
Sample records for forming region afgl


    Energy Technology Data Exchange (ETDEWEB)

    Jimenez-Serra, I.; Zhang, Q. [Harvard-Smithsonian Center for Astrophysics, 60 Garden St., Cambridge, MA 02138 (United States); Viti, S. [Department of Physics and Astronomy, University College London, Gower Place, London WC1E 6BT (United Kingdom); Martin-Pintado, J. [Centro de Astrobiologia (CSIC/INTA), Ctra. de Torrejon a Ajalvir km 4, E-28850 Torrejon de Ardoz, Madrid (Spain); De Wit, W.-J., E-mail:, E-mail:, E-mail:, E-mail:, E-mail: [European Southern Observatory, Alonso de Cordova 3107, Vitacura, Santiago (Chile)


    We present high angular resolution observations (0.''5 Multiplication-Sign 0.''3) carried out with the Submillimeter Array (SMA) toward the AFGL2591 high-mass star-forming region. Our SMA images reveal a clear chemical segregation within the AFGL2591 VLA 3 hot core, where different molecular species (Types I, II, and III) appear distributed in three concentric shells. This is the first time that such a chemical segregation is ever reported at linear scales {<=}3000 AU within a hot core. While Type I species (H{sub 2}S and {sup 13}CS) peak at the AFGL2591 VLA 3 protostar, Type II molecules (HC{sub 3}N, OCS, SO, and SO{sub 2}) show a double-peaked structure circumventing the continuum peak. Type III species, represented by CH{sub 3}OH, form a ring-like structure surrounding the continuum emission. The excitation temperatures of SO{sub 2}, HC{sub 3}N, and CH{sub 3}OH (185 {+-} 11 K, 150 {+-} 20 K, and 124 {+-} 12 K, respectively) show a temperature gradient within the AFGL2591 VLA 3 envelope, consistent with previous observations and modeling of the source. By combining the H{sub 2}S, SO{sub 2}, and CH{sub 3}OH images, representative of the three concentric shells, we find that the global kinematics of the molecular gas follow Keplerian-like rotation around a 40 M{sub Sun} star. The chemical segregation observed toward AFGL2591 VLA 3 is explained by the combination of molecular UV photodissociation and a high-temperature ({approx}1000 K) gas-phase chemistry within the low extinction innermost region in the AFGL2591 VLA 3 hot core.

  2. The HIFI spectral survey of AFGL 2591 (CHESS). II. Summary of the survey (United States)

    Kaźmierczak-Barthel, M.; van der Tak, F. F. S.; Helmich, F. P.; Chavarría, L.; Wang, K.-S.; Ceccarelli, C.


    Aims: This paper presents the richness of submillimeter spectral features in the high-mass star forming region AFGL 2591. Methods: As part of the Chemical Herschel Survey of Star Forming Regions (CHESS) key programme, AFGL 2591 was observed by the Herschel (HIFI) instrument. The spectral survey covered a frequency range from 480 to 1240 GHz as well as single lines from 1267 to 1901 GHz (i.e. CO, HCl, NH3, OH, and [CII]). Rotational and population diagram methods were used to calculate column densities, excitation temperatures, and the emission extents of the observed molecules associated with AFGL 2591. The analysis was supplemented with several lines from ground-based JCMT spectra. Results: From the HIFI spectral survey analysis a total of 32 species were identified (including isotopologues). Although the lines are mostly quite weak (∫TmbdV ~ few K km s-1), 268 emission and 16 absorption lines were found (excluding blends). Molecular column densities range from 6 × 1011 to 1 × 1019 cm-2 and excitation temperatures from 19 to 175 K. Cold (e.g. HCN, H2S, and NH3 with temperatures below 70 K) and warm species (e.g. CH3OH, SO2) in the protostellar envelope can be distinguished. Herschel is an ESA space observatory with science instruments provided by European-led Principal Investigator consortia and with important participation from NASA.Appendix A is available in electronic form at

  3. Kinematics of the inner thousand AU region around the young massive star AFGL 2591-VLA3: a massive disk candidate?

    NARCIS (Netherlands)

    Wang, K. -S.; van der Tak, F. F. S.; Hogerheijde, M. R.

