluorotoluene (F), a low-polarity mimic of thymine (T), to form a hydrogen-bonded complex with adenine in DNA. The hydrogen bonding ability of F has been characterized as small to zero in various experimental studies, and moderate to small in computational studies. However, recent X-ray crystallographic studies of difluorotoluene in DNA/RNA have indicated, based on interatomic distances, possible hydrogen bonding interactions between F and natural bases in nucleic acid duplexes and in a DNA polymerase active site. Since F is widely used to measure electrostatic contributions to pairing and replication, it is important to quantify the impact of this isostere on DNA stability. Here, we studied the pairing stability and selectivity of this compound and a closely related variant, dichlorotoluene deoxyriboside (L), in DNA, using both experimental and computational approaches. We measured the thermodynamics of duplex formation in three sequence contexts and with all possible pairing partners by thermal melting studies using the van't Hoff approach, and for selected cases by isothermal titration calorimetry (ITC). Experimental results showed that internal F-A pairing in DNA is destabilizing by 3.8 kcal/mol (van't Hoff, 37 °C) as compared with T-A pairing. At the end of a duplex, base-base interactions are considerably smaller; however, the net F-A interaction remains repulsive while T-A pairing is attractive. As for selectivity, F is found to be slightly selective for adenine over C, G, T by 0.5 kcal mol, as compared with thymine's selectivity of 2.4 kcal/mol. Interestingly, dichlorotoluene in DNA is slightly less destabilizing and slightly more selective than F, despite the lack of strongly electronegative fluorine atoms. Experimental data were complemented by computational results, evaluated at the M06-2X/6-31+G(d) and MP2/cc-pVTZ levels of theory. These computations suggest that the pairing energy of F to A
Flavor profiles of two Florida strawberry cultivars were determined using GC-olfactometry,GC-MS, odor activity values (OAVs) and sensory analysis. Thirty-six aroma active compounds were detected using GC-O. Thirty-four were identified. The major odor-active compounds in decreasing intensity were: me...
Yu, Chuanfei; Gao, Kai; Zhu, Lei; Wang, Wenbo; Wang, Lan; Zhang, Feng; Liu, Chunyu; Li, Meng; Wormald, Mark R; Rudd, Pauline M; Wang, Junzhi
2016-01-29
Two non-human glycan epitopes, galactose-α-1,3-galactose (α-gal) and Neu5Gc-α-2-6-galactose (Neu5Gc) have been shown to be antigenic when attached to Fab oligosaccharides of monoclonal antibodies (mAbs) , while α-gal attached to Fc glycans was not. However, the antigenicity of Neu5Gc on the Fc glycans remains unclear in the context that most mAbs carry only Fc glycans. After studying two clinical mAbs carrying significant amounts of Fc Neu5Gc, we show that their binding activity with anti-Neu5Gc antibody resided in a small subset of mAbs carrying two or more Fc Neu5Gc, while mAbs harboring only one Neu5Gc showed no reactivity. Since most Neu5Gc epitopes were distributed singly on the Fc of mAbs, our results suggest that the potential antigenicity of Fc Neu5Gc is low. Our study could be referenced in the process design and optimization of mAb production in murine myeloma cells and in the quality control of mAbs for industries and regulatory authorities.
Czech Academy of Sciences Publication Activity Database
Šponer, Judit E.; Leszczynski, J.; Šponer, Jiří
2005-01-01
Roč. 22, č. 6 (2005), s. 826 ISSN 0739-1102. [Albany 2005. Conversation /14./. 14.06.2005-18.06.2005, Albany] Institutional research plan: CEZ:AV0Z50040507 Keywords : RNA base pairing * DNA * Watson-Crick/Sugar Edge Subject RIV: BO - Biophysics
Kondo, Jiro; Westhof, Eric
2011-10-01
Nucleotide bases are recognized by amino acid residues in a variety of DNA/RNA binding and nucleotide binding proteins. In this study, a total of 446 crystal structures of nucleotide-protein complexes are analyzed manually and pseudo pairs together with single and bifurcated hydrogen bonds observed between bases and amino acids are classified and annotated. Only 5 of the 20 usual amino acid residues, Asn, Gln, Asp, Glu and Arg, are able to orient in a coplanar fashion in order to form pseudo pairs with nucleotide bases through two hydrogen bonds. The peptide backbone can also form pseudo pairs with nucleotide bases and presents a strong bias for binding to the adenine base. The Watson-Crick side of the nucleotide bases is the major interaction edge participating in such pseudo pairs. Pseudo pairs between the Watson-Crick edge of guanine and Asp are frequently observed. The Hoogsteen edge of the purine bases is a good discriminatory element in recognition of nucleotide bases by protein side chains through the pseudo pairing: the Hoogsteen edge of adenine is recognized by various amino acids while the Hoogsteen edge of guanine is only recognized by Arg. The sugar edge is rarely recognized by either the side-chain or peptide backbone of amino acid residues.
Kondo, Jiro; Westhof, Eric
2011-01-01
Nucleotide bases are recognized by amino acid residues in a variety of DNA/RNA binding and nucleotide binding proteins. In this study, a total of 446 crystal structures of nucleotide–protein complexes are analyzed manually and pseudo pairs together with single and bifurcated hydrogen bonds observed between bases and amino acids are classified and annotated. Only 5 of the 20 usual amino acid residues, Asn, Gln, Asp, Glu and Arg, are able to orient in a coplanar fashion in order to form pseudo pairs with nucleotide bases through two hydrogen bonds. The peptide backbone can also form pseudo pairs with nucleotide bases and presents a strong bias for binding to the adenine base. The Watson–Crick side of the nucleotide bases is the major interaction edge participating in such pseudo pairs. Pseudo pairs between the Watson–Crick edge of guanine and Asp are frequently observed. The Hoogsteen edge of the purine bases is a good discriminatory element in recognition of nucleotide bases by protein side chains through the pseudo pairing: the Hoogsteen edge of adenine is recognized by various amino acids while the Hoogsteen edge of guanine is only recognized by Arg. The sugar edge is rarely recognized by either the side-chain or peptide backbone of amino acid residues. PMID:21737431
Giri, Anupam; Zelinkova, Zuzana; Wenzl, Thomas
2017-12-01
For the implementation of Regulation (EC) No 2065/2003 related to smoke flavourings used or intended for use in or on foods a method based on solid-phase micro extraction (SPME) GC/MS was developed for the characterisation of liquid smoke products. A statistically based experimental design (DoE) was used for method optimisation. The best general conditions to quantitatively analyse the liquid smoke compounds were obtained with a polydimethylsiloxane/divinylbenzene (PDMS/DVB) fibre, 60°C extraction temperature, 30 min extraction time, 250°C desorption temperature, 180 s desorption time, 15 s agitation time, and 250 rpm agitation speed. Under the optimised conditions, 119 wood pyrolysis products including furan/pyran derivatives, phenols, guaiacol, syringol, benzenediol, and their derivatives, cyclic ketones, and several other heterocyclic compounds were identified. The proposed method was repeatable (RSD% <5) and the calibration functions were linear for all compounds under study. Nine isotopically labelled internal standards were used for improving quantification of analytes by compensating matrix effects that might affect headspace equilibrium and extractability of compounds. The optimised isotope dilution SPME-GC/MS based analytical method proved to be fit for purpose, allowing the rapid identification and quantification of volatile compounds in liquid smoke flavourings.
Accumulation of GC donor splice signals in mammals
Directory of Open Access Journals (Sweden)
Koonin Eugene V
2008-07-01
Full Text Available Abstract The GT dinucleotide in the first two intron positions is the most conserved element of the U2 donor splice signals. However, in a small fraction of donor sites, GT is replaced by GC. A substantial enrichment of GC in donor sites of alternatively spliced genes has been observed previously in human, nematode and Arabidopsis, suggesting that GC signals are important for regulation of alternative splicing. We used parsimony analysis to reconstruct evolution of donor splice sites and inferred 298 GT > GC conversion events compared to 40 GC > GT conversion events in primate and rodent genomes. Thus, there was substantive accumulation of GC donor splice sites during the evolution of mammals. Accumulation of GC sites might have been driven by selection for alternative splicing. Reviewers This article was reviewed by Jerzy Jurka and Anton Nekrutenko. For the full reviews, please go to the Reviewers' Reports section.
International Nuclear Information System (INIS)
Wang, Xiao-jing; Liu, Chao; Li, Xu-li; Li, Fa-tang; Li, Yu-pei; Zhao, Jun; Liu, Rui-hong
2017-01-01
Highlights: • Ultrathin g-C_3N_4/Al_2O_3 hybrids are prepared via in-situ reaction. • The structure modification role of in-situ formed HNO_3 for g-C_3N_4 is found. • The ultrathin g-C_3N_4 nanosheets are formed by the acidified melamine and Al(OH)_3. • In-situ calcination of melamine and Al(OH)_3 benefits the contact of C_3N_4 and Al_2O_3. • The activity of g-C_3N_4/Al_2O_3 is 16.6 times that of pristine g-C_3N_4 in degrading RhB. - Abstract: Homogeneous ultrathin g-C_3N_4 nanosheets/Al_2O_3 heterojunctions are synthesized using melamine and Al(NO_3)_3 via in-situ reaction and the following thermal polymerization approach. The in-situ reaction between melamine and Al(NO_3)_3 results in the existence of HNO_3-acidified melamine and Al(OH)_3 aggregates via the hydrolysis of Al(NO_3)_3. After thermal polymerization, the aggregates are converted to g-C_3N_4/Al_2O_3 composites. The thermal polymerization of acidified melamine and the support effect of aluminum hydroxide for g-C_3N_4 during the calcination process lead to highly dispersed amrophous Al_2O_3 on ultrathin g-C_3N_4 nanosheets, which is beneficial for the separation of photogenerated electron-hole pairs in the heterojunction. The degradation rate for Rhodamine B (RhB) over the most activie sample is 16.6 times than that of pristine g-C_3N_4 under visible light irradiation, which can be attributed to the high specific surface area, highly dispersion of amorphous Al_2O_3 on ultrathin g-C_3N_4 nanosheet, and the effective electrons transfer from g-C_3N_4 to the amorphous Al_2O_3.
International Nuclear Information System (INIS)
Qiu, Pengxiang; Yao, Jinhua; Chen, Huan; Jiang, Fang; Xie, Xianchuan
2016-01-01
Highlights: • A novel flower-on-sheet ZnIn_2S_4/g-C_3N_4 nanocomposite was synthesized. • ZnIn_2S_4/g-C_3N_4 showed high visible light catalytic activity for 2,4-D degradation. • The photocatalytic degradation pathway of 2,4-D was investigated. - Abstract: ZnIn_2S_4/g-C_3N_4 heterojunction photocatalyst was successfully synthesized via a simple hydrothermal method and applied to visible-light photocatalytic decomposition of 2,4-dichlorophenoxyacetic acid (2,4-D) from aqueous phase. The flower-like ZnIn_2S_4 particles were dispersed on the surface of g-C_3N_4 nanosheets in the ZnIn_2S_4/g-C_3N_4 composite. The composite showed higher separation rate of electron-hole pairs as compared to ZnIn_2S_4 and g-C_3N_4. Consequently, the ZnIn_2S_4/g-C_3N_4 composite exhibited enhanced visible light photocatalytic decomposition efficiency of 2,4-D, within 20% ZnIn_2S_4/g-C_3N_4 composite owning the highest photocatalytic efficiency and initial rate. The initial rates of 2,4-D degradation on g-C_3N_4, ZnIn_2S_4, and 20% ZnIn_2S_4/g-C_3N_4 were 1.23, 0.57 and 3.69 mmol/(g_c_a_t h), respectively. The h"+ and O_2"·"− were found to be the dominant active species for 2,4-D decomposition. The photocatalytic degradation pathways of 2,4-D by ZnIn_2S_4/g-C_3N_4 under visible light irradiation were explored. The ZnIn_2S_4/g-C_3N_4 composite displayed high photostability in recycling tests, reflecting its promising potential as an effective visible light photocatalyst for 2,4-D treatment.
International Nuclear Information System (INIS)
Li, Juan; Yin, Yunchao; Liu, Enzhou; Ma, Yongning; Wan, Jun; Fan, Jun; Hu, Xiaoyun
2017-01-01
Graphical abstract: TEM image and schematic diagram of photocatalytic mechanism of Bi_2MoO_6/g-C_3N_4 composite. - Highlights: • BM/CNNs heterojunctions were obtained by an in situ solvothermal method. • 2D CNNs are superior to CN as photocatalysts and supporting materials. • The photocatalytic hydrogen evolution of BM/CNNs has been first studied. • The photocatalytic disinfection of bacteria by BM/CNNs has been first studied. • The photocatalytic mechanism of BM/CNNs heterojunction was described. - Abstract: Bi_2MoO_6/g-C_3N_4 heterojunctions were fabricated by an in situ solvothermal method using g-C_3N_4 nanosheets. The photocatalytic activities of as-prepared samples were evaluated by hydrogen evolution from water splitting and disinfection of bacteria under visible light irradiation. The results indicate that exfoliating bulk g-C_3N_4 to g-C_3N_4 nanosheets greatly enlarges the specific surface area and shortens the diffusion distance for photogenerated charges, which could not only promote the photocatalytic performance but also benefit the sufficient interaction with Bi_2MoO_6. Furthermore, intimate contact of Bi_2MoO_6 (BM) and g-C_3N_4 nanosheets (CNNs) in the BM/CNNs composites facilitates the transfer and separation of photogenetrated electron-hole pairs. 20%-BM/CNNs heterojunction exhibits the optimal photocatalytic hydrogen evolution as well as photocatalytic disinfection of bacteria. Furthermore, h"+ was demonstrated as the dominant reactive species which could make the bacteria cells inactivated in the photocatalytic disinfection process. This study extends new chance of g-C_3N_4-based photocatalysts to the growing demand of clean new energy and drinking water.
Jham, Gulab N; da Silva, Alexsandro A; Lima, Eraldo R; Viana, Paulo
2005-02-01
Two insect colonies of Elasmopalpus lignosellus were reared in our laboratory, the first being initiated from pupae obtained from a cornfield in the region of Sete Lagoas, Minas Gerais and the second from a cornfield in the region of Goiânia, Goiás. From the two colonies, two extracts were prepared from the pheromone glands of virgin E. lignosellus females. The extract obtained from the first colony was designated as extract 1 while the extract obtained from the second colony was designated as extract 2. Extract 1 was analyzed by gas chromatography-mass spectrometry (GC-MS) with (Z)-9-hexadecenyl acetate [(Z)-9-HDA] and (Z)-11-hexadecenyl acetate [(Z)-11-HDA] being identified and confirmed by the formation of DMDS derivatives. In addition, a third acetate, which could be either (E)-8-hexadecenyl acetate [(E)-8-HDA] or (E)-9-hexadecenyl acetate [(E)-9-HDA] was detected by GC-MS. Extract 2 was analyzed by gas chromatography (GC) and gas chromatography-electroannetography (GC-EAD) revealing the presence of (Z)-11-HDA and (Z)-9-TDA. In addition, the same compounds elicited a response with the E. lignosellus male antenna obtained from the second insect colony. Electroantennography (EAG) screening with the male E. lignosellus antenna (obtained from the second insect colony) was conducted with the 23 possible tetradecenyl acetates (TDA) and 22 hexadecenyl acetates (HDA) as standards. Out of the 23 TDA isomers evaluated, only (Z)-9-TDA elicited a response and out of the 22 HDA [(Z) and (E) isomers gamma2 to delta13] evaluated only (Z)-11-HDA elicited a response. The acetate compositions of two extracts obtained from insects originating from the two states (Minas Gerais and Goiás) of Brazil were different from one another as well as from that obtained from insects in Tifton, GA, USA. The bioactivity data (GC-EAD) of the extract 2 differed from those reported for the Tifton, GA, USA population. These data suggest polymorphism in relation to the insect populations found in
The GC-heterogeneity of teleost fishes
Directory of Open Access Journals (Sweden)
Gautier Christian
2008-12-01
Full Text Available Abstract Background One of the most striking features of mammalian and birds chromosomes is the variation in the guanine-cytosine (GC content that occurs over scales of hundreds of kilobases to megabases; this is known as the "isochore" structure. Among other vertebrates the presence of isochores depends upon the taxon; isochore are clearly present in Crocodiles and turtles but fish genome seems very homogeneous on GC content. This has suggested a unique isochore origin after the divergence between Sarcopterygii and Actinopterygii, but before that between Sauropsida and mammals. However during more than 30 years of analysis, isochore characteristics have been studied and many important biological properties have been associated with the isochore structure of human genomes. For instance, the genes are more compact and their density is highest in GC rich isochores. Results This paper shows in teleost fish genomes the existence of "GC segmentation" sharing some of the characteristics of isochores although teleost fish genomes presenting a particular homogeneity in CG content. The entire genomes of T nigroviridis and D rerio are now available, and this has made it possible to check whether a mosaic structure associated with isochore properties can be found in these fishes. In this study, hidden Markov models were trained on fish genes (T nigroviridis and D rerio which were classified by using the isochore class of their human orthologous. A clear segmentation of these genomes was detected. Conclusion The GC content is an excellent indicator of isochores in heterogeneous genomes as mammals. The segmentation we obtained were well correlated with GC content and other properties associated to GC content such as gene density, the number of exons per gene and the length of introns. Therefore, the GC content is the main property that allows the detection of isochore but more biological properties have to be taken into account. This method allows detecting
Vercoutere, Wenonah A.; Winters-Hilt, Stephen; DeGuzman, Veronica S.; Deamer, David; Ridino, Sam E.; Rodgers, Joseph T.; Olsen, Hugh E.; Marziali, Andre; Akeson, Mark
2003-01-01
Nanoscale α-hemolysin pores can be used to analyze individual DNA or RNA molecules. Serial examination of hundreds to thousands of molecules per minute is possible using ionic current impedance as the measured property. In a recent report, we showed that a nanopore device coupled with machine learning algorithms could automatically discriminate among the four combinations of Watson–Crick base pairs and their orientations at the ends of individual DNA hairpin molecules. Here we use kinetic analysis to demonstrate that ionic current signatures caused by these hairpin molecules depend on the number of hydrogen bonds within the terminal base pair, stacking between the terminal base pair and its nearest neighbor, and 5′ versus 3′ orientation of the terminal bases independent of their nearest neighbors. This report constitutes evidence that single Watson–Crick base pairs can be identified within individual unmodified DNA hairpin molecules based on their dynamic behavior in a nanoscale pore. PMID:12582251
Solvent effects on hydrogen bonds in Watson-Crick, mismatched, and modified DNA base pairs
Poater, Jordi; Swart, Marcel; Guerra, Celia Fonseca; Bickelhaupt, F. Matthias
2012-01-01
We have theoretically analyzed a complete series of Watson–Crick and mismatched DNA base pairs, both in gas phase and in solution. Solvation causes a weakening and lengthening of the hydrogen bonds between the DNA bases because of the stabilization of the lone pairs involved in these bonds. We have
Results of the First Mars Organic Molecule Analyzer (MOMA) GC-MS Coupling
Buch, Arnaud; Pinnick, Veronica; Szopa, Cyril; Danell, Ryan; Grand, Noel; Van Amerom, Friso; Glavin, Daniel; Freissinet, Caroline; Humeau, Olivier; Coll, Patrice; Arevalo, Ricardo; Stalport, Fabien; Brinckerhoff, William; Steininger, Harald; Goesmann, Fred; Mahaffy, Paul; Raulin, Francois
2014-11-01
The Mars Organic Molecule Analyzer (MOMA) aboard the ExoMars rover will be a key analytical tool in providing chemical (molecular) information from the solid samples collected by the rover, with a particular focus on the char-acterization of the organic content. The core of the MOMA instrument is a gas chromatograph coupled with a mass spectrometer (GC-MS) which provides the unique capability to characterize a broad range of compounds, including both of volatile and non-volatile species. Samples will be crushed and deposited into sample cups seated in a rotating carousel. Soil samples will be analyzed either by UV laser desorption / ionization (LDI) or pyrolysis gas chromatography ion trap mass spectrometry (pyr-GC-ITMS).The French GC brassboard was coupled to the US ion trap mass spectrometer brassboard in a flight-like con-figuration for several coupling campains. The MOMA GC setup is based on the SAM heritage design with a He reservoir and 4 separate analytical modules including traps, columns and Thermal Conductivity Detectors. Solid samples are sealed and heated in this setup using a manual tapping station, designed and built at MPS in Germany, for GC-MS analysis. The gaseous species eluting from the GC are then ionized by an electron impact ionization source in the MS chamber and analyzed by the linear ion trap mass spectrometer. Volatile and non-volatile compounds were injected in the MOMA instrumental suite. Both of these compounds classes were detected by the TCD and by the MS. MS signal (total ion current) and single mass spectra by comparison with the NIST library, gave us an unambiguous confirmation of these identifications. The mass spectra arise from an average of 10 mass spectra averaged around a given time point in the total ion chromatogram.Based on commercial instrument, the MOMA requirement for sensitivity in the GC-MS mode for organic molecules is 1 pmol. In this test, sensitivity was determined for the GC TCD and MS response to a dilution
KlenTaq polymerase replicates unnatural base pairs by inducing a Watson-Crick geometry.
Betz, Karin; Malyshev, Denis A; Lavergne, Thomas; Welte, Wolfram; Diederichs, Kay; Dwyer, Tammy J; Ordoukhanian, Phillip; Romesberg, Floyd E; Marx, Andreas
2012-07-01
Many candidate unnatural DNA base pairs have been developed, but some of the best-replicated pairs adopt intercalated structures in free DNA that are difficult to reconcile with known mechanisms of polymerase recognition. Here we present crystal structures of KlenTaq DNA polymerase at different stages of replication for one such pair, dNaM-d5SICS, and show that efficient replication results from the polymerase itself, inducing the required natural-like structure.
Ferrocene-based Lewis acids and Lewis pairs: Synthesis and ...
Indian Academy of Sciences (India)
The design and synthesis of molecules containing non-interacting Lewis base and Lewis acid groups. [Frustrated Lewis pairs (FLP's)] have received intense attention due to their potential applications in the area of molecular catalysis.1–3. For example,. Stephen's and co-workers have demonstrated that the unquenched ...
Concealed d-wave pairs in the s± condensate of iron-based superconductors.
Ong, Tzen; Coleman, Piers; Schmalian, Jörg
2016-05-17
A central question in iron-based superconductivity is the mechanism by which the paired electrons minimize their strong mutual Coulomb repulsion. In most unconventional superconductors, Coulomb repulsion is minimized through the formation of higher angular momentum Cooper pairs, with Fermi surface nodes in the pair wavefunction. The apparent absence of such nodes in the iron-based superconductors has led to a belief they form an s-wave ([Formula: see text]) singlet state, which changes sign between the electron and hole pockets. However, the multiorbital nature of these systems opens an alternative possibility. Here, we propose a new class of [Formula: see text] state containing a condensate of d-wave Cooper pairs, concealed by their entanglement with the iron orbitals. By combining the d-wave ([Formula: see text]) motion of the pairs with the internal angular momenta [Formula: see text] of the iron orbitals to make a singlet ([Formula: see text]), an [Formula: see text] superconductor with a nontrivial topology is formed. This scenario allows us to understand the development of octet nodes in potassium-doped Ba1-x KXFe2As2 as a reconfiguration of the orbital and internal angular momentum into a high spin ([Formula: see text]) state; the reverse transition under pressure into a fully gapped state can then be interpreted as a return to the low-spin singlet. The formation of orbitally entangled pairs is predicted to give rise to a shift in the orbital content at the Fermi surface, which can be tested via laser-based angle-resolved photoemission spectroscopy.
Comparison of GC/MSD and GC/AED for the determination of organotin compounds in the environment
Energy Technology Data Exchange (ETDEWEB)
Staeb, J.A. (Inst. of Environmental Studies, Free Univ., Amsterdam (Netherlands)); Cofino, W.P. (Inst. of Environmental Studies, Free Univ., Amsterdam (Netherlands)); Hattum, B. van (Inst. of Environmental Studies, Free Univ., Amsterdam (Netherlands)); Brinkman, U.A.T. (Dept. of Analytical Chemistry, Free Univ., Amsterdam (Netherlands))
Methods are described for the analysis of environmental samples like water, sediment and suspended matter for the determination of all organotin compounds (OTs) that are currently used as biocides: Tributyltin (TBT) triphenyltin (TPT), tricyclohexyltin (TCT) and fenbutatin oxide (FBTO). In water also five degradation products (di and mono substituted analogs) can be determined. Alkylation using a Grignard reagent was used to obtain OT derivatives amenable to gas chromatography (GC). Both methylation and pentylation have been employed for derivatization prior to GC analysis. The present results show that derivatization efficiencies for TPT, TCT and FBTO at trace levels are higher using methylation than pentylation. Detection limits for each type of sample matrix were determined using GC/Mass Selective Detection (GC/MSD) and GC/Atomic Emission Detection (AED). In sediment and suspended matter only tri-substituted OTs (i.e. the parent compounds) could be determined. Detection limits ranged from 0.2 to 10 ng/g dry weight. FBTO, not previously detected in environmental samples, was found at levels of 4 and 11 ng/g in a suspended matter sample and a sediment sample, respectively. In water the OTs and their degradation products were determined at levels of 1-10 ng/l (as tin) using 200 ml water samples. (orig.)
Vendeuvre, Colombe; Ruiz-Guerrero, Rosario; Bertoncini, Fabrice; Duval, Laurent; Thiébaut, Didier; Hennion, Marie-Claire
2005-09-09
The detailed characterisation of middle distillates is essential for a better understanding of reactions involved in refining process. Owing to higher resolution power and enhanced sensitivity, comprehensive two-dimensional gas chromatography (GC x GC) is a powerful tool for improving characterisation of petroleum samples. The aim of this paper is to compare GC x GC and various ASTM methods -- gas chromatography (GC), liquid chromatography (LC) and mass spectrometry (MS) -- for group type separation and detailed hydrocarbon analysis. Best features of GC x GC are demonstrated and compared to these techniques in terms of cost, time consumption and accuracy. In particular, a new approach of simulated distillation (SimDis-GC x GC) is proposed: compared to the standard method ASTM D2887 it gives unequal information for better understanding of conversion process.
The Met Office Global Coupled Model 3.0 and 3.1 (GC3.0 and GC3.1) Configurations
Williams, K. D.; Copsey, D.; Blockley, E. W.; Bodas-Salcedo, A.; Calvert, D.; Comer, R.; Davis, P.; Graham, T.; Hewitt, H. T.; Hill, R.; Hyder, P.; Ineson, S.; Johns, T. C.; Keen, A. B.; Lee, R. W.; Megann, A.; Milton, S. F.; Rae, J. G. L.; Roberts, M. J.; Scaife, A. A.; Schiemann, R.; Storkey, D.; Thorpe, L.; Watterson, I. G.; Walters, D. N.; West, A.; Wood, R. A.; Woollings, T.; Xavier, P. K.
2018-02-01
The Global Coupled 3 (GC3) configuration of the Met Office Unified Model is presented. Among other applications, GC3 is the basis of the United Kingdom's submission to the Coupled Model Intercomparison Project 6 (CMIP6). This paper documents the model components that make up the configuration (although the scientific descriptions of these components are in companion papers) and details the coupling between them. The performance of GC3 is assessed in terms of mean biases and variability in long climate simulations using present-day forcing. The suitability of the configuration for predictability on shorter time scales (weather and seasonal forecasting) is also briefly discussed. The performance of GC3 is compared against GC2, the previous Met Office coupled model configuration, and against an older configuration (HadGEM2-AO) which was the submission to CMIP5. In many respects, the performance of GC3 is comparable with GC2, however, there is a notable improvement in the Southern Ocean warm sea surface temperature bias which has been reduced by 75%, and there are improvements in cloud amount and some aspects of tropical variability. Relative to HadGEM2-AO, many aspects of the present-day climate are improved in GC3 including tropospheric and stratospheric temperature structure, most aspects of tropical and extratropical variability and top-of-atmosphere and surface fluxes. A number of outstanding errors are identified including a residual asymmetric sea surface temperature bias (cool northern hemisphere, warm Southern Ocean), an overly strong global hydrological cycle and insufficient European blocking.
Roles of the Amino Group of Purine Bases in the Thermodynamic Stability of DNA Base Pairing
Directory of Open Access Journals (Sweden)
Shu-ichi Nakano
2014-08-01
Full Text Available The energetic aspects of hydrogen-bonded base-pair interactions are important for the design of functional nucleotide analogs and for practical applications of oligonucleotides. The present study investigated the contribution of the 2-amino group of DNA purine bases to the thermodynamic stability of oligonucleotide duplexes under different salt and solvent conditions, using 2'-deoxyriboinosine (I and 2'-deoxyribo-2,6-diaminopurine (D as non-canonical nucleotides. The stability of DNA duplexes was changed by substitution of a single base pair in the following order: G•C > D•T ≈ I•C > A•T > G•T > I•T. The apparent stabilization energy due to the presence of the 2-amino group of G and D varied depending on the salt concentration, and decreased in the water-ethanol mixed solvent. The effects of salt concentration on the thermodynamics of DNA duplexes were found to be partially sequence-dependent, and the 2-amino group of the purine bases might have an influence on the binding of ions to DNA through the formation of a stable base-paired structure. Our results also showed that physiological salt conditions were energetically favorable for complementary base recognition, and conversely, low salt concentration media and ethanol-containing solvents were effective for low stringency oligonucleotide hybridization, in the context of conditions employed in this study.
Hantavirus Gc induces long-term immune protection via LAMP-targeting DNA vaccine strategy.
Jiang, Dong-Bo; Zhang, Jin-Peng; Cheng, Lin-Feng; Zhang, Guan-Wen; Li, Yun; Li, Zi-Chao; Lu, Zhen-Hua; Zhang, Zi-Xin; Lu, Yu-Chen; Zheng, Lian-He; Zhang, Fang-Lin; Yang, Kun
2018-02-01
Hemorrhagic fever with renal syndrome (HFRS) occurs widely throughout Eurasia. Unfortunately, there is no effective treatment, and prophylaxis remains the best option against the major pathogenic agent, hantaan virus (HTNV), which is an Old World hantavirus. However, the absence of cellular immune responses and immunological memory hampers acceptance of the current inactivated HFRS vaccine. Previous studies revealed that a lysosome-associated membrane protein 1 (LAMP1)-targeting strategy involving a DNA vaccine based on the HTNV glycoprotein Gn successfully conferred long-term immunity, and indicated that further research on Gc, another HTNV antigen, was warranted. Plasmids encoding Gc and lysosome-targeted Gc, designated pVAX-Gc and pVAX-LAMP/Gc, respectively, were constructed. Proteins of interest were identified by fluorescence microscopy following cell line transfection. Five groups of 20 female BALB/c mice were subjected to the following inoculations: inactivated HTNV vaccine, pVAX-LAMP/Gc, pVAX-Gc, and, as the negative controls, pVAX-LAMP or the blank vector pVAX1. Humoral and cellular immunity were assessed by enzyme-linked immunosorbent assays (ELISAs) and 15-mer peptide enzyme-linked immunospot (ELISpot) epitope mapping assays. Repeated immunization with pVAX-LAMP/Gc enhanced adaptive immune responses, as demonstrated by the specific and neutralizing antibody titers and increased IFN-γ production. The inactivated vaccine induced a comparable humoral reaction, but the negative controls only elicited insignificant responses. Using a mouse model of HTNV challenge, the in vivo protection conferred by the inactivated vaccine and Gc-based constructs (with/without LAMP recombination) was confirmed. Evidence of pan-epitope reactions highlighted the long-term cellular response to the LAMP-targeting strategy, and histological observations indicated the safety of the LAMP-targeting vaccines. The long-term protective immune responses induced by pVAX-LAMP/Gc may be
An entropy-based improved k-top scoring pairs (TSP) method for ...
African Journals Online (AJOL)
An entropy-based improved k-top scoring pairs (TSP) (Ik-TSP) method was presented in this study for the classification and prediction of human cancers based on gene-expression data. We compared Ik-TSP classifiers with 5 different machine learning methods and the k-TSP method based on 3 different feature selection ...
Cell Monitoring and Manipulation Systems (CMMSs based on Glass Cell-Culture Chips (GC3s
Directory of Open Access Journals (Sweden)
Sebastian M. Buehler
2016-06-01
Full Text Available We developed different types of glass cell-culture chips (GC3s for culturing cells for microscopic observation in open media-containing troughs or in microfluidic structures. Platinum sensor and manipulation structures were used to monitor physiological parameters and to allocate and permeabilize cells. Electro-thermal micro pumps distributed chemical compounds in the microfluidic systems. The integrated temperature sensors showed a linear, Pt1000-like behavior. Cell adhesion and proliferation were monitored using interdigitated electrode structures (IDESs. The cell-doubling times of primary murine embryonic neuronal cells (PNCs were determined based on the IDES capacitance-peak shifts. The electrical activity of PNC networks was detected using multi-electrode arrays (MEAs. During seeding, the cells were dielectrophoretically allocated to individual MEAs to improve network structures. MEA pads with diameters of 15, 20, 25, and 35 µm were tested. After 3 weeks, the magnitudes of the determined action potentials were highest for pads of 25 µm in diameter and did not differ when the inter-pad distances were 100 or 170 µm. Using 25-µm diameter circular oxygen electrodes, the signal currents in the cell-culture media were found to range from approximately −0.08 nA (0% O2 to −2.35 nA (21% O2. It was observed that 60-nm thick silicon nitride-sensor layers were stable potentiometric pH sensors under cell-culture conditions for periods of days. Their sensitivity between pH 5 and 9 was as high as 45 mV per pH step. We concluded that sensorized GC3s are potential animal replacement systems for purposes such as toxicity pre-screening. For example, the effect of mefloquine, a medication used to treat malaria, on the electrical activity of neuronal cells was determined in this study using a GC3 system.
International Nuclear Information System (INIS)
Takahashi, Nobuhiro; Hieda, Kotaro; Morohoshi, Fumiko; Munakata, Nobuo
1999-01-01
Bacillus subtilis spores were exposed to three types of photons, monochromatic soft X-rays with the energy corresponding to the absorption peak of phosphorus K-shell electron (2,153 eV) and with the slightly lower energy (2,147 eV), and 60 Co γ-rays. From the irradiated spores, 233 mutants exhibiting nalidixic acid resistance were isolated, and together with 94 spontaneous mutants, the sequence changes in the 5'-terminal region of the gyrA gene coding for DNA gyrase subunit A were determined. Among eighteen alleles of the gyrA mutations, eight were single-base substitutions, nine were tandem double-base substitutions, and one was a double substitution skipping a middle base pair. About 6% of the radiation-induced mutations were tandem double-base substitutions, whereas none was observed among the spontaneous ones. Among spontaneous mutations, A:T and G:C pairs were equally subjected to mutations, whereas the substitutions from G:C pairs and those to A:T pairs predominated among those induced with soft X-rays. The peak-energy X-rays were more effective in killing and causing mutations than the low-energy X-rays, however, there seemed no base-change events uniquely attributable to phosphorus K-shell absorption. (author)
Pramanik, Smritimoy; Nakamura, Kaori; Usui, Kenji; Nakano, Shu-ichi; Saxena, Sarika; Matsui, Jun; Miyoshi, Daisuke; Sugimoto, Naoki
2011-03-14
We found that Hoogsteen base pairs were stabilized by molecular crowding and a histone H3-mimicking peptide, which was not observed for Watson-Crick base pairs. Our findings demonstrate that the type of DNA base pair is critical for the interaction between DNA and histones.
Watson-Crick base pairing controls excited-state decay in natural DNA.
Bucher, Dominik B; Schlueter, Alexander; Carell, Thomas; Zinth, Wolfgang
2014-10-13
Excited-state dynamics are essential to understanding the formation of DNA lesions induced by UV light. By using femtosecond IR spectroscopy, it was possible to determine the lifetimes of the excited states of all four bases in the double-stranded environment of natural DNA. After UV excitation of the DNA duplex, we detected a concerted decay of base pairs connected by Watson-Crick hydrogen bonds. A comparison of single- and double-stranded DNA showed that the reactive charge-transfer states formed in the single strands are suppressed by base pairing in the duplex. The strong influence of the Watson-Crick hydrogen bonds indicates that proton transfer opens an efficient decay path in the duplex that prohibits the formation or reduces the lifetime of reactive charge-transfer states. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Integrated multidimensional and comprehensive 2D GC analysis of fatty acid methyl esters.
Zeng, Annie Xu; Chin, Sung-Tong; Marriott, Philip J
2013-03-01
Fatty acid methyl ester (FAME) profiling in complex fish oil and milk fat samples was studied using integrated comprehensive 2D GC (GC × GC) and multidimensional GC (MDGC). Using GC × GC, FAME compounds--cis- and trans-isomers, and essential fatty acid isomers--ranging from C18 to C22 in fish oil and C18 in milk fat were clearly displayed in contour plot format according to structural properties and patterns, further identified based on authentic standards. Incompletely resolved regions were subjected to MDGC, with Cn (n = 18, 20) zones transferred to a (2)D column. Elution behavior of C18 FAME on various (2)D column phases (ionic liquids IL111, IL100, IL76, and modified PEG) was evaluated. Individual isolated Cn zones demonstrated about four-fold increased peak capacities. The IL100 provided superior separation, good peak shape, and utilization of elution space. For milk fat-derived FAME, the (2)D chromatogram revealed at least three peaks corresponding to C18:1, more than six peaks for cis/trans-C18:2 isomers, and two peaks for C18:3. More than 17 peaks were obtained for the C20 region of fish oil-derived FAMEs using MDGC, compared with ten peaks using GC × GC. The MDGC strategy is useful for improved FAME isomer separation and confirmation. © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Performance of various density functionals for the hydrogen bonds in DNA base pairs
van der Wijst, T.; Fonseca Guerra, C.; Swart, M.; Bickelhaupt, F.M.
2006-01-01
We have investigated the performance of seven popular density functionals (B3LYP, BLYP, BP86, mPW, OPBE, PBE, PW91) for describing the geometry and stability of the hydrogen bonds in DNA base pairs. For the gas-phase situation, the hydrogen-bond lengths and strengths in the DNA pairs have been
Bhattacharyya, Dhananjay; Halder, Sukanya; Basu, Sankar; Mukherjee, Debasish; Kumar, Prasun; Bansal, Manju
2017-02-01
Comprehensive analyses of structural features of non-canonical base pairs within a nucleic acid double helix are limited by the availability of a small number of three dimensional structures. Therefore, a procedure for model building of double helices containing any given nucleotide sequence and base pairing information, either canonical or non-canonical, is seriously needed. Here we describe a program RNAHelix, which is an updated version of our widely used software, NUCGEN. The program can regenerate duplexes using the dinucleotide step and base pair orientation parameters for a given double helical DNA or RNA sequence with defined Watson-Crick or non-Watson-Crick base pairs. The original structure and the corresponding regenerated structure of double helices were found to be very close, as indicated by the small RMSD values between positions of the corresponding atoms. Structures of several usual and unusual double helices have been regenerated and compared with their original structures in terms of base pair RMSD, torsion angles and electrostatic potentials and very high agreements have been noted. RNAHelix can also be used to generate a structure with a sequence completely different from an experimentally determined one or to introduce single to multiple mutation, but with the same set of parameters and hence can also be an important tool in homology modeling and study of mutation induced structural changes.
Aviram–Ratner rectifying mechanism for DNA base-pair sequencing through graphene nanogaps
International Nuclear Information System (INIS)
Agapito, Luis A; Gayles, Jacob; Wolowiec, Christian; Kioussis, Nicholas
2012-01-01
We demonstrate that biological molecules such as Watson–Crick DNA base pairs can behave as biological Aviram–Ratner electrical rectifiers because of the spatial separation and weak hydrogen bonding between the nucleobases. We have performed a parallel computational implementation of the ab initio non-equilibrium Green’s function (NEGF) theory to determine the electrical response of graphene—base-pair—graphene junctions. The results show an asymmetric (rectifying) current–voltage response for the cytosine–guanine base pair adsorbed on a graphene nanogap. In sharp contrast we find a symmetric response for the thymine–adenine case. We propose applying the asymmetry of the current–voltage response as a sensing criterion to the technological challenge of rapid DNA sequencing via graphene nanogaps. (paper)
International Nuclear Information System (INIS)
Torigoe, Hidetaka; Miyakawa, Yukako; Ono, Akira; Kozasa, Tetsuo
2012-01-01
Highlights: ► Hg 2+ specifically bound with the T:T mismatched base pair at 1:1 molar ratio. ► The binding constant between Hg 2+ and the T:T mismatched base pair was 10 6 M −1 . ► The binding constant was larger than those for nonspecific metal–DNA interactions. ► The binding constant for the second Hg 2+ was larger than that for the first Hg 2+ . ► The positive cooperative binding was observed between Hg 2+ and multiple T:T. - Abstract: Metal-mediated base pairs by the interaction between metal ions and artificial bases in oligonucleotides have been developed for their potential applications in nanotechnology. We recently found that a natural T:T mismatched base pair bound with Hg 2+ ion to form a novel T–Hg–T base pair. Here, we examined the thermodynamic properties of the binding between Hg 2+ and each of the single and double T:T mismatched base pair duplex DNAs by isothermal titration calorimetry. Hg 2+ specifically bound with the T:T mismatched base pair at 1:1 molar ratio with 10 6 M −1 binding constant, which was significantly larger than those for nonspecific metal ion–DNA interactions. In the Hg 2+ –double T:T mismatched base pair interaction, the affinity for the second Hg 2+ binding was significantly larger than that for the first Hg 2+ binding. The positively cooperative binding may be favorable to align multiple Hg 2+ in duplex DNA for the application of the metal-mediated base pairs in nanotechnology.
Directory of Open Access Journals (Sweden)
Yu Richard MK
2009-11-01
Full Text Available Abstract Background CITED proteins belong to a family of non-DNA-binding transcriptional co-regulators that are characterized by a conserved ED-rich domain at the C-terminus. This family of genes is involved in the regulation of a variety of transcriptional responses through interactions with the CBP/p300 integrators and various transcription factors. In fish, very little is known about the expression and functions of CITEDs. Results We have characterized two closely related but distinct CITED3 genes, gcCited3a and gcCited3b, from the hypoxia-tolerant grass carp. The deduced gcCITED3a and gcCITED3b proteins share 72% amino acid identity, and are highly similar to the CITED3 proteins of both chicken and Xenopus. Northern blot analysis indicates that the mRNA expression of gcCited3a and gcCited3b is strongly induced by hypoxia in the kidney and liver, respectively. Luciferase reporter assays demonstrated that both gene promoters are activated by gcHIF-1. Further, ChIP assays comparing normal and hypoxic conditions reveal differential in vivo binding of gcHIF-1 to both gene promoters in kidney and liver tissues. HRE-luciferase reporter assays demonstrated that both gcCITED3a and gcCITED3b proteins inhibit gcHIF-1 transcriptional activity, and GST pull-down assays confirmed that both proteins bind specifically to the CH1 domain of the grass carp p300 protein. Conclusion The grass carp gcCITED3a and gcCITED3b genes are differentially expressed and regulated in different fish organs in response to hypoxic stress. This is the first report demonstrating in vivo regulation of two closely-related CITED3 isogenes by HIF-1, as well as CITED3 regulation of HIF-1 transcriptional activity in fish. Overall, our findings suggest that unique molecular mechanisms operate through these two gcCITED3 isoforms that likely play an important regulatory role in the hypoxic response in the grass carp.
Yu, Chuanfei; Gao, Kai; Zhu, Lei; Wang, Wenbo; Wang, Lan; Zhang, Feng; Liu, Chunyu; Li, Meng; Wormald, Mark R.; Rudd, Pauline M.; Wang, Junzhi
2016-01-01
Two non-human glycan epitopes, galactose-Į-1,3-galactose (Į-gal) and Neu5Gc-Į-2-6-galactose (Neu5Gc) have been shown to be antigenic when attached to Fab oligosaccharides of monoclonal antibodies (mAbs) , while Į-gal attached to Fc glycans were not. However, the antigenicity of Neu5Gc on the Fc glycans remains unclear in the context that most mAbs carry only Fc glycans. After studying two clinical mAbs carrying significant amounts of Fc Neu5Gc, we show that their binding activity with anti-Ne...
The extension of a DNA double helix by an additional Watson-Crick base pair on the same backbone.
Kumar, Pawan; Sharma, Pawan K; Madsen, Charlotte S; Petersen, Michael; Nielsen, Poul
2013-06-17
Additional base pair: The DNA duplex can be extended with an additional Watson-Crick base pair on the same backbone by the use of double-headed nucleotides. These also work as compressed dinucleotides and form two base pairs with cognate nucleobases on the opposite strand. Copyright © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Visualizing RNA Secondary Structure Base Pair Binding Probabilities using Nested Concave Hulls
Sansen , Joris; Bourqui , Romain; Thebault , Patricia; Allali , Julien; Auber , David
2015-01-01
International audience; The challenge 1 of the BIOVIS 2015 design contest consists in designing an intuitive visual depiction of base pairs binding probabilities for secondary structure of ncRNA. Our representation depicts the potential nucleotide pairs binding using nested concave hulls over the computed MFE ncRNA secondary structure. Thus, it allows to identify regions with a high level of uncertainty in the MFE computation and the structures which seem to match to reality.
Zhang, Guanghui; Zhang, Tianyong; Li, Bin; Jiang, Shuang; Zhang, Xia; Hai, Li; Chen, Xingwei; Wu, Wubin
2018-03-01
An ingenious method was employed to design and fabricate the TiO2/g-C3N4 heterojunction photocatalysts in this study. The thermal oxidation etching of g-C3N4 nanosheets and the in situ growth of TiO2 nanocrystal on the surface of g-C3N4 nanosheets were completed simultaneously by the calcination process. The g-C3N4 nanosheets played a crucial role in regulating and assembling the structures and morphologies of TiO2. Furthermore, the thickness and content of g-C3N4, and the crystallinity of TiO2 in TiO2/g-C3N4 composites could be regulated and controlled by the calcination temperature. Among the resultant TiO2/g-C3N4 samples, the TiO2/g-C3N4 sample with 41.6 wt% g-C3N4 exhibited the highest photocatalytic activity. It could degrade almost all MO molecules under visible light irradiation within 3 h. Moreover, it displayed higher visible light photocatalytic performance for degrading MO solution than pure g-C3N4 and D-TiO2. The synergistic effect between TiO2 and g-C3N4 makes significant contributions to the enhancement of the visible light photocatalytic activity. In addition, the favorable photocatalytic performance of TiO2/g-C3N4 nanocomposites is also attributed to the porous structures and uniform morphologies, and large surface area. Furthermore, the resultant TiO2/g-C3N4 exhibits excellent photocatalytic stability. Radical trapping experiments indicated that rad O2- and h+ were the main reactive species during the photodegradation process under visible light irradiation. Hopefully, the results can offer new design and strategy for preparing other g-C3N4-based nanocomposites for environmental and energy applications.
The glycosylation and characterization of the candidate Gc macrophage activating factor
DEFF Research Database (Denmark)
Ravnsborg, Tina; Olsen, Dorthe T; Thysen, Anna Hammerich
2010-01-01
The vitamin D binding protein, Gc globulin, has in recent years received some attention for its role as precursor for the extremely potent macrophage activating factor (GcMAF). An O-linked trisaccharide has been allocated to the threonine residue at position 420 in two of the three most common...... isoforms of Gc globulin (Gc1s and Gc1f). A substitution for a lysine residue at position 420 in Gc2 prevents this isoform from being glycosylated at that position. It has been suggested that Gc globulin subjected sequentially to sialidase and galactosidase treatment generates GcMAF in the form of Gc...... globulin with only a single GalNAc attached to T420. In this study we confirm the location of a linear trisaccharide on T420. Furthermore, we provide the first structural evidence of the generation of the proposed GcMAF by use of glycosidase treatment and mass spectrometry. Additionally the generated GcMAF...
Bhamra, Inder; Compagnone-Post, Patricia; O'Neil, Ian A; Iwanejko, Lesley A; Bates, Andrew D; Cosstick, Richard
2012-11-01
8-Nitro-2'-deoxyguanosine (8-nitrodG) is a relatively unstable, mutagenic lesion of DNA that is increasingly believed to be associated with tissue inflammation. Due to the lability of the glycosidic bond, 8-nitrodG cannot be incorporated into oligodeoxynucleotides (ODNs) by chemical DNA synthesis and thus very little is known about its physicochemical properties and base-pairing preferences. Here we describe the synthesis of 8-nitro-2'-O-methylguanosine, a ribonucleoside analogue of this lesion, which is sufficiently stable to be incorporated into ODNs. Physicochemical studies demonstrated that 8-nitro-2'-O-methylguanosine adopts a syn conformation about the glycosidic bond; thermal melting studies and molecular modelling suggest a relatively stable syn-8-nitroG·anti-G base pair. Interestingly, when this lesion analogue was placed in a primer-template system, extension of the primer by either avian myeloblastosis virus reverse transcriptase (AMV-RT) or human DNA polymerase β (pol β), was significantly impaired, but where incorporation opposite 8-nitroguanine did occur, pol β showed a 2:1 preference to insert dA over dC, while AMV-RT incorporated predominantly dC. The fact that no 8-nitroG·G base pairing is seen in the primer extension products suggests that the polymerases may discriminate against this pairing system on the basis of its poor geometric match to a Watson-Crick pair.
