
Sample records for gc base pair

  1. Theoretical study of GC+/GC base pair derivatives

    International Nuclear Information System (INIS)

    Meng Fancui; Wang Huanjie; Xu Weiren; Liu Chengbu


    The geometries of R (R=CH 3 , CH 3 O, F, NO 2 ) substituted GC base pair derivatives and their cations have been optimized at B3LYP/6-31G* level and the substituent effects on the neutral and cationic geometric structures and energies have been discussed. The inner reorganization energies of various base pair derivatives and the native GC base pair have been calculated to discuss the substituent effects on the reorganization energy. NBO (natural bond orbital) analysis has been carried out on both the neutral and the cationic systems to investigate the differences of the charge distributions and the electronic structures. The outcomes indicate that 8-CH 3 O-G:C has the greatest reorganization energy and 8-NO 2 -G:C has the least, while the other substituted base pairs have a reorganization energy close to that of G:C. The one charge is mostly localized on guanine part after ionization and as high as 0.95e. The bond distances of N1-N3'andN2-O2' in the cationic base pair derivatives shortened and that of O6-N4' elongated as compared with the corresponding bond distances of the neutral GC base pair derivatives

  2. A novel pseudo-complementary PNA G-C base pair

    DEFF Research Database (Denmark)

    Olsen, Anne G.; Dahl, Otto; Petersen, Asger Bjørn


    Pseudo-complementary oligonucleotide analogues and mimics provide novel opportunities for targeting duplex structures in RNA and DNA. Previously, a pseudo-complementary A-T base pair has been introduced. Towards sequence unrestricted targeting, a pseudo-complementary G-C base pair consisting...

  3. [Under what conditions does G.C Watson-Crick DNA base pair acquire all four configurations characteristic for A.T Watson-Crick DNA base pair?]. (United States)

    Brovarets', O O


    At the MP2/6-311++G(2df,pd)//B3LYP/6-311++G(d,p) level of theory it was established for the first time, that the Löwdin's G*.C* DNA base pair formed by the mutagenic tautomers can acquire, as the A-T Watson-Crick DNA base pair, four biologically important configurations, namely: Watson-Crick, reverse Watson-Crick, Hoogsteen and reverse Hoogsteen. This fact demonstrates rather unexpected role of the tautomerisation of the one of the Watson-Crick DNA base pairs, in particular, via double proton transfer: exactly the G.C-->G*.C* tautomerisation allows to overcome steric hindrances for the implementation of the above mentioned configurations. Geometric, electron-topological and energetic properties of the H-bonds that stabilise the studied pairs, as well as the energetic characteristics of the latters are presented.

  4. Supramolecular Switches Based on the Guanine–Cytosine (GC) Watson–Crick Pair: Effect of Neutral and Ionic Substituents

    NARCIS (Netherlands)

    Guerra, C.F.; van der Wijst, T.; Bickelhaupt, F.M.


    We have theoretically analyzed Watson–Crick guanine–cytosine (GC) base pairs in which purine-C8 and/or pyrimidine-C6 positions carry a substituent X = NH−, NH2, NH3+ (N series), O−, OH, or OH2+ (O series), using the generalized gradient approximation (GGA) of density functional theory at the

  5. DFT study on the attacking mechanisms of H and OH radicals to G-C and A-T base pairs in water

    Energy Technology Data Exchange (ETDEWEB)

    Okutsu, N.; Shimamura, K.; Shimizu, E.; Kurita, N., E-mail: [Department of Computer Science and Engineering, Toyohashi University of Technology, Toyohashi, Aichi, 441-8580 (Japan); Shulga, S. [Institute for Food Biotechnology and Genomics, National Academy of Sciences of Ukraine, Kyiv (Ukraine); Danilov, V. I. [Institute of Molecular Biology and Genetics, National Academy of Sciences of Ukraine, Kyiv (Ukraine)


    To elucidate the effect of radicals on DNA base pairs, we investigated the attacking mechanism of OH and H radicals to the G-C and A-T base pairs, using the density functional theory (DFT) calculations in water approximated by the continuum solvation model. The DFT calculations revealed that the OH radical abstracts the hydrogen atom of a NH{sub 2} group of G or A base and induces a tautomeric reaction for an A-T base pair more significantly than for a G-C base pair. On the other hand, the H radical prefers to bind to the Cytosine NH{sub 2} group of G-C base pair and induce a tautomeric reaction from G-C to G*-C*, whose activation free energy is considerably small (−0.1 kcal/mol) in comparison with that (42.9 kcal/mol) for the reaction of an A-T base pair. Accordingly, our DFT calculations elucidated that OH and H radicals have a significant effect on A-T and G-C base pairs, respectively. This finding will be useful for predicting the effect of radiation on the genetic information recorded in the base sequences of DNA duplexes.

  6. DFT study on the attacking mechanisms of H and OH radicals to G-C and A-T base pairs in water

    International Nuclear Information System (INIS)

    Okutsu, N.; Shimamura, K.; Shimizu, E.; Kurita, N.; Shulga, S.; Danilov, V. I.


    To elucidate the effect of radicals on DNA base pairs, we investigated the attacking mechanism of OH and H radicals to the G-C and A-T base pairs, using the density functional theory (DFT) calculations in water approximated by the continuum solvation model. The DFT calculations revealed that the OH radical abstracts the hydrogen atom of a NH 2 group of G or A base and induces a tautomeric reaction for an A-T base pair more significantly than for a G-C base pair. On the other hand, the H radical prefers to bind to the Cytosine NH 2 group of G-C base pair and induce a tautomeric reaction from G-C to G*-C*, whose activation free energy is considerably small (−0.1 kcal/mol) in comparison with that (42.9 kcal/mol) for the reaction of an A-T base pair. Accordingly, our DFT calculations elucidated that OH and H radicals have a significant effect on A-T and G-C base pairs, respectively. This finding will be useful for predicting the effect of radiation on the genetic information recorded in the base sequences of DNA duplexes

  7. DFT investigation of the vibrational properties of GC Watson-Crick and Hoogsteen base pairs in the presence of Mg²⁺, Ca²⁺, and Cu²⁺ ions. (United States)

    Morari, Cristian; Muntean, Cristina M; Tripon, Carmen; Buimaga-Iarinca, Luiza; Calborean, Adrian


    The binding effects of Mg²⁺, Ca²⁺, and Cu²⁺ ions on the vibrational properties of guanine-cytosine base pairs have been performed using density functional theory investigations. Both Watson-Crick and Hoogsteen configurations of the base pairs were investigated. In Watson-Crick configuration, the metal was coordinated at N7 atom of guanine, while in the case of Hoogsteen configuration, the coordination is at N3 atom of guanine. We have pointed out the geometric properties of the metal-GC base pairs structure, as well as the vibrational bands that can be used to detect the presence of metallic ions in the Watson-Crick and Hoogsteen GC structures. For the geometric models used by us, the vibrational amplitudes of metallic atoms were stronger for wavenumbers lower than 500 cm⁻¹. This suggests that in the experimental studies on DNA the presence of the three metallic atoms (Mg, Ca, and Cu) can be explicitly detected at low frequencies.

  8. Vibrational spectroscopy of the G...C base pair: Experiment, harmonic and anharmonic calculations, and the nature of the anharmonic couplings

    Czech Academy of Sciences Publication Activity Database

    Brauer, B.; Gerber, R. B.; Kabeláč, Martin; Hobza, Pavel; Bakker, J. M.; Abo-Riziq, A.; Vries de, M. S.


    Roč. 109, - (2005), s. 6974-6984 ISSN 1089-5639 Grant - others:NSF(US) CHE-0244341 Institutional research plan: CEZ:AV0Z40550506 Keywords : nucleic acids bases * vibrational spectrum * frequencies anharmonicity Subject RIV: CF - Physical ; Theoretical Chemistry Impact factor: 2.898, year: 2005

  9. Study of the red lacquer from a pair of Namban stirrups by Py-GC/MS

    Directory of Open Access Journals (Sweden)

    José Carlos Frade


    Full Text Available Oriental lacquer is a material of vegetal origin that is used in the Asian countries as a coating for the most varied kinds of religious and civil use objects. With the Portuguese arrival to the East, the Europeans started to develop a taste for the exotic and exquisite Art of Lacquer. From the 16th century onwards a lacquerware market developed with numerous lacquered objects being brought to Europe. In this work, the red lacquer from a pair of Namban stirrups was studied by Py-GC/MS (pyrolysis-gas chromatography/mass spectrometry. The results were compared with lacquer references, and the lacquer type was identified. Based on the results, the stirrups' lacquering technique and the performance of Py-CG/MS in the identification of oriental lacquers are also discussed.

  10. Nanoswitches based on DNA base pairs: why adenine-thymine is less suitable than guanine-cytosine

    NARCIS (Netherlands)

    Fonseca Guerra, C.; van der Wijst, T.; Bickelhaupt, F.M.


    Substituted Watson-Crick guanine-cytosine (GC) base pairs were recently shown to yield robust three-state nanoswitches. Here, we address the question: Can such supramolecular switches also be based on Watson-Crick adenine-thymine (AT) base pairs? We have theoretically analyzed AT pairs in which

  11. Graphene and g-C3N4 based photocatalysts for NOx removal: A review (United States)

    Nikokavoura, Aspasia; Trapalis, Christos


    NOx liberated into atmosphere from automobile exhausts and fossil fuel combustion, comprise the major air pollutants. They are responsible for serious environmental problems such as acid rain, ozone accumulation, haze and photochemical smog. Besides they contribute to the deterioration of human health by causing decrease of the lung function and respiratory problems. The application of photocatalytic methods in order to mitigate the presence of NOx in the atmosphere is preferable as they are environmentally friendly, mild and low cost. Therefore, in this review, the photocatalytic activity of g-C3N4 and graphene based composites towards NOx removal was discussed. NOx oxidation to non volatile nitrates on the surface of graphene and g-C3N4 based photocatalysts has attracted much interest during the last years due to their structures with unique features such as large specific surface area, thermal and chemical stability and enhanced visible light utilization. The formation of 2D-2D intimate heterojunctions between graphene or g-C3N4 and other components ensures the enhanced charge transfer, lifetime of electron/hole pairs and thus photocatalytic activity. The increased visible light harvesting also contributes to their usefulness as effective photocatalytic materials. In the present work, the advantages of these novel photocatalysts and the differences/similarities between them were exhaustively highlighted. The role of graphene as catalyst promoter, electron reservoir, support and photosensitizer in its photocatalytic composites was emphasized. The effect of g-C3N4 doping and copolymerization with metals/semiconductors on its photocatalytic activity towards NOx oxidation was thoroughly discussed. Besides, the preparation methods, photocatalytic efficiencies, type of irradiation, utilization of appropriate cocatalysts, and reaction mechanisms during the photocatalytic NOx removal by graphene and g-C3N4 composies, were summarized. It was demonstrated that in the vast

  12. Report on Pairing-based Cryptography. (United States)

    Moody, Dustin; Peralta, Rene; Perlner, Ray; Regenscheid, Andrew; Roginsky, Allen; Chen, Lily


    This report summarizes study results on pairing-based cryptography. The main purpose of the study is to form NIST's position on standardizing and recommending pairing-based cryptography schemes currently published in research literature and standardized in other standard bodies. The report reviews the mathematical background of pairings. This includes topics such as pairing-friendly elliptic curves and how to compute various pairings. It includes a brief introduction to existing identity-based encryption (IBE) schemes and other cryptographic schemes using pairing technology. The report provides a complete study of the current status of standard activities on pairing-based cryptographic schemes. It explores different application scenarios for pairing-based cryptography schemes. As an important aspect of adopting pairing-based schemes, the report also considers the challenges inherent in validation testing of cryptographic algorithms and modules. Based on the study, the report suggests an approach for including pairing-based cryptography schemes in the NIST cryptographic toolkit. The report also outlines several questions that will require further study if this approach is followed.

  13. Unnatural base pair systems toward the expansion of the genetic alphabet in the central dogma. (United States)

    Hirao, Ichiro; Kimoto, Michiko


    Toward the expansion of the genetic alphabet of DNA, several artificial third base pairs (unnatural base pairs) have been created. Synthetic DNAs containing the unnatural base pairs can be amplified faithfully by PCR, along with the natural A-T and G-C pairs, and transcribed into RNA. The unnatural base pair systems now have high potential to open the door to next generation biotechnology. The creation of unnatural base pairs is a consequence of repeating "proof of concept" experiments. In the process, initially designed base pairs were modified to address their weak points. Some of them were artificially evolved to ones with higher efficiency and selectivity in polymerase reactions, while others were eliminated from the analysis. Here, we describe the process of unnatural base pair development, as well as the tests of their applications.

  14. Watson-Crick base pairs with thiocarbonyl groups: How sulfur changes the hydrogen bonds in DNA

    NARCIS (Netherlands)

    Fonseca Guerra, C.; Baerends, E.J.; Bickelhaupt, F.M.


    We have theoretically analyzed mimics of Watson-Crick AT and GC base pairs in which N-H•••O hydrogen bonds are replaced by N-H•••S, using the generalized gradient approximation (GGA) of density functional theory at BP86/TZ2P level. The general effect of the above substitutions is an elongation and a

  15. Substituent effif ects on hydrogen bonding in Watson-Crick base pairs. A theoretical study

    NARCIS (Netherlands)

    Fonseca Guerra, C.; van der Wijst, T.; Bickelhaupt, F.M.


    We have theoretically analyzed Watson-Crick AT and GC base pairs in which purine C8 and/or pyrimidine C6 positions carry a substituent X = H, F, Cl or Br, using the generalized gradient approximation (GGA) of density functional theory at BP86/TZ2P. The purpose is to study the effects on structure

  16. Hydrogen Bonding in DNA Base Pairs: Reconciliation of Theory and Experiment

    NARCIS (Netherlands)

    Fonseca Guerra, C.; Bickelhaupt, F.M.; Snijders, J.G.; Baerends, E.J.


    Up till now, there has been a significant disagreement between theory and experiment regarding hydrogen bond lengths in Watson - Crick base pairs. To investigate the possible sources of this discrepancy, we have studied numerous model systems for adenine - thymine (AT) and guanine - cytosine (GC)

  17. Higher order structural effects stabilizing the reverse watson-crick guanine-cytosine base pair in functional RNAs

    KAUST Repository

    Chawla, Mohit


    The G:C reverse Watson-Crick (W:W trans) base pair, also known as Levitt base pair in the context of tRNAs, is a structurally and functionally important base pair that contributes to tertiary interactions joining distant domains in functional RNA molecules and also participates in metabolite binding in riboswitches. We previously indicated that the isolated G:C W:W trans base pair is a rather unstable geometry, and that dicationic metal binding to the Guanine base or posttranscriptional modification of the Guanine can increase its stability. Herein, we extend our survey and report on other H-bonding interactions that can increase the stability of this base pair. To this aim, we performed a bioinformatics search of the PDB to locate all the occurencies of G:C trans base pairs. Interestingly, 66% of the G:C trans base pairs in the PDB are engaged in additional H-bonding interactions with other bases, the RNA backbone or structured water molecules. High level quantum mechanical calculations on a data set of representative crystal structures were performed to shed light on the structural stability and energetics of the various crystallographic motifs. This analysis was extended to the binding of the preQ1 metabolite to a preQ1-II riboswitch. 2013 The Author(s).

  18. Radical-pair based avian magnetoreception (United States)

    Procopio, Maria; Ritz, Thorsten


    Behavioural experiments suggest that migratory birds possess a magnetic compass sensor able to detect the direction of the geomagnetic. One hypothesis for the basis of this remarkable sensory ability is that the coherent quantum spin dynamics of photoinduced radical pair reactions transduces directional magnetic information from the geomagnetic field into changes of reaction yields, possibly involving the photoreceptor cryptochrome in the birds retina. The suggested radical-pair based avian magnetoreception has attracted attention in the field of quantum biology as an example of a biological sensor which might exploit quantum coherences for its biological function. Investigations on such a spin-based sensor have focussed on uncovering the design features for the design of a biomimetic magnetic field sensor. We study the effects of slow fluctuations in the nuclear spin environment on the directional signal. We quantitatively evaluate the robustness of signals under fluctuations on a timescale longer than the lifetime of a radical pair, utilizing two models of radical pairs. Our results suggest design principles for building a radical-pair based compass sensor that is both robust and highly directional sensitive.

  19. Base pair probability estimates improve the prediction accuracy of RNA non-canonical base pairs.

    Directory of Open Access Journals (Sweden)

    Michael F Sloma


    Full Text Available Prediction of RNA tertiary structure from sequence is an important problem, but generating accurate structure models for even short sequences remains difficult. Predictions of RNA tertiary structure tend to be least accurate in loop regions, where non-canonical pairs are important for determining the details of structure. Non-canonical pairs can be predicted using a knowledge-based model of structure that scores nucleotide cyclic motifs, or NCMs. In this work, a partition function algorithm is introduced that allows the estimation of base pairing probabilities for both canonical and non-canonical interactions. Pairs that are predicted to be probable are more likely to be found in the true structure than pairs of lower probability. Pair probability estimates can be further improved by predicting the structure conserved across multiple homologous sequences using the TurboFold algorithm. These pairing probabilities, used in concert with prior knowledge of the canonical secondary structure, allow accurate inference of non-canonical pairs, an important step towards accurate prediction of the full tertiary structure. Software to predict non-canonical base pairs and pairing probabilities is now provided as part of the RNAstructure software package.

  20. Base pair probability estimates improve the prediction accuracy of RNA non-canonical base pairs. (United States)

    Sloma, Michael F; Mathews, David H


    Prediction of RNA tertiary structure from sequence is an important problem, but generating accurate structure models for even short sequences remains difficult. Predictions of RNA tertiary structure tend to be least accurate in loop regions, where non-canonical pairs are important for determining the details of structure. Non-canonical pairs can be predicted using a knowledge-based model of structure that scores nucleotide cyclic motifs, or NCMs. In this work, a partition function algorithm is introduced that allows the estimation of base pairing probabilities for both canonical and non-canonical interactions. Pairs that are predicted to be probable are more likely to be found in the true structure than pairs of lower probability. Pair probability estimates can be further improved by predicting the structure conserved across multiple homologous sequences using the TurboFold algorithm. These pairing probabilities, used in concert with prior knowledge of the canonical secondary structure, allow accurate inference of non-canonical pairs, an important step towards accurate prediction of the full tertiary structure. Software to predict non-canonical base pairs and pairing probabilities is now provided as part of the RNAstructure software package.

  1. A quantum theoretical study of reactions of methyldiazonium ion with DNA base pairs

    International Nuclear Information System (INIS)

    Shukla, P.K.; Ganapathy, Vinay; Mishra, P.C.


    Graphical abstract: Reactions of methyldiazonium ion at the different sites of the DNA bases in the Watson-Crick GC and AT base pairs were investigated employing density functional and second order Moller-Plesset (MP2) perturbation theories. Display Omitted Highlights: → Methylation of the DNA bases is important as it can cause mutation and cancer. → Methylation reactions of the GC and AT base pairs with CH 3 N 2 + were not studied earlier theoretically. → Experimental observations have been explained using theoretical methods. - Abstract: Methylation of the DNA bases in the Watson-Crick GC and AT base pairs by the methyldiazonium ion was investigated employing density functional and second order Moller-Plesset (MP2) perturbation theories. Methylation at the N3, N7 and O6 sites of guanine, N1, N3 and N7 sites of adenine, O2 and N3 sites of cytosine and the O2 and O4 sites of thymine were considered. The computed reactivities for methylation follow the order N7(guanine) > N3(adenine) > O6(guanine) which is in agreement with experiment. The base pairing in DNA is found to play a significant role with regard to reactivities of the different sites.

  2. Metal-mediated DNA base pairing: alternatives to hydrogen-bonded Watson-Crick base pairs. (United States)

    Takezawa, Yusuke; Shionoya, Mitsuhiko


    With its capacity to store and transfer the genetic information within a sequence of monomers, DNA forms its central role in chemical evolution through replication and amplification. This elegant behavior is largely based on highly specific molecular recognition between nucleobases through the specific hydrogen bonds in the Watson-Crick base pairing system. While the native base pairs have been amazingly sophisticated through the long history of evolution, synthetic chemists have devoted considerable efforts to create alternative base pairing systems in recent decades. Most of these new systems were designed based on the shape complementarity of the pairs or the rearrangement of hydrogen-bonding patterns. We wondered whether metal coordination could serve as an alternative driving force for DNA base pairing and why hydrogen bonding was selected on Earth in the course of molecular evolution. Therefore, we envisioned an alternative design strategy: we replaced hydrogen bonding with another important scheme in biological systems, metal-coordination bonding. In this Account, we provide an overview of the chemistry of metal-mediated base pairing including basic concepts, molecular design, characteristic structures and properties, and possible applications of DNA-based molecular systems. We describe several examples of artificial metal-mediated base pairs, such as Cu(2+)-mediated hydroxypyridone base pair, H-Cu(2+)-H (where H denotes a hydroxypyridone-bearing nucleoside), developed by us and other researchers. To design the metallo-base pairs we carefully chose appropriate combinations of ligand-bearing nucleosides and metal ions. As expected from their stronger bonding through metal coordination, DNA duplexes possessing metallo-base pairs exhibited higher thermal stability than natural hydrogen-bonded DNAs. Furthermore, we could also use metal-mediated base pairs to construct or induce other high-order structures. These features could lead to metal-responsive functional

  3. Signature scheme based on bilinear pairs (United States)

    Tong, Rui Y.; Geng, Yong J.


    An identity-based signature scheme is proposed by using bilinear pairs technology. The scheme uses user's identity information as public key such as email address, IP address, telephone number so that it erases the cost of forming and managing public key infrastructure and avoids the problem of user private generating center generating forgery signature by using CL-PKC framework to generate user's private key.

  4. Theoretical analysis of noncanonical base pairing interactions in ...

    Indian Academy of Sciences (India)


    Noncanonical base pairs in RNA have strong structural and functional implications but are currently not considered ..... Full optimizations of the systems were also carried out using ... of the individual bases in the base pair through the equation.

  5. Silver(I)-Mediated Base Pairs in DNA Sequences Containing 7-Deazaguanine/Cytosine: towards DNA with Entirely Metallated Watson-Crick Base Pairs. (United States)

    Méndez-Arriaga, José M; Maldonado, Carmen R; Dobado, José A; Galindo, Miguel A


    DNA sequences comprising noncanonical 7-deazaguanine ( 7C G) and canonical cytosine (C) are capable of forming Watson-Crick base pairs via hydrogen bonds as well as silver(I)-mediated base pairs by coordination to central silver(I) ions. Duplexes I and II containing 7C G and C have been synthesized and characterized. The incorporation of silver(I) ions into these duplexes has been studied by means of temperature-dependent UV spectroscopy, circular dichroism, and DFT calculations. The results suggest the formation of DNA molecules comprising contiguous metallated 7C G-Ag I -C Watson-Crick base pairs that preserve the original B-type conformation. Furthermore, additional studies performed on duplex III indicated that, in the presence of Ag I ions, 7C G-C and 7C A-T Watson-Crick base pairs ( 7C A, 7-deazadenine; T, thymine) can be converted to metallated 7C G-Ag I -C and 7C A-Ag I -T base pairs inside the same DNA molecule whilst maintaining its initial double helix conformation. These findings are very important for the development of customized silver-DNA nanostructures based on a Watson-Crick complementarity pattern. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  6. A review on g-C3N4-based photocatalysts

    International Nuclear Information System (INIS)

    Wen, Jiuqing; Xie, Jun; Chen, Xiaobo; Li, Xin


    Graphical abstract: The photocatalytic fundamentals, versatile properties, design strategies and potential applications of g-C 3 N 4 -based photocatalysts were systematically summarized and addressed. - Highlights: • The photocatalytic fundamentals of g-C 3 N 4 were systematically summarized. • The versatile properties of g-C 3 N 4 photocatalysts were highlighted. • The different design strategies of g-C 3 N 4 photocatalysts were reviewed. • The important photocatalytic applications of g-C 3 N 4 were also addressed. - Abstract: As one of the most appealing and attractive technologies, heterogeneous photocatalysis has been utilized to directly harvest, convert and store renewable solar energy for producing sustainable and green solar fuels and a broad range of environmental applications. Due to their unique physicochemical, optical and electrical properties, a wide variety of g-C 3 N 4 -based photocatalysts have been designed to drive various reduction and oxidation reactions under light irradiation with suitable wavelengths. In this review, we have systematically summarized the photocatalytic fundamentals of g-C 3 N 4 -based photocatalysts, including fundamental mechanism of heterogeneous photocatalysis, advantages, challenges and the design considerations of g-C 3 N 4 -based photocatalysts. The versatile properties of g-C 3 N 4 -based photocatalysts are highlighted, including their crystal structural, surface phisicochemical, stability, optical, adsorption, electrochemical, photoelectrochemical and electronic properties. Various design strategies are also thoroughly reviewed, including band-gap engineering, defect control, dimensionality tuning, pore texture tailoring, surface sensitization, heterojunction construction, co-catalyst and nanocarbon loading. Many important applications are also addressed, such as photocatalytic water splitting (H 2 evolution and overall water splitting), degradation of pollutants, carbon dioxide reduction, selective organic

  7. Studies of base pair sequence effects on DNA solvation based on all-atom molecular dynamics simulations. (United States)

    Dixit, Surjit B; Mezei, Mihaly; Beveridge, David L


    Detailed analyses of the sequence-dependent solvation and ion atmosphere of DNA are presented based on molecular dynamics (MD) simulations on all the 136 unique tetranucleotide steps obtained by the ABC consortium using the AMBER suite of programs. Significant sequence effects on solvation and ion localization were observed in these simulations. The results were compared to essentially all known experimental data on the subject. Proximity analysis was employed to highlight the sequence dependent differences in solvation and ion localization properties in the grooves of DNA. Comparison of the MD-calculated DNA structure with canonical A- and B-forms supports the idea that the G/C-rich sequences are closer to canonical A- than B-form structures, while the reverse is true for the poly A sequences, with the exception of the alternating ATAT sequence. Analysis of hydration density maps reveals that the flexibility of solute molecule has a significant effect on the nature of observed hydration. Energetic analysis of solute-solvent interactions based on proximity analysis of solvent reveals that the GC or CG base pairs interact more strongly with water molecules in the minor groove of DNA that the AT or TA base pairs, while the interactions of the AT or TA pairs in the major groove are stronger than those of the GC or CG pairs. Computation of solvent-accessible surface area of the nucleotide units in the simulated trajectories reveals that the similarity with results derived from analysis of a database of crystallographic structures is excellent. The MD trajectories tend to follow Manning's counterion condensation theory, presenting a region of condensed counterions within a radius of about 17 A from the DNA surface independent of sequence. The GC and CG pairs tend to associate with cations in the major groove of the DNA structure to a greater extent than the AT and TA pairs. Cation association is more frequent in the minor groove of AT than the GC pairs. In general, the

  8. AT Base Pair Anions vs. (9-methyl-A)(1-methyl-T) Base Pair Anions

    International Nuclear Information System (INIS)

    Radisic, Dunja; Bowen, Kit H.; Dabkowska, Iwona; Storoniak, Piotr; Rak, Janusz; Gutowski, Maciej S.


    The anionic base pairs of adenine and thymine, (AT)-, and 9-methyladenine and 1-methylthymine, (MAMT)-, have been investigated both theoretically and experimentally in a complementary, synergistic study. Calculations on (AT)- found that it had undergone a barrier-free proton transfer (BFPT) similar to that seen in other dimer anion systems and that its structural configuration that was neither Watson-Crick (WC) nor Hoogsteen (HS). The vertical detachment energy (VDE) of (AT)- was determined by anion photoelectron spectroscopy and found to be in agreement with the VDE value predicted by theory for the BFPT mechanism. An AT pair in DNA is structurally immobilized into the WC configuration, in part, by being bonded to the sugars of the double helix. This circumstance was mimicked by methylating the sites on both A and T where these sugars would have been tied, viz., 9-methyladenine and 1-methylthymine. Calculations found no BFPT in (MAMT)- and a resulting (MAMT)- configuration that wa s either HS or WC, with the configurations differing in stability by ca. 2 kcal/mol. The photoelectron spectrum of (MAMT)- occurred at a completely different electron binding energy than had (AT)-. Moreover, the VDE value of (MAMT)- was in agreement with that predicted by theory. The configuration of (MAMT)- and its lack of electron-induced proton transfer are inter-related. While there may be other pathways for electron-induced damage, BFPT in the WC/HS configurations of (AT)- is not feasible

  9. AT base pair anions versus (9-methyl-A)(1-methyl-T) base pair anions. (United States)

    Radisic, Dunja; Bowen, Kit H; Dabkowska, Iwona; Storoniak, Piotr; Rak, Janusz; Gutowski, Maciej


    The anionic base pairs of adenine and thymine, (AT)(-), and 9-methyladenine and 1-methylthymine, (MAMT)(-), have been investigated both theoretically and experimentally in a complementary, synergistic study. Calculations on (AT)(-) found that it had undergone a barrier-free proton transfer (BFPT) similar to that seen in other dimer anion systems and that its structural configuration was neither Watson-Crick (WC) nor Hoogsteen (HS). The vertical detachment energy (VDE) of (AT)(-) was determined by anion photoelectron spectroscopy and found to be in agreement with the VDE value predicted by theory for the BFPT mechanism. An AT pair in DNA is structurally immobilized into the WC configuration, in part, by being bonded to the sugars of the double helix. This circumstance was mimicked by methylating the sites on both A and T where these sugars would have been tied, viz., 9-methyladenine and 1-methylthymine. Calculations found no BFPT in (MAMT)(-) and a resulting (MAMT)(-) configuration that was either HS or WC, with the configurations differing in stability by ca. 2 kcal/mol. The photoelectron spectrum of (MAMT)(-) occurred at a completely different electron binding energy than had (AT)(-). Moreover, the VDE value of (MAMT)(-) was in agreement with that predicted by theory. The configuration of (MAMT)(-) and its lack of electron-induced proton transfer are inter-related. While there may be other pathways for electron-induced DNA alterations, BFPT in the WC/HS configurations of (AT)(-) is not feasible.

  10. In-situ methylation of strongly polar organic acids in natural waters supported by ion-pairing agents for headspace GC-MSD analysis

    Energy Technology Data Exchange (ETDEWEB)

    Neitzel, P.L.; Walther, W. [Dresden University of Technology, Institute for Groundwater Managemant, Dresden (Germany); Nestler, W. [Institute for Technology and Economics, Department of Civil Engineering and Architecture, Dresden (Germany)


    Strongly polar organic substances like halogenated acetic acids have been analyzed in surface water and groundwater in the catchment area of the upper Elbe river in Saxony since 1992. Coming directly from anthropogenic sources like industry, agriculture and indirectly by rainfall, their concentrations can increase up to 100 {mu}g/L in the aquatic environment of this catchment area. A new static headspace GC-MSD method without a manual pre-concentration step is presented to analyze the chlorinated acetic acids relevant to the Elbe river as their volatile methyl esters. Using an ion-pairing agent as modifier for the in-situ methylation of the analytes by dimethylsulfate, a minimal detection limit of 1 {mu}g/L can be achieved. Problems like the thermal degradation of chlorinated acetic acids to halogenated hydrocarbons and changing reaction yields during the headspace methylation, could be effectively reduced. The method has been successfully applied to monitoring bank infiltrate, surface water, groundwater and water works pumped raw water according to health provision principles. (orig.) With 3 figs., 2 tabs., 29 refs.

  11. Gc protein (vitamin D-binding protein): Gc genotyping and GcMAF precursor activity. (United States)

    Nagasawa, Hideko; Uto, Yoshihiro; Sasaki, Hideyuki; Okamura, Natsuko; Murakami, Aya; Kubo, Shinichi; Kirk, Kenneth L; Hori, Hitoshi


    The Gc protein (human group-specific component (Gc), a vitamin D-binding protein or Gc globulin), has important physiological functions that include involvement in vitamin D transport and storage, scavenging of extracellular G-actin, enhancement of the chemotactic activity of C5a for neutrophils in inflammation and macrophage activation (mediated by a GalNAc-modified Gc protein (GcMAF)). In this review, the structure and function of the Gc protein is focused on especially with regard to Gc genotyping and GcMAF precursor activity. A discussion of the research strategy "GcMAF as a target for drug discovery" is included, based on our own research.

  12. Structure of 2,4-Diaminopyrimidine - Theobromine Alternate Base Pairs (United States)

    Gengeliczki, Zsolt; Callahan, Michael P.; Kabelac, Martin; Rijs, Anouk M.; deVries, Mattanjah S.


    We report the structure of clusters of 2,4-diaminopyrimidine with 3,7-dimethylxanthine (theobromine) in the gas phase determined by IR-UV double resonance spectroscopy in both the near-IR and mid-IR regions in combination with ab initio computations. These clusters represent potential alternate nucleobase pairs, geometrically equivalent to guanine-cytosine. We have found the four lowest energy structures, which include the Watson-Crick base pairing motif. This Watson-Crick structure has not been observed by resonant two-photon ionization (R2PI) in the gas phase for the canonical DNA base pairs.

  13. A novel assay of DGAT activity based on high temperature GC/MS of triacylglycerol. (United States)

    Greer, Michael S; Zhou, Ting; Weselake, Randall J


    Diacylglycerol acyltransferase (DGAT) catalyzes the final step in the acyl-CoA-dependent biosynthesis of triacylglycerol (TAG), a high-energy compound composed of three fatty acids esterified to a glycerol backbone. In vitro DGAT assays, which are usually conducted with radiolabeled substrate using microsomal fractions, have been useful in identifying compounds and genetic modifications that affect DGAT activity. Here, we describe a high-temperature gas chromatography (GC)/mass spectrometry (MS)-based method for monitoring molecular species of TAG produced by the catalytic action of microsomal DGAT. This method circumvents the need for radiolabeled or modified substrates, and only requires a simple lipid extraction prior to GC. The utility of the method is demonstrated using a recombinant type-1 Brassica napus DGAT produced in a strain of Saccharomyces cerevisae that is deficient in TAG synthesis. The GC/MS-based assay of DGAT activity was strongly correlated with the typical in vitro assay of the enzyme using [1-(14)C] acyl-CoA as an acyl donor. In addition to determining DGAT activity, the method is also useful for determining substrate specificity and selectivity properties of the enzyme.

  14. Learning preferences from paired opposite-based semantics

    DEFF Research Database (Denmark)

    Franco de los Ríos, Camilo; Rodríguez, J. Tinguaro; Montero, Javier


    Preference semantics examine the meaning of the preference predicate, according to the way that alternatives can be understood and organized for decision making purposes. Through opposite-based semantics, preference structures can be characterized by their paired decomposition of preference...... on the character of opposition, the compound meaning of preference emerges from the fuzzy reinforcement of paired opposite concepts, searching for significant evidence for affirming dominance among the decision objects. Here we propose a general model for the paired decomposition of preference, examining its...

  15. Stability of non-Watson-Crick G-A/A-G base pair in synthetic DNA and RNA oligonucleotides. (United States)

    Ito, Yuko; Sone, Yumiko; Mizutani, Takaharu


    A non-Watson-Crick G-A/A-G base pair is found in SECIS (selenocysteine-insertion sequence) element in the 3'-untranslated region of Se-protein mRNAs and in the functional site of the hammerhead ribozyme. We studied the stability of G-A/A-G base pair (bold) in 17mer GT(U)GACGGAAACCGGAAC synthetic DNA and RNA oligonucleotides by thermal melting experiments and gel electrophoresis. The measured Tm value of DNA oligonucleotide having G-A/A-G pair showed an intermediate value (58 degrees C) between that of Watson-Crick G-C/C-G base pair (75 degrees C) and that of G-G/A-A of non-base-pair (40 degrees C). Similar thermal melting patterns were obtained with RNA oligonucleotides. This result indicates that the secondary structure of oligonucleotide having G-A/A-G base pair is looser than that of the G-C type Watson-Crick base pair. In the comparison between RNA and DNA having G-A/A-G base pair, the Tm value of the RNA oligonucleotide was 11 degrees C lower than that of DNA, indicating that DNA has a more rigid structure than RNA. The stained pattern of oligonucleotide on polyacrylamide gel clarified that the mobility of the DNA oligonucleotide G-A/A-G base pair changed according to the urea concentration from the rigid state (near the mobility of G-C/C-G oligonucleotide) in the absence of urea to the random state (near the mobility of G-G/A-A oligonucleotide) in 7 M urea. However, the RNA oligonucleotide with G-A/A-G pair moved at an intermediate mobility between that of oligonucleotide with G-C/C-G and of the oligonucleotide with G-G/A-A, and the mobility pattern did not depend on urea concentration. Thus, DNA and RNA oligonucleotides with the G-A/A-G base pair showed a pattern indicating an intermediate structure between the rigid Watson-Crick base pair and the random structure of non-base pair. RNA with G-A/A-G base pair has the intermediate structure not influenced by urea concentration. Finally, this study indicated that the intermediate rigidity imparted by Non

  16. Solid state radiation chemistry of co-crystallized DNA base pairs studied with EPR and ENDOR

    International Nuclear Information System (INIS)

    Nelson, W.H.; Nimmala, S.; Hole, E.O.; Sagstuen, E.; Close, D.M.


    For a number of years, the authors' group has focused on identification of radicals formed from x-irradiation of DNA components by application of EPR and ENDOR spectroscopic techniques to samples in the form of single crystals. With single crystals as samples, it is possible to use the detailed packing and structural information available from x-ray or neutron diffraction reports. This report summarizes results from two crystal systems in which DNA bases are paired by hydrogen bonding. Extensive results are available from one of these, 1-methyl-thymine:9-methyladenine (MTMA), in which the base pairing is the Hoogsteen configuration. Although this configuration is different from that found by Watson-Crick in DNA, nonetheless the hydrogen bond between T(O4) and A(NH 2 ) is present. Although MTMA crystals have been studied previously, the objective was to apply the high-resolution technique of ENDOR to crystals irradiated and studied at temperatures of 10 K or lower in the effort to obtain direct evidence for specific proton transfers. The second system, from which the results are only preliminary, is 9-ethylguanine:1-methyl-5-fluorocytosine (GFC) in which the G:C bases pair is in the Watson Crick configuration. Both crystal systems are anhydrous, so the results include no possible effects from water interactions

  17. Effects of temperature and isotopic substitution on electron attachment dynamics of guanine–cytosine base pair: Ring-polymer and classical molecular dynamics simulations

    Energy Technology Data Exchange (ETDEWEB)

    Minoshima, Yusuke; Seki, Yusuke [Department of Chemistry, Saitama University, 255 Shimo-Okubo, Sakura-ku, Saitama City, Saitama 338-8570 (Japan); Takayanagi, Toshiyuki, E-mail: [Department of Chemistry, Saitama University, 255 Shimo-Okubo, Sakura-ku, Saitama City, Saitama 338-8570 (Japan); Shiga, Motoyuki [Center for Computational Science and E-Systems, Japan Atomic Energy Agency, 148-4, Kashiwanoha Campus, 178-4 Wakashiba, Kashiwa, Chiba 277-0871 (Japan)


    Highlights: • Dynamics of excess electron attachment to guanine–cytosine base pair. • Ring-polymer and classical molecular dynamics simulations are performed. • Temperature and isotope substitution effects are investigated. - Abstract: The dynamical process of electron attachment to a guanine–cytosine pair in the normal (h-GC) and deuterated (d-GC) forms has been studied theoretically by semiclassical ring-polymer molecular dynamics (RPMD) simulations using the empirical valence bond model. The initially formed dipole-bound anion is converted rapidly to the valence-bound anion within about 0.1 ps in both h-GC and d-GC. However, the subsequent proton transfer in h-GC occurs with a rate five times greater than the deuteron transfer in d-GC. The change of rates with isotopic substitution and temperature variation in the RPMD simulations are quantitatively and qualitatively different from those in the classical molecular dynamics (MD) simulations, demonstrating the importance of nuclear quantum effects on the dynamics of this system.

  18. Effects of temperature and isotopic substitution on electron attachment dynamics of guanine–cytosine base pair: Ring-polymer and classical molecular dynamics simulations

    International Nuclear Information System (INIS)

    Minoshima, Yusuke; Seki, Yusuke; Takayanagi, Toshiyuki; Shiga, Motoyuki


    Highlights: • Dynamics of excess electron attachment to guanine–cytosine base pair. • Ring-polymer and classical molecular dynamics simulations are performed. • Temperature and isotope substitution effects are investigated. - Abstract: The dynamical process of electron attachment to a guanine–cytosine pair in the normal (h-GC) and deuterated (d-GC) forms has been studied theoretically by semiclassical ring-polymer molecular dynamics (RPMD) simulations using the empirical valence bond model. The initially formed dipole-bound anion is converted rapidly to the valence-bound anion within about 0.1 ps in both h-GC and d-GC. However, the subsequent proton transfer in h-GC occurs with a rate five times greater than the deuteron transfer in d-GC. The change of rates with isotopic substitution and temperature variation in the RPMD simulations are quantitatively and qualitatively different from those in the classical molecular dynamics (MD) simulations, demonstrating the importance of nuclear quantum effects on the dynamics of this system.

  19. An automated method for the analysis of phenolic acids in plasma based on ion-pairing micro-extraction coupled on-line to gas chromatography/mass spectrometry with in-liner derivatisation

    NARCIS (Netherlands)

    Peters, S.; Kaal, E.; Horsting, I.; Janssen, H.-G.


    A new method is presented for the analysis of phenolic acids in plasma based on ion-pairing ‘Micro-extraction in packed sorbent’ (MEPS) coupled on-line to in-liner derivatisation-gas chromatography-mass spectrometry (GC-MS). The ion-pairing reagent served a dual purpose. It was used both to improve

  20. Hydration of Watson-Crick base pairs and dehydration of Hoogsteen base pairs inducing structural polymorphism under molecular crowding conditions. (United States)

    Miyoshi, Daisuke; Nakamura, Kaori; Tateishi-Karimata, Hisae; Ohmichi, Tatsuo; Sugimoto, Naoki


    It has been revealed recently that molecular crowding, which is one of the largest differences between in vivo and in vitro conditions, is a critical factor determining the structure, stability, and function of nucleic acids. However, the effects of molecular crowding on Watson-Crick and Hoogsteen base pairs remain unclear. In order to investigate directly and quantitatively the molecular crowding effects on base pair types in nucleic acids, we designed intramolecular parallel- and antiparallel-stranded DNA duplexes consisting of Hoogsteen and Watson-Crick base pairs, respectively, as well as an intramolecular parallel-stranded triplex containing both types of base pairs. Thermodynamic analyses demonstrated that the values of free energy change at 25 degrees C for Hoogsteen base-pair formations decreased from +1.45 +/- 0.15 to +1.09 +/- 0.13 kcal mol(-1), and from -1.89 +/- 0.13 to -2.71 +/- 0.11 kcal mol(-1) in the intramolecular duplex and triplex, respectively, when the concentration of PEG 200 (polyethylene glycol with average molecular weight 200) increased from 0 to 20 wt %. However, corresponding values for Watson-Crick formation in the duplex and triplex increased from -10.2 +/- 0.2 to -8.7 +/- 0.1 kcal mol(-1), and from -10.8 +/- 0.2 to -9.2 +/- 0.2 kcal mol(-1), respectively. Furthermore, it was revealed that the opposing effects of molecular crowding on the Hoogsteen and Watson-Crick base pairs were due to different behaviors of water molecules binding to the DNA strands.

  1. Cell Monitoring and Manipulation Systems (CMMSs based on Glass Cell-Culture Chips (GC3s

    Directory of Open Access Journals (Sweden)

    Sebastian M. Buehler


    Full Text Available We developed different types of glass cell-culture chips (GC3s for culturing cells for microscopic observation in open media-containing troughs or in microfluidic structures. Platinum sensor and manipulation structures were used to monitor physiological parameters and to allocate and permeabilize cells. Electro-thermal micro pumps distributed chemical compounds in the microfluidic systems. The integrated temperature sensors showed a linear, Pt1000-like behavior. Cell adhesion and proliferation were monitored using interdigitated electrode structures (IDESs. The cell-doubling times of primary murine embryonic neuronal cells (PNCs were determined based on the IDES capacitance-peak shifts. The electrical activity of PNC networks was detected using multi-electrode arrays (MEAs. During seeding, the cells were dielectrophoretically allocated to individual MEAs to improve network structures. MEA pads with diameters of 15, 20, 25, and 35 µm were tested. After 3 weeks, the magnitudes of the determined action potentials were highest for pads of 25 µm in diameter and did not differ when the inter-pad distances were 100 or 170 µm. Using 25-µm diameter circular oxygen electrodes, the signal currents in the cell-culture media were found to range from approximately −0.08 nA (0% O2 to −2.35 nA (21% O2. It was observed that 60-nm thick silicon nitride-sensor layers were stable potentiometric pH sensors under cell-culture conditions for periods of days. Their sensitivity between pH 5 and 9 was as high as 45 mV per pH step. We concluded that sensorized GC3s are potential animal replacement systems for purposes such as toxicity pre-screening. For example, the effect of mefloquine, a medication used to treat malaria, on the electrical activity of neuronal cells was determined in this study using a GC3 system.

  2. Charge transfer in DNA: role of base pairing

    Czech Academy of Sciences Publication Activity Database

    Kratochvílová, Irena; Bunček, M.; Schneider, Bohdan


    Roč. 38, Suppl. (2009), S123-S123 ISSN 0175-7571. [EBSA European Biophysics Congress /7./. Genoa, 11.07.2009-15.07.2009] Institutional research plan: CEZ:AV0Z10100520; CEZ:AV0Z50520701 Keywords : DNA * charge transport * base pairing Subject RIV: CF - Physical ; Theoretical Chemistry Impact factor: 2.437, year: 2009

  3. Ferrocene-based Lewis acids and Lewis pairs: Synthesis and ...

    Indian Academy of Sciences (India)

    The design and synthesis of molecules containing non-interacting Lewis base and Lewis acid groups. [Frustrated Lewis pairs (FLP's)] have received intense attention due to their potential applications in the area of molecular catalysis.1–3. For example,. Stephen's and co-workers have demonstrated that the unquenched ...

  4. Micromechanics of base pair unzipping in the DNA duplex

    International Nuclear Information System (INIS)

    Volkov, Sergey N; Paramonova, Ekaterina V; Yakubovich, Alexander V; Solov’yov, Andrey V


    All-atom molecular dynamics (MD) simulations of DNA duplex unzipping in a water environment were performed. The investigated DNA double helix consists of a Drew-Dickerson dodecamer sequence and a hairpin (AAG) attached to the end of the double-helix chain. The considered system is used to examine the process of DNA strand separation under the action of an external force. This process occurs in vivo and now is being intensively investigated in experiments with single molecules. The DNA dodecamer duplex is consequently unzipped pair by pair by means of the steered MD. The unzipping trajectories turn out to be similar for the duplex parts with G⋅C content and rather distinct for the parts with A⋅T content. It is shown that during the unzipping each pair experiences two types of motion: relatively quick rotation together with all the duplex and slower motion in the frame of the unzipping fork. In the course of opening, the complementary pair passes through several distinct states: (i) the closed state in the double helix, (ii) the metastable preopened state in the unzipping fork and (iii) the unbound state. The performed simulations show that water molecules participate in the stabilization of the metastable states of the preopened base pairs in the DNA unzipping fork. (paper)

  5. AudioPairBank: Towards A Large-Scale Tag-Pair-Based Audio Content Analysis


    Sager, Sebastian; Elizalde, Benjamin; Borth, Damian; Schulze, Christian; Raj, Bhiksha; Lane, Ian


    Recently, sound recognition has been used to identify sounds, such as car and river. However, sounds have nuances that may be better described by adjective-noun pairs such as slow car, and verb-noun pairs such as flying insects, which are under explored. Therefore, in this work we investigate the relation between audio content and both adjective-noun pairs and verb-noun pairs. Due to the lack of datasets with these kinds of annotations, we collected and processed the AudioPairBank corpus cons...


    Directory of Open Access Journals (Sweden)

    Testiana Deni Wijayatiningsih


    Full Text Available Students had skill to actualize their imagination and interpret their knowledge through writing which could be combined with good writing structure. Moreover, their writing skill still had low motivation and had not reached the standard writing structure. Based on the background above, this research has purpose to know the influence Note Taking Pairs in improving students‘sentence based writing achievement. The subject of this research was the second semester of English Department in Muhammadiyah University of Semarang. It also used statistic non parametric method to analyze the students‘ writing achievement. The result of this research showed that Note Taking Pairs strategy could improve students‘sentence based writing achievement. Hopefully this research is recommended into learning process to improve students‘writing skill especially in sentence-based writing subject.

  7. Solvent effect on the intermolecular proton transfer of the Watson and Crick guanine-cytosine and adenine-thymine base pairs: a polarizable continuum model study. (United States)

    Romero, Eduardo E; Hernandez, Florencio E


    Herein we present our results on the study of the double proton transfer (DPT) mechanism in the adenine-thymine (AT) and guanine-cytosine (GC) base pairs, both in gas phase and in solution. The latter was modeled using the polarizable continuum method (PCM) in different solvents. According to our DFT calculations, the DPT may occur for both complexes in a stepwise mechanism in condensate phase. In gas phase only the GC base pair exhibits a concerted DPT mechanism. Using the Wigner's tunneling corrections to the transition state theory we demonstrate that such corrections are important for the prediction of the rate constants of both systems in gas and in condensate phase. We also show that (i) as the polarity of the medium decreases the equilibrium constant of the DPT reaction increases in both complexes, and (ii) that the equilibrium constant in the GC complex is four orders of magnitude larger than in AT. This observation suggests that the spontaneous mutations in DNA base pairs are more probable in GC than in AT.


    Directory of Open Access Journals (Sweden)

    Mudasir Mudasir


    Full Text Available A research about base-pair specificity of the DNA binding of [Fe(phen3]2+, [Fe(phen2(dip]2+ and [Fe(phen(dip2]2+ complexes and the effect of calf-thymus DNA (ct-DNA binding of these metal complexes on thermal denaturation of ct-DNA has been carried out. This research is intended to evaluate the preferential binding of the complexes to the sequence of DNA (A-T or G-C sequence and to investigate the binding strength and mode upon their interaction with DNA. Base-pair specificity of the DNA binding of the complexes was determined by comparing the equilibrium binding constant (Kb of each complex to polysynthetic DNA that contain only A-T or G-C sequence. The Kb value of the interaction was determined by spectrophotometric titration and thermal denaturation temperature (Tm was determined by monitoring the absorbance of the mixture solution of each complex and ct-DNA at λ =260 nm as temperature was elevated in the range of 25 - 100 oC. Results of the study show that in general all iron(II complexes studied exhibit a base-pair specificity in their DNA binding to prefer the relatively facile A-T sequence as compared to the G-C one. The thermal denaturation experiments have demonstrated that Fe(phen3]2+ and [Fe(phen2(dip]2+ interact weakly with double helical DNA via electrostatic interaction as indicated by insignificant changes in melting temperature, whereas [Fe(phen2(dip]2+  most probably binds to DNA in mixed modes of interaction, i.e.: intercalation and electrostatic interaction. This conclusion is based on the fact that the binding of [Fe(phen2(dip]2+ to ct-DNA moderately increase the Tm value of ct- DNA   Keywords: DNA Binding, mixed-ligand complexes

  9. DFT study on metal-mediated uracil base pair complexes

    Directory of Open Access Journals (Sweden)

    Ayhan Üngördü


    Full Text Available The most stable of metal-mediated uracil base pair complexes were determined. Method was used density functional theory, B3LYP. The calculations of systems containing C, H, N, O were described by 6-311++G(d,p and cc-PVTZ basis sets and LANL2DZ and SDD basis sets was used for transition metals. Then Egap values of complexes were calculated and the electrical conductivity of the complexes for single nanowires was studied by band theory. Metal-mediated uracil base pair complexes which will be used as conductive wires in nanotechnology were predicted. In nanoworld, this study is expected to show a way for practical applications.

  10. Photochemical selectivity in guanine-cytosine base-pair structures

    Czech Academy of Sciences Publication Activity Database

    Abo-Riziq, A.; Grace, L.; Nir, E.; Kabeláč, Martin; Hobza, Pavel; Vries de, M. S.


    Roč. 102, č. 1 (2005), s. 20-23 ISSN 0027-8424 R&D Projects: GA ČR(CZ) GA203/05/0009 Grant - others:NSF(US) CHE-0244341 Institutional research plan: CEZ:AV0Z40550506 Keywords : DNA base pairs * IR-UV spectroscopy * phytochemistry Subject RIV: CF - Physical ; Theoretical Chemistry Impact factor: 10.231, year: 2005

  11. Single base pair mutation analysis by PNA directed PCR clamping

    DEFF Research Database (Denmark)

    Ørum, H.; Nielsen, P.E.; Egholm, M.


    A novel method that allows direct analysis of single base mutation by the polymerase chain reaction (PCR) is described. The method utilizes the finding that PNAs (peptide nucleic acids) recognize and bind to their complementary nucleic acid sequences with higher thermal stability and specificity...... allows selective amplification/suppression of target sequences that differ by only one base pair. Finally we show that PNAs can be designed in such a way that blockage can be accomplished when the PNA target sequence is located between the PCR primers....

  12. Multifamily determination of pesticide residues in soya-based nutraceutical products by GC/MS-MS. (United States)

    Páleníková, Agneša; Martínez-Domínguez, Gerardo; Arrebola, Francisco Javier; Romero-González, Roberto; Hrouzková, Svetlana; Frenich, Antonia Garrido


    An analytical method based on a modified QuEChERS extraction coupled with gas chromatography-tandem mass spectrometry (GC-MS/MS) was evaluated for the determination of 177 pesticides in soya-based nutraceutical products. The QuEChERS method was optimised and different extraction solvents and clean-up approaches were tested, obtaining the most efficient conditions with a mixture of sorbents (PSA, C18, GBC and Zr-Sep(+)). Recoveries were evaluated at 10, 50 and 100 μg/kg and ranged between 70% and 120%. Precision was expressed as relative standard deviation (RSD), and it was evaluated for more than 160 pesticides as intra and inter-day precision, with values always below 20% and 25%, respectively. Limits of detection (LODs) ranged from 0.1 to 10 μg/kg, whereas limits of quantification (LOQs) from 0.5 to 20 μg/kg. The applicability of the method was proved by analysing soya-based nutraceuticals. Two pesticides were found in these samples, malathion and pyriproxyfen, at 11.1 and 1.5 μg/kg respectively. Copyright © 2014 Elsevier Ltd. All rights reserved.

  13. Treatment of pairing correlations based on the equations of motion for zero-coupled pair operators

    International Nuclear Information System (INIS)

    Andreozzi, F.; Covello, A.; Gargano, A.; Ye, L.J.; Porrino, A.


    The pairing problem is treated by means of the equations of motion for zero-coupled pair operators. Exact equations for the seniority-v states of N particles are derived. These equations can be solved by a step-by-step procedure which consists of progressively adding pairs of particles to a core. The theory can be applied at several levels of approximation depending on the number of core states which are taken into account. Some numerical applications to the treatment of v = 0, v = 1, and v = 2 states in the Ni isotopes are performed. The accuracy of various approximations is tested by comparison with exact results. For the seniority-one and seniority-two problems it turns out that the results obtained from the first-order theory are very accurate, while those of higher order calculations are practically exact. Concerning the seniority-zero problem, a fifth-order calculation reproduces quite well the three lowest states

  14. A GC/MS-based metabolomic approach for reliable diagnosis of phenylketonuria. (United States)

    Xiong, Xiyue; Sheng, Xiaoqi; Liu, Dan; Zeng, Ting; Peng, Ying; Wang, Yichao


    ), which showed that phenylacetic acid may be used as a reliable discriminator for the diagnosis of PKU. The low false positive rate (1-specificity, 0.064) can be eliminated or at least greatly reduced by simultaneously referring to other markers, especially phenylpyruvic acid, a unique marker in PKU. Additionally, this standard was obtained with high sensitivity and specificity in a less invasive manner for diagnosing PKU compared with the Phe/Tyr ratio. Therefore, we conclude that urinary metabolomic information based on the improved oximation-silylation method together with GC/MS may be reliable for the diagnosis and differential diagnosis of PKU.

  15. GC-MS-Based Endometabolome Analysis Differentiates Prostate Cancer from Normal Prostate Cells

    Directory of Open Access Journals (Sweden)

    Ana Rita Lima


    Full Text Available Prostate cancer (PCa is an important health problem worldwide. Diagnosis and management of PCa is very complex because the detection of serum prostate specific antigen (PSA has several drawbacks. Metabolomics brings promise for cancer biomarker discovery and for better understanding PCa biochemistry. In this study, a gas chromatography–mass spectrometry (GC-MS based metabolomic profiling of PCa cell lines was performed. The cell lines include 22RV1 and LNCaP from PCa with androgen receptor (AR expression, DU145 and PC3 (which lack AR expression, and one normal prostate cell line (PNT2. Regarding the metastatic potential, PC3 is from an adenocarcinoma grade IV with high metastatic potential, DU145 has a moderate metastatic potential, and LNCaP has a low metastatic potential. Using multivariate analysis, alterations in levels of several intracellular metabolites were detected, disclosing the capability of the endometabolome to discriminate all PCa cell lines from the normal prostate cell line. Discriminant metabolites included amino acids, fatty acids, steroids, and sugars. Six stood out for the separation of all the studied PCa cell lines from the normal prostate cell line: ethanolamine, lactic acid, β-Alanine, L-valine, L-leucine, and L-tyrosine.

  16. GC-MS-Based Metabolome and Metabolite Regulation in Serum-Resistant Streptococcus agalactiae. (United States)

    Wang, Zhe; Li, Min-Yi; Peng, Bo; Cheng, Zhi-Xue; Li, Hui; Peng, Xuan-Xian


    Streptococcus agalactiae causes severe systemic infections in human and fish. In the present study, we established a pathogen-plasma interaction model by which we explored how S. agalactiae evaded serum-mediated killing. We found that S. agalactiae grew faster in the presence of yellow grouper plasma than in the absence of the plasma, indicating S. agalactiae evolved a way of evading the fish immune system. To determine the events underlying this phenotype, we applied GC-MS-based metabolomics approaches to identify differential metabolomes between S. agalactiae cultured with and without yellow grouper plasma. Through bioinformatics analysis, decreased malic acid and increased adenosine were identified as the most crucial metabolites that distinguish the two groups. Meanwhile, they presented with decreased TCA cycle and elevated purine metabolism, respectively. Finally, exogenous malic acid and adenosine were used to reprogram the plasma-resistant metabolome, leading to elevated and decreased susceptibility to the plasma, respectively. Therefore, our findings reveal for the first time that S. agalactiae utilizes a metabolic trick to respond to plasma killing as a result of serum resistance, which may be reverted or enhanced by exogenous malic acid and adenosine, respectively, suggesting that the metabolic trick can be regulated by metabolites.

  17. Light-emitting self-assembled peptide nucleic acids exhibit both stacking interactions and Watson-Crick base pairing. (United States)

    Berger, Or; Adler-Abramovich, Lihi; Levy-Sakin, Michal; Grunwald, Assaf; Liebes-Peer, Yael; Bachar, Mor; Buzhansky, Ludmila; Mossou, Estelle; Forsyth, V Trevor; Schwartz, Tal; Ebenstein, Yuval; Frolow, Felix; Shimon, Linda J W; Patolsky, Fernando; Gazit, Ehud


    The two main branches of bionanotechnology involve the self-assembly of either peptides or DNA. Peptide scaffolds offer chemical versatility, architectural flexibility and structural complexity, but they lack the precise base pairing and molecular recognition available with nucleic acid assemblies. Here, inspired by the ability of aromatic dipeptides to form ordered nanostructures with unique physical properties, we explore the assembly of peptide nucleic acids (PNAs), which are short DNA mimics that have an amide backbone. All 16 combinations of the very short di-PNA building blocks were synthesized and assayed for their ability to self-associate. Only three guanine-containing di-PNAs-CG, GC and GG-could form ordered assemblies, as observed by electron microscopy, and these di-PNAs efficiently assembled into discrete architectures within a few minutes. The X-ray crystal structure of the GC di-PNA showed the occurrence of both stacking interactions and Watson-Crick base pairing. The assemblies were also found to exhibit optical properties including voltage-dependent electroluminescence and wide-range excitation-dependent fluorescence in the visible region.

  18. Use of capillary GC-MS for identification of radiation-induced DNA base damage: Implications for base-excision repair of DNA

    International Nuclear Information System (INIS)

    Dizdaroglu, M.


    Application of GC-MS to characterization of radiation-induced base products of DNA and DNa base-amino acid crosslinks is presented. Samples of γ-irradiated DNa were hydrolyzed with formic acid, trimethylsilylated and subjected to GC-MS analysis using a fused silica capillary column. Hydrolysis conditions suitable for the simultaneous analysis of the radiation-induced products of all four DNA bases in a single run were determined. The trimethylsilyl derivatives of these products had excellent GC-properties and easily interpretable mass spectra. The complementary use of t-butyldimetylsilyl derivatives was also demonstrated. Moreover, the usefulness of this method for identification of radiation-induced DNA base-amino acid crosslinks was shown using γ-irradiated mixtures of thymine and tyrosine or phenylalanine. Because of the excellent resolving power of capillary GC and the instant and highly sensitive identification by MS, GC-MS is suggested as a suitable technique for identification of altered bases removed from DNA by base-excision repair enzymes

  19. Pms2 and uracil-DNA glycosylases act jointly in the mismatch repair pathway to generate Ig gene mutations at A-T base pairs. (United States)

    Girelli Zubani, Giulia; Zivojnovic, Marija; De Smet, Annie; Albagli-Curiel, Olivier; Huetz, François; Weill, Jean-Claude; Reynaud, Claude-Agnès; Storck, Sébastien


    During somatic hypermutation (SHM) of immunoglobulin genes, uracils introduced by activation-induced cytidine deaminase are processed by uracil-DNA glycosylase (UNG) and mismatch repair (MMR) pathways to generate mutations at G-C and A-T base pairs, respectively. Paradoxically, the MMR-nicking complex Pms2/Mlh1 is apparently dispensable for A-T mutagenesis. Thus, how detection of U:G mismatches is translated into the single-strand nick required for error-prone synthesis is an open question. One model proposed that UNG could cooperate with MMR by excising a second uracil in the vicinity of the U:G mismatch, but it failed to explain the low impact of UNG inactivation on A-T mutagenesis. In this study, we show that uracils generated in the G1 phase in B cells can generate equal proportions of A-T and G-C mutations, which suggests that UNG and MMR can operate within the same time frame during SHM. Furthermore, we show that Ung -/- Pms2 -/- mice display a 50% reduction in mutations at A-T base pairs and that most remaining mutations at A-T bases depend on two additional uracil glycosylases, thymine-DNA glycosylase and SMUG1. These results demonstrate that Pms2/Mlh1 and multiple uracil glycosylases act jointly, each one with a distinct strand bias, to enlarge the immunoglobulin gene mutation spectrum from G-C to A-T bases. © 2017 Girelli Zubani et al.

  20. GC/MS-based profiling of amino acids and TCA cycle-related molecules in ulcerative colitis. (United States)

    Ooi, Makoto; Nishiumi, Shin; Yoshie, Tomoo; Shiomi, Yuuki; Kohashi, Michitaka; Fukunaga, Ken; Nakamura, Shiro; Matsumoto, Takayuki; Hatano, Naoya; Shinohara, Masakazu; Irino, Yasuhiro; Takenawa, Tadaomi; Azuma, Takeshi; Yoshida, Masaru


    The roles that amino acids play in immunity and inflammation are well defined, and the relationship between inflammatory bowel disease (IBD) and certain amino acids has recently attracted attention. In this study, the levels of amino acids and trichloroacetic acid (TCA) cycle-related molecules in the colonic tissues and sera of patients with ulcerative colitis (UC) were profiled by gas chromatography/mass spectrometry (GC/MS), with the aim of evaluating whether the clinical state induced by UC leads to variations in the amino acid profile. Colonic biopsy samples from 22 UC patients were used, as well as serum samples from UC patients (n = 13), Crohn's disease (CD) patients (n = 21), and healthy volunteers (n = 17). In the GC/MS-based profiling of amino acids and TCA cycle-related molecules, lower levels of 16 amino acids and 5 TCA cycle-related molecules were observed in the colonic lesion tissues of the UC patients, and the serum profiles of amino acids and TCA cycle-related molecules of the UC patients were different from those of the CD patients and healthy volunteers. Our study raises the possibility that GC/MS-based profiling of amino acids and TCA cycle-related molecules is a useful early diagnostic tool for UC.

  1. On the conformational stability of the smallest RNA kissing complexes maintained through two G·C base pairs

    International Nuclear Information System (INIS)

    Chu, Wally; Weerasekera, Akila; Kim, Chul-Hyun


    Two identical 5′GACG3′ tetra-loop motifs with different stem sequences (called H2 and H3) are found in the 5′ end region of Moloney Murine Leukemia Virus (MMLV) genomic RNA. They play important roles in RNA dimerization and encapsidation through two identical tetra-loops (5′GACG3′) forming a loop-to-loop kissing complex, the smallest RNA kissing complex ever found in nature. We examined the effects of a loop-closing base pair as well as a stem sequence on the conformational stability of the kissing complex. UV melting analysis and gel electrophoresis were performed on eight RNA sequences mimicking the H2 and H3 hairpin tetra-loops with variation in loop-closing base pairs. Our results show that changing the loop-closing base pair from the wildtype (5′A·U3′ for H3, 5′U·A3′ for H2) to 5′G·C3’/5′C·G3′ has significant effect on the stability of the kissing complexes: the substitution to 5′C·G3′ significantly decreases both thermal and mechanical stability, while switching to the 5′G·C3′ significantly increases the mechanical stability only. The kissing complexes with the wildtype loop-closing base pairs (5′A·U3′ for H3 and 5′U·A3′ for H2) show different stability when attached to a different stem sequence (H2 stem vs. H3 stem). This suggests that not only the loop-closing base pair itself, but also the stem sequence, affects the conformational stability of the RNA kissing complex. - Highlights: • Thermodynamic parameters of the smallest RNA kissing interactions were measured. • The effects of loop-closing base pairs on the RNA kissing complex was investigated. • Changing the base pair to 5′CG3′ decreases the stability of the kissing complex. • Changing it to 5′GC3′ increases the mechanical resilience of the kissing complex. • Difference in its stem sequence also affects the stability of the kissing complex.

  2. MZ twin pairs or MZ singletons in population family-based GWAS? More power in pairs

    NARCIS (Netherlands)

    Minica, C.C.; Boomsma, D.I.; Vink, J.M.; Dolan, C.V.


    Family-based genome-wide association studies (GWAS) involve testing the genetic association of (many) genetic variants with the phenotype of interest, while taking into account the relatedness among family members. Occasionally in family-based GWAS, including monozygotic (MZ) twins, the data from

  3. Flexibility of short DNA helices with finite-length effect: From base pairs to tens of base pairs

    International Nuclear Information System (INIS)

    Wu, Yuan-Yan; Bao, Lei; Zhang, Xi; Tan, Zhi-Jie


    Flexibility of short DNA helices is important for the biological functions such as nucleosome formation and DNA-protein recognition. Recent experiments suggest that short DNAs of tens of base pairs (bps) may have apparently higher flexibility than those of kilo bps, while there is still the debate on such high flexibility. In the present work, we have studied the flexibility of short DNAs with finite-length of 5–50 bps by the all-atomistic molecular dynamics simulations and Monte Carlo simulations with the worm-like chain model. Our microscopic analyses reveal that short DNAs have apparently high flexibility which is attributed to the significantly strong bending and stretching flexibilities of ∼6 bps at each helix end. Correspondingly, the apparent persistence length l p of short DNAs increases gradually from ∼29 nm to ∼45 nm as DNA length increases from 10 to 50 bps, in accordance with the available experimental data. Our further analyses show that the short DNAs with excluding ∼6 bps at each helix end have the similar flexibility with those of kilo bps and can be described by the worm-like chain model with l p ∼ 50 nm

  4. Preliminary study of urine metabolism in type two diabetic patients based on GC-MS


    Zhang, Ning; Geng, Fang; Hu, Zhong-Hua; Liu, Bin; Wang, Ye-Qiu; Liu, Jun-Cen; Qi, Yong-Hua; Li, Li-Jing


    Objective: Comparative study of type 2 diabetes and healthy controls by metabolomics methods to explore the pathogenesis of Type II diabetes. Methods: Gas chromatography - mass spectrometry (GC-MS) with a variety of multivariate statistical analysis methods to the healthy control group 58 cases, 68 cases of Type II diabetes group were analyzed. Chromatographic conditions: DB-5MS column; the carrier gas He; flow rate of 1 mL·min-1, the injection volume 1 uL; split ratio is 100: 1. MS condition...

  5. Paired structures and other opposite-based models

    DEFF Research Database (Denmark)

    Rodríguez, J. Tinguaro; Franco, Camilo; Gómez, Daniel


    , that we will assume dependent on a specific negation, previously determined. In this way we can define a paired fuzzy set as a couple of opposite valuation fuzzy sets. Then we shall explore what kind of new valuation fuzzy sets can be generated from the semantic tension between those two poles, leading...... to a more complex valuation structure that still keeps the essence of being paired. In this way several neutral fuzzy sets can appear, in particular indeterminacy, ambivalence and conflict. Two consequences are then presented: on one hand, we will show how Atanassov´s Intuitionistic Fuzzy Sets can be viewed...

  6. Modeling compositional dynamics based on GC and purine contents of protein-coding sequences

    KAUST Repository

    Zhang, Zhang; Yu, Jun


    Background: Understanding the compositional dynamics of genomes and their coding sequences is of great significance in gaining clues into molecular evolution and a large number of publically-available genome sequences have allowed us to quantitatively predict deviations of empirical data from their theoretical counterparts. However, the quantification of theoretical compositional variations for a wide diversity of genomes remains a major challenge.Results: To model the compositional dynamics of protein-coding sequences, we propose two simple models that take into account both mutation and selection effects, which act differently at the three codon positions, and use both GC and purine contents as compositional parameters. The two models concern the theoretical composition of nucleotides, codons, and amino acids, with no prerequisite of homologous sequences or their alignments. We evaluated the two models by quantifying theoretical compositions of a large collection of protein-coding sequences (including 46 of Archaea, 686 of Bacteria, and 826 of Eukarya), yielding consistent theoretical compositions across all the collected sequences.Conclusions: We show that the compositions of nucleotides, codons, and amino acids are largely determined by both GC and purine contents and suggest that deviations of the observed from the expected compositions may reflect compositional signatures that arise from a complex interplay between mutation and selection via DNA replication and repair mechanisms.Reviewers: This article was reviewed by Zhaolei Zhang (nominated by Mark Gerstein), Guruprasad Ananda (nominated by Kateryna Makova), and Daniel Haft. 2010 Zhang and Yu; licensee BioMed Central Ltd.

  7. Modeling compositional dynamics based on GC and purine contents of protein-coding sequences

    KAUST Repository

    Zhang, Zhang


    Background: Understanding the compositional dynamics of genomes and their coding sequences is of great significance in gaining clues into molecular evolution and a large number of publically-available genome sequences have allowed us to quantitatively predict deviations of empirical data from their theoretical counterparts. However, the quantification of theoretical compositional variations for a wide diversity of genomes remains a major challenge.Results: To model the compositional dynamics of protein-coding sequences, we propose two simple models that take into account both mutation and selection effects, which act differently at the three codon positions, and use both GC and purine contents as compositional parameters. The two models concern the theoretical composition of nucleotides, codons, and amino acids, with no prerequisite of homologous sequences or their alignments. We evaluated the two models by quantifying theoretical compositions of a large collection of protein-coding sequences (including 46 of Archaea, 686 of Bacteria, and 826 of Eukarya), yielding consistent theoretical compositions across all the collected sequences.Conclusions: We show that the compositions of nucleotides, codons, and amino acids are largely determined by both GC and purine contents and suggest that deviations of the observed from the expected compositions may reflect compositional signatures that arise from a complex interplay between mutation and selection via DNA replication and repair mechanisms.Reviewers: This article was reviewed by Zhaolei Zhang (nominated by Mark Gerstein), Guruprasad Ananda (nominated by Kateryna Makova), and Daniel Haft. 2010 Zhang and Yu; licensee BioMed Central Ltd.

  8. Accurate interaction energies of base pairing and base stacking. The final chapter

    Czech Academy of Sciences Publication Activity Database

    Šponer, Jiří; Jurečka, Petr; Hobza, Pavel


    Roč. 22, č. 6 (2005), s. 767 ISSN 0739-1102. [Albany 2005. Conversation /14./. 14.06.2005-18.06.2005, Albany] Institutional research plan: CEZ:AV0Z50040507 Keywords : base pairing * base stacking * nucleic acids Subject RIV: BO - Biophysics

  9. Determination of redox potentials for the Watson-Crick base pairs, DNA nucleosides, and relevant nucleoside analogues. (United States)

    Crespo-Hernandez, Carlos E; Close, David M; Gorb, Leonid; Leszczynski, Jerzy


    Redox potentials for the DNA nucleobases and nucleosides, various relevant nucleoside analogues, Watson-Crick base pairs, and seven organic dyes are presented based on DFT/B3LYP/6-31++G(d,p) and B3YLP/6-311+G(2df,p)//B3LYP/6-31+G* levels of calculations. The values are determined from an experimentally calibrated set of equations that correlate the vertical ionization (electron affinity) energy of 20 organic molecules with their experimental reversible oxidation (reduction) potential. Our results are in good agreement with those estimated experimentally for the DNA nucleosides in acetonitrile solutions (Seidel et al. J. Phys. Chem. 1996, 100, 5541). We have found that nucleosides with anti conformation exhibit lower oxidation potentials than the corresponding syn conformers. The lowering in the oxidation potential is due to the formation of an intramolecular hydrogen bonding interaction between the 5'-OH group of the sugar and the N3 of the purine bases or C2=O of the pyrimidine bases in the syn conformation. Pairing of adenine or guanine with its complementary pyrimidine base decreases its oxidation potential by 0.15 or 0.28 V, respectively. The calculated energy difference between the oxidation potential for the G.C base pair and that of the guanine base is in good agreement with the experimental value estimated recently (0.34 V: Caruso, T.; et al. J. Am. Chem. Soc. 2005, 127, 15040). The complete and consistent set of reversible redox values determined in this work for the DNA constituents is expected to be of considerable value to those studying charge and electronic energy transfer in DNA.