    Context. Recent detections of disks around young high-mass stars support the idea of massive star formation through accretion rather than coalescence, but the detailed kinematics in the equatorial region of the disk candidates is not well known, which limits our understanding of the accretion


    International Nuclear Information System (INIS)

    Sanna, A.; Carrasco-González, C.; Menten, K. M.; Brunthaler, A.; Reid, M. J.; Moscadelli, L.; Rygl, K. L. J.


    We report on a detailed study of the water maser kinematics and radio continuum emission toward the most massive and young object in the star-forming region AFGL 2591. Our analysis shows at least two spatial scales of multiple star formation, one projected across 0.1 pc on the sky and another one at about 2000 AU from a ZAMS star of about 38 M ☉ . This young stellar object drives a powerful jet- and wind-driven outflow system with the water masers associated to the outflow walls, previously detected as a limb-brightened cavity in the NIR band. At about 1300 AU to the north of this object a younger protostar drives two bow shocks, outlined by arc-like water maser emission, at 200 AU either side of the source. We have traced the velocity profile of the gas that expands along these arc-like maser structures and compared it with the jet-driven outflow model. This analysis suggests that the ambient medium around the northern protostar is swept up by a jet-driven shock (>66 km s –1 ) and perhaps a lower-velocity (∼10 km s –1 ) wind with an opening angle of about 20° from the jet axis.


    Energy Technology Data Exchange (ETDEWEB)

    Sanna, A.; Carrasco-Gonzalez, C.; Menten, K. M.; Brunthaler, A. [Max-Planck-Institut fuer Radioastronomie, Auf dem Huegel 69, 53121 Bonn (Germany); Reid, M. J. [Harvard-Smithsonian Center for Astrophysics, 60 Garden Street, Cambridge, MA 02138 (United States); Moscadelli, L. [INAF, Osservatorio Astrofisico di Arcetri, Largo E. Fermi 5, 50125 Firenze (Italy); Rygl, K. L. J., E-mail: [IFSI-INAF, Istituto di Fisica dello Spazio Interplanetario, Via del Fosso del Cavaliere 100, 00133 Roma (Italy)


    We report on a detailed study of the water maser kinematics and radio continuum emission toward the most massive and young object in the star-forming region AFGL 2591. Our analysis shows at least two spatial scales of multiple star formation, one projected across 0.1 pc on the sky and another one at about 2000 AU from a ZAMS star of about 38 M{sub Sun }. This young stellar object drives a powerful jet- and wind-driven outflow system with the water masers associated to the outflow walls, previously detected as a limb-brightened cavity in the NIR band. At about 1300 AU to the north of this object a younger protostar drives two bow shocks, outlined by arc-like water maser emission, at 200 AU either side of the source. We have traced the velocity profile of the gas that expands along these arc-like maser structures and compared it with the jet-driven outflow model. This analysis suggests that the ambient medium around the northern protostar is swept up by a jet-driven shock (>66 km s{sup -1}) and perhaps a lower-velocity ({approx}10 km s{sup -1}) wind with an opening angle of about 20 Degree-Sign from the jet axis.

  6. Near-infrared Polarimetry of the Outflow Source AFGL 6366S: Detection of Circular Polarization (United States)

    Kwon, Jungmi; Nakagawa, Takao; Tamura, Motohide; Hough, James H.; Kandori, Ryo; Choi, Minho; Kang, Miju; Cho, Jungyeon; Nakajima, Yasushi; Nagata, Tetsuya


    We have carried out near-infrared circular and linear imaging polarimetry of the AFGL 6366S region. There is one large infrared reflection nebula associated with the AFGL 6366S cluster and one small infrared reflection nebula associated with AFGL 6366S NE. Prominent and extended polarized nebulosities over the AFGL 6366S cluster field are found to be composed of several components and local nebula peaks, and those nebulosities are illuminated by at least three sources, which is roughly consistent with a previous study. However, the detailed linear polarization patterns and their degrees differ from the earlier study. The brightest regions of the nebulae are illuminated by the IRAS/WISE source. In addition, we report the first detection of circular polarization (CP) in the reflection nebula associated with AFGL 6366S. The CP is as large as approximately 4% in the K s band, and the maximum CP extent is approximately 0.45 pc, which is comparable to that for the largest CP regions known to date, such as Orion and Mon R2, although the CP degrees are much smaller. The CP pattern is mostly quadrupolar, and its morphology resembles the shape of the C18O dense core. Therefore, the CP region is probably illuminated by the IRAS/WISE source and its polarization is amplified by the dichroic absorption of the dense core associated with the cluster. This is the ninth source whose degrees of CPs are measured to be greater than 3%, suggesting that large and extended infrared CP regions are common among mid- to high-mass young stellar objects.