Bhamra, Inder; Compagnone-Post, Patricia; O’Neil, Ian A.; Iwanejko, Lesley A.; Bates, Andrew D.; Cosstick, Richard
2012-01-01
8-Nitro-2′-deoxyguanosine (8-nitrodG) is a relatively unstable, mutagenic lesion of DNA that is increasingly believed to be associated with tissue inflammation. Due to the lability of the glycosidic bond, 8-nitrodG cannot be incorporated into oligodeoxynucleotides (ODNs) by chemical DNA synthesis and thus very little is known about its physicochemical properties and base-pairing preferences. Here we describe the synthesis of 8-nitro-2′-O-methylguanosine, a ribonucleoside analogue of this lesion, which is sufficiently stable to be incorporated into ODNs. Physicochemical studies demonstrated that 8-nitro-2′-O-methylguanosine adopts a syn conformation about the glycosidic bond; thermal melting studies and molecular modelling suggest a relatively stable syn-8-nitroG·anti-G base pair. Interestingly, when this lesion analogue was placed in a primer-template system, extension of the primer by either avian myeloblastosis virus reverse transcriptase (AMV-RT) or human DNA polymerase β (pol β), was significantly impaired, but where incorporation opposite 8-nitroguanine did occur, pol β showed a 2:1 preference to insert dA over dC, while AMV-RT incorporated predominantly dC. The fact that no 8-nitroG·G base pairing is seen in the primer extension products suggests that the polymerases may discriminate against this pairing system on the basis of its poor geometric match to a Watson–Crick pair. PMID:22965127
International Nuclear Information System (INIS)
Badea, Silviu-Laurentiu; Lundstedt, Staffan; Liljelind, Per; Tysklind, Mats
2009-01-01
In this study we evaluated a multiresidue analytical protocol for selected Persistent Organic Pollutants (POPs) in soil, that later can be used in adsorption and leaching studies. The method used was based on Soxhlet extraction and open column chromatographic fractionation and clean-up, as well as liquid-liquid extraction and acetylation for phenolic compounds. Target analytes, i.e. polychlorinated phenols (PCPhs), hexachlorobenzene (HCB), polychlorinated dibenzodioxins and furans (PCDDs/Fs), polychlorinated biphenyl (PCBs) PAHs, were detected and quantified using Gas Chromatography-Low Resolution Mass Spectrometry (GC-LRMS) and Gas Chromatography-High Resolution Mass Spectrometry (GC-HRMS) and isotope dilution methodology. Generally, the results show a good recovery and a low standard deviation for those isomers that have also a 13 C labeled compound present in the sample: 4-mono, 2,4 di, 2,4,5 tri, 2,3,4,5 and penta chlorinated phenols. Our results clearly demonstrate that it is possible to analyse a wide range of compounds in complex soil matrixes. (authors(
Stranava, Martin; Man, Petr; Skálová, Tereza; Kolenko, Petr; Blaha, Jan; Fojtikova, Veronika; Martínek, Václav; Dohnálek, Jan; Lengalova, Alzbeta; Rosůlek, Michal; Shimizu, Toru; Martínková, Markéta
2017-12-22
The heme-based oxygen sensor histidine kinase Af GcHK is part of a two-component signal transduction system in bacteria. O 2 binding to the Fe(II) heme complex of its N-terminal globin domain strongly stimulates autophosphorylation at His 183 in its C-terminal kinase domain. The 6-coordinate heme Fe(III)-OH - and -CN - complexes of Af GcHK are also active, but the 5-coordinate heme Fe(II) complex and the heme-free apo-form are inactive. Here, we determined the crystal structures of the isolated dimeric globin domains of the active Fe(III)-CN - and inactive 5-coordinate Fe(II) forms, revealing striking structural differences on the heme-proximal side of the globin domain. Using hydrogen/deuterium exchange coupled with mass spectrometry to characterize the conformations of the active and inactive forms of full-length Af GcHK in solution, we investigated the intramolecular signal transduction mechanisms. Major differences between the active and inactive forms were observed on the heme-proximal side (helix H5), at the dimerization interface (helices H6 and H7 and loop L7) of the globin domain and in the ATP-binding site (helices H9 and H11) of the kinase domain. Moreover, separation of the sensor and kinase domains, which deactivates catalysis, increased the solvent exposure of the globin domain-dimerization interface (helix H6) as well as the flexibility and solvent exposure of helix H11. Together, these results suggest that structural changes at the heme-proximal side, the globin domain-dimerization interface, and the ATP-binding site are important in the signal transduction mechanism of Af GcHK. We conclude that Af GcHK functions as an ensemble of molecules sampling at least two conformational states. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.
Thyer, Lynda; Ward, Emma; Smith, Rodney; Branca, Jacopo Jv; Morucci, Gabriele; Gulisano, Massimo; Noakes, David; Eslinger, Robert; Pacini, Stefania
2013-08-01
α- N -acetylgalactosaminidase (nagalase) accumulates in the serum of cancer patients and its activity correlates with tumor burden, aggressiveness and clinical disease progression. The administration of GC protein-derived macrophage-activating factor (GcMAF) to cancer patients with elevated levels of nagalase has been associated with a decrease of serum nagalase activity and with significant clinical benefits. Here, we report the results of the administration of GcMAF to a heterogeneous cohort of patients with histologically diverse, advanced neoplasms, generally considered as "incurable" diseases. In most cases, GcMAF therapy was initiated at late stages of tumor progression. As this is an open-label, non-controlled, retrospective analysis, caution must be employed when establishing cause-effect relationships between the administration GcMAF and disease outcome. However, the response to GcMAF was generally robust and some trends emerged. All patients (n = 20) presented with elevated serum nagalase activity, well above normal values. All patients but one showed a significant decrease of serum nagalase activity upon weekly GcMAF injections. Decreased nagalase activity was associated with improved clinical conditions and no adverse side effects were reported. The observations reported here confirm and extend previous results and pave the way to further studies aimed at assessing the precise role and indications for GcMAF-based anticancer immunotherapy.
CSIR Research Space (South Africa)
Opoku, F
2018-01-01
Full Text Available Graphite-like carbon nitride (g-C3N4)-based heterostructures have received much attention due to their prominent photocatalytic activity. The g-C3N4/Bi2WO6 and g-C3N4/Bi2MoO6 heterostructures, which follow a typical hetero-junction charge transfer...
Cu-modified alkalinized g-C3N4 as photocatalytically assisted heterogeneous Fenton-like catalyst
Dong, Qimei; Chen, Yingying; Wang, Lingli; Ai, Shasha; Ding, Hanming
2017-12-01
Alkalinized graphitic carbon nitride (CNK-OH) has been synthesized by one-step thermal poly-condensation method, and Cu-modified alkalinized g-C3N4 (Cu-CNK-OH) has been prepared by impregnation approach over CNK-OH. These copper species in Cu-CNK-OH are embedded in the frame of CNK-OH mostly via the Cu-N bonds. Cu-CNK-OH has been employed as a heterogeneous Fenton-like catalyst to degrade rhodamine B (RhB). Both the production efficiency of hydroxyl radicals and the transformation rate of Cu(II)/Cu(I) redox pair increase under visible-light irradiation. As a result, Cu-CNK-OH exhibits improved Fenton-like catalytic activity on the degradation of RhB. The synergetic interaction between Fenton-like process and photocatalytic process also contributes such improvement. The hydroxyl radicals and holes are the major reactive species in the photocatalytically assisted Fenton-like process. This study provides a valuable strategy for metal modification of alkalinized g-C3N4 with enhanced Fenton-like catalytic performance for the degradation of organic contaminants.
Kondo, Jiro; Tada, Yoshinari; Dairaku, Takenori; Saneyoshi, Hisao; Okamoto, Itaru; Tanaka, Yoshiyuki; Ono, Akira
2015-11-02
Metallo-base pairs have been extensively studied for applications in nucleic acid-based nanodevices and genetic code expansion. Metallo-base pairs composed of natural nucleobases are attractive because nanodevices containing natural metallo-base pairs can be easily prepared from commercially available sources. Previously, we have reported a crystal structure of a DNA duplex containing T-Hg(II)-T base pairs. Herein, we have determined a high-resolution crystal structure of the second natural metallo-base pair between pyrimidine bases C-Ag(I)-C formed in an RNA duplex. One Ag(I) occupies the center between two cytosines and forms a C-Ag(I)-C base pair through N3-Ag(I)-N3 linear coordination. The C-Ag(I)-C base pair formation does not disturb the standard A-form conformation of RNA. Since the C-Ag(I)-C base pair is structurally similar to the canonical Watson-Crick base pairs, it can be a useful building block for structure-based design and fabrication of nucleic acid-based nanodevices. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Non-Watson Crick base pairs might stabilize RNA structural motifs in ...
Indian Academy of Sciences (India)
Watson Crick base pairs, internal loops and pseudoknots have been the highlighting feature of recent structural determination of RNAs. The recent crystal structure of group-I introns has demonstrated that these might constitute RNA structural ...
The glycosylation and characterization of the candidate Gc macrophage activating factor.
Ravnsborg, Tina; Olsen, Dorthe T; Thysen, Anna Hammerich; Christiansen, Maja; Houen, Gunnar; Højrup, Peter
2010-04-01
The vitamin D binding protein, Gc globulin, has in recent years received some attention for its role as precursor for the extremely potent macrophage activating factor (GcMAF). An O-linked trisaccharide has been allocated to the threonine residue at position 420 in two of the three most common isoforms of Gc globulin (Gc1s and Gc1f). A substitution for a lysine residue at position 420 in Gc2 prevents this isoform from being glycosylated at that position. It has been suggested that Gc globulin subjected sequentially to sialidase and galactosidase treatment generates GcMAF in the form of Gc globulin with only a single GalNAc attached to T420. In this study we confirm the location of a linear trisaccharide on T420. Furthermore, we provide the first structural evidence of the generation of the proposed GcMAF by use of glycosidase treatment and mass spectrometry. Additionally the generated GcMAF candidate was tested for its effect on cytokine release from macrophages in human whole blood. Copyright 2010 Elsevier B.V. All rights reserved.
Time series regression-based pairs trading in the Korean equities market
Kim, Saejoon; Heo, Jun
2017-07-01
Pairs trading is an instance of statistical arbitrage that relies on heavy quantitative data analysis to profit by capitalising low-risk trading opportunities provided by anomalies of related assets. A key element in pairs trading is the rule by which open and close trading triggers are defined. This paper investigates the use of time series regression to define the rule which has previously been identified with fixed threshold-based approaches. Empirical results indicate that our approach may yield significantly increased excess returns compared to ones obtained by previous approaches on large capitalisation stocks in the Korean equities market.
A Monolithically-Integrated μGC Chemical Sensor System
Directory of Open Access Journals (Sweden)
Davor Copic
2011-06-01
Full Text Available Gas chromatography (GC is used for organic and inorganic gas detection with a range of applications including screening for chemical warfare agents (CWA, breath analysis for diagnostics or law enforcement purposes, and air pollutants/indoor air quality monitoring of homes and commercial buildings. A field-portable, light weight, low power, rapid response, micro-gas chromatography (μGC system is essential for such applications. We describe the design, fabrication and packaging of mGC on monolithically-integrated Si dies, comprised of a preconcentrator (PC, μGC column, detector and coatings for each of these components. An important feature of our system is that the same mechanical micro resonator design is used for the PC and detector. We demonstrate system performance by detecting four different CWA simulants within 2 min. We present theoretical analyses for cost/power comparisons of monolithic versus hybrid μGC systems. We discuss thermal isolation in monolithic systems to improve overall performance. Our monolithically-integrated μGC, relative to its hybrid cousin, will afford equal or slightly lower cost, a footprint that is 1/2 to 1/3 the size and an improved resolution of 4 to 25%.
A rule of seven in Watson-Crick base-pairing of mismatched sequences.
Cisse, Ibrahim I; Kim, Hajin; Ha, Taekjip
2012-05-13
Sequence recognition through base-pairing is essential for DNA repair and gene regulation, but the basic rules governing this process remain elusive. In particular, the kinetics of annealing between two imperfectly matched strands is not well characterized, despite its potential importance in nucleic acid-based biotechnologies and gene silencing. Here we use single-molecule fluorescence to visualize the multiple annealing and melting reactions of two untethered strands inside a porous vesicle, allowing us to precisely quantify the annealing and melting rates. The data as a function of mismatch position suggest that seven contiguous base pairs are needed for rapid annealing of DNA and RNA. This phenomenological rule of seven may underlie the requirement for seven nucleotides of complementarity to seed gene silencing by small noncoding RNA and may help guide performance improvement in DNA- and RNA-based bio- and nanotechnologies, in which off-target effects can be detrimental.
Mai Oanh, Le Thi; Hang, Lam Thi; Lai, Ngoc Diep; Phuong, Nguyen Thi; Thang, Dao Viet; Hung, Nguyen Manh; Danh Bich, Do; Minh, Nguyen Van
2018-03-01
The influences of annealing temperature on structure, morphology, vibration, optical properties and photocatalytic ability of g-C3N4 nanosheets synthesized from urea in Ar atmosphere were investigated in detail by using x-ray diffraction (XRD) analysis, scanning electron microscopy (SEM), X-ray photoelectron spectroscopy (XPS), Brunauer-Emmett-Teller (BET), Fourier transform infrared spectroscopy (FTIR), UV-vis absorption, and photoluminescence (PL). It was found that the preparation temperature had a great effect on structure and physical properties of g-C3N4. As the processing temperature increased from 450 °C to 650 °C, the interlayer stacking distance of g-C3N4 decreased from 3.281 Å to 3.217 Å and the lattice parameter a decreased from 5.010 Å to 4.934 Å. This indicated a denser packing fashion of g-C3N4 at high annealing temperature. Moreover, the FTIR spectra and SEM images revealed a large fraction of small polymer segments containing only a few heptazine units as annealing temperature increased. BET result indicated an increasing specific surface area as preparation temperature increased. UV-vis absorption spectra showed a decrease of the band gap energy with increasing calcination temperature which agrees well with the measured PL spectra. It was demonstrated that samples annealed at 550 °C exhibited the strongest photocatalytic activity. A decomposition of 80% and 100% of rhodamine B was obtained within respectively 1 h and 2 h under Xenon lamp irradiation. Photocatalytic result could be adequately explained based on evidences of specific surface area, average pore volume and pore size, and recombination rate of photoinduced electron-hole pairs.
Gc globulin as a diagnostic and prognostic marker in horses
DEFF Research Database (Denmark)
Pihl, Tina Holberg
can prevent development of shock and thereby increase survival chances. The in vivo toxicity of Gc-globulin infusion is currently being investigated in horses and other species. Gc-globulin has been demonstrated in horse plasma and its structure closely resembles that of human Gc-globulin. Gc......-globulin concentrations in horses under clinical conditions have never previously been investigated. The Ph.D. project focuses on Gc-globulin as a prognostic marker in horses with acute abdominal pain....
Prediction of plant promoters based on hexamers and random triplet pair analysis
Directory of Open Access Journals (Sweden)
Noman Nasimul
2011-06-01
Full Text Available Abstract Background With an increasing number of plant genome sequences, it has become important to develop a robust computational method for detecting plant promoters. Although a wide variety of programs are currently available, prediction accuracy of these still requires further improvement. The limitations of these methods can be addressed by selecting appropriate features for distinguishing promoters and non-promoters. Methods In this study, we proposed two feature selection approaches based on hexamer sequences: the Frequency Distribution Analyzed Feature Selection Algorithm (FDAFSA and the Random Triplet Pair Feature Selecting Genetic Algorithm (RTPFSGA. In FDAFSA, adjacent triplet-pairs (hexamer sequences were selected based on the difference in the frequency of hexamers between promoters and non-promoters. In RTPFSGA, random triplet-pairs (RTPs were selected by exploiting a genetic algorithm that distinguishes frequencies of non-adjacent triplet pairs between promoters and non-promoters. Then, a support vector machine (SVM, a nonlinear machine-learning algorithm, was used to classify promoters and non-promoters by combining these two feature selection approaches. We referred to this novel algorithm as PromoBot. Results Promoter sequences were collected from the PlantProm database. Non-promoter sequences were collected from plant mRNA, rRNA, and tRNA of PlantGDB and plant miRNA of miRBase. Then, in order to validate the proposed algorithm, we applied a 5-fold cross validation test. Training data sets were used to select features based on FDAFSA and RTPFSGA, and these features were used to train the SVM. We achieved 89% sensitivity and 86% specificity. Conclusions We compared our PromoBot algorithm to five other algorithms. It was found that the sensitivity and specificity of PromoBot performed well (or even better with the algorithms tested. These results show that the two proposed feature selection methods based on hexamer frequencies
Zhang, Li; Wang, Zhong-Xia; Liang, Ru-Ping; Qiu, Jian-Ding
2013-07-16
Utilizing the principles of metal-ion-mediated base pairs (C-Ag-C and T-Hg-T), the pH-sensitive conformational transition of C-rich DNA strand, and the ligand-exchange process triggered by DL-dithiothreitol (DTT), a system of colorimetric logic gates (YES, AND, INHIBIT, and XOR) can be rationally constructed based on the aggregation of the DNA-modified Au NPs. The proposed logic operation system is simple, which consists of only T-/C-rich DNA-modified Au NPs, and it is unnecessary to exquisitely design and alter the DNA sequence for different multiple molecular logic operations. The nonnatural base pairing combined with unique optical properties of Au NPs promises great potential in multiplexed ion sensing, molecular-scale computers, and other computational logic devices.
Sinninghe Damsté, J.S.; Dekker, M.H.A.; Piersma, T.
2000-01-01
The intact preen wax esters of the red knot Calidris canutus were studied with gas chromatography/mass spectrometry (GC/MS) and GC/MS/MS. In this latter technique, transitions from the molecular ion to fragment ions representing the fatty acid moiety of the wax esters were measured, providing
International Nuclear Information System (INIS)
Senthil, R.A.; Theerthagiri, J.; Madhavan, J.; Murugan, K.; Arunachalam, Prabhakarn; Arof, A.K.
2016-01-01
This work describes the effect of 2-aminopyrimidine (2-APY) on poly(vinylidinefluoride-co-hexafluoropropylene) (PVDF-HFP)/polyethylene oxide (PEO) blend polymer electrolyte along with binary iodide salts (tetrabutylammonium iodide (TBAI) and potassium iodide (KI)) and iodine (I 2 ) were studied for enhancing the efficiency of the dye-sensitized solar cells (DSSCs) consisting of g-C 3 N 4 /TiO 2 composite as photoanode. The g-C 3 N 4 was synthesized from low cost urea by thermal condensation method. It was used as a precursor to synthesize the various weight percentage ratios (5%, 10% and 15%) of g-C 3 N 4 /TiO 2 composites by wet-impregnation method. The pure and 2-APY incorporated PVDF-HFP/PEO polymer blend electrolytes were arranged by wet chemical process (casting method) using DMF as a solvent. The synthesized g-C 3 N 4 /TiO 2 composites and polymer blend electrolytes were studied and analyzed by Fourier transform infrared (FT-IR) spectroscopy, X-ray diffractometer (XRD) and scanning electron microscopy (SEM). The ionic conductivity values of the pure and 2-APY incorporated PVDF-HFP/PEO blend electrolytes were estimated to be 4.53×10 −5 and 1.87×10 −4 Scm −1 respectively. The UV–vis absorption spectroscopy was carried out for the pure and different wt% of g-C 3 N 4 /TiO 2 composites coated FTO films after N3 dye-sensitization. The 10 wt% g-C 3 N 4 /TiO 2 composite film showed a maximum absorption compared to the others. The DSSC assembled with 10 wt% g-C 3 N 4 /TiO 2 as photoanode using the pure polymer blend electrolyte exhibited a power conversion efficiency (PCE) of 3.17% , which was superior than that of DSSC based pure TiO 2 (2.46%). However, the PCE was increased to 4.73% for the DSSC assembled using 10 wt% g-C 3 N 4 /TiO 2 as photoanode with 2-APY incorporated polymer blend electrolyte. Hence, the present study is a successful attempt to provide a new pathway to enhance the performance of DSSCs. - Graphical abstract: In this study, the g-C 3 N
Gressner, Olav A; Schifflers, Marie-Claire; Kim, Philipp; Heuts, Leo; Lahme, Birgit; Gressner, Axel M
2009-02-01
Preliminary studies report on significantly higher levels of the major cytoskeleton protein actin in CSF of patients with neurodegenerative conditions and that the dynamics of these levels obviously correlates with disease progression and clinical disability. One of the primary functions of actinfree Gc-Globulin is to bind and neutralize extracellular monomeric actin, released into the circulation by necrotic or ruptured cells, and thus ameliorating the clinical outcome in situations of severe organ damage. This is the first study to investigate actinfree Gc-Globulin and S100-B levels (as reliable marker of neurodegeneration) in paired CSF and serum samples of patients with multietiological CNS diseases. 42% of all patients with CNS disease displayed serum concentrations of actinfree Gc-Globulin above the established reference range. CSF concentrations of actinfree Gc-Globulin and S100-B were positively correlated with the severity of blood-brain barrier (BBB) dysfunction. Furthermore, patients with severe BBB dysfunction presented a higher percentage of intrathecal synthesis of actinfree Gc-Globulin compared to patients with mild to moderate dysfunction and to patients with normal BBB function. Representative longitudinal data from selected patients demonstrated an inverse behaviour of actinfree Gc-Globulin and S100-B CSF concentrations, suggesting a consumption of the actin scavenger capacity of Gc-Globulin in times of increased neuronal damage. This presumption was supported by the fact that those conditions associated with a severe neuronal damage, in particular CNS trauma, and highest S100-B concentrations simultaneously displayed lowest actinfree Gc-Globulin levels, and thus residual actin binding capacity of Gc-Globulin. In summary, our data propose a function of actinfree Gc-Globulin also in the clearance of actin filaments from CSF of patients with neuronal damage. However, active recruitment of hepatic derived actinfree Gc-Globulin to the site of CNS
Moddemeijer, R
In the case of two signals with independent pairs of observations (x(n),y(n)) a statistic to estimate the variance of the histogram based mutual information estimator has been derived earlier. We present such a statistic for dependent pairs. To derive this statistic it is necessary to avail of a
NMR and molecular modeling evidence for a G·A mismatch base pair in a purine-rich DNA duplex
International Nuclear Information System (INIS)
Li, Ying; Wilson, W.D.; Zon, G.
1991-01-01
1 H NMR experiments indicate that the oligomer 5'-d(ATGAGCGAATA) forms an unusual 10-base-pair duplex with 4 G·A base pairs and a 3' unpaired adenosine. NMR results indicate that guanoxine imino protons of the F·A mismatches are not hydrogen bonded but are stacked in the helix. A G→ I substitution in either G·A base pair causes a dramatic decrtease in duplex stability and indicates that hydrogen bonding of the guanosine amino group is critical. Nuclear Overhauser effect spectroscopy (NOESY) and two-dimensional correlated spectroscopy (COSY) results indicate that the overall duplex conformation is in the B-family. Cross-strand NOEs in two-dimensional NOESY spectra between a mismatched AH2 and an AH1' of the other mismatched base pair and between a mismatched GH8 and GNH1 of the other mismatch establish a purine-purine stacking pattern, adenosine over adenosine and guanosine over guanosine, which strongly stabilizes the duplex. A computer graphics molecular model of the ususual duplex was constructed with G·A base pairs containing A-NH 2 to GN3 and G-NH 2 to AN7 hydrogen bonds and B-form base pairs on both sides of the G·A pairs [5'-d(ATGAGC)]. The energy-minimized duplex satisfies all experimental constraints from NOESY and COSY results. A hydrogen bond from G-NH 2 of the mismatch to a phosphate oxygen is predicted
Efficient and Provable Secure Pairing-Free Security-Mediated Identity-Based Identification Schemes
Directory of Open Access Journals (Sweden)
Ji-Jian Chin
2014-01-01
Full Text Available Security-mediated cryptography was first introduced by Boneh et al. in 2001. The main motivation behind security-mediated cryptography was the capability to allow instant revocation of a user’s secret key by necessitating the cooperation of a security mediator in any given transaction. Subsequently in 2003, Boneh et al. showed how to convert a RSA-based security-mediated encryption scheme from a traditional public key setting to an identity-based one, where certificates would no longer be required. Following these two pioneering papers, other cryptographic primitives that utilize a security-mediated approach began to surface. However, the security-mediated identity-based identification scheme (SM-IBI was not introduced until Chin et al. in 2013 with a scheme built on bilinear pairings. In this paper, we improve on the efficiency results for SM-IBI schemes by proposing two schemes that are pairing-free and are based on well-studied complexity assumptions: the RSA and discrete logarithm assumptions.
Efficient and provable secure pairing-free security-mediated identity-based identification schemes.
Chin, Ji-Jian; Tan, Syh-Yuan; Heng, Swee-Huay; Phan, Raphael C-W
2014-01-01
Security-mediated cryptography was first introduced by Boneh et al. in 2001. The main motivation behind security-mediated cryptography was the capability to allow instant revocation of a user's secret key by necessitating the cooperation of a security mediator in any given transaction. Subsequently in 2003, Boneh et al. showed how to convert a RSA-based security-mediated encryption scheme from a traditional public key setting to an identity-based one, where certificates would no longer be required. Following these two pioneering papers, other cryptographic primitives that utilize a security-mediated approach began to surface. However, the security-mediated identity-based identification scheme (SM-IBI) was not introduced until Chin et al. in 2013 with a scheme built on bilinear pairings. In this paper, we improve on the efficiency results for SM-IBI schemes by proposing two schemes that are pairing-free and are based on well-studied complexity assumptions: the RSA and discrete logarithm assumptions.
Pacini, Stefania; Morucci, Gabriele; Punzi, Tiziana; Gulisano, Massimo; Ruggiero, Marco
2011-04-01
The effects of Gc protein-derived macrophage-activating factor (GcMAF) have been studied in cancer and other conditions where angiogenesis is deregulated. In this study, we demonstrate for the first time that the mitogenic response of human peripheral blood mononuclear cells (PBMCs) to GcMAF was associated with 3'-5'-cyclic adenosine monophosphate (cAMP) formation. The effect was dose dependent, and maximal stimulation was achieved using 0.1 ng/ml. Heparin inhibited the stimulatory effect of GcMAF on PBMCs. In addition, we demonstrate that GcMAF (1 ng/ml) inhibited prostaglandin E(1)- and human breast cancer cell-stimulated angiogenesis in chick embryo chorionallantoic membrane (CAM) assay. Finally, we tested different GcMAF preparations on CAM, and the assay proved to be a reliable, reproducible and inexpensive method to determine the relative potencies of different preparations and their stability; we observed that storage at room temperature for 15 days decreased GcMAF potency by about 50%. These data could prove useful for upcoming clinical trials on GcMAF.
UV-light-assisted ethanol sensing characteristics of g-C3N4/ZnO composites at room temperature
Zhai, Jiali; Wang, Tao; Wang, Chuang; Liu, Dechen
2018-05-01
A highly efficient UV-light-assisted room temperature sensor based on g-C3N4/ZnO composites were prepared by an in situ precipitation method. The thermostability, composition, structure, and morphology properties of the as-prepared g-C3N4/ZnO composites were characterized by TGA, XRD, FT-IR, TEM, and XPS, respectively. And then, we studied the ethanol (C2H5OH) sensing performance of the g-C3N4/ZnO composites at the room temperature. Compared with pure ZnO and g-C3N4, the gas sensing activity of g-C3N4/ZnO composites was greatly improved at room temperature, for example, the g-C3N4/ZnO-8% composites showed an obvious response of 121-40 ppm C2H5OH at room temperature, which was 60 times higher than the pure ZnO based on the sensors under the same condition. The great enhancement of the C2H5OH sensing properties of composites can be understood by the efficient separation of photogenerated charge carriers of g-C3N4/ZnO heterogeneous and the UV-light catalytic effect. Finally, a possible mechanism for the gas sensing activity was proposed.
The Influence of Square Planar Platinum Complexes on DNA Bases Pairing. An ab initio DFT Study
Czech Academy of Sciences Publication Activity Database
Burda, J. V.; Šponer, Jiří; Leszczynski, J.
2001-01-01
Roč. 3, č. 19 (2001), s. 4404-4411 ISSN 1463-9076 R&D Projects: GA MŠk LN00A032 Institutional research plan: CEZ:AV0Z4040901 Keywords : DNA base pairing * platinated base pairs * ab initio DFT study Subject RIV: CF - Physical ; Theoretical Chemistry Impact factor: 1.787, year: 2001
Hu, Lingling; He, Huanjunwa; Xia, Dehua; Huang, Yajing; Xu, Jiarong; Li, Haoyue; He, Chun; Yang, Wenjing; Shu, Dong; Wong, Po Keung
2018-05-07
A self-stabilized Z-scheme porous g-C3N4/I3--containing BiOI ultrathin nanosheets (g-C3N4/I3--BiOI) heterojunction photocatalyst with I3-/I- redox mediator was successfully synthesized by a facile solvothermal method coupling with light illumination. The structure and optical properties of g-C3N4/I3--BiOI composites were systematically characterized by means of XRD, SEM, TEM, FT-IR, XPS, N2 adsorption/desorption, UV-vis DRS, PL. The g-C3N4/I3--BiOI composites, with heterojunction between porous g-C3N4 and BiOI ultrathin nanosheets, were firstly applied for the photocatalytic elimination of ppm-leveled CH3SH under LED visible light illumination. The g-C3N4/I3--BiOI heterojunction with 10% g-C3N4 showed a dramatically enhanced photocatalytic activity in removal of CH3SH compared with pure BiOI and g-C3N4, due to its effective interfacial charge transfer and separation. The adsorption and photocatalytic oxidation of CH3SH over g-C3N4/I3--BiOI were deeply explored by in situ DRIFTS, and the intermediates and conversion pathways were elucidated and compared. Furthermore, on the basis of reactive species trapping, ESR and Mott-Schottky experiments, it was revealed that the responsible reactive species for catalytic CH3SH composotion were h+, ·O2- and 1O2, thus, the g-C3N4/I3--BiOI heterojunction followed an indirect all-solid state Z-scheme charge transfer mode with self-stabilized I3-/I- pairs as redox mediator, which could accelerate the separation of photo-generated charge and enhance the redox reaction power of charged carriers simultaneously.
DEFF Research Database (Denmark)
Jensen, Trine S.; Arvin, Erik; Svensmark, Bo
2000-01-01
Samples from a long-term bioremediation experiment contaminated with two crude oils, Arabian Heavy and Gullfax, was used to analyze the compositional change of petroleum hydrocarbons. A time course of five different homologous series of petroleum hydrocarbons were analysed by GC/FID and GC...
Yao, Wenzhi; Zhang, Jihua; Wang, Yuanxu; Ren, Fengzhu
2018-03-01
To investigate the origin of the high photocatalytic performance of experimentally synthesized g-C3N4/ BiOCl, we studied its geometry structure, electronic structure, and photocatalytic properties by means of hybrid density-functional theory (DFT). The calculated band alignment of g-C3N4 and few-layer BiOCl sheets clearly shows that g-C3N4/ BiOCl is a standard type-II nanocomposite. The density of states, Bader charge, partial charge density, charge density difference, and the effective masses show that electron-hole pair can be effectively separated in the g-C3N4/BiOCl interface. The calculated absorption coefficients indicate an obvious redshift of the absorption edge. The band gap of g-C3N4/BiOCl can be modulated by external electric field, and a semiconductor-semimetal transition is observed. The type-II vdW heterostructure is still maintained during the changes of external electric field. Especially, when the electric field reaches to +0.7 V/Å, the impurity states have been eliminated with the band gap of 2.3 eV. An analysis of optical properties shows that the absorption coefficient in the visible-light region is enhanced considerably as the electric-field strength increases. Our calculation results suggest that the ultrathin hybrid layered g-C3N4/BiOCl nanocomposite may have significant advantages for visible-light photocatalysis.
Enhanced Stability of DNA Nanostructures by Incorporation of Unnatural Base Pairs.
Liu, Qing; Liu, Guocheng; Wang, Ting; Fu, Jing; Li, Rujiao; Song, Linlin; Wang, Zhen-Gang; Ding, Baoquan; Chen, Fei
2017-11-03
Self-assembled DNA nanostructures hold great promise in the fields of nanofabrication, biosensing and nanomedicine. However, the inherent low stability of the DNA double helices, formed by weak interactions, largely hinders the assembly and functions of DNA nanostructures. In this study, we redesigned and constructed a six-arm DNA junction by incorporation of the unnatural base pairs 5-Me-isoC/isoG and A/2-thioT into the double helices. They not only retained the structural integrity of the DNA nanostructure, but also showed enhanced thermal stability and resistance to T7 Exonuclease digestion. This research may expand the applications of DNA nanostructures in nanofabrication and biomedical fields, and furthermore, the genetic alphabet expansion with unnatural base pairs may enable us to construct more complicated and diversified self-assembled DNA nanostructures. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.
Hydrogen bond disruption in DNA base pairs from (14)C transmutation.
Sassi, Michel; Carter, Damien J; Uberuaga, Blas P; Stanek, Christopher R; Mancera, Ricardo L; Marks, Nigel A
2014-09-04
Recent ab initio molecular dynamics simulations have shown that radioactive carbon does not normally fragment DNA bases when it decays. Motivated by this finding, density functional theory and Bader analysis have been used to quantify the effect of C → N transmutation on hydrogen bonding in DNA base pairs. We find that (14)C decay has the potential to significantly alter hydrogen bonds in a variety of ways including direct proton shuttling (thymine and cytosine), thermally activated proton shuttling (guanine), and hydrogen bond breaking (cytosine). Transmutation substantially modifies both the absolute and relative strengths of the hydrogen bonding pattern, and in two instances (adenine and cytosine), the density at the critical point indicates development of mild covalent character. Since hydrogen bonding is an important component of Watson-Crick pairing, these (14)C-induced modifications, while infrequent, may trigger errors in DNA transcription and replication.
Multifamily determination of pesticide residues in soya-based nutraceutical products by GC/MS-MS.
Páleníková, Agneša; Martínez-Domínguez, Gerardo; Arrebola, Francisco Javier; Romero-González, Roberto; Hrouzková, Svetlana; Frenich, Antonia Garrido
2015-04-15
An analytical method based on a modified QuEChERS extraction coupled with gas chromatography-tandem mass spectrometry (GC-MS/MS) was evaluated for the determination of 177 pesticides in soya-based nutraceutical products. The QuEChERS method was optimised and different extraction solvents and clean-up approaches were tested, obtaining the most efficient conditions with a mixture of sorbents (PSA, C18, GBC and Zr-Sep(+)). Recoveries were evaluated at 10, 50 and 100 μg/kg and ranged between 70% and 120%. Precision was expressed as relative standard deviation (RSD), and it was evaluated for more than 160 pesticides as intra and inter-day precision, with values always below 20% and 25%, respectively. Limits of detection (LODs) ranged from 0.1 to 10 μg/kg, whereas limits of quantification (LOQs) from 0.5 to 20 μg/kg. The applicability of the method was proved by analysing soya-based nutraceuticals. Two pesticides were found in these samples, malathion and pyriproxyfen, at 11.1 and 1.5 μg/kg respectively. Copyright © 2014 Elsevier Ltd. All rights reserved.
Morucci, Gabriele; Branca, Jacopo J V; Gulisano, Massimo; Ruggiero, Marco; Paternostro, Ferdinando; Pacini, Alessandra; Di Cesare Mannelli, Lorenzo; Pacini, Stefania
2015-02-01
Oxaliplatin-based regimens are effective in metastasized advanced cancers. However, a major limitation to their widespread use is represented by neurotoxicity that leads to peripheral neuropathy. In this study we evaluated the roles of a proven immunotherapeutic agent [Gc-protein-derived macrophage activating factor (GcMAF)] in preventing or decreasing oxaliplatin-induced neuronal damage and in modulating microglia activation following oxaliplatin-induced damage. The effects of oxaliplatin and of a commercially available formula of GcMAF [oleic acid-GcMAF (OA-GcMAF)] were studied in human neurons (SH-SY5Y cells) and in human microglial cells (C13NJ). Cell density, morphology and viability, as well as production of cAMP and expression of vascular endothelial growth factor (VEGF), markers of neuron regeneration [neuromodulin or growth associated protein-43 (Gap-43)] and markers of microglia activation [ionized calcium binding adaptor molecule 1 (Iba1) and B7-2], were determined. OA-GcMAF reverted the damage inflicted by oxaliplatin on human neurons and preserved their viability. The neuroprotective effect was accompanied by increased intracellular cAMP production, as well as by increased expression of VEGF and neuromodulin. OA-GcMAF did not revert the effects of oxaliplatin on microglial cell viability. However, it increased microglial activation following oxaliplatin-induced damage, resulting in an increased expression of the markers Iba1 and B7-2 without any concomitant increase in cell number. When neurons and microglial cells were co-cultured, the presence of OA-GcMAF significantly counteracted the toxic effects of oxaliplatin. Our results demonstrate that OA-GcMAF, already used in the immunotherapy of advanced cancers, may significantly contribute to neutralizing the neurotoxicity induced by oxaliplatin, at the same time possibly concurring to an integrated anticancer effect. The association between these two powerful anticancer molecules would probably produce
DEFF Research Database (Denmark)
Carli, Lorenzo; Genta, G; Cantatore, Angela
2011-01-01
3D-SEM is a method, based on the stereophotogrammetry technique, which obtains three-dimensional topographic reconstructions starting typically from two SEM images, called the stereo-pair. In this work, a theoretical uncertainty evaluation of the stereo-pair technique, according to GUM (Guide to ...
Directory of Open Access Journals (Sweden)
Yong-Gang Xia
2018-05-01
Full Text Available A modified GC-MS analytical procedure based on trimethylsilyl-dithioacetal (TMSD derivatization has been established for a simultaneous determination of thirteen carbohydrates. Different from previous approaches, the current GC-MS method was featured by a powerful practicability for simultaneous detection of aldoses, uronic acids, ketoses, and amino sugars; simplifying GC-MS chromatograms and producing a single peak for each derivatized sugar, as well as high resolution, sensitivity, and repeatability. An additional liquid-liquid extraction from derivatization mixtures was performed not only to increase the detection sensitivity of amino sugars but also to decrease the by-products of derivatization. Contrarily, three amino sugars were detected at a very low intensity or not detected at all. The effect of time on monosaccharide- mercaptalated reaction was systematically investigated. The effect of trimethylsilylation on the formation of TMSD was also optimized. The established GC-MS based on TMSD derivatization was suitable for complex carbohydrate analysis and has been successfully applied for the detection of free carbohydrates in water extracts of Anemarrhena asphodeloides roots and determination of monosaccharides in Glossy ganoderma polysaccharides.
Group separation of organohalogenated contaminants by GCxGC
Energy Technology Data Exchange (ETDEWEB)
Korytar, P.; Leonards, P.; Boer, J. de [Netherlands Institute for Fisheries Research, IJmuiden (Netherlands); Parera, J. [Barcelona Univ. (Spain); Brinkman, U. [Vrije Univ., Amsterdam (Netherlands)
2004-09-15
The congener specific analysis of organohalogenated compounds is challenging, because of a large number of possibly interfering compounds not only within the compound class but also from congeners of other compound classes. Therefore, analytical procedures usually include complicated and time-consuming multi-step sample pre-treatment and/or selective detection (e.g. HRMS, MS/MS) in the consequent gas chromatographic analysis, what makes the procedures laborious and expensive. One way how to improve the situation would be to considerably increase the separation efficiency of the gas chromatographic analysis by replacing conventional GC by so-called comprehensive two-dimensional gas chromatography (GC x GC). In GC x GC two independent separations are applied to an entire sample which effects a considerably enhanced overall resolution and also, because of the analyte refocusing during modulation, an improved analyte detectability. One further aspect which makes GC x GC especially attractive is the ordered structure of the two-dimensional chromatograms, which is observed when mixtures of related compounds, homologues or congeners are analysed. One good example are the bands of alkanes, naphthenes and aromatics present in 2D chromatogram when petrochemical samples are analysed. The ordered structure was reported also within the compound class of some organohalogenated contaminants, more precisely, of polychlorinated biphenyls and toxaphenes (ordering to number of chlorine atoms on the skeleton). However, to date, no study of separation among the different compound classes has been reported. In the present paper, this topic will be studied for the most common contaminants. While the principle aim is the group type separation, some attention will be devoted also to within the class separation (e.g., for polychlorinated diphenylethers and polychlorinated alkanes).
International Nuclear Information System (INIS)
Palmero, F; Archilla, J F R; Hennig, D; Romero, F R
2004-01-01
Some recent results for a three-dimensional, semi-classical, tight-binding model for DNA show that there are two types of polarons, namely radial and twist polarons, which can transport charge along the DNA molecule. However, the existence of two types of base pairs in real DNA makes it crucial to find out if charge transport also exists in DNA chains with different base pairs. In this paper, we address this problem in its simple case, a homogeneous chain except for a single different base pair, which we call a base-pair inhomogeneity, and its effect on charge transport. Radial polarons experience either reflection or trapping. However, twist polarons are good candidates for charge transport along real DNA. This transport is also very robust with respect to weak parametric and diagonal disorder
DEFF Research Database (Denmark)
Frederiksen, Marie; Thomsen, Cathrine; Frøshaug, May
2010-01-01
determined in placental tissue from the same individuals, and the relationship with the external exposure from house dust from the participants' homes was explored. Samples of maternal and umbilical cord plasma from a cohort of 51 pregnant women from the Copenhagen area were collected. Paired maternal...... and umbilical cord plasma were analysed for BDE-28, 37, 47, 85, 99, 100, 119, 138, 153, 154, 183, 209 and the brominated biphenyl BB-153 using automated SPE extraction and GC-HRMS for the tri- to hepta-BDEs and GC-LRMS (ECNI) for BDE-209. PBDEs were detected in all maternal and umbilical cord plasma samples...
Curtis, Byron; Kemp, Philip; Harty, Linda; Choi, Chai; Christensen, Dix
2003-10-01
2,5-Dimethoxy-4-n-propylthiophenethylamine (2C-T-7) has structural and pharmacodynamic similarities to methylenedioxymethamphetamine (MDMA). This compound was initially identified from a routine screening procedure in postmortem urine from a 20-year-old male that died in a local emergency room after reportedly insufflating 35 mg. This report describes the development of a quantitative method for 2C-T-7. A number of method parameters were studied including internal standard selection, liquid-liquid extraction scheme, and drug stability in preserved refrigerated blood. The adopted method for blood and urine involves the addition of trimethoxyamphetamine (TMA) as internal standard, alkalinization with ammonium hydroxide, and liquid-liquid extraction with n-chlorobutane. To facilitate recovery from liver, a 1:4 aqueous homogenate was pretreated with dilute perchloric acid, centrifuged, and the supernatant was extracted as previously described. In each case, 0.1% hydrochloric acid in methanol was added during the final concentration step to prevent loss of drug caused by evaporation. Samples were analyzed by gas chromatography with nitrogen-phosphorus detection (GC-NPD) and electron ionization GC-mass spectrometry (MS) utilizing selected ion monitoring. For the GC-MS analysis, the characteristic ions monitored for 2C-T-7 were m/z 226, 255, and 183 and for TMA, m/z 182. The limits of detection and quantitation in blood were 6.0 and 15.6 ng/mL, respectively, by both GC-NPD and GC-MS. The results from the postmortem case were as follows: heart blood, 57 ng/mL; femoral blood, 100 ng/mL; urine, 1120 ng/mL; and liver, 854 ng/g.
Dye-sensitized solar cell with a pair of carbon-based electrodes
International Nuclear Information System (INIS)
Kyaw, Aung Ko Ko; Demir, Hilmi Volkan; Sun Xiaowei; Tantang, Hosea; Zhang Qichun; Wu Tao; Ke, Lin; Wei Jun
2012-01-01
We have fabricated a dye-sensitized solar cell (DSSC) with a pair of carbon-based electrodes using a transparent, conductive carbon nanotubes (CNTs) film modified with ultra-thin titanium-sub-oxide (TiO x ) as the working electrode and a bilayer of conductive CNTs and carbon black as the counter electrode. Without TiO x modification, the DSSC is almost nonfunctional whereas the power conversion efficiency (PCE) increases significantly when the working electrode is modified with TiO x . The performance of the cell could be further improved when the carbon black film was added on the counter electrode. The improved efficiency can be attributed to the inhibition of the mass recombination at the working electrode/electrolyte interface by TiO x and the acceleration of the electron transfer kinetics at the counter electrode by carbon black. The DSSC with a pair of carbon-based electrodes gives the PCE of 1.37%. (paper)
Single base pair mutation analysis by PNA directed PCR clamping
DEFF Research Database (Denmark)
Ørum, H.; Nielsen, P.E.; Egholm, M.
1993-01-01
A novel method that allows direct analysis of single base mutation by the polymerase chain reaction (PCR) is described. The method utilizes the finding that PNAs (peptide nucleic acids) recognize and bind to their complementary nucleic acid sequences with higher thermal stability and specificity...... allows selective amplification/suppression of target sequences that differ by only one base pair. Finally we show that PNAs can be designed in such a way that blockage can be accomplished when the PNA target sequence is located between the PCR primers....
PandA : pairings and arithmetic
Chuengsatiansup, C.; Naehrig, M.; Ribarski, P.; Schwabe, P.; Cao, Z.; Zhang, F.
2014-01-01
This paper introduces PandA, a software framework for Pairings and Arithmetic. It is designed to bring together advances in the efficient computation of cryptographic pairings and the development and implementation of pairing-based protocols. The intention behind the PandA framework is to give
Capturing alternative secondary structures of RNA by decomposition of base-pairing probabilities.
Hagio, Taichi; Sakuraba, Shun; Iwakiri, Junichi; Mori, Ryota; Asai, Kiyoshi
2018-02-19
It is known that functional RNAs often switch their functions by forming different secondary structures. Popular tools for RNA secondary structures prediction, however, predict the single 'best' structures, and do not produce alternative structures. There are bioinformatics tools to predict suboptimal structures, but it is difficult to detect which alternative secondary structures are essential. We proposed a new computational method to detect essential alternative secondary structures from RNA sequences by decomposing the base-pairing probability matrix. The decomposition is calculated by a newly implemented software tool, RintW, which efficiently computes the base-pairing probability distributions over the Hamming distance from arbitrary reference secondary structures. The proposed approach has been demonstrated on ROSE element RNA thermometer sequence and Lysine RNA ribo-switch, showing that the proposed approach captures conformational changes in secondary structures. We have shown that alternative secondary structures are captured by decomposing base-paring probabilities over Hamming distance. Source code is available from http://www.ncRNA.org/RintW .
Kabir, Ayesha; Suresh Kumar, Gopinatha
2013-01-01
The thermodynamics of the base pair specificity of the binding of the polyamines spermine, spermidine, putrescine, and cadaverine with three genomic DNAs Clostridium perfringens, 27% GC, Escherichia coli, 50% GC and Micrococcus lysodeikticus, 72% GC have been studied using titration calorimetry and the data supplemented with melting studies, ethidium displacement and circular dichroism spectroscopy results. Isothermal titration calorimetry, differential scanning calorimetry, optical melting studies, ethidium displacement, circular dichroism spectroscopy are the various techniques employed to characterize the interaction of four polyamines, spermine, spermidine, putersine and cadaverine with the DNAs. Polyamines bound stronger with AT rich DNA compared to the GC rich DNA and the binding varied depending on the charge on the polyamine as spermine>spermidine >putrescine>cadaverine. Thermodynamics of the interaction revealed that the binding was entropy driven with small enthalpy contribution. The binding was influenced by salt concentration suggesting the contribution from electrostatic forces to the Gibbs energy of binding to be the dominant contributor. Each system studied exhibited enthalpy-entropy compensation. The negative heat capacity changes suggested a role for hydrophobic interactions which may arise due to the non polar interactions between DNA and polyamines. From a thermodynamic analysis, the AT base specificity of polyamines to DNAs has been elucidated for the first time and supplemented by structural studies.
Brovarets', O O; Hovorun, D M
2010-01-01
A novel physico-chemical mechanism of the Watson-Crick DNA base pair Gua.Cyt tautomerization Gua.Cyt*Gua.CytGua*.Cyt (mutagenic tautomers of bases are marked by asterisks) have been revealed and realized in a pathway of single proton transfer through two mutual isoenergetic transition states with Gibbs free energy of activation 30.4 and 30.6 kcal/mol and they are ion pairs stabilized by three (N2H...N3, N1H...N4- and O6+H...N4-) and five (N2H...O2, N1H...O2, N1H...N3, O6+H...N4- and 06+H...N4-) H-bonds accordingly. Stable base pairs Gua-Cyt* and Gua*.Cyt which dissociate comparably easy into monomers have acceptable relative Gibbs energies--12.9 and 14.3 kcal/mol--for the explanation of the nature of the spontaneous transitions of DNA replication. Results are obtained at the MP2/6-311++G(2df,pd)//B3LYP/6-31 1++G(d,p) level of theory in vacuum approach.
Directory of Open Access Journals (Sweden)
Rie Kawai
2012-03-01
Full Text Available Toward the expansion of the genetic alphabet, an unnatural base pair between 7-(2-thienylimidazo[4,5-b]pyridine (Ds and pyrrole-2-carbaldehyde (Pa functions as a third base pair in replication and transcription, and provides a useful tool for the site-specific, enzymatic incorporation of functional components into nucleic acids. We have synthesized several modified-Pa substrates, such as alkylamino-, biotin-, TAMRA-, FAM-, and digoxigenin-linked PaTPs, and examined their transcription by T7 RNA polymerase using Ds-containing DNA templates with various sequences. The Pa substrates modified with relatively small functional groups, such as alkylamino and biotin, were efficiently incorporated into RNA transcripts at the internal positions, except for those less than 10 bases from the 3′-terminus. We found that the efficient incorporation into a position close to the 3′-terminus of a transcript depended on the natural base contexts neighboring the unnatural base, and that pyrimidine-Ds-pyrimidine sequences in templates were generally favorable, relative to purine-Ds-purine sequences. The unnatural base pair transcription system provides a method for the site-specific functionalization of large RNA molecules.
Chemical Analysis of Essential oil of "Artemisia haussknechtii Boiss" by GC and GC/ MS
Directory of Open Access Journals (Sweden)
A. Nassir- Ahraadi . A. Rustaiyan
1994-08-01
Full Text Available The composition of the essential oil from the leaves and flowers of "Artemisia haussknechtii Boiss growing wild in the north-west of Iran, was investigated by GC and GC/MS."nThe main components of the volatile oil were 1,8 - cineol (16.5%, camphor (14.1%. artemisia ketone (10.5%, fragranol (9.0%, Yomogi alcohol (7.5% and B- pinene (5.4%. The total contribution of these compounds to the oil amounted to 63.0%."nMonoterpens and sesquiterpenes represent 90.08% and 1.52% of the oil respectively. Of the twenty oxygen-containing monoterpenes which made up a fairly large fraction of the terpenoid composition, the predominant components were 1,8 - cineole and camphor.
Energy Technology Data Exchange (ETDEWEB)
Recke, R. von der; Goetsch, A.; Vetter, W. [Hohenheim Univ., Stuttgart (Germany). Inst. fuer Lebensmittelchemie; Mariussen, E. [Norwegian Inst. for Air Research, Kjeller (Norway); Berger, U.; Herzke, D. [NILU, The Polar Environmental Centre, Tromso (Norway)
2004-09-15
Technical mixtures of polybrominated biphenyls (PBBs) have been extensively used as flameretardants in textile and electronic industries and as additives in plastics. Despite a continuous reduction of the worldwide annual production in the last decade, the presence of PBBs in the environment was recently confirmed in a wide range of samples. PBBs exist in a theoretical variety of 209 congeners. Many di-ortho, tri-ortho, and tetra-ortho PBBs form stable pairs of enantiomers, which was experimentally confirmed by enantioselective HPLC separation of chiral PBB in a technical mixture. It is known from the literature, that chiral organohalogen compounds can be degraded enantioselectively. In this work we used a chiral GC stationary phase and developed a method using GC/NICI-MSMS in the single reaction monitoring mode for the determination of the enantioratio of PBB 149 in extracts from Norwegian bird of prey eggs.
Babbitt, Gregory A; Alawad, Mohammed A; Schulze, Katharina V; Hudson, André O
2014-01-01
While mRNA stability has been demonstrated to control rates of translation, generating both global and local synonymous codon biases in many unicellular organisms, this explanation cannot adequately explain why codon bias strongly tracks neighboring intergene GC content; suggesting that structural dynamics of DNA might also influence codon choice. Because minor groove width is highly governed by 3-base periodicity in GC, the existence of triplet-based codons might imply a functional role for the optimization of local DNA molecular dynamics via GC content at synonymous sites (≈GC3). We confirm a strong association between GC3-related intrinsic DNA flexibility and codon bias across 24 different prokaryotic multiple whole-genome alignments. We develop a novel test of natural selection targeting synonymous sites and demonstrate that GC3-related DNA backbone dynamics have been subject to moderate selective pressure, perhaps contributing to our observation that many genes possess extreme DNA backbone dynamics for their given protein space. This dual function of codons may impose universal functional constraints affecting the evolution of synonymous and non-synonymous sites. We propose that synonymous sites may have evolved as an 'accessory' during an early expansion of a primordial genetic code, allowing for multiplexed protein coding and structural dynamic information within the same molecular context. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.