  10. Widespread Transient Hoogsteen Base-Pairs in Canonical Duplex DNA with Variable Energetics (United States)

    Alvey, Heidi S.; Gottardo, Federico L.; Nikolova, Evgenia N.; Al-Hashimi, Hashim M.


    Hoogsteen base-pairing involves a 180 degree rotation of the purine base relative to Watson-Crick base-pairing within DNA duplexes, creating alternative DNA conformations that can play roles in recognition, damage induction, and replication. Here, using Nuclear Magnetic Resonance R1ρ relaxation dispersion, we show that transient Hoogsteen base-pairs occur across more diverse sequence and positional contexts than previously anticipated. We observe sequence-specific variations in Hoogsteen base-pair energetic stabilities that are comparable to variations in Watson-Crick base-pair stability, with Hoogsteen base-pairs being more abundant for energetically less favorable Watson-Crick base-pairs. Our results suggest that the variations in Hoogsteen stabilities and rates of formation are dominated by variations in Watson-Crick base pair stability, suggesting a late transition state for the Watson-Crick to Hoogsteen conformational switch. The occurrence of sequence and position-dependent Hoogsteen base-pairs provide a new potential mechanism for achieving sequence-dependent DNA transactions. PMID:25185517

  11. Unstable Hoogsteen base pairs adjacent to echinomycin binding sites within a DNA duplex

    International Nuclear Information System (INIS)

    Gilbert, D.E.; van der Marel, G.A.; van Boom, J.H.; Feigon, J.


    The bisintercalation complex present between the DNA octamer [d(ACGTACGT)] 2 and the cyclic octadepsipeptide antibiotic echinomycin has been studied by one- and two-dimensional proton NMR, and the results obtained have been compared with the crystal structures of related DNA-echinomycin complexes. Two echinomycins are found to bind cooperatively to each DNA duplex at the CpG steps, with the two quinoxaline rings of each echinomycin bisintercalating between the C·G and A·T base pairs. At low temperatures, the A·T base pairs on either side of the intercalation site adopt the Hoogsteen conformation, as observed in the crystal structures. However, as the temperature is raised, the Hoogsteen base pairs in the interior of the duplex are destabilized and are observed to be exchanging between the Hoogsteen base pair and either an open or a Watson-Crick base-paired state. The terminal A·T base pairs, which are not as constrained by the helix as the internal base pairs, remain stably Hoogsteen base-paired up to at least 45 degree C. The implications of these results for the biological role of Hoogsteen base pairs in echinomycin-DNA complexes in vivo are discussed

  12. Predicting the Mechanism and Kinetics of the Watson-Crick to Hoogsteen Base Pairing Transition

    NARCIS (Netherlands)

    Vreede, J.; Bolhuis, P.G.; Swenson, D.W.H.


    DNA duplexes predominantly contain Watson-Crick (WC) base pairs. Yet, a non-negligible number of base pairs converts to the Hoogsteen (HG) hydrogen bonding pattern, involving a 180° rotation of the purine base relative to Watson-Crick. These WC to HG conversions alter the conformation of DNA, and

  13. Experimental design-based isotope-dilution SPME-GC/MS method development for the analysis of smoke flavouring products. (United States)

    Giri, Anupam; Zelinkova, Zuzana; Wenzl, Thomas


    For the implementation of Regulation (EC) No 2065/2003 related to smoke flavourings used or intended for use in or on foods a method based on solid-phase micro extraction (SPME) GC/MS was developed for the characterisation of liquid smoke products. A statistically based experimental design (DoE) was used for method optimisation. The best general conditions to quantitatively analyse the liquid smoke compounds were obtained with a polydimethylsiloxane/divinylbenzene (PDMS/DVB) fibre, 60°C extraction temperature, 30 min extraction time, 250°C desorption temperature, 180 s desorption time, 15 s agitation time, and 250 rpm agitation speed. Under the optimised conditions, 119 wood pyrolysis products including furan/pyran derivatives, phenols, guaiacol, syringol, benzenediol, and their derivatives, cyclic ketones, and several other heterocyclic compounds were identified. The proposed method was repeatable (RSD% <5) and the calibration functions were linear for all compounds under study. Nine isotopically labelled internal standards were used for improving quantification of analytes by compensating matrix effects that might affect headspace equilibrium and extractability of compounds. The optimised isotope dilution SPME-GC/MS based analytical method proved to be fit for purpose, allowing the rapid identification and quantification of volatile compounds in liquid smoke flavourings.

  14. Tile-based Fisher ratio analysis of comprehensive two-dimensional gas chromatography time-of-flight mass spectrometry (GC × GC-TOFMS) data using a null distribution approach. (United States)

    Parsons, Brendon A; Marney, Luke C; Siegler, W Christopher; Hoggard, Jamin C; Wright, Bob W; Synovec, Robert E


    Comprehensive two-dimensional (2D) gas chromatography coupled with time-of-flight mass spectrometry (GC × GC-TOFMS) is a versatile instrumental platform capable of collecting highly informative, yet highly complex, chemical data for a variety of samples. Fisher-ratio (F-ratio) analysis applied to the supervised comparison of sample classes algorithmically reduces complex GC × GC-TOFMS data sets to find class distinguishing chemical features. F-ratio analysis, using a tile-based algorithm, significantly reduces the adverse effects of chromatographic misalignment and spurious covariance of the detected signal, enhancing the discovery of true positives while simultaneously reducing the likelihood of detecting false positives. Herein, we report a study using tile-based F-ratio analysis whereby four non-native analytes were spiked into diesel fuel at several concentrations ranging from 0 to 100 ppm. Spike level comparisons were performed in two regimes: comparing the spiked samples to the nonspiked fuel matrix and to each other at relative concentration factors of two. Redundant hits were algorithmically removed by refocusing the tiled results onto the original high resolution pixel level data. To objectively limit the tile-based F-ratio results to only features which are statistically likely to be true positives, we developed a combinatorial technique using null class comparisons, called null distribution analysis, by which we determined a statistically defensible F-ratio cutoff for the analysis of the hit list. After applying null distribution analysis, spiked analytes were reliably discovered at ∼1 to ∼10 ppm (∼5 to ∼50 pg using a 200:1 split), depending upon the degree of mass spectral selectivity and 2D chromatographic resolution, with minimal occurrence of false positives. To place the relevance of this work among other methods in this field, results are compared to those for pixel and peak table-based approaches.

  15. Nanoscale protein diffusion by STED-based pair correlation analysis.

    Directory of Open Access Journals (Sweden)

    Paolo Bianchini

    Full Text Available We describe for the first time the combination between cross-pair correlation function analysis (pair correlation analysis or pCF and stimulated emission depletion (STED to obtain diffusion maps at spatial resolution below the optical diffraction limit (super-resolution. Our approach was tested in systems characterized by high and low signal to noise ratio, i.e. Capsid Like Particles (CLPs bearing several (>100 active fluorescent proteins and monomeric fluorescent proteins transiently expressed in living Chinese Hamster Ovary cells, respectively. The latter system represents the usual condition encountered in living cell studies on fluorescent protein chimeras. Spatial resolution of STED-pCF was found to be about 110 nm, with a more than twofold improvement over conventional confocal acquisition. We successfully applied our method to highlight how the proximity to nuclear envelope affects the mobility features of proteins actively imported into the nucleus in living cells. Remarkably, STED-pCF unveiled the existence of local barriers to diffusion as well as the presence of a slow component at distances up to 500-700 nm from either sides of nuclear envelope. The mobility of this component is similar to that previously described for transport complexes. Remarkably, all these features were invisible in conventional confocal mode.

  16. Lewis pair polymerization by classical and frustrated Lewis pairs: Acid, base and monomer scope and polymerization mechanism

    KAUST Repository

    Zhang, Yuetao


    Classical and frustrated Lewis pairs (LPs) of the strong Lewis acid (LA) Al(C 6F 5) 3 with several Lewis base (LB) classes have been found to exhibit exceptional activity in the Lewis pair polymerization (LPP) of conjugated polar alkenes such as methyl methacrylate (MMA) as well as renewable α-methylene-γ-butyrolactone (MBL) and γ-methyl- α-methylene-γ-butyrolactone (γ-MMBL), leading to high molecular weight polymers, often with narrow molecular weight distributions. This study has investigated a large number of LPs, consisting of 11 LAs as well as 10 achiral and 4 chiral LBs, for LPP of 12 monomers of several different types. Although some more common LAs can also be utilized for LPP, Al(C 6F 5) 3-based LPs are far more active and effective than other LA-based LPs. On the other hand, several classes of LBs, when paired with Al(C 6F 5) 3, can render highly active and effective LPP of MMA and γ-MMBL; such LBs include phosphines (e.g., P tBu 3), chiral chelating diphosphines, N-heterocyclic carbenes (NHCs), and phosphazene superbases (e.g., P 4- tBu). The P 4- tBu/Al(C 6F 5) 3 pair exhibits the highest activity of the LP series, with a remarkably high turn-over frequency of 9.6 × 10 4 h -1 (0.125 mol% catalyst, 100% MMA conversion in 30 s, M n = 2.12 × 10 5 g mol -1, PDI = 1.34). The polymers produced by LPs at RT are typically atactic (P γMMBL with ∼47% mr) or syndio-rich (PMMA with ∼70-75% rr), but highly syndiotactic PMMA with rr ∼91% can be produced by chiral or achiral LPs at -78 °C. Mechanistic studies have identified and structurally characterized zwitterionic phosphonium and imidazolium enolaluminates as the active species of the current LPP system, which are formed by the reaction of the monomer·Al(C 6F 5) 3 adduct with P tBu 3 and NHC bases, respectively. Kinetic studies have revealed that the MMA polymerization by the tBu 3P/ Al(C 6F 5) 3 pair is zero-order in monomer concentration after an initial induction period, and the polymerization

  17. Piperamides from Piper ottonoides by NMR and GC-MS based mixture analysis

    International Nuclear Information System (INIS)

    Wolff, Thiago; Valente, Ligia M.M.; Magalhães, Alvicler; Guimarães, Elsie F.


    The species Piper ottonoides Yuncker (Piperaceae), known as 'joão-brandim', is a shrub that occurs in the Brazilian Amazon rainforest. Its roots and leaves are used in traditional medicine as local anesthetic to treat toothache and sore throat. In this study, the structural characterization in mixture of isobutyl amides present in semi-purified fractions from fruits, leaves, stems and roots of P. ottonoides was achieved by employing gas chromatography-mass spectrometry (GC-MS) and a combination of nuclear magnetic resonance (NMR) techniques ( 1 H, 1 H- 1 H COSY, 1 H- 13 CHSQC, 1 H- 13 CHMBC, TOCSY and 1 H- 1 H J-RES). The MS fragmentation patterns and the NMR chemical shifts, multiplicities, coupling constants and the signal correlations in the two-dimensional spectra were carefully analyzed also taking into account some key elements of differentiation among the compounds. The data set allowed identifying unequivocally the new amide N-isobutyl-7-(4'- methoxyphenyl)-2E,4E-heptadienamide, which we named ottonoidenamide as well as piperovatine and chingchengenamide A in all parts of the plant, the additional presence of pipercallosine and pipercallosidine in roots and of dihydropiperlonguminine in fruits and leaves. The presence of piperovatine and pipercallosine in P. ottonoides should be associated to its traditional use. (author)

  18. Fingerprint of volatiles from plant extracts based on SPME-GC-MS

    Directory of Open Access Journals (Sweden)

    Ezequias P. Siqueira

    Full Text Available The Laboratory of Chemistry of Natural Products has an ex situ collection of extracts from organisms of the biodiversity aiming at bioprospecting. Nowadays the collection has about 4000 extracts from 1000 different species. Extracts are used to identify new bioactive compounds that could be useful for developing new drugs against neglected diseases like leishmaniosis, Chagas disease, malaria and tuberculosis. After biologic assays, the bioactive extracts need to be prepared in larger quantity to allow isolation and characterization of the bioactive component. At this time, it is important to not only confirm the bioactivity of new extract but also check if its composition is similar to the old one. It was evaluated the ability of Solid Phase Microextraction and Gas Chromatography-Mass Spectrometry analysis (SPME-GC-MS. It was used the AMDIS (Automatic Mass Spectral Deconvolution and Identification System software as tools to collect and to compare the chromatographic profiles of each extract (fingerprint. Forty six samples were analyzed, it was possible to infer from the composition of each sample and common compounds. Nine groups of samples, collected at different time, were analyzed and seasonal modifications between then could be elucidated. The results showed that this methodology can be used to monitor the composition of extracts, allowing to monitor chemical changes that may occur during storage periods and to investigate the occurrence of a determined component in different extracts.

  19. Piperamides from Piper ottonoides by NMR and GC-MS based mixture analysis

    Energy Technology Data Exchange (ETDEWEB)

    Wolff, Thiago; Valente, Ligia M.M., E-mail: [Universidade Federal do Rio de Janeiro (UFRJ), RJ (Brazil). Inst. de Química; Santos, Priscila F.P. [Centro Federal de Educação Tecnológica Celso Suckow da Fonseca (UnED/CEFET), Angra dos Reis, RJ (Brazil); Magalhães, Alvicler [Universidade Estadual de Campinas (UNICAMP), SP (Brazil). Departamento de Química Inorgânica; Tinoco, Luzineide W. [Universidade Federal do Rio de Janeiro (UFRJ), RJ (Brazil). Instituto de Pesquisa em Produtos Naturais; Pereira, Rita C.A. [Embrapa Agroindústria Tropical, Fortaleza, CE (Brazil); Guimarães, Elsie F. [Instituto de Pesquisas Jardim Botânico do Rio de Janeiro, RJ (Brazil)


    The species Piper ottonoides Yuncker (Piperaceae), known as 'joão-brandim', is a shrub that occurs in the Brazilian Amazon rainforest. Its roots and leaves are used in traditional medicine as local anesthetic to treat toothache and sore throat. In this study, the structural characterization in mixture of isobutyl amides present in semi-purified fractions from fruits, leaves, stems and roots of P. ottonoides was achieved by employing gas chromatography-mass spectrometry (GC-MS) and a combination of nuclear magnetic resonance (NMR) techniques ({sup 1}H, {sup 1}H-{sup 1}H COSY, {sup 1}H-{sup 13}CHSQC, {sup 1}H-{sup 13}CHMBC, TOCSY and {sup 1}H-{sup 1}H J-RES). The MS fragmentation patterns and the NMR chemical shifts, multiplicities, coupling constants and the signal correlations in the two-dimensional spectra were carefully analyzed also taking into account some key elements of differentiation among the compounds. The data set allowed identifying unequivocally the new amide N-isobutyl-7-(4'- methoxyphenyl)-2E,4E-heptadienamide, which we named ottonoidenamide as well as piperovatine and chingchengenamide A in all parts of the plant, the additional presence of pipercallosine and pipercallosidine in roots and of dihydropiperlonguminine in fruits and leaves. The presence of piperovatine and pipercallosine in P. ottonoides should be associated to its traditional use. (author)

  20. The Influence of Square Planar Platinum Complexes on DNA Bases Pairing. An ab initio DFT Study

    Czech Academy of Sciences Publication Activity Database

    Burda, J. V.; Šponer, Jiří; Leszczynski, J.


    Roč. 3, č. 19 (2001), s. 4404-4411 ISSN 1463-9076 R&D Projects: GA MŠk LN00A032 Institutional research plan: CEZ:AV0Z4040901 Keywords : DNA base pairing * platinated base pairs * ab initio DFT study Subject RIV: CF - Physical ; Theoretical Chemistry Impact factor: 1.787, year: 2001

  1. Solvent effects on hydrogen bonds in Watson-Crick, mismatched, and modified DNA base pairs

    NARCIS (Netherlands)

    Poater, Jordi; Swart, Marcel; Guerra, Celia Fonseca; Bickelhaupt, F. Matthias


    We have theoretically analyzed a complete series of Watson–Crick and mismatched DNA base pairs, both in gas phase and in solution. Solvation causes a weakening and lengthening of the hydrogen bonds between the DNA bases because of the stabilization of the lone pairs involved in these bonds. We have

  2. Roles of the Amino Group of Purine Bases in the Thermodynamic Stability of DNA Base Pairing

    Directory of Open Access Journals (Sweden)

    Shu-ichi Nakano


    Full Text Available The energetic aspects of hydrogen-bonded base-pair interactions are important for the design of functional nucleotide analogs and for practical applications of oligonucleotides. The present study investigated the contribution of the 2-amino group of DNA purine bases to the thermodynamic stability of oligonucleotide duplexes under different salt and solvent conditions, using 2'-deoxyriboinosine (I and 2'-deoxyribo-2,6-diaminopurine (D as non-canonical nucleotides. The stability of DNA duplexes was changed by substitution of a single base pair in the following order: G•C > D•T ≈ I•C > A•T > G•T > I•T. The apparent stabilization energy due to the presence of the 2-amino group of G and D varied depending on the salt concentration, and decreased in the water-ethanol mixed solvent. The effects of salt concentration on the thermodynamics of DNA duplexes were found to be partially sequence-dependent, and the 2-amino group of the purine bases might have an influence on the binding of ions to DNA through the formation of a stable base-paired structure. Our results also showed that physiological salt conditions were energetically favorable for complementary base recognition, and conversely, low salt concentration media and ethanol-containing solvents were effective for low stringency oligonucleotide hybridization, in the context of conditions employed in this study.

  3. KlenTaq polymerase replicates unnatural base pairs by inducing a Watson-Crick geometry. (United States)

    Betz, Karin; Malyshev, Denis A; Lavergne, Thomas; Welte, Wolfram; Diederichs, Kay; Dwyer, Tammy J; Ordoukhanian, Phillip; Romesberg, Floyd E; Marx, Andreas


    Many candidate unnatural DNA base pairs have been developed, but some of the best-replicated pairs adopt intercalated structures in free DNA that are difficult to reconcile with known mechanisms of polymerase recognition. Here we present crystal structures of KlenTaq DNA polymerase at different stages of replication for one such pair, dNaM-d5SICS, and show that efficient replication results from the polymerase itself, inducing the required natural-like structure.

  4. Covering All the Bases in Genetics: Simple Shorthands and Diagrams for Teaching Base Pairing to Biology Undergraduates

    Directory of Open Access Journals (Sweden)

    Sergei Kuchin


    Full Text Available Explaining base pairing is an important element in teaching undergraduate genetics. I propose a teaching approach that aims to close the gap between the mantra “A pairs with T, and G pairs with C” and the “intimidating” chemical diagrams. The approach offers a set of simple “shorthands” for the key bases that can be used to quickly deduce all canonical and wobble pairs that the students need to know. The approach can be further developed to analyze mutagenic mismatch pairing.

  5. Hoogsteen base pairs proximal and distal to echinomycin binding sites on DNA

    International Nuclear Information System (INIS)

    Mendel, D.; Dervan, P.B.


    Forms of the DNA double helix containing non-Watson-Crick base-pairing have been discovered recently based on x-ray diffraction analysis of quionoxaline antibiotic-oligonucleotide complexes. In an effort to find evidence for Hoogsteen base-pairing at quinoxaline-binding sites in solution, chemical footprinting (differential cleavage reactivity) of echinomycin bound to DNA restriction fragments was examined. The authors report that purines (A>G) in the first and/or fourth base-pair positions of occupied echinomycin-binding sites are hyperreactive to diethyl pyrocarbonate. The correspondence of the solid-state data and the sites of diethyl pyrocarbonate hyperreactivity suggests that diethyl pyrocarbonate may be a sensitive reagent for the detection of Hoogsteen base-pairing in solution. Moreover, a 12-base-pair segment of alternating A-T DNA, which is 6 base pairs away from the nearest strong echinomycin-binding site, is also hyperreactive to diethyl pyrocarbonate in the presence of echinomycin. This hyperreactive segment may be an altered form of right-handed DNA that is entirely Hoogsteen base-paired

  6. Trace Analysis of Mutagenic Heterocyclic Aromatic Amines in Cigarette Smoke Condensate and its Base Fractions via Silylation-GC-MS

    Directory of Open Access Journals (Sweden)

    Liu S


    Full Text Available Among the more than 5000 chemicals reported in cigarette smoke condensate (CSC, heterocyclic aromatic amines (HAAs are considered to be a contributor to observed biological activity. HAAs are non-volatile and are reported at ppb levels in CSC. A new method for HAA analysis at the trace level is reported here. N, O-Bis(trimethylsilyl trifluoroacetamide (BSTFA containing 1% trimethylchlorosilane was employed to derivatize amino groups by heating the reagent containing a sample of CSC at 80 °C for 30 min followed by analysis employing gas chromatography-mass spectroscopy (GC-MS in the selected-ion-monitoring (SIM mode. This derivatization method afforded symmetrical peak shapes on a ZB-50 stationary phase and achieved instrumental limits of quantification (LOQ at 10:1 S/N from -1 ng/mL for AαC to120 ng/mL for Glu-P-1. The chemical identity of each derivative was confirmed by comparison of retention time and mass spectra of standards. The latter were characterized by the following ions: M·+ or [M-1]+, [M-15]+, and m/z 73 (i.e., trimethylsilyl. CSC and its base sub-fractions were studied using the GC-MS method. Ten HAAs were screened and five were quantified in cigarette smoke condensate, while 2-5 HAAs were quantified in each of three base sub-fractions. Values obtained with the new procedure agree well with values reported in the literature and with results obtained from a commercial laboratory via a different analytical method. The potential contribution of each HAA to the overall mutagenic activity observed for CSC and its base fractions is discussed. When considered together, HAAs account for only a small portion (-7.8% of the observed mutagenicity of the CSC.

  7. Performance of various density functionals for the hydrogen bonds in DNA base pairs

    NARCIS (Netherlands)

    van der Wijst, T.; Fonseca Guerra, C.; Swart, M.; Bickelhaupt, F.M.


    We have investigated the performance of seven popular density functionals (B3LYP, BLYP, BP86, mPW, OPBE, PBE, PW91) for describing the geometry and stability of the hydrogen bonds in DNA base pairs. For the gas-phase situation, the hydrogen-bond lengths and strengths in the DNA pairs have been

  8. Envisaging quantum transport phenomenon in a muddled base pair of DNA (United States)

    Vohra, Rajan; Sawhney, Ravinder Singh


    The effect of muddled base pair on electron transfer through a deoxyribonucleic acid (DNA) molecule connected to the gold electrodes has been elucidated using tight binding model. The effect of hydrogen and nitrogen bonds on the resistance of the base pair has been minutely observed. Using the semiempirical extended Huckel approach within NEGF regime, we have determined the current and conductance vs. bias voltage for disordered base pairs of DNA made of thymine (T) and adenine (A). The asymmetrical behaviour amid five times depreciation in the current characteristics has been observed for deviated Au-AT base pair-Au devices. An interesting revelation is that the conductance of the intrinsic AT base pair configuration attains dramatically high values with the symmetrical zig-zag pattern of current, which clearly indicates the transformation of the bond length within the strands of base pair when compared with other samples. A thorough investigation of the transmission coefficients T( E) and HOMO-LUMO gap reveals the misalignment of the strands in base pairs of DNA. The observed results present an insight to extend this work to build biosensing devices to predict the abnormality with the DNA.

  9. Discrimination among individual Watson–Crick base pairs at the termini of single DNA hairpin molecules (United States)

    Vercoutere, Wenonah A.; Winters-Hilt, Stephen; DeGuzman, Veronica S.; Deamer, David; Ridino, Sam E.; Rodgers, Joseph T.; Olsen, Hugh E.; Marziali, Andre; Akeson, Mark


    Nanoscale α-hemolysin pores can be used to analyze individual DNA or RNA molecules. Serial examination of hundreds to thousands of molecules per minute is possible using ionic current impedance as the measured property. In a recent report, we showed that a nanopore device coupled with machine learning algorithms could automatically discriminate among the four combinations of Watson–Crick base pairs and their orientations at the ends of individual DNA hairpin molecules. Here we use kinetic analysis to demonstrate that ionic current signatures caused by these hairpin molecules depend on the number of hydrogen bonds within the terminal base pair, stacking between the terminal base pair and its nearest neighbor, and 5′ versus 3′ orientation of the terminal bases independent of their nearest neighbors. This report constitutes evidence that single Watson–Crick base pairs can be identified within individual unmodified DNA hairpin molecules based on their dynamic behavior in a nanoscale pore. PMID:12582251

  10. Gc protein-derived macrophage activating factor (GcMAF): isoelectric focusing pattern and tumoricidal activity. (United States)

    Mohamad, Saharuddin Bin; Nagasawa, Hideko; Sasaki, Hideyuki; Uto, Yoshihiro; Nakagawa, Yoshinori; Kawashima, Ken; Hori, Hitoshi


    Gc protein is the precursor for Gc protein-derived macrophage activating factor (GcMAF), with three phenotypes: Gc1f, Gc1s and Gc2, based on its electrophoretic mobility. The difference in electrophoretic mobility is because of the difference in its posttranslational sugar moiety composition. We compared the difference between Gc protein and GcMAF electrophoretic mobility using the isoelectric focusing (IEF) method. The tumoricidal activity of GcMAF-treated macrophage was evaluated after coculture with L-929 cell. The tumoricidal mechanism was investigated using TNF bioassay and nitric oxide (NO) release. The difference in Gc protein and GcMAF electrophoretic mobility was detected. The tumoricidal activity of GcMAF-treated macrophage was detected, but no release of TNF and NO was detected. The difference of isoelectric focusing mobility in Gc protein and GcMAF would be useful to develop a GcMAF detection method. GcMAF increased macrophage tumoricidal activity but TNF and NO release were not involved in the mechanism.

  11. Estimating the Per-Base-Pair Mutation Rate in the Yeast Saccharomyces cerevisiae


    Lang, Gregory I.; Murray, Andrew W.


    Although mutation rates are a key determinant of the rate of evolution they are difficult to measure precisely and global mutations rates (mutations per genome per generation) are often extrapolated from the per-base-pair mutation rate assuming that mutation rate is uniform across the genome. Using budding yeast, we describe an improved method for the accurate calculation of mutation rates based on the fluctuation assay. Our analysis suggests that the per-base-pair mutation rates at two genes...

  12. Differential stabilities and sequence-dependent base pair opening dynamics of Watson-Crick base pairs with 5-hydroxymethylcytosine, 5-formylcytosine, or 5-carboxylcytosine. (United States)

    Szulik, Marta W; Pallan, Pradeep S; Nocek, Boguslaw; Voehler, Markus; Banerjee, Surajit; Brooks, Sonja; Joachimiak, Andrzej; Egli, Martin; Eichman, Brandt F; Stone, Michael P


    5-Hydroxymethylcytosine (5hmC), 5-formylcytosine (5fC), and 5-carboxylcytosine (5caC) form during active demethylation of 5-methylcytosine (5mC) and are implicated in epigenetic regulation of the genome. They are differentially processed by thymine DNA glycosylase (TDG), an enzyme involved in active demethylation of 5mC. Three modified Dickerson-Drew dodecamer (DDD) sequences, amenable to crystallographic and spectroscopic analyses and containing the 5'-CG-3' sequence associated with genomic cytosine methylation, containing 5hmC, 5fC, or 5caC placed site-specifically into the 5'-T(8)X(9)G(10)-3' sequence of the DDD, were compared. The presence of 5caC at the X(9) base increased the stability of the DDD, whereas 5hmC or 5fC did not. Both 5hmC and 5fC increased imino proton exchange rates and calculated rate constants for base pair opening at the neighboring base pair A(5):T(8), whereas 5caC did not. At the oxidized base pair G(4):X(9), 5fC exhibited an increase in the imino proton exchange rate and the calculated kop. In all cases, minimal effects to imino proton exchange rates occurred at the neighboring base pair C(3):G(10). No evidence was observed for imino tautomerization, accompanied by wobble base pairing, for 5hmC, 5fC, or 5caC when positioned at base pair G(4):X(9); each favored Watson-Crick base pairing. However, both 5fC and 5caC exhibited intranucleobase hydrogen bonding between their formyl or carboxyl oxygens, respectively, and the adjacent cytosine N(4) exocyclic amines. The lesion-specific differences observed in the DDD may be implicated in recognition of 5hmC, 5fC, or 5caC in DNA by TDG. However, they do not correlate with differential excision of 5hmC, 5fC, or 5caC by TDG, which may be mediated by differences in transition states of the enzyme-bound complexes.

  13. Differential Stabilities and Sequence-Dependent Base Pair Opening Dynamics of Watson–Crick Base Pairs with 5-Hydroxymethylcytosine, 5-Formylcytosine, or 5-Carboxylcytosine (United States)


    5-Hydroxymethylcytosine (5hmC), 5-formylcytosine (5fC), and 5-carboxylcytosine (5caC) form during active demethylation of 5-methylcytosine (5mC) and are implicated in epigenetic regulation of the genome. They are differentially processed by thymine DNA glycosylase (TDG), an enzyme involved in active demethylation of 5mC. Three modified Dickerson–Drew dodecamer (DDD) sequences, amenable to crystallographic and spectroscopic analyses and containing the 5′-CG-3′ sequence associated with genomic cytosine methylation, containing 5hmC, 5fC, or 5caC placed site-specifically into the 5′-T8X9G10-3′ sequence of the DDD, were compared. The presence of 5caC at the X9 base increased the stability of the DDD, whereas 5hmC or 5fC did not. Both 5hmC and 5fC increased imino proton exchange rates and calculated rate constants for base pair opening at the neighboring base pair A5:T8, whereas 5caC did not. At the oxidized base pair G4:X9, 5fC exhibited an increase in the imino proton exchange rate and the calculated kop. In all cases, minimal effects to imino proton exchange rates occurred at the neighboring base pair C3:G10. No evidence was observed for imino tautomerization, accompanied by wobble base pairing, for 5hmC, 5fC, or 5caC when positioned at base pair G4:X9; each favored Watson–Crick base pairing. However, both 5fC and 5caC exhibited intranucleobase hydrogen bonding between their formyl or carboxyl oxygens, respectively, and the adjacent cytosine N4 exocyclic amines. The lesion-specific differences observed in the DDD may be implicated in recognition of 5hmC, 5fC, or 5caC in DNA by TDG. However, they do not correlate with differential excision of 5hmC, 5fC, or 5caC by TDG, which may be mediated by differences in transition states of the enzyme-bound complexes. PMID:25632825

  14. An ID-based Blind Signature Scheme from Bilinear Pairings


    B.Umaprasada Rao; K.A.Ajmath


    Blind signatures, introduced by Chaum, allow a user to obtain a signature on a message without revealing any thing about the message to the signer. Blind signatures play on important role in plenty of applications such as e-voting, e-cash system where anonymity is of great concern. Identity based(ID-based) public key cryptography can be a good alternative for certified based public key setting, especially when efficient key management and moderate security are required. In this paper, we prop...

  15. Principles of RNA base pairing: Structures and energies of cis and trans-Watson-Crick/Sugar Edge base pairs revealed by quantum chemical calculations

    Czech Academy of Sciences Publication Activity Database

    Šponer, Judit E.; Leszczynski, J.; Šponer, Jiří


    Roč. 22, č. 6 (2005), s. 826 ISSN 0739-1102. [Albany 2005. Conversation /14./. 14.06.2005-18.06.2005, Albany] Institutional research plan: CEZ:AV0Z50040507 Keywords : RNA base pairing * DNA * Watson-Crick/Sugar Edge Subject RIV: BO - Biophysics

  16. 1000 human genomes carry widespread signatures of GC biased gene conversion. (United States)

    Dutta, Rajib; Saha-Mandal, Arnab; Cheng, Xi; Qiu, Shuhao; Serpen, Jasmine; Fedorova, Larisa; Fedorov, Alexei


    GC-Biased Gene Conversion (gBGC) is one of the important theories put forward to explain profound long-range non-randomness in nucleotide compositions along mammalian chromosomes. Nucleotide changes due to gBGC are hard to distinguish from regular mutations. Here, we present an algorithm for analysis of millions of known SNPs that detects a subset of so-called "SNP flip-over" events representing recent gBGC nucleotide changes, which occurred in previous generations via non-crossover meiotic recombination. This algorithm has been applied in a large-scale analysis of 1092 sequenced human genomes. Altogether, 56,328 regions on all autosomes have been examined, which revealed 223,955 putative gBGC cases leading to SNP flip-overs. We detected a strong bias (11.7% ± 0.2% excess) in AT- > GC over GC- > AT base pair changes within the entire set of putative gBGC cases. On average, a human gamete acquires 7 SNP flip-over events, in which one allele is replaced by its complementary allele during the process of meiotic non-crossover recombination. In each meiosis event, on average, gBGC results in replacement of 7 AT base pairs by GC base pairs, while only 6 GC pairs are replaced by AT pairs. Therefore, every human gamete is enriched by one GC pair. Happening over millions of years of evolution, this bias may be a noticeable force in changing the nucleotide composition landscape along chromosomes.

  17. The extension of a DNA double helix by an additional Watson-Crick base pair on the same backbone

    DEFF Research Database (Denmark)

    Kumar, P.; Sharma, P. K.; Madsen, Charlotte S.


    Additional base pair: The DNA duplex can be extended with an additional Watson-Crick base pair on the same backbone by the use of double-headed nucleotides. These also work as compressed dinucleotides and form two base pairs with cognate nucleobases on the opposite strand.......Additional base pair: The DNA duplex can be extended with an additional Watson-Crick base pair on the same backbone by the use of double-headed nucleotides. These also work as compressed dinucleotides and form two base pairs with cognate nucleobases on the opposite strand....

  18. Identification of the base-pairing requirements for repression of hctA translation by the small RNA IhtA leads to the discovery of a new mRNA target in Chlamydia trachomatis.

    Directory of Open Access Journals (Sweden)

    Nicole A Grieshaber

    Full Text Available The non-coding small RNA, IhtA expressed by the obligate intracellular human pathogen Chlamydia trachomatis modulates the translation of HctA, a key protein involved in replicative to infectious cell type differentiation. Using a combination of bioinformatics and mutagenesis we sought to identify the base pairing requirement for functional repression of HctA protein expression, with an eye to applying our findings towards the identification of additional targets. IhtA is predicted to fold into a three stem:loop structure. We found that loop 1 occludes the initiation codon of hctA, while loop 2 and 3 are not required for function. This 7 nucleotide region forms G/C rich interactions surrounding the AUG of hctA. Two additional genes in the chlamydial genome, CTL0322 and CTL0097, contained some elements of the hctA:IhtA recognition sequence. The mRNA of both CTL0322and CTL0097 interacted with IhtA in vitro as measured by biolayer interferometry. However, using a CheZ reporter expression system, IhtA only inhibited the translation of CTL0322. The proposed IhtA recognition site in the CTL0322 message contains significant G/C base pairing on either side of the initiation codon while CTL0097 only contains G/C base pairing 3' to the AUG initiation codon. These data suggest that as the functional interacting region is only 6-7nt in length that full translation repression is dependent on the degree of G/C base pairing. Additionally our results indicate that IhtA may regulate multiple mRNAs involved in the chlamydial infectious cycle.

  19. Validation of a Crowdsourcing Methodology for Developing a Knowledge Base of Related Problem-Medication Pairs. (United States)

    McCoy, A B; Wright, A; Krousel-Wood, M; Thomas, E J; McCoy, J A; Sittig, D F


    Clinical knowledge bases of problem-medication pairs are necessary for many informatics solutions that improve patient safety, such as clinical summarization. However, developing these knowledge bases can be challenging. We sought to validate a previously developed crowdsourcing approach for generating a knowledge base of problem-medication pairs in a large, non-university health care system with a widely used, commercially available electronic health record. We first retrieved medications and problems entered in the electronic health record by clinicians during routine care during a six month study period. Following the previously published approach, we calculated the link frequency and link ratio for each pair then identified a threshold cutoff for estimated problem-medication pair appropriateness through clinician review; problem-medication pairs meeting the threshold were included in the resulting knowledge base. We selected 50 medications and their gold standard indications to compare the resulting knowledge base to the pilot knowledge base developed previously and determine its recall and precision. The resulting knowledge base contained 26,912 pairs, had a recall of 62.3% and a precision of 87.5%, and outperformed the pilot knowledge base containing 11,167 pairs from the previous study, which had a recall of 46.9% and a precision of 83.3%. We validated the crowdsourcing approach for generating a knowledge base of problem-medication pairs in a large non-university health care system with a widely used, commercially available electronic health record, indicating that the approach may be generalizable across healthcare settings and clinical systems. Further research is necessary to better evaluate the knowledge, to compare crowdsourcing with other approaches, and to evaluate if incorporating the knowledge into electronic health records improves patient outcomes.

  20. Validation of a Crowdsourcing Methodology for Developing a Knowledge Base of Related Problem-Medication Pairs (United States)

    Wright, A.; Krousel-Wood, M.; Thomas, E. J.; McCoy, J. A.; Sittig, D. F.


    Summary Background Clinical knowledge bases of problem-medication pairs are necessary for many informatics solutions that improve patient safety, such as clinical summarization. However, developing these knowledge bases can be challenging. Objective We sought to validate a previously developed crowdsourcing approach for generating a knowledge base of problem-medication pairs in a large, non-university health care system with a widely used, commercially available electronic health record. Methods We first retrieved medications and problems entered in the electronic health record by clinicians during routine care during a six month study period. Following the previously published approach, we calculated the link frequency and link ratio for each pair then identified a threshold cutoff for estimated problem-medication pair appropriateness through clinician review; problem-medication pairs meeting the threshold were included in the resulting knowledge base. We selected 50 medications and their gold standard indications to compare the resulting knowledge base to the pilot knowledge base developed previously and determine its recall and precision. Results The resulting knowledge base contained 26,912 pairs, had a recall of 62.3% and a precision of 87.5%, and outperformed the pilot knowledge base containing 11,167 pairs from the previous study, which had a recall of 46.9% and a precision of 83.3%. Conclusions We validated the crowdsourcing approach for generating a knowledge base of problem-medication pairs in a large non-university health care system with a widely used, commercially available electronic health record, indicating that the approach may be generalizable across healthcare settings and clinical systems. Further research is necessary to better evaluate the knowledge, to compare crowdsourcing with other approaches, and to evaluate if incorporating the knowledge into electronic health records improves patient outcomes. PMID:26171079

  1. Vinylimidazole-Based Asymmetric Ion Pair Comonomers: Synthesis, Polymerization Studies and Formation of Ionically Crosslinked PMMA

    NARCIS (Netherlands)

    Jana, S.; Vasantha, V.A.; Stubbs, L.P.; Parthiban, A.; Vancso, Gyula J.


    Vinylimidazole-based asymmetric ion pair comonomers (IPCs) which are free from nonpolymerizable counter ions have been synthesized, characterized and polymerized by free radical polymerization (FRP), atom transfer radical polymerization (ATRP), and reversible addition-fragmentation chain transfer

  2. Non-Watson Crick base pairs might stabilize RNA structural motifs in ...

    Indian Academy of Sciences (India)

    Watson Crick base pairs, internal loops and pseudoknots have been the highlighting feature of recent structural determination of RNAs. The recent crystal structure of group-I introns has demonstrated that these might constitute RNA structural ...

  3. GC-MS Based Plasma Metabolomics for Identification of Candidate Biomarkers for Hepatocellular Carcinoma in Egyptian Cohort.

    Directory of Open Access Journals (Sweden)

    Mohammad R Nezami Ranjbar

    Full Text Available This study evaluates changes in metabolite levels in hepatocellular carcinoma (HCC cases vs. patients with liver cirrhosis by analysis of human blood plasma using gas chromatography coupled with mass spectrometry (GC-MS. Untargeted metabolomic analysis of plasma samples from participants recruited in Egypt was performed using two GC-MS platforms: a GC coupled to single quadruple mass spectrometer (GC-qMS and a GC coupled to a time-of-flight mass spectrometer (GC-TOFMS. Analytes that showed statistically significant changes in ion intensities were selected using ANOVA models. These analytes and other candidates selected from related studies were further evaluated by targeted analysis in plasma samples from the same participants as in the untargeted metabolomic analysis. The targeted analysis was performed using the GC-qMS in selected ion monitoring (SIM mode. The method confirmed significant changes in the levels of glutamic acid, citric acid, lactic acid, valine, isoleucine, leucine, alpha tocopherol, cholesterol, and sorbose in HCC cases vs. patients with liver cirrhosis. Specifically, our findings indicate up-regulation of metabolites involved in branched-chain amino acid (BCAA metabolism. Although BCAAs are increasingly used as a treatment for cancer cachexia, others have shown that BCAA supplementation caused significant enhancement of tumor growth via activation of mTOR/AKT pathway, which is consistent with our results that BCAAs are up-regulated in HCC.

  4. Imidazopyridine/Pyrrole and hydroxybenzimidazole/pyrrole pairs for DNA minor groove recognition. (United States)

    Renneberg, Dorte; Dervan, Peter B


    The DNA binding properties of fused heterocycles imidazo[4,5-b]pyridine (Ip) and hydroxybenzimidazole (Hz) paired with pyrrole (Py) in eight-ring hairpin polyamides are reported. The recognition profile of Ip/Py and Hz/Py pairs were compared to the five-membered ring pairs Im/Py and Hp/Py on a DNA restriction fragment at four 6-base pair recognition sites which vary at a single position 5'-TGTNTA-3', where N = G, C, T, A. The Ip/Py pair distinguishes G.C from C.G, T.A, and A.T, and the Hz/Py pair distinguishes T.A from A.T, G.C, and C.G, affording a new set of heterocycle pairs to target the four Watson-Crick base pairs in the minor groove of DNA.

  5. Base Pair Opening in a Deoxynucleotide Duplex Containing a cis-syn Thymine Cyclobutane Dimer Lesion (United States)

    Wenke, Belinda B.; Huiting, Leah N.; Frankel, Elisa B.; Lane, Benjamin F.; Núñez, Megan E.


    The cis-syn thymine cyclobutane dimer is a DNA photoproduct implicated in skin cancer. We compared the stability of individual base pairs in thymine dimer-containing duplexes to undamaged parent 10-mer duplexes. UV melting thermodynamic measurements, CD spectroscopy, and 2D NOESY NMR spectroscopy confirm that the thymine dimer lesion is locally and moderately destabilizing within an overall B-form duplex conformation. We measured the rates of exchange of individual imino protons by NMR using magnetization transfer from water and determined the equilibrium constant for the opening of each base pair Kop. In the normal duplex Kop decreases from the frayed ends of the duplex toward the center, such that the central TA pair is the most stable with a Kop of 8×10−7. In contrast, base pair opening at the 5’T of the thymine dimer is facile. The 5’T of the dimer has the largest equilibrium constant (Kop =3×10−4) in its duplex, considerably larger than even the frayed penultimate base pairs. Notably, base pairing by the 3’T of the dimer is much more stable than by the 5’T, indicating that the predominant opening mechanism for the thymine dimer lesion is not likely to be flipping out into solution as a single unit. The dimer asymmetrically affects the stability of the duplex in its vicinity, destabilizing base pairing on its 5’ side more than on the 3’ side. The striking differences in base pair opening between parent and dimer duplexes occur independently of the duplex-single strand melting transitions. PMID:24328089

  6. Tunnel conductance of Watson-Crick nucleoside-base pairs from telegraph noise

    International Nuclear Information System (INIS)

    Chang Shuai; He Jin; Lin Lisha; Zhang Peiming; Liang Feng; Huang Shuo; Lindsay, Stuart; Young, Michael


    The use of tunneling signals to sequence DNA is presently hampered by the small tunnel conductance of a junction spanning an entire DNA molecule. The design of a readout system that uses a shorter tunneling path requires knowledge of the absolute conductance across base pairs. We have exploited the stochastic switching of hydrogen-bonded DNA base-nucleoside pairs trapped in a tunnel junction to determine the conductance of individual molecular pairs. This conductance is found to be sensitive to the geometry of the junction, but a subset of the data appears to come from unstrained molecular pairs. The conductances determined from these pairs are within a factor of two of the predictions of density functional calculations. The experimental data reproduces the counterintuitive theoretical prediction that guanine-deoxycytidine pairs (3 H-bonds) have a smaller conductance than adenine-thymine pairs (2 H-bonds). A bimodal distribution of switching lifetimes shows that both H-bonds and molecule-metal contacts break.

  7. Physical implementation of pair-based spike timing dependent plasticity

    International Nuclear Information System (INIS)

    Azghadi, M.R.; Al-Sarawi, S.; Iannella, N.; Abbott, D.


    Full text: Objective Spike-timing-dependent plasticity (STOP) is one of several plasticity rules which leads to learning and memory in the brain. STOP induces synaptic weight changes based on the timing of the pre- and post-synaptic neurons. A neural network which can mimic the adaptive capability of biological brains in the temporal domain, requires the weight of single connections to be altered by spike timing. To physically realise this network into silicon, a large number of interconnected STOP circuits on the same substrate is required. This imposes two significant limitations in terms of power and area. To cover these limitations, very large scale integrated circuit (VLSI) technology provides attractive features in terms of low power and small area requirements. An example is demonstrated by (lndiveli et al. 2006). The objective of this paper is to present a new implementation of the STOP circuit which demonstrates better power and area in comparison to previous implementations. Methods The proposed circuit uses complementary metal oxide semiconductor (CMOS) technology as depicted in Fig. I. The synaptic weight can be stored on a capacitor and charging/discharging current can lead to potentiation and depression. HSpice simulation results demonstrate that the average power, peak power, and area of the proposed circuit have been reduced by 6, 8 and 15%, respectively, in comparison with Indiveri's implementation. These improvements naturally lead to packing more STOP circuits onto the same substrate, when compared to previous proposals. Hence, this new implementation is quite interesting for real-world large neural networks.

  8. Community Mining Method of Label Propagation Based on Dense Pairs

    Directory of Open Access Journals (Sweden)

    WENG Wei


    Full Text Available In recent years, with the popularity of handheld Internet equipments like mobile phones, increasing numbers of people are becoming involved in the virtual social network. Because of its large amount of data and complex structure, the network faces new challenges of community mining. A label propagation algorithm with low time complexity and without prior parameters deals easily with a large networks. This study explored a new method of community mining, based on label propagation with two stages. The first stage involved identifying closely linked nodes according to their local adjacency relations that gave rise to a micro-community. The second stage involved expanding and adjusting this community through a label propagation algorithm (LPA to finally obtain the community structure of the entire social network. This algorithm reduced the number of initial labels and avoided the merging of small communities in general LPAs. Thus, the quality of community discovery was improved, and the linear time complexity of the LPA was maintained.

  9. Influence of Hydration on Proton Transfer in the Guanine-Cytosine Radical Cation (G•+-C) Base Pair: A Density Functional Theory Study (United States)

    Kumar, Anil; Sevilla, Michael D.


    On one-electron oxidation all molecules including DNA bases become more acidic in nature. For the GC base pair experiments suggest that a facile proton transfer takes place in the G•+-C base pair from N1 of G•+ to N3 of cytosine. This intra-base pair proton transfer reaction has been extensively considered using theoretical methods for the gas phase and it is predicted that the proton transfer is slightly unfavorable in disagreement with experiment. In the present study, we consider the effect of the first hydration layer on the proton transfer reaction in G•+-C by the use of density functional theory (DFT), B3LYP/6-31+G** calculations of the G•+-C base pair in the presence of 6 and 11 water molecules. Under the influence of hydration of 11 waters, a facile proton transfer from N1 of G•+ to N3 of C is predicted. The zero point energy (ZPE) corrected forward and backward energy barriers, for the proton transfer from N1 of G•+ to N3 of C, was found to be 1.4 and 2.6 kcal/mol, respectively. The proton transferred G•-(H+)C + 11H2O was found to be 1.2 kcal/mol more stable than G•+-C + 11H2O in agreement with experiment. The present calculation demonstrates that the inclusion of the first hydration shell around G•+-C base pair has an important effect on the internal proton transfer energetics. PMID:19485319

  10. Visualizing RNA Secondary Structure Base Pair Binding Probabilities using Nested Concave Hulls


    Sansen , Joris; Bourqui , Romain; Thebault , Patricia; Allali , Julien; Auber , David


    International audience; The challenge 1 of the BIOVIS 2015 design contest consists in designing an intuitive visual depiction of base pairs binding probabilities for secondary structure of ncRNA. Our representation depicts the potential nucleotide pairs binding using nested concave hulls over the computed MFE ncRNA secondary structure. Thus, it allows to identify regions with a high level of uncertainty in the MFE computation and the structures which seem to match to reality.

  11. Thermodynamic stability of Hoogsteen and Watson-Crick base pairs in the presence of histone H3-mimicking peptide. (United States)

    Pramanik, Smritimoy; Nakamura, Kaori; Usui, Kenji; Nakano, Shu-ichi; Saxena, Sarika; Matsui, Jun; Miyoshi, Daisuke; Sugimoto, Naoki


    We found that Hoogsteen base pairs were stabilized by molecular crowding and a histone H3-mimicking peptide, which was not observed for Watson-Crick base pairs. Our findings demonstrate that the type of DNA base pair is critical for the interaction between DNA and histones.

  12. The extension of a DNA double helix by an additional Watson-Crick base pair on the same backbone. (United States)

    Kumar, Pawan; Sharma, Pawan K; Madsen, Charlotte S; Petersen, Michael; Nielsen, Poul


    Additional base pair: The DNA duplex can be extended with an additional Watson-Crick base pair on the same backbone by the use of double-headed nucleotides. These also work as compressed dinucleotides and form two base pairs with cognate nucleobases on the opposite strand. Copyright © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  13. An atlas of RNA base pairs involving modified nucleobases with optimal geometries and accurate energies

    KAUST Repository

    Chawla, Mohit


    Posttranscriptional modifications greatly enhance the chemical information of RNA molecules, contributing to explain the diversity of their structures and functions. A significant fraction of RNA experimental structures available to date present modified nucleobases, with half of them being involved in H-bonding interactions with other bases, i.e. ‘modified base pairs’. Herein we present a systematic investigation of modified base pairs, in the context of experimental RNA structures. To this end, we first compiled an atlas of experimentally observed modified base pairs, for which we recorded occurrences and structural context. Then, for each base pair, we selected a representative for subsequent quantum mechanics calculations, to find out its optimal geometry and interaction energy. Our structural analyses show that most of the modified base pairs are non Watson–Crick like and are involved in RNA tertiary structure motifs. In addition, quantum mechanics calculations quantify and provide a rationale for the impact of the different modifications on the geometry and stability of the base pairs they participate in.

  14. An atlas of RNA base pairs involving modified nucleobases with optimal geometries and accurate energies

    KAUST Repository

    Chawla, Mohit; Oliva, R.; Bujnicki, J. M.; Cavallo, Luigi


    Posttranscriptional modifications greatly enhance the chemical information of RNA molecules, contributing to explain the diversity of their structures and functions. A significant fraction of RNA experimental structures available to date present modified nucleobases, with half of them being involved in H-bonding interactions with other bases, i.e. ‘modified base pairs’. Herein we present a systematic investigation of modified base pairs, in the context of experimental RNA structures. To this end, we first compiled an atlas of experimentally observed modified base pairs, for which we recorded occurrences and structural context. Then, for each base pair, we selected a representative for subsequent quantum mechanics calculations, to find out its optimal geometry and interaction energy. Our structural analyses show that most of the modified base pairs are non Watson–Crick like and are involved in RNA tertiary structure motifs. In addition, quantum mechanics calculations quantify and provide a rationale for the impact of the different modifications on the geometry and stability of the base pairs they participate in.

  15. An entropy-based improved k-top scoring pairs (TSP) method for ...

    African Journals Online (AJOL)

    An entropy-based improved k-top scoring pairs (TSP) (Ik-TSP) method was presented in this study for the classification and prediction of human cancers based on gene-expression data. We compared Ik-TSP classifiers with 5 different machine learning methods and the k-TSP method based on 3 different feature selection ...

  16. A statistic to estimate the variance of the histogram-based mutual information estimator based on dependent pairs of observations

    NARCIS (Netherlands)

    Moddemeijer, R

    In the case of two signals with independent pairs of observations (x(n),y(n)) a statistic to estimate the variance of the histogram based mutual information estimator has been derived earlier. We present such a statistic for dependent pairs. To derive this statistic it is necessary to avail of a

  17. Optimisation of recovery protocols for double-base smokeless powder residues analysed by total vaporisation (TV) SPME/GC-MS. (United States)

    Sauzier, Georgina; Bors, Dana; Ash, Jordan; Goodpaster, John V; Lewis, Simon W


    The investigation of explosive events requires appropriate evidential protocols to recover and preserve residues from the scene. In this study, a central composite design was used to determine statistically validated optimum recovery parameters for double-base smokeless powder residues on steel, analysed using total vaporisation (TV) SPME/GC-MS. It was found that maximum recovery was obtained using isopropanol-wetted swabs stored under refrigerated conditions, then extracted for 15min into acetone on the same day as sample collection. These parameters were applied to the recovery of post-blast residues deposited on steel witness surfaces following a PVC pipe bomb detonation, resulting in detection of all target components across the majority of samples. Higher overall recoveries were obtained from plates facing the sides of the device, consistent with the point of first failure occurring in the pipe body as observed in previous studies. The methodology employed here may be readily applied to a variety of other explosive compounds, and thus assist in establishing 'best practice' procedures for explosive investigations. Copyright © 2016 Elsevier B.V. All rights reserved.

  18. Generation of arbitrary vector fields based on a pair of orthogonal elliptically polarized base vectors. (United States)

    Xu, Danfeng; Gu, Bing; Rui, Guanghao; Zhan, Qiwen; Cui, Yiping


    We present an arbitrary vector field with hybrid polarization based on the combination of a pair of orthogonal elliptically polarized base vectors on the Poincaré sphere. It is shown that the created vector field is only dependent on the latitude angle 2χ but is independent on the longitude angle 2ψ on the Poincaré sphere. By adjusting the latitude angle 2χ, which is related to two identical waveplates in a common path interferometric arrangement, one could obtain arbitrary type of vector fields. Experimentally, we demonstrate the generation of such kind of vector fields and confirm the distribution of state of polarization by the measurement of Stokes parameters. Besides, we investigate the tight focusing properties of these vector fields. It is found that the additional degree of freedom 2χ provided by arbitrary vector field with hybrid polarization allows one to control the spatial structure of polarization and to engineer the focusing field.

  19. Interactions between Al₁₂X (X = Al, C, N and P) nanoparticles and DNA nucleobases/base pairs: implications for nanotoxicity. (United States)

    Jin, Peng; Chen, Yongsheng; Zhang, Shengbai B; Chen, Zhongfang


    The interactions between neutral Al(12)X(I ( h )) (X = Al, C, N and P) nanoparticles and DNA nucleobases, namely adenine (A), thymine (T), guanine (G) and cytosine (C), as well as the Watson-Crick base pairs (BPs) AT and GC, were investigated by means of density functional theory computations. The Al(12)X clusters can tightly bind to DNA bases and BPs to form stable complexes with negative binding Gibbs free energies at room temperature, and considerable charge transfers occur between the bases/BPs and the Al(12)X clusters. These strong interactions, which are also expected for larger Al nanoparticles, may have potentially adverse impacts on the structure and stability of DNA and thus cause its dysfunction.

  20. Comparable stability of Hoogsteen and Watson-Crick base pairs in ionic liquid choline dihydrogen phosphate. (United States)

    Tateishi-Karimata, Hisae; Nakano, Miki; Sugimoto, Naoki


    The instability of Hoogsteen base pairs relative to Watson-Crick base pairs has limited biological applications of triplex-forming oligonucleotides. Hydrated ionic liquids (ILs) provide favourable environments for a wide range of chemical reactions and are known to impact the stabilities of Watson-Crick base pairs. We found that DNA triplex formation was significantly stabilized in hydrated choline dihydrogen phosphate as compared with an aqueous buffer at neutral pH. Interestingly, the stability of Hoogsteen base pairs was found to be comparable with that of Watson-Crick base pairs in the hydrated IL. Molecular dynamics simulations of a DNA triplex in the presence of choline ions revealed that the DNA triplex was stabilized because of the binding of choline ion around the third strand in the grooves. Our finding will facilitate the development of new DNA materials. Our data also indicate that triplex formation may be stabilized inside cells where choline ions and their derivatives are abundant in vivo.

  1. Comparable Stability of Hoogsteen and Watson–Crick Base Pairs in Ionic Liquid Choline Dihydrogen Phosphate (United States)

    Tateishi-Karimata, Hisae; Nakano, Miki; Sugimoto, Naoki


    The instability of Hoogsteen base pairs relative to Watson–Crick base pairs has limited biological applications of triplex-forming oligonucleotides. Hydrated ionic liquids (ILs) provide favourable environments for a wide range of chemical reactions and are known to impact the stabilities of Watson–Crick base pairs. We found that DNA triplex formation was significantly stabilized in hydrated choline dihydrogen phosphate as compared with an aqueous buffer at neutral pH. Interestingly, the stability of Hoogsteen base pairs was found to be comparable with that of Watson–Crick base pairs in the hydrated IL. Molecular dynamics simulations of a DNA triplex in the presence of choline ions revealed that the DNA triplex was stabilized because of the binding of choline ion around the third strand in the grooves. Our finding will facilitate the development of new DNA materials. Our data also indicate that triplex formation may be stabilized inside cells where choline ions and their derivatives are abundant in vivo. PMID:24399194

  2. Molecular dynamics study of some non-hydrogen-bonding base pair DNA strands (United States)

    Tiwari, Rakesh K.; Ojha, Rajendra P.; Tiwari, Gargi; Pandey, Vishnudatt; Mall, Vijaysree


    In order to elucidate the structural activity of hydrophobic modified DNA, the DMMO2-D5SICS, base pair is introduced as a constituent in different set of 12-mer and 14-mer DNA sequences for the molecular dynamics (MD) simulation in explicit water solvent. AMBER 14 force field was employed for each set of duplex during the 200ns production-dynamics simulation in orthogonal-box-water solvent by the Particle-Mesh-Ewald (PME) method in infinite periodic boundary conditions (PBC) to determine conformational parameters of the complex. The force-field parameters of modified base-pair were calculated by Gaussian-code using Hartree-Fock /ab-initio methodology. RMSD Results reveal that the conformation of the duplex is sequence dependent and the binding energy of the complex depends on the position of the modified base-pair in the nucleic acid strand. We found that non-bonding energy had a significant contribution to stabilising such type of duplex in comparison to electrostatic energy. The distortion produced within strands by such type of base-pair was local and destabilised the duplex integrity near to substitution, moreover the binding energy of duplex depends on the position of substitution of hydrophobic base-pair and the DNA sequence and strongly supports the corresponding experimental study.

  3. The influence of anharmonic and solvent effects on the theoretical vibrational spectra of the guanine-cytosine base pairs in Watson-Crick and Hoogsteen configurations. (United States)

    Bende, Attila; Muntean, Cristina M


    The theoretical IR and Raman spectra of the guanine-cytosine DNA base pairs in Watson-Crick and Hoogsteen configurations were computed using DFT method with M06-2X meta-hybrid GGA exchange-correlation functional, including the anharmonic corrections and solvent effects. The results for harmonic frequencies and their anharmonic corrections were compared with our previously calculated values obtained with the B3PW91 hybrid GGA functional. Significant differences were obtained for the anharmonic corrections calculated with the two different DFT functionals, especially for the stretching modes, while the corresponding harmonic frequencies did not differ considerable. For the Hoogtseen case the H⁺ vibration between the G-C base pair can be characterized as an asymmetric Duffing oscillator and therefore unrealistic anharmonic corrections for normal modes where this proton vibration is involved have been obtained. The spectral modification due to the anharmonic corrections, solvent effects and the influence of sugar-phosphate group for the Watson-Crick and Hoogsteen base pair configurations, respectively, were also discussed. For the Watson-Crick case also the influence of the stacking interaction on the theoretical IR and Raman spectra was analyzed. Including the anharmonic correction in our normal mode analysis is essential if one wants to obtain correct assignments of the theoretical frequency values as compared with the experimental spectra.

  4. Energetics and dynamics of the non-natural fluorescent 4AP:DAP base pair

    KAUST Repository

    Chawla, Mohit


    The fluorescent non-natural 4-aminophthalimide (4AP) base, when paired to the complementary 2,4-diaminopyrimidine (DAP) nucleobase, is accommodated in a B-DNA duplex being efficiently recognized and incorporated by DNA polymerases. To complement the experimental studies and rationalize the impact of the above non-natural bases on the structure, stability and dynamics of nucleic acid structures, we performed quantum mechanics (QM) calculations along with classical molecular dynamics (MD) simulations. QM calculations were initially focused on the geometry and energetics of the 4AP:DAP non-natural pair and of H-bonded base pairs between 4AP and all the natural bases in their classical Watson-Crick geometries. The QM calculations indicate that the 4AP:DAP pair, despite the fact that it can form 3 H-bonds in a classic Watson-Crick geometry, has a stability comparable to the A:T pair. Then, we extended the study to reverse Watson-Crick geometries, characteristic of parallel strands. MD simulations were carried out on two 13-mer DNA duplexes, featuring a central 4AP:DAP or A:T pair, respectively. No major structural deformation of the duplex was observed during the MD simulation. Snapshots from the MD simulations were subjected to QM calculations to investigate the 4AP:DAP interaction energy when embedded into a duplex structure, and to investigate the impact of the two non-natural bases on the stacking interactions with adjacent bases in the DNA duplex. We found a slight increase in stacking interactions involving the 4AP:DAP pair, counterbalanced by a moderate decrease in H-bonding interactions of the 4AP:DAP and of the adjacent base pairs in the duplex. The results of our study are in agreement with experimental data and complement them by providing an insight into which factors contribute positively and which factors contribute negatively to the structural compatibility of the fluorescent 4AP:DAP pair with a B-DNA structure.

  5. Base-pairing preferences, physicochemical properties and mutational behaviour of the DNA lesion 8-nitroguanine. (United States)

    Bhamra, Inder; Compagnone-Post, Patricia; O'Neil, Ian A; Iwanejko, Lesley A; Bates, Andrew D; Cosstick, Richard


    8-Nitro-2'-deoxyguanosine (8-nitrodG) is a relatively unstable, mutagenic lesion of DNA that is increasingly believed to be associated with tissue inflammation. Due to the lability of the glycosidic bond, 8-nitrodG cannot be incorporated into oligodeoxynucleotides (ODNs) by chemical DNA synthesis and thus very little is known about its physicochemical properties and base-pairing preferences. Here we describe the synthesis of 8-nitro-2'-O-methylguanosine, a ribonucleoside analogue of this lesion, which is sufficiently stable to be incorporated into ODNs. Physicochemical studies demonstrated that 8-nitro-2'-O-methylguanosine adopts a syn conformation about the glycosidic bond; thermal melting studies and molecular modelling suggest a relatively stable syn-8-nitroG·anti-G base pair. Interestingly, when this lesion analogue was placed in a primer-template system, extension of the primer by either avian myeloblastosis virus reverse transcriptase (AMV-RT) or human DNA polymerase β (pol β), was significantly impaired, but where incorporation opposite 8-nitroguanine did occur, pol β showed a 2:1 preference to insert dA over dC, while AMV-RT incorporated predominantly dC. The fact that no 8-nitroG·G base pairing is seen in the primer extension products suggests that the polymerases may discriminate against this pairing system on the basis of its poor geometric match to a Watson-Crick pair.

  6. Base-pairing preferences, physicochemical properties and mutational behaviour of the DNA lesion 8-nitroguanine† (United States)

    Bhamra, Inder; Compagnone-Post, Patricia; O’Neil, Ian A.; Iwanejko, Lesley A.; Bates, Andrew D.; Cosstick, Richard


    8-Nitro-2′-deoxyguanosine (8-nitrodG) is a relatively unstable, mutagenic lesion of DNA that is increasingly believed to be associated with tissue inflammation. Due to the lability of the glycosidic bond, 8-nitrodG cannot be incorporated into oligodeoxynucleotides (ODNs) by chemical DNA synthesis and thus very little is known about its physicochemical properties and base-pairing preferences. Here we describe the synthesis of 8-nitro-2′-O-methylguanosine, a ribonucleoside analogue of this lesion, which is sufficiently stable to be incorporated into ODNs. Physicochemical studies demonstrated that 8-nitro-2′-O-methylguanosine adopts a syn conformation about the glycosidic bond; thermal melting studies and molecular modelling suggest a relatively stable syn-8-nitroG·anti-G base pair. Interestingly, when this lesion analogue was placed in a primer-template system, extension of the primer by either avian myeloblastosis virus reverse transcriptase (AMV-RT) or human DNA polymerase β (pol β), was significantly impaired, but where incorporation opposite 8-nitroguanine did occur, pol β showed a 2:1 preference to insert dA over dC, while AMV-RT incorporated predominantly dC. The fact that no 8-nitroG·G base pairing is seen in the primer extension products suggests that the polymerases may discriminate against this pairing system on the basis of its poor geometric match to a Watson–Crick pair. PMID:22965127

  7. Triple helical DNA in a duplex context and base pair opening (United States)

    Esguerra, Mauricio; Nilsson, Lennart; Villa, Alessandra


    It is fundamental to explore in atomic detail the behavior of DNA triple helices as a means to understand the role they might play in vivo and to better engineer their use in genetic technologies, such as antigene therapy. To this aim we have performed atomistic simulations of a purine-rich antiparallel triple helix stretch of 10 base triplets flanked by canonical Watson–Crick double helices. At the same time we have explored the thermodynamic behavior of a flipping Watson–Crick base pair in the context of the triple and double helix. The third strand can be accommodated in a B-like duplex conformation. Upon binding, the double helix changes shape, and becomes more rigid. The triple-helical region increases its major groove width mainly by oversliding in the negative direction. The resulting conformations are somewhere between the A and B conformations with base pairs remaining almost perpendicular to the helical axis. The neighboring duplex regions maintain a B DNA conformation. Base pair opening in the duplex regions is more probable than in the triplex and binding of the Hoogsteen strand does not influence base pair breathing in the neighboring duplex region. PMID:25228466

  8. Modeling gas solubilities in imidazolium based ionic liquids with the [Tf2N] anion using the GC-EoS

    NARCIS (Netherlands)

    Pereda, Selva; Raeissi, Sonia; Andreatta, A.E. (Alfonsina); Bottini, Susana B.; Kroon, Maaike; Peters, Cor


    The group contribution equation of state (GC-EoS) is extended to model gas solubilities in the homologous 1-alkyl-3-methylimidazolium bis(trifluoromethyl-sulfonyl) imide family. The gases considered in this work are CO2, CO, H2, CH4, and C2H6. The model parameters were estimated on the basis of 1400

  9. Measurement and theory of hydrogen bonding contribution to isosteric DNA base pairs. (United States)

    Khakshoor, Omid; Wheeler, Steven E; Houk, K N; Kool, Eric T


    We address the recent debate surrounding the ability of 2,4-difluorotoluene (F), a low-polarity mimic of thymine (T), to form a hydrogen-bonded complex with adenine in DNA. The hydrogen bonding ability of F has been characterized as small to zero in various experimental studies, and moderate to small in computational studies. However, recent X-ray crystallographic studies of difluorotoluene in DNA/RNA have indicated, based on interatomic distances, possible hydrogen bonding interactions between F and natural bases in nucleic acid duplexes and in a DNA polymerase active site. Since F is widely used to measure electrostatic contributions to pairing and replication, it is important to quantify the impact of this isostere on DNA stability. Here, we studied the pairing stability and selectivity of this compound and a closely related variant, dichlorotoluene deoxyriboside (L), in DNA, using both experimental and computational approaches. We measured the thermodynamics of duplex formation in three sequence contexts and with all possible pairing partners by thermal melting studies using the van't Hoff approach, and for selected cases by isothermal titration calorimetry (ITC). Experimental results showed that internal F-A pairing in DNA is destabilizing by 3.8 kcal/mol (van't Hoff, 37 °C) as compared with T-A pairing. At the end of a duplex, base-base interactions are considerably smaller; however, the net F-A interaction remains repulsive while T-A pairing is attractive. As for selectivity, F is found to be slightly selective for adenine over C, G, T by 0.5 kcal mol, as compared with thymine's selectivity of 2.4 kcal/mol. Interestingly, dichlorotoluene in DNA is slightly less destabilizing and slightly more selective than F, despite the lack of strongly electronegative fluorine atoms. Experimental data were complemented by computational results, evaluated at the M06-2X/6-31+G(d) and MP2/cc-pVTZ levels of theory. These computations suggest that the pairing energy of F to A

  10. Coordination and redox state-dependent structural changes of the heme-based oxygen sensor AfGcHK associated with intraprotein signal transduction. (United States)

    Stranava, Martin; Man, Petr; Skálová, Tereza; Kolenko, Petr; Blaha, Jan; Fojtikova, Veronika; Martínek, Václav; Dohnálek, Jan; Lengalova, Alzbeta; Rosůlek, Michal; Shimizu, Toru; Martínková, Markéta


    The heme-based oxygen sensor histidine kinase Af GcHK is part of a two-component signal transduction system in bacteria. O 2 binding to the Fe(II) heme complex of its N-terminal globin domain strongly stimulates autophosphorylation at His 183 in its C-terminal kinase domain. The 6-coordinate heme Fe(III)-OH - and -CN - complexes of Af GcHK are also active, but the 5-coordinate heme Fe(II) complex and the heme-free apo-form are inactive. Here, we determined the crystal structures of the isolated dimeric globin domains of the active Fe(III)-CN - and inactive 5-coordinate Fe(II) forms, revealing striking structural differences on the heme-proximal side of the globin domain. Using hydrogen/deuterium exchange coupled with mass spectrometry to characterize the conformations of the active and inactive forms of full-length Af GcHK in solution, we investigated the intramolecular signal transduction mechanisms. Major differences between the active and inactive forms were observed on the heme-proximal side (helix H5), at the dimerization interface (helices H6 and H7 and loop L7) of the globin domain and in the ATP-binding site (helices H9 and H11) of the kinase domain. Moreover, separation of the sensor and kinase domains, which deactivates catalysis, increased the solvent exposure of the globin domain-dimerization interface (helix H6) as well as the flexibility and solvent exposure of helix H11. Together, these results suggest that structural changes at the heme-proximal side, the globin domain-dimerization interface, and the ATP-binding site are important in the signal transduction mechanism of Af GcHK. We conclude that Af GcHK functions as an ensemble of molecules sampling at least two conformational states. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

  11. Concealed d-wave pairs in the s± condensate of iron-based superconductors. (United States)

    Ong, Tzen; Coleman, Piers; Schmalian, Jörg


    A central question in iron-based superconductivity is the mechanism by which the paired electrons minimize their strong mutual Coulomb repulsion. In most unconventional superconductors, Coulomb repulsion is minimized through the formation of higher angular momentum Cooper pairs, with Fermi surface nodes in the pair wavefunction. The apparent absence of such nodes in the iron-based superconductors has led to a belief they form an s-wave ([Formula: see text]) singlet state, which changes sign between the electron and hole pockets. However, the multiorbital nature of these systems opens an alternative possibility. Here, we propose a new class of [Formula: see text] state containing a condensate of d-wave Cooper pairs, concealed by their entanglement with the iron orbitals. By combining the d-wave ([Formula: see text]) motion of the pairs with the internal angular momenta [Formula: see text] of the iron orbitals to make a singlet ([Formula: see text]), an [Formula: see text] superconductor with a nontrivial topology is formed. This scenario allows us to understand the development of octet nodes in potassium-doped Ba1-x KXFe2As2 as a reconfiguration of the orbital and internal angular momentum into a high spin ([Formula: see text]) state; the reverse transition under pressure into a fully gapped state can then be interpreted as a return to the low-spin singlet. The formation of orbitally entangled pairs is predicted to give rise to a shift in the orbital content at the Fermi surface, which can be tested via laser-based angle-resolved photoemission spectroscopy.

  12. The Influence of the Thymine C5 Methyl Group on Spontaneous Base Pair Breathing in DNA

    Czech Academy of Sciences Publication Activity Database

    Wärmländer, S.; Šponer, Jiří; Leijon, M.; Šponer, Judit E.


    Roč. 277, č. 32 (2002), s. 28491-28497 ISSN 0021-9258 R&D Projects: GA MŠk LN00A016 Institutional research plan: CEZ:AV0Z4040901 Keywords : thymine * DNA * base pairs Subject RIV: CF - Physical ; Theoretical Chemistry Impact factor: 6.696, year: 2002

  13. Metalophillic attraction in the consecutive T-HgII-T DNA base pairs

    Czech Academy of Sciences Publication Activity Database

    Benda, Ladislav; Straka, Michal; Bouř, Petr; Tanaka, Y.; Sychrovský, Vladimír


    Roč. 12, č. 1 (2012), s. 50-50 ISSN 1210-8529. [10th Discussions in Structural Molecular Biology. 22.03.2012-24.03.2012, Nové Hrady] Institutional research plan: CEZ:AV0Z40550506 Keywords : T-HgII-T * DNA base pairs Subject RIV: CF - Physical ; Theoretical Chemistry

  14. Time series regression-based pairs trading in the Korean equities market (United States)

    Kim, Saejoon; Heo, Jun


    Pairs trading is an instance of statistical arbitrage that relies on heavy quantitative data analysis to profit by capitalising low-risk trading opportunities provided by anomalies of related assets. A key element in pairs trading is the rule by which open and close trading triggers are defined. This paper investigates the use of time series regression to define the rule which has previously been identified with fixed threshold-based approaches. Empirical results indicate that our approach may yield significantly increased excess returns compared to ones obtained by previous approaches on large capitalisation stocks in the Korean equities market.

  15. A rule of seven in Watson-Crick base-pairing of mismatched sequences. (United States)

    Cisse, Ibrahim I; Kim, Hajin; Ha, Taekjip


    Sequence recognition through base-pairing is essential for DNA repair and gene regulation, but the basic rules governing this process remain elusive. In particular, the kinetics of annealing between two imperfectly matched strands is not well characterized, despite its potential importance in nucleic acid-based biotechnologies and gene silencing. Here we use single-molecule fluorescence to visualize the multiple annealing and melting reactions of two untethered strands inside a porous vesicle, allowing us to precisely quantify the annealing and melting rates. The data as a function of mismatch position suggest that seven contiguous base pairs are needed for rapid annealing of DNA and RNA. This phenomenological rule of seven may underlie the requirement for seven nucleotides of complementarity to seed gene silencing by small noncoding RNA and may help guide performance improvement in DNA- and RNA-based bio- and nanotechnologies, in which off-target effects can be detrimental.