  7. Energetic molecular outflow near AFGL 961: millimeter-wave and infrared observations

    International Nuclear Information System (INIS)

    Lada, C.J.; Gautier, T.N. III


    We report detailed millimeter-wave and near-infrared spectroscopy of the dynamically active region around the infrared source AFGL 961, near the Rosette nebula. Millimeter-wave 12 CO observations are used to study the high-velocity molecular flow around AFGL 961. These observations show that the high-velocity flow has a maximum extent of at least 6' or 2.9 pc at the distance of AFGL 961. The flow is found to be anisotropic, with redshifted high-velocity emission considerably more extended than blueshifted high-velocity emission. However, the flow does not appear to be as highly collimated as some other sources of high-velocity bipolar outflow. We also find the emission profiles to be asymmetric in velocity such that the integrated intensity of the redshifted high-velocity emission is on average 2.5 times greater than that of the blueshifted emission. The mass of the gas involved in the flow is determined to be approximately 19 M/sub sun/, and the kinetic energy of this gas is estimated to be about 8 x 10 46 ergs. These observations are interpreted as evidence that an energetic bipolar outflow of molecular gas is occurring near AFGL 961. The momentum of the outflowing molecular gas is large, and it is shown that this places strong constraints on possible physical mechanisms which may be driving the outflow. The near-infrared spectrum of AFGL 961 from 1.4-2.4 μm was obtained in order to study the conditions immediately around the infrared source which may be driving the molecular outflow


    International Nuclear Information System (INIS)

    Williams, Jonathan P.; Mann, Rita K.; Beaumont, Christopher N.; Swift, Jonathan J.; Adams, Joseph D.; Hora, Joe; Kassis, Marc; Lada, Elizabeth A.; Roman-Zuniga, Carlos G.


    We present arcsecond resolution mid-infrared and millimeter observations of the center of the young stellar cluster AFGL961 in the Rosette molecular cloud. Within 0.2 pc of each other, we find an early B star embedded in a dense core, a neighboring star of similar luminosity with no millimeter counterpart, a protostar that has cleared out a cavity in the circumcluster envelope, and two massive, dense cores with no infrared counterparts. An outflow emanates from one of these cores, indicating a deeply embedded protostar, but the other is starless, bound, and appears to be collapsing. The diversity of states implies either that protostellar evolution is faster in clusters than in isolation or that clusters form via quasi-static rather than dynamic collapse. The existence of a pre-stellar core at the cluster center shows that some star formation continues after and in close proximity to massive, ionizing stars.


    Energy Technology Data Exchange (ETDEWEB)

    Liu, Tie; Kim, Kee-Tae; Lee, Chang-Won; Cho, Se-Hyung [Korea Astronomy and Space Science Institute 776, Daedeokdae-ro, Yuseong-gu, Daejeon, 305-348 (Korea, Republic of); Zhang, Qizhou [Harvard-Smithsonian Center for Astrophysics, 60 Garden Street, Cambridge, MA 02138 (United States); Wu, Yuefang [Department of Astronomy, Peking University, Beijing 100871 (China); Goldsmith, Paul F. [Jet Propulsion Laboratory, California Institute of Technology, 4800 Oak Grove Drive, Pasadena, CA 91109 (United States); Li, Di [National Astronomical Observatories, Chinese Academy of Science, A20 Datun Road, Chaoyang District, Beijing 100012 (China); Liu, Sheng-Yuan; Chen, Huei-Ru [Institute of Astronomy and Astrophysics, Academia Sinica, Taipei, Taiwan (China); Tatematsu, Ken’ichi [National Astronomical Observatory of Japan, 2-21-1 Osawa, Mitaka, Tokyo 181-8588 (Japan); Wang, Ke [European Southern Observatory, Karl-Schwarzschild-Str. 2, D-85748 Garching bei München (Germany); Lee, Jeong-Eun [School of Space Research, Kyung Hee University, Yongin-Si, Gyeonggi-Do 446-701 (Korea, Republic of); Qin, Sheng-Li [Department of Astronomy, Yunnan University, and Key Laboratory of Astroparticle Physics of Yunnan Province, Kunming 650091 (China); Mardones, Diego, E-mail: [Departamento de Astronomía, Universidad de Chile, Casilla 36-D, Santiago (Chile)