Röttger, Katharina; Marroux, Hugo J B; Grubb, Michael P; Coulter, Philip M; Böhnke, Hendrik; Henderson, Alexander S; Galan, M Carmen; Temps, Friedrich; Orr-Ewing, Andrew J; Roberts, Gareth M
2015-12-01
Ultrafast deactivation pathways bestow photostability on nucleobases and hence preserve the structural integrity of DNA following absorption of ultraviolet (UV) radiation. One controversial recovery mechanism proposed to account for this photostability involves electron-driven proton transfer (EDPT) in Watson-Crick base pairs. The first direct observation is reported of the EDPT process after UV excitation of individual guanine-cytosine (G⋅C) Watson-Crick base pairs by ultrafast time-resolved UV/visible and mid-infrared spectroscopy. The formation of an intermediate biradical species (G[-H]⋅C[+H]) with a lifetime of 2.9 ps was tracked. The majority of these biradicals return to the original G⋅C Watson-Crick pairs, but up to 10% of the initially excited molecules instead form a stable photoproduct G*⋅C* that has undergone double hydrogen-atom transfer. The observation of these sequential EDPT mechanisms across intermolecular hydrogen bonds confirms an important and long debated pathway for the deactivation of photoexcited base pairs, with possible implications for the UV photochemistry of DNA. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Clinical experience of integrative cancer immunotherapy with GcMAF.
Inui, Toshio; Kuchiike, Daisuke; Kubo, Kentaro; Mette, Martin; Uto, Yoshihiro; Hori, Hitoshi; Sakamoto, Norihiro
2013-07-01
Immunotherapy has become an attractive new strategy in the treatment of cancer. The laboratory and clinical study of cancer immunotherapy is rapidly advancing. However, in the clinical setting, the results of cancer immunotherapy are mixed. We therefore contend that cancer immunotherapy should be customized to each patient individually based on their immune status and propose an integrative immunotherapy approach with second-generation group-specific component macrophage activating factor (GcMAF)-containing human serum. The standard protocol of our integrative cancer immunotherapy is as follows: i) 0.5 ml GcMAF-containing human serum is administered intramuscularly or subcutaneously once or twice per week for the duration of cancer therapy until all cancer cells are eradicated; ii) hyper T/natural killer (NK) cell therapy is given once per week for six weeks; iii) high-dose vitamin C is administered intravenously twice per week; iv) alpha lipoic acid (600 mg) is administered orally daily; v) vitamin D3 (5,000-10,000 IU) is administered orally daily. By March 2013, Saisei Mirai have treated over 345 patients with GcMAF. Among them we here present the cases of three patients for whom our integrative immunotherapy was remarkably effective. The results of our integrative immunotherapy seem hopeful. We also plan to conduct a comparative clinical study.>
Case report: A breast cancer patient treated with GcMAF, sonodynamic therapy and hormone therapy.
Inui, Toshio; Makita, Kaori; Miura, Hirona; Matsuda, Akiko; Kuchiike, Daisuke; Kubo, Kentaro; Mette, Martin; Uto, Yoshihiro; Nishikata, Takahito; Hori, Hitoshi; Sakamoto, Norihiro
2014-08-01
Gc protein-derived macrophage-activating factor (GcMAF) occurs naturally in the human body. It has various functions, such as macrophage activation and antitumor activities. Recently, immunotherapy has become an attractive new strategy in the treatment of cancer. GcMAF-based immunotherapy can be combined with many other therapies. Sonodynamic therapy (SDT) using low-intensity ultrasound is a novel therapeutic modality. Ultrasound has been demonstrated to activate a number of sonosensitive agents allowing for the possibility of non-invasive targeted treatment for both superficial and deep-seated tumors. The current case study demonstrates that GcMAF and SDT can be used in combination with conventional therapies in patients with metastatic cancer, especially where treatment options are limited due to factors such as toxicity. This case study also suggests a new concept of cancer treatment using local destruction of cancer tissue, in this case conducted with SDT, to be used in combination with GcMAF immunotherapy as a systemic treatment. Copyright© 2014 International Institute of Anticancer Research (Dr. John G. Delinassios), All rights reserved.
Quality Control Of Selected Pesticides With GC
Energy Technology Data Exchange (ETDEWEB)
Karasali, H. [Benaki Phytopathological Institute Laboratory of Physical and Chemical Analysis of Pesticides, Ekalis (Greece)
2009-07-15
The practical quality control of selected pesticides with GC is treated. Detailed descriptions are given on materials and methods used, including sample preparation and GC operating conditions. The systematic validation of multi methods is described, comprising performance characteristics in routine analysis, like selectivity, specificity etc. This is illustrated by chromatograms, calibration curves and tables derived from real laboratory data. (author)
Liang, Feng; Lindsay, Stuart; Zhang, Peiming
2012-11-21
With the aid of Density Functional Theory (DFT), we designed 1,8-naphthyridine-2,7-diamine as a recognition molecule to read DNA base pairs for genomic sequencing by electron tunneling. NMR studies show that it can form stable triplets with both A : T and G : C base pairs through hydrogen bonding. Our results suggest that the naphthyridine molecule should be able to function as a universal base pair reader in a tunneling gap, generating distinguishable signatures under electrical bias for each of DNA base pairs.
Effect of proton transfer on the electronic coupling in DNA
International Nuclear Information System (INIS)
Rak, Janusz; Makowska, Joanna; Voityuk, Alexander A.
2006-01-01
The effects of single and double proton transfer within Watson-Crick base pairs on donor-acceptor electronic couplings, V da , in DNA are studied on the bases of quantum chemical calculations. Four dimers [AT,AT], [GC,GC], [GC,AT] and [GC,TA)] are considered. Three techniques - the generalized Mulliken-Hush scheme, the fragment charge method and the diabatic states method - are employed to estimate V da for hole transfer between base pairs. We show that both single- and double proton transfer (PT) reactions may substantially affect the electronic coupling in DNA. The electronic coupling in [AT,AT] is predicted to be most sensitive to PT. Single PT within the first base pair in the dimer leads to increase in the hole transfer efficiency by a factor of 4, while proton transfer within the second pair should substantially, by 2.7 times, decrease the rate of charge transfer. Thus, directional asymmetry of the PT effects on the electronic coupling is predicted. The changes in the V da matrix elements correlate with the topological properties of orbitals of donor and acceptor and can be qualitatively rationalized in terms of resonance structures of donor and acceptor. Atomic pair contributions to the V da matrix elements are also analyzed
Directory of Open Access Journals (Sweden)
Lia M. S. de Ferrante
Full Text Available Baccharis trimera (carqueja is a medicinal plant used for stomach pain, bad digestion, heart bum, kidney problems and constipation. The objective of the present work was a quality study of carqueja commercialized in Curitiba and metropolitan region (Paraná-Brazil using gas chromatography techniques (GC/FID for analyses of the essential oil, which was extracted through hydrodistillation using a Clevenger system. Macro and microscopic analyses were also done. Some samples were contaminated by other species of plants, fungi and small insects, some of them could be identified. Among all samples, 21 showed similar chromatographic profile to the standard oil, and 7 had different profile in relation to the standard. The chromatogram analyses showed that most of the analyzed samples had the similar profile as the standard oil of Baccharis trimera. GC/FID-based authentication of Baccharis trimera may be useful as a rapid tool to ensure quality control and safety monitoring of this kind of herbal pharmaceuticals.
Paired structures and other opposite-based models
DEFF Research Database (Denmark)
Rodríguez, J. Tinguaro; Franco, Camilo; Gómez, Daniel
2015-01-01
, that we will assume dependent on a specific negation, previously determined. In this way we can define a paired fuzzy set as a couple of opposite valuation fuzzy sets. Then we shall explore what kind of new valuation fuzzy sets can be generated from the semantic tension between those two poles, leading...... to a more complex valuation structure that still keeps the essence of being paired. In this way several neutral fuzzy sets can appear, in particular indeterminacy, ambivalence and conflict. Two consequences are then presented: on one hand, we will show how Atanassov´s Intuitionistic Fuzzy Sets can be viewed...
A long baseline global stereo matching based upon short baseline estimation
Li, Jing; Zhao, Hong; Li, Zigang; Gu, Feifei; Zhao, Zixin; Ma, Yueyang; Fang, Meiqi
2018-05-01
In global stereo vision, balancing the matching efficiency and computing accuracy seems to be impossible because they contradict each other. In the case of a long baseline, this contradiction becomes more prominent. In order to solve this difficult problem, this paper proposes a novel idea to improve both the efficiency and accuracy in global stereo matching for a long baseline. In this way, the reference images located between the long baseline image pairs are firstly chosen to form the new image pairs with short baselines. The relationship between the disparities of pixels in the image pairs with different baselines is revealed by considering the quantized error so that the disparity search range under the long baseline can be reduced by guidance of the short baseline to gain matching efficiency. Then, the novel idea is integrated into the graph cuts (GCs) to form a multi-step GC algorithm based on the short baseline estimation, by which the disparity map under the long baseline can be calculated iteratively on the basis of the previous matching. Furthermore, the image information from the pixels that are non-occluded under the short baseline but are occluded for the long baseline can be employed to improve the matching accuracy. Although the time complexity of the proposed method depends on the locations of the chosen reference images, it is usually much lower for a long baseline stereo matching than when using the traditional GC algorithm. Finally, the validity of the proposed method is examined by experiments based on benchmark datasets. The results show that the proposed method is superior to the traditional GC method in terms of efficiency and accuracy, and thus it is suitable for long baseline stereo matching.
DNA electronic circular dichroism on the inter-base pair scale
DEFF Research Database (Denmark)
Di Meo, Florent; Nørby, Morten Steen; Rubio-Magnieto, Jenifer
2015-01-01
A successful elucidation of the near-ultraviolet electronic circular dichroism spectrum of a short double-stranded DNA is reported. Time-dependent density functional theory methods are shown to accurately predict spectra and assign bands on the microscopic base-pair scale, a finding that opens...... the field for using circular dichroism spectroscopy as a sensitive nanoscale probe of DNA to reveal its complex interactions with the environment. (Chemical Equation Presented)....
A GC/MS-based metabolomic approach for reliable diagnosis of phenylketonuria.
Xiong, Xiyue; Sheng, Xiaoqi; Liu, Dan; Zeng, Ting; Peng, Ying; Wang, Yichao
2015-11-01
), which showed that phenylacetic acid may be used as a reliable discriminator for the diagnosis of PKU. The low false positive rate (1-specificity, 0.064) can be eliminated or at least greatly reduced by simultaneously referring to other markers, especially phenylpyruvic acid, a unique marker in PKU. Additionally, this standard was obtained with high sensitivity and specificity in a less invasive manner for diagnosing PKU compared with the Phe/Tyr ratio. Therefore, we conclude that urinary metabolomic information based on the improved oximation-silylation method together with GC/MS may be reliable for the diagnosis and differential diagnosis of PKU.
Das, Shubhajit
2015-09-17
We employ first-principles Density Functional Theory (DFT) and time-dependent DFT (TDDFT) to elucidate structural, electronic and optical properties of a few recently reported triazole adenine nucleobase analogues. The results are compared against the findings obtained for both natural adenine nucleobase and available experimental data. The optical absorption of these adenine analogues are calculated both in gas-phase and in solvent (methanol) using Polarized Continuum Model (PCM). We find that all the analogues show a red-shifted absorption profile as compared to adenine. Our simulated emission spectra in solvent compare fairly well with experimentally observed results. We investigate base paring ability of these adenine analogues with thymine. The calculations on the intrinsic stability of these base pairs ascertain that all the adenine analogues form the hydrogen bonded Watson-Crick base pair with similar H-bonding energy as obtained for natural adenine-thymine base pair. In our study, we provide a microscopic origin of the low-energy absorption and emission peaks, observed experimentally.
Das, Shubhajit; Samanta, Pralok Kumar; Pati, Swapan
2015-01-01
We employ first-principles Density Functional Theory (DFT) and time-dependent DFT (TDDFT) to elucidate structural, electronic and optical properties of a few recently reported triazole adenine nucleobase analogues. The results are compared against the findings obtained for both natural adenine nucleobase and available experimental data. The optical absorption of these adenine analogues are calculated both in gas-phase and in solvent (methanol) using Polarized Continuum Model (PCM). We find that all the analogues show a red-shifted absorption profile as compared to adenine. Our simulated emission spectra in solvent compare fairly well with experimentally observed results. We investigate base paring ability of these adenine analogues with thymine. The calculations on the intrinsic stability of these base pairs ascertain that all the adenine analogues form the hydrogen bonded Watson-Crick base pair with similar H-bonding energy as obtained for natural adenine-thymine base pair. In our study, we provide a microscopic origin of the low-energy absorption and emission peaks, observed experimentally.
Fleming, Aaron M; Muller, James G; Dlouhy, Adrienne C; Burrows, Cynthia J
2012-09-12
8-Oxo-7,8-dihydroguanine (OG) is the most common base damage found in cells, where it resides in many structural contexts, including the nucleotide pool, single-stranded DNA at transcription forks and replication bubbles, and duplex DNA base-paired with either adenine (A) or cytosine (C). OG is prone to further oxidation to the highly mutagenic hydantoin products spiroiminodihydantoin (Sp) and 5-guanidinohydantoin (Gh) in a sharply pH-dependent fashion within nucleosides. In the present work, studies were conducted to determine how the structural context affects OG oxidation to the hydantoins. These studies revealed a trend in which the Sp yield was greatest in unencumbered contexts, such as nucleosides, while the Gh yield increased in oligodeoxynucleotide (ODN) contexts or at reduced pH. Oxidation of oligomers containing hydrogen-bond modulators (2,6-diaminopurine, N(4)-ethylcytidine) or alteration of the reaction conditions (pH, temperature, and salt) identify base stacking, electrostatics, and base pairing as the drivers of the key intermediate 5-hydroxy-8-oxo-7,8-dihydroguanine (5-HO-OG) partitioning along the two hydantoin pathways, allowing us to propose a mechanism for the observed base-pairing effects. Moreover, these structural effects cause an increase in the effective pK(a) of 5-HO-OG, following an increasing trend from 5.7 in nucleosides to 7.7 in a duplex bearing an OG·C base pair, which supports the context-dependent product yields. The high yield of Gh in ODNs underscores the importance of further study on this lesion. The structural context of OG also determined its relative reactivity toward oxidation, for which the OG·A base pair is ~2.5-fold more reactive than an OG·C base pair, and with the weak one-electron oxidant ferricyanide, the OG nucleoside reactivity is >6000-fold greater than that of OG·C in a duplex, leading to the conclusion that OG in the nucleoside pool should act as a protective agent for OG in the genome.
Cropper, Paul M.; Overson, Devon K.; Cary, Robert A.; Eatough, Delbert J.; Chow, Judith C.; Hansen, Jaron C.
2017-11-01
Particulate matter (PM) is among the most harmful air pollutants to human health, but due to its complex chemical composition is poorly characterized. A large fraction of PM is composed of organic compounds, but these compounds are not regularly monitored due to limitations in current sampling and analysis techniques. The Organic Aerosol Monitor (GC-MS OAM) combines a collection device with thermal desorption, gas chromatography and mass spectrometry to quantitatively measure the carbonaceous components of PM on an hourly averaged basis. The GC-MS OAM is fully automated and has been successfully deployed in the field. It uses a chemically deactivated filter for collection followed by thermal desorption and GC-MS analysis. Laboratory tests show that detection limits range from 0.2 to 3 ng for 16 atmospherically relevant compounds, with the possibility for hundreds more. The GC-MS OAM was deployed in the field for semi-continuous measurement of the organic markers, levoglucosan, dehydroabietic acid, and polycyclic aromatic hydrocarbons (PAHs) from January to March 2015. Results illustrate the significance of this monitoring technique to characterize the organic components of PM and identify sources of pollution.
Directory of Open Access Journals (Sweden)
Das Tanmoy
2012-03-01
Full Text Available We show that, by using the unit-cell transformation between 1 Fe per unit cell to 2 Fe per unit cell, one can qualitatively understand the pairing symmetry of several families of iron-based superconductors. In iron-pnictides and iron-chalcogenides, the nodeless s±-pairing and the resulting magnetic resonance mode transform nicely between the two unit cells, while retaining all physical properties unchanged. However, when the electron-pocket disappears from the Fermi surface with complete doping in KFe2As2, we find that the unit-cell invariant requirement prohibits the occurrence of s±-pairing symmetry (caused by inter-hole-pocket nesting. However, the intra-pocket nesting is compatible here, which leads to a nodal d-wave pairing. The corresponding Fermi surface topology and the pairing symmetry are similar to Ce-based heavy-fermion superconductors. Furthermore, when the Fermi surface hosts only electron-pockets in KyFe2-xSe2, the inter-electron-pocket nesting induces a nodeless and isotropic d-wave pairing. This situation is analogous to the electron-doped cuprates, where the strong antiferromagnetic order creates similar disconnected electron-pocket Fermi surface, and hence nodeless d-wave pairing appears. The unit-cell transformation in KyFe2-xSe2 exhibits that the d-wave pairing breaks the translational symmetry of the 2 Fe unit cell, and thus cannot be realized unless a vacancy ordering forms to compensate for it. These results are consistent with the coexistence picture of a competing order and nodeless d-wave superconductivity in both cuprates and KyFe1.6Se2.
Non-standard base pairing and stacked structures in methyl xanthine clusters
Czech Academy of Sciences Publication Activity Database
Callahan, M. P.; Gengeliczki, Z.; Svadlenak, N.; Valdes, Haydee; Hobza, Pavel; de Vries, M. S.
2008-01-01
Roč. 10, č. 19 (2008), s. 2819-2826 ISSN 1463-9076 R&D Projects: GA MŠk LC512 Grant - others:NSF(US) CHE-0615401 Institutional research plan: CEZ:AV0Z40550506 Keywords : non-standard base pairing * stacked structures * in methyl xanthine Subject RIV: CF - Physical ; Theoretical Chemistry Impact factor: 4.064, year: 2008
Charge transport through DNA based electronic barriers
Patil, Sunil R.; Chawda, Vivek; Qi, Jianqing; Anantram, M. P.; Sinha, Niraj
2018-05-01
We report charge transport in electronic 'barriers' constructed by sequence engineering in DNA. Considering the ionization potentials of Thymine-Adenine (AT) and Guanine-Cytosine (GC) base pairs, we treat AT as 'barriers'. The effect of DNA conformation (A and B form) on charge transport is also investigated. Particularly, the effect of width of 'barriers' on hole transport is investigated. Density functional theory (DFT) calculations are performed on energy minimized DNA structures to obtain the electronic Hamiltonian. The quantum transport calculations are performed using the Landauer-Buttiker framework. Our main findings are contrary to previous studies. We find that a longer A-DNA with more AT base pairs can conduct better than shorter A-DNA with a smaller number of AT base pairs. We also find that some sequences of A-DNA can conduct better than a corresponding B-DNA with the same sequence. The counterions mediated charge transport and long range interactions are speculated to be responsible for counter-intuitive length and AT content dependence of conductance of A-DNA.
Bonadio, Federica; Margot, Pierre; Delémont, Olivier; Esseiva, Pierre
2009-05-30
A headspace solid-phase microextraction procedure (HS-SPME) was developed for the profiling of traces present in 3,4-methylenedioxymethylampethamine (MDMA). Traces were first extracted using HS-SPME and then analyzed by gas chromatography-mass spectroscopy (GC-MS). The HS-SPME conditions were optimized using varying conditions. Optimal results were obtained when 40 mg of crushed MDMA sample was heated at 80 degrees C for 15 min, followed by extraction at 80 degrees C for 15 min with a polydimethylsiloxane/divinylbenzene coated fibre. A total of 31 compounds were identified as traces related to MDMA synthesis, namely precursors, intermediates or by-products. In addition some fatty acids used as tabletting materials and caffeine used as adulterant, were also detected. The use of a restricted set of 10 target compounds was also proposed for developing a screening tool for clustering samples having close profile. 114 seizures were analyzed using an SPME auto-sampler (MultiPurpose Samples MPS2), purchased from Gerstel GMBH & Co. (Germany), and coupled to GC-MS. The data was handled using various pre-treatment methods, followed by the study of similarities between sample pairs based on the Pearson correlation. The results show that HS-SPME, coupled with the suitable statistical method is a powerful tool for distinguishing specimens coming from the same seizure and specimens coming from different seizures. This information can be used by law enforcement personnel to visualize the ecstasy distribution network as well as the clandestine tablet manufacturing.
Directory of Open Access Journals (Sweden)
Martyna N. Wieczorek
2018-01-01
Full Text Available One of Maillard reaction products formed in the production of ammonia caramel is 4(5-methylimidazole (4-MeI classified as carcinogen. A method of 4-MeI determination based on ion-pair extraction and derivatisation with isobutyl chloroformate with subsequent gas chromatography-tandem mass spectrometry analysis was proposed. Tandem mass spectrometry was applied to reduce the influence of matrix and increase the selectivity and sensitivity of the method. Triple quadrupole GC-MS system was used for this study. The collision energies were optimized for MRM mode. The detection (LOD and quantification limits (LOQ of the elaborated method were 17 and 37.8 μg kg−1, respectively, repeatability was <15% RSD for analyzed caramel samples, and the recovery for 4-MeI was 101%. Comparison of MS/MS with SIM detection on the same instrument proved almost 30 times lower LODs achieved by tandem mass spectrometry compared to SIM. Described method can be routinely used for monitoring 4-MeI as a quality and safety marker in the production of ammonia caramel.
Abi-Ghanem, Josephine; Rabin, Clémence; Porrini, Massimiliano; Dausse, Eric; Toulmé, Jean-Jacques; Gabelica, Valérie
2017-10-06
In the RNA realm, non-Watson-Crick base pairs are abundant and can affect both the RNA 3D structure and its function. Here, we investigated the formation of RNA kissing complexes in which the loop-loop interaction is modulated by non-Watson-Crick pairs. Mass spectrometry, surface plasmon resonance, and UV-melting experiments show that the G⋅U wobble base pair favors kissing complex formation only when placed at specific positions. We tried to rationalize this effect by molecular modeling, including molecular mechanics Poisson-Boltzmann surface area (MMPBSA) thermodynamics calculations and PBSA calculations of the electrostatic potential surfaces. Modeling reveals that the G⋅U stabilization is due to a specific electrostatic environment defined by the base pairs of the entire loop-loop region. The loop is not symmetric, and therefore the identity and position of each base pair matters. Predicting and visualizing the electrostatic environment created by a given sequence can help to design specific kissing complexes with high affinity, for potential therapeutic, nanotechnology or analytical applications. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.
Treatment of pairing correlations based on the equations of motion for zero-coupled pair operators
International Nuclear Information System (INIS)
Andreozzi, F.; Covello, A.; Gargano, A.; Ye, L.J.; Porrino, A.
1985-01-01
The pairing problem is treated by means of the equations of motion for zero-coupled pair operators. Exact equations for the seniority-v states of N particles are derived. These equations can be solved by a step-by-step procedure which consists of progressively adding pairs of particles to a core. The theory can be applied at several levels of approximation depending on the number of core states which are taken into account. Some numerical applications to the treatment of v = 0, v = 1, and v = 2 states in the Ni isotopes are performed. The accuracy of various approximations is tested by comparison with exact results. For the seniority-one and seniority-two problems it turns out that the results obtained from the first-order theory are very accurate, while those of higher order calculations are practically exact. Concerning the seniority-zero problem, a fifth-order calculation reproduces quite well the three lowest states
Brinkman, U.A.T.; Goosens, E.C.; de Jong, D.; de Jong, G.J.; Beerthuizen, I.M.
1995-01-01
In order to enable the coupling of reversed-phase liquid chromatography (RPLC) with capillary gas chromatography (GC), the performance of an anion-exchange micromembrane device has been studied to remove the ion-pair reagent methanesulphonic acid from an acetonitrile/water LC eluent. The regenerant
A Hierarchical Z-Scheme α-Fe2 O3 /g-C3 N4 Hybrid for Enhanced Photocatalytic CO2 Reduction.
Jiang, Zhifeng; Wan, Weiming; Li, Huaming; Yuan, Shouqi; Zhao, Huijun; Wong, Po Keung
2018-03-01
The challenge in the artificial photosynthesis of fossil resources from CO 2 by utilizing solar energy is to achieve stable photocatalysts with effective CO 2 adsorption capacity and high charge-separation efficiency. A hierarchical direct Z-scheme system consisting of urchin-like hematite and carbon nitride provides an enhanced photocatalytic activity of reduction of CO 2 to CO, yielding a CO evolution rate of 27.2 µmol g -1 h -1 without cocatalyst and sacrifice reagent, which is >2.2 times higher than that produced by g-C 3 N 4 alone (10.3 µmol g -1 h -1 ). The enhanced photocatalytic activity of the Z-scheme hybrid material can be ascribed to its unique characteristics to accelerate the reduction process, including: (i) 3D hierarchical structure of urchin-like hematite and preferable basic sites which promotes the CO 2 adsorption, and (ii) the unique Z-scheme feature efficiently promotes the separation of the electron-hole pairs and enhances the reducibility of electrons in the conduction band of the g-C 3 N 4 . The origin of such an obvious advantage of the hierarchical Z-scheme is not only explained based on the experimental data but also investigated by modeling CO 2 adsorption and CO adsorption on the three different atomic-scale surfaces via density functional theory calculation. The study creates new opportunities for hierarchical hematite and other metal-oxide-based Z-scheme system for solar fuel generation. © 2018 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Bioaccumulation study of acrylate monomers in algae (Chlorella Kessleri) by PY-GC and PY-GC/MS
International Nuclear Information System (INIS)
Halas, L.; Orinak, A.; Adamova, M.; Ladomersky, J.
2004-01-01
Acrylate monomers methylmethacrylate (MMA) and cyclohexylmethacrylate (CHMA) bioaccumulation has been determined in aquatic organism, algae (Chlorella kessleri). Algae were collected in amount of 0.4 mg and directly injected to the paralytic cell. In algae bodies accumulated monomers were analysed by pyrolysis gas chromatography (Py-GC) and pyrolysis gas chromatography coupled with mass spectrometry (Py-GC/MS). Traces of the accumulated monomers in algae body can be determined after 1-, 2 -, 3-weeks of incubation. Maximum content of MMA was determined after 3-week of experiment, contrariwise in the case of CHMA after 2-week exposition. Relationship with pyrolysis temperature has also been studied. (authors)
Directory of Open Access Journals (Sweden)
Ayesha Kabir
Full Text Available BACKGROUND: The thermodynamics of the base pair specificity of the binding of the polyamines spermine, spermidine, putrescine, and cadaverine with three genomic DNAs Clostridium perfringens, 27% GC, Escherichia coli, 50% GC and Micrococcus lysodeikticus, 72% GC have been studied using titration calorimetry and the data supplemented with melting studies, ethidium displacement and circular dichroism spectroscopy results. METHODOLOGY/PRINCIPAL FINDINGS: Isothermal titration calorimetry, differential scanning calorimetry, optical melting studies, ethidium displacement, circular dichroism spectroscopy are the various techniques employed to characterize the interaction of four polyamines, spermine, spermidine, putersine and cadaverine with the DNAs. Polyamines bound stronger with AT rich DNA compared to the GC rich DNA and the binding varied depending on the charge on the polyamine as spermine>spermidine >putrescine>cadaverine. Thermodynamics of the interaction revealed that the binding was entropy driven with small enthalpy contribution. The binding was influenced by salt concentration suggesting the contribution from electrostatic forces to the Gibbs energy of binding to be the dominant contributor. Each system studied exhibited enthalpy-entropy compensation. The negative heat capacity changes suggested a role for hydrophobic interactions which may arise due to the non polar interactions between DNA and polyamines. CONCLUSION/SIGNIFICANCE: From a thermodynamic analysis, the AT base specificity of polyamines to DNAs has been elucidated for the first time and supplemented by structural studies.
International Nuclear Information System (INIS)
Ai Yuejie; Zhang Feng; Cui Ganglong; Fang Weihai; Luo Yi
2010-01-01
2-aminopyridine dimer has frequently been used as a model system for studying photochemistry of DNA base pairs. We examine here the relevance of 2-aminopyridine dimer for a Watson-Crick adenine-thymine base pair by studying UV-light induced photodynamics along two main hydrogen bridges after the excitation to the localized 1 ππ* excited-state. The respective two-dimensional potential-energy surfaces have been determined by time-dependent density functional theory with Coulomb-attenuated hybrid exchange-correlation functional (CAM-B3LYP). Different mechanistic aspects of the deactivation pathway have been analyzed and compared in detail for both systems, while the related reaction rates have also be obtained from Monte Carlo kinetic simulations. The limitations of the 2-aminopyridine dimer as a model system for the adenine-thymine base pair are discussed.
Middle distillates hydrogen content via GC×GC-FID.
Vozka, Petr; Mo, Huaping; Šimáček, Pavel; Kilaz, Gozdem
2018-08-15
Liquid transportation fuels in the middle distillate range contain thousands of hydrocarbons making the predictions and calculations of properties from composition a challenging process. We present a new approach of hydrogen content determination by comprehensive two-dimensional gas chromatography with flame ionization detector (GC×GC-FID) using a weighted average method. GC×GC-FID hydrogen determination precision was excellent (0.005 wt% repeatability). The method accuracy was evaluated by high-resolution nuclear magnetic resonance (NMR) technique, which is non-biased, measures the H signal directly and was independently validated by controls in the current study. The hydrogen content (in the range of 12.72-15.54 wt%) in 28 fuel samples were determined using GC×GC-FID. Results were within ± 2% of those obtained via NMR. Owing to the fact that NMR is accepted as an accurate technique for hydrogen content determination, the GC×GC method proposed in this study can be considered precise and accurate. Copyright © 2018 Elsevier B.V. All rights reserved.
Santamaría-Díaz, Noelia; Méndez-Arriaga, José M; Salas, Juan M; Galindo, Miguel A
2016-05-17
The oligonucleotide d(TX)9 , which consists of an octadecamer sequence with alternating non-canonical 7-deazaadenine (X) and canonical thymine (T) as the nucleobases, was synthesized and shown to hybridize into double-stranded DNA through the formation of hydrogen-bonded Watson-Crick base pairs. dsDNA with metal-mediated base pairs was then obtained by selectively replacing W-C hydrogen bonds by coordination bonds to central silver(I) ions. The oligonucleotide I adopts a duplex structure in the absence of Ag(+) ions, and its stability is significantly enhanced in the presence of Ag(+) ions while its double-helix structure is retained. Temperature-dependent UV spectroscopy, circular dichroism spectroscopy, and ESI mass spectrometry were used to confirm the selective formation of the silver(I)-mediated base pairs. This strategy could become useful for preparing stable metallo-DNA-based nanostructures. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Datsenko, Kirill A.; Jackson, Ryan N.; Wiedenheft, Blake; Severinov, Konstantin; Brouns, Stan J. J.
2013-01-01
Discriminating self and non-self is a universal requirement of immune systems. Adaptive immune systems in prokaryotes are centered around repetitive loci called CRISPRs (clustered regularly interspaced short palindromic repeat), into which invader DNA fragments are incorporated. CRISPR transcripts are processed into small RNAs that guide CRISPR-associated (Cas) proteins to invading nucleic acids by complementary base pairing. However, to avoid autoimmunity it is essential that these RNA-guides exclusively target invading DNA and not complementary DNA sequences (i.e., self-sequences) located in the host's own CRISPR locus. Previous work on the Type III-A CRISPR system from Staphylococcus epidermidis has demonstrated that a portion of the CRISPR RNA-guide sequence is involved in self versus non-self discrimination. This self-avoidance mechanism relies on sensing base pairing between the RNA-guide and sequences flanking the target DNA. To determine if the RNA-guide participates in self versus non-self discrimination in the Type I-E system from Escherichia coli we altered base pairing potential between the RNA-guide and the flanks of DNA targets. Here we demonstrate that Type I-E systems discriminate self from non-self through a base pairing-independent mechanism that strictly relies on the recognition of four unchangeable PAM sequences. In addition, this work reveals that the first base pair between the guide RNA and the PAM nucleotide immediately flanking the target sequence can be disrupted without affecting the interference phenotype. Remarkably, this indicates that base pairing at this position is not involved in foreign DNA recognition. Results in this paper reveal that the Type I-E mechanism of avoiding self sequences and preventing autoimmunity is fundamentally different from that employed by Type III-A systems. We propose the exclusive targeting of PAM-flanked sequences to be termed a target versus non-target discrimination mechanism. PMID:24039596
International Nuclear Information System (INIS)
Uto, Yoshihiro; Hori, Hitoshi
2013-01-01
Radiation oncologists know the conflict between radiotherapy and immunotherapy, but now challenged trails of the integrative cancer therapies combined radiation therapy and various immunoreaction/immune therapies begin. We therefore review the recent results of basic research and clinical trial of the integrated cancer therapies which combined radiotherapy and various immune therapies/immunoreaction, and the challenged studies of combined use of radiotherapy and our developed cancer immunotherapy using serum GcMAF which is human serum containing Gc protein-derived macrophage activating factor (GcMAF). (author)
Efficient Implementation of the Pairing on Mobilephones Using BREW
Yoshitomi, Motoi; Takagi, Tsuyoshi; Kiyomoto, Shinsaku; Tanaka, Toshiaki
Pairing based cryptosystems can accomplish novel security applications such as ID-based cryptosystems, which have not been constructed efficiently without the pairing. The processing speed of the pairing based cryptosystems is relatively slow compared with the other conventional public key cryptosystems. However, several efficient algorithms for computing the pairing have been proposed, namely Duursma-Lee algorithm and its variant ηT pairing. In this paper, we present an efficient implementation of the pairing over some mobilephones. Moreover, we compare the processing speed of the pairing with that of the other standard public key cryptosystems, i. e. RSA cryptosystem and elliptic curve cryptosystem. Indeed the processing speed of our implementation in ARM9 processors on BREW achieves under 100 milliseconds using the supersingular curve over F397. In addition, the pairing is more efficient than the other public key cryptosystems, and the pairing can be achieved enough also on BREW mobilephones. It has become efficient enough to implement security applications, such as short signature, ID-based cryptosystems or broadcast encryption, using the pairing on BREW mobilephones.
Fleming, Aaron M.; Muller, James G.; Dlouhy, Adrienne C.; Burrows, Cynthia J.
2012-01-01
8-Oxo-7,8-dihydroguanine (OG) is the most common base damage found in the cell where it resides in many structural contexts including the nucleotide pool, single-stranded DNA at transcription forks and replication bubbles, and in duplex DNA base paired with either A or C. OG is prone to further oxidation to the highly mutagenic hydantoin products, spiroiminodihydantoin (Sp) and 5-guanidinohydantoin (Gh) in a sharply pH-dependent fashion within nucleosides. In the present work, studies were conducted to determine how the structural context affects OG oxidation to the hydantoins. These studies revealed a trend in which the Sp yield was greatest in unencumbered contexts, such as nucleosides, while the Gh yield increased in oligodeoxynucleotide (ODN) contexts or at reduced pH. Oxidation of oligomers containing hydrogen bond modulators (2,6-diaminopurine, N4-ethylcytidine) or alteration of the reaction conditions (pH, temperature, and salt) identify base stacking, electrostatics and base pairing as the drivers of the key intermediate 5-hydroxy-8-oxo-7,8-dihydroguanine (5-HO-OG) partitioning along the two hydantoin pathways, allowing us to propose a mechanism for the observed base pairing effects. Moreover, these structural effects cause an increase in the effective pKa of 5-HO-OG following an increasing trend from 5.7 in nucleosides to 7.7 in a duplex bearing an OG•C base pair, which supports the context-dependent product yields. The high yield of Gh in ODNs underscores the importance of further study on this lesion. The structural context of OG also determined its relative reactivity toward oxidation for which the OG•A base pair is ~2.5-fold more reactive than an OG•C base pair, and with the weak one-electron oxidant ferricyanide, the OG nucleoside reactivity is >6000-fold greater than that of OG•C in a duplex, leading to the conclusion that OG in the nucleoside pool should act as a protective agent for OG in the genome. PMID:22880947
GC-MS-Based Metabolome and Metabolite Regulation in Serum-Resistant Streptococcus agalactiae.
Wang, Zhe; Li, Min-Yi; Peng, Bo; Cheng, Zhi-Xue; Li, Hui; Peng, Xuan-Xian
2016-07-01
Streptococcus agalactiae causes severe systemic infections in human and fish. In the present study, we established a pathogen-plasma interaction model by which we explored how S. agalactiae evaded serum-mediated killing. We found that S. agalactiae grew faster in the presence of yellow grouper plasma than in the absence of the plasma, indicating S. agalactiae evolved a way of evading the fish immune system. To determine the events underlying this phenotype, we applied GC-MS-based metabolomics approaches to identify differential metabolomes between S. agalactiae cultured with and without yellow grouper plasma. Through bioinformatics analysis, decreased malic acid and increased adenosine were identified as the most crucial metabolites that distinguish the two groups. Meanwhile, they presented with decreased TCA cycle and elevated purine metabolism, respectively. Finally, exogenous malic acid and adenosine were used to reprogram the plasma-resistant metabolome, leading to elevated and decreased susceptibility to the plasma, respectively. Therefore, our findings reveal for the first time that S. agalactiae utilizes a metabolic trick to respond to plasma killing as a result of serum resistance, which may be reverted or enhanced by exogenous malic acid and adenosine, respectively, suggesting that the metabolic trick can be regulated by metabolites.
Crenshaw, Charisse M.; Wade, Jacqueline E.; Arthanari, Haribabu; Frueh, Dominique; Lane, Benjamin F.; Núñez, Megan E.
2011-01-01
The base lesion 8-oxoguanine is formed readily by oxidation of DNA, potentially leading to G→T transversion mutations. Despite the apparent similarity of 8-oxoguanine-cytosine base pairs to normal guanine-cytosine base pairs, cellular base excision repair systems effectively recognize the lesion base. Here we apply several techniques to examine a single 8-oxoguanine lesion at the center of a nonpalindromic 15-mer duplex oligonucleotide in an effort to determine what, if anything, distinguishes an 8-oxoguanine-cytosine base pair from a normal base pair. The lesion duplex is globally almost indistinguishable from the unmodified parent duplex using CD spectroscopy and UV melting thermodynamics. The DNA mismatch-detecting photocleavage agent Rh(bpy)2chrysi3+ cleaves only weakly and nonspecifically, revealing that the 8oxoG-C pair is locally stable at the level of the individual base pairs. NMR spectra are also consistent with a well-conserved B-form duplex structure. In the 2D NOESY spectra, base-sugar and imino-imino crosspeaks are strikingly similar between parent and lesion duplexes. Changes in chemical shift due to the 8oxoG lesion are localized to its complementary cytosine and to the 2–3 base pairs immediately flanking the lesion on the lesion strand. Residues further removed from the lesion are shown to be unperturbed by its presence. Notably, imino exchange experiments indicate that the 8-oxoguanine-cytosine pair is strong and stable, with an apparent equilibrium constant for opening equal to that of other internal guanine-cytosine base pairs, on the order of 10−6. This collection of experiments shows that the 8-oxoguanine-cytosine base pair is incredibly stable and similar to the native pair. PMID:21902242
Base pairing and structural insights into the 5-formylcytosine in RNA duplex
Wang, Rui; Luo, Zhipu; He, Kaizhang; Delaney, Michael O.; Chen, Doris; Sheng, Jia
2016-01-01
Abstract 5-Formylcytidine (f5C), a previously discovered natural nucleotide in the mitochondrial tRNA of many species including human, has been recently detected as the oxidative product of 5-methylcytidine (m5C) through 5-hydroxymethylcytidine (hm5C) in total RNA of mammalian cells. The discovery indicated that these cytosine derivatives in RNA might also play important epigenetic roles similar as in DNA, which has been intensively investigated in the past few years. In this paper, we studied the base pairing specificity of f5C in different RNA duplex contexts. We found that the 5-formyl group could increase duplex thermal stability and enhance base pairing specificity. We present three high-resolution crystal structures of an octamer RNA duplex [5′-GUA(f5C)GUAC-3′]2 that have been solved under three crystallization conditions with different buffers and pH values. Our results showed that the 5-formyl group is located in the same plane as the cytosine base and forms an intra-residue hydrogen bond with the amino group in the N4 position. In addition, this modification increases the base stacking between the f5C and the neighboring bases while not causing significant global and local structure perturbations. This work provides insights into the effects of 5-formylcytosine on RNA duplex. PMID:27079978
Metalophillic attraction in the consecutive T-HgII-T DNA base pairs
Czech Academy of Sciences Publication Activity Database
Benda, Ladislav; Straka, Michal; Bouř, Petr; Tanaka, Y.; Sychrovský, Vladimír
2012-01-01
Roč. 12, č. 1 (2012), s. 50-50 ISSN 1210-8529. [10th Discussions in Structural Molecular Biology. 22.03.2012-24.03.2012, Nové Hrady] Institutional research plan: CEZ:AV0Z40550506 Keywords : T-HgII-T * DNA base pairs Subject RIV: CF - Physical ; Theoretical Chemistry
GC-MS profile of antimicrobial and antioxidant fractions from Cordia rothii roots.
Khan, Kehkashan; Firdous, Sadiqa; Ahmad, Aqeel; Fayyaz, Nida; Nadir, Muhammad; Rasheed, Munawwer; Faizi, Shaheen
2016-11-01
An ethnobotanical survey of Cordia rothii Roem. & Schult. (Boraginaceae) reveals it as a medicinal plant. Antimicrobial and antioxidant potential evaluation and identification of chemical constituents via GC-MS of C. rothii roots fractions. To the best of our knowledge, this is the first systematic investigation of the roots exploiting GC-MS. Extraction and fractionation of C. rothii roots furnished various fractions using solvents of varying polarity, i.e., n-hexane, chloroform, ethyl acetate, acetone and methanol. In vitro antimicrobial and antioxidant screening was performed using disk diffusion and DPPH methods, respectively. MIC of active fractions was also determined using disk diffusion method. GC-MS was used to identify constituents which may be responsible for these activities. Among various fractions from C. rothii roots, fraction KA-C showed strong antibacterial activity against 17 microorganisms tested, with MIC ranging from 250-31.25 μg/mL. Fractions KA-A, KM and KM-A exhibited significant antioxidant potential with EC 50 46.875 μg/mL, while fractions KEA-PE, KM-PE and KM-M were good with EC 50 93.750 μg/mL. Forty-five phytochemicals were identified in GC-MS studies including eight hydrocarbons, six free fatty acids, 11 fatty acids esters, two phenylpropanoids, four aromatics, four terpenoid quinones/hydroquinones, three triterpenes, four phytosterols, two hexose metabolites and a DNA base. Of these, 32 constituents have been reported for the first time from C. rothii, 24 from genus Cordia and 15 from Boraginaceae. Strong antibacterial and antioxidant potential of C. rothii roots may be due to the contribution of phytoconstituents identified through GC-MS studies.
GC-Content Normalization for RNA-Seq Data
2011-01-01
Background Transcriptome sequencing (RNA-Seq) has become the assay of choice for high-throughput studies of gene expression. However, as is the case with microarrays, major technology-related artifacts and biases affect the resulting expression measures. Normalization is therefore essential to ensure accurate inference of expression levels and subsequent analyses thereof. Results We focus on biases related to GC-content and demonstrate the existence of strong sample-specific GC-content effects on RNA-Seq read counts, which can substantially bias differential expression analysis. We propose three simple within-lane gene-level GC-content normalization approaches and assess their performance on two different RNA-Seq datasets, involving different species and experimental designs. Our methods are compared to state-of-the-art normalization procedures in terms of bias and mean squared error for expression fold-change estimation and in terms of Type I error and p-value distributions for tests of differential expression. The exploratory data analysis and normalization methods proposed in this article are implemented in the open-source Bioconductor R package EDASeq. Conclusions Our within-lane normalization procedures, followed by between-lane normalization, reduce GC-content bias and lead to more accurate estimates of expression fold-changes and tests of differential expression. Such results are crucial for the biological interpretation of RNA-Seq experiments, where downstream analyses can be sensitive to the supplied lists of genes. PMID:22177264
Surface modification of TiO2 with g-C3N4 for enhanced UV and visible photocatalytic activity
International Nuclear Information System (INIS)
Lei, Juying; Chen, Ying; Shen, Fan; Wang, Lingzhi; Liu, Yongdi; Zhang, Jinlong
2015-01-01
Highlights: • g-C 3 N 4 /TiO 2 was prepared by a one-step preparation under mild conditions. • Photocatalysts showed excellent activity under both UV and visible light. • A neat surface modification process is proved, excluding influence of N doping. • Two photocatalytic mechanisms under different wavelengths are proposed. • A wide range of available wavelengths would greatly improve practicability of TiO 2 . - Abstract: g-C 3 N 4 modified TiO 2 composites were prepared through a simple calcination process of anatase and cyanamide. The as-prepared samples were characterized by X-ray diffraction (XRD), diffuse reflectance spectrophotometry (DRS), fourier transform infrared spectroscopy (FT-IR), transmission electron microscopy (TEM), thermogravimetry differential thermal analysis (TG–DTA) and X-ray photoelectron spectroscopy (XPS), proving a successful modification of TiO 2 with g-C 3 N 4 . Photodegradation of acid orange 7 (AO7) was used to evaluate the photocatalytic activities of the composites, showing excellent activity of them under both visible and UV light. In addition, base treatment was then introduced to investigate the interaction between g-C 3 N 4 and TiO 2 . After removing the g-C 3 N 4 modified on TiO 2 by base, no nitrogen doping is found in TiO 2 lattice, demonstrating the g-C 3 N 4 was surface attached on TiO 2 and attributing all improvement of photocatalytic activity of g-C 3 N 4 /TiO 2 composite to the synergy between the two semiconductors
VOLATILE ORGANO-METALLOIDS IN BIO-SOLID MATERIALS: ANALYSIS BY VACUUM DISTILLATION-GC/MS
An analytical method based on vacuum distillation-gas chromatography-mass spectrometry (VD-GC-MS)was developed for determining volatile organo-metalloid contaminants in bio-solid materials. Methodperformance was evaluated for dimethylselenide (DMSe), dimethyldisel...
Sequence-dependent unfolding kinetics of DNA hairpins studied by nanopore force spectroscopy
International Nuclear Information System (INIS)
Renner, Stephan; Bessonov, Andrey; Simmel, Friedrich C; Gerland, Ulrich
2010-01-01
Nanopore force spectroscopy is used to study the unzipping kinetics of two DNA hairpin molecules with a 12 base pair long stem containing two contiguous stretches of six GC and six AT base pairs in interchanged order. Even though the thermodynamic stabilities of the two structures are nearly the same, they differ greatly in their unzipping kinetics. When the GC segment has to be broken before the AT segment, the unfolding rate is orders of magnitude smaller than in the opposite case. We also investigated hairpins with stem regions consisting only of AT or GC base pairs. The pure AT hairpins translocate much faster than the other hairpins, whereas the pure GC hairpins translocate on similar timescales to the hairpins with only an initial GC segment. For each hairpin, nanopore force spectroscopy is performed for different loading rates and the resulting unzipping distributions are mathematically transformed to a master curve that yields the unfolding rate as a function of applied voltage. This is compared with a stochastic model of the unfolding process for the two sequences for different voltages. The results can be rationalized in terms of the different natures of the free energy landscapes for the unfolding process.
High GC content causes orphan proteins to be intrinsically disordered.
Directory of Open Access Journals (Sweden)
Walter Basile
2017-03-01
Full Text Available De novo creation of protein coding genes involves the formation of short ORFs from noncoding regions; some of these ORFs might then become fixed in the population. These orphan proteins need to, at the bare minimum, not cause serious harm to the organism, meaning that they should for instance not aggregate. Therefore, although the creation of short ORFs could be truly random, the fixation should be subjected to some selective pressure. The selective forces acting on orphan proteins have been elusive, and contradictory results have been reported. In Drosophila young proteins are more disordered than ancient ones, while the opposite trend is present in yeast. To the best of our knowledge no valid explanation for this difference has been proposed. To solve this riddle we studied structural properties and age of proteins in 187 eukaryotic organisms. We find that, with the exception of length, there are only small differences in the properties between proteins of different ages. However, when we take the GC content into account we noted that it could explain the opposite trends observed for orphans in yeast (low GC and Drosophila (high GC. GC content is correlated with codons coding for disorder promoting amino acids. This leads us to propose that intrinsic disorder is not a strong determining factor for fixation of orphan proteins. Instead these proteins largely resemble random proteins given a particular GC level. During evolution the properties of a protein change faster than the GC level causing the relationship between disorder and GC to gradually weaken.
Directory of Open Access Journals (Sweden)
Chowdhury Sona
2012-06-01
Full Text Available Abstract Background Herpes simplex virus type-1 (HSV-1 enters into cells via membrane fusion of the viral envelope with plasma or endosomal membranes mediated by viral glycoproteins. HSV-1 virions attach to cell surfaces by binding of viral glycoproteins gC, gD and gB to specific cellular receptors. Here we show that the human ocular and highly neurovirulent HSV-1 strain McKrae enters substantially more efficiently into cells via the gB-specific human paired immunoglobulin-like type-2 receptor-α (hPILR-α. Comparison of the predicted amino acid sequences between HSV-1(F and McKrae strains indicates that amino acid changes within gB, gC, gH and gL may cause increased entry via the hPILR- α receptor. Results HSV-1 (McKrae entered substantially more efficiently than viral strain F in Chinese hamster ovary (CHO cells expressing hPIRL-α but not within CHO-human nectin-1, -(CHO-hNectin-1, CHO-human HVEM (CHO-hHVEM or Vero cells. The McKrae genes encoding viral glycoproteins gB, gC, gD, gH, gL, gK and the membrane protein UL20 were sequenced and their predicted amino acid (aa sequences were compared with virulent strains F, H129, and the attenuated laboratory strain KOS. Most aa differences between McKrae and F were located at their gB amino termini known to bind with the PILRα receptor. These aa changes included a C10R change, also seen in the neurovirulent strain ANG, as well as redistribution and increase of proline residues. Comparison of gC aa sequences revealed multiple aa changes including an L132P change within the 129-247 aa region known to bind to heparan sulfate (HS receptors. Two aa changes were located within the H1 domain of gH that binds gL. Multiple aa changes were located within the McKrae gL sequence, which were preserved in the H129 isolate, but differed for the F strain. Viral glycoproteins gD and gK and the membrane protein UL20 were conserved between McKrae and F strains. Conclusions The results indicate that the observed
Huang, Shu Rong; Palmer, Peter T.
2017-01-01
This paper describes a method for determination of trihalomethanes (THMs) in drinking water via solid-phase microextraction (SPME) GC/MS as a means to develop and improve student understanding of the use of GC/MS for qualitative and quantitative analysis. In the classroom, students are introduced to SPME, GC/MS instrumentation, and the use of MS…
Ren, Bin; Wang, Tiecheng; Qu, Guangzhou; Deng, Fang; Liang, Dongli; Yang, Wenli; Liu, Meishan
2018-05-04
As a highly active photocatalyst, g-C 3 N 4 /TiO 2 heterojunction nanocomposites were in situ synthesized by simple ultrasonic mixing and calcination by using TiO 2 and melamine as precursors. The morphology and structure of the prepared photocatalysts were characterized by field emission scanning electron microscopy, transmission electron microscopy, X-ray diffraction, Fourier-transform infrared spectroscopy, UV-Vis diffuse reflectance spectroscopy, and X-ray photoelectron spectroscopy. The photocatalytic activities of g-C 3 N 4 /TiO 2 nanocomposites to degrade Orange II (AO7) under visible light irradiation were evaluated. Results showed that the photocatalytic rate of the prepared g-C 3 N 4 /TiO 2 photocatalyst to degrade AO7 was about three times than that of pristine TiO 2 and g-C 3 N 4 . The g-C 3 N 4 /TiO 2 composite with a ratio of 1:4 had the highest degradation efficiency for AO7 solution. Its degradation efficiency under acidic conditions was significantly higher than that under alkaline conditions. The enhancement of photocatalytic activity can be attributed to the formation of heterojunctions between g-C 3 N 4 and TiO 2 , which leads to rapid charge transfer and the efficient separation of photogenerated electron-hole pairs. The recycling experiment indicated that the photocatalyst of g-C 3 N 4 /TiO 2 nanocomposites still maintained good photochemical stability and recyclability after five cycles; this finding was important for its practical applications. A series of free radical trapping experiments showed that •O 2 - played a crucial role in the degradation of AO7. Graphical Abstract ᅟ.
