Time-resolved functional analysis of acute impairment of frataxin expression in an inducible cell model of Friedreich ataxia

Directory of Open Access Journals (Sweden)

Dörte Poburski

2016-05-01

Full Text Available Friedreich ataxia is a neurodegenerative disease caused by a GAA triplet repeat expansion in the first intron of the frataxin gene, which results in reduced expression levels of the corresponding protein. Despite numerous animal and cellular models, therapeutic options that mechanistically address impaired frataxin expression are lacking. Here, we have developed a new mammalian cell model employing the Cre/loxP recombination system to induce a homozygous or heterozygous frataxin knockout in mouse embryonic fibroblasts. Induction of Cre-mediated disruption by tamoxifen was successfully tested on RNA and protein levels. After loss of frataxin protein, cell division, aconitase activity and oxygen consumption rates were found to be decreased, while ROS production was increased in the homozygous state. By contrast, in the heterozygous state no such changes were observed. A time-resolved analysis revealed the loss of aconitase activity as an initial event after induction of complete frataxin deficiency, followed by secondarily elevated ROS production and a late increase in iron content. Initial impairments of oxygen consumption and ATP production were found to be compensated in the late state and seemed to play a minor role in Friedreich ataxia pathophysiology. In conclusion and as predicted from its proposed role in iron sulfur cluster (ISC biosynthesis, disruption of frataxin primarily causes impaired function of ISC-containing enzymes, whereas other consequences, including elevated ROS production and iron accumulation, appear secondary. These parameters and the robustness of the newly established system may additionally be used for a time-resolved study of pharmacological candidates in a HTS manner.

An AAV9 coding for frataxin clearly improved the symptoms and prolonged the life of Friedreich ataxia mouse models

Directory of Open Access Journals (Sweden)

Catherine Gérard

2014-01-01

Full Text Available Friedreich ataxia (FRDA is a genetic disease due to increased repeats of the GAA trinucleotide in intron 1 of the frataxin gene. This mutation leads to a reduced expression of frataxin. We have produced an adeno-associated virus (AAV9 coding for human frataxin (AAV9-hFXN. This AAV was delivered by intraperitoneal (IP injection to young conditionally knockout mice in which the frataxin gene had been knocked-out in some tissues during embryogenesis by breeding them with mice expressing the Cre recombinase gene under the muscle creatine kinase (MCK or the neuron-specific enolase (NSE promoter. In the first part of the study, different doses of virus were tested from 6 × 1011 v.p. to 6 × 109 v.p. in NSE-cre mice and all leading to an increase in life spent of the mice. The higher and the lower dose were also tested in MCK-cre mice. A single administration of the AAV9-hFXN at 6 × 1011 v.p. more than doubled the life of these mice. In fact the MCK-cre mice treated with the AAV9-hFXN were sacrificed for further molecular investigations at the age of 29 weeks without apparent symptoms. Echography analysis of the heart function clearly indicated that the cardiac systolic function was better preserved in the mice that received 6 × 1011 v.p. of AAV9-hFXN. The human frataxin protein was detected by ELISA in the heart, brain, muscles, kidney, and liver with the higher dose of virus in both mouse models. Thus, gene therapy with an AAV9-hFXN is a potential treatment of FRDA.

Frataxin Is Localized to Both the Chloroplast and Mitochondrion and Is Involved in Chloroplast Fe-S Protein Function in Arabidopsis.

Directory of Open Access Journals (Sweden)

Valeria R Turowski

Full Text Available Frataxin plays a key role in eukaryotic cellular iron metabolism, particularly in mitochondrial heme and iron-sulfur (Fe-S cluster biosynthesis. However, its precise role has yet to be elucidated. In this work, we studied the subcellular localization of Arabidopsis frataxin, AtFH, using confocal microscopy, and found a novel dual localization for this protein. We demonstrate that plant frataxin is targeted to both the mitochondria and the chloroplast, where it may play a role in Fe-S cluster metabolism as suggested by functional studies on nitrite reductase (NIR and ferredoxin (Fd, two Fe-S containing chloroplast proteins, in AtFH deficient plants. Our results indicate that frataxin deficiency alters the normal functioning of chloroplasts by affecting the levels of Fe, chlorophyll, and the photosynthetic electron transport chain in this organelle.

SAXS and stability studies of iron-induced oligomers of bacterial frataxin CyaY.

Directory of Open Access Journals (Sweden)

Mostafa Fekry

Full Text Available Frataxin is a highly conserved protein found in both prokaryotes and eukaryotes. It is involved in several central functions in cells, which include iron delivery to biochemical processes, such as heme synthesis, assembly of iron-sulfur clusters (ISC, storage of surplus iron in conditions of iron overload, and repair of ISC in aconitase. Frataxin from different organisms has been shown to undergo iron-dependent oligomerization. At least two different classes of oligomers, with different modes of oligomer packing and stabilization, have been identified. Here, we continue our efforts to explore the factors that control the oligomerization of frataxin from different organisms, and focus on E. coli frataxin CyaY. Using small-angle X-ray scattering (SAXS, we show that higher iron-to-protein ratios lead to larger oligomeric species, and that oligomerization proceeds in a linear fashion as a results of iron oxidation. Native mass spectrometry and online size-exclusion chromatography combined with SAXS show that a dimer is the most common form of CyaY in the presence of iron at atmospheric conditions. Modeling of the dimer using the SAXS data confirms the earlier proposed head-to-tail packing arrangement of monomers. This packing mode brings several conserved acidic residues into close proximity to each other, creating an environment for metal ion binding and possibly even mineralization. Together with negative-stain electron microscopy, the experiments also show that trimers, tetramers, pentamers, and presumably higher-order oligomers may exist in solution. Nano-differential scanning fluorimetry shows that the oligomers have limited stability and may easily dissociate at elevated temperatures. The factors affecting the possible oligomerization mode are discussed.

Pepsin homologues in bacteria

Directory of Open Access Journals (Sweden)

Bateman Alex

2009-09-01

Full Text Available Abstract Background Peptidase family A1, to which pepsin belongs, had been assumed to be restricted to eukaryotes. The tertiary structure of pepsin shows two lobes with similar folds and it has been suggested that the gene has arisen from an ancient duplication and fusion event. The only sequence similarity between the lobes is restricted to the motif around the active site aspartate and a hydrophobic-hydrophobic-Gly motif. Together, these contribute to an essential structural feature known as a psi-loop. There is one such psi-loop in each lobe, and so each lobe presents an active Asp. The human immunodeficiency virus peptidase, retropepsin, from peptidase family A2 also has a similar fold but consists of one lobe only and has to dimerize to be active. All known members of family A1 show the bilobed structure, but it is unclear if the ancestor of family A1 was similar to an A2 peptidase, or if the ancestral retropepsin was derived from a half-pepsin gene. The presence of a pepsin homologue in a prokaryote might give insights into the evolution of the pepsin family. Results Homologues of the aspartic peptidase pepsin have been found in the completed genomic sequences from seven species of bacteria. The bacterial homologues, unlike those from eukaryotes, do not possess signal peptides, and would therefore be intracellular acting at neutral pH. The bacterial homologues have Thr218 replaced by Asp, a change which in renin has been shown to confer activity at neutral pH. No pepsin homologues could be detected in any archaean genome. Conclusion The peptidase family A1 is found in some species of bacteria as well as eukaryotes. The bacterial homologues fall into two groups, one from oceanic bacteria and one from plant symbionts. The bacterial homologues are all predicted to be intracellular proteins, unlike the eukaryotic enzymes. The bacterial homologues are bilobed like pepsin, implying that if no horizontal gene transfer has occurred the duplication

Frataxin mRNA Isoforms in FRDA Patients and Normal Subjects: Effect of Tocotrienol Supplementation

Directory of Open Access Journals (Sweden)

Provvidenza Maria Abruzzo

2013-01-01

Full Text Available Friedreich’s ataxia (FRDA is caused by deficient expression of the mitochondrial protein frataxin involved in the formation of iron-sulphur complexes and by consequent oxidative stress. We analysed low-dose tocotrienol supplementation effects on the expression of the three splice variant isoforms (FXN-1, FXN-2, and FXN-3 in mononuclear blood cells of FRDA patients and healthy subjects. In FRDA patients, tocotrienol leads to a specific and significant increase of FXN-3 expression while not affecting FXN-1 and FXN-2 expression. Since no structural and functional details were available for FNX-2 and FXN-3, 3D models were built. FXN-1, the canonical isoform, was then docked on the human iron-sulphur complex, and functional interactions were computed; when FXN-1 was replaced by FXN-2 or FNX-3, we found that the interactions were maintained, thus suggesting a possible biological role for both isoforms in human cells. Finally, in order to evaluate whether tocotrienol enhancement of FXN-3 was mediated by an increase in peroxisome proliferator-activated receptor-γ (PPARG, PPARG expression was evaluated. At a low dose of tocotrienol, the increase of FXN-3 expression appeared to be independent of PPARG expression. Our data show that it is possible to modulate the mRNA expression of the minor frataxin isoforms and that they may have a functional role.

The import and function of diatom and plant frataxins in the mitochondrion of Trypanosoma brucei

Czech Academy of Sciences Publication Activity Database

Long, Shaojun; Vávrová, Zuzana; Lukeš, Julius

2008-01-01

Roč. 162, č. 1 (2008), s. 100-104 ISSN 0166-6851 R&D Projects: GA AV ČR IAA500960705; GA MŠk LC07032; GA MŠk 2B06129; GA ČR GA204/06/1558 Institutional research plan: CEZ:AV0Z60220518 Keywords : frataxin * mitochondrion * Trypanosoma * diatom * evolutionary conservativeness * import Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 2.951, year: 2008

An exploration of Glb1 Homologue AntibodyLevels in Children at Increased Risk for Type 1 Diabetes mellitus

Science.gov (United States)

Simpson, M.; Mojibian, M.; Barriga, K.; Scott, F.W.; Fasano, A.; Rewers, M.; Norris, J.M.

2010-01-01

Aims To determine whether Glb1 homologue antibodies are associated with islet autoimmunity (IA) in children at increased risk for type 1 diabetes (T1D), and to investigate their relation with putative environmental correlates of T1D. Methods We selected a sample from the Diabetes Autoimmunity Study in the Young (DAISY), a prospective study of children at increased risk for T1D. Cases were those who were positive for insulin, glutamic acid decarboxylase (GAD), or insulinoma-associated antigen-2 (IA-2) autoantibodies on two consecutive visits and either diagnosed with diabetes mellitus or still autoantibody positive when selected. Controls were from the same increased risk group, of similar age as the cases but negative for autoantibodies. Sera from 91 IA cases and 82 controls were analyzed in a blinded manner for immunoglobulin G (IgG) antibodies to Glb1 homologue by ELISA. Results Adjusting for family history of T1D and HLA-DR4 positivity, Glb1 homologue antibodies were not associated with IA case status (OR: 1.01, 95% CI: 0.99 – 1.03). Adjusting for age, family history of T1D, and HLA-DR4 positivity, Glb1 homologue antibody levels were inversely associated with breast-feeding duration (beta = −0.08, p = 0.001) and directly associated with current intake of foods containing gluten (beta = 0.24, p = 0.007) in IA cases but not in controls. Zonulin, a biomarker of gut permeability, was directly associated with Glb1 homologue antibody levels in cases (beta = 0.73, p = 0.003) but not in controls. Conclusion Differences in correlates of Glb1 antibodies in IA cases and controls suggest an underlying difference in mucosal immune response. PMID:19622083

Liver Growth Factor (LGF Upregulates Frataxin Protein Expression and Reduces Oxidative Stress in Friedreich’s Ataxia Transgenic Mice

Directory of Open Access Journals (Sweden)

Lucía Calatrava-Ferreras

2016-12-01

Full Text Available Friedreich’s ataxia (FA is a severe disorder with autosomal recessive inheritance that is caused by the abnormal expansion of GAA repeat in intron 1 of FRDA gen. This alteration leads to a partial silencing of frataxin transcription, causing a multisystem disorder disease that includes neurological and non-neurological damage. Recent studies have proven the effectiveness of neurotrophic factors in a number of neurodegenerative diseases. Therefore, we intend to determine if liver growth factor (LGF, which has a demonstrated antioxidant and neuroprotective capability, could be a useful therapy for FA. To investigate the potential therapeutic activity of LGF we used transgenic mice of the FXNtm1MknTg (FXNYG8Pook strain. In these mice, intraperitoneal administration of LGF (1.6 μg/mouse exerted a neuroprotective effect on neurons of the lumbar spinal cord and improved cardiac hypertrophy. Both events could be the consequence of the increment in frataxin expression induced by LGF in spinal cord (1.34-fold and heart (1.2-fold. LGF also upregulated by 2.6-fold mitochondrial chain complex IV expression in spinal cord, while in skeletal muscle it reduced the relation oxidized glutathione/reduced glutathione. Since LGF partially restores motor coordination, we propose LGF as a novel factor that may be useful in the treatment of FA.

Three TFL1 homologues regulate floral initiation in the biofuel plant Jatropha curcas

Science.gov (United States)

Li, Chaoqiong; Fu, Qiantang; Niu, Longjian; Luo, Li; Chen, Jianghua; Xu, Zeng-Fu

2017-01-01

Recent research revealed that TERMINAL FLOWER 1 (TFL1) homologues are involved in the critical developmental process of floral initiation in several plant species. In this study, the functions of three putative TFL1 homologues (JcTFL1a, JcTFL1b and JcTFL1c) in the biofuel plant Jatropha curcas were analysed using the transgenic approach. JcTFL1b and JcTFL1c, but not JcTFL1a, could complement the TFL1 function and rescue early flowering and determinate inflorescence phenotype in tfl1-14 Arabidopsis mutant, thus suggesting that JcTFL1b and JcTFL1c may be homologues of TFL1. Transgenic Jatropha overexpressing JcTFL1a, JcTFL1b or JcTFL1c showed late flowering, whereas only JcTFL1b and JcTFL1c overexpression delayed flowering in transgenic Arabidopsis. JcTFL1b-RNAi transgenic Jatropha consistently exhibited moderately early flowering phenotype. JcFT and JcAP1 were significantly downregulated in transgenic Jatropha overexpressing JcTFL1a, JcTFL1b or JcTFL1c, which suggested that the late flowering phenotype of these transgenic Jatropha may result from the repressed expression of JcFT and JcAP1. Our results indicate that these three JcTFL1 genes play redundant roles in repressing flowering in Jatropha. PMID:28225036

Cloning and characterization of maize ZmSPK1, a homologue to ...

African Journals Online (AJOL)

hope&shola

2006-03-15

Mar 15, 2006 ... homologue to nonfermenting1-related protein kinase2 ... RT-PCR analysis showed that the ZmSPK1 expression was induced by mannitol, salt and ... MAPKKK in which each component is activated by .... It has been one of the main ... Protein kinase ATP-binding region signature is shown in gray box.

Crystal structure of a bacterial homologue of glucose transporters GLUT1-4.

Science.gov (United States)

Sun, Linfeng; Zeng, Xin; Yan, Chuangye; Sun, Xiuyun; Gong, Xinqi; Rao, Yu; Yan, Nieng

2012-10-18

Glucose transporters are essential for metabolism of glucose in cells of diverse organisms from microbes to humans, exemplified by the disease-related human proteins GLUT1, 2, 3 and 4. Despite rigorous efforts, the structural information for GLUT1-4 or their homologues remains largely unknown. Here we report three related crystal structures of XylE, an Escherichia coli homologue of GLUT1-4, in complex with d-xylose, d-glucose and 6-bromo-6-deoxy-D-glucose, at resolutions of 2.8, 2.9 and 2.6 Å, respectively. The structure consists of a typical major facilitator superfamily fold of 12 transmembrane segments and a unique intracellular four-helix domain. XylE was captured in an outward-facing, partly occluded conformation. Most of the important amino acids responsible for recognition of D-xylose or d-glucose are invariant in GLUT1-4, suggesting functional and mechanistic conservations. Structure-based modelling of GLUT1-4 allows mapping and interpretation of disease-related mutations. The structural and biochemical information reported here constitutes an important framework for mechanistic understanding of glucose transporters and sugar porters in general.

TOR1 and TOR2 are structurally and functionally similar but not identical phosphatidylinositol kinase homologues in yeast

OpenAIRE

Helliwell, S. B.; Wagner, P.; Kunz, J.; Deuter-Reinhard, M.; Henriquez, R.; Hall, M. N.

1994-01-01

The Saccharomyces cerevisiae genes TOR1 and TOR2 were originally identified by mutations that confer resistance to the immunosuppressant rapamycin. TOR2 was previously shown to encode an essential 282-kDa phosphatidylinositol kinase (PI kinase) homologue. The TOR1 gene product is also a large (281 kDa) PI kinase homologue, with 67% identity to TOR2. TOR1 is not essential, but a TOR1 TOR2 double disruption uniquely confers a cell cycle (G1) arrest as does exposure to rapamycin; disruption of T...

Iron-induced oligomerization of human FXN^81-210 and bacterial CyaY frataxin and the effect of iron chelators

DEFF Research Database (Denmark)

Ahlgren, Eva Christina; Fekry, Mostafa; Wiemann, Mathias

2017-01-01

long forms, FXN42-210 and FXN56-210, have been shown to spontaneously form oligomeric particles stabilized by the extended N-terminal sequence. The short variant FXN81-210, on other hand, has only been observed in the monomeric state. However, a highly homologous E. coli frataxin CyaY, which also lacks...

A lesion mimic phenotype in tomato obtained by isolating and silencing an Lls1 homologue

NARCIS (Netherlands)

Spassieva, S; Hille, J

Lesion mimic phenotypes serve as a tool to study the regulation of cell death in plants. In order to obtain a tomato lesion mimic phenotype, we used the conservation of the lethal leaf spot 1 (Lls1) genes between plant species. The tomato Lls1 homologue was cloned, sequenced and analyzed. It showed

Genetic analysis of the spindle checkpoint genes san-1, mdf-2, bub-3 and the CENP-F homologues hcp-1 and hcp-2 in Caenorhabditis elegans

Directory of Open Access Journals (Sweden)

Moore Landon L

2008-02-01

Full Text Available Abstract Background The spindle checkpoint delays the onset of anaphase until all sister chromatids are aligned properly at the metaphase plate. To investigate the role san-1, the MAD3 homologue, has in Caenorhabditis elegans embryos we used RNA interference (RNAi to identify genes synthetic lethal with the viable san-1(ok1580 deletion mutant. Results The san-1(ok1580 animal has low penetrating phenotypes including an increased incidence of males, larvae arrest, slow growth, protruding vulva, and defects in vulva morphogenesis. We found that the viability of san-1(ok1580 embryos is significantly reduced when HCP-1 (CENP-F homologue, MDF-1 (MAD-1 homologue, MDF-2 (MAD-2 homologue or BUB-3 (predicted BUB-3 homologue are reduced by RNAi. Interestingly, the viability of san-1(ok1580 embryos is not significantly reduced when the paralog of HCP-1, HCP-2, is reduced. The phenotype of san-1(ok1580;hcp-1(RNAi embryos includes embryonic and larval lethality, abnormal organ development, and an increase in abnormal chromosome segregation (aberrant mitotic nuclei, anaphase bridging. Several of the san-1(ok1580;hcp-1(RNAi animals displayed abnormal kinetochore (detected by MPM-2 and microtubule structure. The survival of mdf-2(RNAi;hcp-1(RNAi embryos but not bub-3(RNAi;hcp-1(RNAi embryos was also compromised. Finally, we found that san-1(ok1580 and bub-3(RNAi, but not hcp-1(RNAi embryos, were sensitive to anoxia, suggesting that like SAN-1, BUB-3 has a functional role as a spindle checkpoint protein. Conclusion Together, these data suggest that in the C. elegans embryo, HCP-1 interacts with a subset of the spindle checkpoint pathway. Furthermore, the fact that san-1(ok1580;hcp-1(RNAi animals had a severe viability defect whereas in the san-1(ok1580;hcp-2(RNAi and san-1(ok1580;hcp-2(ok1757 animals the viability defect was not as severe suggesting that hcp-1 and hcp-2 are not completely redundant.

Biodegradation of diesel fuel by a microbial consortium in the presence of 1-alkoxymethyl-2-methyl-5-hydroxypyridinium chloride homologues

DEFF Research Database (Denmark)

Chrzanowski, L; Stasiewicz, M; Owsianiak, Mikolaj

2009-01-01

hypothesize that in the presence of diesel fuel low-water-soluble ionic liquids may become more toxic to hydrocarbon-degrading microorganisms. In this study the influence of 1-alkoxymethyl-2-methyl-5-hydroxypyridinium chloride homologues (side-chain length from C-3 to C-18) on biodegradation of diesel fuel...... by a bacterial consortium was investigated. Whereas test performed for the consortium cultivated on disodium succinate showed that toxicity of the investigated ionic liquids decreased with increase in side-chain length, only higher homologues (C-8-C-18) caused a decrease in diesel fuel biodegradation......, respectively. We conclude that in the presence of hydrocarbons acting as a solvent, the increased bioavailability of hydrophobic homologues is responsible for the decrease in biodegradation efficiency of diesel fuel....

Characterization of four RecQ homologues from rice (Oryza sativa L. cv. Nipponbare)

International Nuclear Information System (INIS)

Saotome, Ai; Kimura, Seisuke; Mori, Yoko; Uchiyama, Yukinobu; Morohashi, Kengo; Sakaguchi, Kengo

2006-01-01

The RecQ family of DNA helicases is conserved throughout the biological kingdoms. In this report, we have characterized four RecQ homologues clearly expressed in rice. OsRecQ1, OsRecQ886, and OsRecQsim expressions were strongly detected in meristematic tissues. Transcription of the OsRecQ homologues was differentially induced by several types of DNA-damaging agents. The expression of four OsRecQ homologues was induced by MMS and bleomycin. OsRecQ1 and OsRecQ886 were induced by H 2 O 2 , and MitomycinC strongly induced the expression of OsRecQ1. Transient expression of OsRecQ/GFP fusion proteins demonstrated that OsRecQ2 and OsRecQ886 are found in nuclei, whereas OsRecQ1 and OsRecQsim are found in plastids. Neither OsRecQ1 nor OsRecQsim are induced by light. These results indicate that four of the RecQ homologues have different and specific functions in DNA repair pathways, and that OsRecQ1 and OsRecQsim may not involve in plastid differentiation but different aspects of a plastid-specific DNA repair system

Conservation of Oxidative Protein Stabilization in an Insect Homologue of Parkinsonism-Associated Protein DJ-1

Energy Technology Data Exchange (ETDEWEB)

Lin, Jiusheng; Prahlad, Janani; Wilson, Mark A. (UNL)

2012-08-21

DJ-1 is a conserved, disease-associated protein that protects against oxidative stress and mitochondrial damage in multiple organisms. Human DJ-1 contains a functionally essential cysteine residue (Cys106) whose oxidation is important for regulating protein function by an unknown mechanism. This residue is well-conserved in other DJ-1 homologues, including two (DJ-1{alpha} and DJ-1{beta}) in Drosophila melanogaster. Because D. melanogaster is a powerful model system for studying DJ-1 function, we have determined the crystal structure and impact of cysteine oxidation on Drosophila DJ-1{beta}. The structure of D. melanogaster DJ-1{beta} is similar to that of human DJ-1, although two important residues in the human protein, Met26 and His126, are not conserved in DJ-1{beta}. His126 in human DJ-1 is substituted with a tyrosine in DJ-1{beta}, and this residue is not able to compose a putative catalytic dyad with Cys106 that was proposed to be important in the human protein. The reactive cysteine in DJ-1 is oxidized readily to the cysteine-sulfinic acid in both flies and humans, and this may regulate the cytoprotective function of the protein. We show that the oxidation of this conserved cysteine residue to its sulfinate form (Cys-SO{sub 2{sup -}}) results in considerable thermal stabilization of both Drosophila DJ-1{beta} and human DJ-1. Therefore, protein stabilization is one potential mechanism by which cysteine oxidation may regulate DJ-1 function in vivo. More generally, most close DJ-1 homologues are likely stabilized by cysteine-sulfinic acid formation but destabilized by further oxidation, suggesting that they are biphasically regulated by oxidative modification.

Novel frataxin isoforms may contribute to the pathological mechanism of Friedreich ataxia.

Directory of Open Access Journals (Sweden)

Haiyan Xia

Full Text Available Friedreich ataxia (FRDA is an inherited neurodegenerative disease caused by frataxin (FXN deficiency. The nervous system and heart are the most severely affected tissues. However, highly mitochondria-dependent tissues, such as kidney and liver, are not obviously affected, although the abundance of FXN is normally high in these tissues. In this study we have revealed two novel FXN isoforms (II and III, which are specifically expressed in affected cerebellum and heart tissues, respectively, and are functional in vitro and in vivo. Increasing the abundance of the heart-specific isoform III significantly increased the mitochondrial aconitase activity, while over-expression of the cerebellum-specific isoform II protected against oxidative damage of Fe-S cluster-containing aconitase. Further, we observed that the protein level of isoform III decreased in FRDA patient heart, while the mRNA level of isoform II decreased more in FRDA patient cerebellum compared to total FXN mRNA. Our novel findings are highly relevant to understanding the mechanism of tissue-specific pathology in FRDA.

Homologue Pairing in Flies and Mammals: Gene Regulation When Two Are Involved

Directory of Open Access Journals (Sweden)

Manasi S. Apte

2012-01-01

Full Text Available Chromosome pairing is usually discussed in the context of meiosis. Association of homologues in germ cells enables chromosome segregation and is necessary for fertility. A few organisms, such as flies, also pair their entire genomes in somatic cells. Most others, including mammals, display little homologue pairing outside of the germline. Experimental evidence from both flies and mammals suggests that communication between homologues contributes to normal genome regulation. This paper will contrast the role of pairing in transmitting information between homologues in flies and mammals. In mammals, somatic homologue pairing is tightly regulated, occurring at specific loci and in a developmentally regulated fashion. Inappropriate pairing, or loss of normal pairing, is associated with gene misregulation in some disease states. While homologue pairing in flies is capable of influencing gene expression, the significance of this for normal expression remains unknown. The sex chromosomes pose a particularly interesting situation, as females are able to pair X chromosomes, but males cannot. The contribution of homologue pairing to the biology of the X chromosome will also be discussed.

Toxicities of emamectin benzoate homologues and photodegradates to Lepidoptera.

Science.gov (United States)

Argentine, Joseph A; Jansson, Richard K; Starner, Van R; Halliday, W Ross

2002-12-01

The toxicity of a number of emamectin benzoate homologues and photodegradates to five species of Lepidoptera was investigated using diet and foliar bioassays. The emamectin benzoate homologues B1a and B1b were equally toxic in the diet and foliar assays to Spodoptera exigua (Hübner), Heliothis virescens (F.), Tricoplusia ni (Hübner), and Spodoptera frugiperda (J. E. Smith), within each of these species. Plutella xylostella (L.) was the most sensitive species to emamectin benzoate. The AB1a photodegradate of emamectin benzoate was as toxic as the parent compound in the diet assay. However, in the foliage assay AB1a was 4.4-fold less toxic to S. exigua than the parent compound. The MFB1a photodegradate of emamectin benzoate was as toxic as the parent compound to P. xylostella, and 3.1 to 6.2 times as toxic as the parent compound to the other species in the diet assay. The order of toxicity of the photodegradates were AB1a > MFB1a > FAB1a > 8,9-Z-MAB1a > PAB1a.

Over-expression, purification and characterization of an Asc-1 homologue from Gloeobacter violaceus

DEFF Research Database (Denmark)

Wang, Xiaole; Hald, Helle; Ernst, Heidi Asschenfeldt

2010-01-01

The human alanine-serine-cysteine transporter 1 (Asc-1) belongs to the slc7a family of solute carrier transporters. Asc-1 mediates the uptake of D-serine in an exchanger-type fashion, coupling the process to the release of alanine and cysteine. Among the bacterial Asc-1 homologues, one transporter...... of auto-induction was crucial for obtaining high yields and purity of the transporter. The transporter was purified with yields in the range of 0.2-0.4 mg per L culture and eluted in a single peak from a size-exclusion column. The circular dichroism spectrum revealed a folded and apparently all...

Identification of aldehyde oxidase 1 and aldehyde oxidase homologue 1 as dioxin-inducible genes

International Nuclear Information System (INIS)

Rivera, Steven P.; Choi, Hyun Ho; Chapman, Brett; Whitekus, Michael J.; Terao, Mineko; Garattini, Enrico; Hankinson, Oliver

2005-01-01

Aldehyde oxidases are a family of highly related molybdo-flavoenzymes acting upon a variety of compounds of industrial and medical importance. We have identified aldehyde oxidase 1 (AOX1) as a 2,3,7,8-tetrachlorodibenzo-p-dioxin (dioxin) inducible gene in the mouse hepatoma cell line Hepa-1. AOX1 mRNA levels were not increased by dioxin in mutant derivatives of the Hepa-1 cell line lacking either functional aryl hydrocarbon receptor (AHR) or aryl hydrocarbon receptor nuclear translocator (ARNT) proteins, thus demonstrating that transcriptional induction of AOX1 in response to dioxin occurs through the AHR pathway. Dioxin induction of AOX1 mRNA was also observed in mouse liver. In addition, levels of AOX1 protein as well as those of aldehyde oxidase homologue 1 (AOH1), a recently identified homolog of AOX1, were elevated in mouse liver in response to dioxin. Employing an aldehyde oxidase specific substrate, AOX1/AOH1 activity was shown to be induced by dioxin in mouse liver. This activity was inhibited by a known inhibitor of aldehyde oxidases, and eliminated by including tungstate in the mouse diet, which is known to lead to inactivation of molybdoflavoenzymes, thus confirming that the enzymatic activity was attributable to AOX1/AOH1. Our observations thus identify two additional xenobiotic metabolizing enzymes induced by dioxin

Homologue Structure of the SLAC1 Anion Channel for Closing Stomata in Leaves

Energy Technology Data Exchange (ETDEWEB)

Y Chen; L Hu; M Punta; R Bruni; B Hillerich; B Kloss; B Rost; J Love; S Siegelbaum; W Hendrickson

2011-12-31

The plant SLAC1 anion channel controls turgor pressure in the aperture-defining guard cells of plant stomata, thereby regulating the exchange of water vapour and photosynthetic gases in response to environmental signals such as drought or high levels of carbon dioxide. Here we determine the crystal structure of a bacterial homologue (Haemophilus influenzae) of SLAC1 at 1.20 {angstrom} resolution, and use structure-inspired mutagenesis to analyse the conductance properties of SLAC1 channels. SLAC1 is a symmetrical trimer composed from quasi-symmetrical subunits, each having ten transmembrane helices arranged from helical hairpin pairs to form a central five-helix transmembrane pore that is gated by an extremely conserved phenylalanine residue. Conformational features indicate a mechanism for control of gating by kinase activation, and electrostatic features of the pore coupled with electrophysiological characteristics indicate that selectivity among different anions is largely a function of the energetic cost of ion dehydration.

The monomeric orphan nuclear receptor Schistosoma mansoni Ftz-F1 dimerizes specifically and functionally with the schistosome RXR homologue, SmRXR1

International Nuclear Information System (INIS)

Bertin, Benjamin; Caby, Stephanie; Oger, Frederik; Sasorith, Souphatta; Wurtz, Jean-Marie; Pierce, Raymond J.

2005-01-01

In an attempt to understand development and differentiation processes of the parasitic blood fluke Schistosoma mansoni, several members of the nuclear receptor superfamily were cloned, including SmFtz-F1 (S. mansoni Fushi Tarazu-factor 1). The Ftz-F1 nuclear receptor subfamily only contains orphan receptors that bind to their response element as monomers. Whereas SmFtz-F1 displays these basic functional properties, we have identified an original and specific interaction between SmFtz-F1 and the schistosome RXR homologue, SmRXR1. The mammalian two-hybrid assay showed that the D, E, and F domains of SmFtz-F1 were capable of interacting specifically with the E domain of SmRXR1 but not with that of mouse RXRα. Using three-dimensional LBD homology modelling and structure-guided mutagenesis, we were able to demonstrate the essential role of exposed residues located in the dimerization interfaces of both receptors in the maintenance of the interaction. Cotransfection experiments with constructions encoding full-length nuclear receptors show that SmRXR1 potentiates the transcriptional activity of SmFtz-F1 from various promoters. Nevertheless, the lack of identification of a dimeric response element for this SmFtz-F1/SmRXR1 heterodimer seems to indicate a 'tethering' mechanism. Thus, our results suggest for the first time that a member of the Ftz-F1 family could heterodimerize functionally with a homologue of the universal heterodimerization partner of nuclear receptors. This unique property confirms that SmFtz-F1 may be involved in the development and differentiation of schistosome-specific structures

Temperature-sensitive defects of the GSP1gene, yeast Ran homologue, activate the Tel1-dependent pathway

International Nuclear Information System (INIS)

Hayashi, Naoyuki; Murakami, Seishi; Tsurusaki, Susumu; Nagaura, Zen-ichiro; Oki, Masaya; Nishitani, Hideo; Kobayashi, Masahiko; Shimizu, Hiroko; Yamamoto, Ken-ichi; Nishimoto, Takeharu

2007-01-01

RanGTPase is involved in many cellular processes. It functions in nuclear-cytosolic transport and centrosome formation. Ran also localizes to chromatin as RCC1 does, its guanine nucleotide exchange factor, but Ran's function on chromatin is not known. We found that gsp1, a temperature-sensitive mutant of GSP1, a Saccharomyces cerevisiae Ran homologue, suppressed the hydroxyurea (HU) and ultra violet (UV) sensitivities of the mec1 mutant. In UV-irradiated mec1 gsp1 cells, Rad53 was phosphorylated despite the lack of Mec1. This suppression depended on the TEL1 gene, given that the triple mutant, mec1 gsp1 tel1, was unable to grow. The gsp1 mutations also suppressed the HU sensitivity of the rad9 mutant in a Tel1-dependent manner, but not the HU sensitivity of the rad53 mutant. These results indicated that Rad53 was activated by the Tel1 pathway in mec1 gsp1 cells, suggesting that Gsp1 helps regulate the role switching the ATM family kinases Mec1 and Tel1

Single-Crystal X-Ray Diffraction Studies of Homologues in the Series nBa(Nb,Zr)O 3+3 mNbO with n=2, 3, 4, 5 and m=1

Science.gov (United States)

Nilsson, G.; Svensson, G.

2001-01-01

Single crystals of four homologues in the series nBa(Nb,Zr)O3+3mNbO, with n:m=2:1, 3:1, 4:1, and 5:1, were found in the reduced Ba-Nb-Zr-O system. Single-crystal X-ray diffraction data were collected for all the crystals. For all homologues the space group was found to be P4/mmm. The structures can be described as intergrowths of Ba(Nb,Zr)O3 perovskite and NbO slabs. The refined cell parameters and compositions of the 2:1, 3:1, and 4:1 homologues are a=4.1768(5) Å and c=12.269(2) Å for Ba2Nb4.5(1)Zr0.5(1)O9, a=4.1769(5) Å and c=16.493(3) Å for Ba3+δNb4.8(2)-δ Zr1.2(2)O12-δ (δ=0.098(4)), and a=4.1747(6) Å and c= 20.619(4) Å for Ba4+δNb5.1(4)-δZr1.9(4)O15-δ (δ=0.270(9)). The refined cell parameters of the 5:1 homologue are a=4.1727(3) Å and c=24.804(3) Å. Zr replaces Nb only in the NbO6 octahedra found in the perovskite slabs.

Homologue Pairing in Flies and Mammals: Gene Regulation When Two Are Involved

OpenAIRE

Apte, Manasi S.; Meller, Victoria H.

2011-01-01

Chromosome pairing is usually discussed in the context of meiosis. Association of homologues in germ cells enables chromosome segregation and is necessary for fertility. A few organisms, such as flies, also pair their entire genomes in somatic cells. Most others, including mammals, display little homologue pairing outside of the germline. Experimental evidence from both flies and mammals suggests that communication between homologues contributes to normal genome regulation. This paper will co...

The Molecular Bases of the Dual Regulation of Bacterial Iron Sulfur Cluster Biogenesis by CyaY and IscX

Directory of Open Access Journals (Sweden)

Salvatore Adinolfi

2018-02-01

Full Text Available IscX (or YfhJ is a protein of unknown function which takes part in the iron-sulfur cluster assembly machinery, a highly specialized and essential metabolic pathway. IscX binds to iron with low affinity and interacts with IscS, the desulfurase central to cluster assembly. Previous studies have suggested a competition between IscX and CyaY, the bacterial ortholog of frataxin, for the same binding surface of IscS. This competition could suggest a link between the two proteins with a functional significance. Using a hybrid approach based on nuclear magnetic resonance, small angle scattering and biochemical methods, we show here that IscX is a modulator of the inhibitory properties of CyaY: by competing for the same site on IscS, the presence of IscX rescues the rates of enzymatic cluster formation which are inhibited by CyaY. The effect is stronger at low iron concentrations, whereas it becomes negligible at high iron concentrations. These results strongly suggest the mechanism of the dual regulation of iron sulfur cluster assembly under the control of iron as the effector.

MicroRNA-15a finetunes the level of Delta-like 1 homologue (DLK1) in proliferating 3T3-L1 preadipocytes

DEFF Research Database (Denmark)

Andersen, Ditte C; Jensen, Charlotte H; Schneider, Mikael

2010-01-01

Delta like 1 homologue (Dlk1) exists in both transmembrane and soluble molecular forms, and is implicated in cellular growth and plays multiple roles in development, tissue regeneration, and cancer. Thus, DLK1 levels are critical for cell function, and abnormal DLK1 expression can be lethal...... increases with cell density, and peaks at the same stage where membrane DLK1(M) and soluble DLK1(S) are found at maximum levels. Remarkably, miR-15a represses the amount of all Dlk1 variants at the mRNA level but also the level of DLK1(M) protein while it increases the amount of DLK1(S) supporting a direct...... while increasing cell numbers, scenarios that were completely rescued by addition of purified DLK1(S). Our data thus imply that miR-15a regulates cell size and proliferation by fine-tuning Dlk1 among others, and further emphasize miR-15a and DLK1 levels to play important roles in growth signaling...

Contribution of polycomb homologues Bmi-1 and Mel-18 to medulloblastoma pathogenesis.

Science.gov (United States)

Wiederschain, Dmitri; Chen, Lin; Johnson, Brett; Bettano, Kimberly; Jackson, Dowdy; Taraszka, John; Wang, Y Karen; Jones, Michael D; Morrissey, Michael; Deeds, James; Mosher, Rebecca; Fordjour, Paul; Lengauer, Christoph; Benson, John D

2007-07-01

Bmi-1 and Mel-18 are structural homologues that belong to the Polycomb group of transcriptional regulators and are believed to stably maintain repression of gene expression by altering the state of chromatin at specific promoters. While a number of clinical and experimental observations have implicated Bmi-1 in human tumorigenesis, the role of Mel-18 in cancer cell growth has not been investigated. We report here that short hairpin RNA-mediated knockdown of either Bmi-1 or Mel-18 in human medulloblastoma DAOY cells results in the inhibition of proliferation, loss of clonogenic survival, anchorage-independent growth, and suppression of tumor formation in nude mice. Furthermore, overexpression of both Bmi-1 and Mel-18 significantly increases the clonogenic survival of Rat1 fibroblasts. In contrast, stable downregulation of Bmi-1 or Mel-18 alone does not affect the growth of normal human WI38 fibroblasts. Proteomics-based characterization of Bmi-1 and Mel-18 protein complexes isolated from cancer cells revealed substantial similarities in their respective compositions. Finally, gene expression analysis identified a number of cancer-relevant pathways that may be controlled by Bmi-1 and Mel-18 and also showed that these Polycomb proteins regulate a set of common gene targets. Taken together, these results suggest that Bmi-1 and Mel-18 may have overlapping functions in cancer cell growth.

Selected missense mutations impair frataxin processing in Friedreich ataxia.

Science.gov (United States)

Clark, Elisia; Butler, Jill S; Isaacs, Charles J; Napierala, Marek; Lynch, David R

2017-08-01

Frataxin (FXN) is a highly conserved mitochondrial protein. Reduced FXN levels cause Friedreich ataxia, a recessive neurodegenerative disease. Typical patients carry GAA repeat expansions on both alleles, while a subgroup of patients carry a missense mutation on one allele and a GAA repeat expansion on the other. Here, we report that selected disease-related FXN missense mutations impair FXN localization, interaction with mitochondria processing peptidase, and processing. Immunocytochemical studies and subcellular fractionation were performed to study FXN import into the mitochondria and examine the mechanism by which mutations impair FXN processing. Coimmunoprecipitation was performed to study the interaction between FXN and mitochondrial processing peptidase. A proteasome inhibitor was used to model traditional therapeutic strategies. In addition, clinical profiles of subjects with and without point mutations were compared in a large natural history study. FXN I 154F and FXN G 130V missense mutations decrease FXN 81-210 levels compared with FXN WT , FXN R 165C , and FXN W 155R , but do not block its association with mitochondria. FXN I 154F and FXN G 130V also impair FXN maturation and enhance the binding between FXN 42-210 and mitochondria processing peptidase. Furthermore, blocking proteosomal degradation does not increase FXN 81-210 levels. Additionally, impaired FXN processing also occurs in fibroblasts from patients with FXN G 130V . Finally, clinical data from patients with FXN G 130V and FXN I 154F mutations demonstrates a lower severity compared with other individuals with Friedreich ataxia. These data suggest that the effects on processing associated with FXN G 130V and FXN I 154F mutations lead to higher levels of partially processed FXN, which may contribute to the milder clinical phenotypes in these patients.

Turning Escherichia coli into a Frataxin-Dependent Organism.

Directory of Open Access Journals (Sweden)

Béatrice Roche

2015-05-01

Full Text Available Fe-S bound proteins are ubiquitous and contribute to most basic cellular processes. A defect in the ISC components catalyzing Fe-S cluster biogenesis leads to drastic phenotypes in both eukaryotes and prokaryotes. In this context, the Frataxin protein (FXN stands out as an exception. In eukaryotes, a defect in FXN results in severe defects in Fe-S cluster biogenesis, and in humans, this is associated with Friedreich's ataxia, a neurodegenerative disease. In contrast, prokaryotes deficient in the FXN homolog CyaY are fully viable, despite the clear involvement of CyaY in ISC-catalyzed Fe-S cluster formation. The molecular basis of the differing importance in the contribution of FXN remains enigmatic. Here, we have demonstrated that a single mutation in the scaffold protein IscU rendered E. coli viability strictly dependent upon a functional CyaY. Remarkably, this mutation changed an Ile residue, conserved in prokaryotes at position 108, into a Met residue, conserved in eukaryotes. We found that in the double mutant IscUIM ΔcyaY, the ISC pathway was completely abolished, becoming equivalent to the ΔiscU deletion strain and recapitulating the drastic phenotype caused by FXN deletion in eukaryotes. Biochemical analyses of the "eukaryotic-like" IscUIM scaffold revealed that it exhibited a reduced capacity to form Fe-S clusters. Finally, bioinformatic studies of prokaryotic IscU proteins allowed us to trace back the source of FXN-dependency as it occurs in present-day eukaryotes. We propose an evolutionary scenario in which the current mitochondrial Isu proteins originated from the IscUIM version present in the ancestor of the Rickettsiae. Subsequent acquisition of SUF, the second Fe-S cluster biogenesis system, in bacteria, was accompanied by diminished contribution of CyaY in prokaryotic Fe-S cluster biogenesis, and increased tolerance to change in the amino acid present at the 108th position of the scaffold.

Monolayer structures of alkyl aldehydes: Odd-membered homologues

International Nuclear Information System (INIS)

Phillips, T.K.; Clarke, S.M.; Bhinde, T.; Castro, M.A.; Millan, C.; Medina, S.

2011-01-01

Crystalline monolayers of three aldehydes with an odd number of carbon atoms in the alkyl chain (C 7 , C 9 and C 11 ) at low coverages are observed by a combination of X-ray and neutron diffraction. Analysis of the diffraction data is discussed and possible monolayer crystal structures are proposed; although unique structures could not be ascertained for all molecules. We conclude that the structures are flat on the surface, with the molecules lying in the plane of the layer. The C 11 homologue is determined to have a plane group of either p2, pgb or pgg, and for the C 7 homologue the p2 plane group is preferred.

acn-1, a C. elegans homologue of ACE, genetically interacts with the let-7 microRNA and other heterochronic genes.

Science.gov (United States)

Metheetrairut, Chanatip; Ahuja, Yuri; Slack, Frank J

2017-10-02

The heterochronic pathway in C. elegans controls the relative timing of cell fate decisions during post-embryonic development. It includes a network of microRNAs (miRNAs), such as let-7, and protein-coding genes, such as the stemness factors, LIN-28 and LIN-41. Here we identified the acn-1 gene, a homologue of mammalian angiotensin-converting enzyme (ACE), as a new suppressor of the stem cell developmental defects of let-7 mutants. Since acn-1 null mutants die during early larval development, we used RNAi to characterize the role of acn-1 in C. elegans seam cell development, and determined its interaction with heterochronic factors, including let-7 and its downstream interactors - lin-41, hbl-1, and apl-1. We demonstrate that although RNAi knockdown of acn-1 is insufficient to cause heterochronic defects on its own, loss of acn-1 suppresses the retarded phenotypes of let-7 mutants and enhances the precocious phenotypes of hbl-1, though not lin-41, mutants. Conversely, the pattern of acn-1 expression, which oscillates during larval development, is disrupted by lin-41 mutants but not by hbl-1 mutants. Finally, we show that acn-1(RNAi) enhances the let-7-suppressing phenotypes caused by loss of apl-1, a homologue of the Alzheimer's disease-causing amyloid precursor protein (APP), while significantly disrupting the expression of apl-1 during the L4 larval stage. In conclusion, acn-1 interacts with heterochronic genes and appears to function downstream of let-7 and its target genes, including lin-41 and apl-1.

A Hexose Transporter Homologue Controls Glucose Repression in the Methylotrophic Yeast Hansenula polymorpha

NARCIS (Netherlands)

Stasyk, Oleh V.; Stasyk, Olena G.; Komduur, Janet; Veenhuis, Marten; Cregg, James M.; Sibirny, Andrei A.

2004-01-01

Peroxisome biogenesis and synthesis of peroxisomal enzymes in the methylotrophic yeast Hansenula polymorpha are under the strict control of glucose repression. We identified an H. polymorpha glucose catabolite repression gene (HpGCR1) that encodes a hexose transporter homologue. Deficiency in GCR1

An initial biochemical and cell biological characterization of the mammalian homologue of a central plant developmental switch, COP1

Directory of Open Access Journals (Sweden)

Wang Haiyang

2002-12-01

Full Text Available Abstract Background Constitutive photomorphogenic 1 (COP1 has been defined as a central regulator of photomorphogenic development in plants, which targets key transcription factors for proteasome-dependent degradation. Although COP1 mammalian homologue has been previously reported, its function and distribution in animal kingdom are not known. Results Here we report the characterization of full-length human and mouse COP1 cDNAs and the genomic structures of the COP1 genes from several different species. Mammalian COP1 protein binds to ubiquitinated proteins in vivo and is itself ubiquitinated. Furthermore, mammalian COP1 is predominately nuclear localized and exists primarily as a complex of over 700 kDa. Through mutagenesis studies, we have defined a leucine-rich nuclear export signal (NES within the coiled-coil domain of mammalian COP1 and a nuclear localization signal (NLS, which is composed of two clusters of positive-charged amino acids, bridged by the RING finger. Disruption of the RING finger structure abolishes the nuclear import, while deletion of the entire RING finger restores the nuclear import. Conclusions Our data suggest that mammalian COP1, similar to its plant homologue, may play a role in ubiquitination. Mammalian COP1 contains a classic leucine-rich NES and a novel bipartite NLS bridged by a RING finger domain. We propose a working model in which the COP1 RING finger functions as a structural scaffold to bring two clusters of positive-charged residues within spatial proximity to mimic a bipartite NLS. Therefore, in addition to its well-characterized role in ubiquitination, the RING finger domain may also play a structural role in nuclear import.

The effect of delta-like 1 homologue on the proliferation and odontoblastic differentiation in human dental pulp stem cells.

Science.gov (United States)

Qi, Shengcai; Yan, Yanhong; Wen, Yue; Li, Jialiang; Wang, Jing; Chen, Fubo; Tang, Xiaoshan; Shang, Guangwei; Xu, Yuanzhi; Wang, Raorao

2017-06-01

This study aimed to investigate the functions of delta-like homologue 1 (DLK1) in the proliferation and differentiation of human dental pulp stem cells (hDPSCs). Immunohistochemical analysis was used to determine the expression of alkaline phosphatase (ALP), dentin sialophosphoprotein (DSPP), DLK1, NOTCH1 and p-ERK1/2 in the mouse first maxillary molar. Recombinant lentivirus was constructed to overexpress DLK1 stably in hDPSCs. The cell viability and proliferation of hDPSCs were examined by CCK8 and EdU incorporation assay respectively. The odontoblastic differentiation of hDPSCs was determined by detection of ALPase activity assay, ALP and alizarin red staining and the expression of mineralization-related genes including ALP, DSPP and dental matrix protein. The mRNA and protein levels of DLK1 and p-ERK1/2 protein expression were detected. ERK inhibitor was used to test the differentiation effect of DLK1 on hDPSCs. Delta-like homologue 1 was highly expressed on the odontoblasts and dental pulp cells on the first maxillary molar; the expression of p-ERK1/2 is similar with the DLK1 in the same process. The expression level of DLK1 increased significantly after the odontoblastic induction of hDPSCs. DLK1 overexpression increased the proliferation ability of hDPSCs and inhibited odontoblastic differentiation of hDPSCs. The protein level of p-ERK1/2 significantly increased in hDPSCs/dlk1-oe group. ERK signalling pathway inhibitor reversed the odontoblastic differentiation effects of DLK1 on hDPSCs. The proliferation of hDPSCs was promoted after DLK1 overexpression. DLK1 inhibited the odontoblastic differentiation of hDPSCs, which maybe through ERK signalling pathway. © 2017 John Wiley & Sons Ltd.

The expression of the rice (Oryza sativa L.) homologue of Snm1 is induced by DNA damages

International Nuclear Information System (INIS)

Kimura, Seisuke; Saotome, Ai; Uchiyama, Yukinobu; Mori, Yoko; Tahira, Yasue; Sakaguchi, Kengo

2005-01-01

We isolated and characterized the rice homologue of the DNA repair gene Snm1 (OsSnm1). The length of the cDNA was 1862 bp; the open reading frame encoded a predicted product of 485 amino acid residues with a molecular mass of 53.2 kDa. The OsSnm1 protein contained the conserved β-lactamase domain in its internal region. OsSnm1 was expressed in all rice organs. The expression was induced by MMS, H 2 O 2 , and mitomycin C, but not by UV. Transient expression of an OsSnm1/GFP fusion protein in onion epidermal cells revealed the localization of OsSnm1 to the nucleus. These results suggest that OsSnm1 is involved not only in the repair of DNA interstrand crosslinks, but also in various other DNA repair pathways

Genetic and physical mapping of homologues of the virus resistance gene Rx1 and the cyst nematode resistance gene Gpa2 in potato.

Science.gov (United States)

Bakker, E; Butterbach, P; Rouppe van der Voort, J; van der Vossen, E; van Vliet, J; Bakker, J; Goverse, A

2003-05-01

Nine resistance gene homologues (RGHs) were identified in two diploid potato clones (SH and RH), with a specific primer pair based on conserved motifs in the LRR domain of the potato cyst nematode resistance gene Gpa2 and the potato virus X resistance gene Rx1. A modified AFLP method was used to facilitate the genetic mapping of the RGHs in the four haplotypes under investigation. All nine RGHs appeared to be located in the Gpa2/ Rx1 cluster on chromosome XII. Construction of a physical map using bacterial artificial chromosome (BAC) clones for both the Solanum tuberosum ssp. tuberosum and the S. tuberosum ssp. andigena haplotype of SH showed that the RGHs are located within a stretch of less than 200 kb. Sequence analysis of the RGHs revealed that they are highly similar (93 to 95%) to Gpa2 and Rx1. The sequence identities among all RGHs range from 85 to 100%. Two pairs of RGHs are identical, or nearly so (100 and 99.9%), with each member located in a different genotype. Southern-blot analysis on genomic DNA revealed no evidence for additional homologues outside the Gpa2/ Rx1 cluster on chromosome XII.

Identification of possible targets of the Aspergillus fumigatus CRZ1 homologue, CrzA

Directory of Open Access Journals (Sweden)

Goldman Gustavo H

2010-01-01

Full Text Available Abstract Background Calcineurin, a serine/threonine-specific protein phosphatase, plays an important role in the control of cell morphology and virulence in fungi. Calcineurin regulates localization and activity of a transcription factor called CRZ1. Recently, we characterize Aspergillus fumigatus CRZ1 homologue, AfCrzA. Here, we investigate which pathways are influenced by A. fumigatus AfCrzA during a short pulse of calcium by comparatively determining the transcriptional profile of A. fumigatus wild type and ΔAfcrzA mutant strains. Results We were able to observe 3,622 genes modulated in at least one timepoint in the mutant when compared to the wild type strain (3,211 and 411 at 10 and 30 minutes, respectively. Decreased mRNA abundance in the ΔcrzA was seen for genes encoding calcium transporters, transcription factors and genes that could be directly or indirectly involved in calcium metabolism. Increased mRNA accumulation was observed for some genes encoding proteins involved in stress response. AfCrzA overexpression in A. fumigatus increases the expression of several of these genes. The deleted strain of one of these genes, AfRcnA, belonging to a class of endogenous calcineurin regulators, calcipressins, had more calcineurin activity after exposure to calcium and was less sensitive to menadione 30 μM, hydrogen peroxide 2.5 mM, EGTA 25 mM, and MnCl2 25 mM. We constructed deletion, overexpression, and GFP fusion protein for the closely related A. nidulans AnRcnA. GFP::RcnA was mostly detected along the germling, did not accumulate in the nuclei and its location is not affected by the cellular response to calcium chloride. Conclusion We have performed a transcriptional profiling analysis of the A. fumigatus ΔAfcrzA mutant strain exposed to calcium stress. This provided an excellent opportunity to identify genes and pathways that are under the influence of AfCrzA. AfRcnA, one of these selected genes, encodes a modulator of calcineurin

The role of the leukemia-associated ETO homologue repressors in hematopoiesis

OpenAIRE

Olsson, André

2006-01-01

The fusion protein AML1-ETO is observed in acute myeloid patients with the chromosomal translocation t(8;21). Cells with this chimeric protein have impaired granulocytic and erythroid differentiation with accumulation of myeloblasts. The transcriptional co-repressor ETO (Eight Twenty One) was identified from the cloning of AML1-ETO. Subsequently, MTGR1 (Myeloid Translocation Gene-Related protein 1) and MTG16 (Myeloid Translocation Gene on chromosome 16) were found to be homologues to ETO, all...

The Mycobacterium tuberculosis homologue of the Mycobacterium ...

African Journals Online (AJOL)

With the completion of genome sequencing of Mycobacterium tuberculosis and upsurge in the incidence of M. tuberculosis infection worldwide partly as a result of HIV pandemic, there is need for rationale approach to vaccine and chemotherapy discoveries for M. tuberculosis. The homologue of mig gene of. Mycobacterium ...

Detection of a Yersinia pestis gene homologue in rodent samples

Directory of Open Access Journals (Sweden)

Timothy A. Giles

2016-08-01

Full Text Available A homologue to a widely used genetic marker, pla, for Yersinia pestis has been identified in tissue samples of two species of rat (Rattus rattus and Rattus norvegicus and of mice (Mus musculus and Apodemus sylvaticus using a microarray based platform to screen for zoonotic pathogens of interest. Samples were from urban locations in the UK (Liverpool and Canada (Vancouver. The results indicate the presence of an unknown bacterium that shares a homologue for the pla gene of Yersinia pestis, so caution should be taken when using this gene as a diagnostic marker.

Towards structural studies of the old yellow enzyme homologue SYE4 from Shewanella oneidensis and its complexes at atomic resolution

International Nuclear Information System (INIS)

Elegheert, Jonathan; Hemel, Debbie van den; Dix, Ina; Stout, Jan; Van Beeumen, Jozef; Brigé, Ann; Savvides, Savvas N.

2009-01-01

Of the four old yellow enzyme homologues found in S. oneidensis, SYE4 is the homologue most implicated in resistance to oxidative stress. SYE4 was recombinantly expressed in Escherichia coli, purified and crystallized using the hanging-drop vapour-diffusion method. Shewanella oneidensis is an environmentally versatile Gram-negative γ-proteobacterium that is endowed with an unusually large proteome of redox proteins. Of the four old yellow enzyme (OYE) homologues found in S. oneidensis, SYE4 is the homologue most implicated in resistance to oxidative stress. SYE4 was recombinantly expressed in Escherichia coli, purified and crystallized using the hanging-drop vapour-diffusion method. The crystals belonged to the orthorhombic space group P2 1 2 1 2 1 and were moderately pseudo-merohedrally twinned, emulating a P422 metric symmetry. The native crystals of SYE4 were of exceptional diffraction quality and provided complete data to 1.10 Å resolution using synchrotron radiation, while crystals of the reduced enzyme and of the enzyme in complex with a wide range of ligands typically led to high-quality complete data sets to 1.30–1.60 Å resolution, thus providing a rare opportunity to dissect the structure–function relationships of a good-sized enzyme (40 kDa) at true atomic resolution. Here, the attainment of a number of experimental milestones in the crystallographic studies of SYE4 and its complexes are reported, including isolation of the elusive hydride–Meisenheimer complex

Identification of a candidate CD5 homologue in the amphibian Xenopus laevis.

Science.gov (United States)

Jürgens, J B; Gartland, L A; Du Pasquier, L; Horton, J D; Göbel, T W; Cooper, M D

1995-11-01

We identified a novel T cell Ag in the South African clawed toad (Xenopus laevis) by a mAb designated 2B1. This Ag is present in relatively high levels on most thymocytes, approximately 65% of splenocytes, 55% of PBL, and 65% of intestinal lymphocytes, but is rarely seen on IgM+ B cells in any of these tissues. Lymphocytes bearing the 2B1 Ag proliferate in response to stimulation with Con A or PHA, whereas the 2B1- lymphocytes are reactive to LPS. Biochemical analysis indicates that this Ag is a differentially phosphorylated glycoprotein of 71 to 82 kDa. The protein core of 64 kDa bears both N- and O-linked carbohydrate side chains. The amino-terminal protein sequence of the 2B1 Ag shares significant homology with both the macrophage scavenger receptor type 1 motif and the mammalian CD5/CD6 family. The biochemical characteristics and cellular distribution of the 2B1 Ag suggest that it represents the CD5 homologue in X. laevis. While T cells constitutively express this highly conserved molecule, Xenopus B cells acquire the CD5 homologue only when they are stimulated in the presence of T cells.

Phosphatase and tensin homologue deleted on chromosome 10 ...

African Journals Online (AJOL)

Phosphatase and tensin homologue deleted on chromosome 10 (PTEN) is a tumor suppressor gene deleted or mutated in many human cancers such as glioblastoma, spinal tumors, prostate, bladder, adrenals, thyroid, breast, endometrium, and colon cancers. They result from loss of heterozygosity (LOH) for the PTEN ...

DNA methyltransferase homologue TRDMT1 in Plasmodium falciparum specifically methylates endogenous aspartic acid tRNA.

Science.gov (United States)

Govindaraju, Gayathri; Jabeena, C A; Sethumadhavan, Devadathan Valiyamangalath; Rajaram, Nivethika; Rajavelu, Arumugam

2017-10-01

In eukaryotes, cytosine methylation regulates diverse biological processes such as gene expression, development and maintenance of genomic integrity. However, cytosine methylation and its functions in pathogenic apicomplexan protozoans remain enigmatic. To address this, here we investigated the presence of cytosine methylation in the nucleic acids of the protozoan Plasmodium falciparum. Interestingly, P. falciparum has TRDMT1, a conserved homologue of DNA methyltransferase DNMT2. However, we found that TRDMT1 did not methylate DNA, in vitro. We demonstrate that TRDMT1 methylates cytosine in the endogenous aspartic acid tRNA of P. falciparum. Through RNA bisulfite sequencing, we mapped the position of 5-methyl cytosine in aspartic acid tRNA and found methylation only at C38 position. P. falciparum proteome has significantly higher aspartic acid content and a higher proportion of proteins with poly aspartic acid repeats than other apicomplexan pathogenic protozoans. Proteins with such repeats are functionally important, with significant roles in host-pathogen interactions. Therefore, TRDMT1 mediated C38 methylation of aspartic acid tRNA might play a critical role by translational regulation of important proteins and modulate the pathogenicity of the malarial parasite. Copyright © 2017 Elsevier B.V. All rights reserved.

Interactions of iron-bound frataxin with ISCU and ferredoxin on the cysteine desulfurase complex leading to Fe-S cluster assembly.

Science.gov (United States)

Cai, Kai; Frederick, Ronnie O; Tonelli, Marco; Markley, John L

2018-06-01

Frataxin (FXN) is involved in mitochondrial iron‑sulfur (Fe-S) cluster biogenesis and serves to accelerate Fe-S cluster formation. FXN deficiency is associated with Friedreich ataxia, a neurodegenerative disease. We have used a combination of isothermal titration calorimetry and multinuclear NMR spectroscopy to investigate interactions among the components of the biological machine that carries out the assembly of iron‑sulfur clusters in human mitochondria. Our results show that FXN tightly binds a single Fe 2+ but not Fe 3+ . While FXN (with or without bound Fe 2+ ) does not bind the scaffold protein ISCU directly, the two proteins interact mutually when each is bound to the cysteine desulfurase complex ([NFS1] 2 :[ISD11] 2 :[Acp] 2 ), abbreviated as (NIA) 2 , where "N" represents the cysteine desulfurase (NFS1), "I" represents the accessory protein (ISD11), and "A" represents acyl carrier protein (Acp). FXN binds (NIA) 2 weakly in the absence of ISCU but more strongly in its presence. Fe 2+ -FXN binds to the (NIA) 2 -ISCU 2 complex without release of iron. However, upon the addition of both l-cysteine and a reductant (either reduced FDX2 or DTT), Fe 2+ is released from FXN as consistent with Fe 2+ -FXN being the proximal source of iron for Fe-S cluster assembly. Copyright © 2018 The Authors. Published by Elsevier Inc. All rights reserved.

Crystal structure of myotoxin-II: a myotoxic phospholipase A2 - homologue from Bothrops moojeni venom

International Nuclear Information System (INIS)

Azevedo, W.F.; Ward, R.J.; Lombardi, F.R.; Arni, R.K.; Soares, A.M.; Giglio, J.R.; Fontes, M.R.M.

1997-01-01

Full text. Phospho lipases A2 (PLA 2 ; E C 3.1.1.4, phosphatides s n-2 acyl hydrolases) hydrolysis the s n-2 ester bond of phospholipids showing enhanced activity at lamellar or membrane surfaces. Intracellular PLA 2 s are involved at phospholipid metabolism and signal transduction, whereas extracellular PLA 2 s are found in mammalian pancreatic juices, the venoms of snakes, lizards and insects. Based on their high primary sequence similarity, extracellular PLA 2 s are separated into Classes I, II and III. Class II PLA 2 s are found in snake venoms of Crotalidae an Viperidae species, and include the sub-family of Lys PLA 2 s homologue. he coordination of the Ca 2+ ion in the PLA 2 calcium-binding loop includes and aspartate at position 49. In the catalytically active PLA 2 s, this calcium ion plays a critical role in the stabilization of the tetrahedral transition state intermediate in the catalytic mechanism. The conservative substitution Asp49-Lys results in a decreased calcium affinity with a concomitant loss of catalytic activity, and naturally occurring PLA 2 s-homologues showing the same substitution are catalytically inactive. However, the Lys PLA 2 s possess cytolytic and myotoxic activities and furthermore retain the ability to disrupt the integrity of both plasma membranes and model lipid layers by a ca 2+ -independent mechanism for which there is no evidence of lipid hydrolysis. Lys 49 PLA 2 homologues have been isolated from several Bothrops spp. venoms including B. moojeni. Therefore, in order to improve our understanding of the molecular basis of the myotoxic and Ca 2+ independent membrane damaging activities we have determined the crystal structure of MjTX-II, a Lys 49 homologue from the venom of B. moojeni. The model presented has been determined at 2.0 A resolution and refined to a crystallographic residual of 19.7% (R f ree=28.1%). (author)

Neuronal SIRT1 (Silent Information Regulator 2 Homologue 1) Regulates Glycolysis and Mediates Resveratrol-Induced Ischemic Tolerance.

Science.gov (United States)

Koronowski, Kevin B; Khoury, Nathalie; Saul, Isabel; Loris, Zachary B; Cohan, Charles H; Stradecki-Cohan, Holly M; Dave, Kunjan R; Young, Juan I; Perez-Pinzon, Miguel A

2017-11-01

Resveratrol, at least in part via SIRT1 (silent information regulator 2 homologue 1) activation, protects against cerebral ischemia when administered 2 days before injury. However, it remains unclear if SIRT1 activation must occur, and in which brain cell types, for the induction of neuroprotection. We hypothesized that neuronal SIRT1 is essential for resveratrol-induced ischemic tolerance and sought to characterize the metabolic pathways regulated by neuronal Sirt1 at the cellular level in the brain. We assessed infarct size and functional outcome after transient 60 minute middle cerebral artery occlusion in control and inducible, neuronal-specific SIRT1 knockout mice. Nontargeted primary metabolomics analysis identified putative SIRT1-regulated pathways in brain. Glycolytic function was evaluated in acute brain slices from adult mice and primary neuronal-enriched cultures under ischemic penumbra-like conditions. Resveratrol-induced neuroprotection from stroke was lost in neuronal Sirt1 knockout mice. Metabolomics analysis revealed alterations in glucose metabolism on deletion of neuronal Sirt1 , accompanied by transcriptional changes in glucose metabolism machinery. Furthermore, glycolytic ATP production was impaired in acute brain slices from neuronal Sirt1 knockout mice. Conversely, resveratrol increased glycolytic rate in a SIRT1-dependent manner and under ischemic penumbra-like conditions in vitro. Our data demonstrate that resveratrol requires neuronal SIRT1 to elicit ischemic tolerance and identify a novel role for SIRT1 in the regulation of glycolytic function in brain. Identification of robust neuroprotective mechanisms that underlie ischemia tolerance and the metabolic adaptations mediated by SIRT1 in brain are crucial for the translation of therapies in cerebral ischemia and other neurological disorders. © 2017 American Heart Association, Inc.

The SPF27 homologue Num1 connects splicing and kinesin 1-dependent cytoplasmic trafficking in Ustilago maydis.

Directory of Open Access Journals (Sweden)

Nikola Kellner

2014-01-01

Full Text Available The conserved NineTeen protein complex (NTC is an integral subunit of the spliceosome and required for intron removal during pre-mRNA splicing. The complex associates with the spliceosome and participates in the regulation of conformational changes of core spliceosomal components, stabilizing RNA-RNA- as well as RNA-protein interactions. In addition, the NTC is involved in cell cycle checkpoint control, response to DNA damage, as well as formation and export of mRNP-particles. We have identified the Num1 protein as the homologue of SPF27, one of NTC core components, in the basidiomycetous fungus Ustilago maydis. Num1 is required for polarized growth of the fungal hyphae, and, in line with the described NTC functions, the num1 mutation affects the cell cycle and cell division. The num1 deletion influences splicing in U. maydis on a global scale, as RNA-Seq analysis revealed increased intron retention rates. Surprisingly, we identified in a screen for Num1 interacting proteins not only NTC core components as Prp19 and Cef1, but several proteins with putative functions during vesicle-mediated transport processes. Among others, Num1 interacts with the motor protein Kin1 in the cytoplasm. Similar phenotypes with respect to filamentous and polar growth, vacuolar morphology, as well as the motility of early endosomes corroborate the genetic interaction between Num1 and Kin1. Our data implicate a previously unidentified connection between a component of the splicing machinery and cytoplasmic transport processes. As the num1 deletion also affects cytoplasmic mRNA transport, the protein may constitute a novel functional interconnection between the two disparate processes of splicing and trafficking.

OVO homologue-like 1 (Ovol1) transcription factor: a novel target of neurogenin-3 in rodent pancreas.

Science.gov (United States)

Vetere, A; Li, W-C; Paroni, F; Juhl, K; Guo, L; Nishimura, W; Dai, X; Bonner-Weir, S; Sharma, A

2010-01-01

The basic helix-loop-helix transcription factor neurogenin-3 (NGN3) commits the fates of pancreatic progenitors to endocrine cell types, but knowledge of the mechanisms regulating the choice between proliferation and differentiation of these progenitors is limited. Using a chromatin immunoprecipitation cloning approach, we searched for direct targets of NGN3 and identified a zinc-finger transcription factor, OVO homologue-like 1 (OVOL1). Transactivation experiments were carried out to elucidate the functional role of NGN3 in Ovol1 gene expression. Embryonic and adult rodents pancreases were immunostained for OVOL1, Ki67 and NGN3. We showed that NGN3 negatively regulates transcription of Ovol1 in an E-box-dependent fashion. The presence of either NGN3 or NEUROD1, but not MYOD, reduced endogenous Ovol1 mRNA. OVOL1 was detected in pancreatic tissue around embryonic day 15.5, after which OVOL1 levels dramatically increased. In embryonic pancreas, OVOL1 protein levels were low in NGN3(+) or Ki67(+) cells, but high in quiescent differentiated cells. OVOL1 presence was maintained in adult pancreas, where it was detected in islets, pancreatic ducts and some acinar cells. Additionally OVOL1 presence was lacking in proliferating ductules in regenerating pancreas and induced in cells as they began to acquire their differentiated phenotype. The timing of OVOL1 appearance in pancreas and its increased levels in differentiated cells suggest that OVOL1 promotes the transition of cells from a proliferating, less-differentiated state to a quiescent more-differentiated state. We conclude that OVOL1, a downstream target of NGN3, may play an important role in regulating the balance between proliferation and differentiation of pancreatic cells.