    Most bipolar outflows are associated with individual young stellar objects and have small opening angles. Here we report the discovery of an extremely wide-angle (∼180°) bipolar outflow (“EWBO”) in a cluster forming region AFGL 5142 from low-velocity emission of the HCN (3–2) and HCO{sup +} (3–2) lines. This bipolar outflow is along a north-west to south-east direction with a line of sight flow velocity of about 3 km s{sup −1} and is spatially connected to the high-velocity jet-like outflows. It seems to be a collection of low-velocity material entrained by the high-velocity outflows due to momentum feedback. The total ejected mass and mass loss rate due to both high-velocity jet-like outflows and the “EWBO” are ∼24.5 M {sub ⊙} and ∼1.7 × 10{sup −3} M {sub ⊙} yr{sup −1}, respectively. Global collapse of the clump is revealed by the “blue profile” in the HCO{sup +} (1–0) line. A hierarchical network of filaments was identified in NH{sub 3} (1, 1) emission. Clear velocity gradients of the order of 10 km s{sup −1} pc{sup −1} are found along filaments, indicating gas inflow along the filaments. The sum of the accretion rate along filaments and mass infall rate along the line of sight is ∼3.1 × 10{sup −3} M {sub ⊙} yr{sup −1}, which exceeds the total mass loss rate, indicating that the central cluster is probably still gaining mass. The central cluster is highly fragmented and 22 condensations are identified in 1.1 mm continuum emission. The fragmentation process seems to be determined by thermal pressure and turbulence. The magnetic field may not play an important role in fragmentation.

  10. Daily Magnetograms for 1979 from the AFGL Network. (United States)


    produced the edited data shown in these plots and who lost his life in October 1982 while the work was under way. Many other persons have also...S317g 42919 24 OCT 79 (LAY 79.297) UIVERSAL TlrE AFGL r’bETt’ETER NErUcwa 304 5 NO.. ’.e> FLLA jTE X CiUtFffT40i’EL.Sr 1c I’III 161127 p C

  11. OH outflows in star-forming regions

    International Nuclear Information System (INIS)

    Mirabel, I.F.; Ruiz, A.; Rodriguez, L.F.; Canto, J.; Universidad de Puer; Universidad de Puerto Rico, Rio Piedras; Universidad Nacional Autonoma de Mexico, Mexico City)


    The results from a survey for high-velocity OH in molecular outflows in star-forming regions are reported. High-velocity OH was detected in absorption in nine of these regions. When the telescope beam can resolve the outflows, they show similar anisotropic angular distribution as the redshifted and blueshifted CO. The OH transitions are markedly subthermal since for several sources it is found that the radiation that is being absorbed is a background continuum constituted by the cosmic component plus a small Galactic contribution. The absorbing OH appears to trace gas with higher velocities and lower densities than does the CO and, in some cases, provides information on the structure of the outflows at larger distances from the central source. At scales of 0.1 pc, the outflows are elongated in the direction of the steepest density gradient of the ambient cloud, suggesting that the large-scale collimation of the outflow is produced by the density structure of the ambient cloud. 29 references

  12. The HIFI spectral survey of AFGL 2591 (CHESS). III. Chemical structure of the protostellar envelope

    NARCIS (Netherlands)

    Kaźmierczak-Barthel, M.; Semenov, D. A.; van der Tak, F. F. S.; Chavarría, L.; van der Wiel, M. H. D.

    Aims: The aim of this work is to understand the richness of chemical species observed in the isolated high-mass envelope of AFGL 2591, a prototypical object for studying massive star formation. Methods: Based on HIFI and JCMT data, the molecular abundances of species found in the protostellar

  13. Problems of regional innovation strategy forming

    Directory of Open Access Journals (Sweden)