Yang, Changwon; Kim, Eunae; Pak, Youngshang
2015-01-01
Houghton (HG) base pairing plays a central role in the DNA binding of proteins and small ligands. Probing detailed transition mechanism from Watson–Crick (WC) to HG base pair (bp) formation in duplex DNAs is of fundamental importance in terms of revealing intrinsic functions of double helical DNAs beyond their sequence determined functions. We investigated a free energy landscape of a free B-DNA with an adenosine–thymine (A–T) rich sequence to probe its conformational transition pathways from WC to HG base pairing. The free energy landscape was computed with a state-of-art two-dimensional umbrella molecular dynamics simulation at the all-atom level. The present simulation showed that in an isolated duplex DNA, the spontaneous transition from WC to HG bp takes place via multiple pathways. Notably, base flipping into the major and minor grooves was found to play an important role in forming these multiple transition pathways. This finding suggests that naked B-DNA under normal conditions has an inherent ability to form HG bps via spontaneous base opening events. PMID:26250116
LC clean-up and GC/MS analysis of polycyclic aromatic hydrocarbons in river sediment
International Nuclear Information System (INIS)
Nondek, L.; Kuzilek, M.; Krupicka, S.
1993-01-01
An LC clean-up procedure based upon a complexation between polycyclic aromatic hydrocarbons (PAHs) and silica with chemically bonded 2,4-dinitroaniline has been combined with GC/MS. The LC pre-separation makes it possible to obtain a relatively clean fraction of PAHs free from alkanes, alkylbenzenes and naphthalenes, PCBs, chlorinated pesticides and many other interfering compounds. This fraction has been analyzed using capillary GC and mass selective detector (MSD). Substantial improvement of the MS spectra of PAHs with three or more fused benzene rings is achieved. (orig.)
Amino acid analysis in biological fluids by GC-MS
Kaspar, Hannelore
2009-01-01
Amino acids are intermediates in cellular metabolism and their quantitative analysis plays an important role in disease diagnostics. A gas chromatography-mass spectrometry (GC-MS) based method was developed for the quantitative analysis of free amino acids as their propyl chloroformate derivatives in biological fluids. Derivatization with propyl chloroformate could be carried out directly in the biological samples without prior protein precipitation or solid-phase extraction of the amino acid...
Multi-pair states in electron–positron pair creation
Directory of Open Access Journals (Sweden)
Anton Wöllert
2016-09-01
Full Text Available Ultra strong electromagnetic fields can lead to spontaneous creation of single or multiple electron–positron pairs. A quantum field theoretical treatment of the pair creation process combined with numerical methods provides a description of the fermionic quantum field state, from which all observables of the multiple electron–positron pairs can be inferred. This allows to study the complex multi-particle dynamics of electron–positron pair creation in-depth, including multi-pair statistics as well as momentum distributions and spin. To illustrate the potential benefit of this approach, it is applied to the intermediate regime of pair creation between nonperturbative Schwinger pair creation and perturbative multiphoton pair creation where the creation of multi-pair states becomes nonnegligible but cascades do not yet set in. Furthermore, it is demonstrated how spin and helicity of the created electrons and positrons are affected by the polarization of the counterpropagating laser fields, which induce the creation of electron–positron pairs.
Multi-pair states in electron–positron pair creation
Energy Technology Data Exchange (ETDEWEB)
Wöllert, Anton, E-mail: woellert@mpi-hd.mpg.de; Bauke, Heiko, E-mail: heiko.bauke@mpi-hd.mpg.de; Keitel, Christoph H.
2016-09-10
Ultra strong electromagnetic fields can lead to spontaneous creation of single or multiple electron–positron pairs. A quantum field theoretical treatment of the pair creation process combined with numerical methods provides a description of the fermionic quantum field state, from which all observables of the multiple electron–positron pairs can be inferred. This allows to study the complex multi-particle dynamics of electron–positron pair creation in-depth, including multi-pair statistics as well as momentum distributions and spin. To illustrate the potential benefit of this approach, it is applied to the intermediate regime of pair creation between nonperturbative Schwinger pair creation and perturbative multiphoton pair creation where the creation of multi-pair states becomes nonnegligible but cascades do not yet set in. Furthermore, it is demonstrated how spin and helicity of the created electrons and positrons are affected by the polarization of the counterpropagating laser fields, which induce the creation of electron–positron pairs.
Multi-pair states in electron–positron pair creation
International Nuclear Information System (INIS)
Wöllert, Anton; Bauke, Heiko; Keitel, Christoph H.
2016-01-01
Ultra strong electromagnetic fields can lead to spontaneous creation of single or multiple electron–positron pairs. A quantum field theoretical treatment of the pair creation process combined with numerical methods provides a description of the fermionic quantum field state, from which all observables of the multiple electron–positron pairs can be inferred. This allows to study the complex multi-particle dynamics of electron–positron pair creation in-depth, including multi-pair statistics as well as momentum distributions and spin. To illustrate the potential benefit of this approach, it is applied to the intermediate regime of pair creation between nonperturbative Schwinger pair creation and perturbative multiphoton pair creation where the creation of multi-pair states becomes nonnegligible but cascades do not yet set in. Furthermore, it is demonstrated how spin and helicity of the created electrons and positrons are affected by the polarization of the counterpropagating laser fields, which induce the creation of electron–positron pairs.
International Nuclear Information System (INIS)
Swasey, Steven M; Gwinn, Elisabeth G
2016-01-01
The thermal and chemical fragility of DNA nanomaterials assembled by Watson–Crick (WC) pairing constrain the settings in which these materials can be used and how they can be functionalized. Here we investigate use of the silver cation, Ag + , as an agent for more robust, metal-mediated self-assembly, focusing on the simplest duplex building blocks that would be required for more elaborate Ag + –DNA nanostructures. Our studies of Ag + -induced assembly of non-complementary DNA oligomers employ strands of 2–24 bases, with varied base compositions, and use electrospray ionization mass spectrometry to determine product compositions. High yields of duplex products containing narrowly distributed numbers of Ag + can be achieved by optimizing solution conditions. These Ag + -mediated duplexes are stable to at least 60 mM Mg 2+ , higher than is necessary for WC nanotechnology schemes such as tile assemblies and DNA origami, indicating that sequential stages of Ag + -mediated and WC-mediated assembly may be feasible. Circular dichroism spectroscopy suggests simple helical structures for Ag + -mediated duplexes with lengths to at least 20 base pairs, and further indicates that the structure of cytosine-rich duplexes is preserved at high urea concentrations. We therefore propose an approach towards dynamic DNA nanomaterials with enhanced thermal and chemical stability through designs that combine sturdy silver-mediated ‘frames’ with WC paired ‘pictures’. (paper)
Directory of Open Access Journals (Sweden)
Maayan Amit
2012-05-01
Full Text Available During evolution segments of homeothermic genomes underwent a GC content increase. Our analyses reveal that two exon-intron architectures have evolved from an ancestral state of low GC content exons flanked by short introns with a lower GC content. One group underwent a GC content elevation that abolished the differential exon-intron GC content, with introns remaining short. The other group retained the overall low GC content as well as the differential exon-intron GC content, and is associated with longer introns. We show that differential exon-intron GC content regulates exon inclusion level in this group, in which disease-associated mutations often lead to exon skipping. This group's exons also display higher nucleosome occupancy compared to flanking introns and exons of the other group, thus “marking” them for spliceosomal recognition. Collectively, our results reveal that differential exon-intron GC content is a previously unidentified determinant of exon selection and argue that the two GC content architectures reflect the two mechanisms by which splicing signals are recognized: exon definition and intron definition.
Directory of Open Access Journals (Sweden)
Carroll Adam J
2010-07-01
Full Text Available Abstract Background Standardization of analytical approaches and reporting methods via community-wide collaboration can work synergistically with web-tool development to result in rapid community-driven expansion of online data repositories suitable for data mining and meta-analysis. In metabolomics, the inter-laboratory reproducibility of gas-chromatography/mass-spectrometry (GC/MS makes it an obvious target for such development. While a number of web-tools offer access to datasets and/or tools for raw data processing and statistical analysis, none of these systems are currently set up to act as a public repository by easily accepting, processing and presenting publicly submitted GC/MS metabolomics datasets for public re-analysis. Description Here, we present MetabolomeExpress, a new File Transfer Protocol (FTP server and web-tool for the online storage, processing, visualisation and statistical re-analysis of publicly submitted GC/MS metabolomics datasets. Users may search a quality-controlled database of metabolite response statistics from publicly submitted datasets by a number of parameters (eg. metabolite, species, organ/biofluid etc.. Users may also perform meta-analysis comparisons of multiple independent experiments or re-analyse public primary datasets via user-friendly tools for t-test, principal components analysis, hierarchical cluster analysis and correlation analysis. They may interact with chromatograms, mass spectra and peak detection results via an integrated raw data viewer. Researchers who register for a free account may upload (via FTP their own data to the server for online processing via a novel raw data processing pipeline. Conclusions MetabolomeExpress https://www.metabolome-express.org provides a new opportunity for the general metabolomics community to transparently present online the raw and processed GC/MS data underlying their metabolomics publications. Transparent sharing of these data will allow researchers to
International Nuclear Information System (INIS)
Spiegelberg, A.; Helde, L.; Boegl, K.W.
1991-01-01
For the detection of irradiated meat, a procedure is reported which involves high vacuum distillation of the separated fat and analysis by gas chromatography/mass spectrometry (GC/MS) of hydrocarbons. This equipment was well sulted for the method described in this report for the detection of irradiated chicken by separating the volatiles from the lipid fraction and further identification by GC/MS. The results are based on investigations of 7 types of whole frozen chicken 2 types of frozen chicken thigh, and 1 type of frozen chicken. The results demonstrate that irradiated chicken can be monitored by cold-finger high-vacuum distillation-and further GC/MS-Identification of the major hydrocarbons formed during the radiolysis of lipids. The detection of these compounds was simplified by Single Ion Monitoring. 4 figs., 20 refs
Directory of Open Access Journals (Sweden)
Praveen K. Yadav
2017-12-01
Full Text Available Alcohol is a subject of forensic research across the world. The forensic characterization of alcoholic beverages is required in cases of death and crimes due to alcohol consumption. In many cases, determining the geographic origin becomes a very important part of the investigation. Therefore, it is important to develop more sensitive methods for the analysis of alcoholic beverages. In this review, an attempt has been made to summarize the work accomplished so far in the field of analysis and detection of alcoholic beverages. In this review, various sample preparation techniques for GC-MS analysis of alcoholic beverages have been discussed along with its applications. GC-MS based analysis is less time consuming, more sensitive and more accurate. Keywords: Forensic Sciences, Alcoholic beverages, Mortality, Analysis, GC-MS
Zhang, Lei; Jaffe, Daniel A.; Gao, Xin; McClure, Crystal D.
2018-04-01
In this study, we developed a method for continuous PAN measurements by gas chromatography (GC) with a non-radioactive pulsed discharge detector (PDD). Operational parameters were optimized based on the ratio of peak height over baseline noise (P/N ratio). The GC/PDD system was compared with a traditional radioactive electron-capture detector (ECD). In the lab, the method detection limit (MDL) of the new GC/PDD method (9 pptv) was lower than the radioactive GC/ECD method (15 pptv), demonstrating its excellent potential. The MDL of GC/PDD in the field campaign at the Mt. Bachelor Observatory (MBO) was 23 pptv, higher than in the lab. This was caused in part by the decreased slope of the calibration curve resulting from the low air pressure level at MBO. However, the MDL level of GC/PDD at MBO is still low enough for accurate PAN measurements, although special attention should be paid to its application at high-elevation sites. Observations of PAN were conducted at MBO in the summer of 2016 with the GC/PDD system, and provided more evidence of the performance of the system. PAN was found to be highly correlated with CO. The promising performance of GC/PDD which does not require a radioactive source makes it a useful approach for accurate PAN measurements in the field.
Array based Discovery of Aptamer Pairs (Open Access Publisher’s Version)
2014-12-11
Array-based Discovery of Aptamer Pairs Minseon Cho,†,‡ Seung Soo Oh,‡ Jeff Nie,§ Ron Stewart,§ Monte J. Radeke,⊥ Michael Eisenstein ,†,‡ Peter J...ac504076k | Anal. Chem. 2015, 87, 821−828827 (24) Cho, M.; Oh, S. S.; Nie, J.; Stewart, R.; Eisenstein , M.; Chambers, J.; Marth, J. D.; Walker, F
2011-01-01
Background The performance of 3D-based virtual screening similarity functions is affected by the applied conformations of compounds. Therefore, the results of 3D approaches are often less robust than 2D approaches. The application of 3D methods on multiple conformer data sets normally reduces this weakness, but entails a significant computational overhead. Therefore, we developed a special conformational space encoding by means of Gaussian mixture models and a similarity function that operates on these models. The application of a model-based encoding allows an efficient comparison of the conformational space of compounds. Results Comparisons of our 4D flexible atom-pair approach with over 15 state-of-the-art 2D- and 3D-based virtual screening similarity functions on the 40 data sets of the Directory of Useful Decoys show a robust performance of our approach. Even 3D-based approaches that operate on multiple conformers yield inferior results. The 4D flexible atom-pair method achieves an averaged AUC value of 0.78 on the filtered Directory of Useful Decoys data sets. The best 2D- and 3D-based approaches of this study yield an AUC value of 0.74 and 0.72, respectively. As a result, the 4D flexible atom-pair approach achieves an average rank of 1.25 with respect to 15 other state-of-the-art similarity functions and four different evaluation metrics. Conclusions Our 4D method yields a robust performance on 40 pharmaceutically relevant targets. The conformational space encoding enables an efficient comparison of the conformational space. Therefore, the weakness of the 3D-based approaches on single conformations is circumvented. With over 100,000 similarity calculations on a single desktop CPU, the utilization of the 4D flexible atom-pair in real-world applications is feasible. PMID:21733172
Flexibility of short DNA helices with finite-length effect: From base pairs to tens of base pairs
International Nuclear Information System (INIS)
Wu, Yuan-Yan; Bao, Lei; Zhang, Xi; Tan, Zhi-Jie
2015-01-01
Flexibility of short DNA helices is important for the biological functions such as nucleosome formation and DNA-protein recognition. Recent experiments suggest that short DNAs of tens of base pairs (bps) may have apparently higher flexibility than those of kilo bps, while there is still the debate on such high flexibility. In the present work, we have studied the flexibility of short DNAs with finite-length of 5–50 bps by the all-atomistic molecular dynamics simulations and Monte Carlo simulations with the worm-like chain model. Our microscopic analyses reveal that short DNAs have apparently high flexibility which is attributed to the significantly strong bending and stretching flexibilities of ∼6 bps at each helix end. Correspondingly, the apparent persistence length l p of short DNAs increases gradually from ∼29 nm to ∼45 nm as DNA length increases from 10 to 50 bps, in accordance with the available experimental data. Our further analyses show that the short DNAs with excluding ∼6 bps at each helix end have the similar flexibility with those of kilo bps and can be described by the worm-like chain model with l p ∼ 50 nm
Analysis of poly-beta-hydroxybutyrate in environmental samples by GC-MS/MS.
Elhottová, D; Tríska, J; Petersen, S O; Santrůcková, H
2000-05-01
Application of gas chromatography-mass spectrometry (GC-MS) can significantly improve trace analyses of compounds in complex matrices from natural environments compared to gas chromatography only. A GC-MS/MS technique for determination of poly-beta-hydroxybutyrate (PHB), a bacterial storage compound, has been developed and used for analysis of two soils stored for up to 319 d, fresh samples of sewage sludge, as well as a pure culture of Bacillus megaterium. Specific derivatization of beta-hydroxybutyrate (3-OH C4:0) PHB monomer units by N-tert-butyl-dimethylsilyl-N-methyltrifluoracetamide (MTBSTFA) improved chromatographic and mass spectrometric properties of the analyte. The diagnostic fragmentation scheme of the derivates tert-butyldimethylsilyl ester and ether of beta-hydroxybutyric acid (MTBSTFA-HB) essential for the PHB identification was shown. The ion trap MS was used, therefore the scan gave the best sensitivity and with MS/MS the noise decreased, so the S/N was better and also with second fragmentation the amount of ions increased compared to SIM. The detection limit for MTBSTFA-HB by GC-MS/MS was about 10(-13) g microL(-1) of injected volume, while by GC (FID) and GC-MS (scan) it was around 10(-10) g microL(-1) of injected volume. Sensitivity of GC-MS/MS measurements of PHB in arable soil and activated sludge samples was down to 10 pg of PHB g(-1) dry matter. Comparison of MTBSTFA-HB detection in natural soil sample by GC (FID), GC-MS (scan) and by GC-MS/MS demonstrated potentials and limitations of the individual measurement techniques.
Link-based quantitative methods to identify differentially coexpressed genes and gene Pairs
Directory of Open Access Journals (Sweden)
Ye Zhi-Qiang
2011-08-01
Full Text Available Abstract Background Differential coexpression analysis (DCEA is increasingly used for investigating the global transcriptional mechanisms underlying phenotypic changes. Current DCEA methods mostly adopt a gene connectivity-based strategy to estimate differential coexpression, which is characterized by comparing the numbers of gene neighbors in different coexpression networks. Although it simplifies the calculation, this strategy mixes up the identities of different coexpression neighbors of a gene, and fails to differentiate significant differential coexpression changes from those trivial ones. Especially, the correlation-reversal is easily missed although it probably indicates remarkable biological significance. Results We developed two link-based quantitative methods, DCp and DCe, to identify differentially coexpressed genes and gene pairs (links. Bearing the uniqueness of exploiting the quantitative coexpression change of each gene pair in the coexpression networks, both methods proved to be superior to currently popular methods in simulation studies. Re-mining of a publicly available type 2 diabetes (T2D expression dataset from the perspective of differential coexpression analysis led to additional discoveries than those from differential expression analysis. Conclusions This work pointed out the critical weakness of current popular DCEA methods, and proposed two link-based DCEA algorithms that will make contribution to the development of DCEA and help extend it to a broader spectrum.
Directory of Open Access Journals (Sweden)
Jie Yu Chen
2009-08-01
Full Text Available The determination of γ-nonalactone as one of the important odor-active compounds in freshly cooked non-scented rice is reported. It was evaluated by gas chromatography-olfactometry (GC-O analysis and identified by gas chromatography-mass spectrometry (GC-MS analysis in the headspace above the freshly cooked non-scented rice samples extracted by using a modified headspace solid-phase microextraction (SPME method. This component had a mass spectrum with a characteristic ion peak at m/z 85 (100% and a linear retention index (RI of 2,023 on a DB Wax column, consistent with those of an authentic sample of γ-nonalactone. The odor characterization of a strong, sweet, coconut-like aroma of this compound was also validated by GC-O comparison with the authentic compound.
Directory of Open Access Journals (Sweden)
E Yulianto
2013-09-01
Full Text Available Background: Osteoporosis is a silent metabolic disease characterized by diminished bone mass and change in bone microstructure which cause increment of fracture risk. Until now, osteoporosis still becomes one of major health problems around the world. In Indonesia, the incidence of osteoporosisis 25%. Previous study have shown the relation between osteoporosis and IL-6 gene polymorphism at-572G>C and -174 G>C. There are some controversies about the correlation between thesepolymorphism and osteoporosis because of different result between each study. Genotype G polymorphism at -572 G>C of IL-6 gene has been correlated with lower Bone mineral density (BMD and Genotype G polymorphism at -174G>C of IL-6 gene has been correlated with higher BMD value.In Indonesia, there are still no study about the association between IL-6 gene polymorphism and osteoporosis. In the future this IL-6 gene polymorphism could be used as a genetic marker for osteoporosis in postmenopausal woman. The objective of this study is to determine the difference ofgenotype of -572G>C and -174G>C polymorphism of IL-6 gene and osteoporosis in Balinese postmenopausal women.Method: This research design is a case control study. Sample was obtained at orthopedic outpatient clinic of Sanglah General Hospital, Bali-Indonesia from June 2012 untilNovember 2012. The diagnosis of osteoporosis is described as BMD value with T score ≤ -2.5 SDusing DEXA. All sample’s peripheral blood are taken to be isolated for DNA and analyzed for IL-6 gene polymorphism at -572G>C and -174G>C using Real Time PCR. Data obtained was analyzed with chi square test using SPSS.Results: This research found 11 osteoporosis sample from total 52 with no difference sample characteristic between case and control (p > 0.05. Using Chi square test,There was a significant differences between genotype -572 G>C; IL-6 gene polymorphism in Balinese postmenopausal woman with osteoporosis and in Balinese
MURATHAN, ZEHRA TUĞBA; ZARIFIKHOSROSHAHI, MOZGAN; KAFKAS, NESİBE EBRU
2016-01-01
In this study, we aimed to compare fatty acid and volatile compound compositions of four rosehip species, namely Rosa pimpinellifolia, R. Villosa, R. Canina, and R. Dumalis, by gas chromatography with flame ionization detector (GC/FID) and headspace and immersion solid-phase microextraction gas chromatography-mass spectrometry (HS-SPME/GC-MS and Im-SPME/GC-MS) techniques. The total lipid contents in fruits of the rosehip species varied from 5.83% (R. Villosa) to 7.84% (R. Dumalis). A total of...
International Nuclear Information System (INIS)
Yang, Xiaoxia; Ji, Xiaoqing; Shi, Chunhuan; Liu, Jing; Wang, Haiyang; Luan, Yuxia
2014-01-01
The amantadine drug and oleic acid surfactant are used to form amantadine-based ion pair amphiphiles based on proton transfer reaction between the drug and the surfactant molecules. The ion pair amphiphiles are characterized by 1 H-nuclear magnetic resonance, Fourier transform infrared spectroscopy, and X-ray diffraction. Self-assembly properties of amantadine-based ion pair amphiphiles are studied by surface tension determination, transmission electron microscopy, zeta potential, and dynamic light scattering. The aggregation behavior studies indicate that the as-prepared ion pair amphiphiles can self-assemble into vesicles with the size of 200–300 nm in aqueous solution. The drug release results show that the amantadine release rate could be well controlled by incorporating the amantadine-based ion pair vesicles in poly (lactic-co-glycolic acid)-poly (ethylene glycol)-poly (lactic-co-glycolic acid) (PLGA–PEG–PLGA) copolymer hydrogel. The drug release from the AT–OA vesicle-loaded PLGA–PEG–PLGA hydrogel is significantly inhibited in comparison with the AT-loaded PLGA–PEG–PLGA hydrogel. The present work thus demonstrates that the vesicle-loaded hydrogel is a good candidate for the drug delivery system with long-term controlled drug release behavior
Watson-Crick Base Pair Radical Cation as a Model for Oxidative Damage in DNA.
Feketeová, Linda; Chan, Bun; Khairallah, George N; Steinmetz, Vincent; Maitre, Philippe; Radom, Leo; O'Hair, Richard A J
2017-07-06
The deleterious cellular effects of ionizing radiation are well-known, but the mechanisms causing DNA damage are poorly understood. The accepted molecular events involve initial oxidation and deprotonation at guanine sites, triggering hydrogen atom abstraction reactions from the sugar moieties, causing DNA strand breaks. Probing the chemistry of the initially formed radical cation has been challenging. Here, we generate, spectroscopically characterize, and examine the reactivity of the Watson-Crick nucleobase pair radical cation in the gas phase. We observe rich chemistry, including proton transfer between the bases and propagation of the radical site in deoxyguanosine from the base to the sugar, thus rupturing the sugar. This first example of a gas-phase model system providing molecular-level details on the chemistry of an ionized DNA base pair paves the way toward a more complete understanding of molecular processes induced by radiation. It also highlights the role of radical propagation in chemistry, biology, and nanotechnology.
Kondo, Jiro; Yamada, Tom; Hirose, Chika; Okamoto, Itaru; Tanaka, Yoshiyuki; Ono, Akira
2014-02-24
The metallo DNA duplex containing mercury-mediated T-T base pairs is an attractive biomacromolecular nanomaterial which can be applied to nanodevices such as ion sensors. Reported herein is the first crystal structure of a B-form DNA duplex containing two consecutive T-Hg(II)-T base pairs. The Hg(II) ion occupies the center between two T residues. The N3-Hg(II) bond distance is 2.0 Å. The relatively short Hg(II)-Hg(II) distance (3.3 Å) observed in consecutive T-Hg(II)-T base pairs suggests that the metallophilic attraction could exist between them and may stabilize the B-form double helix. To support this, the DNA duplex is largely distorted and adopts an unusual nonhelical conformation in the absence of Hg(II). The structure of the metallo DNA duplex itself and the Hg(II)-induced structural switching from the nonhelical form to the B-form provide the basis for structure-based design of metal-conjugated nucleic acid nanomaterials. Copyright © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Chawla, Mohit; Credendino, Raffaele; Chermak, Edrisse; Oliva, Romina; Cavallo, Luigi
2016-01-01
:C base pair, has been introduced in DNA molecules for expanding the genetic code. Our results indicate that the Z:P base pair closely mimics the G:C base pair both in terms of structure and stability. To clarify the role of the NO2 group on the C5
Wang, Biao; Kuang, Anlong; Luo, Xukai; Wang, Guangzhao; Yuan, Hongkuan; Chen, Hong
2018-05-01
Two-dimensional (2D) gallium sulfide (GaS), hexagonal boron nitride (h-BN) and graphitic carbon nitride (g-C3N4) have been fabricated and expected to be promising photocatalysts under ultraviolet irradiation. Here, we employ hybrid density functional calculations to explore the potential of the 2D GaS-based heterojunctions GaS/h-BN (g-C3N4) for the design of efficient water redox photocatalysts. Both heterostructures can be formed via van der Waals (vdW) interaction and are direct bandgap semiconductors, whose bandgaps are reduced comparing with isolated GaS, h-BN or g-C3N4 monolayers and whose bandedges straddle water redox potentials. Furthermore, the optical absorption of GaS/h-BN (g-C3N4) heterostructures is observably enhanced in the ultraviolet-visible (UV-vis) light range. The electron-hole pairs in GaS/h-BN (g-C3N4) heterostructures are completely separated from different layers. In addition, the in-plane biaxial strain can effectively modulate the electronic properties of GaS/h-BN (g-C3N4) heterostructures. Thus the GaS/h-BN (g-C3N4) heterostructures are anticipated to be promising candidates for photocatalytic water splitting to produce hydrogen.
de Albuquerque Cavalcanti, Gustavo; Rodrigues, Lucas Martins; Dos Santos, Leonardo; Zheng, Xin; Gujar, Amit; Cole, Jason; Padilha, Monica Costa; de Aquino Neto, Francisco Radler
2018-03-01
This is a first look at a non-targeted screening method based on Orbitrap gas chromatography-mass spectrometry (GC-MS) technology for a large number of banned compounds in sports found in urine, including exogenous anabolic steroids, β-agonists, narcotics, stimulants, hormone modulators, and diuretics. A simple sample preparation was processed in four steps: an enzymatic hydrolysis, liquid-liquid extraction, evaporation, and trimethylsilylation. All compounds were able to meet the World Anti-Doping Agency's sensitivity criteria with mass accuracies less than 1 ppm and with sufficient points across the peak by running the Orbitrap GC-MS in full-scan mode. In addition, we discuss our initial findings of using a full-scan selected ion monitoring-tandem mass spectrometry (SIM-MS/MS) approach as a way to obtain lower detection limits and reach desirable selectivity for some exogenous anabolic steroids. Copyright © 2017 John Wiley & Sons, Ltd.
GC-MS-Based Endometabolome Analysis Differentiates Prostate Cancer from Normal Prostate Cells
Directory of Open Access Journals (Sweden)
Ana Rita Lima
2018-03-01
Full Text Available Prostate cancer (PCa is an important health problem worldwide. Diagnosis and management of PCa is very complex because the detection of serum prostate specific antigen (PSA has several drawbacks. Metabolomics brings promise for cancer biomarker discovery and for better understanding PCa biochemistry. In this study, a gas chromatography–mass spectrometry (GC-MS based metabolomic profiling of PCa cell lines was performed. The cell lines include 22RV1 and LNCaP from PCa with androgen receptor (AR expression, DU145 and PC3 (which lack AR expression, and one normal prostate cell line (PNT2. Regarding the metastatic potential, PC3 is from an adenocarcinoma grade IV with high metastatic potential, DU145 has a moderate metastatic potential, and LNCaP has a low metastatic potential. Using multivariate analysis, alterations in levels of several intracellular metabolites were detected, disclosing the capability of the endometabolome to discriminate all PCa cell lines from the normal prostate cell line. Discriminant metabolites included amino acids, fatty acids, steroids, and sugars. Six stood out for the separation of all the studied PCa cell lines from the normal prostate cell line: ethanolamine, lactic acid, β-Alanine, L-valine, L-leucine, and L-tyrosine.
Yang, Changwon; Kim, Eunae; Pak, Youngshang
2015-09-18
Houghton (HG) base pairing plays a central role in the DNA binding of proteins and small ligands. Probing detailed transition mechanism from Watson-Crick (WC) to HG base pair (bp) formation in duplex DNAs is of fundamental importance in terms of revealing intrinsic functions of double helical DNAs beyond their sequence determined functions. We investigated a free energy landscape of a free B-DNA with an adenosine-thymine (A-T) rich sequence to probe its conformational transition pathways from WC to HG base pairing. The free energy landscape was computed with a state-of-art two-dimensional umbrella molecular dynamics simulation at the all-atom level. The present simulation showed that in an isolated duplex DNA, the spontaneous transition from WC to HG bp takes place via multiple pathways. Notably, base flipping into the major and minor grooves was found to play an important role in forming these multiple transition pathways. This finding suggests that naked B-DNA under normal conditions has an inherent ability to form HG bps via spontaneous base opening events. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.
Determination of the pairing-strength constants in the isovector plus isoscalar pairing case
Mokhtari, D.; Fellah, M.; Allal, N. H.
2016-05-01
A method for the determination of the pairing-strength constants, in the neutron-proton (n-p) isovector plus isoscalar pairing case, is proposed in the framework of the BCS theory. It is based on the fitting of these constants to reproduce the experimentally known pairing gap parameters as well as the root-mean-squared (r.m.s) charge radii values. The method is applied to some proton-rich even-even nuclei. The single-particle energies used are those of a deformed Woods-Saxon mean field. It is shown that the obtained value of the ratio GnpT=0/G npT=1 is of the same order as the ones, arbitrary chosen, of some previous works. The effect of the inclusion of the isoscalar n-p pairing in the r.m.s matter radii is then numerically studied for the same nuclei.
International Nuclear Information System (INIS)
Mahapatro, Ajit K; Jeong, Kyung J; Lee, Gil U; Janes, David B
2007-01-01
This paper presents a study of sequence specific electronic conduction through short (15-base-pair) double-stranded (ds) DNA molecules, measured by immobilizing 3 ' -thiol-derivatized DNAs in nanometre scale gaps between gold electrodes. The polycation spermidine was used to stabilize the ds-DNA structure, allowing electrical measurements to be performed in a dry state. For specific sequences, the conductivity was observed to scale with the surface density of immobilized DNA, which can be controlled by the buffer concentration. A series of 15-base DNA oligonucleotide pairs, in which the centre sequence of five base pairs was changed from G:C to A:T pairs, has been studied. The conductivity per molecule is observed to decrease exponentially with the number of adjacent A:T pairs replacing G:C pairs, consistent with a barrier at the A:T sites. Conductance-based devices for short DNA sequences could provide sensing approaches with direct electrical readout, as well as label-free detection
International Nuclear Information System (INIS)
Plassmeyer, Matthew L.; Soldan, Samantha S.; Stachelek, Karen M.; Martin-Garcia, Julio; Gonzalez-Scarano, Francisco
2005-01-01
Members of the California serogroup of orthobunyaviruses, particularly La Crosse (LAC) and Tahyna (TAH) viruses, are significant human pathogens in areas where their mosquito vectors are endemic. Previous studies using wild-type LAC and TAH181/57, a highly neurovirulent strain with low neuroinvasiveness (Janssen, R., Gonzalez-Scarano, F., Nathanson, N., 1984. Mechanisms of bunyavirus virulence. Comparative pathogenesis of a virulent strain of La Crosse and an avirulent strain of Tahyna virus. Lab. Invest. 50 (4), 447-455), have demonstrated that the neuroinvasive phenotype maps to the M segment, the segment that encodes the two viral glycoproteins GN (G2) and GC (G1), as well as a non-structural protein NSm. To further define the role of GN and GC in fusion and entry, we prepared a panel of recombinant M segment constructs using LAC, TAH181/57, and V22F, a monoclonal-resistant variant of LAC with deficient fusion function. These M segment constructs were then tested in two surrogate assays for virus entry: a cell-to-cell fusion assay based on T7-luciferase expression, and a pseudotype transduction assay based on the incorporation of the bunyavirus glycoproteins on an MLV backbone. Both assays demonstrated that GC is the principal determinant of virus fusion and cell entry, and furthermore that the region delineated by amino acids 860-1442, corresponding to the membrane proximal two-thirds of GC, is key to these processes. These results, coupled with structural modeling suggesting homologies between the carboxy region of GC and Sindbis virus E1, suggest that the LAC GC functions as a type II fusion protein
Directory of Open Access Journals (Sweden)
Liu S
2014-12-01
Full Text Available Among the more than 5000 chemicals reported in cigarette smoke condensate (CSC, heterocyclic aromatic amines (HAAs are considered to be a contributor to observed biological activity. HAAs are non-volatile and are reported at ppb levels in CSC. A new method for HAA analysis at the trace level is reported here. N, O-Bis(trimethylsilyl trifluoroacetamide (BSTFA containing 1% trimethylchlorosilane was employed to derivatize amino groups by heating the reagent containing a sample of CSC at 80 °C for 30 min followed by analysis employing gas chromatography-mass spectroscopy (GC-MS in the selected-ion-monitoring (SIM mode. This derivatization method afforded symmetrical peak shapes on a ZB-50 stationary phase and achieved instrumental limits of quantification (LOQ at 10:1 S/N from -1 ng/mL for AαC to120 ng/mL for Glu-P-1. The chemical identity of each derivative was confirmed by comparison of retention time and mass spectra of standards. The latter were characterized by the following ions: M·+ or [M-1]+, [M-15]+, and m/z 73 (i.e., trimethylsilyl. CSC and its base sub-fractions were studied using the GC-MS method. Ten HAAs were screened and five were quantified in cigarette smoke condensate, while 2-5 HAAs were quantified in each of three base sub-fractions. Values obtained with the new procedure agree well with values reported in the literature and with results obtained from a commercial laboratory via a different analytical method. The potential contribution of each HAA to the overall mutagenic activity observed for CSC and its base fractions is discussed. When considered together, HAAs account for only a small portion (-7.8% of the observed mutagenicity of the CSC.
GC ‘Multi-Analyte’ Detection Method
Energy Technology Data Exchange (ETDEWEB)
Dudar, E. [Plant Protection & Soil Conservation Service of Budapest, Budapest (Hungary)
2009-07-15
Elaborated methodologies for GC multi-analyte detection are presented, comprising the steps of method development, chromatographic conditions and procedures including the determination of relative retention times and summary results tables. (author)
International Nuclear Information System (INIS)
Lee, K.M.; Marshall, A.G.
1987-01-01
Base-pair sequences for 5S and 5.8S RNAs are not readily extracted from proton homonuclear nuclear Overhauser enhancement (NOE) connectivity experiments alone, due to extensive peak overlap in the downfield (11-15 ppm) proton NMR spectrum. In this paper, we introduce a new method for base-pair proton peak assignment for ribosomal RNAs, based upon the distance-dependent broadening of the resonances of base-pair protons spatially proximal to a paramagnetic group. Introduction of a nitroxide spin-label covalently attached to the 3'-terminal ribose provides an unequivocal starting point for base-pair hydrogen-bond proton NMR assignment. Subsequent NOE connectivities then establish the base-pair sequence for the terminal stem of a 5S RNA. Periodate oxidation of yeast 5S RNA, followed by reaction with 4-amino-2,2,6,6-tetramethylpiperidinyl-1-oxy (TEMPO-NH2) and sodium borohydride reduction, produces yeast 5S RNA specifically labeled with a paramagnetic nitroxide group at the 3'-terminal ribose. Comparison of the 500-MHz 1H NMR spectra of native and 3'-terminal spin-labeled yeast 5S RNA serves to identify the terminal base pair (G1 . C120) and its adjacent base pair (G2 . U119) on the basis of their proximity to the 3'-terminal spin-label. From that starting point, we have then identified (G . C, A . U, or G . U) and sequenced eight of the nine base pairs in the terminal helix via primary and secondary NOE's
Gao, Qian; Wang, Hui-Li; Zhang, Li-Fu; Hu, Shuang-Lin; Hu, Zhen-Peng
2018-06-01
In this study, based on the first-principles calculations, we systematically investigated the electronic and magnetic properties of the transition metal-oxide-incorporated 2D g-C3N4 nanosheet (labeled C3N4-TM-O, TM = Sc-Mn). The results suggest that the TM-O binds to g-C3N4 nanosheets strongly for all systems. We found that the 2D C3N4-TM-O framework is ferromagnetic for TM = Sc, Ti, V, Cr, while it is antiferromagnetic for TM = Mn. All the ferromagnetic systems exhibit the half-metallic property. Furthermore, Monte Carlo simulations based on the Heisenberg model suggest that the Curie temperatures ( T c ) of the C3N4-TM-O (TM = Sc, Ti, V, Cr) framework are 169 K, 68 K, 203 K, and 190 K, respectively. Based on Bader charge analysis, we found that the origin of the half-metallicity at Fermi energy can be partially attributed to the transfer of electrons from TM atoms to the g-C3N4 nanosheet. In addition, we found that not only electrons but also holes can induce half-metallicity for 2D g-C3N4 nanosheets, which may help to understand the origin of half-metallicity for graphitic carbon nitride.
Survivin -31 G/C polymorphism might contribute to colorectal cancer (CRC) risk: a meta-analysis.
Yao, Linhua; Hu, Yi; Deng, Zhongmin; Li, Jingjing
2015-01-01
Published data has shown inconsistent findings about the association of survivin -31 G/C polymorphism with the risk of colorectal cancer (CRC). This meta-analysis quantitatively assesses the results from published studies to provide a more precise estimate of the association between survivin -31 G/C polymorphism as a possible predictor of the risk of CRC. We conducted a literature search in the PubMed, Web of Science, and Cochrane Library databases. Stata 12 software was used to calculate the pooled odds ratios (ORs) with 95% confidence intervals (CIs) based on the available data from each article. Six studies including 1840 cases with CRC and 1804 controls were included in this study. Survivin -31 G/C polymorphism was associated with a significantly increased risk of CRC (OR = 1.78; 95% CI, 1.53-2.07; I(2) = 0%). In the race subgroup analysis, both Asians (OR = 1.72; 95% CI, 1.44-2.05; I(2) = 0%) and Caucasians (OR = 1.93; 95% CI, 1.46-2.55; I(2) = 0%) with survivin -31 G/C polymorphism had increased CRC risk. In the subgroup analysis according to site of CRC, survivin -31 G/C polymorphism was not associated with colon cancer risk (OR = 2.02; 95% CI, 0.79-5.22; I(2) = 82%). However, this polymorphism was significantly associated with rectum cancer risk (OR = 1.98; 95% CI, 1.42-2.74; I(2) = 0%). In the subgroup analysis by clinical stage, both early stage (I+II) and advanced stage (III+IV) were associated with survivin -31 G/C polymorphism (OR = 1.61; 95% CI, 1.20-2.16; I(2) = 0% and OR = 2.30; 95% CI, 1.70-3.13; I(2) = 0%, respectively). In the subgroup analysis by smoke status, both smokers and non-smokers with survivin -31 G/C polymorphism showed increased CRC risk (OR = 1.47; 95% CI, 1.01-2.13; I(2) = 60% and OR = 1.71; 95% CI, 1.28-2.30; I(2) = 0%, respectively). In the subgroup analysis by drink status, both drinkers and non-drinkers with survivin -31 G/C polymorphism showed increased CRC risk (OR = 1.58; 95% CI, 1.06-2.37; I(2) = 8% and OR = 1.61; 95% CI, 1
Gas chromatography coupled to atmospheric pressure ionization mass spectrometry (GC-API-MS): review.
Li, Du-Xin; Gan, Lin; Bronja, Amela; Schmitz, Oliver J
2015-09-03
Although the coupling of GC/MS with atmospheric pressure ionization (API) has been reported in 1970s, the interest in coupling GC with atmospheric pressure ion source was expanded in the last decade. The demand of a "soft" ion source for preserving highly diagnostic molecular ion is desirable, as compared to the "hard" ionization technique such as electron ionization (EI) in traditional GC/MS, which fragments the molecule in an extensive way. These API sources include atmospheric pressure chemical ionization (APCI), atmospheric pressure photoionization (APPI), atmospheric pressure laser ionization (APLI), electrospray ionization (ESI) and low temperature plasma (LTP). This review discusses the advantages and drawbacks of this analytical platform. After an introduction in atmospheric pressure ionization the review gives an overview about the history and explains the mechanisms of various atmospheric pressure ionization techniques used in combination with GC such as APCI, APPI, APLI, ESI and LTP. Also new developments made in ion source geometry, ion source miniaturization and multipurpose ion source constructions are discussed and a comparison between GC-FID, GC-EI-MS and GC-API-MS shows the advantages and drawbacks of these techniques. The review ends with an overview of applications realized with GC-API-MS. Copyright © 2015. Published by Elsevier B.V.
Gupta, Ashutosh; Jaeger, Heather M; Compaan, Katherine R; Schaefer, Henry F
2012-05-17
The guanine-cytosine (GC) radical anion and its interaction with a single water molecule is studied using ab initio and density functional methods. Z-averaged second-order perturbation theory (ZAPT2) was applied to GC radical anion for the first time. Predicted spin densities show that the radical character is localized on cytosine. The Watson-Crick monohydrated GC anion is compared to neutral GC·H2O, as well as to the proton-transferred analogue on the basis of structural and energetic properties. In all three systems, local minima are identified that correspond to water positioned in the major and minor grooves of macromolecular DNA. On the anionic surface, two novel structures have water positioned above or below the GC plane. On the neutral and anionic surfaces, the global minimum can be described as water interacting with the minor groove. These structures are predicted to have hydration energies of 9.7 and 11.8 kcal mol(-1), respectively. Upon interbase proton-transfer (PT), the anionic global minimum has water positioned in the major groove, and the hydration energy increases to 13.4 kcal mol(-1). PT GC·H2O(•-) has distonic character; the radical character resides on cytosine, while the negative charge is localized on guanine. The effects of proton transfer are further investigated through the computed adiabatic electron affinities (AEA) of GC and monohydrated GC, and the vertical detachment energies (VDE) of the corresponding anions. Monohydration increases the AEAs and VDEs by only 0.1 eV, while proton-transfer increases the VDEs substantially (0.8 eV). The molecular charge distribution of monohydrated guanine-cytosine radical anion depends heavily on interbase proton transfer.
Directory of Open Access Journals (Sweden)
Tiekun Jia
2017-08-01
Full Text Available A novel ultrathin g-C3N4 nanosheet-modified BiOCl hierarchical flower-like plate heterostructure (abbreviated as BC/CN was constructed via a thermal polymerization of urea precursor followed with hydrolysis route. The as-prepared samples were well characterized by various analytical techniques. The morphological observation showed that hierarchical flower-like BiOCl nanoplates were discretely anchored on the surface of ultra-thin C3N4 nanosheets. The photocatalytic performance of the as-prepared photocatalysts was evaluated by degradation of methylene blue (MB under visible-light irradiation. The results showed that BC/CN photocatalyst exhibited enhanced photostability and photocatalytic performance in the degradation process. On the basis of experimental results and the analysis of band energy structure, it could be inferred that the enhanced photocatalytic performance of BC/CN photocatalyst was intimately related with the hybridization of hierarchical flower-like BiOCl nanoplates with ultrathin g-C3N4 nanosheets, which provided good adsorptive capacity, extended light absorption, suppressed the recombination of photo-generated electron–hole pairs, and facilitated charge transfer efficiently.
The aim of this work is to develop group-contribution+ (GC+) method (combined group-contribution (GC) method and atom connectivity index (CI) method) based property models to provide reliable estimations of environment-related properties of organic chemicals together with uncert...
Determination of Porosity in Shale by Double Headspace Extraction GC Analysis.
Zhang, Chun-Yun; Li, Teng-Fei; Chai, Xin-Sheng; Xiao, Xian-Ming; Barnes, Donald
2015-11-03
This paper reports on a novel method for the rapid determination of the shale porosity by double headspace extraction gas chromatography (DHE-GC). Ground core samples of shale were placed into headspace vials and DHE-GC measurements of released methane gas were performed at a given time interval. A linear correlation between shale porosity and the ratio of consecutive GC signals was established both theoretically and experimentally by comparing with the results from the standard helium pycnometry method. The results showed that (a) the porosity of ground core samples of shale can be measured within 30 min; (b) the new method is not significantly affected by particle size of the sample; (c) the uncertainties of measured porosities of nine shale samples by the present method range from 0.31 to 0.46 p.u.; and (d) the results obtained by the DHE-GC method are in a good agreement with those from the standard helium pycnometry method. In short, the new DHE-GC method is simple, rapid, and accurate, making it a valuable tool for shale gas-related research and applications.
Laser assisted ratio analysis - An alternative to GC/IRMS for CO2
International Nuclear Information System (INIS)
Murnick, D.E.
2001-01-01
A new technique for laser based analysis of carbon isotope ratios, with the acronym LARA, based on large isotope shifts in molecular spectra, the use of fixed frequency isotopic lasers, and sensitive detection via the laser optogalvanic effect is reviewed and compared with GC/IRMS for carbon dioxide in specific applications. The possibility for development of new classes of isotope ratio measurement systems with LARA is explored. (author)
Thanh, L.; Dung, N.X.; Bighelli, A.; Casanova, J.; Leclercq, P.A.
1997-01-01
The essential oil from the rhizomes of Piper betle L. (betel), collected around Hue, was obtained in 0.20% yield. The oil was examined by a combination of capillary GC and GC/MS. 13C-NMR studies confirmed the structure assignments proposed by retention data and mass spectra of the components with a
Opoku, Francis; Govender, Krishna Kuben; Sittert, Cornelia Gertina Catharina Elizabeth van; Govender, Penny Poomani
2018-01-01
Graphite-like carbon nitride (g-C3N4)-based heterostructures have received much attention due to their prominent photocatalytic activity. The g-C3N4/Bi2WO6 and g-C3N4/Bi2MoO6 heterostructures, which follow a typical hetero-junction charge transfer mechanisms show a weak potential for hydrogen evolution and reactive radical generation under visible light irradiation. A mediator-free Z-scheme g-C3N4/Bi2MoO6(010) and g-C3N4/Bi2WO6(010) heterostructures photocatalyst are designed for the first time using first-principles studies. Moreover, theoretical understanding of the underlying mechanism, the effects of interfacial composition and the role the interface play in the overall photoactivity is still unexplained. The calculated band gap of the heterostructures is reduced compared to the bulk Bi2WO6 and Bi2MoO6. In this study, we systematically calculated energy band structure, optical properties and charge transfer of the g-C3N4/Bi2MoO6(010) and g-C3N4/Bi2WO6(010) heterostructures using the hybrid density functional theory approach. The results show that the charge transfer at the interface of the heterostructures induces a built-in potential, which benefits the separation of photogenerated charge carriers. The g-C3N4/Bi2MoO6(010) heterostructure with more negative adhesion energy (-1.10 eVA-2) is predicted to have a better adsorptive ability and can form more easily compared to the g-C3N4/Bi2WO6(010) interface (-1.16 eVA-2). Therefore, our results show that the g-C3N4 interaction with Bi2MoO6 is stronger than Bi2WO6, which is also verified by the smaller vertical separation (3.25 Å) between Bi2MoO6 and g-C3N4 compared to the g-C3N4/Bi2WO6(010) interface (3.36 Å). The optical absorption verifies that these proposed Z-scheme heterostructures are excellent visible light harvesting semiconductor photocatalyst materials. This enhancement is ascribed to the role of g-C3N4 monolayer as an electron acceptor and the direct Z-scheme charge carrier transfer at the interface of
Modeling compositional dynamics based on GC and purine contents of protein-coding sequences
Zhang, Zhang
2010-11-08
Background: Understanding the compositional dynamics of genomes and their coding sequences is of great significance in gaining clues into molecular evolution and a large number of publically-available genome sequences have allowed us to quantitatively predict deviations of empirical data from their theoretical counterparts. However, the quantification of theoretical compositional variations for a wide diversity of genomes remains a major challenge.Results: To model the compositional dynamics of protein-coding sequences, we propose two simple models that take into account both mutation and selection effects, which act differently at the three codon positions, and use both GC and purine contents as compositional parameters. The two models concern the theoretical composition of nucleotides, codons, and amino acids, with no prerequisite of homologous sequences or their alignments. We evaluated the two models by quantifying theoretical compositions of a large collection of protein-coding sequences (including 46 of Archaea, 686 of Bacteria, and 826 of Eukarya), yielding consistent theoretical compositions across all the collected sequences.Conclusions: We show that the compositions of nucleotides, codons, and amino acids are largely determined by both GC and purine contents and suggest that deviations of the observed from the expected compositions may reflect compositional signatures that arise from a complex interplay between mutation and selection via DNA replication and repair mechanisms.Reviewers: This article was reviewed by Zhaolei Zhang (nominated by Mark Gerstein), Guruprasad Ananda (nominated by Kateryna Makova), and Daniel Haft. 2010 Zhang and Yu; licensee BioMed Central Ltd.
Modeling compositional dynamics based on GC and purine contents of protein-coding sequences
Zhang, Zhang; Yu, Jun
2010-01-01
Background: Understanding the compositional dynamics of genomes and their coding sequences is of great significance in gaining clues into molecular evolution and a large number of publically-available genome sequences have allowed us to quantitatively predict deviations of empirical data from their theoretical counterparts. However, the quantification of theoretical compositional variations for a wide diversity of genomes remains a major challenge.Results: To model the compositional dynamics of protein-coding sequences, we propose two simple models that take into account both mutation and selection effects, which act differently at the three codon positions, and use both GC and purine contents as compositional parameters. The two models concern the theoretical composition of nucleotides, codons, and amino acids, with no prerequisite of homologous sequences or their alignments. We evaluated the two models by quantifying theoretical compositions of a large collection of protein-coding sequences (including 46 of Archaea, 686 of Bacteria, and 826 of Eukarya), yielding consistent theoretical compositions across all the collected sequences.Conclusions: We show that the compositions of nucleotides, codons, and amino acids are largely determined by both GC and purine contents and suggest that deviations of the observed from the expected compositions may reflect compositional signatures that arise from a complex interplay between mutation and selection via DNA replication and repair mechanisms.Reviewers: This article was reviewed by Zhaolei Zhang (nominated by Mark Gerstein), Guruprasad Ananda (nominated by Kateryna Makova), and Daniel Haft. 2010 Zhang and Yu; licensee BioMed Central Ltd.