Identification of NoxD/Pro41 as the homologue of the p22phox NADPH oxidase subunit in fungi.

Science.gov (United States)

Lacaze, Isabelle; Lalucque, Hervé; Siegmund, Ulrike; Silar, Philippe; Brun, Sylvain

2015-03-01

NADPH oxidases (Nox) are membrane complexes that produce O2(-). Researches in mammals, plants and fungi highlight the involvement of Nox-generated ROS in cell proliferation, differentiation and defense. In mammals, the core enzyme gp91(phox)/Nox2 is associated with p22(phox) forming the flavocytochrome b558 ready for activation by a cytosolic complex. Intriguingly, no homologue of the p22(phox) gene has been found in fungal genomes, questioning how the flavoenzyme forms. Using whole genome sequencing combined with phylogenetic analysis and structural studies, we identify the fungal p22(phox) homologue as being mutated in the Podospora anserina mutant IDC(509). Functional studies show that the fungal p22(phox), PaNoxD, acts along PaNox1, but not PaNox2, a second fungal gp91(phox) homologue. Finally, cytological analysis of functional tagged versions of PaNox1, PaNoxD and PaNoxR shows clear co-localization of PaNoxD and PaNox1 and unravel a dynamic assembly of the complex in the endoplasmic reticulum and in the vacuolar system. © 2014 John Wiley & Sons Ltd.

Drosophila homologue of Diaphanous 1 (DIAPH1) controls the metastatic potential of colon cancer cells by regulating microtubule-dependent adhesion.

Science.gov (United States)

Lin, Yuan-Na; Bhuwania, Ridhirama; Gromova, Kira; Failla, Antonio Virgilio; Lange, Tobias; Riecken, Kristoffer; Linder, Stefan; Kneussel, Matthias; Izbicki, Jakob R; Windhorst, Sabine

2015-07-30

Drosophila homologue of Diaphanous 1 (DIAPH1) regulates actin polymerization and microtubule (MT) stabilization upon stimulation with lysophosphatidic acid (LPA). Recently, we showed strongly reduced lung metastasis of DIAPH1-depleted colon cancer cells but we found accumulations of DIAPH1-depleted cells in bone marrow. Here, we analyzed possible organ- or tissue-specific metastasis of DIAPH1-depleted HCT-116 cells. Our data confirmed that depletion of DIAPH1 strongly inhibited lung metastasis and revealed that, in contrast to control cells, DIAPH1-depleted cells did not form metastases in further organs. Detailed mechanistic analysis on cells that were not stimulated with LPA to activate the cytoskeleton-modulating activity of DIAPH1, revealed that even under basal conditions DIAPH1 was essential for cellular adhesion to collagen. In non-stimulated cells DIAPH1 did not control actin dynamics but, interestingly, was essential for stabilization of microtubules (MTs). Additionally, DIAPH1 controlled directed vesicle trafficking and with this, local clustering of the adhesion protein integrin-β1 at the plasma membrane. Therefore, we conclude that under non-stimulating conditions DIAPH1 controls cellular adhesion by stabilizing MTs required for local clustering of integrin-β1 at the plasma membrane. Thus, blockade of DIAPH1-tubulin interaction may be a promising approach to inhibit one of the earliest steps in the metastatic cascade of colon cancer.

Snipper, an Eri1 homologue, affects histone mRNA abundance and is crucial for normal Drosophila melanogaster development.

Science.gov (United States)

Alexiadis, Anastasios; Delidakis, Christos; Kalantidis, Kriton

2017-07-01

The conserved 3'-5' RNA exonuclease ERI1 is implicated in RNA interference inhibition, 5.8S rRNA maturation and histone mRNA maturation and turnover. The single ERI1 homologue in Drosophila melanogaster Snipper (Snp) is a 3'-5' exonuclease, but its in vivo function remains elusive. Here, we report Snp requirement for normal Drosophila development, since its perturbation leads to larval arrest and tissue-specific downregulation results in abnormal tissue development. Additionally, Snp directly interacts with histone mRNA, and its depletion results in drastic reduction in histone transcript levels. We propose that Snp protects the 3'-ends of histone mRNAs and upon its absence, histone transcripts are readily degraded. This in turn may lead to cell cycle delay or arrest, causing growth arrest and developmental perturbations. © 2017 Federation of European Biochemical Societies.

Characterization of the cDNA encoding a BPI/LBP homologue in venom gland of the hundred-pace snake Deinagkistrodon acutus

Directory of Open Access Journals (Sweden)

Jianrao HU, Mingfu CAO, Jiong Chen

2009-10-01

Full Text Available Bactericidal/permeability-increasing protein (BPI and LPS-binding protein (LBP play an important role in host defence. Current evidence shows that BPI/LBP may be widely existed in different cells and tissue types of animals. A full-length cDNA clone encoding a BPI/LBP homologue (dBPI, 1757bp in size, was characterized in venom gland of the hundred-pace snake Deinagkistrodon acutus. Its deduced amino acid sequence of 417 residues had 13.8%–21.5% identity to BPI like 1(BPIL1 and BPI like 3(BPIL3 of other animals. Conserved cysteine residues which are involved in disulfide bond formation between the final strand of the N-terminal beta sheet and the long alpha helix of BPI are identified as Cys146-Cys183 of dBPI. Phylogenetic tree analysis showed that the BPI/LBP homologues formed five large clusters and dBPI was in a large cluster including BPIL1 and BPIL3. dBPI mRNA shows a tissue specific expression in venom gland. This is the first study to identify the cDNA encoding BPI/LBP homologues from reptiles [Current Zoology 55 (5: –2009].

Characterization of cogon grass (Imperata cylindrica) pollen extract and preliminary analysis of grass group 1, 4 and 5 homologues using monoclonal antibodies to Phleum pratense.

Science.gov (United States)

Kumar, L; Sridhara, S; Singh, B P; Gangal, S V

1998-11-01

Previous studies have established the role of Imperata cylindrica (Ic) pollen in type I allergic disorders. However, no systematic information is available on the allergen composition of Ic pollen extract. To characterize the IgE-binding proteins of Ic pollen extract and to detect the presence of grass group 1, 4 and 5 allergen homologues, if any. Pollen extract of Ic was analyzed by in vivo and in vitro procedures such as intradermal tests (ID), enzyme-linked immunosorbent assay (ELISA), ELISA-inhibition, thin-layer isoelectric focusing (TLIEF), sodium dodecylsulfate polyacrylamide gel electrophoresis (SDS-PAGE) and immunoblotting. Dot blot assay was carried out to check the presence of well-known group 1, 4, and 5 allergen homologues in Ic pollen extract. Out of 303 respiratory allergies patients skin-tested, 27 showed sensitivity to Ic pollen extract. Specific IgE levels were elevated in all 15 serum samples tested. The extract prepared for this study was found to be highly potent since it required only 400 ng of homologous proteins for 50% inhibition of binding in ELISA inhibition assays. TLIEF of Ic pollen extract showed 44 silver-stained bands (pI 3.5-7.0) while SDS-PAGE resolved it into 24 Coomassie-Brilliant-Blue-stained bands (MW 100-10 kD). Immunoblotting with individual patient sera recognized 7 major IgE-binding bands (MW 85, 62, 57, 43, 40, 28 and 16 kD) in Ic pollen extract. A panel of monoclonal antibodies, specific to group 1, 4 and 5 allergens from Phleum pratense pollen extract identified group 5 and group 4 homologues in Ic pollen extract. Ic pollen extract was characterized for the protein profile by TLIEF and SDS-PAGE. IgE reactivity was determined by ELISA and immunoblot. Monoclonal antibodies to group 5 and group 4 allergens reacted weakly showing that this pollen contains group 5 and group 4 homologous allergens.

Isolation and characterization of an AGAMOUS homologue from cocoa

NARCIS (Netherlands)

Chaidamsari, T.; Sugiarit, H.; Santoso, D.; Angenent, G.C.; Maagd, de R.A.

2006-01-01

We report the cloning of a cDNA from TcAG, an AG (Arabidopsis thaliana MADS-box C-type transcription factor gene AGAMOUS) homologue from cocoa (Theobroma cacao L.). TcAG was in the cocoa flower expressed primarily in stamens and ovaries, comparable to AG in Arabidopsis. Additionally, we found that

The actin homologue MreB organizes the bacterial cell membrane

NARCIS (Netherlands)

Strahl, H.; Burmann, F.; Hamoen, L.W.

2014-01-01

The eukaryotic cortical actin cytoskeleton creates specific lipid domains, including lipid rafts, which determine the distribution of many membrane proteins. Here we show that the bacterial actin homologue MreB displays a comparable activity. MreB forms membrane-associated filaments that coordinate

A pomegranate (Punica granatum L.) WD40-repeat gene is a functional homologue of Arabidopsis TTG1 and is involved in the regulation of anthocyanin biosynthesis during pomegranate fruit development.

Science.gov (United States)

Ben-Simhon, Zohar; Judeinstein, Sylvie; Nadler-Hassar, Talia; Trainin, Taly; Bar-Ya'akov, Irit; Borochov-Neori, Hamutal; Holland, Doron

2011-11-01

Anthocyanins are the major pigments responsible for the pomegranate (Punica granatum L.) fruit skin color. The high variability in fruit external color in pomegranate cultivars reflects variations in anthocyanin composition. To identify genes involved in the regulation of anthocyanin biosynthesis pathway in the pomegranate fruit skin we have isolated, expressed and characterized the pomegranate homologue of the Arabidopsis thaliana TRANSPARENT TESTA GLABRA1 (TTG1), encoding a WD40-repeat protein. The TTG1 protein is a regulator of anthocyanins and proanthocyanidins (PAs) biosynthesis in Arabidopsis, and acts by the formation of a transcriptional regulatory complex with two other regulatory proteins: bHLH and MYB. Our results reveal that the pomegranate gene, designated PgWD40, recovered the anthocyanin, PAs, trichome and seed coat mucilage phenotype in Arabidopsis ttg1 mutant. PgWD40 expression and anthocyanin composition in the skin were analyzed during pomegranate fruit development, in two accessions that differ in skin color intensity and timing of appearance. The results indicate high positive correlation between the total cyanidin derivatives quantity (red pigments) and the expression level of PgWD40. Furthermore, strong correlation was found between the steady state levels of PgWD40 transcripts and the transcripts of pomegranate homologues of the structural genes PgDFR and PgLDOX. PgWD40, PgDFR and PgLDOX expression also correlated with the expression of pomegranate homologues of the regulatory genes PgAn1 (bHLH) and PgAn2 (MYB). On the basis of our results we propose that PgWD40 is involved in the regulation of anthocyanin biosynthesis during pomegranate fruit development and that expression of PgWD40, PgAn1 and PgAn2 in the pomegranate fruit skin is required to regulate the expression of downstream structural genes involved in the anthocyanin biosynthesis.

Inhibition of hydroxyapatite growth by casein, a potential salivary phosphoprotein homologue.

Science.gov (United States)

Romero, Maria J R H; Nakashima, Syozi; Nikaido, Toru; Ichinose, Shizuko; Sadr, Alireza; Tagami, Junji

2015-08-01

Salivary phosphoproteins are essential in tooth mineral regulation but are often overlooked in vitro. This study aimed to evaluate the effect of casein, as a salivary phosphoprotein homologue, on the deposition and growth of hydroxyapatite (HA) on tooth surfaces. Hydroxyapatite growth was quantified using seeded crystal systems. Artificial saliva (AS) containing HA powder and 0, 10, 20, 50, or 100 μg ml(-1) of casein, or 100 μg ml(-1) of dephosphorylated casein (Dcasein), was incubated for 0-8 h at 37°C, pH 7.2. Calcium concentrations were measured using atomic absorption spectroscopy (AAS). Surface precipitation of HA on bovine enamel and dentine blocks, incubated in similar conditions for 7 d, was examined using field emission scanning electron microscopy (FE-SEM) and transmission electron microscopy (TEM) with selected area electron diffraction (SAED). Casein adsorption was assessed using modified Lowry assays and zeta-potential measurements. The AAS results revealed a concentration-dependent inhibition of calcium consumption. Hydroxyapatite precipitation occurred when no casein was present, whereas precipitation of HA was apparently completely inhibited in casein-containing groups. Adsorption data demonstrated increasingly negative zeta-potential with increased casein concentration and an affinity constant similar to proline-rich proteins with Langmuir modelling. Casein inhibited the deposition and growth of HA primarily through the binding of esterized phosphate to HA active sites, indicating its potential as a mineral-regulating salivary phosphoprotein homologue in vitro. © 2015 Eur J Oral Sci.

Characterization and cloning of TMV resistance gene N homologues ...

African Journals Online (AJOL)

Tobacco cultivars Nicotiana tabacum cv. Samsun NN plants carrying the N gene contain a multitude of N-related genes. We cloned a few N homologues and isolated two full-length cDNAs of NL-C26 and NL-B69 genes from N. tabacum cv. Samsun NN. Nucleotide sequence analysis showed that the coding regions of ...

Reversible Axonal Dystrophy by Calcium Modulation in Frataxin-Deficient Sensory Neurons of YG8R Mice

Directory of Open Access Journals (Sweden)

Belén Mollá

2017-08-01

Full Text Available Friedreich’s ataxia (FRDA is a peripheral neuropathy involving a loss of proprioceptive sensory neurons. Studies of biopsies from patients suggest that axonal dysfunction precedes the death of proprioceptive neurons in a dying-back process. We observed that the deficiency of frataxin in sensory neurons of dorsal root ganglia (DRG of the YG8R mouse model causes the formation of axonal spheroids which retain dysfunctional mitochondria, shows alterations in the cytoskeleton and it produces impairment of axonal transport and autophagic flux. The homogenous distribution of axonal spheroids along the neurites supports the existence of continues focal damages. This lead us to propose for FRDA a model of distal axonopathy based on axonal focal damages. In addition, we observed the involvement of oxidative stress and dyshomeostasis of calcium in axonal spheroid formation generating axonal injury as a primary cause of pathophysiology. Axonal spheroids may be a consequence of calcium imbalance, thus we propose the quenching or removal extracellular Ca2+ to prevent spheroids formation. In our neuronal model, treatments with BAPTA and o-phenanthroline reverted the axonal dystrophy and the mitochondrial dysmorphic parameters. These results support the hypothesis that axonal pathology is reversible in FRDA by pharmacological manipulation of intracellular Ca2+ with Ca2+ chelators or metalloprotease inhibitors, preventing Ca2+-mediated axonal injury. Thus, the modulation of Ca2+ levels may be a relevant therapeutic target to develop early axonal protection and prevent dying-back neurodegeneration.

Mouse homologue of yeast Prp19 interacts with mouse SUG1, the regulatory subunit of 26S proteasome

International Nuclear Information System (INIS)

Sihn, Choong-Ryoul; Cho, Si Young; Lee, Jeong Ho; Lee, Tae Ryong; Kim, Sang Hoon

2007-01-01

Yeast Prp19 has been shown to involve in pre-mRNA splicing and DNA repair as well as being an ubiquitin ligase. Mammalian homologue of yeast Prp19 also plays on similar functional activities in cells. In the present study, we isolated mouse SUG1 (mSUG1) as binding partner of mouse Prp19 (mPrp19) by the yeast two-hybrid system. We confirmed the interaction of mPrp9 with mSUG1 by GST pull-down assay and co-immunoprecipitation assay. The N-terminus of mPrp19 including U-box domain was associated with the C-terminus of mSUG1. Although, mSUG1 is a regulatory subunit of 26S proteasome, mPrp19 was not degraded in the proteasome-dependent pathway. Interestingly, GFP-mPrp19 fusion protein was co-localized with mSUG1 protein in cytoplasm as the formation of the speckle-like structures in the presence of a proteasome inhibitor MG132. In addition, the activity of proteasome was increased in cells transfected with mPrp19. Taken together, these results suggest that mPrp19 involves the regulation of protein turnover and may transport its substrates to 26S proteasome through mSUG1 protein

The human homologue of Dictyostelium discoideum phg1A is expressed by human metastatic melanoma cells.

Science.gov (United States)

Lozupone, Francesco; Perdicchio, Maurizio; Brambilla, Daria; Borghi, Martina; Meschini, Stefania; Barca, Stefano; Marino, Maria Lucia; Logozzi, Mariantonia; Federici, Cristina; Iessi, Elisabetta; de Milito, Angelo; Fais, Stefano

2009-12-01

Tumour cannibalism is a characteristic of malignancy and metastatic behaviour. This atypical phagocytic activity is a crucial survival option for tumours in conditions of low nutrient supply, and has some similarities to the phagocytic activity of unicellular microorganisms. In fact, Dictyostelium discoideum has been used widely as a model to study phagocytosis. Recently, phg1A has been described as a protein that is primarily involved in the phagocytic process of this microorganism. The closest human homologue to phg1A is transmembrane 9 superfamily protein member 4 (TM9SF4). Here, we report that TM9SF4 is highly expressed in human malignant melanoma cells deriving from metastatic lesions, whereas it is undetectable in healthy human tissues and cells. TM9SF4 is predominantly expressed in acidic vesicles of melanoma cells, in which it co-localizes with the early endosome antigens Rab5 and early endosome antigen 1. TM9SF4 silencing induced marked inhibition of cannibal activity, which is consistent with a derangement of intracellular pH gradients, with alkalinization of acidic vesicles and acidification of the cell cytosol. We propose TM9SF4 as a new marker of malignancy, representing a potential new target for anti-tumour strategies with a specific role in tumour cannibalism and in the establishment of a metastatic phenotype.

Partial functional complementation between human and mouse cytomegalovirus chemokine receptor homologues

DEFF Research Database (Denmark)

Farrell, Helen E; Abraham, Alexander M; Cardin, Rhonda D

2011-01-01

The human cytomegalovirus (CMV) proteins US28 and UL33 are homologous to chemokine receptors (CKRs). Knockout of the mouse CMV M33 protein (UL33 homologue) results in substantial attenuation of salivary gland infection/replication and reduced efficiency of reactivation from tissue explants. M33-m...

Purification, crystallization and preliminary X-ray analysis of SGR6054, a Streptomyces homologue of the mycobacterial integration host factor mIHF

International Nuclear Information System (INIS)

Nomoto, Ryohei; Tezuka, Takeaki; Miyazono, Ken-ichi; Tanokura, Masaru; Horinouchi, Sueharu; Ohnishi, Yasuo

2012-01-01

A Streptomyces homologue of the mycobacterial integration host factor mIHF was heterologously produced, purified and crystallized in the presence of a 16-mer duplex DNA by the sitting-drop vapour-diffusion method. The best crystal diffracted X-rays to 2.22 Å resolution and belonged to space group C2. The mycobacterial integration host factor (mIHF) is a small nonspecific DNA-binding protein that is essential for the growth of Mycobacterium smegmatis. mIHF homologues are widely distributed among Actinobacteria, and a Streptomyces homologue of mIHF is involved in control of sporulation and antibiotic production in S. coelicolor A3(2). Despite their important biological functions, a structure of mIHF or its homologues has not been elucidated to date. Here, the S. griseus mIHF homologue (SGR6054) was expressed and purified from Escherichia coli and crystallized in the presence of a 16-mer duplex DNA by the sitting-drop vapour-diffusion method. The plate-shaped crystal belonged to space group C2, with unit-cell parameters a = 88.53, b = 69.35, c = 77.71 Å, β = 96.63°, and diffracted X-rays to 2.22 Å resolution

Purification, crystallization and preliminary X-ray analysis of SGR6054, a Streptomyces homologue of the mycobacterial integration host factor mIHF

Energy Technology Data Exchange (ETDEWEB)

Nomoto, Ryohei; Tezuka, Takeaki; Miyazono, Ken-ichi; Tanokura, Masaru; Horinouchi, Sueharu; Ohnishi, Yasuo [Graduate School of Agricultural and Life Sciences, The University of Tokyo, 1-1-1 Yayoi, Bunkyo-ku, Tokyo 113-8657 (Japan)

2012-08-31

A Streptomyces homologue of the mycobacterial integration host factor mIHF was heterologously produced, purified and crystallized in the presence of a 16-mer duplex DNA by the sitting-drop vapour-diffusion method. The best crystal diffracted X-rays to 2.22 Å resolution and belonged to space group C2. The mycobacterial integration host factor (mIHF) is a small nonspecific DNA-binding protein that is essential for the growth of Mycobacterium smegmatis. mIHF homologues are widely distributed among Actinobacteria, and a Streptomyces homologue of mIHF is involved in control of sporulation and antibiotic production in S. coelicolor A3(2). Despite their important biological functions, a structure of mIHF or its homologues has not been elucidated to date. Here, the S. griseus mIHF homologue (SGR6054) was expressed and purified from Escherichia coli and crystallized in the presence of a 16-mer duplex DNA by the sitting-drop vapour-diffusion method. The plate-shaped crystal belonged to space group C2, with unit-cell parameters a = 88.53, b = 69.35, c = 77.71 Å, β = 96.63°, and diffracted X-rays to 2.22 Å resolution.

Sequence Classification: 889733 [

Lifescience Database Archive (English)

Full Text Available teracts with electron transport chain components and may influence respiration; human homolog involved in Friedrich's ataxia; Yfh1p || http://www.ncbi.nlm.nih.gov/protein/6320083 ...

SLAH1, a homologue of the slow type anion channel SLAC1, modulates shoot Cl − accumulation and salt tolerance in Arabidopsis thaliana

KAUST Repository

Qiu, Jiaen; Henderson, Sam W; Tester, Mark A.; Roy, Stuart J; Gilliham, Mathew

2016-01-01

Salinity tolerance is correlated with shoot chloride (Cl–) exclusion in multiple crops, but the molecular mechanisms of long-distance Cl– transport are poorly defined. Here, we characterize the in planta role of AtSLAH1 (a homologue of the slow type anion channel-associated 1 (SLAC1)). This protein, localized to the plasma membrane of root stelar cells, has its expression reduced by salt or ABA, which are key predictions for a protein involved with loading Cl– into the root xylem. Artificial microRNA knockdown mutants of AtSLAH1 had significantly reduced shoot Cl− accumulation when grown under low Cl–, whereas shoot Cl– increased and the shoot nitrate/chloride ratio decreased following AtSLAH1 constitutive or stelar-specific overexpression when grown in high Cl–. In both sets of overexpression lines a significant reduction in shoot biomass over the null segregants was observed under high Cl– supply, but not low Cl– supply. Further in planta data showed AtSLAH3 overexpression increased the shoot nitrate/chloride ratio, consistent with AtSLAH3 favouring nitrate transport. Heterologous expression of AtSLAH1 in Xenopus laevis oocytes led to no detectible transport, suggesting the need for post-translational modifications for AtSLAH1 to be active. Our in planta data are consistent with AtSLAH1 having a role in controlling root-to-shoot Cl– transport.

SLAH1, a homologue of the slow type anion channel SLAC1, modulates shoot Cl − accumulation and salt tolerance in Arabidopsis thaliana

KAUST Repository

Qiu, Jiaen

2016-06-23

Salinity tolerance is correlated with shoot chloride (Cl–) exclusion in multiple crops, but the molecular mechanisms of long-distance Cl– transport are poorly defined. Here, we characterize the in planta role of AtSLAH1 (a homologue of the slow type anion channel-associated 1 (SLAC1)). This protein, localized to the plasma membrane of root stelar cells, has its expression reduced by salt or ABA, which are key predictions for a protein involved with loading Cl– into the root xylem. Artificial microRNA knockdown mutants of AtSLAH1 had significantly reduced shoot Cl− accumulation when grown under low Cl–, whereas shoot Cl– increased and the shoot nitrate/chloride ratio decreased following AtSLAH1 constitutive or stelar-specific overexpression when grown in high Cl–. In both sets of overexpression lines a significant reduction in shoot biomass over the null segregants was observed under high Cl– supply, but not low Cl– supply. Further in planta data showed AtSLAH3 overexpression increased the shoot nitrate/chloride ratio, consistent with AtSLAH3 favouring nitrate transport. Heterologous expression of AtSLAH1 in Xenopus laevis oocytes led to no detectible transport, suggesting the need for post-translational modifications for AtSLAH1 to be active. Our in planta data are consistent with AtSLAH1 having a role in controlling root-to-shoot Cl– transport.

From Cell Death to Metabolism: Holin-Antiholin Homologues with New Functions

DEFF Research Database (Denmark)

van den Esker, Marielle H.; Kovács, Ákos T.; Kuipers, Oscar P.

2017-01-01

, but their functions can be different, depending on the species. Using a series of biochemical and genetic approaches, in a recent article in mBio, Charbonnier et al. (mBio 8:e00976-17, 2017, https://doi.org/10.1128/mBio.00976-17) demonstrate that the antiholin homologue in Bacillus subtilis transports pyruvate...

The CD11a partner in Sus scrofa lymphocyte function-associated antigen-1 (LFA-1: mRNA cloning, structure analysis and comparison with mammalian homologues

Directory of Open Access Journals (Sweden)

Thomas Anne VT

2005-10-01

Full Text Available Abstract Background Lymphocyte function-associated antigen-1 (LFA-1, CD11a/CD18, alphaLbeta2, the most abundant and widely expressed beta2-integrin, is required for many cellular adhesive interactions during the immune response. Many studies have shown that LFA-1 is centrally involved in the pathogenesis of several diseases caused by Repeats-in-toxin (RTX -producing bacteria. Results The porcine-LFA-1 CD11a (alpha subunit coding sequence was cloned, sequenced and compared with the available mammalian homologues in this study. Despite some focal differences, it shares all the main characteristics of these latter. Interestingly, as in sheep and humans, an allelic variant with a triplet insertion resulting in an additional Gln-744 was consistently identified, which suggests an allelic polymorphism that might be biologically relevant. Conclusion Together with the pig CD18-encoding cDNA, which has been available for a long time, the sequence data provided here will allow the successful expression of porcine CD11a, thus giving the first opportunity to express the Sus scrofa beta2-integrin LFA-1 in vitro as a tool to examine the specificities of inflammation in the porcine species.

No changes in heme synthesis in human Friedreich´s ataxia erythroid progenitor cells.

Science.gov (United States)

Steinkellner, Hannes; Singh, Himanshu Narayan; Muckenthaler, Martina U; Goldenberg, Hans; Moganty, Rajeswari R; Scheiber-Mojdehkar, Barbara; Sturm, Brigitte

2017-07-20

Friedreich's ataxia (FRDA) is a neurodegenerative disease caused by reduced expression of the protein frataxin. Frataxin is thought to play a role in iron-sulfur cluster biogenesis and heme synthesis. In this study, we used erythroid progenitor stem cells obtained from FRDA patients and healthy donors to investigate the putative role, if any, of frataxin deficiency in heme synthesis. We used electrochemiluminescence and qRT-PCR for frataxin protein and mRNA quantification. We used atomic absorption spectrophotometry for iron levels and a photometric assay for hemoglobin levels. Protoporphyrin IX and Ferrochelatase were analyzed using auto-fluorescence. An "IronChip" microarray analysis followed by a protein-protein interaction analysis was performed. FRDA patient cells showed no significant changes in iron levels, hemoglobin synthesis, protoporphyrin IX levels, and ferrochelatase activity. Microarray analysis presented 11 genes that were significantly changed in all patients compared to controls. The genes are especially involved in oxidative stress, iron homeostasis and angiogenesis. The mystery about the involvement of frataxin on iron metabolism raises the question why frataxin deficiency in primary FRDA cells did not lead to changes in biochemical parameters of heme synthesis. It seems that alternative pathways can circumvent the impact of frataxin deficiency on heme synthesis. We show for the first time in primary FRDA patient cells that reduced frataxin levels are still sufficient for heme synthesis and possibly other mechanisms can overcome reduced frataxin levels in this process. Our data strongly support the fact that so far no anemia in FRDA patients was reported. Copyright © 2017 Elsevier B.V. All rights reserved.

Behaviour of the homologues of Rf and Db in complexing media

International Nuclear Information System (INIS)

Trubert, D.; Monroy Guzman, F.; Hussonnois, M.; Brillard, L.; Le Naour, C.; Servajean, V.; Constantinescu, O.; Constantinescu, M.; Ardisson, G.; Barci, V.; Weiss, B.

1999-01-01

In order to study the chemical behaviour of the trans-actinide elements, the chemical properties of their most probable homologues have been investigated by ion exchange methods in various complexing media. A new chromatographic method allowing the determination of distribution coefficients in the case o short-lived isotopes has been developed and successfully tested with the RACHEL device. (authors)

The actin homologue MreB organizes the bacterial cell membrane

OpenAIRE

Strahl, Henrik; Bürmann, Frank; Hamoen, Leendert W.

2014-01-01

The eukaryotic cortical actin cytoskeleton creates specific lipid domains, including lipid rafts, which determine the distribution of many membrane proteins. Here we show that the bacterial actin homologue MreB displays a comparable activity. MreB forms membrane-associated filaments that coordinate bacterial cell wall synthesis. We noticed that the MreB cytoskeleton influences fluorescent staining of the cytoplasmic membrane. Detailed analyses combining an array of mutants, using specific lip...

Identification and characterisation of the angiotensin converting enzyme-3 (ACE3) gene: a novel mammalian homologue of ACE

OpenAIRE

Rella, Monika; Elliot, Joann L; Revett, Timothy J; Lanfear, Jerry; Phelan, Anne; Jackson, Richard M; Turner, Anthony J; Hooper, Nigel M

2007-01-01

Abstract Background Mammalian angiotensin converting enzyme (ACE) plays a key role in blood pressure regulation. Although multiple ACE-like proteins exist in non-mammalian organisms, to date only one other ACE homologue, ACE2, has been identified in mammals. Results Here we report the identification and characterisation of the gene encoding a third homologue of ACE, termed ACE3, in several mammalian genomes. The ACE3 gene is located on the same chromosome downstream of the ACE gene. Multiple ...

Species-specific flight styles of flies are reflected in the response dynamics of a homologue motion sensitive neuron

Directory of Open Access Journals (Sweden)

Bart eGeurten

2012-03-01

Full Text Available Hoverflies and blowflies have distinctly different flight styles. Yet, both species have been shown to structure their flight behaviour in a way that facilitates extraction of 3D information from the image flow on the retina (optic flow. Neuronal candidates to analyse the optic flow are the tangential cells in the third optical ganglion – the lobula complex. These neurons are directionally selective and integrate the optic flow over large parts of the visual field. Homologue tangential cells in hoverflies and blowflies have a similar morphology. Because blowflies and hoverflies have similar neuronal layout but distinctly different flight behaviours, they are an ideal substrate to pinpoint potential neuronal adaptations to the different flight styles.In this article we describe the relationship between locomotion behaviour and motion vision on three different levels:1.We compare the different flight styles based on the categorisation of flight behaviour into prototypical movements.2.We measure the species specific dynamics of the optic flow under naturalistic flight conditions. We found the translational optic flow of both species to be very different.3.We describe possible adaptations of a homologue motion sensitive neuron. We stimulate this cell in blowflies (Calliphora and hoverflies (Eristalis with naturalistic optic flow generated by both species during free flight. The characterized hoverfly tangential cell responds faster to transient changes in the optic flow than its blowfly homologue. It is discussed whether and how the different dynamical response properties aid optic flow analysis.

E3B1, a human homologue of the mouse gene product Abi-1, sensitizes activation of Rap1 in response to epidermal growth factor

International Nuclear Information System (INIS)

Jenei, Veronika; Andersson, Tommy; Jakus, Judit; Dib, Karim

2005-01-01

E3B1, a human homologue of the mouse gene product Abi-1, has been implicated in growth-factor-mediated regulation of the small GTPases p21 Ras and Rac. E3b1 is a regulator of Rac because it can form a complex with Sos-1 and eps8, and such a Sos-1-e3B1-eps8 complex serves as a guanine nucleotide exchange factor for Rac. In the present study, we found that overexpression of e3B1 in NIH3T3/EGFR cells sensitized EGF-induced activation of Rac1, whereas it had no impact on EGF-induced activation of p21 Ras . Remarkably, we found that EGF-induced activation of the p21 Ras -related GTPase Rap1 was also sensitized in NIH3T3/EGFR-e3B1 cells. Thus, in NIH3T3/EGFR-e3B1 cells, maximal EGF-induced activation of Rap1 occurs with a dose of EGF much lower than in NIH3T3/EGFR cells. We also report that overexpression of e3B1 in NIH3T3/EGFR cells renders EGF-induced activation of Rap1 completely dependent on Src tyrosine kinases but not on c-Abl. However, EGF-induced tyrosine phosphorylation of the Rap GEF C3G occurred regardless of whether e3B1 was overexpressed or not, and this did not involve Src tyrosine kinases. Accordingly, we propose that overexpression of e3B1 in NIH3T3/EGFR cells leads to mobilization of Src tyrosine kinases that participate in EGF-induced activation of Rap1 and inhibition of cell proliferation

Structural studies on a non-toxic homologue of type II RIPs from ...

Indian Academy of Sciences (India)

Structural studies on a non-toxic homologue of type II RIPs from bitter gourd: Molecular basis of non-toxicity, conformational selection and glycan structure. MS accepted http://www.ias.ac.in/jbiosci. THYAGESHWAR CHANDRAN, ALOK SHARMA and M VIJAYAN. J. Biosci. 40(5), October 2015, 929–941, © Indian Academy of ...

Mono-, di- and trimethylated homologues of isoprenoid tetraether lipid cores in archaea and environmental samples: mass spectrometric identification and significance.

Science.gov (United States)

Knappy, Chris; Barillà, Daniela; Chong, James; Hodgson, Dominic; Morgan, Hugh; Suleman, Muhammad; Tan, Christine; Yao, Peng; Keely, Brendan

2015-12-01

Higher homologues of widely reported C(86) isoprenoid diglycerol tetraether lipid cores, containing 0-6 cyclopentyl rings, have been identified in (hyper)thermophilic archaea, representing up to 21% of total tetraether lipids in the cells. Liquid chromatography-tandem mass spectrometry confirms that the additional carbon atoms in the C(87-88) homologues are located in the etherified chains. Structures identified include dialkyl and monoalkyl ('H-shaped') tetraethers containing C(40-42) or C(81-82) hydrocarbons, respectively, many representing novel compounds. Gas chromatography-mass spectrometric analysis of hydrocarbons released from the lipid cores by ether cleavage suggests that the C(40) chains are biphytanes and the C(41) chains 13-methylbiphytanes. Multiple isomers, having different chain combinations, were recognised among the dialkyl lipids. Methylated tetraethers are produced by Methanothermobacter thermautotrophicus in varying proportions depending on growth conditions, suggesting that methylation may be an adaptive mechanism to regulate cellular function. The detection of methylated lipids in Pyrobaculum sp. AQ1.S2 and Sulfolobus acidocaldarius represents the first reported occurrences in Crenarchaeota. Soils and aquatic sediments from geographically distinct mesotemperate environments that were screened for homologues contained monomethylated tetraethers, with di- and trimethylated structures being detected occasionally. The structural diversity and range of occurrences of the C(87-89) tetraethers highlight their potential as complementary biomarkers for archaea in natural environments. Copyright © 2015 John Wiley & Sons, Ltd.

Structure of HLA-A*1101 in complex with a hepatitis B peptide homologue

DEFF Research Database (Denmark)

Blicher, Thomas; Kastrup, Jette Sandholm; Pedersen, Lars Østergaard

2006-01-01

A high-resolution structure of the human MHC-I molecule HLA-A*1101 is presented in which it forms a complex with a sequence homologue of a peptide that occurs naturally in hepatitis B virus DNA polymerase. The sequence of the bound peptide is AIMPARFYPK, while that of the corresponding natural...

TORC1 Inhibition by Rapamycin Promotes Antioxidant Defences in a Drosophila Model of Friedreich's Ataxia.

Directory of Open Access Journals (Sweden)

Pablo Calap-Quintana

Full Text Available Friedreich's ataxia (FRDA, the most common inherited ataxia in the Caucasian population, is a multisystemic disease caused by a significant decrease in the frataxin level. To identify genes capable of modifying the severity of the symptoms of frataxin depletion, we performed a candidate genetic screen in a Drosophila RNAi-based model of FRDA. We found that genetic reduction in TOR Complex 1 (TORC1 signalling improves the impaired motor performance phenotype of FRDA model flies. Pharmacologic inhibition of TORC1 signalling by rapamycin also restored this phenotype and increased the lifespan and ATP levels. Furthermore, rapamycin reduced the altered levels of malondialdehyde + 4-hydroxyalkenals and total glutathione of the model flies. The rapamycin-mediated protection against oxidative stress is due in part to an increase in the transcription of antioxidant genes mediated by cap-n-collar (Drosophila ortholog of Nrf2. Our results suggest that autophagy is indeed necessary for the protective effect of rapamycin in hyperoxia. Rapamycin increased the survival and aconitase activity of model flies subjected to high oxidative insult, and this improvement was abolished by the autophagy inhibitor 3-methyladenine. These results point to the TORC1 pathway as a new potential therapeutic target for FRDA and as a guide to finding new promising molecules for disease treatment.

Expression patterns of Passiflora edulis APETALA1/FRUITFULL homologues shed light onto tendril and corona identities

Directory of Open Access Journals (Sweden)

Livia C. T. Scorza

2017-02-01

Full Text Available Abstract Background Passiflora (passionflowers makes an excellent model for studying plant evolutionary development. They are mostly perennial climbers that display axillary tendrils, which are believed to be modifications of the inflorescence. Passionflowers are also recognized by their unique flower features, such as the extra whorls of floral organs composed of corona filaments and membranes enclosing the nectary. Although some work on Passiflora organ ontogeny has been done, the developmental identity of both Passiflora tendrils and the corona is still controversial. Here, we combined ultrastructural analysis and expression patterns of the flower meristem and floral organ identity genes of the MADS-box AP1/FUL clade to reveal a possible role for these genes in the generation of evolutionary novelties in Passiflora. Results We followed the development of structures arising from the axillary meristem from juvenile to adult phase in P. edulis. We further assessed the expression pattern of P. edulis AP1/FUL homologues (PeAP1 and PeFUL, by RT-qPCR and in situ hybridization in several tissues, correlating it with the developmental stages of P. edulis. PeAP1 is expressed only in the reproductive stage, and it is highly expressed in tendrils and in flower meristems from the onset of their development. PeAP1 is also expressed in sepals, petals and in corona filaments, suggesting a novel role for PeAP1 in floral organ diversification. PeFUL presented a broad expression pattern in both vegetative and reproductive tissues, and it is also expressed in fruits. Conclusions Our results provide new molecular insights into the morphological diversity in the genus Passiflora. Here, we bring new evidence that tendrils are part of the Passiflora inflorescence. This points to the convergence of similar developmental processes involving the recruitment of genes related to flower identity in the origin of tendrils in different plant families. The data obtained also

Rapid and Complete Reversal of Sensory Ataxia by Gene Therapy in a Novel Model of Friedreich Ataxia.

Science.gov (United States)

Piguet, Françoise; de Montigny, Charline; Vaucamps, Nadège; Reutenauer, Laurence; Eisenmann, Aurélie; Puccio, Hélène

2018-05-28

Friedreich ataxia (FA) is a rare mitochondrial disease characterized by sensory and spinocerebellar ataxia, hypertrophic cardiomyopathy, and diabetes, for which there is no treatment. FA is caused by reduced levels of frataxin (FXN), an essential mitochondrial protein involved in the biosynthesis of iron-sulfur (Fe-S) clusters. Despite significant progress in recent years, to date, there are no good models to explore and test therapeutic approaches to stop or reverse the ganglionopathy and the sensory neuropathy associated to frataxin deficiency. Here, we report a new conditional mouse model with complete frataxin deletion in parvalbumin-positive cells that recapitulate the sensory ataxia and neuropathy associated to FA, albeit with a more rapid and severe course. Interestingly, although fully dysfunctional, proprioceptive neurons can survive for many weeks without frataxin. Furthermore, we demonstrate that post-symptomatic delivery of frataxin-expressing AAV allows for rapid and complete rescue of the sensory neuropathy associated with frataxin deficiency, thus establishing the pre-clinical proof of concept for the potential of gene therapy in treating FA neuropathy. Copyright © 2018 The American Society of Gene and Cell Therapy. Published by Elsevier Inc. All rights reserved.

Protein 4.1, a component of the erythrocyte membrane skeleton and its related homologue proteins forming the protein 4.1/FERM superfamily.

Directory of Open Access Journals (Sweden)

Aleksander F Sikorski

2007-01-01

Full Text Available The review is focused on the domain structure and function of protein 4.1, one of the proteins belonging to the membrane skeleton. The protein 4.1 of the red blood cells (4.1R is a multifunctional protein that localizes to the membrane skeleton and stabilizes erythrocyte shape and membrane mechanical properties, such as deformability and stability, via lateral interactions with spectrin, actin, glycophorin C and protein p55. Protein 4.1 binding is modulated through the action of kinases and/or calmodulin-Ca2+. Non-erythroid cells express the 4.1R homologues: 4.1G (general type, 4.1B (brain type, and 4.1N (neuron type, and the whole group belongs to the protein 4.1 superfamily, which is characterized by the presence of a highly conserved FERM domain at the N-terminus of the molecule. Proteins 4.1R, 4.1G, 4.1N and 4.1B are encoded by different genes. Most of the 4.1 superfamily proteins also contain an actin-binding domain. To date, more than 40 members have been identified. They can be divided into five groups: protein 4.1 molecules, ERM proteins, talin-related molecules, protein tyrosine phosphatase (PTPH proteins and NBL4 proteins. We have focused our attention on the main, well known representatives of 4.1 superfamily and tried to choose the proteins which are close to 4.1R or which have distinct functions. 4.1 family proteins are not just linkers between the plasma membrane and membrane skeleton; they also play an important role in various processes. Some, such as focal adhesion kinase (FAK, non-receptor tyrosine kinase that localizes to focal adhesions in adherent cells, play the role in cell adhesion. The other members control or take part in tumor suppression, regulation of cell cycle progression, inhibition of cell proliferation, downstream signaling of the glutamate receptors, and establishment of cell polarity; some are also involved in cell proliferation, cell motility, and/or cell-to-cell communication.

Short- and medium-chain chlorinated paraffins in biota from the European Arctic -- differences in homologue group patterns.

Science.gov (United States)

Reth, Margot; Ciric, Anita; Christensen, Guttorm N; Heimstad, Eldbjørg S; Oehme, Michael

2006-08-15

Congener and homologue group patterns of chlorinated paraffins (CPs) in biota can be influenced by different processes, but these are not well studied yet. Short- (SCCPs) and medium-chain chlorinated paraffins (MCCPs) were quantified in liver from Arctic char and seabirds (little auk and kittiwake) collected at Bear Island (European Arctic) as well as in cod from Iceland and Norway. CP concentrations were between 5 and 88 ng/g wet weight (ww) for SCCPs and between 5 and 55 ng/g ww for MCCPs with one exception of 370 ng/g measured in a liver sample from little auk. The SCCP homologue group patterns were compared with those of technical mixtures and of SCCPs present in cod liver from the Baltic Sea. The latter showed a more common SCCP homologue distribution (sum of C(11) and C(12)>60%) in contrast to cod liver from the Northwest of Europe, which had a high abundance of C(10) and C(12) congeners. Seabirds from Bear Island contained an equally distributed SCCP homologue group pattern. In Arctic char, the SCCP distribution was closer to technical products, but with a high proportion (average of 18.9%) of C(10) congeners. A comparison of C(10)/C(12) ratios confirmed the higher abundance of C(10) congeners in samples from higher latitudes. For the first time, MCCPs could be detected in Arctic samples. The average proportion of C(14) congeners was 65.8%. The C(14)/C(15) abundance ratio was similar to technical mixtures. High-chlorinated CPs (Cl(>7)) were also detectable. The average chlorine content of the SCCPs was 61.9% (59.0-63.3%), and that of the MCCPs 55.8% (54.5-57.4%).

First report of a thioredoxin homologue in jellyfish: molecular cloning, expression and antioxidant activity of CcTrx1 from Cyanea capillata.

Directory of Open Access Journals (Sweden)

Zengliang Ruan

Full Text Available Thioredoxins (Trx proteins are a family of small, highly-conserved and ubiquitous proteins that play significant roles in the resistance of oxidative damage. In this study, a homologue of Trx was identified from the cDNA library of tentacle of the jellyfish Cyanea capillata and named CcTrx1. The full-length cDNA of CcTrx1 was 479 bp with a 312 bp open reading frame encoding 104 amino acids. Bioinformatics analysis revealed that the putative CcTrx1 protein harbored the evolutionarily-conserved Trx active site 31CGPC34 and shared a high similarity with Trx1 proteins from other organisms analyzed, indicating that CcTrx1 is a new member of Trx1 sub-family. CcTrx1 mRNA was found to be constitutively expressed in tentacle, umbrella, oral arm and gonad, indicating a general role of CcTrx1 protein in various physiological processes. The recombinant CcTrx1 (rCcTrx1 protein was expressed in Escherichia coli BL21 (DE3, and then purified by affinity chromatography. The rCcTrx1 protein was demonstrated to possess the expected redox activity in enzymatic analysis and protection against oxidative damage of supercoiled DNA. These results indicate that CcTrx1 may function as an important antioxidant in C. capillata. To our knowledge, this is the first Trx protein characterized from jellyfish species.

A Potato cDNA Encoding a Homologue of Mammalian Multidrug Resistant P-Glycoprotein

Science.gov (United States)

Wang, W.; Takezawa, D.; Poovaiah, B. W.

1996-01-01

A homologue of the multidrug resistance (MDR) gene was obtained while screening a potato stolon tip cDNA expression library with S-15-labeled calmodulin. The mammalian MDR gene codes for a membrane-bound P-glycoprotein (170-180 kDa) which imparts multidrug resistance to cancerous cells. The potato cDNA (PMDR1) codes for a polypeptide of 1313 amino acid residues (ca. 144 kDa) and its structural features are very similar to the MDR P-glycoprotein. The N-terminal half of the PMDR1-encoded protein shares striking homology with its C-terminal half, and each half contains a conserved ATP-binding site and six putative transmembrane domains. Southern blot analysis indicated that potato has one or two MDR-like genes. PMDR1 mRNA is constitutively expressed in all organs studied with higher expression in the stem and stolon tip. The PMDR1 expression was highest during tuber initiation and decreased during tuber development.

Fisetin up-regulates the expression of adiponectin in 3T3-L1 adipocytes via the activation of silent mating type information regulation 2 homologue 1 (SIRT1)-deacetylase and peroxisome proliferator-activated receptors (PPARs).

Science.gov (United States)

Jin, Taewon; Kim, Oh Yoen; Shin, Min-Jeong; Choi, Eun Young; Lee, Sung Sook; Han, Ye Sun; Chung, Ji Hyung

2014-10-29

Adiponectin, an adipokine, has been described as showing physiological benefits against obesity-related malfunctions and vascular dysfunction. Several natural compounds that promote the expression and secretion of adipokines in adipocytes could be useful for treating metabolic disorders. This study investigated the effect of fisetin, a dietary flavonoid, on the regulation of adiponectin in adipocytes using 3T3-L1 preadipocytes. The expression and secretion of adiponectin increased in 3T3-L1 cells upon treatment with fisetin in a dose-dependent manner. Fisetin-induced adiponectin secretion was inhibited by peroxisome proliferator-activated receptor (PPAR) antagonists. It was also revealed that fisetin increased the activities of PPARs and silent mating type information regulation 2 homologue 1 (SIRT1) in a dose-dependent manner. Furthermore, the up-regulation of adiponectin and the activation of PPARs induced by fisetin were prevented by a SIRT1 inhibitor. Fisetin also promoted deacetylation of PPAR γ coactivator 1 (PGC-1) and its interaction with PPARs. SIRT knockdown by siRNA significantly decreased both adiponectin production and PPARs-PGC-1 interaction. These results provide evidence that fisetin promotes the gene expression of adiponectin through the activation of SIRT1 and PPARs in adipocytes.

Self-assembly of diphenylalanine backbone homologues and their combination with functionalized carbon nanotubes.

Science.gov (United States)

Dinesh, Bhimareddy; Squillaci, Marco A; Ménard-Moyon, Cécilia; Samorì, Paolo; Bianco, Alberto

2015-10-14

The integration of carbon nanotubes (CNTs) into organized nanostructures is of great interest for applications in materials science and biomedicine. In this work we studied the self-assembly of β and γ homologues of diphenylalanine peptides under different solvent and pH conditions. We aimed to investigate the role of peptide backbone in tuning the formation of different types of nanostructures alone or in combination with carbon nanotubes. In spite of having the same side chain, β and γ peptides formed distinctively different nanofibers, a clear indication of the role played by the backbone homologation on the self-assembly. The variation of the pH allowed to transform the nanofibers into spherical structures. Moreover, the co-assembly of β and γ peptides with carbon nanotubes covalently functionalized with the same peptide generated unique dendritic assemblies. This comparative study on self-assembly using diphenylalanine backbone homologues and of the co-assembly with CNT covalent conjugates is the first example exploring the capacity of β and γ peptides to adopt precise nanostructures, particularly in combination with carbon nanotubes. The dendritic organization obtained by mixing carbon nanotubes and peptides might find interesting applications in tissue engineering and neuronal interfacing.

Is the Prosthetic Homologue Necessary for Embodiment?

Science.gov (United States)

Dornfeld, Chelsea; Swanston, Michelle; Cassella, Joseph; Beasley, Casey; Green, Jacob; Moshayev, Yonatan; Wininger, Michael

2016-01-01

Embodiment is the process by which patients with limb loss come to accept their peripheral device as a natural extension of self. However, there is little guidance as to how exacting the prosthesis must be in order for embodiment to take place: is it necessary for the prosthetic hand to look just like the absent hand? Here, we describe a protocol for testing whether an individual would select a hand that looks like their own from among a selection of five hands, and whether the hand selection (regardless of homology) is consistent across multiple exposures to the same (but reordered) set of candidate hands. Pilot results using healthy volunteers reveals that hand selection is only modestly consistent, and that selection of the prosthetic homologue is atypical (61 of 192 total exposures). Our protocol can be executed in minutes, and makes use of readily available equipment and softwares. We present both a face-to-face and a virtual protocol, for maximum flexibility of implementation.

The role of the Saccharomyces cerevisiae lipoate protein ligase homologue, Lip3, in lipoic acid synthesis.

Science.gov (United States)

Hermes, Fatemah A; Cronan, John E

2013-10-01

The covalent attachment of lipoate to the lipoyl domains (LDs) of the central metabolism enzymes pyruvate dehydrogenase (PDH) and oxoglutarate dehydrogenase (OGDH) is essential for their activation and thus for respiratory growth in Saccharomyces cerevisiae. A third lipoate-dependent enzyme system, the glycine cleavage system (GCV), is required for utilization of glycine as a nitrogen source. Lipoate is synthesized by extraction of its precursor, octanoyl-acyl carrier protein (ACP), from the pool of fatty acid biosynthetic intermediates. Alternatively, lipoate is salvaged from previously modified proteins or from growth medium by lipoate protein ligases (Lpls). The first Lpl to be characterized, LplA of Escherichia coli, catalyses two partial reactions: activation of the acyl chain by formation of acyl-AMP, followed by transfer of the acyl chain to lipoyl domains (LDs). There is a surprising diversity within the Lpl family of enzymes, several of which catalyse reactions other than ligation reactions. For example, the Bacillus subtilis Lpl homologue LipM is an octanoyltransferase that transfers the octanoyl moiety from octanoyl-ACP to GCV. Another B. subtilis Lpl homologue, LipL, transfers octanoate from octanoyl-GCV to other LDs in an amido-transfer reaction. Study of eukaryotic Lpls has lagged behind studies of the bacterial enzymes. We report that the Lip3 Lpl homologue of the yeast S. cerevisiae has octanoyl-CoA-protein transferase activity, and discuss implications of this activity on the physiological role of Lip3 in lipoate synthesis. Published 2013. This article is a U.S. Government work and is in the public domain in the USA.

Crystallization and preliminary diffraction analysis of a DsbA homologue from Wolbachia pipientis

Energy Technology Data Exchange (ETDEWEB)

Kurz, M. [Institute for Molecular Bioscience and ARC Special Research Centre for Functional and Applied Genomics, University of Queensland, St Lucia, QLD 4072 (Australia); Iturbe-Ormaetxe, I. [School of Integrative Biology, The University of Queensland, St Lucia, QLD 4072 (Australia); Jarrott, R. [Institute for Molecular Bioscience and ARC Special Research Centre for Functional and Applied Genomics, University of Queensland, St Lucia, QLD 4072 (Australia); O’Neill, S. L. [School of Integrative Biology, The University of Queensland, St Lucia, QLD 4072 (Australia); Byriel, K. A.; Martin, J. L., E-mail: j.martin@imb.uq.edu.au; Heras, B., E-mail: j.martin@imb.uq.edu.au [Institute for Molecular Bioscience and ARC Special Research Centre for Functional and Applied Genomics, University of Queensland, St Lucia, QLD 4072 (Australia)

2008-02-01

The first crystallization of a W. pipientis protein, α-DsbA1, was achieved using hanging-drop and sitting-drop vapour diffusion. α-DsbA1 is one of two DsbA homologues encoded by the Gram-negative α-proteobacterium Wolbachia pipientis, an endosymbiont that can behave as a reproductive parasite in insects and as a mutualist in medically important filarial nematodes. The α-DsbA1 protein is thought to be important for the folding and secretion of Wolbachia proteins involved in the induction of reproductive distortions. Crystals of native and SeMet α-DsbA1 were grown by vapour diffusion and belong to the monoclinic space group C2, with unit-cell parameters a = 71.4, b = 49.5, c = 69.3 Å, β = 107.0° and one molecule in the asymmetric unit (44% solvent content). X-ray data were recorded from native crystals to a resolution of 2.01 Å using a copper anode and data from SeMet α-DsbA1 crystals were recorded to 2.45 Å resolution using a chromium anode.

Structural characterization and expression analysis of a beta-thymosin homologue (Tβ) in disk abalone, Haliotis discus discus.

Science.gov (United States)

Kasthuri, Saranya Revathy; Premachandra, H K A; Umasuthan, Navaneethaiyer; Whang, Ilson; Lee, Jehee

2013-09-15

Repertoires of proteins and small peptides play numerous physiological roles as hormones, antimicrobial peptides, and cellular signaling factors. The beta-thymosins are a group of small acidic peptides involved in processes such as actin sequestration, neuronal development, wound healing, tissue repair, and angiogenesis. Recent characterization of the beta thymosins as immunological regulators in invertebrates led to our identification and characterization of a beta-thymosin homologue (Tβ) from Haliotis discus discus. The cDNA possessed an ORF of 132 bp encoding a protein of 44 amino acids with a molecular mass of 4977 Da. The amino acid sequence shows high identity with another molluskan beta-thymosin and has a characteristic actin binding motif (LKKTET) and glutamyl donors. Phylogenetic analysis showed a close relationship with molluskan homologues, as well as its distinct identity and common ancestral origin. Genomic analysis revealed a 3 exon-2 intron structure similar to the other homologues. In silico promoter analysis also revealed significant transcription factor binding sites, providing evidence for the expression of this gene under different cellular conditions, including stress or pathogenic attack. Tissue distribution profiling revealed a ubiquitous presence in all the examined tissues, but with the highest expression in mantle and hemocyte. Immune challenge with lipopolysaccharide, poly I:C and Vibrio parahemolyticus induced beta-thymosin expression in gill and hemocytes, affirming an immune-related role in invertebrates. Copyright © 2013 Elsevier B.V. All rights reserved.

A combined nucleic acid and protein analysis in Friedreich ataxia: implications for diagnosis, pathogenesis and clinical trial design.

Directory of Open Access Journals (Sweden)

Francesco Saccà

Full Text Available BACKGROUND: Friedreich's ataxia (FRDA is the most common hereditary ataxia among caucasians. The molecular defect in FRDA is the trinucleotide GAA expansion in the first intron of the FXN gene, which encodes frataxin. No studies have yet reported frataxin protein and mRNA levels in a large cohort of FRDA patients, carriers and controls. METHODOLOGY/PRINCIPAL FINDINGS: We enrolled 24 patients with classic FRDA phenotype (cFA, 6 late onset FRDA (LOFA, all homozygous for GAA expansion, 5 pFA cases who harbored the GAA expansion in compound heterozygosis with FXN point mutations (namely, p.I154F, c.482+3delA, p.R165P, 33 healthy expansion carriers, and 29 healthy controls. DNA was genotyped for GAA expansion, mRNA/FXN was quantified in real-time, and frataxin protein was measured using lateral-flow immunoassay in peripheral blood mononuclear cells (PBMCs. Mean residual levels of frataxin, compared to controls, were 35.8%, 65.6%, 33%, and 68.7% in cFA, LOFA, pFA and healthy carriers, respectively. Comparison of both cFA and pFA with controls resulted in 100% sensitivity and specificity, but there was overlap between LOFA, carriers and controls. Frataxin levels correlated inversely with GAA1 and GAA2 expansions, and directly with age at onset. Messenger RNA expression was reduced to 19.4% in cFA, 50.4% in LOFA, 52.7% in pFA, 53.0% in carriers, as compared to controls (p<0.0001. mRNA levels proved to be diagnostic when comparing cFA with controls resulting in 100% sensitivity and specificity. In cFA and LOFA patients mRNA levels correlated directly with protein levels and age at onset, and inversely with GAA1 and GAA2. CONCLUSION/SIGNIFICANCE: We report the first explorative study on combined frataxin and mRNA levels in PBMCs from a cohort of FRDA patients, carriers and healthy individuals. Lateral-flow immunoassay differentiated cFA and pFA patients from controls, whereas determination of mRNA in q-PCR was sensitive and specific only in cFA.

Periodontal status of teeth restored with crowns and its contralateral homologue, Valdivia- Chile.

OpenAIRE

Israel Antonio Juárez; Sofía Larroulet; Makarena Ojeda; Cristian Rosas

2015-01-01

ABSTRACT Aim: To determine periodontal status of fixes single prostheses (FSP) made during the year 2013 in Austral University of Chile, and its contralateral homologue (CH).Methods: All patients with FSP made during 2013, that met the selection criteria and agreed to participate were evaluated. During the year 2014 was measured: probing depth, attachment level; bleeding on probing and dental plaque index for each FSP and CH; and consigned biological width invasion. Were measured one FSP...

Short-chain chlorinated paraffins in soil, paddy seeds (Oryza sativa) and snails (Ampullariidae) in an e-waste dismantling area in China: Homologue group pattern, spatial distribution and risk assessment.

Science.gov (United States)

Yuan, Bo; Fu, Jianjie; Wang, Yawei; Jiang, Guibin

2017-01-01

Short-chain chlorinated paraffins (SCCPs) in multi-environmental matrices are studied in Taizhou, Zhejiang Province, China, which is a notorious e-waste dismantling area. The investigated matrices consist of paddy field soil, paddy seeds (Oryza sativa, separated into hulls and rice unpolished) and apple snails (Ampullariidae, inhabiting the paddy fields). The sampling area covered a 65-km radius around the contamination center. C 10 and C 11 are the two predominant homologue groups in the area, accounting for about 35.7% and 33.0% of total SCCPs, respectively. SCCPs in snails and hulls are generally higher than in soil samples (30.4-530 ng/g dw), and SCCPs in hulls are approximate five times higher than in corresponding rice samples (4.90-55.1 ng/g dw). Homologue pattern analysis indicates that paddy seeds (both hull and rice) tend to accumulate relatively high volatile SCCP homologues, especially the ones with shorter carbon chain length, while snails tend to accumulate relatively high lipophilic homologues, especially the ones with more substituted chlorines. SCCPs in both paddy seeds and snails are linearly related to those in the soil. The e-waste dismantling area, which covers a radius of approximate 20 km, shows higher pollution levels for SCCPs according to their spatial distribution in four matrices. The preliminary assessment indicates that SCCP levels in local soils pose no significant ecological risk for soil dwelling organisms, but higher risks from dietary exposure of SCCPs are suspected for people living in e-waste dismantling area. Copyright © 2016 Elsevier Ltd. All rights reserved.

Crystal structure of pira toxin-I: a calcium-independent, myotoxic phospholipase A2 - homologue from Bothrops pirajai venom

International Nuclear Information System (INIS)

Canduri, R.J.; Ward, R.J.; Azevedo Junior, G.W.F. de; Arni, R.K.; Soares, A.M.; Giglio, J.R.

1997-01-01

Full text. Phospho lipases A2 (PLA 2 ) are small enzymes that specifically hydrolysed the sn-2 ester bond of phospholipids, preferentially in lamellar or micellar aggregates at membrane surfaces. These enzymes are widely distributed in nature and have been extensively studied. Toxic proteins from venoms from Bothrops species include catalytically active PLA 2 s and calcium independent PLA 2L ys 49 homologues. The substitution of Asp49 by Lys greatly diminishes the ability of these PLA 2 to bind calcium, an ion that plays a critical role in the stabilization of the tetrahedral transition state intermediate in the catalytic mechanism. The Lys 49 PLA 2 homologues and therefore catalytically inactive yet maintain cytolytic and myotoxic activities and furthermore retain the ability to disrupt the integrity of both plasma membranes and model lipid bilayers by a poorly understood Ca 2+ independente mechanism. Lys49 PLA 2 homologues demonstrate a specific toxic activity against skeletal muscle, affecting only muscle fibers and leaving other tissue structure such as connective tissue, nerves and vessels essentially unharmed. In order to improve our understanding of the molecular basis of the myotoxic and Ca 2+ -independent membrane damaging activities, we have determined the crystal structure of Pr TX-I, a Lys49 variant from the venom of B. pirajai. The model presented has been determined at 2.8 angstrom resolution and refined to a crystallographic residual of 19.7% (R free =29.7%). (author)

Phospholipase C δ-type consists of three isozymes: bovine PLCδ2 is a homologue of human/mouse PLCδ4

International Nuclear Information System (INIS)

Irino, Yasuhiro; Cho, Hiroyuki; Nakamura, Yoshikazu; Nakahara, Masamichi; Furutani, Masahiro; Suh, Pann-Ghill; Takenawa, Tadaomi; Fukami, Kiyoko

2004-01-01

To date, 12 phospholipase C (PLC) isozymes have been identified in mammals, and they are divided into five classes, β-, γ-, δ-, ε-, and ζ-type. PLCδ-type is reported to be composed of four isozymes, PLCδ1-δ4. Here we report that a screening for mouse PLCδ2 from a BAC library with primers that amplify a specific region of bovine PLCδ2 resulted in isolation of one clone containing the mouse PLCδ4 gene. Furthermore, a database search revealed that there is only one gene corresponding to PLCδ2 and PLCδ4 in the mouse and human genomes, indicating that bovine PLCδ2 is a homologue of human and mouse PLCδ4. However, PLCδ2 Western blot analysis with a widely used commercial anti-PLCδ2 antibody showed an expression pattern distinct from that of PLCδ4 in wild-type mice. In addition, an 80-kDa band, which was recognized by antibody against PLCδ2, was smaller than an 85-kDa band detected by anti-PLCδ4 antibody, and the 80-kDa band was detectable in lysates of brain, testis, and spleen from PLCδ4-deficient mice. We also found that immunoprecipitates from brain lysates with this PLCδ2 antibody contained no PLC activity. From these data, we conclude that bovine PLCδ2 is a homologue of human and mouse PLCδ4, and that three isozymes (δ1, δ3, and δ4) exist in the PLCδ family

Molecular Alterations in a Mouse Cardiac Model of Friedreich Ataxia

DEFF Research Database (Denmark)

Anzovino, Amy; Chiang, Shannon; Brown, Bronwyn E

2017-01-01

mechanisms. Using a mouse conditional frataxin knockout (KO) model in the heart and skeletal muscle, we examined the Nrf2 pathway in these tissues. Frataxin KO results in fatal cardiomyopathy, whereas skeletal muscle was asymptomatic. In the KO heart, protein oxidation and a decreased glutathione...

[Intersection point rule for the retention value with mobile phase composition and boiling point of the homologues and chlorobenzenes in soil leaching column chromatography].

Science.gov (United States)

Xu, F; Liang, X; Lin, B; Su, F

1999-03-01

Based on the linear retention equation of the logarithm of the capacity factor (logk') vs. the methanol volume fraction (psi) of aqueous binary mobile phase in soil leaching column chromatography, the intersection point rule for the logk' of homologues and weak polar chlorobenzenes, with psi, as well as with boiling point, has been derived due to existence of the similar interactions among solutes of the same series, stationary phase (soil) and eluent (methanol-water). These rules were testified by experimental data of homologues (n-alkylbenzenes, methylbenzenes) and weak polar chlorobenzenes.

Structure and function of the native and recombinant mitochondrial MRP1/MRP2 complex from

Czech Academy of Sciences Publication Activity Database

Zíková, Alena; Kopečná, Jana; Schumacher, M. A.; Stuart, K.; Trantírek, Lukáš; Lukeš, Julius

2008-01-01

Roč. 38, 8/9 (2008), s. 901-912 ISSN 0020-7519 R&D Projects: GA MŠk 2B06129; GA ČR GA204/06/1558; GA AV ČR IAA500960705; GA ČR GP204/04/P191; GA MŠk LC07032; GA MŠk(CZ) 1K04011 Institutional research plan: CEZ:AV0Z60220518 Keywords : frataxin * mitochondrie * trypanosoma * rozsivka * evoluční konzervovanost * import Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 3.752, year: 2008

CORRELATIONS BETWEEN HOMOLOGUE CONCENTRATIONS OF PCDD/FS AND TOXIC EQUIVALENCY VALUES IN LABORATORY-, PACKAGE BOILER-, AND FIELD-SCALE INCINERATORS

Science.gov (United States)

The toxic equivalency (TEQ) values of polychlorinated dibenzo-p-dioxins and polychlorinated dibenzofurans (PCDD/Fs) are predicted with a model based on the homologue concentrations measured from a laboratory-scale reactor (124 data points), a package boiler (61 data points), and ...

Targeting the Enhancer of Zeste Homologue 2 in Medulloblastoma

Science.gov (United States)

Alimova, Irina; Venkataraman, Sujatha; Harris, Peter; Marquez, Victor E.; Northcott, Paul A; Dubuc, Adrian; Taylor, Michael D; Foreman, Nicholas K; Vibhakar, Rajeev

2012-01-01

Enhancer of zeste homologue 2 (EZH2) is the catalytic subunit of Polycomb repressive complex 2 that catalyzes the trimethylation of histone H3 on Lys 27, and represses gene transcription. EZH2 enhances cancer-cell proliferation and regulates stem cell maintenance and differentiation. Here, we demonstrate that EZH2 is highly expressed in medulloblastoma, a highly malignant brain tumor of childhood, and this altered expression is correlated with genomic gain of chromosome 7 in a subset of medulloblastoma. Inhibition of EZH2 by RNAi suppresses medulloblastoma tumor cell growth. We show that 3-deazaneplanocin A, a chemical inhibitor of EZH2, can suppress medulloblastoma cell growth partially by inducing apoptosis. Suppression of EZH2 expression diminishes the ability of tumor cells to form spheres in culture and strongly represses the ability of known oncogenes to transform neural stem cells. These findings establish a role of EZH2 in medulloblastoma and identify EZH2 as a potential therapeutic target especially in high-risk tumors. PMID:22287205

Bombyx mori nucleopolyhedrovirus nucleic acid binding proteins BRO-B and BRO-E associate with host T-cell intracellular antigen 1 homologue BmTRN-1 to influence protein synthesis during infection.

Science.gov (United States)

Kotani, Eiji; Muto, Sayaka; Ijiri, Hiroshi; Mori, Hajime

2015-07-01

Previous reports have indicated that the Bombyx mori nucleopolyhedrovirus (BmNPV) nucleic acid binding proteins BRO-B and BRO-E are expressed during the early stage of infection and that the BRO family likely supports the regulation of mRNA; however, no study has directly examined the function of BRO family proteins in virus-permissive cells. Here, we show that BRO-B and BRO-E associate with cellular T-cell intracellular antigen 1 homologue (BmTRN-1), a translational regulator, and other cellular translation-related proteins in silkworm cells during viral infection. We created BM-N cells that expressed BRO-B/E to study molecular interactions between BmTRN-1 and BRO-B/E and how they influenced protein synthesis. Fluorescent microscopy revealed that BmTRN-1 was localized in cytoplasmic foci during BmNPV infection. Immunofluorescence studies confirmed that BmTRN-1 and BRO-B/E were colocalized in the amorphous conspicuous cytoplasmic foci. Reporter gene studies revealed that co-expression of BRO-B/E synergistically led to a significant decrease in protein synthesis from a designed transcript carrying the 5'untranslated region of a cellular mRNA with no significant change of transcript abundance. Additionally, RNA interference-mediated knockdown of BmTRN-1 resulted in a marked inhibition of the ability of BRO-B/E to regulate the transcript. These results suggested that the association of BmTRN-1 with BRO-B/E is responsible for the inhibitory regulation of certain mRNAs at the post-transcriptional level and add an additional mechanism for how baculoviruses control protein synthesis during infection.