  16. Analysis of Phenolic and Cyclic Compounds in Plants Using Derivatization Techniques in Combination with GC-MS-Based Metabolite Profiling

    Directory of Open Access Journals (Sweden)

    Jens Rohloff


    Full Text Available Metabolite profiling has been established as a modern technology platform for the description of complex chemical matrices and compound identification in biological samples. Gas chromatography coupled with mass spectrometry (GC-MS in particular is a fast and accurate method widely applied in diagnostics, functional genomics and for screening purposes. Following solvent extraction and derivatization, hundreds of metabolites from different chemical groups can be characterized in one analytical run. Besides sugars, acids, and polyols, diverse phenolic and other cyclic metabolites can be efficiently detected by metabolite profiling. The review describes own results from plant research to exemplify the applicability of GC-MS profiling and concurrent detection and identification of phenolics and other cyclic structures.

  17. The MetabolomeExpress Project: enabling web-based processing, analysis and transparent dissemination of GC/MS metabolomics datasets

    Directory of Open Access Journals (Sweden)

    Carroll Adam J


    Full Text Available Abstract Background Standardization of analytical approaches and reporting methods via community-wide collaboration can work synergistically with web-tool development to result in rapid community-driven expansion of online data repositories suitable for data mining and meta-analysis. In metabolomics, the inter-laboratory reproducibility of gas-chromatography/mass-spectrometry (GC/MS makes it an obvious target for such development. While a number of web-tools offer access to datasets and/or tools for raw data processing and statistical analysis, none of these systems are currently set up to act as a public repository by easily accepting, processing and presenting publicly submitted GC/MS metabolomics datasets for public re-analysis. Description Here, we present MetabolomeExpress, a new File Transfer Protocol (FTP server and web-tool for the online storage, processing, visualisation and statistical re-analysis of publicly submitted GC/MS metabolomics datasets. Users may search a quality-controlled database of metabolite response statistics from publicly submitted datasets by a number of parameters (eg. metabolite, species, organ/biofluid etc.. Users may also perform meta-analysis comparisons of multiple independent experiments or re-analyse public primary datasets via user-friendly tools for t-test, principal components analysis, hierarchical cluster analysis and correlation analysis. They may interact with chromatograms, mass spectra and peak detection results via an integrated raw data viewer. Researchers who register for a free account may upload (via FTP their own data to the server for online processing via a novel raw data processing pipeline. Conclusions MetabolomeExpress provides a new opportunity for the general metabolomics community to transparently present online the raw and processed GC/MS data underlying their metabolomics publications. Transparent sharing of these data will allow researchers to

  18. Genomic Mapping of Human DNA provides Evidence of Difference in Stretch between AT and GC rich regions (United States)

    Reifenberger, Jeffrey; Dorfman, Kevin; Cao, Han

    Human DNA is a not a polymer consisting of a uniform distribution of all 4 nucleic acids, but rather contains regions of high AT and high GC content. When confined, these regions could have different stretch due to the extra hydrogen bond present in the GC basepair. To measure this potential difference, human genomic DNA was nicked with NtBspQI, labeled with a cy3 like fluorophore at the nick site, stained with YOYO, loaded into a device containing an array of nanochannels, and imaged. Over 473,000 individual molecules of DNA, corresponding to roughly 30x coverage of a human genome, were collected and aligned to the human reference. Based on the known AT/GC content between aligned pairs of labels, the stretch was measured for regions of similar size but different AT/GC content. We found that regions of high GC content were consistently more stretched than regions of high AT content between pairs of labels varying in size between 2.5 kbp and 500 kbp. We measured that for every 1% increase in GC content there was roughly a 0.06% increase in stretch. While this effect is small, it is important to take into account differences in stretch between AT and GC rich regions to improve the sensitivity of detection of structural variations from genomic variations. NIH Grant: R01-HG006851.

  19. Site-Specific Incorporation of Functional Components into RNA by an Unnatural Base Pair Transcription System

    Directory of Open Access Journals (Sweden)

    Rie Kawai


    Full Text Available Toward the expansion of the genetic alphabet, an unnatural base pair between 7-(2-thienylimidazo[4,5-b]pyridine (Ds and pyrrole-2-carbaldehyde (Pa functions as a third base pair in replication and transcription, and provides a useful tool for the site-specific, enzymatic incorporation of functional components into nucleic acids. We have synthesized several modified-Pa substrates, such as alkylamino-, biotin-, TAMRA-, FAM-, and digoxigenin-linked PaTPs, and examined their transcription by T7 RNA polymerase using Ds-containing DNA templates with various sequences. The Pa substrates modified with relatively small functional groups, such as alkylamino and biotin, were efficiently incorporated into RNA transcripts at the internal positions, except for those less than 10 bases from the 3′-terminus. We found that the efficient incorporation into a position close to the 3′-terminus of a transcript depended on the natural base contexts neighboring the unnatural base, and that pyrimidine-Ds-pyrimidine sequences in templates were generally favorable, relative to purine-Ds-purine sequences. The unnatural base pair transcription system provides a method for the site-specific functionalization of large RNA molecules.

  20. Non-targeted acquisition strategy for screening doping compounds based on GC-EI-hybrid quadrupole-Orbitrap mass spectrometry: A focus on exogenous anabolic steroids. (United States)

    de Albuquerque Cavalcanti, Gustavo; Rodrigues, Lucas Martins; Dos Santos, Leonardo; Zheng, Xin; Gujar, Amit; Cole, Jason; Padilha, Monica Costa; de Aquino Neto, Francisco Radler


    This is a first look at a non-targeted screening method based on Orbitrap gas chromatography-mass spectrometry (GC-MS) technology for a large number of banned compounds in sports found in urine, including exogenous anabolic steroids, β-agonists, narcotics, stimulants, hormone modulators, and diuretics. A simple sample preparation was processed in four steps: an enzymatic hydrolysis, liquid-liquid extraction, evaporation, and trimethylsilylation. All compounds were able to meet the World Anti-Doping Agency's sensitivity criteria with mass accuracies less than 1 ppm and with sufficient points across the peak by running the Orbitrap GC-MS in full-scan mode. In addition, we discuss our initial findings of using a full-scan selected ion monitoring-tandem mass spectrometry (SIM-MS/MS) approach as a way to obtain lower detection limits and reach desirable selectivity for some exogenous anabolic steroids. Copyright © 2017 John Wiley & Sons, Ltd.

  1. GC/FID-based authentication of Baccharis trimera: a quality control study of products commercialized in Curitiba and metropolitan region (Brazil

    Directory of Open Access Journals (Sweden)

    Lia M. S. de Ferrante

    Full Text Available Baccharis trimera (carqueja is a medicinal plant used for stomach pain, bad digestion, heart bum, kidney problems and constipation. The objective of the present work was a quality study of carqueja commercialized in Curitiba and metropolitan region (Paraná-Brazil using gas chromatography techniques (GC/FID for analyses of the essential oil, which was extracted through hydrodistillation using a Clevenger system. Macro and microscopic analyses were also done. Some samples were contaminated by other species of plants, fungi and small insects, some of them could be identified. Among all samples, 21 showed similar chromatographic profile to the standard oil, and 7 had different profile in relation to the standard. The chromatogram analyses showed that most of the analyzed samples had the similar profile as the standard oil of Baccharis trimera. GC/FID-based authentication of Baccharis trimera may be useful as a rapid tool to ensure quality control and safety monitoring of this kind of herbal pharmaceuticals.

  2. Aviram–Ratner rectifying mechanism for DNA base-pair sequencing through graphene nanogaps

    International Nuclear Information System (INIS)

    Agapito, Luis A; Gayles, Jacob; Wolowiec, Christian; Kioussis, Nicholas


    We demonstrate that biological molecules such as Watson–Crick DNA base pairs can behave as biological Aviram–Ratner electrical rectifiers because of the spatial separation and weak hydrogen bonding between the nucleobases. We have performed a parallel computational implementation of the ab initio non-equilibrium Green’s function (NEGF) theory to determine the electrical response of graphene—base-pair—graphene junctions. The results show an asymmetric (rectifying) current–voltage response for the cytosine–guanine base pair adsorbed on a graphene nanogap. In sharp contrast we find a symmetric response for the thymine–adenine case. We propose applying the asymmetry of the current–voltage response as a sensing criterion to the technological challenge of rapid DNA sequencing via graphene nanogaps. (paper)

  3. Watson-Crick Base Pair Radical Cation as a Model for Oxidative Damage in DNA. (United States)

    Feketeová, Linda; Chan, Bun; Khairallah, George N; Steinmetz, Vincent; Maitre, Philippe; Radom, Leo; O'Hair, Richard A J


    The deleterious cellular effects of ionizing radiation are well-known, but the mechanisms causing DNA damage are poorly understood. The accepted molecular events involve initial oxidation and deprotonation at guanine sites, triggering hydrogen atom abstraction reactions from the sugar moieties, causing DNA strand breaks. Probing the chemistry of the initially formed radical cation has been challenging. Here, we generate, spectroscopically characterize, and examine the reactivity of the Watson-Crick nucleobase pair radical cation in the gas phase. We observe rich chemistry, including proton transfer between the bases and propagation of the radical site in deoxyguanosine from the base to the sugar, thus rupturing the sugar. This first example of a gas-phase model system providing molecular-level details on the chemistry of an ionized DNA base pair paves the way toward a more complete understanding of molecular processes induced by radiation. It also highlights the role of radical propagation in chemistry, biology, and nanotechnology.

  4. Watson-Crick base pairing controls excited-state decay in natural DNA. (United States)

    Bucher, Dominik B; Schlueter, Alexander; Carell, Thomas; Zinth, Wolfgang


    Excited-state dynamics are essential to understanding the formation of DNA lesions induced by UV light. By using femtosecond IR spectroscopy, it was possible to determine the lifetimes of the excited states of all four bases in the double-stranded environment of natural DNA. After UV excitation of the DNA duplex, we detected a concerted decay of base pairs connected by Watson-Crick hydrogen bonds. A comparison of single- and double-stranded DNA showed that the reactive charge-transfer states formed in the single strands are suppressed by base pairing in the duplex. The strong influence of the Watson-Crick hydrogen bonds indicates that proton transfer opens an efficient decay path in the duplex that prohibits the formation or reduces the lifetime of reactive charge-transfer states. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  5. Energy Landscape and Pathways for Transitions between Watson-Crick and Hoogsteen Base Pairing in DNA. (United States)

    Chakraborty, Debayan; Wales, David J


    The recent discovery that Hoogsteen (HG) base pairs are widespread in DNA across diverse sequences and positional contexts could have important implications for understanding DNA replication and DNA-protein recognition. While evidence is emerging that the Hoogsteen conformation could be a thermodynamically accessible conformation of the DNA duplex and provide a means to expand its functionality, relatively little is known about the molecular mechanism underlying the Watson-Crick (WC) to HG transition. In this Perspective, we describe pathways and kinetics for this transition at an atomic level of detail, using the energy landscape perspective. We show that competition between the duplex conformations results in a double funnel landscape, which explains some recent experimental observations. The interconversion pathways feature a number of intermediates, with a variable number of WC and HG base pairs. The relatively slow kinetics, with possible deviations from two-state behavior, suggest that this conformational switch is likely to be a challenging target for both simulation and experiment.

  6. Hydrogen bond disruption in DNA base pairs from (14)C transmutation. (United States)

    Sassi, Michel; Carter, Damien J; Uberuaga, Blas P; Stanek, Christopher R; Mancera, Ricardo L; Marks, Nigel A


    Recent ab initio molecular dynamics simulations have shown that radioactive carbon does not normally fragment DNA bases when it decays. Motivated by this finding, density functional theory and Bader analysis have been used to quantify the effect of C → N transmutation on hydrogen bonding in DNA base pairs. We find that (14)C decay has the potential to significantly alter hydrogen bonds in a variety of ways including direct proton shuttling (thymine and cytosine), thermally activated proton shuttling (guanine), and hydrogen bond breaking (cytosine). Transmutation substantially modifies both the absolute and relative strengths of the hydrogen bonding pattern, and in two instances (adenine and cytosine), the density at the critical point indicates development of mild covalent character. Since hydrogen bonding is an important component of Watson-Crick pairing, these (14)C-induced modifications, while infrequent, may trigger errors in DNA transcription and replication.

  7. Enhanced Stability of DNA Nanostructures by Incorporation of Unnatural Base Pairs. (United States)

    Liu, Qing; Liu, Guocheng; Wang, Ting; Fu, Jing; Li, Rujiao; Song, Linlin; Wang, Zhen-Gang; Ding, Baoquan; Chen, Fei


    Self-assembled DNA nanostructures hold great promise in the fields of nanofabrication, biosensing and nanomedicine. However, the inherent low stability of the DNA double helices, formed by weak interactions, largely hinders the assembly and functions of DNA nanostructures. In this study, we redesigned and constructed a six-arm DNA junction by incorporation of the unnatural base pairs 5-Me-isoC/isoG and A/2-thioT into the double helices. They not only retained the structural integrity of the DNA nanostructure, but also showed enhanced thermal stability and resistance to T7 Exonuclease digestion. This research may expand the applications of DNA nanostructures in nanofabrication and biomedical fields, and furthermore, the genetic alphabet expansion with unnatural base pairs may enable us to construct more complicated and diversified self-assembled DNA nanostructures. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  8. Array based Discovery of Aptamer Pairs (Open Access Publisher’s Version) (United States)


    Array-based Discovery of Aptamer Pairs Minseon Cho,†,‡ Seung Soo Oh,‡ Jeff Nie,§ Ron Stewart,§ Monte J. Radeke,⊥ Michael Eisenstein ,†,‡ Peter J...ac504076k | Anal. Chem. 2015, 87, 821−828827 (24) Cho, M.; Oh, S. S.; Nie, J.; Stewart, R.; Eisenstein , M.; Chambers, J.; Marth, J. D.; Walker, F

  9. DNA electronic circular dichroism on the inter-base pair scale

    DEFF Research Database (Denmark)

    Di Meo, Florent; Nørby, Morten Steen; Rubio-Magnieto, Jenifer


    A successful elucidation of the near-ultraviolet electronic circular dichroism spectrum of a short double-stranded DNA is reported. Time-dependent density functional theory methods are shown to accurately predict spectra and assign bands on the microscopic base-pair scale, a finding that opens...... the field for using circular dichroism spectroscopy as a sensitive nanoscale probe of DNA to reveal its complex interactions with the environment. (Chemical Equation Presented)....

  10. Non-standard base pairing and stacked structures in methyl xanthine clusters

    Czech Academy of Sciences Publication Activity Database

    Callahan, M. P.; Gengeliczki, Z.; Svadlenak, N.; Valdes, Haydee; Hobza, Pavel; de Vries, M. S.


    Roč. 10, č. 19 (2008), s. 2819-2826 ISSN 1463-9076 R&D Projects: GA MŠk LC512 Grant - others:NSF(US) CHE-0615401 Institutional research plan: CEZ:AV0Z40550506 Keywords : non-standard base pairing * stacked structures * in methyl xanthine Subject RIV: CF - Physical ; Theoretical Chemistry Impact factor: 4.064, year: 2008

  11. Paired-Associate and Feedback-Based Weather Prediction Tasks Support Multiple Category Learning Systems


    Li, Kaiyun; Fu, Qiufang; Sun, Xunwei; Zhou, Xiaoyan; Fu, Xiaolan


    It remains unclear whether probabilistic category learning in the feedback-based weather prediction task (FB-WPT) can be mediated by a non-declarative or procedural learning system. To address this issue, we compared the effects of training time and verbal working memory, which influence the declarative learning system but not the non-declarative learning system, in the FB and paired-associate (PA) WPTs, as the PA task recruits a declarative learning system. The results of Experiment 1 showed...

  12. Thermodynamic and structural properties of the specific binding between Ag⁺ ion and C:C mismatched base pair in duplex DNA to form C-Ag-C metal-mediated base pair. (United States)

    Torigoe, Hidetaka; Okamoto, Itaru; Dairaku, Takenori; Tanaka, Yoshiyuki; Ono, Akira; Kozasa, Tetsuo


    Metal ion-nucleic acid interactions have attracted considerable interest for their involvement in structure formation and catalytic activity of nucleic acids. Although interactions between metal ion and mismatched base pair duplex are important to understand mechanism of gene mutations related to heavy metal ions, they have not been well-characterized. We recently found that the Ag(+) ion stabilized a C:C mismatched base pair duplex DNA. A C-Ag-C metal-mediated base pair was supposed to be formed by the binding between the Ag(+) ion and the C:C mismatched base pair to stabilize the duplex. Here, we examined specificity, thermodynamics and structure of possible C-Ag-C metal-mediated base pair. UV melting indicated that only the duplex with the C:C mismatched base pair, and not of the duplexes with the perfectly matched and other mismatched base pairs, was specifically stabilized on adding the Ag(+) ion. Isothermal titration calorimetry demonstrated that the Ag(+) ion specifically bound with the C:C base pair at 1:1 molar ratio with a binding constant of 10(6) M(-1), which was significantly larger than those for nonspecific metal ion-DNA interactions. Electrospray ionization mass spectrometry also supported the specific 1:1 binding between the Ag(+) ion and the C:C base pair. Circular dichroism spectroscopy and NMR revealed that the Ag(+) ion may bind with the N3 positions of the C:C base pair without distorting the higher-order structure of the duplex. We conclude that the specific formation of C-Ag-C base pair with large binding affinity would provide a binding mode of metal ion-DNA interactions, similar to that of the previously reported T-Hg-T base pair. The C-Ag-C base pair may be useful not only for understanding of molecular mechanism of gene mutations related to heavy metal ions but also for wide variety of potential applications of metal-mediated base pairs in various fields, such as material, life and environmental sciences. Copyright © 2012 Elsevier

  13. Silver-mediated base pairings: towards dynamic DNA nanostructures with enhanced chemical and thermal stability

    International Nuclear Information System (INIS)

    Swasey, Steven M; Gwinn, Elisabeth G


    The thermal and chemical fragility of DNA nanomaterials assembled by Watson–Crick (WC) pairing constrain the settings in which these materials can be used and how they can be functionalized. Here we investigate use of the silver cation, Ag + , as an agent for more robust, metal-mediated self-assembly, focusing on the simplest duplex building blocks that would be required for more elaborate Ag + –DNA nanostructures. Our studies of Ag + -induced assembly of non-complementary DNA oligomers employ strands of 2–24 bases, with varied base compositions, and use electrospray ionization mass spectrometry to determine product compositions. High yields of duplex products containing narrowly distributed numbers of Ag + can be achieved by optimizing solution conditions. These Ag + -mediated duplexes are stable to at least 60 mM Mg 2+ , higher than is necessary for WC nanotechnology schemes such as tile assemblies and DNA origami, indicating that sequential stages of Ag + -mediated and WC-mediated assembly may be feasible. Circular dichroism spectroscopy suggests simple helical structures for Ag + -mediated duplexes with lengths to at least 20 base pairs, and further indicates that the structure of cytosine-rich duplexes is preserved at high urea concentrations. We therefore propose an approach towards dynamic DNA nanomaterials with enhanced thermal and chemical stability through designs that combine sturdy silver-mediated ‘frames’ with WC paired ‘pictures’. (paper)

  14. Prediction of plant promoters based on hexamers and random triplet pair analysis

    Directory of Open Access Journals (Sweden)

    Noman Nasimul


    Full Text Available Abstract Background With an increasing number of plant genome sequences, it has become important to develop a robust computational method for detecting plant promoters. Although a wide variety of programs are currently available, prediction accuracy of these still requires further improvement. The limitations of these methods can be addressed by selecting appropriate features for distinguishing promoters and non-promoters. Methods In this study, we proposed two feature selection approaches based on hexamer sequences: the Frequency Distribution Analyzed Feature Selection Algorithm (FDAFSA and the Random Triplet Pair Feature Selecting Genetic Algorithm (RTPFSGA. In FDAFSA, adjacent triplet-pairs (hexamer sequences were selected based on the difference in the frequency of hexamers between promoters and non-promoters. In RTPFSGA, random triplet-pairs (RTPs were selected by exploiting a genetic algorithm that distinguishes frequencies of non-adjacent triplet pairs between promoters and non-promoters. Then, a support vector machine (SVM, a nonlinear machine-learning algorithm, was used to classify promoters and non-promoters by combining these two feature selection approaches. We referred to this novel algorithm as PromoBot. Results Promoter sequences were collected from the PlantProm database. Non-promoter sequences were collected from plant mRNA, rRNA, and tRNA of PlantGDB and plant miRNA of miRBase. Then, in order to validate the proposed algorithm, we applied a 5-fold cross validation test. Training data sets were used to select features based on FDAFSA and RTPFSGA, and these features were used to train the SVM. We achieved 89% sensitivity and 86% specificity. Conclusions We compared our PromoBot algorithm to five other algorithms. It was found that the sensitivity and specificity of PromoBot performed well (or even better with the algorithms tested. These results show that the two proposed feature selection methods based on hexamer frequencies

  15. Base pairing and structural insights into the 5-formylcytosine in RNA duplex (United States)

    Wang, Rui; Luo, Zhipu; He, Kaizhang; Delaney, Michael O.; Chen, Doris; Sheng, Jia


    Abstract 5-Formylcytidine (f5C), a previously discovered natural nucleotide in the mitochondrial tRNA of many species including human, has been recently detected as the oxidative product of 5-methylcytidine (m5C) through 5-hydroxymethylcytidine (hm5C) in total RNA of mammalian cells. The discovery indicated that these cytosine derivatives in RNA might also play important epigenetic roles similar as in DNA, which has been intensively investigated in the past few years. In this paper, we studied the base pairing specificity of f5C in different RNA duplex contexts. We found that the 5-formyl group could increase duplex thermal stability and enhance base pairing specificity. We present three high-resolution crystal structures of an octamer RNA duplex [5′-GUA(f5C)GUAC-3′]2 that have been solved under three crystallization conditions with different buffers and pH values. Our results showed that the 5-formyl group is located in the same plane as the cytosine base and forms an intra-residue hydrogen bond with the amino group in the N4 position. In addition, this modification increases the base stacking between the f5C and the neighboring bases while not causing significant global and local structure perturbations. This work provides insights into the effects of 5-formylcytosine on RNA duplex. PMID:27079978

  16. A GC-MS Based Metabonomics Study of Rheumatoid Arthritis and the Interventional Effects of the Simiaowan in Rats. (United States)

    Wang, Yuming; Guo, Xuejun; Xie, Jiabin; Hou, Zhiguo; Li, Yubo


    Simiaowan (SMW) is a famous Chinese prescription widely used in clinical treatment of rheumatoid arthritis (RA). The aim of the present study is to determine novel biomarkers to increase the current understanding of RA mechanisms, as well as the underlying therapeutic mechanism of SMW, in RA-model rats. Plasma extracts from control, RA model, and SMW-treated rats were analyzed by gas chromatography coupled with mass spectrometry (GC-MS). An orthogonal partial least-square discriminant analysis (OPLS-DA) model was created to detect metabolites that were expressed in significantly different amounts between the RA model and the control rats and investigate the therapeutic effect of SMW. Metabonomics may prove to be a valuable tool for determining the efficacy of complex traditional prescriptions.

  17. A GC-MS Based Metabonomics Study of Rheumatoid Arthritis and the Interventional Effects of the Simiaowan in Rats

    Directory of Open Access Journals (Sweden)

    Yuming Wang


    Full Text Available Simiaowan (SMW is a famous Chinese prescription widely used in clinical treatment of rheumatoid arthritis (RA. The aim of the present study is to determine novel biomarkers to increase the current understanding of RA mechanisms, as well as the underlying therapeutic mechanism of SMW, in RA-model rats. Plasma extracts from control, RA model, and SMW-treated rats were analyzed by gas chromatography coupled with mass spectrometry (GC-MS. An orthogonal partial least-square discriminant analysis (OPLS-DA model was created to detect metabolites that were expressed in significantly different amounts between the RA model and the control rats and investigate the therapeutic effect of SMW. Metabonomics may prove to be a valuable tool for determining the efficacy of complex traditional prescriptions.

  18. An approach to determination of phenolic compounds in seawater using SPME-GC-MS based on SWCNTs coating (United States)

    Zhu, Jia; Wang, Ying; Zeng, Lin


    Phenolic compounds have become one kind of the important pollutants of the marine environment. Single-walled Carbon nanotubes, as one-dimensional nano materials, have light weight and perfect hexagonal structure of connections, with many unusual mechanical, chemical and electrical properties. In recent years, with the research of carbon nanotubes and other nano materials, the application prospect is also constantly discussed. In this paper, homemade single-walled carbon nanotubes (SWCNTs) coating was used for establishing an analytical approach to the determination of five kinds of phenolic compounds in seawater using SPME-GC-MS. Optimal conditions: After saturation was conducted with NaCl, and pH was adjusted to 2.0 with H2SO4, the extract was immersed in a water bath at 40°C for GC-MS determination through 40-min agitating extraction at 500 rmin-1 and 3-min desorption at 280°C. The liniearities ranged between 0.01-100 μg L-1, and the determination limits ranged between 1.5-10 ng L-1. The relative standard deviation (RSD, n = 5) was less than 6.5%. For the phenolic compounds obtained from the spiked recovery test for actual seawater samples, the rates of recovery were 87.5%-101.7%, and the RSDs were less than 8.8%, which met the requirements of determination. Due to its simplicity, high efficiency and low consumption, this approach is suitable for the analysis of trace amounts of phenolic compounds in marine waters.

  19. Improving Student Understanding of Qualitative and Quantitative Analysis via GC/MS Using a Rapid SPME-Based Method for Determination of Trihalomethanes in Drinking Water (United States)

    Huang, Shu Rong; Palmer, Peter T.


    This paper describes a method for determination of trihalomethanes (THMs) in drinking water via solid-phase microextraction (SPME) GC/MS as a means to develop and improve student understanding of the use of GC/MS for qualitative and quantitative analysis. In the classroom, students are introduced to SPME, GC/MS instrumentation, and the use of MS…

  20. The analysis of photon pair source at telecom wavelength based on the BBO crystal (Conference Presentation) (United States)

    Gajewski, Andrzej; Kolenderski, Piotr L.


    There are several problems that must be solved in order to increase the distance of quantum communication protocols based on photons as an information carriers. One of them is the dispersion, whose effects can be minimized by engineering spectral properties of transmitted photons. In particular, it is expected that positively correlated photon pairs can be very useful. We present the full characterization of a source of single photon pairs at a telecom wavelength based on type II spontaneous parametric down conversion (SPDC) process in a beta-barium borate (BBO) crystal. In the type II process, a pump photon, which is polarized extraordinarily, splits in a nonlinear medium into signal and idler photons, which are polarized perpendicularly to each other. In order for the process to be efficient a phase matching condition must be fulfilled. These conditions originate from momentum and energy conservation rules and put severe restrictions on source parameters. Seemingly, these conditions force the photon pair to be negatively correlated in their spectral domain. However, it is possible to achieve positive correlation for pulsed pumping. The experimentally available degrees of freedom of a source are the width of the pumping beam, the collected modes' widths, the length of the nonlinear crystal and the duration of the pumping pulse. In our numerical model we use the following figures of merit: the pair production rate, the efficiency of photon coupling into a single mode fiber, the spectral correlation of the coupled photon pair. The last one is defined as the Pearson correlation parameter for a joint spectral distribution. The aim here is to find the largest positive spectral correlation and the highest coupling efficiency. By resorting to the numerical model Ref. [1] we showed in Ref. [2], that by careful adjustment of the pump's and the collected modes' characteristics, one can optimize any of the source's parameters. Our numerical outcomes conform to the

  1. Detection of protonated non-Watson-Crick base pairs using electrospray ionization mass spectrometry. (United States)

    Ishida, Riyoko; Iwahashi, Hideo


    Many studies have shown that protonated nucleic acid base pairs are involved in a wide variety of nucleic acid structures. However, little information is available on relative stability of hemiprotonated self- and non-self-dimers at monomer level. We used electrospray ionization mass spectrometry (ESI-MS) to evaluate the relative stability under various concentrations of hydrogen ion. These enable conjecture of the formation of protonated non-Watson-Crick base pairs based on DNA and RNA base sequence. In the present study, we observed that ESI-MS peaks corresponded to respective self-dimers for all examined nucleosides except for adenosine. Peak heights depended on the concentration of hydrogen ion. The ESI-MS peak heights of the hemiprotonated cytidine dimers and the hemiprotonated thymidine dimer sharply increased with increased concentration of hydrogen ion, suggesting direct participation of hydrogen ion in dimer formations. In ESI-MS measurements of the solutions containing adenosine, cytidine, thymidine and guanosine, we observed protonated cytidine-guanosine dimer (CH+-G) and protonated cytidine-thymidine dimer (CH+-T) in addition to hemiprotonated cytidine-cytidine dimer (CH+-C) with following relative peak height, (CH+-C) > (CH+-G) ≈ (CH+-T) > (CH+-A). Additionally, in the ESI-MS measurements of solutions containing adenosine, thymidine and guanosine, we observed a considerable amount of protonated adenosine-guanosine (AH+-G) and protonated adenosine-thymidine (AH+-T).

  2. Efficient and Provable Secure Pairing-Free Security-Mediated Identity-Based Identification Schemes

    Directory of Open Access Journals (Sweden)

    Ji-Jian Chin


    Full Text Available Security-mediated cryptography was first introduced by Boneh et al. in 2001. The main motivation behind security-mediated cryptography was the capability to allow instant revocation of a user’s secret key by necessitating the cooperation of a security mediator in any given transaction. Subsequently in 2003, Boneh et al. showed how to convert a RSA-based security-mediated encryption scheme from a traditional public key setting to an identity-based one, where certificates would no longer be required. Following these two pioneering papers, other cryptographic primitives that utilize a security-mediated approach began to surface. However, the security-mediated identity-based identification scheme (SM-IBI was not introduced until Chin et al. in 2013 with a scheme built on bilinear pairings. In this paper, we improve on the efficiency results for SM-IBI schemes by proposing two schemes that are pairing-free and are based on well-studied complexity assumptions: the RSA and discrete logarithm assumptions.

  3. Efficient and provable secure pairing-free security-mediated identity-based identification schemes. (United States)

    Chin, Ji-Jian; Tan, Syh-Yuan; Heng, Swee-Huay; Phan, Raphael C-W


    Security-mediated cryptography was first introduced by Boneh et al. in 2001. The main motivation behind security-mediated cryptography was the capability to allow instant revocation of a user's secret key by necessitating the cooperation of a security mediator in any given transaction. Subsequently in 2003, Boneh et al. showed how to convert a RSA-based security-mediated encryption scheme from a traditional public key setting to an identity-based one, where certificates would no longer be required. Following these two pioneering papers, other cryptographic primitives that utilize a security-mediated approach began to surface. However, the security-mediated identity-based identification scheme (SM-IBI) was not introduced until Chin et al. in 2013 with a scheme built on bilinear pairings. In this paper, we improve on the efficiency results for SM-IBI schemes by proposing two schemes that are pairing-free and are based on well-studied complexity assumptions: the RSA and discrete logarithm assumptions.

  4. Uncertainty evaluation for three-dimensional scanning electron microscope reconstructions based on the stereo-pair technique

    DEFF Research Database (Denmark)

    Carli, Lorenzo; Genta, G; Cantatore, Angela


    3D-SEM is a method, based on the stereophotogrammetry technique, which obtains three-dimensional topographic reconstructions starting typically from two SEM images, called the stereo-pair. In this work, a theoretical uncertainty evaluation of the stereo-pair technique, according to GUM (Guide to ...

  5. Positive cooperativity of the specific binding between Hg2+ ion and T:T mismatched base pairs in duplex DNA

    International Nuclear Information System (INIS)

    Torigoe, Hidetaka; Miyakawa, Yukako; Ono, Akira; Kozasa, Tetsuo


    Highlights: ► Hg 2+ specifically bound with the T:T mismatched base pair at 1:1 molar ratio. ► The binding constant between Hg 2+ and the T:T mismatched base pair was 10 6 M −1 . ► The binding constant was larger than those for nonspecific metal–DNA interactions. ► The binding constant for the second Hg 2+ was larger than that for the first Hg 2+ . ► The positive cooperative binding was observed between Hg 2+ and multiple T:T. - Abstract: Metal-mediated base pairs by the interaction between metal ions and artificial bases in oligonucleotides have been developed for their potential applications in nanotechnology. We recently found that a natural T:T mismatched base pair bound with Hg 2+ ion to form a novel T–Hg–T base pair. Here, we examined the thermodynamic properties of the binding between Hg 2+ and each of the single and double T:T mismatched base pair duplex DNAs by isothermal titration calorimetry. Hg 2+ specifically bound with the T:T mismatched base pair at 1:1 molar ratio with 10 6 M −1 binding constant, which was significantly larger than those for nonspecific metal ion–DNA interactions. In the Hg 2+ –double T:T mismatched base pair interaction, the affinity for the second Hg 2+ binding was significantly larger than that for the first Hg 2+ binding. The positively cooperative binding may be favorable to align multiple Hg 2+ in duplex DNA for the application of the metal-mediated base pairs in nanotechnology.

  6. Gas chromatography time-of-flight mass spectrometry (GC-TOF-MS)-based metabolomics for comparison of caffeinated and decaffeinated coffee and its implications for Alzheimer's disease. (United States)

    Chang, Kai Lun; Ho, Paul C


    Findings from epidemiology, preclinical and clinical studies indicate that consumption of coffee could have beneficial effects against dementia and Alzheimer's disease (AD). The benefits appear to come from caffeinated coffee, but not decaffeinated coffee or pure caffeine itself. Therefore, the objective of this study was to use metabolomics approach to delineate the discriminant metabolites between caffeinated and decaffeinated coffee, which could have contributed to the observed therapeutic benefits. Gas chromatography time-of-flight mass spectrometry (GC-TOF-MS)-based metabolomics approach was employed to characterize the metabolic differences between caffeinated and decaffeinated coffee. Orthogonal partial least squares discriminant analysis (OPLS-DA) showed distinct separation between the two types of coffee (cumulative Q(2) = 0.998). A total of 69 discriminant metabolites were identified based on the OPLS-DA model, with 37 and 32 metabolites detected to be higher in caffeinated and decaffeinated coffee, respectively. These metabolites include several benzoate and cinnamate-derived phenolic compounds, organic acids, sugar, fatty acids, and amino acids. Our study successfully established GC-TOF-MS based metabolomics approach as a highly robust tool in discriminant analysis between caffeinated and decaffeinated coffee samples. Discriminant metabolites identified in this study are biologically relevant and provide valuable insights into therapeutic research of coffee against AD. Our data also hint at possible involvement of gut microbial metabolism to enhance therapeutic potential of coffee components, which represents an interesting area for future research.

  7. Conformational analysis of a covalently cross-linked Watson-Crick base pair model. (United States)

    Jensen, Erik A; Allen, Benjamin D; Kishi, Yoshito; O'Leary, Daniel J


    Low-temperature NMR experiments and molecular modeling have been used to characterize the conformational behavior of a covalently cross-linked DNA base pair model. The data suggest that Watson-Crick or reverse Watson-Crick hydrogen bonding geometries have similar energies and can interconvert at low temperatures. This low-temperature process involves rotation about the crosslink CH(2)C(5') (psi) carbon-carbon bond, which is energetically preferred over the alternate CH(2)N(3) (phi) carbon-nitrogen bond rotation.

  8. Conformational Analysis of a Covalently Cross-Linked Watson-Crick Base Pair Model


    Jensen, Erik A.; Allen, Benjamin D.; Kishi, Yoshito; O'Leary, Daniel J.


    Low temperature NMR experiments and molecular modeling have been used to characterize the conformational behavior of a covalently cross-linked DNA base pair model. The data suggest that Watson-Crick or reverse Watson-Crick hydrogen bonding geometries have similar energies and can interconvert at low temperatures. This low-temperature process involves rotation about the crosslink CH2–C(5′) (ψ) carbon-carbon bond, which is energetically preferred over the alternate CH2–N(3) (ϕ) carbon-nitrogen ...

  9. Enol tautomers of Watson-Crick base pair models are metastable because of nuclear quantum effects. (United States)

    Pérez, Alejandro; Tuckerman, Mark E; Hjalmarson, Harold P; von Lilienfeld, O Anatole


    Intermolecular enol tautomers of Watson-Crick base pairs could emerge spontaneously via interbase double proton transfer. It has been hypothesized that their formation could be facilitated by thermal fluctuations and proton tunneling, and possibly be relevant to DNA damage. Theoretical and computational studies, assuming classical nuclei, have confirmed the dynamic stability of these rare tautomers. However, by accounting for nuclear quantum effects explicitly through Car-Parrinello path integral molecular dynamics calculations, we find the tautomeric enol form to be dynamically metastable, with lifetimes too insignificant to be implicated in DNA damage.

  10. Superior coexistence: systematicALLY regulatING land subsidence BASED on set pair theory

    Directory of Open Access Journals (Sweden)

    Y. Chen


    Full Text Available Anthropogenic land subsidence is an environmental side effect of exploring and using natural resources in the process of economic development. The key points of the system for controlling land subsidence include cooperation and superior coexistence while the economy develops, exploring and using natural resources, and geological environmental safety. Using the theory and method of set pair analysis (SPA, this article anatomises the factors, effects, and transformation of land subsidence. Based on the principle of superior coexistence, this paper promotes a technical approach to the system for controlling land subsidence, in order to improve the prevention and control of geological hazards.

  11. Base-pairing preferences, physicochemical properties and mutational behaviour of the DNA lesion 8-nitroguanine †


    Bhamra, Inder; Compagnone-Post, Patricia; O’Neil, Ian A.; Iwanejko, Lesley A.; Bates, Andrew D.; Cosstick, Richard


    8-Nitro-2′-deoxyguanosine (8-nitrodG) is a relatively unstable, mutagenic lesion of DNA that is increasingly believed to be associated with tissue inflammation. Due to the lability of the glycosidic bond, 8-nitrodG cannot be incorporated into oligodeoxynucleotides (ODNs) by chemical DNA synthesis and thus very little is known about its physicochemical properties and base-pairing preferences. Here we describe the synthesis of 8-nitro-2′-O-methylguanosine, a ribonucleoside analogue of this lesi...

  12. Complexes of DNA bases and Watson-Crick base pairs with small neutral gold clusters. (United States)

    Kryachko, E S; Remacle, F


    The nature of the DNA-gold interaction determines and differentiates the affinity of the nucleobases (adenine, thymine, guanine, and cytosine) to gold. Our preliminary computational study [Kryachko, E. S.; Remacle, F. Nano Lett. 2005, 5, 735] demonstrates that two major bonding factors govern this interaction: the anchoring, either of the Au-N or Au-O type, and the nonconventional N-H...Au hydrogen bonding. In this paper, we offer insight into the nature of nucleobase-gold interactions and provide a detailed characterization of their different facets, i.e., geometrical, energetic, and spectroscopic aspects; the gold cluster size and gold coordination effects; proton affinity; and deprotonation energy. We then investigate how the Watson-Crick DNA pairing patterns are modulated by the nucleobase-gold interaction. We do so in terms of the proton affinities and deprotonation energies of those proton acceptors and proton donors which are involved in the interbase hydrogen bondings. A variety of properties of the most stable Watson-Crick [A x T]-Au3 and [G x C]-Au3 hybridized complexes are described and compared with the isolated Watson-Crick A x T and G x C ones. It is shown that enlarging the gold cluster size to Au6 results in a rather short gold-gold bond in the Watson-Crick interbase region of the [G x C]-Au6 complex that bridges the G x C pair and thus leads to a significant strengthening of G x C pairing.

  13. Easy design of colorimetric logic gates based on nonnatural base pairing and controlled assembly of gold nanoparticles. (United States)

    Zhang, Li; Wang, Zhong-Xia; Liang, Ru-Ping; Qiu, Jian-Ding


    Utilizing the principles of metal-ion-mediated base pairs (C-Ag-C and T-Hg-T), the pH-sensitive conformational transition of C-rich DNA strand, and the ligand-exchange process triggered by DL-dithiothreitol (DTT), a system of colorimetric logic gates (YES, AND, INHIBIT, and XOR) can be rationally constructed based on the aggregation of the DNA-modified Au NPs. The proposed logic operation system is simple, which consists of only T-/C-rich DNA-modified Au NPs, and it is unnecessary to exquisitely design and alter the DNA sequence for different multiple molecular logic operations. The nonnatural base pairing combined with unique optical properties of Au NPs promises great potential in multiplexed ion sensing, molecular-scale computers, and other computational logic devices.

  14. Capturing alternative secondary structures of RNA by decomposition of base-pairing probabilities. (United States)

    Hagio, Taichi; Sakuraba, Shun; Iwakiri, Junichi; Mori, Ryota; Asai, Kiyoshi


    It is known that functional RNAs often switch their functions by forming different secondary structures. Popular tools for RNA secondary structures prediction, however, predict the single 'best' structures, and do not produce alternative structures. There are bioinformatics tools to predict suboptimal structures, but it is difficult to detect which alternative secondary structures are essential. We proposed a new computational method to detect essential alternative secondary structures from RNA sequences by decomposing the base-pairing probability matrix. The decomposition is calculated by a newly implemented software tool, RintW, which efficiently computes the base-pairing probability distributions over the Hamming distance from arbitrary reference secondary structures. The proposed approach has been demonstrated on ROSE element RNA thermometer sequence and Lysine RNA ribo-switch, showing that the proposed approach captures conformational changes in secondary structures. We have shown that alternative secondary structures are captured by decomposing base-paring probabilities over Hamming distance. Source code is available from .

  15. Link-based quantitative methods to identify differentially coexpressed genes and gene Pairs

    Directory of Open Access Journals (Sweden)

    Ye Zhi-Qiang


    Full Text Available Abstract Background Differential coexpression analysis (DCEA is increasingly used for investigating the global transcriptional mechanisms underlying phenotypic changes. Current DCEA methods mostly adopt a gene connectivity-based strategy to estimate differential coexpression, which is characterized by comparing the numbers of gene neighbors in different coexpression networks. Although it simplifies the calculation, this strategy mixes up the identities of different coexpression neighbors of a gene, and fails to differentiate significant differential coexpression changes from those trivial ones. Especially, the correlation-reversal is easily missed although it probably indicates remarkable biological significance. Results We developed two link-based quantitative methods, DCp and DCe, to identify differentially coexpressed genes and gene pairs (links. Bearing the uniqueness of exploiting the quantitative coexpression change of each gene pair in the coexpression networks, both methods proved to be superior to currently popular methods in simulation studies. Re-mining of a publicly available type 2 diabetes (T2D expression dataset from the perspective of differential coexpression analysis led to additional discoveries than those from differential expression analysis. Conclusions This work pointed out the critical weakness of current popular DCEA methods, and proposed two link-based DCEA algorithms that will make contribution to the development of DCEA and help extend it to a broader spectrum.

  16. NMR and molecular modeling evidence for a G·A mismatch base pair in a purine-rich DNA duplex

    International Nuclear Information System (INIS)

    Li, Ying; Wilson, W.D.; Zon, G.


    1 H NMR experiments indicate that the oligomer 5'-d(ATGAGCGAATA) forms an unusual 10-base-pair duplex with 4 G·A base pairs and a 3' unpaired adenosine. NMR results indicate that guanoxine imino protons of the F·A mismatches are not hydrogen bonded but are stacked in the helix. A G→ I substitution in either G·A base pair causes a dramatic decrtease in duplex stability and indicates that hydrogen bonding of the guanosine amino group is critical. Nuclear Overhauser effect spectroscopy (NOESY) and two-dimensional correlated spectroscopy (COSY) results indicate that the overall duplex conformation is in the B-family. Cross-strand NOEs in two-dimensional NOESY spectra between a mismatched AH2 and an AH1' of the other mismatched base pair and between a mismatched GH8 and GNH1 of the other mismatch establish a purine-purine stacking pattern, adenosine over adenosine and guanosine over guanosine, which strongly stabilizes the duplex. A computer graphics molecular model of the ususual duplex was constructed with G·A base pairs containing A-NH 2 to GN3 and G-NH 2 to AN7 hydrogen bonds and B-form base pairs on both sides of the G·A pairs [5'-d(ATGAGC)]. The energy-minimized duplex satisfies all experimental constraints from NOESY and COSY results. A hydrogen bond from G-NH 2 of the mismatch to a phosphate oxygen is predicted

  17. Matched molecular pair-based data sets for computer-aided medicinal chemistry (United States)

    Bajorath, Jürgen


    Matched molecular pairs (MMPs) are widely used in medicinal chemistry to study changes in compound properties including biological activity, which are associated with well-defined structural modifications. Herein we describe up-to-date versions of three MMP-based data sets that have originated from in-house research projects. These data sets include activity cliffs, structure-activity relationship (SAR) transfer series, and second generation MMPs based upon retrosynthetic rules. The data sets have in common that they have been derived from compounds included in the ChEMBL database (release 17) for which high-confidence activity data are available. Thus, the activity data associated with MMP-based activity cliffs, SAR transfer series, and retrosynthetic MMPs cover the entire spectrum of current pharmaceutical targets. Our data sets are made freely available to the scientific community. PMID:24627802

  18. Amino acid differences in glycoproteins B (gB, C (gC, H (gH and L(gL are associated with enhanced herpes simplex virus type-1 (McKrae entry via the paired immunoglobulin-like type-2 receptor α

    Directory of Open Access Journals (Sweden)

    Chowdhury Sona


    Full Text Available Abstract Background Herpes simplex virus type-1 (HSV-1 enters into cells via membrane fusion of the viral envelope with plasma or endosomal membranes mediated by viral glycoproteins. HSV-1 virions attach to cell surfaces by binding of viral glycoproteins gC, gD and gB to specific cellular receptors. Here we show that the human ocular and highly neurovirulent HSV-1 strain McKrae enters substantially more efficiently into cells via the gB-specific human paired immunoglobulin-like type-2 receptor-α (hPILR-α. Comparison of the predicted amino acid sequences between HSV-1(F and McKrae strains indicates that amino acid changes within gB, gC, gH and gL may cause increased entry via the hPILR- α receptor. Results HSV-1 (McKrae entered substantially more efficiently than viral strain F in Chinese hamster ovary (CHO cells expressing hPIRL-α but not within CHO-human nectin-1, -(CHO-hNectin-1, CHO-human HVEM (CHO-hHVEM or Vero cells. The McKrae genes encoding viral glycoproteins gB, gC, gD, gH, gL, gK and the membrane protein UL20 were sequenced and their predicted amino acid (aa sequences were compared with virulent strains F, H129, and the attenuated laboratory strain KOS. Most aa differences between McKrae and F were located at their gB amino termini known to bind with the PILRα receptor. These aa changes included a C10R change, also seen in the neurovirulent strain ANG, as well as redistribution and increase of proline residues. Comparison of gC aa sequences revealed multiple aa changes including an L132P change within the 129-247 aa region known to bind to heparan sulfate (HS receptors. Two aa changes were located within the H1 domain of gH that binds gL. Multiple aa changes were located within the McKrae gL sequence, which were preserved in the H129 isolate, but differed for the F strain. Viral glycoproteins gD and gK and the membrane protein UL20 were conserved between McKrae and F strains. Conclusions The results indicate that the observed

  19. A QM/MM refinement of an experimental DNA structure with metal-mediated base pairs. (United States)

    Kumbhar, Sadhana; Johannsen, Silke; Sigel, Roland K O; Waller, Mark P; Müller, Jens


    A series of hybrid quantum mechanical/molecular mechanical (QM/MM) calculations was performed on models of a DNA duplex with artificial silver(I)-mediated imidazole base pairs. The optimized structures were compared to the original experimental NMR structure (Nat. Chem. 2 (2010) 229-234). The metal⋯metal distances are significantly shorter (~0.5Å) in the QM/MM model than in the original NMR structure. As a result, argentophilic interactions are feasible between the silver(I) ions of neighboring metal-mediated base pairs. Using the computationally determined metal⋯metal distances, a re-refined NMR solution structure of the DNA duplex was obtained. In this new NMR structure, all experimental constraints remain fulfilled. The new NMR structure shows less deviation from the regular B-type conformation than the original one. This investigation shows that the application of QM/MM models to generate additional constraints to be used during NMR structural refinements represents an elegant approach to obtaining high-resolution NMR structures. Copyright © 2013 Elsevier Inc. All rights reserved.

  20. [Biological and neural bases of partner preferences in rodents: models to understand human pair bonds]. (United States)

    Coria-Avila, G A; Hernández-Aguilar, M E; Toledo-Cárdenas, R; García-Hernández, L I; Manzo, J; Pacheco, P; Miquel, M; Pfaus, J G

    To analyse the biological and neural bases of partner preference formation in rodents as models to understand human pair bonding. Rodents are social individuals, capable of forming short- or long-lasting partner preferences that develop slowly by stimuli like cohabitation, or rapidly by stimuli like sex and stress. Dopamine, corticosteroids, oxytocin, vasopressin, and opioids form the neurochemical substrate for pair bonding in areas like the nucleus accumbens, the prefrontal cortex, the piriform cortex, the medial preoptic area, the ventral tegmental area and the medial amygdala, among others. Additional areas may participate depending on the nature of the conditioned stimuli by which and individual recognizes a preferred partner. Animal models help us understand that the capacity of an individual to display long-lasting and selective preferences depends on neural bases, selected throughout evolution. The challenge in neuroscience is to use this knowledge to create new solutions for mental problems associated with the incapacity of an individual to display a social bond, keep one, or cope with the disruption of a consolidated one.

  1. Dye-sensitized solar cell with a pair of carbon-based electrodes

    International Nuclear Information System (INIS)

    Kyaw, Aung Ko Ko; Demir, Hilmi Volkan; Sun Xiaowei; Tantang, Hosea; Zhang Qichun; Wu Tao; Ke, Lin; Wei Jun


    We have fabricated a dye-sensitized solar cell (DSSC) with a pair of carbon-based electrodes using a transparent, conductive carbon nanotubes (CNTs) film modified with ultra-thin titanium-sub-oxide (TiO x ) as the working electrode and a bilayer of conductive CNTs and carbon black as the counter electrode. Without TiO x modification, the DSSC is almost nonfunctional whereas the power conversion efficiency (PCE) increases significantly when the working electrode is modified with TiO x . The performance of the cell could be further improved when the carbon black film was added on the counter electrode. The improved efficiency can be attributed to the inhibition of the mass recombination at the working electrode/electrolyte interface by TiO x and the acceleration of the electron transfer kinetics at the counter electrode by carbon black. The DSSC with a pair of carbon-based electrodes gives the PCE of 1.37%. (paper)

  2. DNA base dimers are stabilized by hydrogen-bonding interactions including non-Watson-Crick pairing near graphite surfaces. (United States)

    Shankar, Akshaya; Jagota, Anand; Mittal, Jeetain


    Single- and double-stranded DNA are increasingly being paired with surfaces and nanoparticles for numerous applications, such as sensing, imaging, and drug delivery. Unlike the majority of DNA structures in bulk that are stabilized by canonical Watson-Crick pairing between Ade-Thy and Gua-Cyt, those adsorbed on surfaces are often stabilized by noncanonical base pairing, quartet formation, and base-surface stacking. Not much is known about these kinds of interactions. To build an understanding of the role of non-Watson-Crick pairing on DNA behavior near surfaces, one requires basic information on DNA base pair stacking and hydrogen-bonding interactions. All-atom molecular simulations of DNA bases in two cases--in bulk water and strongly adsorbed on a graphite surface--are conducted to study the relative strengths of stacking and hydrogen bond interactions for each of the 10 possible combinations of base pairs. The key information obtained from these simulations is the free energy as a function of distance between two bases in a pair. We find that stacking interactions exert the dominant influence on the stability of DNA base pairs in bulk water as expected. The strength of stability for these stacking interactions is found to decrease in the order Gua-Gua > Ade-Gua > Ade-Ade > Gua-Thy > Gua-Cyt > Ade-Thy > Ade-Cyt > Thy-Thy > Cyt-Thy > Cyt-Cyt. On the other hand, mutual interactions of surface-adsorbed base pairs are stabilized mostly by hydrogen-bonding interactions in the order Gua-Cyt > Ade-Gua > Ade-Thy > Ade-Ade > Cyt-Thy > Gua-Gua > Cyt-Cyt > Ade-Cyt > Thy-Thy > Gua-Thy. Interestingly, several non-Watson-Crick base pairings, which are commonly ignored, have similar stabilization free energies due to interbase hydrogen bonding as Watson-Crick pairs. This clearly highlights the importance of non-Watson-Crick base pairing in the development of secondary structures of oligonucleotides near surfaces.

  3. Classification of pseudo pairs between nucleotide bases and amino acids by analysis of nucleotide-protein complexes. (United States)

    Kondo, Jiro; Westhof, Eric


    Nucleotide bases are recognized by amino acid residues in a variety of DNA/RNA binding and nucleotide binding proteins. In this study, a total of 446 crystal structures of nucleotide-protein complexes are analyzed manually and pseudo pairs together with single and bifurcated hydrogen bonds observed between bases and amino acids are classified and annotated. Only 5 of the 20 usual amino acid residues, Asn, Gln, Asp, Glu and Arg, are able to orient in a coplanar fashion in order to form pseudo pairs with nucleotide bases through two hydrogen bonds. The peptide backbone can also form pseudo pairs with nucleotide bases and presents a strong bias for binding to the adenine base. The Watson-Crick side of the nucleotide bases is the major interaction edge participating in such pseudo pairs. Pseudo pairs between the Watson-Crick edge of guanine and Asp are frequently observed. The Hoogsteen edge of the purine bases is a good discriminatory element in recognition of nucleotide bases by protein side chains through the pseudo pairing: the Hoogsteen edge of adenine is recognized by various amino acids while the Hoogsteen edge of guanine is only recognized by Arg. The sugar edge is rarely recognized by either the side-chain or peptide backbone of amino acid residues.

  4. Classification of pseudo pairs between nucleotide bases and amino acids by analysis of nucleotide–protein complexes (United States)

    Kondo, Jiro; Westhof, Eric


    Nucleotide bases are recognized by amino acid residues in a variety of DNA/RNA binding and nucleotide binding proteins. In this study, a total of 446 crystal structures of nucleotide–protein complexes are analyzed manually and pseudo pairs together with single and bifurcated hydrogen bonds observed between bases and amino acids are classified and annotated. Only 5 of the 20 usual amino acid residues, Asn, Gln, Asp, Glu and Arg, are able to orient in a coplanar fashion in order to form pseudo pairs with nucleotide bases through two hydrogen bonds. The peptide backbone can also form pseudo pairs with nucleotide bases and presents a strong bias for binding to the adenine base. The Watson–Crick side of the nucleotide bases is the major interaction edge participating in such pseudo pairs. Pseudo pairs between the Watson–Crick edge of guanine and Asp are frequently observed. The Hoogsteen edge of the purine bases is a good discriminatory element in recognition of nucleotide bases by protein side chains through the pseudo pairing: the Hoogsteen edge of adenine is recognized by various amino acids while the Hoogsteen edge of guanine is only recognized by Arg. The sugar edge is rarely recognized by either the side-chain or peptide backbone of amino acid residues. PMID:21737431

  5. Nucleic Acid Base Analog FRET-Pair Facilitating Detailed Structural Measurements in Nucleic Acid Containing Systems

    DEFF Research Database (Denmark)

    Börjesson, Karl; Preus, Søren; El-Sagheer, Afaf


    We present the first nucleobase analog fluorescence resonance energy transfer (FRET)-pair. The pair consists of tCO, 1,3-diaza-2-oxophenoxazine, as an energy donor and the newly developed tC(nitro), 7-nitro-1,3-diaza-2-oxophenothiazine, as an energy acceptor. The FRET-pair successfully monitors d...

  6. A label-free photoelectrochemical biosensor for urokinase-type plasminogen activator detection based on a g-C3N4/CdS nanocomposite. (United States)

    Liu, Xing-Pei; Chen, Jing-Shuai; Mao, Chang-Jie; Niu, He-Lin; Song, Ji-Ming; Jin, Bao-Kang


    Herein, we established a novel ultrasensitive photoelectrochemical biosensor for detecting urokinase-type plasminogen activator (u-PA), based on a g-C 3 N 4 /CdS nanocomposite. The prepared nanocomposite was characterized by transmission electron microscopy, X-ray photoelectron spectroscopy, ultraviolet-visible absorption spectroscopy, and Fourier transform infrared spectroscopy, thus indicating that the nanocomposite was prepared successfully. In the typical process, the prepared nanocomposite was deposited on the surface of a bare FTO electrode. After being air-dried, the g-C 3 N 4 /CdS nanocomposite modified electrode was successively incubated with antibody against urokinase-type plasminogen activator and the blocking agent BSA to produce a photoelectrochemical biosensor for u-PA. In the presence of target u-PA antigen, the photocurrent response of the prepared biosensor electrode decreased significantly. The proposed novel photoelectrochemical biosensor exhibited good sensitivity, specificity, and reproducibility for u-PA detection, and a low detection limit of 33 fg mL -1 , ranging from 1 μg mL -1 -0.1 pg mL -1 . The proposed strategy should provide a promising method for detection of other biomarkers. Copyright © 2018 Elsevier B.V. All rights reserved.

  7. A Novel MOS Nanowire Gas Sensor Device (S3 and GC-MS-Based Approach for the Characterization of Grated Parmigiano Reggiano Cheese

    Directory of Open Access Journals (Sweden)

    Veronica Sberveglieri


    Full Text Available To determine the originality of a typical Italian Parmigiano Reggiano cheese, it is crucial to define and characterize its quality, ripening period, and geographical origin. Different analytical techniques have been applied aimed at studying the organoleptic and characteristic volatile organic compounds (VOCs profile of this cheese. However, most of the classical methods are time consuming and costly. The aim of this work was to illustrate a new simple, portable, fast, reliable, non-destructive, and economic sensor device S3 based on an array of six metal oxide semiconductor nanowire gas sensors to assess and discriminate the quality ranking of grated Parmigiano Reggiano cheese samples and to identify the VOC biomarkers using a headspace SPME-GC-MS. The device could clearly differentiate cheese samples varying in quality and ripening time when the results were analyzed by multivariate statistical analysis involving principal component analysis (PCA. Similarly, the volatile constituents of Parmigiano Reggiano identified were consistent with the compounds intimated in the literature. The obtained results show the applicability of an S3 device combined with SPME-GC-MS and sensory evaluation for a fast and high-sensitivity analysis of VOCs in Parmigiano Reggiano cheese and for the quality control of this class of cheese.

  8. Effect of base-pair inhomogeneities on charge transport along the DNA molecule, mediated by twist and radial polarons

    International Nuclear Information System (INIS)

    Palmero, F; Archilla, J F R; Hennig, D; Romero, F R


    Some recent results for a three-dimensional, semi-classical, tight-binding model for DNA show that there are two types of polarons, namely radial and twist polarons, which can transport charge along the DNA molecule. However, the existence of two types of base pairs in real DNA makes it crucial to find out if charge transport also exists in DNA chains with different base pairs. In this paper, we address this problem in its simple case, a homogeneous chain except for a single different base pair, which we call a base-pair inhomogeneity, and its effect on charge transport. Radial polarons experience either reflection or trapping. However, twist polarons are good candidates for charge transport along real DNA. This transport is also very robust with respect to weak parametric and diagonal disorder

  9. A GC Instrument Simulator (United States)

    Armitage, D. Bruce


    This simulator was developed to help students beginning the study of gas chromatographic instruments to understand their operation. It is not meant to teach chromatographic theory. The instrument simulator is divided into 5 sections. One is for sample preparation. Another is used to manage carrier gases and choose a detector and column. The third sets the conditions for either isothermal or programmed temperature operation. A fourth section models manual injections, and the fifth is the autosampler. The operator has a choice among 6 columns of differing diameters and packing polarities and a choice of either isothermal or simple one-stage temperature programming. The simulator can be operated in either single-sample mode or as a 10-sample autosampler. The integrator has two modes of operation, a "dumb" mode in which only the retention time, area of the peak, and percentage area are listed and a "smart" mode that also lists the components' identities. The identities are obtained from a list of names and retention times created by the operator. Without this list only the percentages and areas are listed. The percentages are based on the areas obtained from the chromatogram and not on the actual percentages assigned during sample preparation. The data files for the compounds used in the simulator are ASCII files and can be edited easily to add more compounds than the 11 included with the simulator. A maximum of 10 components can be used in any one sample. Sample mixtures can be made on a percent-by-volume basis, but not by mass of sample per volume of solvent. A maximum of 30 compounds can be present in any one file, but the number of files is limited only by the operating system. (I suggest that not more than 20 compounds be used in any one file, as scrolling through large numbers of compounds is annoying to say the least.) File construction and layout are discussed in detail in the User's Manual. Chromatograms are generated by calculating a retention time based on

  10. GC-MS based Gestational Diabetes Mellitus longitudinal study: Identification of 2-and 3-hydroxybutyrate as potential prognostic biomarkers. (United States)

    Dudzik, Danuta; Zorawski, Marcin; Skotnicki, Mariusz; Zarzycki, Wieslaw; García, Antonia; Angulo, Santiago; Lorenzo, M Paz; Barbas, Coral; Ramos, M Pilar


    Gestational Diabetes Mellitus (GDM) causes severe short- and long-term complications for the mother, fetus and neonate, including type 2-diabetes (T2DM) later in life. In this pilot study, GC-Q/MS analysis was applied for plasma metabolomics fingerprinting of 24 healthy and 24 women with GDM at different stages of gestation (second and third trimester) and postpartum (one and three months). Multivariate (unsupervised and supervised) statistical analysis was performed to investigate variance in the data, identify outliers and for unbiased assessment of data quality. Plasma fingerprints allowed for the discrimination of GDM pregnant women from controls both in the 2nd and 3rd trimesters of gestation. However, metabolic profiles tended to be similar after delivery. Follow up of these women revealed that 4 of them developed T2DM within 2 years postpartum. Multivariate PLS-DA models limited to women with GDM showed clear separation 3 months postpartum. In the 2nd trimester of gestation there was also a clear separation between GDM women that were normoglycemic after pregnancy and those with recognized postpartum T2DM. Metabolites that had the strongest discriminative power between these groups in the 2nd trimester of gestation were 2-hydroxybutyrate, 3-hydroxybutyrate, and stearic acid. We have described, that early GDM comprises metabotypes that are associated with the risk of future complications, including postpartum T2DM. In this pilot study, we provide evidence that 2-hydroxybutyrate and 3-hydroxybutyrate may be considered as future prognostic biomarkers to predict the onset of diabetic complications in women with gestational diabetes after delivery. Copyright © 2017 Elsevier B.V. All rights reserved.

  11. Design, realization and testing of an adsorption refrigerator based on activated carbon/ethanol working pair

    International Nuclear Information System (INIS)

    Frazzica, A.; Palomba, V.; Dawoud, B.; Gullì, G.; Brancato, V.; Sapienza, A.; Vasta, S.; Freni, A.; Costa, F.; Restuccia, G.


    Highlights: • Development of a lab-scale adsorption refrigerator. • Optimization of working pair and adsorber configuration through experimental activity. • Experimental testing of the prototype under real working boundary conditions. - Abstract: In the present paper design, realization and testing of a novel small scale adsorption refrigerator prototype based on activated carbon/ethanol working pair is described. Firstly, experimental activity has been carried out for identification of the best performing activated carbon available on the market, through the evaluation of the achievable thermodynamic performance both under air conditioning and refrigeration conditions. Once identified the best performing activated carbon, the design of the adsorber was developed by experimental dynamic performance analysis, carried out by means of the Gravimetric-Large Temperature Jump (G-LTJ) apparatus available at CNR ITAE lab. Finally, the whole 0.5 kW refrigerator prototype was designed and built. First experimental results both under reference air conditioning and refrigeration cycles have been reported, to check the achievable performance. High Specific Cooling Powers (SCPs), 95 W/kg and 50 W/kg, for air conditioning and refrigeration respectively, were obtained, while the COP ranged between 0.09 and 0.11, thus showing an improvement of the current state of the art.

  12. Analysis of intra-genomic GC content homogeneity within prokaryotes

    DEFF Research Database (Denmark)

    Bohlin, J; Snipen, L; Hardy, S.P.


    the GC content varies within microbial genomes to assess whether this property can be associated with certain biological functions related to the organism's environment and phylogeny. We utilize a new quantity GCVAR, the intra-genomic GC content variability with respect to the average GC content......Bacterial genomes possess varying GC content (total guanines (Gs) and cytosines (Cs) per total of the four bases within the genome) but within a given genome, GC content can vary locally along the chromosome, with some regions significantly more or less GC rich than on average. We have examined how...... both aerobic and facultative microbes. Although an association has previously been found between mean genomic GC content and oxygen requirement, our analysis suggests that no such association exits when phylogenetic bias is accounted for. A significant association between GCVAR and mean GC content...

  13. Fingerprint Identification Using SIFT-Based Minutia Descriptors and Improved All Descriptor-Pair Matching

    Directory of Open Access Journals (Sweden)

    Jiuqiang Han


    Full Text Available The performance of conventional minutiae-based fingerprint authentication algorithms degrades significantly when dealing with low quality fingerprints with lots of cuts or scratches. A similar degradation of the minutiae-based algorithms is observed when small overlapping areas appear because of the quite narrow width of the sensors. Based on the detection of minutiae, Scale Invariant Feature Transformation (SIFT descriptors are employed to fulfill verification tasks in the above difficult scenarios. However, the original SIFT algorithm is not suitable for fingerprint because of: (1 the similar patterns of parallel ridges; and (2 high computational resource consumption. To enhance the efficiency and effectiveness of the algorithm for fingerprint verification, we propose a SIFT-based Minutia Descriptor (SMD to improve the SIFT algorithm through image processing, descriptor extraction and matcher. A two-step fast matcher, named improved All Descriptor-Pair Matching (iADM, is also proposed to implement the 1:N verifications in real-time. Fingerprint Identification using SMD and iADM (FISiA achieved a significant improvement with respect to accuracy in representative databases compared with the conventional minutiae-based method. The speed of FISiA also can meet real-time requirements.

  14. Theoretical studies on the intermolecular interactions of potentially primordial base-pair analogues

    Czech Academy of Sciences Publication Activity Database

    Šponer, Judit E.; Vázquez-Mayagoitia, Á.; Sumpter, B.G.; Leszczynski, J.; Šponer, Jiří; Otyepka, M.; Banáš, P.; Fuentes-Cabrera, M.


    Roč. 16, č. 10 (2010), s. 3057-3065 ISSN 0947-6539 R&D Projects: GA MŠk(CZ) LC06030; GA AV ČR(CZ) 1QS500040581; GA AV ČR(CZ) IAA400040802; GA ČR(CZ) GA203/09/1476 Grant - others:GA MŠk(CZ) LC512; GA AV ČR(CZ) IAA400550701; GA ČR(CZ) GD203/09/H046 Program:LC; IA; GD Institutional research plan: CEZ:AV0Z50040507; CEZ:AV0Z50040702 Keywords : quantum chemistry * base pairing * origin of life Subject RIV: BO - Biophysics Impact factor: 5.476, year: 2010

  15. High-speed true random number generation based on paired memristors for security electronics (United States)

    Zhang, Teng; Yin, Minghui; Xu, Changmin; Lu, Xiayan; Sun, Xinhao; Yang, Yuchao; Huang, Ru


    True random number generator (TRNG) is a critical component in hardware security that is increasingly important in the era of mobile computing and internet of things. Here we demonstrate a TRNG using intrinsic variation of memristors as a natural source of entropy that is otherwise undesirable in most applications. The random bits were produced by cyclically switching a pair of tantalum oxide based memristors and comparing their resistance values in the off state, taking advantage of the more pronounced resistance variation compared with that in the on state. Using an alternating read scheme in the designed TRNG circuit, the unbiasedness of the random numbers was significantly improved, and the bitstream passed standard randomness tests. The Pt/TaO x /Ta memristors fabricated in this work have fast programming/erasing speeds of ˜30 ns, suggesting a high random number throughput. The approach proposed here thus holds great promise for physically-implemented random number generation.

  16. Atomic-scale Visualization of Electronic Nematicity and Cooper Pairing in Iron-based Superconductors (United States)

    Allan, Milan P.


    The mechanism of high-temperature superconductivity in the relatively novel iron-based high-Tc superconductors is unresolved, both in terms of how the phases evolve with doping, and in terms of the actual Cooper pairing process. To explore these issues, we used spectroscopic-imaging scanning tunneling microscopy to study the electronic structure of CaFe2As2 in the antiferromagnetic-orthorhombic `parent' state from which the superconductivity emerges. We discovered and visualized the now widely studied electronic `nematicity' of this phase, whose suppression is associated with the emergence of superconductivity (Science 327, 181, 2010). As subsequent transport experiments discovered a related anisotropic conductance which increases with dopant concentration, the interplay between the electronic structure surrounding each dopant atom, quasiparticle scattering therefrom, and the transport nematicity has become a pivotal focus of research. We find that substituting Co for Fe atoms in underdoped Ca(Fe1-xCox)2As2 generates a dense population of identical and strongly anisotropic impurity states that are distributed randomly but aligned with the antiferromagnetic a-axis. We also demonstrate, by imaging their surrounding interference patterns, that these impurity states scatter quasiparticles and thus influence transport in a highly anisotropic manner (M.P. Allan et al., 2013). Next, we studied the momentum dependence of the energy gaps of iron-based superconductivity, now focusing on LiFeAs. If strong electron-electron interactions mediate the Cooper pairing, then momentum-space anisotropic superconducting energy gaps Δi (k) were predicted by multiple techniques to appear on the different electronic bands i. We introduced intraband Bogoliubov quasiparticle scattering interference (QPI) techniques for the determination of anisotropic energy gaps to test these hypotheses and discovered the anisotropy, magnitude, and relative orientations of the energy gaps on multiple

  17. A Thiazole Coumarin (TC) Turn-On Fluorescence Probe for AT-Base Pair Detection and Multipurpose Applications in Different Biological Systems (United States)

    Narayanaswamy, Nagarjun; Kumar, Manoj; Das, Sadhan; Sharma, Rahul; Samanta, Pralok K.; Pati, Swapan K.; Dhar, Suman K.; Kundu, Tapas K.; Govindaraju, T.


    Sequence-specific recognition of DNA by small turn-on fluorescence probes is a promising tool for bioimaging, bioanalytical and biomedical applications. Here, the authors report a novel cell-permeable and red fluorescent hemicyanine-based thiazole coumarin (TC) probe for DNA recognition, nuclear staining and cell cycle analysis. TC exhibited strong fluorescence enhancement in the presence of DNA containing AT-base pairs, but did not fluoresce with GC sequences, single-stranded DNA, RNA and proteins. The fluorescence staining of HeLa S3 and HEK 293 cells by TC followed by DNase and RNase digestion studies depicted the selective staining of DNA in the nucleus over the cytoplasmic region. Fluorescence-activated cell sorting (FACS) analysis by flow cytometry demonstrated the potential application of TC in cell cycle analysis in HEK 293 cells. Metaphase chromosome and malaria parasite DNA imaging studies further confirmed the in vivo diagnostic and therapeutic applications of probe TC. Probe TC may find multiple applications in fluorescence spectroscopy, diagnostics, bioimaging and molecular and cell biology. PMID:25252596

  18. Current Hormonal Contraceptive Use Predicts Female Extra-Pair and Dyadic Sexual Behavior: Evidence Based on Czech National Survey Data

    Directory of Open Access Journals (Sweden)

    Kateřina Klapilová


    Full Text Available Data from 1155 Czech women (493 using oral contraception, 662 non-users, obtained from the Czech National Survey of Sexual Behavior, were used to investigate evolutionary-based hypotheses concerning the predictive value of current oral contraceptive (OC use on extra-pair and dyadic (in-pair sexual behavior of coupled women. Specifically, the aim was to determine whether current OC use was associated with lower extra-pair and higher in-pair sexual interest and behavior, because OC use suppresses cyclical shifts in mating psychology that occur in normally cycling women. Zero-inflated Poisson (ZIP regression and negative binomial models were used to test associations between OC use and these sexual measures, controlling for other relevant predictors (e.g., age, parity, in-pair sexual satisfaction, relationship length. The overall incidence of having had an extra-pair partner or one-night stand in the previous year was not related to current OC use (the majority of the sample had not. However, among the women who had engaged in extra-pair sexual behavior, OC users had fewer one-night stands than non-users, and tended to have fewer partners, than non-users. OC users also had more frequent dyadic intercourse than non-users, potentially indicating higher commitment to their current relationship. These results suggest that suppression of fertility through OC use may alter important aspects of female sexual behavior, with potential implications for relationship functioning and stability.

  19. Bio-activity of aminosulfonyl ureas in the light of nucleic acid bases and DNA base pair interaction. (United States)

    Mondal Roy, Sutapa


    The quantum chemical descriptors based on density functional theory (DFT) are applied to predict the biological activity (log IC 50 ) of one class of acyl-CoA: cholesterol O-acyltransferase (ACAT) inhibitors, viz. aminosulfonyl ureas. ACAT are very effective agents for reduction of triglyceride and cholesterol levels in human body. Successful two parameter quantitative structure-activity relationship (QSAR) models are developed with a combination of relevant global and local DFT based descriptors for prediction of biological activity of aminosulfonyl ureas. The global descriptors, electron affinity of the ACAT inhibitors (EA) and/or charge transfer (ΔN) between inhibitors and model biosystems (NA bases and DNA base pairs) along with the local group atomic charge on sulfonyl moiety (∑Q Sul ) of the inhibitors reveals more than 90% efficacy of the selected descriptors for predicting the experimental log (IC 50 ) values. Copyright © 2018 Elsevier Ltd. All rights reserved.

  20. Simulation-based investigation of the paired-gear method in cod-end selectivity studies

    DEFF Research Database (Denmark)

    Herrmann, Bent; Frandsen, Rikke; Holst, René


    In this paper, the paired-gear and covered cod-end methods for estimating the selectivity of trawl cod-ends are compared. A modified version of the cod-end selectivity simulator PRESEMO is used to simulate the data that would be collected from a paired-gear experiment where the test cod-end also ...

  1. Surprising conformers of the biologically important A·T DNA base pairs: QM/QTAIM proofs (United States)

    Brovarets', Ol'ha O.; Tsiupa, Kostiantyn S.; Hovorun, Dmytro M.