Towards comprehensive hydrocarbons analysis of middle distillates by LC-GCxGC.
Adam, Frédérick; Bertoncini, Fabrice; Thiébaut, Didier; Esnault, Sébastien; Espinat, Didier; Hennion, M C
2007-01-01
The detailed characterization of middle distillates is essential for a better understanding of reactions involved in refining processes. Owing to a higher resolution power and an enhanced sensitivity, but especially to a group-type ordering in the chromatographic plane, comprehensive two-dimensional gas chromatography (GCxGC) offers unsurpassed characterization possibilities for petroleum samples. However, GCxGC fails to totally discriminate naphthenes from unsaturates occurring in hydrotreated diesel samples. This article aims at promoting the implementation of LC-GCxGC for the quantitative determination of hydrocarbon distribution in middle distillates, including naphthenes. In this configuration, liquid chromatography (LC) enables the separation of hydrocarbons into two fractions (viz., saturated and unsaturated) before the subsequent analysis of each fraction by GCxGC. In this paper, the choice of GCxGC conditions in order to achieve the separation and identification of hydrocarbons by chemical class is discussed; under these conditions, naphthenes are separated according to the number of saturated rings. For the first time, the presence of di-, tri-, and tetra-naphthenes resulting from the hydroconversion of aromatics can clearly be evidenced. A quantitative procedure for the determination of the distribution of hydrocarbons, including the distribution of naphthenes according to the number of saturated rings, is also proposed and discussed in detail. LC-GCxGC is found to provide an unequalled degree of information that will widely contribute to a better understanding of hydroconversion processes.
Investigations into nuclear pairing
International Nuclear Information System (INIS)
Clark, R.M.
2006-01-01
This paper is divided in two main sections focusing on different aspects of collective nuclear behavior. In the first section, solutions are considered for the collective pairing Hamiltonian. In particular, an approximate solution at the critical point of the pairing transition from harmonic vibration (normal nuclear behavior) to deformed rotation (superconducting behavior) in gauge space is found by analytic solution of the Hamiltonian. The eigenvalues are expressed in terms of the zeros of Bessel functions of integer order. The results are compared to the pairing bands based on the Pb isotopes. The second section focuses on the experimental search for the Giant Pairing Vibration (GPV) in nuclei. After briefly describing the origin of the GPV, and the reasons that the state has remained unidentified, a novel idea for populating this state is presented. A recent experiment has been performed using the LIBERACE+STARS detector system at the 88-Inch Cyclotron of LBNL to test the idea. (Author)
A simple model for the influence of meiotic conversion tracts on GC content.
Directory of Open Access Journals (Sweden)
Marie-Claude Marsolier-Kergoat
Full Text Available A strong correlation between GC content and recombination rate is observed in many eukaryotes, which is thought to be due to conversion events linked to the repair of meiotic double-strand breaks. In several organisms, the length of conversion tracts has been shown to decrease exponentially with increasing distance from the sites of meiotic double-strand breaks. I show here that this behavior leads to a simple analytical model for the evolution and the equilibrium state of the GC content of sequences devoid of meiotic double-strand break sites. In the yeast Saccharomyces cerevisiae, meiotic double-strand breaks are practically excluded from protein-coding sequences. A good fit was observed between the predictions of the model and the variations of the average GC content of the third codon position (GC3 of S. cerevisiae genes. Moreover, recombination parameters that can be extracted by fitting the data to the model coincide with experimentally determined values. These results thus indicate that meiotic recombination plays an important part in determining the fluctuations of GC content in yeast coding sequences. The model also accounted for the different patterns of GC variations observed in the genes of Candida species that exhibit a variety of sexual lifestyles, and hence a wide range of meiotic recombination rates. Finally, the variations of the average GC3 content of human and chicken coding sequences could also be fitted by the model. These results suggest the existence of a widespread pattern of GC variation in eukaryotic genes due to meiotic recombination, which would imply the generality of two features of meiotic recombination: its association with GC-biased gene conversion and the quasi-exclusion of meiotic double-strand breaks from coding sequences. Moreover, the model points out to specific constraints on protein fragments encoded by exon terminal sequences, which are the most affected by the GC bias.
Validation of rapid dioxin screening by GC-FID in fish products
Energy Technology Data Exchange (ETDEWEB)
Bassompierre, M.; Munck, L.; Bro, R.; Tomasi, G.; Engelsen, S.B. [Royal Veterinary and Agricultural Univ., Copenhagen (Denmark). Food Technology, Institute of Food Science, Centre for Advanced Food Studies
2004-09-15
A novel, cost- and time-effective dioxin screening method was developed and validated for fish product. The method is based on multivariate covariance between fatty acid composition monitored by GC-FID and dioxin content as teq WHO pg/ g fat. A dioxin range varying from 1.1 to 47.1 pg TEQ-WHO/ g fat using 65 fish meal samples was accessible for model calibration. An optimal multivariate dioxin prediction model was developed based on automatic peak integration, thereby enabling extraction of the area of 140 peaks from the gas chromatogramms. Models were produced employing partial least squares regression (PLS) based upon the duplicate GC-FID run and 46 specific peaks, selected after variable selection from the 140 investigated. The best results were yielded by local pls modelling employing three latent variables based upon the 12 nearest neighbors. For each prediction sample, the neighbors, yielding the 12 smallest sum of squares of differences to the test sample using the 140 peaks, were extracted from the whole calibration set and a local model built using these 12 chromatograms and related dioxin content. Prediction performance was thereafter validated for 10 fully independent samples. The performance of this model, yielded a correlation of 0.85 (r{sup 2}) and a root mean square error of prediction of 2.3 pg PCDD/F TEQWHO/ g fat.
Directory of Open Access Journals (Sweden)
John P McCutcheon
2009-07-01
Full Text Available The genetic code relates nucleotide sequence to amino acid sequence and is shared across all organisms, with the rare exceptions of lineages in which one or a few codons have acquired novel assignments. Recoding of UGA from stop to tryptophan has evolved independently in certain reduced bacterial genomes, including those of the mycoplasmas and some mitochondria. Small genomes typically exhibit low guanine plus cytosine (GC content, and this bias in base composition has been proposed to drive UGA Stop to Tryptophan (Stop-->Trp recoding. Using a combination of genome sequencing and high-throughput proteomics, we show that an alpha-Proteobacterial symbiont of cicadas has the unprecedented combination of an extremely small genome (144 kb, a GC-biased base composition (58.4%, and a coding reassignment of UGA Stop-->Trp. Although it is not clear why this tiny genome lacks the low GC content typical of other small bacterial genomes, these observations support a role of genome reduction rather than base composition as a driver of codon reassignment.
Directory of Open Access Journals (Sweden)
García-Casco, J. M.
2013-04-01
Full Text Available In the present work we have analyzed a total of 734 subcutaneous fat samples from Iberian pigs with different feeding systems for fattening (“Bellota”, “Recebo”, “Campo” and “Cebo” over three consecutive years, 2009-2011. Lipids were extracted from the subcutaneous fat on the rump, and after esterification, they were analyzed by Gas Chromatography (GC-FID and Gas Chromatography- Combustion-Isotope Ratio Mass Spectrometry (GC-C-IRMS. Mean fatty acids and isotope ratios show that there are differences according to the year and feeding systems, two factors that should be taken into account when classifying the animals. The application of different prediction models based on Discriminant analysis has allowed us to establish a method for the classification of animals according to the feeding system type, with a correct percentage of 85% using three or four classification categories (Bellota, Recebo, Campo and/or Cebo and 91% using only two categories, Cebo and Bellota. This model could provide the basis for appropriate classification of Iberian pigs according to their feeding regime.En el presente trabajo se han analizado un total de 734 muestras de tejido subcutáneo de cerdos ibéricos con distintos tipos de alimentación de engorde (Bellota, Recebo, Cebo y Campo a lo largo de tres años consecutivos, 2009-2011. Se han extraído los lípidos de la grasa subcutánea de rabadilla, y después de su esterificación, se han analizado por Cromatografía de gases (GC-FID y por Espectrometría de masas de relaciones isotópicas (GC-C-IRMS. Las medias de los ácidos grasos y de las relaciones isotópicas muestran que existen diferencias según el año y tipo de alimentación, factores que deberían tenerse en cuenta a la hora de clasificar los animales. La aplicación de distintos modelos de predicción basados en análisis discriminante permite establecer un método para la clasificación de los animales según el tipo de alimentación, con
Both selective and neutral processes drive GC content evolution in the human genome
Directory of Open Access Journals (Sweden)
Cagliani Rachele
2008-03-01
Full Text Available Abstract Background Mammalian genomes consist of regions differing in GC content, referred to as isochores or GC-content domains. The scientific debate is still open as to whether such compositional heterogeneity is a selected or neutral trait. Results Here we analyze SNP allele frequencies, retrotransposon insertion polymorphisms (RIPs, as well as fixed substitutions accumulated in the human lineage since its divergence from chimpanzee to indicate that biased gene conversion (BGC has been playing a role in within-genome GC content variation. Yet, a distinct contribution to GC content evolution is accounted for by a selective process. Accordingly, we searched for independent evidences that GC content distribution does not conform to neutral expectations. Indeed, after correcting for possible biases, we show that intron GC content and size display isochore-specific correlations. Conclusion We consider that the more parsimonious explanation for our results is that GC content is subjected to the action of both weak selection and BGC in the human genome with features such as nucleosome positioning or chromatin conformation possibly representing the final target of selective processes. This view might reconcile previous contrasting findings and add some theoretical background to recent evidences suggesting that GC content domains display different behaviors with respect to highly regulated biological processes such as developmentally-stage related gene expression and programmed replication timing during neural stem cell differentiation.
Matched molecular pair-based data sets for computer-aided medicinal chemistry
Bajorath, Jürgen
2014-01-01
Matched molecular pairs (MMPs) are widely used in medicinal chemistry to study changes in compound properties including biological activity, which are associated with well-defined structural modifications. Herein we describe up-to-date versions of three MMP-based data sets that have originated from in-house research projects. These data sets include activity cliffs, structure-activity relationship (SAR) transfer series, and second generation MMPs based upon retrosynthetic rules. The data sets have in common that they have been derived from compounds included in the ChEMBL database (release 17) for which high-confidence activity data are available. Thus, the activity data associated with MMP-based activity cliffs, SAR transfer series, and retrosynthetic MMPs cover the entire spectrum of current pharmaceutical targets. Our data sets are made freely available to the scientific community. PMID:24627802
Kojiro, Daniel R.; Stimac, Robert M.; Kaye, William J.; Holland, Paul M.; Takeuchi, Norishige
2006-01-01
Astrobiology flight experiments require highly sensitive instrumentation for in situ analysis of volatile chemical species and minerals present in the atmospheres and surfaces of planets, moons, and asteroids. The complex mixtures encountered place a heavy burden on the analytical instrumentation to detect and identify all species present. The use of land rovers and balloon aero-rovers place additional emphasis on miniaturization of the analytical instrumentation. In addition, smaller instruments, using tiny amounts of consumables, allow the use of more instrumentation and/or ionger mission life for stationary landers/laboratories. The miniCometary Ice and Dust Experiment (miniCIDEX), which combined Gas Chromatography (GC) with helium Ion Mobility Spectrometry (IMS), was capable of providing the wide range of analytical information required for Astrobiology missions. The IMS used here was based on the PCP model 111 IMS. A similar system, the Titan Ice and Dust Experiment (TIDE), was proposed as part of the Titan Orbiter Aerorover Mission (TOAM). Newer GC systems employing Micro Electro- Mechanical System (MEMS) based technology have greatly reduced both the size and resource requirements for space GCs. These smaller GCs, as well as the continuing miniaturization of Astrobiology analytical instruments in general, has highlighted the need for smaller, dry helium IMS systems. We describe here the development of a miniature, MEMS GC-IMS system (MEMS GC developed by Thorleaf Research Inc.), employing the MiniCell Ion Mobility Spectrometer (IMS), from Ion Applications Inc., developed through NASA's Astrobiology Science and Technology Instrument Development (ASTID) Program and NASA s Small Business Innovative Research (SBIR) Program.
Antitumor effect of degalactosylated gc-globulin on orthotopic grafted lung cancer in mice.
Hirota, Keiji; Nakagawa, Yoshinori; Takeuchi, Ryota; Uto, Yoshihiro; Hori, Hitoshi; Onizuka, Shinya; Terada, Hiroshi
2013-07-01
Group-specific component (Gc)-globulin-derived macrophage-activating factor (GcMAF) generated by a cascade of catalytic reactions with deglycosidase enzymes exerts antitumor activity. We hypothesized that degalactosyl Gc-globulin (DG3), a precursor of GcMAF, also plays a role in recovery from cancer as well as GcMAF due to progression of deglycosylation by generally resident sialidases and mannosidases. We prepared the subtypes of DG3, such as 1f1f and 1s1s and its 22 homodimers, by using vitamin D3-binding Sepharose CL-6B and examined their antitumor activity in mice bearing Lewis lung carcinoma cells, by counting the number of nodules formed in their lungs. Antitumor activity of DG3 was observed regardless of its subtype, being equivalent to that of GcMAF. The injection route of DG3 affected its antitumor activity, with subcutaneous and intramuscular administration being more favorable than the intraperitoneal or intravenous route. In order to obtain significant antitumor activity, more than 160 ng/kg of DG3 were required. DG3 proved to be promising as an antitumor agent, similarly to GcMAF.
Kanda, Shigeru; Mochizuki, Yasushi; Miyata, Yasuyoshi; Kanetake, Hiroshi; Yamamoto, Nobuto
2002-09-04
The vitamin D(3)-binding protein (Gc protein)-derived macrophage activating factor (GcMAF) activates tumoricidal macrophages against a variety of cancers indiscriminately. We investigated whether GcMAF also acts as an antiangiogenic factor on endothelial cells. The effects of GcMAF on angiogenic growth factor-induced cell proliferation, chemotaxis, and tube formation were examined in vitro by using cultured endothelial cells (murine IBE cells, porcine PAE cells, and human umbilical vein endothelial cells [HUVECs]) and in vivo by using a mouse cornea micropocket assay. Blocking monoclonal antibodies to CD36, a receptor for the antiangiogenic factor thrombospondin-1, which is also a possible receptor for GcMAF, were used to investigate the mechanism of GcMAF action. GcMAF inhibited the endothelial cell proliferation, chemotaxis, and tube formation that were all stimulated by fibroblast growth factor-2 (FGF-2), vascular endothelial growth factor-A, or angiopoietin 2. FGF-2-induced neovascularization in murine cornea was also inhibited by GcMAF. Monoclonal antibodies against murine and human CD36 receptor blocked the antiangiogenic action of GcMAF on the angiogenic factor stimulation of endothelial cell chemotaxis. In addition to its ability to activate tumoricidal macrophages, GcMAF has direct antiangiogenic effects on endothelial cells independent of tissue origin. The antiangiogenic effects of GcMAF may be mediated through the CD36 receptor.
Environmental trace analysis by means of supersensitive GC-IMS
International Nuclear Information System (INIS)
Leonhardt, J.W.
1997-01-01
The effective control of pollutants in ambient air requires their fast in situ identification and concentration determination of chemical compounds in the range of micrograms per m 3 . There are attempts to use conventional analytical techniques as portable GC and GC-MS. These systems are relatively expensive. A new supersensitive ion Mobility Sensor (IMS) was developed and checked by IUT Ltd, which meets the new demands. The use of tritium sources is an advantage in comparison with other IMS being equipped by nickel-63, the application of which is rather critical in respect of the radiation protection. On the other hand an integrated separation column allows to reduce interferences by matrix effects. The technical parameters of the IUT GC- IMS and some of its most important applications are briefly presented
Detection of protonated non-Watson-Crick base pairs using electrospray ionization mass spectrometry.
Ishida, Riyoko; Iwahashi, Hideo
2018-03-01
Many studies have shown that protonated nucleic acid base pairs are involved in a wide variety of nucleic acid structures. However, little information is available on relative stability of hemiprotonated self- and non-self-dimers at monomer level. We used electrospray ionization mass spectrometry (ESI-MS) to evaluate the relative stability under various concentrations of hydrogen ion. These enable conjecture of the formation of protonated non-Watson-Crick base pairs based on DNA and RNA base sequence. In the present study, we observed that ESI-MS peaks corresponded to respective self-dimers for all examined nucleosides except for adenosine. Peak heights depended on the concentration of hydrogen ion. The ESI-MS peak heights of the hemiprotonated cytidine dimers and the hemiprotonated thymidine dimer sharply increased with increased concentration of hydrogen ion, suggesting direct participation of hydrogen ion in dimer formations. In ESI-MS measurements of the solutions containing adenosine, cytidine, thymidine and guanosine, we observed protonated cytidine-guanosine dimer (CH+-G) and protonated cytidine-thymidine dimer (CH+-T) in addition to hemiprotonated cytidine-cytidine dimer (CH+-C) with following relative peak height, (CH+-C) > (CH+-G) ≈ (CH+-T) > (CH+-A). Additionally, in the ESI-MS measurements of solutions containing adenosine, thymidine and guanosine, we observed a considerable amount of protonated adenosine-guanosine (AH+-G) and protonated adenosine-thymidine (AH+-T).
[Study on rapid analysis method of pesticide contamination in processed foods by GC-MS and GC-FPD].
Kobayashi, Maki; Otsuka, Kenji; Tamura, Yasuhiro; Tomizawa, Sanae; Kamijo, Kyoko; Iwakoshi, Keiko; Sato, Chizuko; Nagayama, Toshihiro; Takano, Ichiro
2011-01-01
A simple and rapid method using GC-MS and GC-FPD for the determination of pesticide contamination in processed food has been developed. Pesticides were extracted from a sample with ethyl acetate in the presence of anhydrous sodium sulfate, then cleaned up with a combination of mini-columns, such as macroporous diatomaceous earth, C18, GCB (graphite carbon black) and PSA. Recovery tests of 57 pesticides (known to be toxic or harmful) from ten kinds of processed foods (butter, cheese, corned beef, dried shrimp, frozen Chinese dumplings, grilled eels, instant noodles, kimchi, retort-packed curry and wine) were performed, and the recovery rates were mostly between 70% and 120%. This method can be used to judge whether or not processed foods are contaminated with pesticides at potentially harmful levels.
Novosjolova, Irina; Kennedy, Scott D; Rozners, Eriks
2017-11-02
The development of nucleic acid base-pair analogues that use new modes of molecular recognition is important both for fundamental research and practical applications. The goal of this study was to evaluate 2-methoxypyridine as a cationic thymidine mimic in the A-T base pair. The hypothesis was that including protonation in the Watson-Crick base pairing scheme would enhance the thermal stability of the DNA double helix without compromising the sequence selectivity. DNA and peptide nucleic acid (PNA) sequences containing the new 2-methoxypyridine nucleobase (P) were synthesized and studied by using UV thermal melting and NMR spectroscopy. Introduction of P nucleobase caused a loss of thermal stability of ≈10 °C in DNA-DNA duplexes and ≈20 °C in PNA-DNA duplexes over a range of mildly acidic to neutral pH. Despite the decrease in thermal stability, the NMR structural studies showed that P-A formed the expected protonated base pair at pH 4.3. Our study demonstrates the feasibility of cationic unnatural base pairs; however, future optimization of such analogues will be required. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.
Sinurat, E. N.; Yudiarsah, E.
2017-07-01
The charge transport properties of DNA aperiodic molecule has been studied by considering various interbase hopping parameter on Watson-Crick base pair. 32 base pairs long double-stranded DNA aperiodic model with sequence GCTAGTACGTGACGTAGCTAGGATATGCCTGA on one chain and its complement on the other chain is used. Transfer matrix method has been used to calculate transmission probabilities, for determining I-V characteristic using Landauer Büttiker formula. DNA molecule is modeled using tight binding hamiltonian combined with the theory of Slater-Koster. The result show, the increment of Watson-Crick hopping value leads to the transmission probabilities and current of DNA aperiodic molecule increases.
Sun, Zheng; Zhang, Wenkai; Ji, Minbiao; Hartsock, Robert; Gaffney, Kelly J
2013-12-12
The interaction of charged species in aqueous solution has important implications for chemical, biological, and environmental processes. We have used 2DIR spectroscopy to study the equilibrium dynamics of thiocyanate chemical exchange between free ion (NCS(-)) and contact ion pair configurations (MNCS(+)), where M(2+) = Mg(2+) or Ca(2+). Detailed studies of the influence of anion concentration and anion speciation show that the chemical exchange observed with the 2DIR measurements results from NCS(-) exchanging with other anion species in the first solvation shell surrounding Mg(2+) or Ca(2+). The presence of chemical exchange in the 2DIR spectra provides an indirect, but robust, determinant of contact ion pair formation. We observe preferential contact ion pair formation between soft Lewis base anions and hard Lewis acid cations. This observation cannot be easily reconciled with Pearson's acid-base concept or Collins' Law of Matching Water Affinities. The anions that form contact ion pairs also correspond to the ions with an affinity for water and protein surfaces, so similar physical and chemical properties may control these distinct phenomena.
Wang, Mingfang; Wang, Jinyu; Li, Bingcheng; Meng, Lingxin; Tian, Zhaoxing
2017-09-01
Co-delivery of chemotherapy drugs and siRNA for cancer therapy has achieved remarkable results according to synergistic/combined antitumor effects, and is recognized as a promising therapeutic modality. However, little attention has been paid to the extremely complex mechanisms of chemotherapy drug-siRNA pairs during co-delivery process. Proper selection of chemotherapy drug-siRNA pairs is beneficial for achieving desirable cancer therapeutic effects. Exploring the inherent principles during chemotherapy drug-siRNA pair selection for co-delivery would greatly enhanced therapeutic efficiency. To achieve ideal results, this article will systematically review current different mechanism-based chemotherapy drug-siRNA pairs for co-delivery in cancer treatment. Large-scale library screening of recent different chemotherapy drug-siRNA pairs for co-delivery would help to establish the chemotherapy drug-siRNA pair selection principle, which could pave the way for co-delivery of chemotherapy drugs and siRNA for cancer treatment in clinic. Following the inherent principle of chemotherapy drug-siRNA pair, more effective co-delivery vectors can be designed in the future. Copyright © 2017 Elsevier B.V. All rights reserved.
Tada, Atsuko; Ishizuki, Kyoko; Yamazaki, Takeshi; Sugimoto, Naoki; Akiyama, Hiroshi
2014-07-01
Natural ester-type gum bases, which are used worldwide as food additives, mainly consist of wax esters composed of long-chain fatty acids and long-chain fatty alcohols. There are many varieties of ester-type gum bases, and thus a useful method for their discrimination is needed in order to establish official specifications and manage their quality control. Herein is reported a rapid and simple method for the analysis of different ester-type gum bases used as food additives by high-temperature gas chromatography/mass spectrometry (GC/MS). With this method, the constituent wax esters in ester-type gum bases can be detected without hydrolysis and derivatization. The method was applied to the determination of 10 types of gum bases, including beeswax, carnauba wax, lanolin, and jojoba wax, and it was demonstrated that the gum bases derived from identical origins have specific and characteristic total ion chromatogram (TIC) patterns and ester compositions. Food additive gum bases were thus distinguished from one another based on their TIC patterns and then more clearly discriminated using simultaneous monitoring of the fragment ions corresponding to the fatty acid moieties of the individual molecular species of the wax esters. This direct high-temperature GC/MS method was shown to be very useful for the rapid and simple discrimination of varieties of ester-type gum bases used as food additives.
Tada, Atsuko; Ishizuki, Kyoko; Yamazaki, Takeshi; Sugimoto, Naoki; Akiyama, Hiroshi
2014-01-01
Natural ester-type gum bases, which are used worldwide as food additives, mainly consist of wax esters composed of long-chain fatty acids and long-chain fatty alcohols. There are many varieties of ester-type gum bases, and thus a useful method for their discrimination is needed in order to establish official specifications and manage their quality control. Herein is reported a rapid and simple method for the analysis of different ester-type gum bases used as food additives by high-temperature gas chromatography/mass spectrometry (GC/MS). With this method, the constituent wax esters in ester-type gum bases can be detected without hydrolysis and derivatization. The method was applied to the determination of 10 types of gum bases, including beeswax, carnauba wax, lanolin, and jojoba wax, and it was demonstrated that the gum bases derived from identical origins have specific and characteristic total ion chromatogram (TIC) patterns and ester compositions. Food additive gum bases were thus distinguished from one another based on their TIC patterns and then more clearly discriminated using simultaneous monitoring of the fragment ions corresponding to the fatty acid moieties of the individual molecular species of the wax esters. This direct high-temperature GC/MS method was shown to be very useful for the rapid and simple discrimination of varieties of ester-type gum bases used as food additives. PMID:25473499
Huang, Wenyuan; Liu, Ning; Zhang, Xiaodong; Wu, Minghong; Tang, Liang
2017-12-01
In this study, hybrid nanocomposites based on Fe-based MOF and graphitic carbon nitride (g-C3N4) were developed by a facile solvothermal method. The as-prepared materials were characterized by XRD, FESEM, TEM, XPS and PL analysis. It was showed that the introduction of a certain amount of g-C3N4 on the surface of MIL-53(Fe) would improve the separation and migration rate of photo-induced charges, consequently resulting in the boost of photocatalytic efficiency. Compared with g-C3N4 and MIL-53(Fe), the CMFe composites displayed more excellent visible light-resposive photocatalytic activity for the reduction of Cr(VI). The optimal doping content of g-C3N4 in g-C3N4/MIL-53(Fe) composite was determined to be 3.0 wt%, and it showed about 2.1 and 2.0 times as high photocatalytic efficiency for the reduction of Cr(VI) as that of pure g-C3N4 and MIL-53(Fe), respectively. Meanwhile, the composite exhibited good reusability and stability in the process of cyclic experiments. A possible photocatalytic reaction mechanism was also investigated in detail by the related electrochemical analysis.
Performance of the future MOMA GC-ITMS instrument
Grand, Noel; Buch, Arnaud; Veronica, Pinnick; Szopa, Cyril; Danell, Ryan; Van Amerom, Friso H. W.; Glavin, Daniel P.; Freissinet, Caroline; Arevalo, Ricardo; Stalport, Fabien; Getty, Stephanie; Coll, Patrice; Steinninger, Harald; Brinckerhoff, William; Mahaffy, Paul; Goesmann, Fred; Raulin, F.; Goetz, Walter; MOMA Team
2016-10-01
The Mars Organic Molecule Analyzer (MOMA) experiment aboard the future ExoMars mission will be the continuation of the SAM expirement aboard the Curiosity rover, with the search for the organic composition of the Mars surface. With ExoMars the sample will be extracted as deep as 2 meters below the martian surface to minimize effects of radiation and oxidation on organic materials. To analyze the wide range of organic composition (volatile and non-volatiles compounds) of the Martian soil MOMA is composed with an UV laser desorption / ionization (LDI) and a pyrolysis gas chromatography ion trap mass spectrometry (pyr-GC-ITMS). In order to analyze refractory organic compounds and chirality samples which undergo GC-ITMS analysis may be submitted to a derivatization process, consisting of the reaction of the sample components with specific reactants (MTBSTFA [1], DMF-DMA [2] or TMAH [3]).To optimize and test the performance of the GC-ITMS instrument we have performed several coupling tests campaigns between the GC, providing by the French team (LISA, LATMOS, CentraleSupelec), and the MS, providing by the US team (NASA, GSFC). Last campaign has been done with the ETU models which is similar to the flight model and which include the oven and the taping station providing by the German team (MPS).The results obtained demonstrate the current status of the end-to-end performance of the gas chromatography-mass spectrometry mode of operation.
Directory of Open Access Journals (Sweden)
Yan Wang
2017-09-01
Full Text Available Flower-like SnO2/g-C3N4 nanocomposites were synthesized via a facile hydrothermal method by using SnCl4·5H2O and urea as the precursor. The structure and morphology of the as-synthesized samples were characterized by using the X-ray powder diffraction (XRD, electron microscopy (FESEM and TEM, and Fourier transform infrared spectrometer (FT-IR techniques. SnO2 displays the unique 3D flower-like microstructure assembled with many uniform nanorods with the lengths and diameters of about 400–600 nm and 50–100 nm, respectively. For the SnO2/g-C3N4 composites, SnO2 flower-like nanorods were coupled by a lamellar structure 2D g-C3N4. Gas sensing performance test results indicated that the response of the sensor based on 7 wt. % 2D g-C3N4-decorated SnO2 composite to 500 ppm ethanol vapor was 150 at 340 °C, which was 3.5 times higher than that of the pure flower-like SnO2 nanorods-based sensor. The gas sensing mechanism of the g-C3N4nanosheets-decorated SnO2 flower-like nanorods was discussed in relation to the heterojunction structure between g-C3N4 and SnO2.
Jana, S.; Vasantha, V.A.; Stubbs, L.P.; Parthiban, A.; Vancso, Gyula J.
2013-01-01
Vinylimidazole-based asymmetric ion pair comonomers (IPCs) which are free from nonpolymerizable counter ions have been synthesized, characterized and polymerized by free radical polymerization (FRP), atom transfer radical polymerization (ATRP), and reversible addition-fragmentation chain transfer
Enhanced photocatalytic ozonation of organics by g-C3N4 under visible light irradiation
International Nuclear Information System (INIS)
Liao, Gaozu; Zhu, Dongyun; Li, Laisheng; Lan, Bingyan
2014-01-01
Highlights: • g-C 3 N 4 is employed as active catalyst in the photocatalytic ozonation system. • The more negative conduction band of g-C 3 N 4 benefits the transfer of electrons. • The synergistic effect between photocatalysis and ozonation is promoted by g-C 3 N 4 . • Enhanced degradation of oxalic acid and biphenol A is achieved via g-C 3 N 4 /Vis/O 3 . - Abstract: Graphitic carbon nitride (g-C 3 N 4 ) was employed as the active photocatalyst in the photocatalytic ozonation coupling system in the present study. g-C 3 N 4 was prepared by directly heating thiourea in air at 550 °C. XRD, FT-IR, UV–vis was used to characterize the structure and optical property. Oxalic acid and bisphenol A were selected as model substances for photocatalytic ozonation reactions to evaluate the catalytic ability of g-C 3 N 4 (g-C 3 N 4 /Vis/O 3 ). The results showed that the degradation ratio of oxalic acid with g-C 3 N 4 /Vis/O 3 was 65.2% higher than the sum of ratio when it was individually decomposed by g-C 3 N 4 /Vis and O 3 . The TOC removal of biphenol A with g-C 3 N 4 /Vis/O 3 was 2.17 times as great as the sum of the ratio when using g-C 3 N 4 /Vis and O 3 . This improvement was attributed to the enhanced synergistic effect between photocatalysis and ozonation by g-C 3 N 4 . Under visible light irradiation, the photo-generated electrons produced on g-C 3 N 4 facilitated the electrons transfer owing to the more negative conduction band potential (−1.3 V versus NHE). It meant that the photo-generated electrons could be trapped by ozone and reaction with it more easily. Subsequently, the yield of hydroxyl radicals was improved so as to enhance the organics degradation efficiency. This work indicated that metal-free g-C 3 N 4 could be an excellent catalyst for mineralization of organic compounds in waste control
Environmental trace analysis by means of supersensitive GC-IMS
Energy Technology Data Exchange (ETDEWEB)
Leonhardt, J.W. [IUTLimited, Berlin, (Germany)
1997-10-01
The effective control of pollutants in ambient air requires their fast in situ identification and concentration determination of chemical compounds in the range of micrograms per m{sup 3}. There are attempts to use conventional analytical techniques as portable GC and GC-MS. These systems are relatively expensive. A new supersensitive ion Mobility Sensor (IMS) was developed and checked by IUT Ltd, which meets the new demands. The use of tritium sources is an advantage in comparison with other IMS being equipped by nickel-63, the application of which is rather critical in respect of the radiation protection. On the other hand an integrated separation column allows to reduce interferences by matrix effects. The technical parameters of the IUT GC- IMS and some of its most important applications are briefly presented 6 refs., 1 tab., 5 figs.
International Nuclear Information System (INIS)
Carli, L; Cantatore, A; De Chiffre, L; Genta, G; Barbato, G; Levi, R
2011-01-01
3D-SEM is a method, based on the stereophotogrammetry technique, which obtains three-dimensional topographic reconstructions starting typically from two SEM images, called the stereo-pair. In this work, a theoretical uncertainty evaluation of the stereo-pair technique, according to GUM (Guide to the Expression of Uncertainty in Measurement), was carried out, considering 3D-SEM reconstructions of a wire gauge with a reference diameter of 250 µm. Starting from the more commonly used tilting strategy, one based on the item rotation inside the SEM chamber was also adopted. The latter enables multiple-view reconstructions of the cylindrical item under consideration. Uncertainty evaluation was performed starting from a modified version of the Piazzesi equation, enabling the calculation of the z-coordinate from a given stereo-pair. The metrological characteristics of each input variable have been taken into account and a SEM stage calibration has been performed. Uncertainty tables for the cases of tilt and rotation were then produced, leading to the calculation of expanded uncertainty. For the case of rotation, the largest uncertainty contribution resulted to be the rotational angle; however, for the case of tilt it resulted to be the pixel size. A relative expanded uncertainty equal to 5% and 4% was obtained for the case of rotation and tilt, respectively
GC content around splice sites affects splicing through pre-mRNA secondary structures
Directory of Open Access Journals (Sweden)
Chen Liang
2011-01-01
Full Text Available Abstract Background Alternative splicing increases protein diversity by generating multiple transcript isoforms from a single gene through different combinations of exons or through different selections of splice sites. It has been reported that RNA secondary structures are involved in alternative splicing. Here we perform a genomic study of RNA secondary structures around splice sites in humans (Homo sapiens, mice (Mus musculus, fruit flies (Drosophila melanogaster, and nematodes (Caenorhabditis elegans to further investigate this phenomenon. Results We observe that GC content around splice sites is closely associated with the splice site usage in multiple species. RNA secondary structure is the possible explanation, because the structural stability difference among alternative splice sites, constitutive splice sites, and skipped splice sites can be explained by the GC content difference. Alternative splice sites tend to be GC-enriched and exhibit more stable RNA secondary structures in all of the considered species. In humans and mice, splice sites of first exons and long exons tend to be GC-enriched and hence form more stable structures, indicating the special role of RNA secondary structures in promoter proximal splicing events and the splicing of long exons. In addition, GC-enriched exon-intron junctions tend to be overrepresented in tissue-specific alternative splice sites, indicating the functional consequence of the GC effect. Compared with regions far from splice sites and decoy splice sites, real splice sites are GC-enriched. We also found that the GC-content effect is much stronger than the nucleotide-order effect to form stable secondary structures. Conclusion All of these results indicate that GC content is related to splice site usage and it may mediate the splicing process through RNA secondary structures.
Qiao, Jun-Qin; Liang, Chao; Wei, Lan-Chun; Cao, Zhao-Ming; Lian, Hong-Zhen
2016-12-01
The study on nucleic acid retention in ion-pair reversed-phase high-performance liquid chromatography mainly focuses on size-dependence, however, other factors influencing retention behaviors have not been comprehensively clarified up to date. In this present work, the retention behaviors of oligonucleotides and double-stranded DNAs were investigated on silica-based C 18 stationary phase by ion-pair reversed-phase high-performance liquid chromatography. It is found that the retention of oligonucleotides was influenced by base composition and base sequence as well as size, and oligonucleotides prone to self-dimerization have weaker retention than those not prone to self-dimerization but with the same base composition. However, homo-oligonucleotides are suitable for the size-dependent separation as a special case of oligonucleotides. For double-stranded DNAs, the retention is also influenced by base composition and base sequence, as well as size. This may be attributed to the interaction of exposed bases in major or minor grooves with the hydrophobic alky chains of stationary phase. In addition, no specific influence of guanine and cytosine content was confirmed on retention of double-stranded DNAs. Notably, the space effect resulted from the stereostructure of nucleic acids also influences the retention behavior in ion-pair reversed-phase high-performance liquid chromatography. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Chawla, Mohit
2016-02-16
We report a quantum chemical characterization of the non-natural (synthetic) H-bonded base pair formed by 6-amino-5-nitro-2(1H)-pyridone (Z) and 2-amino-imidazo [1,2-a]-1,3,5-triazin-4(8H)-one (P). The Z:P base pair, orthogonal to the classical G:C base pair, has been introduced in DNA molecules for expanding the genetic code. Our results indicate that the Z:P base pair closely mimics the G:C base pair both in terms of structure and stability. To clarify the role of the NO2 group on the C5 position of the Z base, we compared the stability of the Z:P base pair with that of base pairs having different functional group on the C5 position of Z. Our results indicate that the electron donating/withdrawing properties of the group in the C5 position has a clear impact on the stability of the Z:P base pair, with the strong electron withdrawing nitro group achieving the largest stabilizing effect on the H-bonding interaction, and the strong electron donating NH2 group destabilizing the Z:P pair by almost 4 kcal/mol. Finally, our gas phase and in water calculations confirm that the Z-nitro group reinforce the stacking interaction with its adjacent purine or pyrimidine ring.
Preliminary study of urine metabolism in type two diabetic patients based on GC-MS
Zhang, Ning; Geng, Fang; Hu, Zhong-Hua; Liu, Bin; Wang, Ye-Qiu; Liu, Jun-Cen; Qi, Yong-Hua; Li, Li-Jing
2016-01-01
Objective: Comparative study of type 2 diabetes and healthy controls by metabolomics methods to explore the pathogenesis of Type II diabetes. Methods: Gas chromatography - mass spectrometry (GC-MS) with a variety of multivariate statistical analysis methods to the healthy control group 58 cases, 68 cases of Type II diabetes group were analyzed. Chromatographic conditions: DB-5MS column; the carrier gas He; flow rate of 1 mL·min-1, the injection volume 1 uL; split ratio is 100: 1. MS condition...
Kuchiike, Daisuke; Uto, Yoshihiro; Mukai, Hirotaka; Ishiyama, Noriko; Abe, Chiaki; Tanaka, Daichi; Kawai, Tomohito; Kubo, Kentaro; Mette, Martin; Inui, Toshio; Endo, Yoshio; Hori, Hitoshi
2013-07-01
The group-specific component protein-derived macrophage-activating factor (GcMAF) has various biological activities, such as macrophage activation and antitumor activity. Clinical trials of GcMAF have been carried out for metastatic breast cancer, prostate cancer, and metastatic colorectal cancer. In this study, despite the complicated purification process of GcMAF, we used enzymatically-treated human serum containing GcMAF with a considerable macrophage-stimulating activity and antitumor activity. We detected GcMAF in degalactosylated/desialylated human serum by western blotting using an anti-human Gc globulin antibody, and Helix pomatia agglutinin lectin. We also found that GcMAF-containing human serum significantly enhanced the phagocytic activity of mouse peritoneal macrophages and extended the survival time of mice bearing Ehrlich ascites tumors. We demonstrated that GcMAF-containing human serum can be used as a potential macrophage activator for cancer immunotherapy.
Conformational analysis of a covalently cross-linked Watson-Crick base pair model.
Jensen, Erik A; Allen, Benjamin D; Kishi, Yoshito; O'Leary, Daniel J
2008-11-15
Low-temperature NMR experiments and molecular modeling have been used to characterize the conformational behavior of a covalently cross-linked DNA base pair model. The data suggest that Watson-Crick or reverse Watson-Crick hydrogen bonding geometries have similar energies and can interconvert at low temperatures. This low-temperature process involves rotation about the crosslink CH(2)C(5') (psi) carbon-carbon bond, which is energetically preferred over the alternate CH(2)N(3) (phi) carbon-nitrogen bond rotation.
Directory of Open Access Journals (Sweden)
Jens Rohloff
2015-02-01
Full Text Available Metabolite profiling has been established as a modern technology platform for the description of complex chemical matrices and compound identification in biological samples. Gas chromatography coupled with mass spectrometry (GC-MS in particular is a fast and accurate method widely applied in diagnostics, functional genomics and for screening purposes. Following solvent extraction and derivatization, hundreds of metabolites from different chemical groups can be characterized in one analytical run. Besides sugars, acids, and polyols, diverse phenolic and other cyclic metabolites can be efficiently detected by metabolite profiling. The review describes own results from plant research to exemplify the applicability of GC-MS profiling and concurrent detection and identification of phenolics and other cyclic structures.
Trettin, Arne; Zoerner, Alexander A; Böhmer, Anke; Gutzki, Frank-Mathias; Stichtenoth, Dirk O; Jordan, Jens; Tsikas, Dimitrios
2011-08-01
We report on the quantitative determination of acetaminophen (paracetamol; NAPAP-d(0)) in human plasma and urine by GC-MS and GC-MS/MS in the electron-capture negative-ion chemical ionization (ECNICI) mode after derivatization with pentafluorobenzyl (PFB) bromide (PFB-Br). Commercially available tetradeuterated acetaminophen (NAPAP-d(4)) was used as the internal standard. NAPAP-d(0) and NAPAP-d(4) were extracted from 100-μL aliquots of plasma and urine with 300 μL ethyl acetate (EA) by vortexing (60s). After centrifugation the EA phase was collected, the solvent was removed under a stream of nitrogen gas, and the residue was reconstituted in acetonitrile (MeCN, 100 μL). PFB-Br (10 μL, 30 vol% in MeCN) and N,N-diisopropylethylamine (10 μL) were added and the mixture was incubated for 60 min at 30 °C. Then, solvents and reagents were removed under nitrogen and the residue was taken up with 1000 μL of toluene, from which 1-μL aliquots were injected in the splitless mode. GC-MS quantification was performed by selected-ion monitoring ions due to [M-PFB](-) and [M-PFB-H](-), m/z 150 and m/z 149 for NAPAP-d(0) and m/z 154 and m/z 153 for NAPAP-d(4), respectively. GC-MS/MS quantification was performed by selected-reaction monitoring the transition m/z 150 → m/z 107 and m/z 149 → m/z 134 for NAPAP-d(0) and m/z 154 → m/z 111 and m/z 153 → m/z 138 for NAPAP-d(4). The method was validated for human plasma (range, 0-130 μM NAPAP-d(0)) and urine (range, 0-1300 μM NAPAP-d(0)). Accuracy (recovery, %) ranged between 89 and 119%, and imprecision (RSD, %) was below 19% in these matrices and ranges. A close correlation (r>0.999) was found between the concentrations measured by GC-MS and GC-MS/MS. By this method, acetaminophen can be reliably quantified in small plasma and urine sample volumes (e.g., 10 μL). The analytical performance of the method makes it especially useful in pediatrics. Copyright © 2011 Elsevier B.V. All rights reserved.
Liu, Xing-Pei; Chen, Jing-Shuai; Mao, Chang-Jie; Niu, He-Lin; Song, Ji-Ming; Jin, Bao-Kang
2018-09-26
Herein, we established a novel ultrasensitive photoelectrochemical biosensor for detecting urokinase-type plasminogen activator (u-PA), based on a g-C 3 N 4 /CdS nanocomposite. The prepared nanocomposite was characterized by transmission electron microscopy, X-ray photoelectron spectroscopy, ultraviolet-visible absorption spectroscopy, and Fourier transform infrared spectroscopy, thus indicating that the nanocomposite was prepared successfully. In the typical process, the prepared nanocomposite was deposited on the surface of a bare FTO electrode. After being air-dried, the g-C 3 N 4 /CdS nanocomposite modified electrode was successively incubated with antibody against urokinase-type plasminogen activator and the blocking agent BSA to produce a photoelectrochemical biosensor for u-PA. In the presence of target u-PA antigen, the photocurrent response of the prepared biosensor electrode decreased significantly. The proposed novel photoelectrochemical biosensor exhibited good sensitivity, specificity, and reproducibility for u-PA detection, and a low detection limit of 33 fg mL -1 , ranging from 1 μg mL -1 -0.1 pg mL -1 . The proposed strategy should provide a promising method for detection of other biomarkers. Copyright © 2018 Elsevier B.V. All rights reserved.
Analysis of residual solvents in PET radiopharmaceuticals by GC
International Nuclear Information System (INIS)
Li Yungang; Zhang Xiaojun; Liu Jian; Tian Jiahe; Zhang Jinming
2013-01-01
The residual solvents in PET radiopharmaceuticals were analyzed by GC, which were acetonitrile, ethanol, N, N-dimethylethanolamine (DMEA), dimethylsulfoxide (DMSO). The standard curves were established with the AT-624 capillary column at GC, and the sensitivity of acetonitrile and ethanol were 0.004-0.320 g/L and 0.010-0.120 g/L respectively. The residual solvents of acetonitrile, ethanol, DMEA and DMSO in PET radio- pharmaceuticals were analyzed by GC. The linearity were 0.9994, 0.9999, 0.9997, 0.999 6 respectively. The residual of acetonitrile were (0.0313±0.0433), (0.0829±0.0668), (0.0156±0.0059), (0.0254±0.0266) g/L in 18 F-FDG, 18 F-FLT, 11 C-CFT, 11 C-PIB respectively. The residual of ethanol was (0.0505±0.00528) g/L in 18 F-FDG. The residual of DMSO were (0.0331±0.0180) g/L, (0.0238±0.0100) g/L in 18 F-W372 and 11 C-DTBZ respectively. The residual of DMEA was (0.0348±0.0022) g/L in 11 C-Choline. The survived of organic solvent in PET radiopharmaceuticals can be analyzed with GC directly. The results showed that the QC should be done in PET radiopharmaceuticals purity with semi-HPLC to avoid the high residual. (authors)
Analysis of acrylamide by LC-MS/MS and GC-MS in processed Japanese foods.
Ono, H; Chuda, Y; Ohnishi-Kameyama, M; Yada, H; Ishizaka, M; Kobayashi, H; Yoshida, M
2003-03-01
Acrylamide concentrations in processed foods (63 samples covering 31 product types) from Japan were analysed by LC-MS/MS and GC-MS methods. The limit of detection and limit of quantification of acrylamide were 0.2 ng x ml(-1) (6 fmol) and 0.8 ng x ml(-1) (22 fmol), respectively, by LC-MS/MS, and those of 2,3-dibromopropionamide derived from acrylamide were 12 ng x ml(-1) (52 fmol) and 40 ng x ml(-1) (170 fmol), respectively, by GC-MS. Repeatability given as RSD was 1000 microg x kg(-1). The concentrations in non-whole potato-based snacks, rice crackers processed by grilling or frying, and candied sweet potatoes were lower compared with those in the potato crisps and the whole potato-based fried snacks. One of the whole potato-based fried snacks, however, showed low acrylamide concentration (instant precooked noodles and won-tons were <100 microg x kg(-1) with only one exception. Roasted barley grains for 'Mugi-cha' tea contained 200-600 microg x kg(-1) acrylamide.
EH-GC: An Efficient and Secure Architecture of Energy Harvesting Green Cloud Infrastructure
Directory of Open Access Journals (Sweden)
Saurabh Singh
2017-04-01
Full Text Available Nowadays, the high power consumption of data centers is the biggest challenge to making cloud computing greener. Many researchers are still seeking effective solutions to reduce or harvest the energy produced at data centers. To address this challenge, we propose a green cloud infrastructure which provides security and efficiency based on energy harvesting (EH-GC. The EH-GC is basically focused on harvesting the heat energy produced by data centers in the Infrastructure-as-a-Service (IaaS infrastructure. A pyroelectric material is used to generate the electric current from heat using the Olsen cycle. In order to achieve efficient green cloud computing, the architecture utilizes a genetic algorithm for proper virtual machine allocation, taking into consideration less Service Level Agreement (SLA violations. The architecture utilizes Multivariate Correlation Analysis (MCA correlation analysis based on a triangular map area generation to detect Denial of Service (DoS attacks in the data center layer of the IaaS. Finally, the experimental analysis is explained based on the energy parameter, which proves that our model is efficient and secure, and that it efficiently reuses the energy emitted from the data center.
Detection of gamma-irradiated peanuts by ESR spectroscopy and GC analysis of hydrocarbons
Energy Technology Data Exchange (ETDEWEB)
Wei Mingli; An Li [Institute of Agro-food Science and Technology, Chinese Academy of Agricultural Sciences, 100193 Beijing (China); Yi Mingha, E-mail: wangyilwm@163.co [Institute of Agro-food Science and Technology, Chinese Academy of Agricultural Sciences, 100193 Beijing (China); Feng Wang [Institute of Agro-food Science and Technology, Chinese Academy of Agricultural Sciences, 100193 Beijing (China); Yan Lizhang [Division of Metrology in Ionizing Radiation and Medicine, National Institute of Metrology, 100013 Beijing (China)
2011-03-15
Peanuts were analyzed by electron spin resonance (ESR) spectroscopy and gas chromatography (GC) before and after gamma irradiation. Using European protocols, the validity and effectiveness of these two techniques were compared with regard to sample preparation, sample and solvent consumption and dose-response curves after irradiation. The results showed the possibility of using ESR and GC for distinguishing between irradiated and unirradiated peanuts. A radiation dose of 0.1 kGy could be detected by ESR but not by GC. The results also indicated that GC is an effective method for qualitative analysis of irradiated peanut, while ESR is suitable for the rapid detection of irradiated peanuts.
How Does Mg2+ Modulate the RNA Folding Mechanism: A Case Study of the G:C W:W Trans Basepair.
Halder, Antarip; Roy, Rohit; Bhattacharyya, Dhananjay; Mitra, Abhijit
2017-07-25
Reverse Watson-Crick G:C basepairs (G:C W:W Trans) occur frequently in different functional RNAs. This is one of the few basepairs whose gas-phase-optimized isolated geometry is inconsistent with the corresponding experimental geometry. Several earlier studies indicate that through post-transcriptional modification, direct protonation, or coordination with Mg 2+ , accumulation of positive charge near N7 of guanine can stabilize the experimental geometry. Interestingly, recent studies reveal significant variation in the position of putatively bound Mg 2+ . This, in conjunction with recently raised doubts regarding some of the Mg 2+ assignments near the imino nitrogen of guanine, is suggestive of the existence of multiple Mg 2+ binding modes for this basepair. Our detailed investigation of Mg 2+ -bound G:C W:W Trans pairs occurring in high-resolution RNA crystal structures shows that they are found in 14 different contexts, eight of which display Mg 2+ binding at the Hoogsteen edge of guanine. Further examination of occurrences in these eight contexts led to the characterization of three different Mg 2+ binding modes: 1) direct binding via N7 coordination, 2) direct binding via O6 coordination, and 3) binding via hydrogen-bonding interaction with the first-shell water molecules. In the crystal structures, the latter two modes are associated with a buckled and propeller-twisted geometry of the basepair. Interestingly, respective optimized geometries of these different Mg 2+ binding modes (optimized using six different DFT functionals) are consistent with their corresponding experimental geometries. Subsequent interaction energy calculations at the MP2 level, and decomposition of its components, suggest that for G:C W:W Trans , Mg 2+ binding can fine tune the basepair geometries without compromising with their stability. Our results, therefore, underline the importance of the mode of binding of Mg 2+ ions in shaping RNA structure, folding and function. Copyright
Energy Technology Data Exchange (ETDEWEB)
Jackson Lepage, C.R.; Hancock, J.R. [Defence Research and Development Canada, Medicine Hat, AB (Canada); Wyatt, H.D.M. [Regina Univ., SK (Canada)
2004-07-01
Defence R and D Canada-Suffield (DRDC-Suffield) is responsible for analyzing samples that are suspected to contain chemical warfare agents, either collected by the Canadian Forces or by first-responders in the event of a terrorist attack in Canada. The analytical techniques used to identify the composition of the samples include gas chromatography-mass spectrometry (GC-MS), liquid chromatography-mass spectrometry (LC-MS), Fourier-transform infrared spectroscopy (FT-IR) and nuclear magnetic resonance spectroscopy. GC-MS and LC-MS generally require solvent extraction and reconcentration, thereby increasing sample handling. The authors examined analytical techniques which reduce or eliminate sample manipulation. In particular, this paper presented a screening method based on solid phase microextraction (SPME) headspace sampling and GC-MS analysis for chemical warfare agents such as mustard, sarin, soman, and cyclohexyl methylphosphonofluoridate in contaminated soil samples. SPME is a method which uses small adsorbent polymer coated silica fibers that trap vaporous or liquid analytes for GC or LC analysis. Collection efficiency can be increased by adjusting sampling time and temperature. This method was tested on two real-world samples, one from excavated chemical munitions and the second from a caustic decontamination mixture. 7 refs., 2 tabs., 3 figs.