Identification and characterization of the ESAT-6 homologue of Mycobacterium leprae and T-cell cross-reactivity with Mycobacterium tuberculosis

NARCIS (Netherlands)

Geluk, Annemieke; van Meijgaarden, Krista E.; Franken, Kees L. M. C.; Subronto, Yanri W.; Wieles, Brigitte; Arend, Sandra M.; Sampaio, Elizabeth P.; de Boer, Tjitske; Faber, William R.; Naafs, Ben; Ottenhoff, Tom H. M.

2002-01-01

In this paper we describe identification and characterization of Mycobacterium leprae ESAT-6 (L-ESAT-6), the homologue of M. tuberculosis ESAT-6 (T-ESAT-6). T-ESAT-6 is expressed by all pathogenic strains belonging to the M. tuberculosis complex but is absent from virtually all other mycobacterial

4-Oxalocrotonate tautomerase, its homologue YwhB, and active vinylpyruvate hydratase : Synthesis and evaluation of 2-fluoro substrate analogues

NARCIS (Netherlands)

Johnson, William H; Wang, Susan C; Stanley, Thanuja M; Czerwinski, Robert M; Almrud, Jeffrey J; Poelarends, Gerrit J; Murzin, Alexey G; Whitman, Christian P

2004-01-01

A series of 2-fluoro-4-alkene and 2-fluoro-4-alkyne substrate analogues were synthesized and examined as potential inhibitors of three enzymes: 4-oxalocrotonate tautomerase (4-OT) and vinylpyruvate hydratase (VPH) from the catechol meta-fission pathway and a closely related 4-OT homologue found in

The use of polynuclear aromatic hydrocarbon (PAH) alkyl homologues in determining petroleum source identification and weathering

International Nuclear Information System (INIS)

Brown, J.S.; Boehm, P.D.; Sauer, T.C.; Wong, W.M.C.

1993-01-01

Techniques utilizing double ratio plots of selected polynuclear aromatic hydrocarbon (PAH) alkyl homologues were used to identify and distinguish crude oils and refined petroleum products from each other and to distinguish petroleum sources in complex pollutant regimes. Petroleum samples were fractionated by high performance liquid chromatography (HPLC) into saturated and aromatic (PAH) hydrocarbon fractions. The saturated hydrocarbon fractions were then analyzed by gas chromatography/flame ionization detection (GC/FID) to obtain a resolved/unresolved alkane fingerprint of each oil. The aromatic fractions of the oils were analyzed by gas chromatography/mass spectrometry (GC/MS) for PAH and selected alkyl homologues. Comparisons of the saturated hydrocarbon fingerprints indicated that some oils were indistinguishable based on the alkane fingerprint alone. Another double ratio plot of the alkyl chrysenes and alkyl dibenzothiophenes was effective in establishing the weathering of oil in environmental samples which were processed using the same analytical techniques, since the dibenzothiophenes are degraded more rapidly than the chrysenes. The application of selected ratios in oil spill source identification in complex environmental samples from Suisin Bay California and Boston Harbor are discussed. The use of ratios to measure the extent of weathering in oil spill samples from Prince William Sound and the Gulf of Alaska is examined

The SANT2 domain of the murine tumor cell DnaJ-like protein 1 human homologue interacts with alpha1-antichymotrypsin and kinetically interferes with its serpin inhibitory activity.

Science.gov (United States)

Kroczynska, Barbara; Evangelista, Christina M; Samant, Shalaka S; Elguindi, Ebrahim C; Blond, Sylvie Y

2004-03-19

The murine tumor cell DnaJ-like protein 1 or MTJ1/ERdj1 is a membrane J-domain protein enriched in microsomal and nuclear fractions. We previously showed that its lumenal J-domain stimulates the ATPase activity of the molecular chaperone BiP/GRP78 (Chevalier, M., Rhee, H., Elguindi, E. C., and Blond, S. Y. (2000) J. Biol. Chem. 275, 19620-19627). MTJ1/ERdj1 also contains a large carboxyl-terminal cytosolic extension composed of two tryptophan-mediated repeats or SANT domains for which the function(s) is unknown. Here we describe the cloning of the human homologue HTJ1 and its interaction with alpha(1)-antichymotrypsin (ACT), a member of the serine proteinase inhibitor (serpin) family. The interaction was initially identified in a two-hybrid screening and further confirmed in vitro by dot blots, native electrophoresis, and fluorescence studies. The second SANT domain of HTJ1 (SANT2) was found to be sufficient for binding to ACT, both in yeast and in vitro. Single tryptophan-alanine substitutions at two strictly conserved residues significantly (Trp-497) or totally (Trp-520) abolished the interaction with ACT. SANT2 binds to human ACT with an intrinsic affinity equal to 0.5 nm. Preincubation of ACT with nearly stoichiometric concentrations of SANT2 wild-type but not SANT2: W520A results in an apparent loss of ACT inhibitory activity toward chymotrypsin. Kinetic analysis indicates that the formation of the covalent inhibitory complex ACT-chymotrypsin is significantly delayed in the presence of SANT2 with no change on the catalytic efficiency of the enzyme. This work demonstrates for the first time that the SANT2 domain of MTJ1/HTJ1/ERdj1 mediates stable and high affinity protein-protein interactions.

The actin homologue MreB organizes the bacterial cell membrane.

Science.gov (United States)

Strahl, Henrik; Bürmann, Frank; Hamoen, Leendert W

2014-03-07

The eukaryotic cortical actin cytoskeleton creates specific lipid domains, including lipid rafts, which determine the distribution of many membrane proteins. Here we show that the bacterial actin homologue MreB displays a comparable activity. MreB forms membrane-associated filaments that coordinate bacterial cell wall synthesis. We noticed that the MreB cytoskeleton influences fluorescent staining of the cytoplasmic membrane. Detailed analyses combining an array of mutants, using specific lipid staining techniques and spectroscopic methods, revealed that MreB filaments create specific membrane regions with increased fluidity (RIFs). Interference with these fluid lipid domains (RIFs) perturbs overall lipid homeostasis and affects membrane protein localization. The influence of MreB on membrane organization and fluidity may explain why the active movement of MreB stimulates membrane protein diffusion. These novel MreB activities add additional complexity to bacterial cell membrane organization and have implications for many membrane-associated processes.

Drosophila homologues of adenomatous polyposis coli (APC) and the formin diaphanous collaborate by a conserved mechanism to stimulate actin filament assembly.

Science.gov (United States)

Jaiswal, Richa; Stepanik, Vince; Rankova, Aneliya; Molinar, Olivia; Goode, Bruce L; McCartney, Brooke M

2013-05-10

Vertebrate APC collaborates with Dia through its Basic domain to assemble actin filaments. Despite limited sequence homology between the vertebrate and Drosophila APC Basic domains, Drosophila APC1 collaborates with Dia to stimulate actin assembly in vitro. The mechanism of actin assembly is highly conserved over evolution. APC-Dia collaborations may be crucial in a wide range of animal cells. Adenomatous polyposis coli (APC) is a large multidomain protein that regulates the cytoskeleton. Recently, it was shown that vertebrate APC through its Basic domain directly collaborates with the formin mDia1 to stimulate actin filament assembly in the presence of nucleation barriers. However, it has been unclear whether these activities extend to homologues of APC and Dia in other organisms. Drosophila APC and Dia are each required to promote actin furrow formation in the syncytial embryo, suggesting a potential collaboration in actin assembly, but low sequence homology between the Basic domains of Drosophila and vertebrate APC has left their functional and mechanistic parallels uncertain. To address this question, we purified Drosophila APC1 and Dia and determined their individual and combined effects on actin assembly using both bulk fluorescence assays and total internal reflection fluorescence microscopy. Our data show that APC1, similar to its vertebrate homologue, bound to actin monomers and nucleated and bundled filaments. Further, Drosophila Dia nucleated actin assembly and protected growing filament barbed ends from capping protein. Drosophila APC1 and Dia directly interacted and collaborated to promote actin assembly in the combined presence of profilin and capping protein. Thus, despite limited sequence homology, Drosophila and vertebrate APCs exhibit highly related activities and mechanisms and directly collaborate with formins. These results suggest that APC-Dia interactions in actin assembly are conserved and may underlie important in vivo functions in a broad

Human CD4+ T cell responses to the dog major allergen Can f 1 and its human homologue tear lipocalin resemble each other.

Directory of Open Access Journals (Sweden)

Aino L K Liukko

Full Text Available Lipocalin allergens form a notable group of proteins, as they contain most of the significant respiratory allergens from mammals. The basis for the allergenic capacity of allergens in the lipocalin family, that is, the development of T-helper type 2 immunity against them, is still unresolved. As immunogenicity has been proposed to be a decisive feature of allergens, the purpose of this work was to examine human CD4+ T cell responses to the major dog allergen Can f 1 and to compare them with those to its human homologue, tear lipocalin (TL. For this, specific T cell lines were induced in vitro from the peripheral blood mononuclear cells of Can f 1-allergic and healthy dog dust-exposed subjects with peptides containing the immunodominant T cell epitopes of Can f 1 and the corresponding TL peptides. We found that the frequency of Can f 1 and TL-specific T cells in both subject groups was low and close to each other, the difference being about two-fold. Importantly, we found that the proliferative responses of both Can f 1 and TL-specific T cell lines from allergic subjects were stronger than those from healthy subjects, but that the strength of the responses within the subject groups did not differ between these two antigens. Moreover, the phenotype of the Can f 1 and TL-specific T cell lines, determined by cytokine production and expression of cell surface markers, resembled each other. The HLA system appeared to have a minimal role in explaining the allergenicity of Can f 1, as the allergic and healthy subjects' HLA background did not differ, and HLA binding was very similar between Can f 1 and TL peptides. Along with existing data on lipocalin allergens, we conclude that strong antigenicity is not decisive for the allergenicity of Can f 1.

Cloning and Characterization of the Genes Encoding the Murine Homologues of the Human Melanoma Antigens MART1 and gp100

Science.gov (United States)

Zhai, Yifan; Yang, James C.; Spiess, Paul; Nishimura, Michael I.; Overwijk, Willem W.; Roberts, Bruce; Restifo, Nicholas P.; Rosenberg, Steven A.

2008-01-01

The recent identification of genes encoding melanoma-associated antigens has opened new possibilities for the development of cancer vaccines designed to cause the rejection of established tumors. To develop a syngeneic animal model for evaluating antigen-specific vaccines in cancer therapy, the murine homologues of the human melanoma antigens MART1 and gp 100, which were specifically recognized by tumor-infiltrating lymphocytes from patients with melanoma, were cloned and sequenced from a murine B16 melanoma cDNA library. The open reading frames of murine MART1 and gp 100 encode proteins of 113- and 626-amino acids with 68.8 and 77% identity to the respective human proteins. Comparison of the DNA sequences of the murine MART1 genes, derived from normal melanocytes, the immortalized nontumorgenic melanocyte line Melan-a and the B16 melanoma, showed all to be identical. Northern and Western blot analyses confirmed that both genes encoded products that were melanocyte lineage proteins. Mice immunized with murine MART1 or gp 100 using recombinant vaccinia virus failed to produce any detectable T-cell responses or protective immunity against B16 melanoma. In contrast, immunization of mice with human gp 100 using recombinant adenoviruses elicited T cells specific for hgp100, but these T cells also cross reacted with B16 tumor in vitro and induced significant but weak protection against B16 challenge. Immunization with human and mouse gp100 together [adenovirus type 2 (Ad2)-hep100 plus recombinant vaccinia virus (rVV)-mgp100], or immunization with human gp100 (Ad2-hgp100) and boosting with heterologous vector (rVV-hgp100 or rVV-mgp100) or homologous vector (Ad2-hgp100), did not significantly enhance the protective response against B16 melanoma. These results may suggest that immunization with heterologous tumor antigen, rather than self, may be more effective as an immunotherapeutic reagent in designing antigen-specific cancer vaccines. PMID:9101410

Insertion of a specific fungal 3'-phosphoadenosine-5'-phosphatase motif into a plant homologue improves halotolerance and drought tolerance of plants.

Science.gov (United States)

Gašparič, Meti Buh; Lenassi, Metka; Gostinčar, Cene; Rotter, Ana; Plemenitaš, Ana; Gunde-Cimerman, Nina; Gruden, Kristina; Zel, Jana

2013-01-01

Soil salinity and drought are among the most serious agricultural and environmental problems of today. Therefore, investigations of plant resistance to abiotic stress have received a lot of attention in recent years. In this study, we identified the complete coding sequence of a 3'-phosphoadenosine-5'-phosphatase protein, ApHal2, from the halotolerant yeast Aureobasidium pullulans. Expression of the ApHAL2 gene in a Saccharomyces cerevisiae hal2 mutant complemented the mutant auxotrophy for methionine, and rescued the growth of the hal2 mutant in media with high NaCl concentrations. A 21-amino-acids-long region of the ApHal2 enzyme was inserted into the Arabidopsis thaliana homologue of Hal2, the SAL1 phosphatase. The inserted sequence included the META motif, which has previously been implicated in increased sodium tolerance of the Hal2 homologue from a related fungal species. Transgenic Arabidopsis plants overexpressing this modified SAL1 (mSAL1) showed improved halotolerance and drought tolerance. In a medium with an elevated salt concentration, mSAL1-expressing plants were twice as likely to have roots in a higher length category in comparison with the wild-type Arabidopsis and with plants overexpressing the native SAL1, and had 5% to 10% larger leaf surface area under moderate and severe salt stress, respectively. Similarly, after moderate drought exposure, the mSAL1-expressing plants showed 14% increased dry weight after revitalisation, with no increase in dry weight of the wild-type plants. With severe drought, plants overexpressing native SAL1 had the worst rehydration success, consistent with the recently proposed role of SAL1 in severe drought. This was not observed for plants expressing mSAL1. Therefore, the presence of this fungal META motif sequence is beneficial under conditions of increased salinity and moderate drought, and shows no drawbacks for plant survival under severe drought. This demonstrates that adaptations of extremotolerant fungi should

Understanding the genetic and molecular pathogenesis of Friedreich’s ataxia through animal and cellular models

Science.gov (United States)

Martelli, Alain; Napierala, Marek; Puccio, Hélène

2012-01-01

In 1996, a link was identified between Friedreich’s ataxia (FRDA), the most common inherited ataxia in men, and alterations in the gene encoding frataxin (FXN). Initial studies revealed that the disease is caused by a unique, most frequently biallelic, expansion of the GAA sequence in intron 1 of FXN. Since the identification of this link, there has been tremendous progress in understanding frataxin function and the mechanism of FRDA pathology, as well as in developing diagnostics and therapeutic approaches for the disease. These advances were the subject of the 4th International Friedreich’s Ataxia Conference held on 5th–7th May in the Institut de Génétique et de Biologie Moléculaire et Cellulaire, Illkirch, France. More than 200 scientists gathered from all over the world to present the results of research spanning all areas of investigation into FRDA (including clinical aspects, FRDA pathogenesis, genetics and epigenetics of the disease, development of new models of FRDA, and drug discovery). This review provides an update on the understanding of frataxin function, developments of animal and cellular models of the disease, and recent advances in trying to uncover potential molecules for therapy. PMID:22382366

Molecular cloning and expression of the human homologue of the murine gene encoding myeloid leukemia-inhibitory factor

International Nuclear Information System (INIS)

Gough, N.M.; Gearing, D.P.; King, J.A.; Willson, T.A.; Hilton, D.J.; Nicola, N.A.; Metcalf, D.

1988-01-01

A human homologue of the recently cloned murine leukemia-inhibitory factor (LIF) gene was isolated from a genomic library by using the marine cDNA as a hybridization probe. The nucleotide sequence of the human gene indicated that human LIF has 78% amino acid sequence identity with murine LIF, with no insertions or deletions, and that the region of the human gene encoding the mature protein has one intervening sequence. After oligonucleotide-mediated mutagenesis, the mature protein-coding region of the LIF gene was introduced into the yeast expression vector YEpsec1. Yeast cells transformed with the resulting recombinant could be induced with galactose to produce high levels of a factor that induced the differentiation of murine M1 leukemic cells in a manner analogous to murine LIF. This factor competed with 125 I-labeled native murine LIF for binding to specific cellular receptors on murine cells, compatible with a high degree of structural similarity between the murine and human factors

Isolation of a cotton NADP(H oxidase homologue induced by drought stress

Directory of Open Access Journals (Sweden)

NEPOMUCENO ALEXANDRE LIMA

2000-01-01

Full Text Available The aim of this study was to identify and isolate genes that are differentially expressed in four selected cotton (Gossypium hirsutum L. genotypes contrasting according to their tolerance to water deficit. The genotypes studied were Siokra L-23, Stoneville 506, CS 50 and T-1521. Physiological, morphological and developmental changes that confer drought tolerance in plants must have a molecular genetic basis. To identify and isolate the genes, the mRNA Differential Display (DD technique was used. Messenger RNAs differentially expressed during water deficit were identified, isolated, cloned and sequenced. The cloned transcript A12B15-5, a NADP(H oxidase homologue, was up regulated only during the water deficit stress and only in Siokra L-23, a drought tolerant genotype. Ribonuclease protection assay confirmed that transcription.

Meticillin-resistant Staphylococcus aureus with a novel mecA homologue in human and bovine populations in the UK and Denmark: a descriptive study.

Science.gov (United States)

García-Álvarez, Laura; Holden, Matthew T G; Lindsay, Heather; Webb, Cerian R; Brown, Derek F J; Curran, Martin D; Walpole, Enid; Brooks, Karen; Pickard, Derek J; Teale, Christopher; Parkhill, Julian; Bentley, Stephen D; Edwards, Giles F; Girvan, E Kirsty; Kearns, Angela M; Pichon, Bruno; Hill, Robert L R; Larsen, Anders Rhod; Skov, Robert L; Peacock, Sharon J; Maskell, Duncan J; Holmes, Mark A

2011-08-01

Animals can act as a reservoir and source for the emergence of novel meticillin-resistant Staphylococcus aureus (MRSA) clones in human beings. Here, we report the discovery of a strain of S aureus (LGA251) isolated from bulk milk that was phenotypically resistant to meticillin but tested negative for the mecA gene and a preliminary investigation of the extent to which such strains are present in bovine and human populations. Isolates of bovine MRSA were obtained from the Veterinary Laboratories Agency in the UK, and isolates of human MRSA were obtained from diagnostic or reference laboratories (two in the UK and one in Denmark). From these collections, we searched for mecA PCR-negative bovine and human S aureus isolates showing phenotypic meticillin resistance. We used whole-genome sequencing to establish the genetic basis for the observed antibiotic resistance. A divergent mecA homologue (mecA(LGA251)) was discovered in the LGA251 genome located in a novel staphylococcal cassette chromosome mec element, designated type-XI SCCmec. The mecA(LGA251) was 70% identical to S aureus mecA homologues and was initially detected in 15 S aureus isolates from dairy cattle in England. These isolates were from three different multilocus sequence type lineages (CC130, CC705, and ST425); spa type t843 (associated with CC130) was identified in 60% of bovine isolates. When human mecA-negative MRSA isolates were tested, the mecA(LGA251) homologue was identified in 12 of 16 isolates from Scotland, 15 of 26 from England, and 24 of 32 from Denmark. As in cows, t843 was the most common spa type detected in human beings. Although routine culture and antimicrobial susceptibility testing will identify S aureus isolates with this novel mecA homologue as meticillin resistant, present confirmatory methods will not identify them as MRSA. New diagnostic guidelines for the detection of MRSA should consider the inclusion of tests for mecA(LGA251). Department for Environment, Food and Rural Affairs

In human pseudouridine synthase 1 (hPus1), a C-terminal helical insert blocks tRNA from binding in the same orientation as in the Pus1 bacterial homologue TruA, consistent with their different target selectivities.

Science.gov (United States)

Czudnochowski, Nadine; Wang, Amy Liya; Finer-Moore, Janet; Stroud, Robert M

2013-10-23

Human pseudouridine (Ψ) synthase Pus1 (hPus1) modifies specific uridine residues in several non-coding RNAs: tRNA, U2 spliceosomal RNA, and steroid receptor activator RNA. We report three structures of the catalytic core domain of hPus1 from two crystal forms, at 1.8Å resolution. The structures are the first of a mammalian Ψ synthase from the set of five Ψ synthase families common to all kingdoms of life. hPus1 adopts a fold similar to bacterial Ψ synthases, with a central antiparallel β-sheet flanked by helices and loops. A flexible hinge at the base of the sheet allows the enzyme to open and close around an electropositive active-site cleft. In one crystal form, a molecule of Mes [2-(N-morpholino)ethane sulfonic acid] mimics the target uridine of an RNA substrate. A positively charged electrostatic surface extends from the active site towards the N-terminus of the catalytic domain, suggesting an extensive binding site specific for target RNAs. Two α-helices C-terminal to the core domain, but unique to hPus1, extend along the back and top of the central β-sheet and form the walls of the RNA binding surface. Docking of tRNA to hPus1 in a productive orientation requires only minor conformational changes to enzyme and tRNA. The docked tRNA is bound by the electropositive surface of the protein employing a completely different binding mode than that seen for the tRNA complex of the Escherichia coli homologue TruA. Copyright © 2013 Elsevier Ltd. All rights reserved.

Metal Homeostasis Regulators Suppress FRDA Phenotypes in a Drosophila Model of the Disease.

Directory of Open Access Journals (Sweden)

Sirena Soriano

Full Text Available Friedreich's ataxia (FRDA, the most commonly inherited ataxia in populations of European origin, is a neurodegenerative disorder caused by a decrease in frataxin levels. One of the hallmarks of the disease is the accumulation of iron in several tissues including the brain, and frataxin has been proposed to play a key role in iron homeostasis. We found that the levels of zinc, copper, manganese and aluminum were also increased in a Drosophila model of FRDA, and that copper and zinc chelation improve their impaired motor performance. By means of a candidate genetic screen, we identified that genes implicated in iron, zinc and copper transport and metal detoxification can restore frataxin deficiency-induced phenotypes. Taken together, these results demonstrate that the metal dysregulation in FRDA includes other metals besides iron, therefore providing a new set of potential therapeutic targets.

Investigation of evaporation characteristics of polonium and its lighter homologues selenium and tellurium from liquid Pb-Bi-eutecticum

CERN Document Server

Neuhausen, J; Eichler, B

2004-01-01

The evaporation behaviour of polonium and its lighter homologues selenium and tellurium dissolved in liquid Pb-Bi-eutecticum (LBE) has been studied at various temperatures in the range from 482 K up to 1330 K under Ar/H2 and Ar/H2O-atmospheres using γ-ray spectroscopy. Polonium release in the temperature range of interest for technical applications is slow. Within short term (1h) experiments measurable amounts of polonium are evaporated only at temperatures above 973 K. Long term experiments reveal that a slow evaporation of polonium occurs at temperatures around 873 K resulting in a fractional polonium loss of the melt around 1% per day. Evaporation rates of selenium and tellurium are smaller than those of polonium. The presence of H2O does not enhance the evaporation within the error limits of our experiments. The thermodynamics and possible reaction pathways involved in polonium release from LBE are discussed.

TMBP200, a XMAP215 homologue of tobacco BY-2 cells, has an essential role in plant mitosis.

Science.gov (United States)

Yasuhara, Hiroki; Oe, Yuki

2011-07-01

TMBP200 from tobacco BY-2 cells is a member of the highly conserved family of microtubule-associated proteins that includes Xenopus XMAP215, human TOGp, and Arabidopsis MOR1/GEM1. XMAP215 homologues have an essential role in spindle assembly and function in animals and yeast, but their role in plant mitosis is not fully clarified. Here, we show by immunoblot analysis that TMBP200 levels in synchronously cultured BY-2 cells increased when the cells entered mitosis, thus indicating that TMBP200 plays an important role in mitosis in tobacco. To investigate the role of TMBP200 in mitosis, we employed inducible RNA interference to silence TMBP200 expression in BY-2 cells. The resulting depletion of TMBP200 caused severe defects in bipolar spindle formation and resulted in the appearance of multinucleated cells with variable-sized nuclei. This finding indicates that TMBP200 has an essential role in bipolar spindle formation and function.

CRP-ductin, the mouse homologue of gp-340/deleted in malignant brain tumors 1 (DMBT1), binds gram-positive and gram-negative bacteria and interacts with lung surfactant protein D

DEFF Research Database (Denmark)

Madsen, Jens; Tornøe, Ida; Nielsen, Ole

2003-01-01

CRP-ductin is a protein expressed mainly by mucosal epithelial cells in the mouse. Sequence homologies indicate that CRP-ductin is the mouse homologue of human gp-340, a glycoprotein that agglutinates microorganisms and binds the lung mucosal collectin surfactant protein-D (SP-D). Here we report...... that purified CRP-ductin binds human SP-D in a calcium-dependent manner and that the binding is not inhibited by maltose. The same properties have previously been observed for gp-340 binding of SP-D. CRP-ductin also showed calcium-dependent binding to both gram-positive and -negative bacteria. A polyclonal...... antibody raised against gp-340 reacted specifically with CRP-ductin in Western blots. Immunoreactivity to CRP-ductin was found in the exocrine pancreas, in epithelial cells throughout the gastrointestinal tract and in the parotid ducts. A panel of RNA preparations from mouse tissues was screened for CRP...

Crystal structure of a bacterial homologue of the bile acid sodium symporter ASBT

Science.gov (United States)

Hu, Nien-Jen; Iwata, So; Cameron, Alexander D.; Drew, David

2011-01-01

High cholesterol levels greatly increase the risk of cardiovascular disease. By its conversion into bile acids, about 50% of cholesterol is eliminated from the body. However bile acids released from the bile duct are constantly recycled, being reabsorbed in the intestine via the Apical Sodium dependent Bile acid Transporter (ASBT). It has been shown in animal models that plasma cholesterol levels are significantly lowered by specific inhibitors of ASBT1,2, thus ASBT is a target for hypercholesterolemia drugs. Here, we describe the crystal structure of a bacterial homologue of ASBT from Neisseria meningitidis (ASBTNM) at 2.2Å. ASBTNM contains two inverted structural repeats of five transmembrane helices. A Core domain of six helices harbours two sodium ions while the remaining helices form a Panel-like domain. Overall the architecture of the protein is remarkably similar to the sodium-proton antiporter NhaA3 despite no detectable sequence homology. A bile acid molecule is situated between the Core and Panel domains in a large hydrophobic cavity. Residues near to this cavity have been shown to affect the binding of specific inhibitors of human ASBT4. The position of the bile acid together with the molecular architecture suggests the rudiments of a possible transport mechanism. PMID:21976025

The TFIID components human TAF(II)140 and Drosophila BIP2 (TAF(II)155) are novel metazoan homologues of yeast TAF(II)47 containing a histone fold and a PHD finger.

Science.gov (United States)

Gangloff, Y G; Pointud, J C; Thuault, S; Carré, L; Romier, C; Muratoglu, S; Brand, M; Tora, L; Couderc, J L; Davidson, I

2001-08-01

The RNA polymerase II transcription factor TFIID comprises the TATA binding protein (TBP) and a set of TBP-associated factors (TAF(II)s). TFIID has been extensively characterized for yeast, Drosophila, and humans, demonstrating a high degree of conservation of both the amino acid sequences of the constituent TAF(II)s and overall molecular organization. In recent years, it has been assumed that all the metazoan TAF(II)s have been identified, yet no metazoan homologues of yeast TAF(II)47 (yTAF(II)47) and yTAF(II)65 are known. Both of these yTAF(II)s contain a histone fold domain (HFD) which selectively heterodimerizes with that of yTAF(II)25. We have cloned a novel mouse protein, TAF(II)140, containing an HFD and a plant homeodomain (PHD) finger, which we demonstrated by immunoprecipitation to be a mammalian TFIID component. TAF(II)140 shows extensive sequence similarity to Drosophila BIP2 (dBIP2) (dTAF(II)155), which we also show to be a component of Drosophila TFIID. These proteins are metazoan homologues of yTAF(II)47 as their HFDs selectively heterodimerize with dTAF(II)24 and human TAF(II)30, metazoan homologues of yTAF(II)25. We further show that yTAF(II)65 shares two domains with the Drosophila Prodos protein, a recently described potential dTAF(II). These conserved domains are critical for yTAF(II)65 function in vivo. Our results therefore identify metazoan homologues of yTAF(II)47 and yTAF(II)65.

Analysis of dofA, a fruA-Dependent Developmental Gene, and Its Homologue, dofB, in Myxococcus xanthus

OpenAIRE

Horiuchi, Takayuki; Akiyama, Takuya; Inouye, Sumiko; Komano, Teruya

2002-01-01

The developmentally regulated gene dofA, identified from pulse-labeling experiments by two-dimensional gel electrophoresis, and its homologue, dofB, were cloned and characterized in Myxococcus xanthus. Deletion of dofA and dofB did not affect the vegetative growth and development of M. xanthus. dofA was specifically expressed during development, while dofB expression was observed during vegetative growth and development. The dofA-lacZ fusion was introduced into a fruA mutant and A, B, C, D, a...

Broad anti-HIV activity of the Oscillatoria agardhii agglutinin homologue lectin family.

Science.gov (United States)

Férir, Geoffrey; Huskens, Dana; Noppen, Sam; Koharudin, Leonardus M I; Gronenborn, Angela M; Schols, Dominique

2014-10-01

Oscillatoria agardhii agglutinin homologue (OAAH) proteins belong to a recently discovered lectin family. The founding member OAA and a designed hybrid OAAH (OPA) recognize similar but unique carbohydrate structures of Man-9, compared with other antiviral carbohydrate-binding agents (CBAs). These two newly described CBAs were evaluated for their inactivating properties on HIV replication and transmission and for their potential as microbicides. Various cellular assays were used to determine antiviral activity against wild-type and certain CBA-resistant HIV-1 strains: (i) free HIV virion infection in human T lymphoma cell lines and PBMCs; (ii) syncytium formation assay using persistently HIV-infected T cells and non-infected CD4+ T cells; (iii) DC-SIGN-mediated viral capture; and (iv) transmission to uninfected CD4+ T cells. OAA and OPA were also evaluated for their mitogenic properties and potential synergistic effects using other CBAs. OAA and OPA inhibit HIV replication, syncytium formation between HIV-1-infected and uninfected T cells, DC-SIGN-mediated HIV-1 capture and transmission to CD4+ target T cells, thereby rendering a variety of HIV-1 and HIV-2 clinical isolates non-infectious, independent of their coreceptor use. Both CBAs competitively inhibit the binding of the Manα(1-2)Man-specific 2G12 monoclonal antibody (mAb) as shown by flow cytometry and surface plasmon resonance analysis. The HIV-1 NL4.3(2G12res), NL4.3(MVNres) and IIIB(GRFTres) strains were equally inhibited as the wild-type HIV-1 strains by these CBAs. Combination studies indicate that OAA and OPA act synergistically with Hippeastrum hybrid agglutinin, 2G12 mAb and griffithsin (GRFT), with the exception of OPA/GRFT. OAA and OPA are unique CBAs with broad-spectrum anti-HIV activity; however, further optimization will be necessary for microbicidal application. © The Author 2014. Published by Oxford University Press on behalf of the British Society for Antimicrobial Chemotherapy. All rights

In vivo metabolism of the methyl homologues of delta-8-tetrahydrocannabinol, delta-9-tetrahydrocannabinol and abn-delta-8-tetrahydrocannabinol in the mouse.

Science.gov (United States)

Brown, N K; Harvey, D J

1988-04-01

Methyl-delta-8-tetrahydrocannabinol (methyl-delta-8-THC), methyl-delta-9-THC and abn-methyl-delta-8-THC were synthesized by condensation of orcinol and (1S)-cis-verbenol and were administered to male Charles River CD-1 mice. Extracted hepatic metabolites were isolated by chromatography on Sephadex LH-20 and examined by gas chromatography/mass spectrometry as trimethylsilyl (TMS), (2H9)TMS and methyl ester/TMS derivatives. In addition, metabolic fractions were reduced with lithium aluminium deuteride to convert carboxylic acids to alcohols for structural correlation. Metabolites from methyl-delta-8-THC were similar with respect to the positions substituted to those produced by higher homologues; the major metabolite was methyl-delta-8-THC-11-oic acid. abn-Methyl-delta-8-THC was metabolized in a different manner. The location of the aromatic methyl group at the position adjacent to ring fusion appeared to inhibit metabolism at C(11) to a considerable extent and also to reduce the amount of the resulting alcohol from being oxidized to a carboxylic acid. This caused other metabolic pathways to become dominant, with the result that a compound containing a hydroxy group at the gem-methyl position was the major metabolite. Hydroxylation at this position has not been confirmed with any other cannabinoid, although it is thought to result in trace concentrations of hydroxy metabolites from some compounds. Metabolism of methyl-delta-9-THC was also similar to that of the higher homologues, with the exception that less metabolism occurred at C(8) and a higher percentage of the total metabolic fraction was accounted for by the 11-oic acid metabolite. Minor metabolites were mainly dihydroxy compounds and hydroxylated derivatives of delta-9-THC-11-oic acid.

Determination of vitamin K homologues by high-performance liquid chromatography with on-line photoreactor and peroxyoxalate chemiluminescence detection

International Nuclear Information System (INIS)

Ahmed, Sameh; Kishikawa, Naoya; Nakashima, Kenichiro; Kuroda, Naotaka

2007-01-01

A sensitive and highly selective high-performance liquid chromatography (HPLC) method was developed for the determination of vitamin K homologues including phylloquinone (PK), menaquinone-4 (MK-4) and menaquinone-7 (MK-7) in human plasma using post-column peroxyoxalate chemiluminescence (PO-CL) detection following on-line ultraviolet (UV) irradiation. The method was based on ultraviolet irradiation (254 nm, 15 W) of vitamin K to produce hydrogen peroxide and a fluorescent product at the same time, which can be determined with PO-CL detection. The separation of vitamin K by HPLC was accomplished isocratically on an ODS column within 35 min. The method involves the use of 2-methyl-3-pentadecyl-1,4-naphthoquinone as an internal standard. The detection limits (signal-to-noise ratio = 3) were 32, 38 and 85 fmol for PK, MK-4 and MK-7, respectively. The recoveries of PK, MK-4 and MK-7 were greater than 82% and the inter- and intra-assay R.S.D. values were 1.9-5.4%. The sensitivity and selectivity of this method were sufficient for clinical and nutritional applications

Detection and Characterization of Homologues of Human Hepatitis Viruses and Pegiviruses in Rodents and Bats in Vietnam.

Science.gov (United States)

Van Nguyen, Dung; Van Nguyen, Cuong; Bonsall, David; Ngo, Tue Tri; Carrique-Mas, Juan; Pham, Anh Hong; Bryant, Juliet E; Thwaites, Guy; Baker, Stephen; Woolhouse, Mark; Simmonds, Peter

2018-02-28

Rodents and bats are now widely recognised as important sources of zoonotic virus infections in other mammals, including humans. Numerous surveys have expanded our knowledge of diverse viruses in a range of rodent and bat species, including their origins, evolution, and range of hosts. In this study of pegivirus and human hepatitis-related viruses, liver and serum samples from Vietnamese rodents and bats were examined by PCR and sequencing. Nucleic acids homologous to human hepatitis B, C, E viruses were detected in liver samples of 2 (1.3%) of 157 bats, 38 (8.1%), and 14 (3%) of 470 rodents, respectively. Hepacivirus-like viruses were frequently detected (42.7%) in the bamboo rat, Rhizomys pruinosus , while pegivirus RNA was only evident in 2 (0.3%) of 638 rodent serum samples. Complete or near-complete genome sequences of HBV, HEV and pegivirus homologues closely resembled those previously reported from rodents and bats. However, complete coding region sequences of the rodent hepacivirus-like viruses substantially diverged from all of the currently classified variants and potentially represent a new species in the Hepacivirus genus. Of the viruses identified, their routes of transmission and potential to establish zoonoses remain to be determined.

The oil palm Shell gene controls oil yield and encodes a homologue of SEEDSTICK

Science.gov (United States)

Singh, Rajinder; Leslie Low, Eng-Ti; Ooi, Leslie Cheng-Li; Ong-Abdullah, Meilina; Chin, Ting Ngoot; Nagappan, Jayanthi; Nookiah, Rajanaidu; Amiruddin, Mohd Din; Rosli, Rozana; Abdul Manaf, Mohamad Arif; Chan, Kuang-Lim; Halim, Mohd Amin; Azizi, Norazah; Lakey, Nathan; Smith, Steven W; Budiman, Muhammad A; Hogan, Michael; Bacher, Blaire; Van Brunt, Andrew; Wang, Chunyan; Ordway, Jared M; Sambanthamurthi, Ravigadevi; Martienssen, Robert A

2014-01-01

A key event in the domestication and breeding of the oil palm, Elaeis guineensis, was loss of the thick coconut-like shell surrounding the kernel. Modern E. guineensis has three fruit forms, dura (thick-shelled), pisifera (shell-less) and tenera (thin-shelled), a hybrid between dura and pisifera1–4. The pisifera palm is usually female-sterile but the tenera yields far more oil than dura, and is the basis for commercial palm oil production in all of Southeast Asia5. Here, we describe the mapping and identification of the Shell gene responsible for the different fruit forms. Using homozygosity mapping by sequencing we found two independent mutations in the DNA binding domain of a homologue of the MADS-box gene SEEDSTICK (STK) which controls ovule identity and seed development in Arabidopsis. The Shell gene is responsible for the tenera phenotype in both cultivated and wild palms from sub-Saharan Africa, and our findings provide a genetic explanation for the single gene heterosis attributed to Shell, via heterodimerization. This gene mutation explains the single most important economic trait in oil palm, and has implications for the competing interests of global edible oil production, biofuels and rainforest conservation6. PMID:23883930

The urokinase receptor and its structural homologue C4.4A in human cancer

DEFF Research Database (Denmark)

Jacobsen, B; Ploug, M

2008-01-01

The urokinase-type plasminogen activator receptor (uPAR) and its structural homologue C4.4A are multidomain members of the Ly6/uPAR/alpha-neurotoxin protein domain family. Both are glycosylphosphatidylinositol-anchored membrane glycoproteins encoded by neighbouring genes located on chromosome 19q13...... that high protein expression in tumour cells of non-small cell pulmonary adenocarcinomas is associated with a particularly severe disease progression. This review will evaluate structural-functional and disease-related aspects of uPAR and C4.4A with a view to possible pharmacological targeting strategies...... in the human genome. The structural relationship between the two proteins is, however, not reflected at the functional level. Whereas uPAR has a well-established role in regulating and focalizing uPA-mediated plasminogen activation to the surface of those cells expressing the receptor, the biological function...

Synthesis, electrochemistry, and electrogenerated chemiluminescence of two BODIPY-appended bipyridine homologues.

Science.gov (United States)

Qi, Honglan; Teesdale, Justin J; Pupillo, Rachel C; Rosenthal, Joel; Bard, Allen J

2013-09-11

Two new 2,2'-bipyridine (bpy) derivatives containing ancillary BODIPY chromophores attached at the 5- and 5'-positions (BB3) or 6- and 6'-positions (BB4) were prepared and characterized. In this work, the basic photophysics, electrochemistry, and electrogenerated chemiluminescence (ECL) of BB3 and BB4 are compared with those previously reported for a related bpy-BODIPY derivative (BB2) (J. Phys. Chem. C 2011, 115, 17993-18001). Cyclic voltammetry revealed that BB3 and BB4 display reversible 2e(-) oxidation and reduction waves, which consist of two closely spaced (50-70 mV) 1e(-) events. This redox behavior is consistent with the frontier molecular orbitals calculated for BB3 and BB4 and indicates that the 2,2'-bipyridine spacer of each bpy-BODIPY homologue does not facilitate efficient electronic communication between the tethered indacene units. In the presence of a coreactant such as tri-n-propylamine (TPA) or benzoyl peroxide (BPO), BB3 and BB4 exhibit strong ECL and produce spectra that are very similar to their corresponding photoluminescence profiles. The ECL signal obtained under annihilation conditions, however, is significantly different and is characterized by two distinct bands. One of these bands is centered at ∼570 nm and is attributed to emission via an S- or T-route. The second band occurs at longer wavelengths and is centered around ∼740 nm. The shape and concentration dependence of this long-wavelength ECL signal is not indicative of emission from an excimer or aggregate, but rather it suggests that a new emissive species is formed from the bpy-BODIPY luminophores during the annihilation process.

Synthesis, Electrochemistry and Electrogenerated Chemiluminesce of two BODIPY-Appended Bipyridine Homologues

Science.gov (United States)

Qi, Honglan; Teesdale, Justin J.; Pupillo, Rachel C.

2014-01-01

Two new 2,2’-bipyridine (bpy) derivatives containing ancillary BODIPY chromophores attached at the 5- and 5’-positions (BB3) or 6- and 6’-positions (BB4) were prepared and characterized. In this work, the basic photophysics, electrochemistry and electrogenerated chemiluminescence (ECL) of BB3 and BB4 are compared with those previously reported for a related bpy-BODIPY derivative (BB2) (J. Phys. Chem. C 2011, 115, 17993–18001). Cyclic voltammetry revealed that BB3 and BB4 display reversible 2e− oxidation and reduction waves, which consist of two closely spaced (50 – 70 mV) 1e− events. This redox behavior is consistent with the frontier molecular orbitals calculated for BB3 and BB4 and indicates that the 2,2’-bipyridine spacer of each bpy- BODIPY homologue does not facilitate efficient electronic communication between the tethered indacene units. In the presence of a coreactant such as tri-n-propylamine (TPA) or benzoyl peroxide (BPO), BB3 and BB4 exhibit strong ECL and produce spectra that are very similar to their corresponding photoluminescence profiles. The ECL signal obtained under annihilation conditions, however, is significantly different and is characterized by two distinct bands. One of these bands is centered at ~570 nm and is attributed to emission via an S- or T-route. The second band, occurs at longer wavelengths and is centered around ~740 nm. The shape and concentration dependence of this long-wavelength ECL signal is not indicative of emission from an excimer or aggregate, but rather is suggests that a new emissive species is formed from the bpy-BODIPY luminophores during the annihilation process. PMID:23980850

Identification and characterisation of the angiotensin converting enzyme-3 (ACE3 gene: a novel mammalian homologue of ACE

Directory of Open Access Journals (Sweden)

Phelan Anne

2007-06-01

Full Text Available Abstract Background Mammalian angiotensin converting enzyme (ACE plays a key role in blood pressure regulation. Although multiple ACE-like proteins exist in non-mammalian organisms, to date only one other ACE homologue, ACE2, has been identified in mammals. Results Here we report the identification and characterisation of the gene encoding a third homologue of ACE, termed ACE3, in several mammalian genomes. The ACE3 gene is located on the same chromosome downstream of the ACE gene. Multiple sequence alignment and molecular modelling have been employed to characterise the predicted ACE3 protein. In mouse, rat, cow and dog, the predicted protein has mutations in some of the critical residues involved in catalysis, including the catalytic Glu in the HEXXH zinc binding motif which is Gln, and ESTs or reverse-transcription PCR indicate that the gene is expressed. In humans, the predicted ACE3 protein has an intact HEXXH motif, but there are other deletions and insertions in the gene and no ESTs have been identified. Conclusion In the genomes of several mammalian species there is a gene that encodes a novel, single domain ACE-like protein, ACE3. In mouse, rat, cow and dog ACE3, the catalytic Glu is replaced by Gln in the putative zinc binding motif, indicating that in these species ACE3 would lack catalytic activity as a zinc metalloprotease. In humans, no evidence was found that the ACE3 gene is expressed and the presence of deletions and insertions in the sequence indicate that ACE3 is a pseudogene.

Enhancer of rudimentary homologue interacts with scaffold attachment factor B at the nuclear matrix to regulate SR protein phosphorylation.

Science.gov (United States)

Drakouli, Sotiria; Lyberopoulou, Aggeliki; Papathanassiou, Maria; Mylonis, Ilias; Georgatsou, Eleni

2017-08-01

Scaffold attachment factor B1 (SAFB1) is an integral component of the nuclear matrix of vertebrate cells. It binds to DNA on scaffold/matrix attachment region elements, as well as to RNA and a multitude of different proteins, affecting basic cellular activities such as transcription, splicing and DNA damage repair. In the present study, we show that enhancer of rudimentary homologue (ERH) is a new molecular partner of SAFB1 and its 70% homologous paralogue, scaffold attachment factor B2 (SAFB2). ERH interacts directly in the nucleus with the C-terminal Arg-Gly-rich region of SAFB1/2 and co-localizes with it in the insoluble nuclear fraction. ERH, a small ubiquitous protein with striking homology among species and a unique structure, has also been implicated in fundamental cellular mechanisms. Our functional analyses suggest that the SAFB/ERH interaction does not affect SAFB1/2 function in transcription (e.g. as oestrogen receptor α co-repressors), although it reverses the inhibition exerted by SAFB1/2 on the splicing kinase SR protein kinase 1 (SRPK1), which also binds on the C-terminus of SAFB1/2. Accordingly, ERH silencing decreases lamin B receptor and SR protein phosphorylation, which are major SRPK1 substrates, further substantiating the role of SAFB1 and SAFB2 in the co-ordination of nuclear function. © 2017 Federation of European Biochemical Societies.

Unique variability of tocopherol composition in various seed oils recovered from by-products of apple industry: rapid and simple determination of all four homologues (α, β, γ and δ) by RP-HPLC/FLD.

Science.gov (United States)

Górnaś, Paweł

2015-04-01

The tocochromanol profile was studied in seed oils recovered from by-products of fruit industry, five dessert and seven crab apple varieties grown in Eastern Europe (Latvia). The seed oils obtained from dessert apples were characterized by higher contents of tocopherols (191.05-379.08 mg/100g oil) when compared to seed oils recovered from crab apples (130.55-202.54 mg/100g oil). The predominant homologues of tocopherol in all the studied samples were α and β over γ and δ. However, seed oils recovered from the apple cultivars 'Antej' and 'Beforest' had a unique profile of four tocopherol homologues (α:β:γ:δ) 91.41:80.55:72.46:79.03 and 114.55:112.84:78.69:73.00 mg/100g oil, respectively. A single dilution of seed oils in 2-propanol facilitated the direct use samples in the DPPH assay as well as injection into the RP-HPLC system containing a PFP (pentafluorophenyl) column, which resulted in a rapid separation of all four tocopherol homologues with excellent repeatability and reproducibility. Copyright © 2014 Elsevier Ltd. All rights reserved.

SimCP3—An Advanced Homologue of SimCP2 as a Solution-Processed Small Molecular Host Material for Blue Phosphorescence Organic Light-Emitting Diodes

Directory of Open Access Journals (Sweden)

Yi-Ting Lee

2016-09-01

Full Text Available We have overcome the synthetic difficulty of 9,9′,9′′,9′′′,9′′′′,9′′′′′-((phenylsilanetriyltris(benzene-5,3,1-triylhexakis(9H-carbazole (SimCP3 an advanced homologue of previously known SimCP2 as a solution-processed, high triplet gap energy host material for a blue phosphorescence dopant. A series of organic light-emitting diodes based on blue phosphorescence dopant iridium (III bis(4,6-difluorophenylpyridinatopicolate, FIrpic, were fabricated and tested to demonstrate the validity of solution-processed SimCP3 in the device fabrication.

Identification and expression analysis of CYS-A1, CYS-C1, NIT4 genes in rice seedlings exposed to cyanide.

Science.gov (United States)

Yu, Xiao-Zhang; Lin, Yu-Juan; Lu, Chun-Jiao; Zhang, Xue-Hong

2017-09-01

Involvement of genes (CYS-A1, CYS-C1 and NIT4) encoded with cysteine synthase, β-cyanoalanine synthase, nitrilase and cyanide metabolisms are evident in Arabidopsis. In the present study, identifications of CYS-A1, CYS-C1 and NIT4, predictions of conserved motifs, and constructions of phylogenetic relationships, based on their amino acid sequences in rice, were conducted. In order to elucidate the transcriptional responses of these cyanide-degrading genes, two candidate homologues were selected for each gene to test their expression changes upon exposure to exogenous KCN in rice seedlings using RT-PCR. Results showed that all selected candidate homologous genes were differentially expressed at different exposure points in roots and shoots of rice seedlings, suggesting their distinct roles during cyanide assimilation. Both candidate homologues for CYS-A1 constantly exhibited more abundant transcripts in comparison to control. However, only one candidate homologue for CYS-C1 and NIT4 showed a remarkable up-regulation during KCN exposure. Analysis of both tissue and solution cyanide indicated that rice seedlings were quickly able to metabolize exogenous KCN with minor accumulation in plant tissues. In conclusion, significant up-regulation of CYS-A1 suggested that the endogenous pool of cysteine catalyzed by cysteine synthase does not restrict the conversion of exogenous KCN into cyanoalanine through the β-cyanoalanine pathway. However, insufficient responses of the transcription level of NIT4 suggested that NIT enzyme may be a limiting factor for cyanoalanine assimilation by rice seedlings.

Stereoselectivity of the demethylation of nicotine piperidine homologues by Nicotiana plumbaginifolia cell suspension cultures.

Science.gov (United States)

Bartholomeusz, Trixie Ann; Molinié, Roland; Roscher, Albrecht; Felpin, François-Xavier; Gillet, Françoise; Lebreton, Jacques; Mesnard, François; Robins, Richard J

2005-08-01

The metabolism of (R,S)-N-methylanabasine and (R,S)-N-methylanatabine has been studied in a cell suspension culture of Nicotiana plumbaginifolia. Both substrates are effectively demethylated, anabasine or anatabine, respectively, accumulating in the medium. Similarly, there is strong stereoselectivity for the (R)-isomers of both substrates. The kinetics of metabolism of (R,S)-N-methylanabasine differ significantly from those of nicotine in that no further degradation of the initial demethylation product occurs. (R,S)-N-Methylanatabine, however, shows kinetics closer to those of nicotine, with loss of alkaloid from the system. Further more, (R,S)-N-methylanabasine does not diminish (S)-nicotine demethylation, indicating a lack of competition. However, the metabolism of (S)-nicotine is affected by the presence of (R,S)-N-methylanabasine. Hence, the demethylation of the piperidine homologues of nicotine is seen to be similar but not identical to that of the pyridine analogues. The implications of these different metabolic profiles in relation to the demethylation activity are discussed.

Ensembles generated from crystal structures of single distant homologues solve challenging molecular-replacement cases in AMPLE.

Science.gov (United States)

Rigden, Daniel J; Thomas, Jens M H; Simkovic, Felix; Simpkin, Adam; Winn, Martyn D; Mayans, Olga; Keegan, Ronan M

2018-03-01

Molecular replacement (MR) is the predominant route to solution of the phase problem in macromolecular crystallography. Although routine in many cases, it becomes more effortful and often impossible when the available experimental structures typically used as search models are only distantly homologous to the target. Nevertheless, with current powerful MR software, relatively small core structures shared between the target and known structure, of 20-40% of the overall structure for example, can succeed as search models where they can be isolated. Manual sculpting of such small structural cores is rarely attempted and is dependent on the crystallographer's expertise and understanding of the protein family in question. Automated search-model editing has previously been performed on the basis of sequence alignment, in order to eliminate, for example, side chains or loops that are not present in the target, or on the basis of structural features (e.g. solvent accessibility) or crystallographic parameters (e.g. B factors). Here, based on recent work demonstrating a correlation between evolutionary conservation and protein rigidity/packing, novel automated ways to derive edited search models from a given distant homologue over a range of sizes are presented. A variety of structure-based metrics, many readily obtained from online webservers, can be fed to the MR pipeline AMPLE to produce search models that succeed with a set of test cases where expertly manually edited comparators, further processed in diverse ways with MrBUMP, fail. Further significant performance gains result when the structure-based distance geometry method CONCOORD is used to generate ensembles from the distant homologue. To our knowledge, this is the first such approach whereby a single structure is meaningfully transformed into an ensemble for the purposes of MR. Additional cases further demonstrate the advantages of the approach. CONCOORD is freely available and computationally inexpensive, so

Characterization of Two 20kDa-Cement Protein (cp20k) Homologues in Amphibalanus amphitrite

KAUST Repository

He, Li-Sheng

2013-05-22

The barnacle, Amphibalanus amphitrite, is a common marine fouling organism. Understanding the mechanism of barnacle adhesion will be helpful in resolving the fouling problem. Barnacle cement is thought to play a key role in barnacle attachment. Although several adult barnacle cement proteins have been identified in Megabalanus rosa, little is known about their function in barnacle settlement. In this study, two homologous 20k-cement proteins (cp20k) in Amphibalanus amphitrite, named Bamcp20k-1 and Bamcp20k-2, were characterized. The two homologues share primary sequence structure with proteins from other species including Megabalanus rosa and Fistulobalanus albicostatus. The conserved structure included repeated Cys domains and abundant charged amino acids, such as histidine. In this study we demonstrated that Bamcp20k-1 localized at the α secretory cells in the cyprid cement gland, while Bamcp20k-2 localized to the β secretory cells. The differential localizations suggest differential regulation for secretion from the secretory cells. Both Bamcp20k-1 and Bamcp20k-2 from cyprids dissolved in PBS. However, adult Bamcp20k-2, which was dominant in the basal shell of adult barnacles, was largely insoluble in PBS. Solubility increased in the presence of the reducing reagent Dithiothreitol (DTT), suggesting that the formation of disulfide bonds plays a role in Bamcp20k-2 function. In comparison, Bamcp20k-1, which was enriched in soft tissue, could not be easily detected in the shell and base by Western blot and easily dissolved in PBS. These differential solubilities and localizations indicate that Bamcp20k-1 and Bamcp20k-2 have distinct functions in barnacle cementing. © 2013 He et al.

Characterization of Two 20kDa-Cement Protein (cp20k) Homologues in Amphibalanus amphitrite

KAUST Repository

He, Li-Sheng; Zhang, Gen; Qian, Pei-Yuan

2013-01-01

The barnacle, Amphibalanus amphitrite, is a common marine fouling organism. Understanding the mechanism of barnacle adhesion will be helpful in resolving the fouling problem. Barnacle cement is thought to play a key role in barnacle attachment. Although several adult barnacle cement proteins have been identified in Megabalanus rosa, little is known about their function in barnacle settlement. In this study, two homologous 20k-cement proteins (cp20k) in Amphibalanus amphitrite, named Bamcp20k-1 and Bamcp20k-2, were characterized. The two homologues share primary sequence structure with proteins from other species including Megabalanus rosa and Fistulobalanus albicostatus. The conserved structure included repeated Cys domains and abundant charged amino acids, such as histidine. In this study we demonstrated that Bamcp20k-1 localized at the α secretory cells in the cyprid cement gland, while Bamcp20k-2 localized to the β secretory cells. The differential localizations suggest differential regulation for secretion from the secretory cells. Both Bamcp20k-1 and Bamcp20k-2 from cyprids dissolved in PBS. However, adult Bamcp20k-2, which was dominant in the basal shell of adult barnacles, was largely insoluble in PBS. Solubility increased in the presence of the reducing reagent Dithiothreitol (DTT), suggesting that the formation of disulfide bonds plays a role in Bamcp20k-2 function. In comparison, Bamcp20k-1, which was enriched in soft tissue, could not be easily detected in the shell and base by Western blot and easily dissolved in PBS. These differential solubilities and localizations indicate that Bamcp20k-1 and Bamcp20k-2 have distinct functions in barnacle cementing. © 2013 He et al.

Cloning of the cDNA for a human homologue of the Drosophila white gene and mapping to chromosome 21q22.3.

OpenAIRE

Chen, H.; Rossier, C.; Lalioti, M. D.; Lynn, A.; Chakravarti, A.; Perrin, G.; Antonarakis, S. E.

1996-01-01

In an effort to contribute to the transcript map of human chromosome 21 and the understanding of the pathophysiology of trisomy 21, we have used exon trapping to identify fragments of chromosome 21 genes. Two trapped exons, from pools of chromosome 21-specific cosmids, showed homology to the Drosophila white (w) gene. We subsequently cloned the corresponding cDNA for a human homologue of the Drosophila w gene (hW) from human retina and fetal brain cDNA libraries. The gene belongs to the ATP-b...

Discovery of practical production processes for arylsulfur pentafluorides and their higher homologues, bis- and tris(sulfur pentafluorides: Beginning of a new era of “super-trifluoromethyl” arene chemistry and its industry

Directory of Open Access Journals (Sweden)

Teruo Umemoto

2012-03-01

Full Text Available Various arylsulfur pentafluorides, ArSF5, have long been desired in both academic and industrial areas, and ArSF5 compounds have attracted considerable interest in many areas such as medicines, agrochemicals, and other new materials, since the highly stable SF5 group is considered a “super-trifluoromethyl group” due to its significantly higher electronegativity and lipophilicity. This article describes the first practical method for the production of various arylsulfur pentafluorides and their higher homologues, bis- and tris(sulfur pentafluorides, from the corresponding diaryl disulfides or aryl thiols. The method consists of two steps: (Step 1 treatment of a diaryl disulfide or an aryl thiol with chlorine in the presence of an alkali metal fluoride, and (step 2 treatment of the resulting arylsulfur chlorotetrafluoride with a fluoride source, such as ZnF2, HF, and Sb(III/V fluorides. The intermediate arylsulfur chlorotetrafluorides were isolated by distillation or recrystallization and characterized. The aspects of these new reactions are revealed and reaction mechanisms are discussed. As the method offers considerable improvement over previous methods in cost, yield, practicality, applicability, and large-scale production, the new processes described here can be employed as the first practical methods for the economical production of various arylsulfur pentafluorides and their higher homologues, which could then open up a new era of “super-trifluoromethyl” arene chemistry and its applications in many areas.

Immune responses of B. malayi thioredoxin (TRX) and venom allergen homologue (VAH) chimeric multiple antigen for lymphatic filariasis.

Science.gov (United States)

Anugraha, Gandhirajan; Jeyaprita, Parasurama Jawaharlal; Madhumathi, Jayaprakasam; Sheeba, Tamilvanan; Kaliraj, Perumal

2013-12-01

Although multiple vaccine strategy for lymphatic filariasis has provided tremendous hope, the choice of antigens used in combination has determined its success in the previous studies. Multiple antigens comprising key vaccine candidates from different life cycle stages would provide a promising strategy if the antigenic combination is chosen by careful screening. In order to analyze one such combination, we have used a chimeric construct carrying the well studied B. malayi antigens thioredoxin (BmTRX) and venom allergen homologue (BmVAH) as a fusion protein (TV) and evaluated its immune responses in mice model. The efficacy of fusion protein vaccine was explored in comparison with the single antigen vaccines and their cocktail. In mice, TV induced significantly high antibody titer of 1,28,000 compared to cocktail vaccine TRX+VAH (50,000) and single antigen vaccine TRX (16,000) or VAH (50,000). Furthermore, TV elicited higher level of cellular proliferative response together with elevated levels of IFN-γ, IL-4 and IL-5 indicating a Th1/Th2 balanced response. The isotype antibody profile showed significantly high level of IgG1 and IgG2b confirming the balanced response elicited by TV. Immunization with TV antigen induced high levels of both humoral and cellular immune responses compared to either cocktail or antigen given alone. The result suggests that TV is highly immunogenic in mice and hence the combination needs to be evaluated for its prophylactic potential.

A density functional theory study of magneto-electric Jones birefringence of noble gases, furan homologues, and mono-substituted benzenes

International Nuclear Information System (INIS)

Fahleson, Tobias; Norman, Patrick; Coriani, Sonia; Rizzo, Antonio; Rikken, Geert L. J. A.

2013-01-01

We report on the results of a systematic ab initio study of the Jones birefringence of noble gases, of furan homologues, and of monosubstituted benzenes, in the gas phase, with the aim of analyzing the behavior and the trends within a list of systems of varying size and complexity, and of identifying candidates for a combined experimental/theoretical study of the effect. We resort here to analytic linear and nonlinear response functions in the framework of time-dependent density functional theory. A correlation is made between the observable (the Jones constant) and the atomic radius for noble gases, or the permanent electric dipole and a structure/chemical reactivity descriptor as the para Hammett constant for substituted benzenes

Cloning, purification, crystallization and preliminary crystallographic analysis of a penicillin-binding protein homologue from Pyrococcus abyssi

International Nuclear Information System (INIS)

Delfosse, Vanessa; Hugonnet, Jean-Emmanuel; Sougakoff, Wladimir; Mayer, Claudine

2005-01-01

The crystallization of a hypothetical penicillin-binding protein from the archaeon P. abyssi in space group C2 by hanging-drop vapour diffusion is reported. The genome of the hyperthermophilic archaeon Pyrococcus abyssi contains a gene (pab0087) encoding a penicillin-binding protein (PBP) homologue. This sequence consists of 447 residues and shows significant sequence similarity to low-molecular-weight PBPs and class C β-lactamases. The Pab0087 protein was overexpressed, purified and crystallized. Diffraction data from two different crystal forms were collected to 2.7 and 2.0 Å resolution. Both crystals belong to space group C2, with unit-cell parameters a = 160.59, b = 135.74, c = 113.02 Å, β = 117.36° and a = 166.97, b = 131.25, c = 189.39 Å, β = 113.81°, respectively. The asymmetric unit contains four and eight molecules, respectively, with fourfold non-crystallographic symmetry

Interactions of an Arabidopsis RanBPM homologue with LisH-CTLH domain proteins revealed high conservation of CTLH complexes in eukaryotes

Czech Academy of Sciences Publication Activity Database

Tomaštíková, Eva; Cenklová, Věra; Kohoutová, Lucie; Petrovská, Beáta; Váchová, Lenka; Halada, Petr; Kočárová, Gabriela; Binarová, Pavla

2012-01-01

Roč. 12, č. 83 (2012) ISSN 1471-2229 R&D Projects: GA ČR(CZ) GA204/07/1169; GA ČR GP204/09/P155; GA ČR GAP501/12/2333; GA MŠk(CZ) LC06034; GA MŠk LC545; GA AV ČR IAA500200719 Grant - others:GA MŠk(CZ) ED0007/01/01 Program:ED Institutional research plan: CEZ:AV0Z50380511; CEZ:AV0Z50200510 Keywords : Arabidopsis homologue of RanBPM * CTLH-complex * LisH-CTLH domain proteins Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 4.354, year: 2012

Antidepressant Binding Site in a Bacterial Homologue of Neurotransmitter Transporters

International Nuclear Information System (INIS)

Singh, S.; Yamashita, A.; Gouaux, E.

2007-01-01

Sodium-coupled transporters are ubiquitous pumps that harness pre-existing sodium gradients to catalyse the thermodynamically unfavourable uptake of essential nutrients, neurotransmitters and inorganic ions across the lipid bilayer. Dysfunction of these integral membrane proteins has been implicated in glucose/galactose malabsorption, congenital hypothyroidism, Bartter's syndrome, epilepsy, depression, autism and obsessive-compulsive disorder. Sodium-coupled transporters are blocked by a number of therapeutically important compounds, including diuretics, anticonvulsants and antidepressants, many of which have also become indispensable tools in biochemical experiments designed to probe antagonist binding sites and to elucidate transport mechanisms. Steady-state kinetic data have revealed that both competitive and noncompetitive modes of inhibition exist. Antagonist dissociation experiments on the serotonin transporter (SERT) have also unveiled the existence of a low-affinity allosteric site that slows the dissociation of inhibitors from a separate high-affinity site. Despite these strides, atomic-level insights into inhibitor action have remained elusive. Here we screen a panel of molecules for their ability to inhibit LeuT, a prokaryotic homologue of mammalian neurotransmitter sodium symporters, and show that the tricyclic antidepressant (TCA) clomipramine noncompetitively inhibits substrate uptake. Cocrystal structures show that clomipramine, along with two other TCAs, binds in an extracellular-facing vestibule about 11 (angstrom) above the substrate and two sodium ions, apparently stabilizing the extracellular gate in a closed conformation. Off-rate assays establish that clomipramine reduces the rate at which leucine dissociates from LeuT and reinforce our contention that this TCA inhibits LeuT by slowing substrate release. Our results represent a molecular view into noncompetitive inhibition of a sodium-coupled transporter and define principles for the rational

Antidepressant Binding Site in a Bacterial Homologue of Neurotransmitter Transporters

Energy Technology Data Exchange (ETDEWEB)

Singh,S.; Yamashita, A.; Gouaux, E.

2007-01-01

Sodium-coupled transporters are ubiquitous pumps that harness pre-existing sodium gradients to catalyse the thermodynamically unfavourable uptake of essential nutrients, neurotransmitters and inorganic ions across the lipid bilayer. Dysfunction of these integral membrane proteins has been implicated in glucose/galactose malabsorption, congenital hypothyroidism, Bartter's syndrome, epilepsy, depression, autism and obsessive-compulsive disorder. Sodium-coupled transporters are blocked by a number of therapeutically important compounds, including diuretics, anticonvulsants and antidepressants, many of which have also become indispensable tools in biochemical experiments designed to probe antagonist binding sites and to elucidate transport mechanisms. Steady-state kinetic data have revealed that both competitive and noncompetitive modes of inhibition exist. Antagonist dissociation experiments on the serotonin transporter (SERT) have also unveiled the existence of a low-affinity allosteric site that slows the dissociation of inhibitors from a separate high-affinity site. Despite these strides, atomic-level insights into inhibitor action have remained elusive. Here we screen a panel of molecules for their ability to inhibit LeuT, a prokaryotic homologue of mammalian neurotransmitter sodium symporters, and show that the tricyclic antidepressant (TCA) clomipramine noncompetitively inhibits substrate uptake. Cocrystal structures show that clomipramine, along with two other TCAs, binds in an extracellular-facing vestibule about 11 {angstrom} above the substrate and two sodium ions, apparently stabilizing the extracellular gate in a closed conformation. Off-rate assays establish that clomipramine reduces the rate at which leucine dissociates from LeuT and reinforce our contention that this TCA inhibits LeuT by slowing substrate release. Our results represent a molecular view into noncompetitive inhibition of a sodium-coupled transporter and define principles for the

The ontogeny of nanos homologue expression in the oligochaete annelid Tubifex tubifex.

Science.gov (United States)

Mohri, Ki-Ichi; Nakamoto, Ayaki; Shimizu, Takashi

2016-01-01

We have cloned and characterized the expression of a nanos homologue (designated Ttu-nos) from the oligochaete annelid Tubifex tubifex. Ttu-nos mRNA is distributed broadly throughout the early cleavage stages. Ttu-nos is expressed in most if not all of the early blastomeres, in which Ttu-nos RNA associates with pole plasms. Ttu-nos transcripts are concentrated to 2d and 4d cells. Shortly after 2d(111) (derived from 2d cell) divides into a bilateral pair of NOPQ proteloblasts, Ttu-nos RNA vanishes from the embryo, which is soon followed by the resumption of Ttu-nos expression in nascent primary blast cells produced by teloblasts. The resumption of Ttu-nos expression occurs only in a subset of teloblast lineages (viz., M, N and Q). After Ttu-nos expression is retained in the germ band for a while, it disappears in anterior-to-posterior progression. At the end of embryogenesis, there is no trace of Ttu-nos expression. Thereafter, growing juveniles do not show any sign of Ttu-nos expression, either. The first sign of Ttu-nos expression is detected in oocytes in the ovary of young adults (ca 40 days after hatching), and its expression continues in growing oocytes that undergo yolk deposition and maturation in the ovisac. Copyright © 2015 Elsevier B.V. All rights reserved.

Two mannose-binding lectin homologues and an MBL-associated serine protease are expressed in the gut epithelia of the urochordate species Ciona intestinalis

DEFF Research Database (Denmark)

Skjødt, Mikkel-Ole; Palarasah, Yaseelan; Rasmussen, Karina Juhl

2010-01-01

The lectin complement pathway has important functions in vertebrate host defence and accumulating evidence of primordial complement components trace its emergence to invertebrate phyla. We introduce two putative mannose-binding lectin homologues (CioMBLs) from the urochordate species Ciona intest...... protease in the epithelia cells lining the stomach and intestine. In conclusion we present two urochordate MBLs and identify an associated serine protease, which support the concept of an evolutionary ancient origin of the lectin complement pathway....

The Ca{sup 2+} channel TRPML3 specifically interacts with the mammalian ATG8 homologue GATE16 to regulate autophagy

Energy Technology Data Exchange (ETDEWEB)

Choi, Suzy; Kim, Hyun Jin, E-mail: kimhyunjin@skku.edu

2014-01-03

Highlights: •Split-ubiquitin MY2H screen identified GATE16 as an interacting protein of TRPML3. •TRPML3 specifically binds to a mammalian ATG8 homologue GATE16, not to LC3B. •The interaction of TRPML3 with GATE16 facilitates autophagosome formation. •GATE16 is expressed in both autophagosome and extra-autophagosomal compartments. -- Abstract: TRPML3 is a Ca{sup 2+} permeable cation channel expressed in multiple intracellular compartments. Although TRPML3 is implicated in autophagy, how TRPML3 can regulate autophagy is not understood. To search interacting proteins with TRPML3 in autophagy, we performed split-ubiquitin membrane yeast two-hybrid (MY2H) screening with TRPML3-loop as a bait and identified GATE16, a mammalian ATG8 homologue. GST pull-down assay revealed that TRPML3 and TRPML3-loop specifically bind to GATE16, not to LC3B. Co-immunoprecipitation (co-IP) experiments showed that TRPML3 and TRPML3-loop pull down only the lipidated form of GATE16, indicating that the interaction occurs exclusively at the organellar membrane. The interaction of TRPML3 with GATE16 and GATE16-positive vesicle formation were increased in starvation induced autophagy, suggesting that the interaction facilitates the function of GATE16 in autophagosome formation. However, GATE16 was not required for TRPML3 trafficking to autophagosomes. Experiments using dominant-negative (DN) TRPML3(D458K) showed that GATE16 is localized not only in autophagosomes but also in extra-autophagosomal compartments, by contrast with LC3B. Since GATE16 acts at a later stage of the autophagosome biogenesis, our results suggest that TRPML3 plays a role in autophagosome maturation through the interaction with GATE16, by providing Ca{sup 2+} in the fusion process.