    For the first time novel high-energy conformers – A·T(wWC) (5.36), A·T(wrWC) (5.97), A·T(wH) (5.78) and A·T(wrH) (ΔG=5.82 kcal•mol-1) were revealed for each of the four biologically important A·T(WC) DNA base pairs – Watson-Crick A·T(WC), reverse Watson-Crick A·T(rWC), Hoogsteen A·T(H) and reverse Hoogsteen A·T(rH) at the MP2/aug-cc-pVDZ//B3LYP/6-311++G(d,p) level of quantum-mechanical theory in the continuum with ɛ=4 under normal conditions. Each of these conformers possesses substantially non-planar wobble (w) structure and is stabilized by the participation of the two anti-parallel N6H/N6H'…O4/O2 and N3H…N6 H-bonds, involving the pyramidalized amino group of the A DNA base as an acceptor and a donor of the H-bonding. The transition states – TSA·T(WC)↔A·T(wWC), TSA·T(rWC)↔A·T(wrWC), TSA·T(H)↔A·T(wH) and TSA·T(rH)↔A·T(wrH), controlling the dipole-active transformations of the conformers from the main plane-symmetric state into the high-energy, significantly non-planar state and vice versa, were localized. They also possess wobble structures similarly to the high-energy conformers and are stabilized by the participation of the N6H/N6H'…O4/O2 and N3H…N6 H-bonds. Discovered conformers of the A·T DNA base pairs are dynamically stable short-lived structures (lifetime τ = (1.4-3.9) ps). Their possible biological significance and future perspectives have been briefly discussed.

  2. Surprising Conformers of the Biologically Important A·T DNA Base Pairs: QM/QTAIM Proofs

    Directory of Open Access Journals (Sweden)

    Ol'ha O. Brovarets'


    Full Text Available For the first time novel high-energy conformers–A·T(wWC (5.36, A·T(wrWC (5.97, A·T(wH (5.78, and A·T(wrH (ΔG = 5.82 kcal·mol−1 (See Graphical Abstract were revealed for each of the four biologically important A·T DNA base pairs – Watson-Crick A·T(WC, reverse Watson-Crick A·T(rWC, Hoogsteen A·T(H and reverse Hoogsteen A·T(rH at the MP2/aug-cc-pVDZ//B3LYP/6-311++G(d,p level of quantum-mechanical theory in the continuum with ε = 4 under normal conditions. Each of these conformers possesses substantially non-planar wobble (w structure and is stabilized by the participation of the two anti-parallel N6H/N6H′…O4/O2 and N3H…N6 H-bonds, involving the pyramidalized amino group of the A DNA base as an acceptor and a donor of the H-bonding. The transition states – TSA·T(WC↔A·T(wWC, TSA·T(rWC↔A·T(wrWC, TSA·T(H↔A·T(wH, and TSA·T(rH↔A·T(wrH, controlling the dipole-active transformations of the conformers from the main plane-symmetric state into the high-energy, significantly non-planar state and vice versa, were localized. They also possess wobble structures similarly to the high-energy conformers and are stabilized by the participation of the N6H/N6H′…O4/O2 and N3H…N6 H-bonds. Discovered conformers of the A·T DNA base pairs are dynamically stable short-lived structures [lifetime τ = (1.4–3.9 ps]. Their possible biological significance and future perspectives have been briefly discussed.

  3. Polydimethylsiloxane-air partition ratios for semi-volatile organic compounds by GC-based measurement and COSMO-RS estimation: Rapid measurements and accurate modelling. (United States)

    Okeme, Joseph O; Parnis, J Mark; Poole, Justen; Diamond, Miriam L; Jantunen, Liisa M


    Polydimethylsiloxane (PDMS) shows promise for use as a passive air sampler (PAS) for semi-volatile organic compounds (SVOCs). To use PDMS as a PAS, knowledge of its chemical-specific partitioning behaviour and time to equilibrium is needed. Here we report on the effectiveness of two approaches for estimating the partitioning properties of polydimethylsiloxane (PDMS), values of PDMS-to-air partition ratios or coefficients (KPDMS-Air), and time to equilibrium of a range of SVOCs. Measured values of KPDMS-Air, Exp' at 25 °C obtained using the gas chromatography retention method (GC-RT) were compared with estimates from a poly-parameter free energy relationship (pp-FLER) and a COSMO-RS oligomer-based model. Target SVOCs included novel flame retardants (NFRs), polybrominated diphenyl ethers (PBDEs), polycyclic aromatic hydrocarbons (PAHs), organophosphate flame retardants (OPFRs), polychlorinated biphenyls (PCBs) and organochlorine pesticides (OCPs). Significant positive relationships were found between log KPDMS-Air, Exp' and estimates made using the pp-FLER model (log KPDMS-Air, pp-LFER) and the COSMOtherm program (log KPDMS-Air, COSMOtherm). The discrepancy and bias between measured and predicted values were much higher for COSMO-RS than the pp-LFER model, indicating the anticipated better performance of the pp-LFER model than COSMO-RS. Calculations made using measured KPDMS-Air, Exp' values show that a PDMS PAS of 0.1 cm thickness will reach 25% of its equilibrium capacity in ∼1 day for alpha-hexachlorocyclohexane (α-HCH) to ∼ 500 years for tris (4-tert-butylphenyl) phosphate (TTBPP), which brackets the volatility range of all compounds tested. The results presented show the utility of GC-RT method for rapid and precise measurements of KPDMS-Air. Copyright © 2016. Published by Elsevier Ltd.

  4. Studies of base pair sequence effects on DNA solvation based on all

    Indian Academy of Sciences (India)

    Detailed analyses of the sequence-dependent solvation and ion atmosphere of DNA are presented based on molecular dynamics (MD) simulations on all the 136 unique tetranucleotide steps obtained by the ABC consortium using the AMBER suite of programs. Significant sequence effects on solvation and ion localization ...

  5. RNAHelix: computational modeling of nucleic acid structures with Watson-Crick and non-canonical base pairs. (United States)

    Bhattacharyya, Dhananjay; Halder, Sukanya; Basu, Sankar; Mukherjee, Debasish; Kumar, Prasun; Bansal, Manju


    Comprehensive analyses of structural features of non-canonical base pairs within a nucleic acid double helix are limited by the availability of a small number of three dimensional structures. Therefore, a procedure for model building of double helices containing any given nucleotide sequence and base pairing information, either canonical or non-canonical, is seriously needed. Here we describe a program RNAHelix, which is an updated version of our widely used software, NUCGEN. The program can regenerate duplexes using the dinucleotide step and base pair orientation parameters for a given double helical DNA or RNA sequence with defined Watson-Crick or non-Watson-Crick base pairs. The original structure and the corresponding regenerated structure of double helices were found to be very close, as indicated by the small RMSD values between positions of the corresponding atoms. Structures of several usual and unusual double helices have been regenerated and compared with their original structures in terms of base pair RMSD, torsion angles and electrostatic potentials and very high agreements have been noted. RNAHelix can also be used to generate a structure with a sequence completely different from an experimentally determined one or to introduce single to multiple mutation, but with the same set of parameters and hence can also be an important tool in homology modeling and study of mutation induced structural changes.

  6. Graph-based surface reconstruction from stereo pairs using image segmentation (United States)

    Bleyer, Michael; Gelautz, Margrit


    This paper describes a novel stereo matching algorithm for epipolar rectified images. The method applies colour segmentation on the reference image. The use of segmentation makes the algorithm capable of handling large untextured regions, estimating precise depth boundaries and propagating disparity information to occluded regions, which are challenging tasks for conventional stereo methods. We model disparity inside a segment by a planar equation. Initial disparity segments are clustered to form a set of disparity layers, which are planar surfaces that are likely to occur in the scene. Assignments of segments to disparity layers are then derived by minimization of a global cost function via a robust optimization technique that employs graph cuts. The cost function is defined on the pixel level, as well as on the segment level. While the pixel level measures the data similarity based on the current disparity map and detects occlusions symmetrically in both views, the segment level propagates the segmentation information and incorporates a smoothness term. New planar models are then generated based on the disparity layers' spatial extents. Results obtained for benchmark and self-recorded image pairs indicate that the proposed method is able to compete with the best-performing state-of-the-art algorithms.

  7. A Novel Clustering Model Based on Set Pair Analysis for the Energy Consumption Forecast in China

    Directory of Open Access Journals (Sweden)

    Mingwu Wang


    Full Text Available The energy consumption forecast is important for the decision-making of national economic and energy policies. But it is a complex and uncertainty system problem affected by the outer environment and various uncertainty factors. Herein, a novel clustering model based on set pair analysis (SPA was introduced to analyze and predict energy consumption. The annual dynamic relative indicator (DRI of historical energy consumption was adopted to conduct a cluster analysis with Fisher’s optimal partition method. Combined with indicator weights, group centroids of DRIs for influence factors were transferred into aggregating connection numbers in order to interpret uncertainty by identity-discrepancy-contrary (IDC analysis. Moreover, a forecasting model based on similarity to group centroid was discussed to forecast energy consumption of a certain year on the basis of measured values of influence factors. Finally, a case study predicting China’s future energy consumption as well as comparison with the grey method was conducted to confirm the reliability and validity of the model. The results indicate that the method presented here is more feasible and easier to use and can interpret certainty and uncertainty of development speed of energy consumption and influence factors as a whole.

  8. Enhanced performance of dye-sensitized solar cells based on organic dopant incorporated PVDF-HFP/PEO polymer blend electrolyte with g-C3N4/TiO2 photoanode

    International Nuclear Information System (INIS)

    Senthil, R.A.; Theerthagiri, J.; Madhavan, J.; Murugan, K.; Arunachalam, Prabhakarn; Arof, A.K.


    This work describes the effect of 2-aminopyrimidine (2-APY) on poly(vinylidinefluoride-co-hexafluoropropylene) (PVDF-HFP)/polyethylene oxide (PEO) blend polymer electrolyte along with binary iodide salts (tetrabutylammonium iodide (TBAI) and potassium iodide (KI)) and iodine (I 2 ) were studied for enhancing the efficiency of the dye-sensitized solar cells (DSSCs) consisting of g-C 3 N 4 /TiO 2 composite as photoanode. The g-C 3 N 4 was synthesized from low cost urea by thermal condensation method. It was used as a precursor to synthesize the various weight percentage ratios (5%, 10% and 15%) of g-C 3 N 4 /TiO 2 composites by wet-impregnation method. The pure and 2-APY incorporated PVDF-HFP/PEO polymer blend electrolytes were arranged by wet chemical process (casting method) using DMF as a solvent. The synthesized g-C 3 N 4 /TiO 2 composites and polymer blend electrolytes were studied and analyzed by Fourier transform infrared (FT-IR) spectroscopy, X-ray diffractometer (XRD) and scanning electron microscopy (SEM). The ionic conductivity values of the pure and 2-APY incorporated PVDF-HFP/PEO blend electrolytes were estimated to be 4.53×10 −5 and 1.87×10 −4 Scm −1 respectively. The UV–vis absorption spectroscopy was carried out for the pure and different wt% of g-C 3 N 4 /TiO 2 composites coated FTO films after N3 dye-sensitization. The 10 wt% g-C 3 N 4 /TiO 2 composite film showed a maximum absorption compared to the others. The DSSC assembled with 10 wt% g-C 3 N 4 /TiO 2 as photoanode using the pure polymer blend electrolyte exhibited a power conversion efficiency (PCE) of 3.17% , which was superior than that of DSSC based pure TiO 2 (2.46%). However, the PCE was increased to 4.73% for the DSSC assembled using 10 wt% g-C 3 N 4 /TiO 2 as photoanode with 2-APY incorporated polymer blend electrolyte. Hence, the present study is a successful attempt to provide a new pathway to enhance the performance of DSSCs. - Graphical abstract: In this study, the g-C 3 N

  9. Pairing symmetries of several iron-based superconductor families and some similarities with cuprates and heavy-fermions

    Directory of Open Access Journals (Sweden)

    Das Tanmoy


    Full Text Available We show that, by using the unit-cell transformation between 1 Fe per unit cell to 2 Fe per unit cell, one can qualitatively understand the pairing symmetry of several families of iron-based superconductors. In iron-pnictides and iron-chalcogenides, the nodeless s±-pairing and the resulting magnetic resonance mode transform nicely between the two unit cells, while retaining all physical properties unchanged. However, when the electron-pocket disappears from the Fermi surface with complete doping in KFe2As2, we find that the unit-cell invariant requirement prohibits the occurrence of s±-pairing symmetry (caused by inter-hole-pocket nesting. However, the intra-pocket nesting is compatible here, which leads to a nodal d-wave pairing. The corresponding Fermi surface topology and the pairing symmetry are similar to Ce-based heavy-fermion superconductors. Furthermore, when the Fermi surface hosts only electron-pockets in KyFe2-xSe2, the inter-electron-pocket nesting induces a nodeless and isotropic d-wave pairing. This situation is analogous to the electron-doped cuprates, where the strong antiferromagnetic order creates similar disconnected electron-pocket Fermi surface, and hence nodeless d-wave pairing appears. The unit-cell transformation in KyFe2-xSe2 exhibits that the d-wave pairing breaks the translational symmetry of the 2 Fe unit cell, and thus cannot be realized unless a vacancy ordering forms to compensate for it. These results are consistent with the coexistence picture of a competing order and nodeless d-wave superconductivity in both cuprates and KyFe1.6Se2.

  10. Ultrafast deactivation processes in the 2-aminopyridine dimer and the adenine-thymine base pair: Similarities and differences

    International Nuclear Information System (INIS)

    Ai Yuejie; Zhang Feng; Cui Ganglong; Fang Weihai; Luo Yi


    2-aminopyridine dimer has frequently been used as a model system for studying photochemistry of DNA base pairs. We examine here the relevance of 2-aminopyridine dimer for a Watson-Crick adenine-thymine base pair by studying UV-light induced photodynamics along two main hydrogen bridges after the excitation to the localized 1 ππ* excited-state. The respective two-dimensional potential-energy surfaces have been determined by time-dependent density functional theory with Coulomb-attenuated hybrid exchange-correlation functional (CAM-B3LYP). Different mechanistic aspects of the deactivation pathway have been analyzed and compared in detail for both systems, while the related reaction rates have also be obtained from Monte Carlo kinetic simulations. The limitations of the 2-aminopyridine dimer as a model system for the adenine-thymine base pair are discussed.

  11. Doppler Broadening Analysis of Steel Specimens Using Accelerator Based In Situ Pair Production

    International Nuclear Information System (INIS)

    Makarashvili, V.; Wells, D. P.; Roy, A. K.


    Positron Annihilation Spectroscopy (PAS) techniques can be utilized as a sensitive probe of defects in materials. Studying these microscopic defects is very important for a number of industries in order to predict material failure or structural integrity. We have been developing gamma-induced pair-production techniques to produce positrons in thick samples (∼4-40 g/cm 2 , or ∼0.5-5 cm in steel). These techniques are called 'Accelerator-based Gamma-induced Positron Annihilation Spectroscopy'(AG-PAS). We have begun testing the capabilities of this technique for imaging of defect densities in thick structural materials. As a first step, a linear accelerator (LINAC) was employed to produce photon beams by stopping 15 MeV electrons in a 1 mm thick tungsten converter. The accelerator is capable of operating with 30-60 ns pulse width, up to 200 mA peak current at 1 kHz repetition rate. The highly collimated bremsstrahlung beam impinged upon our steel tensile specimens, after traveling through a 1.2 m thick concrete wall. Annihilation radiation was detected by a well-shielded and collimated high-purity germanium detector (HPGe). Conventional Doppler broadening spectrometry (DBS) was performed to determine S, W and T parameters for our samples.

  12. Study of intrinsic anchoring in nematic liquid crystals based on modified Gruhn-Hess pair potential

    International Nuclear Information System (INIS)

    Zhang Zhidong; Zhang Yanjun


    A nematic liquid crystal slab composed of N molecular layers is investigated using a simple cubic lattice model, based upon the molecular pair potential which is spatially anisotropic and dependent on elastic constants of liquid crystals. A perfect nematic order is assumed in the theoretical treatment, which means the orientation of the molecular long axis coincides with the director of liquid crystal and the total free energy equals to the total interaction energy. We present a modified Gruhn-Hess model, which is relative to the splay-bend elastic constant K 13 . Furthermore, we have studied the free nematic interfacial behavior (intrinsic anchoring) by this model in the assumption of the perfect nematic order. We find that the preferred orientation at the free interface and the intrinsic anchoring strength change with the value of modification, and that the director profile can be determined by the competition of the intrinsic anchoring with external forces present in the system. Also we simulate the intrinsic anchoring at different temperatures using Monte Carlo method and the simulation results show that the intrinsic anchoring favors planar alignment and the free interface is more disordered than the bulk

  13. Locations of Joint Physical Activity in Parent-Child Pairs Based on Accelerometer and GPS Monitoring (United States)

    Dunton, Genevieve Fridlund; Liao, Yue; Almanza, Estela; Jerrett, Micheal; Spruijt-Metz, Donna; Pentz, Mary Ann


    Background Parental factors may play an important role in influencing children’s physical activity levels. Purpose This cross-sectional study sought to describe the locations of joint physical activity among parents and children. Methods Parent-child pairs (N = 291) wore an Actigraph GT2M accelerometer and GlobalSat BT-335 Global Positioning Systems (GPS) device over the same 7-day period. Children were ages 8–14 years. Joint behavior was defined by a linear separation distance of less than 50m between parent and child. Land use classifications were assigned to GPS data points. Results Joint physical activity was spread across residential locations (35%), and commercial venues (24%), and open spaces/parks (20%). Obese children and parents performed less joint physical activity in open spaces/parks than under/normal weight children and parents (p’s parent-child physical activity naturally occurs may inform location-based interventions to promote these behaviors. PMID:23011914

  14. Self-Similarity Based Corresponding-Point Extraction from Weakly Textured Stereo Pairs

    Directory of Open Access Journals (Sweden)

    Min Mao


    Full Text Available For the areas of low textured in image pairs, there is nearly no point that can be detected by traditional methods. The information in these areas will not be extracted by classical interest-point detectors. In this paper, a novel weakly textured point detection method is presented. The points with weakly textured characteristic are detected by the symmetry concept. The proposed approach considers the gray variability of the weakly textured local regions. The detection mechanism can be separated into three steps: region-similarity computation, candidate point searching, and refinement of weakly textured point set. The mechanism of radius scale selection and texture strength conception are used in the second step and the third step, respectively. The matching algorithm based on sparse representation (SRM is used for matching the detected points in different images. The results obtained on image sets with different objects show high robustness of the method to background and intraclass variations as well as to different photometric and geometric transformations; the points detected by this method are also the complement of points detected by classical detectors from the literature. And we also verify the efficacy of SRM by comparing with classical algorithms under the occlusion and corruption situations for matching the weakly textured points. Experiments demonstrate the effectiveness of the proposed weakly textured point detection algorithm.

  15. Proton tunneling in the A∙T Watson-Crick DNA base pair: myth or reality? (United States)

    Brovarets', Ol'ha O; Hovorun, Dmytro M


    The results and conclusions reached by Godbeer et al. in their recent work, that proton tunneling in the A∙T(WC) Watson-Crick (WC) DNA base pair occurs according to the Löwdin's (L) model, but with a small (~10(-9)) probability were critically analyzed. Here, it was shown that this finding overestimates the possibility of the proton tunneling at the A∙T(WC)↔A*∙T*(L) tautomerization, because this process cannot be implemented as a chemical reaction. Furthermore, it was outlined those biologically important nucleobase mispairs (A∙A*↔A*∙A, G∙G*↔G*∙G, T∙T*↔T*∙T, C∙C*↔C*∙C, H∙H*↔H*∙H (H - hypoxanthine)) - the players in the field of the spontaneous point mutagenesis - where the tunneling of protons is expected and for which the application of the model proposed by Godbeer et al. can be productive.

  16. Intercalation of a Zn(II) complex containing ciprofloxacin drug between DNA base pairs. (United States)

    Shahabadi, Nahid; Asadian, Ali Ashraf; Mahdavi, Mryam


    In this study, an attempt has been made to study the interaction of a Zn(II) complex containing an antibiotic drug, ciprofloxacin, with calf thymus DNA using spectroscopic methods. It was found that Zn(II) complex could bind with DNA via intercalation mode as evidenced by: hyperchromism in UV-Vis spectrum; these spectral characteristics suggest that the Zn(II) complex interacts with DNA most likely through a mode that involves a stacking interaction between the aromatic chromophore and the base pairs of DNA. DNA binding constant (K b = 1.4 × 10 4 M -1 ) from spectrophotometric studies of the interaction of Zn(II) complex with DNA is comparable to those of some DNA intercalative polypyridyl Ru(II) complexes 1.0 -4.8 × 10 4 M -1 . CD study showed stabilization of the right-handed B form of DNA in the presence of Zn(II) complex as observed for the classical intercalator methylene blue. Thermodynamic parameters (ΔH DNA-MB, indicating that it binds to DNA in strong competition with MB for the intercalation.

  17. DNA base pair resolution measurements using resonance energy transfer efficiency in lanthanide doped nanoparticles.

    Directory of Open Access Journals (Sweden)

    Aleksandra Delplanque

    Full Text Available Lanthanide-doped nanoparticles are of considerable interest for biodetection and bioimaging techniques thanks to their unique chemical and optical properties. As a sensitive luminescence material, they can be used as (bio probes in Förster Resonance Energy Transfer (FRET where trivalent lanthanide ions (La3+ act as energy donors. In this paper we present an efficient method to transfer ultrasmall (ca. 8 nm NaYF4 nanoparticles dispersed in organic solvent to an aqueous solution via oxidation of the oleic acid ligand. Nanoparticles were then functionalized with single strand DNA oligomers (ssDNA by inducing covalent bonds between surface carboxylic groups and a 5' amine modified-ssDNA. Hybridization with the 5' fluorophore (Cy5 modified complementary ssDNA strand demonstrated the specificity of binding and allowed the fine control over the distance between Eu3+ ions doped nanoparticle and the fluorophore by varying the number of the dsDNA base pairs. First, our results confirmed nonradiative resonance energy transfer and demonstrate the dependence of its efficiency on the distance between the donor (Eu3+ and the acceptor (Cy5 with sensitivity at a nanometre scale.

  18. DNA base pair resolution measurements using resonance energy transfer efficiency in lanthanide doped nanoparticles. (United States)

    Delplanque, Aleksandra; Wawrzynczyk, Dominika; Jaworski, Pawel; Matczyszyn, Katarzyna; Pawlik, Krzysztof; Buckle, Malcolm; Nyk, Marcin; Nogues, Claude; Samoc, Marek


    Lanthanide-doped nanoparticles are of considerable interest for biodetection and bioimaging techniques thanks to their unique chemical and optical properties. As a sensitive luminescence material, they can be used as (bio) probes in Förster Resonance Energy Transfer (FRET) where trivalent lanthanide ions (La3+) act as energy donors. In this paper we present an efficient method to transfer ultrasmall (ca. 8 nm) NaYF4 nanoparticles dispersed in organic solvent to an aqueous solution via oxidation of the oleic acid ligand. Nanoparticles were then functionalized with single strand DNA oligomers (ssDNA) by inducing covalent bonds between surface carboxylic groups and a 5' amine modified-ssDNA. Hybridization with the 5' fluorophore (Cy5) modified complementary ssDNA strand demonstrated the specificity of binding and allowed the fine control over the distance between Eu3+ ions doped nanoparticle and the fluorophore by varying the number of the dsDNA base pairs. First, our results confirmed nonradiative resonance energy transfer and demonstrate the dependence of its efficiency on the distance between the donor (Eu3+) and the acceptor (Cy5) with sensitivity at a nanometre scale.

  19. Biomolecule Analogues 2-Hydroxypyridine and 2-Pyridone Base Pairing on Ice Nanoparticles. (United States)

    Rubovič, Peter; Pysanenko, Andriy; Lengyel, Jozef; Nachtigallová, Dana; Fárník, Michal


    Ice nanoparticles (H2O)N, N ≈ 450 generated in a molecular beam experiment pick up individual gas phase molecules of 2-hydroxypyridine and 2-pyridone (HP) evaporated in a pickup cell at temperatures between 298 and 343 K. The mass spectra of the doped nanoparticles show evidence for generation of clusters of adsorbed molecules (HP)n up to n = 8. The clusters are ionized either by 70 eV electrons or by two photons at 315 nm (3.94 eV). The two ionization methods yield different spectra, and their comparison provides an insight into the neutral cluster composition, ionization and intracluster ion-molecule reactions, and cluster fragmentation. Quite a few molecules were reported not to coagulate on ice nanoparticles previously. The (HP)n cluster generation on ice nanoparticles represents the first evidence for coagulating of molecules and cluster formation on free ice nanoparticles. For comparison, we investigate the coagulation of HP molecules picked up on large clusters ArN, N ≈ 205, and also (HP)n clusters generated in supersonic expansions with Ar buffer gas. This comparison points to a propensity for the (HP)2 dimer generation on ice nanoparticles. This shows the feasibility of base pairing for model of biological molecules on free ice nanoparticles. This result is important for hypotheses of the biomolecule synthesis on ice grains in the space. We support our findings by theoretical calculations that show, among others, the HP dimer structures on water clusters.

  20. Paired-Associate and Feedback-Based Weather Prediction Tasks Support Multiple Category Learning Systems. (United States)

    Li, Kaiyun; Fu, Qiufang; Sun, Xunwei; Zhou, Xiaoyan; Fu, Xiaolan


    It remains unclear whether probabilistic category learning in the feedback-based weather prediction task (FB-WPT) can be mediated by a non-declarative or procedural learning system. To address this issue, we compared the effects of training time and verbal working memory, which influence the declarative learning system but not the non-declarative learning system, in the FB and paired-associate (PA) WPTs, as the PA task recruits a declarative learning system. The results of Experiment 1 showed that the optimal accuracy in the PA condition was significantly decreased when the training time was reduced from 7 to 3 s, but this did not occur in the FB condition, although shortened training time impaired the acquisition of explicit knowledge in both conditions. The results of Experiment 2 showed that the concurrent working memory task impaired the optimal accuracy and the acquisition of explicit knowledge in the PA condition but did not influence the optimal accuracy or the acquisition of self-insight knowledge in the FB condition. The apparent dissociation results between the FB and PA conditions suggested that a non-declarative or procedural learning system is involved in the FB-WPT and provided new evidence for the multiple-systems theory of human category learning.

  1. Identification of somatic mutations in cancer through Bayesian-based analysis of sequenced genome pairs. (United States)

    Christoforides, Alexis; Carpten, John D; Weiss, Glen J; Demeure, Michael J; Von Hoff, Daniel D; Craig, David W


    The field of cancer genomics has rapidly adopted next-generation sequencing (NGS) in order to study and characterize malignant tumors with unprecedented resolution. In particular for cancer, one is often trying to identify somatic mutations--changes specific to a tumor and not within an individual's germline. However, false positive and false negative detections often result from lack of sufficient variant evidence, contamination of the biopsy by stromal tissue, sequencing errors, and the erroneous classification of germline variation as tumor-specific. We have developed a generalized Bayesian analysis framework for matched tumor/normal samples with the purpose of identifying tumor-specific alterations such as single nucleotide mutations, small insertions/deletions, and structural variation. We describe our methodology, and discuss its application to other types of paired-tissue analysis such as the detection of loss of heterozygosity as well as allelic imbalance. We also demonstrate the high level of sensitivity and specificity in discovering simulated somatic mutations, for various combinations of a) genomic coverage and b) emulated heterogeneity. We present a Java-based implementation of our methods named Seurat, which is made available for free academic use. We have demonstrated and reported on the discovery of different types of somatic change by applying Seurat to an experimentally-derived cancer dataset using our methods; and have discussed considerations and practices regarding the accurate detection of somatic events in cancer genomes. Seurat is available at

  2. Universal quantum gates for Single Cooper Pair Box based quantum computing (United States)

    Echternach, P.; Williams, C. P.; Dultz, S. C.; Braunstein, S.; Dowling, J. P.


    We describe a method for achieving arbitrary 1-qubit gates and controlled-NOT gates within the context of the Single Cooper Pair Box (SCB) approach to quantum computing. Such gates are sufficient to support universal quantum computation.

  3. Neutron matter, neutron pairing, and neutron drops based on chiral effective field theory interactions

    Energy Technology Data Exchange (ETDEWEB)

    Krueger, Thomas


    calculate the pairing gaps in neutron matter and provide uncertainty estimates. The formation of heavy elements in the early universe proceeds through the rapid neutron-capture process. This process requires precise knowledge of the properties of very neutron-rich nuclei, which are unstable and at present not accessible in experiments. Thus, one can explore their properties only with theoretical calculations. Currently the only approach to the properties of all nuclei are energy-density functionals (EDFs). All EDFs used today are based on phenomenological models and fits to stable nuclei, which makes their predictive power for unknown (neutron-rich) nuclei unclear. Deriving an ab initio EDF directly from the nuclear forces is an important goal of nuclear theory. A promising approach is the optimised effective potential (OEP) method. We take a step into that direction and calculate neutron drops within the OEP formalism. In addition to the exact-exchange approximation we study for the first time the effect of second-order contributions and compare to quantum Monte Carlo and other results.

  4. Charge transport properties of DNA aperiodic molecule: The role of interbase hopping in Watson-Crick base pair (United States)

    Sinurat, E. N.; Yudiarsah, E.


    The charge transport properties of DNA aperiodic molecule has been studied by considering various interbase hopping parameter on Watson-Crick base pair. 32 base pairs long double-stranded DNA aperiodic model with sequence GCTAGTACGTGACGTAGCTAGGATATGCCTGA on one chain and its complement on the other chain is used. Transfer matrix method has been used to calculate transmission probabilities, for determining I-V characteristic using Landauer Büttiker formula. DNA molecule is modeled using tight binding hamiltonian combined with the theory of Slater-Koster. The result show, the increment of Watson-Crick hopping value leads to the transmission probabilities and current of DNA aperiodic molecule increases.

  5. Comparability of results from pair and classical model formulations for different sexually transmitted infections.

    Directory of Open Access Journals (Sweden)

    Jimmy Boon Som Ong

    Full Text Available The "classical model" for sexually transmitted infections treats partnerships as instantaneous events summarized by partner change rates, while individual-based and pair models explicitly account for time within partnerships and gaps between partnerships. We compared predictions from the classical and pair models over a range of partnership and gap combinations. While the former predicted similar or marginally higher prevalence at the shortest partnership lengths, the latter predicted self-sustaining transmission for gonorrhoea (GC and Chlamydia (CT over much broader partnership and gap combinations. Predictions on the critical level of condom use (C(c required to prevent transmission also differed substantially when using the same parameters. When calibrated to give the same disease prevalence as the pair model by adjusting the infectious duration for GC and CT, and by adjusting transmission probabilities for HIV, the classical model then predicted much higher C(c values for GC and CT, while C(c predictions for HIV were fairly close. In conclusion, the two approaches give different predictions over potentially important combinations of partnership and gap lengths. Assuming that it is more correct to explicitly model partnerships and gaps, then pair or individual-based models may be needed for GC and CT since model calibration does not resolve the differences.

  6. GC-MS-Based metabolomics discovers a shared serum metabolic characteristic among three types of epileptic seizures. (United States)

    Wang, Dian; Wang, Xingxing; Kong, Jing; Wu, Jiayan; Lai, Minchao


    Understanding the overall and common metabolic changes of seizures can provide novel clues for their control and prevention. Here, we aim to investigate the global metabolic feature of serum for three types of seizures. We recruited 27 patients who had experienced a seizure within 48h (including 11 who had a generalized seizure, nine who had a generalized seizure secondary to partial seizure and seven who had a partial seizure) and 23 healthy controls. We analyzed the global metabolic changes of serum after seizures using gas chromatography-mass spectrometry-based metabolomics. Based on differential metabolites, the metabolic pathways and their potential to diagnose seizures were analyzed, and metabolic differences among three types of seizures were compared. The metabolic profiles of serum were distinctive between the seizure group and the controls but were not different among the three types of seizures. Compared to the controls, patients with seizures had higher levels of lactate, butanoic acid, proline and glutamate and lower levels of palmitic acid, linoleic acid, elaidic acid, trans-13-octadecenoic acid, stearic acid, citrate, cysteine, glutamine, asparagine, and glyceraldehyde in the serum. Furthermore, these differential metabolites had common change trends among the three types of seizures. Related pathophysiological processes reflected by these metabolites are energy deficit, inflammation, nervous excitation and neurotoxicity. Importantly, transamination inhibition is suspected to occur in seizures. Lactate, glyceraldehyde and trans-13-octadecenoic acid in serum jointly enabled a precision of 92.9% for diagnosing seizures. There is a common metabolic feature in three types of seizures. Lactate, glyceraldehyde and trans-13-octadecenoic acid levels jointly enable high-precision seizure diagnosis. Copyright © 2016 Elsevier B.V. All rights reserved.

  7. A rhodium(III) complex for high-affinity DNA base-pair mismatch recognition (United States)

    Junicke, Henrik; Hart, Jonathan R.; Kisko, Jennifer; Glebov, Oleg; Kirsch, Ilan R.; Barton, Jacqueline K.


    A rhodium(III) complex, rac-[Rh(bpy)2phzi]3+ (bpy, 2,2′-bipyridine; phzi, benzo[a]phenazine-5,6-quinone diimine) has been designed as a sterically demanding intercalator targeted to destabilized mismatched sites in double-helical DNA. The complex is readily synthesized by condensation of the phenazine quinone with the corresponding diammine complex. Upon photoactivation, the complex promotes direct strand scission at single-base mismatch sites within the DNA duplex. As with the parent mismatch-specific reagent, [Rh(bpy)2(chrysi)]3+ [chrysene-5,6-quinone diimine (chrysi)], mismatch selectivity depends on the helix destabilization associated with mispairing. Unlike the parent chrysi complex, the phzi analogue binds and cleaves with high affinity and efficiency. The specific binding constants for CA, CC, and CT mismatches within a 31-mer oligonucleotide duplex are 0.3, 1, and 6 × 107 M−1, respectively; site-specific photocleavage is evident at nanomolar concentrations. Moreover, the specificity, defined as the ratio in binding affinities for mispaired vs. well paired sites, is maintained. The increase in affinity is attributed to greater stability in the mismatched site associated with stacking by the heterocyclic aromatic ligand. The high-affinity complex is also applied in the differential cleavage of DNA obtained from cell lines deficient in mismatch repair vs. those proficient in mismatch repair. Agreement is found between photocleavage by the mismatch-specific probes and deficiency in mismatch repair. This mismatch-specific targeting, therefore, offers a potential strategy for new chemotherapeutic design. PMID:12610209

  8. Mass renormalization and unconventional pairing in multi-band Fe-based superconductors- a phenomenological approach

    Energy Technology Data Exchange (ETDEWEB)

    Drechsler, S.L.; Efremov, D.; Grinenko, V. [IFW-Dresden (Germany); Johnston, S. [Inst. of Quantum Matter, University of British Coulumbia, Vancouver (Canada); Rosner, H. [MPI-cPfS, Dresden, (Germany); Kikoin, K. [Tel Aviv University (Israel)


    Combining DFT calculations of the density of states and plasma frequencies with experimental thermodynamic, optical, ARPES, and dHvA data taken from the literature, we estimate both the high-energy (Coulomb, Hund's rule coupling) and the low-energy (el-boson coupling) electronic mass renormalization [H(L)EMR] for typical Fe-pnictides with T{sub c}<40 K, focusing on (K,Rb,Cs)Fe{sub 2}As{sub 2}, (Ca,Na)122, (Ba,K)122, LiFeAs, and LaFeO{sub 1-x}F{sub x}As with and without As-vacancies. Using Eliashberg theory we show that these systems can NOT be described by a very strong el-boson coupling constant λ ≥ ∝ 2, being in conflict with the HEMR as seen by DMFT, ARPES and optics. Instead, an intermediate s{sub ±} coupling regime is realized, mainly based on interband spin fluctuations from one predominant pair of bands. For (Ca,Na)122, there is also a non-negligible intraband el-phonon/orbital fluctuation intraband contribution. The coexistence of magnetic As-vacancies and high-T{sub c}=28 K for LaFeO{sub 1-x}F{sub x}As{sub 1-δ} excludes an orbital fluctuation dominated s{sub ++} scenario at least for that system. In contrast, the line nodal BaFe{sub 2}(As,P){sub 2} near the quantum critical point is found as a superstrongly coupled system. The role of a pseudo-gap is briefly discussed for some of these systems.

  9. Base pair mismatches and carcinogen-modified bases in DNA: an NMR study of G x T and G x O4meT pairing in dodecanucleotide duplexes

    International Nuclear Information System (INIS)

    Kalnik, M.W.; Kouchakdjian, M.; Li, B.F.L.; Swann, P.F.; Patel, D.J.


    High-resolution two-dimensional NMR studies have been completed on the self-complementary d(C-G-C-G-A-G-C-T-T-G-C-G) duplex (designated G x T 12-mer) and the self-complementary d(C-G-C-G-A-G-C-T-O 4 meT-G-C-G) duplex (designated G x O 4 meT 12-mer) containing G x T and G x O 4 meT pairs at identical positions four base pairs in from either end of the duplex. The exchangeable and nonexchangeable proton resonances have been assigned from an analysis of two-dimensional nuclear Overhauser enhancement (NOESY) spectra for the G x T 12-mer and G x O 4 meT 12-mer duplexes in H 2 O and D 2 O solution. The guanosine and thymidine imino protons in the G x T mismatch resonate at 10.57 and 11.98 ppm, respectively, and exhibit a strong NOE between themselves and to imino protons of flanking base pairs in the G x T 12-mer duplex. The large upfield chemical shift of this proton relative to that of the imino proton resonance of G in the G x T mismatch or in G x C base pairs indicates that hydrogen bonding to O 4 meT is either very weak or absent. This guanosine imino proton has an NOE to the OCH 3 group of O 4 meT across the pair and NOEs to the imino protons of flanking base pairs. Taken together with data from the NMR of nonexchangeable protons, this shows that both G and O 4 meT have anti-glycosidic torsion angles and are stacked into the duplex. Comparison of the intensity of the NOEs between the guanosine imino proton and the OCH 3 of O 4 meT as well as other protons in its vicinity demonstrates that the OCH 3 group of O 4 meT adopts the syn orientation with respect to N3 of the methylated thymidine. The authors propose an alternate base pairing mode stabilized by one short hydrogen bond between the 2-amino group of guanosine and the 2-carbonyl group of O 4 met

  10. Higher order structural effects stabilizing the reverse watson-crick guanine-cytosine base pair in functional RNAs

    KAUST Repository

    Chawla, Mohit; Abdel-Azeim, Safwat; Oliva, Romina; Cavallo, Luigi


    of the Guanine can increase its stability. Herein, we extend our survey and report on other H-bonding interactions that can increase the stability of this base pair. To this aim, we performed a bioinformatics search of the PDB to locate all the occurencies of G

  11. A 3-base pair deletion, c.9711_9713del, in DMD results in intellectual disability without muscular dystrophy

    NARCIS (Netherlands)

    Brouwer, A.P.M. de; Nabuurs, S.B.; Verhaart, I.E.; Oudakker, A.R.; Hordijk, R.; Yntema, H.G.; Hordijk-Hos, J.M.; Voesenek, K.E.; Vries, B. de; Essen, T. van; Chen, W.; Hu, H; Chelly, J.; Dunnen, J.T. den; Kalscheuer, V.M.M.; Aartsma-Rus, A.M.; Hamel, B.C.J.; Bokhoven, H. van; Kleefstra, T.


    We have identified a deletion of 3 base pairs in the dystrophin gene (DMD), c.9711_9713del, in a family with nonspecific X-linked intellectual disability (ID) by sequencing of the exons of 86 known X-linked ID genes. This in-frame deletion results in the deletion of a single-amino-acid residue,

  12. Geminal phosphorus/aluminum-based frustrated Lewis pairs: C-H versus C≡C activation and CO2 fixation

    NARCIS (Netherlands)

    Appelt, C.; Westenberg, H.; Bertini, F.; Ehlers, A.W.; Slootweg, J.C.; Lammertsma, K.; Uhl, W.


    Catch it! Geminal phosphorus/aluminum-based frustrated Lewis pairs (FLPs) are easily obtained by hydroalumination of alkynylphosphines. These FLPs can activate terminal acetylenes by two competitive pathways, which were analyzed by DFT calculations, and they can bind carbon dioxide reversibly.

  13. Photoinduced electron transfer in a Watson-Crick base-paired, 2-aminopurine:uracil-C60 hydrogen bonding conjugate. (United States)

    D'Souza, Francis; Gadde, Suresh; Islam, D-M Shafiqul; Pang, Siew-Cheng; Schumacher, Amy Lea; Zandler, Melvin E; Horie, Rumiko; Araki, Yasuyaki; Ito, Osamu


    A fluorescent reporter molecule, 2-aminopurine was self-assembled via Watson-Crick base-pairing to a uracil appended fullerene to form a donor-acceptor conjugate; efficient photoinduced charge separation was confirmed by time-resolved emission and transient absorption spectral studies.

  14. Identification of a two base pair deletion in five unrelated families with adrenoleukodystrophy: a possible hot spot for mutations

    NARCIS (Netherlands)

    Kemp, S.; Ligtenberg, M. J.; van Geel, B. M.; Barth, P. G.; Wolterman, R. A.; Schoute, F.; Sarde, C. O.; Mandel, J. L.; van Oost, B. A.; Bolhuis, P. A.


    The gene for X-linked adrenoleukodystrophy (ALD) was recently identified. Intragenic deletions of several kilobases were found in about 7% of patients. Point mutations, expected to be very heterogeneous, were identified so far in only two patients. We report the identification of a two base pair

  15. High-Resolution Crystal Structure of a Silver(I)-RNA Hybrid Duplex Containing Watson-Crick-like C-Silver(I)-C Metallo-Base Pairs. (United States)

    Kondo, Jiro; Tada, Yoshinari; Dairaku, Takenori; Saneyoshi, Hisao; Okamoto, Itaru; Tanaka, Yoshiyuki; Ono, Akira


    Metallo-base pairs have been extensively studied for applications in nucleic acid-based nanodevices and genetic code expansion. Metallo-base pairs composed of natural nucleobases are attractive because nanodevices containing natural metallo-base pairs can be easily prepared from commercially available sources. Previously, we have reported a crystal structure of a DNA duplex containing T-Hg(II)-T base pairs. Herein, we have determined a high-resolution crystal structure of the second natural metallo-base pair between pyrimidine bases C-Ag(I)-C formed in an RNA duplex. One Ag(I) occupies the center between two cytosines and forms a C-Ag(I)-C base pair through N3-Ag(I)-N3 linear coordination. The C-Ag(I)-C base pair formation does not disturb the standard A-form conformation of RNA. Since the C-Ag(I)-C base pair is structurally similar to the canonical Watson-Crick base pairs, it can be a useful building block for structure-based design and fabrication of nucleic acid-based nanodevices. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  16. Gas-Chromatography Mass-Spectrometry (GC-MS Based Metabolite Profiling Reveals Mannitol as a Major Storage Carbohydrate in the Coccolithophorid Alga Emiliania huxleyi

    Directory of Open Access Journals (Sweden)

    Alisdair R. Fernie


    Full Text Available Algae are divergent organisms having a wide variety of evolutional histories. Although most of them share photosynthetic activity, their pathways of primary carbon metabolism are rather diverse among species. Here we developed a method for gas chromatography-mass spectroscopy (GC-MS based metabolite profiling for the coccolithophorid alga Emiliania huxleyi, which is one of the most abundant microalgae in the ocean, in order to gain an overview of the pathway of primary metabolism within this alga. Following method optimization, twenty-six metabolites could be detected by this method. Whilst most proteogenic amino acids were detected, no peaks corresponding to malate and fumarate were found. The metabolite profile of E. huxleyi was, however, characterized by a prominent accumulation of mannitol reaching in excess of 14 nmol 106 cells−1. Similarly, the accumulation of the 13C label during short term H13CO3− feeding revealed a massive redistribution of label into mannitol as well as rapid but saturating label accumulation into glucose and several amino acids including aspartate, glycine and serine. These results provide support to previous work suggesting that this species adopts C3 photosynthesis and that mannitol functions as a carbon store in E. huxleyi.

  17. Identification of sex-specific urinary biomarkers for major depressive disorder by combined application of NMR- and GC-MS-based metabonomics. (United States)

    Zheng, P; Chen, J-J; Zhou, C-J; Zeng, L; Li, K-W; Sun, L; Liu, M-L; Zhu, D; Liang, Z-H; Xie, P


    Women are more vulnerable to major depressive disorder (MDD) than men. However, molecular biomarkers of sex differences are limited. Here we combined gas chromatography-mass spectrometry (GC-MS)- and nuclear magnetic resonance (NMR)-based metabonomics to investigate sex differences of urinary metabolite markers in MDD, and further explore their potential of diagnosing MDD. Consequently, the metabolite signatures of women and men MDD subjects were significantly different from of that in their respective healthy controls (HCs). Twenty seven women and 36 men related differentially expressed metabolites were identified in MDD. Fourteen metabolites were changed in both women and men MDD subjects. Significantly, the women-specific (m-Hydroxyphenylacetate, malonate, glycolate, hypoxanthine, isobutyrate and azelaic acid) and men-specific (tyrosine, N-acetyl-d-glucosamine, N-methylnicotinamide, indoxyl sulfate, citrate and succinate) marker panels were further identified, which could differentiate men and women MDD patients from their respective HCs with higher accuracy than previously reported sex-nonspecific marker panels. Our findings demonstrate that men and women MDD patients have distinct metabonomic signatures and sex-specific biomarkers have promising values in diagnosing MDD.

  18. Multiresidue method for pesticide residue analysis in food of animal and plant origin based on GC or LC and MS or MS/MS. (United States)

    Muñoz, Eva; Muñoz, Gloria; Pineda, Laura; Serrahima, Eulalia; Centrich, Francesc


    A multiresidue method based on GC or LC and MS or MS/MS for the determination of 204 pesticides in diverse food matrixes of animal and plant origin is described. The method can include different stages of cleanup according to the chemical characteristics of each sample. Samples were extracted using accelerated solvent extraction. Those with a high fat content or that contained chlorophyll required further purification by gel permeation chromatography and/or SPE (ENVI-Carb). The methodology developed here was fully validated; the LOQs for the 204 pesticides are presented. The LOQ values lie between 0.01 to 0.02 mg/kg. However, in some cases, mainly in baby food, they were as low as 0.003 mg/kg, thereby meeting European Union requirements on maximum residue levels for pesticides, as outlined in European regulation 396/2005 and the Commission Directive 2003/13/EC. The procedure has been accredited for a wide scope of pesticides and matrixes by the Spanish Accreditation Body (ENAC) following ISO/IEC 17025:2005, as outlined in ENAC technical note NT-19.

  19. Ultraviolet Absorption Induces Hydrogen-Atom Transfer in G⋅C Watson-Crick DNA Base Pairs in Solution. (United States)

    Röttger, Katharina; Marroux, Hugo J B; Grubb, Michael P; Coulter, Philip M; Böhnke, Hendrik; Henderson, Alexander S; Galan, M Carmen; Temps, Friedrich; Orr-Ewing, Andrew J; Roberts, Gareth M


    Ultrafast deactivation pathways bestow photostability on nucleobases and hence preserve the structural integrity of DNA following absorption of ultraviolet (UV) radiation. One controversial recovery mechanism proposed to account for this photostability involves electron-driven proton transfer (EDPT) in Watson-Crick base pairs. The first direct observation is reported of the EDPT process after UV excitation of individual guanine-cytosine (G⋅C) Watson-Crick base pairs by ultrafast time-resolved UV/visible and mid-infrared spectroscopy. The formation of an intermediate biradical species (G[-H]⋅C[+H]) with a lifetime of 2.9 ps was tracked. The majority of these biradicals return to the original G⋅C Watson-Crick pairs, but up to 10% of the initially excited molecules instead form a stable photoproduct G*⋅C* that has undergone double hydrogen-atom transfer. The observation of these sequential EDPT mechanisms across intermolecular hydrogen bonds confirms an important and long debated pathway for the deactivation of photoexcited base pairs, with possible implications for the UV photochemistry of DNA. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  20. Adjusted Wald Confidence Interval for a Difference of Binomial Proportions Based on Paired Data (United States)

    Bonett, Douglas G.; Price, Robert M.


    Adjusted Wald intervals for binomial proportions in one-sample and two-sample designs have been shown to perform about as well as the best available methods. The adjusted Wald intervals are easy to compute and have been incorporated into introductory statistics courses. An adjusted Wald interval for paired binomial proportions is proposed here and…

  1. Effect of protonation on the electronic properties of DNA base pairs: applications for molecular electronics. (United States)

    Mallajosyula, Sairam S; Pati, Swapan K


    Protonation of DNA basepairs is a reversible phenomenon that can be controlled by tuning the pH of the system. Under mild acidic conditions, the hydrogen-bonding pattern of the DNA basepairs undergoes a change. We study the effect of protonation on the electronic properties of the DNA basepairs to probe for possible molecular electronics applications. We find that, under mild acidic pH conditions, the A:T basepair shows excellent rectification behavior that is, however, absent in the G:C basepair. The mechanism of rectification has been discussed using a simple chemical potential model. We also consider the noncanonical A:A basepair and find that it can be used as efficient pH dependent molecular switch. The switching action in the A:A basepair is explained in the light of pi-pi interactions, which lead to efficient delocalization over the entire basepair.

  2. Classification between normal and tumor tissues based on the pair-wise gene expression ratio

    International Nuclear Information System (INIS)

    Yap, YeeLeng; Zhang, XueWu; Ling, MT; Wang, XiangHong; Wong, YC; Danchin, Antoine


    Precise classification of cancer types is critically important for early cancer diagnosis and treatment. Numerous efforts have been made to use gene expression profiles to improve precision of tumor classification. However, reliable cancer-related signals are generally lacking. Using recent datasets on colon and prostate cancer, a data transformation procedure from single gene expression to pair-wise gene expression ratio is proposed. Making use of the internal consistency of each expression profiling dataset this transformation improves the signal to noise ratio of the dataset and uncovers new relevant cancer-related signals (features). The efficiency in using the transformed dataset to perform normal/tumor classification was investigated using feature partitioning with informative features (gene annotation) as discriminating axes (single gene expression or pair-wise gene expression ratio). Classification results were compared to the original datasets for up to 10-feature model classifiers. 82 and 262 genes that have high correlation to tissue phenotype were selected from the colon and prostate datasets respectively. Remarkably, data transformation of the highly noisy expression data successfully led to lower the coefficient of variation (CV) for the within-class samples as well as improved the correlation with tissue phenotypes. The transformed dataset exhibited lower CV when compared to that of single gene expression. In the colon cancer set, the minimum CV decreased from 45.3% to 16.5%. In prostate cancer, comparable CV was achieved with and without transformation. This improvement in CV, coupled with the improved correlation between the pair-wise gene expression ratio and tissue phenotypes, yielded higher classification efficiency, especially with the colon dataset – from 87.1% to 93.5%. Over 90% of the top ten discriminating axes in both datasets showed significant improvement after data transformation. The high classification efficiency achieved suggested

  3. Volume overload cleanup: An approach for on-line SPE-GC, GPC-GC, and GPC-SPE-GC

    NARCIS (Netherlands)

    Kerkdijk, H.; Mol, H.G.J.; Nagel, B. van der


    A new concept for cleanup, based on volume overloading of the cleanup column, has been developed for on-line coupling of gel permeation chromatography (GPC), solid-phase extraction (SPE), or both, to gas chromatography (GC). The principle is outlined and the applicability demonstrated by the

  4. Investigations on therapeutic glucocerebrosidases through paired detection with fluorescent activity-based probes.

    Directory of Open Access Journals (Sweden)

    Wouter W Kallemeijn

    Full Text Available Deficiency of glucocerebrosidase (GBA causes Gaucher disease (GD. In the common non-neuronopathic GD type I variant, glucosylceramide accumulates primarily in the lysosomes of visceral macrophages. Supplementing storage cells with lacking enzyme is accomplished via chronic intravenous administration of recombinant GBA containing mannose-terminated N-linked glycans, mediating the selective uptake by macrophages expressing mannose-binding lectin(s. Two recombinant GBA preparations with distinct N-linked glycans are registered in Europe for treatment of type I GD: imiglucerase (Genzyme, contains predominantly Man(3 glycans, and velaglucerase (Shire PLC Man(9 glycans. Activity-based probes (ABPs enable fluorescent labeling of recombinant GBA preparations through their covalent attachment to the catalytic nucleophile E340 of GBA. We comparatively studied binding and uptake of ABP-labeled imiglucerase and velaglucerase in isolated dendritic cells, cultured human macrophages and living mice, through simultaneous detection of different GBAs by paired measurements. Uptake of ABP-labeled rGBAs by dendritic cells was comparable, as well as the bio-distribution following equimolar intravenous administration to mice. ABP-labeled rGBAs were recovered largely in liver, white-blood cells, bone marrow and spleen. Lungs, brain and skin, affected tissues in severe GD types II and III, were only poorly supplemented. Small, but significant differences were noted in binding and uptake of rGBAs in cultured human macrophages, in the absence and presence of mannan. Mannan-competed binding and uptake were largest for velaglucerase, when determined with single enzymes or as equimolar mixtures of both enzymes. Vice versa, imiglucerase showed more prominent binding and uptake not competed by mannan. Uptake of recombinant GBAs by cultured macrophages seems to involve multiple receptors, including several mannose-binding lectins. Differences among cells from different donors

  5. Web Camera Based Eye Tracking to Assess Visual Memory on a Visual Paired Comparison Task

    Directory of Open Access Journals (Sweden)

    Nicholas T. Bott


    Full Text Available Background: Web cameras are increasingly part of the standard hardware of most smart devices. Eye movements can often provide a noninvasive “window on the brain,” and the recording of eye movements using web cameras is a burgeoning area of research.Objective: This study investigated a novel methodology for administering a visual paired comparison (VPC decisional task using a web camera.To further assess this method, we examined the correlation between a standard eye-tracking camera automated scoring procedure [obtaining images at 60 frames per second (FPS] and a manually scored procedure using a built-in laptop web camera (obtaining images at 3 FPS.Methods: This was an observational study of 54 clinically normal older adults.Subjects completed three in-clinic visits with simultaneous recording of eye movements on a VPC decision task by a standard eye tracker camera and a built-in laptop-based web camera. Inter-rater reliability was analyzed using Siegel and Castellan's kappa formula. Pearson correlations were used to investigate the correlation between VPC performance using a standard eye tracker camera and a built-in web camera.Results: Strong associations were observed on VPC mean novelty preference score between the 60 FPS eye tracker and 3 FPS built-in web camera at each of the three visits (r = 0.88–0.92. Inter-rater agreement of web camera scoring at each time point was high (κ = 0.81–0.88. There were strong relationships on VPC mean novelty preference score between 10, 5, and 3 FPS training sets (r = 0.88–0.94. Significantly fewer data quality issues were encountered using the built-in web camera.Conclusions: Human scoring of a VPC decisional task using a built-in laptop web camera correlated strongly with automated scoring of the same task using a standard high frame rate eye tracker camera.While this method is not suitable for eye tracking paradigms requiring the collection and analysis of fine-grained metrics, such as

  6. Bacteriophage GC1, a Novel Tectivirus Infecting Gluconobacter Cerinus, an Acetic Acid Bacterium Associated with Wine-Making

    Directory of Open Access Journals (Sweden)

    Cécile Philippe


    Full Text Available The Gluconobacter phage GC1 is a novel member of the Tectiviridae family isolated from a juice sample collected during dry white wine making. The bacteriophage infects Gluconobacter cerinus, an acetic acid bacterium which represents a spoilage microorganism during wine making, mainly because it is able to produce ethyl alcohol and transform it into acetic acid. Transmission electron microscopy revealed tail-less icosahedral particles with a diameter of ~78 nm. The linear double-stranded DNA genome of GC1 (16,523 base pairs contains terminal inverted repeats and carries 36 open reading frames, only a handful of which could be functionally annotated. These encode for the key proteins involved in DNA replication (protein-primed family B DNA polymerase as well as in virion structure and assembly (major capsid protein, genome packaging ATPase (adenosine triphosphatase and several minor capsid proteins. GC1 is the first tectivirus infecting an alphaproteobacterial host and is thus far the only temperate tectivirus of gram-negative bacteria. Based on distinctive sequence and life-style features, we propose that GC1 represents a new genus within the Tectiviridae, which we tentatively named “Gammatectivirus”. Furthermore, GC1 helps to bridge the gap in the sequence space between alphatectiviruses and betatectiviruses.

  7. Contact ion pair formation between hard acids and soft bases in aqueous solutions observed with 2DIR spectroscopy. (United States)

    Sun, Zheng; Zhang, Wenkai; Ji, Minbiao; Hartsock, Robert; Gaffney, Kelly J


    The interaction of charged species in aqueous solution has important implications for chemical, biological, and environmental processes. We have used 2DIR spectroscopy to study the equilibrium dynamics of thiocyanate chemical exchange between free ion (NCS(-)) and contact ion pair configurations (MNCS(+)), where M(2+) = Mg(2+) or Ca(2+). Detailed studies of the influence of anion concentration and anion speciation show that the chemical exchange observed with the 2DIR measurements results from NCS(-) exchanging with other anion species in the first solvation shell surrounding Mg(2+) or Ca(2+). The presence of chemical exchange in the 2DIR spectra provides an indirect, but robust, determinant of contact ion pair formation. We observe preferential contact ion pair formation between soft Lewis base anions and hard Lewis acid cations. This observation cannot be easily reconciled with Pearson's acid-base concept or Collins' Law of Matching Water Affinities. The anions that form contact ion pairs also correspond to the ions with an affinity for water and protein surfaces, so similar physical and chemical properties may control these distinct phenomena.

  8. Intense charge transfer surface based on graphene and thymine-Hg(II)-thymine base pairs for detection of Hg(2.). (United States)

    Li, Jiao; Lu, Liping; Kang, Tianfang; Cheng, Shuiyuan


    In this article, we developed an electrochemiluminescence (ECL) sensor with a high-intensity charge transfer interface for Hg(2+) detection based on Hg(II)-induced DNA hybridization. The sensor was fabricated by the following simple method. First, graphene oxide (GO) was electrochemically reduced onto a glassy carbon electrode through cyclic voltammetry. Then, amino-labeled double-stranded (ds)DNA was assembled on the electrode surface using 1-pyrenebutyric acid N-hydroxysuccinimide as a linker between GO and DNA. The other terminal of dsDNA, which was labeled with biotin, was linked to CdSe quantum dots via biotin-avidin interactions. Reduced graphene oxide has excellent electrical conductivity. dsDNA with T-Hg(II)-T base pairs exhibited more facile charge transfer. They both accelerate the electron transfer performance and sensitivity of the sensor. The increased ECL signals were logarithmically linear with the concentration of Hg(II) when Hg(2+) was present in the detection solution. The linear range of the sensor was 10(-11) to 10(-8)mol/L (R=0.9819) with a detection limit of 10(-11)mol/L. This biosensor exhibited satisfactory results when it was used to detect Hg(II) in real water samples. The biosensor with high-intense charge transfer performance is a prospect avenue to pursue more and more sensitive detection method. Copyright © 2015 Elsevier B.V. All rights reserved.

  9. 1,8-Naphthyridine-2,7-diamine: a potential universal reader of Watson-Crick base pairs for DNA sequencing by electron tunneling. (United States)

    Liang, Feng; Lindsay, Stuart; Zhang, Peiming


    With the aid of Density Functional Theory (DFT), we designed 1,8-naphthyridine-2,7-diamine as a recognition molecule to read DNA base pairs for genomic sequencing by electron tunneling. NMR studies show that it can form stable triplets with both A : T and G : C base pairs through hydrogen bonding. Our results suggest that the naphthyridine molecule should be able to function as a universal base pair reader in a tunneling gap, generating distinguishable signatures under electrical bias for each of DNA base pairs.

  10. Mispairs with Watson-Crick base-pair geometry observed in ternary complexes of an RB69 DNA polymerase variant. (United States)

    Xia, Shuangluo; Konigsberg, William H


    Recent structures of DNA polymerase complexes with dGMPCPP/dT and dCTP/dA mispairs at the insertion site have shown that they adopt Watson-Crick geometry in the presence of Mn(2+) indicating that the tautomeric or ionization state of the base has changed. To see whether the tautomeric or ionization state of base-pair could be affected by its microenvironment, we determined 10 structures of an RB69 DNA polymerase quadruple mutant with dG/dT or dT/dG mispairs at position n-1 to n-5 of the Primer/Template duplex. Different shapes of the mispairs, including Watson-Crick geometry, have been observed, strongly suggesting that the local environment of base-pairs plays an important role in their tautomeric or ionization states. © 2014 The Protein Society.

  11. Photon-Pair Sources Based on Intermodal Four-Wave Mixing in Few-Mode Fibers

    Directory of Open Access Journals (Sweden)

    Karsten Rottwitt


    Full Text Available Four-wave mixing in optical fibers has been proven to have many applications within processing of classical optical signals. In addition, recent developments in multimode fibers have made it possible to achieve the necessary phase-matching for efficient four-wave mixing over a very wide bandwidth. Thus, the combination of multimode fiber optics and four-wave mixing is very attractive for various applications. This is especially the case for applications in quantum communication, for example in photon-pair generation. This is the subject of this work, where we discuss the impact of fluctuations in core radius on the quality of the heralded single-photon states and demonstrate experimental results of intermodal spontaneous four-wave mixing for photon-pair generation.

  12. Free energy landscape and transition pathways from Watson–Crick to Hoogsteen base pairing in free duplex DNA (United States)

    Yang, Changwon; Kim, Eunae; Pak, Youngshang


    Houghton (HG) base pairing plays a central role in the DNA binding of proteins and small ligands. Probing detailed transition mechanism from Watson–Crick (WC) to HG base pair (bp) formation in duplex DNAs is of fundamental importance in terms of revealing intrinsic functions of double helical DNAs beyond their sequence determined functions. We investigated a free energy landscape of a free B-DNA with an adenosine–thymine (A–T) rich sequence to probe its conformational transition pathways from WC to HG base pairing. The free energy landscape was computed with a state-of-art two-dimensional umbrella molecular dynamics simulation at the all-atom level. The present simulation showed that in an isolated duplex DNA, the spontaneous transition from WC to HG bp takes place via multiple pathways. Notably, base flipping into the major and minor grooves was found to play an important role in forming these multiple transition pathways. This finding suggests that naked B-DNA under normal conditions has an inherent ability to form HG bps via spontaneous base opening events. PMID:26250116

  13. Free energy landscape and transition pathways from Watson-Crick to Hoogsteen base pairing in free duplex DNA. (United States)

    Yang, Changwon; Kim, Eunae; Pak, Youngshang


    Houghton (HG) base pairing plays a central role in the DNA binding of proteins and small ligands. Probing detailed transition mechanism from Watson-Crick (WC) to HG base pair (bp) formation in duplex DNAs is of fundamental importance in terms of revealing intrinsic functions of double helical DNAs beyond their sequence determined functions. We investigated a free energy landscape of a free B-DNA with an adenosine-thymine (A-T) rich sequence to probe its conformational transition pathways from WC to HG base pairing. The free energy landscape was computed with a state-of-art two-dimensional umbrella molecular dynamics simulation at the all-atom level. The present simulation showed that in an isolated duplex DNA, the spontaneous transition from WC to HG bp takes place via multiple pathways. Notably, base flipping into the major and minor grooves was found to play an important role in forming these multiple transition pathways. This finding suggests that naked B-DNA under normal conditions has an inherent ability to form HG bps via spontaneous base opening events. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

  14. 4D Flexible Atom-Pairs: An efficient probabilistic conformational space comparison for ligand-based virtual screening (United States)


    Background The performance of 3D-based virtual screening similarity functions is affected by the applied conformations of compounds. Therefore, the results of 3D approaches are often less robust than 2D approaches. The application of 3D methods on multiple conformer data sets normally reduces this weakness, but entails a significant computational overhead. Therefore, we developed a special conformational space encoding by means of Gaussian mixture models and a similarity function that operates on these models. The application of a model-based encoding allows an efficient comparison of the conformational space of compounds. Results Comparisons of our 4D flexible atom-pair approach with over 15 state-of-the-art 2D- and 3D-based virtual screening similarity functions on the 40 data sets of the Directory of Useful Decoys show a robust performance of our approach. Even 3D-based approaches that operate on multiple conformers yield inferior results. The 4D flexible atom-pair method achieves an averaged AUC value of 0.78 on the filtered Directory of Useful Decoys data sets. The best 2D- and 3D-based approaches of this study yield an AUC value of 0.74 and 0.72, respectively. As a result, the 4D flexible atom-pair approach achieves an average rank of 1.25 with respect to 15 other state-of-the-art similarity functions and four different evaluation metrics. Conclusions Our 4D method yields a robust performance on 40 pharmaceutically relevant targets. The conformational space encoding enables an efficient comparison of the conformational space. Therefore, the weakness of the 3D-based approaches on single conformations is circumvented. With over 100,000 similarity calculations on a single desktop CPU, the utilization of the 4D flexible atom-pair in real-world applications is feasible. PMID:21733172

  15. Development of a clinician reputation metric to identify appropriate problem-medication pairs in a crowdsourced knowledge base. (United States)

    McCoy, Allison B; Wright, Adam; Rogith, Deevakar; Fathiamini, Safa; Ottenbacher, Allison J; Sittig, Dean F


    Correlation of data within electronic health records is necessary for implementation of various clinical decision support functions, including patient summarization. A key type of correlation is linking medications to clinical problems; while some databases of problem-medication links are available, they are not robust and depend on problems and medications being encoded in particular terminologies. Crowdsourcing represents one approach to generating robust knowledge bases across a variety of terminologies, but more sophisticated approaches are necessary to improve accuracy and reduce manual data review requirements. We sought to develop and evaluate a clinician reputation metric to facilitate the identification of appropriate problem-medication pairs through crowdsourcing without requiring extensive manual review. We retrieved medications from our clinical data warehouse that had been prescribed and manually linked to one or more problems by clinicians during e-prescribing between June 1, 2010 and May 31, 2011. We identified measures likely to be associated with the percentage of accurate problem-medication links made by clinicians. Using logistic regression, we created a metric for identifying clinicians who had made greater than or equal to 95% appropriate links. We evaluated the accuracy of the approach by comparing links made by those physicians identified as having appropriate links to a previously manually validated subset of problem-medication pairs. Of 867 clinicians who asserted a total of 237,748 problem-medication links during the study period, 125 had a reputation metric that predicted the percentage of appropriate links greater than or equal to 95%. These clinicians asserted a total of 2464 linked problem-medication pairs (983 distinct pairs). Compared to a previously validated set of problem-medication pairs, the reputation metric achieved a specificity of 99.5% and marginally improved the sensitivity of previously described knowledge bases. A

  16. Crystal structure of metallo DNA duplex containing consecutive Watson-Crick-like T-Hg(II)-T base pairs. (United States)

    Kondo, Jiro; Yamada, Tom; Hirose, Chika; Okamoto, Itaru; Tanaka, Yoshiyuki; Ono, Akira


    The metallo DNA duplex containing mercury-mediated T-T base pairs is an attractive biomacromolecular nanomaterial which can be applied to nanodevices such as ion sensors. Reported herein is the first crystal structure of a B-form DNA duplex containing two consecutive T-Hg(II)-T base pairs. The Hg(II) ion occupies the center between two T residues. The N3-Hg(II) bond distance is 2.0 Å. The relatively short Hg(II)-Hg(II) distance (3.3 Å) observed in consecutive T-Hg(II)-T base pairs suggests that the metallophilic attraction could exist between them and may stabilize the B-form double helix. To support this, the DNA duplex is largely distorted and adopts an unusual nonhelical conformation in the absence of Hg(II). The structure of the metallo DNA duplex itself and the Hg(II)-induced structural switching from the nonhelical form to the B-form provide the basis for structure-based design of metal-conjugated nucleic acid nanomaterials. Copyright © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  17. Watson-Crick Base Pairing, Electronic and Photophysical Properties of Triazole Modified Adenine Analogues: A Computational Study

    KAUST Repository

    Das, Shubhajit


    We employ first-principles Density Functional Theory (DFT) and time-dependent DFT (TDDFT) to elucidate structural, electronic and optical properties of a few recently reported triazole adenine nucleobase analogues. The results are compared against the findings obtained for both natural adenine nucleobase and available experimental data. The optical absorption of these adenine analogues are calculated both in gas-phase and in solvent (methanol) using Polarized Continuum Model (PCM). We find that all the analogues show a red-shifted absorption profile as compared to adenine. Our simulated emission spectra in solvent compare fairly well with experimentally observed results. We investigate base paring ability of these adenine analogues with thymine. The calculations on the intrinsic stability of these base pairs ascertain that all the adenine analogues form the hydrogen bonded Watson-Crick base pair with similar H-bonding energy as obtained for natural adenine-thymine base pair. In our study, we provide a microscopic origin of the low-energy absorption and emission peaks, observed experimentally.

  18. Watson-Crick Base Pairing, Electronic and Photophysical Properties of Triazole Modified Adenine Analogues: A Computational Study

    KAUST Repository

    Das, Shubhajit; Samanta, Pralok Kumar; Pati, Swapan


    We employ first-principles Density Functional Theory (DFT) and time-dependent DFT (TDDFT) to elucidate structural, electronic and optical properties of a few recently reported triazole adenine nucleobase analogues. The results are compared against the findings obtained for both natural adenine nucleobase and available experimental data. The optical absorption of these adenine analogues are calculated both in gas-phase and in solvent (methanol) using Polarized Continuum Model (PCM). We find that all the analogues show a red-shifted absorption profile as compared to adenine. Our simulated emission spectra in solvent compare fairly well with experimentally observed results. We investigate base paring ability of these adenine analogues with thymine. The calculations on the intrinsic stability of these base pairs ascertain that all the adenine analogues form the hydrogen bonded Watson-Crick base pair with similar H-bonding energy as obtained for natural adenine-thymine base pair. In our study, we provide a microscopic origin of the low-energy absorption and emission peaks, observed experimentally.

  19. Hidden in Plain Sight: Subtle Effects of the 8-Oxoguanine Lesion on the Structure, Dynamics, and Thermodynamics of a 15-Base-Pair Oligodeoxynucleotide Duplex† (United States)

    Crenshaw, Charisse M.; Wade, Jacqueline E.; Arthanari, Haribabu; Frueh, Dominique; Lane, Benjamin F.; Núñez, Megan E.


    The base lesion 8-oxoguanine is formed readily by oxidation of DNA, potentially leading to G→T transversion mutations. Despite the apparent similarity of 8-oxoguanine-cytosine base pairs to normal guanine-cytosine base pairs, cellular base excision repair systems effectively recognize the lesion base. Here we apply several techniques to examine a single 8-oxoguanine lesion at the center of a nonpalindromic 15-mer duplex oligonucleotide in an effort to determine what, if anything, distinguishes an 8-oxoguanine-cytosine base pair from a normal base pair. The lesion duplex is globally almost indistinguishable from the unmodified parent duplex using CD spectroscopy and UV melting thermodynamics. The DNA mismatch-detecting photocleavage agent Rh(bpy)2chrysi3+ cleaves only weakly and nonspecifically, revealing that the 8oxoG-C pair is locally stable at the level of the individual base pairs. NMR spectra are also consistent with a well-conserved B-form duplex structure. In the 2D NOESY spectra, base-sugar and imino-imino crosspeaks are strikingly similar between parent and lesion duplexes. Changes in chemical shift due to the 8oxoG lesion are localized to its complementary cytosine and to the 2–3 base pairs immediately flanking the lesion on the lesion strand. Residues further removed from the lesion are shown to be unperturbed by its presence. Notably, imino exchange experiments indicate that the 8-oxoguanine-cytosine pair is strong and stable, with an apparent equilibrium constant for opening equal to that of other internal guanine-cytosine base pairs, on the order of 10−6. This collection of experiments shows that the 8-oxoguanine-cytosine base pair is incredibly stable and similar to the native pair. PMID:21902242

  20. A Subcarrier-Pair Based Resource Allocation Scheme Using Proportional Fairness for Cooperative OFDM-Based Cognitive Radio Networks (United States)

    Ma, Yongtao; Zhou, Liuji; Liu, Kaihua


    The paper presents a joint subcarrier-pair based resource allocation algorithm in order to improve the efficiency and fairness of cooperative multiuser orthogonal frequency division multiplexing (MU-OFDM) cognitive radio (CR) systems. A communication model where one source node communicates with one destination node assisted by one half-duplex decode-and-forward (DF) relay is considered in the paper. An interference-limited environment is considered, with the constraint of transmitted sum-power over all channels and aggregate average interference towards multiple primary users (PUs). The proposed resource allocation algorithm is capable of maximizing both the system transmission efficiency and fairness among secondary users (SUs). Besides, the proposed algorithm can also keep the interference introduced to the PU bands below a threshold. A proportional fairness constraint is used to assure that each SU can achieve a required data rate, with quality of service guarantees. Moreover, we extend the analysis to the scenario where each cooperative SU has no channel state information (CSI) about non-adjacent links. We analyzed the throughput and fairness tradeoff in CR system. A detailed analysis of the performance of the proposed algorithm is presented with the simulation results. PMID:23939586

  1. Electronic structure of an anticancer drug DC81 and its interaction with DNA base pairs

    Energy Technology Data Exchange (ETDEWEB)

    Tiwari, Gargi, E-mail:; Sharma, Dipendra, E-mail:; Dwivedi, K. K., E-mail: [Department of Physics, DDU Gorakhpur University, Gorakhpur (India); Dwivedi, M. K., E-mail: [Department of Physics, Banaras Hindu University, Varanasi (India)


    The drug, 8-Hydroxy-7-methoxy-pyrrolo-[2,1-c][1,4] benzodiazepine-5-one, commonly christened as DC81 belongs to the pyrrolo-[2,1-c][1,4]benzodiazepine (PBDs) family. It is a member of the group of naturally occurring antitumour antibiotics produced by various Streptomyces species. The antitumour activity of DC81 is attributed to its sequence specific interaction with G-C rich DNA region in particular, for Pu-G-Pu motifs. In the present paper, physico-chemical properties DC81 have been carried out using an ab-initio method, HF/6-31G(d,p) with GAMESS program. MEP, HOMO and LUMO surfaces have been scanned. Ionization potential, electron affinity, electronegativity, global hardness and softness of the drug have been calculated. Further, drug-DNA interactions have been examined using modified second order perturbation theory along with multicentred-multipole expansion technique. Results have been discussed in the light of other theoretical and experimental observations. Efforts have been made to elucidate the binding patterns and thereby biological properties of the drug.