A QM/MM refinement of an experimental DNA structure with metal-mediated base pairs.
Kumbhar, Sadhana; Johannsen, Silke; Sigel, Roland K O; Waller, Mark P; Müller, Jens
2013-10-01
A series of hybrid quantum mechanical/molecular mechanical (QM/MM) calculations was performed on models of a DNA duplex with artificial silver(I)-mediated imidazole base pairs. The optimized structures were compared to the original experimental NMR structure (Nat. Chem. 2 (2010) 229-234). The metal⋯metal distances are significantly shorter (~0.5Å) in the QM/MM model than in the original NMR structure. As a result, argentophilic interactions are feasible between the silver(I) ions of neighboring metal-mediated base pairs. Using the computationally determined metal⋯metal distances, a re-refined NMR solution structure of the DNA duplex was obtained. In this new NMR structure, all experimental constraints remain fulfilled. The new NMR structure shows less deviation from the regular B-type conformation than the original one. This investigation shows that the application of QM/MM models to generate additional constraints to be used during NMR structural refinements represents an elegant approach to obtaining high-resolution NMR structures. Copyright © 2013 Elsevier Inc. All rights reserved.
Conformational Analysis of a Covalently Cross-Linked Watson-Crick Base Pair Model
Jensen, Erik A.; Allen, Benjamin D.; Kishi, Yoshito; O'Leary, Daniel J.
2008-01-01
Low temperature NMR experiments and molecular modeling have been used to characterize the conformational behavior of a covalently cross-linked DNA base pair model. The data suggest that Watson-Crick or reverse Watson-Crick hydrogen bonding geometries have similar energies and can interconvert at low temperatures. This low-temperature process involves rotation about the crosslink CH2–C(5′) (ψ) carbon-carbon bond, which is energetically preferred over the alternate CH2–N(3) (ϕ) carbon-nitrogen ...
Preparation of WO3/g-C3N4 composites and their application in oxidative desulfurization
International Nuclear Information System (INIS)
Zhao, Rongxiang; Li, Xiuping; Su, Jianxun; Gao, Xiaohan
2017-01-01
Highlights: • The WO 3 /g-C 3 N 4 was successfully synthesized through simple calcination. • The process is simple and the cost raw materials is cheap. • The WO 3 /g-C 3 N 4 firstly applied to ODS. • The desulpurization rate of WO 3 /g-C 3 N 4 may attach to 91.2%. • Five recycles of WO 3 /g-C 3 N 4 still attach to 89.5% due to heterogeneous catalysis. - Abstract: WO 3 /graphitic carbon nitride (g-C 3 N 4 ) composites were successfully synthesized through direct calcining of a mixture of WO 3 and g-C 3 N 4 at 400 °C for 2 h. The WO 3 was prepared by calcination of phosphotungstic acid at 550 °C for 4 h, and the g-C 3 N 4 was obtained by calcination of melamine at 520 °C for 4 h. The WO 3 /g-C 3 N 4 composites were characterized by X-ray diffraction (XRD), Scanning electron microscopy (SEM), Fourier-transform infrared spectroscopy (FT-IR), and Brunner−Emmett−Teller analysis (BET). The WO 3 /g-C 3 N 4 composites exhibited stronger XRD peaks of WO 3 and g-C 3 N 4 than the WO 3 and pure g-C 3 N 4 . In addition, two WO 3 peaks at 25.7° and 26.6° emerged for the 36% −WO 3 /g-C 3 N 4 composite. This finding indicated that WO 3 was highly dispersed on the surface of the g-C 3 N 4 nanosheets and interacted with the nanosheets, which resulted in the appearance of (012) and (022) planes of WO 3 . The WO 3 /g-C 3 N 4 composite also exhibited a larger specific surface area and higher degree of crystallization than WO 3 or pure g-C 3 N 4 , which resulted in high catalytic activity of the catalyst. Desulfurization experiments demonstrated that the desulfurization rate of dibenzothiophene (DBT) in model oil reached 91.2% under optimal conditions. Moreover, the activity of the catalyst was not significantly decreased after five recycles.
Yamamoto, Nobuto; Suyama, Hirofumi; Nakazato, Hiroaki; Yamamoto, Nobuyuki; Koga, Yoshihiko
2008-07-01
Serum vitamin D binding protein (Gc protein) is the precursor for the principal macrophage-activating factor (MAF). The MAF precursor activity of serum Gc protein of colorectal cancer patients was lost or reduced because Gc protein is deglycosylated by serum alpha-N-acetylgalactosaminidase (Nagalase) secreted from cancerous cells. Deglycosylated Gc protein cannot be converted to MAF, leading to immunosuppression. Stepwise treatment of purified Gc protein with immobilized beta-galactosidase and sialidase generated the most potent macrophage-activating factor (GcMAF) ever discovered, but it produces no side effect in humans. Macrophages treated with GcMAF (100 microg/ml) develop an enormous variation of receptors and are highly tumoricidal to a variety of cancers indiscriminately. Administration of 100 nanogram (ng)/ human maximally activates systemic macrophages that can kill cancerous cells. Since the half-life of the activated macrophages is approximately 6 days, 100 ng GcMAF was administered weekly to eight nonanemic colorectal cancer patients who had previously received tumor-resection but still carried significant amounts of metastatic tumor cells. As GcMAF therapy progressed, the MAF precursor activities of all patients increased and conversely their serum Nagalase activities decreased. Since serum Nagalase is proportional to tumor burden, serum Nagalase activity was used as a prognostic index for time course analysis of GcMAF therapy. After 32-50 weekly administrations of 100 ng GcMAF, all colorectal cancer patients exhibited healthy control levels of the serum Nagalase activity, indicating eradication of metastatic tumor cells. During 7 years after the completion of GcMAF therapy, their serum Nagalase activity did not increase, indicating no recurrence of cancer, which was also supported by the annual CT scans of these patients.
DEFF Research Database (Denmark)
Rodríguez, J. Tinguaro; Franco de los Ríos, Camilo; Gómez, Daniel
2015-01-01
In this paper we want to stress the relevance of paired fuzzy sets, as already proposed in previous works of the authors, as a family of fuzzy sets that offers a unifying view for different models based upon the opposition of two fuzzy sets, simply allowing the existence of different types...
Classification of Coffee Beans by GC-C-IRMS, GC-MS, and 1H-NMR
Arana, Victoria Andrea; Esseiva, Pierre; Pazos, Diego
2016-01-01
In a previous work using 1H-NMR we reported encouraging steps towards the construction of a robust expert system for the discrimination of coffees from Colombia versus nearby countries (Brazil and Peru), to assist the recent protected geographical indication granted to Colombian coffee in 2007. This system relies on fingerprints acquired on a 400 MHz magnet and is thus well suited for small scale random screening of samples obtained at resellers or coffee shops. However, this approach cannot easily be implemented at harbour's installations, due to the elevated operational costs of cryogenic magnets. This limitation implies shipping the samples to the NMR laboratory, making the overall approach slower and thereby more expensive and less attractive for large scale screening at harbours. In this work, we report on our attempt to obtain comparable classification results using alternative techniques that have been reported promising as an alternative to NMR: GC-MS and GC-C-IRMS. Although statistically significant information could be obtained by all three methods, the results show that the quality of the classifiers depends mainly on the number of variables included in the analysis; hence NMR provides an advantage since more molecules are detected to obtain a model with better predictions. PMID:27516919
Classification of Coffee Beans by GC-C-IRMS, GC-MS, and (1)H-NMR.
Arana, Victoria Andrea; Medina, Jessica; Esseiva, Pierre; Pazos, Diego; Wist, Julien
2016-01-01
In a previous work using (1)H-NMR we reported encouraging steps towards the construction of a robust expert system for the discrimination of coffees from Colombia versus nearby countries (Brazil and Peru), to assist the recent protected geographical indication granted to Colombian coffee in 2007. This system relies on fingerprints acquired on a 400 MHz magnet and is thus well suited for small scale random screening of samples obtained at resellers or coffee shops. However, this approach cannot easily be implemented at harbour's installations, due to the elevated operational costs of cryogenic magnets. This limitation implies shipping the samples to the NMR laboratory, making the overall approach slower and thereby more expensive and less attractive for large scale screening at harbours. In this work, we report on our attempt to obtain comparable classification results using alternative techniques that have been reported promising as an alternative to NMR: GC-MS and GC-C-IRMS. Although statistically significant information could be obtained by all three methods, the results show that the quality of the classifiers depends mainly on the number of variables included in the analysis; hence NMR provides an advantage since more molecules are detected to obtain a model with better predictions.
Czyznikowska, Z; Góra, R W; Zaleśny, R; Lipkowski, P; Jarzembska, K N; Dominiak, P M; Leszczynski, J
2010-07-29
A set of nearly 100 crystallographic structures was analyzed using ab initio methods in order to verify the effect of the conformational variability of Watson-Crick guanine-cytosine and adenine-thymine base pairs on the intermolecular interaction energy and its components. Furthermore, for the representative structures, a potential energy scan of the structural parameters describing mutual orientation of the base pairs was carried out. The results were obtained using the hybrid variational-perturbational interaction energy decomposition scheme. The electron correlation effects were estimated by means of the second-order Møller-Plesset perturbation theory and coupled clusters with singles and doubles method adopting AUG-cc-pVDZ basis set. Moreover, the characteristics of hydrogen bonds in complexes, mimicking those appearing in B-DNA, were evaluated using topological analysis of the electron density. Although the first-order electrostatic energy is usually the largest stabilizing component, it is canceled out by the associated exchange repulsion in majority of the studied crystallographic structures. Therefore, the analyzed complexes of the nucleic acid bases appeared to be stabilized mainly by the delocalization component of the intermolecular interaction energy which, in terms of symmetry adapted perturbation theory, encompasses the second- and higher-order induction and exchange-induction terms. Furthermore, it was found that the dispersion contribution, albeit much smaller in terms of magnitude, is also a vital stabilizing factor. It was also revealed that the intermolecular interaction energy and its components are strongly influenced by four (out of six) structural parameters describing mutual orientation of bases in Watson-Crick pairs, namely shear, stagger, stretch, and opening. Finally, as a part of a model study, much of the effort was devoted to an extensive testing of the UBDB databank. It was shown that the databank quite successfully reproduces the
An Intelligent Model for Pairs Trading Using Genetic Algorithms.
Huang, Chien-Feng; Hsu, Chi-Jen; Chen, Chi-Chung; Chang, Bao Rong; Li, Chen-An
2015-01-01
Pairs trading is an important and challenging research area in computational finance, in which pairs of stocks are bought and sold in pair combinations for arbitrage opportunities. Traditional methods that solve this set of problems mostly rely on statistical methods such as regression. In contrast to the statistical approaches, recent advances in computational intelligence (CI) are leading to promising opportunities for solving problems in the financial applications more effectively. In this paper, we present a novel methodology for pairs trading using genetic algorithms (GA). Our results showed that the GA-based models are able to significantly outperform the benchmark and our proposed method is capable of generating robust models to tackle the dynamic characteristics in the financial application studied. Based upon the promising results obtained, we expect this GA-based method to advance the research in computational intelligence for finance and provide an effective solution to pairs trading for investment in practice.
Awasthi, Pamita; Dogra, Shilpa; Barthwal, Ritu
2013-10-05
The interaction of mitoxantrone with alternating Poly(dG-dC).Poly(dG-dC) and Poly(dA-dT).Poly(dA-dT) duplex has been studied by absorption, fluorescence and Circular Dichroism (CD) spectroscopy at Drug to Phosphate base pair ratios D/P=20.0-0.04. Binding to GC polymer occurs in two distinct modes: partial stacking characterized by red shifts of 18-23nm at D/P=0.2-0.8 and external binding at D/P=1.0-20.0 whereas that to AT polymer occurs externally in the entire range of D/P. The binding constant and number of binding sites is 3.7×10(5)M(-1), 0.3 and 1.3× 10(4)M(-1), 1.5 in GC and AT polymers, respectively at low D/P ratios. CD binding isotherms show breakpoints at D/P=0.1, 0.5 and 0.25, 0.5 in GC and AT polymers, respectively. The intrinsic CD bands indicate that the distortions in GC polymer are significantly higher than that in AT polymer. Docking studies show partial insertion of mitoxantrone rings between to GC base pairs in alternating GC polymer. Side chains of mitoxantrone interact specifically with base pairs and DNA backbone. The studies are relevant to the understanding of suppression or inhibition of DNA cleavage on formation of ternary complex with topoisomerase-II enzyme and hence the anti cancer action. Copyright © 2013 Elsevier B.V. All rights reserved.
Development and Validation of a GC-FID Method for Diagnosis of Methylmalonic Acidemia
Directory of Open Access Journals (Sweden)
Fatemeh Keyfi
2016-05-01
Full Text Available Background: Urinary organic acids are water-soluble intermediates and end products of the metabolism of amino acids, carbohydrates, lipids, and a number of other metabolic processes. In the hereditary diseases known as organic acidurias, an enzyme or co-factor defect in a metabolic pathway leads to the accumulation and increased excretion of one or more of these acidic metabolites. Gas chromatography is the most commonly-used technology to separate and identify these metabolites. In this report the analytical conditions for the determination of methylmalonic acid using a gas chromatography/flame ionization detector (GC-FID are studied with the aim to establish a method to analyze organic acids in human urine. Methods: Studies included the GC-FID method development, the conditions of the derivatization (trimethylsilylation reaction, and the stability of the methylmalonic acid standard solution and trimethylsilyl derivatives during storage. Also, a systematic comparison between GC-FID and gas chromatography/mass spectrometry (GC-MS was performed. Results: The highest resolution and sensitivity were obtained at 60 oC with a 30 min reaction time. Standard solutions and derivatized samples were stable for 7 days at 4-8 oC. Relative standard deviations of within-day and day-to-day assay results were less than 5%. Methylmalonic acid was detected in thirty human urine samples by the proposed GC-FID, and the results were compared with gold standard technique GC-MS. The correlation coefficient between GC-MS and GC-FID was obtained with R2= 0.997. Conclusions: The developed method was applied to the quantitative analysis of methylmalonic acid in urine from hospitalized children with methylmalonic acidemia. With this method we aim to support pediatric clinics in Iran and assist in clinical diagnostics.
Deuterium isotope effects and fractionation factors of hydrogen-bonded A:T base pairs of DNA
International Nuclear Information System (INIS)
Vakonakis, Ioannis; Salazar, Miguel; Kang, Mijeong; Dunbar, Kim R.; Li Wang, Andy C.
2003-01-01
Deuterium isotope effects and fractionation factors of N1...H3-N3 hydrogen bonded Watson-Crick A:T base pairs of two DNA dodecamers are presented here. Specifically, two-bond deuterium isotope effects on the chemical shifts of 13 C2 and 13 C4, 2 Δ 13 C2 and 2 Δ 13 C4, and equilibrium deuterium/protium fractionation factors of H3, Φ, were measured and seen to correlate with the chemical shift of the corresponding imino proton, δ H3 . Downfield-shifted imino protons associated with larger values of 2 Δ 13 C2 and 2 Δ 13 C4 and smaller Φ values, which together suggested that the effective H3-N3 vibrational potentials were more anharmonic in the stronger hydrogen bonds of these DNA molecules. We anticipate that 2 Δ 13 C2, 2 Δ 13 C4 and Φ values can be useful gauges of hydrogen bond strength of A:T base pairs
Chakraborty, Debayan; Wales, David J
2018-01-04
The recent discovery that Hoogsteen (HG) base pairs are widespread in DNA across diverse sequences and positional contexts could have important implications for understanding DNA replication and DNA-protein recognition. While evidence is emerging that the Hoogsteen conformation could be a thermodynamically accessible conformation of the DNA duplex and provide a means to expand its functionality, relatively little is known about the molecular mechanism underlying the Watson-Crick (WC) to HG transition. In this Perspective, we describe pathways and kinetics for this transition at an atomic level of detail, using the energy landscape perspective. We show that competition between the duplex conformations results in a double funnel landscape, which explains some recent experimental observations. The interconversion pathways feature a number of intermediates, with a variable number of WC and HG base pairs. The relatively slow kinetics, with possible deviations from two-state behavior, suggest that this conformational switch is likely to be a challenging target for both simulation and experiment.
Biased Gene Conversion and GC-Content Evolution in the Coding Sequences of Reptiles and Vertebrates
Figuet, Emeric; Ballenghien, Marion; Romiguier, Jonathan; Galtier, Nicolas
2015-01-01
Mammalian and avian genomes are characterized by a substantial spatial heterogeneity of GC-content, which is often interpreted as reflecting the effect of local GC-biased gene conversion (gBGC), a meiotic repair bias that favors G and C over A and T alleles in high-recombining genomic regions. Surprisingly, the first fully sequenced nonavian sauropsid (i.e., reptile), the green anole Anolis carolinensis, revealed a highly homogeneous genomic GC-content landscape, suggesting the possibility that gBGC might not be at work in this lineage. Here, we analyze GC-content evolution at third-codon positions (GC3) in 44 vertebrates species, including eight newly sequenced transcriptomes, with a specific focus on nonavian sauropsids. We report that reptiles, including the green anole, have a genome-wide distribution of GC3 similar to that of mammals and birds, and we infer a strong GC3-heterogeneity to be already present in the tetrapod ancestor. We further show that the dynamic of coding sequence GC-content is largely governed by karyotypic features in vertebrates, notably in the green anole, in agreement with the gBGC hypothesis. The discrepancy between third-codon positions and noncoding DNA regarding GC-content dynamics in the green anole could not be explained by the activity of transposable elements or selection on codon usage. This analysis highlights the unique value of third-codon positions as an insertion/deletion-free marker of nucleotide substitution biases that ultimately affect the evolution of proteins. PMID:25527834
Kwon, Dongwook; Ko, Myoung-Soo; Yang, Jung-Seok; Kwon, Man Jae; Lee, Seung-Woo; Lee, Seunghak
2015-08-01
Hydrocarbons found in the environment are typically characterized by gas chromatography (GC). The shape of the GC chromatogram has been used to identify the source of petroleum contamination. However, the conventional practice of simply comparing the peak patterns of source products to those of environmental samples is dependent on the subjective decisions of individual analysts. We have developed and verified a quantitative analytical method for interpreting GC chromatograms to distinguish refined petroleum products in contaminated soils. We found that chromatograms for gasoline, kerosene, and diesel could be divided into three ranges with boundaries at C6, C8, C16, and C26. In addition, the relative peak area (RPA(GC)) of each range, a dimensionless ratio of the peak area within each range to that of the total range (C6-C26), had a unique value for each petroleum product. An identification index for GC chromatograms (ID(GC)), defined as the ratio of RPA(GC) of C8-C16 to that of C16-C26, was able to identify diesel and kerosene sources in samples extracted from artificially contaminated soils even after weathering. Thus, the ID(GC) can be used to effectively distinguish between refined petroleum products in contaminated soils.
Pradhan, Vivek; Saha, Krishna K; Banerjee, Tathagata; Evans, John C
2014-07-30
Inference on the difference between two binomial proportions in the paired binomial setting is often an important problem in many biomedical investigations. Tang et al. (2010, Statistics in Medicine) discussed six methods to construct confidence intervals (henceforth, we abbreviate it as CI) for the difference between two proportions in paired binomial setting using method of variance estimates recovery. In this article, we propose weighted profile likelihood-based CIs for the difference between proportions of a paired binomial distribution. However, instead of the usual likelihood, we use weighted likelihood that is essentially making adjustments to the cell frequencies of a 2 × 2 table in the spirit of Agresti and Min (2005, Statistics in Medicine). We then conduct numerical studies to compare the performances of the proposed CIs with that of Tang et al. and Agresti and Min in terms of coverage probabilities and expected lengths. Our numerical study clearly indicates that the weighted profile likelihood-based intervals and Jeffreys interval (cf. Tang et al.) are superior in terms of achieving the nominal level, and in terms of expected lengths, they are competitive. Finally, we illustrate the use of the proposed CIs with real-life examples. Copyright © 2014 John Wiley & Sons, Ltd.
Optimasi Instrumen GC Shimadzu-2014 Terhadap Beberapa Senyawa Metil Ester Asam Lemak (FAME)
Tanaty, Muhammad Zaid M. M; Pontoh, Julius; Fatimah, Feti
2016-01-01
Telah dilakukan penelitian mengenai penentuan batas deteksi (LOD) dan respon faktor (RF) GC Shimadzhu-2014 terhadap beberapa senyawa metil ester asam lemak (FAME). Adapun kajian yang dilakukan meliputi pembuatan dan pengenceran larutan FAME standard serta analisis dengan GC sebanyak 2 kali pengulangan sehingga didapat kurva standar senyawa FAME. Berdasarkan hasil analisis dengan GC, kurva standar masing-masing senyawa FAME memiliki presisi yang cukup baik yakni berkisar antara 0.995-0.999. Pe...
Makarova, Alena V; Ignatov, Artem; Miropolskaya, Nataliya; Kulbachinskiy, Andrey
2014-10-01
Human DNA polymerase iota (Pol ι) is a Y-family polymerase that can bypass various DNA lesions but possesses very low fidelity of DNA synthesis in vitro. Structural analysis of Pol ι revealed a narrow active site that promotes noncanonical base-pairing during catalysis. To better understand the structure-function relationships in the active site of Pol ι we investigated substitutions of individual amino acid residues in its fingers domain that contact either the templating or the incoming nucleotide. Two of the substitutions, Y39A and Q59A, significantly decreased the catalytic activity but improved the fidelity of Pol ι. Surprisingly, in the presence of Mn(2+) ions, the wild-type and mutant Pol ι variants efficiently incorporated nucleotides opposite template purines containing modifications that disrupted either Hoogsteen or Watson-Crick base-pairing, suggesting that Pol ι may use various types of interactions during nucleotide addition. In contrast, in Mg(2+) reactions, wild-type Pol ι was dependent on Hoogsteen base-pairing, the Y39A mutant was essentially inactive, and the Q59A mutant promoted Watson-Crick interactions with template purines. The results suggest that Pol ι utilizes distinct mechanisms of nucleotide incorporation depending on the metal cofactor and reveal important roles of specific residues from the fingers domain in base-pairing and catalysis. Copyright © 2014 Elsevier B.V. All rights reserved.
Yamamoto, Nobuto; Suyama, Hirofumi; Yamamoto, Nobuyuki; Ushijima, Naofumi
2008-01-15
Serum vitamin D3-binding protein (Gc protein) is the precursor for the principal macrophage activating factor (MAF). The MAF precursor activity of serum Gc protein of breast cancer patients was lost or reduced because Gc protein was deglycosylated by serum alpha-N-acetylgalactosaminidase (Nagalase) secreted from cancerous cells. Patient serum Nagalase activity is proportional to tumor burden. The deglycosylated Gc protein cannot be converted to MAF, resulting in no macrophage activation and immunosuppression. Stepwise incubation of purified Gc protein with immobilized beta-galactosidase and sialidase generated probably the most potent macrophage activating factor (termed GcMAF) ever discovered, which produces no adverse effect in humans. Macrophages treated in vitro with GcMAF (100 pg/ml) are highly tumoricidal to mammary adenocarcinomas. Efficacy of GcMAF for treatment of metastatic breast cancer was investigated with 16 nonanemic patients who received weekly administration of GcMAF (100 ng). As GcMAF therapy progresses, the MAF precursor activity of patient Gc protein increased with a concomitant decrease in serum Nagalase. Because of proportionality of serum Nagalase activity to tumor burden, the time course progress of GcMAF therapy was assessed by serum Nagalase activity as a prognostic index. These patients had the initial Nagalase activities ranging from 2.32 to 6.28 nmole/min/mg protein. After about 16-22 administrations (approximately 3.5-5 months) of GcMAF, these patients had insignificantly low serum enzyme levels equivalent to healthy control enzyme levels, ranging from 0.38 to 0.63 nmole/min/mg protein, indicating eradication of the tumors. This therapeutic procedure resulted in no recurrence for more than 4 years. Copyright 2007 Wiley-Liss, Inc.
Preparation of WO3/g-C3N4 composites and their application in oxidative desulfurization
Zhao, Rongxiang; Li, Xiuping; Su, Jianxun; Gao, Xiaohan
2017-01-01
WO3/graphitic carbon nitride (g-C3N4) composites were successfully synthesized through direct calcining of a mixture of WO3 and g-C3N4 at 400 °C for 2 h. The WO3 was prepared by calcination of phosphotungstic acid at 550 °C for 4 h, and the g-C3N4 was obtained by calcination of melamine at 520 °C for 4 h. The WO3/g-C3N4 composites were characterized by X-ray diffraction (XRD), Scanning electron microscopy (SEM), Fourier-transform infrared spectroscopy (FT-IR), and Brunner-Emmett-Teller analysis (BET). The WO3/g-C3N4 composites exhibited stronger XRD peaks of WO3 and g-C3N4 than the WO3 and pure g-C3N4. In addition, two WO3 peaks at 25.7° and 26.6° emerged for the 36% -WO3/g-C3N4 composite. This finding indicated that WO3 was highly dispersed on the surface of the g-C3N4 nanosheets and interacted with the nanosheets, which resulted in the appearance of (012) and (022) planes of WO3. The WO3/g-C3N4 composite also exhibited a larger specific surface area and higher degree of crystallization than WO3 or pure g-C3N4, which resulted in high catalytic activity of the catalyst. Desulfurization experiments demonstrated that the desulfurization rate of dibenzothiophene (DBT) in model oil reached 91.2% under optimal conditions. Moreover, the activity of the catalyst was not significantly decreased after five recycles.
Xia, Shuangluo; Konigsberg, William H
2014-04-01
Recent structures of DNA polymerase complexes with dGMPCPP/dT and dCTP/dA mispairs at the insertion site have shown that they adopt Watson-Crick geometry in the presence of Mn(2+) indicating that the tautomeric or ionization state of the base has changed. To see whether the tautomeric or ionization state of base-pair could be affected by its microenvironment, we determined 10 structures of an RB69 DNA polymerase quadruple mutant with dG/dT or dT/dG mispairs at position n-1 to n-5 of the Primer/Template duplex. Different shapes of the mispairs, including Watson-Crick geometry, have been observed, strongly suggesting that the local environment of base-pairs plays an important role in their tautomeric or ionization states. © 2014 The Protein Society.
Amino Acid Usage Is Asymmetrically Biased in AT- and GC-Rich Microbial Genomes
DEFF Research Database (Denmark)
Bohlin, Jon; Brynildsrud, Ola Brønstad; Vesth, Tammi Camilla
2013-01-01
frequencies were distributed in over 2000 microbial genomes and how these distributions were affected by base compositional changes. In addition, we wanted to know how genome-wide amino acid usage was biased in the different genomes and how changes to base composition and mutations affected this bias...... purifying selection than genomes with higher AAUB. Conclusion: Genomic base composition has a substantial effect on both amino acid- and codon frequencies in bacterial genomes. While phylogeny influenced amino acid usage more in GC-rich genomes, AT-content was driving amino acid usage in AT-rich genomes. We...
Photosynthetic CO2 fixation in guard cells (GC)
International Nuclear Information System (INIS)
Gotow, K.; Taylor, S.; Zeiger, E.
1987-01-01
Recent studies indicate that carbon metabolism in GC is modulated by light quality. The fate of 14 CO 2 supplied to highly purified Vicia GC protoplasts irradiated with red light was investigated. The suspension was stirred at 25 0 C and dark-adapted for 5 min. After 5 min. in red light, 4.8 uCi of NaH 14 CO 3 was added (final concentration: 100 uM). Metabolism was quenched after 30 s with boiling ethanol. Anionic compounds were separated by 2D PC and TLC, and quantified. Rates of CO 2 fixation were 5- to 8-fold higher in the light. In the dark, malate and aspartate had 90% of the total label; in the light, 3-PGA, sugar monophosphates (SMP) and sugar diophosphates (SDP) had up to 60% of the label. Phosphates treatment and rechromatography of labelled SDP showed the presence of ribulose, a specific PCRP metabolite. In time-course experiments, labelled 3-PGA was detected within 5 s. With time, the percentage of label in 3-PGA decreased and that in SMP increased. The authors conclude that 3-PGA is a primary carboxylation product of the PCRP in GC and that the activity of the PCRP and PEP-carboxylase is metabolically regulated
Directory of Open Access Journals (Sweden)
Veronica Sberveglieri
2016-12-01
Full Text Available To determine the originality of a typical Italian Parmigiano Reggiano cheese, it is crucial to define and characterize its quality, ripening period, and geographical origin. Different analytical techniques have been applied aimed at studying the organoleptic and characteristic volatile organic compounds (VOCs profile of this cheese. However, most of the classical methods are time consuming and costly. The aim of this work was to illustrate a new simple, portable, fast, reliable, non-destructive, and economic sensor device S3 based on an array of six metal oxide semiconductor nanowire gas sensors to assess and discriminate the quality ranking of grated Parmigiano Reggiano cheese samples and to identify the VOC biomarkers using a headspace SPME-GC-MS. The device could clearly differentiate cheese samples varying in quality and ripening time when the results were analyzed by multivariate statistical analysis involving principal component analysis (PCA. Similarly, the volatile constituents of Parmigiano Reggiano identified were consistent with the compounds intimated in the literature. The obtained results show the applicability of an S3 device combined with SPME-GC-MS and sensory evaluation for a fast and high-sensitivity analysis of VOCs in Parmigiano Reggiano cheese and for the quality control of this class of cheese.
Inui, Toshio; Amitani, Haruka; Kubo, Kentaro; Kuchiike, Daisuke; Uto, Yoshihiro; Nishikata, Takahito; Mette, Martin
2016-07-01
Macrophage activating factor (MAF)-based immunotherapy has a wide application for use in treating many diseases via macrophage activation. Sonodynamic therapy (SDT) using low-intensity ultrasound and tumor treating field (TTF) therapy are novel therapeutic modalities. SDT is usually combined with ozone therapy to improve local hypoxia within the tumor environment. We treated a 77-year-old male diagnosed with non-small cell lung cancer ((NSCLC) stage 3B) using second-generation serum GcMAF and oral colostrum MAF-based immunotherapy combined with SDT, TTF and ozone therapies. This case report demonstrates that GcMAF, oral colostrum MAF, SDT, TTF and ozone therapy can be used for NSCLC without adverse effects. This case report suggests a new concept of cancer treatment using local destruction of cancer tissue, in this case conducted with SDT and TTF therapy, to be used in combination with serum GcMAF and colostrum MAF immunotherapy as a systemic treatment. Copyright© 2016 International Institute of Anticancer Research (Dr. John G. Delinassios), All rights reserved.
iGC-an integrated analysis package of gene expression and copy number alteration.
Lai, Yi-Pin; Wang, Liang-Bo; Wang, Wei-An; Lai, Liang-Chuan; Tsai, Mong-Hsun; Lu, Tzu-Pin; Chuang, Eric Y
2017-01-14
With the advancement in high-throughput technologies, researchers can simultaneously investigate gene expression and copy number alteration (CNA) data from individual patients at a lower cost. Traditional analysis methods analyze each type of data individually and integrate their results using Venn diagrams. Challenges arise, however, when the results are irreproducible and inconsistent across multiple platforms. To address these issues, one possible approach is to concurrently analyze both gene expression profiling and CNAs in the same individual. We have developed an open-source R/Bioconductor package (iGC). Multiple input formats are supported and users can define their own criteria for identifying differentially expressed genes driven by CNAs. The analysis of two real microarray datasets demonstrated that the CNA-driven genes identified by the iGC package showed significantly higher Pearson correlation coefficients with their gene expression levels and copy numbers than those genes located in a genomic region with CNA. Compared with the Venn diagram approach, the iGC package showed better performance. The iGC package is effective and useful for identifying CNA-driven genes. By simultaneously considering both comparative genomic and transcriptomic data, it can provide better understanding of biological and medical questions. The iGC package's source code and manual are freely available at https://www.bioconductor.org/packages/release/bioc/html/iGC.html .
International Nuclear Information System (INIS)
Krull, I.S.; Swartz, M.; Driscoll, J.N.
1984-01-01
Pentafluorophenyldimethylsilyl chloride (flophemesyl chloride, Fl) is a well known derivatization reagent for improved electron capture detection (ECD) in gas chromatography (GC)(GC-ECD), but it has never been utilized for improved detectability and sensitivity in GC-photoionization detection (GC-PID). A wide variety of flophemesyl alcohol derivatives have been used in order to show a new approach for realizing greatly reduced minimum detection limits (MDL) of virtually all alcohol derivatives in GC-PID analysis. This particular derivatization approach is inexpensive and easy to apply, leading to quantitative or near 100% conversion of the starting alcohols to the expected flophemesyl ethers (silyl ethers). Detection limits can be lowered by 2-3 orders of magnitude for such derivatives when compared with the starting alcohols, along with calibration plots that are linear over 5-7 orders of magnitude. Specific GC conditions have been developed for many flophemesyl derivatives, in all cases using packed columns. Both ECD and PID relative response factors (RRFs) and normalized RRFs have been determined, and such ratios can now be used for improved analytic identification from complex sample matrices, where appropriate. 28 references, 2 figures, 5 tables
PAIR'14 / PAIR'15 STUDENT CONFERENCES ON PLANNING IN ARTIFICIAL INTELLIGENCE AND ROBOTICS
Directory of Open Access Journals (Sweden)
Editorial Foreword
2015-12-01
Full Text Available Dear Readerthe original idea of the student conference on “Planning in Artificial Intelligence and Robotics” (PAIR is to join young researchers from particular laboratories in Czech Republic, where planning problems are investigated from artificial intelligence (AI or robotics points of view. The first year of PAIR has been organized at the Dept. of Computer Science, Faculty Electrical Engineering, Czech Technical University in 2014.At PAIR 2014, laboratories from Prague and Brno were presented. In particular, students and researchers from Charles University, Czech Technical University in Prague, Brno University of Technology, and Central European Institute of Technology participated at the event. Beside an introduction of the particular research groups and their topics, students presented contributions on their current research results. Ten papers were presented on topics ranging from domain–independent planning, trajectory planning to applications for unmanned aerial and legged robots. This first event provides us an initial experience with the community of young researchers in Czech Republic that are working planning in robotic or AI. Based on the success of PAIR 2014, we decided to continue with our effort to establish a suitable fora for students that are geographically very close, but usually do not meet, because of participation on different Robotics and AI events.The second student conference on Planning in Artificial Intelligence and Robotics (PAIR 2015 successfully continues the tradition of the first year of the conference organized in Prague. This year, the conference was collocated with 10th anniversary of RoboTour contest in Písek. This format enable us to extend the impact of the PAIR conference and improve the visibility of the growing student community. The conference reached a good amount of interesting papers focused on image processing for mobile robots, swarm control, driving simulation, robot control, or domain
Zhou, Fei; Zhao, Yajing; Peng, Jiyu; Jiang, Yirong; Li, Maiquan; Jiang, Yuan; Lu, Baiyi
2017-07-01
Osmanthus fragrans flowers are used as folk medicine and additives for teas, beverages and foods. The metabolites of O. fragrans flowers from different geographical origins were inconsistent in some extent. Chromatography and mass spectrometry combined with multivariable analysis methods provides an approach for discriminating the origin of O. fragrans flowers. To discriminate the Osmanthus fragrans var. thunbergii flowers from different origins with the identified metabolites. GC-MS and UPLC-PDA were conducted to analyse the metabolites in O. fragrans var. thunbergii flowers (in total 150 samples). Principal component analysis (PCA), soft independent modelling of class analogy analysis (SIMCA) and random forest (RF) analysis were applied to group the GC-MS and UPLC-PDA data. GC-MS identified 32 compounds common to all samples while UPLC-PDA/QTOF-MS identified 16 common compounds. PCA of the UPLC-PDA data generated a better clustering than PCA of the GC-MS data. Ten metabolites (six from GC-MS and four from UPLC-PDA) were selected as effective compounds for discrimination by PCA loadings. SIMCA and RF analysis were used to build classification models, and the RF model, based on the four effective compounds (caffeic acid derivative, acteoside, ligustroside and compound 15), yielded better results with the classification rate of 100% in the calibration set and 97.8% in the prediction set. GC-MS and UPLC-PDA combined with multivariable analysis methods can discriminate the origin of Osmanthus fragrans var. thunbergii flowers. Copyright © 2017 John Wiley & Sons, Ltd. Copyright © 2017 John Wiley & Sons, Ltd.
Directory of Open Access Journals (Sweden)
Suzuki Haruo
2009-12-01
Full Text Available Abstract Background Due to their bi-directional replication machinery starting from a single finite origin, bacterial genomes show characteristic nucleotide compositional bias between the two replichores, which can be visualised through GC skew or (C-G/(C+G. Although this polarisation is used for computational prediction of replication origins in many bacterial genomes, the degree of GC skew visibility varies widely among different species, necessitating a quantitative measurement of GC skew strength in order to provide confidence measures for GC skew-based predictions of replication origins. Results Here we discuss a quantitative index for the measurement of GC skew strength, named the generalised GC skew index (gGCSI, which is applicable to genomes of any length, including bacterial chromosomes and plasmids. We demonstrate that gGCSI is independent of the window size and can thus be used to compare genomes with different sizes, such as bacterial chromosomes and plasmids. It can suggest the existence of different replication mechanisms in archaea and of rolling-circle replication in plasmids. Correlation of gGCSI values between plasmids and their corresponding host chromosomes suggests that within the same strain, these replicons have reproduced using the same replication machinery and thus exhibit similar strengths of replication strand skew. Conclusions gGCSI can be applied to genomes of any length and thus allows comparative study of replication-related mutation and selection pressures in genomes of different lengths such as bacterial chromosomes and plasmids. Using gGCSI, we showed that replication-related mutation or selection pressure is similar for replicons with similar machinery.
A simple method for assessment of human anti-Neu5Gc antibodies applied to Kawasaki disease.
Directory of Open Access Journals (Sweden)
Vered Padler-Karavani
Full Text Available N-glycolylneuraminic acid (Neu5Gc is an immunogenic sugar of dietary origin that metabolically incorporates into diverse native glycoconjugates in humans. Anti-Neu5Gc antibodies are detected in all human sera, though with variable levels and epitope-recognition profiles. These antibodies likely play a role in several inflammation-mediated pathologies including cardiovascular diseases and cancer. In cancer, they have dualistic and opposing roles, either stimulating or repressing disease, as a function of their dose, and some of these antibodies serve as carcinoma biomarkers. Thus, anti-Neu5Gc antibodies may signify risk of inflammation-mediated diseases, and changes in their levels could potentially be used to monitor disease progression and/or response to therapy. Currently, it is difficult to determine levels of anti-Neu5Gc antibodies in individual human samples because these antibodies recognize multiple Neu5Gc-epitopes. Here we describe a simple and specific method for detection and overall estimation of human anti-Neu5Gc antibodies. We exploit the difference between two mouse models that differ only by Neu5Gc-presence (wild-type or Neu5Gc-absence (Cmah(-/- knockout. We characterize mouse serum from both strains by HPLC, lectin and mass-spectrometry analysis and show the target Neu5Gc-epitopes. We then use Cmah(-/- knockout sera to inhibit all non-Neu5Gc-reactivity followed by binding to wild-type sera to detect overall anti-Neu5Gc response in a single assay. We applied this methodology to characterize and quantify anti-Neu5Gc IgG and IgA in sera of patients with Kawasaki disease (KD at various stages compared to controls. KD is an acute childhood febrile disease characterized by inflammation of coronary arteries that untreated may lead to coronary artery aneurysms with risk of thrombosis and myocardial infarction. This estimated response is comparable to the average of detailed anti-Neu5Gc IgG profile analyzed by a sialoglycan microarray
On-line Analysis of Catalytic Reaction Products Using a High-Pressure Tandem Micro-reactor GC/MS.
Watanabe, Atsushi; Kim, Young-Min; Hosaka, Akihiko; Watanabe, Chuichi; Teramae, Norio; Ohtani, Hajime; Kim, Seungdo; Park, Young-Kwon; Wang, Kaige; Freeman, Robert R
2017-01-01
When a GC/MS system is coupled with a pressurized reactor, the separation efficiency and the retention time are directly affected by the reactor pressure. To keep the GC column flow rate constant irrespective of the reaction pressure, a restrictor capillary tube and an open split interface are attached between the GC injection port and the head of a GC separation column. The capability of the attached modules is demonstrated for the on-line GC/MS analysis of catalytic reaction products of a bio-oil model sample (guaiacol), produced under a pressure of 1 to 3 MPa.
Ni2+-binding RNA motifs with an asymmetric purine-rich internal loop and a G-A base pair.
Hofmann, H P; Limmer, S; Hornung, V; Sprinzl, M
1997-01-01
RNA molecules with high affinity for immobilized Ni2+ were isolated from an RNA pool with 50 randomized positions by in vitro selection-amplification. The selected RNAs preferentially bind Ni2+ and Co2+ over other cations from first series transition metals. Conserved structure motifs, comprising about 15 nt, were identified that are likely to represent the Ni2+ binding sites. Two conserved motifs contain an asymmetric purine-rich internal loop and probably a mismatch G-A base pair. The structure of one of these motifs was studied with proton NMR spectroscopy and formation of the G-A pair at the junction of helix and internal loop was demonstrated. Using Ni2+ as a paramagnetic probe, a divalent metal ion binding site near this G-A base pair was identified. Ni2+ ions bound to this motif exert a specific stabilization effect. We propose that small asymmetric purine-rich loops that contain a G-A interaction may represent a divalent metal ion binding site in RNA. PMID:9409620
Li, Kaiyun; Fu, Qiufang; Sun, Xunwei; Zhou, Xiaoyan; Fu, Xiaolan
2016-01-01
It remains unclear whether probabilistic category learning in the feedback-based weather prediction task (FB-WPT) can be mediated by a non-declarative or procedural learning system. To address this issue, we compared the effects of training time and verbal working memory, which influence the declarative learning system but not the non-declarative learning system, in the FB and paired-associate (PA) WPTs, as the PA task recruits a declarative learning system. The results of Experiment 1 showed...
Wang, Yanyun; Zhao, Shuo; Zhang, Yiwei; Fang, Jiasheng; Zhou, Yuming; Yuan, Shenhao; Zhang, Chao; Chen, Wenxia
2018-05-01
Graphite carbon nitride (g-C3N4), as a promising low cost, visible light driven conjugated polymer semiconductor photocatalyst, has attracted wide attentions from researchers. However, low light absorption efficiency and inadequate charge separation limit the potential applications of g-C3N4. This paper exhibits K-doped g-C3N4 prepared by a facile thermal polymerization with KBr as the K source. The experiments of photocatalytic hydrogen evolution demonstrate that KBr content strongly affects the activity of the catalyst. XRD, FT-IR, XPS, SEM, TEM, UV-vis diffuse reflectance spectra, photoluminescence (PL) characterization methods are used to study the effects of potassium on the catalyst performance. The results find that K-modified g-C3N4 has a narrower band gap and enhanced light harvesting properties. Moreover, the photocatalytic hydrogen evolution rate (HER) of the optimized K-doped g-C3N4 nanosheets (10 wt % KBr) reaches 1337.2 μmol g-1h-1, which is about 5.6 times in comparison with that of pure g-C3N4 (239.8 μmol g-1h-1). The doping of the potassium may increase the π-conjugated systems and accelerate the electron transport rate, then improve the photocatalytic properties. Based on the results of the analysis, a possible mechanism is proposed.
Czech Academy of Sciences Publication Activity Database
Šebera, Jakub; Tanaka, Y.; Ono, A.; Sychrovský, Vladimír
2016-01-01
Roč. 452, Oct 1 (2016), s. 199-204 ISSN 0020-1693 R&D Projects: GA ČR GA13-27676S Institutional support: RVO:61388963 Keywords : DFT * metal-mediated base pairs * Hg * Ag Subject RIV: CF - Physical ; Theoretical Chemistry Impact factor: 2.002, year: 2016
Generalized pairing strategies-a bridge from pairing strategies to colorings
Directory of Open Access Journals (Sweden)
Győrffy Lajos
2016-12-01
Full Text Available In this paper we define a bridge between pairings and colorings of the hypergraphs by introducing a generalization of pairs called t-cakes for t ∈ ℕ, t ≥ 2. For t = 2 the 2-cakes are the same as the well-known pairs of system of distinct representatives, that can be turned to pairing strategies in Maker-Breaker hypergraph games, see Hales and Jewett [12]. The two-colorings are the other extremity of t-cakes, in which the whole ground set of the hypergraph is one big cake that we divide into two parts (color classes. Starting from the pairings (2-cake placement and two-colorings we define the generalized t-cake placements where we pair p elements by q elements (p, q ∈ ℕ, 1 ≤ p, q < t, p + q = t.
International Nuclear Information System (INIS)
Muhammad, N.; Khan, A.Z.; Barkatullah, A.; Ibrar, M.
2013-01-01
In the present study, the essential oils of the leaves of Zanthoxylum armatum (ZEO) were screened for various behavioral properties viz., sedative-hypnotic, anxiolytic, antidepressant, and muscle relaxant activities. In sedative-hypnotic assays, ZEO demonstrated marked reduction in mice movement in open field test at 100 and 200 mg/kg i.p. and potentiated the duration of sleep, in phenobarbitone induced sleeping mice. Profound reduction in the number of steps and rearing were observed at 100 and 200 mg/kg in a dose dependent manner. When analyzed in forced swimming test, it was devoid of any antidepressant effect at test doses. Similarly, ZEO showed significant muscle relaxant activity at 100 and 200 mg/kg i.p. in both chimney test and inclined plant test. GC/GC-MS analysis of ZEO led to the identification of 34 components, linalool being the most dominant constituent. The results suggested that ZEO has strong sedative-hypnotic, anxiolytic and muscle relaxant properties in various animal models. (author)
The DBP Phenotype Gc-1f/Gc-1f Is Associated with Reduced Risk of Cancer. The Tromsø Study.
Directory of Open Access Journals (Sweden)
Rolf Jorde
Full Text Available In addition to its role as a transport protein, the vitamin D binding protein (DBP may also affect lipid metabolism, inflammation and carcinogenesis. There are three common variants of the DBP, Gc1s (1s, Gc1f (1f, Gc2 (2 that result in six common phenotypes (1s/1s, 1s/1f, 1s/2, 1f/1f, 1f/2, and 2/2. These phenotypes can be identified by genotyping for the two single nucleotide polymorphisms rs7041 and rs4588 in the GC gene. The DBP variants have different binding coefficients for the vitamin D metabolites, and accordingly there may be important relations between DBP phenotypes and health.DNA was prepared from subjects who participated in the fourth survey of the Tromsø Study in 1994-1995 and who were registered with the endpoints myocardial infarction (MI, type 2 diabetes (T2DM, cancer or death as well as a randomly selected control group. The endpoint registers were complete up to 2010- 2013. Genotyping was performed for rs7041 and rs4588 and serum 25-hydroxyvitamin D (25(OHD was measured.Genotyping for rs7041 and rs4588 was performed successfully in 11 704 subjects. Among these, 1660 were registered with incident MI, 958 with T2DM, 2410 with cancer and 4318 had died. Subjects with the DBP phenotype 1f/1f had 23 - 26 % reduced risk of incident cancer compared to the 1s/1s and 2/2 phenotypes (P < 0.02, Cox regression with gender as covariate. Differences in serum 25(OHD levels could not explain the apparent cancer protective effect of the DBP variant 1f. In addition to cancer and 25(OHD, there were significant associations between DBP phenotype and body height, hip circumference and serum calcium.There are important biological differences between the common DBP phenotypes. If the relation between the DBP variant 1f and cancer is confirmed in other studies, determination of DBP phenotype may have clinical importance.
Multi-user distribution of polarization entangled photon pairs
Energy Technology Data Exchange (ETDEWEB)
Trapateau, J.; Orieux, A.; Diamanti, E.; Zaquine, I., E-mail: isabelle.zaquine@telecom-paristech.fr [LTCI, CNRS, Télécom ParisTech, Université Paris-Saclay, 75013 Paris (France); Ghalbouni, J. [Applied Physics Laboratory, Faculty of Sciences 2, Lebanese University, Campus Fanar, BP 90656 Jdeidet (Lebanon)
2015-10-14
We experimentally demonstrate multi-user distribution of polarization entanglement using commercial telecom wavelength division demultiplexers. The entangled photon pairs are generated from a broadband source based on spontaneous parametric down conversion in a periodically poled lithium niobate crystal using a double path setup employing a Michelson interferometer and active phase stabilisation. We test and compare demultiplexers based on various technologies and analyze the effect of their characteristics, such as losses and polarization dependence, on the quality of the distributed entanglement for three channel pairs of each demultiplexer. In all cases, we obtain a Bell inequality violation, whose value depends on the demultiplexer features. This demonstrates that entanglement can be distributed to at least three user pairs of a network from a single source. Additionally, we verify for the best demultiplexer that the violation is maintained when the pairs are distributed over a total channel attenuation corresponding to 20 km of optical fiber. These techniques are therefore suitable for resource-efficient practical implementations of entanglement-based quantum key distribution and other quantum communication network applications.
Organotin analysis by gas chromatography-pulsed flame-photometric detection (GC-PFPD)
Energy Technology Data Exchange (ETDEWEB)
Leermakers, M.; Nuyttens, J.; Baeyens, W. [Vrije Universiteit Brussel, Analytical and Environmental Chemistry (ANCH), Brussel (Belgium)
2005-03-01
Monobutyltin (MBuT), dibutyltin (DBuT), and tributyltin (TBuT) mixtures have been separated and quantified by gas chromatography with pulsed flame-photometric detection (GC-PFPD). The compounds were first derivatized with NaBEt{sub 4}, then extracted with hexane and injected into the GC in splitless mode. Optimum GC and detector conditions were established. For GC, various injector temperatures and oven temperature programs were tested. For the PFPD detector, gate settings (gate delay and gate width) and detector temperature were optimized. A very good linearity was obtained up to 100-150 ppb for all organotin compounds. The detection limits obtained were: MBuT (0.7 ppb), DBuT (0.8 ppb), and TBuT (0.6 ppb). RSD for repeatability and reproducibility were well below 20% when the instrument was in routine operation. A biological sample (CRM 477) was also analyzed for organotins. Extraction from the biological matrix was performed with TMAH. Besides the increased risk of contamination, the derivatization step seemed to be critical. pH and amount of derivatizing agent were tested. When using an internal standard (TPrT) between 90% and 110% of the certified amounts of organotin were recovered. (orig.)