Equilibrium evaporation behavior of polonium and its homologue tellurium in liquid lead-bismuth eutectic

International Nuclear Information System (INIS)

Ohno, Shuji; Miyahara, Shinya; Kurata, Yuji; Katsura, Ryoei; Yoshida, Shigeru

2006-01-01

Experimental study using the transpiration method investigates equilibrium evaporation behavior of radionuclide polonium ( 210 Po) generated and accumulated in liquid lead-bismuth eutectic (LBE) cooled nuclear systems. The experiment consists of two series of tests: preliminary evaporation tests for homologue element tellurium (Te) in LBE, and evaporation tests for 210 Po-accumulated LBE in which test specimens are prepared by neutron irradiation. The evaporation tests of Te in LBE provide the suggestion that Te exists in a chemical form of PbTe as well as the information for confirming the validity of technique and conditions of Po test. From the evaporation tests of 210 Po in LBE, we obtain fundamental data and empirical equations such as 210 Po vapor concentration in the gas phase, 210 Po partial vapor pressure, thermodynamic activity coefficients, and gas-liquid equilibrium partition coefficient of 210 Po in LBE in the temperature range from 450 to 750degC. Additionally, radioactivity concentration of 210 Po and 210m Bi vapor in a cover gas region of a typical LBE-cooled nuclear system is specifically estimated based on the obtained experimental results, and the importance of 210 Po evaporation behavior is quantitatively demonstrated. (author)

The regulation of APAF1 expression during development and tumourigenesis

DEFF Research Database (Denmark)

Hickman, E S; Helin, K

2002-01-01

Apoptosis Protease-Activating Factor 1, APAF1, was originally isolated four years ago and shown to be the mammalian homologue of the C. elegans pro-apoptotic ced4 gene. Since then, the expression of APAF1 has been demonstrated to be involved in several cell death pathways, including the induction...

Functional analysis of three type-2 DGAT homologue genes for triacylglycerol production in the green microalga Chlamydomonas reinhardtii.

Science.gov (United States)

La Russa, M; Bogen, C; Uhmeyer, A; Doebbe, A; Filippone, E; Kruse, O; Mussgnug, J H

2012-11-30

Photosynthetic organisms like plants and algae can use sunlight to produce lipids as important metabolic compounds. Plant-derived triacylglycerols (TAGs) are valuable for human and animal nutrition because of their high energy content and are becoming increasingly important for the production of renewable biofuels. Acyl-CoA:diacylglycerol acyltransferases (DGATs) have been demonstrated to play an important role in the accumulation of TAG compounds in higher plants. DGAT homologue genes have been identified in the genome of the green alga Chlamydomonas reinhardtii, however their function in vivo is still unknown. In this work, the three most promising type-2 DGAT candidate genes potentially involved in TAG lipid accumulation (CrDGAT2a, b and c) were investigated by constructing overexpression strains. For each of the genes, three strains were identified which showed enhanced mRNA levels of between 1.7 and 29.1 times that of the wild type (wt). Total lipid contents, neutral lipids and fatty acid profiles were determined and showed that an enhanced mRNA expression level of the investigated DGAT genes did not boost the intracellular TAG accumulation or resulted in alterations of the fatty acid profiles compared to wild type during standard growth condition or during nitrogen or sulfur stress conditions. We conclude that biotechnological efforts to enhance cellular TAG amount in microalgae need further insights into the complex network of lipid biosynthesis to identify potential bottlenecks of neutral lipid production. Copyright © 2012 Elsevier B.V. All rights reserved.

The Zygosaccharomyces bailii transcription factor Haa1 is required for acetic acid and copper stress responses suggesting subfunctionalization of the ancestral bifunctional protein Haa1/Cup2.

Science.gov (United States)

Palma, Margarida; Dias, Paulo Jorge; Roque, Filipa de Canaveira; Luzia, Laura; Guerreiro, Joana Fernandes; Sá-Correia, Isabel

2017-01-13

The food spoilage yeast species Zygosaccharomyces bailii exhibits an extraordinary capacity to tolerate weak acids, in particular acetic acid. In Saccharomyces cerevisiae, the transcription factor Haa1 (ScHaa1) is considered the main player in genomic expression reprogramming in response to acetic acid stress, but the role of its homologue in Z. bailii (ZbHaa1) is unknown. In this study it is demonstrated that ZbHaa1 is a ScHaa1 functional homologue by rescuing the acetic acid susceptibility phenotype of S. cerevisiae haa1Δ. The disruption of ZbHAA1 in Z. bailii IST302 and the expression of an extra ZbHAA1 copy confirmed ZbHAA1 as a determinant of acetic acid tolerance. ZbHaa1 was found to be required for acetic acid stress-induced transcriptional activation of Z. bailii genes homologous to ScHaa1-target genes. An evolutionary analysis of the Haa1 homologues identified in 28 Saccharomycetaceae species genome sequences, including Z bailii, was carried out using phylogenetic and gene neighbourhood approaches. Consistent with previous studies, this analysis revealed a group containing pre-whole genome duplication species Haa1/Cup2 single orthologues, including ZbHaa1, and two groups containing either Haa1 or Cup2 orthologues from post-whole genome duplication species. S. cerevisiae Cup2 (alias Ace1) is a transcription factor involved in response and tolerance to copper stress. Taken together, these observations led us to hypothesize and demonstrate that ZbHaa1 is also involved in copper-induced transcriptional regulation and copper tolerance. The transcription factor ZbHaa1 is required for adaptive response and tolerance to both acetic acid and copper stresses. The subfunctionalization of the single ancestral Haa1/Cup2 orthologue that originated Haa1 and Cup2 paralogues after whole genome duplication is proposed.

Etude par génétique inverse du gène codant la protéine TARGET OF RAPAMYCIN d'Arabidopsis thaliana (AtTOR), l'homologue d'une kinase contrôlant la croissance cellulaire chez les eucaryotes

OpenAIRE

Menand, Benoit

2002-01-01

TOR (target of rapamycin) protein kinases were identified in yeast, mammals and Drosophila as central controllers of cell growth. Thu, G1 to S phases progression through the cell cycle is blocked by rapamycin, a drug which specifically inhibits TOR activity by forming a ternary complex with the peptidyl-prolyl isomerase FKBP12 (FK506 and rapamycin binding protein), and the FKBP-rapamycin binding domain (FRB) of TOR proteins. This work presents the study, the Arabidopsis homologue of yeast and...

A gonococcal homologue of meningococcal γ-glutamyl transpeptidase gene is a new type of bacterial pseudogene that is transcriptionally active but phenotypically silent

Directory of Open Access Journals (Sweden)

Watanabe Haruo

2005-10-01

Full Text Available Abstract Background It has been speculated that the γ-glutamyl transpeptidase (ggt gene is present only in Neisseria meningitidis and not among related species such as Neisseria gonorrhoeae and Neisseria lactamica, because N. meningitidis is the only bacterium with GGT activity. However, nucleotide sequences highly homologous to the meningococcal ggt gene were found in the genomes of N. gonorrhoeae isolates. Results The gonococcal homologue (ggt gonococcal homologue; ggh was analyzed. The nucleotide sequence of the ggh gene was approximately 95 % identical to that of the meningococcal ggt gene. An open reading frame in the ggh gene was disrupted by an ochre mutation and frameshift mutations induced by a 7-base deletion, but the amino acid sequences deduced from the artificially corrected ggh nucleotide sequences were approximately 97 % identical to that of the meningococcal ggt gene. The analyses of the sequences flanking the ggt and ggh genes revealed that both genes were localized in a common DNA region containing the fbp-ggt (or ggh-glyA-opcA-dedA-abcZ gene cluster. The expression of the ggh RNA could be detected by dot blot, RT-PCR and primer extension analyses. Moreover, the truncated form of ggh-translational product was also found in some of the gonococcal isolates. Conclusion This study has shown that the gonococcal ggh gene is a pseudogene of the meningococcal ggt gene, which can also be designated as Ψggt. The gonococcal ggh (Ψggt gene is the first identified bacterial pseudogene that is transcriptionally active but phenotypically silent.

Over-expression of ZmPti1, a homologue to Pti1, increases salt ...

African Journals Online (AJOL)

PRECIOUS

2010-02-01

Feb 1, 2010 ... have not been studied for its roles under salt stress condition. Previous study has ..... expression of a single Ca2+-dependent protein kinase confers both cold and ... Mechanisms of high salinity tolerance in plants. Methods ...

Validating tyrosinase homologue melA as a photoacoustic reporter gene for imaging Escherichia coli

Science.gov (United States)

Paproski, Robert J.; Li, Yan; Barber, Quinn; Lewis, John D.; Campbell, Robert E.; Zemp, Roger

2015-10-01

To understand the pathogenic processes for infectious bacteria, appropriate research tools are required for replicating and characterizing infections. Fluorescence and bioluminescence imaging have primarily been used to image infections in animal models, but optical scattering in tissue significantly limits imaging depth and resolution. Photoacoustic imaging, which has improved depth-to-resolution ratio compared to conventional optical imaging, could be useful for visualizing melA-expressing bacteria since melA is a bacterial tyrosinase homologue which produces melanin. Escherichia coli-expressing melA was visibly dark in liquid culture. When melA-expressing bacteria in tubes were imaged with a VisualSonics Vevo LAZR system, the signal-to-noise ratio of a 9× dilution sample was 55, suggesting that ˜20 bacteria cells could be detected with our system. Multispectral (680, 700, 750, 800, 850, and 900 nm) analysis of the photoacoustic signal allowed unmixing of melA-expressing bacteria from blood. To compare photoacoustic reporter gene melA (using Vevo system) with luminescent and fluorescent reporter gene Nano-lantern (using Bruker Xtreme In-Vivo system), tubes of bacteria expressing melA or Nano-lantern were submerged 10 mm in 1% Intralipid, spaced between melA-expressing bacteria even when the tubes were less than 1 mm from each other, while bioluminescence and fluorescence imaging could not resolve the two tubes of Nano-lantern-expressing bacteria even when the tubes were spaced 10 mm from each other. After injecting 100-μL of melA-expressing bacteria in the back flank of a chicken embryo, photoacoustic imaging allowed visualization of melA-expressing bacteria up to 10-mm deep into the embryo. Photoacoustic signal from melA could also be separated from deoxy- and oxy-hemoglobin signal observed within the embryo and chorioallantoic membrane. Our results suggest that melA is a useful photoacoustic reporter gene for visualizing bacteria, and further work

Evidence of an association between genetic variation of the coactivator PGC-1beta and obesity

DEFF Research Database (Denmark)

Andersen, G; Wegner, L; Yanagisawa, K

2005-01-01

Peroxisome proliferator activated receptor-gamma coactivator-1beta (PGC-1beta) is a recently identified homologue of the tissue specific coactivator PGC-1alpha, a coactivator of transcription factors such as the peroxisome proliferators activated receptors and nuclear respiratory factors. PGC-1...

Initial characterization of a bolA homologue from Pseudomonas fluorescens indicates different roles for BolA-like proteins in P. fluorescens and Escherichia coli

DEFF Research Database (Denmark)

Koch, Birgit; Nybroe, Ole

2006-01-01

A expression. The mutant grew slower than the wild-type strain in minimal medium with L-serine as the sole nitrogen source, while growth rates were similar on a mixture of L-serine and L-cysteine. Reverse transcriptase polymerase chain reaction analysis indicated that the bolA homologue is the second gene...

Characterization of a novel organic solute transporter homologue from Clonorchis sinensis.

Directory of Open Access Journals (Sweden)

Yanyan Lu

2018-04-01

Full Text Available Clonorchis sinensis is a liver fluke that can dwell in the bile ducts of mammals. Bile acid transporters function to maintain the homeostasis of bile acids in C. sinensis, as they induce physiological changes or have harmful effects on C. sinensis survival. The organic solute transporter (OST transports mainly bile acid and belongs to the SLC51 subfamily of solute carrier transporters. OST plays a critical role in the recirculation of bile acids in higher animals. In this study, we cloned full-length cDNA of the 480-amino acid OST from C. sinensis (CsOST. Genomic analysis revealed 11 exons and nine introns. The CsOST protein had a 'Solute_trans_a' domain with 67% homology to Schistosoma japonicum OST. For further analysis, the CsOST protein sequence was split into the ordered domain (CsOST-N at the N-terminus and disordered domain (CsOST-C at the C-terminus. The tertiary structure of each domain was built using a threading-based method and determined by manual comparison. In a phylogenetic tree, the CsOST-N domain belonged to the OSTα and CsOST-C to the OSTβ clade. These two domains were more highly conserved with the OST α- and β-subunits at the structure level than at sequence level. These findings suggested that CsOST comprised the OST α- and β-subunits. CsOST was localized in the oral and ventral suckers and in the mesenchymal tissues abundant around the intestine, vitelline glands, uterus, and testes. This study provides fundamental data for the further understanding of homologues in other flukes.

Characterization of a novel organic solute transporter homologue from Clonorchis sinensis

Science.gov (United States)

Dai, Fuhong; Lee, Ji-Yun; Pak, Jhang Ho; Sohn, Woon-Mok

2018-01-01

Clonorchis sinensis is a liver fluke that can dwell in the bile ducts of mammals. Bile acid transporters function to maintain the homeostasis of bile acids in C. sinensis, as they induce physiological changes or have harmful effects on C. sinensis survival. The organic solute transporter (OST) transports mainly bile acid and belongs to the SLC51 subfamily of solute carrier transporters. OST plays a critical role in the recirculation of bile acids in higher animals. In this study, we cloned full-length cDNA of the 480-amino acid OST from C. sinensis (CsOST). Genomic analysis revealed 11 exons and nine introns. The CsOST protein had a ‘Solute_trans_a’ domain with 67% homology to Schistosoma japonicum OST. For further analysis, the CsOST protein sequence was split into the ordered domain (CsOST-N) at the N-terminus and disordered domain (CsOST-C) at the C-terminus. The tertiary structure of each domain was built using a threading-based method and determined by manual comparison. In a phylogenetic tree, the CsOST-N domain belonged to the OSTα and CsOST-C to the OSTβ clade. These two domains were more highly conserved with the OST α- and β-subunits at the structure level than at sequence level. These findings suggested that CsOST comprised the OST α- and β-subunits. CsOST was localized in the oral and ventral suckers and in the mesenchymal tissues abundant around the intestine, vitelline glands, uterus, and testes. This study provides fundamental data for the further understanding of homologues in other flukes. PMID:29702646

Edge profiles in K shell photoabsorption spectra of gaseous hydrides of 3p elements and homologues

Science.gov (United States)

Hauko, R.; Gomilšek, J. Padežnik; Kodre, A.; Arčon, I.; Aquilanti, G.

2017-10-01

Photoabsorption spectra of gaseous hydrides of 3p elements (PH3, H2S, HCl) are measured in the energy region of photoexcitations pertaining to K edge. The analysis of the edge profile is extended to hydrides of 4p series (GeH4, AsH3, H2Se, HBr) from an earlier experiment, and to published spectra of 2p hydrides (CH4, NH3, H2O, HF) and noble gases Ar, Kr and Ne and SiH4. The edge profiles are modelled with a linear combination of lorentzian components, describing excitations to individual bound states and to continuum. Transition energies and probabilities are also calculated in the non-relativistic molecular model of the ORCA code, in good agreement with the experiment. Edge profiles in the heavier homologues are closely similar, the symmetry of the molecule governs the transitions to the lowest unoccupied orbitals. In 2p series the effect of the strong nuclear potential prevails. Transitions to higher, atomic-like levels remain very much the same as in free atoms.

Structure of a thermostable serralysin from Serratia sp. FS14 at 1.1 Å resolution.

Science.gov (United States)

Wu, Dongxia; Ran, Tinting; Wang, Weiwu; Xu, Dongqing

2016-01-01

Serralysin is a well studied metalloprotease, and typical serralysins are not thermostable. The serralysin isolated from Serratia sp. FS14 was found to be thermostable, and in order to reveal the mechanism responsible for its thermostability, the crystal structure of serralysin from Serratia sp. FS14 was solved to a crystallographic R factor of 0.1619 at 1.10 Å resolution. Similar to its homologues, it mainly consists of two domains: an N-terminal catalytic domain and a `parallel β-roll' C-terminal domain. Comparative studies show that the shape of the catalytic active-site cavity is more open owing to the 189-198 loop, with a short 310-helix protruding further from the molecular surface, and that the β-sheets comprising the `parallel β-roll' are longer than those in its homologues. The formation of hydrogen bonds from one of the nonconserved residues (Asn200) to Lys27 may contribute to the thermostability.

Phagosome maturation in unicellular eukaryote Paramecium: the presence of RILP, Rab7 and LAMP-2 homologues

Directory of Open Access Journals (Sweden)

E Wyroba

2009-08-01

Full Text Available Phagosome maturation is a complex process enabling degradation of internalised particles. Our data obtained at the gene, protein and cellular level indicate that the set of components involved in this process and known up to now in mammalian cells is functioning in unicellular eukaryote. Rab7-interacting partners: homologues of its effector RILP (Rab-interacting lysosomal protein and LAMP-2 (lysosomal membrane protein 2 as well as a7 subunit of the 26S proteasome were revealed in Paramecium phagolysosomal compartment. We identified the gene/transcript fragments encoding RILP-related proteins (RILP1 and RILP2 in Paramecium by PCR/RT-PCR and sequencing. The deduced amino acid sequences of RILP1 and RILP2 show 60.5% and 58.3% similarity, respectively, to the region involved in regulating of lysosomal morphology and dynein-dynactin recruitment of human RILP. RILP colocalised with Rab7 in Paramecium lysosomes and at phagolysosomal membrane during phagocytosis of both the latex beads and bacteria. In the same compartment LAMP-2 was present and its expression during latex internalisation was 2.5-fold higher than in the control when P2 protein fractions (100 000 x g of equal load were quantified by immunoblotting. LAMP-2 crossreacting polypeptide of ~106 kDa was glycosylated as shown by fluorescent and Western analysis of the same blot preceded by PNGase F treatment. The a7 subunit of 26S proteasome was detected close to the phagosomal membrane in the small vesicles, in some of which it colocalised with Rab7. Immunoblotting confirmed presence of RILPrelated polypeptide and a7 subunit of 26S proteasome in Paramecium protein fractions. These results suggest that Rab7, RILP and LAMP-2 may be involved in phagosome maturation in Paramecium.

阴道毛滴虫Rac1蛋白的cDNA克隆和序列分析%Molecular Cloning and Characterization of a Rac1 Homologue cDNA from Trichomonas vaginalis

Institute of Scientific and Technical Information of China (English)

傅玉才; 章家新; 郑晓虹; 刘红

2004-01-01

Objective To clone and characterize a Racl homologue from Trichomonas vaginalis for studying cell cycle of the organism. Methods A cDNA library derived from T. vaginalis mRNA was constructed into λ TriplEx2 phage vector. An expression sequence tag program was launched. Sequences of cDNA clones were analyzed using NCBI BLAST algorithms, and ClustalW and Treeview programs. Results A cDNA clone with a length of 714 base pairs was isolated. The sequence analysis showed that the cDNA clone has an open reading frame with 600 bp. The deduced amino acid sequence from the open reading frame contains 200 residuals and is most homologous to Rac1 subfamily of Rho GTPases with ＞ 60% identity. The conserved sequence elements of Rho GTPases, such as GTP-binding sites, GTPase-activating protein (GAP) interaction motifs, GTP-dissociation inhibitors (GDI) interaction motifs, guanine nucleotide exchange factor (GEF) interaction elements, etc, were detected in the amino acid sequence. The phylogenetic analysis showed that the cDNA clone is grouped in the Rac subfamily and is more closely related to Rac1 proteins of protozoa. Conclusion The cDNA clone isolated belongs to Rac subfamily of Rho GTPases and is probably a Rac1 protein of T. vaginalis.%目的获得阴道毛滴虫Rac1蛋白的cDNA克隆,研究其在细胞周期中的调解作用.方法提取阴道毛滴虫总RNA,构建cDNA表达文库,随机分离cDNA克隆并测序.用在线生物分析软件NCBI BLAST、ClustalW以及Treeview等程序进行序列分析.结果获得一株有714 bp的cDNA克隆.序列分析表明,该克隆开放阅读框具600 bp,推测肽链具200个氨基酸.该肽链与Rho家族中Rac1鸟苷三磷酸(GTP)酶同源性最高(＞60%),并具多种Rho GTP酶的保守基序,如GTP结合部位、GTP酶激活蛋白作用基序、GTP分离抑制因子作用基序、鸟嘌呤核苷酸交换因子作用基序等.进化树分析显示该克隆属于Rac亚家族GTP酶,与原虫Rac1蛋白最接近.结论该克隆�

Genetic link between Cabeza, a Drosophila homologue of Fused in Sarcoma (FUS), and the EGFR signaling pathway

Energy Technology Data Exchange (ETDEWEB)

Shimamura, Mai; Kyotani, Akane [Department of Applied Biology, Kyoto Institute of Technology, Matsugasaki, Sakyo-ku, Kyoto 606-8585 (Japan); Insect Biomedical Research Center, Kyoto Institute of Technology, Matsugasaki, Sakyo-ku, Kyoto 606-8585 (Japan); Azuma, Yumiko [Department of Neurology, Kyoto Prefectural University of Medicine, 465 Kajii-cho,Kamigyo-ku, Kyoto 602-8566 (Japan); Yoshida, Hideki; Binh Nguyen, Thanh [Department of Applied Biology, Kyoto Institute of Technology, Matsugasaki, Sakyo-ku, Kyoto 606-8585 (Japan); Insect Biomedical Research Center, Kyoto Institute of Technology, Matsugasaki, Sakyo-ku, Kyoto 606-8585 (Japan); Mizuta, Ikuko; Yoshida, Tomokatsu; Mizuno, Toshiki [Department of Neurology, Kyoto Prefectural University of Medicine, 465 Kajii-cho,Kamigyo-ku, Kyoto 602-8566 (Japan); Nakagawa, Masanori [North Medical Center, Kyoto Prefectural University of Medicine, 465 Kajii-cho, Kamigyo-ku, Kyoto 602-8566 (Japan); Tokuda, Takahiko, E-mail: ttokuda@koto.kpu-m.ac.jp [Department of Neurology, Kyoto Prefectural University of Medicine, 465 Kajii-cho,Kamigyo-ku, Kyoto 602-8566 (Japan); Department of Molecular Pathobiology of Brain Diseases, Graduate School of Medical Science, Kyoto Prefectural University of Medicine, 465 Kajii-cho, Kamigyo-ku, Kyoto 602-8566 (Japan); Yamaguchi, Masamitsu, E-mail: myamaguc@kit.ac.jp [Department of Applied Biology, Kyoto Institute of Technology, Matsugasaki, Sakyo-ku, Kyoto 606-8585 (Japan); Insect Biomedical Research Center, Kyoto Institute of Technology, Matsugasaki, Sakyo-ku, Kyoto 606-8585 (Japan)

2014-08-01

Amyotrophic Lateral Sclerosis (ALS) is a fatal neurodegenerative disease that causes progressive muscular weakness. Fused in Sarcoma (FUS) that has been identified in familial ALS is an RNA binding protein that is normally localized in the nucleus. However, its function in vivo is not fully understood. Drosophila has Cabeza (Caz) as a FUS homologue and specific knockdown of Caz in the eye imaginal disc and pupal retina using a GMR-GAL4 driver was here found to induce an abnormal morphology of the adult compound eyes, a rough eye phenotype. This was partially suppressed by expression of the apoptosis inhibitor P35. Knockdown of Caz exerted no apparent effect on differentiation of photoreceptor cells. However, immunostaining with an antibody to Cut that marks cone cells revealed fusion of these and ommatidia of pupal retinae. These results indicate that Caz knockdown induces apoptosis and also inhibits differentiation of cone cells, resulting in abnormal eye morphology in adults. Mutation in EGFR pathway-related genes, such as rhomboid-1, rhomboid-3 and mirror suppressed the rough eye phenotype induced by Caz knockdown. Moreover, the rhomboid-1 mutation rescued the fusion of cone cells and ommatidia observed in Caz knockdown flies. The results suggest that Caz negatively regulates the EGFR signaling pathway required for determination of cone cell fate in Drosophila. - Highlights: • Knockdown of Cabeza induced rough eye phenotype. • Knockdown of Cabeza induced fusion of cone cells in pupal retinae. • Knockdown of Cabeza induced apoptosis in pupal retinae. • Mutation in EGFR pathway-related genes suppressed the rough eye phenotype. • Cabeza may negatively regulate the EGFR pathway.

Sequence of a cDNA encoding turtle high mobility group 1 protein.

Science.gov (United States)

Zheng, Jifang; Hu, Bi; Wu, Duansheng

2005-07-01

In order to understand sequence information about turtle HMG1 gene, a cDNA encoding HMG1 protein of the Chinese soft-shell turtle (Pelodiscus sinensis) was amplified by RT-PCR from kidney total RNA, and was cloned, sequenced and analyzed. The results revealed that the open reading frame (ORF) of turtle HMG1 cDNA is 606 bp long. The ORF codifies 202 amino acid residues, from which two DNA-binding domains and one polyacidic region are derived. The DNA-binding domains share higher amino acid identity with homologues sequences of chicken (96.5%) and mammalian (74%) than homologues sequence of rainbow trout (67%). The polyacidic region shows 84.6% amino acid homology with the equivalent region of chicken HMG1 cDNA. Turtle HMG1 protein contains 3 Cys residues located at completely conserved positions. Conservation in sequence and structure suggests that the functions of turtle HMG1 cDNA may be highly conserved during evolution. To our knowledge, this is the first report of HMG1 cDNA sequence in any reptilian.

Splicing factor 1 modulates dietary restriction and TORC1 pathway longevity in C. elegans

DEFF Research Database (Denmark)

Heintz, Caroline; Doktor, Thomas K; Lanjuin, Anne

2017-01-01

via splicing factor 1 (SFA-1; the C. elegans homologue of SF1, also known as branchpoint binding protein, BBP). We show that SFA-1 is specifically required for lifespan extension by dietary restriction and by modulation of the TORC1 pathway components AMPK, RAGA-1 and RSKS-1/S6 kinase. We also...... homeostasis is a biomarker and predictor of life expectancy in Caenorhabditis elegans. Using transcriptomics and in-depth splicing analysis in young and old animals fed ad libitum or subjected to dietary restriction, we find defects in global pre-mRNA splicing with age that are reduced by dietary restriction...

Novel Mitochondrial Homoplasmic T4216C Mutation in Iranian Patients with Friedreich Ataxia

Directory of Open Access Journals (Sweden)

M Heidari

2010-06-01

Full Text Available Introduction: The mitochondrial defects in Friedreich ataxia (FRDA have been reported in many researches. Friedreich ataxia is an autosomal recessive neurodegenerative disorder caused by decreased expression of the Frataxin protein. Frataxin deficiency leads to excessive free radical production and dysfunction of respiratory chain complexes. Mitochondrial DNA (mtDNA could be considered as a candidate modifier factor for FRDA disease. It prompted us to focus on the mtDNA and monitor the nucleotide changes of genome which are probably the cause of respiratory chain defects and reduced ATP generation. Methods: We searched the mitochondrial NADH dehydroganase I (ND1 gene by PCR-TTGE and DNA fragments showing abnormal banding patterns were sequenced for the identification of exact mutations. Results: In 20 patients, we detected 3 mtDNA mutations which is novel in Friedreich ataxia. T4216C mutation results in conversion of Tyrosine to Histidine in 313 amino acid locations in ND1 and bioinformatics studies show that ND1 protein loses sixth intramembrane α chain. Conclusion: Our results showed that ND1 gene mutations in FRDA samples are higher than normal controls (P<0.001. It is possible that mutations in mtDNA could constitute a predisposing factor in combination with environmental risk factors that could affect the age of onset and rate of disease progression.

Induction of MAP Kinase Homologues during Growth and Morphogenetic Development of Karnal Bunt (Tilletia indica) under the Influence of Host Factor(s) from Wheat Spikes

Science.gov (United States)

Gupta, Atul K.; Seneviratne, J. M.; Joshi, G. K.; Kumar, Anil

2012-01-01

Signaling pathways that activate different mitogen-activated protein kinases (MAPKs) in response to certain environmental conditions, play important role in mating type switching (Fus3) and pathogenicity (Pmk1) in many fungi. In order to determine the roles of such regulatory genes in Tilletia indica, the causal pathogen of Karnal bunt (KB) of wheat, semi-quantitative and quantitative RT-PCR was carried out to isolate and determine the expression of MAP kinase homologues during fungal growth and development under in vitro culture. Maximum expression of TiFus3 and TiPmk1 genes were observed at 14th and 21st days of culture and decreased thereafter. To investigate whether the fungus alters the expression levels of same kinases upon interaction with plants, cultures were treated with 1% of host factors (extracted from S-2 stage of wheat spikes). Such treatment induced the expression of MAPks in time dependent manner compared to the absence of host factors. These results suggest that host factor(s) provide certain signal(s) which activate TiFus3 and TiPmk1 during morphogenetic development of T. indica. The results also provides a clue about the role of host factors in enhancing the disease potential due to induction of MAP kinases involved in fungal development and pathogenecity. PMID:22547988

Selective inhibition of Sarcocystis neurona calcium-dependent protein kinase 1 for equine protozoal myeloencephalitis therapy

Science.gov (United States)

Sarcocystis neurona is the most frequent cause of Equine Protozoal Myeloencephalitis (EPM), a debilitating neurologic disease of horses that can be difficult to treat. We identified SnCDPK1, the S. neurona homologue of calcium dependent protein kinase 1 (CDPK1), a validated drug target in Toxoplasma...

Overexpression of the essential Sis1 chaperone reduces TDP-43 effects on toxicity and proteolysis

Science.gov (United States)

Park, Sei-Kyoung; Hong, Joo Y.; Arslan, Fatih; Tietsort, Alex; Tank, Elizabeth M. H.; Li, Xingli

2017-01-01

Amyotrophic lateral sclerosis (ALS) is a devastating neurodegenerative disease characterized by selective loss of motor neurons with inclusions frequently containing the RNA/DNA binding protein TDP-43. Using a yeast model of ALS exhibiting TDP-43 dependent toxicity, we now show that TDP-43 overexpression dramatically alters cell shape and reduces ubiquitin dependent proteolysis of a reporter construct. Furthermore, we show that an excess of the Hsp40 chaperone, Sis1, reduced TDP-43’s effect on toxicity, cell shape and proteolysis. The strength of these effects was influenced by the presence of the endogenous yeast prion, [PIN+]. Although overexpression of Sis1 altered the TDP-43 aggregation pattern, we did not detect physical association of Sis1 with TDP-43, suggesting the possibility of indirect effects on TDP-43 aggregation. Furthermore, overexpression of the mammalian Sis1 homologue, DNAJB1, relieves TDP-43 mediated toxicity in primary rodent cortical neurons, suggesting that Sis1 and its homologues may have neuroprotective effects in ALS. PMID:28531192

Reference: 475 [Arabidopsis Phenome Database[Archive

Lifescience Database Archive (English)

Full Text Available n higher plants, we analyze two knock-out and one knock-down T-DNA insertion mutants. The knock...-out mutants present an embryo-lethal phenotype, indicating an essential role for frataxin. The knock

C7L family of poxvirus host range genes inhibits antiviral activities induced by type I interferons and interferon regulatory factor 1.

Science.gov (United States)

Meng, Xiangzhi; Schoggins, John; Rose, Lloyd; Cao, Jingxin; Ploss, Alexander; Rice, Charles M; Xiang, Yan

2012-04-01

Vaccinia virus (VACV) K1L and C7L function equivalently in many mammalian cells to support VACV replication and antagonize antiviral activities induced by type I interferons (IFNs). While K1L is limited to orthopoxviruses, genes that are homologous to C7L are found in diverse mammalian poxviruses. In this study, we showed that the C7L homologues from sheeppox virus and swinepox virus could rescue the replication defect of a VACV mutant deleted of both K1L and C7L (vK1L(-)C7L(-)). Interestingly, the sheeppox virus C7L homologue could rescue the replication of vK1L(-)C7L(-) in human HeLa cells but not in murine 3T3 and LA-4 cells, in contrast to all other C7L homologues. Replacing amino acids 134 and 135 of the sheeppox virus C7L homologue, however, made it functional in the two murine cell lines, suggesting that these two residues are critical for antagonizing a putative host restriction factor which has some subtle sequence variation in human and murine cells. Furthermore, the C7L family of host range genes from diverse mammalian poxviruses were all capable of antagonizing type I IFN-induced antiviral activities against VACV. Screening of a library of more than 350 IFN-stimulated genes (ISGs) identified interferon-regulated factor 1 (IRF1) as an inhibitor of vK1L(-)C7L(-) but not wild-type VACV. Expression of either K1L or C7L, however, rendered vK1L(-)C7L(-) resistant to IRF1-induced antiviral activities. Altogether, our data show that K1L and C7L antagonize IRF1-induced antiviral activities and that the host modulation function of C7L is evolutionally conserved in all poxviruses that can readily replicate in tissue-cultured mammalian cells.

Occurrence, homologue patterns and source apportionment of short- and medium-chain chlorinated paraffins in suburban soils of Shanghai, China.

Science.gov (United States)

Wang, Xue-Tong; Xu, Si-Yue; Wang, Xi-Kui; Hu, Bao-Ping; Jia, Hao-Hao

2017-08-01

In order to systematically investigate the spatial distribution, homologue profiles, and sources of short- and medium-chain chlorinated paraffins (SCCPs and MCCPs) in suburban soils in Shanghai, SCCPs and MCCPs in soils were analyzed using gas chromatography coupled with low resolution mass spectrometry in electron capture negative ion (ECNI) mode (GC-ECNI-MS). The CP concentrations in soils were between not detected (ND) - 697 ng g -1 with a median value of 3.52 ng g -1 for SCCPs, and ND - 666 ng g -1 with a median value of 15.3 ng g -1 for MCCPs, respectively. The concentrations of MCCPs in most soils were higher than that of SCCPs. The total CP concentrations (sum of SCCPs and MCCPs) in soils varied from ND to 964 ng g -1 with a median value of 20.5 ng g -1 . The concentration of MCCPs was higher than that of SCCPs in most soils. The levels of SCCPs and MCCPs in suburban soils in Shanghai were at the medium level when compared to other areas around the world. No significant correlation was observed between soil CP concentrations and total organic carbon contents (p > 0.05). For different use type of soils, the median concentrations of CPs in soils were found higher in greenland than that in other areas probably due to busy traffic, sewage sludge application and/or wastewater irrigation. All soils were divided into two groups by hierarchical cluster analysis (HCA) both for SCCPs and MCCPs. Three discharge sources of CPs in suburban soil of Shanghai were identified by PMF model. Copyright © 2017 Elsevier Ltd. All rights reserved.

TRBP and eIF6 homologue in Marsupenaeus japonicus play crucial roles in antiviral response.

Directory of Open Access Journals (Sweden)

Shuai Wang

Full Text Available Plants and invertebrates can suppress viral infection through RNA silencing, mediated by RNA-induced silencing complex (RISC. Trans-activation response RNA-binding protein (TRBP, consisting of three double-stranded RNA-binding domains, is a component of the RISC. In our previous paper, a TRBP homologue in Fenneropenaeus chinensis (Fc-TRBP was reported to directly bind to eukaryotic initiation factor 6 (Fc-eIF6. In this study, we further characterized the function of TRBP and the involvement of TRBP and eIF6 in antiviral RNA interference (RNAi pathway of shrimp. The double-stranded RNA binding domains (dsRBDs B and C of the TRBP from Marsupenaeus japonicus (Mj-TRBP were found to mediate the interaction of TRBP and eIF6. Gel-shift assays revealed that the N-terminal of Mj-TRBP dsRBD strongly binds to double-stranded RNA (dsRNA and that the homodimer of the TRBP mediated by the C-terminal dsRBD increases the affinity to dsRNA. RNAi against either Mj-TRBP or Mj-eIF6 impairs the dsRNA-induced sequence-specific RNAi pathway and facilitates the proliferation of white spot syndrome virus (WSSV. These results further proved the important roles of TRBP and eIF6 in the antiviral response of shrimp.

The small GTPase Rab5 homologue Ypt5 regulates cell morphology, sexual development, ion-stress response and vacuolar formation in fission yeast

Energy Technology Data Exchange (ETDEWEB)

Tsukamoto, Yuta; Katayama, Chisako [Graduate School of Science, Kobe University, 1-1 Rokkodai-cho Nada, Kobe 657-8501 (Japan); Shinohara, Miki; Shinohara, Akira [Institute for Protein Research, Osaka University, 3-2 Yamadaoka, Suita, Osaka 565-0871 (Japan); Maekawa, Shohei [Graduate School of Science, Kobe University, 1-1 Rokkodai-cho Nada, Kobe 657-8501 (Japan); Miyamoto, Masaaki, E-mail: miya@kobe-u.ac.jp [Graduate School of Science, Kobe University, 1-1 Rokkodai-cho Nada, Kobe 657-8501 (Japan); Center for Supports to Research and Education Activities, Kobe University, 1-1 Rokkodai-cho Nada, Kobe 657-8501 (Japan)

2013-11-29

Highlights: •Multiple functions of Rab5 GTPase in fission yeast were found. •Roles of Rab5 in fission yeast were discussed. •Relation between Rab5 and actin cytoskeleton were discussed. -- Abstract: Inner-membrane transport is critical to cell function. Rab family GTPases play an important role in vesicle transport. In mammalian cells, Rab5 is reported to be involved in the regulation of endosome formation, phagocytosis and chromosome alignment. Here, we examined the role of the fission yeast Rab5 homologue Ypt5 using a point mutant allele. Mutant cells displayed abnormal cell morphology, mating, sporulation, endocytosis, vacuole fusion and responses to ion stress. Our data strongly suggest that fission yeast Rab5 is involved in the regulation of various types of cellular functions.

The small GTPase Rab5 homologue Ypt5 regulates cell morphology, sexual development, ion-stress response and vacuolar formation in fission yeast

International Nuclear Information System (INIS)

Tsukamoto, Yuta; Katayama, Chisako; Shinohara, Miki; Shinohara, Akira; Maekawa, Shohei; Miyamoto, Masaaki

2013-01-01

Highlights: •Multiple functions of Rab5 GTPase in fission yeast were found. •Roles of Rab5 in fission yeast were discussed. •Relation between Rab5 and actin cytoskeleton were discussed. -- Abstract: Inner-membrane transport is critical to cell function. Rab family GTPases play an important role in vesicle transport. In mammalian cells, Rab5 is reported to be involved in the regulation of endosome formation, phagocytosis and chromosome alignment. Here, we examined the role of the fission yeast Rab5 homologue Ypt5 using a point mutant allele. Mutant cells displayed abnormal cell morphology, mating, sporulation, endocytosis, vacuole fusion and responses to ion stress. Our data strongly suggest that fission yeast Rab5 is involved in the regulation of various types of cellular functions

Isolation and characterisation of a banana CYCD2;1 gene and its ...

African Journals Online (AJOL)

Stimulation of the cell cycle by over-expression of Arabidopsis CyclinD2;1 enhanced growth in tobacco and rice, but not Arabidopsis. To broaden the range of species and to improve an important crop species for developing countries, a CyclinD2;1 homologue was isolated from an East African highland banana cultivar ...

SEC14 is a specific requirement for secretion of phospholipase B1 and pathogenicity of Cryptococcus neoformans

Science.gov (United States)

Chayakulkeeree, Methee; Johnston, Simon Andrew; Oei, Johanes Bijosono; Lev, Sophie; Williamson, Peter Richard; Wilson, Christabel Frewen; Zuo, Xiaoming; Leal, Ana Lusia; Vainstein, Marilene Henning; Meyer, Wieland; Sorrell, Tania Christine; May, Robin Charles; Djordjevic, Julianne Teresa

2011-01-01

Summary Secreted phospholipase B1 (CnPlb1) is essential for dissemination of Cryptococcus neoformans to the central nervous system (CNS) yet essential components of its secretion machinery remain to be elucidated. Using gene deletion analysis we demonstrate that CnPlb1 secretion is dependent on the CnSEC14 product, CnSec14-1p. CnSec14-1p is a homologue of the phosphatidylinositol transfer protein (PITP) ScSec14p, which is essential for secretion and viability in Saccharomyces cerevisiae. In contrast to CnPlb1, neither laccase 1 (Lac1)-induced melanization within the cell wall nor capsule induction were negatively impacted in CnSEC14-1 deletion mutants (CnΔsec14-1 and CnΔsec14-1CnΔsfh5). Similar to the CnPLB1 deletion mutant (CnΔplb1), CnΔsec14-1 was hypo-virulent in mice and did not disseminate to the CNS by day 14 post infection. Furthermore, macrophage expulsion of live CnΔsec14-1 and CnΔplb1 (vomocytosis) was reduced. Individual deletion of CnSEC14-2, a closely-related CnSEC14-1 homologue, and CnSFH5, a distantly-related SEC fourteen-like homologue, did not abrogate CnPlb1 secretion or virulence. However, reconstitution of CnΔsec14-1 with CnSEC14-1 or CnSEC14-2 restored both phenotypes, consistent with functional genetic redundancy. We conclude that CnPlb1 secretion is SEC14-dependent and that C. neoformans preferentially exports virulence determinants to the cell periphery via distinct pathways. We also demonstrate that CnPlb1 secretion is essential for vomocytosis. PMID:21453402

The plant PTS1 receptor : similarities and differences to its human and yeast counterparts

NARCIS (Netherlands)

Wimmer, C; Schmid, Markus; Veenhuis, M; Gietl, C

1998-01-01

Two targeting signals, PTS1 and PTS2, mediate import of proteins into the peroxisomal matrix. We have cloned and sequenced the watermelon (Citrullus vulgaris) cDNA homologue to the PTS1 receptor gene (PEX5). Its gene product, CvPex5p, belongs to the family of tetratricopeptide repeat (TPR)

Identification and quantification of 1,3-dimethylbutylamine (DMBA) from Camellia sinensis tea leaves and dietary supplements

Science.gov (United States)

1, 3-Dimethylbutylamine (DMBA), is a CNS stimulant which has recently been identified in multiple dietary supplements and sometimes labeled as a natural constituent of Pouchung tea. DMBA is an homologue of 1,3-dimethylamylamine (DMAA) which the US Food and Drug Administration has attempted to remov...

Draft genome sequence of Penicillium marneffei strain PM1.

Science.gov (United States)

Woo, Patrick C Y; Lau, Susanna K P; Liu, Bin; Cai, James J; Chong, Ken T K; Tse, Herman; Kao, Richard Y T; Chan, Che-Man; Chow, Wang-Ngai; Yuen, Kwok-Yung

2011-12-01

Penicillium marneffei is the most important thermal dimorphic, pathogenic fungus endemic in China and Southeast Asia and is particularly important in HIV-positive patients. We report the 28,887,485-bp draft genome sequence of P. marneffei, which contains its complete mitochondrial genome, sexual cycle genes, a high diversity of Mp1p homologues, and polyketide synthase genes.

Dpb11/TopBP1 contributes to genomicstability via homologous recombinationand checkpoint signaling

DEFF Research Database (Denmark)

Germann, Susanne Manuela

for recruitment. Also, the chicken homologue TopBP1 colocalizes with RPA1 as well as Rad51 when DNA damage is induced. Previously, dpb11 mutants have been shown to be sensitive to DNA-damaging agents that cause DSBs, DNA alkylation and stalled replication forks. Interestingly, we found the point mutants dpb11-PF...

The Orphan Nuclear Receptor TLX/NR2E1 in Neural Stem Cells and Diseases.

Science.gov (United States)

Wang, Tao; Xiong, Jian-Qiong

2016-02-01

The human TLX gene encodes an orphan nuclear receptor predominantly expressed in the central nervous system. Tailess and Tlx, the TLX homologues in Drosophila and mouse, play essential roles in body-pattern formation and neurogenesis during early embryogenesis and perform crucial functions in maintaining stemness and controlling the differentiation of adult neural stem cells in the central nervous system, especially the visual system. Multiple target genes and signaling pathways are regulated by TLX and its homologues in specific tissues during various developmental stages. This review aims to summarize previous studies including many recent updates from different aspects concerning TLX and its homologues in Drosophila and mouse.

Validating tyrosinase homologue MelA as a photoacoustic reporter gene for imaging Escherichia coli

Science.gov (United States)

Paproski, Robert J.; Li, Yan; Barber, Quinn; Lewis, John D.; Campbell, Robert; Zemp, Roger

2015-03-01

Antibiotic drug resistance is a major worldwide issue. Development of new therapies against pathogenic bacteria requires appropriate research tools for replicating and characterizing infections. Previously fluorescence and bioluminescence modalities have been used to image infectious burden in animal models but scattering significantly limits imaging depth and resolution. We hypothesize that photoacoustic imaging, which has improved depth-toresolution ratio, could be useful for visualizing MelA-expressing bacteria since MelA is a bacterial tyrosinase homologue involved in melanin production. Using an inducible expression system, E. coli expressing MelA were visibly black in liquid culture. Phosphate buffered saline (PBS), MelA-expressing bacteria (at different dilutions in PBS), and chicken embryo blood were injected in plastic tubes which were imaged using a VisualSonics Vevo LAZR system. Photoacoustic imaging at 6 different wavelengths (680, 700, 750, 800, 850 and 900nm) enabled spectral de-mixing to distinguish melanin signals from blood. The signal to noise ratio of 9x diluted MelA bacteria was 55, suggesting that ~20 bacteria cells could be detected with our system. When MelA bacteria were injected as a 100 μL bolus into a chicken embryo, photoacoustic signals from deoxy- and oxy- hemoglobin as well as MelA-expressing bacteria could be separated and overlaid on an ultrasound image, allowing visualization of the bacterial location. Photoacoustic imaging may be a useful tool for visualizing bacterial infections and further work incorporating photoacoustic reporters into infectious bacterial strains is warranted.

Anatomy of rat semaphorin III/collapsin-1 mRNA expression and relationship to developing nerve tracts during neuroembryogenesis

NARCIS (Netherlands)

Giger, Roman J; Wolfer, D P; De Wit, G M; Verhaagen, J

1996-01-01

Semaphorin III/collapsin-1 (semaIII/coll-1) is a chemorepellent that exhibits a repulsive effect on growth cones of dorsal root ganglion neurons. To identify structures that express semaIII/coll-1 in developing mammals, we cloned the rat homologue and performed in situ hybridization on embryonic,

PP-O and PP-V, Monascus pigment homologues, production, and phylogenetic analysis in Penicillium purpurogenum.

Science.gov (United States)

Arai, Teppei; Kojima, Ryo; Motegi, Yoshiki; Kato, Jun; Kasumi, Takafumi; Ogihara, Jun

2015-12-01

The production of pigments as secondary metabolites by microbes is known to vary by species and by physiological conditions within a single strain. The fungus strain Penicillium purpurogenum IAM15392 has been found to produce violet pigment (PP-V) and orange pigment (PP-O),Monascus azaphilone pigment homologues, when grown under specific culture conditions. In this study, we analysed PP-V and PP-O production capability in seven strains of P. purpurogenum in addition to strain IAM15392 under specific culture conditions. The pigment production pattern of five strains cultivated in PP-V production medium was similar to that of strain IAM15392, and all violet pigments produced by these five strains were confirmed to be PP-V. Strains that did not produce pigment were also identified. In addition, two strains cultivated in PP-O production medium produced a violet pigment identified as PP-V. The ribosomal DNA (rDNA) internal transcribed spacer (ITS) region sequences from the eight P. purpurogenum strains were sequenced and used to construct a neighbor-joining phylogenetic tree. PP-O and PP-V production of P. purpurogenum was shown to be related to phylogenetic placement based on rDNA ITS sequence. Based on these results, two hypotheses for the alteration of pigment production of P. purpurogenum in evolution were proposed. Copyright © 2015 The British Mycological Society. Published by Elsevier Ltd. All rights reserved.

Molecular characterization and functional analysis of PR-1-like proteins identified from the wheat head blight fungus Fusarium graminearum

Science.gov (United States)

The group 1 pathogenesis-related (PR-1) proteins originally identified from plants and their homologues are also found in other eukaryotic kingdoms. Studies on non-plant PR-1-like (PR-1L) proteins have been pursued widely in humans/animals but rarely in filamentous ascomycetes. Here we report the ch...

The Orf virus E3L homologue is able to complement deletion of the vaccinia virus E3L gene in vitro but not in vivo

International Nuclear Information System (INIS)

Vijaysri, Sangeetha; Talasela, Latha; Mercer, Andrew A.; Mcinnes, Colin J.; Jacobs, Bertram L.; Langland, Jeffrey O.

2003-01-01

Orf virus (OV), the prototypic parapoxvirus, is resistant to the effects of interferon (IFN) and this function of OV has been mapped to the OV20.0L gene. The protein product of this gene shares 31% amino acid identity to the E3L-encoded protein of vaccinia virus (VV) that is required for the broad host range and IFN-resistant phenotype of VV in cells in culture and for virulence of the virus in vivo. In this study we investigated whether the distantly related OV E3L homologue could complement the deletion of E3L in VV. The recombinant VV (VV/ORF-E3L) expressing the OV E3L homologue in place of VV E3L was indistinguishable from wt VV in its cell-culture phenotype. But VV/ORF-E3L was over a 1000-fold less pathogenic than wt VV (LD 50 > 5 x 10 6 PFU, compared to LD 50 of wtVV = 4 x 10 3 PFU) following intranasal infection of mice. While wt VV spread to the lungs and brain and replicated to high titers in the brain of infected mice, VV/ORF-E3L could not be detected in the lungs or brain following intranasal infection. VV/ORF-E3L was at least 100,000-fold less pathogenic than wt VV on intracranial injection. Domain swap experiments demonstrate that the difference in pathogenesis maps to the C-terminal domain of these proteins. This domain has been shown to be required for the dsRNA binding function of the VV E3L

Mouse fetal antigen 1 (mFA1), the circulating gene product of mdlk, pref-1 and SCP-1: isolation, characterization and biology

DEFF Research Database (Denmark)

Bachmann, E; Krogh, T N; Højrup, P

1996-01-01

The mouse homologue to human fetal antigen 1 (hFA1) was purified from mouse amniotic fluid by cation exchange chromatography and immunospecific affinity chromatography. Mouse FA1 (mFA1) is a single chain glycoprotein with an M(r) of 42-50 kDa (SDS-PAGE). The N-terminal amino acid sequence (39...... residues) revealed 74% identity to hFA1 and 100% identity to the translated cDNAs referred to as mouse dlk, pref-1 and SCP-1. mFA1 is the secreted processed molecule encoded by the mRNA defined by these identical mouse cDNAs. Monospecific rabbit anti-mFA1 antibodies, purified by ammonium sulfate...... precipitation and immunospecific affinity chromatography, were used for immunohistochemical and quantitative ELISA techniques. The indirect immunoperoxidase technique demonstrated mFA1 within the endocrine structures of adult mouse pancreas, whereas the exocrine tissue remained unstained. FA1-positive staining...

Br...Br and van der Waals interactions along a homologous series: crystal packing of 1,2-dibromo-4,5-dialkoxybenzenes.

Science.gov (United States)

Suarez, Sebastián A; Muller, Federico; Gutiérrez Suburu, Matías E; Fonrouge, Ana; Baggio, Ricardo F; Cukiernik, Fabio D

2016-10-01

The crystalline structures of four homologues of the 1,2-dibromo-4,5-dialkoxybenzene series [Br 2 C 6 H 2 (OC n H 2n + 1 ) 2 for n = 2, 12, 14 and 18] have been solved by means of single-crystal crystallography. Comparison along the series, including the previously reported n = 10 and n = 16 derivatives, shows a clear metric trend (b and c essentially fixed along the series and a growing linearly with n), in spite of some subtle differences in space groups and/or packing modes. A uniform packing pattern for the aliphatic chains has been found for the n = 12 to 18 homologues, which slightly differs from that of the n = 10 derivative. The crystalline structures of all the higher homologues (n = 10-18) seem to arise from van der Waals interchain interactions and, to a lesser extent, type II Br...Br interactions. The dominant role of interchain interactions provides direct structural support for the usual interpretation of melting point trends like that found along this series. Atoms in Molecules (AIM) analysis allows a comparison of the relative magnitude of the interchain and Br...Br interactions, an analysis validated by the measured melting enthalpies.

Associations of dietary methyl donor intake with MLH1 promoter hypermethylation and related molecular phenotypes in sporadic colorectal cancer

NARCIS (Netherlands)

Vogel, S. de; Bongaerts, B.W.C.; Wouters, K.A.D.; Kester, A.D.M.; Schouten, L.J.; Goeij, A.F.P.M. de; Bruïne, A.P. de; Goldbohm, R.A.; Brandt, P.A. van den; Engeland, M. van; Weijenberg, M.P.

2008-01-01

Intake of dietary factors that serve as methyl group donors may influence promoter hypermethylation in colorectal carcinogenesis. We investigated whether dietary folate, vitamin B2 and vitamin B6, methionine and alcohol were associated with mutL homologue 1 (MLH1) hypermethylation and the related

The first genome sequence of a metatherian herpesvirus: Macropodid herpesvirus 1.

Science.gov (United States)

Vaz, Paola K; Mahony, Timothy J; Hartley, Carol A; Fowler, Elizabeth V; Ficorilli, Nino; Lee, Sang W; Gilkerson, James R; Browning, Glenn F; Devlin, Joanne M

2016-01-22

While many placental herpesvirus genomes have been fully sequenced, the complete genome of a marsupial herpesvirus has not been described. Here we present the first genome sequence of a metatherian herpesvirus, Macropodid herpesvirus 1 (MaHV-1). The MaHV-1 viral genome was sequenced using an Illumina MiSeq sequencer, de novo assembly was performed and the genome was annotated. The MaHV-1 genome was 140 kbp in length and clustered phylogenetically with the primate simplexviruses, sharing 67% nucleotide sequence identity with Human herpesviruses 1 and 2. The MaHV-1 genome contained 66 predicted open reading frames (ORFs) homologous to those in other herpesvirus genomes, but lacked homologues of UL3, UL4, UL56 and glycoprotein J. This is the first alphaherpesvirus genome that has been found to lack the UL3 and UL4 homologues. We identified six novel ORFs and confirmed their transcription by RT-PCR. This is the first genome sequence of a herpesvirus that infects metatherians, a taxonomically unique mammalian clade. Members of the Simplexvirus genus are remarkably conserved, so the absence of ORFs otherwise retained in eutherian and avian alphaherpesviruses contributes to our understanding of the Alphaherpesvirinae. Further study of metatherian herpesvirus genetics and pathogenesis provides a unique approach to understanding herpesvirus-mammalian interactions.

Molecular cloning and responsive expression to injury stimulus of a defender against cell death 1 (DAD1) gene from bay scallops Argopecten irradians.

Science.gov (United States)

Zhu, Ling; Song, Linsheng; Zhang, Huan; Zhao, Jianmin; Li, Chenghua; Xu, Wei

2008-06-01

Apoptosis is an active process of cell death, which is an integral part of growth and development in multicellular organisms. The defender against cell death 1 (DAD1), the regulatory protein to inhibit the apoptosis process, was first cloned from the bay scallop Argopecten irradians by randomly sequencing a whole tissue cDNA library and rapid amplification of cDNA end (RACE). The full-length cDNA of the A. irradians DAD1 was 607 bp, consist of a 5'-terminal untranslated region (UTR) of 63 bp, a 3'-terminal UTR of 205 bp with a canonical polyadenylation signal sequence AATAAA and a poly (A) tail, and an open reading frame of 339 bp. The deduced amino acid sequence of the A. irradians DAD1 showed 75.5% identity to Araneus ventricosus, 74.5% to Drosophila melanogaster, and 73.6% to Homo sapiens, Sus scrofa, Mesocricetus auratus, Rattus norvegicus and Mus musculus. Excluding the Saccharomyces cerevisiae DAD1 homologue, all animal DAD1 including A. irradians DAD1 homologue formed a subgroup and all plant DAD1 proteins formed another subgroup in the phylogenetic analysis. The A. irradians DAD1 was expressed in all examined tissues including adductor muscle, mantle, gills, digestive gland, gonad and hemolymph, suggesting that A. irradians DAD1 is expressed in most body tissues. Furthermore, the mRNA expression levels of A. irradians DAD1 gene of hemolymph were particularly high after injury, suggesting that the gene is responsive to injury stimuli.

Characterization of Translationally Controlled Tumour Protein from the Sea Anemone Anemonia viridis and Transcriptome Wide Identification of Cnidarian Homologues.

Science.gov (United States)

Nicosia, Aldo; Bennici, Carmelo; Biondo, Girolama; Costa, Salvatore; Di Natale, Marilena; Masullo, Tiziana; Monastero, Calogera; Ragusa, Maria Antonietta; Tagliavia, Marcello; Cuttitta, Angela

2018-01-11

Gene family encoding translationally controlled tumour protein (TCTP) is defined as highly conserved among organisms; however, there is limited knowledge of non-bilateria. In this study, the first TCTP homologue from anthozoan was characterised in the Mediterranean Sea anemone, Anemonia viridis . The release of the genome sequence of Acropora digitifera , Exaiptasia pallida , Nematostella vectensis and Hydra vulgaris enabled a comprehensive study of the molecular evolution of TCTP family among cnidarians. A comparison among TCTP members from Cnidaria and Bilateria showed conserved intron exon organization, evolutionary conserved TCTP signatures and 3D protein structure. The pattern of mRNA expression profile was also defined in A. viridis . These analyses revealed a constitutive mRNA expression especially in tissues with active proliferation. Additionally, the transcriptional profile of A. viridis TCTP ( AvTCTP ) after challenges with different abiotic/biotic stresses showed induction by extreme temperatures, heavy metals exposure and immune stimulation. These results suggest the involvement of AvTCTP in the sea anemone defensome taking part in environmental stress and immune responses.

Characterization of Translationally Controlled Tumour Protein from the Sea Anemone Anemonia viridis and Transcriptome Wide Identification of Cnidarian Homologues

Directory of Open Access Journals (Sweden)

Aldo Nicosia

2018-01-01

Full Text Available Gene family encoding translationally controlled tumour protein (TCTP is defined as highly conserved among organisms; however, there is limited knowledge of non-bilateria. In this study, the first TCTP homologue from anthozoan was characterised in the Mediterranean Sea anemone, Anemonia viridis. The release of the genome sequence of Acropora digitifera, Exaiptasia pallida, Nematostella vectensis and Hydra vulgaris enabled a comprehensive study of the molecular evolution of TCTP family among cnidarians. A comparison among TCTP members from Cnidaria and Bilateria showed conserved intron exon organization, evolutionary conserved TCTP signatures and 3D protein structure. The pattern of mRNA expression profile was also defined in A. viridis. These analyses revealed a constitutive mRNA expression especially in tissues with active proliferation. Additionally, the transcriptional profile of A. viridis TCTP (AvTCTP after challenges with different abiotic/biotic stresses showed induction by extreme temperatures, heavy metals exposure and immune stimulation. These results suggest the involvement of AvTCTP in the sea anemone defensome taking part in environmental stress and immune responses.

Structure-guided mutational analysis reveals the functional requirements for product specificity of DOT1 enzymes.

Science.gov (United States)

Dindar, Gülcin; Anger, Andreas M; Mehlhorn, Christine; Hake, Sandra B; Janzen, Christian J

2014-11-12

DOT1 enzymes are conserved methyltransferases that catalyse the methylation of lysine 79 on histone H3 (H3K79). Most eukaryotes contain one DOT1 enzyme, whereas African trypanosomes have two homologues, DOT1A and DOT1B, with different enzymatic activities. DOT1A mediates mono- and dimethylation of H3K76, the homologue of H3K79 in other organisms, whereas DOT1B additionally catalyses H3K76 trimethylation. However, it is unclear how these different enzymatic activities are achieved. Here we employ a trypanosomal nucleosome reconstitution system and structure-guided homology modelling to identify critical residues within and outside the catalytic centre that modulate product specificity. Exchange of these residues transfers the product specificity from one enzyme to the other, and reveals the existence of distinct regulatory domains adjacent to the catalytic centre. Our study provides the first evidence that a few crucial residues in DOT1 enzymes are sufficient to catalyse methyl-state-specific reactions. These results might also have far-reaching consequences for the functional understanding of homologous enzymes in higher eukaryotes.

Enhancer of zeste homologue 2 plays an important role in neuroblastoma cell survival independent of its histone methyltransferase activity.

Science.gov (United States)

Bate-Eya, Laurel T; Gierman, Hinco J; Ebus, Marli E; Koster, Jan; Caron, Huib N; Versteeg, Rogier; Dolman, M Emmy M; Molenaar, Jan J

2017-04-01

Neuroblastoma is predominantly characterised by chromosomal rearrangements. Next to V-Myc Avian Myelocytomatosis Viral Oncogene Neuroblastoma Derived Homolog (MYCN) amplification, chromosome 7 and 17q gains are frequently observed. We identified a neuroblastoma patient with a regional 7q36 gain, encompassing the enhancer of zeste homologue 2 (EZH2) gene. EZH2 is the histone methyltransferase of lysine 27 of histone H3 (H3K27me3) that forms the catalytic subunit of the polycomb repressive complex 2. H3K27me3 is commonly associated with the silencing of genes involved in cellular processes such as cell cycle regulation, cellular differentiation and cancer. High EZH2 expression correlated with poor prognosis and overall survival independent of MYCN amplification status. Unexpectedly, treatment of 3 EZH2-high expressing neuroblastoma cell lines (IMR32, CHP134 and NMB), with EZH2-specific inhibitors (GSK126 and EPZ6438) resulted in only a slight G1 arrest, despite maximum histone methyltransferase activity inhibition. Furthermore, colony formation in cell lines treated with the inhibitors was reduced only at concentrations much higher than necessary for complete inhibition of EZH2 histone methyltransferase activity. Knockdown of the complete protein with three independent shRNAs resulted in a strong apoptotic response and decreased cyclin D1 levels. This apoptotic response could be rescued by overexpressing EZH2ΔSET, a truncated form of wild-type EZH2 lacking the SET transactivation domain necessary for histone methyltransferase activity. Our findings suggest that high EZH2 expression, at least in neuroblastoma, has a survival function independent of its methyltransferase activity. This important finding highlights the need for studies on EZH2 beyond its methyltransferase function and the requirement for compounds that will target EZH2 as a complete protein. Copyright © 2017 Elsevier Ltd. All rights reserved.

Functional analysis of the conserved transcriptional regulator CfWor1 in Cladosporium fulvum reveals diverse roles in the virulence of plant pathogenic fungi

NARCIS (Netherlands)

Ökmen, B.; Collemare, J.; Griffiths, S.A.; Burgt, van der A.; Cox, R.; Wit, de P.J.G.M.

2014-01-01

Fungal Wor1-like proteins are conserved transcriptional regulators that are reported to regulate the virulence of several plant pathogenic fungi by affecting the expression of virulence genes. Here, we report the functional analysis of CfWor1, the homologue of Wor1 in Cladosporium fulvum. ¿cfwor1

Enhancer of the rudimentary gene homologue (ERH expression pattern in sporadic human breast cancer and normal breast tissue

Directory of Open Access Journals (Sweden)

Knüchel Ruth

2008-05-01

Full Text Available Abstract Background The human gene ERH (Enhancer of the Rudimentary gene Homologue has previously been identified by in silico analysis of four million ESTs as a gene differentially expressed in breast cancer. The biological function of ERH protein has not been fully elucidated, however functions in cell cycle progression, pyrimidine metabolism a possible interaction with p21(Cip1/Waf1 via the Ciz1 zinc finger protein have been suggested. The aim of the present study was a systematic characterization of ERH expression in human breast cancer in order to evaluate possible clinical applications of this molecule. Methods The expression pattern of ERH was analyzed using multiple tissue northern blots (MTN on a panel of 16 normal human tissues and two sets of malignant/normal breast and ovarian tissue samples. ERH expression was further analyzed in breast cancer and normal breast tissues and in tumorigenic as well as non-tumorigenic breast cancer cell lines, using quantitative RT-PCR and non-radioisotopic in situ hybridization (ISH. Results Among normal human tissues, ERH expression was most abundant in testis, heart, ovary, prostate, and liver. In the two MTN sets of malignant/normal breast and ovarian tissue,ERH was clearly more abundantly expressed in all tumours than in normal tissue samples. Quantitative RT-PCR analyses showed that ERH expression was significantly more abundant in tumorigenic than in non-tumorigenic breast cancer cell lines (4.5-fold; p = 0.05, two-tailed Mann-Whitney U-test; the same trend was noted in a set of 25 primary invasive breast cancers and 16 normal breast tissue samples (2.5-fold; p = 0.1. These findings were further confirmed by non-radioisotopic ISH in human breast cancer and normal breast tissue. Conclusion ERH expression is clearly up-regulated in malignant as compared with benign breast cells both in primary human breast cancer and in cell models of breast cancer. Since similar results were obtained for ovarian

Disruption of Higher Order DNA Structures in Friedreich's Ataxia (GAA)(n) Repeats by PNA or LNA Targeting

DEFF Research Database (Denmark)

Bergquist, Helen; Rocha, Cristina S. J.; Alvarez-Asencio, Ruben

2016-01-01

Expansion of (GAA)n repeats in the first intron of the Frataxin gene is associated with reduced mRNA and protein levels and the development of Friedreich’s ataxia. (GAA)n expansions form non-canonical structures, including intramolecular triplex (H-DNA), and R-loops and are associated with epigen...

Characterization of Pseudomonas chlororaphis myovirus 201φ2-1 via genomic sequencing, mass spectrometry, and electron microscopy

International Nuclear Information System (INIS)

Thomas, Julie A.; Rolando, Mandy R.; Carroll, Christopher A.; Shen, Peter S.; Belnap, David M.; Weintraub, Susan T.; Serwer, Philip; Hardies, Stephen C.

2008-01-01

Pseudomonas chlororaphis phage 201φ2-1 is a relative of Pseudomonas aeruginosa myovirus φKZ. Phage 201φ2-1 was examined by complete genomic sequencing (316,674 bp), by a comprehensive mass spectrometry survey of its virion proteins and by electron microscopy. Seventy-six proteins, of which at least 69 have homologues in φKZ, were identified by mass spectrometry. Eight proteins, in addition to the major head, tail sheath and tail tube proteins, are abundant in the virion. Electron microscopy of 201φ2-1 revealed a multitude of long, fine fibers apparently decorating the tail sheath protein. Among the less abundant virion proteins are three homologues to RNA polymerase β or β' subunits. Comparison between the genomes of 201φ2-1 and φKZ revealed substantial conservation of the genome plan, and a large region with an especially high rate of gene replacement. The φKZ-like phages exhibited a two-fold higher rate of divergence than for T4-like phages or host genomes

Insights into the role of oxidative stress in the pathology of Friedreich ataxia using peroxidation resistant polyunsaturated fatty acids

Directory of Open Access Journals (Sweden)

M. Grazia Cotticelli

2013-01-01

Full Text Available Friedreich ataxia is an autosomal recessive, inherited neuro- and cardio-degenerative disorder characterized by progressive ataxia of all four limbs, dysarthria, areflexia, sensory loss, skeletal deformities, and hypertrophic cardiomyopathy. Most disease alleles have a trinucleotide repeat expansion in the first intron of the FXN gene, which decreases expression of the encoded protein frataxin. Frataxin is involved in iron–sulfur-cluster (ISC assembly in the mitochondrial matrix, and decreased frataxin is associated with ISC-enzyme and mitochondrial dysfunction, mitochondrial iron accumulation, and increased oxidative stress. To assess the role of oxidative stress in lipid peroxidation in Friedreich ataxia we used the novel approach of treating Friedreich ataxia cell models with polyunsaturated fatty acids (PUFAs deuterated at bis-allylic sites. In ROS-driven oxidation of PUFAs, the rate-limiting step is hydrogen abstraction from a bis-allylic site; isotopic reinforcement (deuteration of bis-allylic sites slows down their peroxidation. We show that linoleic and α-linolenic acids deuterated at the peroxidation-prone bis-allylic positions actively rescue oxidative-stress-challenged Friedreich ataxia cells. The protective effect of the deuterated PUFAs is additive in our models with the protective effect of the CoQ10 analog idebenone, which is thought to decrease the production of free radicals. Moreover, the administration of deuterated PUFAs resulted in decreased lipid peroxidation as measured by the fluorescence of the fatty acid analog C11-BODIPY (581/591 probe. Our results are consistent with a role for lipid peroxidation in Friedreich ataxia pathology, and suggest that the novel approach of oral delivery of isotope-reinforced PUFAs may have therapeutic potential in Friedreich ataxia and other disorders involving oxidative stress and lipid peroxidation.