  2. Mahonian pairs


    Sagan, Bruce E.; Savage, Carla D.


    We introduce the notion of a Mahonian pair. Consider the set, P^*, of all words having the positive integers as alphabet. Given finite subsets S,T of P^*, we say that (S,T) is a Mahonian pair if the distribution of the major index, maj, over S is the same as the distribution of the inversion number, inv, over T. So the well-known fact that maj and inv are equidistributed over the symmetric group, S_n, can be expressed by saying that (S_n,S_n) is a Mahonian pair. We investigate various Mahonia...

  3. DNA sequence of 15 base pairs is sufficient to mediate both glucocorticoid and progesterone induction of gene expression

    International Nuclear Information System (INIS)

    Straehle, U.; Klock, G.; Schuetz, G.


    To define the recognition sequence of the glucocorticoid receptor and its relationship with that of the progesterone receptor, oligonucleotides derived from the glucocorticoid response element of the tyrosine aminotransferase gene were tested upstream of a heterologous promoter for their capacity to mediate effects of these two steroids. The authors show that a 15-base-pair sequence with partial symmetry is sufficient to confer glucocorticoid inducibility on the promoter of the herpes simplex virus thymidine kinase gene. The same 15-base-pair sequence mediates induction by progesterone. Point mutations in the recognition sequence affect inducibility by glucocorticoids and progesterone similarly. Together with the strong conservation of the sequence of the DNA-binding domain of the two receptors, these data suggest that both proteins recognize a sequence that is similar, if not the same

  4. A new image reconstruction method for 3-D PET based upon pairs of near-missing lines of response

    Energy Technology Data Exchange (ETDEWEB)

    Kawatsu, Shoji [Department of Radiology, Kyoritu General Hospital, 4-33 Go-bancho, Atsuta-ku, Nagoya-shi, Aichi 456-8611 (Japan) and Department of Brain Science and Molecular Imaging, National Institute for Longevity Sciences, National Center for Geriatrics and Gerontology, 36-3, Gengo Moriaka-cho, Obu-shi, Aichi 474-8522 (Japan)]. E-mail:; Ushiroya, Noboru [Department of General Education, Wakayama National College of Technology, 77 Noshima, Nada-cho, Gobo-shi, Wakayama 644-0023 (Japan)


    We formerly introduced a new image reconstruction method for three-dimensional positron emission tomography, which is based upon pairs of near-missing lines of response. This method uses an elementary geometric property of lines of response, namely that two lines of response which originate from radioactive isotopes located within a sufficiently small voxel, will lie within a few millimeters of each other. The effectiveness of this method was verified by performing a simulation using GATE software and a digital Hoffman phantom.

  5. [Quantum-chemical investigation of tautomerization ways of Watson-Crick DNA base pair guanine-cytosine]. (United States)

    Brovarets', O O; Hovorun, D M


    A novel physico-chemical mechanism of the Watson-Crick DNA base pair Gua.Cyt tautomerization Gua.Cyt*Gua.CytGua*.Cyt (mutagenic tautomers of bases are marked by asterisks) have been revealed and realized in a pathway of single proton transfer through two mutual isoenergetic transition states with Gibbs free energy of activation 30.4 and 30.6 kcal/mol and they are ion pairs stabilized by three (N2H...N3, N1H...N4- and O6+H...N4-) and five (N2H...O2, N1H...O2, N1H...N3, O6+H...N4- and 06+H...N4-) H-bonds accordingly. Stable base pairs Gua-Cyt* and Gua*.Cyt which dissociate comparably easy into monomers have acceptable relative Gibbs energies--12.9 and 14.3 kcal/mol--for the explanation of the nature of the spontaneous transitions of DNA replication. Results are obtained at the MP2/6-311++G(2df,pd)//B3LYP/6-31 1++G(d,p) level of theory in vacuum approach.

  6. An oxygen-vacancy-rich Z-scheme g-C3N4/Pd/TiO2 heterostructure for enhanced visible light photocatalytic performance (United States)

    Guo, Yanru; Xiao, Limin; Zhang, Min; Li, Qiuye; Yang, Jianjun


    An oxygen-vacancy-rich Z-scheme g-C3N4/Pd/TiO2 ternary nanocomposite was fabricated using nanotubular titanic acid as precursors via a simple photo-deposition of Pd nanoparticles and calcination process. The prepared nanocomposites were investigated by X-ray diffraction, transmission electron microscopy, X-ray photoelectron spectroscopy, and UV-visible diffuse reflectance spectroscopy, respectively. For g-C3N4/TiO2 binary nanocomposites, at the optimal content of g-C3N4 (2%), the apparent photocatalytic activity of 2%g-C3N4/TiO2 was 9 times higher than that of pure TiO2 under visible-light illumination. After deposition of Pd (1 wt%) at the contact interface between g-C3N4 and TiO2, the 2%g-C3N4/Pd/TiO2 ternary nanocomposites demonstrated the highest visible-light-driven photocatalytic activity for the degradation of gaseous propylene, which was 16- and 2-fold higher activities than pure TiO2 and 2%g-C3N4/TiO2, respectively. The mechanism for the enhanced photocatalytic performance of the g-C3N4/Pd/TiO2 photo-catalyst is proposed to be based on the efficient separation of photo-generated electron-hole pairs through Z-scheme system, in which uniform dispersity of Pd nanoparticles at contact interface between g-C3N4 and TiO2 and oxygen vacancies promote charge separation.

  7. E. coli mismatch repair enhances AT-to-GC mutagenesis caused by alkylating agents. (United States)

    Nakano, Kota; Yamada, Yoko; Takahashi, Eizo; Arimoto, Sakae; Okamoto, Keinosuke; Negishi, Kazuo; Negishi, Tomoe


    Alkylating agents are known to induce the formation of O 6 -alkylguanine (O 6 -alkG) and O 4 -alkylthymine (O 4 -alkT) in DNA. These lesions have been widely investigated as major sources of mutations. We previously showed that mismatch repair (MMR) facilitates the suppression of GC-to-AT mutations caused by O 6 -methylguanine more efficiently than the suppression of GC-to-AT mutations caused by O 6 -ethylguanine. However, the manner by which O 4 -alkyT lesions are repaired remains unclear. In the present study, we investigated the repair pathway involved in the repair of O 4 -alkT. The E. coli CC106 strain, which harbors Δprolac in its genomic DNA and carries the F'CC106 episome, can be used to detect AT-to-GC reverse-mutation of the gene encoding β-galactosidase. Such AT-to-GC mutations should be induced through the formation of O 4 -alkT at AT base pairs. As expected, an O 6 -alkylguanine-DNA alkyltransferase (AGT) -deficient CC106 strain, which is defective in both ada and agt genes, exhibited elevated mutant frequencies in the presence of methylating agents and ethylating agents. However, in the UvrA-deficient strain, the methylating agents were less mutagenic than in wild-type, while ethylating agents were more mutagenic than in wild-type, as observed with agents that induce O 6 -alkylguanine modifications. Unexpectedly, the mutant frequencies decreased in a MutS-deficient strain, and a similar tendency was observed in MutL- or MutH-deficient strains. Thus, MMR appears to promote mutation at AT base pairs. Similar results were obtained in experiments employing double-mutant strains harboring defects in both MMR and AGT, or MMR and NER. E. coli MMR enhances AT-to-GC mutagenesis, such as that caused by O 4 -alkylthymine. We hypothesize that the MutS protein recognizes the O 4 -alkT:A base pair more efficiently than O 4 -alkT:G. Such a distinction would result in misincorporation of G at the O 4 -alkT site, followed by higher mutation frequencies in wild

  8. Benchmark studies on the building blocks of DNA. 3. Watson-Crick and stacked base pairs. (United States)

    Szalay, Péter G; Watson, Thomas; Perera, Ajith; Lotrich, Victor; Bartlett, Rodney J


    Excited states of stacked adenine-thymine and guanine-cytosine pairs as well as the Watson-Crick pair of guanine-thymine have been investigated using the equation of motion coupled-cluster (EOM-CC) method with single and double as well as approximate triple excitations. Transitions have been assigned, and the form of the excitations has been analyzed. The majority of the excitations could be classified as localized on the nucleobases, but for all three studied systems, charge-transfer (CT) transitions could also be identified. The main aim of this study was to compare the performance of lower-level methods (ADC(2) and TDDFT) to the high-level EOM-CC ones. It was shown that both ADC(2) and TDDFT with long-range correction have nonsystematic error in excitation energies, causing alternation of the energetic ordering of the excitations. Considering the high costs of the EOM-CC calculations, there is a need for reliable new approximate methods.

  9. Weighted profile likelihood-based confidence interval for the difference between two proportions with paired binomial data. (United States)

    Pradhan, Vivek; Saha, Krishna K; Banerjee, Tathagata; Evans, John C


    Inference on the difference between two binomial proportions in the paired binomial setting is often an important problem in many biomedical investigations. Tang et al. (2010, Statistics in Medicine) discussed six methods to construct confidence intervals (henceforth, we abbreviate it as CI) for the difference between two proportions in paired binomial setting using method of variance estimates recovery. In this article, we propose weighted profile likelihood-based CIs for the difference between proportions of a paired binomial distribution. However, instead of the usual likelihood, we use weighted likelihood that is essentially making adjustments to the cell frequencies of a 2 × 2 table in the spirit of Agresti and Min (2005, Statistics in Medicine). We then conduct numerical studies to compare the performances of the proposed CIs with that of Tang et al. and Agresti and Min in terms of coverage probabilities and expected lengths. Our numerical study clearly indicates that the weighted profile likelihood-based intervals and Jeffreys interval (cf. Tang et al.) are superior in terms of achieving the nominal level, and in terms of expected lengths, they are competitive. Finally, we illustrate the use of the proposed CIs with real-life examples. Copyright © 2014 John Wiley & Sons, Ltd.

  10. Uncertainty evaluation for three-dimensional scanning electron microscope reconstructions based on the stereo-pair technique

    International Nuclear Information System (INIS)

    Carli, L; Cantatore, A; De Chiffre, L; Genta, G; Barbato, G; Levi, R


    3D-SEM is a method, based on the stereophotogrammetry technique, which obtains three-dimensional topographic reconstructions starting typically from two SEM images, called the stereo-pair. In this work, a theoretical uncertainty evaluation of the stereo-pair technique, according to GUM (Guide to the Expression of Uncertainty in Measurement), was carried out, considering 3D-SEM reconstructions of a wire gauge with a reference diameter of 250 µm. Starting from the more commonly used tilting strategy, one based on the item rotation inside the SEM chamber was also adopted. The latter enables multiple-view reconstructions of the cylindrical item under consideration. Uncertainty evaluation was performed starting from a modified version of the Piazzesi equation, enabling the calculation of the z-coordinate from a given stereo-pair. The metrological characteristics of each input variable have been taken into account and a SEM stage calibration has been performed. Uncertainty tables for the cases of tilt and rotation were then produced, leading to the calculation of expanded uncertainty. For the case of rotation, the largest uncertainty contribution resulted to be the rotational angle; however, for the case of tilt it resulted to be the pixel size. A relative expanded uncertainty equal to 5% and 4% was obtained for the case of rotation and tilt, respectively

  11. Ni2+-binding RNA motifs with an asymmetric purine-rich internal loop and a G-A base pair. (United States)

    Hofmann, H P; Limmer, S; Hornung, V; Sprinzl, M


    RNA molecules with high affinity for immobilized Ni2+ were isolated from an RNA pool with 50 randomized positions by in vitro selection-amplification. The selected RNAs preferentially bind Ni2+ and Co2+ over other cations from first series transition metals. Conserved structure motifs, comprising about 15 nt, were identified that are likely to represent the Ni2+ binding sites. Two conserved motifs contain an asymmetric purine-rich internal loop and probably a mismatch G-A base pair. The structure of one of these motifs was studied with proton NMR spectroscopy and formation of the G-A pair at the junction of helix and internal loop was demonstrated. Using Ni2+ as a paramagnetic probe, a divalent metal ion binding site near this G-A base pair was identified. Ni2+ ions bound to this motif exert a specific stabilization effect. We propose that small asymmetric purine-rich loops that contain a G-A interaction may represent a divalent metal ion binding site in RNA. PMID:9409620

  12. Alpha–beta monitoring system based on pair of simultaneous Multi-Wire Proportional Counters

    Energy Technology Data Exchange (ETDEWEB)

    Wengrowicz, U.; Amidan, D. [Department of Nuclear Engineering, Ben Gurion University of the Negev, Beer-Sheva 84105 (Israel); NRC-Negev, P.O. Box 9001, Beer-Sheva 84190 (Israel); Orion, I. [Department of Nuclear Engineering, Ben Gurion University of the Negev, Beer-Sheva 84105 (Israel)


    A new approach for a simultaneous alpha–beta Multi-wire Proportional Counter (MWPC) is presented. The popular approach for alpha–beta monitoring systems consists of a large area MWPC using noble gas flow such as Argon Methane. This method of measurement is effective but requires large-scale and expensive maintenance due to the needs of gas flow control and periodic replacements. In this work, a pair of simultaneous MWPCs for alpha–beta measuring is presented. The developed detector consists of a sealed gas MWPC sensor for beta particles, behind a free air alpha sensor. This approach allows effective simultaneous detection and discrimination of both alpha and beta radiation without the maintenance cost noble gas flow required for unsealed detectors.

  13. Determining degree of roasting in cocoa beans by artificial neural network (ANN)-based electronic nose system and gas chromatography/mass spectrometry (GC/MS). (United States)

    Tan, Juzhong; Kerr, William L


    Roasting is a critical step in chocolate processing, where moisture content is decreased and unique flavors and texture are developed. The determination of the degree of roasting in cocoa beans is important to ensure the quality of chocolate. Determining the degree of roasting relies on human specialists or sophisticated chemical analyses that are inaccessible to small manufacturers and farmers. In this study, an electronic nose system was constructed consisting of an array of gas sensors and used to detect volatiles emanating from cocoa beans roasted for 0, 20, 30 and 40 min. The several signals were used to train a three-layer artificial neural network (ANN). Headspace samples were also analyzed by gas chromatography/mass spectrometry (GC/MS), with 23 select volatiles used to train a separate ANN. Both ANNs were used to predict the degree of roasting of cocoa beans. The electronic nose had a prediction accuracy of 94.4% using signals from sensors TGS 813, 826, 822, 830, 830, 2620, 2602 and 2610. In comparison, the GC/MS predicted the degree of roasting with an accuracy of 95.8%. The electronic nose system is able to predict the extent of roasting, as well as a more sophisticated approach using GC/MS. © 2018 Society of Chemical Industry. © 2018 Society of Chemical Industry.

  14. Effect of Watson-Crick and Hoogsteen base pairing on the conformational stability of C8-phenoxyl-2'-deoxyguanosine adducts. (United States)

    Millen, Andrea L; Churchill, Cassandra D M; Manderville, Richard A; Wetmore, Stacey D


    Bulky DNA addition products (adducts) formed through attack at the C8 site of guanine can adopt the syn orientation about the glycosidic bond due to changes in conformational stability or hydrogen-bonding preferences directly arising from the bulky group. Indeed, the bulky substituent may improve the stability of (non-native) Hoogsteen pairs. Therefore, such adducts often result in mutations upon DNA replication. This work examines the hydrogen-bonded pairs between the Watson-Crick and Hoogsteen faces of the ortho or para C8-phenoxyl-2'-deoxyguanosine adduct and each natural (undamaged) nucleobase with the goal to clarify the conformational preference of this type of damage, as well as provide insight into the likelihood of subsequent mutation events. B3LYP/6-311+G(2df,p)//B3LYP/6-31G(d) hydrogen-bond strengths were determined using both nucleobase and nucleoside models for adduct pairs, as well as the corresponding complexes involving natural 2'-deoxyguanosine. In addition to the magnitude of the binding strengths, the R(C1'···C1') distances and ∠(N9C1'C1') angles, as well as the degree of propeller-twist and buckle distortions, were carefully compared to the values observed in natural DNA strands. Due to structural changes in the adduct monomer upon inclusion of the sugar moiety, the monomer deformation energy significantly affects the relative hydrogen-bond strengths calculated with the nucleobase and nucleoside models. Therefore, we recommend the use of at least a nucleoside model to accurately evaluate hydrogen-bond strengths of base pairs involving flexible, bulky nucleobase adducts. Our results also emphasize the importance of considering both the magnitude of the hydrogen-bond strength and the structure of the base pair when predicting the preferential binding patterns of nucleobases. Using our best models, we conclude that the Watson-Crick face of the ortho phenoxyl adduct forms significantly more stable complexes than the Hoogsteen face, which

  15. A fully synthetic human Fab antibody library based on fixed VH/VL framework pairings with favorable biophysical properties (United States)

    Tiller, Thomas; Schuster, Ingrid; Deppe, Dorothée; Siegers, Katja; Strohner, Ralf; Herrmann, Tanja; Berenguer, Marion; Poujol, Dominique; Stehle, Jennifer; Stark, Yvonne; Heßling, Martin; Daubert, Daniela; Felderer, Karin; Kaden, Stefan; Kölln, Johanna; Enzelberger, Markus; Urlinger, Stefanie


    This report describes the design, generation and testing of Ylanthia, a fully synthetic human Fab antibody library with 1.3E+11 clones. Ylanthia comprises 36 fixed immunoglobulin (Ig) variable heavy (VH)/variable light (VL) chain pairs, which cover a broad range of canonical complementarity-determining region (CDR) structures. The variable Ig heavy and Ig light (VH/VL) chain pairs were selected for biophysical characteristics favorable to manufacturing and development. The selection process included multiple parameters, e.g., assessment of protein expression yield, thermal stability and aggregation propensity in fragment antigen binding (Fab) and IgG1 formats, and relative Fab display rate on phage. The framework regions are fixed and the diversified CDRs were designed based on a systematic analysis of a large set of rearranged human antibody sequences. Care was taken to minimize the occurrence of potential posttranslational modification sites within the CDRs. Phage selection was performed against various antigens and unique antibodies with excellent biophysical properties were isolated. Our results confirm that quality can be built into an antibody library by prudent selection of unmodified, fully human VH/VL pairs as scaffolds. PMID:23571156

  16. Return and Risk of Pairs Trading Using a Simulation-Based Bayesian Procedure for Predicting Stable Ratios of Stock Prices

    Directory of Open Access Journals (Sweden)

    David Ardia


    Full Text Available We investigate the direct connection between the uncertainty related to estimated stable ratios of stock prices and risk and return of two pairs trading strategies: a conditional statistical arbitrage method and an implicit arbitrage one. A simulation-based Bayesian procedure is introduced for predicting stable stock price ratios, defined in a cointegration model. Using this class of models and the proposed inferential technique, we are able to connect estimation and model uncertainty with risk and return of stock trading. In terms of methodology, we show the effect that using an encompassing prior, which is shown to be equivalent to a Jeffreys’ prior, has under an orthogonal normalization for the selection of pairs of cointegrated stock prices and further, its effect for the estimation and prediction of the spread between cointegrated stock prices. We distinguish between models with a normal and Student t distribution since the latter typically provides a better description of daily changes of prices on financial markets. As an empirical application, stocks are used that are ingredients of the Dow Jones Composite Average index. The results show that normalization has little effect on the selection of pairs of cointegrated stocks on the basis of Bayes factors. However, the results stress the importance of the orthogonal normalization for the estimation and prediction of the spread—the deviation from the equilibrium relationship—which leads to better results in terms of profit per capital engagement and risk than using a standard linear normalization.

  17. Splitting efficiency and interference effects in a Cooper pair splitter based on a triple quantum dot with ferromagnetic contacts (United States)

    Bocian, Kacper; Rudziński, Wojciech; Weymann, Ireneusz


    We theoretically study the spin-resolved subgap transport properties of a Cooper pair splitter based on a triple quantum dot attached to superconducting and ferromagnetic leads. Using the Keldysh Green's function formalism, we analyze the dependence of the Andreev conductance, Cooper pair splitting efficiency, and tunnel magnetoresistance on the gate and bias voltages applied to the system. We show that the system's transport properties are strongly affected by spin dependence of tunneling processes and quantum interference between different local and nonlocal Andreev reflections. We also study the effects of finite hopping between the side quantum dots on the Andreev current. This allows for identifying the optimal conditions for enhancing the Cooper pair splitting efficiency of the device. We find that the splitting efficiency exhibits a nonmonotonic dependence on the degree of spin polarization of the leads and the magnitude and type of hopping between the dots. An almost perfect splitting efficiency is predicted in the nonlinear response regime when the energies of the side quantum dots are tuned to the energies of the corresponding Andreev bound states. In addition, we analyzed features of the tunnel magnetoresistance (TMR) for a wide range of the gate and bias voltages, as well as for different model parameters, finding the corresponding sign changes of the TMR in certain transport regimes. The mechanisms leading to these effects are thoroughly discussed.

  18. Graphitic carbon nitride based nanocomposites: a review (United States)

    Zhao, Zaiwang; Sun, Yanjuan; Dong, Fan


    Graphitic carbon nitride (g-C3N4), as an intriguing earth-abundant visible light photocatalyst, possesses a unique two-dimensional structure, excellent chemical stability and tunable electronic structure. Pure g-C3N4 suffers from rapid recombination of photo-generated electron-hole pairs resulting in low photocatalytic activity. Because of the unique electronic structure, the g-C3N4 could act as an eminent candidate for coupling with various functional materials to enhance the performance. According to the discrepancies in the photocatalytic mechanism and process, six primary systems of g-C3N4-based nanocomposites can be classified and summarized: namely, the g-C3N4 based metal-free heterojunction, the g-C3N4/single metal oxide (metal sulfide) heterojunction, g-C3N4/composite oxide, the g-C3N4/halide heterojunction, g-C3N4/noble metal heterostructures, and the g-C3N4 based complex system. Apart from the depiction of the fabrication methods, heterojunction structure and multifunctional application of the g-C3N4-based nanocomposites, we emphasize and elaborate on the underlying mechanisms in the photocatalytic activity enhancement of g-C3N4-based nanocomposites. The unique functions of the p-n junction (semiconductor/semiconductor heterostructures), the Schottky junction (metal/semiconductor heterostructures), the surface plasmon resonance (SPR) effect, photosensitization, superconductivity, etc. are utilized in the photocatalytic processes. Furthermore, the enhanced performance of g-C3N4-based nanocomposites has been widely employed in environmental and energetic applications such as photocatalytic degradation of pollutants, photocatalytic hydrogen generation, carbon dioxide reduction, disinfection, and supercapacitors. This critical review ends with a summary and some perspectives on the challenges and new directions in exploring g-C3N4-based advanced nanomaterials.

  19. Hydroxylamine and methoxyamine mutagenesis: displacement of the tautomeric equilibrium of the promutagen N6-methoxyadenosine by complementary base pairing. (United States)

    Stolarski, R; Kierdaszuk, B; Hagberg, C E; Shugar, D


    The imino-amino tautomeric equilibrium of the promutagenic adenosine analogue N6-methoxy-2',3',5'-tri-O-methyladenosine [OMe6A(Me)3], in solvents of various polarities, has been studied with the aid of 1H and 13C NMR spectroscopy. The high energy barrier (free enthalpy delta G = 80 +/- 5 kJ X mol-1) between the two tautomeric species renders possible direct observation of the independent sets of all 1H and 13C signals from each of them. The equilibrium ranges from 10% imino in CCl4 to 90% in aqueous medium. Thermodynamic parameters, including energy barriers and lifetimes, were calculated from the temperature dependence of the equilibrium. Essentially similar results prevail for the promutagenic N6-hydroxy analogue. The conformations of the sugar moieties, and of the base about the glycosidic bond, for both tautomers are similar to those for adenosine. The conformation of the exocyclic N6-OCH3 group, which determines the ability of each species to form planar associates (hydrogen-bonded base pairs), has also been evaluated. Formation of autoassociates of OMe6A(Me)3 and of heteroassociates with the potentially complementary 2',3',5'-tri-O-methyluridine and -cytidine, in chloroform solution, was also investigated. The amino form base pairs with uridine and the imino form with cytidine. Formation of a complementary base pair by a given tautomeric species was accompanied by an increase of up to 10% in the population of this species and a concomitant decrease in population of the other species.(ABSTRACT TRUNCATED AT 250 WORDS)

  20. Structural variability and the nature of intermolecular interactions in Watson-Crick B-DNA base pairs. (United States)

    Czyznikowska, Z; Góra, R W; Zaleśny, R; Lipkowski, P; Jarzembska, K N; Dominiak, P M; Leszczynski, J


    A set of nearly 100 crystallographic structures was analyzed using ab initio methods in order to verify the effect of the conformational variability of Watson-Crick guanine-cytosine and adenine-thymine base pairs on the intermolecular interaction energy and its components. Furthermore, for the representative structures, a potential energy scan of the structural parameters describing mutual orientation of the base pairs was carried out. The results were obtained using the hybrid variational-perturbational interaction energy decomposition scheme. The electron correlation effects were estimated by means of the second-order Møller-Plesset perturbation theory and coupled clusters with singles and doubles method adopting AUG-cc-pVDZ basis set. Moreover, the characteristics of hydrogen bonds in complexes, mimicking those appearing in B-DNA, were evaluated using topological analysis of the electron density. Although the first-order electrostatic energy is usually the largest stabilizing component, it is canceled out by the associated exchange repulsion in majority of the studied crystallographic structures. Therefore, the analyzed complexes of the nucleic acid bases appeared to be stabilized mainly by the delocalization component of the intermolecular interaction energy which, in terms of symmetry adapted perturbation theory, encompasses the second- and higher-order induction and exchange-induction terms. Furthermore, it was found that the dispersion contribution, albeit much smaller in terms of magnitude, is also a vital stabilizing factor. It was also revealed that the intermolecular interaction energy and its components are strongly influenced by four (out of six) structural parameters describing mutual orientation of bases in Watson-Crick pairs, namely shear, stagger, stretch, and opening. Finally, as a part of a model study, much of the effort was devoted to an extensive testing of the UBDB databank. It was shown that the databank quite successfully reproduces the

  1. A dynamically tunable plasmonic multi-functional device based on graphene nano-sheet pair arrays (United States)

    Wang, Wei; Meng, Zhao; Liang, Ruisheng; Chen, Shijie; Ding, Li; Wang, Faqiang; Liu, Hongzhan; Meng, Hongyun; Wei, Zhongchao


    Dynamically tunable plasmonic multi-functional is particularly desirable for various nanotechnological applications. In this paper, graphene nano-sheet pair arrays separated by a substrate, which can act as a dynamically tunable plasmonic band stop filter with transmission at resonance wavelength lower than 1%, a high sensitivity refractive index sensor with sensitivity up to 4879 nm/RIU, figure of merit of 40.66 and a two circuit optical switch with the modulation depth up to 0.998, are proposed and numerically investigated. These excellent optical performances are calculated by using FDTD numerical modeling and theoretical deduction. Simulation results show that a slight variation of chemical potential of the graphene nano-sheet can achieve significant resonance wavelength shifts. In additional, the resonance wavelength and transmission of this plasmonic device can be tuned easily by two voltages owing to the simple patterned graphene. These studies may have great potential in fabrication of multi-functional and dynamically tunable optoelectronic integrated devices.

  2. Knowledge-based errors in anesthesia: a paired, controlled trial of learning and retention. (United States)

    Goldhaber-Fiebert, Sara N; Goldhaber-Fiebert, Jeremy D; Rosow, Carl E


    Optimizing patient safety by improving the training of physicians is a major challenge of medical education. In this pilot study, we hypothesized that a brief lecture, targeted to rare but potentially dangerous situations, could improve anesthesia practitioners' knowledge levels with significant retention of learning at six months. In this paired controlled trial, anesthesia residents and attending physicians at Massachusetts General Hospital took the same 14-question multiple choice examination three times: at baseline, immediately after a brief lecture, and six months later. The lecture covered material on seven "intervention" questions; the remaining seven were "control" questions. The authors measured immediate knowledge acquisition, defined as the change in percentage of correct answers on intervention questions between baseline and post-lecture, and measured learning retention as the difference between baseline and six months. Both measurements were corrected for change in performance on control questions. Fifty of the 89 subjects completed all three examinations. The post-lecture increase in percentage of questions answered correctly, adjusted for control, was 22.2% [95% confidence interval (CI) 16.0-28.4%; P learning at six months. Exposing residents or other practitioners to this type of inexpensive teaching intervention may help them to avoid preventable uncommon errors that are rooted in unfamiliarity with the situation or the equipment. The methods used for this study may also be applied to compare the effect of various other teaching modalities while, at the same time, preserving participant anonymity and making adjustments for ongoing learning.

  3. The effect of chemical modification of DNA base on binding of Hg-II and Ag-I in metal-mediated base pairs

    Czech Academy of Sciences Publication Activity Database

    Šebera, Jakub; Tanaka, Y.; Ono, A.; Sychrovský, Vladimír


    Roč. 452, Oct 1 (2016), s. 199-204 ISSN 0020-1693 R&D Projects: GA ČR GA13-27676S Institutional support: RVO:61388963 Keywords : DFT * metal-mediated base pairs * Hg * Ag Subject RIV: CF - Physical ; Theoretical Chemistry Impact factor: 2.002, year: 2016

  4. Dissociation of single-strand DNA: single-walled carbon nanotube hybrids by Watson-Crick base-pairing. (United States)

    Jung, Seungwon; Cha, Misun; Park, Jiyong; Jeong, Namjo; Kim, Gunn; Park, Changwon; Ihm, Jisoon; Lee, Junghoon


    It has been known that single-strand DNA wraps around a single-walled carbon nanotube (SWNT) by pi-stacking. In this paper it is demonstrated that such DNA is dissociated from the SWNT by Watson-Crick base-pairing with a complementary sequence. Measurement of field effect transistor characteristics indicates a shift of the electrical properties as a result of this "unwrapping" event. We further confirm the suggested process through Raman spectroscopy and gel electrophoresis. Experimental results are verified in view of atomistic mechanisms with molecular dynamics simulations and binding energy analyses.

  5. Design of a rotary dielectric elastomer actuator using a topology optimization method based on pairs of curves (United States)

    Wang, Nianfeng; Guo, Hao; Chen, Bicheng; Cui, Chaoyu; Zhang, Xianmin


    Dielectric elastomers (DE), known as electromechanical transducers, have been widely used in the field of sensors, generators, actuators and energy harvesting for decades. A large number of DE actuators including bending actuators, linear actuators and rotational actuators have been designed utilizing an experience design method. This paper proposes a new method for the design of DE actuators by using a topology optimization method based on pairs of curves. First, theoretical modeling and optimization design are discussed, after which a rotary dielectric elastomer actuator has been designed using this optimization method. Finally, experiments and comparisons between several DE actuators have been made to verify the optimized result.

  6. Method for the determination of natural ester-type gum bases used as food additives via direct analysis of their constituent wax esters using high-temperature GC/MS (United States)

    Tada, Atsuko; Ishizuki, Kyoko; Yamazaki, Takeshi; Sugimoto, Naoki; Akiyama, Hiroshi


    Natural ester-type gum bases, which are used worldwide as food additives, mainly consist of wax esters composed of long-chain fatty acids and long-chain fatty alcohols. There are many varieties of ester-type gum bases, and thus a useful method for their discrimination is needed in order to establish official specifications and manage their quality control. Herein is reported a rapid and simple method for the analysis of different ester-type gum bases used as food additives by high-temperature gas chromatography/mass spectrometry (GC/MS). With this method, the constituent wax esters in ester-type gum bases can be detected without hydrolysis and derivatization. The method was applied to the determination of 10 types of gum bases, including beeswax, carnauba wax, lanolin, and jojoba wax, and it was demonstrated that the gum bases derived from identical origins have specific and characteristic total ion chromatogram (TIC) patterns and ester compositions. Food additive gum bases were thus distinguished from one another based on their TIC patterns and then more clearly discriminated using simultaneous monitoring of the fragment ions corresponding to the fatty acid moieties of the individual molecular species of the wax esters. This direct high-temperature GC/MS method was shown to be very useful for the rapid and simple discrimination of varieties of ester-type gum bases used as food additives. PMID:25473499

  7. Method for the determination of natural ester-type gum bases used as food additives via direct analysis of their constituent wax esters using high-temperature GC/MS. (United States)

    Tada, Atsuko; Ishizuki, Kyoko; Yamazaki, Takeshi; Sugimoto, Naoki; Akiyama, Hiroshi


    Natural ester-type gum bases, which are used worldwide as food additives, mainly consist of wax esters composed of long-chain fatty acids and long-chain fatty alcohols. There are many varieties of ester-type gum bases, and thus a useful method for their discrimination is needed in order to establish official specifications and manage their quality control. Herein is reported a rapid and simple method for the analysis of different ester-type gum bases used as food additives by high-temperature gas chromatography/mass spectrometry (GC/MS). With this method, the constituent wax esters in ester-type gum bases can be detected without hydrolysis and derivatization. The method was applied to the determination of 10 types of gum bases, including beeswax, carnauba wax, lanolin, and jojoba wax, and it was demonstrated that the gum bases derived from identical origins have specific and characteristic total ion chromatogram (TIC) patterns and ester compositions. Food additive gum bases were thus distinguished from one another based on their TIC patterns and then more clearly discriminated using simultaneous monitoring of the fragment ions corresponding to the fatty acid moieties of the individual molecular species of the wax esters. This direct high-temperature GC/MS method was shown to be very useful for the rapid and simple discrimination of varieties of ester-type gum bases used as food additives.

  8. Optimization of the Municipal Waste Collection Route Based on the Method of the Minimum Pairing

    Directory of Open Access Journals (Sweden)

    Michal Petřík


    Full Text Available In the present article is shown the use of Maple program for processing of data describing the position of municipal waste sources and topology of collecting area. The data are further processed through the use of graph theory algorithms, which enable creation of collection round proposal. In this case study is described method of waste pick-up solution in a certain village of approx. 1,600 inhabitants and built-up area of approx. 30 hectares. Village has approx. 11.5 kilometers of ride able routes, with approx. 1 kilometer without waste source. The first part shows topology of the village in light of location of waste sources and capacity of the routes. In the second part are topological data converted into data that can be processed by use of the Graph Theory and the correspondent graph is shown. Optimizing collection route in a certain graph means to find the Euler circle. However, this circle can be constructed only on condition that all the vertices of the graph are of an even degree. Practically this means that is necessary to introduce auxiliary edges – paths that will be passed twice. These paths will connect vertices with odd values. The optimal solution then requires that the total length of the inserted edges was minimal possible, which corresponds to the minimum pairing method. As it is a problem of exponential complexity, it is necessary to make some simplifications. These simplifications are depicted graphically and the results are displayed in the conclusion. The resulting graph with embedded auxiliary edges can be used as a basic decision making material for creation of real collection round that respects local limitations such as one way streets or streets where is the waste collection is not possible from both sides at the same time.

  9. Effect of single interstitial impurity in iron-based superconductors with sign-changed s-wave pairing symmetry

    Energy Technology Data Exchange (ETDEWEB)

    Yu, Xiang-Long, E-mail: [Key Laboratory of Materials Physics, Institute of Solid State Physics, Chinese Academy of Sciences, P. O. Box 1129, Hefei 230031 (China); Liu, Da-Yong; Quan, Ya-Min; Zheng, Xiao-Jun [Key Laboratory of Materials Physics, Institute of Solid State Physics, Chinese Academy of Sciences, P. O. Box 1129, Hefei 230031 (China); Zou, Liang-Jian, E-mail: [Key Laboratory of Materials Physics, Institute of Solid State Physics, Chinese Academy of Sciences, P. O. Box 1129, Hefei 230031 (China); Department of Physics, University of Science and Technology of China, Hefei 230026 (China)


    Highlights: • Effects of single interstitial impurity are studied in iron-based superconductors. • Bound states within the superconducting gap can be induced. • The interstitial impurity can induce a π phase shift of pairing order parameter. • For strong magnetic scattering the bound-state peak can appear at the Fermi level. - Abstract: We employ the self-consistent Bogoliubov-de Gennes (BdG) formulation to investigate the effect of single interstitial nonmagnetic/magnetic impurity in iron-based superconductors with s ± -wave pairing symmetry. We find that both the nonmagnetic and magnetic impurities can induce bound states within the superconducting (SC) gap and a π phase shift of SC order parameter at the impurity site. However, different from the interstitial-nonmagnetic-impurity case characterized by two symmetric peaks with respect to zero energy, the interstitial magnetic one only induces single bound-state peak. In the strong scattering regime this peak can appear at the Fermi level, which has been observed in the recent scanning tunneling microscope (STM) experiment of Fe(Te,Se) superconductor with interstitial Fe impurities (Yin et al. 2015 [44]). This novel single in-gap peak feature also distinguishes the interstitial case from the substitutional one with two peaks. These results provide important information for comparing the different impurity effects in the iron-based superconductors.

  10. Accurate classification of brain gliomas by discriminate dictionary learning based on projective dictionary pair learning of proton magnetic resonance spectra. (United States)

    Adebileje, Sikiru Afolabi; Ghasemi, Keyvan; Aiyelabegan, Hammed Tanimowo; Saligheh Rad, Hamidreza


    Proton magnetic resonance spectroscopy is a powerful noninvasive technique that complements the structural images of cMRI, which aids biomedical and clinical researches, by identifying and visualizing the compositions of various metabolites within the tissues of interest. However, accurate classification of proton magnetic resonance spectroscopy is still a challenging issue in clinics due to low signal-to-noise ratio, overlapping peaks of metabolites, and the presence of background macromolecules. This paper evaluates the performance of a discriminate dictionary learning classifiers based on projective dictionary pair learning method for brain gliomas proton magnetic resonance spectroscopy spectra classification task, and the result were compared with the sub-dictionary learning methods. The proton magnetic resonance spectroscopy data contain a total of 150 spectra (74 healthy, 23 grade II, 23 grade III, and 30 grade IV) from two databases. The datasets from both databases were first coupled together, followed by column normalization. The Kennard-Stone algorithm was used to split the datasets into its training and test sets. Performance comparison based on the overall accuracy, sensitivity, specificity, and precision was conducted. Based on the overall accuracy of our classification scheme, the dictionary pair learning method was found to outperform the sub-dictionary learning methods 97.78% compared with 68.89%, respectively. Copyright © 2016 John Wiley & Sons, Ltd. Copyright © 2016 John Wiley & Sons, Ltd.

  11. Assessment of anti-inflammatory and anti-arthritic properties of Acmella uliginosa (Sw. Cass. based on experiments in arthritic rat models and qualitative GC/MS analyses.

    Directory of Open Access Journals (Sweden)

    Subhashis Paul


    of AU and AV showed the best recovery potential in all the studied parameters, confirming the synergistic efficacy of the herbal formulation. GC/MS analyses revealed the presence of at least 5 anti-inflammatory compounds including 9-octadecenoic acid (Z-, phenylmethyl ester, astaxanthin, à-N-Normethadol, fenretinide that have reported anti-inflammatory/anti-arthritic properties. Conclusion: Our findings indicated that the crude flower homogenate of AU contains potential anti-inflammatory compounds which could be used as an anti-inflammatory/anti-arthritic medication. [J Complement Med Res 2016; 5(3.000: 257-262

  12. Retention of nucleic acids in ion-pair reversed-phase high-performance liquid chromatography depends not only on base composition but also on base sequence. (United States)

    Qiao, Jun-Qin; Liang, Chao; Wei, Lan-Chun; Cao, Zhao-Ming; Lian, Hong-Zhen


    The study on nucleic acid retention in ion-pair reversed-phase high-performance liquid chromatography mainly focuses on size-dependence, however, other factors influencing retention behaviors have not been comprehensively clarified up to date. In this present work, the retention behaviors of oligonucleotides and double-stranded DNAs were investigated on silica-based C 18 stationary phase by ion-pair reversed-phase high-performance liquid chromatography. It is found that the retention of oligonucleotides was influenced by base composition and base sequence as well as size, and oligonucleotides prone to self-dimerization have weaker retention than those not prone to self-dimerization but with the same base composition. However, homo-oligonucleotides are suitable for the size-dependent separation as a special case of oligonucleotides. For double-stranded DNAs, the retention is also influenced by base composition and base sequence, as well as size. This may be attributed to the interaction of exposed bases in major or minor grooves with the hydrophobic alky chains of stationary phase. In addition, no specific influence of guanine and cytosine content was confirmed on retention of double-stranded DNAs. Notably, the space effect resulted from the stereostructure of nucleic acids also influences the retention behavior in ion-pair reversed-phase high-performance liquid chromatography. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  13. Milestones and Millennials: A Perfect Pairing-Competency-Based Medical Education and the Learning Preferences of Generation Y. (United States)

    Desy, Janeve R; Reed, Darcy A; Wolanskyj, Alexandra P


    Millennials are quickly becoming the most prevalent generation of medical learners. These individuals have a unique outlook on education and have different preferences and expectations than their predecessors. As evidenced by its implementation by the Accreditation Council for Graduate Medical Education in the United States and the Royal College of Physicians and Surgeons in Canada, competency based medical education is rapidly gaining international acceptance. Characteristics of competency based medical education can be perfectly paired with Millennial educational needs in several dimensions including educational expectations, the educational process, attention to emotional quotient and professionalism, assessment, feedback, and intended outcomes. We propose that with its attention to transparency, personalized learning, and frequent formative assessment, competency based medical education is an ideal fit for the Millennial generation as it realigns education and assessment with the needs of these 21st century learners. Copyright © 2016 Mayo Foundation for Medical Education and Research. Published by Elsevier Inc. All rights reserved.

  14. Structural context effects in the oxidation of 8-oxo-7,8-dihydro-2'-deoxyguanosine to hydantoin products: electrostatics, base stacking, and base pairing. (United States)

    Fleming, Aaron M; Muller, James G; Dlouhy, Adrienne C; Burrows, Cynthia J


    8-Oxo-7,8-dihydroguanine (OG) is the most common base damage found in cells, where it resides in many structural contexts, including the nucleotide pool, single-stranded DNA at transcription forks and replication bubbles, and duplex DNA base-paired with either adenine (A) or cytosine (C). OG is prone to further oxidation to the highly mutagenic hydantoin products spiroiminodihydantoin (Sp) and 5-guanidinohydantoin (Gh) in a sharply pH-dependent fashion within nucleosides. In the present work, studies were conducted to determine how the structural context affects OG oxidation to the hydantoins. These studies revealed a trend in which the Sp yield was greatest in unencumbered contexts, such as nucleosides, while the Gh yield increased in oligodeoxynucleotide (ODN) contexts or at reduced pH. Oxidation of oligomers containing hydrogen-bond modulators (2,6-diaminopurine, N(4)-ethylcytidine) or alteration of the reaction conditions (pH, temperature, and salt) identify base stacking, electrostatics, and base pairing as the drivers of the key intermediate 5-hydroxy-8-oxo-7,8-dihydroguanine (5-HO-OG) partitioning along the two hydantoin pathways, allowing us to propose a mechanism for the observed base-pairing effects. Moreover, these structural effects cause an increase in the effective pK(a) of 5-HO-OG, following an increasing trend from 5.7 in nucleosides to 7.7 in a duplex bearing an OG·C base pair, which supports the context-dependent product yields. The high yield of Gh in ODNs underscores the importance of further study on this lesion. The structural context of OG also determined its relative reactivity toward oxidation, for which the OG·A base pair is ~2.5-fold more reactive than an OG·C base pair, and with the weak one-electron oxidant ferricyanide, the OG nucleoside reactivity is >6000-fold greater than that of OG·C in a duplex, leading to the conclusion that OG in the nucleoside pool should act as a protective agent for OG in the genome.

  15. Structural Context Effects in the Oxidation of 8-Oxo-7,8-dihydro-2’-deoxyguanosine to Hydantoin Products: Electrostatics, Base Stacking, and Base Pairing (United States)

    Fleming, Aaron M.; Muller, James G.; Dlouhy, Adrienne C.; Burrows, Cynthia J.


    8-Oxo-7,8-dihydroguanine (OG) is the most common base damage found in the cell where it resides in many structural contexts including the nucleotide pool, single-stranded DNA at transcription forks and replication bubbles, and in duplex DNA base paired with either A or C. OG is prone to further oxidation to the highly mutagenic hydantoin products, spiroiminodihydantoin (Sp) and 5-guanidinohydantoin (Gh) in a sharply pH-dependent fashion within nucleosides. In the present work, studies were conducted to determine how the structural context affects OG oxidation to the hydantoins. These studies revealed a trend in which the Sp yield was greatest in unencumbered contexts, such as nucleosides, while the Gh yield increased in oligodeoxynucleotide (ODN) contexts or at reduced pH. Oxidation of oligomers containing hydrogen bond modulators (2,6-diaminopurine, N4-ethylcytidine) or alteration of the reaction conditions (pH, temperature, and salt) identify base stacking, electrostatics and base pairing as the drivers of the key intermediate 5-hydroxy-8-oxo-7,8-dihydroguanine (5-HO-OG) partitioning along the two hydantoin pathways, allowing us to propose a mechanism for the observed base pairing effects. Moreover, these structural effects cause an increase in the effective pKa of 5-HO-OG following an increasing trend from 5.7 in nucleosides to 7.7 in a duplex bearing an OG•C base pair, which supports the context-dependent product yields. The high yield of Gh in ODNs underscores the importance of further study on this lesion. The structural context of OG also determined its relative reactivity toward oxidation for which the OG•A base pair is ~2.5-fold more reactive than an OG•C base pair, and with the weak one-electron oxidant ferricyanide, the OG nucleoside reactivity is >6000-fold greater than that of OG•C in a duplex, leading to the conclusion that OG in the nucleoside pool should act as a protective agent for OG in the genome. PMID:22880947

  16. Deuterium isotope effects and fractionation factors of hydrogen-bonded A:T base pairs of DNA

    International Nuclear Information System (INIS)

    Vakonakis, Ioannis; Salazar, Miguel; Kang, Mijeong; Dunbar, Kim R.; Li Wang, Andy C.


    Deuterium isotope effects and fractionation factors of N1...H3-N3 hydrogen bonded Watson-Crick A:T base pairs of two DNA dodecamers are presented here. Specifically, two-bond deuterium isotope effects on the chemical shifts of 13 C2 and 13 C4, 2 Δ 13 C2 and 2 Δ 13 C4, and equilibrium deuterium/protium fractionation factors of H3, Φ, were measured and seen to correlate with the chemical shift of the corresponding imino proton, δ H3 . Downfield-shifted imino protons associated with larger values of 2 Δ 13 C2 and 2 Δ 13 C4 and smaller Φ values, which together suggested that the effective H3-N3 vibrational potentials were more anharmonic in the stronger hydrogen bonds of these DNA molecules. We anticipate that 2 Δ 13 C2, 2 Δ 13 C4 and Φ values can be useful gauges of hydrogen bond strength of A:T base pairs

  17. NMR scalar couplings across Watson–Crick base pair hydrogen bonds in DNA observed by transverse relaxation-optimized spectroscopy (United States)

    Pervushin, Konstantin; Ono, Akira; Fernández, César; Szyperski, Thomas; Kainosho, Masatsune; Wüthrich, Kurt


    This paper describes the NMR observation of 15N—15N and 1H—15N scalar couplings across the hydrogen bonds in Watson–Crick base pairs in a DNA duplex, hJNN and hJHN. These couplings represent new parameters of interest for both structural studies of DNA and theoretical investigations into the nature of the hydrogen bonds. Two dimensional [15N,1H]-transverse relaxation-optimized spectroscopy (TROSY) with a 15N-labeled 14-mer DNA duplex was used to measure hJNN, which is in the range 6–7 Hz, and the two-dimensional hJNN-correlation-[15N,1H]-TROSY experiment was used to correlate the chemical shifts of pairs of hydrogen bond-related 15N spins and to observe, for the first time, hJHN scalar couplings, with values in the range 2–3.6 Hz. TROSY-based studies of scalar couplings across hydrogen bonds should be applicable for large molecular sizes, including protein-bound nucleic acids. PMID:9826668


    Directory of Open Access Journals (Sweden)

    Abu Husen


    Full Text Available This study aims to implement of Problem Based Learning combined Think Pair Share in order to improve critical thinking and science process skills of students at XI IPA SMA. This research was classroom action research. The subjects were 28 students of classroom XI IPA 1 SMAN 1 Kasiman Bojonegoro 2016/2017. This research was conducted in two cycles. The research data consists of the learning realized by observation, the results of the critical thinking paper and pencil tests, and the science process skills by observation. Data were analyzed by descriptive qualitative technique. The results showed that the combined PBL and TPS learning model can improve the ability of critical thinking, and science process skills students of classroom XI IPA 1 SMAN 1 Kasiman Bojonegoro. Penelitian ini bertujuan untuk menerapkan Problem Based Learning dipadu Think Pair Share dalam rangka meningkatkan kemampuan berpikir kritis dan keterampilan proses sains siswa kelas XI IPA SMA. Penelitian ini merupakan penelitian tindakan kelas. Subjek penelitian adalah siswa kelas XI IPA 1 SMAN 1 Kasiman Bojonegoro tahun pelajaran 2016/2017 dengan jumlah 28 siswa. Penelitian dilaksanakan selama dua siklus. Data penelitian terdiri atas hasil observasi keterlaksanaan pembelajaran, hasil tes tulis kemampuan berpikir kritis, dan hasil observasi keterampilan proses sains. Data dianalisis secara deskriptif kualitatif. Hasil penelitian menunjukkan bahwa model pembelajaran PBL dipadu TPS dapat meningkatkan kemampuan berpikir kritis dan keterampilan proses sains siswa kelas XI IPA 1 SMAN 1 Kasiman Bojonegoro.

  19. Selection of candidate radiation bio-markers in the serum of rats exposed to gamma-rays by GC/TOFMS-based metabolomics

    International Nuclear Information System (INIS)

    Liu, H.; Wang, Z.; Zhang, X.; Qiao, Y.; Wu, S.; Dong, F.; Chen, Y.


    In the study, gas chromatography/time-of-flight mass spectrometry (GC/TOFMS) techniques coupled with principal components analysis (PCA) were used to investigate metabolite perturbations in the serum of the rats exposed to 0.75, 3 or 8 Gy gamma rays. Male standard deviation rats were gamma-irradiated at doses of 0.75, 3 and 8 Gy (1.9 Gy min -1 ) or sham-irradiated. Serum samples were collected over the first 24 h under the exposure to irradiation in order to analyse the samples by GC/TOFMS. And multivariate data were analysed by PCA. The composition of metabolites in serum yielded distinct metabolomic phenotypes for 0.75, 3 and 8 Gy at 24 h after irradiation. Nine serum metabolites were significantly altered as a result of radiation exposure. Up-regulated metabolites included inositol, serine, lysine, glycine, threonine and glycerol; down regulated metabolites included isocitrate, gluconic acid and stearic acid. The nine metabolites were significantly altered after ionising radiation for they may be the potential bio-markers for the diagnosis of radiation injury. All rights reserved. (authors)

  20. NMR and GC-MS based metabolic profiling and free-radical scavenging activities of Cordyceps pruinosa mycelia cultivated under different media and light conditions.

    Directory of Open Access Journals (Sweden)

    Taek-Joo Oh

    Full Text Available Variation of metabolic profiles in Cordyceps pruinosa mycelia cultivated under various media and light conditions was investigated using 1H nuclear magnetic resonance (NMR analysis and gas chromatography mass spectrometry (GC-MS with multivariate statistical analysis. A total of 71 metabolites were identified (5 alcohols, 21 amino acids, 15 organic acids, 4 purines, 3 pyrimidines, 7 sugars, 11 fatty acids, and 5 other metabolites by NMR and GC-MS analysis. The mycelia grown in nitrogen media and under dark conditions showed the lowest growth and ergosterol levels, essential to a functional fungal cell membrane; these mycelia, however, had the highest levels of putrescine, which is involved in abiotic stress tolerance. In contrast, mycelia cultivated in sabouraud dextrose agar with yeast extract (SDAY media and under light conditions contained relatively higher levels of fatty acids, including valeric acid, stearic acid, lignoceric acid, myristic acid, oleic acid, palmitoleic acid, hepadecenoic acid, and linoleic acid. These mycelia also had the highest phenolic content and antioxidant activity, and did not exhibit growth retardation due to enhanced asexual development caused by higher levels of linoleic acid. Therefore, we suggested that a light-enriched environment with SDAY media was more optimal than dark condition for cultivation of C. pruinosa mycelia as biopharmaceutical or nutraceutical resources.

  1. Energetics and dynamics of the non-natural fluorescent 4AP:DAP base pair

    KAUST Repository

    Chawla, Mohit; Autiero, Ida; Oliva, Romina; Cavallo, Luigi


    the experimental studies and rationalize the impact of the above non-natural bases on the structure, stability and dynamics of nucleic acid structures, we performed quantum mechanics (QM) calculations along with classical molecular dynamics (MD) simulations. QM

  2. Chain propagation and termination mechanisms for polymerization of conjugated polar alkenes by [Al]-based frustrated Lewis pairs

    KAUST Repository

    He, Jianghua


    A combined experimental and theoretical study on mechanistic aspects of polymerization of conjugated polar alkenes by frustrated Lewis pairs (FLPs) based on N-heterocyclic carbene (NHC) and Al(C6F5)3 pairs is reported. This study consists of three key parts: structural characterization of active propagating intermediates, propagation kinetics, and chain-termination pathways. Zwitterionic intermediates that simulate the active propagating species in such polymerization have been generated or isolated from the FLP activation of monomers such as 2-vinylpyridine and 2-isopropenyl-2-oxazoline-one of which, IMes+-CH2C(Me)=(C3H2NO)Al(C6F5)3 - (2), has been structurally characterized. Kinetics performed on the polymerization of 2-vinylpyridine by ItBu/Al(C6F5)3 revealed that the polymerization follows a zero-order dependence on monomer concentration and a first-order dependence on initiator (ItBu) and activator [Al(C6F5)3] concentrations, indicating a bimolecular, activated monomer propagation mechanism. The Lewis pair polymerization of conjugate polar alkenes such as methacrylates is accompanied by competing chain-termination side reactions; between the two possible chain-termination pathways, the one that proceeds via intramolecular backbiting cyclization involving nucleophilic attack of the activated ester group of the growing polymer chain by the O-ester enolate active chain end to generate a six-membered lactone (δ-valerolactone)-terminated polymer chain is kinetically favored, but thermodynamically disfavored, over the pathway leading to the -ketoester-terminated chain, as revealed by computational studies.

  3. Morpholino spin-labeling for base-pair sequencing of a 3'-terminal RNA stem by proton homonuclear Overhauser enhancements: yeast ribosomal 5S RNA

    International Nuclear Information System (INIS)

    Lee, K.M.; Marshall, A.G.


    Base-pair sequences for 5S and 5.8S RNAs are not readily extracted from proton homonuclear nuclear Overhauser enhancement (NOE) connectivity experiments alone, due to extensive peak overlap in the downfield (11-15 ppm) proton NMR spectrum. In this paper, we introduce a new method for base-pair proton peak assignment for ribosomal RNAs, based upon the distance-dependent broadening of the resonances of base-pair protons spatially proximal to a paramagnetic group. Introduction of a nitroxide spin-label covalently attached to the 3'-terminal ribose provides an unequivocal starting point for base-pair hydrogen-bond proton NMR assignment. Subsequent NOE connectivities then establish the base-pair sequence for the terminal stem of a 5S RNA. Periodate oxidation of yeast 5S RNA, followed by reaction with 4-amino-2,2,6,6-tetramethylpiperidinyl-1-oxy (TEMPO-NH2) and sodium borohydride reduction, produces yeast 5S RNA specifically labeled with a paramagnetic nitroxide group at the 3'-terminal ribose. Comparison of the 500-MHz 1H NMR spectra of native and 3'-terminal spin-labeled yeast 5S RNA serves to identify the terminal base pair (G1 . C120) and its adjacent base pair (G2 . U119) on the basis of their proximity to the 3'-terminal spin-label. From that starting point, we have then identified (G . C, A . U, or G . U) and sequenced eight of the nine base pairs in the terminal helix via primary and secondary NOE's

  4. Dynamic DNA devices and assemblies formed by shape-complementary, non-base pairing 3D components (United States)

    Gerling, Thomas; Wagenbauer, Klaus F.; Neuner, Andrea M.; Dietz, Hendrik


    We demonstrate that discrete three-dimensional (3D) DNA components can specifically self-assemble in solution on the basis of shape-complementarity and without base pairing. Using this principle, we produced homo- and heteromultimeric objects, including micrometer-scale one- and two-stranded filaments and lattices, as well as reconfigurable devices, including an actuator, a switchable gear, an unfoldable nanobook, and a nanorobot. These multidomain assemblies were stabilized via short-ranged nucleobase stacking bonds that compete against electrostatic repulsion between the components’ interfaces. Using imaging by electron microscopy, ensemble and single-molecule fluorescence resonance energy transfer spectroscopy, and electrophoretic mobility analysis, we show that the balance between attractive and repulsive interactions, and thus the conformation of the assemblies, may be finely controlled by global parameters such as cation concentration or temperature and by an allosteric mechanism based on strand-displacement reactions.

  5. Electron attachment to the guanine-cytosine nucleic acid base pair and the effects of monohydration and proton transfer. (United States)

    Gupta, Ashutosh; Jaeger, Heather M; Compaan, Katherine R; Schaefer, Henry F


    The guanine-cytosine (GC) radical anion and its interaction with a single water molecule is studied using ab initio and density functional methods. Z-averaged second-order perturbation theory (ZAPT2) was applied to GC radical anion for the first time. Predicted spin densities show that the radical character is localized on cytosine. The Watson-Crick monohydrated GC anion is compared to neutral GC·H2O, as well as to the proton-transferred analogue on the basis of structural and energetic properties. In all three systems, local minima are identified that correspond to water positioned in the major and minor grooves of macromolecular DNA. On the anionic surface, two novel structures have water positioned above or below the GC plane. On the neutral and anionic surfaces, the global minimum can be described as water interacting with the minor groove. These structures are predicted to have hydration energies of 9.7 and 11.8 kcal mol(-1), respectively. Upon interbase proton-transfer (PT), the anionic global minimum has water positioned in the major groove, and the hydration energy increases to 13.4 kcal mol(-1). PT GC·H2O(•-) has distonic character; the radical character resides on cytosine, while the negative charge is localized on guanine. The effects of proton transfer are further investigated through the computed adiabatic electron affinities (AEA) of GC and monohydrated GC, and the vertical detachment energies (VDE) of the corresponding anions. Monohydration increases the AEAs and VDEs by only 0.1 eV, while proton-transfer increases the VDEs substantially (0.8 eV). The molecular charge distribution of monohydrated guanine-cytosine radical anion depends heavily on interbase proton transfer.

  6. Long-Range Vibrational Dynamics Are Directed by Watson-Crick Base Pairing in Duplex DNA. (United States)

    Hithell, Gordon; Shaw, Daniel J; Donaldson, Paul M; Greetham, Gregory M; Towrie, Michael; Burley, Glenn A; Parker, Anthony W; Hunt, Neil T


    Ultrafast two-dimensional infrared (2D-IR) spectroscopy of a 15-mer A-T DNA duplex in solution has revealed structure-dependent vibrational coupling and energy transfer processes linking bases with the sugar-phosphate backbone. Duplex melting induces significant changes in the positions of off-diagonal peaks linking carbonyl and ring-stretching vibrational modes of the adenine and thymine bases with vibrations of the phosphate group and phosphodiester linkage. These indicate that Watson-Crick hydrogen bonding and helix formation lead to a unique vibrational coupling arrangement of base vibrational modes with those of the phosphate unit. On the basis of observations from time-resolved 2D-IR data, we conclude that rapid energy transfer processes occur between base and backbone, mediated by additional modes located on the deoxyribose moiety within the same nucleotide. These relaxation dynamics are insensitive to duplex melting, showing that efficient intramolecular energy relaxation to the solvent via the phosphate groups is the key to excess energy dissipation in both single- and double-stranded DNA.

  7. Synchronized Pair Configuration in Virtualization-Based Lab for Learning Computer Networks (United States)

    Kongcharoen, Chaknarin; Hwang, Wu-Yuin; Ghinea, Gheorghita


    More studies are concentrating on using virtualization-based labs to facilitate computer or network learning concepts. Some benefits are lower hardware costs and greater flexibility in reconfiguring computer and network environments. However, few studies have investigated effective mechanisms for using virtualization fully for collaboration.…

  8. Pairing based threshold cryptography improving on Libert-Quisquater and Baek-Zheng

    DEFF Research Database (Denmark)

    Desmedt, Yvo; Lange, Tanja


    In this paper we apply techniques from secret sharing and threshold decryption to show how to properly design an ID-based threshold system in which one assumes no trust in any party. In our scheme: We avoid that any single machine ever knew the master secret s of the trusted authority (TA). Inste...

  9. Optimization of polymeric triiodide membrane electrode based on clozapine-triiodide ion-pair using experimental design. (United States)

    Farhadi, Khalil; Bahram, Morteza; Shokatynia, Donya; Salehiyan, Floria


    Central composite design (CCD) and response surface methodology (RSM) were developed as experimental strategies for modeling and optimization of the influence of some variables on the performance of a new PVC membrane triiodide ion-selective electrode. This triiodide sensor is based on triiodide-clozapine ion-pair complexation. PVC, plasticizers, ion-pair amounts and pH were investigated as four variables to build a model to achieve the best Nernstian slope (59.9 mV) as response. The electrode is prepared by incorporating the ion-exchanger in PVC matrix plasticized with 2-nitrophenyl octal ether, which is directly coated on the surface of a graphite electrode. The influence of foreign ions on the electrode performance was also investigated. The optimized membranes demonstrate Nernstian response for triiodide ions over a wide linear range from 5.0 x 10(-6) to 1.0 x 10(-2)mol L(-1) with a limit of detection 2.0 x 10(-6) mol L(-1) at 25 degrees C. The electrodes could be used over a wide pH range 4-8, and have the advantages of easy to prepare, good selectivity and fast response time, long lifetime (over 3 months) and small interferences from hydrogen ion. The proposed electrode was successfully used as indicator electrode in potentiometric titration of triiodide ions and ascorbic acid.

  10. Detection of Wuchereria bancrofti DNA in paired serum and urine samples using polymerase chain reaction-based systems

    Directory of Open Access Journals (Sweden)

    Camila Ximenes


    Full Text Available The Global Program for the Elimination of Lymphatic Filariasis (GPELF aims to eliminate this disease by the year 2020. However, the development of more specific and sensitive tests is important for the success of the GPELF. The present study aimed to standardise polymerase chain reaction (PCR-based systems for the diagnosis of filariasis in serum and urine. Twenty paired biological urine and serum samples from individuals already known to be positive for Wuchereria bancrofti were collected during the day. Conventional PCR and semi-nested PCR assays were optimised. The detection limit of the technique for purified W. bancrofti DNA extracted from adult worms was 10 fg for the internal systems (WbF/Wb2 and 0.1 fg by using semi-nested PCR. The specificity of the primers was confirmed experimentally by amplification of 1 ng of purified genomic DNA from other species of parasites. Evaluation of the paired urine and serum samples by the semi-nested PCR technique indicated only two of the 20 tested individuals were positive, whereas the simple internal PCR system (WbF/Wb2, which has highly promising performance, revealed that all the patients were positive using both samples. This study successfully demonstrated the possibility of using the PCR technique on urine for the diagnosis of W. bancrofti infection.

  11. Measurement and Theory of Hydrogen Bonding Contribution to Isosteric DNA Base Pairs


    Khakshoor, Omid; Wheeler, Steven E.; Houk, K. N.; Kool, Eric T.


    We address the recent debate surrounding the ability of 2,4-difluorotoluene (F), a low-polarity mimic of thymine (T), to form a hydrogen-bonded complex with adenine in DNA. The hydrogen bonding ability of F has been characterized as small to zero in various experimental studies, and moderate to small in computational studies. However, recent X-ray crystallographic studies of difluorotoluene in DNA/RNA have indicated, based on interatomic distances, possible hydrogen bonding interactions betwe...

  12. Non-linguistic learning and aphasia: Evidence from a paired associate and feedback-based task (United States)

    Vallila-Rohter, Sofia; Kiran, Swathi


    Though aphasia is primarily characterized by impairments in the comprehension and/or expression of language, research has shown that patients with aphasia also show deficits in cognitive-linguistic domains such as attention, executive function, concept knowledge and memory (Helm-Estabrooks, 2002 for review). Research in aphasia suggests that cognitive impairments can impact the online construction of language, new verbal learning, and transactional success (Freedman & Martin, 2001; Hula & McNeil, 2008; Ramsberger, 2005). In our research, we extend this hypothesis to suggest that general cognitive deficits influence progress with therapy. The aim of our study is to explore learning, a cognitive process that is integral to relearning language, yet underexplored in the field of aphasia rehabilitation. We examine non-linguistic category learning in patients with aphasia (n=19) and in healthy controls (n=12), comparing feedback and non-feedback based instruction. Participants complete two computer-based learning tasks that require them to categorize novel animals based on the percentage of features shared with one of two prototypes. As hypothesized, healthy controls showed successful category learning following both methods of instruction. In contrast, only 60% of our patient population demonstrated successful non-linguistic category learning. Patient performance was not predictable by standardized measures of cognitive ability. Results suggest that general learning is affected in aphasia and is a unique, important factor to consider in the field of aphasia rehabilitation. PMID:23127795

  13. Differentiation of Commercial PDO Wines Produced in Istria (Croatia According to Variety and Harvest Year Based on HS-SPME-GC/MS Volatile Aroma Compound Profiling

    Directory of Open Access Journals (Sweden)

    Igor Lukić


    Full Text Available To differentiate monovarietal wines made from native and introduced varieties in Istria (Croatia, samples of Malvazija istarska, Chardonnay and Muscat yellow from two harvest years (2013 and 2014 were subjected to headspace solid-phase microextraction and gas chromatographic/mass spectrometric analysis (HS-SPME-GC/MS of volatile aroma compounds. Significant effects of variety and harvest year were determined, but their interaction complicated the differentiation. Particular compounds were consistent as markers of variety in both years: nerol for Malvazija, ethyl cinnamate and a tentatively identified isomer of dimethylbenzaldehyde for Chardonnay, and terpenes for Muscat yellow. Wines from 2013 contained higher concentrations of the majority of important volatiles. A 100 % correct differentiation of Malvazija istarska and Chardonnay wines according to both variety and harvest year was achieved by stepwise linear discriminant analysis.

  14. Differentiation of wines according to grape variety and geographical origin based on volatiles profiling using SPME-MS and SPME-GC/MS methods. (United States)

    Ziółkowska, Angelika; Wąsowicz, Erwin; Jeleń, Henryk H


    Among methods to detect wine adulteration, profiling volatiles is one with a great potential regarding robustness, analysis time and abundance of information for subsequent data treatment. Volatile fraction fingerprinting by solid-phase microextraction with direct analysis by mass spectrometry without compounds separation (SPME-MS) was used for differentiation of white as well as red wines. The aim was to differentiate between varieties used for wine production and to also differentiate wines by country of origin. The results obtained were compared to SPME-GC/MS analysis in which compounds were resolved by gas chromatography. For both approaches the same type of statistical procedure was used to compare samples: principal component analysis (PCA) followed by linear discriminant analysis (LDA). White wines (38) and red wines (41) representing different grape varieties and various regions of origin were analysed. SPME-MS proved to be advantageous in use due to better discrimination and higher sample throughput. Copyright © 2016 Elsevier Ltd. All rights reserved.

  15. Differentiation of Commercial PDO Wines Produced in Istria (Croatia) According to Variety and Harvest Year Based on HS-SPME-GC/MS Volatile Aroma Compound Profiling. (United States)

    Lukić, Igor; Horvat, Ivana


    To differentiate monovarietal wines made from native and introduced varieties in Istria (Croatia), samples of Malvazija istarska, Chardonnay and Muscat yellow from two harvest years (2013 and 2014) were subjected to headspace solid-phase microextraction and gas chromatographic/mass spectrometric analysis (HS-SPME-GC/MS) of volatile aroma compounds. Significant effects of variety and harvest year were determined, but their interaction complicated the differentiation. Particular compounds were consistent as markers of variety in both years: nerol for Malvazija, ethyl cinnamate and a tentatively identified isomer of dimethylbenzaldehyde for Chardonnay, and terpenes for Muscat yellow. Wines from 2013 contained higher concentrations of the majority of important volatiles. A 100% correct differentiation of Malvazija istarska and Chardonnay wines according to both variety and harvest year was achieved by stepwise linear discriminant analysis.

  16. Metallicity in the GC

    International Nuclear Information System (INIS)

    Najarro, Francisco


    We review quantitative spectroscopic studies of massive stars in the three Galactic Center clusters: Quintuplet, Arches and Central cluster. Thanks to the impressive evolution of IR detectors and the new generation of line blanketed models for the extended atmospheres of hot stars we are able to accurately derive the physical properties and metallicity estimates of the massive stars in these clusters. For the Quintuplet cluster our analysis of the LBVs provides a direct estimate of a-elements and Fe chemical abundances in these objects. For the Arches cluster, we introduce a method based on the N abundance of WNL stars and the theory of evolution of massive stars. For the Central cluster, new observations reveal IRS 8 as an outsider with respect to the rest of massive stars in the cluster both in terms of age and location. Using the derived properties of IR.S 8, a new method is presented to derive metallicity from the OIII feature at 2.115 μm. Our results indicate solar metallicity in the three clusters

  17. Non-Halal biomarkers identification based on Fourier Transform Infrared Spectroscopy (FTIR) and Gas Chromatography-Time of Flight Mass Spectroscopy (GC-TOF MS) techniques (United States)

    Witjaksono, Gunawan; Saputra, Irwan; Latief, Marsad; Jaswir, Irwandi; Akmeliawati, Rini; Abdelkreem Saeed Rabih, Almur


    Consumption of meat from halal (lawful) sources is essential for Muslims. The identification of non-halal meat is one of the main issues that face consumers in meat markets, especially in non-Islamic countries. Pig is one of the non-halal sources of meat, and hence pig meat and its derivatives are forbidden for Muslims to consume. Although several studies have been conducted to identify the biomarkers for nonhalal meats like pig meat, these studies are still in their infancy stages, and as a result there is no universal biomarker which could be used for clear cut identification. The purpose of this paper is to use Fourier Transform Infrared Spectroscopy (FTIR) and Gas Chromatography-Time of Flight Mass Spectroscopy (GC-TOF MS) techniques to study fat of pig, cow, lamb and chicken to find possible biomarkers for pig fat (lard) identification. FTIR results showed that lard and chicken fat have unique peaks at wavenumbers 1159.6 cm-1, 1743.4 cm-1, 2853.1 cm-1 and 2922.5 cm-1 compared to lamb and beef fats which did not show peaks at these wavenumbers. On the other hand, GC/MS-TOF results showed that the concentration of 1,2,3-trimethyl-Benzene, Indane, and Undecane in lard are 250, 14.5 and 1.28 times higher than their concentrations in chicken fat, respectively, and 91.4, 2.3 and 1.24 times higher than their concentrations in cow fat, respectively. These initial results clearly indicate that there is a possibility to find biomarkers for non-halal identification.

  18. Combination of ¹H NMR- and GC-MS-based metabonomics to study on the toxicity of Coptidis Rhizome in rats.

    Directory of Open Access Journals (Sweden)

    Yuting Zhou

    Full Text Available BACKGROUND: Coptidis Rhizome (CR, widely applied to treat with heat and toxicity, is one of the most commonly used traditional Chinese medicine (TCM, however, an extensive dosage can induce toxicity. Diarrhea is one of the most frequent side effects of CR treatment. METHODOLOGY/PRINCIPAL FINDINGS: In this study, metabonomics was combined with the multivariate statistical analysis to discover the endogenous metabolites which related to the diarrheal induced by CR. The male Sprague-Dawley rats were dosed with 4.95 g CR/kg weight. Urine samples were collected at day -1 (before treatment, and days 14 and 21 for NMR analysis. Serum and tissues were collected at day 14 for GC-MS analysis and histopathological examination, respectively. The urine and serum metabolic profiles provided clearer distinction between CR-treated group and control group, which was confirmed by body weight change and diarrhea. Through multivariate statistical analysis, 12 marker metabolites from ¹H NMR and 8 ones from GC-MS have been found. Among those metabolites, hippurate, acetate, alanine, glycine and glutamate are likely to break the balance of gut microbiota, whereas, lactate and 2-ketoisovalerate showed association with energy metabolism. Meanwhile, we observed that the CR-induced toxicity will recover when the treatment was stopped. CONCLUSIONS/SIGNIFICANCE: These results suggest that the main reason for the CR-associated diarrhea might be disturbance in the normal gut microbiota. This metabonomics approach may provide an effective way to study the alteration of gut microbiota, which is expected to find broader application in other drug-induced gastrointestinal reaction assessment.

  19. Nematic fluctuations, fermiology and the pairing potential in iron-based superconductors

    Energy Technology Data Exchange (ETDEWEB)

    Kretzschmar, Florian


    The thesis comprises a systematic study on the doping, temperature and momentum dependent electron dynamics in iron-based superconductors using inelastic light scattering. The observation of Bardasis-Schrieffer modes in the excitation spectrum of superconducting Ba{sub 0.6}K{sub 0.4}Fe{sub 2}As{sub 2} is reported and the energy and symmetry dependence of the modes are analyzed. The analysis yields the identification of a strong subdominant component of the interaction potential V(k,k{sup '}). Strong nematic fluctuations are investigated in Ba(Fe{sub 1-x}Co{sub x}){sub 2}As{sub 2}. The nature of the fluctuations and the origin of nematicity in Ba(Fe{sub 1-x}Co{sub x}){sub 2}As{sub 2} are identified.

  20. Cyanine-based probe\\tag-peptide pair fluorescence protein imaging and fluorescence protein imaging methods (United States)

    Mayer-Cumblidge, M. Uljana; Cao, Haishi


    A molecular probe comprises two arsenic atoms and at least one cyanine based moiety. A method of producing a molecular probe includes providing a molecule having a first formula, treating the molecule with HgOAc, and subsequently transmetallizing with AsCl.sub.3. The As is liganded to ethanedithiol to produce a probe having a second formula. A method of labeling a peptide includes providing a peptide comprising a tag sequence and contacting the peptide with a biarsenical molecular probe. A complex is formed comprising the tag sequence and the molecular probe. A method of studying a peptide includes providing a mixture containing a peptide comprising a peptide tag sequence, adding a biarsenical probe to the mixture, and monitoring the fluorescence of the mixture.