Mondal, Sunil Kanti; Kundu, Sudip; Das, Rabindranath; Roy, Sujit
2016-08-01
Bacteria and archaea have evolved with the ability to fix atmospheric dinitrogen in the form of ammonia, catalyzed by the nitrogenase enzyme complex which comprises three structural genes nifK, nifD and nifH. The nifK and nifD encodes for the beta and alpha subunits, respectively, of component 1, while nifH encodes for component 2 of nitrogenase. Phylogeny based on nifDHK have indicated that Cyanobacteria is closer to Proteobacteria alpha and gamma but not supported by the tree based on 16SrRNA. The evolutionary ancestor for the different trees was also different. The GC1 and GC2% analysis showed more consistency than GC3% which appeared to below for Firmicutes, Cyanobacteria and Euarchaeota while highest in Proteobacteria beta and clearly showed the proportional effect on the codon usage with a few exceptions. Few genes from Firmicutes, Euryarchaeota, Proteobacteria alpha and delta were found under mutational pressure. These nif genes with low and high GC3% from different classes of organisms showed similar expected number of codons. Distribution of the genes and codons, based on codon usage demonstrated opposite pattern for different orientation of mirror plane when compared with each other. Overall our results provide a comprehensive analysis on the evolutionary relationship of the three structural nif genes, nifK, nifD and nifH, respectively, in the context of codon usage bias, GC content relationship and amino acid composition of the encoded proteins and exploration of crucial statistical method for the analysis of positive data with non-constant variance to identify the shape factors of codon adaptation index.
Basset, Jean-Marie
2016-06-09
The design of novel heterogeneous catalysts with multiple adjacent functionalities is of high interest for heterogeneous catalysis. Herein, we report a method to obtain a majority bifunctional acid-base pairs on SBA15. Aniline reacts with SBA15 by opening siloxane bridges leading to N-phenylsilanamine-silanol pairs. In contrast with ammonia treated surfaces, the material is stable under air/moisture. Advanced solid state MAS NMR: 2D ¹H-¹H double-quantum, ¹H-¹³C HETCOR experiments and dynamic nuclear polarization enhanced ²⁹Si and ¹⁵N spectra demonstrate both the close proximity between the two moieties and the formation of a covalent Si-N surface bond and confirm the design of vicinal acid-base pairs. This approach was successfully applied to the design of a series of aniline derivatives bifunctional SBA15. A correlation of the substituents effects on the aromatic ring (Hammet parameters) on the kinetics of the model reaction of Knoevenagel is observed.
Chang, Kai Lun; Ho, Paul C
2014-01-01
Findings from epidemiology, preclinical and clinical studies indicate that consumption of coffee could have beneficial effects against dementia and Alzheimer's disease (AD). The benefits appear to come from caffeinated coffee, but not decaffeinated coffee or pure caffeine itself. Therefore, the objective of this study was to use metabolomics approach to delineate the discriminant metabolites between caffeinated and decaffeinated coffee, which could have contributed to the observed therapeutic benefits. Gas chromatography time-of-flight mass spectrometry (GC-TOF-MS)-based metabolomics approach was employed to characterize the metabolic differences between caffeinated and decaffeinated coffee. Orthogonal partial least squares discriminant analysis (OPLS-DA) showed distinct separation between the two types of coffee (cumulative Q(2) = 0.998). A total of 69 discriminant metabolites were identified based on the OPLS-DA model, with 37 and 32 metabolites detected to be higher in caffeinated and decaffeinated coffee, respectively. These metabolites include several benzoate and cinnamate-derived phenolic compounds, organic acids, sugar, fatty acids, and amino acids. Our study successfully established GC-TOF-MS based metabolomics approach as a highly robust tool in discriminant analysis between caffeinated and decaffeinated coffee samples. Discriminant metabolites identified in this study are biologically relevant and provide valuable insights into therapeutic research of coffee against AD. Our data also hint at possible involvement of gut microbial metabolism to enhance therapeutic potential of coffee components, which represents an interesting area for future research.
Coria-Avila, G A; Hernández-Aguilar, M E; Toledo-Cárdenas, R; García-Hernández, L I; Manzo, J; Pacheco, P; Miquel, M; Pfaus, J G
To analyse the biological and neural bases of partner preference formation in rodents as models to understand human pair bonding. Rodents are social individuals, capable of forming short- or long-lasting partner preferences that develop slowly by stimuli like cohabitation, or rapidly by stimuli like sex and stress. Dopamine, corticosteroids, oxytocin, vasopressin, and opioids form the neurochemical substrate for pair bonding in areas like the nucleus accumbens, the prefrontal cortex, the piriform cortex, the medial preoptic area, the ventral tegmental area and the medial amygdala, among others. Additional areas may participate depending on the nature of the conditioned stimuli by which and individual recognizes a preferred partner. Animal models help us understand that the capacity of an individual to display long-lasting and selective preferences depends on neural bases, selected throughout evolution. The challenge in neuroscience is to use this knowledge to create new solutions for mental problems associated with the incapacity of an individual to display a social bond, keep one, or cope with the disruption of a consolidated one.
Thyer, Lynda; Ward, Emma; Smith, Rodney; Branca, Jacopo JV; Morucci, Gabriele; Gulisano, Massimo; Noakes, David; Eslinger, Robert; Pacini, Stefania
2013-01-01
?-N-acetylgalactosaminidase (nagalase) accumulates in the serum of cancer patients and its activity correlates with tumor burden, aggressiveness and clinical disease progression. The administration of GC protein-derived macrophage-activating factor (GcMAF) to cancer patients with elevated levels of nagalase has been associated with a decrease of serum nagalase activity and with significant clinical benefits. Here, we report the results of the administration of GcMAF to a heterogeneous cohort ...
Mondal Roy, Sutapa
2018-08-01
The quantum chemical descriptors based on density functional theory (DFT) are applied to predict the biological activity (log IC 50 ) of one class of acyl-CoA: cholesterol O-acyltransferase (ACAT) inhibitors, viz. aminosulfonyl ureas. ACAT are very effective agents for reduction of triglyceride and cholesterol levels in human body. Successful two parameter quantitative structure-activity relationship (QSAR) models are developed with a combination of relevant global and local DFT based descriptors for prediction of biological activity of aminosulfonyl ureas. The global descriptors, electron affinity of the ACAT inhibitors (EA) and/or charge transfer (ΔN) between inhibitors and model biosystems (NA bases and DNA base pairs) along with the local group atomic charge on sulfonyl moiety (∑Q Sul ) of the inhibitors reveals more than 90% efficacy of the selected descriptors for predicting the experimental log (IC 50 ) values. Copyright © 2018 Elsevier Ltd. All rights reserved.
Detecting nonlocal Cooper pair entanglement by optical Bell inequality violation
Energy Technology Data Exchange (ETDEWEB)
Nigg, Simon E.; Tiwari, Rakesh P.; Walter, Stefan; Schmidt, Thomas L. [Department of Physics, University of Basel, Klingelbergstrasse 82, 4056 Basel (Switzerland)
2015-07-01
Based on the Bardeen Cooper Schrieffer (BCS) theory of superconductivity, the coherent splitting of Cooper pairs from a superconductor to two spatially separated quantum dots has been predicted to generate nonlocal pairs of entangled electrons. In order to test this hypothesis, we propose a scheme to transfer the spin state of a split Cooper pair onto the polarization state of a pair of optical photons. We show that the produced photon pairs can be used to violate a Bell inequality, unambiguously demonstrating the entanglement of the split Cooper pairs.
Detecting nonlocal Cooper pair entanglement by optical Bell inequality violation
Nigg, Simon E.; Tiwari, Rakesh P.; Walter, Stefan; Schmidt, Thomas L.
2015-03-01
Based on the Bardeen-Cooper-Schrieffer theory of superconductivity, the coherent splitting of Cooper pairs from a superconductor to two spatially separated quantum dots has been predicted to generate nonlocal pairs of entangled electrons. In order to test this hypothesis, we propose a scheme to transfer the spin state of a split Cooper pair onto the polarization state of a pair of optical photons. We show that the photon pairs produced can be used to violate a Bell inequality, unambiguously demonstrating the entanglement of the split Cooper pairs.
Error-correcting pairs for a public-key cryptosystem
International Nuclear Information System (INIS)
Pellikaan, Ruud; Márquez-Corbella, Irene
2017-01-01
Code-based Cryptography (CBC) is a powerful and promising alternative for quantum resistant cryptography. Indeed, together with lattice-based cryptography, multivariate cryptography and hash-based cryptography are the principal available techniques for post-quantum cryptography. CBC was first introduced by McEliece where he designed one of the most efficient Public-Key encryption schemes with exceptionally strong security guarantees and other desirable properties that still resist to attacks based on Quantum Fourier Transform and Amplitude Amplification. The original proposal, which remains unbroken, was based on binary Goppa codes. Later, several families of codes have been proposed in order to reduce the key size. Some of these alternatives have already been broken. One of the main requirements of a code-based cryptosystem is having high performance t -bounded decoding algorithms which is achieved in the case the code has a t -error-correcting pair (ECP). Indeed, those McEliece schemes that use GRS codes, BCH, Goppa and algebraic geometry codes are in fact using an error-correcting pair as a secret key. That is, the security of these Public-Key Cryptosystems is not only based on the inherent intractability of bounded distance decoding but also on the assumption that it is difficult to retrieve efficiently an error-correcting pair. In this paper, the class of codes with a t -ECP is proposed for the McEliece cryptosystem. Moreover, we study the hardness of distinguishing arbitrary codes from those having a t -error correcting pair. (paper)
On the analysis of mercuric nitrate in flue gas by GC-MS
Energy Technology Data Exchange (ETDEWEB)
Olson, Edwin S.; Sharma, Ramesh K.; Pavlish, John H. [Energy and Environmental Research Center, University of North Dakota, Grand Forks, ND 58202 (United States)
2002-11-01
Recent research has demonstrated that in a simulated flue gas stream containing NO{sub 2} and SO{sub 2} elemental mercury is initially captured on a carbon or manganese oxide sorbent. After approximately an hour, however, mercury breaks through relatively rapidly, and the volatile form of mercury emitted is an oxidized species. The volatile mercury species emitted from a granular MnO{sub 2} sorbent was trapped in an impinger containing cold acetonitrile. Subsequent evaporation of 95% of the acetonitrile in a Kuderna-Danish apparatus and gas chromatography (GC) of the concentrate resulted in a single mercury-containing GC peak at 5.5 min; the retention time and mass spectrum of this compound matched exactly those of a standard mercury(II) nitrate hydrate, Hg(NO{sub 3}){sub 2}.H{sub 2}O dissolved in acetonitrile. The volatile mercury component analyzed from injection of this standard solution was shown to be a form of methylmercury that is produced in the GC column by reaction of the highly reactive mercury nitrate with the methylsiloxane GC phase. Because the on-column derivatization reaction seems to be unique to mercury nitrate, the GC-MS (gas chromatography-mass spectroscopic) analysis provides strong evidence for identification of the trapped oxidized mercury species as mercury nitrate although, because the nitrate becomes detached from the mercury atom in the on-column reaction, the identity is not proven. (orig.)
Guo, Xiurong; Seela, Frank
2017-09-04
α-d-Nucleosides are rare in nature but can develop fascinating properties when incorporated into DNA. This work reports on the first silver-mediated base pair constructed from two anomeric nucleosides: α-dC and β-dC. The hybrid base pair was integrated into the DNA and DNA/RNA double helix. A 12-mer duplex with α-dC and β-dC pair exhibits a higher thermal stability (T m =43 °C) than that incorporating the β-dC-Ag + -β-dC homo pair (T m =34 °C). Furthermore, α-dC shows excellent mismatch discrimination for DNA single nucleotide polymorphism (SNP). All four SNPs were identified on the basis of large T m value differences measured in the presence of silver ions. High resolution melting was not required. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.
Stuhne, G. R.; Peltier, W. R.
2017-12-01
We analyze the effects of nudging 100 kyr numerical simulations of the Laurentide and Fennoscandian ice sheets toward the glacial isostatic adjustment-based (GIA-based) ICE-6G_C reconstruction of the most recent ice age cycle. Starting with the ice physics approximations of the PISM ice sheet model and the SeaRISE simulation protocols, we incorporate nudging at characteristic time scales, τf, through anomalous mass balance terms in the ice mass conservation equation. As should be expected, these mass balances exhibit physically unrealistic details arising from pure GIA-based reconstruction geometry when nudging is very strong (τf=20 years for North America), while weakly nudged (τf=1,000 years) solutions deviate from ICE-6G_C sufficiently to degrade its observational fit quality. For reasonable intermediate time scales (τf=100 years and 200 years), we perturbatively analyze nudged ice dynamics as a superposition of "leading-order smoothing" that diffuses ICE-6G_C in a physically and observationally consistent manner and "higher-order" deviations arising, for instance, from biases in the time dependence of surface climate boundary conditions. Based upon the relative deviations between respective nudged simulations in which these biases follow surface temperature from ice cores and eustatic sea level from marine sediment cores, we compute "ice core climate adjustments" that suggest how local paleoclimate observations may be applied to the systematic refinement of ICE-6G_C. Our results are consistent with a growing body of evidence suggesting that the geographical origins of Meltwater Pulse 1B (MWP1b) may lie primarily in North America as opposed to Antarctica (as reconstructed in ICE-6G_C).
The Influence of the Thymine C5 Methyl Group on Spontaneous Base Pair Breathing in DNA
Czech Academy of Sciences Publication Activity Database
Wärmländer, S.; Šponer, Jiří; Leijon, M.; Šponer, Judit E.
2002-01-01
Roč. 277, č. 32 (2002), s. 28491-28497 ISSN 0021-9258 R&D Projects: GA MŠk LN00A016 Institutional research plan: CEZ:AV0Z4040901 Keywords : thymine * DNA * base pairs Subject RIV: CF - Physical ; Theoretical Chemistry Impact factor: 6.696, year: 2002
Chawla, Mohit; Abdel-Azeim, Safwat; Oliva, Romina; Cavallo, Luigi
2013-01-01
of the Guanine can increase its stability. Herein, we extend our survey and report on other H-bonding interactions that can increase the stability of this base pair. To this aim, we performed a bioinformatics search of the PDB to locate all the occurencies of G
Ma, Shuai; Wu, Qi; Hu, Yibo; Wei, Fuwen
2018-05-20
The explosive growth in genomic data has provided novel insights into the conflicting signals hidden in phylogenetic trees. Although some studies have explored the effects of the GC content and parsimony informative sites (PIS) on the phylogenetic tree, the effect of the heterogeneity of the GC content at the first/second/third codon position on parsimony informative sites (GC1/2/3 PIS ) among different species and the effect of PIS on phylogenetic tree construction remain largely unexplored. Here, we used two different mammal genomic datasets to explore the patterns of GC1/2/3 PIS heterogeneity and the effect of PIS on the phylogenetic tree of genes: (i) all GC1/2/3 PIS have obvious heterogeneity between different mammals, and the levels of heterogeneity are GC3 PIS > GC2 PIS > GC1 PIS ; (ii) the number of PIS is positively correlated with the metrics of "good" gene tree topologies, and excluding the third codon position (C3) decreases the quality of gene trees by removing too many PIS. These results provide novel insights into the heterogeneity pattern of GC1/2/3 PIS in mammals and the relationship between GC3/PIS and gene trees. Additionally, it is necessary to carefully consider whether to exclude C3 to improve the quality of gene trees, especially in the super-tree method. Copyright © 2018 Elsevier B.V. All rights reserved.
Directory of Open Access Journals (Sweden)
C. Chen
2012-02-01
Full Text Available Two dimensional gas chromatography (GC × GC with detection by time-of-flight mass spectrometry (TOFMS was applied in the rapid analysis of air samples containing highly complex mixtures of volatilizable biogenic organic compounds (VBOCs. VBOC analytical methodologies are briefly reviewed, and optimal conditions are discussed for sampling with both adsorption/thermal desorption (ATD cartridges and solid-phase microextraction (SPME fibers. Air samples containing VBOC emissions from leaves of two tree species (Cedrus atlantica and Calycolpus moritzianus were obtained by both ATD and SPME. The optimized gas chromatographic conditions utilized a 45 m, 0.25 mm I.D. low-polarity primary column (DB-VRX, 1.4 μm film and a 1.5 m, 0.25 mm I.D. polar secondary column (StabilwaxTM, 0.25 μm film. Excellent separation was achieved in a 36 min temperature programmed GC × GC chromatogram. Thousands of VBOC peaks were present in the sample chromatograms; hundreds of tentative identifications by NIST mass spectral matching are provided. Very few of the tentatively identified compounds are currently available as authentic standards. Minimum detection limit values for a 5 l ATD sample were 3.5 pptv (10 ng m−3 for isoprene, methyl vinyl ketone, and methacrolein, and ~1.5 pptv (~10 ng m−3 for monoterpenes and sesquiterpenes. Kovats-type chromatographic retention index values on the primary column and relative retention time values on the secondary column are provided for 21 standard compounds and for 417 tentatively identified VBOCs. 19 of the 21 authentic standard compounds were found in one of the Cedrus atlantica SPME samples. In addition, easily quantifiable levels of at least 13 sesquiterpenes were found in an ATD sample obtained from a branch enclosure of Calycolpus moritzianus. Overall, the results obtained via GC × GC-TOFMS highlight an extreme, and largely uncharacterized diversity of VBOCs, consistent with the hypothesis that sesquiterpenes and
Pankow, J. F.; Luo, W.; Melnychenko, A. N.; Barsanti, K. C.; Isabelle, L. M.; Chen, C.; Guenther, A. B.; Rosenstiel, T. N.
2012-02-01
Two dimensional gas chromatography (GC × GC) with detection by time-of-flight mass spectrometry (TOFMS) was applied in the rapid analysis of air samples containing highly complex mixtures of volatilizable biogenic organic compounds (VBOCs). VBOC analytical methodologies are briefly reviewed, and optimal conditions are discussed for sampling with both adsorption/thermal desorption (ATD) cartridges and solid-phase microextraction (SPME) fibers. Air samples containing VBOC emissions from leaves of two tree species (Cedrus atlantica and Calycolpus moritzianus) were obtained by both ATD and SPME. The optimized gas chromatographic conditions utilized a 45 m, 0.25 mm I.D. low-polarity primary column (DB-VRX, 1.4 μm film) and a 1.5 m, 0.25 mm I.D. polar secondary column (StabilwaxTM, 0.25 μm film). Excellent separation was achieved in a 36 min temperature programmed GC × GC chromatogram. Thousands of VBOC peaks were present in the sample chromatograms; hundreds of tentative identifications by NIST mass spectral matching are provided. Very few of the tentatively identified compounds are currently available as authentic standards. Minimum detection limit values for a 5 l ATD sample were 3.5 pptv (10 ng m-3) for isoprene, methyl vinyl ketone, and methacrolein, and ~1.5 pptv (~10 ng m-3) for monoterpenes and sesquiterpenes. Kovats-type chromatographic retention index values on the primary column and relative retention time values on the secondary column are provided for 21 standard compounds and for 417 tentatively identified VBOCs. 19 of the 21 authentic standard compounds were found in one of the Cedrus atlantica SPME samples. In addition, easily quantifiable levels of at least 13 sesquiterpenes were found in an ATD sample obtained from a branch enclosure of Calycolpus moritzianus. Overall, the results obtained via GC × GC-TOFMS highlight an extreme, and largely uncharacterized diversity of VBOCs, consistent with the hypothesis that sesquiterpenes and other compounds
Barriga, Gonzalo P; Villalón-Letelier, Fernando; Márquez, Chantal L; Bignon, Eduardo A; Acuña, Rodrigo; Ross, Breyan H; Monasterio, Octavio; Mardones, Gonzalo A; Vidal, Simon E; Tischler, Nicole D
2016-07-01
Hantaviruses can cause hantavirus pulmonary syndrome or hemorrhagic fever with renal syndrome in humans. To enter cells, hantaviruses fuse their envelope membrane with host cell membranes. Previously, we have shown that the Gc envelope glycoprotein is the viral fusion protein sharing characteristics with class II fusion proteins. The ectodomain of class II fusion proteins is composed of three domains connected by a stem region to a transmembrane anchor in the viral envelope. These fusion proteins can be inhibited through exogenous fusion protein fragments spanning domain III (DIII) and the stem region. Such fragments are thought to interact with the core of the fusion protein trimer during the transition from its pre-fusion to its post-fusion conformation. Based on our previous homology model structure for Gc from Andes hantavirus (ANDV), here we predicted and generated recombinant DIII and stem peptides to test whether these fragments inhibit hantavirus membrane fusion and cell entry. Recombinant ANDV DIII was soluble, presented disulfide bridges and beta-sheet secondary structure, supporting the in silico model. Using DIII and the C-terminal part of the stem region, the infection of cells by ANDV was blocked up to 60% when fusion of ANDV occurred within the endosomal route, and up to 95% when fusion occurred with the plasma membrane. Furthermore, the fragments impaired ANDV glycoprotein-mediated cell-cell fusion, and cross-inhibited the fusion mediated by the glycoproteins from Puumala virus (PUUV). The Gc fragments interfered in ANDV cell entry by preventing membrane hemifusion and pore formation, retaining Gc in a non-resistant homotrimer stage, as described for DIII and stem peptide inhibitors of class II fusion proteins. Collectively, our results demonstrate that hantavirus Gc shares not only structural, but also mechanistic similarity with class II viral fusion proteins, and will hopefully help in developing novel therapeutic strategies against hantaviruses.
English for au pairs the au pair's guide to learning English
Curtis, Lucy
2014-01-01
English for Au Pairs has interlinked stories about a group of au pairs new to England. Marta, an 18-year-old from Poland arrives in the UK to work as an au pair. Throughout her year-long stay she has many different experiences - some bad, some good - but with the support of her host family she finds new friends and improves her English. English for Au Pairs offers insight into the joys and difficulties of being an au pair while at the same time reinforcing English language learning through grammar explanations and exercises.
Theoretical studies on the intermolecular interactions of potentially primordial base-pair analogues
Czech Academy of Sciences Publication Activity Database
Šponer, Judit E.; Vázquez-Mayagoitia, Á.; Sumpter, B.G.; Leszczynski, J.; Šponer, Jiří; Otyepka, M.; Banáš, P.; Fuentes-Cabrera, M.
2010-01-01
Roč. 16, č. 10 (2010), s. 3057-3065 ISSN 0947-6539 R&D Projects: GA MŠk(CZ) LC06030; GA AV ČR(CZ) 1QS500040581; GA AV ČR(CZ) IAA400040802; GA ČR(CZ) GA203/09/1476 Grant - others:GA MŠk(CZ) LC512; GA AV ČR(CZ) IAA400550701; GA ČR(CZ) GD203/09/H046 Program:LC; IA; GD Institutional research plan: CEZ:AV0Z50040507; CEZ:AV0Z50040702 Keywords : quantum chemistry * base pairing * origin of life Subject RIV: BO - Biophysics Impact factor: 5.476, year: 2010
Directory of Open Access Journals (Sweden)
Kateřina Klapilová
2014-01-01
Full Text Available Data from 1155 Czech women (493 using oral contraception, 662 non-users, obtained from the Czech National Survey of Sexual Behavior, were used to investigate evolutionary-based hypotheses concerning the predictive value of current oral contraceptive (OC use on extra-pair and dyadic (in-pair sexual behavior of coupled women. Specifically, the aim was to determine whether current OC use was associated with lower extra-pair and higher in-pair sexual interest and behavior, because OC use suppresses cyclical shifts in mating psychology that occur in normally cycling women. Zero-inflated Poisson (ZIP regression and negative binomial models were used to test associations between OC use and these sexual measures, controlling for other relevant predictors (e.g., age, parity, in-pair sexual satisfaction, relationship length. The overall incidence of having had an extra-pair partner or one-night stand in the previous year was not related to current OC use (the majority of the sample had not. However, among the women who had engaged in extra-pair sexual behavior, OC users had fewer one-night stands than non-users, and tended to have fewer partners, than non-users. OC users also had more frequent dyadic intercourse than non-users, potentially indicating higher commitment to their current relationship. These results suggest that suppression of fertility through OC use may alter important aspects of female sexual behavior, with potential implications for relationship functioning and stability.
Energy Technology Data Exchange (ETDEWEB)
Ahmed, M.; George, S.C. [CSIRO Petroleum, North Ryde, NSW (Australia)
2004-02-01
Rotary evaporation and nitrogen blowing are the two frequently used procedures in organic geochemistry laboratories to prepare crude oils and extractable organic matter for gas chromatography (GC) and GC-mass spectrometry (GC-MS) analyses. In this work, the effects of these preparatory procedures on the molecular composition have been comprehensively assessed for the first time, by evaporating 34 aliquots of North Sea Oil-1 dissolved in dichloromethane under a variety of conditions: (a) rotary evaporation with a reduced pressure of 80 to 60 kpa, and water bath temperatures of 30-60 {sup o}C, (b) nitrogen blowing, with flow rates of 130 to >850 ml/min and heater block temperatures of 30-60 {sup o}C, and (c) open vial evaporation in a refrigerator at 3 {sup o}C and in a fume cupboard at 22 {sup o}C. Analyses of the unaltered original oil, solution and the evaporated oil aliquots for 215 target compounds, from benzene to n-C{sub 32}, indicate that (1)
Detecting nonlocal Cooper pair entanglement by optical Bell inequality violation
Nigg, Simon E.; Tiwari, Rakesh P.; Walter, Stefan; Schmidt, Thomas L.
2014-01-01
Based on the Bardeen Cooper Schrieffer (BCS) theory of superconductivity, the coherent splitting of Cooper pairs from a superconductor to two spatially separated quantum dots has been predicted to generate nonlocal pairs of entangled electrons. In order to test this hypothesis, we propose a scheme to transfer the spin state of a split Cooper pair onto the polarization state of a pair of optical photons. We show that the produced photon pairs can be used to violate a Bell inequality, unambiguo...
Directory of Open Access Journals (Sweden)
Hong GUO
2011-06-01
Full Text Available The archaeological discoveries of Tang tomb murals in Xi’an, China brought to light unprecedented data for the study of the art of the Tang Dynasty (618-907 AD. The spectacular murals with their particular contents provided first-hand material for the study of Chinese history and the techniques of wall paintings during the Tang Dynasty. In order to gain a better understanding of the materials used and to preserve those paintings, pyrolysis-gas chromatography-mass spectrometry (Py-GC/MS and gas chromatography-mass spectrometry (GC/MS were applied for the characterization of the binding media in the paintings. The combination of these analytical techniques is an ideal methodology to identify binding media in unknown samples.
Observation of H-bond mediated 3hJH2H3coupling constants across Watson-Crick AU base pairs in RNA
International Nuclear Information System (INIS)
Luy, Burkhard; Richter, Uwe; DeJong, Eric S.; Sorensen, Ole W.; Marino, John P.
2002-01-01
3h J H2H3 trans-hydrogen bond scalar coupling constants have been observed for the first time in Watson-Crick AU base pairs in uniformly 15 N-labeled RNA oligonucleotides using a new 2h J NN -HNN-E. COSY experiment. The experiment utilizes adenosine H2 (AH2) for original polarization and detection, while employing 2h J NN couplings for coherence transfer across the hydrogen bonds (H-bonds). The H3 protons of uracil bases are unperturbed throughout the experiment so that these protons appear as passive spins in E. COSY patterns. 3h J H2H3 coupling constants can therefore be accurately measured in the acquisition dimension from the displacement of the E. COSY multiplet components, which are separated by the relatively large 1 J H3N3 coupling constants in the indirect dimension of the two-dimensional experiment. The 3h J H2H3 scalar coupling constants determined for AU base pairs in the two RNA hairpins examined here have been found to be positive and range in magnitude up to 1.8 Hz. Using a molecular fragment representation of an AU base pair, density functional theory/finite field perturbation theory (DFT/FPT) methods have been applied to attempt to predict the relative contributions of H-bond length and angular geometry to the magnitude of 3h J H2H3 coupling constants. Although the DFT/FPT calculations did not reproduce the full range of magnitude observed experimentally for the 3h J H2H3 coupling constants, the calculations do predict the correct sign and general trends in variation in size of these coupling constants. The calculations suggest that the magnitude of the coupling constants depends largely on H-bond length, but can also vary with differences in base pair geometry. The dependency of the 3h J H2H3 coupling constant on H-bond strength and geometry makes it a new probe for defining base pairs in NMR studies of nucleic acids
Manzano, Carlos; Hoh, Eunha; Simonich, Staci L. Massey
2012-01-01
Complex mixtures of polycyclic aromatic hydrocarbons (PAHs) are difficult to resolve because of the high degree of overlap in compound vapor pressures, boiling points and mass spectral fragmentation patterns. The objective of this research was to improve the separation of complex PAH mixtures (including 97 different parent, alkyl-, nitro-, oxy-, thio-, chloro-, bromo-, and high molecular weight PAHs) using GC×GC/ToF-MS by maximizing the orthogonality of different GC column combinations and improving the separation of PAHs from the sample matrix interferences, including unresolved complex mixtures (UCM). Four different combinations of non-polar, polar, liquid crystal and nano-stationary phase columns were tested. Each column combination was optimized and evaluated for orthogonality using a method based on conditional entropy that considers the quantitative peak distribution in the entire two-dimensional space. Finally, an atmospheric particulate matter with diameter column in the first dimension and a 1.2 m × 0.10 mm × 0.10 µm NSP-35 nano-stationary phase column in the second dimension. In addition, the use of this column combination in GC×GC/ToF-MS resulted in significantly shorter analysis times (176 min) for complex PAH mixtures compared to one-dimensional GC/MS (257 min), as well as potentially reduced sample preparation time. PMID:22769970
Xu, Danfeng; Gu, Bing; Rui, Guanghao; Zhan, Qiwen; Cui, Yiping
2016-02-22
We present an arbitrary vector field with hybrid polarization based on the combination of a pair of orthogonal elliptically polarized base vectors on the Poincaré sphere. It is shown that the created vector field is only dependent on the latitude angle 2χ but is independent on the longitude angle 2ψ on the Poincaré sphere. By adjusting the latitude angle 2χ, which is related to two identical waveplates in a common path interferometric arrangement, one could obtain arbitrary type of vector fields. Experimentally, we demonstrate the generation of such kind of vector fields and confirm the distribution of state of polarization by the measurement of Stokes parameters. Besides, we investigate the tight focusing properties of these vector fields. It is found that the additional degree of freedom 2χ provided by arbitrary vector field with hybrid polarization allows one to control the spatial structure of polarization and to engineer the focusing field.
McCoy, Allison B; Wright, Adam; Rogith, Deevakar; Fathiamini, Safa; Ottenbacher, Allison J; Sittig, Dean F
2014-04-01
Correlation of data within electronic health records is necessary for implementation of various clinical decision support functions, including patient summarization. A key type of correlation is linking medications to clinical problems; while some databases of problem-medication links are available, they are not robust and depend on problems and medications being encoded in particular terminologies. Crowdsourcing represents one approach to generating robust knowledge bases across a variety of terminologies, but more sophisticated approaches are necessary to improve accuracy and reduce manual data review requirements. We sought to develop and evaluate a clinician reputation metric to facilitate the identification of appropriate problem-medication pairs through crowdsourcing without requiring extensive manual review. We retrieved medications from our clinical data warehouse that had been prescribed and manually linked to one or more problems by clinicians during e-prescribing between June 1, 2010 and May 31, 2011. We identified measures likely to be associated with the percentage of accurate problem-medication links made by clinicians. Using logistic regression, we created a metric for identifying clinicians who had made greater than or equal to 95% appropriate links. We evaluated the accuracy of the approach by comparing links made by those physicians identified as having appropriate links to a previously manually validated subset of problem-medication pairs. Of 867 clinicians who asserted a total of 237,748 problem-medication links during the study period, 125 had a reputation metric that predicted the percentage of appropriate links greater than or equal to 95%. These clinicians asserted a total of 2464 linked problem-medication pairs (983 distinct pairs). Compared to a previously validated set of problem-medication pairs, the reputation metric achieved a specificity of 99.5% and marginally improved the sensitivity of previously described knowledge bases. A
SPME GC/MS Analysis of Three Ornithogalum L. species from Turkey
Directory of Open Access Journals (Sweden)
Gülin Renda
2016-01-01
Full Text Available In this study, a solid phase micro extraction (SPME method with gas chromatography-mass spectrometry (GC-MS was used for analysis of volatile compounds in flowers and bulbs of three Ornithogalum species. The samples of flowers and bulbs of Ornithogalum sigmoideum, Ornithogalum orthophyllum, Ornithogalum oligophyllum was separately analyzed by SPME-GC-MS. A comparison of volatile compounds was made between species and the parts studied. A total of 70 compounds were identified and different volatile compounds were determined in distinct parts of the species. The major volatile organic compound of the flowers of O. sigmoideum and O. ornithogalum was furan (54.5% and 57.0% respectively. For O. oligophyllum the major volatile organic compound was nonanal (19.2%. Analyses revealed that SPME-GC-MS method is appropriate for the analysis of volatile compounds of Ornithogalum species.
Millen, Andrea L; Churchill, Cassandra D M; Manderville, Richard A; Wetmore, Stacey D
2010-10-14
Bulky DNA addition products (adducts) formed through attack at the C8 site of guanine can adopt the syn orientation about the glycosidic bond due to changes in conformational stability or hydrogen-bonding preferences directly arising from the bulky group. Indeed, the bulky substituent may improve the stability of (non-native) Hoogsteen pairs. Therefore, such adducts often result in mutations upon DNA replication. This work examines the hydrogen-bonded pairs between the Watson-Crick and Hoogsteen faces of the ortho or para C8-phenoxyl-2'-deoxyguanosine adduct and each natural (undamaged) nucleobase with the goal to clarify the conformational preference of this type of damage, as well as provide insight into the likelihood of subsequent mutation events. B3LYP/6-311+G(2df,p)//B3LYP/6-31G(d) hydrogen-bond strengths were determined using both nucleobase and nucleoside models for adduct pairs, as well as the corresponding complexes involving natural 2'-deoxyguanosine. In addition to the magnitude of the binding strengths, the R(C1'···C1') distances and ∠(N9C1'C1') angles, as well as the degree of propeller-twist and buckle distortions, were carefully compared to the values observed in natural DNA strands. Due to structural changes in the adduct monomer upon inclusion of the sugar moiety, the monomer deformation energy significantly affects the relative hydrogen-bond strengths calculated with the nucleobase and nucleoside models. Therefore, we recommend the use of at least a nucleoside model to accurately evaluate hydrogen-bond strengths of base pairs involving flexible, bulky nucleobase adducts. Our results also emphasize the importance of considering both the magnitude of the hydrogen-bond strength and the structure of the base pair when predicting the preferential binding patterns of nucleobases. Using our best models, we conclude that the Watson-Crick face of the ortho phenoxyl adduct forms significantly more stable complexes than the Hoogsteen face, which
D'Souza, Francis; Gadde, Suresh; Islam, D-M Shafiqul; Pang, Siew-Cheng; Schumacher, Amy Lea; Zandler, Melvin E; Horie, Rumiko; Araki, Yasuyaki; Ito, Osamu
2007-02-07
A fluorescent reporter molecule, 2-aminopurine was self-assembled via Watson-Crick base-pairing to a uracil appended fullerene to form a donor-acceptor conjugate; efficient photoinduced charge separation was confirmed by time-resolved emission and transient absorption spectral studies.
Geminal phosphorus/aluminum-based frustrated Lewis pairs: C-H versus C≡C activation and CO2 fixation
Appelt, C.; Westenberg, H.; Bertini, F.; Ehlers, A.W.; Slootweg, J.C.; Lammertsma, K.; Uhl, W.
2011-01-01
Catch it! Geminal phosphorus/aluminum-based frustrated Lewis pairs (FLPs) are easily obtained by hydroalumination of alkynylphosphines. These FLPs can activate terminal acetylenes by two competitive pathways, which were analyzed by DFT calculations, and they can bind carbon dioxide reversibly.
Photocatalytic decomposition of N2O over TiO2/g-C3N4 photocatalysts heterojunction
Kočí, K.; Reli, M.; Troppová, I.; Šihor, M.; Kupková, J.; Kustrowski, P.; Praus, P.
2017-02-01
TiO2/g-C3N4 photocatalysts with the various TiO2/g-C3N4 weight ratios from 1:2 to 1:6 were fabricated by mechanical mixing in water suspension followed by calcination. Pure TiO2 was prepared by thermal hydrolysis and pure g-C3N4 was prepared from commercial melamine by thermal annealing at 620 °C. All the nanocomposites were characterized by X-ray powder diffraction, UV-vis diffuse reflectance spectroscopy, Raman spectroscopy, infrared spectroscopy, scanning electron microscopy, transmission electron microscopy, photoelectrochemical measurements and nitrogen physisorption. The prepared mixtures along with pure TiO2 and g-C3N4 were tested for the photocatalytic decomposition of nitrous oxide under UVC (λ = 254 nm), UVA (λ = 365 nm) and Vis (λ > 400 nm) irradiation. The TiO2/g-C3N4 nanocomposites showed moderate improvement compared to pure g-C3N4 but pure TiO2 proved to be a better photocatalyst under UVC irradiation. However, under UVA irradiation conditions, the photocatalytic activity of TiO2/g-C3N4 (1:2) nanocomposite exhibited an increase compared to pure TiO2. Nevertheless, further increase of g-C3N4 amount leads/led to a decrease in reactivity. These results are suggesting the nanocomposite with the optimal weight ratio of TiO2 and g-C3N4 have shifted absorption edge energy towards longer wavelengths and decreased the recombination rate of charge carriers compared to pure g-C3N4. This is probably due to the generation of heterojunction on the TiO2/g-C3N4 interface.
Thermodynamics of pairing phase transition in nuclei
International Nuclear Information System (INIS)
Karim, Afaque; Ahmad, Shakeb
2014-01-01
The pairing gaps, pairing energy, heat capacity and entropy are calculated within BCS (Bardeen- Cooper-Schrieffer) based quasi particle approach, including thermal fluctuations on pairing field within pairing model for all nuclei (light, medium, heavy and super heavy nuclei). Quasi particles approach in BCS theory was introduced and reformulated to study various properties. For thermodynamic behavior of nuclei at finite temperatures, the anomalous averages of creation and annihilation operators are introduced. It is solved self consistently at finite temperatures to obtain BCS Hamiltonian. After doing unitary transformation, we obtained the Hamiltonian in the diagonal form. Thus, one gets temperature dependence gap parameter and pairing energy for nuclei. Moreover, the energy at finite temperatures is the sum of the condensation energy and the thermal energy of fermionic quasi particles. With the help of BCS Hamiltonian, specific heat, entropy and free energy are calculated for different nuclei. In this paper the gap parameter occupation number and pairing energy as a function of temperature which is important for all the light, medium, heavy and super heavy nuclei is calculated. Moreover, the various thermo dynamical quantities like specific heat, entropy and free energy is also obtained for different nuclei. Thus, the thermodynamics of pairing phase transition in nuclei is studied
Directory of Open Access Journals (Sweden)
V. Sinha
2012-12-01
Full Text Available The primary and most important oxidant in the atmosphere is the hydroxyl radical (OH. Currently OH sinks, particularly gas phase reactions, are poorly constrained. One way to characterize the overall sink of OH is to measure directly the ambient loss rate of OH, the total OH reactivity. To date, direct measurements of total OH reactivity have been either performed using a Laser-Induced Fluorescence (LIF system ("pump-and-probe" or "flow reactor" or the Comparative Reactivity Method (CRM with a Proton-Transfer-Reaction Mass Spectrometer (PTR-MS. Both techniques require large, complex and expensive detection systems. This study presents a feasibility assessment for CRM total OH reactivity measurements using a new detector, a Gas Chromatographic Photoionization Detector (GC-PID. Such a system is smaller, more portable, less power consuming and less expensive than other total OH reactivity measurement techniques.
Total OH reactivity is measured by the CRM using a competitive reaction between a reagent (here pyrrole with OH alone and in the presence of atmospheric reactive molecules. The new CRM method for total OH reactivity has been tested with parallel measurements of the GC-PID and the previously validated PTR-MS as detector for the reagent pyrrole during laboratory experiments, plant chamber and boreal field studies. Excellent agreement of both detectors was found when the GC-PID was operated under optimum conditions. Time resolution (60–70 s, sensitivity (LOD 3–6 s−1 and overall uncertainty (25% in optimum conditions for total OH reactivity were similar to PTR-MS based total OH reactivity measurements. One drawback of the GC-PID system was the steady loss of sensitivity and accuracy during intensive measurements lasting several weeks, and a possible toluene interference. Generally, the GC-PID system has been shown to produce closely comparable results to the PTR-MS and thus in suitable environments (e.g. forests it
No predictive value of GC phenotypes for HIV infection and progression to AIDS
Pronk, J. C.; Frants, R. R.; Crusius, B.; Eriksson, A. W.; de Wolf, F.; Boucher, C. A.; Bakker, M.; Goudsmit, J.
1988-01-01
The genetic polymorphism of group-specific component (GC) was investigated with isoelectric focusing in 351 homosexual men at risk for HIV infection, 96 male patients with AIDS, and 86 heterosexual controls. No significant differences in GC phenotype distribution were seen between controls and any
Energy Technology Data Exchange (ETDEWEB)
Smith, David Roy; Burki, Fabien; Yamada, Takashi; Grimwood, Jane; Grigoriev, Igor V.; Van Etten, James L.; Keeling, Patrick J.
2011-05-13
Most of the available mitochondrial and plastid genome sequences are biased towards adenine and thymine (AT) over guanine and cytosine (GC). Examples of GC-rich organelle DNAs are limited to a small but eclectic list of species, including certain green algae. Here, to gain insight in the evolution of organelle nucleotide landscape, we present the GC-rich mitochondrial and plastid DNAs from the trebouxiophyte green alga Coccomyxa sp. C-169. We compare these sequences with other GC-rich organelle DNAs and argue that the forces biasing them towards G and C are nonadaptive and linked to the metabolic and/or life history features of this species. The Coccomyxa organelle genomes are also used for phylogenetic analyses, which highlight the complexities in trying to resolve the interrelationships among the core chlorophyte green algae, but ultimately favour a sister relationship between the Ulvophyceae and Chlorophyceae, with the Trebouxiophyceae branching at the base of the chlorophyte crown.
Hantavirus Gn and Gc glycoproteins self-assemble into virus-like particles.
Acuña, Rodrigo; Cifuentes-Muñoz, Nicolás; Márquez, Chantal L; Bulling, Manuela; Klingström, Jonas; Mancini, Roberta; Lozach, Pierre-Yves; Tischler, Nicole D
2014-02-01
How hantaviruses assemble and exit infected cells remains largely unknown. Here, we show that the expression of Andes (ANDV) and Puumala (PUUV) hantavirus Gn and Gc envelope glycoproteins lead to their self-assembly into virus-like particles (VLPs) which were released to cell supernatants. The viral nucleoprotein was not required for particle formation. Further, a Gc endodomain deletion mutant did not abrogate VLP formation. The VLPs were pleomorphic, exposed protrusions and reacted with patient sera.
Cui, Xingkai; Tian, Lin; Xian, Xiaozhai; Tang, Hua; Yang, Xiaofei
2018-02-01
Solar-driven water splitting over semiconductor-based photocatalysts provides direct conversion of solar energy to chemical energy, in which electron-hole separation and charge transport are critical for enhancing the photocatalytic activity of semiconducting materials. Moreover, the search for active photocatalysts that efficiently oxidize water remains a challenging task. Here, we demonstrate that a series of Ag3PO4/Ag/graphene/graphitic carbon nitride (g-C3N4) heterostructured materials can drive photocatalytic water oxidation efficiently under LED illumination. The water oxidation behavior of as-prepared composite photocatalysts in relation to the added amount of g-C3N4 and the roles of electron mediators was investigated in detail. Based on the illuminated Z-scheme photocatalytic mechanism, the photogenerated electrons and holes can be separated effectively and the electron-hole recombination of bulk material is suppressed. The reduced metallic Ag nanoparticles were found to function as the center for the accumulation of electrons from Ag3PO4 and holes from g-C3N4. By exploiting the proper addition of g-C3N4 into the composite, photocatalytic oxygen evolution performance over the heterostructured materials could be suitably tuned, which resulted in highly efficient water oxidation.
Ion-pair chromatography of nucleic acid derivatives
International Nuclear Information System (INIS)
Perrone, P.A.; Brown, P.R.
1985-01-01
Little work has been done on the ion-pair chromatography of nucleic acid constituents, although there is a great potential for the use of this technique in the field. Since the classic work in 1949, nucleotides, as well as nucleosides and bases, have been separated by ion-exchange chromatography. However, ion exchange is a difficult mode and most researchers prefer the use of reversed-phase whenever possible. Although reversed-phase is now the method of choice, ionic compounds like nucleotides and some of the more polar bases are not adequately retained by many systems of this type. In addition, it is difficult to analyze simultaneously members of all three classes of nucleic acid compounds (bases, nucleosides, and nucleotides) using a reversed-phase system, even with gradient elution. Ion pairing can be a useful technique because, theoretically, the separation of nonionic bases and nucleosides along with the ionic nucleotides can be achieved. Additionally, each group of compounds may be separated isocratically. In this chapter, they will discuss ion-pair chromatography as applied to nucleic acid constituents. The current theories, advantages and disadvantages, a limited number of applications, and potential for future work are presented
Bastien, Olivier; Ortet, Philippe; Roy, Sylvaine; Maréchal, Eric
2005-03-10
Popular methods to reconstruct molecular phylogenies are based on multiple sequence alignments, in which addition or removal of data may change the resulting tree topology. We have sought a representation of homologous proteins that would conserve the information of pair-wise sequence alignments, respect probabilistic properties of Z-scores (Monte Carlo methods applied to pair-wise comparisons) and be the basis for a novel method of consistent and stable phylogenetic reconstruction. We have built up a spatial representation of protein sequences using concepts from particle physics (configuration space) and respecting a frame of constraints deduced from pair-wise alignment score properties in information theory. The obtained configuration space of homologous proteins (CSHP) allows the representation of real and shuffled sequences, and thereupon an expression of the TULIP theorem for Z-score probabilities. Based on the CSHP, we propose a phylogeny reconstruction using Z-scores. Deduced trees, called TULIP trees, are consistent with multiple-alignment based trees. Furthermore, the TULIP tree reconstruction method provides a solution for some previously reported incongruent results, such as the apicomplexan enolase phylogeny. The CSHP is a unified model that conserves mutual information between proteins in the way physical models conserve energy. Applications include the reconstruction of evolutionary consistent and robust trees, the topology of which is based on a spatial representation that is not reordered after addition or removal of sequences. The CSHP and its assigned phylogenetic topology, provide a powerful and easily updated representation for massive pair-wise genome comparisons based on Z-score computations.
Directory of Open Access Journals (Sweden)
Maréchal Eric
2005-03-01
Full Text Available Abstract Background Popular methods to reconstruct molecular phylogenies are based on multiple sequence alignments, in which addition or removal of data may change the resulting tree topology. We have sought a representation of homologous proteins that would conserve the information of pair-wise sequence alignments, respect probabilistic properties of Z-scores (Monte Carlo methods applied to pair-wise comparisons and be the basis for a novel method of consistent and stable phylogenetic reconstruction. Results We have built up a spatial representation of protein sequences using concepts from particle physics (configuration space and respecting a frame of constraints deduced from pair-wise alignment score properties in information theory. The obtained configuration space of homologous proteins (CSHP allows the representation of real and shuffled sequences, and thereupon an expression of the TULIP theorem for Z-score probabilities. Based on the CSHP, we propose a phylogeny reconstruction using Z-scores. Deduced trees, called TULIP trees, are consistent with multiple-alignment based trees. Furthermore, the TULIP tree reconstruction method provides a solution for some previously reported incongruent results, such as the apicomplexan enolase phylogeny. Conclusion The CSHP is a unified model that conserves mutual information between proteins in the way physical models conserve energy. Applications include the reconstruction of evolutionary consistent and robust trees, the topology of which is based on a spatial representation that is not reordered after addition or removal of sequences. The CSHP and its assigned phylogenetic topology, provide a powerful and easily updated representation for massive pair-wise genome comparisons based on Z-score computations.
Chang, Kai Lun; Ho, Paul C.
2014-01-01
Findings from epidemiology, preclinical and clinical studies indicate that consumption of coffee could have beneficial effects against dementia and Alzheimer’s disease (AD). The benefits appear to come from caffeinated coffee, but not decaffeinated coffee or pure caffeine itself. Therefore, the objective of this study was to use metabolomics approach to delineate the discriminant metabolites between caffeinated and decaffeinated coffee, which could have contributed to the observed therapeutic benefits. Gas chromatography time-of-flight mass spectrometry (GC-TOF-MS)-based metabolomics approach was employed to characterize the metabolic differences between caffeinated and decaffeinated coffee. Orthogonal partial least squares discriminant analysis (OPLS-DA) showed distinct separation between the two types of coffee (cumulative Q2 = 0.998). A total of 69 discriminant metabolites were identified based on the OPLS-DA model, with 37 and 32 metabolites detected to be higher in caffeinated and decaffeinated coffee, respectively. These metabolites include several benzoate and cinnamate-derived phenolic compounds, organic acids, sugar, fatty acids, and amino acids. Our study successfully established GC-TOF-MS based metabolomics approach as a highly robust tool in discriminant analysis between caffeinated and decaffeinated coffee samples. Discriminant metabolites identified in this study are biologically relevant and provide valuable insights into therapeutic research of coffee against AD. Our data also hint at possible involvement of gut microbial metabolism to enhance therapeutic potential of coffee components, which represents an interesting area for future research. PMID:25098597
RNA-PAIRS: RNA probabilistic assignment of imino resonance shifts
International Nuclear Information System (INIS)
Bahrami, Arash; Clos, Lawrence J.; Markley, John L.; Butcher, Samuel E.; Eghbalnia, Hamid R.