Metabolomic profiling reveals a role for CPT1c in neuronal oxidative metabolism

OpenAIRE

Lee, Jieun; Wolfgang, Michael J

2012-01-01

Abstract Background Carnitine Palmitoyltransferase-1c (CPT1c) is a neuron specific homologue of the carnitine acyltransferase family of enzymes. CPT1 isoenzymes transfer long chain acyl groups to carnitine. This constitutes a rate setting step for mitochondrial fatty acid beta-oxidation by facilitating the initial step in acyl transfer to the mitochondrial matrix. In general, neurons do not heavily utilize fatty acids for bioenergetic needs and definitive enzymatic activity has been unable to...

SOLO: a meiotic protein required for centromere cohesion, coorientation, and SMC1 localization in Drosophila melanogaster.

Science.gov (United States)

Yan, Rihui; Thomas, Sharon E; Tsai, Jui-He; Yamada, Yukihiro; McKee, Bruce D

2010-02-08

Sister chromatid cohesion is essential to maintain stable connections between homologues and sister chromatids during meiosis and to establish correct centromere orientation patterns on the meiosis I and II spindles. However, the meiotic cohesion apparatus in Drosophila melanogaster remains largely uncharacterized. We describe a novel protein, sisters on the loose (SOLO), which is essential for meiotic cohesion in Drosophila. In solo mutants, sister centromeres separate before prometaphase I, disrupting meiosis I centromere orientation and causing nondisjunction of both homologous and sister chromatids. Centromeric foci of the cohesin protein SMC1 are absent in solo mutants at all meiotic stages. SOLO and SMC1 colocalize to meiotic centromeres from early prophase I until anaphase II in wild-type males, but both proteins disappear prematurely at anaphase I in mutants for mei-S332, which encodes the Drosophila homologue of the cohesin protector protein shugoshin. The solo mutant phenotypes and the localization patterns of SOLO and SMC1 indicate that they function together to maintain sister chromatid cohesion in Drosophila meiosis.

DNA triplex structures in neurodegenerative disorder, Friedreich's ...

Indian Academy of Sciences (India)

2012-06-25

Jun 25, 2012 ... clearly suggests that the shape of DNA is the determining factor in the cellular function. FRDA is the only ..... SCA VII. CAG. 4–35. 28–35. 37 –200. SBMA. CAG. 15–31. –. 40–62 ... production of Frataxin (Babcock et al. 1997).

Regulation of Metalloprotease Gene Expression in Vibrio vulnificus by a Vibrio harveyi LuxR Homologue

Science.gov (United States)

Shao, Chung-Ping; Hor, Lien-I

2001-01-01

Expression of the Vibrio vulnificus metalloprotease gene, vvp, was turned up rapidly when bacterial growth reached the late log phase. A similar pattern of expression has been found in the metalloprotease gene of Vibrio cholerae, and this has been shown to be regulated by a Vibrio harveyi LuxR-like transcriptional activator. To find out whether a LuxR homologue exists in V. vulnificus, a gene library of this organism was screened by colony hybridization using a probe derived from a sequence that is conserved in various luxR-like genes of vibrios. A gene containing a 618-bp open reading frame was identified and found to be identical to the smcR gene of V. vulnificus reported previously. An isogenic SmcR-deficient (RD) mutant was further constructed by an in vivo allelic exchange technique. This mutant exhibited an extremely low level of vvp transcription compared with that of the parent strain. On the other hand, the cytolysin gene, vvhA, was expressed at a higher level in the RD mutant than in the parent strain during the log phase of growth. These data suggested that SmcR might not only be a positive regulator of the protease gene but might also be involved in negative regulation of the cytolysin gene. Virulence of the RD mutant in either normal or iron-overloaded mice challenged by intraperitoneal injection was comparable to that of the parent strain, indicating that SmcR is not required for V. vulnificus virulence in mice. PMID:11157950

Development and mapping of SSR markers linked to resistance-gene homologue clusters in common bean

Institute of Scientific and Technical Information of China (English)

Luz; Nayibe; Garzon; Matthew; Wohlgemuth; Blair

2014-01-01

Common bean is an important but often a disease-susceptible legume crop of temperate,subtropical and tropical regions worldwide. The crop is affected by bacterial, fungal and viral pathogens. The strategy of resistance-gene homologue(RGH) cloning has proven to be an efficient tool for identifying markers and R(resistance) genes associated with resistances to diseases. Microsatellite or SSR markers can be identified by physical association with RGH clones on large-insert DNA clones such as bacterial artificial chromosomes(BACs). Our objectives in this work were to identify RGH-SSR in a BAC library from the Andean genotype G19833 and to test and map any polymorphic markers to identify associations with known positions of disease resistance genes. We developed a set of specific probes designed for clades of common bean RGH genes and then identified positive BAC clones and developed microsatellites from BACs having SSR loci in their end sequences. A total of 629 new RGH-SSRs were identified and named BMr(bean microsatellite RGH-associated markers). A subset of these markers was screened for detecting polymorphism in the genetic mapping population DOR364 × G19833. A genetic map was constructed with a total of 264 markers,among which were 80 RGH loci anchored to single-copy RFLP and SSR markers. Clusters of RGH-SSRs were observed on most of the linkage groups of common bean and in positions associated with R-genes and QTL. The use of these new markers to select for disease resistance is discussed.

Anion exchange behaviour of Zr, Hf, Nb, Ta and Pa as homologues of RF and Db in fluoride medium

International Nuclear Information System (INIS)

Monroy G, F.; Trubert, D.; Brillard, L.; Hussonnois, M.; Constantinescu, O.; Le Naour, C.

2010-01-01

Studies of the chemical property of trans actinide elements are very difficult due to their short half-lives and extremely small production yields. However it is still possible to obtain considerable information about their chemical properties, such as the most stable oxidation states in aqueous solution, complexing ability, etc., comparing their behaviour with their lighter homologous in the periodic table. In order to obtain a better knowledge of the behaviour of rutherfordium, RF (element 104), dub nium, Db (element 105) in HF medium, the sorption properties of Zr, Hf, Nb, Ta an Pa, homologues of RF and Db, were studied in NH 4 F/HClO 4 medium in this work. Stability constants of the fluoride complexes of these elements were experimentally obtained from K d obtained at different F - and H + concentrations. The anionic complexes: [Zr(Hf)F 5 ] - , [Zr(Hf)F 6 ] 2- , [Zr(Hf)F 7 ] 3- , [Ta(Pa)F 6 ] - , [Ta(Pa)F 7 ] 2- , [Ta(Pa)F 8 ] 3- , [NbOF 4 ] - and [NbOF 5 ] 2- are present as predominant species in the HF range over investigation. (Author)

The Hsk1(Cdc7) Replication Kinase Regulates Origin Efficiency

OpenAIRE

Patel, Prasanta K.; Kommajosyula, Naveen; Rosebrock, Adam; Bensimon, Aaron; Leatherwood, Janet; Bechhoefer, John; Rhind, Nicholas

2008-01-01

Origins of DNA replication are generally inefficient, with most firing in fewer than half of cell cycles. However, neither the mechanism nor the importance of the regulation of origin efficiency is clear. In fission yeast, origin firing is stochastic, leading us to hypothesize that origin inefficiency and stochasticity are the result of a diffusible, rate-limiting activator. We show that the Hsk1-Dfp1 replication kinase (the fission yeast Cdc7-Dbf4 homologue) plays such a role. Increasing or ...

The Saccharomyces cerevisiae RAD30 gene, a homologue of Escherichia coli dinB and umuC, is DNA damage inducible and functions in a novel error-free postreplication repair mechanism

Energy Technology Data Exchange (ETDEWEB)

McDonald, J. P. [NIH, Bethesda, MD. (United States); Levine, A. S.; Woodgate, R.

1997-12-15

Damage-inducible mutagenesis in prokaryotes is largely dependent upon the activity of the UmuD'C-like proteins. Since many DNA repair processes are structurally and/or functionally conserved between prokaryotes and eukaryotes, we investigated the role of RAD30, a previously uncharacterized Saccharomyces cerevisiae DNA repair gene related to the Escherichia coli dinB, umuC and S. cerevisiae REV1 genes, in UV resistance and UV-induced mutagenesis. Similar to its prokaryotic homologues, RAD30 was found to be damage inducible. Like many S. cerevisiae genes involved in error-prone DNA repair, epistasis analysis clearly places RAD30 in the RAD6 group and rad30 mutants display moderate UV sensitivity reminiscent of rev mutants. However, unlike rev mutants, no defect in UV-induced reversion was seen in rad30 strains. While rad6 and rad18 are both epistatic to rad30, no epistasis was observed with rev1, rev3, rev7 or rad5, all of which are members of the RAD6 epistasis group. These findings suggest that RD30 participates in a novel error-free repair pathway dependent on RAD6 and RAD18, but independent of REV1, REV3, REV7 and RAD5. (author)

The Genetic Basis of Constitutive and Herbivore-Induced ESP-Independent Nitrile Formation in Arabidopsis1[W][OA

Science.gov (United States)

Burow, Meike; Losansky, Anja; Müller, René; Plock, Antje; Kliebenstein, Daniel J.; Wittstock, Ute

2009-01-01

Glucosinolates are a group of thioglucosides that are components of an activated chemical defense found in the Brassicales. Plant tissue damage results in hydrolysis of glucosinolates by endogenous thioglucosidases known as myrosinases. Spontaneous rearrangement of the aglucone yields reactive isothiocyanates that are toxic to many organisms. In the presence of specifier proteins, alternative products, namely epithionitriles, simple nitriles, and thiocyanates with different biological activities, are formed at the expense of isothiocyanates. Recently, simple nitriles were recognized to serve distinct functions in plant-insect interactions. Here, we show that simple nitrile formation in Arabidopsis (Arabidopsis thaliana) ecotype Columbia-0 rosette leaves increases in response to herbivory and that this increase is independent of the known epithiospecifier protein (ESP). We combined phylogenetic analysis, a screen of Arabidopsis mutants, recombinant protein characterization, and expression quantitative trait locus mapping to identify a gene encoding a nitrile-specifier protein (NSP) responsible for constitutive and herbivore-induced simple nitrile formation in Columbia-0 rosette leaves. AtNSP1 is one of five Arabidopsis ESP homologues that promote simple nitrile, but not epithionitrile or thiocyanate, formation. Four of these homologues possess one or two lectin-like jacalin domains, which share a common ancestry with the jacalin domains of the putative Arabidopsis myrosinase-binding proteins MBP1 and MBP2. A sixth ESP homologue lacked specifier activity and likely represents the ancestor of the gene family with a different biochemical function. By illuminating the genetic and biochemical bases of simple nitrile formation, our study provides new insights into the evolution of metabolic diversity in a complex plant defense system. PMID:18987211

The Eps15 C. elegans homologue EHS-1 is implicated in synaptic vesicle recycling

DEFF Research Database (Denmark)

Salcini, A E; Hilliard, M A; Croce, A

2001-01-01

implicated Eps15 in endocytosis, its function in the endocytic machinery remains unclear. Here we show that the Caenorhabditis elegans gene, zk1248.3 (ehs-1), is the orthologue of Eps15 in nematodes, and that its product, EHS-1, localizes to synaptic-rich regions. ehs-1-impaired worms showed temperature...

Expression of cinnamyl alcohol dehydrogenases and their putative homologues during Arabidopsis thaliana growth and development: lessons for database annotations?

Science.gov (United States)

Kim, Sung-Jin; Kim, Kye-Won; Cho, Man-Ho; Franceschi, Vincent R; Davin, Laurence B; Lewis, Norman G

2007-07-01

A major goal currently in Arabidopsis research is determination of the (biochemical) function of each of its approximately 27,000 genes. To date, however, 12% of its genes actually have known biochemical roles. In this study, we considered it instructive to identify the gene expression patterns of nine (so-called AtCAD1-9) of 17 genes originally annotated by The Arabidopsis Information Resource (TAIR) as cinnamyl alcohol dehydrogenase (CAD, EC 1.1.1.195) homologues [see Costa, M.A., Collins, R.E., Anterola, A.M., Cochrane, F.C., Davin, L.B., Lewis N.G., 2003. An in silico assessment of gene function and organization of the phenylpropanoid pathway metabolic networks in Arabidopsis thaliana and limitations thereof. Phytochemistry 64, 1097-1112.]. In agreement with our biochemical studies in vitro [Kim, S.-J., Kim, M.-R., Bedgar, D.L., Moinuddin, S.G.A., Cardenas, C.L., Davin, L.B., Kang, C.-H., Lewis, N.G., 2004. Functional reclassification of the putative cinnamyl alcohol dehydrogenase multigene family in Arabidopsis. Proc. Natl. Acad. Sci. USA 101, 1455-1460.], and analysis of a double mutant [Sibout, R., Eudes, A., Mouille, G., Pollet, B., Lapierre, C., Jouanin, L., Séguin A., 2005. Cinnamyl Alcohol Dehydrogenase-C and -D are the primary genes involved in lignin biosynthesis in the floral stem of Arabidopsis. Plant Cell 17, 2059-2076.], both AtCAD5 (At4g34230) and AtCAD4 (At3g19450) were found to have expression patterns consistent with development/formation of different forms of the lignified vascular apparatus, e.g. lignifying stem tissues, bases of trichomes, hydathodes, abscission zones of siliques, etc. Expression was also observed in various non-lignifying zones (e.g. root caps) indicative of, perhaps, a role in plant defense. In addition, expression patterns of the four CAD-like homologues were investigated, i.e. AtCAD2 (At2g21730), AtCAD3 (At2g21890), AtCAD7 (At4g37980) and AtCAD8 (At4g37990), each of which previously had been demonstrated to have low CAD

Neurophysiological Evidence That Musical Training Influences the Recruitment of Right Hemispheric Homologues for Speech Perception

Directory of Open Access Journals (Sweden)

McNeel Gordon Jantzen

2014-03-01

Full Text Available Musicians have a more accurate temporal and tonal representation of auditory stimuli than their non-musician counterparts (Kraus & Chandrasekaran, 2010; Parbery-Clark, Skoe, & Kraus, 2009; Zendel & Alain, 2008; Musacchia, Sams, Skoe, & Kraus, 2007. Musicians who are adept at the production and perception of music are also more sensitive to key acoustic features of speech such as voice onset timing and pitch. Together, these data suggest that musical training may enhance the processing of acoustic information for speech sounds. In the current study, we sought to provide neural evidence that musicians process speech and music in a similar way. We hypothesized that for musicians, right hemisphere areas traditionally associated with music are also engaged for the processing of speech sounds. In contrast we predicted that in non-musicians processing of speech sounds would be localized to traditional left hemisphere language areas. Speech stimuli differing in voice onset time was presented using a dichotic listening paradigm. Subjects either indicated aural location for a specified speech sound or identified a specific speech sound from a directed aural location. Musical training effects and organization of acoustic features were reflected by activity in source generators of the P50. This included greater activation of right middle temporal gyrus (MTG and superior temporal gyrus (STG in musicians. The findings demonstrate recruitment of right hemisphere in musicians for discriminating speech sounds and a putative broadening of their language network. Musicians appear to have an increased sensitivity to acoustic features and enhanced selective attention to temporal features of speech that is facilitated by musical training and supported, in part, by right hemisphere homologues of established speech processing regions of the brain.

Drosophila arginine methyltransferase 1 (DART1) is an ecdysone receptor co-repressor

International Nuclear Information System (INIS)

Kimura, Shuhei; Sawatsubashi, Shun; Ito, Saya; Kouzmenko, Alexander; Suzuki, Eriko; Zhao, Yue; Yamagata, Kaoru; Tanabe, Masahiko; Ueda, Takashi; Fujiyama, Sari; Murata, Takuya; Matsukawa, Hiroyuki; Takeyama, Ken-ichi; Yaegashi, Nobuo

2008-01-01

Histone arginine methylation is an epigenetic marker that regulates gene expression by defining the chromatin state. Arginine methyltransferases, therefore, serve as transcriptional co-regulators. However, unlike other transcriptional co-regulators, the physiological roles of arginine methyltransferases are poorly understood. Drosophila arginine methyltransferase 1 (DART1), the mammalian PRMT1 homologue, methylates the arginine residue of histone H4 (H4R3me2). Disruption of DART1 in Drosophila by imprecise P-element excision resulted in low viability during metamorphosis in the pupal stages. In the pupal stage, an ecdysone hormone signal is critical for developmental progression. DART1 interacted with the nuclear ecdysone receptor (EcR) in a ligand-dependent manner, and co-repressed EcR in intact flies. These findings suggest that DART1, a histone arginine methyltransferase, is a co-repressor of EcR that is indispensable for normal pupal development in the intact fly

The Fe/S Cluster Assembly Protein Isd11 Is Essential for tRNA Thiolation in Trypanosoma brucei

Czech Academy of Sciences Publication Activity Database

Paris, Zdeněk; Changmai, Piya; RUBIO, M. A. T.; Zíková, Alena; Stuart, K. D.; Alfonzo, J. D.; Lukeš, Julius

2010-01-01

Roč. 285, č. 29 (2010), s. 22394-22402 ISSN 0021-9258 R&D Projects: GA ČR GA204/09/1667 Institutional research plan: CEZ:AV0Z60220518 Keywords : IRON-SULFUR PROTEINS * SACCHAROMYCES-CEREVISIAE * CYSTEINE DESULFURASE * THIO- MODIFICATION * FRATAXIN Subject RIV: EB - Genetic s ; Molecular Biology Impact factor: 5.328, year: 2010

Delimitation of the Earliness per se D1 (Eps-D1) flowering gene to a subtelomeric chromosomal deletion in bread wheat (Triticum aestivum)

Science.gov (United States)

Zikhali, Meluleki; Wingen, Luzie U.; Griffiths, Simon

2016-01-01

Earliness per se (Eps) genes account for the variation in flowering time when vernalization and photoperiod requirements are satisfied. Genomics and bioinformatics approaches were used to describe allelic variation for 40 Triticum aestivum genes predicted, by synteny with Brachypodium distachyon, to be in the 1DL Eps region. Re-sequencing 1DL genes revealed that varieties carrying early heading alleles at this locus, Spark and Cadenza, carry a subtelomeric deletion including several genes. The equivalent region in Rialto and Avalon is intact. A bimodal distribution in the segregating Spark X Rialto single seed descent (SSD) populations enabled the 1DL QTL to be defined as a discrete Mendelian factor, which we named Eps-D1. Near isogenic lines (NILs) and NIL derived key recombinants between markers flanking Eps-D1 suggest that the 1DL deletion contains the gene(s) underlying Eps-D1. The deletion spans the equivalent of the Triticum monoccocum Eps-A m 1 locus, and hence includes MODIFIER OF TRANSCRIPTION 1 (MOT1) and FTSH PROTEASE 4 (FTSH4), the candidates for Eps-A m 1. The deletion also contains T. aestivum EARLY FLOWERING 3-D1 (TaELF3-D1) a homologue of the Arabidopsis thaliana circadian clock gene EARLY FLOWERING 3. Eps-D1 is possibly a homologue of Eps-B1 on chromosome 1BL. NILs carrying the Eps-D1 deletion have significantly reduced total TaELF3 expression and altered TaGIGANTEA (TaGI) expression compared with wild type. Altered TaGI expression is consistent with an ELF3 mutant, hence we propose TaELF3-D1 as the more likely candidate for Eps-D1. This is the first direct fine mapping of Eps effect in bread wheat. PMID:26476691

Delimitation of the Earliness per se D1 (Eps-D1) flowering gene to a subtelomeric chromosomal deletion in bread wheat (Triticum aestivum).

Science.gov (United States)

Zikhali, Meluleki; Wingen, Luzie U; Griffiths, Simon

2016-01-01

Earliness per se (Eps) genes account for the variation in flowering time when vernalization and photoperiod requirements are satisfied. Genomics and bioinformatics approaches were used to describe allelic variation for 40 Triticum aestivum genes predicted, by synteny with Brachypodium distachyon, to be in the 1DL Eps region. Re-sequencing 1DL genes revealed that varieties carrying early heading alleles at this locus, Spark and Cadenza, carry a subtelomeric deletion including several genes. The equivalent region in Rialto and Avalon is intact. A bimodal distribution in the segregating Spark X Rialto single seed descent (SSD) populations enabled the 1DL QTL to be defined as a discrete Mendelian factor, which we named Eps-D1. Near isogenic lines (NILs) and NIL derived key recombinants between markers flanking Eps-D1 suggest that the 1DL deletion contains the gene(s) underlying Eps-D1. The deletion spans the equivalent of the Triticum monoccocum Eps-A (m) 1 locus, and hence includes MODIFIER OF TRANSCRIPTION 1 (MOT1) and FTSH PROTEASE 4 (FTSH4), the candidates for Eps-A (m) 1. The deletion also contains T. aestivum EARLY FLOWERING 3-D1 (TaELF3-D1) a homologue of the Arabidopsis thaliana circadian clock gene EARLY FLOWERING 3. Eps-D1 is possibly a homologue of Eps-B1 on chromosome 1BL. NILs carrying the Eps-D1 deletion have significantly reduced total TaELF3 expression and altered TaGIGANTEA (TaGI) expression compared with wild type. Altered TaGI expression is consistent with an ELF3 mutant, hence we propose TaELF3-D1 as the more likely candidate for Eps-D1. This is the first direct fine mapping of Eps effect in bread wheat. © The Author 2015. Published by Oxford University Press on behalf of the Society for Experimental Biology.

Isolation and characterization of the human homologue of rig and its pseudogenes: The functional gene has features characteristic of housekeeping genes

International Nuclear Information System (INIS)

Shiga, Kiyoto; Yamamoto, Hiroshi; Okamoto, Hiroshi

1990-01-01

Rig (rat insulinoma gene) was first isolated from a cDNA library of rat insulinomas and has been found to be activated in various human tumors such as insulinomas, esophageal cancers, and colon cancers. Here the authors isolated the human homologue of rig from a genomic DNA library constructed from a human esophageal carcinoma and determined its complete nucleotide sequence. The gene is composed of about 3,000 nucleotides and divided into four exons separated by three introns: exon 3 encodes the nuclear location signal and the DNA-binding domain of the RIG protein. The transcription initiation site was located at -46 base pairs upstream from the first ATG codon. The 5'-flanking region of the gene has no apparent TATA-box or CAAT-box sequence. However, two GC boxes are found at -189 and -30 base pairs upstream from the transcription initiation site and five GC boxes are also found in introns 1 and 2. The gene is bounded in the 5' region by CpG islands, regions of DNA with a high GC content and a high frequency of CpG dinucleotides relative to the bulk genome. Furthermore, the human genome contains at least six copies of RIG pseudogenes, and four of them have the characteristics of processed pseudogenes. From these results together with the finding that RIG is expressed in a wide variety of tissues and cells, they speculate that RIG belongs to the class of housekeeping genes, whose products are necessary for the growth of all cell types

Purification of the spliced leader ribonucleoprotein particle from Leptomonas collosoma revealed the existence of an Sm protein in trypanosomes. Cloning the SmE homologue.

Science.gov (United States)

Goncharov, I; Palfi, Z; Bindereif, A; Michaeli, S

1999-04-30

Trans-splicing in trypanosomes involves the addition of a common spliced leader (SL) sequence, which is derived from a small RNA, the SL RNA, to all mRNA precursors. The SL RNA is present in the cell in the form of a ribonucleoprotein, the SL RNP. Using conventional chromatography and affinity selection with 2'-O-methylated RNA oligonucleotides at high ionic strength, five proteins of 70, 16, 13, 12, and 8 kDa were co-selected with the SL RNA from Leptomonas collosoma, representing the SL RNP core particle. Under conditions of lower ionic strength, additional proteins of 28 and 20 kDa were revealed. On the basis of peptide sequences, the gene coding for a protein with a predicted molecular weight of 11.9 kDa was cloned and identified as homologue of the cis-spliceosomal SmE. The protein carries the Sm motifs 1 and 2 characteristic of Sm antigens that bind to all known cis-spliceosomal uridylic acid-rich small nuclear RNAs (U snRNAs), suggesting the existence of Sm proteins in trypanosomes. This finding is of special interest because trypanosome snRNPs are the only snRNPs examined to date that are not recognized by anti-Sm antibodies. Because of the early divergence of trypanosomes from the eukaryotic lineage, the trypanosome SmE protein represents one of the primordial Sm proteins in nature.

Anion exchange behaviour of Zr, Hf, Nb, Ta and Pa as homologues of RF and Db in fluoride medium

Energy Technology Data Exchange (ETDEWEB)

Monroy G, F. [ININ, Carretera Mexico-Toluca s/n, 52750 Ocoyoacac, Estado de Mexico (Mexico); Trubert, D.; Brillard, L.; Hussonnois, M.; Constantinescu, O.; Le Naour, C., E-mail: fabiola.monroy@inin.gob.m [Institut de Physique Nucleaire, F-91406 Orsay, France (France)

2010-07-01

Studies of the chemical property of trans actinide elements are very difficult due to their short half-lives and extremely small production yields. However it is still possible to obtain considerable information about their chemical properties, such as the most stable oxidation states in aqueous solution, complexing ability, etc., comparing their behaviour with their lighter homologous in the periodic table. In order to obtain a better knowledge of the behaviour of rutherfordium, RF (element 104), dub nium, Db (element 105) in HF medium, the sorption properties of Zr, Hf, Nb, Ta an Pa, homologues of RF and Db, were studied in NH{sub 4}F/HClO{sub 4} medium in this work. Stability constants of the fluoride complexes of these elements were experimentally obtained from K{sub d} obtained at different F{sup -} and H{sup +} concentrations. The anionic complexes: [Zr(Hf)F{sub 5}]{sup -}, [Zr(Hf)F{sub 6}]{sup 2-}, [Zr(Hf)F{sub 7}]{sup 3-}, [Ta(Pa)F{sub 6}]{sup -}, [Ta(Pa)F{sub 7}]{sup 2-}, [Ta(Pa)F{sub 8}]{sup 3-}, [NbOF{sub 4}]{sup -} and [NbOF{sub 5}]{sup 2-} are present as predominant species in the HF range over investigation. (Author)

Rasputin, the Drosophila homologue of the RasGAP SH3 binding protein, functions in ras- and Rho-mediated signaling.

Science.gov (United States)

Pazman, C; Mayes, C A; Fanto, M; Haynes, S R; Mlodzik, M

2000-04-01

The small GTPase Ras plays an important role in many cellular signaling processes. Ras activity is negatively regulated by GTPase activating proteins (GAPs). It has been proposed that RasGAP may also function as an effector of Ras activity. We have identified and characterized the Drosophila homologue of the RasGAP-binding protein G3BP encoded by rasputin (rin). rin mutants are viable and display defects in photoreceptor recruitment and ommatidial polarity in the eye. Mutations in rin/G3BP genetically interact with components of the Ras signaling pathway that function at the level of Ras and above, but not with Raf/MAPK pathway components. These interactions suggest that Rin is required as an effector in Ras signaling during eye development, supporting an effector role for RasGAP. The ommatidial polarity phenotypes of rin are similar to those of RhoA and the polarity genes, e.g. fz and dsh. Although rin/G3BP interacts genetically with RhoA, affecting both photoreceptor differentiation and polarity, it does not interact with the gain-of-function genotypes of fz and dsh. These data suggest that Rin is not a general component of polarity generation, but serves a function specific to Ras and RhoA signaling pathways.

SIRT1 may play a crucial role in overload-induced hypertrophy of skeletal muscle.

Science.gov (United States)

Koltai, Erika; Bori, Zoltán; Chabert, Clovis; Dubouchaud, Hervé; Naito, Hisashi; Machida, Shuichi; Davies, Kelvin Ja; Murlasits, Zsolt; Fry, Andrew C; Boldogh, Istvan; Radak, Zsolt

2017-06-01

Silent mating type information regulation 2 homologue 1 (SIRT1) activity and content increased significantly in overload-induced hypertrophy. SIRT1-mediated signalling through Akt, the endothelial nitric oxide synthase mediated pathway, regulates anabolic process in the hypertrophy of skeletal muscle. The regulation of catabolic signalling via forkhead box O 1 and protein ubiquitination is SIRT1 dependent. Overload-induced changes in microRNA levels regulate SIRT1 and insulin-like growth factor 1 signalling. Significant skeletal muscle mass guarantees functional wellbeing and is important for high level performance in many sports. Although the molecular mechanism for skeletal muscle hypertrophy has been well studied, it still is not completely understood. In the present study, we used a functional overload model to induce plantaris muscle hypertrophy by surgically removing the soleus and gastrocnemius muscles in rats. Two weeks of muscle ablation resulted in a 40% increase in muscle mass, which was associated with a significant increase in silent mating type information regulation 2 homologue 1 (SIRT1) content and activity (P overload-induced hypertrophy. These findings, along with the well-known regulatory roles that SIRT1 plays in modulating both anabolic and catabolic pathways, allow us to propose the hypothesis that SIRT1 may actually play a crucial causal role in overload-induced hypertrophy of skeletal muscle. This hypothesis will now require rigorous direct and functional testing. © 2017 The Authors. The Journal of Physiology © 2017 The Physiological Society.

Analysis of dofA, a fruA-dependent developmental gene, and its homologue, dofB, in Myxococcus xanthus.

Science.gov (United States)

Horiuchi, Takayuki; Akiyama, Takuya; Inouye, Sumiko; Komano, Teruya

2002-12-01

The developmentally regulated gene dofA, identified from pulse-labeling experiments by two-dimensional gel electrophoresis, and its homologue, dofB, were cloned and characterized in Myxococcus xanthus. Deletion of dofA and dofB did not affect the vegetative growth and development of M. xanthus. dofA was specifically expressed during development, while dofB expression was observed during vegetative growth and development. The dofA-lacZ fusion was introduced into a fruA mutant and A, B, C, D, and E extracellular signal mutants. The pattern of dofA expression in the C signal mutant was similar to that of the wild-type strain, while dofA expression was not detected in the fruA mutant. These results are consistent with those of the pulse-labeling experiments. dofA expression was reduced in A and E signal mutants, whereas dofA expression was delayed in B and D signal mutants. The patterns of expression of the dofA gene in the fruA mutant and the five signal mutants are strikingly similar to that of the tps gene, which encodes protein S, a major component of the outer surface of the myxospore; this result suggests that the dofA and tps genes are similarly regulated. The involvement of a highly GC-rich inverted repeat sequence (underlined), CGGCCCCCGATTCGTCGGGGGCCG, in developmentally regulated dofA expression is suggested.

Effect of Phosphatase and Tensin Homologue on Chromosome 10 on Angiotensin II-Mediated Proliferation, Collagen Synthesis, and Akt/P27 Signaling in Neonatal Rat Cardiac Fibroblasts

Directory of Open Access Journals (Sweden)

Ling Nie

2016-01-01

Full Text Available Cardiac fibroblasts (CFs play a key role in cardiac fibrosis by regulating the balance between extracellular matrix synthesis and breakdown. Although phosphatase and tensin homologue on chromosome 10 (PTEN has been found to play an important role in cardiovascular disease, it is not clear whether PTEN is involved in functional regulation of CFs. In the present study, PTEN was overexpressed in neonatal rat CFs via recombinant adenovirus-mediated gene transfer. The effects of PTEN overexpression on cell-cycle progression and angiotensin II- (Ang II- mediated regulation of collagen metabolism, synthesis of matrix metalloproteinases, and Akt/P27 signaling were investigated. Compared with uninfected cells and cells infected with green fluorescent protein-expressing adenovirus (Ad-GFP, cells infected with PTEN-expressing adenovirus (Ad-PTEN significantly increased PTEN protein and mRNA levels in CFs (P<0.05. The proportion of CFs in the G1/S cell-cycle phase was significantly higher for PTEN-overexpressing cells. In addition, Ad-PTEN decreased mRNA expression and the protein synthesis rate of collagen types I and III and antagonized Ang II-induced collagen synthesis. Overexpression of PTEN also decreased Ang II-induced matrix metalloproteinase-2 (MMP-2 and tissue inhibitor of metalloproteinase-1 (TIMP-1 production as well as gelatinase activity. Moreover, Ad-PTEN decreased Akt expression and increased P27 expression independent of Ang II stimulation. These results suggest that PTEN could regulate its functional effects in neonatal rat CFs partially via the Akt/P27 signaling pathway.

Crystallization and preliminary X-ray diffraction studies of the ubiquitin-like (UbL) domain of the human homologue A of Rad23 (hHR23A) protein.

Science.gov (United States)

Chen, Yu Wai; Tajima, Toshitaka; Rees, Martin; Garcia-Maya, Mitla

2009-09-01

Human homologue A of Rad23 (hHR23A) plays dual roles in DNA repair as well as serving as a shuttle vehicle targeting polyubiquitinated proteins for degradation. Its N-terminal ubiquitin-like (UbL) domain interacts with the 19S proteasomal cap and provides the docking mechanism for protein delivery. Pyramidal crystals of the UbL domain of hHR23A were obtained by the hanging-drop vapour-diffusion method with ammonium sulfate as the crystallizing agent. The crystals diffracted to beyond 2 A resolution and belonged to the hexagonal space group P6(5)22, with unit-cell parameters a = b = 78.48, c = 63.57 A. The structure was solved by molecular replacement using the UbL domain of yeast Dsk2 as the search model.

Regulation of the Src Kinase-associated Phosphoprotein 55 Homologue by the Protein Tyrosine Phosphatase PTP-PEST in the Control of Cell Motility*

Science.gov (United States)

Ayoub, Emily; Hall, Anita; Scott, Adam M.; Chagnon, Mélanie J.; Miquel, Géraldine; Hallé, Maxime; Noda, Masaharu; Bikfalvi, Andreas; Tremblay, Michel L.

2013-01-01

PTP-PEST is a cytosolic ubiquitous protein tyrosine phosphatase (PTP) that contains, in addition to its catalytic domain, several protein-protein interaction domains that allow it to interface with several signaling pathways. Among others, PTP-PEST is a key regulator of cellular motility and cytoskeleton dynamics. The complexity of the PTP-PEST interactome underscores the necessity to identify its interacting partners and physiological substrates in order to further understand its role in focal adhesion complex turnover and actin organization. Using a modified yeast substrate trapping two-hybrid system, we identified a cytosolic adaptor protein named Src kinase-associated phosphoprotein 55 homologue (SKAP-Hom) as a novel substrate of PTP-PEST. To confirm PTP-PEST interaction with SKAP-Hom, in vitro pull down assays were performed demonstrating that the PTP catalytic domain and Proline-rich 1 (P1) domain are respectively binding to the SKAP-Hom Y260 and Y297 residues and its SH3 domain. Subsequently, we generated and rescued SKAP-Hom-deficient mouse embryonic fibroblasts (MEFs) with WT SKAP-Hom, SKAP-Hom tyrosine mutants (Y260F, Y260F/Y297F), or SKAP-Hom SH3 domain mutant (W335K). Given the role of PTP-PEST, wound-healing and trans-well migration assays were performed using the generated lines. Indeed, SKAP-Hom-deficient MEFs showed a defect in migration compared with WT-rescued MEFs. Interestingly, the SH3 domain mutant-rescued MEFs showed an enhanced cell migration corresponding potentially with higher tyrosine phosphorylation levels of SKAP-Hom. These findings suggest a novel role of SKAP-Hom and its phosphorylation in the regulation of cellular motility. Moreover, these results open new avenues by which PTP-PEST regulates cellular migration, a hallmark of metastasis. PMID:23897807

How do individuals cope with stress? Behavioural, physiological and neuronal differences between proactive and reactive coping styles in fish

DEFF Research Database (Denmark)

Vindas, Marco A; Gorissen, Marnix; Höglund, Erik

2017-01-01

of the 5-HT1A receptor abundance) in the proposed amygdala homologue (Dm), increased expression of the neuroplasticity marker brain derived neurotropic factor (bdnf) in both Dl and Vv (lateral septum homologue), as well as increased expression of the corticotropin releasing factor 1 (crf1) receptor...

The phocein homologue SmMOB3 is essential for vegetative cell fusion and sexual development in the filamentous ascomycete Sordaria macrospora.

Science.gov (United States)

Bernhards, Yasmine; Pöggeler, Stefanie

2011-04-01

Members of the striatin family and their highly conserved interacting protein phocein/Mob3 are key components in the regulation of cell differentiation in multicellular eukaryotes. The striatin homologue PRO11 of the filamentous ascomycete Sordaria macrospora has a crucial role in fruiting body development. Here, we functionally characterized the phocein/Mob3 orthologue SmMOB3 of S. macrospora. We isolated the gene and showed that both, pro11 and Smmob3 are expressed during early and late developmental stages. Deletion of Smmob3 resulted in a sexually sterile strain, similar to the previously characterized pro11 mutant. Fusion assays revealed that ∆Smmob3 was unable to undergo self-fusion and fusion with the pro11 strain. The essential function of the SmMOB3 N-terminus containing the conserved mob domain was demonstrated by complementation analysis of the sterile S. macrospora ∆Smmob3 strain. Downregulation of either pro11 in ∆Smmob3, or Smmob3 in pro11 mutants by means of RNA interference (RNAi) resulted in synthetic sexual defects, demonstrating for the first time the importance of a putative PRO11/SmMOB3 complex in fruiting body development.

Estimation of physicochemical properties of 1-alkyl-3-methylimidazolium glutamate

International Nuclear Information System (INIS)

Fang, Da-wei; Yan, Qiang; Li, Du; Xia, Li-Xin; Zang, Shu-Liang

2014-01-01

Highlights: • The standard addition method (SAM) was applied in determination of density and surface tension of amino acid ionic liquids. • The molar refraction has been calculated by experimental data of refractive index. • Physico-chemical properties of the homologue of [C n mim][Glu] have been predicted by semiempirical methods. - Abstract: Amino acid ionic liquids (AAILs) [C 5 mim][Glu] (1-pentyl-3-methylimidazolium glutamate) and [C 6 mim][Glu] (1-hexyl-3-methylimidazolium glutamate) were prepared by the neutralization method and characterized by 1 H NMR spectroscopy and DSC. The values of their density, surface tension were measured over the temperature range (308.15 to 343.15 ± 0.05) K, and the refractive index was measured within the temperature range (293.15 to 328.15 ± 0.05) K. Since the AAILs can form strong hydrogen bonds with water, a small amount of water is difficult to remove from the AAILs by common methods. In order to eliminate the effect of water as an impurity existed in AAIL sample, the standard addition method (SAM) was applied to these measurements. In terms of a semi-empirical method, the following physico-chemical properties were predicted: molecular volume, V m , standard molar entropy, S 0 , parachor, P, surface tension, γ, thermal expansion coefficients, α, molar refraction, R M , and refractive index, n D , of the homologue of [C n mim][Glu] (n = 2, 3, 4)

Aplasia Ras homologue member Ⅰ overexpression inhibits tumor growth and induces apoptosis through inhibition of PI3K/Akt survival pathways in human osteosarcoma MG-63 cells in culture.

Science.gov (United States)

Ye, Kaishan; Wang, Shuanke; Yang, Yong; Kang, Xuewen; Wang, Jing; Han, Hua

2015-09-01

Aplasia Ras homologue member Ⅰ (ARHI), an imprinted tumor-suppressor gene, is downregulated in various types of cancer. However, the expression, function and specific mechanisms of ARHI in human osteosarcoma (OS) cells remain unclear. The aim of the present study was to assess the effect of ARHI on OS cell proliferation and apoptosis and its associated mechanism. In the study, ARHI mRNA and protein levels were markedly downregulated in OS cells compared with the human osteoblast precursor cell line hFOB1.19. By generating stable transfectants, ARHI was overexpressed in OS cells that had low levels of ARHI. Overexpression of ARHI inhibited cell viability and proliferation and induced apoptosis. However, caspase‑3 activity was not changed by ARHI overexpression. In addition, phosphorylated Akt protein expression decreased in the ARHI overexpression group compared to that in the control vector group. The knockdown of ARHI also resulted in the promotion of cell proliferation and the attenuation of apoptosis in MG‑63 cells. Additionally, ARHI silencing increased the level of p‑Akt. The present results indicate that ARHI inhibits OS cell proliferation and may have a key role in the development of OS.

Iron metabolism mutant hbd mice have a deletion in Sec15l1, which has homology to a yeast gene for vesicle docking.

Science.gov (United States)

White, Robert A; Boydston, Leigh A; Brookshier, Terri R; McNulty, Steven G; Nsumu, Ndona N; Brewer, Brandon P; Blackmore, Krista

2005-12-01

Defects in iron absorption and utilization lead to iron deficiency and anemia. While iron transport by transferrin receptor-mediated endocytosis is well understood, it is not completely clear how iron is transported from the endosome to the mitochondria where heme is synthesized. We undertook a positional cloning project to identify the causative mutation for the hemoglobin-deficit (hbd) mouse mutant, which suffers from a microcytic, hypochromic anemia apparently due to defective iron transport in the endocytosis cycle. As shown by previous studies, reticulocyte iron accumulation in homozygous hbd/hbd mice is deficient despite normal binding of transferrin to its receptor and normal transferrin uptake in the cell. We have identified a strong candidate gene for hbd, Sec15l1, a homologue to yeast SEC15, which encodes a key protein in vesicle docking. The hbd mice have an exon deletion in Sec15l1, which is the first known mutation of a SEC gene homologue in mammals.

SPAR1/RTEL1 maintains genomic stability by suppressing homologous recombination

Science.gov (United States)

Barber, Louise J.; Youds, Jillian L.; Ward, Jordan D.; McIlwraith, Michael J.; O’Neil, Nigel J.; Petalcorin, Mark I.R.; Martin, Julie S.; Collis, Spencer J.; Cantor, Sharon B.; Auclair, Melissa; Tissenbaum, Heidi; West, Stephen C.; Rose, Ann M.; Boulton, Simon J.

2013-01-01

SUMMARY Inappropriate homologous recombination (HR) can cause gross chromosomal rearrangements that in mammalian cells may lead to tumorigenesis. In yeast, the Srs2 protein is an anti-recombinase that eliminates inappropriate recombination events, but the functional equivalent of Srs2 in higher eukaryotes has proven to be elusive. In this work, we identify C. elegans SPAR-1 as a functional analogue of Srs2 and describe its vertebrate counterpart, SPAR1/RTEL1, which is required for genome stability and tumour avoidance. We find that spar-1 mutant worms and SPAR1 knockdown human cells share characteristic phenotypes with yeast srs2 mutants, including inviability upon deletion of the sgs1/BLM homologue, hyper-recombination, and DNA damage sensitivity. In vitro, purified human SPAR1 antagonises HR by promoting the disassembly of D loop recombination intermediates in a reaction dependent upon ATP hydrolysis. We propose that loss of HR control following deregulation of SPAR1/RTEL1 may be a critical event that drives genome instability and cancer. PMID:18957201

Altered expression of HER-2 and the mismatch repair genes MLH1 and MSH2 predicts the outcome of T1 high-grade bladder cancer.

Science.gov (United States)

Sanguedolce, Francesca; Cormio, Antonella; Massenio, Paolo; Pedicillo, Maria C; Cagiano, Simona; Fortunato, Francesca; Calò, Beppe; Di Fino, Giuseppe; Carrieri, Giuseppe; Bufo, Pantaleo; Cormio, Luigi

2018-04-01

The identification of factors predicting the outcome of stage T1 high-grade bladder cancer (BC) is a major clinical issue. We performed immunohistochemistry to assess the role of human epidermal growth factor receptor-2 (HER-2) and microsatellite instability (MSI) factors MutL homologue 1 (MLH1) and MutS homologue 2 (MSH2) in predicting recurrence and progression of T1 high-grade BCs having undergone transurethral resection of bladder tumor (TURBT) alone or TURBT + intravesical instillations of bacillus Calmette-Guerin (BCG). HER-2 overexpression was a significant predictor of disease-free survival (DFS) in the overall as well as in the two patients' population; as for progression-free survival (PFS), it was significant in the overall but not in the two patients' population. MLH1 was an independent predictor of PFS only in patients treated with BCG and MSH2 failed to predict DFS and PFS in all populations. Most importantly, the higher the number of altered markers the lowers the DFS and PFS. In multivariate Cox proportional-hazards regression analysis, the number of altered molecular markers and BCG treatment were significant predictors (p = 0.0004 and 0.0283, respectively) of DFS, whereas the number of altered molecular markers was the only significant predictor (p = 0.0054) of PFS. Altered expression of the proto-oncogene HER-2 and the two molecular markers of genetic instability MLH1 and MSH2 predicted T1 high-grade BC outcome with the higher the number of altered markers the lower the DFS and PFS. These findings provide grounds for further testing them in predicting the outcome of this challenging disease.

Nuclear import and export signals of human cohesins SA1/STAG1 and SA2/STAG2 expressed in Saccharomyces cerevisiae.

Directory of Open Access Journals (Sweden)

Leszek J Tarnowski

Full Text Available BACKGROUND: Human SA/STAG proteins, homologues of the yeast Irr1/Scc3 cohesin, are the least studied constituents of the sister chromatid cohesion complex crucial for proper chromosome segregation. The two SA paralogues, SA1 and SA2, show some specificity towards the chromosome region they stabilize, and SA2, but not SA1, has been shown to participate in transcriptional regulation as well. The molecular basis of this functional divergence is unknown. METHODOLOGY/PRINCIPAL FINDINGS: In silico analysis indicates numerous putative nuclear localization (NLS and export (NES signals in the SA proteins, suggesting the possibility of their nucleocytoplasmic shuttling. We studied the functionality of those putative signals by expressing fluorescently tagged SA1 and SA2 in the yeast Saccharomyces cerevisiae. Only the N-terminal NLS turned out to be functional in SA1. In contrast, the SA2 protein has at least two functional NLS and also two functional NES. Depending on the balance between these opposing signals, SA2 resides in the nucleus or is distributed throughout the cell. Validation of the above conclusions in HeLa cells confirmed that the same N-terminal NLS of SA1 is functional in those cells. In contrast, in SA2 the principal NLS functioning in HeLa cells is different from that identified in yeast and is localized to the C-terminus. CONCLUSIONS/SIGNIFICANCE: This is the first demonstration of the possibility of non-nuclear localization of an SA protein. The reported difference in the organization between the two SA homologues may also be relevant to their partially divergent functions. The mechanisms determining subcellular localization of cohesins are only partially conserved between yeast and human cells.

The putative oncogene Pim-1 in the mouse: its linkage and variation among t haplotypes.

Science.gov (United States)

Nadeau, J H; Phillips, S J

1987-11-01

Pim-1, a putative oncogene involved in T-cell lymphomagenesis, was mapped between the pseudo-alpha globin gene Hba-4ps and the alpha-crystallin gene Crya-1 on mouse chromosome 17 and therefore within the t complex. Pim-1 restriction fragment variants were identified among t haplotypes. Analysis of restriction fragment sizes obtained with 12 endonucleases demonstrated that the Pim-1 genes in some t haplotypes were indistinguishable from the sizes for the Pim-1b allele in BALB/c inbred mice. There are now three genes, Pim-1, Crya-1 and H-2 I-E, that vary among independently derived t haplotypes and that have indistinguishable alleles in t haplotypes and inbred strains. These genes are closely linked within the distal inversion of the t complex. Because it is unlikely that these variants arose independently in t haplotypes and their wild-type homologues, we propose that an exchange of chromosomal segments, probably through double crossingover, was responsible for indistinguishable Pim-1 genes shared by certain t haplotypes and their wild-type homologues. There was, however, no apparent association between variant alleles of these three genes among t haplotypes as would be expected if a single exchange introduced these alleles into t haplotypes. If these variant alleles can be shown to be identical to the wild-type allele, then lack of association suggests that multiple exchanges have occurred during the evolution of the t complex.

Cloning, sequencing, disruption and phenotypic analysis of uvsC, an Aspergillus nidulans homologue of yeast RAD51.

Science.gov (United States)

van Heemst, D; Swart, K; Holub, E F; van Dijk, R; Offenberg, H H; Goosen, T; van den Broek, H W; Heyting, C

1997-05-01

We have cloned the uvsC gene of Aspergillus nidulans by complementation of the A. nidulans uvsC114 mutant. The predicted protein UVSC shows 67.4% sequence identity to the Saccharomyces cerevisiae Rad51 protein and 27.4% sequence identity to the Escherichia coli RecA protein. Transcription of uvsC is induced by methyl-methane sulphonate (MMS), as is transcription of RAD51 of yeast. Similar levels of uvsC transcription were observed after MMS induction in a uvsC+ strain and the uvsC114 mutant. The coding sequence of the uvsC114 allele has a deletion of 6 bp, which results in deletion of two amino acids and replacement of one amino acid in the translation product. In order to gain more insight into the biological function of the uvsC gene, a uvsC null mutant was constructed, in which the entire uvsC coding sequence was replaced by a selectable marker gene. Meiotic and mitotic phenotypes of a uvsC+ strain, the uvsC114 mutant and the uvsC null mutant were compared. The uvsC null mutant was more sensitive to both UV and MMS than the uvsC114 mutant. The uvsC114 mutant arrested in meiotic prophase-I. The uvsC null mutant arrested at an earlier stage, before the onset of meiosis. One possible interpretation of these meiotic phenotypes is that the A. nidulans homologue of Rad51 of yeast has a role both in the specialized processes preceding meiosis and in meiotic prophase I.

RBFOX1 and RBFOX3 mutations in rolandic epilepsy

DEFF Research Database (Denmark)

Lal, Dennis; Reinthaler, Eva M; Altmüller, Janine

2013-01-01

Partial deletions of the gene encoding the neuronal splicing regulator RBFOX1 have been reported in a range of neurodevelopmental diseases, including idiopathic generalized epilepsy. The RBFOX1 protein and its homologues (RBFOX2 and RBFOX3) regulate alternative splicing of many neuronal transcripts...... involved in the homeostatic control of neuronal excitability. In this study, we explored if structural microdeletions and exonic sequence variations in RBFOX1, RBFOX2, RBFOX3 confer susceptibility to rolandic epilepsy (RE), a common idiopathic focal childhood epilepsy. By high-density SNP array screening...... that exon deletions and truncating mutations of RBFOX1 and RBFOX3 contribute to the genetic variance of partial and generalized idiopathic epilepsy syndromes....

Molecular cloning, sequence characterization and expression analysis of a CD63 homologue from the coleopteran beetle, Tenebrio molitor.

Science.gov (United States)

Patnaik, Bharat Bhusan; Kang, Seong Min; Seo, Gi Won; Lee, Hyo Jeong; Patnaik, Hongray Howrelia; Jo, Yong Hun; Tindwa, Hamisi; Lee, Yong Seok; Lee, Bok Luel; Kim, Nam Jung; Bang, In Seok; Han, Yeon Soo

2013-10-15

CD63, a member of the tetraspanin membrane protein family, plays a pivotal role in cell growth, motility, signal transduction, host-pathogen interactions and cancer. In this work, the cDNA encoding CD63 homologue (TmCD63) was cloned from larvae of a coleopteran beetle, Tenebrio molitor. The cDNA is comprised of an open reading frame of 705 bp, encoding putative protein of 235 amino acid residues. In silico analysis shows that the protein has four putative transmembrane domains and one large extracellular loop. The characteristic "Cys-Cys-Gly" motif and "Cys188" residues are highly conserved in the large extracellular loop. Phylogenetic analysis of TmCD63 revealed that they belong to the insect cluster with 50%-56% identity. Analysis of spatial expression patterns demonstrated that TmCD63 mRNA is mainly expressed in gut and Malphigian tubules of larvae and the testis of the adult. Developmental expression patterns of CD63 mRNA showed that TmCD63 transcripts are detected in late larval, pupal and adult stages. Interestingly, TmCD63 transcripts are upregulated to the maximum level of 4.5 fold, in response to DAP-type peptidoglycan during the first 6 h, although other immune elicitors also caused significant increase to the transcript level at later time-points. These results suggest that CD63 might contribute to T. molitor immune response against various microbial pathogens.

Molecular Cloning, Sequence Characterization and Expression Analysis of a CD63 Homologue from the Coleopteran Beetle, Tenebrio molitor

Directory of Open Access Journals (Sweden)

Yeon Soo Han

2013-10-01

Full Text Available CD63, a member of the tetraspanin membrane protein family, plays a pivotal role in cell growth, motility, signal transduction, host-pathogen interactions and cancer. In this work, the cDNA encoding CD63 homologue (TmCD63 was cloned from larvae of a coleopteran beetle, Tenebrio molitor. The cDNA is comprised of an open reading frame of 705 bp, encoding putative protein of 235 amino acid residues. In silico analysis shows that the protein has four putative transmembrane domains and one large extracellular loop. The characteristic “Cys-Cys-Gly” motif and “Cys188” residues are highly conserved in the large extracellular loop. Phylogenetic analysis of TmCD63 revealed that they belong to the insect cluster with 50%–56% identity. Analysis of spatial expression patterns demonstrated that TmCD63 mRNA is mainly expressed in gut and Malphigian tubules of larvae and the testis of the adult. Developmental expression patterns of CD63 mRNA showed that TmCD63 transcripts are detected in late larval, pupal and adult stages. Interestingly, TmCD63 transcripts are upregulated to the maximum level of 4.5 fold, in response to DAP-type peptidoglycan during the first 6 h, although other immune elicitors also caused significant increase to the transcript level at later time-points. These results suggest that CD63 might contribute to T. molitor immune response against various microbial pathogens.

Molecular Cloning, Sequence Characterization and Expression Analysis of a CD63 Homologue from the Coleopteran Beetle, Tenebrio molitor

Science.gov (United States)

Patnaik, Bharat Bhusan; Kang, Seong Min; Seo, Gi Won; Lee, Hyo Jeong; Patnaik, Hongray Howrelia; Jo, Yong Hun; Tindwa, Hamisi; Lee, Yong Seok; Lee, Bok Luel; Kim, Nam Jung; Bang, In Seok; Han, Yeon Soo

2013-01-01

CD63, a member of the tetraspanin membrane protein family, plays a pivotal role in cell growth, motility, signal transduction, host-pathogen interactions and cancer. In this work, the cDNA encoding CD63 homologue (TmCD63) was cloned from larvae of a coleopteran beetle, Tenebrio molitor. The cDNA is comprised of an open reading frame of 705 bp, encoding putative protein of 235 amino acid residues. In silico analysis shows that the protein has four putative transmembrane domains and one large extracellular loop. The characteristic “Cys-Cys-Gly” motif and “Cys188” residues are highly conserved in the large extracellular loop. Phylogenetic analysis of TmCD63 revealed that they belong to the insect cluster with 50%–56% identity. Analysis of spatial expression patterns demonstrated that TmCD63 mRNA is mainly expressed in gut and Malphigian tubules of larvae and the testis of the adult. Developmental expression patterns of CD63 mRNA showed that TmCD63 transcripts are detected in late larval, pupal and adult stages. Interestingly, TmCD63 transcripts are upregulated to the maximum level of 4.5 fold, in response to DAP-type peptidoglycan during the first 6 h, although other immune elicitors also caused significant increase to the transcript level at later time-points. These results suggest that CD63 might contribute to T. molitor immune response against various microbial pathogens. PMID:24132157

Duplication in the microtubule-actin cross-linking factor 1 gene causes a novel neuromuscular condition

DEFF Research Database (Denmark)

Jørgensen, Louise H; Mosbech, Mai-Britt; Færgeman, Nils J

2014-01-01

Spectrins and plakins are important communicators linking cytoskeletal components to each other and to cellular junctions. Microtubule-actin cross-linking factor 1 (MACF1) belongs to the spectraplakin family and is involved in control of microtubule dynamics. Complete knock out of MACF1 in mice...... muscles and diminished motor skills, with heterogeneous presentation among the affected family members. To corroborate these findings we used RNA interference to knock down the VAB-10 locus containing the MACF1 homologue in C. elegans, and we could show that this also causes movement disturbances...

Extracellular Matrix Regulations of Membrane Type 1 - Matrix Metalloproteinasis (MT1-MMP) and Matrix Metalloproteinase-2 (MMP-2) in Human Breast Fibroblasts

National Research Council Canada - National Science Library

Harnandez-Barrantes, Sonia

2001-01-01

.... Thus, under certain conditions, TIMP-2 is a positive regulator of MMP activity. TIMP-4, a close homologue of TIMP-2 also binds to pro-MMP- 2 and can potentially participate in pro-MMP-2 activation...

Deep mRNA sequencing of the Tritonia diomedea brain transcriptome provides access to gene homologues for neuronal excitability, synaptic transmission and peptidergic signalling.

Directory of Open Access Journals (Sweden)

Adriano Senatore

Full Text Available The sea slug Tritonia diomedea (Mollusca, Gastropoda, Nudibranchia, has a simple and highly accessible nervous system, making it useful for studying neuronal and synaptic mechanisms underlying behavior. Although many important contributions have been made using Tritonia, until now, a lack of genetic information has impeded exploration at the molecular level.We performed Illumina sequencing of central nervous system mRNAs from Tritonia, generating 133.1 million 100 base pair, paired-end reads. De novo reconstruction of the RNA-Seq data yielded a total of 185,546 contigs, which partitioned into 123,154 non-redundant gene clusters (unigenes. BLAST comparison with RefSeq and Swiss-Prot protein databases, as well as mRNA data from other invertebrates (gastropod molluscs: Aplysia californica, Lymnaea stagnalis and Biomphalaria glabrata; cnidarian: Nematostella vectensis revealed that up to 76,292 unigenes in the Tritonia transcriptome have putative homologues in other databases, 18,246 of which are below a more stringent E-value cut-off of 1x10-6. In silico prediction of secreted proteins from the Tritonia transcriptome shotgun assembly (TSA produced a database of 579 unique sequences of secreted proteins, which also exhibited markedly higher expression levels compared to other genes in the TSA.Our efforts greatly expand the availability of gene sequences available for Tritonia diomedea. We were able to extract full length protein sequences for most queried genes, including those involved in electrical excitability, synaptic vesicle release and neurotransmission, thus confirming that the transcriptome will serve as a useful tool for probing the molecular correlates of behavior in this species. We also generated a neurosecretome database that will serve as a useful tool for probing peptidergic signalling systems in the Tritonia brain.

Homologues of CsLOB1 in citrus function as disease susceptibility genes in citrus canker.

Science.gov (United States)

Zhang, Junli; Huguet-Tapia, Jose Carlos; Hu, Yang; Jones, Jeffrey; Wang, Nian; Liu, Sanzhen; White, Frank F

2017-08-01

The lateral organ boundary domain (LBD) genes encode a group of plant-specific proteins that function as transcription factors in the regulation of plant growth and development. Citrus sinensis lateral organ boundary 1 (CsLOB1) is a member of the LBD family and functions as a disease susceptibility gene in citrus bacterial canker (CBC). Thirty-four LBD members have been identified from the Citrus sinensis genome. We assessed the potential for additional members of LBD genes in citrus to function as surrogates for CsLOB1 in CBC, and compared host gene expression on induction of different LBD genes. Using custom-designed transcription activator-like (TAL) effectors, two members of the same clade as CsLOB1, named CsLOB2 and CsLOB3, were found to be capable of functioning similarly to CsLOB1 in CBC. RNA sequencing and quantitative reverse transcription-polymerase chain reaction analyses revealed a set of cell wall metabolic genes that are associated with CsLOB1, CsLOB2 and CsLOB3 expression and may represent downstream genes involved in CBC. © 2016 BSPP AND JOHN WILEY & SONS LTD.

Differential Rac1 signalling by guanine nucleotide exchange factors implicates FLII in regulating Rac1-driven cell migration

Science.gov (United States)

Marei, Hadir; Carpy, Alejandro; Woroniuk, Anna; Vennin, Claire; White, Gavin; Timpson, Paul; Macek, Boris; Malliri, Angeliki

2016-01-01

The small GTPase Rac1 has been implicated in the formation and dissemination of tumours. Upon activation by guanine nucleotide exchange factors (GEFs), Rac1 associates with a variety of proteins in the cell thereby regulating various functions, including cell migration. However, activation of Rac1 can lead to opposing migratory phenotypes raising the possibility of exacerbating tumour progression when targeting Rac1 in a clinical setting. This calls for the identification of factors that influence Rac1-driven cell motility. Here we show that Tiam1 and P-Rex1, two Rac GEFs, promote Rac1 anti- and pro-migratory signalling cascades, respectively, through regulating the Rac1 interactome. In particular, we demonstrate that P-Rex1 stimulates migration through enhancing the interaction between Rac1 and the actin-remodelling protein flightless-1 homologue, to modulate cell contraction in a RhoA-ROCK-independent manner. PMID:26887924

EGCG Prevents High Fat Diet-Induced Changes in Gut Microbiota, Decreases of DNA Strand Breaks, and Changes in Expression and DNA Methylation of Dnmt1 and MLH1 in C57BL/6J Male Mice

Directory of Open Access Journals (Sweden)

Marlene Remely

2017-01-01

Full Text Available Obesity as a multifactorial disorder involves low-grade inflammation, increased reactive oxygen species incidence, gut microbiota aberrations, and epigenetic consequences. Thus, prevention and therapies with epigenetic active antioxidants, (--Epigallocatechin-3-gallate (EGCG, are of increasing interest. DNA damage, DNA methylation and gene expression of DNA methyltransferase 1, interleukin 6, and MutL homologue 1 were analyzed in C57BL/6J male mice fed a high-fat diet (HFD or a control diet (CD with and without EGCG supplementation. Gut microbiota was analyzed with quantitative real-time polymerase chain reaction. An induction of DNA damage was observed, as a consequence of HFD-feeding, whereas EGCG supplementation decreased DNA damage. HFD-feeding induced a higher inflammatory status. Supplementation reversed these effects, resulting in tissue specific gene expression and methylation patterns of DNA methyltransferase 1 and MutL homologue 1. HFD feeding caused a significant lower bacterial abundance. The Firmicutes/Bacteroidetes ratio is significantly lower in HFD + EGCG but higher in CD + EGCG compared to control groups. The results demonstrate the impact of EGCG on the one hand on gut microbiota which together with dietary components affects host health. On the other hand effects may derive from antioxidative activities as well as epigenetic modifications observed on CpG methylation but also likely to include other epigenetic elements.

The Neurospora crassa UVS-3 epistasis group encodes homologues of the ATR/ATRIP checkpoint control system.

Science.gov (United States)

Kazama, Yusuke; Ishii, Chizu; Schroeder, Alice L; Shimada, Hisao; Wakabayashi, Michiyoshi; Inoue, Hirokazu

2008-02-01

The mutagen sensitive uvs-3 and mus-9 mutants of Neurospora show mutagen and hydroxyurea sensitivity, mutator effects and duplication instability typical of recombination repair and DNA damage checkpoint defective mutants. To determine the nature of these genes we used cosmids from a genomic library to clone the uvs-3 gene by complementation for MMS sensitivity. Mutation induction by transposon insertion and RIP defined the coding sequence. RFLP analysis confirmed that this sequence maps in the area of uvs-3 at the left telomere of LG IV. Analysis of the cDNA showed that the UVS-3 protein contains an ORF of 969 amino acids with one intron. It is homologous to UvsD of Aspergillus nidulans, a member of the ATRIP family of checkpoint proteins. It retains the N' terminal coiled-coil motif followed by four basic amino acids typical of these proteins and shows the highest homology in this region. The uvsD cDNA partially complements the defects of the uvs-3 mutation. The uvs-3 mutant shows a higher level of micronuclei in conidia and failure to halt germination and nuclear division in the presence of hydroxyurea than wild type, suggesting checkpoint defects. ATRIP proteins bind tightly to ATR PI-3 kinase (phosphatidylinositol 3-kinase) proteins. Therefore, we searched the Neurospora genome sequence for homologues of the Aspergillus nidulans ATR, UvsB. A uvsB homologous sequence was present in the right arm of chromosome I where the mus-9 gene maps. A cosmid containing this genomic DNA complemented the mus-9 mutation. The putative MUS-9 protein is 2484 amino acids long with eight introns. Homology is especially high in the C-terminal 350 amino acids that correspond to the PI-3 kinase domain. In wild type a low level of constitutive mRNA is present for both genes. It is transiently induced upon UV exposure.

A La autoantigen homologue is required for the internal ribosome entry site mediated translation of giardiavirus.

Directory of Open Access Journals (Sweden)

Srinivas Garlapati

2011-03-01

Full Text Available Translation of Giardiavirus (GLV mRNA is initiated at an internal ribosome entry site (IRES in the viral transcript. The IRES localizes to a downstream portion of 5' untranslated region (UTR and a part of the early downstream coding region of the transcript. Recent studies indicated that the IRES does not require a pre-initiation complex to initiate translation but may directly recruit the small ribosome subunit with the help of a number of trans-activating protein factors. A La autoantigen homologue in the viral host Giardia lamblia, GlLa, was proposed as one of the potential trans-activating factors based on its specific binding to GLV-IRES in vitro. In this study, we further elucidated the functional role of GlLa in GLV-IRES mediated translation in Giardia by knocking down GlLa with antisense morpholino oligo, which resulted in a reduction of GLV-IRES activity by 40%. An over-expression of GlLa in Giardia moderately stimulated GLV-IRES activity by 20%. A yeast inhibitory RNA (IRNA, known to bind mammalian and yeast La autoantigen and inhibit Poliovirus and Hepatitis C virus IRES activities in vitro and in vivo, was also found to bind to GlLa protein in vitro and inhibited GLV-IRES function in vivo. The C-terminal domain of La autoantigen interferes with the dimerization of La and inhibits its function. An over-expression of the C-terminal domain (200-348aa of GlLa in Giardia showed a dominant-negative effect on GLV-IRES activity, suggesting a potential inhibition of GlLa dimerization. HA tagged GlLa protein was detected mainly in the cytoplasm of Giardia, thus supporting a primary role of GlLa in translation initiation in Giardiavirus.

Gene dosage effects of the imprinted delta-like homologue 1 (dlk1/pref1 in development: implications for the evolution of imprinting.

Directory of Open Access Journals (Sweden)

Simao Teixeira da Rocha

2009-02-01

Full Text Available Genomic imprinting is a normal process that causes genes to be expressed according to parental origin. The selective advantage conferred by imprinting is not understood but is hypothesised to act on dosage-critical genes. Here, we report a unique model in which the consequences of a single, double, and triple dosage of the imprinted Dlk1/Pref1, normally repressed on the maternally inherited chromosome, can be assessed in the growing embryo. BAC-transgenic mice were generated that over-express Dlk1 from endogenous regulators at all sites of embryonic activity. Triple dosage causes lethality associated with major organ abnormalities. Embryos expressing a double dose of Dlk1, recapitulating loss of imprinting, are growth enhanced but fail to thrive in early life, despite the early growth advantage. Thus, any benefit conferred by increased embryonic size is offset by postnatal lethality. We propose a negative correlation between gene dosage and survival that fixes an upper limit on growth promotion by Dlk1, and we hypothesize that trade-off between growth and lethality might have driven imprinting at this locus.

An Arabidopsis chloroplast-targeted Hsp101 homologue, APG6, has an essential role in chloroplast development as well as heat-stress response.

Science.gov (United States)

Myouga, Fumiyoshi; Motohashi, Reiko; Kuromori, Takashi; Nagata, Noriko; Shinozaki, Kazuo

2006-10-01

Analysis of albino or pale-green (apg) mutants is important for identifying nuclear genes responsible for chloroplast development and pigment synthesis. We have identified 38 apg mutants by screening 11 000 Arabidopsis Ds-tagged lines. One mutant, apg6, contains a Ds insertion in a gene encoding APG6 (ClpB3), a homologue of the heat-shock protein Hsp101 (ClpB1). We isolated somatic revertants and identified two Ds-tagged and one T-DNA-tagged mutant alleles of apg6. All three alleles gave the same pale-green phenotype. These results suggest that APG6 is important for chloroplast development. The APG6 protein contains a transit peptide and is localized in chloroplasts. The plastids of apg6 pale-green cells were smaller than those of the wild type, and contained undeveloped thylakoid membranes. APG6 mRNA accumulated in response to heat shock in various organs, but not in response to other abiotic stresses. Under normal conditions, APG6 is constitutively expressed in the root tips, the organ boundary region, the reproductive tissues of mature plants where plastids exist as proplastids, and slightly in the stems and leaves. In addition, constitutive overexpression of APG6 in transgenic plants inhibited chloroplast development and resulted in a mild pale-green phenotype. The amounts of chloroplast proteins related to photosynthesis were markedly decreased in apg6 mutants. These results suggest that APG6 functions as a molecular chaperone involved in plastid differentiation mediating internal thylakoid membrane formation and conferring thermotolerance to chloroplasts during heat stress. The APG6 protein is not only involved in heat-stress response in chloroplasts, but is also essential for chloroplast development.

Influence of light, UV-B radiation, and herbicides on wax biosynthesis of cucumber seedlings

International Nuclear Information System (INIS)

Tevini, M.; Steinmüller, D.

1987-01-01

The behavior of cuticular alkane-1-ols and alkanes were studied in different developmental stages of cucumber seedlings grown in the dark or under white light, with or without UV-B radiation or in presence of wax biosynthesis inhibitors, trichloroacetic acid and metolachlor. Accumulation of alkane-1-ols increased light independently with seedling age. Synthesis of alkanes was strictly light and dose dependent. Addition of UV-B radiation did not alter the amounts of alkanes or alcohols, however, the distribution of homologues was shifted towards shorter chain homologues. Treatments with Cl 3 AcOH resulted in strong inhibition of alkane accumulation, whereas the amount of alkane-1-ols was changed neither at low nor at moderate concentrations of Cl 3 AcOH but their homologue distribution shifted towards longer chain lengths. This shifting was depressed in the presence of UV-B. At high concentrations of Cl 3 Ac0H similar homologue distributions as produced by UV-B (shift to shorter homologues) were observed. Metolachlor treatment resulted in an inhibition of alkane-1-ol production connected with rising amounts of alkanes, predominantly of short chain species. A simple model of wax biosynthesis is proposed which describes the interactions with white light, UV-B radiation and herbicides. (author)

The mammalian homologue of yeast Afg1 ATPase (lactation elevated 1) mediates degradation of nuclear-encoded complex IV subunits

Czech Academy of Sciences Publication Activity Database

Česneková, J.; Rodinová, M.; Hansíková, H.; Houštěk, Josef; Zeman, J.; Stibůrek, L.