  1. A Novel 3670-Base Pair Mitochondrial DNA Deletion Resulting in Multi-systemic Manifestations in a Child

    Directory of Open Access Journals (Sweden)

    Hsin-Ming Liu


    Full Text Available Mitochondrial DNA (mtDNA deletion is a rare occurrence that results in defects to oxidative phosphorylation. The common clinical presentations of mtDNA deletion vary but include mitochondrial myopathy, Pearson syndrome, Kearns-Sayre syndrome, and progressive external ophthalmoplegia. Here, we report the case of a 10-year-old boy who presented with progressive deterioration of his clinical status (which included hypoglycemia, short stature, sensorineural hearing loss, retinitis pigmentosa, and chronic gastrointestinal dysmotility that progressed to acute deterioration with pancreatitis, Fanconi syndrome, lactic acidosis, and acute encephalopathy. Following treatment, the patient was stabilized and his neurological condition improved. Through a combination of histological examinations and biochemical and molecular analyses, mitochondrial disease was confirmed. A novel 3670-base pair deletion (deletion of mtDNA nt 7,628-11,297 was identified in the muscle tissue. A direct repeat of CTACT at the breakpoints was also detected.

  2. Stereo Vision-Based High Dynamic Range Imaging Using Differently-Exposed Image Pair

    Directory of Open Access Journals (Sweden)

    Won-Jae Park


    Full Text Available In this paper, a high dynamic range (HDR imaging method based on the stereo vision system is presented. The proposed method uses differently exposed low dynamic range (LDR images captured from a stereo camera. The stereo LDR images are first converted to initial stereo HDR images using the inverse camera response function estimated from the LDR images. However, due to the limited dynamic range of the stereo LDR camera, the radiance values in under/over-exposed regions of the initial main-view (MV HDR image can be lost. To restore these radiance values, the proposed stereo matching and hole-filling algorithms are applied to the stereo HDR images. Specifically, the auxiliary-view (AV HDR image is warped by using the estimated disparity between initial the stereo HDR images and then effective hole-filling is applied to the warped AV HDR image. To reconstruct the final MV HDR, the warped and hole-filled AV HDR image is fused with the initial MV HDR image using the weight map. The experimental results demonstrate objectively and subjectively that the proposed stereo HDR imaging method provides better performance compared to the conventional method.

  3. Binding to the DNA Minor Groove by Heterocyclic Dications: From AT Specific Monomers to GC Recognition with Dimers (United States)

    Nanjunda, Rupesh; Wilson, W. David


    Compounds that bind in the DNA minor groove have provided critical information on DNA molecular recognition, they have found extensive uses in biotechnology and they are providing clinically useful drugs against diseases as diverse as cancer and sleeping sickness. This review focuses on the development of clinically useful heterocyclic diamidine minor groove binders. These compounds have shown us that the classical model for minor groove binding in AT DNA sequences must be expanded in several ways: compounds with nonstandard shapes can bind strongly to the groove, water can be directly incorporated into the minor groove complex in an interfacial interaction, and the compounds can form cooperative stacked dimers to recognize GC and mixed AT/GC base pair sequences. PMID:23255206

  4. Mutational Biases and GC-Biased Gene Conversion Affect GC Content in the Plastomes of Dendrobium Genus

    Directory of Open Access Journals (Sweden)

    Zhitao Niu


    Full Text Available The variation of GC content is a key genome feature because it is associated with fundamental elements of genome organization. However, the reason for this variation is still an open question. Different kinds of hypotheses have been proposed to explain the variation of GC content during genome evolution. However, these hypotheses have not been explicitly investigated in whole plastome sequences. Dendrobium is one of the largest genera in the orchid species. Evolutionary studies of the plastomic organization and base composition are limited in this genus. In this study, we obtained the high-quality plastome sequences of D. loddigesii and D. devonianum. The comparison results showed a nearly identical organization in Dendrobium plastomes, indicating that the plastomic organization is highly conserved in Dendrobium genus. Furthermore, the impact of three evolutionary forces—selection, mutational biases, and GC-biased gene conversion (gBGC—on the variation of GC content in Dendrobium plastomes was evaluated. Our results revealed: (1 consistent GC content evolution trends and mutational biases in single-copy (SC and inverted repeats (IRs regions; and (2 that gBGC has influenced the plastome-wide GC content evolution. These results suggest that both mutational biases and gBGC affect GC content in the plastomes of Dendrobium genus.

  5. Mutational Biases and GC-Biased Gene Conversion Affect GC Content in the Plastomes of Dendrobium Genus (United States)

    Niu, Zhitao; Xue, Qingyun; Wang, Hui; Xie, Xuezhu; Zhu, Shuying; Liu, Wei; Ding, Xiaoyu


    The variation of GC content is a key genome feature because it is associated with fundamental elements of genome organization. However, the reason for this variation is still an open question. Different kinds of hypotheses have been proposed to explain the variation of GC content during genome evolution. However, these hypotheses have not been explicitly investigated in whole plastome sequences. Dendrobium is one of the largest genera in the orchid species. Evolutionary studies of the plastomic organization and base composition are limited in this genus. In this study, we obtained the high-quality plastome sequences of D. loddigesii and D. devonianum. The comparison results showed a nearly identical organization in Dendrobium plastomes, indicating that the plastomic organization is highly conserved in Dendrobium genus. Furthermore, the impact of three evolutionary forces—selection, mutational biases, and GC-biased gene conversion (gBGC)—on the variation of GC content in Dendrobium plastomes was evaluated. Our results revealed: (1) consistent GC content evolution trends and mutational biases in single-copy (SC) and inverted repeats (IRs) regions; and (2) that gBGC has influenced the plastome-wide GC content evolution. These results suggest that both mutational biases and gBGC affect GC content in the plastomes of Dendrobium genus. PMID:29099062

  6. Gas Chromatography Time-Of-Flight Mass Spectrometry (GC-TOF-MS)-Based Metabolomics for Comparison of Caffeinated and Decaffeinated Coffee and Its Implications for Alzheimer’s Disease (United States)

    Chang, Kai Lun; Ho, Paul C.


    Findings from epidemiology, preclinical and clinical studies indicate that consumption of coffee could have beneficial effects against dementia and Alzheimer’s disease (AD). The benefits appear to come from caffeinated coffee, but not decaffeinated coffee or pure caffeine itself. Therefore, the objective of this study was to use metabolomics approach to delineate the discriminant metabolites between caffeinated and decaffeinated coffee, which could have contributed to the observed therapeutic benefits. Gas chromatography time-of-flight mass spectrometry (GC-TOF-MS)-based metabolomics approach was employed to characterize the metabolic differences between caffeinated and decaffeinated coffee. Orthogonal partial least squares discriminant analysis (OPLS-DA) showed distinct separation between the two types of coffee (cumulative Q2 = 0.998). A total of 69 discriminant metabolites were identified based on the OPLS-DA model, with 37 and 32 metabolites detected to be higher in caffeinated and decaffeinated coffee, respectively. These metabolites include several benzoate and cinnamate-derived phenolic compounds, organic acids, sugar, fatty acids, and amino acids. Our study successfully established GC-TOF-MS based metabolomics approach as a highly robust tool in discriminant analysis between caffeinated and decaffeinated coffee samples. Discriminant metabolites identified in this study are biologically relevant and provide valuable insights into therapeutic research of coffee against AD. Our data also hint at possible involvement of gut microbial metabolism to enhance therapeutic potential of coffee components, which represents an interesting area for future research. PMID:25098597

  7. Investigations into nuclear pairing

    International Nuclear Information System (INIS)

    Clark, R.M.


    This paper is divided in two main sections focusing on different aspects of collective nuclear behavior. In the first section, solutions are considered for the collective pairing Hamiltonian. In particular, an approximate solution at the critical point of the pairing transition from harmonic vibration (normal nuclear behavior) to deformed rotation (superconducting behavior) in gauge space is found by analytic solution of the Hamiltonian. The eigenvalues are expressed in terms of the zeros of Bessel functions of integer order. The results are compared to the pairing bands based on the Pb isotopes. The second section focuses on the experimental search for the Giant Pairing Vibration (GPV) in nuclei. After briefly describing the origin of the GPV, and the reasons that the state has remained unidentified, a novel idea for populating this state is presented. A recent experiment has been performed using the LIBERACE+STARS detector system at the 88-Inch Cyclotron of LBNL to test the idea. (Author)

  8. Separation of fatty acid methyl esters by GC-online hydrogenation × GC. (United States)

    Delmonte, Pierluigi; Fardin-Kia, Ali Reza; Rader, Jeanne I


    The separation of fatty acid methyl esters (FAME) provided by a 200 m × 0.25 mm SLB-IL111 capillary column is enhanced by adding a second dimension of separation ((2)D) in a GC × GC design. Rather than employing two GC columns of different polarities or using different elution temperatures, the separation in the two-dimensional space is achieved by altering the chemical structure of selected analytes between the two dimensions of separation. A capillary tube coated with palladium is added between the first dimension of separation ((1)D) column and the cryogenic modulator, providing the reduction of unsaturated FAMEs to their fully saturated forms. The (2)D separation is achieved using a 2.5 m × 0.10 mm SLB-IL111 capillary column and separates FAMEs based solely on their carbon skeleton. The two-dimensional separation can be easily interpreted based on the principle that all the saturated FAMEs lie on a straight diagonal line bisecting the separation plane, while the FAMEs with the same carbon skeleton but differing in the number, geometric configuration or position of double bonds lie on lines parallel to the (1)D time axis. This technique allows the separation of trans fatty acids (FAs) and polyunsaturated FAs (PUFAs) in a single experiment and eliminates the overlap between PUFAs with different chain lengths. To our knowledge, this the first example of GC × GC in which a chemical change is instituted between the two dimensions to alter the relative retentions of components and identify unsaturated FAMEs.

  9. Anomeric 2'-Deoxycytidines and Silver Ions: Hybrid Base Pairs with Greatly Enhanced Stability and Efficient DNA Mismatch Detection with α-dC. (United States)

    Guo, Xiurong; Seela, Frank


    α-d-Nucleosides are rare in nature but can develop fascinating properties when incorporated into DNA. This work reports on the first silver-mediated base pair constructed from two anomeric nucleosides: α-dC and β-dC. The hybrid base pair was integrated into the DNA and DNA/RNA double helix. A 12-mer duplex with α-dC and β-dC pair exhibits a higher thermal stability (T m =43 °C) than that incorporating the β-dC-Ag + -β-dC homo pair (T m =34 °C). Furthermore, α-dC shows excellent mismatch discrimination for DNA single nucleotide polymorphism (SNP). All four SNPs were identified on the basis of large T m value differences measured in the presence of silver ions. High resolution melting was not required. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  10. A configuration space of homologous proteins conserving mutual information and allowing a phylogeny inference based on pair-wise Z-score probabilities


    Maréchal Eric; Ortet Philippe; Roy Sylvaine; Bastien Olivier


    Abstract Background Popular methods to reconstruct molecular phylogenies are based on multiple sequence alignments, in which addition or removal of data may change the resulting tree topology. We have sought a representation of homologous proteins that would conserve the information of pair-wise sequence alignments, respect probabilistic properties of Z-scores (Monte Carlo methods applied to pair-wise comparisons) and be the basis for a novel method of consistent and stable phylogenetic recon...

  11. Discrimination of cherry wines based on their sensory properties and aromatic fingerprinting using HS-SPME-GC-MS and multivariate analysis. (United States)

    Xiao, Zuobing; Liu, Shengjiang; Gu, Yongbo; Xu, Na; Shang, Yi; Zhu, Jiancai


    Volatiles of cherry wines were extracted by headspace solid phase microextraction (HS-SPME) and analyzed by gas chromatography mass spectrometry (GC-MS), multivariate statistical techniques (such as principal component analysis (PCA) and cluster analysis (CA) and correlation analysis) to differentiate sensory attributes of 3 groups of the wines through characterization of volatiles of cherry wine. Seventy-five volatiles were identified in 9 samples, including 29 esters, 22 alcohols, 8 acids, 3 ketones, 5 aldehydes, and 8 miscellaneous compounds. The PCA results showed that the cherry wines were mainly differentiated by 8 sensory attributes. The samples W2, W4, and W7 were grouped around sweet aromatic and the samples W1, W5, and W9 were highly associated with the sweet, esters, green, bitter, and fermented. Nevertheless, the samples W3, W6, and W8 were located close to the sour, alcoholic, and fruity. The final result of correlation analysis was in conformity with the conclusion of PCA. The CA results showed that the group of W2, W4, and W7, and the group of W1, W5, and W9 had less difference than the group of W3, W6, and W8. The reason should be that esterification reactions and fermentation process during the ageing period was more extended. The results of analyzing revealed that HS-SPME-GC-MS coupled with chemometrics could give an appropriate way of characterizing and classifying the cherry wines. Attributes that represent and discriminate among cherry wines might be made use of a better comprehending of the wines and for being utilized in future work. In addition, several chemometrics were used to classify the type of wines and try to install the relationship between volatiles and sensory property. Especially, PCA clearly revealed that the most contributing compounds for sensory attributes of cherry wines, CA was a more applicable way to distinguish types of cherry wines. Therefore, a feasible method that would be helpful to promote the quality of the wines by

  12. Analysis of Alkaloids from Physalis peruviana by Capillary GC, Capillary GC-MS, and GC-FTIR. (United States)

    Kubwabo, C; Rollmann, B; Tilquin, B


    The alkaloid composition of the aerial parts and roots of PHYSALIS PERUVIANA was analysed by capillary GC (GC (2)), GC (2)-MS and GC (2)-FTIR. Eight alkaloids were identified, three of those alkaloids are 3beta-acetoxytropane and two N-methylpyrrolidinylhygrine isomers, which were not previously found in the genus PHYSALIS. A reproduction of the identification of alkaloids detected in the plant by the use of retention indices has been proposed.

  13. Microwave assisted saponification (MAS) followed by on-line liquid chromatography (LC)-gas chromatography (GC) for high-throughput and high-sensitivity determination of mineral oil in different cereal-based foodstuffs. (United States)

    Moret, Sabrina; Scolaro, Marianna; Barp, Laura; Purcaro, Giorgia; Conte, Lanfranco S


    A high throughput, high-sensitivity procedure, involving simultaneous microwave-assisted extraction (MAS) and unsaponifiable extraction, followed by on-line liquid chromatography (LC)-gas chromatography (GC), has been optimised for rapid and efficient extraction and analytical determination of mineral oil saturated hydrocarbons (MOSH) and mineral oil aromatic hydrocarbons (MOAH) in cereal-based products of different composition. MAS has the advantage of eliminating fat before LC-GC analysis, allowing an increase in the amount of sample extract injected, and hence in sensitivity. The proposed method gave practically quantitative recoveries and good repeatability. Among the different cereal-based products analysed (dry semolina and egg pasta, bread, biscuits, and cakes), egg pasta packed in direct contact with recycled paperboard had on average the highest total MOSH level (15.9 mg kg(-1)), followed by cakes (10.4 mg kg(-1)) and bread (7.5 mg kg(-1)). About 50% of the pasta and bread samples and 20% of the biscuits and cake samples had detectable MOAH amounts. The highest concentrations were found in an egg pasta in direct contact with recycled paperboard (3.6 mg kg(-1)) and in a milk bread (3.6 mg kg(-1)). Copyright © 2015 Elsevier Ltd. All rights reserved.

  14. Recent advances in mechanism-based chemotherapy drug-siRNA pairs in co-delivery systems for cancer: A review. (United States)

    Wang, Mingfang; Wang, Jinyu; Li, Bingcheng; Meng, Lingxin; Tian, Zhaoxing


    Co-delivery of chemotherapy drugs and siRNA for cancer therapy has achieved remarkable results according to synergistic/combined antitumor effects, and is recognized as a promising therapeutic modality. However, little attention has been paid to the extremely complex mechanisms of chemotherapy drug-siRNA pairs during co-delivery process. Proper selection of chemotherapy drug-siRNA pairs is beneficial for achieving desirable cancer therapeutic effects. Exploring the inherent principles during chemotherapy drug-siRNA pair selection for co-delivery would greatly enhanced therapeutic efficiency. To achieve ideal results, this article will systematically review current different mechanism-based chemotherapy drug-siRNA pairs for co-delivery in cancer treatment. Large-scale library screening of recent different chemotherapy drug-siRNA pairs for co-delivery would help to establish the chemotherapy drug-siRNA pair selection principle, which could pave the way for co-delivery of chemotherapy drugs and siRNA for cancer treatment in clinic. Following the inherent principle of chemotherapy drug-siRNA pair, more effective co-delivery vectors can be designed in the future. Copyright © 2017 Elsevier B.V. All rights reserved.

  15. The Antarctica component of postglacial rebound model ICE-6G_C (VM5a) based on GPS positioning, exposure age dating of ice thicknesses, and relative sea level histories (United States)

    Argus, Donald F.; Peltier, W. R.; Drummond, R.; Moore, Angelyn W.


    A new model of the deglaciation history of Antarctica over the past 25 kyr has been developed, which we refer to herein as ICE-6G_C (VM5a). This revision of its predecessor ICE-5G (VM2) has been constrained to fit all available geological and geodetic observations, consisting of: (1) the present day uplift rates at 42 sites estimated from GPS measurements, (2) ice thickness change at 62 locations estimated from exposure-age dating, (3) Holocene relative sea level histories from 12 locations estimated on the basis of radiocarbon dating and (4) age of the onset of marine sedimentation at nine locations along the Antarctic shelf also estimated on the basis of 14C dating. Our new model fits the totality of these data well. An additional nine GPS-determined site velocities are also estimated for locations known to be influenced by modern ice loss from the Pine Island Bay and Northern Antarctic Peninsula regions. At the 42 locations not influenced by modern ice loss, the quality of the fit of postglacial rebound model ICE-6G_C (VM5A) is characterized by a weighted root mean square residual of 0.9 mm yr-1. The Southern Antarctic Peninsula is inferred to be rising at 2 mm yr-1, requiring there to be less Holocene ice loss there than in the prior model ICE-5G (VM2). The East Antarctica coast is rising at approximately 1 mm yr-1, requiring ice loss from this region to have been small since Last Glacial Maximum. The Ellsworth Mountains, at the base of the Antarctic Peninsula, are inferred to be rising at 5-8 mm yr-1, indicating large ice loss from this area during deglaciation that is poorly sampled by geological data. Horizontal deformation of the Antarctic Plate is minor with two exceptions. First, O'Higgins, at the tip of the Antarctic Peninsula, is moving southeast at a significant 2 mm yr-1 relative to the Antarctic Plate. Secondly, the margins of the Ronne and Ross Ice Shelves are moving horizontally away from the shelf centres at an approximate rate of 0.8 mm yr-1, in

  16. Multi-objective optimization of Stirling engine systems using Front-based Yin-Yang-Pair Optimization

    International Nuclear Information System (INIS)

    Punnathanam, Varun; Kotecha, Prakash


    Highlights: • Efficient multi-objective optimization algorithm F-YYPO demonstrated. • Three Stirling engine applications with a total of eight cases. • Improvements in the objective function values of up to 30%. • Superior to the popularly used gamultiobj of MATLAB. • F-YYPO has extremely low time complexity. - Abstract: In this work, we demonstrate the performance of Front-based Yin-Yang-Pair Optimization (F-YYPO) to solve multi-objective problems related to Stirling engine systems. The performance of F-YYPO is compared with that of (i) a recently proposed multi-objective optimization algorithm (Multi-Objective Grey Wolf Optimizer) and (ii) an algorithm popularly employed in literature due to its easy accessibility (MATLAB’s inbuilt multi-objective Genetic Algorithm function: gamultiobj). We consider three Stirling engine based optimization problems: (i) the solar-dish Stirling engine system which considers objectives of output power, thermal efficiency and rate of entropy generation; (ii) Stirling engine thermal model which considers the associated irreversibility of the cycle with objectives of output power, thermal efficiency and pressure drop; and finally (iii) an experimentally validated polytropic finite speed thermodynamics based Stirling engine model also with objectives of output power and pressure drop. We observe F-YYPO to be significantly more effective as compared to its competitors in solving the problems, while requiring only a fraction of the computational time required by the other algorithms.

  17. Accommodation of an N-(deoxyguanosin-8-yl)-2-acetylaminofluorene adduct in the active site of human DNA polymerase iota: Hoogsteen or Watson-Crick base pairing? (United States)

    Donny-Clark, Kerry; Shapiro, Robert; Broyde, Suse


    Bypass across DNA lesions by specialized polymerases is essential for maintenance of genomic stability. Human DNA polymerase iota (poliota) is a bypass polymerase of the Y family. Crystal structures of poliota suggest that Hoogsteen base pairing is employed to bypass minor groove DNA lesions, placing them on the spacious major groove side of the enzyme. Primer extension studies have shown that poliota is also capable of error-free nucleotide incorporation opposite the bulky major groove adduct N-(deoxyguanosin-8-yl)-2-acetylaminofluorene (dG-AAF). We present molecular dynamics simulations and free energy calculations suggesting that Watson-Crick base pairing could be employed in poliota for bypass of dG-AAF. In poliota with Hoogsteen-paired dG-AAF the bulky AAF moiety would reside on the cramped minor groove side of the template. The Hoogsteen-capable conformation distorts the active site, disrupting interactions necessary for error-free incorporation of dC opposite the lesion. Watson-Crick pairing places the AAF rings on the spacious major groove side, similar to the position of minor groove adducts observed with Hoogsteen pairing. Watson-Crick-paired structures show a well-ordered active site, with a near reaction-ready ternary complex. Thus our results suggest that poliota would utilize the same spacious region for lesion bypass of both major and minor groove adducts. Therefore, purine adducts with bulk on the minor groove side would use Hoogsteen pairing, while adducts with the bulky lesion on the major groove side would utilize Watson-Crick base pairing as indicated by our MD simulations for dG-AAF. This suggests the possibility of an expanded role for poliota in lesion bypass.

  18. 2-Methoxypyridine as a Thymidine Mimic in Watson-Crick Base Pairs of DNA and PNA: Synthesis, Thermal Stability, and NMR Structural Studies. (United States)

    Novosjolova, Irina; Kennedy, Scott D; Rozners, Eriks


    The development of nucleic acid base-pair analogues that use new modes of molecular recognition is important both for fundamental research and practical applications. The goal of this study was to evaluate 2-methoxypyridine as a cationic thymidine mimic in the A-T base pair. The hypothesis was that including protonation in the Watson-Crick base pairing scheme would enhance the thermal stability of the DNA double helix without compromising the sequence selectivity. DNA and peptide nucleic acid (PNA) sequences containing the new 2-methoxypyridine nucleobase (P) were synthesized and studied by using UV thermal melting and NMR spectroscopy. Introduction of P nucleobase caused a loss of thermal stability of ≈10 °C in DNA-DNA duplexes and ≈20 °C in PNA-DNA duplexes over a range of mildly acidic to neutral pH. Despite the decrease in thermal stability, the NMR structural studies showed that P-A formed the expected protonated base pair at pH 4.3. Our study demonstrates the feasibility of cationic unnatural base pairs; however, future optimization of such analogues will be required. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  19. A process-based approach to characterizing the effect of acute alprazolam challenge on visual paired associate learning and memory in healthy older adults. (United States)

    Pietrzak, Robert H; Scott, James Cobb; Harel, Brian T; Lim, Yen Ying; Snyder, Peter J; Maruff, Paul


    Alprazolam is a benzodiazepine that, when administered acutely, results in impairments in several aspects of cognition, including attention, learning, and memory. However, the profile (i.e., component processes) that underlie alprazolam-related decrements in visual paired associate learning has not been fully explored. In this double-blind, placebo-controlled, randomized cross-over study of healthy older adults, we used a novel, "process-based" computerized measure of visual paired associate learning to examine the effect of a single, acute 1-mg dose of alprazolam on component processes of visual paired associate learning and memory. Acute alprazolam challenge was associated with a large magnitude reduction in visual paired associate learning and memory performance (d = 1.05). Process-based analyses revealed significant increases in distractor, exploratory, between-search, and within-search error types. Analyses of percentages of each error type suggested that, relative to placebo, alprazolam challenge resulted in a decrease in the percentage of exploratory errors and an increase in the percentage of distractor errors, both of which reflect memory processes. Results of this study suggest that acute alprazolam challenge decreases visual paired associate learning and memory performance by reducing the strength of the association between pattern and location, which may reflect a general breakdown in memory consolidation, with less evidence of reductions in executive processes (e.g., working memory) that facilitate visual paired associate learning and memory. Copyright © 2012 John Wiley & Sons, Ltd.

  20. Novel transmission pricing scheme based on point-to-point tariff and transaction pair matching for pool market

    International Nuclear Information System (INIS)

    Chen, Qixin; Xia, Qing; Kang, Chongqing


    Transmission pricing scheme is a key component in the infrastructure of power market, and pool is an indispensable pattern of market organization; meanwhile, pay-as-bid (PAB) serves as a main option to determine market prices in pool. In this paper, a novel transmission pricing scheme is proposed for pool power market based on PAB. The new scheme is developed by utilizing point-to-point (PTP) tariff and introducing an approach of transaction pair matching (TPM). The model and procedure of the new scheme are presented in detail. Apart from the advantages of existing transmission pricing schemes, such as ensuing open, fair and non-discriminatory access, proper recovery for investment as well as transparency, the new scheme provides economic signals to promote the maximum use of the existing transmission network, encourages appropriate bidding behaviors in pool, and helps to reduce the possibility of the enforcement of market power and the appearing of price spikes; thus improves market operation efficiency and trading effects. In order to testify the effectiveness of the proposed scheme, a case based on IEEE 30-bus system is studied. (author)

  1. Computational Identification of Protein Pupylation Sites by Using Profile-Based Composition of k-Spaced Amino Acid Pairs.

    Directory of Open Access Journals (Sweden)

    Md Mehedi Hasan

    Full Text Available Prokaryotic proteins are regulated by pupylation, a type of post-translational modification that contributes to cellular function in bacterial organisms. In pupylation process, the prokaryotic ubiquitin-like protein (Pup tagging is functionally analogous to ubiquitination in order to tag target proteins for proteasomal degradation. To date, several experimental methods have been developed to identify pupylated proteins and their pupylation sites, but these experimental methods are generally laborious and costly. Therefore, computational methods that can accurately predict potential pupylation sites based on protein sequence information are highly desirable. In this paper, a novel predictor termed as pbPUP has been developed for accurate prediction of pupylation sites. In particular, a sophisticated sequence encoding scheme [i.e. the profile-based composition of k-spaced amino acid pairs (pbCKSAAP] is used to represent the sequence patterns and evolutionary information of the sequence fragments surrounding pupylation sites. Then, a Support Vector Machine (SVM classifier is trained using the pbCKSAAP encoding scheme. The final pbPUP predictor achieves an AUC value of 0.849 in 10-fold cross-validation tests and outperforms other existing predictors on a comprehensive independent test dataset. The proposed method is anticipated to be a helpful computational resource for the prediction of pupylation sites. The web server and curated datasets in this study are freely available at

  2. Novel transmission pricing scheme based on point-to-point tariff and transaction pair matching for pool market

    Energy Technology Data Exchange (ETDEWEB)

    Chen, Qixin; Xia, Qing; Kang, Chongqing [State Key Lab. of Power System, Dept. of Electrical Engineering, Tsinghua University, Beijing 100084 (China)


    Transmission pricing scheme is a key component in the infrastructure of power market, and pool is an indispensable pattern of market organization; meanwhile, pay-as-bid (PAB) serves as a main option to determine market prices in pool. In this paper, a novel transmission pricing scheme is proposed for pool power market based on PAB. The new scheme is developed by utilizing point-to-point (PTP) tariff and introducing an approach of transaction pair matching (TPM). The model and procedure of the new scheme are presented in detail. Apart from the advantages of existing transmission pricing schemes, such as ensuing open, fair and non-discriminatory access, proper recovery for investment as well as transparency, the new scheme provides economic signals to promote the maximum use of the existing transmission network, encourages appropriate bidding behaviors in pool, and helps to reduce the possibility of the enforcement of market power and the appearing of price spikes; thus improves market operation efficiency and trading effects. In order to testify the effectiveness of the proposed scheme, a case based on IEEE 30-bus system is studied. (author)

  3. Determination of Organophosphorous Pesticides in Environmental Water Samples Using Surface-Engineered C18 Functionalized Silica-Coated Core-Shell Magnetic Nanoparticles-Based Extraction Coupled with GC-MS/MS Analysis. (United States)

    Srivastava, Neha; Kumari, Supriya; Nair, Kishore; Alam, Samsul; Raza, Syed K


    The present paper depicts a novel method based on magnetic SPE (MSPE) for the determination of organophosphorus pesticides (OPs) such as phorate, malathion, and chlorpyrifos in environmental water samples. In this study, C18 functionalized silica-coated core-shell iron oxide magnetic nanoparticles (MNPs) were used as a surface-engineered magnetic sorbent for the selective extraction of pesticides from aqueous samples, followed by GC-MS and GC-tandem MS analysis for confirmative determination of the analytes. Various important method parameters, including quantity of MNP adsorbent, volume of sample, effective time for extraction, nature of the desorbing solvent, and pH of the aqueous sample, were investigated and optimized to obtain maximum method performance. Under the optimized instrumental analysis conditions, good linearity (r2 value ≥0.994) was achieved at the concentration range of 0.5-500 μg/L. Recoveries were in the range of 79.2-96.3 and 80.4-97.5% in selective-ion monitoring and multiple reaction monitoring (MRM) modes, respectively, at the spiking concentrations of 1, 5, and 10 μg/L. MRM mode showed better sensitivity, selectivity, and low-level detection (0.5 μg/L) of analytes. The novel MSPE method is a simple, cheap, rapid, and eco-friendly method for the determination of OPs in environmental water samples.

  4. Electrostatics Explains the Position-Dependent Effect of G⋅U Wobble Base Pairs on the Affinity of RNA Kissing Complexes. (United States)

    Abi-Ghanem, Josephine; Rabin, Clémence; Porrini, Massimiliano; Dausse, Eric; Toulmé, Jean-Jacques; Gabelica, Valérie


    In the RNA realm, non-Watson-Crick base pairs are abundant and can affect both the RNA 3D structure and its function. Here, we investigated the formation of RNA kissing complexes in which the loop-loop interaction is modulated by non-Watson-Crick pairs. Mass spectrometry, surface plasmon resonance, and UV-melting experiments show that the G⋅U wobble base pair favors kissing complex formation only when placed at specific positions. We tried to rationalize this effect by molecular modeling, including molecular mechanics Poisson-Boltzmann surface area (MMPBSA) thermodynamics calculations and PBSA calculations of the electrostatic potential surfaces. Modeling reveals that the G⋅U stabilization is due to a specific electrostatic environment defined by the base pairs of the entire loop-loop region. The loop is not symmetric, and therefore the identity and position of each base pair matters. Predicting and visualizing the electrostatic environment created by a given sequence can help to design specific kissing complexes with high affinity, for potential therapeutic, nanotechnology or analytical applications. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  5. Investigation on the ion pair amphiphiles and their in vitro release of amantadine drug based on PLGA–PEG–PLGA gel

    International Nuclear Information System (INIS)

    Yang, Xiaoxia; Ji, Xiaoqing; Shi, Chunhuan; Liu, Jing; Wang, Haiyang; Luan, Yuxia


    The amantadine drug and oleic acid surfactant are used to form amantadine-based ion pair amphiphiles based on proton transfer reaction between the drug and the surfactant molecules. The ion pair amphiphiles are characterized by 1 H-nuclear magnetic resonance, Fourier transform infrared spectroscopy, and X-ray diffraction. Self-assembly properties of amantadine-based ion pair amphiphiles are studied by surface tension determination, transmission electron microscopy, zeta potential, and dynamic light scattering. The aggregation behavior studies indicate that the as-prepared ion pair amphiphiles can self-assemble into vesicles with the size of 200–300 nm in aqueous solution. The drug release results show that the amantadine release rate could be well controlled by incorporating the amantadine-based ion pair vesicles in poly (lactic-co-glycolic acid)-poly (ethylene glycol)-poly (lactic-co-glycolic acid) (PLGA–PEG–PLGA) copolymer hydrogel. The drug release from the AT–OA vesicle-loaded PLGA–PEG–PLGA hydrogel is significantly inhibited in comparison with the AT-loaded PLGA–PEG–PLGA hydrogel. The present work thus demonstrates that the vesicle-loaded hydrogel is a good candidate for the drug delivery system with long-term controlled drug release behavior

  6. Selective Preference of Parallel DNA Triplexes Is Due to the Disruption of Hoogsteen Hydrogen Bonds Caused by the Severe Nonisostericity between the G*GC and T*AT Triplets.

    Directory of Open Access Journals (Sweden)

    Gunaseelan Goldsmith

    Full Text Available Implications of DNA, RNA and RNA.DNA hybrid triplexes in diverse biological functions, diseases and therapeutic applications call for a thorough understanding of their structure-function relationships. Despite exhaustive studies mechanistic rationale for the discriminatory preference of parallel DNA triplexes with G*GC & T*AT triplets still remains elusive. Here, we show that the highest nonisostericity between the G*GC & T*AT triplets imposes extensive stereochemical rearrangements contributing to context dependent triplex destabilisation through selective disruption of Hoogsteen scheme of hydrogen bonds. MD simulations of nineteen DNA triplexes with an assortment of sequence milieu reveal for the first time fresh insights into the nature and extent of destabilization from a single (non-overlapping, double (overlapping and multiple pairs of nonisosteric base triplets (NIBTs. It is found that a solitary pair of NIBTs, feasible either at a G*GC/T*AT or T*AT/G*GC triplex junction, does not impinge significantly on triplex stability. But two overlapping pairs of NIBTs resulting from either a T*AT or a G*GC interruption disrupt Hoogsteen pair to a noncanonical mismatch destabilizing the triplex by ~10 to 14 kcal/mol, implying that their frequent incidence in multiples, especially, in short sequences could even hinder triplex formation. The results provide (i an unambiguous and generalised mechanistic rationale for the discriminatory trait of parallel triplexes, including those studied experimentally (ii clarity for the prevalence of antiparallel triplexes and (iii comprehensive perspectives on the sequence dependent influence of nonisosteric base triplets useful in the rational design of TFO's against potential triplex target sites.

  7. Evaluation of the comprehensive palatability of Japanese sake paired with dishes by multiple regression analysis based on subdomains. (United States)

    Nakamura, Ryo; Nakano, Kumiko; Tamura, Hiroyasu; Mizunuma, Masaki; Fushiki, Tohru; Hirata, Dai


    Many factors contribute to palatability. In order to evaluate the palatability of Japanese alcohol sake paired with certain dishes by integrating multiple factors, here we applied an evaluation method previously reported for palatability of cheese by multiple regression analysis based on 3 subdomain factors (rewarding, cultural, and informational). We asked 94 Japanese participants/subjects to evaluate the palatability of sake (1st evaluation/E1 for the first cup, 2nd/E2 and 3rd/E3 for the palatability with aftertaste/afterglow of certain dishes) and to respond to a questionnaire related to 3 subdomains. In E1, 3 factors were extracted by a factor analysis, and the subsequent multiple regression analyses indicated that the palatability of sake was interpreted by mainly the rewarding. Further, the results of attribution-dissections in E1 indicated that 2 factors (rewarding and informational) contributed to the palatability. Finally, our results indicated that the palatability of sake was influenced by the dish eaten just before drinking.

  8. Controlled and Efficient Polymerization of Conjugated Polar Alkenes by Lewis Pairs Based on Sterically Hindered Aryloxide-Substituted Alkylaluminum

    Directory of Open Access Journals (Sweden)

    Xiaojun Wang


    Full Text Available Reported herein is the development of an effective strategy for controlled and efficient Lewis pair polymerization of conjugated polar alkenes, including methyl methacrylate (MMA, n-butyl methacrylate (nBuMA, and γ-methyl-α-methylene-γ-butyrolactone (γMMBL, by the utilization of sterically encumbered Al(BHT2Me (BHT: 2,6-di-tert-butyl-4-methylphenol as a Lewis acid that shuts down intramolecular backbiting termination. In combination with a selected N-heterocyclic carbene (NHC as a Lewis base, the polymerization of MMA exhibited activity up to 3000 h−1 TOF and an acceptable initiation efficiency of 60.6%, producing polymers with high molecular weight (Mn up to 130 kg/mol and extremely narrow dispersity (Đ = 1.06~1.13. This controlled polymerization with a living characteristic has been evidenced by chain-extension experiments and chain-end analysis, and enabled the synthesis of well-defined diblock copolymers.

  9. PASSion: a pattern growth algorithm-based pipeline for splice junction detection in paired-end RNA-Seq data. (United States)

    Zhang, Yanju; Lameijer, Eric-Wubbo; 't Hoen, Peter A C; Ning, Zemin; Slagboom, P Eline; Ye, Kai


    RNA-seq is a powerful technology for the study of transcriptome profiles that uses deep-sequencing technologies. Moreover, it may be used for cellular phenotyping and help establishing the etiology of diseases characterized by abnormal splicing patterns. In RNA-Seq, the exact nature of splicing events is buried in the reads that span exon-exon boundaries. The accurate and efficient mapping of these reads to the reference genome is a major challenge. We developed PASSion, a pattern growth algorithm-based pipeline for splice site detection in paired-end RNA-Seq reads. Comparing the performance of PASSion to three existing RNA-Seq analysis pipelines, TopHat, MapSplice and HMMSplicer, revealed that PASSion is competitive with these packages. Moreover, the performance of PASSion is not affected by read length and coverage. It performs better than the other three approaches when detecting junctions in highly abundant transcripts. PASSion has the ability to detect junctions that do not have known splicing motifs, which cannot be found by the other tools. Of the two public RNA-Seq datasets, PASSion predicted ≈ 137,000 and 173,000 splicing events, of which on average 82 are known junctions annotated in the Ensembl transcript database and 18% are novel. In addition, our package can discover differential and shared splicing patterns among multiple samples. The code and utilities can be freely downloaded from and

  10. Perturbative triples correction for local pair natural orbital based explicitly correlated CCSD(F12*) using Laplace transformation techniques. (United States)

    Schmitz, Gunnar; Hättig, Christof


    We present an implementation of pair natural orbital coupled cluster singles and doubles with perturbative triples, PNO-CCSD(T), which avoids the quasi-canonical triples approximation (T0) where couplings due to off-diagonal Fock matrix elements are neglected. A numerical Laplace transformation of the canonical expression for the perturbative (T) triples correction is used to avoid an I/O and storage bottleneck for the triples amplitudes. Results for a test set of reaction energies show that only very few Laplace grid points are needed to obtain converged energy differences and that PNO-CCSD(T) is a more robust approximation than PNO-CCSD(T0) with a reduced mean absolute deviation from canonical CCSD(T) results. We combine the PNO-based (T) triples correction with the explicitly correlated PNO-CCSD(F12*) method and investigate the use of specialized F12-PNOs in the conventional triples correction. We find that no significant additional errors are introduced and that PNO-CCSD(F12*)(T) can be applied in a black box manner.

  11. A pair natural orbital based implementation of CCSD excitation energies within the framework of linear response theory (United States)

    Frank, Marius S.; Hättig, Christof


    We present a pair natural orbital (PNO)-based implementation of coupled cluster singles and doubles (CCSD) excitation energies that builds upon the previously proposed state-specific PNO approach to the excited state eigenvalue problem. We construct the excited state PNOs for each state separately in a truncated orbital specific virtual basis and use a local density-fitting approximation to achieve an at most quadratic scaling of the computational costs for the PNO construction. The earlier reported excited state PNO construction is generalized such that a smooth convergence of the results for charge transfer states is ensured for general coupled cluster methods. We investigate the accuracy of our implementation by applying it to a large and diverse test set comprising 153 singlet excitations in organic molecules. Already moderate PNO thresholds yield mean absolute errors below 0.01 eV. The performance of the implementation is investigated through the calculations on alkene chains and reveals an at most cubic cost-scaling for the CCSD iterations with the system size.

  12. Type I-E CRISPR-Cas Systems Discriminate Target from Non-Target DNA through Base Pairing-Independent PAM Recognition (United States)

    Datsenko, Kirill A.; Jackson, Ryan N.; Wiedenheft, Blake; Severinov, Konstantin; Brouns, Stan J. J.


    Discriminating self and non-self is a universal requirement of immune systems. Adaptive immune systems in prokaryotes are centered around repetitive loci called CRISPRs (clustered regularly interspaced short palindromic repeat), into which invader DNA fragments are incorporated. CRISPR transcripts are processed into small RNAs that guide CRISPR-associated (Cas) proteins to invading nucleic acids by complementary base pairing. However, to avoid autoimmunity it is essential that these RNA-guides exclusively target invading DNA and not complementary DNA sequences (i.e., self-sequences) located in the host's own CRISPR locus. Previous work on the Type III-A CRISPR system from Staphylococcus epidermidis has demonstrated that a portion of the CRISPR RNA-guide sequence is involved in self versus non-self discrimination. This self-avoidance mechanism relies on sensing base pairing between the RNA-guide and sequences flanking the target DNA. To determine if the RNA-guide participates in self versus non-self discrimination in the Type I-E system from Escherichia coli we altered base pairing potential between the RNA-guide and the flanks of DNA targets. Here we demonstrate that Type I-E systems discriminate self from non-self through a base pairing-independent mechanism that strictly relies on the recognition of four unchangeable PAM sequences. In addition, this work reveals that the first base pair between the guide RNA and the PAM nucleotide immediately flanking the target sequence can be disrupted without affecting the interference phenotype. Remarkably, this indicates that base pairing at this position is not involved in foreign DNA recognition. Results in this paper reveal that the Type I-E mechanism of avoiding self sequences and preventing autoimmunity is fundamentally different from that employed by Type III-A systems. We propose the exclusive targeting of PAM-flanked sequences to be termed a target versus non-target discrimination mechanism. PMID:24039596

  13. Paired fuzzy sets

    DEFF Research Database (Denmark)

    Rodríguez, J. Tinguaro; Franco de los Ríos, Camilo; Gómez, Daniel


    In this paper we want to stress the relevance of paired fuzzy sets, as already proposed in previous works of the authors, as a family of fuzzy sets that offers a unifying view for different models based upon the opposition of two fuzzy sets, simply allowing the existence of different types...

  14. Affine pairings on ARM

    NARCIS (Netherlands)

    Acar, T.; Lauter, K.; Naehrig, M.; Shumow, D.; Abdalla, M.; Lange, T.


    We report on relative performance numbers for affine and projective pairings on a dual-core Cortex A9 ARM processor. Using a fast inversion in the base field and doing inversion in extension fields by using the norm map to reduce to inversions in smaller fields, we find a very low ratio of

  15. Design of two and three input molecular logic gates using non-Watson-Crick base pairing-based molecular beacons. (United States)

    Lin, Jia-Hui; Tseng, Wei-Lung


    This study presents a single, resettable, and sensitive molecular beacon (MB) used to operate molecular-scale logic gates. The MB consists of a random DNA sequence, a fluorophore at the 5'-end, and a quencher at the 3'-end. The presence of Hg(2+), Ag(+), and coralyne promoted the formation of stable T-Hg(2+)-T, C-Ag(+)-C, and A2-coralyne-A2 coordination in the MB probe, respectively, thereby driving its conformational change. The metal ion or small molecule-mediated coordination of mismatched DNA brought the fluorophore and the quencher into close proximity, resulting in collisional quenching of fluorescence between the two organic dyes. Because thiol can bind Hg(2+) and remove it from the T-Hg(2+)-T-based MB, adding thiol to a solution of the T-Hg(2+)-T-based MB allowed the fluorophore and the quencher to be widely separated. A similar phenomenon was observed when replacing Hg(2+) with Ag(+). Because Ag(+) strongly binds to iodide, cyanide, and cysteine, they were capable of removing Ag(+) from the C-Ag(+)-C-based MB, restoring the fluorescence of the MB. Moreover, the fluorescence of the A2-coralyne-A2-based MB could be switched on by adding polyadenosine. Using these analytes as inputs and the MB as a signal transducer, we successfully developed a series of two-input, three-input, and set-reset logic gates at the molecular level.

  16. A double base change in alternate base pairs induced by ultraviolet irradiation in a glycine transfer RNA gene

    International Nuclear Information System (INIS)

    Coleman, R.D.; Dunst, R.W.; Hill, C.W.; Pennsylvania State Univ., Hershey


    The glyUsusub(AGA) mutation affects Escherichia coli tRNAsup(Gly)sub(GGG), changing it to an AGA missense suppressor tRNA. Sequence studies have shown that the mutation involves a double base substitution at the first and third positions of the tRNA anticodon, the result being a change in the anticodon from CCC to UCU. A system has been developed to facilitate the detection of this novel mutation, and we have shown that ultraviolet irradiation and N-methyl-N'-nitro-N-nitrosoguanidine (MNNG) are effective in causing the double base change. A single observation of the mutation occuring spontaneously has been made also. The frequency of MNNG-induced glyUsusub(AGA) mutations is compatible with their being caused by two separate mutagenic events. The frequency of UV-induced glyUsusub(AGA) mutations, however, strongly suggests that the occurence of one base substitution strongly enhances the chance of finding the second substitution at the alternate position. In addition to the double change in the anticodon, the glyUsusub(AGA) tRNA differs from tRNAsup(gly)sub(GGG) in that it bears a modification of the A adjacent to the 3' position of the anticodon. Most likely, this modified base is N-[9-(β-D-ribofuranosyl)-purin-6-ylcarbamoyl] threonine. (orig.) 891 AJ/orig. 892 BRE [de

  17. Purification of equine Gc-globulin

    DEFF Research Database (Denmark)

    Houen, Gunnar; Pihl, Tina Holberg; Andersen, Pia Haubro

    Objectives With the aim of producing antibodies for an equine Group specific component (Gc)-globulin assay, the protein was purified from normal equine plasma. Methods Equine Gc-globulin was purified from healthy horse plasma using ion exchange chromatography (Q-Sepharose, CM......-Sepharose) and preparative PAGE. Results Equine Gc-globulin has successfully been purified from healthy horse plasma and rabbits and mice are being immunized to produce specific antibodies. Conclusions Purification of equine Gc-globulin and the production of specific antibodies will make it possible to develop an assay...... to be a sensitive marker of acute tissue injury and fatal outcome in humans. Patients with a low plasma concentration of Gc-globulin due to severe tissue injury might potentially benefit from infusions with purified Gc-globulin [1]. With an equine Gc-globulin assay, future studies will investigate the concentration...

  18. ACL2 Meets the GPU: Formalizing a CUDA-based Parallelizable All-Pairs Shortest Path Algorithm in ACL2

    Directory of Open Access Journals (Sweden)

    David S. Hardin


    Full Text Available As Graphics Processing Units (GPUs have gained in capability and GPU development environments have matured, developers are increasingly turning to the GPU to off-load the main host CPU of numerically-intensive, parallelizable computations. Modern GPUs feature hundreds of cores, and offer programming niceties such as double-precision floating point, and even limited recursion. This shift from CPU to GPU, however, raises the question: how do we know that these new GPU-based algorithms are correct? In order to explore this new verification frontier, we formalized a parallelizable all-pairs shortest path (APSP algorithm for weighted graphs, originally coded in NVIDIA's CUDA language, in ACL2. The ACL2 specification is written using a single-threaded object (stobj and tail recursion, as the stobj/tail recursion combination yields the most straightforward translation from imperative programming languages, as well as efficient, scalable executable specifications within ACL2 itself. The ACL2 version of the APSP algorithm can process millions of vertices and edges with little to no garbage generation, and executes at one-sixth the speed of a host-based version of APSP coded in C – a very respectable result for a theorem prover. In addition to formalizing the APSP algorithm (which uses Dijkstra's shortest path algorithm at its core, we have also provided capability that the original APSP code lacked, namely shortest path recovery. Path recovery is accomplished using a secondary ACL2 stobj implementing a LIFO stack, which is proven correct. To conclude the experiment, we ported the ACL2 version of the APSP kernels back to C, resulting in a less than 5% slowdown, and also performed a partial back-port to CUDA, which, surprisingly, yielded a slight performance increase.

  19. Can tautomerization of the A·T Watson-Crick base pair via double proton transfer provoke point mutations during DNA replication? A comprehensive QM and QTAIM analysis. (United States)

    Brovarets, Ol'ha O; Hovorun, Dmytro M


    Trying to answer the question posed in the title, we have carried out a detailed theoretical investigation of the biologically important mechanism of the tautomerization of the A·T Watson-Crick DNA base pair, information that is hard to establish experimentally. By combining theoretical investigations at the MP2 and density functional theory levels of QM theory with quantum theory of atoms in molecules analysis, the tautomerization of the A·T Watson-Crick base pair by the double proton transfer (DPT) was comprehensively studied in vacuo and in the continuum with a low dielectric constant (ϵ = 4) corresponding to a hydrophobic interfaces of protein-nucleic acid interactions. Based on the sweeps of the electron-topological, geometric, and energetic parameters, which describe the course of the tautomerization along its intrinsic reaction coordinate (IRC), it was proved that the A·T → A(∗)·T(∗) tautomerization through the DPT is a concerted (i.e. the pathway without an intermediate) and asynchronous (i.e. protons move with a time gap) process. The limiting stage of this phenomenon is the final PT along the N6H⋯O4 hydrogen bond (H-bond). The continuum with ϵ = 4 does not affect qualitatively the course of the tautomerization reaction: similar to that observed in vacuo, it proceeds via a concerted asynchronous process with the same structure of the transition state (TS). For the first time, the nine key points along the IRC of the A·T base pair tautomerization, which could be considered as electron-topological "fingerprints" of a concerted asynchronous process of the tautomerization via the DPT, have been identified and fully characterized. These nine key points have been used to define the reactant, TS, and product regions of the DPT in the A·T base pair. Considering the energy dependence of each of the three H-bonds, which stabilize the Watson-Crick and Löwdin's base pairs, along the IRC of the tautomerization, it was found that all these H

  20. Small, synthetic, GC-rich mRNA stem-loop modules 5' proximal to the AUG start-codon predictably tune gene expression in yeast. (United States)

    Lamping, Erwin; Niimi, Masakazu; Cannon, Richard D


    A large range of genetic tools has been developed for the optimal design and regulation of complex metabolic pathways in bacteria. However, fewer tools exist in yeast that can precisely tune the expression of individual enzymes in novel metabolic pathways suitable for industrial-scale production of non-natural compounds. Tuning expression levels is critical for reducing the metabolic burden of over-expressed proteins, the accumulation of toxic intermediates, and for redirecting metabolic flux from native pathways involving essential enzymes without negatively affecting the viability of the host. We have developed a yeast membrane protein hyper-expression system with critical advantages over conventional, plasmid-based, expression systems. However, expression levels are sometimes so high that they adversely affect protein targeting/folding or the growth and/or phenotype of the host. Here we describe the use of small synthetic mRNA control modules that allowed us to predictably tune protein expression levels to any desired level. Down-regulation of expression was achieved by engineering small GC-rich mRNA stem-loops into the 5' UTR that inhibited translation initiation of the yeast ribosomal 43S preinitiation complex (PIC). Exploiting the fact that the yeast 43S PIC has great difficulty scanning through GC-rich mRNA stem-loops, we created yeast strains containing 17 different RNA stem-loop modules in the 5' UTR that expressed varying amounts of the fungal multidrug efflux pump reporter Cdr1p from Candida albicans. Increasing the length of mRNA stem-loops (that contained only GC-pairs) near the AUG start-codon led to a surprisingly large decrease in Cdr1p expression; ~2.7-fold for every additional GC-pair added to the stem, while the mRNA levels remained largely unaffected. An mRNA stem-loop of seven GC-pairs (∆G = -15.8 kcal/mol) reduced Cdr1p expression levels by >99%, and even the smallest possible stem-loop of only three GC-pairs (∆G = -4.4 kcal/mol) inhibited

  1. Small, synthetic, GC-rich mRNA stem-loop modules 5′ proximal to the AUG start-codon predictably tune gene expression in yeast (United States)


    Background A large range of genetic tools has been developed for the optimal design and regulation of complex metabolic pathways in bacteria. However, fewer tools exist in yeast that can precisely tune the expression of individual enzymes in novel metabolic pathways suitable for industrial-scale production of non-natural compounds. Tuning expression levels is critical for reducing the metabolic burden of over-expressed proteins, the accumulation of toxic intermediates, and for redirecting metabolic flux from native pathways involving essential enzymes without negatively affecting the viability of the host. We have developed a yeast membrane protein hyper-expression system with critical advantages over conventional, plasmid-based, expression systems. However, expression levels are sometimes so high that they adversely affect protein targeting/folding or the growth and/or phenotype of the host. Here we describe the use of small synthetic mRNA control modules that allowed us to predictably tune protein expression levels to any desired level. Down-regulation of expression was achieved by engineering small GC-rich mRNA stem-loops into the 5′ UTR that inhibited translation initiation of the yeast ribosomal 43S preinitiation complex (PIC). Results Exploiting the fact that the yeast 43S PIC has great difficulty scanning through GC-rich mRNA stem-loops, we created yeast strains containing 17 different RNA stem-loop modules in the 5′ UTR that expressed varying amounts of the fungal multidrug efflux pump reporter Cdr1p from Candida albicans. Increasing the length of mRNA stem-loops (that contained only GC-pairs) near the AUG start-codon led to a surprisingly large decrease in Cdr1p expression; ~2.7-fold for every additional GC-pair added to the stem, while the mRNA levels remained largely unaffected. An mRNA stem-loop of seven GC-pairs (∆G = −15.8 kcal/mol) reduced Cdr1p expression levels by >99%, and even the smallest possible stem-loop of only three GC-pairs (

  2. Attenuation-based kV pair selection in dual source dual energy computed tomography angiography of the chest: impact on radiation dose and image quality

    Energy Technology Data Exchange (ETDEWEB)

    Renapurkar, Rahul D.; Azok, Joseph; Lempel, Jason; Karim, Wadih; Graham, Ruffin [Thoracic Imaging, L10, Imaging Institute, Cleveland Clinic, Cleveland, OH (United States); Primak, Andrew [Siemens Medical Solutions, Malvern, PA (United States); Tandon, Yasmeen [Case Western Reserve University-Metro Health Medical Center, Department of Radiology, Cleveland, OH (United States); Bullen, Jennifer [Quantitative Health Sciences, Cleveland Clinic, Cleveland, OH (United States); Dong, Frank [Section of Medical Physics, Cleveland Clinic, Cleveland, OH (United States)


    The purpose of this study was to evaluate the impact of attenuation-based kilovoltage (kV) pair selection in dual source dual energy (DSDE)-pulmonary embolism (PE) protocol examinations on radiation dose savings and image quality. A prospective study was carried out on 118 patients with suspected PE. In patients in whom attenuation-based kV pair selection selected the 80/140Sn kV pair, the pre-scan 100/140Sn CTDIvol (computed tomography dose index volume) values were compared with the pre-scan 80/140Sn CTDIvol values. Subjective and objective image quality parameters were assessed. Attenuation-based kV pair selection switched to the 80/140Sn kV pair (''switched'' cohort) in 63 out of 118 patients (53%). The mean 100/140Sn pre-scan CTDIvol was 8.8 mGy, while the mean 80/140Sn pre-scan CTDIvol was 7.5 mGy. The average estimated dose reduction for the ''switched'' cohort was 1.3 mGy (95% CI 1.2, 1.4; p < 0.001), representing a 15% reduction in dose. After adjusting for patient weight, mean attenuation was significantly higher in the ''switched'' vs. ''non-switched'' cohorts in all five pulmonary arteries and in all lobes on iodine maps. This study demonstrates that attenuation-based kV pair selection in DSDE examination is feasible and can offer radiation dose reduction without compromising image quality. (orig.)

  3. The structure of an E. coli tRNAfMet A1-U72 variant shows an unusual conformation of the A1-U72 base pair. (United States)

    Monestier, Auriane; Aleksandrov, Alexey; Coureux, Pierre-Damien; Panvert, Michel; Mechulam, Yves; Schmitt, Emmanuelle


    Translation initiation in eukaryotes and archaea involves a methionylated initiator tRNA delivered to the ribosome in a ternary complex with e/aIF2 and GTP. Eukaryotic and archaeal initiator tRNAs contain a highly conserved A 1 -U 72 base pair at the top of the acceptor stem. The importance of this base pair to discriminate initiator tRNAs from elongator tRNAs has been established previously using genetics and biochemistry. However, no structural data illustrating how the A 1 -U 72 base pair participates in the accurate selection of the initiator tRNAs by the translation initiation systems are available. Here, we describe the crystal structure of a mutant E. coli initiator tRNA f Met A 1 -U 72 , aminoacylated with methionine, in which the C 1 :A 72 mismatch at the end of the tRNA acceptor stem has been changed to an A 1 -U 72 base pair. Sequence alignments show that the mutant E. coli tRNA is a good mimic of archaeal initiator tRNAs. The crystal structure, determined at 2.8 Å resolution, shows that the A 1 -U 72 pair adopts an unusual arrangement. A 1 is in a syn conformation and forms a single H-bond interaction with U 72 This interaction requires protonation of the N1 atom of A 1 Moreover, the 5' phosphoryl group folds back into the major groove of the acceptor stem and interacts with the N7 atom of G 2 A possible role of this unusual geometry of the A 1 -U 72 pair in the recognition of the initiator tRNA by its partners during eukaryotic and archaeal translation initiation is discussed. © 2017 Monestier et al.; Published by Cold Spring Harbor Laboratory Press for the RNA Society.

  4. Lumping of degree-based mean-field and pair-approximation equations for multistate contact processes (United States)

    Kyriakopoulos, Charalampos; Grossmann, Gerrit; Wolf, Verena; Bortolussi, Luca


    Contact processes form a large and highly interesting class of dynamic processes on networks, including epidemic and information-spreading networks. While devising stochastic models of such processes is relatively easy, analyzing them is very challenging from a computational point of view, particularly for large networks appearing in real applications. One strategy to reduce the complexity of their analysis is to rely on approximations, often in terms of a set of differential equations capturing the evolution of a random node, distinguishing nodes with different topological contexts (i.e., different degrees of different neighborhoods), such as degree-based mean-field (DBMF), approximate-master-equation (AME), or pair-approximation (PA) approaches. The number of differential equations so obtained is typically proportional to the maximum degree kmax of the network, which is much smaller than the size of the master equation of the underlying stochastic model, yet numerically solving these equations can still be problematic for large kmax. In this paper, we consider AME and PA, extended to cope with multiple local states, and we provide an aggregation procedure that clusters together nodes having similar degrees, treating those in the same cluster as indistinguishable, thus reducing the number of equations while preserving an accurate description of global observables of interest. We also provide an automatic way to build such equations and to identify a small number of degree clusters that give accurate results. The method is tested on several case studies, where it shows a high level of compression and a reduction of computational time of several orders of magnitude for large networks, with minimal loss in accuracy.

  5. Roles of the active site residues and metal cofactors in noncanonical base-pairing during catalysis by human DNA polymerase iota. (United States)

    Makarova, Alena V; Ignatov, Artem; Miropolskaya, Nataliya; Kulbachinskiy, Andrey


    Human DNA polymerase iota (Pol ι) is a Y-family polymerase that can bypass various DNA lesions but possesses very low fidelity of DNA synthesis in vitro. Structural analysis of Pol ι revealed a narrow active site that promotes noncanonical base-pairing during catalysis. To better understand the structure-function relationships in the active site of Pol ι we investigated substitutions of individual amino acid residues in its fingers domain that contact either the templating or the incoming nucleotide. Two of the substitutions, Y39A and Q59A, significantly decreased the catalytic activity but improved the fidelity of Pol ι. Surprisingly, in the presence of Mn(2+) ions, the wild-type and mutant Pol ι variants efficiently incorporated nucleotides opposite template purines containing modifications that disrupted either Hoogsteen or Watson-Crick base-pairing, suggesting that Pol ι may use various types of interactions during nucleotide addition. In contrast, in Mg(2+) reactions, wild-type Pol ι was dependent on Hoogsteen base-pairing, the Y39A mutant was essentially inactive, and the Q59A mutant promoted Watson-Crick interactions with template purines. The results suggest that Pol ι utilizes distinct mechanisms of nucleotide incorporation depending on the metal cofactor and reveal important roles of specific residues from the fingers domain in base-pairing and catalysis. Copyright © 2014 Elsevier B.V. All rights reserved.

  6. A Novel Mechanism of High-Level, Broad-Spectrum Antibiotic Resistance Caused by a Single Base Pair Change in Neisseria gonorrhoeae (United States)


    respect, Eisenstein and Sparling noted that a single base pair deletion in the inverted repeat in the mtrR promoter, a mutation which also confers high...Regulation of the MtrC-MtrD-MtrE efflux-pump system modulates the in vivo fitness of Neisseria gonorrhoeae. J. Infect. Dis. 196:1804 –1812. 21. Eisenstein BI

  7. High-Resolution Nuclear Magnetic Resonance Determination of Transfer RNA Tertiary Base Pairs in Solution. 2. Species Containing a Large Variable Loop

    NARCIS (Netherlands)



    The number of base pairs in the solution structure of several class III D3VN tRNA species from E. coli has been determined by analyzing the number of low-field (-15 to -11 ppm) proton resonances in their nuclear magnetic resonance spectra at 360 MHz. Contrary to previous reports indicating the

  8. Structures, physicochemical properties, and applications of T-Hg-II-T, C-Ag-I-C, and other metallo-base-pairs

    Czech Academy of Sciences Publication Activity Database

    Tanaka, Y.; Kondo, J.; Sychrovský, Vladimír; Šebera, Jakub; Dairaku, T.; Saneyoshi, H.; Urata, H.; Torigoe, H.; Ono, A.


    Roč. 51, č. 98 (2015), s. 17343-17360 ISSN 1359-7345 R&D Projects: GA ČR GAP205/10/0228 Institutional support: RVO:61388963 Keywords : metal-mediated base-pairs * T–Hg–T * C–Ag–C Subject RIV: CF - Physical ; Theoretical Chemistry Impact factor: 6.567, year: 2015

  9. Polymerase recognition of 2-thio-iso-guanine·5-methyl-4-pyrimidinone (iGs·P)--A new DD/AA base pair. (United States)

    Lee, Dong-Kye; Switzer, Christopher


    Polymerase specificity is reported for a previously unknown base pair with a non-standard DD/AA hydrogen bonding pattern: 2-thio-iso-guanine·5-methyl-4-pyrimidinone. Our findings suggest that atomic substitution may provide a solution for low fidelity previously associated with enzymatic copying of iso-guanine. Copyright © 2016 Elsevier Ltd. All rights reserved.

  10. Complexes of DNA bases and Watson-Crick base pairs interaction with neutral silver Agn (n = 8, 10, 12) clusters: a DFT and TDDFT study. (United States)

    Srivastava, Ruby


    We study the binding of the neutral Ag n (n = 8, 10, 12) to the DNA base-adenine (A), guanine (G) and Watson-Crick -adenine-thymine, guanine-cytosine pairs. Geometries of complexes were optimized at the DFT level using the hybrid B3LYP functional. LANL2DZ effective core potential was used for silver and 6-31 + G ** was used for all other atoms. NBO charges were analyzed using the Natural population analysis. The absorption properties of Ag n -A,G/WC complexes were also studied using time-dependent density functional theory. The absorption spectra for these complexes show wavelength in the visible region. It was revealed that silver clusters interact more strongly with WC pairs than with isolated DNA complexes. Furthermore, it was found that the electronic charge transferred from silver to isolated DNA clusters are less than the electronic charge transferred from silver to the Ag n -WC complexes. The vertical ionization potential, vertical electron affinity, hardness, and electrophilicity index of Ag n -DNA/WC complexes have also been discussed.

  11. Comparison and combination of "direct" and fragment based local correlation methods: Cluster in molecules and domain based local pair natural orbital perturbation and coupled cluster theories (United States)

    Guo, Yang; Becker, Ute; Neese, Frank


    Local correlation theories have been developed in two main flavors: (1) "direct" local correlation methods apply local approximation to the canonical equations and (2) fragment based methods reconstruct the correlation energy from a series of smaller calculations on subsystems. The present work serves two purposes. First, we investigate the relative efficiencies of the two approaches using the domain-based local pair natural orbital (DLPNO) approach as the "direct" method and the cluster in molecule (CIM) approach as the fragment based approach. Both approaches are applied in conjunction with second-order many-body perturbation theory (MP2) as well as coupled-cluster theory with single-, double- and perturbative triple excitations [CCSD(T)]. Second, we have investigated the possible merits of combining the two approaches by performing CIM calculations with DLPNO methods serving as the method of choice for performing the subsystem calculations. Our cluster-in-molecule approach is closely related to but slightly deviates from approaches in the literature since we have avoided real space cutoffs. Moreover, the neglected distant pair correlations in the previous CIM approach are considered approximately. Six very large molecules (503-2380 atoms) were studied. At both MP2 and CCSD(T) levels of theory, the CIM and DLPNO methods show similar efficiency. However, DLPNO methods are more accurate for 3-dimensional systems. While we have found only little incentive for the combination of CIM with DLPNO-MP2, the situation is different for CIM-DLPNO-CCSD(T). This combination is attractive because (1) the better parallelization opportunities offered by CIM; (2) the methodology is less memory intensive than the genuine DLPNO-CCSD(T) method and, hence, allows for large calculations on more modest hardware; and (3) the methodology is applicable and efficient in the frequently met cases, where the largest subsystem calculation is too large for the canonical CCSD(T) method.

  12. Formative Value of an Active Learning Strategy: Technology Based Think-Pair-Share in an EFL Writing Classroom (United States)

    Demirci, Cavide; Düzenli, Halil


    Think-Pair-Share (TPS) activities in classrooms provide an opportunity for students to revise, practice and reproduce previously learned knowledge. Teachers also benefit from this active learning strategy by exploiting new learning materials, saving time by minimizing presentations and using it as a formative assessment tool. This article explores…

  13. Admission levels of serum Gc-globulin

    DEFF Research Database (Denmark)

    Schiødt, F V; Bondesen, S; Petersen, I


    Gc-globulin scavenges actin released from necrotic hepatocytes to the extracellular space. In 77 patients with fulminant hepatic failure (FHF) (excluding patients treated with liver transplantation), admission levels of serum Gc-globulin and degree of complexing with monomeric actin (complex ratio...... in the same range as the KCH criteria. An advantage of Gc-globulin is that it gives an estimate of the outcome already on admission. Acute liver transplantation should be considered in FHF patients with Gc-globulin less than 100 mg/L....

  14. Characterizing Fluorotelomer and Polyfluoroalkyl Substances in New and Aged Fluorotelomer-Based Polymers for Degradation Studies with GC/MS and LC/MS/MS (United States)

    Fluorotelomer-based polymers (FTPs), the dominant product of the fluorotelomer industry, are antistaining and antiwetting agents that permeate the products and surfaces of modern society. However, the degree to which these materials expose humans and the environment to fluorotelo...

  15. [Comparative study on promoting blood effects of Danshen-Honghua herb pair with different preparations based on chemometrics and multi-attribute comprehensive index methods]. (United States)

    Qu, Cheng; Tang, Yu-Ping; Shi, Xu-Qin; Zhou, Gui-Sheng; Shang, Er-Xin; Shang, Li-Li; Guo, Jian-Ming; Liu, Pei; Zhao, Jing; Zhao, Bu-Chang; Duan, Jin-Ao


    To evaluate the promoting blood circulation and removing blood stasis effects of Danshen-Honghua(DH) herb pair with different preparations (alcohol, 50% alcohol and water) on blood rheology and coagulation functions in acute blood stasis rats, and optimize the best preparation method of DH based on principal component analysis(PCA), hierarchical cluster heatmap analysis and multi-attribute comprehensive index methods. Ice water bath and subcutaneous injection of adrenaline were both used to establish the acute blood stasis rat model. Then the blood stasis rats were administrated intragastrically with DH (alcohol, 50% alcohol and water) extracts. The whole blood viscosity(WBV), plasma viscosity(PV), erythrocyte sedimentation rate(ESR) and haematocrit(HCT) were tested to observe the effects of DH herb pair with different preparations and doses on hemorheology of blood stasis rats; the activated partial thromboplastin time(APTT), thrombin time(TT), prothrombin time(PT), and plasma fibrinogen(FIB) were tested to observe the effects of DH herb pair with different preparations on blood coagulation function and platelet aggregation of blood stasis rats. Then PCA, hierarchical cluster heatmap analysis and multi-attribute comprehensive index methods were all used to comprehensively evaluate the total promoting blood circulation and removing blood stasis effects of DH herb pair with different preparations. The hemorheological indexes and coagulation parameters of model group had significant differences with normal blank group. As compared with the model group, the DH herb pair with different preparations at low, middle and high doses could improve the blood hemorheology indexes and coagulation parameters in acute blood stasis rats with dose-effect relation. Based on the PCA, hierarchical cluster heatmap analysis and multi-attribute comprehensive index methods, the high dose group of 50% alcohol extract had the best effect of promoting blood circulation and removing blood

  16. Charge transport properties of poly(dA)-poly(dT) DNA in variation of backbone disorder and amplitude of base-pair twisting motion

    Energy Technology Data Exchange (ETDEWEB)

    Rahmi, Kinanti Aldilla, E-mail:; Yudiarsah, Efta [Physics Department, FMIPA, Universitas Indonesia, Kampus UI Depok (Indonesia)


    By using tight binding Hamiltonian model, charge transport properties of poly(dA)-poly(dT) DNA in variation of backbone disorder and amplitude of base-pair twisting motion is studied. The DNA chain used is 32 base pairs long poly(dA)-poly(dT) molecule. The molecule is contacted to electrode at both ends. The influence of environment on charge transport in DNA is modeled as variation of backbone disorder. The twisting motion amplitude is taking into account by assuming that the twisting angle distributes following Gaussian distribution function with zero average and standard deviation proportional to square root of temperature and inversely proportional to the twisting motion frequency. The base-pair twisting motion influences both the onsite energy of the bases and electron hopping constant between bases. The charge transport properties are studied by calculating current using Landauer-Buttiker formula from transmission probabilities which is calculated by transfer matrix methods. The result shows that as the backbone disorder increases, the maximum current decreases. By decreasing the twisting motion frequency, the current increases rapidly at low voltage, but the current increases slower at higher voltage. The threshold voltage can increase or decrease with increasing backbone disorder and increasing twisting frequency.

  17. Amplification of a GC-rich heterochromatin in the freshwater fish Leporinus desmotes (Characiformes, Anostomidae

    Directory of Open Access Journals (Sweden)

    Vladimir Pavan Margarido


    Full Text Available This is the first description of the karyotype of Leporinus desmotes. The diploid female number was 2n = 54 meta- and submetacentric chromosomes. The nucleolar organizing regions (NORs were studied by silver nitrate staining and rDNA fluorescence in situ hybridization (FISH and were found to be located in the telomeric region of the long arm of the 9th pair. C-banding revealed centromeric and telomeric heterochromatin segments in most chromosomes. Intercalar blocks of heterochromatin were observed in the long arm of six chromosome pairs. Besides a NOR-adjacent heterochromatin, all of the intercalar heterochromatic segments were brightly fluorescent by mithramycin staining. These data suggest that a unique amplification of a primordial GC-rich heterochromatin, probably NOR-associated, may have taken place in the karyotype diversification of this Leporinus species.Esta é a primeira descrição do cariótipo de Leporinus desmotes fêmea. O número diplóide encontrado foi 2n = 54 cromossomos meta- e submetacêntricos. As regiões organizadoras de nucléolos (NORs foram estudadas através da impregnação pela prata e por hibridização in situ com sondas de DNAr (FISH, e foram localizadas na região telomérica do braço longo do 9º par. Heterocromatinas centromérica e telomérica foram reveladas pelo bandamento C na maioria dos cromossomos. Adicionalmente, grande quantidade de heterocromatina intercalar ou subtelomérica foi também observada. Diferenciação composicional na maior parte da heterocromatina identificada em L. desmotes pode ser inferida através da coloração pela mitramicina, caracterizando um caso peculiar de amplificação de segmentos heterocromáticos ricos em bases GC neste grupo de peixes.

  18. Quality Control Of Selected Pesticides With GC

    Energy Technology Data Exchange (ETDEWEB)

    Karasali, H. [Benaki Phytopathological Institute Laboratory of Physical and Chemical Analysis of Pesticides, Ekalis (Greece)


    The practical quality control of selected pesticides with GC is treated. Detailed descriptions are given on materials and methods used, including sample preparation and GC operating conditions. The systematic validation of multi methods is described, comprising performance characteristics in routine analysis, like selectivity, specificity etc. This is illustrated by chromatograms, calibration curves and tables derived from real laboratory data. (author)

  19. Protein chemical characterization of Gc globulin (vitamin D-binding protein) isoforms; Gc-1f, Gc-1s and Gc-2

    DEFF Research Database (Denmark)

    Christiansen, Maja; Jørgensen, Charlotte S; Laursen, Inga


    -survival of patients with fulminant hepatic failure and trauma. Here, we characterize the dominant isoforms of plasma-derived Gc globulin from Cohn fraction IV paste with respect to amino acid sequence and posttranslational modifications. Gc globulin was purified in large scale and the isoforms separated by ion...