2012-01-01
The significant biological role of RNA has further highlighted the need for improving the accuracy, efficiency and the reach of methods for investigating RNA structure and function. Nuclear magnetic resonance (NMR) spectroscopy is vital to furthering the goals of RNA structural biology because of its distinctive capabilities. However, the dispersion pattern in the NMR spectra of RNA makes automated resonance assignment, a key step in NMR investigation of biomolecules, remarkably challenging. Herein we present RNA Probabilistic Assignment of Imino Resonance Shifts (RNA-PAIRS), a method for the automated assignment of RNA imino resonances with synchronized verification and correction of predicted secondary structure. RNA-PAIRS represents an advance in modeling the assignment paradigm because it seeds the probabilistic network for assignment with experimental NMR data, and predicted RNA secondary structure, simultaneously and from the start. Subsequently, RNA-PAIRS sets in motion a dynamic network that reverberates between predictions and experimental evidence in order to reconcile and rectify resonance assignments and secondary structure information. The procedure is halted when assignments and base-parings are deemed to be most consistent with observed crosspeaks. The current implementation of RNA-PAIRS uses an initial peak list derived from proton-nitrogen heteronuclear multiple quantum correlation ( 1 H– 15 N 2D HMQC) and proton–proton nuclear Overhauser enhancement spectroscopy ( 1 H– 1 H 2D NOESY) experiments. We have evaluated the performance of RNA-PAIRS by using it to analyze NMR datasets from 26 previously studied RNAs, including a 111-nucleotide complex. For moderately sized RNA molecules, and over a range of comparatively complex structural motifs, the average assignment accuracy exceeds 90%, while the average base pair prediction accuracy exceeded 93%. RNA-PAIRS yielded accurate assignments and base pairings consistent with imino resonances for a
RNA-PAIRS: RNA probabilistic assignment of imino resonance shifts
Energy Technology Data Exchange (ETDEWEB)
Bahrami, Arash; Clos, Lawrence J.; Markley, John L.; Butcher, Samuel E. [National Magnetic Resonance Facility at Madison (United States); Eghbalnia, Hamid R., E-mail: eghbalhd@uc.edu [University of Cincinnati, Department of Molecular and Cellular Physiology (United States)
2012-04-15
The significant biological role of RNA has further highlighted the need for improving the accuracy, efficiency and the reach of methods for investigating RNA structure and function. Nuclear magnetic resonance (NMR) spectroscopy is vital to furthering the goals of RNA structural biology because of its distinctive capabilities. However, the dispersion pattern in the NMR spectra of RNA makes automated resonance assignment, a key step in NMR investigation of biomolecules, remarkably challenging. Herein we present RNA Probabilistic Assignment of Imino Resonance Shifts (RNA-PAIRS), a method for the automated assignment of RNA imino resonances with synchronized verification and correction of predicted secondary structure. RNA-PAIRS represents an advance in modeling the assignment paradigm because it seeds the probabilistic network for assignment with experimental NMR data, and predicted RNA secondary structure, simultaneously and from the start. Subsequently, RNA-PAIRS sets in motion a dynamic network that reverberates between predictions and experimental evidence in order to reconcile and rectify resonance assignments and secondary structure information. The procedure is halted when assignments and base-parings are deemed to be most consistent with observed crosspeaks. The current implementation of RNA-PAIRS uses an initial peak list derived from proton-nitrogen heteronuclear multiple quantum correlation ({sup 1}H-{sup 15}N 2D HMQC) and proton-proton nuclear Overhauser enhancement spectroscopy ({sup 1}H-{sup 1}H 2D NOESY) experiments. We have evaluated the performance of RNA-PAIRS by using it to analyze NMR datasets from 26 previously studied RNAs, including a 111-nucleotide complex. For moderately sized RNA molecules, and over a range of comparatively complex structural motifs, the average assignment accuracy exceeds 90%, while the average base pair prediction accuracy exceeded 93%. RNA-PAIRS yielded accurate assignments and base pairings consistent with imino
Energy Technology Data Exchange (ETDEWEB)
Renapurkar, Rahul D.; Azok, Joseph; Lempel, Jason; Karim, Wadih; Graham, Ruffin [Thoracic Imaging, L10, Imaging Institute, Cleveland Clinic, Cleveland, OH (United States); Primak, Andrew [Siemens Medical Solutions, Malvern, PA (United States); Tandon, Yasmeen [Case Western Reserve University-Metro Health Medical Center, Department of Radiology, Cleveland, OH (United States); Bullen, Jennifer [Quantitative Health Sciences, Cleveland Clinic, Cleveland, OH (United States); Dong, Frank [Section of Medical Physics, Cleveland Clinic, Cleveland, OH (United States)
2017-08-15
The purpose of this study was to evaluate the impact of attenuation-based kilovoltage (kV) pair selection in dual source dual energy (DSDE)-pulmonary embolism (PE) protocol examinations on radiation dose savings and image quality. A prospective study was carried out on 118 patients with suspected PE. In patients in whom attenuation-based kV pair selection selected the 80/140Sn kV pair, the pre-scan 100/140Sn CTDIvol (computed tomography dose index volume) values were compared with the pre-scan 80/140Sn CTDIvol values. Subjective and objective image quality parameters were assessed. Attenuation-based kV pair selection switched to the 80/140Sn kV pair (''switched'' cohort) in 63 out of 118 patients (53%). The mean 100/140Sn pre-scan CTDIvol was 8.8 mGy, while the mean 80/140Sn pre-scan CTDIvol was 7.5 mGy. The average estimated dose reduction for the ''switched'' cohort was 1.3 mGy (95% CI 1.2, 1.4; p < 0.001), representing a 15% reduction in dose. After adjusting for patient weight, mean attenuation was significantly higher in the ''switched'' vs. ''non-switched'' cohorts in all five pulmonary arteries and in all lobes on iodine maps. This study demonstrates that attenuation-based kV pair selection in DSDE examination is feasible and can offer radiation dose reduction without compromising image quality. (orig.)
Determination of selected organophosphorus pesticides using GC ...
African Journals Online (AJOL)
A reproducible analytical method utilising GC-MS is presented for the analysis of thirteen organophosphorus insecticides (OPs) often found in environmental aqueous samples. Extraction of filtered river and canal water (100 mL), fortified with the OPs, was conducted using solid-phase extraction and eluted with a variety of ...
Mohamad, Saharuddin B; Nagasawa, Hideko; Uto, Yoshihiro; Hori, Hitoshi
2002-05-01
Alpha-N-acetyl galactosaminidase (alpha-NaGalase) has been reported to accumulate in serum of cancer patients and be responsible for deglycosylation of Gc protein, which is a precursor of GcMAF-mediated macrophage activation cascade, finally leading to immunosuppression in advanced cancer patients. We studied the biochemical characterization of alpha-NaGalase from several human tumor cell lines. We also examined its effect on the potency of GcMAF to activate mouse peritoneal macrophage to produce superoxide in GcMAF-mediated macrophage activation cascade. The specific activity of alpha-NaGalases from human colon tumor cell line HCT116, human hepatoma cell line HepG2, and normal human liver cells (Chang liver cell line) were evaluated using two types of substrates; GalNAc-alpha-PNP (exo-type substrate) and Gal-beta-GalNAc-alpha-PNP (endo-type substrate). Tumor-derived alpha-NaGalase having higher activity than normal alpha-NaGalase, had higher substrate specificity to the exo-type substrate than to the endo-type substrate, and still maintained its activity at pH 7. GcMAF enhance superoxide production in mouse macrophage, and pre-treatment of GcMAF with tumor cell lysate reduce the activity. We conclude that tumor-derived alpha-NaGalase is different in biochemical characterization compared to normal alpha-NaGalase from normal Chang liver cells. In addition, tumor cell-derived alpha-NaGalase decreases the potency of GcMAF on macrophage activation.
International Nuclear Information System (INIS)
Straehle, U.; Klock, G.; Schuetz, G.
1987-01-01
To define the recognition sequence of the glucocorticoid receptor and its relationship with that of the progesterone receptor, oligonucleotides derived from the glucocorticoid response element of the tyrosine aminotransferase gene were tested upstream of a heterologous promoter for their capacity to mediate effects of these two steroids. The authors show that a 15-base-pair sequence with partial symmetry is sufficient to confer glucocorticoid inducibility on the promoter of the herpes simplex virus thymidine kinase gene. The same 15-base-pair sequence mediates induction by progesterone. Point mutations in the recognition sequence affect inducibility by glucocorticoids and progesterone similarly. Together with the strong conservation of the sequence of the DNA-binding domain of the two receptors, these data suggest that both proteins recognize a sequence that is similar, if not the same
Directory of Open Access Journals (Sweden)
O'Callaghan Sean
2012-05-01
Full Text Available Abstract Background Gas chromatography–mass spectrometry (GC-MS is a technique frequently used in targeted and non-targeted measurements of metabolites. Most existing software tools for processing of raw instrument GC-MS data tightly integrate data processing methods with graphical user interface facilitating interactive data processing. While interactive processing remains critically important in GC-MS applications, high-throughput studies increasingly dictate the need for command line tools, suitable for scripting of high-throughput, customized processing pipelines. Results PyMS comprises a library of functions for processing of instrument GC-MS data developed in Python. PyMS currently provides a complete set of GC-MS processing functions, including reading of standard data formats (ANDI- MS/NetCDF and JCAMP-DX, noise smoothing, baseline correction, peak detection, peak deconvolution, peak integration, and peak alignment by dynamic programming. A novel common ion single quantitation algorithm allows automated, accurate quantitation of GC-MS electron impact (EI fragmentation spectra when a large number of experiments are being analyzed. PyMS implements parallel processing for by-row and by-column data processing tasks based on Message Passing Interface (MPI, allowing processing to scale on multiple CPUs in distributed computing environments. A set of specifically designed experiments was performed in-house and used to comparatively evaluate the performance of PyMS and three widely used software packages for GC-MS data processing (AMDIS, AnalyzerPro, and XCMS. Conclusions PyMS is a novel software package for the processing of raw GC-MS data, particularly suitable for scripting of customized processing pipelines and for data processing in batch mode. PyMS provides limited graphical capabilities and can be used both for routine data processing and interactive/exploratory data analysis. In real-life GC-MS data processing scenarios PyMS performs
Brovarets, Ol'ha O; Hovorun, Dmytro M
2014-01-01
Trying to answer the question posed in the title, we have carried out a detailed theoretical investigation of the biologically important mechanism of the tautomerization of the A·T Watson-Crick DNA base pair, information that is hard to establish experimentally. By combining theoretical investigations at the MP2 and density functional theory levels of QM theory with quantum theory of atoms in molecules analysis, the tautomerization of the A·T Watson-Crick base pair by the double proton transfer (DPT) was comprehensively studied in vacuo and in the continuum with a low dielectric constant (ϵ = 4) corresponding to a hydrophobic interfaces of protein-nucleic acid interactions. Based on the sweeps of the electron-topological, geometric, and energetic parameters, which describe the course of the tautomerization along its intrinsic reaction coordinate (IRC), it was proved that the A·T → A(∗)·T(∗) tautomerization through the DPT is a concerted (i.e. the pathway without an intermediate) and asynchronous (i.e. protons move with a time gap) process. The limiting stage of this phenomenon is the final PT along the N6H⋯O4 hydrogen bond (H-bond). The continuum with ϵ = 4 does not affect qualitatively the course of the tautomerization reaction: similar to that observed in vacuo, it proceeds via a concerted asynchronous process with the same structure of the transition state (TS). For the first time, the nine key points along the IRC of the A·T base pair tautomerization, which could be considered as electron-topological "fingerprints" of a concerted asynchronous process of the tautomerization via the DPT, have been identified and fully characterized. These nine key points have been used to define the reactant, TS, and product regions of the DPT in the A·T base pair. Considering the energy dependence of each of the three H-bonds, which stabilize the Watson-Crick and Löwdin's base pairs, along the IRC of the tautomerization, it was found that all these H
Directory of Open Access Journals (Sweden)
Julie M. Panko
2012-11-01
Full Text Available Pyrolysis(pyr-GC/MS analysis of characteristic thermal decomposition fragments has been previously used for qualitative fingerprinting of organic sources in environmental samples. A quantitative pyr-GC/MS method based on characteristic tire polymer pyrolysis products was developed for tread particle quantification in environmental matrices including soil, sediment, and air. The feasibility of quantitative pyr-GC/MS analysis of tread was confirmed in a method evaluation study using artificial soil spiked with known amounts of cryogenically generated tread. Tread concentration determined by blinded analyses was highly correlated (r2 ³ 0.88 with the known tread spike concentration. Two critical refinements to the initial pyrolysis protocol were identified including use of an internal standard and quantification by the dimeric markers vinylcyclohexene and dipentene, which have good specificity for rubber polymer with no other appreciable environmental sources. A novel use of deuterated internal standards of similar polymeric structure was developed to correct the variable analyte recovery caused by sample size, matrix effects, and ion source variability. The resultant quantitative pyr-GC/MS protocol is reliable and transferable between laboratories.
Unice, Kenneth M; Kreider, Marisa L; Panko, Julie M
2012-11-08
Pyrolysis(pyr)-GC/MS analysis of characteristic thermal decomposition fragments has been previously used for qualitative fingerprinting of organic sources in environmental samples. A quantitative pyr-GC/MS method based on characteristic tire polymer pyrolysis products was developed for tread particle quantification in environmental matrices including soil, sediment, and air. The feasibility of quantitative pyr-GC/MS analysis of tread was confirmed in a method evaluation study using artificial soil spiked with known amounts of cryogenically generated tread. Tread concentration determined by blinded analyses was highly correlated (r2 ≥ 0.88) with the known tread spike concentration. Two critical refinements to the initial pyrolysis protocol were identified including use of an internal standard and quantification by the dimeric markers vinylcyclohexene and dipentene, which have good specificity for rubber polymer with no other appreciable environmental sources. A novel use of deuterated internal standards of similar polymeric structure was developed to correct the variable analyte recovery caused by sample size, matrix effects, and ion source variability. The resultant quantitative pyr-GC/MS protocol is reliable and transferable between laboratories.
Acar, T.; Lauter, K.; Naehrig, M.; Shumow, D.; Abdalla, M.; Lange, T.
2013-01-01
We report on relative performance numbers for affine and projective pairings on a dual-core Cortex A9 ARM processor. Using a fast inversion in the base field and doing inversion in extension fields by using the norm map to reduce to inversions in smaller fields, we find a very low ratio of
Adiabatic pair creation in heavy-ion and laser fields
International Nuclear Information System (INIS)
Pickl, P.; Durr, D.
2008-01-01
The planned generation of lasers and heavy-ion colliders renews the hope to see electron-positron pair creation in strong classical fields. This old prediction is usually referred to as spontaneous pair creation. We observe that both heavy-ion collisions and pair creation in strong laser fields, are instances of the theory of adiabatic pair creation. We shall present the theory, thereby correcting earlier results. We give the momentum distribution of created pairs in overcritical fields. We discuss carefully the proposed experimental verifications and conclude that pure laser-based experiments are highly questionable. We propose a new experiment, joining laser fields and heavy ions, which may be feasible with present-day technology and which may indeed verify the theoretical prediction of adiabatic pair creation. Our presentation relies on recent rigorous works in mathematical physics. (authors)
Sagan, Bruce E.; Savage, Carla D.
2012-01-01
We introduce the notion of a Mahonian pair. Consider the set, P^*, of all words having the positive integers as alphabet. Given finite subsets S,T of P^*, we say that (S,T) is a Mahonian pair if the distribution of the major index, maj, over S is the same as the distribution of the inversion number, inv, over T. So the well-known fact that maj and inv are equidistributed over the symmetric group, S_n, can be expressed by saying that (S_n,S_n) is a Mahonian pair. We investigate various Mahonia...
Lax pairs: a novel type of separability
International Nuclear Information System (INIS)
Fokas, A S
2009-01-01
An attempt is made to place into historical context the fundamental concept of Lax pairs. For economy of presentation, emphasis is placed on the effectiveness of Lax pairs for the analysis of integrable nonlinear evolution PDEs. It is argued that Lax pairs provide a deeper type of separability than the classical separation of variables. Indeed, it is shown that: (a) the solution of the Cauchy problem of evolution equations is based on the derivation of a nonlinear Fourier transform pair, and this is achieved by employing the spectral analysis of one of the two eigenvalue equations forming a Lax pair; thus, although this methodology still follows the reverent philosophy of the classical separation of variables and transform methods, it can be applied to a class of nonlinear PDEs. (b) The solution of initial-boundary-value problems of evolution equations is based on the simultaneous spectral analysis of both equations forming a Lax pair and hence, in a sense, it employs the synthesis instead of the separation of variables; this methodology does not have a direct classical analogue, however, it can be considered as the nonlinearization of a method which combines Green's function classical integral representations with an analogue of the method of images, but which are now formulated in the spectral (Fourier) instead of the physical space. In addition to presenting a general methodology for analysing initial- and initial-boundary-value problems for nonlinear integrable evolution equations in one and two spatial variables, recent progress is reviewed for the derivation and the solution of integrable nonlinear evolution PDEs formulated in higher than two spatial dimensions. (topical review)
DEFF Research Database (Denmark)
Hukkerikar, Amol; Kalakul, Sawitree; Sarup, Bent
2012-01-01
The aim of this work is to develop group-3 contribution+ (GC+)method (combined group-contribution (GC) method and atom connectivity index (CI)) based 15 property models to provide reliable estimations of environment-related properties of organic chemicals together with uncertainties of estimated...... property values. For this purpose, a systematic methodology for property modeling and uncertainty analysis is used. The methodology includes a parameter estimation step to determine parameters of property models and an uncertainty analysis step to establish statistical information about the quality......, poly functional chemicals, etc.) taken from the database of the US Environmental Protection Agency (EPA) and from the database of USEtox is used. For property modeling and uncertainty analysis, the Marrero and Gani GC method and atom connectivity index method have been considered. In total, 22...
Directory of Open Access Journals (Sweden)
Igor W. Ouédraogo
2009-08-01
Full Text Available Three carbonyl-containing extracts of essential oils from Eucalyptus citriodora (Myrtaceae, Cymbopogon citratus (Gramineae and Lippia multiflora (Verbenaceae were used for the preparation of oximes. The reaction mixtures were analyzed by GC-MS and different compounds were identified on the basis of their retention times and mass spectra. We observed quantitative conversion of aldehydes to their corresponding oximes with a purity of 95 to 99%. E and Z stereoisomers of the oximes were obtained and separated by GC-MS. During GC analysis, the high temperature in the injector was shown to cause partial dehydratation of oximes and the resulting nitriles were readily identified. Based on FT-IR spectroscopy, that revealed the high stability and low volatility of these compounds, the so-obtained oximes could be useful for future biological studies.
Chen, Yin; Lin, Bin; Yu, Weili; Yang, Yong; Bashir, Shahid M.; Wang, Hong; Takanabe, Kazuhiro; Idriss, Hicham; Basset, Jean-Marie
2015-01-01
A stable noble-metal-free hydrogen evolution photocatalyst based on graphite carbon nitride (g-C3N4) was developed by a molecular-level design strategy. Surface functionalization was successfully conducted to introduce a single nickel active site
Actionable gene-based classification toward precision medicine in gastric cancer
Directory of Open Access Journals (Sweden)
Hiroshi Ichikawa
2017-10-01
Full Text Available Abstract Background Intertumoral heterogeneity represents a significant hurdle to identifying optimized targeted therapies in gastric cancer (GC. To realize precision medicine for GC patients, an actionable gene alteration-based molecular classification that directly associates GCs with targeted therapies is needed. Methods A total of 207 Japanese patients with GC were included in this study. Formalin-fixed, paraffin-embedded (FFPE tumor tissues were obtained from surgical or biopsy specimens and were subjected to DNA extraction. We generated comprehensive genomic profiling data using a 435-gene panel including 69 actionable genes paired with US Food and Drug Administration-approved targeted therapies, and the evaluation of Epstein-Barr virus (EBV infection and microsatellite instability (MSI status. Results Comprehensive genomic sequencing detected at least one alteration of 435 cancer-related genes in 194 GCs (93.7% and of 69 actionable genes in 141 GCs (68.1%. We classified the 207 GCs into four The Cancer Genome Atlas (TCGA subtypes using the genomic profiling data; EBV (N = 9, MSI (N = 17, chromosomal instability (N = 119, and genomically stable subtype (N = 62. Actionable gene alterations were not specific and were widely observed throughout all TCGA subtypes. To discover a novel classification which more precisely selects candidates for targeted therapies, 207 GCs were classified using hypermutated phenotype and the mutation profile of 69 actionable genes. We identified a hypermutated group (N = 32, while the others (N = 175 were sub-divided into six clusters including five with actionable gene alterations: ERBB2 (N = 25, CDKN2A, and CDKN2B (N = 10, KRAS (N = 10, BRCA2 (N = 9, and ATM cluster (N = 12. The clinical utility of this classification was demonstrated by a case of unresectable GC with a remarkable response to anti-HER2 therapy in the ERBB2 cluster. Conclusions This actionable gene-based
Noninteractive Verifiable Outsourcing Algorithm for Bilinear Pairing with Improved Checkability
Directory of Open Access Journals (Sweden)
Yanli Ren
2017-01-01
Full Text Available It is well known that the computation of bilinear pairing is the most expensive operation in pairing-based cryptography. In this paper, we propose a noninteractive verifiable outsourcing algorithm of bilinear pairing based on two servers in the one-malicious model. The outsourcer need not execute any expensive operation, such as scalar multiplication and modular exponentiation. Moreover, the outsourcer could detect any failure with a probability close to 1 if one of the servers misbehaves. Therefore, the proposed algorithm improves checkability and decreases communication cost compared with the previous ones. Finally, we utilize the proposed algorithm as a subroutine to achieve an anonymous identity-based encryption (AIBE scheme with outsourced decryption and an identity-based signature (IBS scheme with outsourced verification.
Pair-correlations in swimmer suspensions
Nambiar, Sankalp; Subramanian, Ganesh
2017-11-01
Suspensions of rear-actuated swimming microorganisms, such as E.coli, exhibit several interesting phenomena including spontaneous pattern formation above a critical concentration, novel rheological properties, shear-induced concentration banding etc. Explanations based on mean-field theory are only qualitative, since interactions between swimmers are important for typical experimental concentrations. We analytically characterize the hydrodynamic pair-interactions in a quiescent suspension of slender straight swimmers. The pair-correlation, calculated at leading order by integrating the swimmer velocity disturbances along straight trajectories, decays as 1/r2 for r >> L (L being the swimmer size). This allows us to characterize both polar and nematic correlations in an interacting swimmer suspension. In the absence of correlations, the velocity covariance asymptotes from a constant for r > L, the latter being characteristic of a suspension of non-interacting point force-dipoles. On including correlations, the slow decay of the pair-orientation correlation leads to an additional contribution to the velocity covariance that diverges logarithmically with system size.
Identification of natural indigo in historical textiles by GC-MS.
Degani, Laura; Riedo, Chiara; Chiantore, Oscar
2015-02-01
The possibility of successfully applying a common GC-MS procedure for identification in one step of all types of dyes from plants of unknown origin and from historical objects is particularly attractive due to the high separation efficiency of the capillary columns, the MS detection sensitivity and the reproducibility of results. In this work, GC-MS analysis, previously and successfully used for the characterization of anthraquinones, flavonoids and tannins from plant extracts and historical samples, has been tested on indigoid dyestuffs. An analytical procedure based on the silylating agent N,O-bis-(trimethylsilyl)trifluoroacetamide (BSTFA) with 1% trimethylchlorosilane (TMCS) was applied to pure molecules of indigotin and indirubin and to plant extracts of Indigofera tinctoria L. and Isatis tinctoria L. Preliminary tests have been done to establish the chromatographic conditions and the derivatization amounts most suitable for the simultaneous detection of indigoid molecules and of the other natural compounds, such as fatty acids, carboxylic acids and sugars, contained within the plant extracts. In order to assess the capacity and the sensitivity of the analytical procedure in typical archaeometric applications, wool samples dyed in the laboratory with indigo were analysed by mimicking the sample amounts typically available with historical objects. The electron ionization (EI) spectra of the main silylated derivatives of indigoid molecules obtained in this way constitute the necessary data set for the characterization of natural extracts and historical works of art. Subsequently, the procedure has been applied to historical samples for the detection of indigo and of other dyestuffs eventually contained in samples. Additional information, useful for restoration and preservation of works of art, could be also obtained on the nature of stains and smudges present on the sampled textile material. The GC-MS method turns out to be an efficient and fast analytical tool
Facile synthesis of Fe3O4/g-C3N4/HKUST-1 composites as a novel biosensor platform for ochratoxin A.
Hu, Shuisheng; Ouyang, Wenjun; Guo, Longhua; Lin, Zhenyu; Jiang, Xiaohua; Qiu, Bin; Chen, Guonan
2017-06-15
A fluorescent biosensor for ochratoxin A was fabricated on the basis of a new nanocomposite (Fe 3 O 4 /g-C 3 N 4 /HKUST-1 composites). Fe 3 O 4 /g-C 3 N 4 /HKUST-1 was synthesized in this work for the first time, which combined HKUST-1 with g-C 3 N 4 to improve its chemical stability. Fe 3 O 4 /g-C 3 N 4 /HKUST-1 composites have strong adsorption capacity for dye-labeled aptamer and are able to completely quench the fluorescence of the dye through the photoinduced electron transfer (PET) mechanism. In the presence of ochratoxin A (OTA), it can bind with the aptamer with high affinity, causing the releasing of the dye-labeled aptamer from the Fe 3 O 4 /g-C 3 N 4 /HKUST-1 and therefore results in the recovery of fluorescence. The fluorescence intensity of the biosensor has a linear relationship with the OTA concentration in the range of 5.0-160.0ng/mL. The LOD of sensor is 2.57ng/mL (S/N=3). This fluorescence sensor based on the Fe 3 O 4 /g-C 3 N 4 /HKUST-1 composites has been applied to detect OTA in corn with satisfying results. Copyright © 2016. Published by Elsevier B.V.
Wang, Peng; Zong, Lanlan; Guan, Zhongjie; Li, Qiuye; Yang, Jianjun
2018-02-01
An economic and effective Pt-based alloy cocatalyst has attracted considerable attention due to their excellent catalytic activity and reducing Pt usage. In this study, PtNi alloy cocatalyst was successfully decorated on the g-C3N4/GO hybrid photocatalyst via a facile chemical reduction method. The Eosin Y-sensitized g-C3N4/PtNi/GO-0.5% composite photocatalyst yields about 1.54 and 1178 times higher hydrogen evolution rate than the Eosin Y-sensitized g-C3N4/Pt/GO-0.5% and g-C3N4/Ni/GO-0.5% samples, respectively. Mechanism of enhanced performance for the g-C3N4/PtNi/GO composite was also investigated by different characterization, such as photoluminescence, transient photocurrent response, and TEM. These results indicated that enhanced charge separation efficiency and more reactive sites are responsible for the improved hydrogen evolution performance due to the positive synergetic effect between Pt and Ni. This study suggests that PtNi alloy can be used as an economic and effective cocatalyst for hydrogen evolution reaction. [Figure not available: see fulltext.
Borges, Chad R; Rehder, Douglas S
2016-09-15
Disagreement exists regarding the O-glycan structure attached to human vitamin D binding protein (DBP). Previously reported evidence indicated that the O-glycan of the Gc1S allele product is the linear core 1 NeuNAc-Gal-GalNAc-Thr trisaccharide. Here, glycan structural evidence is provided from glycan linkage analysis and over 30 serial glycosidase-digestion experiments which were followed by analysis of the intact protein by electrospray ionization mass spectrometry (ESI-MS). Results demonstrate that the O-glycan from the Gc1F protein is the same linear trisaccharide found on the Gc1S protein and that the hexose residue is galactose. In addition, the putative anti-cancer derivative of DBP known as Gc Protein-derived Macrophage Activating Factor (GcMAF, which is formed by the combined action of β-galactosidase and neuraminidase upon DBP) was analyzed intact by ESI-MS, revealing that the activating E. coli β-galactosidase cleaves nothing from the protein-leaving the glycan structure of active GcMAF as a Gal-GalNAc-Thr disaccharide, regardless of the order in which β-galactosidase and neuraminidase are applied. Moreover, glycosidase digestion results show that α-N-Acetylgalactosamindase (nagalase) lacks endoglycosidic function and only cleaves the DBP O-glycan once it has been trimmed down to a GalNAc-Thr monosaccharide-precluding the possibility of this enzyme removing the O-glycan trisaccharide from cancer-patient DBP in vivo. Copyright © 2016 Elsevier Inc. All rights reserved.
Czech Academy of Sciences Publication Activity Database
Brauer, B.; Gerber, R. B.; Kabeláč, Martin; Hobza, Pavel; Bakker, J. M.; Abo-Riziq, A.; Vries de, M. S.
2005-01-01
Roč. 109, - (2005), s. 6974-6984 ISSN 1089-5639 Grant - others:NSF(US) CHE-0244341 Institutional research plan: CEZ:AV0Z40550506 Keywords : nucleic acids bases * vibrational spectrum * frequencies anharmonicity Subject RIV: CF - Physical ; Theoretical Chemistry Impact factor: 2.898, year: 2005
Ponderomotive effects in multiphoton pair production
Kohlfürst, Christian; Alkofer, Reinhard
2018-02-01
The Dirac-Heisenberg-Wigner formalism is employed to investigate electron-positron pair production in cylindrically symmetric but otherwise spatially inhomogeneous, oscillating electric fields. The oscillation frequencies are hereby tuned to obtain multiphoton pair production in the nonperturbative threshold regime. An effective mass, as well as a trajectory-based semiclassical analysis, is introduced in order to interpret the numerical results for the distribution functions as well as for the particle yields and spectra. The results, including the asymptotic particle spectra, display clear signatures of ponderomotive forces.
Application of accelerator mass spectrometry to environmental research, Trial of GC-AMS
International Nuclear Information System (INIS)
Shibata, Yasuyuki
2003-01-01
The accelerator analysis facility of the National Institute for Environmental Studies, which aims to develop a new device capable of measuring "1"4C age for each compound, is promoting the study to establish the GC-AMS that combines two-dimensional gas chromatograph (GC) and accelerator mass spectrometry (AMS). The on-line GC-AMS system for the metabolic measurement of "1"4C-labeled compounds for medicinal biochemical research is a system, in which a GC-separated sample is continuously converted into CO_2 in a combustion tube and introduced directly to a gas ion source to continuously measure "1"4C. In the "1"4C detection experiment, the concentration of CO_2 gas was changed using a helium introduction line and a sample injection valve, and CO_2 gas plus helium gas were introduced into the gas ion source. As a result, it was found that the online GC-AMS has feasibility and high potential capability. For off-line GC-AMS for environmental samples, after purification with preparative gas chromatography, the sample is converted to graphite in a vacuum line and applied to common AMS measurement. The authors collected Northwest Pacific Ocean bottom sediment cores, and performed the extraction and purification of fatty acids of specific stratigraphy and the "1"4C measurement of each compound. The age of the compound derived from the surface layer planktons was the result capable of indicating the sedimentary age of the stratigraphy. In addition, as an application study to explore the source of pollutants in the environment using "1"4C as a tracer representing the characteristics of each source, the authors started to conduct the research choosing atmospheric dust samples. As a starting point, the authors attempted to measure the "1"4C concentration of vehicle exhaust particles and incinerator fly ash particles respectively. There was hardly any "1"4C in vehicle exhaust particles. (A.O.)
Pairing States of Spin-3/2 Fermions: Symmetry-Enforced Topological Gap Functions
Venderbos, Jörn W. F.; Savary, Lucile; Ruhman, Jonathan; Lee, Patrick A.; Fu, Liang
2018-01-01
We study the topological properties of superconductors with paired j =3/2 quasiparticles. Higher spin Fermi surfaces can arise, for instance, in strongly spin-orbit coupled band-inverted semimetals. Examples include the Bi-based half-Heusler materials, which have recently been established as low-temperature and low-carrier density superconductors. Motivated by this experimental observation, we obtain a comprehensive symmetry-based classification of topological pairing states in systems with higher angular momentum Cooper pairing. Our study consists of two main parts. First, we develop the phenomenological theory of multicomponent (i.e., higher angular momentum) pairing by classifying the stationary points of the free energy within a Ginzburg-Landau framework. Based on the symmetry classification of stationary pairing states, we then derive the symmetry-imposed constraints on their gap structures. We find that, depending on the symmetry quantum numbers of the Cooper pairs, different types of topological pairing states can occur: fully gapped topological superconductors in class DIII, Dirac superconductors, and superconductors hosting Majorana fermions. Notably, we find a series of nematic fully gapped topological superconductors, as well as double- and triple-Dirac superconductors, with quadratic and cubic dispersion, respectively. Our approach, applied here to the case of j =3/2 Cooper pairing, is rooted in the symmetry properties of pairing states, and can therefore also be applied to other systems with higher angular momentum and high-spin pairing. We conclude by relating our results to experimentally accessible signatures in thermodynamic and dynamic probes.
Donny-Clark, Kerry; Shapiro, Robert; Broyde, Suse
2009-01-13
Bypass across DNA lesions by specialized polymerases is essential for maintenance of genomic stability. Human DNA polymerase iota (poliota) is a bypass polymerase of the Y family. Crystal structures of poliota suggest that Hoogsteen base pairing is employed to bypass minor groove DNA lesions, placing them on the spacious major groove side of the enzyme. Primer extension studies have shown that poliota is also capable of error-free nucleotide incorporation opposite the bulky major groove adduct N-(deoxyguanosin-8-yl)-2-acetylaminofluorene (dG-AAF). We present molecular dynamics simulations and free energy calculations suggesting that Watson-Crick base pairing could be employed in poliota for bypass of dG-AAF. In poliota with Hoogsteen-paired dG-AAF the bulky AAF moiety would reside on the cramped minor groove side of the template. The Hoogsteen-capable conformation distorts the active site, disrupting interactions necessary for error-free incorporation of dC opposite the lesion. Watson-Crick pairing places the AAF rings on the spacious major groove side, similar to the position of minor groove adducts observed with Hoogsteen pairing. Watson-Crick-paired structures show a well-ordered active site, with a near reaction-ready ternary complex. Thus our results suggest that poliota would utilize the same spacious region for lesion bypass of both major and minor groove adducts. Therefore, purine adducts with bulk on the minor groove side would use Hoogsteen pairing, while adducts with the bulky lesion on the major groove side would utilize Watson-Crick base pairing as indicated by our MD simulations for dG-AAF. This suggests the possibility of an expanded role for poliota in lesion bypass.
Gajewski, Andrzej; Kolenderski, Piotr L.
2016-10-01
There are several problems that must be solved in order to increase the distance of quantum communication protocols based on photons as an information carriers. One of them is the dispersion, whose effects can be minimized by engineering spectral properties of transmitted photons. In particular, it is expected that positively correlated photon pairs can be very useful. We present the full characterization of a source of single photon pairs at a telecom wavelength based on type II spontaneous parametric down conversion (SPDC) process in a beta-barium borate (BBO) crystal. In the type II process, a pump photon, which is polarized extraordinarily, splits in a nonlinear medium into signal and idler photons, which are polarized perpendicularly to each other. In order for the process to be efficient a phase matching condition must be fulfilled. These conditions originate from momentum and energy conservation rules and put severe restrictions on source parameters. Seemingly, these conditions force the photon pair to be negatively correlated in their spectral domain. However, it is possible to achieve positive correlation for pulsed pumping. The experimentally available degrees of freedom of a source are the width of the pumping beam, the collected modes' widths, the length of the nonlinear crystal and the duration of the pumping pulse. In our numerical model we use the following figures of merit: the pair production rate, the efficiency of photon coupling into a single mode fiber, the spectral correlation of the coupled photon pair. The last one is defined as the Pearson correlation parameter for a joint spectral distribution. The aim here is to find the largest positive spectral correlation and the highest coupling efficiency. By resorting to the numerical model Ref. [1] we showed in Ref. [2], that by careful adjustment of the pump's and the collected modes' characteristics, one can optimize any of the source's parameters. Our numerical outcomes conform to the
International Nuclear Information System (INIS)
Shimizu, Yoshifumi
2009-01-01
Except for the closed shell nuclei, almost all nuclei are in the superconducting state at their ground states. This well-known pair correlation in nuclei causes various interesting phenomena. It is especially to be noted that the pair correlation becomes weak in the excited states of nuclei with high angular momentum, which leads to the pair phase transition to the normal state in the high spin limit. On the other hand, the pair correlation becomes stronger in the nuclei with lower nucleon density than in those with normal density. In the region of neutron halo or skin state of unstable nuclei, this phenomenon is expected to be further enhanced to be observed compared to the ground state of stable nuclei. An overview of those interesting aspects caused via the pair correlation is presented here in the sections titled 'pair correlations in ground states', pair correlations in high spin states' and 'pair correlations in unstable nuclei' focusing on the high spin state. (S. Funahashi)
Experimental many-pairs nonlocality
Poh, Hou Shun; Cerè, Alessandro; Bancal, Jean-Daniel; Cai, Yu; Sangouard, Nicolas; Scarani, Valerio; Kurtsiefer, Christian
2017-08-01
Collective measurements on large quantum systems together with a majority voting strategy can lead to a violation of the Clauser-Horne-Shimony-Holt Bell inequality. In the presence of many entangled pairs, this violation decreases quickly with the number of pairs and vanishes for some critical pair number that is a function of the noise present in the system. Here we show that a different binning strategy can lead to a more substantial Bell violation when the noise is sufficiently small. Given the relation between the critical pair number and the source noise, we then present an experiment where the critical pair number is used to quantify the quality of a high visibility photon pair source. Our results demonstrate nonlocal correlations using collective measurements operating on clusters of more than 40 photon pairs.
DEFF Research Database (Denmark)
Dalgas, Karina Märcher
2015-01-01
pair-sending families in the Philippines, this dissertation examines the long-term trajectories of these young Filipinas. It shows how the au pairs’ local and transnational family relations develop over time and greatly influence their life trajectories. A focal point of the study is how au pairs...... that Filipina au pairs see their stay abroad as an avenue of personal development and social recognition, I examine how the au pairs re-position themselves within their families at home through migration, and how they navigate between the often conflicting expectations of participation in the sociality......Since 2000, thousands of young Filipino migrants have come to Denmark as au pairs. Officially, they are there to “broaden their cultural horizons” by living temporarily with a Danish host family, but they also conduct domestic labor in exchange for food and money, which allows them to send...
Enhanced visible light photocatalytic activity of g-C3N4 assisted by hydrogen peroxide
Chen, Quan-Liang; Liu, Yi-Ling; Tong, Li-Ge
2018-04-01
Water pollution has caused much attention nowadays. Photocatalysis as a kind of advanced oxidation technology has been widely studied in the field of environmental pollution control. As a stable non-metal photocatalyst, the photocatalytic activity of g-C3N4 assisted by H2O2 was investigated for the degradation of Rhodamine B (RhB) under visible light irradiation. The combination of g-C3N4 and H2O2 has much higher activity than that of pure g-C3N4 or H2O2. Neutral solution is preferred for the high phtotocatalytic activity of g-C3N4 with H2O2. The effect of the amount of catalyst, H2O2 concentration and RhB concentration was investigated. Photocatalytic mechanism study using radical scavenger showed free radicals {{{{O}}}2}- and · OH are the main active species. g-C3N4 assisted by H2O2 showed good photostability and repeatability after five cycles of degradation experiment.
Dislocation processes in quasicrystals-Kink-pair formation control or jog-pair formation control
International Nuclear Information System (INIS)
Takeuchi, Shin
2005-01-01
A computer simulation of dislocation in a model quasiperiodic lattice indicates that the dislocation feels a large Peierls potential when oriented in particular directions. For a dislocation with a high Peierls potential, the glide velocity and the climb velocity of the dislocation can be described almost in parallel in terms of the kink-pair formation followed by kink motion and the jog-pair formation followed by jog motion, respectively. The activation enthalpy of the kink-pair formation is the sum of the kink-pair formation enthalpy and the atomic jump activation enthalpy, while the activation enthalpy of the jog-pair formation involves the jog-pair enthalpy and the self-diffusion enthalpy. Since the kink-pair energy can be considerably larger than the jog-pair energy, the climb velocity can be faster than the glide velocity, so that the plastic deformation of quasicrystals can be brought not by dislocation glide but by dislocation climb at high temperatures
Malik, Manzoor Ahmad; Shukla, Swati; Azad, Shorya Vardhan; Kaur, Jasbir
2014-01-01
Purpose Vascular endothelial growth factor polymorphism (VEGF-634G/C, rs 2010963) has been considered a risk factor for the development of retinopathy of prematurity (ROP). However, the results remain controversial. Therefore, the aim of the present meta-analysis was to determine the association between VEGF-634G/C polymorphism and ROP risk. Methods Published literature from PubMed and other databases were retrieved. All studies evaluating the association between VEGF-634G/C polymorphism and ROP risk were included. Pooled odds ratio (OR) and 95% confidence interval (CI) were calculated using random or fixed effects model. A total of six case-control studies including 355 cases and 471 controls were included. Results By pooling all the studies, we found that VEGF-634G/C polymorphism was not associated with ROP risk at co-dominant and allele levels and no association was also found in dominant and recessive models. While stratifying on ethnicity level no association was observed in Caucasian and Asian population. Discussion This meta-analysis suggests that VEGF-634G/C polymorphism may not be associated with ROP risk, the association between single VEGF-634G/C polymorphism and ROP risk awaits further investigation. PMID:25473347
Transverse Momentum Distributions for Heavy Quark Pairs
Berger, Edmond L.; Meng, Ruibin
1993-01-01
We study the transverse momentum distribution for a $pair$ of heavy quarks produced in hadron-hadron interactions. Predictions for the large transverse momentum region are based on exact order $\\alpha_s^3$ QCD perturbation theory. For the small transverse momentum region, we use techniques for all orders resummation of leading logarithmic contributions associated with initial state soft gluon radiation. The combination provides the transverse momentum distribution of heavy quark pairs for all...
Clandestine laboratory scene investigation and processing using portable GC/MS
Matejczyk, Raymond J.
1997-02-01
This presentation describes the use of portable gas chromatography/mass spectrometry for on-scene investigation and processing of clandestine laboratories. Clandestine laboratory investigations present special problems to forensic investigators. These crime scenes contain many chemical hazards that must be detected, identified and collected as evidence. Gas chromatography/mass spectrometry performed on-scene with a rugged, portable unit is capable of analyzing a variety of matrices for drugs and chemicals used in the manufacture of illicit drugs, such as methamphetamine. Technologies used to detect various materials at a scene have particular applications but do not address the wide range of samples, chemicals, matrices and mixtures that exist in clan labs. Typical analyses performed by GC/MS are for the purpose of positively establishing the identity of starting materials, chemicals and end-product collected from clandestine laboratories. Concerns for the public and investigator safety and the environment are also important factors for rapid on-scene data generation. Here is described the implementation of a portable multiple-inlet GC/MS system designed for rapid deployment to a scene to perform forensic investigations of clandestine drug manufacturing laboratories. GC/MS has long been held as the 'gold standard' in performing forensic chemical analyses. With the capability of GC/MS to separate and produce a 'chemical fingerprint' of compounds, it is utilized as an essential technique for detecting and positively identifying chemical evidence. Rapid and conclusive on-scene analysis of evidence will assist the forensic investigators in collecting only pertinent evidence thereby reducing the amount of evidence to be transported, reducing chain of custody concerns, reducing costs and hazards, maintaining sample integrity and speeding the completion of the investigative process.
Isominkowskian theory of Cooper Pairs in superconductors
International Nuclear Information System (INIS)
Animalu, A.O.E.
1993-01-01
Via the use of Santilli's isominkowskian space, the author presents a relativistic extension of the author's recent treatment of the Cooper Pair in superconductivity based on the Lie-isotopic lifting of quantum mechanics known as Hadronic Mechanics. The isominkowskian treatment reduces the solution of the eiganvalue problem for the quasiparticle energy spectrum to a geometric problem of specifying the metric of the isominkowskian space inside the pair in various models of ordinary high T c superconductors. The use of an intriguing realization of the metric due to Dirac reduces the dimensionality of the interior space to two yielding a spin mutation from 1/2 to zero inside a Cooper pair in two-band BCS and Hubbard models. 12 refs
Szymanski, Eric S; Kimsey, Isaac J; Al-Hashimi, Hashim M
2017-03-29
The replicative and translational machinery utilizes the unique geometry of canonical G·C and A·T/U Watson-Crick base pairs to discriminate against DNA and RNA mismatches in order to ensure high fidelity replication, transcription, and translation. There is growing evidence that spontaneous errors occur when mismatches adopt a Watson-Crick-like geometry through tautomerization and/or ionization of the bases. Studies employing NMR relaxation dispersion recently showed that wobble dG·dT and rG·rU mismatches in DNA and RNA duplexes transiently form tautomeric and anionic species with probabilities (≈0.01-0.40%) that are in concordance with replicative and translational errors. Although computational studies indicate that these exceptionally short-lived and low-abundance species form Watson-Crick-like base pairs, their conformation could not be directly deduced from the experimental data, and alternative pairing geometries could not be ruled out. Here, we report direct NMR evidence that the transient tautomeric and anionic species form hydrogen-bonded Watson-Crick-like base pairs. A guanine-to-inosine substitution, which selectively knocks out a Watson-Crick-type (G)N2H 2 ···O2(T) hydrogen bond, significantly destabilized the transient tautomeric and anionic species, as assessed by lack of any detectable chemical exchange by imino nitrogen rotating frame spin relaxation (R 1ρ ) experiments. An 15 N R 1ρ NMR experiment targeting the amino nitrogen of guanine (dG-N2) provides direct evidence for Watson-Crick (G)N2H 2 ···O2(T) hydrogen bonding in the transient tautomeric state. The strategy presented in this work can be generally applied to examine hydrogen-bonding patterns in nucleic acid transient states including in other tautomeric and anionic species that are postulated to play roles in replication and translational errors.
Tang, Weijuan; Hazebroek, Jan; Zhong, Cathy; Harp, Teresa; Vlahakis, Chris; Baumhover, Brian; Asiago, Vincent
2017-06-28
We evaluated the variability of metabolites in various maize hybrids due to the effect of environment, genotype, phenotype as well as the interaction of the first two factors. We analyzed 480 forage and the same number of grain samples from 21 genetically diverse non-GM Pioneer brand maize hybrids, including some with drought tolerance and viral resistance phenotypes, grown at eight North American locations. As complementary platforms, both GC/MS and LC/MS were utilized to detect a wide diversity of metabolites. GC/MS revealed 166 and 137 metabolites in forage and grain samples, respectively, while LC/MS captured 1341 and 635 metabolites in forage and grain samples, respectively. Univariate and multivariate analyses were utilized to investigate the response of the maize metabolome to the environment, genotype, phenotype, and their interaction. Based on combined percentages from GC/MS and LC/MS datasets, the environment affected 36% to 84% of forage metabolites, while less than 7% were affected by genotype. The environment affected 12% to 90% of grain metabolites, whereas less than 27% were affected by genotype. Less than 10% and 11% of the metabolites were affected by phenotype in forage and grain, respectively. Unsupervised PCA and HCA analyses revealed similar trends, i.e., environmental effect was much stronger than genotype or phenotype effects. On the basis of comparisons of disease tolerant and disease susceptible hybrids, neither forage nor grain samples originating from different locations showed obvious phenotype effects. Our findings demonstrate that the combination of GC/MS and LC/MS based metabolite profiling followed by broad statistical analysis is an effective approach to identify the relative impact of environmental, genetic and phenotypic effects on the forage and grain composition of maize hybrids.
Energy Technology Data Exchange (ETDEWEB)
Treffert, U. (chemlab, Gesellschaft fuer Analytik und Umweltberatung mbH, Bensheim (Germany). Abt. ' ' Organische Analytik' ' ); Kolb, M. (Fachhochschule Aalen (Germany)); Stoerk, H. (chemlab, Gesellschaft fuer Analytik und Umweltberatung mbH, Bensheim (Germany))
1999-06-01
The articel describes an analysis method for the determination of 16 polycyclic aromatic hydrocarbons in deposited waste. The single steps are described very detailed: sample preparation by extraction, evaporation, flash-chromatography (Al[sub 2]O[sub 3]), quantitative analysis by GC-MSD. (SR)
The Effects of Reinforcer Pairing and Fading on Preschoolers' Snack Selections
Solberg, Katherine M.; Hanley, Gregory P.; Layer, Stacy A.; Ingvarsson, Einar T.
2007-01-01
The effects of reinforcement pairing and fading on preschoolers' snack selections were evaluated in a multiple baseline design. Baseline preferences for snack options were assessed via repeated paired-item preference assessments. Edible, social, and activity-based reinforcers were then exclusively paired with a less preferred snack option. Once…
DNA nanostructure-based drug delivery nanosystems in cancer therapy.
Wu, Dandan; Wang, Lei; Li, Wei; Xu, Xiaowen; Jiang, Wei
2017-11-25
DNA as a novel biomaterial can be used to fabricate different kinds of DNA nanostructures based on its principle of GC/AT complementary base pairing. Studies have shown that DNA nanostructure is a nice drug carrier to overcome big obstacles existing in cancer therapy such as systemic toxicity and unsatisfied drug efficacy. Thus, different types of DNA nanostructure-based drug delivery nanosystems have been designed in cancer therapy. To improve treating efficacy, they are also developed into more functional drug delivery nanosystems. In recent years, some important progresses have been made. The objective of this review is to make a retrospect and summary about these different kinds of DNA nanostructure-based drug delivery nanosystems and their latest progresses: (1) active targeting; (2) mutidrug co-delivery; (3) construction of stimuli-responsive/intelligent nanosystems. Copyright © 2017 Elsevier B.V. All rights reserved.
International Nuclear Information System (INIS)
Garcia de Oteyza, T.; Grimalt, J.O.
2006-01-01
The massive oil discharge in the Saudi Arabian coast at the end of the 1991 Gulf War is used here as a natural experiment to study the ability of microbial mats to transform oil residues after major spills. The degree of oil transformation has been evaluated from the analysis of the aliphatic and aromatic hydrocarbons by gas chromatography (GC) and GC coupled to mass spectrometry (GC-MS). The oil-polluted microbial mat samples from coastal environments exhibited an intermediate degree of transformation between that observed in superficial and deep sediments. Evaporation, photo-oxidation and water-washing seemed to lead to more effective and rapid elimination of hydrocarbons than cyanobacteria and its associated microorganisms. Furthermore, comparison of some compounds (e.g. regular isoprenoid hydrocarbons or alkylnaphthalenes) in the oil collected in the area after the spill or in the mixtures retained by cyanobacterial growth gave rise to an apparent effect of hydrocarbon preservation in the microbial mat ecosystems. - Cyanobacterial mats inhibit degradation of oil by reducing exposure to the atmosphere and seawater
DEFF Research Database (Denmark)
Börjesson, Karl; Preus, Søren; El-Sagheer, Afaf
2009-01-01
We present the first nucleobase analog fluorescence resonance energy transfer (FRET)-pair. The pair consists of tCO, 1,3-diaza-2-oxophenoxazine, as an energy donor and the newly developed tC(nitro), 7-nitro-1,3-diaza-2-oxophenothiazine, as an energy acceptor. The FRET-pair successfully monitors d...
Superior coexistence: systematicALLY regulatING land subsidence BASED on set pair theory
Directory of Open Access Journals (Sweden)
Y. Chen
2015-11-01
Full Text Available Anthropogenic land subsidence is an environmental side effect of exploring and using natural resources in the process of economic development. The key points of the system for controlling land subsidence include cooperation and superior coexistence while the economy develops, exploring and using natural resources, and geological environmental safety. Using the theory and method of set pair analysis (SPA, this article anatomises the factors, effects, and transformation of land subsidence. Based on the principle of superior coexistence, this paper promotes a technical approach to the system for controlling land subsidence, in order to improve the prevention and control of geological hazards.
Graph-based surface reconstruction from stereo pairs using image segmentation
Bleyer, Michael; Gelautz, Margrit
2005-01-01
This paper describes a novel stereo matching algorithm for epipolar rectified images. The method applies colour segmentation on the reference image. The use of segmentation makes the algorithm capable of handling large untextured regions, estimating precise depth boundaries and propagating disparity information to occluded regions, which are challenging tasks for conventional stereo methods. We model disparity inside a segment by a planar equation. Initial disparity segments are clustered to form a set of disparity layers, which are planar surfaces that are likely to occur in the scene. Assignments of segments to disparity layers are then derived by minimization of a global cost function via a robust optimization technique that employs graph cuts. The cost function is defined on the pixel level, as well as on the segment level. While the pixel level measures the data similarity based on the current disparity map and detects occlusions symmetrically in both views, the segment level propagates the segmentation information and incorporates a smoothness term. New planar models are then generated based on the disparity layers' spatial extents. Results obtained for benchmark and self-recorded image pairs indicate that the proposed method is able to compete with the best-performing state-of-the-art algorithms.