2016-01-01

Roč. 473, č. 6 (2016), s. 797-804 ISSN 0264-6021 R&D Projects: GA ČR(CZ) GA13-07223S Institutional support: RVO:67985823 Keywords : complex IV * LACE1 * mitochondria * oxidative phosphorylation * YME1L Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 3.797, year: 2016

The nematode homologue of Mediator complex subunit 28, F28F8.5, is a critical regulator of C. elegans development.

Science.gov (United States)

Kostrouchová, Markéta; Kostrouch, David; Chughtai, Ahmed A; Kaššák, Filip; Novotný, Jan P; Kostrouchová, Veronika; Benda, Aleš; Krause, Michael W; Saudek, Vladimír; Kostrouchová, Marta; Kostrouch, Zdeněk

2017-01-01

The evolutionarily conserved Mediator complex is a critical player in regulating transcription. Comprised of approximately two dozen proteins, the Mediator integrates diverse regulatory signals through direct protein-protein interactions that, in turn, modulate the influence of Mediator on RNA Polymerase II activity. One Mediator subunit, MED28, is known to interact with cytoplasmic structural proteins, providing a potential direct link between cytoplasmic dynamics and the control of gene transcription. Although identified in many animals and plants, MED28 is not present in yeast; no bona fide MED28 has been described previously in Caenorhabditis elegans. Here, we identify bioinformatically F28F8.5, an uncharacterized predicted protein, as the nematode homologue of MED28. As in other Metazoa, F28F8.5 has dual nuclear and cytoplasmic localization and plays critical roles in the regulation of development. F28F8.5 is a vital gene and its null mutants have severely malformed gonads and do not reproduce. F28F8.5 interacts on the protein level with the Mediator subunits MDT-6 and MDT-30. Our results indicate that F28F8.5 is an orthologue of MED28 and suggest that the potential to link cytoplasmic and nuclear events is conserved between MED28 vertebrate and nematode orthologues.

Assembling Fe/S-clusters and modifying tRNAs: ancient co-factors meet ancient adaptors

Czech Academy of Sciences Publication Activity Database

Alfonzo, J. D.; Lukeš, Julius

2011-01-01

Roč. 27, č. 6 (2011), 234-237 ISSN 1471-4922 R&D Projects: GA MŠk LC07032; GA MŠk 2B06129; GA ČR GA204/09/1667 Institutional research plan: CEZ:AV0Z60220518 Keywords : IRON-SULFUR CLUSTERS * TRYPANOSOMA-BRUCEI * MITOCHONDRIAL * PROTEIN * FRATAXIN * BIOSYNTHESIS * SYNTHETASES * BIOGENESIS * THIOLATION * ANTICODON Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 5.144, year: 2011

Identification of the Mycobacterium marinum Apa antigen O-mannosylation sites reveals important glycosylation variability with the M. tuberculosis Apa homologue.

Science.gov (United States)

Coddeville, Bernadette; Wu, Sz-Wei; Fabre, Emeline; Brassart, Colette; Rombouts, Yoann; Burguière, Adeline; Kremer, Laurent; Khoo, Kay-Hooi; Elass-Rochard, Elisabeth; Guérardel, Yann

2012-10-22

The 45/47 kDa Apa, an immuno-dominant antigen secreted by Mycobacterium tuberculosis is O-mannosylated at multiple sites. Glycosylation of Apa plays a key role in colonization and invasion of the host cells by M. tuberculosis through interactions of Apa with the host immune system C-type lectins. Mycobacterium marinum (M.ma) a fish pathogen, phylogenetically close to M. tuberculosis, induces a granulomatous response with features similar to those described for M. tuberculosis in human. Although M.ma possesses an Apa homologue, its glycosylation status is unknown, and whether this represents a crucial element in the pathophysiology induced by M.ma remains to be addressed. To this aim, we have identified two concanavalin A-reactive 45/47 kDa proteins from M.ma, which have been further purified by a two-step anion exchange chromatography process. Advanced liquid chromatography-nanoESI mass spectrometry-based proteomic analyses of peptides, derived from either tryptic digestion alone or in combination with the Asp-N endoproteinase, established that M.ma Apa possesses up to seven distinct O-mannosylated sites with mainly single mannose substitutions, which can be further extended at the Ser/Thr/Pro rich region near the N-terminus. This opens the way to further studies focussing on the involvement and biological functions of Apa O-mannosylation using the M.ma/zebrafish model. Copyright © 2012 Elsevier B.V. All rights reserved.

Structural and functional basis for RNA cleavage by Ire1

Directory of Open Access Journals (Sweden)

Stroud Robert M

2011-07-01

Full Text Available Abstract Background The unfolded protein response (UPR controls the protein folding capacity of the endoplasmic reticulum (ER. Central to this signaling pathway is the ER-resident bifunctional transmembrane kinase/endoribonuclease Ire1. The endoribonuclease (RNase domain of Ire1 initiates a non-conventional mRNA splicing reaction, leading to the production of a transcription factor that controls UPR target genes. The mRNA splicing reaction is an obligatory step of Ire1 signaling, yet its mechanism has remained poorly understood due to the absence of substrate-bound crystal structures of Ire1, the lack of structural similarity between Ire1 and other RNases, and a scarcity of quantitative enzymological data. Here, we experimentally define the active site of Ire1 RNase and quantitatively evaluate the contribution of the key active site residues to catalysis. Results This analysis and two new crystal structures suggest that Ire1 RNase uses histidine H1061 and tyrosine Y1043 as the general acid-general base pair contributing ≥ 7.6 kcal/mol and 1.4 kcal/mol to transition state stabilization, respectively, and asparagine N1057 and arginine R1056 for coordination of the scissile phosphate. Investigation of the stem-loop recognition revealed that additionally to the stem-loops derived from the classic Ire1 substrates HAC1 and Xbp1 mRNA, Ire1 can site-specifically and rapidly cleave anticodon stem-loop (ASL of unmodified tRNAPhe, extending known substrate specificity of Ire1 RNase. Conclusions Our data define the catalytic center of Ire1 RNase and suggest a mechanism of RNA cleavage: each RNase monomer apparently contains a separate catalytic apparatus for RNA cleavage, whereas two RNase subunits contribute to RNA stem-loop docking. Conservation of the key residues among Ire1 homologues suggests that the mechanism elucidated here for yeast Ire1 applies to Ire1 in metazoan cells, and to the only known Ire1 homologue RNase L.

Cloning of Interleukin-10 from African Clawed Frog (Xenopus tropicalis, with the Finding of IL-19/20 Homologue in the IL-10 Locus

Directory of Open Access Journals (Sweden)

Zhitao Qi

2015-01-01

Full Text Available Interleukin-10 (IL-10 is a pleiotropic cytokine that plays an important role in immune system. In the present study, the IL-10 gene of African clawed frog (Xenopus tropicalis was first cloned, and its expression pattern and 3D structure were also analyzed. The frog IL-10 mRNA encoded 172 amino acids which possessed several conserved features found in IL-10s from other species, including five-exon/four-intron genomic structure, conserved four cysteine residues, IL-10 family motif, and six α-helices. Real-time PCR showed that frog IL-10 mRNA was ubiquitous expressed in all examined tissues, highly in some immune related tissues including kidney, spleen, and intestine and lowly in heart, stomach, and liver. The frog IL-10 mRNA was upregulated at 24 h after LPS stimulation, indicating that it plays a part in the host immune response to bacterial infection. Another IL, termed as IL-20, was identified from the frog IL-10 locus, which might be the homologue of mammalian IL-19/20 according to the analysis results of the phylogenetic tree and the sequence identities.

Herpesvirus pan encodes a functional homologue of BHRF1, the Epstein-Barr virus v-Bcl-2

Directory of Open Access Journals (Sweden)

Williams Tracey

2005-02-01

Full Text Available Abstract Background Epstein-Barr virus (EBV latently infects about 90% of the human population and is associated with benign and malignant diseases of lymphoid and epithelial origin. BHRF1, an early lytic cycle antigen, is an apoptosis suppressing member of the Bcl-2 family. In vitro studies imply that BHRF1 is dispensable for both virus replication and transformation. However, the fact that BHRF1 is highly conserved not only in all EBV isolates studied to date but also in the analogous viruses Herpesvirus papio and Herpesvirus pan that infect baboons and chimpanzees respectively, suggests BHRF1 may play an important role in vivo. Results Herpesvirus papio BHRF1 has been shown to function in an analogous manner to EBV BHRF1 in response to DNA damaging agents in human keratinocytes. In this study we show that the heterologous expression of the previously uncharacterised Herpesvirus pan BHRF1 in the human Burkitt's lymphoma cell line Ramos-BL provides similar anti-apoptotic functions to that of EBV BHRF1 in response to apoptosis triggered by serum withdrawal, etoposide treatment and ultraviolet (UV radiation. We also map the amino acid changes onto the recently solved structure of the EBV BHRF1 and reveal that these changes are unlikely to alter the 3D structure of the protein. Conclusions These findings show that the functional conservation of BHRF1 extends to a lymphoid background, suggesting that the primate virus proteins interact with cellular proteins that are themselves highly conserved across the higher primates. Further weight is added to this suggestion when we show that the difference in amino acid sequences map to regions on the 3D structure of EBV BHRF1 that are unlikely to change the conformation of the protein.

DMC1 functions in a Saccharomyces cerevisiae meiotic pathway that is largely independent of the RAD51 pathway

International Nuclear Information System (INIS)

Dresser, M.E.; Ewing, D.J.; Conrad, M.N.; Dominguez, A.M.; Barstead, R.; Jiang, H.; Kodadek, T.

1997-01-01

Meiotic recombination in the yeast Saccharomyces cerevisiae requires two similar recA-like proteins, Dmc1p and Rad51p. A screen for dominant meiotic mutants provided DMC1-G126D, a dominant allele mutated in the conserved ATP-binding site (specifically, the A-loop motif) that confers a null phenotype. A recessive null allele, dmc1-K69E, was isolated as an intragenic suppressor of DMC1-G126D. Dmc1-K69Ep, unlike Dmc1p, does not interact homotypically in a two-hybrid assay, although it does interact with other fusion proteins identified by two-hybrid screen with Dmc1p. Dmc1p, unlike Rad51p, does not interact in the two-hybrid assay with Rad52p or Rad54p. However, Dmc1p does interact with Tid1p, a Rad54p homologue, with Tid4p, a Rad16p homologue, and with other fusion proteins that do not interact with Rad51p, suggesting that Dmc1p and Rad51p function in separate, though possibly overlapping, recombinational repair complexes. Epistasis analysis suggests that DMC1 and RAD51 function in separate pathways responsible for meiotic recombination. Taken together, our results are consistent with a requirement for DMC1 for meiosis-specific entry of DNA double-strand break ends into chromatin. Interestingly, the pattern on CHEF gels of chromosome fragments that result from meiotic DNA double-strand break formation is different in DMC1 mutant strains from that seen in rad50S strains. (author)

Modulation of ethylene responses by OsRTH1 overexpression reveals the biological significance of ethylene in rice seedling growth and development

Science.gov (United States)

Zhang, Wei; Zhou, Xin; Wen, Chi-Kuang

2012-01-01

Overexpression of Arabidopsis Reversion-To-ethylene Sensitivity1 (RTE1) results in whole-plant ethylene insensitivity dependent on the ethylene receptor gene Ethylene Response1 (ETR1). However, overexpression of the tomato RTE1 homologue Green Ripe (GR) delays fruit ripening but does not confer whole-plant ethylene insensitivity. It was decided to investigate whether aspects of ethylene-induced growth and development of the monocotyledonous model plant rice could be modulated by rice RTE1 homologues (OsRTH genes). Results from a cross-species complementation test in Arabidopsis showed that OsRTH1 overexpression complemented the rte1-2 loss-of-function mutation and conferred whole-plant ethylene insensitivity in an ETR1-dependent manner. In contrast, OsRTH2 and OsRTH3 overexpression did not complement rte1-2 or confer ethylene insensitivity. In rice, OsRTH1 overexpression substantially prevented ethylene-induced alterations in growth and development, including leaf senescence, seedling leaf elongation and development, coleoptile elongation or curvature, and adventitious root development. Results of subcellular localizations of OsRTHs, each fused with the green fluorescent protein, in onion epidermal cells suggested that the three OsRTHs were predominantly localized to the Golgi. OsRTH1 may be an RTE1 orthologue of rice and modulate rice ethylene responses. The possible roles of auxins and gibberellins in the ethylene-induced alterations in growth were evaluated and the biological significance of ethylene in the early stage of rice seedling growth is discussed. PMID:22451723

Expression and functional analysis of TaASY1 during meiosis of bread wheat (Triticum aestivum

Directory of Open Access Journals (Sweden)

Langridge Peter

2007-08-01

Full Text Available Abstract Background Pairing and synapsis of homologous chromosomes is required for normal chromosome segregation and the exchange of genetic material via recombination during meiosis. Synapsis is complete at pachytene following the formation of a tri-partite proteinaceous structure known as the synaptonemal complex (SC. In yeast, HOP1 is essential for formation of the SC, and localises along chromosome axes during prophase I. Homologues in Arabidopsis (AtASY1, Brassica (BoASY1 and rice (OsPAIR2 have been isolated through analysis of mutants that display decreased fertility due to severely reduced synapsis of homologous chromosomes. Analysis of these genes has indicated that they play a similar role to HOP1 in pairing and formation of the SC through localisation to axial/lateral elements of the SC. Results The full length wheat cDNA and genomic clone, TaASY1, has been isolated, sequenced and characterised. TaASY1 is located on chromosome Group 5 and the open reading frame displays significant nucleotide sequence identity to OsPAIR2 (84% and AtASY1 (63%. Transcript and protein analysis showed that expression is largely restricted to meiotic tissue, with elevated levels during the stages of prophase I when pairing and synapsis of homologous chromosomes occur. Immunolocalisation using transmission electron microscopy showed TaASY1 interacts with chromatin that is associated with both axial elements before SC formation as well as lateral elements of formed SCs. Conclusion TaASY1 is a homologue of ScHOP1, AtASY1 and OsPAIR2 and is the first gene to be isolated from bread wheat that is involved in pairing and synapsis of homologous chromosomes.

Multiplicity of 3-Ketosteroid-9 alpha-Hydroxylase Enzymes in Rhodococcus rhodochrous DSM43269 for Specific Degradation of Different Classes of Steroids

OpenAIRE

Petrusma, Mirjan; Hessels, Gerda; Dijkhuizen, Lubbert; van der Geize, Robert

2011-01-01

The well-known large catabolic potential of rhodococci is greatly facilitated by an impressive gene multiplicity. This study reports on the multiplicity of kshA, encoding the oxygenase component of 3-ketosteroid 9 alpha-hydroxylase, a key enzyme in steroid catabolism. Five kshA homologues (kshA1 to kshA5) were previously identified in Rhodococcus rhodochrous DSM43269. These KshA(DSM43269) homologues are distributed over several phylogenetic groups. The involvement of these KshA homologues in ...

Expression of human PQBP-1 in Drosophila impairs long-term memory and induces abnormal courtship.

Science.gov (United States)

Yoshimura, Natsue; Horiuchi, Daisuke; Shibata, Masao; Saitoe, Minoru; Qi, Mei-Ling; Okazawa, Hitoshi

2006-04-17

Frame shift mutations of the polyglutamine binding protein-1 (PQBP1) gene lead to total or partial truncation of the C-terminal domain (CTD) and cause mental retardation in human patients. Interestingly, normal Drosophila homologue of PQBP-1 lacks CTD. As a model to analyze the molecular network of PQBP-1 affecting intelligence, we generated transgenic flies expressing human PQBP-1 with CTD. Pavlovian olfactory conditioning revealed that the transgenic flies showed disturbance of long-term memory. In addition, they showed abnormal courtship that male flies follow male flies. Abnormal functions of PQBP-1 or its binding partner might be linked to these symptoms.

QTL list: [PGDBj Registered plant list, Marker list, QTL list, Plant DB link and Genome analysis methods[Archive

Lifescience Database Archive (English)

Full Text Available ene and FLC gene homologue concerning induction of flowering, the one of the homologue region of the top of A. thaliana chromosome 5 5 pO160E1 LG_O03 ... 2.6 ... 10.1139/g01-082 11681610

The Caenorhabditis elegans nicotinamidase PNC-1 enhances survival.

Science.gov (United States)

van der Horst, Armando; Schavemaker, Jolanda M; Pellis-van Berkel, Wendy; Burgering, Boudewijn M T

2007-04-01

In yeast, increasing the copy number of the nicotinamide adenine dinucleotide (NAD)-dependent deacetylase Sir2 extends lifespan, which can be inhibited by nicotinamide (Nam), the end-product of Sir2-mediated NAD-breakdown. Furthermore, the yeast pyrazinamidase/nicotinamidase PNC-1 can extend yeast lifespan by converting Nam. In Caenorhabditis elegans (C. elegans), increased dosage of the gene encoding SIR-2.1 also increases lifespan. Here, we report that knockdown of the C. elegans homologue of yeast PNC-1 as well as growing worms on Nam-containing medium significantly decreases adult lifespan. Accordingly, increased gene dosage of pnc-1 increases adult survival under conditions of oxidative stress. These data show for the first time the involvement of PNC-1/Nam in the survival of a multicellular organism and may also contribute to our understanding of lifespan regulation in mammals.

A spinach O-acetylserine(thiollyase homologue, SoCSaseLP, suppresses cysteine biosynthesis catalysed by other enzyme isoforms

Directory of Open Access Journals (Sweden)

Miki Noda

2016-06-01

Full Text Available An enzyme, O-acetylserine(thiollyase (OASTL, also known as O-acetylserine sulfhydrylase or cysteine synthase (CSase, catalyses the incorporation of sulfide into O-acetylserine and produces cysteine. We previously identified a cDNA encoding an OASTL-like protein from Spinacia oleracea, (SoCSaseLP, but a recombinant SoCSaseLP produced in Escherichia coli did not show OASTL activity. The exon-intron structure of the SoCSaseLP gene shared conserved structures with other spinach OASTL genes. The SoCSaseLP and a Beta vulgaris homologue protein, KMT13462, comprise a unique clade in the phylogenetic tree of the OASTL family. Interestingly, when the SoCSaseLP gene was expressed in tobacco plants, total OASTL activity in tobacco leaves was reduced. This reduction in total OASTL activity was most likely caused by interference by SoCSaseLP with cytosolic OASTL. To investigate the possible interaction of SoCSaseLP with a spinach cytosolic OASTL isoform SoCSaseA, a pull-down assay was carried out. The recombinant glutathione S-transferase (GST-SoCSaseLP fusion protein was expressed in E. coli together with the histidine-tagged SoCSaseA protein, and the protein extract was subjected to glutathione affinity chromatography. The histidine-tagged SoCSaseA was co-purified with the GST-SoCSaseLP fusion protein, indicating the binding of SoCSaseLP to SoCSaseA. Consistent with this interaction, the OASTL activity of the co-purified SoCSaseA was reduced compared with the activity of SoCSaseA that was purified on its own. These results strongly suggest that SoCSaseLP negatively regulates the activity of other cytosolic OASTL family members by direct interaction.

The nematode homologue of Mediator complex subunit 28, F28F8.5, is a critical regulator of C. elegans development

Directory of Open Access Journals (Sweden)

Markéta Kostrouchová

2017-06-01

Full Text Available The evolutionarily conserved Mediator complex is a critical player in regulating transcription. Comprised of approximately two dozen proteins, the Mediator integrates diverse regulatory signals through direct protein-protein interactions that, in turn, modulate the influence of Mediator on RNA Polymerase II activity. One Mediator subunit, MED28, is known to interact with cytoplasmic structural proteins, providing a potential direct link between cytoplasmic dynamics and the control of gene transcription. Although identified in many animals and plants, MED28 is not present in yeast; no bona fide MED28 has been described previously in Caenorhabditis elegans. Here, we identify bioinformatically F28F8.5, an uncharacterized predicted protein, as the nematode homologue of MED28. As in other Metazoa, F28F8.5 has dual nuclear and cytoplasmic localization and plays critical roles in the regulation of development. F28F8.5 is a vital gene and its null mutants have severely malformed gonads and do not reproduce. F28F8.5 interacts on the protein level with the Mediator subunits MDT-6 and MDT-30. Our results indicate that F28F8.5 is an orthologue of MED28 and suggest that the potential to link cytoplasmic and nuclear events is conserved between MED28 vertebrate and nematode orthologues.

The ATM homologue MEC1 is required for phosphorylation of replication protein A in yeast

International Nuclear Information System (INIS)

Brush, G.S.; Morrow, D.M.; Hieter, P.; Kelly, T.J.

1996-01-01

Replication protein A (RPA) is a highly conserved single-stranded DNA-binding protein, required for cellular DNA replication, repair, and recombination. In human cells, RPA is phosphorylated during the S and G2 phases of the cell cycle and also in response to ionizing or ultraviolet radiation. Saccharomyces cerevisiae exhibits a similar pattern of cell cycle-regulated RPA phosphorylation, and our studies indicate that the radiation-induced reactions occur in yeast as well. We have examined yeast RPA phosphorylation during the normal cell cycle and in response to environmental insult, and have demonstrated that the checkpoint gene MEC1 is required for the reaction under all conditions tested. Through examination of several checkpoint mutants, we have placed RPA phosphorylation in a novel pathway of the DNA damage response. MEC1 is similar in sequence to human ATM, the gene mutated in patients with ataxia-telangiectasia (A-T). A-T cells are deficient in multiple checkpoint pathways and are hypersensitive to killing by ionizing radiation. Because A-T cells exhibit a delay in ionizing radiation-induced RPA phosphorylation, our results indicate a functional similarity between MEC1 and ATM, and suggest that RPA phosphorylation is involved in a conserved eukaryotic DNA damage-response pathway defective in A-T

The human homologue of unc-93 maps to chromosome 6q27 – characterisation and analysis in sporadic epithelial ovarian cancer

Directory of Open Access Journals (Sweden)

Charnock F Mark L

2002-10-01

Full Text Available Abstract Background In sporadic ovarian cancer, we have previously reported allele loss at D6S193 (62% on chromosome 6q27, which suggested the presence of a putative tumour suppressor gene. Based on our data and that from another group, the minimal region of allele loss was between D6S264 and D6S149 (7.4 cM. To identify the putative tumour suppressor gene, we established a physical map initially with YACs and subsequently with PACs/BACs from D6S264 to D6S149. To accelerate the identification of genes, we sequenced the entire contig of approximately 1.1 Mb. Seven genes were identified within the region of allele loss between D6S264 and D6S149. Results The human homologue of unc-93 (UNC93A in C. elegans was identified to be within the interval of allele loss centromeric to D6S149. This gene is 24.5 kb and comprises of 8 exons. There are two transcripts with the shorter one due to splicing out of exon 4. It is expressed in testis, small intestine, spleen, prostate, and ovary. In a panel of 8 ovarian cancer cell lines, UNC93A expression was detected by RT-PCR which identified the two transcripts in 2/8 cell lines. The entire coding sequence was examined for mutations in a panel of ovarian tumours and ovarian cancer cell lines. Mutations were identified in exons 1, 3, 4, 5, 6 and 8. Only 3 mutations were identified specifically in the tumour. These included a c.452G>A (W151X mutation in exon 3, c.676C>T (R226X in exon 5 and c.1225G>A(V409I mutation in exon 8. However, the mutations in exon 3 and 5 were also present in 6% and 2% of the normal population respectively. The UNC93A cDNA was shown to express at the cell membrane and encodes for a protein of 60 kDa. Conclusions These results suggest that no evidence for UNC93A as a tumour suppressor gene in sporadic ovarian cancer has been identified and further research is required to evaluate its normal function and role in the pathogenesis of ovarian cancer.

C1-Pathways in Methyloversatilis universalis FAM5: Genome Wide Gene Expression and Mutagenesis Studies

Directory of Open Access Journals (Sweden)

Nathan M. Good

2015-04-01

Full Text Available Methyloversatilis universalis FAM5 utilizes single carbon compounds such as methanol or methylamine as a sole source of carbon and energy. Expression profiling reveals distinct sets of genes altered during growth on methylamine vs methanol. As expected, all genes for the N-methylglutamate pathway were induced during growth on methylamine. Among other functions responding to the aminated source of C1-carbon, are a heme-containing amine dehydrogenase (Qhp, a distant homologue of formaldehyde activating enzyme (Fae3, molybdenum-containing formate dehydrogenase, ferredoxin reductase, a set of homologues to urea/ammonium transporters and amino-acid permeases. Mutants lacking one of the functional subunits of the amine dehydrogenase (ΔqhpA or Δfae3 showed no growth defect on C1-compounds. M. universalis FAM5 strains with a lesion in the H4-folate pathway were not able to use any C1-compound, methanol or methylamine. Genes essential for C1-assimilation (the serine cycle and glyoxylate shunt and H4MTP-pathway for formaldehyde oxidation showed similar levels of expression on both C1-carbon sources. M. universalis FAM5 possesses three homologs of the formaldehyde activating enzyme, a key enzyme of the H4MTP-pathway. Strains lacking the canonical Fae (fae1 lost the ability to grow on both C1-compounds. However, upon incubation on methylamine the fae1-mutant produced revertants (Δfae1R, which regained the ability to grow on methylamine. Double and triple mutants (Δfae1RΔfae3, or Δfae1RΔfae2 or Δfae1RΔfae2Δfae3 constructed in the revertant strain background showed growth similar to the Δfae1R phenotype. The metabolic pathways for utilization of methanol and methylamine in Methyloversatilis universalis FAM5 are reconstructed based on these gene expression and phenotypic data.

The Saccharomyces cerevisiae Mlh1-Mlh3 heterodimer is an endonuclease that preferentially binds to Holliday junctions.

Science.gov (United States)

Ranjha, Lepakshi; Anand, Roopesh; Cejka, Petr

2014-02-28

MutLγ, a heterodimer of the MutL homologues Mlh1 and Mlh3, plays a critical role during meiotic homologous recombination. The meiotic function of Mlh3 is fully dependent on the integrity of a putative nuclease motif DQHAX2EX4E, inferring that the anticipated nuclease activity of Mlh1-Mlh3 is involved in the processing of joint molecules to generate crossover recombination products. Although a vast body of genetic and cell biological data regarding Mlh1-Mlh3 is available, mechanistic insights into its function have been lacking due to the unavailability of the recombinant protein complex. Here we expressed the yeast Mlh1-Mlh3 heterodimer and purified it into near homogeneity. We show that recombinant MutLγ is a nuclease that nicks double-stranded DNA. We demonstrate that MutLγ binds DNA with a high affinity and shows a marked preference for Holliday junctions. We also expressed the human MLH1-MLH3 complex and show that preferential binding to Holliday junctions is a conserved capacity of eukaryotic MutLγ complexes. Specific DNA recognition has never been observed with any other eukaryotic MutL homologue. MutLγ thus represents a new paradigm for the function of the eukaryotic MutL protein family. We provide insights into the mode of Holliday junction recognition and show that Mlh1-Mlh3 prefers to bind the open unstacked Holliday junction form. This further supports the model where MutLγ is part of a complex acting on joint molecules to generate crossovers in meiosis.

The Saccharomyces cerevisiae Mlh1-Mlh3 Heterodimer Is an Endonuclease That Preferentially Binds to Holliday Junctions*

Science.gov (United States)

Ranjha, Lepakshi; Anand, Roopesh; Cejka, Petr

2014-01-01

MutLγ, a heterodimer of the MutL homologues Mlh1 and Mlh3, plays a critical role during meiotic homologous recombination. The meiotic function of Mlh3 is fully dependent on the integrity of a putative nuclease motif DQHAX2EX4E, inferring that the anticipated nuclease activity of Mlh1-Mlh3 is involved in the processing of joint molecules to generate crossover recombination products. Although a vast body of genetic and cell biological data regarding Mlh1-Mlh3 is available, mechanistic insights into its function have been lacking due to the unavailability of the recombinant protein complex. Here we expressed the yeast Mlh1-Mlh3 heterodimer and purified it into near homogeneity. We show that recombinant MutLγ is a nuclease that nicks double-stranded DNA. We demonstrate that MutLγ binds DNA with a high affinity and shows a marked preference for Holliday junctions. We also expressed the human MLH1-MLH3 complex and show that preferential binding to Holliday junctions is a conserved capacity of eukaryotic MutLγ complexes. Specific DNA recognition has never been observed with any other eukaryotic MutL homologue. MutLγ thus represents a new paradigm for the function of the eukaryotic MutL protein family. We provide insights into the mode of Holliday junction recognition and show that Mlh1-Mlh3 prefers to bind the open unstacked Holliday junction form. This further supports the model where MutLγ is part of a complex acting on joint molecules to generate crossovers in meiosis. PMID:24443562

Sustained expression of a neuron-specific isoform of the Taf1 gene in development stages and aging in mice

International Nuclear Information System (INIS)

Jambaldorj, Jamiyansuren; Makino, Satoshi; Munkhbat, Batmunkh; Tamiya, Gen

2012-01-01

Highlights: ► We identified the mouse homologue of neuron-specific TAF1 (N-Taf1). ► Taf1 mRNA was expressed in most tissues and cell lines. ► N-Taf1 mRNA was expressed in the brain and Neuroblastoma N2a cell lines. ► Taf1 and N-Taf1 showed different expression profile in development stage and aging. -- Abstract: TATA-box binding protein associated factor 1 (TAF1) protein is the largest and the essential component of the TFIID complex in the pathway of RNA polymerase II–mediated gene transcription, and it regulates transcription of a large number of genes related to cell division. The neuron-specific isoform of the TAF1 gene (N-TAF1), which we reported previously, may have an essential role in neurons through transcriptional regulation of many neuron-specific genes. In the present study, we cloned the full-length cDNA that encodes the mouse homologue of N-TAF1 (N-Taf1) protein. By carrying out of real time RT-PCR, we investigated the expression analysis of the N-Taf1 mRNA in mouse tissues and cell lines. As well as the human N-TAF1, the N-Taf1 showed limited expression in the brain and neuroblastoma, whereas Taf1 expressed elsewhere. Furthermore, in mouse embryo head or mouse brain, mRNA expression of TAF1 changes dramatically during development but N-Taf1 showed sustained expression. Our result suggests that the N-Taf1 gene has an important role in non-dividing neuronal cell rather than in cell division and proliferation during neurogenesis.

Sustained expression of a neuron-specific isoform of the Taf1 gene in development stages and aging in mice

Energy Technology Data Exchange (ETDEWEB)

Jambaldorj, Jamiyansuren [Department of Pharmacology, Institute of Health Biosciences, Graduate School, The University of Tokushima, Tokushima 770-8503 (Japan); Advanced Molecular Epidemiology Research Institute, Yamagata University Faculty of Medicine, Yamagata 990-9585 (Japan); Central Scientific Research Laboratory, Institute of Medical Sciences, Ulaanbaatar (Mongolia); Makino, Satoshi, E-mail: smakino@genetix-h.com [Molecular Neuroscience Research Center, Shiga University of Medical Science, Otsu 520-2192 (Japan); Munkhbat, Batmunkh [Central Scientific Research Laboratory, Institute of Medical Sciences, Ulaanbaatar (Mongolia); Tamiya, Gen [Advanced Molecular Epidemiology Research Institute, Yamagata University Faculty of Medicine, Yamagata 990-9585 (Japan)

2012-08-24

Highlights: Black-Right-Pointing-Pointer We identified the mouse homologue of neuron-specific TAF1 (N-Taf1). Black-Right-Pointing-Pointer Taf1 mRNA was expressed in most tissues and cell lines. Black-Right-Pointing-Pointer N-Taf1 mRNA was expressed in the brain and Neuroblastoma N2a cell lines. Black-Right-Pointing-Pointer Taf1 and N-Taf1 showed different expression profile in development stage and aging. -- Abstract: TATA-box binding protein associated factor 1 (TAF1) protein is the largest and the essential component of the TFIID complex in the pathway of RNA polymerase II-mediated gene transcription, and it regulates transcription of a large number of genes related to cell division. The neuron-specific isoform of the TAF1 gene (N-TAF1), which we reported previously, may have an essential role in neurons through transcriptional regulation of many neuron-specific genes. In the present study, we cloned the full-length cDNA that encodes the mouse homologue of N-TAF1 (N-Taf1) protein. By carrying out of real time RT-PCR, we investigated the expression analysis of the N-Taf1 mRNA in mouse tissues and cell lines. As well as the human N-TAF1, the N-Taf1 showed limited expression in the brain and neuroblastoma, whereas Taf1 expressed elsewhere. Furthermore, in mouse embryo head or mouse brain, mRNA expression of TAF1 changes dramatically during development but N-Taf1 showed sustained expression. Our result suggests that the N-Taf1 gene has an important role in non-dividing neuronal cell rather than in cell division and proliferation during neurogenesis.

Isolation and characterization of cyp19a1a and cyp19a1b promoters in the protogynous hermaphrodite orange-spotted grouper (Epinephelus coioides).

Science.gov (United States)

Zhang, Weimin; Lu, Huijie; Jiang, Haiyan; Li, Mu; Zhang, Shen; Liu, Qiongyou; Zhang, Lihong

2012-02-01

Aromatase (CYP19A1) catalyzes the conversion of androgens to estrogens. In teleosts, duplicated copies of cyp19a1 genes, namely cyp19a1a and cyp19a1b, were identified, however, the transcriptional regulation of these two genes remains poorly understood. In the present study, the 5'-flanking regions of the orange-spotted grouper cyp19a1a (gcyp19a1a) and cyp19a1b (gcyp19a1b) genes were isolated and characterized. The proximal promoter regions of both genes were relatively conserved when compared to those of the other teleosts. Notably, a conserved FOXO transcriptional factor binding site was firstly reported in the proximal promoter of gcyp19a1a, and deletion of the region (-112 to -60) containing this site significantly decreased the promoter activities. The deletion of the region (-246 to -112) containing the two conserved FTZ-F1 sites also dramatically decreased the transcriptional activities of gcyp19a1a promoter, and both two FTZ-F1 sites were shown to be stimulatory cis-acting elements. A FTZ-F1 homologue isolated from ricefield eel (eFTZ-F1) up-regulated gcyp19a1a promoter activities possibly via the FTZ-F1 sites, however, a previously identified orange-spotted grouper FTZ-F1 homologue (gFTZ-F1) did not activate the transcription of gcyp19a1a promoter unexpectedly. As to gcyp19a1b promoter, all the deletion constructs did not show good promoter activities in either TM4 or U251-MG cells. Estradiol (100nM) up-regulated gcyp19a1b promoter activities by about 13- and 36-fold in TM4 and U251-MG cells, respectively, via the conserved ERE motif, but did not stimulate gcyp19a1a promoter activities. These results are helpful to further elucidate the regulatory mechanisms of cyp19a1a and cyp19a1b expression in the orange-spotted grouper as well as other teleosts. Copyright © 2011 Elsevier Inc. All rights reserved.

Die Kardiomyopathie in der Friedreich-Ataxie

OpenAIRE

Reichert [geb. Florescu], Christiane Katharina

2018-01-01

Die Friedreich-Ataxie ist eine autosomal-rezessiv vererbte neurodegenerative Erkrankung, die sich meistens vor dem 20. Lebensjahr manifestiert. Der Erkrankung liegt eine GAA-Trinukleotid-Expansion im FXN-Gen (Chromosom 9q13) zu Grunde. Diese Mutation führt zu einer verminderten Bildung von Frataxin, wodurch es zur Eisenanreicherung in den Mitochondrien kommt. Diese Eisenakkumulation führt zu oxidativem Stress und mitochondrialer Dysfunktion, die sich vor allem in Gewebe mit einem hohen An...

Molecular and functional characterization of a human ATM gene analogue at Arabidopsis thaliana; Caracterisation moleculaire et Fonctionnelle d'un Homologue du gene humain ATM chez Arabidopsis thaliana

Energy Technology Data Exchange (ETDEWEB)

Garcia, V.

2001-12-15

The human ATM gene, whose inactivation is responsible for the human disease ataxia telangiectasia is conserved throughout the Eukaryotes and plays an important role in the cellular responses to DNA damage, in particular to DNA double-strand breaks (DSBs). Here we describe the identification of an Arabidopsis thaliana homologue of ATM (AtATM), and the molecular and cytological characterization of plants, hereafter called atm, carrying a disrupting T-DNA insertion in this gene. AtATM covers a 32 kb region on chromosome 3. The AtATM transcript has a complex structure, is 12 kb long and formed by 79 exons. The transcriptional level of AtATM is very low in all the tissues tested, and does not vary after exposure to ionizing radiations (IR). In atm plants, the protein is not detected suggesting the mutants are null. The atm mutants are partially sterile. Aberrant segregation of chromosomes during meiosis I on both male and female sides account for this sterility. However, meiotic recombination frequency is normal. Mutant plants are also hypersensitive to gamma rays and methyl methane sulfonate, but not to UV-B, pointing to a specific defect of atm mutants in the response to DNA DSBs. In plants, ionizing radiations induce a strong, rapid and transient transcriptional activation of genes involved in the cellular response to or the repair of DSBs. This transcriptional regulation of AtRAD51, AtPARP1, atGR1 and AtL1G4 is lost in the atm mutants . The absence of AtRAD51 induction associated with ionizing radiation sensitivity suggest that AtAtm play an important function in DSB repair by homologous recombination. In addition we show that homologous intra-chromosomal recombination frequency is elevated in the mutant comparing to wild-type, with or without gamma irradiation. These results show the implication of AtAtm in the genomic stability. (author)

Molecular characterization and expression analysis of chloroplast protein import components in tomato (Solanum lycopersicum.

Directory of Open Access Journals (Sweden)

Jianmin Yan

Full Text Available The translocon at the outer envelope membrane of chloroplasts (Toc mediates the recognition and initial import into the organelle of thousands of nucleus-encoded proteins. These proteins are translated in the cytosol as precursor proteins with cleavable amino-terminal targeting sequences called transit peptides. The majority of the known Toc components that mediate chloroplast protein import were originally identified in pea, and more recently have been studied most extensively in Arabidopsis. With the completion of the tomato genome sequencing project, it is now possible to identify putative homologues of the chloroplast import components in tomato. In the work reported here, the Toc GTPase cDNAs from tomato were identified, cloned and analyzed. The analysis revealed that there are four Toc159 homologues (slToc159-1, -2, -3 and -4 and two Toc34 homologues (slToc34-1 and -2 in tomato, and it was shown that tomato Toc159 and Toc34 homologues share high sequence similarity with the comparable import apparatus components from Arabidopsis and pea. Thus, tomato is a valid model for further study of this system. The expression level of Toc complex components was also investigated in different tissues during tomato development. The two tomato Toc34 homologues are expressed at higher levels in non-photosynthetic tissues, whereas, the expression of two tomato Toc159 homologues, slToc159-1 and slToc159-4, were higher in photosynthetic tissues, and the expression patterns of slToc159-2 was not significantly different in photosynthetic and non-photosynthetic tissues, and slToc159-3 expression was limited to a few select tissues.

Allelic imbalance and cytogenetic deletion of 1p in colorectal adenomas: a target region identified between DIS199 and DIS234

DEFF Research Database (Denmark)

Bomme, L; Heim, S; Bardi, G

1998-01-01

short-term cultured and karyotyped colorectal adenomas for allelic imbalance at eight microsatellite loci in 1p. Allelic imbalances were detected in seven of the 12 adenomas that had cytogenetically visible abnormalities of chromosome 1, as well as in four adenomas that either had a normal karyotype...... region. This genomic area contains the human homologue of the tumor modifier gene Mom1 (1p35-36.1), which, in mice, modifies the number of intestinal tumors in multiple intestinal neoplasia (Min)-mutated animals. To evaluate whether the imbalances corresponded to interstitial deletions of 1p material, we...

The General Amino Acid Permease FfGap1 of Fusarium fujikuroi Is Sorted to the Vacuole in a Nitrogen-Dependent, but Npr1 Kinase-Independent Manner.

Directory of Open Access Journals (Sweden)

Andreas Pfannmüller

Full Text Available The rice pathogenic fungus Fusarium fujikuroi is well known for the production of a broad spectrum of secondary metabolites (SMs such as gibberellic acids (GAs, mycotoxins and pigments. The biosynthesis of most of these SMs strictly depends on nitrogen availability and of the activity of permeases of nitrogen sources, e.g. the ammonium and amino acid permeases. One of the three ammonium permeases, MepB, was recently shown to act not only as a transporter but also as a nitrogen sensor affecting the production of nitrogen-repressed SMs. Here we describe the identification of a general amino acid permease, FfGap1, among the 99 putative amino acid permeases (AAPs in the genome of F. fujikuroi. FfGap1 is able to fully restore growth of the yeast gap1∆ mutant on several amino acids including citrulline and tryptophane. In S. cerevisiae, Gap1 activity is regulated by shuttling between the plasma membrane (nitrogen limiting conditions and the vacuole (nitrogen sufficiency, which we also show for FfGap1. In yeast, the Npr1 serine/threonine kinase stabilizes the Gap1 position at the plasma membrane. Here, we identified and characterized three NPR1-homologous genes, encoding the putative protein kinases FfNpr1-1, FfNpr1-2 and FfNpr1-3 with significant similarity to yeast Npr1. Complementation of the yeast npr1Δ mutant with each of the three F. fujikuroi NPR1 homologues, resulted in partial restoration of ammonium, arginine and proline uptake by FfNPR1-1 while none of the three kinases affect growth on different nitrogen sources and nitrogen-dependent sorting of FfGap1 in F. fujikuroi. However, exchange of the putative ubiquitin-target lysine 9 (K9A and 15 (K15A residues of FfGap1 resulted in extended localization to the plasma membrane and increased protein stability independently of nitrogen availability. These data suggest a similar regulation of FfGap1 by nitrogen-dependent ubiquitination, but differences regarding the role of Fusarium Npr1

LBP/BPI homologue in Eisenia andrei earthworms

Czech Academy of Sciences Publication Activity Database

Škanta, František; Procházková, Petra; Roubalová, Radka; Dvořák, Jiří; Bilej, Martin

2016-01-01

Roč. 54, č. 1 (2016), s. 1-6 ISSN 0145-305X R&D Projects: GA MŠk(CZ) ED1.1.00/02.0109; GA MŠk(CZ) EE2.3.30.0003 Institutional support: RVO:61388971 Keywords : Earthworm * Eisenia * LBP/BPI Subject RIV: EC - Immunology Impact factor: 3.218, year: 2016

Drosophila DJ-1 decreases neural sensitivity to stress by negatively regulating Daxx-like protein through dFOXO.

Directory of Open Access Journals (Sweden)

Soojin Hwang

2013-04-01

Full Text Available DJ-1, a Parkinson's disease (PD-associated gene, has been shown to protect against oxidative stress in Drosophila. However, the molecular mechanism underlying oxidative stress-induced phenotypes, including apoptosis, locomotive defects, and lethality, in DJ-1-deficient flies is not fully understood. Here we showed that Daxx-like protein (DLP, a Drosophila homologue of the mammalian Death domain-associated protein (Daxx, was upregulated under oxidative stress conditions in the loss-of-function mutants of Drosophila DJ-1β, a Drosophila homologue of DJ-1. DLP overexpression induced apoptosis via the c-Jun N-terminal kinase (JNK/Drosophila forkhead box subgroup O (dFOXO pathway, whereas loss of DLP increased resistance to oxidative stress and UV irradiation. Moreover, the oxidative stress-induced phenotypes of DJ-1β mutants were dramatically rescued by DLP deficiency, suggesting that enhanced expression of DLP contributes to the DJ-1β mutant phenotypes. Interestingly, we found that dFOXO was required for the increase in DLP expression in DJ-1β mutants and that dFOXO activity was increased in the heads of DJ-1β mutants. In addition, subcellular localization of DLP appeared to be influenced by DJ-1 expression so that cytosolic DLP was increased in DJ-1β mutants. Similarly, in mammalian cells, Daxx translocation from the nucleus to the cytosol was suppressed by overexpressed DJ-1β under oxidative stress conditions; and, furthermore, targeted expression of DJ-1β to mitochondria efficiently inhibited the Daxx translocation. Taken together, our findings demonstrate that DJ-1β protects flies against oxidative stress- and UV-induced apoptosis by regulating the subcellular localization and gene expression of DLP, thus implying that Daxx-induced apoptosis is involved in the pathogenesis of DJ-1-associated PD.

Brassica napusGLABRA3-1 promotes anthocyanin biosynthesis and trichome formation in true leaves when expressed in Arabidopsis thaliana.

Science.gov (United States)

Gao, C; Guo, Y; Wang, J; Li, D; Liu, K; Qi, S; Jin, C; Duan, S; Gong, J; Li, Z; Chen, M

2018-01-01

Previous studies have shown that GLABRA3 (AtGL3), a bHLH transcription factor, plays essential roles in anthocyanin biosynthesis and trichome formation in Arabidopsis thaliana. However, there have been no such studies of a homologue, BnGL3, from the closely related crop, Brassica napus. Here, we analysed the BnGL3-1 coding domain sequence from the B. napus cultivar QINYOU Seven, identified conserved protein domains and performed a phylogenetic analysis to elucidate its relationship with homologues form a range of plant species. When expressed in tobacco leaves as a fusion protein with green fluorescent protein, BnGL3-1 accumulated in the nucleus, consistent with its predicted function as a transcription factor. Ectopic expression of the BnGL3-1 gene in the A. thaliana gl3-3 mutant resulted in levels of anthocyanins and numbers of trichomes in true leaves that were higher than in wild-type plants. Moreover, overexpression of BnGL3-1 in gl3-3 compensated for the promotion and repression of genes involved in anthocyanin biosynthesis and trichome formation, respectively, that has been reported in gl3-3 young shoots and expanding true leaves. This study provides new insights into GL3 function in anthocyanin biosynthesis and trichome formation in crucifers, and represents a promising target for genetic manipulation of B. napus. © 2017 German Society for Plant Sciences and The Royal Botanical Society of the Netherlands.

Structural domains required for channel function of the mouse transient receptor potential protein homologue TRP1beta.

Science.gov (United States)

Engelke, Michael; Friedrich, Olaf; Budde, Petra; Schäfer, Christina; Niemann, Ursula; Zitt, Christof; Jüngling, Eberhard; Rocks, Oliver; Lückhoff, Andreas; Frey, Jürgen

2002-07-17

Transient receptor potential proteins (TRP) are supposed to participate in the formation of store-operated Ca(2+) influx channels by co-assembly. However, little is known which domains facilitate the interaction of subunits. Contribution of the N-terminal coiled-coil domain and ankyrin-like repeats and the putative pore region of the mouse TRP1beta (mTRP1beta) variant to the formation of functional cation channels were analyzed following overexpression in HEK293 (human embryonic kidney) cells. MTRP1beta expressing cells exhibited enhanced Ca(2+) influx and enhanced whole-cell membrane currents compared to mTRP1beta deletion mutants. Using a yeast two-hybrid assay only the coiled-coil domain facilitated homodimerization of the N-terminus. These results suggest that the N-terminus of mTRP1beta is required for structural organization thus forming functional channels.

Identification and characterisation of ROS modulator 1 in Lampetra japonica.

Science.gov (United States)

Zhao, Chunhui; Feng, Bin; Cao, Ying; Xie, Peng; Xu, Jie; Pang, Yue; Liu, Xin; Li, Qingwei

2013-08-01

Reactive oxygen species (ROS) are a heterogeneous group of highly reactive molecules that oxidise targets in biological systems. ROS are also considered important immune regulators. In this study, we identified a homologue of reactive oxygen species modulator 1 (Romo1) in the Japanese lamprey (Lampetra japonica). The L japonica Romo1 (Lj-Romo1) gene shares high sequence homology with the Romo1 genes of jawed vertebrates. Real-time quantitative PCR demonstrated the wide distribution of Lj-Romo1 in lamprey tissues. Furthermore, after the lampreys were stimulated with lipopolysaccharide (LPS), the level of Lj-Romo1 mRNA was markedly up-regulated in the liver, gill, kidney, and intestine tissues. Lj-Romo1 was localised to the mitochondria and has the capacity to increase the ROS level in cells. The results obtained in the present study will help us to understand the roles of Romo1 in ROS production and innate immune responses in jawless vertebrates. Copyright © 2013 Elsevier Ltd. All rights reserved.

Conserved chromosomal positions of dual domains of the ets protooncogene in cats, mice, and humans

International Nuclear Information System (INIS)

Watson, D.K.; McWilliams-Smith, M.J.; Kozak, C.

1986-01-01

The mammalian protooncogene homologue of the avian v-ets sequence from the E26 retrovirus consists of two sequentially distinct domains located on different chromosomes. Using somatic cell hybrid panels, the authors have mapped the mammalian homologue of the 5' v-ets-domain to chromosome 11 (ETS1) in man, to chromosome 9 (ets-1) in mouse, and to chromosome D1 (ETS1) in the domestic cat. The mammalian homologue of the 3' v-ets domain was similarly mapped to human chromosome 21 (ETS2), to mouse chromosome 16 (Ets-2), and to feline chromosome C2 (ETS2). Both protooncogenes fell in syntenic groups of homologous linked loci that were conserved among the three species. The occurrence of two distinct functional protooncogenes and their conservation of linkage positions in the three mammalian orders indicate that these two genes have been separate since before the evolutionary divergence of mammals

Lipid Signaling via Pkh1/2 Regulates Fungal CO2 Sensing through the Kinase Sch9

Directory of Open Access Journals (Sweden)

Susann Pohlers

2017-01-01

Full Text Available Adaptation to alternating CO2 concentrations is crucial for all organisms. Carbonic anhydrases—metalloenzymes that have been found in all domains of life—enable fixation of scarce CO2 by accelerating its conversion to bicarbonate and ensure maintenance of cellular metabolism. In fungi and other eukaryotes, the carbonic anhydrase Nce103 has been shown to be essential for growth in air (~0.04% CO2. Expression of NCE103 is regulated in response to CO2 availability. In Saccharomyces cerevisiae, NCE103 is activated by the transcription factor ScCst6, and in Candida albicans and Candida glabrata, it is activated by its homologues CaRca1 and CgRca1, respectively. To identify the kinase controlling Cst6/Rca1, we screened an S. cerevisiae kinase/phosphatase mutant library for the ability to regulate NCE103 in a CO2-dependent manner. We identified ScSch9 as a potential ScCst6-specific kinase, as the sch9Δ mutant strain showed deregulated NCE103 expression on the RNA and protein levels. Immunoprecipitation revealed the binding capabilities of both proteins, and detection of ScCst6 phosphorylation by ScSch9 in vitro confirmed Sch9 as the Cst6 kinase. We could show that CO2-dependent activation of Sch9, which is part of a kinase cascade, is mediated by lipid/Pkh1/2 signaling but not TORC1. Finally, we tested conservation of the identified regulatory cascade in the pathogenic yeast species C. albicans and C. glabrata. Deletion of SCH9 homologues of both species impaired CO2-dependent regulation of NCE103 expression, which indicates a conservation of the CO2 adaptation mechanism among yeasts. Thus, Sch9 is a Cst6/Rca1 kinase that links CO2 adaptation to lipid signaling via Pkh1/2 in fungi.

The C. elegans H3K27 Demethylase UTX-1 Is Essential for Normal Development, Independent of Its Enzymatic Activity

DEFF Research Database (Denmark)

Vandamme, Julien; Buchhorn, Gaëlle Lettier; Sidoli, Simone

2012-01-01

specific for H3K27me2/3. We demonstrate that utx-1 is an essential gene that is required for correct embryonic and postembryonic development. Consistent with its homology to UTX, UTX-1 regulates global levels of H3K27me2/3 in C. elegans. Surprisingly, we found that the catalytic activity is not required......Epigenetic modifications influence gene expression and provide a unique mechanism for fine-tuning cellular differentiation and development in multicellular organisms. Here we report on the biological functions of UTX-1, the Caenorhabditis elegans homologue of mammalian UTX, a histone demethylase...

Regulation of Toll-like receptor 2 interaction with Ecgp96 controls Escherichia coli K1 invasion of brain endothelial cells

OpenAIRE

Krishnan, Subramanian; Chen, Shuang; Turcatel, Gianluca; Arditi, Moshe; Prasadarao, Nemani V.

2012-01-01

The interaction of outer membrane protein A (OmpA) with its receptor, Ecgp96 (a homologue of Hsp90β) is critical for the pathogenesis of E. coli K1 meningitis. Since Hsp90 chaperones Toll-like receptors (TLRs), we examined the role of TLRs in E. coli K1 infection. Herein, we show that newborn TLR2−/− mice are resistant to E. coli K1 meningitis, while TLR4−/− mice succumb to infection sooner. In vitro, OmpA+ E. coli infection selectively upregulates Ecgp96 and TLR2 in human brain microvascular...

BmajPLA2-II, a basic Lys49-phospholipase A2 homologue from Bothrops marajoensis snake venom with parasiticidal potential.

Science.gov (United States)

Grabner, Amy N; Alfonso, Jorge; Kayano, Anderson M; Moreira-Dill, Leandro S; Dos Santos, Ana Paula de A; Caldeira, Cleópatra A S; Sobrinho, Juliana C; Gómez, Ana; Grabner, Fernando P; Cardoso, Fabio F; Zuliani, Juliana Pavan; Fontes, Marcos R M; Pimenta, Daniel C; Gómez, Celeste Vega; Teles, Carolina B G; Soares, Andreimar M; Calderon, Leonardo A

2017-09-01

Snake venoms contain various proteins, especially phospholipases A 2 (PLA 2 s), which present potential applications in diverse areas of health and medicine. In this study, a new basic PLA 2 from Bothrops marajoensis with parasiticidal activity was purified and characterized biochemically and biologically. B. marajoensis venom was fractionated through cation exchange followed by reverse phase chromatographies. The isolated toxin, BmajPLA 2 -II, was structurally characterized with MALDI-TOF (Matrix-assisted laser desorption/ionization-time of flight) mass spectrometry, sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE), followed by two-dimensional electrophoresis, partial amino acid sequencing, an enzymatic activity assay, circular dichroism, and dynamic light scattering assays. These structural characterization tests presented BmajPLA 2 -II as a basic Lys49 PLA 2 homologue, compatible with other basic snake venom PLA 2 s (svPLA 2 ), with a tendency to form aggregations. The in vitro anti-parasitic potential of B. marajoensis venom and of BmajPLA 2 -II was evaluated against Leishmania infantum promastigotes and Trypanosoma cruzi epimastigotes, showing significant activity at a concentration of 100μg/mL. The venom and BmajPLA 2 -II presented IC 50 of 0.14±0.08 and 6.41±0.64μg/mL, respectively, against intraerythrocytic forms of Plasmodium falciparum with CC 50 cytotoxicity values against HepG2 cells of 43.64±7.94 and >150μg/mL, respectively. The biotechnological potential of these substances in relation to leishmaniasis, Chagas disease and malaria should be more deeply investigated. Copyright © 2017. Published by Elsevier B.V.

Synergistic regulation of the mouse orphan nuclear receptor SHP gene promoter by CLOCK-BMAL1 and LRH-1

International Nuclear Information System (INIS)

Oiwa, Ako; Kakizawa, Tomoko; Miyamoto, Takahide; Yamashita, Koh; Jiang, Wei; Takeda, Teiji; Suzuki, Satoru; Hashizume, Kiyoshi

2007-01-01

Small heterodimer partner (SHP; NR0B2) is an orphan nuclear receptor and acts as a repressor for wide variety of nuclear hormone receptors. We demonstrated here that mouse SHP mRNA showed a circadian expression pattern in the liver. Transient transfection of the mSHP promoter demonstrated that CLOCK-BMAL1, core circadian clock components, bound to E-box (CACGTG), and stimulated the promoter activity by 4-fold. Liver receptor homologue-1 (LRH-1; NR5A2) stimulated the mSHP promoter, and CLOCK-BMAL1 synergistically enhanced the LRH-1-mediated transactivation. Interestingly, SHP did not affect the CLOCK-BMAL1-mediated promoter activity, but strongly repressed the synergistic activation of CLOCK-BMAL1 and LRH-1. Furthermore, in vitro pull-down assays revealed the existence of direct protein-protein interaction between LRH-1 and CLOCK. In summary, this study shows that CLOCK-BMAL1, LRH-1 and SHP coordinately regulate the mSHP gene to generate the circadian oscillation. The cyclic expression of mSHP may affect daily activity of other nuclear receptors and contribute to circadian liver functions

Midbrain expression of Delta-like 1 homologue is regulated by GDNF and is associated with dopaminergic differentiation

DEFF Research Database (Denmark)

Christophersen, Nicolai S.; Gronborg, Mette; Petersen, Thomas Nordahl

2007-01-01

upregulation with increased positive staining of cell bodies in the SNc and fibers in the striatum. Analysis of the developmental regulation of Dlk1 in the murine ventral midbrain showed that the upregulation of Dlk1 mRNA correlated with the generation of tyrosine hydroxylase (TH)-positive neurons. Furthermore...

Pten regulates spindle pole movement through Dlg1-mediated recruitment of Eg5 to centrosomes

NARCIS (Netherlands)

Ree, J.H. van; Nam, H.J.; Jeganathan, K.B.; Kanakkanthara, A.; Deursen, J.M.A. van

2016-01-01

Phosphatase and tensin homologue (Pten) suppresses neoplastic growth by negatively regulating PI(3)K signalling through its phosphatase activity. To gain insight into the actions of non-catalytic Pten domains in normal physiological processes and tumorigenesis, we engineered mice lacking the

Rapid detection, differentiation and typing of methicillin-resistant Staphylococcus aureus harbouring either mecA or the new mecA homologue mecA(LGA251).

Science.gov (United States)

Stegger, M; Andersen, P S; Kearns, A; Pichon, B; Holmes, M A; Edwards, G; Laurent, F; Teale, C; Skov, R; Larsen, A R

2012-04-01

The recent finding of a new mecA homologue, mecA(LGA251) , with only 70% nucleotide homology to the conventional mecA gene has brought the routine testing for mecA as a confirmatory test for methicillin-resistant Staphylococcus aureus (MRSA) into question. A multiplex PCR was designed to differentiate mecA(LGA251) from the known mecA together with detection of lukF-PV and the spa gene fragments, enabling direct spa typing by sequencing of the PCR amplicons. The PCR analysis and subsequent spa typing were validated on a large collection (n=185) of contemporary MRSA and methicillin-sensitive S. aureus isolates, including 127 isolates carrying mecA(LGA251) . The mecA(LGA251) gene was situated in staphylococcal cassette chromosome mec type XI elements, and sequence variation within a 631-bp fragment of mecA(LGA251) in 79 isolates indicated a very conserved gene sequence. Following a successful validation, the multiplex PCR strategy was implemented in the routine testing of MRSA for national surveillance. Over a 2-month period, among 203 samples tested, 12 new MRSA cases caused by isolates carrying mecA(LGA251) were identified, emphasizing the clinical importance of testing for these new MRSA isolates. © 2011 STATENS SERUM INSTITUT. Clinical Microbiology and Infection © 2011 European Society of Clinical Microbiology and Infectious Diseases.

crm-1 facilitates BMP signaling to control body size in Caenorhabditis elegans.

Science.gov (United States)

Fung, Wong Yan; Fat, Ko Frankie Chi; Eng, Cheah Kathryn Song; Lau, Chow King

2007-11-01

We have identified in Caenorhabditis elegans a homologue of the vertebrate Crim1, crm-1, which encodes a putative transmembrane protein with multiple cysteine-rich (CR) domains known to have bone morphogenetic proteins (BMPs) binding activity. Using the body morphology of C. elegans as an indicator, we showed that attenuation of crm-1 activity leads to a small body phenotype reminiscent of that of BMP pathway mutants. We showed that the crm-1 loss-of-function phenotype can be rescued by constitutive supply of sma-4 activity. crm-1 can enhance BMP signaling and this activity is dependent on the presence of the DBL-1 ligand and its receptors. crm-1 is expressed in neurons at the ventral nerve cord, where the DBL-1 ligand is produced. However, ectopic expression experiments reveal that crm-1 gene products act outside the DBL-1 producing cells and function non-autonomously to facilitate dbl/sma pathway signaling to control body size.

Impact of buffer gas quenching on the 1S0 → 1P1 ground-state atomic transition in nobelium

International Nuclear Information System (INIS)

Chhetri, P.; Lautenschlaeger, F.; Ackermann, D.; Backe, H.; Lauth, W.; Block, M.; Duellmann, C.E.; Goetz, S.; Cheal, B.; Wraith, C.; Even, J.; Ferrer, R.; Giacoppo, F.; Hessberger, F.P.; Khuyagbaatar, J.; Kishor Mistry, A.; Raeder, S.; Yakushev, A.; Kaleja, O.; Kunz, P.; Laatiaoui, M.; Minaya Ramirez, E.; Walther, T.

2017-01-01

Using the sensitive Radiation Detected Resonance Ionization Spectroscopy (RADRIS) technique an optical transition in neutral nobelium (No, Z = 102) was identified. A remnant signal when delaying the ionizing laser indicated the influence of a strong buffer gas induced de-excitation of the optically populated level. A subsequent investigation of the chemical homologue, ytterbium (Yb, Z = 70), enabled a detailed study of the atomic levels involved in this process, leading to the development of a rate equation model. This paves the way for characterizing resonance ionization spectroscopy (RIS) schemes used in the study of nobelium and beyond, where atomic properties are currently unknown. (authors)

LD-aminopterin in the canine homologue of human atopic dermatitis: a randomized, controlled trial reveals dosing factors affecting optimal therapy.

Science.gov (United States)

Zebala, John A; Mundell, Alan; Messinger, Linda; Griffin, Craig E; Schuler, Aaron D; Kahn, Stuart J

2014-01-01

Options are limited for patients with atopic dermatitis (AD) who do not respond to topical treatments. Antifolate therapy with systemic methotrexate improves the disease, but is associated with adverse effects. The investigational antifolate LD-aminopterin may offer improved safety. It is not known how antifolate dose and dosing frequency affect efficacy in AD, but a primary mechanism is thought to involve the antifolate-mediated accumulation of 5-aminoimidazole-4-carboxamide ribonucleotide (AICAR). However, recent in vitro studies indicate that AICAR increases then decreases as a function of antifolate concentration. To address this issue and understand how dosing affects antifolate efficacy in AD, we examined the efficacy and safety of different oral doses and schedules of LD-aminopterin in the canine model of AD. This was a multi-center, double-blind trial involving 75 subjects with canine AD randomized to receive up to 12 weeks of placebo, once-weekly (0.007, 0.014, 0.021 mg/kg) or twice-weekly (0.007 mg/kg) LD-aminopterin. The primary efficacy outcome was the Global Score (GS), a composite of validated measures of disease severity and itch. GS improved in all once-weekly cohorts, with 0.014 mg/kg being optimal and significant (43%, P<0.01). The majority of improvement was seen by 8 weeks. In contrast, GS in the twice-weekly cohort was similar to placebo and worse than all once-weekly cohorts. Adverse events were similar across all treated cohorts and placebo. Once-weekly LD-aminopterin was safe and efficacious in canine AD. Twice-weekly dosing negated efficacy despite having the same daily and weekly dose as effective once-weekly regimens. Optimal dosing in this homologue of human AD correlated with the concentration-selective accumulation of AICAR in vitro, consistent with AICAR mediating LD-aminopterin efficacy in AD.

LD-aminopterin in the canine homologue of human atopic dermatitis: a randomized, controlled trial reveals dosing factors affecting optimal therapy.

Directory of Open Access Journals (Sweden)

John A Zebala

Full Text Available Options are limited for patients with atopic dermatitis (AD who do not respond to topical treatments. Antifolate therapy with systemic methotrexate improves the disease, but is associated with adverse effects. The investigational antifolate LD-aminopterin may offer improved safety. It is not known how antifolate dose and dosing frequency affect efficacy in AD, but a primary mechanism is thought to involve the antifolate-mediated accumulation of 5-aminoimidazole-4-carboxamide ribonucleotide (AICAR. However, recent in vitro studies indicate that AICAR increases then decreases as a function of antifolate concentration. To address this issue and understand how dosing affects antifolate efficacy in AD, we examined the efficacy and safety of different oral doses and schedules of LD-aminopterin in the canine model of AD.This was a multi-center, double-blind trial involving 75 subjects with canine AD randomized to receive up to 12 weeks of placebo, once-weekly (0.007, 0.014, 0.021 mg/kg or twice-weekly (0.007 mg/kg LD-aminopterin. The primary efficacy outcome was the Global Score (GS, a composite of validated measures of disease severity and itch. GS improved in all once-weekly cohorts, with 0.014 mg/kg being optimal and significant (43%, P<0.01. The majority of improvement was seen by 8 weeks. In contrast, GS in the twice-weekly cohort was similar to placebo and worse than all once-weekly cohorts. Adverse events were similar across all treated cohorts and placebo.Once-weekly LD-aminopterin was safe and efficacious in canine AD. Twice-weekly dosing negated efficacy despite having the same daily and weekly dose as effective once-weekly regimens. Optimal dosing in this homologue of human AD correlated with the concentration-selective accumulation of AICAR in vitro, consistent with AICAR mediating LD-aminopterin efficacy in AD.

Meiotic drive on aberrant chromosome 1 in the mouse is determined by a linked distorter.

Science.gov (United States)

Agulnik, S I; Sabantsev, I D; Orlova, G V; Ruvinsky, A O

1993-04-01

An aberrant chromosome 1 carrying an inverted fragment with two amplified DNA regions was isolated from wild populations of Mus musculus. Meiotic drive favouring the aberrant chromosome was demonstrated for heterozygous females. Its cause was preferential passage of aberrant chromosome 1 to the oocyte. Genetic analysis allowed us to identify a two-component system conditioning deviation from equal segregation of the homologues. The system consists of a postulated distorter and responder. The distorter is located on chromosome 1 distally to the responder, between the ln and Pep-3 genes, and it acts on the responder when in trans position. Polymorphism of the distorters was manifested as variation in their effect on meiotic drive level in the laboratory strain and mice from wild populations.

GEI-8, a homologue of vertebrate nuclear receptor corepressor NCoR/SMRT, regulates gonad development and neuronal functions in Caenorhabditis elegans.

Directory of Open Access Journals (Sweden)

Pavol Mikoláš

Full Text Available NCoR and SMRT are two paralogous vertebrate proteins that function as corepressors with unliganded nuclear receptors. Although C. elegans has a large number of nuclear receptors, orthologues of the corepressors NCoR and SMRT have not unambiguously been identified in Drosophila or C. elegans. Here, we identify GEI-8 as the closest homologue of NCoR and SMRT in C. elegans and demonstrate that GEI-8 is expressed as at least two isoforms throughout development in multiple tissues, including neurons, muscle and intestinal cells. We demonstrate that a homozygous deletion within the gei-8 coding region, which is predicted to encode a truncated protein lacking the predicted NR domain, results in severe mutant phenotypes with developmental defects, slow movement and growth, arrested gonadogenesis and defects in cholinergic neurotransmission. Whole genome expression analysis by microarrays identified sets of de-regulated genes consistent with both the observed mutant phenotypes and a role of GEI-8 in regulating transcription. Interestingly, the upregulated transcripts included a predicted mitochondrial sulfide:quinine reductase encoded by Y9C9A.16. This locus also contains non-coding, 21-U RNAs of the piRNA class. Inhibition of the expression of the region coding for 21-U RNAs leads to irregular gonadogenesis in the homozygous gei-8 mutants, but not in an otherwise wild-type background, suggesting that GEI-8 may function in concert with the 21-U RNAs to regulate gonadogenesis. Our results confirm that GEI-8 is the orthologue of the vertebrate NCoR/SMRT corepressors and demonstrate important roles for this putative transcriptional corepressor in development and neuronal function.

FGT-1 is a mammalian GLUT2-like facilitative glucose transporter in Caenorhabditis elegans whose malfunction induces fat accumulation in intestinal cells.

Directory of Open Access Journals (Sweden)

Shun Kitaoka

Full Text Available Caenorhabditis elegans (C. elegans is an attractive animal model for biological and biomedical research because it permits relatively easy genetic dissection of cellular pathways, including insulin/IGF-like signaling (IIS, that are conserved in mammalian cells. To explore C. elegans as a model system to study the regulation of the facilitative glucose transporter (GLUT, we have characterized the GLUT gene homologues in C. elegans: fgt-1, R09B5.11, C35A11.4, F53H8.3, F48E3.2, F13B12.2, Y61A9LA.1, K08F9.1 and Y37A1A.3. The exogenous expression of these gene products in Xenopus oocytes showed transport activity to unmetabolized glucose analogue 2-deoxy-D-glucose only in FGT-1. The FGT-1-mediated transport activity was inhibited by the specific GLUT inhibitor phloretin and exhibited a Michaelis constant (Km of 2.8 mM. Mannose, galactose, and fructose were able to inhibit FGT-1-mediated 2-deoxy-D-glucose uptake (P < 0.01, indicating that FGT-1 is also able to transport these hexose sugars. A GFP fusion protein of FGT-1 was observed only on the basolateral membrane of digestive tract epithelia in C. elegans, but not in other tissues. FGT-1::eGFP expression was observed from early embryonic stages. The knockdown or mutation of fgt-1 resulted in increased fat staining in both wild-type and daf-2 (mammalian insulin receptor homologue mutant animals. Other common phenotypes of IIS mutant animals, including dauer formation and brood size reduction, were not affected by fgt-1 knockdown in wild-type or daf-2 mutants. Our results indicated that in C. elegans, FGT-1 is mainly a mammalian GLUT2-like intestinal glucose transporter and is involved in lipid metabolism.