  20. Synthesis of g-C3N4/Ag3PO4 heterojunction with enhanced photocatalytic performance

    International Nuclear Information System (INIS)

    He, Peizhi; Song, Limin; Zhang, Shujuan; Wu, Xiaoqing; Wei, Qingwu


    Graphical abstract: g-C 3 N 4 /Ag 3 PO 4 heterojunction photocatalyst with visible-light response was prepared by a facile coprecipitation method. The results show that g-C 3 N 4 /Ag 3 PO 4 possesses a much higher activity for the decomposition of RhB than that of the pure Ag 3 PO 4 particles. The most mechanism is that g-C 3 N 4 /Ag 3 PO 4 heterojunction photocatalyst can efficiently separate the photogenerated electron–hole pairs, enhancing the photocatalytic activity of g-C 3 N 4 /Ag 3 PO 4 composites. - Highlights: • g-C 3 N 4 /Ag 3 PO 4 heterojunction showed much higher activity than that of Ag 3 PO 4 . • The high activity could be attributed to g-C 3 N 4 for modifying Ag 3 PO 4 . • More ·OH radicals may be significant reason to improve Ag 3 PO 4 activity. - Abstract: g-C 3 N 4 /Ag 3 PO 4 heterojunction photocatalyst with visible-light response was prepared by a facile coprecipitation method. The photocatalysts were characterized by X-ray powder diffraction, transmission electron microscopy, UV–vis absorption spectroscopy and Fourier transform infrared spectroscopy. The photocatalytic activities of the obtained samples were tested by using Rhodamine B (RhB) as the degradation target under visible light irradiation. g-C 3 N 4 /Ag 3 PO 4 decomposed RhB more effectively than the pure Ag 3 PO 4 particles did, and 2 wt.% g-C 3 N 4 had the highest activity. Furthermore, 2 wt.% g-C 3 N 4 /Ag 3 PO 4 degraded high-concentration RhB more potently than unmodified Ag 3 PO 4 did, probably because g-C 3 N 4 /Ag 3 PO 4 heterojunction photocatalyst enhanced the photocatalytic activity by efficiently separating the photogenerated electron–hole pairs

  1. Quantification of Carbonyl Compounds Generated from Ozone-Based Food Colorants Decomposition Using On-Fiber Derivatization-SPME-GC-MS

    Directory of Open Access Journals (Sweden)

    Wenda Zhu


    Full Text Available Fruit leathers (FLs production produces some not-to-specification material, which contains valuable ingredients like fruit pulp, sugars and acidulates. Recovery of FL for product recycling requires decolorization. In earlier research, we proved the efficiency of an ozone-based decolorization process; however, it produces carbonyls as major byproducts, which could be of concern. A headspace solid-phase microextraction with on-fiber derivatization followed by gas chromatography-mass spectrometry was developed for 10 carbonyls analysis in ozonated FL solution/suspension. Effects of dopant concentration, derivatization temperature and time were studied. The adapted method was used to analyze ozonated FL solution/suspension samples. Dopant concentration and derivatization temperature were optimized to 17 mg/mL and 60 °C, respectively. Competitive extraction was studied, and 5 s extraction time was used to avoid non-linear derivatization of 2-furfural. The detection limits (LODs for target carbonyls ranged from 0.016 and 0.030 µg/L. A much lower LOD (0.016 ppb for 2-furfural was achieved compared with 6 and 35 ppb in previous studies. Analysis results confirmed the robustness of the adapted method for quantification of carbonyls in recycled process water treated with ozone-based decolorization. Ethanal, hexanal, 2-furfural, and benzaldehyde were identified as byproducts of known toxicity but all found below levels for concern.

  2. A configuration space of homologous proteins conserving mutual information and allowing a phylogeny inference based on pair-wise Z-score probabilities. (United States)

    Bastien, Olivier; Ortet, Philippe; Roy, Sylvaine; Maréchal, Eric


    Popular methods to reconstruct molecular phylogenies are based on multiple sequence alignments, in which addition or removal of data may change the resulting tree topology. We have sought a representation of homologous proteins that would conserve the information of pair-wise sequence alignments, respect probabilistic properties of Z-scores (Monte Carlo methods applied to pair-wise comparisons) and be the basis for a novel method of consistent and stable phylogenetic reconstruction. We have built up a spatial representation of protein sequences using concepts from particle physics (configuration space) and respecting a frame of constraints deduced from pair-wise alignment score properties in information theory. The obtained configuration space of homologous proteins (CSHP) allows the representation of real and shuffled sequences, and thereupon an expression of the TULIP theorem for Z-score probabilities. Based on the CSHP, we propose a phylogeny reconstruction using Z-scores. Deduced trees, called TULIP trees, are consistent with multiple-alignment based trees. Furthermore, the TULIP tree reconstruction method provides a solution for some previously reported incongruent results, such as the apicomplexan enolase phylogeny. The CSHP is a unified model that conserves mutual information between proteins in the way physical models conserve energy. Applications include the reconstruction of evolutionary consistent and robust trees, the topology of which is based on a spatial representation that is not reordered after addition or removal of sequences. The CSHP and its assigned phylogenetic topology, provide a powerful and easily updated representation for massive pair-wise genome comparisons based on Z-score computations.

  3. A configuration space of homologous proteins conserving mutual information and allowing a phylogeny inference based on pair-wise Z-score probabilities

    Directory of Open Access Journals (Sweden)

    Maréchal Eric


    Full Text Available Abstract Background Popular methods to reconstruct molecular phylogenies are based on multiple sequence alignments, in which addition or removal of data may change the resulting tree topology. We have sought a representation of homologous proteins that would conserve the information of pair-wise sequence alignments, respect probabilistic properties of Z-scores (Monte Carlo methods applied to pair-wise comparisons and be the basis for a novel method of consistent and stable phylogenetic reconstruction. Results We have built up a spatial representation of protein sequences using concepts from particle physics (configuration space and respecting a frame of constraints deduced from pair-wise alignment score properties in information theory. The obtained configuration space of homologous proteins (CSHP allows the representation of real and shuffled sequences, and thereupon an expression of the TULIP theorem for Z-score probabilities. Based on the CSHP, we propose a phylogeny reconstruction using Z-scores. Deduced trees, called TULIP trees, are consistent with multiple-alignment based trees. Furthermore, the TULIP tree reconstruction method provides a solution for some previously reported incongruent results, such as the apicomplexan enolase phylogeny. Conclusion The CSHP is a unified model that conserves mutual information between proteins in the way physical models conserve energy. Applications include the reconstruction of evolutionary consistent and robust trees, the topology of which is based on a spatial representation that is not reordered after addition or removal of sequences. The CSHP and its assigned phylogenetic topology, provide a powerful and easily updated representation for massive pair-wise genome comparisons based on Z-score computations.

  4. Highly Stable Double-Stranded DNA Containing Sequential Silver(I)-Mediated 7-Deazaadenine/Thymine Watson-Crick Base Pairs. (United States)

    Santamaría-Díaz, Noelia; Méndez-Arriaga, José M; Salas, Juan M; Galindo, Miguel A


    The oligonucleotide d(TX)9 , which consists of an octadecamer sequence with alternating non-canonical 7-deazaadenine (X) and canonical thymine (T) as the nucleobases, was synthesized and shown to hybridize into double-stranded DNA through the formation of hydrogen-bonded Watson-Crick base pairs. dsDNA with metal-mediated base pairs was then obtained by selectively replacing W-C hydrogen bonds by coordination bonds to central silver(I) ions. The oligonucleotide I adopts a duplex structure in the absence of Ag(+) ions, and its stability is significantly enhanced in the presence of Ag(+) ions while its double-helix structure is retained. Temperature-dependent UV spectroscopy, circular dichroism spectroscopy, and ESI mass spectrometry were used to confirm the selective formation of the silver(I)-mediated base pairs. This strategy could become useful for preparing stable metallo-DNA-based nanostructures. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  5. The base pairing RNA Spot 42 participates in a multi-output feedforward loop to help enact catabolite repression in Escherichia coli (United States)

    Beisel, Chase L.; Storz, Gisela


    SUMMARY Bacteria selectively consume some carbon sources over others through a regulatory mechanism termed catabolite repression. Here, we show that the base pairing RNA Spot 42 plays a broad role in catabolite repression in Escherichia coli by directly repressing genes involved in central and secondary metabolism, redox balancing, and the consumption of diverse non-preferred carbon sources. Many of the genes repressed by Spot 42 are transcriptionally activated by the global regulator CRP. Since CRP represses Spot 42, these regulators participate in a specific regulatory circuit called a multi-output feedforward loop. We found that this loop can reduce leaky expression of target genes in the presence of glucose and can maintain repression of target genes under changing nutrient conditions. Our results suggest that base pairing RNAs in feedforward loops can help shape the steady-state levels and dynamics of gene expression. PMID:21292161

  6. A simple and highly selective 2,2-diferrocenylpropane-based multi-channel ion pair receptor for Pb(2+) and HSO4(-). (United States)

    Wan, Qian; Zhuo, Ji-Bin; Wang, Xiao-Xue; Lin, Cai-Xia; Yuan, Yao-Feng


    A structurally simple, 2,2-diferrocenylpropane-based ion pair receptor 1 was synthesized and characterized by (1)H NMR, (13)C NMR, HRMS, elemental analyses, and single-crystal X-ray diffraction. The ion pair receptor 1 showed excellent selectivity and sensitivity towards Pb(2+) with multi-channel responses: a fluorescence enhancement (more than 42-fold), a notable color change from yellow to red, redox anodic shift (ΔE1/2 = 151 mV), while HSO4(-) promoted fluorescence enhancement when Pb(2+) or Zn(2+) was bonded to the cation binding-site. (1)H NMR titration and density functional theory were performed to reveal the sensing mechanism based on photo-induced electron transfer (PET).

  7. Direct NMR Evidence that Transient Tautomeric and Anionic States in dG·dT Form Watson-Crick-like Base Pairs. (United States)

    Szymanski, Eric S; Kimsey, Isaac J; Al-Hashimi, Hashim M


    The replicative and translational machinery utilizes the unique geometry of canonical G·C and A·T/U Watson-Crick base pairs to discriminate against DNA and RNA mismatches in order to ensure high fidelity replication, transcription, and translation. There is growing evidence that spontaneous errors occur when mismatches adopt a Watson-Crick-like geometry through tautomerization and/or ionization of the bases. Studies employing NMR relaxation dispersion recently showed that wobble dG·dT and rG·rU mismatches in DNA and RNA duplexes transiently form tautomeric and anionic species with probabilities (≈0.01-0.40%) that are in concordance with replicative and translational errors. Although computational studies indicate that these exceptionally short-lived and low-abundance species form Watson-Crick-like base pairs, their conformation could not be directly deduced from the experimental data, and alternative pairing geometries could not be ruled out. Here, we report direct NMR evidence that the transient tautomeric and anionic species form hydrogen-bonded Watson-Crick-like base pairs. A guanine-to-inosine substitution, which selectively knocks out a Watson-Crick-type (G)N2H 2 ···O2(T) hydrogen bond, significantly destabilized the transient tautomeric and anionic species, as assessed by lack of any detectable chemical exchange by imino nitrogen rotating frame spin relaxation (R 1ρ ) experiments. An 15 N R 1ρ NMR experiment targeting the amino nitrogen of guanine (dG-N2) provides direct evidence for Watson-Crick (G)N2H 2 ···O2(T) hydrogen bonding in the transient tautomeric state. The strategy presented in this work can be generally applied to examine hydrogen-bonding patterns in nucleic acid transient states including in other tautomeric and anionic species that are postulated to play roles in replication and translational errors.

  8. Systematic exploration of a class of hydrophobic unnatural base pairs yields multiple new candidates for the expansion of the genetic alphabet

    Czech Academy of Sciences Publication Activity Database

    Dhami, K.; Malyshev, D. A.; Ordoukhanian, P.; Kubelka, Tomáš; Hocek, Michal; Romesberg, F. E.


    Roč. 42, č. 16 (2014), s. 10235-10244 ISSN 0305-1048 R&D Projects: GA ČR GBP206/12/G151 Institutional support: RVO:61388963 Keywords : unnatural base pairs * DNA * dTPT3-dNaM Subject RIV: CE - Biochemistry Impact factor: 9.112, year: 2014

  9. Development of a novel device to trap heavy metal cations: application of the specific interaction between heavy metal cation and mismatch DNA base pair. (United States)

    Torigoe, Hidetaka; Miyakawa, Yukako; Fukushi, Miyako; Ono, Akira; Kozasa, Tetsuo


    We have already found that Hg(II) cation specifically binds to T:T mismatch base pair in heteroduplex DNA, which increases the melting temperature of heteroduplex DNA involving T:T mismatch base pair by about 4 degrees C. We have also found that Ag(I) cation specifically binds to C:C mismatch base pair in heteroduplex DNA, which increases the melting temperature of heteroduplex DNA involving C:C mismatch base pair by about 4 degrees C. Using the specific interaction, we developed a novel device to trap each of Hg(II) and Ag(I) cation. The device is composed of 5'-biotinylated T-rich or C-rich DNA oligonucleotides, BIO-T20: 5'-Bio-T(20)-3' or BIO-C20: 5'-Bio-C(20)-3' (Bio is a biotin), immobilized on streptavidin-coated polystylene beads. When the BIO-T20-immobilized beads were added to a solution containing Hg(II) cation, and the beads trapping Hg(II) cation were collected by centrifugation, almost all of Hg(II) cation were removed from the solution. Also, when the BIO-C20-immobilized beads were added to a solution containing Ag(I) cation, and the beads trapping Ag(I) cation were collected by centrifugation, almost all of Ag(I) cation were removed from the solution. We conclude that, using the novel device developed in this study, Hg(II) and Ag(I) cation can be effectively removed from the solution.

  10. Development of a novel method to determine the concentration of heavy metal cations: application of the specific interaction between heavy metal cation and mismatch DNA base pair. (United States)

    Kozasa, Tetsuo; Miyakawa, Yukako; Fukushi, Miyako; Ono, Akira; Torigoe, Hidetaka


    We have already found that Hg(II) cation specifically binds to T:T mismatch base pair in heteroduplex DNA, which increases the melting temperature of heteroduplex DNA involving T:T mismatch base pair by about 4 degrees C. We have also found that Ag(I) cation specifically binds to C:C mismatch base pair in heteroduplex DNA, which increases the melting temperature of heteroduplex DNA involving C:C mismatch base pair by about 4 degrees C. Using the specific interaction, we developed a novel sensor to determine the concentration of each of Hg(II) and Ag(I) cation. The sensor is composed of a dye-labelled T-rich or C-rich DNA oligonucleotide, F2T6W2D: 5'-Fam-T(2)CT(2)CT(2)C(4)T(2)GT(2)GT(2)-Dabcyl-3' or F2C6W2D: 5'-Fam-C(2)TC(2)TC(2)T(4)C(2)AC(2)AC(2)-Dabcyl-3', where 6-carboxyfluorescein (Fam) is a fluorophore and Dabcyl is a quencher. The addition of Hg(II) cation decreased the intensity of Fam emission of F2T6W2D at 520 nm in a concentration-dependent manner. Also, the addition of Ag(I) cation decreased the intensity of Fam emission of F2C6W2D at 520 nm in a concentration-dependent manner. We conclude that, using the novel sensor developed in this study, the concentration of each of Hg(II) and Ag(I) cation can be determined from the intensity of Fam emission at 520 nm.

  11. Gas chromatography coupled to atmospheric pressure ionization mass spectrometry (GC-API-MS): Review

    International Nuclear Information System (INIS)

    Li, Du-Xin; Gan, Lin; Bronja, Amela; Schmitz, Oliver J.


    Although the coupling of GC/MS with atmospheric pressure ionization (API) has been reported in 1970s, the interest in coupling GC with atmospheric pressure ion source was expanded in the last decade. The demand of a “soft” ion source for preserving highly diagnostic molecular ion is desirable, as compared to the “hard” ionization technique such as electron ionization (EI) in traditional GC/MS, which fragments the molecule in an extensive way. These API sources include atmospheric pressure chemical ionization (APCI), atmospheric pressure photoionization (APPI), atmospheric pressure laser ionization (APLI), electrospray ionization (ESI) and low temperature plasma (LTP). This review discusses the advantages and drawbacks of this analytical platform. After an introduction in atmospheric pressure ionization the review gives an overview about the history and explains the mechanisms of various atmospheric pressure ionization techniques used in combination with GC such as APCI, APPI, APLI, ESI and LTP. Also new developments made in ion source geometry, ion source miniaturization and multipurpose ion source constructions are discussed and a comparison between GC-FID, GC-EI-MS and GC-API-MS shows the advantages and drawbacks of these techniques. The review ends with an overview of applications realized with GC-API-MS. - Highlights: • Atmospheric pressure ion sources (APCI, ESI, APPI, APLC etc) enable the coupling of LC-based high-end MS to GC. • APIs show advantages in selectivity and sensitivity compared with EI in GC-MS. • Accurate mass database in GC-APCI/MS is emerging as an alternative to GC-EI/MS database.

  12. Gas chromatography coupled to atmospheric pressure ionization mass spectrometry (GC-API-MS): Review

    Energy Technology Data Exchange (ETDEWEB)

    Li, Du-Xin; Gan, Lin; Bronja, Amela [University of Duisburg-Essen, Applied Analytical Chemistry, Universitaetsstr. 5-7, 45141 Essen (Germany); Schmitz, Oliver J., E-mail: [University of Duisburg-Essen, Applied Analytical Chemistry, Universitaetsstr. 5-7, 45141 Essen (Germany)


    Although the coupling of GC/MS with atmospheric pressure ionization (API) has been reported in 1970s, the interest in coupling GC with atmospheric pressure ion source was expanded in the last decade. The demand of a “soft” ion source for preserving highly diagnostic molecular ion is desirable, as compared to the “hard” ionization technique such as electron ionization (EI) in traditional GC/MS, which fragments the molecule in an extensive way. These API sources include atmospheric pressure chemical ionization (APCI), atmospheric pressure photoionization (APPI), atmospheric pressure laser ionization (APLI), electrospray ionization (ESI) and low temperature plasma (LTP). This review discusses the advantages and drawbacks of this analytical platform. After an introduction in atmospheric pressure ionization the review gives an overview about the history and explains the mechanisms of various atmospheric pressure ionization techniques used in combination with GC such as APCI, APPI, APLI, ESI and LTP. Also new developments made in ion source geometry, ion source miniaturization and multipurpose ion source constructions are discussed and a comparison between GC-FID, GC-EI-MS and GC-API-MS shows the advantages and drawbacks of these techniques. The review ends with an overview of applications realized with GC-API-MS. - Highlights: • Atmospheric pressure ion sources (APCI, ESI, APPI, APLC etc) enable the coupling of LC-based high-end MS to GC. • APIs show advantages in selectivity and sensitivity compared with EI in GC-MS. • Accurate mass database in GC-APCI/MS is emerging as an alternative to GC-EI/MS database.

  13. Frequency band adjustment match filtering based on variable frequency GPR antennas pairing scheme for shallow subsurface investigations (United States)

    Shaikh, Shahid Ali; Tian, Gang; Shi, Zhanjie; Zhao, Wenke; Junejo, S. A.


    Ground penetrating Radar (GPR) is an efficient tool for subsurface geophysical investigations, particularly at shallow depths. The non-destructiveness, cost efficiency, and data reliability are the important factors that make it an ideal tool for the shallow subsurface investigations. Present study encompasses; variations in central frequency of transmitting and receiving GPR antennas (Tx-Rx) have been analyzed and frequency band adjustment match filters are fabricated and tested accordingly. Normally, the frequency of both the antennas remains similar to each other whereas in this study we have experimentally changed the frequencies of Tx-Rx and deduce the response. Instead of normally adopted three pairs, a total of nine Tx-Rx pairs were made from 50 MHz, 100 MHz, and 200 MHz antennas. The experimental data was acquired at the designated near surface geophysics test site of the Zhejiang University, Hangzhou, China. After the impulse response analysis of acquired data through conventional as well as varied Tx-Rx pairs, different swap effects were observed. The frequency band and exploration depth are influenced by transmitting frequencies rather than the receiving frequencies. The impact of receiving frequencies was noticed on the resolution; the more noises were observed using the combination of high frequency transmitting with respect to low frequency receiving. On the basis of above said variable results we have fabricated two frequency band adjustment match filters, the constant frequency transmitting (CFT) and the variable frequency transmitting (VFT) frequency band adjustment match filters. By the principle, the lower and higher frequency components were matched and then incorporated with intermediate one. Therefore, this study reveals that a Tx-Rx combination of low frequency transmitting with high frequency receiving is a better choice. Moreover, both the filters provide better radargram than raw one, the result of VFT frequency band adjustment filter is

  14. A New Sensitive GC-MS-based Method for Analysis of Dipicolinic Acid and Quantifying Bacterial Endospores in Deep Marine Subsurface Sediment (United States)

    Fang, J.


    Marine sediments cover more than two-thirds of the Earth's surface and represent a major part of the deep biosphere. Microbial cells and microbial activity appear to be widespread in these sediments. Recently, we reported the isolation of gram-positive anaerobic spore-forming piezophilic bacteria and detection of bacterial endospores in marine subsurface sediment from the Shimokita coalbed, Japan. However, the modern molecular microbiological methods (e.g., DNA-based microbial detection techniques) cannot detect bacterial endospore, because endospores are impermeable and are not stained by fluorescence DNA dyes or by ribosomal RNA staining techniques such as catalysed reporter deposition fluorescence in situ hybridization. Thus, the total microbial cell abundance in the deep biosphere may has been globally underestimated. This emphasizes the need for a new cultivation independent approach for the quantification of bacterial endospores in the deep subsurface. Dipicolinic acid (DPA, pyridine-2,6-dicarboxylic acid) is a universal and specific component of bacterial endospores, representing 5-15wt% of the dry spore, and therefore is a useful indicator and quantifier of bacterial endospores and permits to estimate total spore numbers in the subsurface biosphere. We developed a sensitive analytical method to quantify DPA content in environmental samples using gas chromatography-mass spectrometry. The method is sensitive and more convenient in use than other traditional methods. We applied this method to analyzing sediment samples from the South China Sea (obtained from IODP Exp. 349) to determine the abundance of spore-forming bacteria in the deep marine subsurface sediment. Our results suggest that gram-positive, endospore-forming bacteria may be the "unseen majority" in the deep biosphere.

  15. Evidence of weak pair coupling in the penetration depth of bi-based high-Tc superconductors

    International Nuclear Information System (INIS)

    Thompson, J.R.; Sun, Yang Ren; Ossandon, J.G.; Christen, D.K.; Chakoumakos, B.C.; Sales, B.C.; Kerchner, H.R.; Sonder, E.


    The magnetic penetration depth λ(T) has been investigated in Bi(Pb)SrCaCuO high-T c compounds having 2- and 3-layers of copper-oxygen per unit cell. Studies of the magnetization in the vortex state were employed and the results were compared with weak and strong coupling calculations. The temperature dependence of λ is described well by BCS theory in the clean limit, giving evidence for weak pair coupling in this family of materials. For the short component of the λ tensor, we obtain values of 292 and 220 nm (T = 0) for Bi-2212 and (BiPb)-2223, respectively

  16. The Effect of Think-Pair-Share-Write Based on Hybrid Learning on Metakognitive Skills, Creative Thinking and Cognitive Learning at SMA Negeri 3 Malang

    Directory of Open Access Journals (Sweden)

    Ika Yulianti Siregar


    Full Text Available The results of biology learning observation show that there are many constraints during the learning process in the class and consultation meeting between teacher and students. The think-pair-share-write based on hybrid learning was conducted to analyze the effect on metacognitive skills, creative thinking and learning outcomes. The research design was quasi experiment with pretest-posttest non-equivalent control group design. The independent variable is think-pair-share-write based on Hybrid learning model, while the dependent variables are metacognitive skills, creative thinking, and cognitive learning outcomes. Metacognitive skills are measured by using metacognitive rubrics. Creative thinking skills and cognitive learning outcomes are measured by using a description test. The data were taken by conducting pretest and posttest. The hypothesis test used was anakova with level of significance 0,05 (P <0,05, as the test result was significant then the test was continued to LSD. Before the anakova test, normality and homogeneity test were performed. The results showed that think-pair-share-write based on Hybrid Learning significantly affecting: 1 the metacognitive skills with F arithmetic of 183,472 and Sig. 0,000; 2 the creative thinking skill with F value of 325,111 and Sig. 0,000; 3 the cognitive learning outcomes with F arithmetic of 175.068 and Sig. 0,000.

  17. In situ growing Bi_2MoO_6 on g-C_3N_4 nanosheets with enhanced photocatalytic hydrogen evolution and disinfection of bacteria under visible light irradiation

    International Nuclear Information System (INIS)

    Li, Juan; Yin, Yunchao; Liu, Enzhou; Ma, Yongning; Wan, Jun; Fan, Jun; Hu, Xiaoyun


    Graphical abstract: TEM image and schematic diagram of photocatalytic mechanism of Bi_2MoO_6/g-C_3N_4 composite. - Highlights: • BM/CNNs heterojunctions were obtained by an in situ solvothermal method. • 2D CNNs are superior to CN as photocatalysts and supporting materials. • The photocatalytic hydrogen evolution of BM/CNNs has been first studied. • The photocatalytic disinfection of bacteria by BM/CNNs has been first studied. • The photocatalytic mechanism of BM/CNNs heterojunction was described. - Abstract: Bi_2MoO_6/g-C_3N_4 heterojunctions were fabricated by an in situ solvothermal method using g-C_3N_4 nanosheets. The photocatalytic activities of as-prepared samples were evaluated by hydrogen evolution from water splitting and disinfection of bacteria under visible light irradiation. The results indicate that exfoliating bulk g-C_3N_4 to g-C_3N_4 nanosheets greatly enlarges the specific surface area and shortens the diffusion distance for photogenerated charges, which could not only promote the photocatalytic performance but also benefit the sufficient interaction with Bi_2MoO_6. Furthermore, intimate contact of Bi_2MoO_6 (BM) and g-C_3N_4 nanosheets (CNNs) in the BM/CNNs composites facilitates the transfer and separation of photogenetrated electron-hole pairs. 20%-BM/CNNs heterojunction exhibits the optimal photocatalytic hydrogen evolution as well as photocatalytic disinfection of bacteria. Furthermore, h"+ was demonstrated as the dominant reactive species which could make the bacteria cells inactivated in the photocatalytic disinfection process. This study extends new chance of g-C_3N_4-based photocatalysts to the growing demand of clean new energy and drinking water.

  18. Observation of H-bond mediated 3hJH2H3coupling constants across Watson-Crick AU base pairs in RNA

    International Nuclear Information System (INIS)

    Luy, Burkhard; Richter, Uwe; DeJong, Eric S.; Sorensen, Ole W.; Marino, John P.


    3h J H2H3 trans-hydrogen bond scalar coupling constants have been observed for the first time in Watson-Crick AU base pairs in uniformly 15 N-labeled RNA oligonucleotides using a new 2h J NN -HNN-E. COSY experiment. The experiment utilizes adenosine H2 (AH2) for original polarization and detection, while employing 2h J NN couplings for coherence transfer across the hydrogen bonds (H-bonds). The H3 protons of uracil bases are unperturbed throughout the experiment so that these protons appear as passive spins in E. COSY patterns. 3h J H2H3 coupling constants can therefore be accurately measured in the acquisition dimension from the displacement of the E. COSY multiplet components, which are separated by the relatively large 1 J H3N3 coupling constants in the indirect dimension of the two-dimensional experiment. The 3h J H2H3 scalar coupling constants determined for AU base pairs in the two RNA hairpins examined here have been found to be positive and range in magnitude up to 1.8 Hz. Using a molecular fragment representation of an AU base pair, density functional theory/finite field perturbation theory (DFT/FPT) methods have been applied to attempt to predict the relative contributions of H-bond length and angular geometry to the magnitude of 3h J H2H3 coupling constants. Although the DFT/FPT calculations did not reproduce the full range of magnitude observed experimentally for the 3h J H2H3 coupling constants, the calculations do predict the correct sign and general trends in variation in size of these coupling constants. The calculations suggest that the magnitude of the coupling constants depends largely on H-bond length, but can also vary with differences in base pair geometry. The dependency of the 3h J H2H3 coupling constant on H-bond strength and geometry makes it a new probe for defining base pairs in NMR studies of nucleic acids

  19. A pair of novel Cd(II) enantiomers based on lactate derivatives: Synthesis, crystal structures and properties

    International Nuclear Information System (INIS)

    Xu, Zhong-Xuan; Ao, Ke-Hou; Zhang, Jian


    A pair of novel 3D homochiral metal−organic frameworks (HMOFs), namely [Cd 2.5 ((R)-CIA) 6 (1,4-DIB)(H 2 O) 2 ]·((CH 3 ) 2 NH 2 )·H 2 O (1-D), [Cd 2.5 ((S)-CIA) 6 (1,4-DIB)(H 2 O) 2 ]·((CH 3 ) 2 NH 2 )·H 2 O (1-L), have been synthesized using lactic acid derivative ligands ((R)-H 3 CIA and (S)-H 3 CIA) and 1,4-DIB. Crystallographic analyses indicate that the complexes 1-D and 1-L are packed by cage substructures. Some physical characteristics, such as solid-state circular dichroism (CD), thermal stabilities and photoluminescent properties are also investigated. Our results highlight the effective method to apply lactic acid derivative ligands to form interesting HMOFs. - Graphical abstract: Using lactic acid derivative ligands ((R)-H 3 CIA and (S)-H 3 CIA) and 1,4-DIB to assemble with Cd 2+ ions, a pair of novel 3D homochiral metal-organic frameworks (HMOFs) with cage substructures have been synthesized. Display Omitted - Highlights: • Lactic acid derivative ligands • Cage substructure • Enantiomers

  20. A pair of novel Cd(II) enantiomers based on lactate derivatives: Synthesis, crystal structures and properties

    Energy Technology Data Exchange (ETDEWEB)

    Xu, Zhong-Xuan, E-mail: [Department of Chemistry, Zunyi Normal College, Zunyi, Guizhou 563002 (China); State Key Laboratory of Structural Chemistry, Fujian Institute of Research on the Structure of Matter, the Chinese Academy of Sciences, Fuzhou, Fujian 350002 (China); Ao, Ke-Hou [Department of Chemistry, Zunyi Normal College, Zunyi, Guizhou 563002 (China); Zhang, Jian [State Key Laboratory of Structural Chemistry, Fujian Institute of Research on the Structure of Matter, the Chinese Academy of Sciences, Fuzhou, Fujian 350002 (China)


    A pair of novel 3D homochiral metal−organic frameworks (HMOFs), namely [Cd{sub 2.5}((R)-CIA){sub 6}(1,4-DIB)(H{sub 2}O){sub 2}]·((CH{sub 3}){sub 2}NH{sub 2})·H{sub 2}O (1-D), [Cd{sub 2.5}((S)-CIA){sub 6}(1,4-DIB)(H{sub 2}O){sub 2}]·((CH{sub 3}){sub 2}NH{sub 2})·H{sub 2}O (1-L), have been synthesized using lactic acid derivative ligands ((R)-H{sub 3}CIA and (S)-H{sub 3}CIA) and 1,4-DIB. Crystallographic analyses indicate that the complexes 1-D and 1-L are packed by cage substructures. Some physical characteristics, such as solid-state circular dichroism (CD), thermal stabilities and photoluminescent properties are also investigated. Our results highlight the effective method to apply lactic acid derivative ligands to form interesting HMOFs. - Graphical abstract: Using lactic acid derivative ligands ((R)-H{sub 3}CIA and (S)-H{sub 3}CIA) and 1,4-DIB to assemble with Cd{sup 2+} ions, a pair of novel 3D homochiral metal-organic frameworks (HMOFs) with cage substructures have been synthesized. Display Omitted - Highlights: • Lactic acid derivative ligands • Cage substructure • Enantiomers.

  1. rSNPBase 3.0: an updated database of SNP-related regulatory elements, element-gene pairs and SNP-based gene regulatory networks. (United States)

    Guo, Liyuan; Wang, Jing


    Here, we present the updated rSNPBase 3.0 database (, which provides human SNP-related regulatory elements, element-gene pairs and SNP-based regulatory networks. This database is the updated version of the SNP regulatory annotation database rSNPBase and rVarBase. In comparison to the last two versions, there are both structural and data adjustments in rSNPBase 3.0: (i) The most significant new feature is the expansion of analysis scope from SNP-related regulatory elements to include regulatory element-target gene pairs (E-G pairs), therefore it can provide SNP-based gene regulatory networks. (ii) Web function was modified according to data content and a new network search module is provided in the rSNPBase 3.0 in addition to the previous regulatory SNP (rSNP) search module. The two search modules support data query for detailed information (related-elements, element-gene pairs, and other extended annotations) on specific SNPs and SNP-related graphic networks constructed by interacting transcription factors (TFs), miRNAs and genes. (3) The type of regulatory elements was modified and enriched. To our best knowledge, the updated rSNPBase 3.0 is the first data tool supports SNP functional analysis from a regulatory network prospective, it will provide both a comprehensive understanding and concrete guidance for SNP-related regulatory studies. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  2. Merging Problem-Based Learning with Simulation-Based Learning in the Medical Undergraduate Curriculum: The PAIRED Framework for Enhancing Lifelong Learning (United States)

    Koh, Jansen


    Lifelong learning is an essential trait that is expected of every physician. The CanMeds 2005 Physician Competency Framework emphasizes lifelong learning as a key competency that physicians must achieve in becoming better physicians. However, many physicians are not competent at engaging in lifelong learning. The current medical education system is deficient in preparing medical students to develop and carry out their own lifelong learning curriculum upon graduation. Despite understanding how physicians learn at work, medical students are not trained to learn while working. Similarly, although barriers to lifelong learning are known, medical students are not adequately skilled in overcoming these barriers. Learning to learn is just as important, if not more, as acquiring the skills and knowledge required of a physician. The medical undergraduate curriculum lacks a specific learning strategy to prepare medical students in becoming an adept lifelong learner. In this article, we propose a learning strategy for lifelong learning at the undergraduate level. In developing this novel strategy, we paid particular attention to two parameters. First, this strategy should be grounded on literature describing a physician’s lifelong learning process. Second, the framework for implementing this strategy must be based on existing undergraduate learning strategies to obviate the need for additional resources, learner burden, and faculty time. In this paper, we propose a Problem, Analysis, Independent Research Reporting, Experimentation Debriefing (PAIRED) framework that follows the learning process of a physician and serves to synergize the components of problem-based learning and simulation-based learning in specifically targeting the barriers to lifelong learning. PMID:27446767

  3. Atomic-Level Organization of Vicinal Acid-Base Pairs through the Chemisorption of Aniline and Derivatives onto Mesoporous SBA15

    KAUST Repository

    Basset, Jean-Marie


    The design of novel heterogeneous catalysts with multiple adjacent functionalities is of high interest for heterogeneous catalysis. Herein, we report a method to obtain a majority bifunctional acid-base pairs on SBA15. Aniline reacts with SBA15 by opening siloxane bridges leading to N-phenylsilanamine-silanol pairs. In contrast with ammonia treated surfaces, the material is stable under air/moisture. Advanced solid state MAS NMR: 2D ¹H-¹H double-quantum, ¹H-¹³C HETCOR experiments and dynamic nuclear polarization enhanced ²⁹Si and ¹⁵N spectra demonstrate both the close proximity between the two moieties and the formation of a covalent Si-N surface bond and confirm the design of vicinal acid-base pairs. This approach was successfully applied to the design of a series of aniline derivatives bifunctional SBA15. A correlation of the substituents effects on the aromatic ring (Hammet parameters) on the kinetics of the model reaction of Knoevenagel is observed.

  4. Ross filter pairs for metal artefact reduction in x-ray tomography: a case study based on imaging and segmentation of metallic implants (United States)

    Arhatari, Benedicta D.; Abbey, Brian


    Ross filter pairs have recently been demonstrated as a highly effective means of producing quasi-monoenergetic beams from polychromatic X-ray sources. They have found applications in both X-ray spectroscopy and for elemental separation in X-ray computed tomography (XCT). Here we explore whether they could be applied to the problem of metal artefact reduction (MAR) for applications in medical imaging. Metal artefacts are a common problem in X-ray imaging of metal implants embedded in bone and soft tissue. A number of data post-processing approaches to MAR have been proposed in the literature, however these can be time-consuming and sometimes have limited efficacy. Here we describe and demonstrate an alternative approach based on beam conditioning using Ross filter pairs. This approach obviates the need for any complex post-processing of the data and enables MAR and segmentation from the surrounding tissue by exploiting the absorption edge contrast of the implant.

  5. Exactly solvable model of transitional nuclei based on dual algebraic structure for the three level pairing model in the framework of sdg interacting boson model (United States)

    Jafarizadeh, M. A.; Ranjbar, Z.; Fouladi, N.; Ghapanvari, M.


    In this paper, a successful algebraic method based on the dual algebraic structure for three level pairing model in the framework of sdg IBM is proposed for transitional nuclei which show transitional behavior from spherical to gamma-unstable quantum shape phase transition. In this method complicated sdg Hamiltonian, which is a three level pairing Hamiltonian is determined easily via the exactly solvable method. This description provides a better interpretation of some observables such as BE (4) in nuclei which exhibits the necessity of inclusion of g boson in the sd IBM, while BE (4) cannot be explained in the sd boson model. Some observables such as Energy levels, BE (2), BE (4), the two neutron separation energies signature splitting of the γ-vibrational band and expectation values of the g-boson number operator are calculated and examined for 46 104 - 110Pd isotopes.

  6. Immunotherapy for Prostate Cancer with Gc Protein-Derived Macrophage-Activating Factor, GcMAF. (United States)

    Yamamoto, Nobuto; Suyama, Hirofumi; Yamamoto, Nobuyuki


    Serum Gc protein (known as vitamin D(3)-binding protein) is the precursor for the principal macrophage-activating factor (MAF). The MAF precursor activity of serum Gc protein of prostate cancer patients was lost or reduced because Gc protein was deglycosylated by serum alpha-N-acetylgalactosaminidase (Nagalase) secreted from cancerous cells. Therefore, macrophages of prostate cancer patients having deglycosylated Gc protein cannot be activated, leading to immunosuppression. Stepwise treatment of purified Gc protein with immobilized beta-galactosidase and sialidase generated the most potent MAF (termed GcMAF) ever discovered, which produces no adverse effect in humans. Macrophages activated by GcMAF develop a considerable variation of receptors that recognize the abnormality in malignant cell surface and are highly tumoricidal. Sixteen nonanemic prostate cancer patients received weekly administration of 100 ng of GcMAF. As the MAF precursor activity increased, their serum Nagalase activity decreased. Because serum Nagalase activity is proportional to tumor burden, the entire time course analysis for GcMAF therapy was monitored by measuring the serum Nagalase activity. After 14 to 25 weekly administrations of GcMAF (100 ng/week), all 16 patients had very low serum Nagalase levels equivalent to those of healthy control values, indicating that these patients are tumor-free. No recurrence occurred for 7 years.

  7. [Mechanism of treatment effect of Huanglian-Huangqin herb pairs on cerebral ischemia rats based on metabolomic approach]. (United States)

    Cao, Hui-Ting; Zhu, Hua-Xu; Zhang, Qi-Chun; Guo, Li-Wei


    The metabolic effect of Huanglian-Huangqin herb pairs on cerebral ischemia rats was studied by using metabolomic method. The rat model of ischemia reperfusion injury induced by introduction of transient middle cerebral artery occlusion (MCAO) followed by reperfusion. Ultra high performance liquid chromatography-series four pole time of flight mass spectrometry method(UPLC-Q-TOF/MS), Markerlynx software, and principal component analysis and partial least-squares discriminant analysis were used to analyze the different endogenous metabolites among the urine samples of sham rats, cerebral ischemia model rats, Huanglian groups (HL), Huangqin groups (HQ) and Huanglian-Huangqin herb pairs groups (LQ) was achieved, combined with accurate information about the endogenous metabolites level and secondary fragment ions, retrieval and identification of possible biological markers, metabolic pathway which build in MetPA database. The 20 potential biomarkers were found in the urine of rats with cerebral ischemia, which mainly involved in the neurotransmitter regulation, amino acid metabolism, energy metabolism, lipid metabolism and so on. Those metabolic pathways were disturbed in cerebral ischemia model rats, the principal component analysis showed that the normal and cerebral ischemia model is clearly distinguished, and the compound can be given to the normal state of change after HL, HQ, LQ administration. This study index the interpretation of cerebral ischemia rat metabolism group and mechanism, the embodiment of metabonomics can reflect the physiological and metabolic state, which can better reflect the traditional Chinese medicine as a whole view, system view and the features of multi ingredient synergistic or antagonistic effects. Copyright© by the Chinese Pharmaceutical Association.

  8. Au pairs on Facebook

    DEFF Research Database (Denmark)

    Dalgas, Karina Märcher


    Ethnographers are increasingly making use of Facebook to acquire access and general acquaintance with their field of study. However, little has been written on how Facebook is used methodologically in research that does not have social media sites as the main focus of interest. This article argues...... the au pairs resist and embrace such dominant representations, and on how such representations are ascribed different meanings in the transnational social fields of which the migrant are a part. The article is based on ethnographic fieldwork conducted between 2010 and 2014 in Denmark, the Philippines...

  9. S-1-Based versus capecitabine-based preoperative chemoradiotherapy in the treatment of locally advanced rectal cancer: a matched-pair analysis.

    Directory of Open Access Journals (Sweden)

    Meng Su

    Full Text Available OBJECTIVE: The aim of this paper was to compare the efficacy and safety of S-1-based and capecitabine-based preoperative chemoradiotherapy regimens in patients with locally advanced rectal cancer through a retrospective matched-pair analysis. MATERIALS AND METHODS: Between Jan 2010 and Mar 2014, 24 patients with locally advanced rectal cancer who received preoperative radiotherapy concurrently with S-1 were individually matched with 24 contemporary patients with locally advanced rectal cancer who received preoperative radiotherapy concurrently with capecitabine according to clinical stage (as determined by pelvic magnetic resonance imaging and computed tomography and age (within five years. All these patients performed mesorectal excision 4-8 weeks after the completion of chemoradiotherapy. RESULTS: The tumor volume reduction rates were 55.9±15.1% in the S-1 group and 53.8±16.0% in the capecitabine group (p = 0.619. The overall downstaging, including both T downstaging and N downstaging, occurred in 83.3% of the S-1 group and 70.8% of the capecitabine group (p = 0.508. The significant tumor regression, including regression grade I and II, occurred in 33.3% of S-1 patients and 25.0% of capecitabine patients (p = 0.754. In the two groups, Grade 4 adverse events were not observed and Grade 3 consisted of only two cases of diarrhea, and no patient suffered hematologic adverse event of Grade 2 or higher. However, the incidence of diarrhea (62.5% vs 33.3%, p = 0.014 and hand-foot syndrome (29.2% vs 0%, p = 0.016 were higher in capecitabine group. Other adverse events did not differ significantly between two groups. CONCLUSIONS: The two preoperative chemoradiotherapy regimens were effective and safe for patients of locally advanced rectal cancer, but regimen with S-1 exhibited a lower incidence of adverse events.

  10. Communication: An improved linear scaling perturbative triples correction for the domain based local pair-natural orbital based singles and doubles coupled cluster method [DLPNO-CCSD(T)

    KAUST Repository

    Guo, Yang


    In this communication, an improved perturbative triples correction (T) algorithm for domain based local pair-natural orbital singles and doubles coupled cluster (DLPNO-CCSD) theory is reported. In our previous implementation, the semi-canonical approximation was used and linear scaling was achieved for both the DLPNO-CCSD and (T) parts of the calculation. In this work, we refer to this previous method as DLPNO-CCSD(T0) to emphasize the semi-canonical approximation. It is well-established that the DLPNO-CCSD method can predict very accurate absolute and relative energies with respect to the parent canonical CCSD method. However, the (T0) approximation may introduce significant errors in absolute energies as the triples correction grows up in magnitude. In the majority of cases, the relative energies from (T0) are as accurate as the canonical (T) results of themselves. Unfortunately, in rare cases and in particular for small gap systems, the (T0) approximation breaks down and relative energies show large deviations from the parent canonical CCSD(T) results. To address this problem, an iterative (T) algorithm based on the previous DLPNO-CCSD(T0) algorithm has been implemented [abbreviated here as DLPNO-CCSD(T)]. Using triples natural orbitals to represent the virtual spaces for triples amplitudes, storage bottlenecks are avoided. Various carefully designed approximations ease the computational burden such that overall, the increase in the DLPNO-(T) calculation time over DLPNO-(T0) only amounts to a factor of about two (depending on the basis set). Benchmark calculations for the GMTKN30 database show that compared to DLPNO-CCSD(T0), the errors in absolute energies are greatly reduced and relative energies are moderately improved. The particularly problematic case of cumulene chains of increasing lengths is also successfully addressed by DLPNO-CCSD(T).

  11. Communication: An improved linear scaling perturbative triples correction for the domain based local pair-natural orbital based singles and doubles coupled cluster method [DLPNO-CCSD(T)

    KAUST Repository

    Guo, Yang; Riplinger, Christoph; Becker, Ute; Liakos, Dimitrios G.; Minenkov, Yury; Cavallo, Luigi; Neese, Frank


    In this communication, an improved perturbative triples correction (T) algorithm for domain based local pair-natural orbital singles and doubles coupled cluster (DLPNO-CCSD) theory is reported. In our previous implementation, the semi-canonical approximation was used and linear scaling was achieved for both the DLPNO-CCSD and (T) parts of the calculation. In this work, we refer to this previous method as DLPNO-CCSD(T0) to emphasize the semi-canonical approximation. It is well-established that the DLPNO-CCSD method can predict very accurate absolute and relative energies with respect to the parent canonical CCSD method. However, the (T0) approximation may introduce significant errors in absolute energies as the triples correction grows up in magnitude. In the majority of cases, the relative energies from (T0) are as accurate as the canonical (T) results of themselves. Unfortunately, in rare cases and in particular for small gap systems, the (T0) approximation breaks down and relative energies show large deviations from the parent canonical CCSD(T) results. To address this problem, an iterative (T) algorithm based on the previous DLPNO-CCSD(T0) algorithm has been implemented [abbreviated here as DLPNO-CCSD(T)]. Using triples natural orbitals to represent the virtual spaces for triples amplitudes, storage bottlenecks are avoided. Various carefully designed approximations ease the computational burden such that overall, the increase in the DLPNO-(T) calculation time over DLPNO-(T0) only amounts to a factor of about two (depending on the basis set). Benchmark calculations for the GMTKN30 database show that compared to DLPNO-CCSD(T0), the errors in absolute energies are greatly reduced and relative energies are moderately improved. The particularly problematic case of cumulene chains of increasing lengths is also successfully addressed by DLPNO-CCSD(T).

  12. GC ‘Multi-Analyte’ Detection Method

    Energy Technology Data Exchange (ETDEWEB)

    Dudar, E. [Plant Protection & Soil Conservation Service of Budapest, Budapest (Hungary)


    Elaborated methodologies for GC multi-analyte detection are presented, comprising the steps of method development, chromatographic conditions and procedures including the determination of relative retention times and summary results tables. (author)

  13. The GC-heterogeneity of teleost fishes

    Directory of Open Access Journals (Sweden)

    Gautier Christian


    Full Text Available Abstract Background One of the most striking features of mammalian and birds chromosomes is the variation in the guanine-cytosine (GC content that occurs over scales of hundreds of kilobases to megabases; this is known as the "isochore" structure. Among other vertebrates the presence of isochores depends upon the taxon; isochore are clearly present in Crocodiles and turtles but fish genome seems very homogeneous on GC content. This has suggested a unique isochore origin after the divergence between Sarcopterygii and Actinopterygii, but before that between Sauropsida and mammals. However during more than 30 years of analysis, isochore characteristics have been studied and many important biological properties have been associated with the isochore structure of human genomes. For instance, the genes are more compact and their density is highest in GC rich isochores. Results This paper shows in teleost fish genomes the existence of "GC segmentation" sharing some of the characteristics of isochores although teleost fish genomes presenting a particular homogeneity in CG content. The entire genomes of T nigroviridis and D rerio are now available, and this has made it possible to check whether a mosaic structure associated with isochore properties can be found in these fishes. In this study, hidden Markov models were trained on fish genes (T nigroviridis and D rerio which were classified by using the isochore class of their human orthologous. A clear segmentation of these genomes was detected. Conclusion The GC content is an excellent indicator of isochores in heterogeneous genomes as mammals. The segmentation we obtained were well correlated with GC content and other properties associated to GC content such as gene density, the number of exons per gene and the length of introns. Therefore, the GC content is the main property that allows the detection of isochore but more biological properties have to be taken into account. This method allows detecting

  14. Analysis of Biogenic Amines by GC/FID and GC/MS


    Nakovich, Laura


    Low levels of biogenic amines occur naturally, but high levels (FDA sets 50 ppm of histamine in fish as the maximum allowable level) can lead to scombroid poisoning. Amines in general are difficult to analyze by Gas Chromatography (GC) due to their lack of volatility and their interaction with the GC column, often leading to significant tailing and poor reproducibility. Biogenic amines need to be derivatized before both GC and HPLC analyses. The objective of this research was to devel...

  15. GC-ASM: Synergistic Integration of Graph-Cut and Active Shape Model Strategies for Medical Image Segmentation. (United States)

    Chen, Xinjian; Udupa, Jayaram K; Alavi, Abass; Torigian, Drew A


    Image segmentation methods may be classified into two categories: purely image based and model based. Each of these two classes has its own advantages and disadvantages. In this paper, we propose a novel synergistic combination of the image based graph-cut (GC) method with the model based ASM method to arrive at the GC-ASM method for medical image segmentation. A multi-object GC cost function is proposed which effectively integrates the ASM shape information into the GC framework. The proposed method consists of two phases: model building and segmentation. In the model building phase, the ASM model is built and the parameters of the GC are estimated. The segmentation phase consists of two main steps: initialization (recognition) and delineation. For initialization, an automatic method is proposed which estimates the pose (translation, orientation, and scale) of the model, and obtains a rough segmentation result which also provides the shape information for the GC method. For delineation, an iterative GC-ASM algorithm is proposed which performs finer delineation based on the initialization results. The proposed methods are implemented to operate on 2D images and evaluated on clinical chest CT, abdominal CT, and foot MRI data sets. The results show the following: (a) An overall delineation accuracy of TPVF > 96%, FPVF ASM for different objects, modalities, and body regions. (b) GC-ASM improves over ASM in its accuracy and precision to search region. (c) GC-ASM requires far fewer landmarks (about 1/3 of ASM) than ASM. (d) GC-ASM achieves full automation in the segmentation step compared to GC which requires seed specification and improves on the accuracy of GC. (e) One disadvantage of GC-ASM is its increased computational expense owing to the iterative nature of the algorithm.

  16. Unconventionally prepared TiO2/g-C3N4 photocatalysts for photocatalytic decomposition of nitrous oxide (United States)

    Troppová, Ivana; Šihor, Marcel; Reli, Martin; Ritz, Michal; Praus, Petr; Kočí, Kamila


    The TiO2/g-C3N4 nanocomposites with the various TiO2:g-C3N4 weight ratios from 1:1 to 1:3 were prepared unconventionally by pressurized hot water processing in a flow regime. The parent TiO2 and g-C3N4 was prepared by thermal hydrolysis and thermal annealing, respectively. The nanocomposites as well as parent TiO2 and g-C3N4 were characterized using several complementary characterization methods and investigated in the photocatalytic decomposition of N2O under UVA (λ = 365 nm) irradiation. All the prepared TiO2/g-C3N4 nanocomposites showed higher photocatalytic activity in comparison with the pure g-C3N4 and chiefly pure TiO2. The photocatalytic activity of TiO2/g-C3N4 nanocomposites was decreasing in the following sequence: TiO2/g-C3N4 (1:3) > TiO2/g-C3N4 (1:2) > TiO2/g-C3N4 (1:1). In comparison with the parent TiO2 or g-C3N4, the TiO2/g-C3N4 nanocomposites' photocatalytic capability was significantly enhanced by coupling TiO2 with g-C3N4. The generation of TiO2/g-C3N4 Z-scheme photocatalyst mainly benefited from the effective separation of photoinduced electron-hole pairs and the extended optical absorption range. The TiO2/g-C3N4 (1:3) nanocomposite showed the best photocatalytic behavior in a consequence of the optimal weight ratio of TiO2:g-C3N4 and the lowest band gap energy from all nanocomposites. The N2O conversion in its presence was 70.6% after 20 h of UVA irradiation.

  17. PandA : pairings and arithmetic

    NARCIS (Netherlands)

    Chuengsatiansup, C.; Naehrig, M.; Ribarski, P.; Schwabe, P.; Cao, Z.; Zhang, F.


    This paper introduces PandA, a software framework for Pairings and Arithmetic. It is designed to bring together advances in the efficient computation of cryptographic pairings and the development and implementation of pairing-based protocols. The intention behind the PandA framework is to give

  18. G+C content dominates intrinsic nucleosome occupancy

    Directory of Open Access Journals (Sweden)

    Hughes Timothy R


    Full Text Available Abstract Background The relative preference of nucleosomes to form on individual DNA sequences plays a major role in genome packaging. A wide variety of DNA sequence features are believed to influence nucleosome formation, including periodic dinucleotide signals, poly-A stretches and other short motifs, and sequence properties that influence DNA structure, including base content. It was recently shown by Kaplan et al. that a probabilistic model using composition of all 5-mers within a nucleosome-sized tiling window accurately predicts intrinsic nucleosome occupancy across an entire genome in vitro. However, the model is complicated, and it is not clear which specific DNA sequence properties are most important for intrinsic nucleosome-forming preferences. Results We find that a simple linear combination of only 14 simple DNA sequence attributes (G+C content, two transformations of dinucleotide composition, and the frequency of eleven 4-bp sequences explains nucleosome occupancy in vitro and in vivo in a manner comparable to the Kaplan model. G+C content and frequency of AAAA are the most important features. G+C content is dominant, alone explaining ~50% of the variation in nucleosome occupancy in vitro. Conclusions Our findings provide a dramatically simplified means to predict and understand intrinsic nucleosome occupancy. G+C content may dominate because it both reduces frequency of poly-A-like stretches and correlates with many other DNA structural characteristics. Since G+C content is enriched or depleted at many types of features in diverse eukaryotic genomes, our results suggest that variation in nucleotide composition may have a widespread and direct influence on chromatin structure.

  19. In vivo dynamics of enterovirus protease revealed by fluorescence resonance emission transfer (FRET) based on a novel FRET pair

    International Nuclear Information System (INIS)

    Hsu, Y.-Y.; Liu, Y.-N.; Wang Wenyen; Kao, Fu-Jen; Kung, S.-H.


    An in vivo protease assay suitable for analysis by fluorescence resonance energy transfer (FRET) was developed on the basis of a novel FRET pair. The specifically designed fusion substrate consists of green fluorescent protein 2 (GFP 2 )-peptide-red fluorescent protein 2 (DsRed2), with a cleavage motif for the enterovirus 2A protease (2A pro ) embedded within the peptide region. FRET can be readily visualized in real-time from cells expressing the fusion substrate until a proteolytic cleavage by 2A pro from the input virus. The level of FRET decay is a function of the amount and infection duration of the inoculated virus as measured by a fluorometer assay. The FRET biosensor also responded well to other related enteroviruses but not to a phylogenetically distant virus. Western blot analysis confirmed the physical cleavage of the fusion substrate upon the infections. The study provides proof of principle for applying the FRET technology to diagnostics, screening procedures, and cell biological research

  20. Novel base-pairing interactions at the tRNA wobble position crucial for accurate reading of the genetic code (United States)

    Rozov, Alexey; Demeshkina, Natalia; Khusainov, Iskander; Westhof, Eric; Yusupov, Marat; Yusupova, Gulnara


    Posttranscriptional modifications at the wobble position of transfer RNAs play a substantial role in deciphering the degenerate genetic code on the ribosome. The number and variety of modifications suggest different mechanisms of action during messenger RNA decoding, of which only a few were described so far. Here, on the basis of several 70S ribosome complex X-ray structures, we demonstrate how Escherichia coli tRNALysUUU with hypermodified 5-methylaminomethyl-2-thiouridine (mnm5s2U) at the wobble position discriminates between cognate codons AAA and AAG, and near-cognate stop codon UAA or isoleucine codon AUA, with which it forms pyrimidine-pyrimidine mismatches. We show that mnm5s2U forms an unusual pair with guanosine at the wobble position that expands general knowledge on the degeneracy of the genetic code and specifies a powerful role of tRNA modifications in translation. Our models consolidate the translational fidelity mechanism proposed previously where the steric complementarity and shape acceptance dominate the decoding mechanism.

  1. Manipulative interplay of two adozelesin molecules with d(ATTAAT)₂achieving ligand-stacked Watson-Crick and Hoogsteen base-paired duplex adducts. (United States)

    Hopton, Suzanne R; Thompson, Andrew S


    Previous structural studies of the cyclopropapyrroloindole (CPI) antitumor antibiotics have shown that these ligands bind covalently edge-on into the minor groove of double-stranded DNA. Reversible covalent modification of the DNA via N3 of adenine occurs in a sequence-specific fashion. Early nuclear magnetic resonance and molecular modeling studies with both mono- and bis-alkylating ligands indicated that the ligands fit tightly within the minor groove, causing little distortion of the helix. In this study, we propose a new binding model for several of the CPI-based analogues, in which the aromatic secondary rings form π-stacked complexes within the minor groove. One of the adducts, formed with adozelesin and the d(ATTAAT)(2) sequence, also demonstrates the ability of these ligands to manipulate the DNA of the binding site, resulting in a Hoogsteen base-paired adduct. Although this type of base pairing has been previously observed with the bisfunctional CPI analogue bizelesin, this is the first time that such an observation has been made with a monoalkylating nondimeric analogue. Together, these results provide a new model for the design of CPI-based antitumor antibiotics, which also has a significant bearing on other structurally related and structurally unrelated minor groove-binding ligands. They indicate the dynamic nature of ligand-DNA interactions, demonstrating both DNA conformational flexibility and the ability of two DNA-bound ligands to interact to form stable covalent modified complexes.

  2. Gestão do Conhecimento – GC – como recurso estratégico e fonte de Vantagem Competitiva Sustentável – VCS – na perspectiva Resource-based view – RBV – Knowledge Management – KM – used as a strategic resource and source of Sustainable Competitive Advantage – SCA – in the Resource-based view – RBV –

    Directory of Open Access Journals (Sweden)

    Virginia Aparecida Castro


    Full Text Available A Gestão do Conhecimento – GC – busca integrar toda a organização ao conhecimento que pode ser criado, compartilhado e armazenado. Desta forma, este trabalho tem por objetivo evidenciar de que maneira a GC é utilizada como recurso estratégico e fonte de Vantagem Competitiva Sustentável – VCS – na perspectiva Resource based view – RBV –. É feito um levantamento na forma de censo junto aos alunos das turmas de pós-graduação lato sensu (MBA da FAGEN – Faculdade de Gestão e Negócios – da UFU – Universidade Federal de Uberlândia –, os quais atuam no mercado como gestores e possuem pelo menos um subordinado sob a sua liderança. Após uma revisão da literatura sobre GC e VCS estruturou-se o instrumento de pesquisa a partir do Diagnóstico de Gestão do Conhecimento criado por Bukowitz e Williams (2002 e do Framework VRIO proposto por Barney (1991,1995. Ao considerar o critério de desempenho global de 55%, o cálculo da média aponta um percentual de 70%. Porém, a GC é utilizada em um nível preliminar, pois nota-se que os gestores necessitam, além de reconhecerem a importância da GC, trabalharem para a sua efetiva implantação. Assim, a GC, alinhada ao plano estratégico global da empresa, poderá ser utilizada como recurso estratégico e fonte de VCS na perspectiva RBV.The Knowledge Management – KM – searches to integrate organization to the knowledge that can be created, shared and stored. This study aims to show how the KM is used as a strategic resource and source of Sustainable Competitive Advantage – SCA – in the Resource based view – RBV – perspective. We made a survey in the form of census with the students of  Master Business Administration – MBA of FAGEN – Faculdade de Gestão e Negócios – da UFU – Universidade Federal de Uberlândia –. This students are managers and have employees with your leadership. After a review of the literature on KM and SCA, we have structured the

  3. General enumeration of RNA secondary structures based on new ...

    African Journals Online (AJOL)

    Crick base pairs between AU and GC. Based on the new representation, this paper also computes the number of various types of constrained secondary structures taking the minimum stack length 1 and minimum size m for each bonding loop as ...

  4. Improvement of Ylang-Ylang Essential Oil Characterization by GC×GC-TOFMS

    Directory of Open Access Journals (Sweden)

    Michał Brokl


    Full Text Available A single fraction of essential oil can often contain hundreds of compounds. Despite of the technical improvements and the enhanced selectivity currently offered by the state-of-the-art gas chromatography (GC and mass spectrometry (MS instruments, the complexity of essential oils is frequently underestimated. Comprehensive two-dimensional GC coupled to time-of-flight MS (GC×GC-TOFMS was used to improve the chemical characterization of ylang-ylang essential oil fractions recently reported in a previous one-dimensional (1D GC study. Based on both, the enhanced chromatographic separation and the mass spectral deconvolution, 161 individual compounds were identified and labeled as potentially characteristic analytes found in both low and high boiling fractions issued from distillation of mature ylang-ylang flowers. Compared to the most recent full GC-MS characterization, this represents 75 new compounds, essentially consisting of terpenes, terpenoid esters, and alcohols.

  5. Integrated multidimensional and comprehensive 2D GC analysis of fatty acid methyl esters. (United States)

    Zeng, Annie Xu; Chin, Sung-Tong; Marriott, Philip J


    Fatty acid methyl ester (FAME) profiling in complex fish oil and milk fat samples was studied using integrated comprehensive 2D GC (GC × GC) and multidimensional GC (MDGC). Using GC × GC, FAME compounds--cis- and trans-isomers, and essential fatty acid isomers--ranging from C18 to C22 in fish oil and C18 in milk fat were clearly displayed in contour plot format according to structural properties and patterns, further identified based on authentic standards. Incompletely resolved regions were subjected to MDGC, with Cn (n = 18, 20) zones transferred to a (2)D column. Elution behavior of C18 FAME on various (2)D column phases (ionic liquids IL111, IL100, IL76, and modified PEG) was evaluated. Individual isolated Cn zones demonstrated about four-fold increased peak capacities. The IL100 provided superior separation, good peak shape, and utilization of elution space. For milk fat-derived FAME, the (2)D chromatogram revealed at least three peaks corresponding to C18:1, more than six peaks for cis/trans-C18:2 isomers, and two peaks for C18:3. More than 17 peaks were obtained for the C20 region of fish oil-derived FAMEs using MDGC, compared with ten peaks using GC × GC. The MDGC strategy is useful for improved FAME isomer separation and confirmation. © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  6. Amino acid analysis in biological fluids by GC-MS


    Kaspar, Hannelore


    Amino acids are intermediates in cellular metabolism and their quantitative analysis plays an important role in disease diagnostics. A gas chromatography-mass spectrometry (GC-MS) based method was developed for the quantitative analysis of free amino acids as their propyl chloroformate derivatives in biological fluids. Derivatization with propyl chloroformate could be carried out directly in the biological samples without prior protein precipitation or solid-phase extraction of the amino acid...

  7. Can an Excess Electron Localise on a Purine Moiety in the Adenine-thymine Watson-Crick Base Pair? A Computational Study

    International Nuclear Information System (INIS)

    Mazurkiewicz, Kamil; Haranczyk, Maciej; Gutowski, Maciej S.; Rak, Janusz


    The electron affinity and the propensity to electron-induced proton transfer (PT) of hydrogen-bonded complexes between the Watson-Crick adenine-thymine pair (AT) and simple organic acid (HX), attached to adenine in the Hoogsteen-type configuration, were studied at the B3LYP/6-31+G** level. Although the carboxyl group is deprotonated at physiological pH, its neutral form, COOH, resembles the peptide bond or the amide fragment in the side chain of asparagine (Asn) or glutamine (Gln). Thus, these complexes mimic the interaction between the DNA environment (e.g., proteins) and nucleobase pairs incorporated in the biopolymer. Electron attachment is thermodynamically feasible and adiabatic electron affinities range from 0.41 to 1.28 eV, while the vertical detachment energies of the resulting anions span the range of 0.39-2.88 eV. Low-energy activation barriers separate the anionic minima: aHX(AT) from the more stable single-PT anionic geometry, aHX(AT)-SPT, and aHX(AT)-SPT from the double-PT anionic geometry, aHX(AT)-DPT. Interaction between the adenine of the Watson-Crick AT base pair with an acidic proton donor probably counterbalances the larger EA of isolated thymine, as SOMO is almost evenly delocalized over both types of nucleic bases in the aHX(AT) anions. Moreover, as a result of PT the excess electron localizes entirely on adenine. Thus, in DNA interacting with its physiological environment, damage induced by low-energy electrons could begin, contrary to the current view, with the formation of purine anions, which are not formed in isolated DNA because of the greater stability of anionic pyrimidines.

  8. A gp41-based heteroduplex mobility assay provides rapid and accurate assessment of intrasubtype epidemiological linkage in HIV type 1 heterosexual transmission Pairs. (United States)

    Manigart, Olivier; Boeras, Debrah I; Karita, Etienne; Hawkins, Paulina A; Vwalika, Cheswa; Makombe, Nathan; Mulenga, Joseph; Derdeyn, Cynthia A; Allen, Susan; Hunter, Eric


    A critical step in HIV-1 transmission studies is the rapid and accurate identification of epidemiologically linked transmission pairs. To date, this has been accomplished by comparison of polymerase chain reaction (PCR)-amplified nucleotide sequences from potential transmission pairs, which can be cost-prohibitive for use in resource-limited settings. Here we describe a rapid, cost-effective approach to determine transmission linkage based on the heteroduplex mobility assay (HMA), and validate this approach by comparison to nucleotide sequencing. A total of 102 HIV-1-infected Zambian and Rwandan couples, with known linkage, were analyzed by gp41-HMA. A 400-base pair fragment within the envelope gp41 region of the HIV proviral genome was PCR amplified and HMA was applied to both partners' amplicons separately (autologous) and as a mixture (heterologous). If the diversity between gp41 sequences was low (<5%), a homoduplex was observed upon gel electrophoresis and the transmission was characterized as having occurred between partners (linked). If a new heteroduplex formed, within the heterologous migration, the transmission was determined to be unlinked. Initial blind validation of gp-41 HMA demonstrated 90% concordance between HMA and sequencing with 100% concordance in the case of linked transmissions. Following validation, 25 newly infected partners in Kigali and 12 in Lusaka were evaluated prospectively using both HMA and nucleotide sequences. Concordant results were obtained in all but one case (97.3%). The gp41-HMA technique is a reliable and feasible tool to detect linked transmissions in the field. All identified unlinked results should be confirmed by sequence analyses.

  9. Tube Stent-Grafts for Infrarenal Aortic Aneurysm: A Matched-Paired Analysis Based on EUROSTAR Data

    International Nuclear Information System (INIS)

    Ruppert, Volker; Leurs, Lina J.; Hobo, Roel; Buth, Jacob; Rieger, Johannes; Umscheid, Thomas


    Objective. Tube stent-grafts for treatment of infrarenal aortic aneurysms (AAAs) are a nearly forgotten concept. For focal aortic pathologies tube stent-grafts may be a treatment option. We have performed a retrospective matched-paired analysis of the EUROSTAR registry regarding the outcome of tube vs. bifurcated stent-grafts for AAA. Tapered aortomonoiliac stent-grafts were not the objective of this study. Materials and methods. From July 1997 to June 2006, 7581 patients who underwent an endovascular AAA repair were entered in the EUROSTAR registry by 164 centers. One hundred fifty-three patients were treated with tube stent-grafts. For each of these 153 patients we selected one patient from a bifurcated stent-graft group (BGG-original, 7428 patients) matched according to gender, ASA, age, AAA diameter, and type of anesthesia. Differences in preoperative details between the two study groups were analyzed using chi-square test for discrete variables and Wilcoxon rank-sum test for continuous variables. Multivariate logistic regression analysis was performed on early complications. Midterm outcomes (>30 days) were analyzed by Kaplan-Meier and multivariate Cox proportional hazard model. Results. The duration of the procedure was shorter in the tube stent-graft group (TGG; 102.3 ± 52.2) than in BGG (128.3 ± 55.0; p 0.0002). Type II endoleak was less frequent in TGG (4.0%; mean follow-up, 23.12 ± 23.9 months) than in BGG (14.3%; mean follow-up, 20.77 ± 20.0 months; p = 0.0394). Type I endoleaks and migration were distributed equally, without significant differences between the groups. Combined 30-day and late mortality was higher for TGG (p = 0.0346) and was obviously not aneurysm related. Conclusions. We conclude that after selection of patients, tube stent-grafts for infrarenal aortic repair can be performed with great safety regarding endoleaks and migration. The combined higher 30-day mortality and non-aneurysm-related mortality during follow-up were mainly

  10. Matched molecular pair-based data sets for computer-aided medicinal chemistry [v1; ref status: indexed,

    Directory of Open Access Journals (Sweden)

    Ye Hu


    Full Text Available Matched molecular pairs (MMPs are widely used in medicinal chemistry to study changes in compound properties including biological activity, which are associated with well-defined structural modifications. Herein we describe up-to-date versions of three MMP-based data sets that have originated from in-house research projects. These data sets include activity cliffs, structure-activity relationship (SAR transfer series, and second generation MMPs based upon retrosynthetic rules. The data sets have in common that they have been derived from compounds included in the latest release of the ChEMBL database for which high-confidence activity data are available. Thus, the activity data associated with MMP-based activity cliffs, SAR transfer series, and retrosynthetic MMPs cover the entire spectrum of current pharmaceutical targets. Our data sets are made freely available to the scientific community.

  11. Sensitivity of GC-EI/MS, GC-EI/MS/MS, LC-ESI/MS/MS, LC-Ag(+) CIS/MS/MS, and GC-ESI/MS/MS for analysis of anabolic steroids in doping control. (United States)

    Cha, Eunju; Kim, Sohee; Kim, Ho Jun; Lee, Kang Mi; Kim, Ki Hun; Kwon, Oh-Seung; Lee, Jaeick


    This study compared the sensitivity of various separation and ionization methods, including gas chromatography with an electron ionization source (GC-EI), liquid chromatography with an electrospray ionization source (LC-ESI), and liquid chromatography with a silver ion coordination ion spray source (LC-Ag(+) CIS), coupled to a mass spectrometer (MS) for steroid analysis. Chromatographic conditions, mass spectrometric transitions, and ion source parameters were optimized. The majority of steroids in GC-EI/MS/MS and LC-Ag(+) CIS/MS/MS analysis showed higher sensitivities than those obtained with other analytical methods. The limits of detection (LODs) of 65 steroids by GC-EI/MS/MS, 68 steroids by LC-Ag(+) CIS/MS/MS, 56 steroids by GC-EI/MS, 54 steroids by LC-ESI/MS/MS, and 27 steroids by GC-ESI/MS/MS were below cut-off value of 2.0 ng/mL. LODs of steroids that formed protonated ions in LC-ESI/MS/MS analysis were all lower than the cut-off value. Several steroids such as unconjugated C3-hydroxyl with C17-hydroxyl structure showed higher sensitivities in GC-EI/MS/MS analysis relative to those obtained using the LC-based methods. The steroids containing 4, 9, 11-triene structures showed relatively poor sensitivities in GC-EI/MS and GC-ESI/MS/MS analysis. The results of this study provide information that may be useful for selecting suitable analytical methods for confirmatory analysis of steroids. Copyright © 2015 John Wiley & Sons, Ltd.

  12. A comparative research of different ensemble surrogate models based on set pair analysis for the DNAPL-contaminated aquifer remediation strategy optimization (United States)

    Hou, Zeyu; Lu, Wenxi; Xue, Haibo; Lin, Jin


    Surrogate-based simulation-optimization technique is an effective approach for optimizing the surfactant enhanced aquifer remediation (SEAR) strategy for clearing DNAPLs. The performance of the surrogate model, which is used to replace the simulation model for the aim of reducing computation burden, is the key of corresponding researches. However, previous researches are generally based on a stand-alone surrogate model, and rarely make efforts to improve the approximation accuracy of the surrogate model to the simulation model sufficiently by combining various methods. In this regard, we present set pair analysis (SPA) as a new method to build ensemble surrogate (ES) model, and conducted a comparative research to select a better ES modeling pattern for the SEAR strategy optimization problems. Surrogate models were developed using radial basis function artificial neural network (RBFANN), support vector regression (SVR), and Kriging. One ES model is assembling RBFANN model, SVR model, and Kriging model using set pair weights according their performance, and the other is assembling several Kriging (the best surrogate modeling method of three) models built with different training sample datasets. Finally, an optimization model, in which the ES model was embedded, was established to obtain the optimal remediation strategy. The results showed the residuals of the outputs between the best ES model and simulation model for 100 testing samples were lower than 1.5%. Using an ES model instead of the simulation model was critical for considerably reducing the computation time of simulation-optimization process and maintaining high computation accuracy simultaneously.

  13. Modern methods of sample preparation for GC analysis

    NARCIS (Netherlands)

    de Koning, S.; Janssen, H.-G.; Brinkman, U.A.Th.


    Today, a wide variety of techniques is available for the preparation of (semi-) solid, liquid and gaseous samples, prior to their instrumental analysis by means of capillary gas chromatography (GC) or, increasingly, comprehensive two-dimensional GC (GC × GC). In the past two decades, a large number


    An analytical method based on vacuum distillation-gas chromatography-mass spectrometry (VD-GC-MS)was developed for determining volatile organo-metalloid contaminants in bio-solid materials. Methodperformance was evaluated for dimethylselenide (DMSe), dimethyldisel...

  15. Variations in screening outcome among pairs of screening radiologists at non-blinded double reading of screening mammograms: a population-based study

    NARCIS (Netherlands)

    Klompenhouwer, E. G.; Duijm, L. E. M.; Voogd, A. C.; den Heeten, G. J.; Nederend, J.; Jansen, F. H.; Broeders, M. J. M.


    Substantial inter-observer variability in screening mammography interpretation has been reported at single reading. However, screening results of pairs of screening radiologists have not yet been published. We determined variations in screening performances among pairs of screening radiologists at

  16. Gc globulin as a diagnostic and prognostic marker in horses

    DEFF Research Database (Denmark)

    Pihl, Tina Holberg

    can prevent development of shock and thereby increase survival chances. The in vivo toxicity of Gc-globulin infusion is currently being investigated in horses and other species. Gc-globulin has been demonstrated in horse plasma and its structure closely resembles that of human Gc-globulin. Gc......-globulin concentrations in horses under clinical conditions have never previously been investigated. The Ph.D. project focuses on Gc-globulin as a prognostic marker in horses with acute abdominal pain....

  17. Determination of h2JNN and h1JHN coupling constants across Watson-Crick base pairs in the Antennapedia homeodomain-DNA complex using TROSY

    International Nuclear Information System (INIS)

    Pervushin, Konstantin; Fernandez, Cesar; Riek, Roland; Ono, Akira; Kainosho, Masatsune; Wuethrich, Kurt


    This paper describes NMR measurements of 15 N- 15 N and 1 H- 15 N scalar couplings across hydrogen bonds in Watson-Crick base pairs, h2 J NN and h1 J HN , in a 17 kDa Antennapedia homeodomain-DNA complex. A new NMR experiment is introduced which relies on zero-quantum coherence-based transverse relaxation-optimized spectroscopy (ZQ-TROSY) and enables measurements of h1 J HN couplings in larger molecules. The h2 J NN and h1 J HN couplings open a new avenue for comparative studies of DNA duplexes and other forms of nucleic acids free in solution and in complexes with proteins, drugs or possibly other classes of compounds

  18. Recent developments in comprehensive two-dimensional gas chromatography (GC X GC) I. Introduction and instrumental set-up

    NARCIS (Netherlands)

    Adahchour, M.; Beens, J.; Vreuls, R.J.J.; Brinkman, U.A.T.