Novel nuclear-encoded proteins interacting with a plastid sigma factor, Sig1, in Arabidopsis thaliana.

Science.gov (United States)

Morikawa, Kazuya; Shiina, Takashi; Murakami, Shinya; Toyoshima, Yoshinori

2002-03-13

Sigma factor binding proteins are involved in modifying the promoter preferences of the RNA polymerase in bacteria. We found the nuclear encoded protein (SibI) that is transported into chloroplasts and interacts specifically with the region 4 of Sig1 in Arabidopsis. SibI and its homologue, T3K9.5 are novel proteins, which are not homologous to any protein of known function. The expression of sibI was tissue specific, light dependent, and developmentally timed. We suggest the transcriptional regulation by sigma factor binding proteins to function in the plastids of higher plant.

Leishmania replication protein A-1 binds in vivo single-stranded telomeric DNA

International Nuclear Information System (INIS)

Neto, J.L. Siqueira; Lira, C.B.B.; Giardini, M.A.; Khater, L.; Perez, A.M.; Peroni, L.A.; Reis, J.R.R. dos; Freitas-Junior, L.H.; Ramos, C.H.I.; Cano, M.I.N.

2007-01-01

Replication protein A (RPA) is a highly conserved heterotrimeric single-stranded DNA-binding protein involved in different events of DNA metabolism. In yeast, subunits 1 (RPA-1) and 2 (RPA-2) work also as telomerase recruiters and, in humans, the complex unfolds G-quartet structures formed by the 3' G-rich telomeric strand. In most eukaryotes, RPA-1 and RPA-2 bind DNA using multiple OB fold domains. In trypanosomatids, including Leishmania, RPA-1 has a canonical OB fold and a truncated RFA-1 structural domain. In Leishmania amazonensis, RPA-1 alone can form a complex in vitro with the telomeric G-rich strand. In this work, we show that LaRPA-1 is a nuclear protein that associates in vivo with Leishmania telomeres. We mapped the boundaries of the OB fold DNA-binding domain using deletion mutants. Since Leishmania and other trypanosomatids lack homologues of known telomere end binding proteins, our results raise questions about the function of RPA-1 in parasite telomeres

Mlh1 is required for female fertility in Drosophila melanogaster: An outcome of effects on meiotic crossing over, ovarian follicles and egg activation.

Science.gov (United States)

Vimal, Divya; Kumar, Saurabh; Pandey, Ashutosh; Sharma, Divya; Saini, Sanjay; Gupta, Snigdha; Ravi Ram, Kristipati; Chowdhuri, Debapratim Kar

2018-03-01

Mismatch repair (MMR) system, a conserved DNA repair pathway, plays crucial role in DNA recombination and is involved in gametogenesis. The impact of alterations in MMR family of proteins (bacterial MutS and MutL homologues) on mammalian fertility is well documented. However, an insight to the role of MMR in reproduction of non-mammalian organisms is limited. Hence, in the present study, we analysed the impact of mlh1 (a MutL homologue) on meiotic crossing over/recombination and fertility in a genetically tractable model, Drosophila melanogaster. Using mlh1 e00130 hypomorphic allele, we report female specific adverse reproductive outcome for reduced mlh1 in Drosophila: mlh1 e00130 homozygous females had severely reduced fertility while males were fertile. Further, mlh1 e00130 females contained small ovaries with large number of early stages as well as significantly reduced mature oocytes, and laid fewer eggs, indicating discrepancies in egg production and ovulation. These observations contrast the sex independent and/or male specific sterility and normal follicular development as well as ovulation reported so far for MMR family proteins in mammals. However, analogous to the role(s) of mlh1 in meiotic crossing over and DNA repair processes underlying mammalian fertility, ovarian follicles from mlh1 e00130 females contained significantly increased DNA double strand breaks (DSBs) and reduced synaptonemal complex foci. In addition, large proportion of fertilized eggs display discrepancies in egg activation and fail to proceed beyond stage 5 of embryogenesis. Hence, reduction of the Mlh1 protein level leads to defective oocytes that fail to complete embryogenesis after fertilization thereby reducing female fertility. Copyright © 2017 Elsevier GmbH. All rights reserved.

Structure of the T6SS lipoprotein TssJ1 from Pseudomonas aeruginosa

International Nuclear Information System (INIS)

Robb, Craig S.; Assmus, Mark; Nano, Francis E.; Boraston, Alisdair B.

2013-01-01

The crystal structure of the type VI secretion-system protein TssJ1 from P. aeruginosa was solved by iodide SAD at a resolution of 1.4 Å. The type VI secretion system of Pseudomonas aeruginosa has been shown to be responsible for the translocation of bacteriolytic effectors into competing bacteria. A mechanistic understanding of this widely distributed secretion system is developing and structural studies of its components are ongoing. Two representative structures of one highly conserved component, TssJ, from Escherichia coli and Serratia marcescens have been published. Here, the X-ray crystal structure of TssJ1 from P. aeruginosa is presented at 1.4 Å resolution. The overall structure is conserved among the three proteins. This finding suggests that the homologues function in a similar manner and bolsters the understanding of the structure of this family of proteins

The expression pattern of the C-terminal kinesin gene kifc1 during the spermatogenesis of Sepiella maindroni.

Science.gov (United States)

Tan, Fu-Qing; Ma, Xiao-Xin; Zhu, Jun-Quan; Yang, Wan-Xi

2013-12-10

In this study, we investigated the gene sequence and characteristic of kifc1 in Sepiella maindroni through PCR and RACE technology. Our research aimed particularly at the spatio-temporal expression pattern of kifc1 in the developmental testis through in situ hybridization. The particular role of kifc1 in the spermatogenesis of S. maindroni was our particular interest. Based on multiple protein sequence alignments of KIFC1 homologues, kifc1 gene from the testis of S. maindroni was identified, which consisted of 2432bp including a 2109 in-frame ORF corresponding to 703 continuous amino acids. The encoded polypeptide shared highest similarity with Octopus tankahkeei. Through the prediction of the secondary and tertiary structures, the motor domain of KIFC1 was conserved at the C-terminal, having putative ATP-binding and microtubule-binding motifs, while the N-terminal was more specific to bind various cargoes for cellular events. The stalk domain connecting between the C-terminal and N-terminal determined the direction of movement. According to RT-PCR results, the kifc1 gene is not tissue-specific, commonly detected in different tissues, for example, the testis, liver, stomach, muscle, caecum and gills. Through an in situ hybridization method, the expression pattern of KIFC1 protein mimics in the spermatogenesis of S. maindroni. During the primary stage of the spermatogenesis, the kifc1 mRNA signal was barely detectable. At the early spermatids, the signal started to be present. With the elongation of spermatids, the signals increased substantially. It peaked and gathered around the acrosome area when the spermatids began to transform to spindle shape. As the spermatids developed into mature sperm, the signal vanished. In summary, the expression of kfic1 at specific stages during spermiogenesis and its distribution shed light on the potential functions of this motor in major cytological transformations. The KIFC1 homologue may provide a direct shaping force to the

Bioenergetics of the calf muscle in Friedreich ataxia patients measured by 31P-MRS before and after treatment with recombinant human erythropoietin.

Directory of Open Access Journals (Sweden)

Wolfgang Nachbauer

Full Text Available Friedreich ataxia (FRDA is caused by a GAA repeat expansion in the FXN gene leading to reduced expression of the mitochondrial protein frataxin. Recombinant human erythropoietin (rhuEPO is suggested to increase frataxin levels, alter mitochondrial function and improve clinical scores in FRDA patients. Aim of the present pilot study was to investigate mitochondrial metabolism of skeletal muscle tissue in FRDA patients and examine effects of rhuEPO administration by phosphorus 31 magnetic resonance spectroscopy (31P MRS. Seven genetically confirmed FRDA patients underwent 31P MRS of the calf muscles using a rest-exercise-recovery protocol before and after receiving 3000 IU of rhuEPO for eight weeks. FRDA patients showed more rapid phosphocreatine (PCr depletion and increased accumulation of inorganic phosphate (Pi during incremental exercise as compared to controls. After maximal exhaustive exercise prolonged regeneration of PCR and slowed decline in Pi can be seen in FRDA. PCr regeneration as hallmark of mitochondrial ATP production revealed correlation to activity of complex II/III of the respiratory chain and to demographic values. PCr and Pi kinetics were not influenced by rhuEPO administration. Our results confirm mitochondrial dysfunction and exercise intolerance due to impaired oxidative phosphorylation in skeletal muscle tissue of FRDA patients. MRS did not show improved mitochondrial bioenergetics after eight weeks of rhuEPO exposition in skeletal muscle tissue of FRDA patients.EU Clinical Trials Register2008-000040-13.

Perturbed desmosomal cadherin expression in grainy head-like 1-null mice.

Science.gov (United States)

Wilanowski, Tomasz; Caddy, Jacinta; Ting, Stephen B; Hislop, Nikki R; Cerruti, Loretta; Auden, Alana; Zhao, Lin-Lin; Asquith, Stephen; Ellis, Sarah; Sinclair, Rodney; Cunningham, John M; Jane, Stephen M

2008-03-19

In Drosophila, the grainy head (grh) gene plays a range of key developmental roles through the regulation of members of the cadherin gene family. We now report that mice lacking the grh homologue grainy head-like 1 (Grhl1) exhibit hair and skin phenotypes consistent with a reduction in expression of the genes encoding the desmosomal cadherin, desmoglein 1 (Dsg1). Grhl1-null mice show an initial delay in coat growth, and older mice exhibit hair loss as a result of poor anchoring of the hair shaft in the follicle. The mice also develop palmoplantar keratoderma, analogous to humans with DSG1 mutations. Sequence analysis, DNA binding, and chromatin immunoprecipitation experiments demonstrate that the human and mouse Dsg1 promoters are direct targets of GRHL1. Ultrastructural analysis reveals reduced numbers of abnormal desmosomes in the interfollicular epidermis. These findings establish GRHL1 as an important regulator of the Dsg1 genes in the context of hair anchorage and epidermal differentiation, and suggest that cadherin family genes are key targets of the grainy head-like genes across 700 million years of evolution.

Hyper-radiation sensitivity of murine scid mutation and mapping of the human homologue HYRC1 gene

International Nuclear Information System (INIS)

Komatsu, Kenshi; Ohta, Tohru; Niikawa, Norio; Okumura, Yutaka; Kubota, Nobuo.

1994-01-01

The murine severe combined immunodeficient mutation (scid) is characterized by a lack of both B and T cells, due to a defect in lymphoid variable-(diversity)-joining(V(D)J) rearrangement. Scid cells are highly sensitive to both radiation-induced killing and chromosomal aberrations. Present experiments also demonstrated the high sensitivity of scid cells to killing, because of a deficient repair of double strand breaks(DSB). Scid cells can repair only 60% of radiation-induced DSB for 3 hours, while normal cells repair 85% of the DSB. Significantly reduced Do and n values were obtained from survival curves of scid cells and were similar to ataxia-telangiectasia(AT) cells (a unique human disease conferring whole body radiosensitivity). However, the kinetics of DNA synthesis after irradiation were different between the two cell types. In contrast with the radioresistant DNA synthesis of AT cells, DNA synthesis of scid cells was markedly inhibited after irradiation. The existence of different mutations was also supported by evidence of complementation in somatic cell hybrids between scid cells and AT cells. Using these hybrid cells, fragments of human chromosome 8 were introduced into scid cells HPRT mutant via X-irradiation and somatic cell fusion. The resulting hybrid clones contained human DNA fragment(s) which complemented the hyper-radiosensitivity of the scid cells. Alu-PCR products from these hybrids were used for chromosome painting using the technique of chromosome in situ suppression hybridization, allowing assignment of the human HYRC1 (hyper-radiosensitivity of murine scid mutation, complementing 1) gene, a candidate for a V(D)J recombinant gene, to human chromosome 8q11. (author)

MS4a4B, a CD20 homologue in T cells, inhibits T cell propagation by modulation of cell cycle.

Directory of Open Access Journals (Sweden)

Hui Xu

2010-11-01

Full Text Available MS4a4B, a CD20 homologue in T cells, is a novel member of the MS4A gene family in mice. The MS4A family includes CD20, FcεRIβ, HTm4 and at least 26 novel members that are characterized by their structural features: with four membrane-spanning domains, two extracellular domains and two cytoplasmic regions. CD20, FcεRIβ and HTm4 have been found to function in B cells, mast cells and hematopoietic cells respectively. However, little is known about the function of MS4a4B in T cell regulation. We demonstrate here that MS4a4B negatively regulates mouse T cell proliferation. MS4a4B is highly expressed in primary T cells, natural killer cells (NK and some T cell lines. But its expression in all malignant T cells, including thymoma and T hybridoma tested, was silenced. Interestingly, its expression was regulated during T cell activation. Viral vector-driven overexpression of MS4a4B in primary T cells and EL4 thymoma cells reduced cell proliferation. In contrast, knockdown of MS4a4B accelerated T cell proliferation. Cell cycle analysis showed that MS4a4B regulated T cell proliferation by inhibiting entry of the cells into S-G2/M phase. MS4a4B-mediated inhibition of cell cycle was correlated with upregulation of Cdk inhibitory proteins and decreased levels of Cdk2 activity, subsequently leading to inhibition of cell cycle progression. Our data indicate that MS4a4B negatively regulates T cell proliferation. MS4a4B, therefore, may serve as a modulator in the negative-feedback regulatory loop of activated T cells.

MS4a4B, a CD20 homologue in T cells, inhibits T cell propagation by modulation of cell cycle.

Science.gov (United States)

Xu, Hui; Yan, Yaping; Williams, Mark S; Carey, Gregory B; Yang, Jingxian; Li, Hongmei; Zhang, Guang-Xian; Rostami, Abdolmohamad

2010-11-01

MS4a4B, a CD20 homologue in T cells, is a novel member of the MS4A gene family in mice. The MS4A family includes CD20, FcεRIβ, HTm4 and at least 26 novel members that are characterized by their structural features: with four membrane-spanning domains, two extracellular domains and two cytoplasmic regions. CD20, FcεRIβ and HTm4 have been found to function in B cells, mast cells and hematopoietic cells respectively. However, little is known about the function of MS4a4B in T cell regulation. We demonstrate here that MS4a4B negatively regulates mouse T cell proliferation. MS4a4B is highly expressed in primary T cells, natural killer cells (NK) and some T cell lines. But its expression in all malignant T cells, including thymoma and T hybridoma tested, was silenced. Interestingly, its expression was regulated during T cell activation. Viral vector-driven overexpression of MS4a4B in primary T cells and EL4 thymoma cells reduced cell proliferation. In contrast, knockdown of MS4a4B accelerated T cell proliferation. Cell cycle analysis showed that MS4a4B regulated T cell proliferation by inhibiting entry of the cells into S-G2/M phase. MS4a4B-mediated inhibition of cell cycle was correlated with upregulation of Cdk inhibitory proteins and decreased levels of Cdk2 activity, subsequently leading to inhibition of cell cycle progression. Our data indicate that MS4a4B negatively regulates T cell proliferation. MS4a4B, therefore, may serve as a modulator in the negative-feedback regulatory loop of activated T cells.

Comparative analysis of the ternary complex factors Elk-1, SAP-1a and SAP-2 (ERP/NET).

Science.gov (United States)

Price, M A; Rogers, A E; Treisman, R

1995-06-01

A transcription factor ternary complex composed of Serum Response Factor (SRF) and Ternary Complex Factor (TCF) mediates the response of the c-fos Serum Response Element (SRE) to growth factors and mitogens. Three Ets domain proteins, Elk-1, SAP-1 and ERP/NET, have been reported to have the properties of TCF. Here we compare Elk-1 and SAP-1a with the human ERP/NET homologue SAP-2. All three TCF RNAs are ubiquitously expressed at similar relative levels. All three proteins contain conserved regions that interact with SRF and the c-fos SRE with comparable efficiency, but in vitro complex formation by SAP-2 is strongly inhibited by its C-terminal sequences. Similarly, only Elk-1 and SAP-1a efficiently bind the c-fos SRE in vivo; ternary complex formation by SAP-2 is weak and is substantially unaffected by serum stimulation or v-ras co-expression. All three TCFs contain C-terminal transcriptional activation domains that are phosphorylated following growth factor stimulation. Activation requires conserved S/T-P motifs found in all the TCF family members. Each TCF activation domain can be phosphorylated in vitro by partially purified ERK2, and ERK activation in vivo is sufficient to potentiate transcriptional activation.

Requirement of Xmsx-1 in the BMP-triggered ventralization of Xenopus embryos.

Science.gov (United States)

Yamamoto, T S; Takagi, C; Ueno, N

2000-03-01

Signaling triggered by polypeptide growth factors leads to the activation of their target genes. Several homeobox genes are known to be induced in response to polypeptide growth factors in early Xenopus development. In particular, Xmsx-1, an amphibian homologue of vertebrate Msx-1, is well characterized as a target gene of bone morphogenetic protein (BMP). Here, using a dominant-negative form of Xmsx-1 (VP-Xmsx-1), which is a fusion protein made with the virus-derived VP16 activation domain, we have examined whether Xmsx-1 activity is required in the endogenous ventralizing pathway. VP-Xmsx-1 induced a secondary body axis, complete with muscle and neural tissues, when overexpressed in ventral blastomeres, suggesting that Xmsx-1 activity is necessary for both mesoderm and ectoderm to be ventralized. We have also examined the epistatic relationship between Xmsx-1 and another ventralizing homeobox protein, Xvent-1, and show that Xmsx-1 is likely to be acting upstream of Xvent-1. We propose that Xmsx-1 is required in the BMP-stimulated ventralization pathway that involves the downstream activation of Xvent-1.

Homologue expression of a fungal endo-1,4-β-D- xylanase using ...

African Journals Online (AJOL)

Jane

2011-03-07

Mar 7, 2011 ... Hemicellulose is the second source of renewable organic carbon on earth, with a high potential for the recovery of ... SSF, solid-state fermentation; XE, xylanase extract. .... Active fractions were pooled, concentrated and.

Plant 115-kDa actin-filament bundling protein, P-115-ABP, is a homologue of plant villin and is widely distributed in cells.

Science.gov (United States)

Yokota, Etsuo; Vidali, Luis; Tominaga, Motoki; Tahara, Hiroshi; Orii, Hidefumi; Morizane, Yosuke; Hepler, Peter K; Shimmen, Teruo

2003-10-01

In many cases, actin filaments are arranged into bundles and serve as tracks for cytoplasmic streaming in plant cells. We have isolated an actin-filament bundling protein, which is composed of 115-kDa polypeptide (P-115-ABP), from the germinating pollen of lily, Lilium longiflorum [Nakayasu et al. (1998) BIOCHEM: Biophys. Res. Commun. 249: 61]. P-115-ABP shared similar antigenicity with a plant 135-kDa actin-filament bundling protein (P-135-ABP), a plant homologue of villin. A full-length cDNA clone (ABP115; accession no. AB097407) was isolated from an expression cDNA library of lily pollen by immuno-screening using antisera against P-115-ABP and P-135-ABP. The amino acid sequence of P-115-ABP deduced from this clone showed high homology with those of P-135-ABP and four villin isoforms of Arabidopsis thaliana (AtVLN1, AtVLN2, AtVLN3 and AtVLN4), especially AtVLN4, indicating that P-115-ABP can also be classified as a plant villin. The P-115-ABP isolated biochemically from the germinating lily pollen was able to arrange F-actin filaments with uniform polarity into bundles and this bundling activity was suppressed by Ca2+-calmodulin (CaM), similar to the actin-filament bundling properties of P-135-ABP. The P-115-ABP type of plant villin was widely distributed in plant cells, from algae to land plants. In root hair cells of Hydrocharis dubia, this type of plant villin was co-localized with actin-filament bundles in the transvacuolar strands and the sub-cortical regions. Microinjection of the antiserum against P-115-ABP into living root hair cells caused the disappearance of transvaculor strands and alteration of the route of cytoplasmic streaming. In internodal cells of Chara corallina in which the P-135-ABP type of plant villin is lacking, the P-115-ABP type showed co-localization with actin-filament cables anchored on the intracellular surface of chloroplasts. These results indicated that plant villins are widely distributed and involved in the organization of actin

NHE1 inhibition by amiloride- and benzoylguanidine-type compounds. Inhibitor binding loci deduced from chimeras of NHE1 homologues with endogenous differences in inhibitor sensitivity

DEFF Research Database (Denmark)

Pedersen, Stine F; King, Scott A; Nygaard, Eva B

2007-01-01

NHE1). Although highly homologous to the amiloride- and HOE-sensitive human NHE1 (hNHE1), AtNHE1 is insensitive to HOE-type and PaNHE1 to both amiloride- and HOE-type compounds. Here we generated chimeras to "knock in" amiloride and HOE sensitivity to PaNHE1, and we thereby identified several NHE1...

DOT1L and H3K79 Methylation in Transcription and Genomic Stability.

Science.gov (United States)

Wood, Katherine; Tellier, Michael; Murphy, Shona

2018-02-27

The organization of eukaryotic genomes into chromatin provides challenges for the cell to accomplish basic cellular functions, such as transcription, DNA replication and repair of DNA damage. Accordingly, a range of proteins modify and/or read chromatin states to regulate access to chromosomal DNA. Yeast Dot1 and the mammalian homologue DOT1L are methyltransferases that can add up to three methyl groups to histone H3 lysine 79 (H3K79). H3K79 methylation is implicated in several processes, including transcription elongation by RNA polymerase II, the DNA damage response and cell cycle checkpoint activation. DOT1L is also an important drug target for treatment of mixed lineage leukemia (MLL)-rearranged leukemia where aberrant transcriptional activation is promoted by DOT1L mislocalisation. This review summarizes what is currently known about the role of Dot1/DOT1L and H3K79 methylation in transcription and genomic stability.

DOT1L and H3K79 Methylation in Transcription and Genomic Stability

Directory of Open Access Journals (Sweden)

Katherine Wood

2018-02-01

Full Text Available The organization of eukaryotic genomes into chromatin provides challenges for the cell to accomplish basic cellular functions, such as transcription, DNA replication and repair of DNA damage. Accordingly, a range of proteins modify and/or read chromatin states to regulate access to chromosomal DNA. Yeast Dot1 and the mammalian homologue DOT1L are methyltransferases that can add up to three methyl groups to histone H3 lysine 79 (H3K79. H3K79 methylation is implicated in several processes, including transcription elongation by RNA polymerase II, the DNA damage response and cell cycle checkpoint activation. DOT1L is also an important drug target for treatment of mixed lineage leukemia (MLL-rearranged leukemia where aberrant transcriptional activation is promoted by DOT1L mislocalisation. This review summarizes what is currently known about the role of Dot1/DOT1L and H3K79 methylation in transcription and genomic stability.

Induction of lethal mutations in the x-chromosome of unirradiated Drosophila oocytes after fertilization by irradiated spermatozoa

International Nuclear Information System (INIS)

Shaposhnikov, M.V.; Zainullin, V.G.

2003-01-01

Full text: In primary study on Drosophila it was found that irradiated male X-chromosomes induce recessive lethals in unirradiated female homologues (Abeleva et al., 1961, Radiobiologya. 1:123-126). The same effects were obtained in Drosophila in some recent investigations. The mechanisms of these effects is unknown. However it may be responsible for low-dose radiation effects as it induce mutations in unirradiated DNA. We assume that this effect may be a result of activation of error prone repair in response to preliminary DNA lesions in irradiated chromosome. In this research we analyse the frequencies of the recessive lethal mutations in the X-chromosome of Drosophila females mated with irradiated Basc males. We used acute irradiation with a dose rate of 10 Gy. For testing our hypothesis we use the mus209 and mei-41 mutant females. Mus209 is a PCNA gene homologue and mei-41 is a homologue of ATM gene. These genes are involved in post-replication DNA repair which may be error prone repair in Drosophila. It was obtained the tendency to decreasing the mutation rate at the mei-41[D5] background and decreasing mutation rate in mus209[B1] background in comparison with wild type strains CS (p<0.05). The obtained results demonstrate the possible role of mus209[B1] and mei-41[D5] genes in the inducing of mutations in the unirradiated X-chromosome in the presence of irradiated homologue

Scandium interaction with diantipyrylmethane homologues and 2-(n-sulphophenylazo)-1,8-dihydroxynaphthalene-3,6 sodium disulphonate

Energy Technology Data Exchange (ETDEWEB)

Ganago, L I; Alinovskaya, L A [AN Belorusskoj SSR, Minsk. Inst. Fiziki Tverdogo Tela i Poluprovodnikov

1979-01-01

The reactions of scandium with homologs of diantipyrilmethane (DAM)-propyldiantipyrilmethane (PDAM) and phenyldiantipyrilmethane (PhDAM) - are studied. The relationship of components in the complexes formed is found, and chemism of their formation is established. The complexes Sc-SPADNE (sodium salt 2-(n-sulphophenylazo)-1,8-dioxynaphthalene-3,6-disulphonic acid) are shown to form within a wide pH range. The maximum yield of complexes is observed at 6.0-7.5 pH. By the ion-exchange method the anion character of heteroligand scandium complexes is established. The complex Sc-SPADNE-PDAM is faster as compared with the complexes Sc-SPADNE-DAM and Sc-SPADNE-PhDAM. The decrease in amine excess and increase in the sensitivity of heteroligand formation of the complexes of scandium with SPADNE and PDAM make them better suited for analysis. The technique is developed for the determination of Sc/sub 2/O/sub 3/ in perovskites using the complete differential spectrophotometry method.

Role of Arabidopsis ABF1/3/4 during det1 germination in salt and osmotic stress conditions.

Science.gov (United States)

Fernando, V C Dilukshi; Al Khateeb, Wesam; Belmonte, Mark F; Schroeder, Dana F

2018-05-01

Arabidopsis det1 mutants exhibit salt and osmotic stress resistant germination. This phenotype requires HY5, ABF1, ABF3, and ABF4. While DE-ETIOLATED 1 (DET1) is well known as a negative regulator of light development, here we describe how det1 mutants also exhibit altered responses to salt and osmotic stress, specifically salt and mannitol resistant germination. LONG HYPOCOTYL 5 (HY5) positively regulates both light and abscisic acid (ABA) signalling. We found that hy5 suppressed the det1 salt and mannitol resistant germination phenotype, thus, det1 stress resistant germination requires HY5. We then queried publically available microarray datasets to identify genes downstream of HY5 that were differentially expressed in det1 mutants. Our analysis revealed that ABA regulated genes, including ABA RESPONSIVE ELEMENT BINDING FACTOR 3 (ABF3), are downregulated in det1 seedlings. We found that ABF3 is induced by salt in wildtype seeds, while homologues ABF4 and ABF1 are repressed, and all three genes are underexpressed in det1 seeds. We then investigated the role of ABF3, ABF4, and ABF1 in det1 phenotypes. Double mutant analysis showed that abf3, abf4, and abf1 all suppress the det1 salt/osmotic stress resistant germination phenotype. In addition, abf1 suppressed det1 rapid water loss and open stomata phenotypes. Thus interactions between ABF genes contribute to det1 salt/osmotic stress response phenotypes.

The final story on the ALA3/ALIS1 complex

DEFF Research Database (Denmark)

Lopez Marques, Rosa Laura

The final story on the ALA3/ALIS1 complex. Lisbeth R. Poulsena, Rosa L. López-Marquésa, Alexander Schultza, Stephen C. McDowellb, Juha Okkeric, Dirk Lichtc, Thomas Pomorskic,  Jeffrey F. Harperb, and Michael G. Palmgrena,1 aCentre for Membrane Pumps in Cells and Disease - PUMPKIN, Danish National......).              Through a database search we have previously identified five Cdc50p/Lem3p homologues in Arabidopsis (ALIS1-5 for ALA Interacting Subunit)..We investigated the capacity of ALA3, alone and in combination with expressed ALIS proteins, to functionally complement a battery of yeast mutants carrying deletions...... in endogenous P4-ATPases. Our results indicated that ALIS1 functions as a true ß-subunit for the Arabidopsis putative flippase ALA3, being required for ATP-dependent phospholipid transport and for genetic complementation of the yeast P4-ATPase gene Drs2, which is involved in vesicle budding from the late Golgi...

Jasmonate signalling in Arabidopsis involves SGT1b-HSP70-HSP90 chaperone complexes.

Science.gov (United States)

Zhang, Xue-Cheng; Millet, Yves A; Cheng, Zhenyu; Bush, Jenifer; Ausubel, Frederick M

Plant hormones play pivotal roles in growth, development and stress responses. Although it is essential to our understanding of hormone signalling, how plants maintain a steady state level of hormone receptors is poorly understood. We show that mutation of the Arabidopsis thaliana co-chaperone SGT1b impairs responses to the plant hormones jasmonate, auxin and gibberellic acid, but not brassinolide and abscisic acid, and that SGT1b and its homologue SGT1a are involved in maintaining the steady state levels of the F-box proteins COI1 and TIR1, receptors for jasmonate and auxin, respectively. The association of SGT1b with COI1 is direct and is independent of the Arabidopsis SKP1 protein, ASK1. We further show that COI1 is a client protein of SGT1b-HSP70-HSP90 chaperone complexes and that the complexes function in hormone signalling by stabilizing the COI1 protein. This study extends the SGT1b-HSP90 client protein list and broadens the functional scope of SGT1b-HSP70-HSP90 chaperone complexes.

Phytophthora capsici homologue of the cell cycle regulator SDA1 is required for sporangial morphology, mycelial growth and plant infection.

Science.gov (United States)

Zhu, Chunyuan; Yang, Xiaoyan; Lv, Rongfei; Li, Zhuang; Ding, Xiaomeng; Tyler, Brett M; Zhang, Xiuguo

2016-04-01

SDA1 encodes a highly conserved protein that is widely distributed in eukaryotic organisms. SDA1 is essential for cell cycle progression and organization of the actin cytoskeleton in yeasts and humans. In this study, we identified a Phytophthora capsici orthologue of yeast SDA1, named PcSDA1. In P. capsici, PcSDA1 is strongly expressed in three asexual developmental states (mycelium, sporangia and germinating cysts), as well as late in infection. Silencing or overexpression of PcSDA1 in P. capsici transformants affected the growth of hyphae and sporangiophores, sporangial development, cyst germination and zoospore release. Phalloidin staining confirmed that PcSDA1 is required for organization of the actin cytoskeleton. Moreover, 4',6-diamidino-2-phenylindole (DAPI) staining and PcSDA1-green fluorescent protein (GFP) fusions revealed that PcSDA1 is involved in the regulation of nuclear distribution in hyphae and sporangia. Both silenced and overexpression transformants showed severely diminished virulence. Thus, our results suggest that PcSDA1 plays a similar role in the regulation of the actin cytoskeleton and nuclear division in this filamentous organism as in non-filamentous yeasts and human cells. © 2015 BSPP and John Wiley & Sons Ltd.

HIPK1 interacts with c-Myb and modulates its activity through phosphorylation

International Nuclear Information System (INIS)

Matre, Vilborg; Nordgard, Oddmund; Alm-Kristiansen, Anne Hege; Ledsaak, Marit; Gabrielsen, Odd Stokke

2009-01-01

The transcription factor v-Myb is a potent inducer of myeloid leukaemias, and its cellular homologue c-Myb plays a crucial role in the regulation of haematopoiesis. In a yeast two-hybrid (Y2H) screening we identified the nuclear kinase HIPK1 as an interaction partner for human c-Myb. The interaction involves a C-terminal region of HIPK1, while a bipartite interaction surface was identified in c-Myb, including regions in its N-terminal DNA-binding domain as well as in its C-terminal region. HIPK1 and c-Myb co-localize in distinct nuclear foci upon co-transfection. c-Myb appears to be phosphorylated by HIPK1 in its negative regulatory domain as supported by both in vivo and in vitro data. A functional assay revealed that HIPK1 repressed the ability of c-Myb to activate a chromatin embedded target gene, mim-1, in haematopoetic cells. Our findings point to a novel link between an important kinase and a key regulator of haematopoiesis.

Dpb11/TopBP1 plays distinct roles in DNA replication, checkpoint response and homologous recombination

DEFF Research Database (Denmark)

Germann, Susanne Manuela; Østergaard, Vibe Hallundbæk; Haas, Caroline

2011-01-01

DPB11/TopBP1 is an essential evolutionarily conserved gene involved in initiation of DNA replication and checkpoint signaling. Here, we show that Saccharomyces cerevisiae Dpb11 forms nuclear foci that localize to sites of DNA damage in G1, S and G2 phase, a recruitment that is conserved for its...... and Tel1, and of the checkpoint mediator Rad9. In a site-directed mutagenesis screen, we identify a separation-of-function mutant, dpb11-PF, that is sensitive to DSB-inducing agents yet remains proficient for DNA replication and the S-phase checkpoint at the permissive temperature. The dpb11-PF mutant...... homologue TopBP1 in Gallus gallus. Damage-induced Dpb11 foci are distinct from Sld3 replication initiation foci. Further, Dpb11 foci are dependent on the checkpoint proteins Mec3 (9-1-1 complex) and Rad24, and require the C-terminal domain of Dpb11. Dpb11 foci are independent of the checkpoint kinases Mec1...

Resveratrol Reactivates Latent HIV through Increasing Histone Acetylation and Activating Heat Shock Factor 1.

Science.gov (United States)

Zeng, Xiaoyun; Pan, Xiaoyan; Xu, Xinfeng; Lin, Jian; Que, Fuchang; Tian, Yuanxin; Li, Lin; Liu, Shuwen

2017-06-07

The persistence of latent HIV reservoirs presents a significant challenge to viral eradication. Effective latency reversing agents (LRAs) based on "shock and kill" strategy are urgently needed. The natural phytoalexin resveratrol has been demonstrated to enhance HIV gene expression, although its mechanism remains unclear. In this study, we demonstrated that resveratrol was able to reactivate latent HIV without global T cell activation in vitro. Mode of action studies showed resveratrol-mediated reactivation from latency did not involve the activation of silent mating type information regulation 2 homologue 1 (SIRT1), which belonged to class-3 histone deacetylase (HDAC). However, latent HIV was reactivated by resveratrol mediated through increasing histone acetylation and activation of heat shock factor 1 (HSF1). Additionally, synergistic activation of the latent HIV reservoirs was observed under cotreatment with resveratrol and conventional LRAs. Collectively, this research reveals that resveratrol is a natural LRA and shows promise for HIV therapy.

The Hsk1(Cdc7) replication kinase regulates origin efficiency.

Science.gov (United States)

Patel, Prasanta K; Kommajosyula, Naveen; Rosebrock, Adam; Bensimon, Aaron; Leatherwood, Janet; Bechhoefer, John; Rhind, Nicholas

2008-12-01

Origins of DNA replication are generally inefficient, with most firing in fewer than half of cell cycles. However, neither the mechanism nor the importance of the regulation of origin efficiency is clear. In fission yeast, origin firing is stochastic, leading us to hypothesize that origin inefficiency and stochasticity are the result of a diffusible, rate-limiting activator. We show that the Hsk1-Dfp1 replication kinase (the fission yeast Cdc7-Dbf4 homologue) plays such a role. Increasing or decreasing Hsk1-Dfp1 levels correspondingly increases or decreases origin efficiency. Furthermore, tethering Hsk1-Dfp1 near an origin increases the efficiency of that origin, suggesting that the effective local concentration of Hsk1-Dfp1 regulates origin firing. Using photobleaching, we show that Hsk1-Dfp1 is freely diffusible in the nucleus. These results support a model in which the accessibility of replication origins to Hsk1-Dfp1 regulates origin efficiency and provides a potential mechanistic link between chromatin structure and replication timing. By manipulating Hsk1-Dfp1 levels, we show that increasing or decreasing origin firing rates leads to an increase in genomic instability, demonstrating the biological importance of appropriate origin efficiency.

The Hsk1(Cdc7) Replication Kinase Regulates Origin Efficiency

Science.gov (United States)

Patel, Prasanta K.; Kommajosyula, Naveen; Rosebrock, Adam; Bensimon, Aaron; Leatherwood, Janet; Bechhoefer, John

2008-01-01

Origins of DNA replication are generally inefficient, with most firing in fewer than half of cell cycles. However, neither the mechanism nor the importance of the regulation of origin efficiency is clear. In fission yeast, origin firing is stochastic, leading us to hypothesize that origin inefficiency and stochasticity are the result of a diffusible, rate-limiting activator. We show that the Hsk1-Dfp1 replication kinase (the fission yeast Cdc7-Dbf4 homologue) plays such a role. Increasing or decreasing Hsk1-Dfp1 levels correspondingly increases or decreases origin efficiency. Furthermore, tethering Hsk1-Dfp1 near an origin increases the efficiency of that origin, suggesting that the effective local concentration of Hsk1-Dfp1 regulates origin firing. Using photobleaching, we show that Hsk1-Dfp1 is freely diffusible in the nucleus. These results support a model in which the accessibility of replication origins to Hsk1-Dfp1 regulates origin efficiency and provides a potential mechanistic link between chromatin structure and replication timing. By manipulating Hsk1-Dfp1 levels, we show that increasing or decreasing origin firing rates leads to an increase in genomic instability, demonstrating the biological importance of appropriate origin efficiency. PMID:18799612

Homozygous missense mutation (G56R in glycosylphosphatidylinositol-anchored high-density lipoprotein-binding protein 1 (GPI-HBP1 in two siblings with fasting chylomicronemia (MIM 144650

Directory of Open Access Journals (Sweden)

Hegele Robert A

2007-09-01

Full Text Available Abstract Background Mice with a deleted Gpihbp1 gene encoding glycosylphosphatidylinositol-anchored high-density lipoprotein-binding protein 1 (GPI-HBP1 develop severe chylomicronemia. We screened the coding regions of the human homologue – GPIHBP1 – from the genomic DNA of 160 unrelated adults with fasting chylomicronemia and plasma triglycerides >10 mmol/L, each of whom had normal sequence of the LPL and APOC2 genes. Results One patient with severe type 5 hyperlipoproteinemia (MIM 144650, fasting chylomicronemia and relapsing pancreatitis resistant to standard therapy was found to be homozygous for a novel GPIHBP1 missense variant, namely G56R. This mutation was absent from the genomes of 600 control subjects and 610 patients with hyperlipidemia. The GPIHBP1 G56 residue has been conserved throughout evolution and the G56R mutation was predicted to have compromised function. Her homozygous brother also had refractory chylomicronemia and relapsing pancreatitis together with early coronary heart disease. G56R heterozygotes in the family had fasting mild hypertriglyceridemia. Conclusion Thus, a very rare GPIHBP1 missense mutation appears to be associated with severe hypertriglyceridemia and chylomicronemia.

Protein Kinase R Degradation Is Essential for Rift Valley Fever Virus Infection and Is Regulated by SKP1-CUL1-F-box (SCF)FBXW11-NSs E3 Ligase.

Science.gov (United States)

Mudhasani, Rajini; Tran, Julie P; Retterer, Cary; Kota, Krishna P; Whitehouse, Chris A; Bavari, Sina

2016-02-01

Activated protein kinase R (PKR) plays a vital role in antiviral defense primarily by inhibiting protein synthesis and augmenting interferon responses. Many viral proteins have adopted unique strategies to counteract the deleterious effects of PKR. The NSs (Non-structural s) protein which is encoded by Rift Valley fever virus (RVFV) promotes early PKR proteasomal degradation through a previously undefined mechanism. In this study, we demonstrate that NSs carries out this activity by assembling the SCF (SKP1-CUL1-F-box)(FBXW11) E3 ligase. NSs binds to the F-box protein, FBXW11, via the six amino acid sequence DDGFVE called the degron sequence and recruits PKR through an alternate binding site to the SCF(FBXW11) E3 ligase. We further show that disrupting the assembly of the SCF(FBXW11-NSs) E3 ligase with MLN4924 (a small molecule inhibitor of SCF E3 ligase activity) or NSs degron viral mutants or siRNA knockdown of FBXW11 can block PKR degradation. Surprisingly, under these conditions when PKR degradation was blocked, NSs was essential and sufficient to activate PKR causing potent inhibition of RVFV infection by suppressing viral protein synthesis. These antiviral effects were antagonized by the loss of PKR expression or with a NSs deleted mutant virus. Therefore, early PKR activation by disassembly of SCF(FBXW11-NSs) E3 ligase is sufficient to inhibit RVFV infection. Furthermore, FBXW11 and BTRC are the two homologues of the βTrCP (Beta-transducin repeat containing protein) gene that were previously described to be functionally redundant. However, in RVFV infection, among the two homologues of βTrCP, FBXW11 plays a dominant role in PKR degradation and is the limiting factor in the assembly of the SCF(FBXW11) complex. Thus, FBXW11 serves as a master regulator of RVFV infection by promoting PKR degradation. Overall these findings provide new insights into NSs regulation of PKR activity and offer potential opportunities for therapeutic intervention of RVFV infection.

Recombination at DNA replication fork barriers is not universal and is differentially regulated by Swi1.

Science.gov (United States)

Pryce, David W; Ramayah, Soshila; Jaendling, Alessa; McFarlane, Ramsay J

2009-03-24

DNA replication stress has been implicated in the etiology of genetic diseases, including cancers. It has been proposed that genomic sites that inhibit or slow DNA replication fork progression possess recombination hotspot activity and can form potential fragile sites. Here we used the fission yeast, Schizosaccharomyces pombe, to demonstrate that hotspot activity is not a universal feature of replication fork barriers (RFBs), and we propose that most sites within the genome that form RFBs do not have recombination hotspot activity under nonstressed conditions. We further demonstrate that Swi1, the TIMELESS homologue, differentially controls the recombination potential of RFBs, switching between being a suppressor and an activator of recombination in a site-specific fashion.

Structure of a hexameric form of RadA recombinase from Methanococcus voltae

International Nuclear Information System (INIS)

Du, Liqin; Luo, Yu

2012-01-01

Hexameric rings of RadA recombinase from M. voltae have been crystallized. Structural comparisons suggest that homologues of RadA tend to form double-ringed assemblies. Archaeal RadA proteins are close homologues of eukaryal Rad51 and DMC1 proteins and are remote homologues of bacterial RecA proteins. For the repair of double-stranded breaks in DNA, these recombinases promote a pivotal strand-exchange reaction between homologous single-stranded and double-stranded DNA substrates. This DNA-repair function also plays a key role in the resistance of cancer cells to chemotherapy and radiotherapy and in the resistance of bacterial cells to antibiotics. A hexameric form of a truncated Methanococcus voltae RadA protein devoid of its small N-terminal domain has been crystallized. The RadA hexamers further assemble into two-ringed assemblies. Similar assemblies can be observed in the crystals of Pyrococcus furiosus RadA and Homo sapiens DMC1. In all of these two-ringed assemblies the DNA-interacting L1 region of each protomer points inward towards the centre, creating a highly positively charged locus. The electrostatic characteristics of the central channels can be utilized in the design of novel recombinase inhibitors

The Hog1p kinase regulates Aft1p transcription factor to control iron accumulation.

Science.gov (United States)

Martins, Telma S; Pereira, Clara; Canadell, David; Vilaça, Rita; Teixeira, Vítor; Moradas-Ferreira, Pedro; de Nadal, Eulàlia; Posas, Francesc; Costa, Vítor

2018-01-01

Iron acquisition systems have to be tightly regulated to assure a continuous supply of iron, since it is essential for survival, but simultaneously to prevent iron overload that is toxic to the cells. In budding yeast, the low‑iron sensing transcription factor Aft1p is a master regulator of the iron regulon. Our previous work revealed that bioactive sphingolipids modulate iron homeostasis as yeast cells lacking the sphingomyelinase Isc1p exhibit an upregulation of the iron regulon. In this study, we show that Isc1p impacts on iron accumulation and localization. Notably, Aft1p is activated in isc1Δ cells due to a decrease in its phosphorylation and an increase in its nuclear levels. Consistently, the expression of a phosphomimetic version of Aft1p-S210/S224 that favours its nuclear export abolished iron accumulation in isc1Δ cells. Notably, the Hog1p kinase, homologue of mammalian p38, interacts with and directly phosphorylates Aft1p at residues S210 and S224. However, Hog1p-Aft1p interaction decreases in isc1Δ cells, which likely contributes to Aft1p dephosphorylation and consequently to Aft1p activation and iron overload in isc1Δ cells. These results suggest that alterations in sphingolipid composition in isc1Δ cells may impact on iron homeostasis by disturbing the regulation of Aft1p by Hog1p. To our knowledge, Hog1p is the first kinase reported to directly regulate Aft1p, impacting on iron homeostasis. Copyright © 2017 Elsevier B.V. All rights reserved.

An Epichloë festucae homologue of MOB3, a component of the STRIPAK complex, is required for the establishment of a mutualistic symbiotic interaction with Lolium perenne

Science.gov (United States)

Green, Kimberly A.; Becker, Yvonne; Fitzsimons, Helen L.

2016-01-01

Summary In both Sordaria macrospora and Neurospora crassa, components of the conserved STRIPAK (striatin‐interacting phosphatase and kinase) complex regulate cell–cell fusion, hyphal network development and fruiting body formation. Interestingly, a number of Epichloë festucae genes that are required for hyphal cell–cell fusion, such as noxA, noxR, proA, mpkA and mkkA, are also required for the establishment of a mutualistic symbiotic interaction with Lolium perenne. To determine whether MobC, a homologue of the STRIPAK complex component MOB3 in S. macrospora and N. crassa, is required for E. festucae hyphal fusion and symbiosis, a mobC deletion strain was generated. The ΔmobC mutant showed reduced rates of hyphal cell–cell fusion, formed intrahyphal hyphae and exhibited enhanced conidiation. Plants infected with ΔmobC were severely stunted. Hyphae of ΔmobC showed a proliferative pattern of growth within the leaves of Lolium perenne with increased colonization of the intercellular spaces and vascular bundles. Although hyphae were still able to form expressoria, structures allowing the colonization of the leaf surface, the frequency of formation was significantly reduced. Collectively, these results show that the STRIPAK component MobC is required for the establishment of a mutualistic symbiotic association between E. festucae and L. perenne, and plays an accessory role in the regulation of hyphal cell–cell fusion and expressorium development in E. festucae. PMID:27277141

The Aspergillus fumigatus SchASCH9 kinase modulates SakAHOG1 MAP kinase activity and it is essential for virulence.

Science.gov (United States)

Alves de Castro, Patrícia; Dos Reis, Thaila Fernanda; Dolan, Stephen K; Oliveira Manfiolli, Adriana; Brown, Neil Andrew; Jones, Gary W; Doyle, Sean; Riaño-Pachón, Diego M; Squina, Fábio Márcio; Caldana, Camila; Singh, Ashutosh; Del Poeta, Maurizio; Hagiwara, Daisuke; Silva-Rocha, Rafael; Goldman, Gustavo H

2016-11-01

The serine-threonine kinase TOR, the Target of Rapamycin, is an important regulator of nutrient, energy and stress signaling in eukaryotes. Sch9, a Ser/Thr kinase of AGC family (the cAMP-dependent PKA, cGMP- dependent protein kinase G and phospholipid-dependent protein kinase C family), is a substrate of TOR. Here, we characterized the fungal opportunistic pathogen Aspergillus fumigatus Sch9 homologue (SchA). The schA null mutant was sensitive to rapamycin, high concentrations of calcium, hyperosmotic stress and SchA was involved in iron metabolism. The ΔschA null mutant showed increased phosphorylation of SakA, the A. fumigatus Hog1 homologue. The schA null mutant has increased and decreased trehalose and glycerol accumulation, respectively, suggesting SchA performs different roles for glycerol and trehalose accumulation during osmotic stress. The schA was transcriptionally regulated by osmotic stress and this response was dependent on SakA and MpkC. The double ΔschA ΔsakA and ΔschA ΔmpkC mutants were more sensitive to osmotic stress than the corresponding parental strains. Transcriptomics and proteomics identified direct and indirect targets of SchA post-exposure to hyperosmotic stress. Finally, ΔschA was avirulent in a low dose murine infection model. Our results suggest there is a complex network of interactions amongst the A. fumigatus TOR, SakA and SchA pathways. © 2016 John Wiley & Sons Ltd.

An Epstein-Barr virus anti-apoptotic protein constitutively expressed in transformed cells and implicated in burkitt lymphomagenesis: the Wp/BHRF1 link.

Directory of Open Access Journals (Sweden)

Gemma L Kelly

2009-03-01

Full Text Available Two factors contribute to Burkitt lymphoma (BL pathogenesis, a chromosomal translocation leading to c-myc oncogene deregulation and infection with Epstein-Barr virus (EBV. Although the virus has B cell growth-transforming ability, this may not relate to its role in BL since many of the transforming proteins are not expressed in the tumor. Mounting evidence supports an alternative role, whereby EBV counteracts the high apoptotic sensitivity inherent to the c-myc-driven growth program. In that regard, a subset of BLs carry virus mutants in a novel form of latent infection that provides unusually strong resistance to apoptosis. Uniquely, these virus mutants use Wp (a viral promoter normally activated early in B cell transformation and express a broader-than-usual range of latent antigens. Here, using an inducible system to express the candidate antigens, we show that this marked apoptosis resistance is mediated not by one of the extended range of EBNAs seen in Wp-restricted latency but by Wp-driven expression of the viral bcl2 homologue, BHRF1, a protein usually associated with the virus lytic cycle. Interestingly, this Wp/BHRF1 connection is not confined to Wp-restricted BLs but appears integral to normal B cell transformation by EBV. We find that the BHRF1 gene expression recently reported in newly infected B cells is temporally linked to Wp activation and the presence of W/BHRF1-spliced transcripts. Furthermore, just as Wp activity is never completely eclipsed in in vitro-transformed lines, low-level BHRF1 transcripts remain detectable in these cells long-term. Most importantly, recognition by BHRF1-specific T cells confirms that such lines continue to express the protein independently of any lytic cycle entry. This work therefore provides the first evidence that BHRF1, the EBV bcl2 homologue, is constitutively expressed as a latent protein in growth-transformed cells in vitro and, in the context of Wp-restricted BL, may contribute to virus

Expression of natural human b1,4-GalT1 variants and of non-mammalian homologues in plants leads to differences in galactosylation of N-glycans

NARCIS (Netherlands)

Hesselink, T.; Rouwendal, G.J.A.; Henquet, M.G.L.; Florack, D.E.A.; Helsper, J.P.F.G.; Bosch, H.J.

2014-01-01

b1,4-Galactosylation of plant N-glycans is a prerequisite for commercial production of certain biopharmaceuticals in plants. Two different types of galactosylated N-glycans have initially been reported in plants as the result of expression of human b1,4-galactosyltransferase 1 (GalT). Here we show

In silico molecular modeling of neuraminidase enzyme H1N1 avian influenza virus and docking with zanamivir ligands

Directory of Open Access Journals (Sweden)

Muthiyan Ramachandran

2012-12-01

Full Text Available Objective: Neuraminidase is an enzyme aspartic protease that is essential for the life cycle of H1N1. Methods: Constructed a model of Neuraminidase enzyme the 3D structure as template using with Modeller software. The Neuraminidase enzyme model was predicted and validated by Procheck, What check, Errat, Verify-3D and AutoDock web server for reliability. Results: The Modeller homology-modeling algorithm was demonstrated excellent accuracy in blind predictions. The Neuraminidase enzyme model built with little, 35% identity could be accurate enough to be successfully used in receptor based rational drug design. The closest homologue with the highest sequence identity 100% was selected. Zanamivir drug and analogues were retrieved from PubChem database, as well as subjected to docking interaction with Neuraminidase enzyme used AutoDock programme. Based on the root mean square deviation and lowest binding energy values the best docking orientation was selected. The better lowest binding energy value -6.91 was selected of CID_25209232. Conclusions: This study will be used in broad screening of inhibitors of the protein. However, further implemented experimental and clinical verification is needed to establishment these analogues as drug.

The SCF ubiquitin ligase Slimb controls Nerfin-1 turnover in Drosophila.

Science.gov (United States)

Lin, Xiaohui; Wang, Feng; Li, Yuanpei; Zhai, Chaojun; Wang, Guiping; Zhang, Xiaoting; Gao, Yang; Yi, Tao; Sun, Dan; Wu, Shian

2018-01-01

The C2H2 type zinc-finger transcription factor Nerfin-1 expresses dominantly in Drosophila nervous system and plays an important role in early axon guidance decisions and preventing neurons dedifferentiation. Recently, increasing reports indicated that INSM1 (homologue to nerfin-1 in mammals) is a useful marker for prognosis of neuroendocrine tumors. The dynamic expression of Nerfin-1 is regulated post-transcriptionally by multiple microRNAs; however, its post-translational regulation is still unclear. Here we showed that the protein turnover of Nerfin-1 is regulated by Slimb, the substrate adaptor of SCF Slimb ubiquitin ligase complex. Mechanistically, Slimb associates with Nerfin-1 and promotes it ubiquitination and degradation in Drosophila S2R + cells. Furthermore, we determined that the C-terminal half of Nerfin-1 (Nerfin-1 CT ) is required for its binding to Slimb. Genetic epistasis assays showed that Slimb misexpression antagonizes, while knock-down enhances the activity of Nerfin-1 CT in Drosophila eyes. Our data revealed a new link to understand the underlying mechanism for Nerfin-1 turnover in post-translational level, and provided useful insights in animal development and disease treatment by manipulating the activity of Slimb and Nerfin-1. Copyright © 2017 Elsevier Inc. All rights reserved.

ORF Alignment: NT_033777 [GENIUS II[Archive

Lifescience Database Archive (English)

Full Text Available NT_033777 gi|24648160 >1mc2A 1 134 1 122 2e-29 ... gb|AAB20876.1| ammodytin L=myotoxi...c phospholipase A2 homologue [Vipera ... ammodytes=European viper, Peptide, 123 aa] ... Length

Depletion of GGA1 and GGA3 mediates post-injury elevation of BACE1

Science.gov (United States)

Walker, Kendall R.; Kang, Eugene L.; Whalen, Michael J.; Shen, Yong; Tesco, Giuseppina

2012-01-01

Traumatic brain injury (TBI) is one of the most robust environmental risk factors for Alzheimer’s disease (AD). Compelling evidence is accumulating that a single event of TBI is associated with increased levels of Aβ. However, the underlying molecular mechanisms remain unknown. We report here that the BACE1 interacting protein, GGA3, is depleted while BACE1 levels increase in the acute phase post-injury (48hrs) in a mouse model of TBI. We further demonstrated the role of GGA3 in the regulation of BACE1 in vivo by showing that BACE1 levels are increased in the brain of GGA3 null mice. We next found that head trauma potentiates BACE1 elevation in GGA3 null mice in the acute phase post-TBI and discovered that GGA1, a GGA3 homologue, is a novel caspase-3 substrate depleted at 48 hrs post-TBI. Moreover, GGA1 silencing potentiates BACE1 elevation induced by GGA3 deletion in neurons in vitro indicating that GGA1 and GGA3 synergistically regulate BACE1. Accordingly, we found that levels of both GGA1 and GGA3 are depleted while BACE1 levels are increased in a series of post-mortem AD brains. Finally, we show that GGA3 haploinsufficiency results in sustained elevation of BACE1 and Aβ levels while GGA1 levels are restored in the subacute phase (7 days) post-injury. In conclusion, our data indicate that depletion of GGA1 and GGA3 engender a rapid and robust elevation of BACE1 in the acute phase post-injury. However, the efficient disposal of the acutely accumulated BACE1 solely depends on GGA3 levels in the sub-acute phase of injury. PMID:22836275

The contribution of Nth and Nei DNA glycosylases to mutagenesis in Mycobacterium smegmatis.

Science.gov (United States)

Moolla, Nabiela; Goosens, Vivianne J; Kana, Bavesh D; Gordhan, Bhavna G

2014-01-01

The increased prevalence of drug resistant strains of Mycobacterium tuberculosis (Mtb) indicates that significant mutagenesis occurs during tuberculosis disease in humans. DNA damage by host-derived reactive oxygen/nitrogen species is hypothesized to be critical for the mutagenic process in Mtb thus, highlighting an important role for DNA repair enzymes in maintenance of genome fidelity. Formamidopyrimidine (Fpg/MutM/Fapy) and EndonucleaseVIII (Nei) constitute the Fpg/Nei family of DNA glycosylases and together with EndonucleaseIII (Nth) are central to the base excision repair pathway in bacteria. In this study we assess the contribution of Nei and Nth DNA repair enzymes in Mycobacterium smegmatis (Msm), which retains a single nth homologue and duplications of the Fpg (fpg1 and fpg2) and Nei (nei1 and nei2) homologues. Using an Escherichia coli nth deletion mutant, we confirm the functionality of the mycobacterial nth gene in the base excision repair pathway. Msm mutants lacking nei1, nei2 and nth individually or in combination did not display aberrant growth in broth culture. Deletion of nth individually results in increased UV-induced mutagenesis and combinatorial deletion with the nei homologues results in reduced survival under oxidative stress conditions and an increase in spontaneous mutagenesis to rifampicin. Deletion of nth together with the fpg homolgues did not result in any growth/survival defects or changes in mutation rate. Furthermore, no differential emergence of the common rifampicin resistance conferring genotypes were noted. Collectively, these data confirm a role for Nth in base excision repair in mycobacteria and further highlight a novel interplay between the Nth and Nei homologues in spontaneous mutagenesis. Copyright © 2013 Elsevier B.V. All rights reserved.

Primary structure and functional characterization of a Drosophila dopamine receptor with high homology to human D1/5 receptors.

Science.gov (United States)

Gotzes, F; Balfanz, S; Baumann, A

1994-01-01

Members of the superfamily of G-protein coupled receptors share significant similarities in sequence and transmembrane architecture. We have isolated a Drosophila homologue of the mammalian dopamine receptor family using a low stringency hybridization approach. The deduced amino acid sequence is approximately 70% homologous to the human D1/D5 receptors. When expressed in HEK 293 cells, the Drosophila receptor stimulates cAMP production in response to dopamine application. This effect was mimicked by SKF 38393, a specific D1 receptor agonist, but inhibited by dopaminergic antagonists such as butaclamol and flupentixol. In situ hybridization revealed that the Drosophila dopamine receptor is highly expressed in the somata of the optic lobes. This suggests that the receptor might be involved in the processing of visual information and/or visual learning in invertebrates.

Quantitative determination of allergenic 5-alk(en)ylresorcinols in mango (Mangifera indica L.) peel, pulp, and fruit products by high-performance liquid chromatography.

Science.gov (United States)

Knödler, Matthias; Reisenhauer, Katharina; Schieber, Andreas; Carle, Reinhold

2009-05-13

Despite a number of serious case reports of mango dermatitis, no attempts at the identification and quantification of allergenic 5-alk(en)ylresorcinols in mango fruits have so far been made. Therefore, total alk(en)ylresorcinol content and relative homologue composition in 13 mango peel samples and 7 samples of mango pulp were determined by HPLC and LC-MS/MS analyses. Furthermore, mango puree and nectar prepared on pilot plant scale were also analyzed and compared with commercially available thermally preserved products. Depending on cultivar, alk(en)ylresorcinol contents ranged from 79.3 to 1850.5 mg/kg of dry matter (DM) in mango peels and from 4.9 to 187.3 mg/kg of DM in samples of mango pulp. The profile of alk(en)ylresorcinols was found to be highly characteristic, with an average homologue composition of C15:0 (6.1%), C15:1 (1.7%), C17:0 (1.1%), C17:1 (52.5%), C17:2 (33.4%), C17:3 (2.4%), C19:1 (2.1%), and C19:2 (0.8%). Mango puree samples prepared from peeled and unpeeled fruits revealed contents of 3.8 and 12.3 mg/kg of fresh weight, respectively. Content and homologue composition were not significantly affected during puree processing and thermal preservation. In nectar samples prepared from peeled and unpeeled fruits, contents of 1.4 and 4.6 mg/L, respectively, were found.

Disrupted epithelial/macrophage crosstalk via Spinster homologue 2-mediated S1P signaling may drive defective macrophage phagocytic function in COPD.

Science.gov (United States)

Tran, Hai B; Jersmann, Hubertus; Truong, Tung Thanh; Hamon, Rhys; Roscioli, Eugene; Ween, Miranda; Pitman, Melissa R; Pitson, Stuart M; Hodge, Greg; Reynolds, Paul N; Hodge, Sandra

2017-01-01

We have previously established a link between impaired phagocytic capacity and deregulated S1P signaling in alveolar macrophages from COPD subjects. We hypothesize that this defect may include a disruption of epithelial-macrophage crosstalk via Spns2-mediated intercellular S1P signaling. Primary alveolar macrophages and bronchial epithelial cells from COPD subjects and controls, cell lines, and a mouse model of chronic cigarette smoke exposure were studied. Cells were exposed to 10% cigarette smoke extract, or vehicle control. Spns2 expression and subcellular localization was studied by immunofluorescence, confocal microscopy and RT-PCR. Phagocytosis was assessed by flow-cytometry. Levels of intra- and extracellular S1P were measured by S1P [3H]-labeling. Spns2 expression was significantly increased (pS1P in the airway and that there is a possible disruption of epithelial/macrophage cross talk via Spns2-mediated S1P signaling in COPD and in response to cigarette smoke exposure.

Clinical neurogenetics: friedreich ataxia.

Science.gov (United States)

Collins, Abigail

2013-11-01

Friedreich ataxia is the most common autosomal recessive ataxia. It is a progressive neurodegenerative disorder, typically with onset before 20 years of age. Signs and symptoms include progressive ataxia, ascending weakness and ascending loss of vibration and joint position senses, pes cavus, scoliosis, cardiomyopathy, and arrhythmias. There are no disease-modifying medications to either slow or halt the progression of the disease, but research investigating therapies to increase endogenous frataxin production and decrease the downstream consequences of disrupted iron homeostasis is ongoing. Clinical trials of promising medications are underway, and the treatment era of Friedreich ataxia is beginning. Copyright © 2013 Elsevier Inc. All rights reserved.

Allelic imbalance on chromosome 1 in human breast cancer. I. Minisatellite and RFLP analysis.

Science.gov (United States)

Loupart, M L; Armour, J; Walker, R; Adams, S; Brammar, W; Varley, J

1995-01-01

In order to characterise the role of chromosome 1 more fully in breast cancer, polymorphic markers mapping along the length of the whole chromosome were used to assess a panel of 71 tumour-lymphocyte pairs for allelic imbalance. Complex patterns of alterations were established that are consistent with cytogenetic data in the literature. Deletion mapping of individuals with loss of heterozygosity identified five independent smallest common regions of deletion, two of which are novel. There are also three discrete regions showing a gain in copy number of one homologue. The two arms of the chromosome may be subject to different events; the short arm primarily undergoes interstitial deletions, whereas the long arm is subject to whole arm events (as both gains and losses) as well as regional deletions.

Analysis of substrate specificity of Schizosaccharomyces pombe Mag1 alkylpurine DNA glycosylase

Energy Technology Data Exchange (ETDEWEB)

Adhikary, Suraj; Eichman, Brandt F. (Vanderbilt)

2014-10-02

DNA glycosylases specialized for the repair of alkylation damage must identify, with fine specificity, a diverse array of subtle modifications within DNA. The current mechanism involves damage sensing through interrogation of the DNA duplex, followed by more specific recognition of the target base inside the active site pocket. To better understand the physical basis for alkylpurine detection, we determined the crystal structure of Schizosaccharomyces pombe Mag1 (spMag1) in complex with DNA and performed a mutational analysis of spMag1 and the close homologue from Saccharomyces cerevisiae (scMag). Despite strong homology, spMag1 and scMag differ in substrate specificity and cellular alkylation sensitivity, although the enzymological basis for their functional differences is unknown. We show that Mag preference for 1,N{sup 6}-ethenoadenine ({var_epsilon}A) is influenced by a minor groove-interrogating residue more than the composition of the nucleobase-binding pocket. Exchanging this residue between Mag proteins swapped their {var_epsilon}A activities, providing evidence that residues outside the extrahelical base-binding pocket have a role in identification of a particular modification in addition to sensing damage.

Selenium utilization in thioredoxin and catalytic advantage provided by selenocysteine

International Nuclear Information System (INIS)

Kim, Moon-Jung; Lee, Byung Cheon; Hwang, Kwang Yeon; Gladyshev, Vadim N.; Kim, Hwa-Young

2015-01-01

Thioredoxin (Trx) is a major thiol-disulfide reductase that plays a role in many biological processes, including DNA replication and redox signaling. Although selenocysteine (Sec)-containing Trxs have been identified in certain bacteria, their enzymatic properties have not been characterized. In this study, we expressed a selenoprotein Trx from Treponema denticola, an oral spirochete, in Escherichia coli and characterized this selenoenzyme and its natural cysteine (Cys) homologue using E. coli Trx1 as a positive control. 75 Se metabolic labeling and mutation analyses showed that the SECIS (Sec insertion sequence) of T. denticola selenoprotein Trx is functional in the E. coli Sec insertion system with specific selenium incorporation into the Sec residue. The selenoprotein Trx exhibited approximately 10-fold higher catalytic activity than the Sec-to-Cys version and natural Cys homologue and E. coli Trx1, suggesting that Sec confers higher catalytic activity on this thiol-disulfide reductase. Kinetic analysis also showed that the selenoprotein Trx had a 30-fold higher K m than Cys-containing homologues, suggesting that this selenoenzyme is adapted to work efficiently with high concentrations of substrate. Collectively, the results of this study support the hypothesis that selenium utilization in oxidoreductase systems is primarily due to the catalytic advantage provided by the rare amino acid, Sec. - Highlights: • The first characterization of a selenoprotein Trx is presented. • The selenoenzyme Trx exhibits 10-fold higher catalytic activity than Cys homologues. • Se utilization in Trx is primarily due to the catalytic advantage provided by Sec residue

Selenium utilization in thioredoxin and catalytic advantage provided by selenocysteine

Energy Technology Data Exchange (ETDEWEB)

Kim, Moon-Jung [Department of Biochemistry and Molecular Biology, Yeungnam University College of Medicine, Daegu 705-717 (Korea, Republic of); Lee, Byung Cheon [Division of Genetics, Department of Medicine, Brigham and Women' s Hospital, Harvard Medical School, Boston, MA 02115 (United States); Division of Biotechnology, College of Life Sciences & Biotechnology, Korea University, Seoul 136-701 (Korea, Republic of); Hwang, Kwang Yeon [Division of Biotechnology, College of Life Sciences & Biotechnology, Korea University, Seoul 136-701 (Korea, Republic of); Gladyshev, Vadim N. [Division of Genetics, Department of Medicine, Brigham and Women' s Hospital, Harvard Medical School, Boston, MA 02115 (United States); Kim, Hwa-Young, E-mail: hykim@ynu.ac.kr [Department of Biochemistry and Molecular Biology, Yeungnam University College of Medicine, Daegu 705-717 (Korea, Republic of)

2015-06-12

Thioredoxin (Trx) is a major thiol-disulfide reductase that plays a role in many biological processes, including DNA replication and redox signaling. Although selenocysteine (Sec)-containing Trxs have been identified in certain bacteria, their enzymatic properties have not been characterized. In this study, we expressed a selenoprotein Trx from Treponema denticola, an oral spirochete, in Escherichia coli and characterized this selenoenzyme and its natural cysteine (Cys) homologue using E. coli Trx1 as a positive control. {sup 75}Se metabolic labeling and mutation analyses showed that the SECIS (Sec insertion sequence) of T. denticola selenoprotein Trx is functional in the E. coli Sec insertion system with specific selenium incorporation into the Sec residue. The selenoprotein Trx exhibited approximately 10-fold higher catalytic activity than the Sec-to-Cys version and natural Cys homologue and E. coli Trx1, suggesting that Sec confers higher catalytic activity on this thiol-disulfide reductase. Kinetic analysis also showed that the selenoprotein Trx had a 30-fold higher K{sub m} than Cys-containing homologues, suggesting that this selenoenzyme is adapted to work efficiently with high concentrations of substrate. Collectively, the results of this study support the hypothesis that selenium utilization in oxidoreductase systems is primarily due to the catalytic advantage provided by the rare amino acid, Sec. - Highlights: • The first characterization of a selenoprotein Trx is presented. • The selenoenzyme Trx exhibits 10-fold higher catalytic activity than Cys homologues. • Se utilization in Trx is primarily due to the catalytic advantage provided by Sec residue.

The Orphan Nuclear Receptor TLX/NR2E1 in Neural Stem Cells and Diseases

OpenAIRE

Wang, Tao; Xiong, Jian-Qiong

2016-01-01

The human TLX gene encodes an orphan nuclear receptor predominantly expressed in the central nervous system. Tailess and Tlx, the TLX homologues in Drosophila and mouse, play essential roles in body-pattern formation and neurogenesis during early embryogenesis and perform crucial functions in maintaining stemness and controlling the differentiation of adult neural stem cells in the central nervous system, especially the visual system. Multiple target genes and signaling pathways are regulated...

CUP-1 Is a Novel Protein Involved in Dietary Cholesterol Uptake in Caenorhabditis elegans

Science.gov (United States)

Valdes, Victor J.; Athie, Alejandro; Salinas, Laura S.; Navarro, Rosa E.; Vaca, Luis

2012-01-01

Sterols transport and distribution are essential processes in all multicellular organisms. Survival of the nematode Caenorhabditis elegans depends on dietary absorption of sterols present in the environment. However the general mechanisms associated to sterol uptake in nematodes are poorly understood. In the present work we provide evidence showing that a previously uncharacterized transmembrane protein, designated Cholesterol Uptake Protein-1 (CUP-1), is involved in dietary cholesterol uptake in C. elegans. Animals lacking CUP-1 showed hypersensitivity to cholesterol limitation and were unable to uptake cholesterol. A CUP-1-GFP fusion protein colocalized with cholesterol-rich vesicles, endosomes and lysosomes as well as the plasma membrane. Additionally, by FRET imaging, a direct interaction was found between the cholesterol analog DHE and the transmembrane “cholesterol recognition/interaction amino acid consensus” (CRAC) motif present in C. elegans CUP-1. In-silico analysis identified two mammalian homologues of CUP-1. Most interestingly, CRAC motifs are conserved in mammalian CUP-1 homologous. Our results suggest a role of CUP-1 in cholesterol uptake in C. elegans and open up the possibility for the existence of a new class of proteins involved in sterol absorption in mammals. PMID:22479487

Nicotinamide and PNC1 govern lifespan extension by calorie restriction in Saccharomyces cerevisiae.

Science.gov (United States)

Anderson, Rozalyn M; Bitterman, Kevin J; Wood, Jason G; Medvedik, Oliver; Sinclair, David A

2003-05-08

Calorie restriction extends lifespan in a broad range of organisms, from yeasts to mammals. Numerous hypotheses have been proposed to explain this phenomenon, including decreased oxidative damage and altered energy metabolism. In Saccharomyces cerevisiae, lifespan extension by calorie restriction requires the NAD+-dependent histone deacetylase, Sir2 (ref. 1). We have recently shown that Sir2 and its closest human homologue SIRT1, a p53 deacetylase, are strongly inhibited by the vitamin B3 precursor nicotinamide. Here we show that increased expression of PNC1 (pyrazinamidase/nicotinamidase 1), which encodes an enzyme that deaminates nicotinamide, is both necessary and sufficient for lifespan extension by calorie restriction and low-intensity stress. We also identify PNC1 as a longevity gene that is responsive to all stimuli that extend lifespan. We provide evidence that nicotinamide depletion is sufficient to activate Sir2 and that this is the mechanism by which PNC1 regulates longevity. We conclude that yeast lifespan extension by calorie restriction is the consequence of an active cellular response to a low-intensity stress and speculate that nicotinamide might regulate critical cellular processes in higher organisms.

Cloning of a protein arginine methyltransferase PRMT1 homologue from Schistosoma mansoni: Evidence for roles in nuclear receptor signaling and RNA metabolism

International Nuclear Information System (INIS)

Mansure, Jose Joao; Furtado, Daniel Rodrigues; Bastos de Oliveira, Francisco Meirelles; Rumjanek, Franklin David; Franco, Gloria Regina; Fantappie, Marcelo Rosado

2005-01-01

The most studied arginine methyltransferase is the type I enzyme, which catalyzes the transfer of an S-adenosyl-L-methionine to a broad spectrum of substrates, including histones, RNA-transporting proteins, and nuclear hormone receptor coactivators. We cloned a cDNA encoding a protein arginine methyltransferase in Schistosoma mansoni (SmPRMT1). SmPRMT1 is highly homologous to the vertebrate PRMT1 enzyme. In vitro methylation assays showed that SmPRMT1 recombinant protein was able to specifically methylate histone H4. Two schistosome proteins likely to be involved in RNA metabolism, SMYB1 and SmSmD3, that display a number of RGG motifs, were strongly methylated by SmPRMT1. In vitro GST pull-down assays showed that SMYB1 and SmSmD3 physically interacted with SmPRMT1. Additional GST pull-down assay suggested the occurrence of a ternary complex including SmPRMT1, SmRXR1 nuclear receptor, and the p160 (SRC-1) nuclear receptor coactivator. Together, these data suggest a mechanism by which SmPRMT1 plays a role in nuclear receptor-mediated chromatin remodeling and RNA transactions

Liquid Phase Micro-Extraction of Linear Alkylbenzene Sulfonate Anionic Surfactants in Aqueous Samples

Directory of Open Access Journals (Sweden)

Jan Åke Jönsson

2011-10-01

Full Text Available Hollow fiber liquid phase micro-extraction (LPME of linear alkylbenzene sulfonates (LAS from aqueous samples was studied. Ion pair extraction of C10, C11, C12 and C13 homologues was facilitated with trihexylamine as ion-pairing agent, using di-n-hexylether as solvent for the supported liquid membrane (SLM. Effects of extraction time, acceptor buffer concentration, stirring speed, sample volume, NaCl and humic acids were studied. At 10–50 µg L−1 linear R2-coefficients were 0.99 for C10 and C11 and 0.96 for C12. RSD was typically ~15%. Three observations were especially made. Firstly, LPME for these analytes was unusually slow with maximum enrichment observed after 15–24 h (depending on sample volume. Secondly, the enrichment depended on LAS sample concentration with 35–150 times enrichment below ~150 µg L−1 and 1850–4400 times enrichment at 1 mg L−1. Thirdly, lower homologues were enriched more than higher homologues at low sample concentrations, with reversed conditions at higher concentrations. These observations may be due to the fact that LAS and the amine counter ion themselves influence the mass transfer at the water-SLM interface. The observations on LPME of LAS may aid in LPME application to other compounds with surfactant properties or in surfactant enhanced membrane extraction of other compounds.

High Expression of UGT1A1/1A6 in Monkey Small Intestine: Comparison of Protein Expression Levels of Cytochromes P450, UDP-Glucuronosyltransferases, and Transporters in Small Intestine of Cynomolgus Monkey and Human.

Science.gov (United States)

Akazawa, Takanori; Uchida, Yasuo; Miyauchi, Eisuke; Tachikawa, Masanori; Ohtsuki, Sumio; Terasaki, Tetsuya

2018-01-02

Cynomolgus monkeys have been widely used for the prediction of drug absorption in humans. The purpose of this study was to clarify the regional protein expression levels of cytochromes P450 (CYPs), UDP-glucuronosyltransferases (UGTs), and transporters in small intestine of cynomolgus monkey using liquid chromatography-tandem mass spectrometry, and to compare them with the corresponding levels in human. UGT1A1 in jejunum and ileum were >4.57- and >3.11-fold and UGT1A6 in jejunum and ileum were >16.1- and >8.57-fold, respectively, more highly expressed in monkey than in human. Also, jejunal expression of monkey CYP3A8 (homologue of human CYP3A4) was >3.34-fold higher than that of human CYP3A4. Among apical drug efflux transporters, BCRP showed the most abundant expression in monkey and human, and the expression levels of BCRP in monkey and human were >1.74- and >1.25-fold greater than those of P-gp and >2.76- and >4.50-fold greater than those of MRP2, respectively. These findings should be helpful to understand species differences of the functions of CYPs, UGTs, and transporters between monkey and human. The UGT1A1/1A6 data would be especially important because it is difficult to identify isoforms responsible for species differences of intestinal glucuronidation by means of functional studies due to overlapping substrate specificity.

Trypanocidal 1,3-arylene diketone bis(guanylhydrazone)s. Structure-activity relationships among substituted and heterocyclic analogues.

Science.gov (United States)

Ulrich, P; Cerami, A

1984-01-01

Based on the antitrypanosomal activity of 1,3-diacetylbenzene bis(guanylhydrazone) (4) and 2,6-diacetylpyridine bis(guanylhydrazone) (17), a number of substituted and heterocyclic 1,3-arylene diketone bis(guanylhydrazone)s were prepared and tested against Trypanosoma brucei infections in mice. A wide range of ED50 values was observed among 5-substituted derivatives of 4. The 5-amino analogue 5 and 5-acetamido analogue 6 were about twice as active as 4. 1,3,5-Triacetylbenzene tris(guanylhydrazone) (12) was about 9 times as active as 4 and was approximately one-half as active as the currently used trypanocide diminazene aceturate in this test system. Other 5-derivatives had activity equivalent to or less than that of the parent compound 4. Three new heterocyclic analogues were all less active than 2,6-diacetylpyridine derivative 17 and benzene derivative 4. Ring substitution ortho to the guanylhydrazone side chains was invariably detrimental to activity. Side-chain homologues 1,3-dipentanoylbenzene bis(guanylhydrazone) and 1,3-diacetylbenzene bis(2-imidazolin-2-ylhydrazone) were essentially inactive.

Heterogeneity of ductular reactions in adult rat and human liver revealed by novel expression of deleted in malignant brain tumor 1

DEFF Research Database (Denmark)

Bisgaard, H.C.; Holmskov, U.; Santoni-Rugiu, E.

2002-01-01

The regenerative capacity of mammalian adult liver reflects the ability of a number of cell populations within the hepatic lineage to take action. Limited information is available regarding factors and mechanisms that determine the specific lineage level at which liver cells contribute to liver......), were specifically associated with the emergence of ductular (oval) cell populations in injured liver. Subsequent cloning and characterization of the rat DMBT1 homologue revealed a highly inducible expression in ductular reactions composed of transit-amplifying ductular (oval) cells, but not in ductular...... reactions after ligation of the common bile duct. In human liver diseases, DMBT1 was expressed in ductular reactions after infection with hepatitis B and acetaminophen intoxication, but not in primary biliary cirrhosis, primary sclerosing cholangitis, and obstruction of the large bile duct. The expression...

Lutte chimique contre le Feu bactérien : quelques résultats d'essais

OpenAIRE

Lecomte, Pascal; Larue, P.

1990-01-01

Introduction[br/] 1- Produits homologués[br/] 2- Efficacité et sélectivité[br/] 2.1. Test en contamination artificielle[br/] 2.2. Test en contamination naturelle[br/] 2.3. Sélectivité[br/] Conclusion

GenBank blastx search result: AK107397 [KOME

Lifescience Database Archive (English)

Full Text Available AK107397 002-127-D06 AB052295.1 Brevibacterium fuscum var. dextranlyticum genes for... ABC membrane transporter homologues, putative alpha-glucosidase, isomaltotrio-dextranase precursor, partial and complete cds.|BCT BCT 1e-122 +2 ...

Disrupted epithelial/macrophage crosstalk via Spinster homologue 2-mediated S1P signaling may drive defective macrophage phagocytic function in COPD.

Directory of Open Access Journals (Sweden)

Hai B Tran

Full Text Available We have previously established a link between impaired phagocytic capacity and deregulated S1P signaling in alveolar macrophages from COPD subjects. We hypothesize that this defect may include a disruption of epithelial-macrophage crosstalk via Spns2-mediated intercellular S1P signaling.Primary alveolar macrophages and bronchial epithelial cells from COPD subjects and controls, cell lines, and a mouse model of chronic cigarette smoke exposure were studied. Cells were exposed to 10% cigarette smoke extract, or vehicle control. Spns2 expression and subcellular localization was studied by immunofluorescence, confocal microscopy and RT-PCR. Phagocytosis was assessed by flow-cytometry. Levels of intra- and extracellular S1P were measured by S1P [3H]-labeling.Spns2 expression was significantly increased (p<0.05 in alveolar macrophages from current-smokers/COPD patients (n = 5 compared to healthy nonsmokers (n = 8 and non-smoker lung transplant patients (n = 4. Consistent with this finding, cigarette smoke induced a significant increase in Spns2 expression in both human alveolar and THP-1 macrophages. In contrast, a remarkable Spns2 down-regulation was noted in response to cigarette smoke in 16HBE14o- cell line (p<0.001 in 3 experiments, primary nasal epithelial cells (p<0.01 in 2 experiments, and in smoke-exposed mice (p<0.001, n = 6 animals per group. Spns2 was localized to cilia in primary bronchial epithelial cells. In both macrophage and epithelial cell types, Spns2 was also found localized to cytoplasm and the nucleus, in line with a predicted bipartile Nuclear Localization Signal at the position aa282 of the human Spns2 sequence. In smoke-exposed mice, alveolar macrophage phagocytic function positively correlated with Spns2 protein expression in bronchial epithelial cells.Our data suggest that the epithelium may be the major source for extracellular S1P in the airway and that there is a possible disruption of epithelial/macrophage cross talk via

Role of ALKBH1 in the Core Transcriptional Network of Embryonic Stem Cells

Directory of Open Access Journals (Sweden)

Rune Ougland

2016-01-01

Full Text Available Background/Aims: ALKBH1, an AlkB homologue in the 2-oxoglutarate and Fe2+ dependent hydroxylase family, is a histone dioxygenase that removes methyl groups from histone H2A. Studies of transgenic mice lacking Alkbh1 reveal that most Alkbh1-/- embryos die during embryonic development. Embryonic stem cells (ESCs derived from these mice have prolonged expression of pluripotency markers and delayed induction of genes involved in neural differentiation, indicating that ALKBH1 is involved in regulation of pluripotency and differentiation. The aim of this study was to further investigate the role ALKBH1 in early development. Methods: Double-filter methods for nitrocellulose-filter binding, dot blot, enzyme-linked immunosorbent assay (ELISA, immonocytochemistry, cell culture and differentiation of mouse ESCs, Co-IP and miRNA analysis. Results: We found that SOX2 and NANOG bind the ALKBH1 promoter, and we identified protein-protein interactions between ALKBH1 and these core transcription factors of the pluripotency network. Furthermore, lack of ALKBH1 affected the expression of developmentally important miRNAs, which are involved in the regulation of NANOG, SOX2 and neural differentiation. Conclusion: Our results suggest that ALKBH1 interacts with the core transcriptional pluripotency network of ESCs and is involved in regulation of pluripotency and differentiation.

Synthesis of 1-octacosanol and GC-C-IRMS discrimination of samples from different origin.

Science.gov (United States)

Cravotto, Giancarlo; Calcio Gaudino, Emanuela; Barge, Alessandro; Binello, Arianna; Albertino, Andrea; Aghemo, Costanza

2010-03-01

Lately, long-chain primary alcohols have been investigated in depth on account of their biological activities. In particular, 1-octacosanol (C(28)H(57)OH), the main component of policosanol, the hypolipidaemic fatty alcohol mixture obtained from sugar cane wax, has been the subject of a multitude of pharmacological studies. The aim of this work was to search a convenient synthetic protocol for the preparation of 1-octacosanol in a gram scale. The key step was a Wittig reaction between the octadecyltriphenylphosphonium ylide and the methyl 10-oxodecanoate. Some steps were further improved by power ultrasound and microwave irradiation, either alone or in combination. Our methodology is suitable for a rapid generation of homologues by varying the chain length in the alkyl halide. Due to the high commercial value, a series of 1-octacosanol samples, either isolated from natural sources or from synthesis (different origin and suppliers), were analysed by gas chromatography-combustion-isotopic ratio mass spectrometry (GC-C-IRMS) and according to the carbon isotopic content, classified on the basis of their origin.

The 1.8-Å resolution crystal structure of YDR533Cp from Saccharomyces cerevisiae: A member of the DJ-1/ThiJ/PfpI superfamily

Science.gov (United States)

Wilson, Mark A.; Amour, Courtney V. St.; Collins, Jennifer L.; Ringe, Dagmar; Petsko, Gregory A.

2004-01-01

The yeast gene YDR533C encodes a protein belonging to the DJ-1/ThiJ/PfpI superfamily. This family includes the human protein DJ-1, which is mutated in autosomal recessive early-onset Parkinson's disease. The function of DJ-1 and its yeast homologue YDR533Cp is unknown. We report here the crystal structure of YDR533Cp at 1.8-Å resolution. The structure indicates that the closest relative to YDR533Cp is the Escherichia coli heat shock protein Hsp31 (YedU), which has both chaperone and protease activity. As expected, the overall fold of the core domain of YDR533Cp is also similar to that of DJ-1 and the bacterial protease PfpI. YDR533Cp contains a possible catalytic triad analogous to that of Hsp31 and an additional domain that is present in Hsp31 but is not seen in DJ-1 and other members of the family. The cysteine in this triad (Cys-138) is oxidized in this crystal structure, similar to modifications seen in the corresponding cysteine in the crystal structure of DJ-1. YDR533Cp appears to be a dimer both in solution and the crystal, but this dimer is formed by a different interface than that found in Hsp31 or other members of the superfamily. PMID:14745011

SIRT1 deacetylase protects against neurodegeneration in models for Alzheimer's disease and amyotrophic lateral sclerosis.

Science.gov (United States)

Kim, Dohoon; Nguyen, Minh Dang; Dobbin, Matthew M; Fischer, Andre; Sananbenesi, Farahnaz; Rodgers, Joseph T; Delalle, Ivana; Baur, Joseph A; Sui, Guangchao; Armour, Sean M; Puigserver, Pere; Sinclair, David A; Tsai, Li-Huei

2007-07-11

A progressive loss of neurons with age underlies a variety of debilitating neurological disorders, including Alzheimer's disease (AD) and amyotrophic lateral sclerosis (ALS), yet few effective treatments are currently available. The SIR2 gene promotes longevity in a variety of organisms and may underlie the health benefits of caloric restriction, a diet that delays aging and neurodegeneration in mammals. Here, we report that a human homologue of SIR2, SIRT1, is upregulated in mouse models for AD, ALS and in primary neurons challenged with neurotoxic insults. In cell-based models for AD/tauopathies and ALS, SIRT1 and resveratrol, a SIRT1-activating molecule, both promote neuronal survival. In the inducible p25 transgenic mouse, a model of AD and tauopathies, resveratrol reduced neurodegeneration in the hippocampus, prevented learning impairment, and decreased the acetylation of the known SIRT1 substrates PGC-1alpha and p53. Furthermore, injection of SIRT1 lentivirus in the hippocampus of p25 transgenic mice conferred significant protection against neurodegeneration. Thus, SIRT1 constitutes a unique molecular link between aging and human neurodegenerative disorders and provides a promising avenue for therapeutic intervention.

SIRT1 deacetylase protects against neurodegeneration in models for Alzheimer's disease and amyotrophic lateral sclerosis

Science.gov (United States)

Kim, Dohoon; Nguyen, Minh Dang; Dobbin, Matthew M; Fischer, Andre; Sananbenesi, Farahnaz; Rodgers, Joseph T; Delalle, Ivana; Baur, Joseph A; Sui, Guangchao; Armour, Sean M; Puigserver, Pere; Sinclair, David A; Tsai, Li-Huei

2007-01-01

A progressive loss of neurons with age underlies a variety of debilitating neurological disorders, including Alzheimer's disease (AD) and amyotrophic lateral sclerosis (ALS), yet few effective treatments are currently available. The SIR2 gene promotes longevity in a variety of organisms and may underlie the health benefits of caloric restriction, a diet that delays aging and neurodegeneration in mammals. Here, we report that a human homologue of SIR2, SIRT1, is upregulated in mouse models for AD, ALS and in primary neurons challenged with neurotoxic insults. In cell-based models for AD/tauopathies and ALS, SIRT1 and resveratrol, a SIRT1-activating molecule, both promote neuronal survival. In the inducible p25 transgenic mouse, a model of AD and tauopathies, resveratrol reduced neurodegeneration in the hippocampus, prevented learning impairment, and decreased the acetylation of the known SIRT1 substrates PGC-1alpha and p53. Furthermore, injection of SIRT1 lentivirus in the hippocampus of p25 transgenic mice conferred significant protection against neurodegeneration. Thus, SIRT1 constitutes a unique molecular link between aging and human neurodegenerative disorders and provides a promising avenue for therapeutic intervention. PMID:17581637

Isolation and characterization of differentially expressed genes in ...

African Journals Online (AJOL)

USER

Through reverse transcriptase-polymerase chain reaction analysis, priA homologue and AP-1 like transcription factor ... The oyster mushroom, Pleurotus ostreatus, and white button mushroom ..... differential display of RAPD. FEMS Microbiol.

Homeodomain-Interacting Protein Kinase (HPK-1) regulates stress responses and ageing in C. elegans.

Science.gov (United States)

Berber, Slavica; Wood, Mallory; Llamosas, Estelle; Thaivalappil, Priya; Lee, Karen; Liao, Bing Mana; Chew, Yee Lian; Rhodes, Aaron; Yucel, Duygu; Crossley, Merlin; Nicholas, Hannah R

2016-01-21

Proteins of the Homeodomain-Interacting Protein Kinase (HIPK) family regulate an array of processes in mammalian systems, such as the DNA damage response, cellular proliferation and apoptosis. The nematode Caenorhabditis elegans has a single HIPK homologue called HPK-1. Previous studies have implicated HPK-1 in longevity control and suggested that this protein may be regulated in a stress-dependent manner. Here we set out to expand these observations by investigating the role of HPK-1 in longevity and in the response to heat and oxidative stress. We find that levels of HPK-1 are regulated by heat stress, and that HPK-1 contributes to survival following heat or oxidative stress. Additionally, we show that HPK-1 is required for normal longevity, with loss of HPK-1 function leading to a faster decline of physiological processes that reflect premature ageing. Through microarray analysis, we have found that HPK-1-regulated genes include those encoding proteins that serve important functions in stress responses such as Phase I and Phase II detoxification enzymes. Consistent with a role in longevity assurance, HPK-1 also regulates the expression of age-regulated genes. Lastly, we show that HPK-1 functions in the same pathway as DAF-16 to regulate longevity and reveal a new role for HPK-1 in development.

Molecular cloning of Ly-1, a membrane glycoprotein of mouse T lymphocytes and a subset of B cells: molecular homology to its human counterpart Leu-1/T1 (CD5)

International Nuclear Information System (INIS)

Huang, H.J.S.; Jones, N.H.; Strominger, J.L.; Herzenberg, L.A.

1987-01-01

The authors report the isolation of cDNA clones of the mouse lymphocyte differentiation antigen Ly-1. One of these cDNA clones was confirmed to be full-length by DNA sequencing and by expression of Ly-1 by L cells transfected with this clone. Analysis of the predicted amino acid sequence indicated that the Ly-1 polypeptide is synthesized with a 23 amino acid leader and that the mature protein consists of an amino-terminal region of 347 amino acids, a transmembrane sequence of 30 residues, and a carboxyl-terminal region of 94 amino acids. The amino-terminal region appears to be divided into two subregions by a threonine- and proline-rich sequence of 23 amino acids that is highly conserved between Ly-1 and its human homologue Leu-1 (CD5) in position and amino acid composition. The first amino-terminal subregion of 111 amino acids is predicted to be arranged in a β-pleated sheet structure of six strands. The entire amino-terminal region is rich in cysteine, with all of its 22 cysteine residues conserved between Ly-1 and Leu-1. The carboxyl-terminal region has no cysteins. Ly-1 and Leu-1 are 63% identical, with a gradient of identical residues from 43% for the first amino-terminal to 58% for the second amino-terminal subregion and 90% for the carboxyl-terminal region. The predicted secondary structure of the first amino-terminal subregion and identities of certain conserved residues among most members of the immunoglobulin gene superfamily suggest that Ly-1 and Leu-1 are distant members of this family

The crystal structure of (001) twinned xilingolite, Pb3Bi2S6, from Mittal-Hohtenn, Valais, Switzerland

DEFF Research Database (Denmark)

Berlepsch, Peter; Armbruster, Thomas; Makovicky, Emil

2002-01-01

geology, xilingolite, crystal structure, twinning, lillianite homologue, electron-microprobe analyses, cannizzarite, Bi-containing galena, Mittal-Hohtenn, Valais, Switzerland......geology, xilingolite, crystal structure, twinning, lillianite homologue, electron-microprobe analyses, cannizzarite, Bi-containing galena, Mittal-Hohtenn, Valais, Switzerland...

Purification and crystallization of Vibrio fischeri CcdB and its complexes with fragments of gyrase and CcdA

International Nuclear Information System (INIS)

De Jonge, Natalie; Buts, Lieven; Vangelooven, Joris; Mine, Natacha; Van Melderen, Laurence; Wyns, Lode; Loris, Remy

2007-01-01

A CcdB homologue from V. fischeri was overexpressed in E. coli and purified. The free protein was crystallized, as were its complexes with fragments of E. coli and V. fischeri gyrase and with the F-plasmid CcdA C-terminal domain. The ccd toxin–antitoxin module from the Escherichia coli F plasmid has a homologue on the Vibrio fischeri integron. The homologue of the toxin (CcdB Vfi ) was crystallized in two different crystal forms. The first form belongs to space group I23 or I2 1 3, with unit-cell parameter a = 84.5 Å, and diffracts to 1.5 Å resolution. The second crystal form belongs to space group C2, with unit-cell parameters a = 58.5, b = 43.6, c = 37.5 Å, β = 110.0°, and diffracts to 1.7 Å resolution. The complex of CcdB Vfi with the GyrA14 Vfi fragment of V. fischeri gyrase crystallizes in space group P2 1 2 1 2 1 , with unit-cell parameters a = 53.5, b = 94.6, c = 58.1 Å, and diffracts to 2.2 Å resolution. The corresponding mixed complex with E. coli GyrA14 Ec crystallizes in space group C2, with unit-cell parameters a = 130.1, b = 90.8, c = 58.1 Å, β = 102.6°, and diffracts to 1.95 Å. Finally, a complex between CcdB Vfi and part of the F-plasmid antitoxin CcdA F crystallizes in space group P2 1 2 1 2 1 , with unit-cell parameters a = 46.9, b = 62.6, c = 82.0 Å, and diffracts to 1.9 Å resolution

Prokaryotic cells: structural organisation of the cytoskeleton and organelles

Directory of Open Access Journals (Sweden)

Wanderley de Souza

2012-05-01

Full Text Available For many years, prokaryotic cells were distinguished from eukaryotic cells based on the simplicity of their cytoplasm, in which the presence of organelles and cytoskeletal structures had not been discovered. Based on current knowledge, this review describes the complex components of the prokaryotic cell cytoskeleton, including (i tubulin homologues composed of FtsZ, BtuA, BtuB and several associated proteins, which play a fundamental role in cell division, (ii actin-like homologues, such as MreB and Mb1, which are involved in controlling cell width and cell length, and (iii intermediate filament homologues, including crescentin and CfpA, which localise on the concave side of a bacterium and along its inner curvature and associate with its membrane. Some prokaryotes exhibit specialised membrane-bound organelles in the cytoplasm, such as magnetosomes and acidocalcisomes, as well as protein complexes, such as carboxysomes. This review also examines recent data on the presence of nanotubes, which are structures that are well characterised in mammalian cells that allow direct contact and communication between cells.

Understanding sex determination in the mouse: genetics ...

Indian Academy of Sciences (India)

challenge now is to understand how controlled epigenomic changes effect the now familiar sexually dimorphic transcriptomic profiles of the ... Cattanach, personal communication, April 2015. .... The human homologue, DMRT1, is found on.

Regulation of Msx-1, Msx-2, Bmp-2 and Bmp-4 during foetal and postnatal mammary gland development.

Science.gov (United States)

Phippard, D J; Weber-Hall, S J; Sharpe, P T; Naylor, M S; Jayatalake, H; Maas, R; Woo, I; Roberts-Clark, D; Francis-West, P H; Liu, Y H; Maxson, R; Hill, R E; Dale, T C

1996-09-01

Expression of the Msx-1 and Msx-2 homeobox genes have been shown to be coordinately regulated with the Bmp-2 and Bmp-4 ligands in a variety of developing tissues. Here we report that transcripts from all four genes are developmentally regulated during both foetal and postnatal mammary gland development. The location and time-course of the Bmp and Msx expression point to a role for Msx and Bmp gene products in the control of epithelial-mesenchymal interactions. Expression of Msx-2, but not Msx-1, Bmp-2 or Bmp-4 was decreased following ovariectomy, while expression of the human Msx-2 homologue was regulated by 17beta-oestradiol in the MCF-7 breast cancer cell line. The regulation of Msx-2 expression by oestrogen raises the possibility that hormonal regulation of mammary development is mediated through the control of epithelial-mesenchymal interactions.

Homologous regions of Fen1 and p21Cip1 compete for binding to the same site on PCNA: a potential mechanism to co-ordinate DNA replication and repair.

Science.gov (United States)

Warbrick, E; Lane, D P; Glover, D M; Cox, L S

1997-05-15

Following genomic damage, the cessation of DNA replication is co-ordinated with onset of DNA repair; this co-ordination is essential to avoid mutation and genomic instability. To investigate these phenomena, we have analysed proteins that interact with PCNA, which is required for both DNA replication and repair. One such protein is p21Cip1, which inhibits DNA replication through its interaction with PCNA, while allowing repair to continue. We have identified an interaction between PCNA and the structure specific nuclease, Fen1, which is involved in DNA replication. Deletion analysis suggests that p21Cip1 and Fen1 bind to the same region of PCNA. Within Fen1 and its homologues a small region (10 amino acids) is sufficient for PCNA binding, which contains an 8 amino acid conserved PCNA-binding motif. This motif shares critical residues with the PCNA-binding region of p21Cip1. A PCNA binding peptide from p21Cip1 competes with Fen1 peptides for binding to PCNA, disrupts the Fen1-PCNA complex in replicating cell extracts, and concomitantly inhibits DNA synthesis. Competition between homologous regions of Fen1 and p21Cip1 for binding to the same site on PCNA may provide a mechanism to co-ordinate the functions of PCNA in DNA replication and repair.

The Bioconcentration and Degradation of Nonylphenol and Nonylphenol Polyethoxylates by Chlorella vulgaris

Directory of Open Access Journals (Sweden)

Hong-Wen Sun

2014-01-01

Full Text Available Nonylphenol polyethoxylates (NPnEOs, a major class of nonionic surfactants, can easily enter into aquatic environments through various pathways due to their wide applications, which leads to the extensive existence of their relative stable metabolites, namely nonylphenol (NP and mono- to tri-ethoxylates. This study investigated the bioconcentration and degradation of NP and NPnEO oligomers (n = 1–12 by a green algae, Chlorella vulgaris. Experimental results showed that C. vulgaris can remove NP from water phase efficiently, and bioconcentration and degradation accounted for approximately half of its loss, respectively, with a 48 h BCF (bioconcentration factor of 2.42 × 103. Moreover, C. vulgaris could concentrate and degrade NPnEOs, distribution profiles of the series homologues of the NPnEOs in algae and water phase were quite different from the initial homologue profile. The 48 h BCF of the NPnEO homologues increased with the length of the EO chain. Degradation extent of total NPnEOs by C. vulgaris was 95.7%, and only 1.1% remained in water phase, and the other 3.2% remained in the algal cells. The algae removed the NPnEOs mainly through degradation. Due to rapid degradation, concentrations of the long chain NPnEO homologous in both water (n ≥ 2 and the algal phase (n ≥ 5 was quite low at the end of a 48 h experiment.

Nitric oxide and plant iron homeostasis.

Science.gov (United States)

Buet, Agustina; Simontacchi, Marcela

2015-03-01

Like all living organisms, plants demand iron (Fe) for important biochemical and metabolic processes. Internal imbalances, as a consequence of insufficient or excess Fe in the environment, lead to growth restriction and affect crop yield. Knowledge of signals and factors affecting each step in Fe uptake from the soil and distribution (long-distance transport, remobilization from old to young leaves, and storage in seeds) is necessary to improve our understanding of plant mineral nutrition. In this context, the role of nitric oxide (NO) is discussed as a key player in maintaining Fe homeostasis through its cross talk with hormones, ferritin, and frataxin and the ability to form nitrosyl-iron complexes. © 2015 New York Academy of Sciences.

Isolation of Mal d 1 and Api g 1 - specific recombinant antibodies from mouse IgG Fab fragment libraries - Mal d 1-specific antibody exhibits cross-reactivity against Bet v 1.

Science.gov (United States)

Haka, Jaana; Niemi, Merja H; Iljin, Kristiina; Reddy, Vanga Siva; Takkinen, Kristiina; Laukkanen, Marja-Leena

2015-05-27

Around 3-5% of the population suffer from IgE-mediated food allergies in Western countries and the number of food-allergenic people is increasing. Individuals with certain pollen allergies may also suffer from a sensitisation to proteins in the food products. As an example a person sensitised to the major birch pollen allergen, Bet v 1, is often sensitised to its homologues, such as the major allergens of apple, Mal d 1, and celery, Api g 1, as well. Development of tools for the reliable, sensitive and quick detection of allergens present in various food products is essential for allergic persons to prevent the consumption of substances causing mild and even life-threatening immune responses. The use of monoclonal antibodies would ensure the specific detection of the harmful food content for a sensitised person. Mouse IgG antibody libraries were constructed from immunised mice and specific recombinant antibodies for Mal d 1 and Api g 1 were isolated from the libraries by phage display. More detailed characterisation of the resulting antibodies was carried out using ELISA, SPR experiments and immunoprecipitation assays. The allergen-specific Fab fragments exhibited high affinity towards the target recombinant allergens. Furthermore, the Fab fragments also recognised native allergens from natural sources. Interestingly, isolated Mal d 1-specific antibody bound also to Bet v 1, the main allergen eliciting the cross-reactivity syndrome between the birch pollen and apple. Despite the similarities in Api g 1 and Bet v 1 tertiary structures, the isolated Api g 1-specific antibodies showed no cross-reactivity to Bet v 1. Here, high-affinity allergen-specific recombinant antibodies were isolated with interesting binding properties. With further development, these antibodies can be utilised as tools for the specific and reliable detection of allergens from different consumable products. This study gives new preliminary insights to elucidate the mechanism behind the pollen

Adenosine triphosphate stimulates Aquifex aeolicus MutL endonuclease activity.

Directory of Open Access Journals (Sweden)

Jerome Mauris

2009-09-01

Full Text Available Human PMS2 (hPMS2 homologues act to nick 5' and 3' to misincorporated nucleotides during mismatch repair in organisms that lack MutH. Mn(++ was previously found to stimulate the endonuclease activity of these homologues. ATP was required for the nicking activity of hPMS2 and yPMS1, but was reported to inhibit bacterial MutL proteins from Thermus thermophilus and Aquifex aeolicus that displayed homology to hPMS2. Mutational analysis has identified the DQHA(X(2E(X(4E motif present in the C-terminus of PMS2 homologues as important for endonuclease activity.We examined the effect ATP had on the Mn(++ induced nicking of supercoiled pBR322 by full-length and mutant A. aeolicus MutL (Aae MutL proteins. Assays were single time point, enzyme titration experiments or reaction time courses. The maximum velocity for MutL nicking was determined to be 1.6+/-0.08x10(-5 s(-1 and 4.2+/-0.3x10(-5 s(-1 in the absence and presence of ATP, respectively. AMPPNP stimulated the nicking activity to a similar extent as ATP. A truncated Aae MutL protein composed of only the C-terminal 123 amino acid residues was found to nick supercoiled DNA. Furthermore, mutations in the conserved C-terminal DQHA(X(2E(X(4E and CPHGRP motifs were shown to abolish Aae MutL endonuclease activity.ATP stimulated the Mn(++ induced endonuclease activity of Aae MutL. Experiments utilizing AMPPNP implied that the stimulation did not require ATP hydrolysis. A mutation in the DQHA(X(2E(X(4E motif of Aae MutL further supported the role of this region in endonclease activity. For the first time, to our knowledge, we demonstrate that changing the histidine residue in the conserved CPHGRP motif abolishes endonucleolytic activity of a hPMS2 homologue. Finally, the C-terminal 123 amino acid residues of Aae MutL were sufficient to display Mn(++ induced nicking activity.

Studies of the expression of human poly(ADP-ribose) polymerase-1 in Saccharomyces cerevisiae and identification of PARP-1 substrates by yeast proteome microarray screening.

Science.gov (United States)

Tao, Zhihua; Gao, Peng; Liu, Hung-Wen

2009-12-15

Poly(ADP-ribosyl)ation of various nuclear proteins catalyzed by a family of NAD(+)-dependent enzymes, poly(ADP-ribose) polymerases (PARPs), is an important posttranslational modification reaction. PARP activity has been demonstrated in all types of eukaryotic cells with the exception of yeast, in which the expression of human PARP-1 was shown to lead to retarded cell growth. We investigated the yeast growth inhibition caused by human PARP-1 expression in Saccharomyces cerevisiae. Flow cytometry analysis reveals that PARP-1-expressing yeast cells accumulate in the G(2)/M stage of the cell cycle. Confocal microscopy analysis shows that human PARP-1 is distributed throughout the nucleus of yeast cells but is enriched in the nucleolus. Utilizing yeast proteome microarray screening, we identified 33 putative PARP-1 substrates, six of which are known to be involved in ribosome biogenesis. The poly(ADP-ribosyl)ation of three of these yeast proteins, together with two human homologues, was confirmed by an in vitro PARP-1 assay. Finally, a polysome profile analysis using sucrose gradient ultracentrifugation demonstrated that the ribosome levels in yeast cells expressing PARP-1 are lower than those in control yeast cells. Overall, our data suggest that human PARP-1 may affect ribosome biogenesis by modifying certain nucleolar proteins in yeast. The artificial PARP-1 pathway in yeast may be used as a simple platform to identify substrates and verify function of this important enzyme.

Vernalization response of Phleum pratense and its relationships to stem lignification and floral transition

DEFF Research Database (Denmark)

Seppänen, Mervi M; Pakarinen, Kirsi; Jokela, Venla

2010-01-01

Background Timothy is a long-day grass species well adapted for cultivation in northern latitudes. It produces elongating tillers not only in spring growth but also later in summer. As the quantity and quality of harvested biomass is dictated by canopy architecture and the proportion of stem......-forming flowering tillers, the regulation of flowering is of great interest in forage grass production. Methods Canopy architecture, stem morphology and freezing tolerance of vernalized timothy were investigated in greenhouse and field experiments. The molecular control of development was examined by analysing......, however, divergent morphology. Vernalization enhanced flowering, and the expression of the VRN1 homologue was elevated when the apex had passed into the reproductive stage. High VRN1 homologue expression was not associated with reduction in freezing tolerance and the expression coincided with increased...

The systemin receptor SYR1 enhances resistance of tomato against herbivorous insects.

Science.gov (United States)

Wang, Lei; Einig, Elias; Almeida-Trapp, Marilia; Albert, Markus; Fliegmann, Judith; Mithöfer, Axel; Kalbacher, Hubert; Felix, Georg

2018-03-01

The discovery in tomato of systemin, the first plant peptide hormone 1,2 , was a fundamental change for the concept of plant hormones. Numerous other peptides have since been shown to play regulatory roles in many aspects of the plant life, including growth, development, fertilization and interactions with symbiotic organisms 3-6 . Systemin, an 18 amino acid peptide derived from a larger precursor protein 7 , was proposed to act as the spreading signal that triggers systemic defence responses observed in plants after wounding or attack by herbivores 1,7,8 . Further work culminated in the identification of a leucine-rich repeat receptor kinase (LRR-RK) as the systemin receptor 160 (SR160) 9,10 . SR160 is a tomato homologue of Brassinosteroid Insensitive 1 (BRI1), which mediates the regulation of growth and development in response to the steroid hormone brassinolide 11-13 . However, a role of SR160/BRI1 as systemin receptor could not be corroborated by others 14-16 . Here, we demonstrate that perception of systemin depends on a pair of distinct LRR-RKs termed SYR1 and SYR2. SYR1 acts as a genuine systemin receptor that binds systemin with high affinity and specificity. Further, we show that presence of SYR1, although not decisive for local and systemic wound responses, is important for defence against insect herbivory.

Ebi/AP-1 suppresses pro-apoptotic genes expression and permits long-term survival of Drosophila sensory neurons.

Directory of Open Access Journals (Sweden)

Young-Mi Lim

Full Text Available Sensory organs are constantly exposed to physical and chemical stresses that collectively threaten the survival of sensory neurons. Failure to protect stressed neurons leads to age-related loss of neurons and sensory dysfunction in organs in which the supply of new sensory neurons is limited, such as the human auditory system. Transducin β-like protein 1 (TBL1 is a candidate gene for ocular albinism with late-onset sensorineural deafness, a form of X-linked age-related hearing loss. TBL1 encodes an evolutionarily conserved F-box-like and WD40 repeats-containing subunit of the nuclear receptor co-repressor/silencing mediator for retinoid and thyroid hormone receptor and other transcriptional co-repressor complexes. Here we report that a Drosophila homologue of TBL1, Ebi, is required for maintenance of photoreceptor neurons. Loss of ebi function caused late-onset neuronal apoptosis in the retina and increased sensitivity to oxidative stress. Ebi formed a complex with activator protein 1 (AP-1 and was required for repression of Drosophila pro-apoptotic and anti-apoptotic genes expression. These results suggest that Ebi/AP-1 suppresses basal transcription levels of apoptotic genes and thereby protects sensory neurons from degeneration.

Structural analysis of sumoylated proteins in Schizosaccharomyces pombe

DEFF Research Database (Denmark)

Jørgensen, Maria Louise Mønster

or Sap1-DNA interactions. In addition, the Sap1 function relationship was investigated in vivo by repeating a search for suppressors of the slow growth phenotype of abp1Δ cbh1Δ mutants. Autonomously replicating sequence binding protein 1 (Abp1) and cenp-B homologue 1 (Cbh1) co-localise with Sap1 in some...

Isolation and characterization of CXC receptor genes in a range of elasmobranchs.

Science.gov (United States)

Goostrey, Anna; Jones, Gareth; Secombes, Christopher J

2005-01-01

The CXC group of chemokines exert their cellular effects via the CXCR group of G-protein coupled receptors. Six CXCR genes have been identified in humans (CXCR1-6), and homologues to some of these have been isolated from a range of vertebrate species. Here we isolate and characterize CXCR genes from a range of elasmobranch species. One CXCR1/2 gene fragment isolated from Scyliorhinus caniculus (lesser spotted catshark), and two CXCR1/2 copies from each of the elasmobranchs, Cetorhinus maximus (basking shark), Carcharodon carcharias (great white shark), and Raja naevus (cuckoo ray), exhibit high similarity to both CXCR1 and CXCR2. The two copies evident in the cuckoo ray and lamniform sharks provide strong evidence of CXCR1/2 lineage specific duplication in rays and sharks. A CXCR fragment isolated from Lamna ditropis (salmon shark) shows high similarity to a range of CXCR4 genes and strong clustering with CXCR4 gene homologues was apparent during phylogenetic reconstruction.

The melatonin-MT1 receptor axis modulates tumor growth in PTEN-mutated gliomas.

Science.gov (United States)

Ma, Huihui; Wang, Zhen; Hu, Lei; Zhang, Shangrong; Zhao, Chenggang; Yang, Haoran; Wang, Hongzhi; Fang, Zhiyou; Wu, Lijun; Chen, Xueran

2018-02-19

More than 40% of glioma patients have tumors that harbor PTEN (phosphatase and tensin homologue deleted on chromosome ten) mutations; this disease is associated with poor therapeutic resistance and outcome. Such mutations are linked to increased cell survival and growth, decreased apoptosis, and drug resistance; thus, new therapeutic strategies focusing on inhibiting glioma tumorigenesis and progression are urgently needed. Melatonin, an indolamine produced and secreted predominantly by the pineal gland, mediates a variety of physiological functions and possesses antioxidant and antitumor properties. Here, we analyzed the relationship between PTEN and the inhibitory effect of melatonin in primary human glioma cells and cultured glioma cell lines. The results showed that melatonin can inhibit glioma cell growth both in culture and in vivo. This inhibition was associated with PTEN levels, which significantly correlated with the expression level of MT1 in patients. In fact, c-fos-mediated MT1 was shown to be a key modulator of the effect of melatonin on gliomas that harbor wild type PTEN. Taken together, these data suggest that melatonin-MT1 receptor complexes represent a potential target for the treatment of glioma. Copyright © 2018 Elsevier Inc. All rights reserved.

QTL list: [PGDBj Registered plant list, Marker list, QTL list, Plant DB link and Genome analysis methods[Archive

Lifescience Database Archive (English)

Full Text Available ene and FLC gene homologue concerning induction of flowering, the one of the homologue region of the top of A. thaliana chromosome 5 5 pN59E5 LG_O09 ... 2.7 ... 10.1139/g01-082 11681610

HTLV-2B Tax oncoprotein is modified by ubiquitination and sumoylation and displays intracellular localization similar to its homologue HTLV-1 Tax

International Nuclear Information System (INIS)

Turci, Marco; Lodewick, Julie; Righi, Paola; Polania, Angela; Romanelli, Maria Grazia; Bex, Francoise; Bertazzoni, Umberto

2009-01-01

HTLV-1 is more pathogenic than HTLV-2B. The difference is generally attributed to the properties of their individual transactivating Tax proteins. By using internal Flag-6His tagged Tax-1 and Tax-2B, which display transcriptional activities comparable to the untagged proteins and can be recognized by a single anti-Flag antibody, we demonstrate that Tax-2B is modified by ubiquitination and sumoylation. In addition, Tax2B is distributed in punctuate nuclear structures that include the RelA subunit of NF-κB, as has been previously demonstrated for Tax-1

The orthologue of Sjögren's syndrome nuclear autoantigen 1 (SSNA1 in Trypanosoma brucei is an immunogenic self-assembling molecule.

Directory of Open Access Journals (Sweden)

Helen P Price

Full Text Available Primary Sjögren's Syndrome (PSS is a highly prevalent autoimmune disease, typically manifesting as lymphocytic infiltration of the exocrine glands leading to chronically impaired lacrimal and salivary secretion. Sjögren's Syndrome nuclear autoantigen 1 (SSNA1 or NA14 is a major specific target for autoantibodies in PSS but the precise function and clinical relevance of this protein are largely unknown. Orthologues of the gene are absent from many of the commonly used model organisms but are present in Chlamyodomonas reinhardtii (in which it has been termed DIP13 and most protozoa. We report the functional characterisation of the orthologue of SSNA1 in the kinetoplastid parasite, Trypanosoma brucei. Both TbDIP13 and human SSNA1 are small coiled-coil proteins which are predicted to be remote homologues of the actin-binding protein tropomyosin. We use comparative proteomic methods to identify potential interacting partners of TbDIP13. We also show evidence that TbDIP13 is able to self-assemble into fibril-like structures both in vitro and in vivo, a property which may contribute to its immunogenicity. Endogenous TbDIP13 partially co-localises with acetylated α-tubulin in the insect procyclic stage of the parasite. However, deletion of the DIP13 gene in cultured bloodstream and procyclic stages of T. brucei has little effect on parasite growth or morphology, indicating either a degree of functional redundancy or a function in an alternative stage of the parasite life cycle.

AAA-ATPase FIDGETIN-LIKE 1 and Helicase FANCM Antagonize Meiotic Crossovers by Distinct Mechanisms.

Directory of Open Access Journals (Sweden)

Chloe Girard

2015-07-01

Full Text Available Meiotic crossovers (COs generate genetic diversity and are critical for the correct completion of meiosis in most species. Their occurrence is tightly constrained but the mechanisms underlying this limitation remain poorly understood. Here we identified the conserved AAA-ATPase FIDGETIN-LIKE-1 (FIGL1 as a negative regulator of meiotic CO formation. We show that Arabidopsis FIGL1 limits CO formation genome-wide, that FIGL1 controls dynamics of the two conserved recombinases DMC1 and RAD51 and that FIGL1 hinders the interaction between homologous chromosomes, suggesting that FIGL1 counteracts DMC1/RAD51-mediated inter-homologue strand invasion to limit CO formation. Further, depleting both FIGL1 and the previously identified anti-CO helicase FANCM synergistically increases crossover frequency. Additionally, we showed that the effect of mutating FANCM on recombination is much lower in F1 hybrids contrasting from the phenotype of inbred lines, while figl1 mutation equally increases crossovers in both contexts. This shows that the modes of action of FIGL1 and FANCM are differently affected by genomic contexts. We propose that FIGL1 and FANCM represent two successive barriers to CO formation, one limiting strand invasion, the other disassembling D-loops to promote SDSA, which when both lifted, leads to a large increase of crossovers, without impairing meiotic progression.

Structural insights into mechanisms of the small RNA methyltransferase HEN1

Energy Technology Data Exchange (ETDEWEB)

Huang, Ying; Ji, Lijuan; Huang, Qichen; Vassylyev, Dmitry G.; Chen, Xuemei; Ma, Jin-Biao; (UAB); (UCR)

2010-02-22

RNA silencing is a conserved regulatory mechanism in fungi, plants and animals that regulates gene expression and defence against viruses and transgenes. Small silencing RNAs of {approx}20-30 nucleotides and their associated effector proteins, the Argonaute family proteins, are the central components in RNA silencing. A subset of small RNAs, such as microRNAs and small interfering RNAs (siRNAs) in plants, Piwi-interacting RNAs in animals and siRNAs in Drosophila, requires an additional crucial step for their maturation; that is, 2'-O-methylation on the 3' terminal nucleotide. A conserved S-adenosyl-L-methionine-dependent RNA methyltransferase, HUA ENHANCER 1 (HEN1), and its homologues are responsible for this specific modification. Here we report the 3.1 {angstrom} crystal structure of full-length HEN1 from Arabidopsis in complex with a 22-nucleotide small RNA duplex and cofactor product S-adenosyl-L-homocysteine. Highly cooperative recognition of the small RNA substrate by multiple RNA binding domains and the methyltransferase domain in HEN1 measures the length of the RNA duplex and determines the substrate specificity. Metal ion coordination by both 2' and 3' hydroxyls on the 3'-terminal nucleotide and four invariant residues in the active site of the methyltransferase domain suggests a novel Mg{sup 2+}-dependent 2'-O-methylation mechanism.

Purification and crystallization of Vibrio fischeri CcdB and its complexes with fragments of gyrase and CcdA

Energy Technology Data Exchange (ETDEWEB)

De Jonge, Natalie, E-mail: ndejonge@vub.ac.be; Buts, Lieven; Vangelooven, Joris [Department of Molecular and Cellular Interactions, VIB, Pleinlaan 2, 1050 Brussels (Belgium); Laboratorium voor Ultrastructuur, Vrije Universiteit Brussel, Pleinlaan 2, 1050 Brussels (Belgium); Mine, Natacha; Van Melderen, Laurence [Laboratoire de Génétique des Procaryotes, Institut de Biologie et de Médecine, Université Libre de Bruxelles, Gosselies (Belgium); Wyns, Lode; Loris, Remy [Department of Molecular and Cellular Interactions, VIB, Pleinlaan 2, 1050 Brussels (Belgium); Laboratorium voor Ultrastructuur, Vrije Universiteit Brussel, Pleinlaan 2, 1050 Brussels (Belgium)

2007-04-01

A CcdB homologue from V. fischeri was overexpressed in E. coli and purified. The free protein was crystallized, as were its complexes with fragments of E. coli and V. fischeri gyrase and with the F-plasmid CcdA C-terminal domain. The ccd toxin–antitoxin module from the Escherichia coli F plasmid has a homologue on the Vibrio fischeri integron. The homologue of the toxin (CcdB{sub Vfi}) was crystallized in two different crystal forms. The first form belongs to space group I23 or I2{sub 1}3, with unit-cell parameter a = 84.5 Å, and diffracts to 1.5 Å resolution. The second crystal form belongs to space group C2, with unit-cell parameters a = 58.5, b = 43.6, c = 37.5 Å, β = 110.0°, and diffracts to 1.7 Å resolution. The complex of CcdB{sub Vfi} with the GyrA14{sub Vfi} fragment of V. fischeri gyrase crystallizes in space group P2{sub 1}2{sub 1}2{sub 1}, with unit-cell parameters a = 53.5, b = 94.6, c = 58.1 Å, and diffracts to 2.2 Å resolution. The corresponding mixed complex with E. coli GyrA14{sub Ec} crystallizes in space group C2, with unit-cell parameters a = 130.1, b = 90.8, c = 58.1 Å, β = 102.6°, and diffracts to 1.95 Å. Finally, a complex between CcdB{sub Vfi} and part of the F-plasmid antitoxin CcdA{sub F} crystallizes in space group P2{sub 1}2{sub 1}2{sub 1}, with unit-cell parameters a = 46.9, b = 62.6, c = 82.0 Å, and diffracts to 1.9 Å resolution.

Identification of a feline leukemia virus variant that can use THTR1, FLVCR1, and FLVCR2 for infection.

Science.gov (United States)

Shalev, Zvi; Duffy, Simon P; Adema, Karen W; Prasad, Rati; Hussain, Naveen; Willett, Brian J; Tailor, Chetankumar S

2009-07-01

The pathogenic subgroup C feline leukemia virus (FeLV-C) arises in infected cats as a result of mutations in the envelope (Env) of the subgroup A FeLV (FeLV-A). To better understand emergence of FeLV-C and potential FeLV intermediates that may arise, we characterized FeLV Env sequences from the primary FY981 FeLV isolate previously derived from an anemic cat. Here, we report the characterization of the novel FY981 FeLV Env that is highly related to FeLV-A Env but whose variable region A (VRA) receptor recognition sequence partially resembles the VRA sequence from the prototypical FeLV-C/Sarma Env. Pseudotype viruses bearing FY981 Env were capable of infecting feline, human, and guinea pig cells, suggestive of a subgroup C phenotype, but also infected porcine ST-IOWA cells that are normally resistant to FeLV-C and to FeLV-A. Analysis of the host receptor used by FY981 suggests that FY981 can use both the FeLV-C receptor FLVCR1 and the feline FeLV-A receptor THTR1 for infection. However, our results suggest that FY981 infection of ST-IOWA cells is not mediated by the porcine homologue of FLVCR1 and THTR1 but by an alternative receptor, which we have now identified as the FLVCR1-related protein FLVCR2. Together, our results suggest that FY981 FeLV uses FLVCR1, FLVCR2, and THTR1 as receptors. Our findings suggest the possibility that pathogenic FeLV-C arises in FeLV-infected cats through intermediates that are multitropic in their receptor use.

Bone-97 Alcohol and Skeletal Adaptation to Mechanical Usage

Science.gov (United States)

2002-10-01

nucleotide mismatches and recruit heterodimers of the MutL homologues (MLH1- PMS2 , MLH1-PMS1, or MLH1-MLH3) to base mismatches (32, 34). These MLH1...generate modified base pairs) (44, 46, 66). Indeed, cells deficient in MLH1 or its interacting protein PMS2 are resistant to apoptosis induced by cisplatin

Depletion of Acyl-Coenzyme A-Binding Protein Affects Sphingolipid Synthesis and Causes Vesicle Accumulation and Membrane Defects in Saccharomyces cerevisiae

DEFF Research Database (Denmark)

Gaigg, B; Neergaard, T B; Schneiter, R

2001-01-01

Deletion of the yeast gene ACB1 encoding Acb1p, the yeast homologue of the acyl-CoA-binding protein (ACBP), resulted in a slower growing phenotype that adapted into a faster growing phenotype with a frequency >1:10(5). A conditional knockout strain (Y700pGAL1-ACB1) with the ACB1 gene under contro...

Two-Channel Kondo Physics due to As Vacancies in the Layered Compound ZrAs1.58Se0.39

Science.gov (United States)

Kirchner, Stefan; Cichorek, T.; Bochenek, L.; Schmidt, M.; Niewa, R.; Czuluccki, A.; Auffermann, G.; Steglich, F.; Kniep, R.

We address the origin of the magnetic-field independent - | A | T 1 / 2 term observed in the low-temperature resistivity of several As-based metallic systems of the PbFCl structure type. For the layered compound ZrAs1.58Se0.39, we show that vacancies in the square nets of As give rise to the low-temperature transport anomaly over a wide temperature regime of almost two decades in temperature. This low-temperature behavior is in line with the non-magnetic version of the two-channel Kondo effect, whose origin we ascribe to a dynamic Jahn-Teller effect operating at the vacancy-carrying As layer with a C4 symmetry. The pair-breaking nature of the dynamical defects in the square nets of As explains the low superconducting transition temperature Tc 0 . 14 K of ZrAs1.58Se0.39, as compared to the free-of-vacancies homologue ZrP1.54S0.46 (Tc 3 . 7 K). Our findings should be relevant to a wide class of metals with disordered pnictogen layers.

Dual roles of TRF1 in tethering telomeres to the nuclear envelope and protecting them from fusion during meiosis.

Science.gov (United States)

Wang, Lina; Tu, Zhaowei; Liu, Chao; Liu, Hongbin; Kaldis, Philipp; Chen, Zijiang; Li, Wei

2018-01-08

Telomeres integrity is indispensable for chromosomal stability by preventing chromosome erosion and end-to-end fusions. During meiosis, telomeres attach to the inner nuclear envelope and cluster into a highly crowded microenvironment at the bouquet stage, which requires specific mechanisms to protect the telomeres from fusion. Here, we demonstrate that germ cell-specific knockout of a shelterin complex subunit, Trf1, results in arrest of spermatocytes at two different stages. The obliterated telomere-nuclear envelope attachment in Trf1-deficient spermatocytes impairs homologue synapsis and recombination, resulting in a pachytene-like arrest, while the meiotic division arrest might stem from chromosome end-to-end fusion due to the failure of recruiting meiosis specific telomere associated proteins. Further investigations uncovered that TRF1 could directly interact with Speedy A, and Speedy A might work as a scaffold protein to further recruit Cdk2, thus protecting telomeres from fusion at this stage. Together, our results reveal a novel mechanism of TRF1, Speedy A, and Cdk2 in protecting telomere from fusion in a highly crowded microenvironment during meiosis.

Pharmacology of (S)-homoquisqualic acid and (S)-2-amino-5-phosphonopentanoic acid [(S)-AP5] at cloned metabotropic glutamate receptors

DEFF Research Database (Denmark)

Bräuner-Osborne, Hans; Krogsgaard-Larsen, P

1998-01-01

1 In this study we have determined the pharmacological profile of (S)-quisqualic acid, (S)-2-amino-4-phosphonobutyric acid ((S)-AP4) and their higher homologues (S)-homoquisqualic acid, (S)-2-amino-5-phosphonopentanoic acid ((S)-AP5), respectively, and (R)-AP5 at subtypes of metabotropic (S)-glutamic...... demonstrate that incorporation of an additional carbon atom into the backbone of (S)-glutamic acid and its analogues, to give the corresponding homologues, and replacement of the terminal carboxyl groups by isosteric acidic groups have profound effects on the pharmacological profiles at mGlu receptor subtypes...... acid (mGlu) receptors expressed in Chinese hamster ovary cells. 2 (S)-Quisqualic acid was a potent mGlu1/mGlu5 agonist (EC50 values of 1.1 microM and 0.055 microM, respectively) showing no activity at mGlu2 and weak agonism at mGlu4 (EC50 approximately 1000 microM). 3 (S)-Homoquisqualic acid displayed...

Calcium/calmodulin kinase1 and its relation to thermotolerance and HSP90 in Sporothrix schenckii: an RNAi and yeast two-hybrid study

Directory of Open Access Journals (Sweden)

Gonzalez-Mendez Ricardo

2011-07-01

Full Text Available Abstract Background Sporothrix schenckii is a pathogenic dimorphic fungus of worldwide distribution. It grows in the saprophytic form with hyaline, regularly septated hyphae and pyriform conidia at 25°C and as the yeast or parasitic form at 35°C. Previously, we characterized a calcium/calmodulin kinase in this fungus. Inhibitors of this kinase were observed to inhibit the yeast cell cycle in S. schenckii. Results The presence of RNA interference (RNAi mechanism in this fungus was confirmed by the identification of a Dicer-1 homologue in S. schenckii DNA. RNAi technology was used to corroborate the role of calcium/calmodulin kinase I in S. schenckii dimorphism. Yeast cells were transformed with the pSilent-Dual2G (pSD2G plasmid w/wo inserts of the coding region of the calcium/calmodulin kinase I (sscmk1 gene. Transformants were selected at 35°C using resistance to geneticin. Following transfer to liquid medium at 35°C, RNAi transformants developed as abnormal mycelium clumps and not as yeast cells as would be expected. The level of sscmk1 gene expression in RNAi transformants at 35°C was less than that of cells transformed with the empty pSD2G at this same temperature. Yeast two-hybrid analysis of proteins that interact with SSCMK1 identified a homologue of heat shock protein 90 (HSP90 as interacting with this kinase. Growth of the fungus similar to that of the RNAi transformants was observed in medium with geldanamycin (GdA, 10 μM, an inhibitor of HSP90. Conclusions Using the RNAi technology we silenced the expression of sscmk1 gene in this fungus. RNAi transformants were unable to grow as yeast cells at 35°C showing decreased tolerance to this temperature. The interaction of SSCMK1 with HSP90, observed using the yeast two-hybrid assay suggests that this kinase is involved in thermotolerance through its interaction with HSP90. SSCMK1 interacted with the C terminal domain of HSP90 where effector proteins and co-chaperones interact. These

Cytochrome P4502D6(193-212): a new immunodominant epitope and target of virus/self cross-reactivity in liver kidney microsomal autoantibody type 1-positive liver disease.

Science.gov (United States)

Kerkar, Nanda; Choudhuri, Kaushik; Ma, Yun; Mahmoud, Ayman; Bogdanos, Dimitrios P; Muratori, Luigi; Bianchi, Francesco; Williams, Roger; Mieli-Vergani, Giorgina; Vergani, Diego

2003-02-01

Cytochrome P4502D6 (CYP2D6), target of liver kidney microsomal autoantibody type 1 (LKM1), characterizes autoimmune hepatitis type 2 (AIH2) but is also found in patients with chronic hepatitis C virus (HCV) infection. To provide a complete linear epitope B cell map of CYP2D6, we tested peptides spanning the entire sequence of CYP2D6. In addition to confirming previously described antigenic sites, we identified four new epitopes (193-212, 238-257, 268-287, and 478-497). CYP2D6(193-212) is immunodominant and was the target of 12 of 13 (93%) patients with AIH2 and 5 of 10 (50%) HCV/LKM1-positive patients. Because LKM1 is present in both AIH2 and a viral infection, we tested whether Abs to CYP2D6(193-212) arise through cross-reactive immunity between virus and self. We identified a hexameric sequence "RLLDLA" sharing 5 of 6 aa with "RLLDLS" of HCV(2985-2990) and all 6 aa with CMV(130-135). Of 17 CYP2D6(193-212)-reactive sera, 11 (7 AIH and 4 HCV) reacted by ELISA with the HCV homologue, 8 (5 AIH and 3 HCV) with the CMV homologue, and 8 (5 AIH and 3 HCV) showed double reactivity. Autoantibody binding to CYP2D6(193-212) was inhibited by preincubation with HCV(2977-2996) or CMV(121-140). Recombinant HCV-nonstructural protein 5 and CMV-UL98 proteins also inhibited Ab binding to CYP2D6(193-212). Affinity-purified CYP2D6(193-212)-specific Ab inhibited the metabolic activity of CYP2D6. The demonstrated similarity and cross-reactivity between CYP2D6(193-212) and two unrelated viruses suggests that multiple exposure to viruses mimicking self may represent an important pathway to the development of autoimmunity.

TRAP230/ARC240 and TRAP240/ARC250 Mediator subunits are functionally conserved through evolution

DEFF Research Database (Denmark)

Samuelsen, Camilla O; Baraznenok, Vera; Khorosjutina, Olga

2003-01-01

In Saccharomyces cerevisiae Mediator, a subgroup of proteins (Srb8, Srb9, Srb10, and Srb11) form a module, which is involved in negative regulation of transcription. Homologues of Srb10 and Srb11 are found in some mammalian Mediator preparations, whereas no clear homologues have been reported...... for Srb8 and Srb9. Here, we identify a TRAP240/ARC250 homologue in Schizosaccharomyces pombe and demonstrate that this protein, spTrap240, is stably associated with a larger form of Mediator, which also contains conserved homologues of Srb8, Srb10, and Srb11. We find that spTrap240 and Sch. pombe Srb8 (sp......Srb8) regulate the same distinct subset of genes and have indistinguishable phenotypic characteristics. Importantly, Mediator containing the spSrb8/spTrap240/spSrb10/spSrb11 subunits is isolated only in free form, devoid of RNA polymerase II. In contrast, Mediator lacking this module associates...

Contrasting behavior of heterochromatic and euchromatic chromosome portions and pericentric genome separation in pre-bouquet spermatocytes of hybrid mice.

Science.gov (United States)

Scherthan, Harry; Schöfisch, Karina; Dell, Thomas; Illner, Doris

2014-12-01

The spatial distribution of parental genomes has attracted much interest because intranuclear chromosome distribution can modulate the transcriptome of cells and influence the efficacy of meiotic homologue pairing. Pairing of parental chromosomes is imperative to sexual reproduction as it translates into homologue segregation and genome haploidization to counteract the genome doubling at fertilization. Differential FISH tagging of parental pericentromeric genome portions and specific painting of euchromatic chromosome arms in Mus musculus (MMU) × Mus spretus (MSP) hybrid spermatogenesis disclosed a phase of homotypic non-homologous pericentromere clustering that led to parental pericentric genome separation from the pre-leptoteneup to zygotene stages. Preferential clustering of MMU pericentromeres correlated with particular enrichment of epigenetic marks (H3K9me3), HP1-γ and structural maintenance of chromosomes SMC6 complex proteins at the MMU major satellite DNA repeats. In contrast to the separation of heterochromatic pericentric genome portions, the euchromatic arms of homeologous chromosomes showed considerable presynaptic pairing already during leptotene stage of all mice investigated. Pericentric genome separation was eventually disbanded by telomere clustering that concentrated both parental pericentric genome portions in a limited nuclear sector of the bouquet nucleus. Our data disclose the differential behavior of pericentromeric heterochromatin and the euchromatic portions of the parental genomes during homologue search. Homotypic pericentromere clustering early in prophase I may contribute to the exclusion of large repetitive DNA domains from homology search, while the telomere bouquet congregates and registers spatially separated portions of the genome to fuel synapsis initiation and high levels of homologue pairing, thus contributing to the fidelity of meiosis and reproduction.

Targeting natural killer cell reactivity by employing antibody to NKp46: implications for type 1 diabetes.

Directory of Open Access Journals (Sweden)

Rami Yossef

Full Text Available Natural killer (NK cells belong to the innate lymphoid cells. Their cytotoxic activity is regulated by the delicate balance between activating and inhibitory signals. NKp46 is a member of the primary activating receptors of NK cells. We previously reported that the NKp46 receptor is involved in the development of type 1 diabetes (T1D. Subsequently, we hypothesized that blocking this receptor could prevent or hinder disease development. To address this goal, we developed monoclonal antibodies for murine NKp46. One mAb, named NCR1.15, recognizes the mouse homologue protein of NKp46, named Ncr1, and was able to down-regulate the surface expression of NKp46 on primary murine NK cells following antibody injection in vivo. Additionally, NCR1.15 treatments were able to down-regulate cytotoxic activity mediated by NKp46, but not by other NK receptors. To test our primary assumption, we examined T1D development in two models, non-obese diabetic mice and low-dose streptozotocin. Our results show a significantly lower incidence of diabetic mice in the NCR1.15-treated group compared to control groups. This study directly demonstrates the involvement of NKp46 in T1D development and suggests a novel treatment strategy for early insulitis.

Improving the bioavailability and anticancer effect of the PCA-1/ALKBH3 inhibitor HUHS015 using sodium salt.

Science.gov (United States)

Mabuchi, Miyuki; Shimizu, Tadashi; Ueda, Masahiro; Sasakawa, Yuka; Nakao, Syuhei; Ueda, Yuko; Kawamura, Akio; Tsujikawa, Kazutake; Tanaka, Akito

2015-01-01

Prostate cancer antigen (PCA)-1/AlkB homologue 3 (ALKBH3) has been identified as a clinically significant factor and siRNA of PCA-1 inhibits DU145 proliferation both in vitro and in vivo. HUHS015 ( 1: ), a previous reported PCA-1 small-molecule inhibitor, was also effective without any obvious side-effects or toxicity. The potency of HUHS015, however, is not satisfying. We thought the reason is poor solubility of HUHS015 because insoluble material remained at the injection site after subcutaneous administration. To improve this inhibitor's solubility, we prepared various salts of HUHS015 and examined their solubility, which resulted in the selection of HUHS015 sodium salt ( 2: ) for further studies in vivo. Next, we compared the pharmacokinetics of 1: and 2: via several administration routes. We observed significant improvements in the pharmacokinetic parameters. For example, subcutaneous administration of 2: increased the area under the curve (AUC)0-24 by 8-fold compared to 1 and increased the suppressive effect on the proliferation of DU145 cells in a xenograft model. Copyright © 2015 International Institute of Anticancer Research (Dr. John G. Delinassios), All rights reserved.

Molecular cloning, sequence analysis and tissue expression of ...

African Journals Online (AJOL)

Proofreader

2017-10-01

Oct 1, 2017 ... p-distance model for amino acid substitutions. A bootstrap .... These were a thymine/cytosine (T/C) SNP and a thymine/adenine (T/A) SNP. ..... Two rat homologues of Drosophila achaete–scute specifically expressed in ...

Linear C32H66 hydrocarbon in the mixed state with C10H22 ...

Indian Academy of Sciences (India)

Unknown

S R Research Laboratory for Studies in Crystallization Phenomena, 10-1-96, ... mixed state with certain shorter chain length homologues (SMOLLENCs), estimated ... Methods. Five hydrocarbons of even carbon numbers, C10, C12, C14, C16 ...