    We review the literature on comprehensive two-dimensional gas chromatography (GC × GC), emphasizing developments in the period 2003-2005. The review opens with a general introduction, the principles of the technique and the set-up of GC × GC systems. It also discusses theoretical aspects, trends in

  19. Sequence-specific high mobility group box factors recognize 10-12-base pair minor groove motifs

    DEFF Research Database (Denmark)

    van Beest, M; Dooijes, D; van De Wetering, M


    Sequence-specific high mobility group (HMG) box factors bind and bend DNA via interactions in the minor groove. Three-dimensional NMR analyses have provided the structural basis for this interaction. The cognate HMG domain DNA motif is generally believed to span 6-8 bases. However, alignment...

  20. The measurement of muscle protein synthesis in broilers with a flooding dose technique: use of 15N-labelled phenylalanine, GC-MS and GC-C-IRMS. (United States)

    Dänicke, S; Böttcher, W; Simon, O; Jeroch, H


    An experiment was carried out to measure fractional muscle protein synthesis rates (k(s)) in broilers with injection of a flooding dose of phenylalanine (1 ml/100 g body weight of 150 mM phenylalanine; 38 atom percent excess (APE) [15N]phenylalanine). K(s) was calculated from the [15N] enrichment in phenylalanine of tissue-free and protein-bound phenylalanine using both gas chromatography mass spectrometry (GC-MS) and gas chromatography combustion isotope ratio mass spectrometry (GC-C-IRMS) for measurements after a 10 min isotope incorporation period. The tertiary-butyldimethylsilyl (t-BDMS) derivatives of phenylalanine were used for gas chromatographic separation in both systems. GC-MS and GC-C-IRMS were calibrated for a range of 7 to 37 [15N]APE and 0 to 0.62 [15N]APE, respectively, and for sample sizes of 0.45 to 4.5 nmol phenylalanine and 7 to 40 nmol phenylalanine, respectively. Reproducibility of standards as a measure of precision varied from 0.06 to 0.29 [15N]APE and from 0.0004 to 0.0018 [15N]APE in GC-MS and GC-C-IRMS, respectively. K(s) was measured in the m. pectoralis major of broilers fed rye based diets (56%) which were provided either unsupplemented (-) or supplemented (+) with an enzyme preparation containing xylanase. K(s) in breast muscles was significantly increased from 21.8%/d to 23.9%/d due to enzyme supplementation. It can be concluded from the study that the measurement of protein synthesis in broilers with the flooding dose technique can be carried out by using [15N]phenylalanine, GC-MS and GC-C-IRMS.

  1. Pairing correlations in nuclei

    International Nuclear Information System (INIS)

    Baba, C.V.K.


    There are many similarities between the properties of nucleons in nuclei and electrons in metals. In addition to the properties explainable in terms of independent particle motion, there are many important co-operative effects suggesting correlated motion. Pairing correlation which leads to superconductivity in metals and several important properties in nuclei , is an exmple of such correlations. An attempt has been made to review the effects of pairing correlations in nuclei. Recent indications of reduction in pairing correlations at high angular momenta is discussed. A comparision between pairing correlations in the cases of nuclei and electrons in metals is attempted. (author). 20 refs., 10 figs

  2. The first example of a Hoogsteen base-paired DNA duplex in dynamic equilibrium with a Watson-Crick base-paired duplex--a structural (NMR), kinetic and thermodynamic study. (United States)

    Isaksson, J; Zamaratski, E; Maltseva, T V; Agback, P; Kumar, A; Chattopadhyaya, J


    A single-point substitution of the O4' oxygen by a CH2 group at the sugar residue of A6 (i.e. 2'-deoxyaristeromycin moiety) in a self-complementary DNA duplex, 5'-d(C1G2C3G4A5A6T7T8C9G10C11G12)2(-3), has been shown to steer the fully Watson-Crick basepaired DNA duplex (1A), akin to the native counterpart, to a doubly A6:T7 Hoogsteen basepaired (1B) B-type DNA duplex, resulting in a dynamic equilibrium of (1A)(1B): Keq = k1/k(-1) = 0.56+/-0.08. The dynamic conversion of the fully Watson-Crick basepaired (1A) to the partly Hoogsteen basepaired (1B) structure is marginally kinetically and thermodynamically disfavoured [k1 (298K) = 3.9 0.8 sec(-1); deltaHdegrees++ = 164+/-14 kJ/mol; -TdeltaS degrees++ (298K) = -92 kJ/mol giving a deltaG degrees++ 298 of 72 kJ/mol. Ea (k1) = 167 14 kJ/mol] compared to the reverse conversion of the Hoogsteen (1B) to the Watson-Crick (1A) structure [k-1 (298K) = 7.0 0.6 sec-1, deltaH degrees++ = 153 13 kJ/mol; -TdeltaSdegrees++ (298K) = -82 kJ/mol giving a deltaGdegrees++(298) of 71 kJ/mol. Ea (k-1) = 155 13 kJ/mol]. Acomparison of deltaGdegrees++(298) of the forward (k1) and backward (k-1) conversions, (1A)(1B), shows that there is ca 1 kJ/mol preference for the Watson-Crick (1A) over the double Hoogsteen basepaired (1B) DNA duplex, thus giving an equilibrium ratio of almost 2:1 in favour of the fully Watson-Crick basepaired duplex. The chemical environments of the two interconverting DNA duplexes are very different as evident from their widely separated sets of chemical shifts connected by temperature-dependent exchange peaks in the NOESY and ROESY spectra. The fully Watson-Crick basepaired structure (1A) is based on a total of 127 intra, 97 inter and 17 cross-strand distance constraints per strand, whereas the double A6:T7 Hoogsteen basepaired (1B) structure is based on 114 intra, 92 inter and 15 cross-strand distance constraints, giving an average of 22 and 20 NOE distance constraints per residue and strand, respectively. In addition

  3. Determination of selected organophosphorus pesticides using GC ...

    African Journals Online (AJOL)

    A reproducible analytical method utilising GC-MS is presented for the analysis of thirteen organophosphorus insecticides (OPs) often found in environmental aqueous samples. Extraction of filtered river and canal water (100 mL), fortified with the OPs, was conducted using solid-phase extraction and eluted with a variety of ...

  4. Comprehensive analysis of yeast metabolite GC x GC-TOFMS data: combining discovery-mode and deconvolution chemometric software. (United States)

    Mohler, Rachel E; Dombek, Kenneth M; Hoggard, Jamin C; Pierce, Karisa M; Young, Elton T; Synovec, Robert E


    The first extensive study of yeast metabolite GC x GC-TOFMS data from cells grown under fermenting, R, and respiring, DR, conditions is reported. In this study, recently developed chemometric software for use with three-dimensional instrumentation data was implemented, using a statistically-based Fisher ratio method. The Fisher ratio method is fully automated and will rapidly reduce the data to pinpoint two-dimensional chromatographic peaks differentiating sample types while utilizing all the mass channels. The effect of lowering the Fisher ratio threshold on peak identification was studied. At the lowest threshold (just above the noise level), 73 metabolite peaks were identified, nearly three-fold greater than the number of previously reported metabolite peaks identified (26). In addition to the 73 identified metabolites, 81 unknown metabolites were also located. A Parallel Factor Analysis graphical user interface (PARAFAC GUI) was applied to selected mass channels to obtain a concentration ratio, for each metabolite under the two growth conditions. Of the 73 known metabolites identified by the Fisher ratio method, 54 were statistically changing to the 95% confidence limit between the DR and R conditions according to the rigorous Student's t-test. PARAFAC determined the concentration ratio and provided a fully-deconvoluted (i.e. mathematically resolved) mass spectrum for each of the metabolites. The combination of the Fisher ratio method with the PARAFAC GUI provides high-throughput software for discovery-based metabolomics research, and is novel for GC x GC-TOFMS data due to the use of the entire data set in the analysis (640 MB x 70 runs, double precision floating point).

  5. Paired Hall states

    International Nuclear Information System (INIS)

    Greiter, M.


    This dissertation contains a collection of individual articles on various topics. Their significance in the corresponding field as well as connections between them are emphasized in a general and comprehensive introduction. In the first article, the author explores the consequences for macroscopic effective Lagrangians of assuming that the momentum density is proportional to the flow of conserved current. The universal corrections obtained for the macroscopic Lagrangian of a superconductor describe the London Hall effect, and provide a fully consistent derivation of it. In the second article, a heuristic principle is proposed for quantized Hall states: the existence and incompressibility of fractionally quantized Hall states is explained by an argument based on an adiabatic localization of magnetic flux, the process of trading uniform flux for an equal amount of fictitious flux attached to the particles. This principle is exactly implemented in the third article. For a certain class of model Hamiltonians, the author obtains Laughlin's Jastrow type wave functions explicitly from a filled Landau level, by smooth extrapolation in quantum statistics. The generalization of this analysis to the torus geometry shows that theorems restricting the possibilities of quantum statistics on closed surfaces are circumvented in the presence of a magnetic field. In the last article, the existence is proposed of a novel incompressible quantum liquid, a paired Hall state, at a half filled Landau level. This state arises adiabatically from free fermions in zero magnetic field, and reduces to a state previously proposed by Halperin in the limit of tightly bound pairs. It supports unusual excitations, including neutral fermions and charge e/4 anyons with statistical parameter θ = π/8

  6. Case Report: GcMAF Treatment in a Patient with Multiple Sclerosis. (United States)

    Inui, Toshio; Katsuura, Goro; Kubo, Kentaro; Kuchiike, Daisuke; Chenery, Leslye; Uto, Yoshihiro; Nishikata, Takahito; Mette, Martin


    Gc protein-derived macrophage-activating factor (GcMAF) has various functions as an immune modulator, such as macrophage activation, anti-angiogenic activity and anti-tumor activity. Clinical trials of second-generation GcMAF demonstrated remarkable clinical effects in several types of cancers. Thus, GcMAF-based immunotherapy has a wide application for use in the treatment of many diseases via macrophage activation that can be used as a supportive therapy. Multiple sclerosis (MS) is considered to be an autoimmune disorder that affects the myelinated axons in the central nervous system (CNS). This study was undertaken to examine the effects of second-generation GcMAF in a patient with MS. This case study demonstrated that treatments of GcMAF in a patient with MS have potent therapeutic actions with early beneficial responses, especially improvement of motor dysfunction. GcMAF shows therapeutic potency in the treatment of MS. Copyright© 2016 International Institute of Anticancer Research (Dr. John G. Delinassios), All rights reserved.

  7. Clinical experience of integrative cancer immunotherapy with GcMAF. (United States)

    Inui, Toshio; Kuchiike, Daisuke; Kubo, Kentaro; Mette, Martin; Uto, Yoshihiro; Hori, Hitoshi; Sakamoto, Norihiro


    Immunotherapy has become an attractive new strategy in the treatment of cancer. The laboratory and clinical study of cancer immunotherapy is rapidly advancing. However, in the clinical setting, the results of cancer immunotherapy are mixed. We therefore contend that cancer immunotherapy should be customized to each patient individually based on their immune status and propose an integrative immunotherapy approach with second-generation group-specific component macrophage activating factor (GcMAF)-containing human serum. The standard protocol of our integrative cancer immunotherapy is as follows: i) 0.5 ml GcMAF-containing human serum is administered intramuscularly or subcutaneously once or twice per week for the duration of cancer therapy until all cancer cells are eradicated; ii) hyper T/natural killer (NK) cell therapy is given once per week for six weeks; iii) high-dose vitamin C is administered intravenously twice per week; iv) alpha lipoic acid (600 mg) is administered orally daily; v) vitamin D3 (5,000-10,000 IU) is administered orally daily. By March 2013, Saisei Mirai have treated over 345 patients with GcMAF. Among them we here present the cases of three patients for whom our integrative immunotherapy was remarkably effective. The results of our integrative immunotherapy seem hopeful. We also plan to conduct a comparative clinical study.>

  8. Cyanine-based probe\\tag-peptide pair for fluorescence protein imaging and fluorescence protein imaging methods (United States)

    Mayer-Cumblidge, M Uljana [Richland, WA; Cao, Haishi [Richland, WA


    A molecular probe comprises two arsenic atoms and at least one cyanine based moiety. A method of producing a molecular probe includes providing a molecule having a first formula, treating the molecule with HgOAc, and subsequently transmetallizing with AsCl.sub.3. The As is liganded to ethanedithiol to produce a probe having a second formula. A method of labeling a peptide includes providing a peptide comprising a tag sequence and contacting the peptide with a biarsenical molecular probe. A complex is formed comprising the tag sequence and the molecular probe. A method of studying a peptide includes providing a mixture containing a peptide comprising a peptide tag sequence, adding a biarsenical probe to the mixture, and monitoring the fluorescence of the mixture.

  9. Unique TTC repeat base pair loss mutation in cases of pure neural leprosy: A survival strategy of Mycobacterium leprae?

    Directory of Open Access Journals (Sweden)

    Abhishek De


    Full Text Available Background: Genomic reduction helps obligate intracellular microbes to survive difficult host niches. Adaptation of Mycobacterium leprae in cases of pure neural leprosy (PNL in the intracellular niche of peripheral nerves can be associated with some gene loss. Recently, a stable but variable number of tandem repefzats (TTC have been reported in strains of M. leprae. FolP and rpoB genes are the two common mutation sites which deal with the susceptibility of the bacteria to drugs. Aim: We attempted to find if genomic reduction of M. leprae in context of these TTC repeats or mutations in folP1 and rpoB can be the reason for the restriction of M. leprae in the nerves in PNL. Materials and Methods: DNA extracts taken from fine needle aspiration of affected nerves of 24 PNL cases were studied for tandem repeats with 21TTC primer in multiplex-PCR. Mutations were also studied by PCR Amplification of SRDR (Sulphone Resistance Determining Region of the folP1 and multiple primer PCR amplification refractory mutation system (MARS of the rpoB. Results: Of the 24 PNL, only 1 patient showed mutation in the rpoB gene and none in the folp1 gene. Studying the mutation in TTC region of the M. leprae gene we found that all the cases have a loss of a few bases in the sequence. Conclusion: We can conclude that there is consistent loss in the bases in the TTC region in all cases of pure neural Hansen and we postulate that it may be an adaptive response of the bacteria to survive host niche resulting in its restriction to peripheral nerves.

  10. Secure pairing with biometrics

    NARCIS (Netherlands)

    Buhan, I.R.; Boom, B.J.; Doumen, J.M.; Hartel, Pieter H.; Veldhuis, Raymond N.J.

    Secure pairing enables two devices that share no prior context with each other to agree upon a security association, which they can use to protect their subsequent communication. Secure pairing offers guarantees of the association partner identity and it should be resistant to eavesdropping and to a

  11. Affine pairings on ARM

    NARCIS (Netherlands)

    Acar, T.; Lauter, K.; Naehrig, M.; Shumow, D.


    Pairings on elliptic curves are being used in an increasing number of cryptographic applications on many different devices and platforms, but few performance numbers for cryptographic pairings have been reported on embedded and mobile devices. In this paper we give performance numbers for affine and

  12. Solutions of nuclear pairing

    International Nuclear Information System (INIS)

    Balantekin, A. B.; Pehlivan, Y.


    We give the exact solution of orbit dependent nuclear pairing problem between two nondegenerate energy levels using the Bethe ansatz technique. Our solution reduces to previously solved cases in the appropriate limits including Richardson's treatment of reduced pairing in terms of rational Gaudin algebra operators

  13. Pair correlations in nuclei

    International Nuclear Information System (INIS)

    Shimizu, Yoshifumi


    Except for the closed shell nuclei, almost all nuclei are in the superconducting state at their ground states. This well-known pair correlation in nuclei causes various interesting phenomena. It is especially to be noted that the pair correlation becomes weak in the excited states of nuclei with high angular momentum, which leads to the pair phase transition to the normal state in the high spin limit. On the other hand, the pair correlation becomes stronger in the nuclei with lower nucleon density than in those with normal density. In the region of neutron halo or skin state of unstable nuclei, this phenomenon is expected to be further enhanced to be observed compared to the ground state of stable nuclei. An overview of those interesting aspects caused via the pair correlation is presented here in the sections titled 'pair correlations in ground states', pair correlations in high spin states' and 'pair correlations in unstable nuclei' focusing on the high spin state. (S. Funahashi)

  14. Optical sensing system based on wireless paired emitter detector diode device and ionogels for lab-on-a-disc water quality analysis. (United States)

    Czugala, Monika; Gorkin, Robert; Phelan, Thomas; Gaughran, Jennifer; Curto, Vincenzo Fabio; Ducrée, Jens; Diamond, Dermot; Benito-Lopez, Fernando


    This work describes the first use of a wireless paired emitter detector diode device (PEDD) as an optical sensor for water quality monitoring in a lab-on-a-disc device. The microfluidic platform, based on an ionogel sensing area combined with a low-cost optical sensor, is applied for quantitative pH and qualitative turbidity monitoring of water samples at point-of-need. The autonomous capabilities of the PEDD system, combined with the portability and wireless communication of the full device, provide the flexibility needed for on-site water testing. Water samples from local fresh and brackish sources were successfully analysed using the device, showing very good correlation with standard bench-top systems.

  15. Physical mapping of a 330 X 10(3)-base-pair region of the Myxococcus xanthus chromosome that is preferentially labeled during spore germination

    International Nuclear Information System (INIS)

    Komano, T.; Inouye, S.; Inouye, M.


    Myxococcus xanthus was pulse-labeled with [ 3 H]thymidine immediately after germination of dimethyl sulfoxide-induced spores. The restriction enzyme digests of the total chromosomal DNA from the pulse- labeled cells were analyzed by one-dimensional as well as two- dimensional agarose gel electrophoresis. Four PstI fragments preferentially labeled at a very early stage of germination were cloned into the unique PstI site of pBR322. By using these clones as probes, a restriction enzyme map was established covering approximately 6% of the total M. xanthus genome (330 X 10(3) base pairs). The distribution of the specific activities of the restriction fragments pulse-labeled after germination suggests a bidirectional mode of DNA replication from a fixed origin

  16. Highly Efficient One-Pot Synthesis of COS-Based Block Copolymers by Using Organic Lewis Pairs. (United States)

    Yang, Jia-Liang; Cao, Xiao-Han; Zhang, Cheng-Jian; Wu, Hai-Lin; Zhang, Xing-Hong


    A one-pot synthesis of block copolymer with regioregular poly(monothiocarbonate) block is described via metal-free catalysis. Lewis bases such as guanidine, quaternary onium salts, and Lewis acid triethyl borane (TEB) were equivalently combined and used as the catalysts. By using polyethylene glycol (PEG) as the macromolecular chain transfer agent (CTA), narrow polydispersity block copolymers were obtained from the copolymerization of carbonyl sulfide (COS) and propylene oxide (PO). The block copolymers had a poly(monothiocarbonate) block with perfect alternating degree and regioregularity. Unexpectedly, the addition of CTA to COS/PO copolymerization system could dramatically improve the turnover frequency (TOF) of PO (up to 240 h -1 ), higher than that of the copolymerization without CTA. In addition, the conversion of CTA could be up to 100% in most cases, as revealed by ¹H NMR spectra. Of consequence, the number-average molecular weights ( M n s) of the resultant block copolymers could be regulated by varying the feed ratio of CTA to PO. Oxygen-sulfur exchange reaction (O/S ER), which can generate randomly distributed thiocarbonate and carbonate units, was effectively suppressed in all of the cases in the presence of CTA, even at 80 °C. This work presents a versatile method for synthesizing sulfur-containing block copolymers through a metal-free route, providing an array of new block copolymers.

  17. Cooper Pairs in Insulators?

    International Nuclear Information System (INIS)

    Valles, James


    Nearly 50 years elapsed between the discovery of superconductivity and the emergence of the microscopic theory describing this zero resistance state. The explanation required a novel phase of matter in which conduction electrons joined in weakly bound pairs and condensed with other pairs into a single quantum state. Surprisingly, this Cooper pair formation has also been invoked to account for recently uncovered high-resistance or insulating phases of matter. To address this possibility, we have used nanotechnology to create an insulating system that we can probe directly for Cooper pairs. I will present the evidence that Cooper pairs exist and dominate the electrical transport in these insulators and I will discuss how these findings provide new insight into superconductor to insulator quantum phase transitions.

  18. Au pair trajectories

    DEFF Research Database (Denmark)

    Dalgas, Karina Märcher


    pair-sending families in the Philippines, this dissertation examines the long-term trajectories of these young Filipinas. It shows how the au pairs’ local and transnational family relations develop over time and greatly influence their life trajectories. A focal point of the study is how au pairs...... that Filipina au pairs see their stay abroad as an avenue of personal development and social recognition, I examine how the au pairs re-position themselves within their families at home through migration, and how they navigate between the often conflicting expectations of participation in the sociality......Since 2000, thousands of young Filipino migrants have come to Denmark as au pairs. Officially, they are there to “broaden their cultural horizons” by living temporarily with a Danish host family, but they also conduct domestic labor in exchange for food and money, which allows them to send...

  19. Hantavirus Gc induces long-term immune protection via LAMP-targeting DNA vaccine strategy. (United States)

    Jiang, Dong-Bo; Zhang, Jin-Peng; Cheng, Lin-Feng; Zhang, Guan-Wen; Li, Yun; Li, Zi-Chao; Lu, Zhen-Hua; Zhang, Zi-Xin; Lu, Yu-Chen; Zheng, Lian-He; Zhang, Fang-Lin; Yang, Kun


    Hemorrhagic fever with renal syndrome (HFRS) occurs widely throughout Eurasia. Unfortunately, there is no effective treatment, and prophylaxis remains the best option against the major pathogenic agent, hantaan virus (HTNV), which is an Old World hantavirus. However, the absence of cellular immune responses and immunological memory hampers acceptance of the current inactivated HFRS vaccine. Previous studies revealed that a lysosome-associated membrane protein 1 (LAMP1)-targeting strategy involving a DNA vaccine based on the HTNV glycoprotein Gn successfully conferred long-term immunity, and indicated that further research on Gc, another HTNV antigen, was warranted. Plasmids encoding Gc and lysosome-targeted Gc, designated pVAX-Gc and pVAX-LAMP/Gc, respectively, were constructed. Proteins of interest were identified by fluorescence microscopy following cell line transfection. Five groups of 20 female BALB/c mice were subjected to the following inoculations: inactivated HTNV vaccine, pVAX-LAMP/Gc, pVAX-Gc, and, as the negative controls, pVAX-LAMP or the blank vector pVAX1. Humoral and cellular immunity were assessed by enzyme-linked immunosorbent assays (ELISAs) and 15-mer peptide enzyme-linked immunospot (ELISpot) epitope mapping assays. Repeated immunization with pVAX-LAMP/Gc enhanced adaptive immune responses, as demonstrated by the specific and neutralizing antibody titers and increased IFN-γ production. The inactivated vaccine induced a comparable humoral reaction, but the negative controls only elicited insignificant responses. Using a mouse model of HTNV challenge, the in vivo protection conferred by the inactivated vaccine and Gc-based constructs (with/without LAMP recombination) was confirmed. Evidence of pan-epitope reactions highlighted the long-term cellular response to the LAMP-targeting strategy, and histological observations indicated the safety of the LAMP-targeting vaccines. The long-term protective immune responses induced by pVAX-LAMP/Gc may be

  20. Growing Right Onto Wellness (GROW): a family-centered, community-based obesity prevention randomized controlled trial for preschool child-parent pairs. (United States)

    Po'e, Eli K; Heerman, William J; Mistry, Rishi S; Barkin, Shari L


    Growing Right Onto Wellness (GROW) is a randomized controlled trial that tests the efficacy of a family-centered, community-based, behavioral intervention to prevent childhood obesity among preschool-aged children. Focusing on parent-child pairs, GROW utilizes a multi-level framework, which accounts for macro (i.e., built-environment) and micro (i.e., genetics) level systems that contribute to the childhood obesity epidemic. Six hundred parent-child pairs will be randomized to a 3-year healthy lifestyle intervention or a 3-year school readiness program. Eligible children are enrolled between ages 3 and 5, are from minority communities, and are not obese. The principal site for the GROW intervention is local community recreation centers and libraries. The primary outcome is childhood body mass index (BMI) trajectory at the end of the three-year study period. In addition to other anthropometric measurements, mediators and moderators of growth are considered, including genetics, accelerometry, and diet recall. GROW is a staged intensity intervention, consisting of intensive, maintenance, and sustainability phases. Throughout the study, parents build skills in nutrition, physical activity, and parenting, concurrently forming new social networks. Participants are taught goal-setting, self-monitoring, and problem solving techniques to facilitate sustainable behavior change. The GROW curriculum uses low health literacy communication and social media to communicate key health messages. The control arm is administered to both control and intervention participants. By conducting this trial in public community centers, and by implementing a family-centered approach to sustainable healthy childhood growth, we aim to develop an exportable community-based intervention to address the expanding public health crisis of pediatric obesity. © 2013.

  1. Sparse maps—A systematic infrastructure for reduced-scaling electronic structure methods. II. Linear scaling domain based pair natural orbital coupled cluster theory

    International Nuclear Information System (INIS)

    Riplinger, Christoph; Pinski, Peter; Becker, Ute; Neese, Frank; Valeev, Edward F.


    Domain based local pair natural orbital coupled cluster theory with single-, double-, and perturbative triple excitations (DLPNO-CCSD(T)) is a highly efficient local correlation method. It is known to be accurate and robust and can be used in a black box fashion in order to obtain coupled cluster quality total energies for large molecules with several hundred atoms. While previous implementations showed near linear scaling up to a few hundred atoms, several nonlinear scaling steps limited the applicability of the method for very large systems. In this work, these limitations are overcome and a linear scaling DLPNO-CCSD(T) method for closed shell systems is reported. The new implementation is based on the concept of sparse maps that was introduced in Part I of this series [P. Pinski, C. Riplinger, E. F. Valeev, and F. Neese, J. Chem. Phys. 143, 034108 (2015)]. Using the sparse map infrastructure, all essential computational steps (integral transformation and storage, initial guess, pair natural orbital construction, amplitude iterations, triples correction) are achieved in a linear scaling fashion. In addition, a number of additional algorithmic improvements are reported that lead to significant speedups of the method. The new, linear-scaling DLPNO-CCSD(T) implementation typically is 7 times faster than the previous implementation and consumes 4 times less disk space for large three-dimensional systems. For linear systems, the performance gains and memory savings are substantially larger. Calculations with more than 20 000 basis functions and 1000 atoms are reported in this work. In all cases, the time required for the coupled cluster step is comparable to or lower than for the preceding Hartree-Fock calculation, even if this is carried out with the efficient resolution-of-the-identity and chain-of-spheres approximations. The new implementation even reduces the error in absolute correlation energies by about a factor of two, compared to the already accurate

  2. ETMB-RBF: discrimination of metal-binding sites in electron transporters based on RBF networks with PSSM profiles and significant amino acid pairs. (United States)

    Ou, Yu-Yen; Chen, Shu-An; Wu, Sheng-Cheng


    Cellular respiration is the process by which cells obtain energy from glucose and is a very important biological process in living cell. As cells do cellular respiration, they need a pathway to store and transport electrons, the electron transport chain. The function of the electron transport chain is to produce a trans-membrane proton electrochemical gradient as a result of oxidation-reduction reactions. In these oxidation-reduction reactions in electron transport chains, metal ions play very important role as electron donor and acceptor. For example, Fe ions are in complex I and complex II, and Cu ions are in complex IV. Therefore, to identify metal-binding sites in electron transporters is an important issue in helping biologists better understand the workings of the electron transport chain. We propose a method based on Position Specific Scoring Matrix (PSSM) profiles and significant amino acid pairs to identify metal-binding residues in electron transport proteins. We have selected a non-redundant set of 55 metal-binding electron transport proteins as our dataset. The proposed method can predict metal-binding sites in electron transport proteins with an average 10-fold cross-validation accuracy of 93.2% and 93.1% for metal-binding cysteine and histidine, respectively. Compared with the general metal-binding predictor from A. Passerini et al., the proposed method can improve over 9% of sensitivity, and 14% specificity on the independent dataset in identifying metal-binding cysteines. The proposed method can also improve almost 76% sensitivity with same specificity in metal-binding histidine, and MCC is also improved from 0.28 to 0.88. We have developed a novel approach based on PSSM profiles and significant amino acid pairs for identifying metal-binding sites from electron transport proteins. The proposed approach achieved a significant improvement with independent test set of metal-binding electron transport proteins.

  3. Use of a line-pair resolution phantom for comprehensive quality assurance of electronic portal imaging devices based on fundamental imaging metrics

    International Nuclear Information System (INIS)

    Gopal, Arun; Samant, Sanjiv S.


    Image guided radiation therapy solutions based on megavoltage computed tomography (MVCT) involve the extension of electronic portal imaging devices (EPIDs) from their traditional role of weekly localization imaging and planar dose mapping to volumetric imaging for 3D setup and dose verification. To sustain the potential advantages of MVCT, EPIDs are required to provide improved levels of portal image quality. Therefore, it is vital that the performance of EPIDs in clinical use is maintained at an optimal level through regular and rigorous quality assurance (QA). Traditionally, portal imaging QA has been carried out by imaging calibrated line-pair and contrast resolution phantoms and obtaining arbitrarily defined QA indices that are usually dependent on imaging conditions and merely indicate relative trends in imaging performance. They are not adequately sensitive to all aspects of image quality unlike fundamental imaging metrics such as the modulation transfer function (MTF), noise power spectrum (NPS), and detective quantum efficiency (DQE) that are widely used to characterize detector performance in radiographic imaging and would be ideal for QA purposes. However, due to the difficulty of performing conventional MTF measurements, they have not been used for routine clinical QA. The authors present a simple and quick QA methodology based on obtaining the MTF, NPS, and DQE of a megavoltage imager by imaging standard open fields and a bar-pattern QA phantom containing 2 mm thick tungsten line-pair bar resolution targets. Our bar-pattern based MTF measurement features a novel zero-frequency normalization scheme that eliminates normalization errors typically associated with traditional bar-pattern measurements at megavoltage x-ray energies. The bar-pattern QA phantom and open-field images are used in conjunction with an automated image analysis algorithm that quickly computes the MTF, NPS, and DQE of an EPID system. Our approach combines the fundamental advantages of

  4. Influence of annealing temperature on physical properties and photocatalytic ability of g-C3N4 nanosheets synthesized through urea polymerization in Ar atmosphere (United States)

    Mai Oanh, Le Thi; Hang, Lam Thi; Lai, Ngoc Diep; Phuong, Nguyen Thi; Thang, Dao Viet; Hung, Nguyen Manh; Danh Bich, Do; Minh, Nguyen Van


    The influences of annealing temperature on structure, morphology, vibration, optical properties and photocatalytic ability of g-C3N4 nanosheets synthesized from urea in Ar atmosphere were investigated in detail by using x-ray diffraction (XRD) analysis, scanning electron microscopy (SEM), X-ray photoelectron spectroscopy (XPS), Brunauer-Emmett-Teller (BET), Fourier transform infrared spectroscopy (FTIR), UV-vis absorption, and photoluminescence (PL). It was found that the preparation temperature had a great effect on structure and physical properties of g-C3N4. As the processing temperature increased from 450 °C to 650 °C, the interlayer stacking distance of g-C3N4 decreased from 3.281 Å to 3.217 Å and the lattice parameter a decreased from 5.010 Å to 4.934 Å. This indicated a denser packing fashion of g-C3N4 at high annealing temperature. Moreover, the FTIR spectra and SEM images revealed a large fraction of small polymer segments containing only a few heptazine units as annealing temperature increased. BET result indicated an increasing specific surface area as preparation temperature increased. UV-vis absorption spectra showed a decrease of the band gap energy with increasing calcination temperature which agrees well with the measured PL spectra. It was demonstrated that samples annealed at 550 °C exhibited the strongest photocatalytic activity. A decomposition of 80% and 100% of rhodamine B was obtained within respectively 1 h and 2 h under Xenon lamp irradiation. Photocatalytic result could be adequately explained based on evidences of specific surface area, average pore volume and pore size, and recombination rate of photoinduced electron-hole pairs.

  5. First comparative approach to touchscreen-based visual object-location paired-associates learning in humans (Homo sapiens) and a nonhuman primate (Microcebus murinus). (United States)

    Schmidtke, Daniel; Ammersdörfer, Sandra; Joly, Marine; Zimmermann, Elke


    A recent study suggests that a specific, touchscreen-based task on visual object-location paired-associates learning (PAL), the so-called Different PAL (dPAL) task, allows effective translation from animal models to humans. Here, we adapted the task to a nonhuman primate (NHP), the gray mouse lemur, and provide first evidence for the successful comparative application of the task to humans and NHPs. Young human adults reach the learning criterion after considerably less sessions (one order of magnitude) than young, adult NHPs, which is likely due to faster and voluntary rejection of ineffective learning strategies in humans and almost immediate rule generalization. At criterion, however, all human subjects solved the task by either applying a visuospatial rule or, more rarely, by memorizing all possible stimulus combinations and responding correctly based on global visual information. An error-profile analysis in humans and NHPs suggests that successful learning in NHPs is comparably based either on the formation of visuospatial associative links or on more reflexive, visually guided stimulus-response learning. The classification in the NHPs is further supported by an analysis of the individual response latencies, which are considerably higher in NHPs classified as spatial learners. Our results, therefore, support the high translational potential of the standardized, touchscreen-based dPAL task by providing first empirical and comparable evidence for two different cognitive processes underlying dPAL performance in primates. (PsycINFO Database Record (c) 2018 APA, all rights reserved).

  6. Preparation of Gc protein-derived macrophage activating factor (GcMAF) and its structural characterization and biological activities. (United States)

    Mohamad, Saharuddin Bin; Nagasawa, Hideko; Uto, Yoshihiro; Hori, Hitoshi


    Gc protein has been reported to be a precursor of Gc protein-derived macrophage activation factor (GcMAF) in the inflammation-primed macrophage activation cascade. An inducible beta-galactosidase of B cells and neuraminidase of T cells convert Gc protein to GcMAF. Gc protein from human serum was purified using 25(OH)D3 affinity column chromatography and modified to GcMAF using immobilized glycosidases (beta-galactosidase and neuraminidase) The sugar moiety structure of GcMAF was characterized by lectin blotting by Helix pomatia agglutinin. The biological activities of GcMAF were evaluated by a superoxide generation assay and a phagocytosis assay. We successfully purified Gc protein from human serum. GcMAF was detected by lectin blotting and showed a high biological activity. Our results support the importance of the terminal N-acetylgalactosamine moiety in the GcMAF-mediated macrophage activation cascade, and the existence of constitutive GcMAF in human serum. These preliminary data are important for designing small molecular GcMAF mimics.

  7. Analytic energy derivatives for the calculation of the first-order molecular properties using the domain-based local pair-natural orbital coupled-cluster theory (United States)

    Datta, Dipayan; Kossmann, Simone; Neese, Frank


    The domain-based local pair-natural orbital coupled-cluster (DLPNO-CC) theory has recently emerged as an efficient and powerful quantum-chemical method for the calculation of energies of molecules comprised of several hundred atoms. It has been demonstrated that the DLPNO-CC approach attains the accuracy of a standard canonical coupled-cluster calculation to about 99.9% of the basis set correlation energy while realizing linear scaling of the computational cost with respect to system size. This is achieved by combining (a) localized occupied orbitals, (b) large virtual orbital correlation domains spanned by the projected atomic orbitals (PAOs), and (c) compaction of the virtual space through a truncated pair natural orbital (PNO) basis. In this paper, we report on the implementation of an analytic scheme for the calculation of the first derivatives of the DLPNO-CC energy for basis set independent perturbations within the singles and doubles approximation (DLPNO-CCSD) for closed-shell molecules. Perturbation-independent one-particle density matrices have been implemented in order to account for the response of the CC wave function to the external perturbation. Orbital-relaxation effects due to external perturbation are not taken into account in the current implementation. We investigate in detail the dependence of the computed first-order electrical properties (e.g., dipole moment) on the three major truncation parameters used in a DLPNO-CC calculation, namely, the natural orbital occupation number cutoff used for the construction of the PNOs, the weak electron-pair cutoff, and the domain size cutoff. No additional truncation parameter has been introduced for property calculation. We present benchmark calculations on dipole moments for a set of 10 molecules consisting of 20-40 atoms. We demonstrate that 98%-99% accuracy relative to the canonical CCSD results can be consistently achieved in these calculations. However, this comes with the price of tightening the

  8. Insights into the photocatalytic mechanism of mediator-free direct Z-scheme g-C3N4/Bi2MoO6(010) and g-C3N4/Bi2WO6(010) heterostructures: A hybrid density functional theory study

    CSIR Research Space (South Africa)

    Opoku, F


    Full Text Available Graphite-like carbon nitride (g-C3N4)-based heterostructures have received much attention due to their prominent photocatalytic activity. The g-C3N4/Bi2WO6 and g-C3N4/Bi2MoO6 heterostructures, which follow a typical hetero-junction charge transfer...

  9. How Mg2+ ion and water network affect the stability and structure of non-Watson-Crick base pairs in E. coli loop E of 5S rRNA: a molecular dynamics and reference interaction site model (RISM) study. (United States)

    Shanker, Sudhanshu; Bandyopadhyay, Pradipta


    The non-Watson-Crick (non-WC) base pairs of Escherichia coli loop E of 5S rRNA are stabilized by Mg 2+ ions through water-mediated interaction. It is important to know the synergic role of Mg 2+ and the water network surrounding Mg 2+ in stabilizing the non-WC base pairs of RNA. For this purpose, free energy change of the system is calculated using molecular dynamics (MD) simulation as Mg 2+ is pulled from RNA, which causes disturbance of the water network. It was found that Mg 2+ remains hexahydrated unless it is close to or far from RNA. In the pentahydrated form, Mg 2+ interacts directly with RNA. Water network has been identified by two complimentary methods; MD followed by a density-based clustering algorithm and three-dimensional-reference interaction site model. These two methods gave similar results. Identification of water network around Mg 2+ and non-WC base pairs gives a clue to the strong effect of water network on the stability of this RNA. Based on sequence analysis of all Eubacteria 5s rRNA, we propose that hexahydrated Mg 2+ is an integral part of this RNA and geometry of base pairs surrounding it adjust to accommodate the [Formula: see text]. Overall the findings from this work can help in understanding the basis of the complex structure and stability of RNA with non-WC base pairs.

  10. Treating sub-valence correlation effects in domain based pair natural orbital coupled cluster calculations: an out-of-the-box approach

    KAUST Repository

    Bistoni, Giovanni; Riplinger, Christoph; Minenkov, Yury; Cavallo, Luigi; Auer, Alexander A.; Neese, Frank


    The validity of the main approximations used in canonical and domain based pair natural orbital coupled cluster methods (CCSD(T) and DLPNO-CCSD(T), respectively) in standard chemical applications is discussed. In particular, we investigate the dependence of the results on the number of electrons included in the correlation treatment in frozen-core (FC) calculations and on the main threshold governing the accuracy of DLPNO all-electron (AE) calculations. Initially, scalar relativistic orbital energies for the ground state of the atoms from Li to Rn in the periodic table are calculated. An energy criterion is applied for determining the orbitals that can be excluded from the correlation treatment in FC coupled cluster calculations without significant loss of accuracy. The heterolytic dissociation energy (HDE) of a series of metal compounds (LiF, NaF, AlF3, CaF2, CuF, GaF3, YF3, AgF, InF3, HfF4 and AuF) is calculated at the canonical CCSD(T) level, and the dependence of the results on the number of correlated electrons is investigated. Although for many of the studied reactions sub-valence correlation effects contribute significantly to the HDE, the use of an energy criterion permits a conservative definition of the size of the core, allowing FC calculations to be performed in a black-box fashion while retaining chemical accuracy. A comparison of the CCSD and the DLPNO-CCSD methods in describing the core-core, core-valence and valence-valence components of the correlation energy is given. It is found that more conservative thresholds must be used for electron pairs containing at least one core electron in order to achieve high accuracy in AE DLPNO-CCSD calculations relative to FC calculations. With the new settings, the DLPNO-CCSD method reproduces canonical CCSD results in both AE and FC calculations with the same accuracy.

  11. Treating sub-valence correlation effects in domain based pair natural orbital coupled cluster calculations: an out-of-the-box approach

    KAUST Repository

    Bistoni, Giovanni


    The validity of the main approximations used in canonical and domain based pair natural orbital coupled cluster methods (CCSD(T) and DLPNO-CCSD(T), respectively) in standard chemical applications is discussed. In particular, we investigate the dependence of the results on the number of electrons included in the correlation treatment in frozen-core (FC) calculations and on the main threshold governing the accuracy of DLPNO all-electron (AE) calculations. Initially, scalar relativistic orbital energies for the ground state of the atoms from Li to Rn in the periodic table are calculated. An energy criterion is applied for determining the orbitals that can be excluded from the correlation treatment in FC coupled cluster calculations without significant loss of accuracy. The heterolytic dissociation energy (HDE) of a series of metal compounds (LiF, NaF, AlF3, CaF2, CuF, GaF3, YF3, AgF, InF3, HfF4 and AuF) is calculated at the canonical CCSD(T) level, and the dependence of the results on the number of correlated electrons is investigated. Although for many of the studied reactions sub-valence correlation effects contribute significantly to the HDE, the use of an energy criterion permits a conservative definition of the size of the core, allowing FC calculations to be performed in a black-box fashion while retaining chemical accuracy. A comparison of the CCSD and the DLPNO-CCSD methods in describing the core-core, core-valence and valence-valence components of the correlation energy is given. It is found that more conservative thresholds must be used for electron pairs containing at least one core electron in order to achieve high accuracy in AE DLPNO-CCSD calculations relative to FC calculations. With the new settings, the DLPNO-CCSD method reproduces canonical CCSD results in both AE and FC calculations with the same accuracy.

  12. Accommodation of an N-(deoxyguanosin-8-yl)-2-acetylaminofluorene adduct in the active site of human DNA polymerase ι: Hoogsteen or Watson-Crick base pairing?† (United States)

    Donny-Clark, Kerry; Shapiro, Robert; Broyde, Suse


    Bypass across DNA lesions by specialized polymerases is essential for maintenance of genomic stability. Human DNA polymerase ι (polι) is a bypass polymerase of the Y family. Crystal structures of polι suggest that Hoogsteen base pairing is employed to bypass minor groove DNA lesions, placing them on the spacious major groove side of the enzyme. Primer extension studies have shown that polι is also capable of error-free nucleotide incorporation opposite the bulky major groove adduct N-(deoxyguanosin-8-yl)-2-acetyl-aminofluorene (dG-AAF). We present molecular dynamics simulations and free energy calculations suggesting that Watson-Crick base pairing could be employed in polι for bypass of dG-AAF. In polι with Hoogsteen paired dG-AAF the bulky AAF moiety would reside on the cramped minor groove side of the template. The Hoogsteen-capable conformation distorts the active site, disrupting interactions necessary for error-free incorporation of dC opposite the lesion. Watson-Crick pairing places the AAF rings on the spacious major groove side, similar to the position of minor groove adducts observed with Hoogsteen pairing. Watson-Crick paired structures show a well-ordered active site, with a near reaction-ready ternary complex. Thus our results suggest that polι would utilize the same spacious region for lesion bypass of both major and minor groove adducts. Therefore, purine adducts with bulk on the minor groove side would use Hoogsteen pairing, while adducts with the bulky lesion on the major groove side would utilize Watson-Crick base pairing as indicated by our MD simulations for dG-AAF. This suggests the possibility of an expanded role for polι in lesion bypass. PMID:19072536

  13. Mesoscopic pairing without superconductivity (United States)

    Hofmann, Johannes


    We discuss pairing signatures in mesoscopic nanowires with a variable attractive pairing interaction. Depending on the wire length, density, and interaction strength, these systems realize a simultaneous bulk-to-mesoscopic and BCS-BEC crossover, which we describe in terms of the parity parameter that quantifies the odd-even energy difference and generalizes the bulk Cooper pair binding energy to mesoscopic systems. We show that the parity parameter can be extracted from recent measurements of conductance oscillations in SrTiO3 nanowires by Cheng et al. [Nature (London) 521, 196 (2015), 10.1038/nature14398], where it marks the critical magnetic field that separates pair and single-particle currents. Our results place the experiment in the fluctuation-dominated mesoscopic regime on the BCS side of the crossover.

  14. Application of Powell's analogy for the prediction of vortex-pairing sound in a low-Mach number jet based on time-resolved planar and tomographic PIV

    NARCIS (Netherlands)

    Violato, D.; Bryon, K.; Moore, P.; Scarano, F.


    This paper describes an experimental investigation by time-resolved planar and tomographic PIV on the sound production mechanism of vortex pairing of a transitional water-jet flow at Re=5000. The shear layer is characterized by axisymmetric vortex rings which undergo pairing with a varicose mode.

  15. Normal-Mode Analysis of Circular DNA at the Base-Pair Level. 2. Large-Scale Configurational Transformation of a Naturally Curved Molecule. (United States)

    Matsumoto, Atsushi; Tobias, Irwin; Olson, Wilma K


    Fine structural and energetic details embedded in the DNA base sequence, such as intrinsic curvature, are important to the packaging and processing of the genetic material. Here we investigate the internal dynamics of a 200 bp closed circular molecule with natural curvature using a newly developed normal-mode treatment of DNA in terms of neighboring base-pair "step" parameters. The intrinsic curvature of the DNA is described by a 10 bp repeating pattern of bending distortions at successive base-pair steps. We vary the degree of intrinsic curvature and the superhelical stress on the molecule and consider the normal-mode fluctuations of both the circle and the stable figure-8 configuration under conditions where the energies of the two states are similar. To extract the properties due solely to curvature, we ignore other important features of the double helix, such as the extensibility of the chain, the anisotropy of local bending, and the coupling of step parameters. We compare the computed normal modes of the curved DNA model with the corresponding dynamical features of a covalently closed duplex of the same chain length constructed from naturally straight DNA and with the theoretically predicted dynamical properties of a naturally circular, inextensible elastic rod, i.e., an O-ring. The cyclic molecules with intrinsic curvature are found to be more deformable under superhelical stress than rings formed from naturally straight DNA. As superhelical stress is accumulated in the DNA, the frequency, i.e., energy, of the dominant bending mode decreases in value, and if the imposed stress is sufficiently large, a global configurational rearrangement of the circle to the figure-8 form takes place. We combine energy minimization with normal-mode calculations of the two states to decipher the configurational pathway between the two states. We also describe and make use of a general analytical treatment of the thermal fluctuations of an elastic rod to characterize the

  16. Research on a Nonlinear Robust Adaptive Control Method of the Elbow Joint of a Seven-Function Hydraulic Manipulator Based on Double-Screw-Pair Transmission

    Directory of Open Access Journals (Sweden)

    Gaosheng Luo


    Full Text Available A robust adaptive control method with full-state feedback is proposed based on the fact that the elbow joint of a seven-function hydraulic manipulator with double-screw-pair transmission features the following control characteristics: a strongly nonlinear hydraulic system, parameter uncertainties susceptible to temperature and pressure changes of the external environment, and unknown outer disturbances. Combined with the design method of the back-stepping controller, the asymptotic stability of the control system in the presence of disturbances from uncertain systematic parameters and unknown external disturbances was demonstrated using Lyapunov stability theory. Based on the elbow joint of the seven-function master-slave hydraulic manipulator for the 4500 m Deep-Sea Working System as the research subject, a comparative study was conducted using the control method presented in this paper for unknown external disturbances. Simulations and experiments of different unknown outer disturbances showed that (1 the proposed controller could robustly track the desired reference trajectory with satisfactory dynamic performance and steady accuracy and that (2 the modified parameter adaptive laws could also guarantee that the estimated parameters are bounded.

  17. Theoretical study on the structure, stability, and electronic properties of the guanine-Zn-cytosine base pair in M-DNA

    International Nuclear Information System (INIS)

    Fuentes-Cabrera, Miguel A.; Sumpter, Bobby G.; Sponer, Judit; Sponer, Jiri; Petit, Leon; Wells, Jack C.


    M-DNA is a type of metalated DNA that forms at high pH and in the presence of Zn, Ni, and Co, with the metals placed in between each base pair, as in G-Zn-C. Experiments have found that M-DNA could be a promising candidate for a variety of nanotechnological applications, as it is speculated that the metal d-states enhance the conductivity, but controversy still clouds these findings. In this paper, we carry out a comprehensive ab initio study of eight G-Zn-C models in the gas phase to help discern the structure and electronic properties of Zn-DNA. Specifically, we study whether a model prefers to be planar and has electronic properties that correlate with Zn-DNA having a metallic-like conductivity. Out of all the studied models, there is only one which preserves its planarity upon full geometry optimization. Nevertheless, starting from this model, one can deduce a parallel Zn-DNA architecture only. This duplex would contain the imino proton, in contrast to what has been proposed experimentally. Among the nonplanar models, there is one that requires less than 8 kcal/mol to flatten (both in gas and solvent conditions), and we propose that it is a plausible model for building an antiparallel duplex. In this duplex, the imino proton would be replaced by Zn, in accordance with experimental models. Neither planar nor nonplanar models have electronic properties that correlate with Zn-DNA having a metallic-like conductivity due to Zn d-states. To understand whether density functional theory (DFT) can describe appropriately the electronic properties of M-DNAs, we have investigated the electronic properties of G-Co-C base pairs. We have found that when self-interaction corrections (SIC) are not included the HOMO state contains Co d-levels, whereas these levels are moved below the HOMO state when SIC are considered. This result indicates that caution should be exercised when studying the electronic properties of M-DNAs with functionals that do not account for strong

  18. Determination of melamine in milk-based products and other food and beverage products by ion-pair liquid chromatography-tandem mass spectrometry

    Energy Technology Data Exchange (ETDEWEB)

    Ibanez, Maria; Sancho, Juan V. [Research Institute for Pesticides and Water, University Jaume I, E-12071, Castellon (Spain); Hernandez, Felix, E-mail: [Research Institute for Pesticides and Water, University Jaume I, E-12071, Castellon (Spain)


    This paper describes a fast method for the sensitive and selective determination of melamine in a wide range of food matrices, including several milk-based products. The method involves an extraction with aqueous 1% trichloroacetic acid before the injection of the 10-fold diluted extract into the liquid chromatography-electrospray tandem mass spectrometry (LC-ESI-MS/MS) system, using labelled melamine as the internal standard. As melamine is present in aqueous media in the cationic form, the chromatographic separation in reversed-phase LC requires the use of anionic ion-pair reagents, such as tridecafluoroheptanoic acid (THFA). This allows a satisfactory chromatographic retention and peak shape in all the types of food samples investigated. The method has been validated in six food matrices (biscuit, dry pasta and four milk-based products) by means of recovery experiments in samples spiked at 1 and 5 mg kg{sup -1}. Average recoveries (n = 5) ranged from 77% to 100%, with excellent precision (RSDs lower than 5%) and limits of detection between 0.01 and 0.1 mg kg{sup -1}. In addition, accuracy and robustness of the method was proven in different soya-based matrices by means of quality control (QC) sample analysis. QC recoveries, at 1 and 2.5 mg kg{sup -1}, were satisfactory, ranging from 79% to 110%. The method developed in this work has been applied to the determination of melamine in different types of food samples. All detections were confirmed by acquiring two MS/MS transitions (127 > 85 for quantification; 127 > 68 for confirmation) and comparing their ion intensity ratio with that of reference standards. Accuracy of the method was also assessed by applying it to a milk-based product and a baking mix material as part of an EU proficiency test, in which highly satisfactory results were obtained.

  19. Determination of melamine in milk-based products and other food and beverage products by ion-pair liquid chromatography-tandem mass spectrometry

    International Nuclear Information System (INIS)

    Ibanez, Maria; Sancho, Juan V.; Hernandez, Felix


    This paper describes a fast method for the sensitive and selective determination of melamine in a wide range of food matrices, including several milk-based products. The method involves an extraction with aqueous 1% trichloroacetic acid before the injection of the 10-fold diluted extract into the liquid chromatography-electrospray tandem mass spectrometry (LC-ESI-MS/MS) system, using labelled melamine as the internal standard. As melamine is present in aqueous media in the cationic form, the chromatographic separation in reversed-phase LC requires the use of anionic ion-pair reagents, such as tridecafluoroheptanoic acid (THFA). This allows a satisfactory chromatographic retention and peak shape in all the types of food samples investigated. The method has been validated in six food matrices (biscuit, dry pasta and four milk-based products) by means of recovery experiments in samples spiked at 1 and 5 mg kg -1 . Average recoveries (n = 5) ranged from 77% to 100%, with excellent precision (RSDs lower than 5%) and limits of detection between 0.01 and 0.1 mg kg -1 . In addition, accuracy and robustness of the method was proven in different soya-based matrices by means of quality control (QC) sample analysis. QC recoveries, at 1 and 2.5 mg kg -1 , were satisfactory, ranging from 79% to 110%. The method developed in this work has been applied to the determination of melamine in different types of food samples. All detections were confirmed by acquiring two MS/MS transitions (127 > 85 for quantification; 127 > 68 for confirmation) and comparing their ion intensity ratio with that of reference standards. Accuracy of the method was also assessed by applying it to a milk-based product and a baking mix material as part of an EU proficiency test, in which highly satisfactory results were obtained.

  20. ADAP-GC 3.0: Improved Peak Detection and Deconvolution of Co-eluting Metabolites from GC/TOF-MS Data for Metabolomics Studies. (United States)

    Ni, Yan; Su, Mingming; Qiu, Yunping; Jia, Wei; Du, Xiuxia


    ADAP-GC is an automated computational pipeline for untargeted, GC/MS-based metabolomics studies. It takes raw mass spectrometry data as input and carries out a sequence of data processing steps including construction of extracted ion chromatograms, detection of chromatographic peak features, deconvolution of coeluting compounds, and alignment of compounds across samples. Despite the increased accuracy from the original version to version 2.0 in terms of extracting metabolite information for identification and quantitation, ADAP-GC 2.0 requires appropriate specification of a number of parameters and has difficulty in extracting information on compounds that are in low concentration. To overcome these two limitations, ADAP-GC 3.0 was developed to improve both the robustness and sensitivity of compound detection. In this paper, we report how these goals were achieved and compare ADAP-GC 3.0 against three other software tools including ChromaTOF, AnalyzerPro, and AMDIS that are widely used in the metabolomics community.

  1. ADAP-GC 3.0: Improved Peak Detection and Deconvolution of Co-eluting Metabolites from GC/TOF-MS Data for Metabolomics Studies (United States)

    Ni, Yan; Su, Mingming; Qiu, Yunping; Jia, Wei


    ADAP-GC is an automated computational pipeline for untargeted, GC-MS-based metabolomics studies. It takes raw mass spectrometry data as input and carries out a sequence of data processing steps including construction of extracted ion chromatograms, detection of chromatographic peak features, deconvolution of co-eluting compounds, and alignment of compounds across samples. Despite the increased accuracy from the original version to version 2.0 in terms of extracting metabolite information for identification and quantitation, ADAP-GC 2.0 requires appropriate specification of a number of parameters and has difficulty in extracting information of compounds that are in low concentration. To overcome these two limitations, ADAP-GC 3.0 was developed to improve both the robustness and sensitivity of compound detection. In this paper, we report how these goals were achieved and compare ADAP-GC 3.0 against three other software tools including ChromaTOF, AnalyzerPro, and AMDIS that are widely used in the metabolomics community. PMID:27461032

  2. Immunotherapy for Prostate Cancer with Gc Protein-Derived Macrophage-Activating Factor, GcMAF1


    Yamamoto, Nobuto; Suyama, Hirofumi; Yamamoto, Nobuyuki


    Serum Gc protein (known as vitamin D3-binding protein) is the precursor for the principal macrophage-activating factor (MAF). The MAF precursor activity of serum Gc protein of prostate cancer patients was lost or reduced because Gc protein was deglycosylated by serum α-N-acetylgalactosaminidase (Nagalase) secreted from cancerous cells. Therefore, macrophages of prostate cancer patients having deglycosylated Gc protein cannot be activated, leading to immunosuppression. Stepwise treatment of pu...

  3. [Paired kidneys in transplant]. (United States)

    Regueiro López, Juan C; Leva Vallejo, Manuel; Prieto Castro, Rafael; Anglada Curado, Francisco; Vela Jiménez, Francisco; Ruiz García, Jesús


    Many factors affect the graft and patient survival on the renal transplant outcome. These factors depend so much of the recipient and donor. We accomplished a study trying to circumvent factors that depend on the donor. We checked the paired kidneys originating of a same donor cadaver. We examined the risk factors in the evolution and follow-up in 278 couples of kidney transplant. We describe their differences, significance, the graft and patient survival, their functionality in 3 and 5 years and the risk factors implicated in their function. We study immunogenic and no immunogenic variables, trying to explain the inferior results in the grafts that are established secondly. We regroup the paired kidneys in those that they did not show paired initial function within the same couple. The results yield a discreet deterioration in the graft and patient survival for second group establish, superior creatinina concentration, without obtaining statistical significance. The Cox regression study establishes the early rejection (inferior to three months) and DR incompatibility values like risk factors. This model of paired kidneys would be able to get close to best-suited form for risk factors analysis in kidney transplant from cadaver donors, if more patients examine themselves in the same way. The paired kidneys originating from the same donor do not show the same function in spite of sharing the same conditions of the donor and perioperative management.

  4. Field-based Evaluation of a Novel SPME-GC-MS Method for Investigation of Below-ground Interaction between Brassica Roots and Larvae of Cabbage Root Fly, Delia radicum L. (United States)

    Deasy, William; Shepherd, Tom; Alexander, Colin J; Birch, A Nicholas E; Evans, K Andrew


    Collection of volatiles from plant roots poses technical challenges due to difficulties accessing the soil environment without damaging the roots. To validate a new non-invasive method for passive sampling of root volatiles in situ, from plants grown under field conditions, using solid phase micro-extraction (SPME). SPME fibres were inserted into perforated polytetrafluoroethene (PTFE) tubes positioned in the soil next to broccoli plants for collection of root volatiles pre- and post-infestation with Delia radicum larvae. After sample analysis by gas chromatography-mass spectrometry (GC-MS), principal component analysis (PCA) was applied to determine differences in the profiles of volatiles between samples. GC-MS analysis revealed that this method can detect temporal changes in root volatiles emitted before and after Delia radicum damage. PCA showed that samples collected pre- and post-infestation were compositionally different due to the presence of root volatiles induced by D. radicum feeding. Sulphur containing compounds, in particular, accounted for the differences observed. Root volatiles emission patterns post-infestation are thought to follow the feeding and developmental progress of larvae. This study shows that volatiles released by broccoli roots can be collected in situ using SPME fibres within perforated PTFE tubes under field conditions. Plants damaged by Delia radicum larvae could be distinguished from plants sampled pre-infestation and soil controls on the basis of larval feeding-induced sulphur-containing volatiles. These results show that this new method is a powerful tool for non-invasive sampling of root volatiles below-ground. Copyright © 2016 John Wiley & Sons, Ltd. Copyright © 2016 John Wiley & Sons, Ltd.

  5. A Single Base Pair Mutation Encoding a Premature Stop Codon in the MIS type II receptor is Responsible for Canine Persistent Müllerian Duct Syndrome (United States)

    Wu, Xiufeng; Wan, Shengqin; Pujar, Shashikant; Haskins, Mark E.; Schlafer, Donald H.; Lee, Mary M.; Meyers-Wallen, Vicki N.


    Müllerian Inhibiting Substance (MIS), a secreted glycoprotein in the Transforming Growth Factor-beta (TGF-beta) family of growth factors, mediates regression of the Müllerian ducts during embryonic sex differentiation in males. In Persistent Müllerian Duct Syndrome (PMDS), rather than undergoing involution, the Müllerian ducts persist in males, giving rise to the uterus, Fallopian tubes, and upper vagina. Genetic defects in MIS or its receptor (MISRII) have been identified in patients with PMDS. The phenotype in the canine model of PMDS derived from the miniature schnauzer breed is strikingly similar to that of human patients. In this model, PMDS is inherited as a sex-limited autosomal recessive trait. Previous studies indicated that a defect in the MIS receptor or its downstream signaling pathway was likely to be causative of the canine syndrome. In this study the canine PMDS phenotype and clinical sequelae are described in detail. Affected and unaffected members of this pedigree are genotyped, identifying a single base pair substitution in MISRII that introduces a stop codon in exon 3. The homozygous mutation terminates translation at 80 amino acids, eliminating much of the extracellular domain and the entire transmembrane and intracellular signaling domains. Findings in this model may enable insights to be garnered from correlation of detailed clinical descriptions with molecular defects, which are not otherwise possible in the human syndrome. PMID:18723470

  6. Alteration of intersubunit acid–base pair interactions at the quasi-threefold axis of symmetry of Cucumber mosaic virus disrupts aphid vector transmission

    International Nuclear Information System (INIS)

    Bricault, Christine A.; Perry, Keith L.


    In the atomic model of Cucumber mosaic virus (CMV), six amino acid residues form stabilizing salt bridges between subunits of the asymmetric unit at the quasi-threefold axis of symmetry. To evaluate the effects of these positions on virion stability and aphid vector transmissibility, six charged amino acid residues were individually mutated to alanine. All of the six engineered viruses were viable and exhibited near wild type levels of virion stability in the presence of urea. Aphid vector transmissibility was nearly or completely eliminated in the case of four of the mutants; two mutants demonstrated intermediate aphid transmissibility. For the majority of the engineered mutants, second-site mutations were observed following aphid transmission and/or mechanical passaging, and one restored transmission rates to that of the wild type. CMV capsids tolerate disruption of acid–base pairing interactions at the quasi-threefold axis of symmetry, but these interactions are essential for maintaining aphid vector transmissibility. - Highlights: ► Amino acids between structural subunits of Cucumber mosaic virus affect vector transmission. ► Mutant structural stability was retained, while aphid vector transmissibility was disrupted. ► Spontaneous, second-site mutations restored aphid vector transmissibility

  7. TALEN-mediated single-base-pair editing identification of an intergenic mutation upstream of BUB1B as causative of PCS (MVA) syndrome (United States)

    Ochiai, Hiroshi; Miyamoto, Tatsuo; Kanai, Akinori; Hosoba, Kosuke; Sakuma, Tetsushi; Kudo, Yoshiki; Asami, Keiko; Ogawa, Atsushi; Watanabe, Akihiro; Kajii, Tadashi; Yamamoto, Takashi; Matsuura, Shinya


    Cancer-prone syndrome of premature chromatid separation with mosaic variegated aneuploidy [PCS (MVA) syndrome] is a rare autosomal recessive disorder characterized by constitutional aneuploidy and a high risk of childhood cancer. We previously reported monoallelic mutations in the BUB1B gene (encoding BUBR1) in seven Japanese families with the syndrome. No second mutation was found in the opposite allele of any of the families studied, although a conserved BUB1B haplotype and a decreased transcript were identified. To clarify the molecular pathology of the second allele, we extended our mutational search to a candidate region surrounding BUB1B. A unique single nucleotide substitution, G > A at ss802470619, was identified in an intergenic region 44 kb upstream of a BUB1B transcription start site, which cosegregated with the disorder. To examine whether this is the causal mutation, we designed a transcription activator-like effector nuclease–mediated two-step single-base pair editing strategy and biallelically introduced this substitution into cultured human cells. The cell clones showed reduced BUB1B transcripts, increased PCS frequency, and MVA, which are the hallmarks of the syndrome. We also encountered a case of a Japanese infant with PCS (MVA) syndrome carrying a homozygous single nucleotide substitution at ss802470619. These results suggested that the nucleotide substitution identified was the causal mutation of PCS (MVA) syndrome. PMID:24344301

  8. A FRET-based probe for epidermal growth factor receptor bound non-covalently to a pair of synthetic amphipathic helixes

    International Nuclear Information System (INIS)

    Itoh, Reina E.; Kurokawa, Kazuo; Fujioka, Aki; Sharma, Alok; Mayer, Bruce J.; Matsuda, Michiyuki


    Epidermal growth factor (EGF) receptor plays a pivotal role in a variety of cellular functions, such as proliferation, differentiation, and migration. To monitor the EGF receptor (EGFR) activity in living cells, we developed a probe for EGFR activity based on the principle of fluorescence resonance energy transfer (FRET). Previously, we developed a probe designated as Picchu (Phosphorylation indicator of the CrkII chimeric unit), which detects the tyrosine phosphorylation of the CrkII adaptor protein. We used a pair of synthetic amphipathic helixes, WinZipA2 and WinZipB1, to bind Picchu non-covalently to the carboxyl-terminus of the EGFR. Using this modified probe named Picchu-Z, the activity of EGFR was followed in EGF-stimulated Cos7 cells. We found that a high level of tyrosine phosphorylation of Picchu-Z probe remained after endocytosis until the point when the EGFR was translocated to the perinuclear region. These findings are in agreement with the previously reported 'signaling endosome' model. Furthermore, by pulse stimulation with EGF and by acute ablation of EGFR activity with AG1478, it was suggested that the phosphorylation of Picchu-Z probe, and probably the phosphorylation of EGFR also, underwent a rapid equilibrium (τ 1/2 < 2 min) between the phosphorylated and dephosphorylated states in the presence of EGF

  9. The Importance of Electron Correlation on Stacking Interaction of Adenine-Thymine Base-Pair Step in B-DNA: A Quantum Monte Carlo Study. (United States)

    Hongo, Kenta; Cuong, Nguyen Thanh; Maezono, Ryo


    We report fixed-node diffusion Monte Carlo (DMC) calculations of stacking interaction energy between two adenine(A)-thymine(T) base pairs in B-DNA (AA:TT), for which reference data are available, obtained from a complete basis set estimate of CCSD(T) (coupled-cluster with singles, doubles, and perturbative triples). We consider four sets of nodal surfaces obtained from self-consistent field calculations and examine how the different nodal surfaces affect the DMC potential energy curves of the AA:TT molecule and the resulting stacking energies. We find that the DMC potential energy curves using the different nodes look similar to each other as a whole. We also benchmark the performance of various quantum chemistry methods, including Hartree-Fock (HF) theory, second-order Møller-Plesset perturbation theory (MP2), and density functional theory (DFT). The DMC and recently developed DFT results of the stacking energy reasonably agree with the reference, while the HF, MP2, and conventional DFT methods give unsatisfactory results.

  10. Assessment of the Coordination Ability of Sustainable Social-Ecological Systems Development Based on a Set Pair Analysis: A Case Study in Yanchi County, China

    Directory of Open Access Journals (Sweden)

    Ya Wang


    Full Text Available Sandy desertification is one of the most severe ecological problems in the world. Essentially, it is land degradation caused by discordance in the Social-Ecological Systems (SES. The ability to coordinate SES is a principal characteristic of regional sustainable development and a key factor in desertification control. This paper directly and comprehensively evaluates the ability to coordinate SES in the desertification reversal process. Assessment indicators and standards for SES have been established using statistical data and materials from government agencies. We applied a coordinated development model based on Identical-Discrepancy-Contrary (IDC situational ranking of a Set Pair Analysis (SPA to analyze the change in Yanchi County’s coordination ability since it implemented the grazing prohibition policy. The results indicated that Yanchi County was basically in the secondary grade of the national sustainable development level, and the subsystems’ development trend was relatively stable. Coordinate ability increased from 0.686 in 2003 to 0.957 in 2014 and experienced “weak coordination to basic coordination to high coordination” development processes. We concluded that drought, the grazing prohibition dilemma and the ecological footprint were key factors impeding the coordination of SES development in this area. These findings should provide information about desertification control and ecological policy implementation to guarantee sustainable rehabilitation.

  11. Alteration of intersubunit acid–base pair interactions at the quasi-threefold axis of symmetry of Cucumber mosaic virus disrupts aphid vector transmission

    Energy Technology Data Exchange (ETDEWEB)

    Bricault, Christine A. [Department of Plant Pathology and Plant-Microbe Biology, 334 Plant Science Building, Cornell University, Ithaca, NY 14850 (United States); Perry, Keith L., E-mail: [Department of Plant Pathology and Plant-Microbe Biology, 334 Plant Science Building, Cornell University, Ithaca, NY 14850 (United States)


    In the atomic model of Cucumber mosaic virus (CMV), six amino acid residues form stabilizing salt bridges between subunits of the asymmetric unit at the quasi-threefold axis of symmetry. To evaluate the effects of these positions on virion stability and aphid vector transmissibility, six charged amino acid residues were individually mutated to alanine. All of the six engineered viruses were viable and exhibited near wild type levels of virion stability in the presence of urea. Aphid vector transmissibility was nearly or completely eliminated in the case of four of the mutants; two mutants demonstrated intermediate aphid transmissibility. For the majority of the engineered mutants, second-site mutations were observed following aphid transmission and/or mechanical passaging, and one restored transmission rates to that of the wild type. CMV capsids tolerate disruption of acid–base pairing interactions at the quasi-threefold axis of symmetry, but these interactions are essential for maintaining aphid vector transmissibility. - Highlights: ► Amino acids between structural subunits of Cucumber mosaic virus affect vector transmission. ► Mutant structural stability was retained, while aphid vector transmissibility was disrupted. ► Spontaneous, second-site mutations restored aphid vector transmissibility.

  12. A single base-pair change in 2009 H1N1 hemagglutinin increases human receptor affinity and leads to efficient airborne viral transmission in ferrets.

    Directory of Open Access Journals (Sweden)

    Akila Jayaraman


    Full Text Available The 2009 H1N1 influenza A virus continues to circulate among the human population as the predominant H1N1 subtype. Epidemiological studies and airborne transmission studies using the ferret model have shown that the transmission efficiency of 2009 H1N1 viruses is lower than that of previous seasonal strains and the 1918 pandemic H1N1 strain. We recently correlated this reduced transmission efficiency to the lower binding affinity of the 2009 H1N1 hemagglutinin (HA to α2→6 sialylated glycan receptors (human receptors. Here we report that a single point mutation (Ile219→Lys; a base pair change in the glycan receptor-binding site (RBS of a representative 2009 H1N1 influenza A virus, A/California/04/09 or CA04/09, quantitatively increases its human receptor-binding affinity. The increased human receptor-affinity is in the same range as that of the HA from highly transmissible seasonal and 1918 pandemic H1N1 viruses. Moreover, a 2009 H1N1 virus carrying this mutation in the RBS (generated using reverse genetics transmits efficiently in ferrets by respiratory droplets thereby reestablishing our previously observed correlation between human receptor-binding affinity and transmission efficiency. These findings are significant in the context of monitoring the evolution of the currently circulating 2009 H1N1 viruses.

  13. Novel Validated RP-HPLC Method for Bendamustine Hydrochloride Based on Ion-pair Chromatography: Application in Determining Infusion Stability and Pharmacokinetics. (United States)

    Singh, Yuvraj; Chandrashekar, Anumandla; Pawar, Vivek K; Saravanakumar, Veeramuthu; Meher, Jayagopal; Raval, Kavit; Singh, Pankaj; Kumar, R Dinesh; Chourasia, Manish K


    Ion pair chromatography was used for quantifying bendamustine hydrochloride (BH) in its marketed vial. The permissive objective was to investigate time duration for which highly susceptible drug content of the marketed vial remained stable after reconstitution. However, the method could also be used to measure extremely low levels of drug in rat plasma and a pharmacokinetic study was accordingly conducted to further showcase method's applicability. Optimized separation was achieved on C-18 Purospher ® STAR (250 mm × 4.6 mm, 5 μm particle size) column. Mobile phase flowing at 1.5 mL/min consisted of 5 mM sodium salt of octane sulfonic acid dissolved in methanol, water and glacial acetic acid (55:45:0.075) maintained at pH 6. Detection was carried out at 233 nm with BH eluting after 7.8 min. Validation parameters were determined as per ICH guidelines. Limit of detection and limit of quantification were found to be 0.1 µg/mL and 0.33 µg/mL, respectively. The recoveries were 98-102% in bulk and 85-91% in plasma. The developed method was specific for BH, and utilized for assessing its short-term stability in physiologic solvents and forced degradation products in acid, base, oxidative, light and temperature induced stress environments. © The Author 2016. Published by Oxford University Press. All rights reserved. For Permissions, please email:

  14. Cyclic AMP regulation of the human glycoprotein hormone α-subunit gene is mediated by an 18-base-pair element

    International Nuclear Information System (INIS)

    Silver, B.J.; Bokar, J.A.; Virgin, J.B.; Vallen, E.A.; Milsted, A.; Nilson, J.H.


    cAMP regulates transcription of the gene encoding the α-subunit of human chorionic gonadotropin (hCG) in the choriocarcinoma cells (BeWo). To define the sequences required for regulation by cAMP, the authors inserted fragments from the 5' flanking region of the α-subunit gene into a test vector containing the simian virus 40 early promoter (devoid of its enhancer) linked to the bacterial chloramphenicol acetyltransferase (CAT) gene. Results from transient expression assays in BeWo cells indicated that a 1500-base-pair (bp) fragment conferred cAMP responsiveness on the CAT gene regardless of position or orientation of the insert relative to the viral promoter. A subfragment extending from position -169 to position -100 had the same effect on cAMP-induced expression. Furthermore, the entire stimulatory effect could be achieved with an 18-bp synthetic oligodeoxynucleotide corresponding to a direct repeat between position -146 and -111. In the absence of cAMP, the α-subunit 5' flanking sequence also enhanced transcription from the simian virus 40 early promoter. They localized this enhancer activity to the same -169/-100 fragment containing the cAMP response element. The 18-bp element alone, however, had no effect on basal expression. Thus, this short DNA sequence serves as a cAMP response element and also functions independently of other promoter-regulatory elements located in the 5' flanking sequence of the α-subunit gene

  15. Detecting cm-scale hot spot over 24-km-long single-mode fiber by using differential pulse pair BOTDA based on double-peak spectrum. (United States)

    Diakaridia, Sanogo; Pan, Yue; Xu, Pengbai; Zhou, Dengwang; Wang, Benzhang; Teng, Lei; Lu, Zhiwei; Ba, Dexin; Dong, Yongkang


    In distributed Brillouin optical fiber sensor when the length of the perturbation to be detected is much smaller than the spatial resolution that is defined by the pulse width