    I. M. Golova


    Full Text Available The author considered problems and contradictions of modern innovation policy in Russia. It is shown, that at present time regions are removed from management of science-technical complex and spatial priorities are not produced. It is a serious factor of risk for conservation perspectives of innovation development for Russia. With taking into account of world experience main districts of rise effects regional police were formulated. It is underlined, that creation conditions for transformation of regional authorities in active subjects of innovation policy is necessary condition for building vital innovation system. It is shown, that state innovation policy must be constructed at combination of next principles: a support science-technical potential of regions — generators of innovation and creation conditions for its realization; b using of innovations for evening-out disproportions of social-economic development between regions; c widening powers and financial possibilities of regions at management of innovation climate. Methodical approaches for making effective mechanisms of management of innovation processes of territory are opened. Typology of Russian regions with high and middle degree of innovation climate is proposed, which takes level of science and innovation potential of territory and also degree of comfort of social-economic conditions for development of innovation activity are offered. Peculiarities of innovation strategy for different types of regions are defined. This typology may be used for substantiation spatial priorities of innovation strategy of Russia.

  14. Extreme Variables in Star Forming Regions (United States)

    Contreras Peña, Carlos Eduardo


    in two multi-epoch infrared surveys: the UKIDSS Galactic Plane Survey (GPS) and the Vista Variables in the Via Lactea (VVV). In order to further investigate the nature of the selected variable stars, we use photometric information arising from public surveys at near- to far-infrared wavelengths. In addition we have performed spectroscopic and photometric follow-up for a large subset of the samples arising from GPS and VVV. We analyse the widely separated two-epoch K-band photometry in the 5th, 7th and 8th data releases of the UKIDSS Galactic Plane Survey. We find 71 stars with ΔK > 1 mag, including 2 previously known OH/IR stars and a Nova. Even though the mid-plane is mostly excluded from the dataset, we find the majority (66%) of our sample to be within known star forming regions (SFRs), with two large concentrations in the Serpens OB2 association (11 stars) and the Cygnus-X complex (27 stars). The analysis of the multi-epoch K-band photometry of 2010-2012 data from VVV covering the Galactic disc at |b| explained as arising from shock-excited emission caused by molecular outflows. Whether these molecular outflows are related to outbursts events cannot be confirmed from our data. Adding the GPS and VVV spectroscopic results, we find that between 6 and 14 objects are new additions to the FUor class from their close resemblance to the near-infrared spectra of FUors, and at least 23 more objects are new additions to the eruptive variable class. For most of these we are unable to classify them into any of the original definitions for this variable class. In any case, we are adding up to 37 new stars to the eruptive variable class which would double the current number of known objects. We note that most objects are found to be deeply embedded optically invisible stars, thus increasing the number of objects belonging to this subclass by a much larger factor. In general, objects in our samples which are found to be likely eruptive variable stars show a mixture of

  15. Optical polarimetry of star-forming regions

    Energy Technology Data Exchange (ETDEWEB)

    Gledhill, T M


    The polarimetric investigation of nebulosity associated with loss-mass pre-main sequence (PMS) stellar objects is detailed. Three regions of on-going star formation are considered, specifically, the Haro 6-5 and the HL/XZ Tau systems - both associated with dark clouds in the Taurus complex - and the PV Cephei nebulosity near NGC7023. In each region the imaging observations suggest bipolarity in the optical structure of the nebulosity, and the polarimetric data are used to determine the locations of the illuminating sources. Evidence is found for the association of circumstellar discs of obscuration with the PMS objects Haro 6-5A (FS Tau), Haro 6-5B, HL Tau, and PV Cephei. In each case the polarimetric data suggest that the local magnetic field has played an important role in the evolution of the star and the circumstellar material. Examination of the source-region polarization maps suggests that at least one of the objects considered is surrounded by a dust grain-aligning magnetic field with a predominantly toroidal geometry in the plane of the circumstellar disc. Implications for current theories of outflow acceleration and cloud evolution are discussed.

  16. Forming controlled inset regions by ion implantation and laser bombardment

    International Nuclear Information System (INIS)

    Gibbons, J.F.


    A semiconductor integrated circuit structure in which the inset regions are ion implanted and laser annealed to maintain substantially the dimensions of the implantation and the method of forming inset implanted regions having controlled dimensions

  17. Daily Magnetograms for 1982 from the AFGL (Air Force Geophysics Laboratory) Network. (United States)


    who as a IN high-school student, carried out much of the computer work that produced the A edited data shown in these plots and who lost his life in...34,. . .. . . . . .. .. .. .. . . . . .. . . . . . .. . . . . .. . ... .. . . .... .. .. .... *... II * .- eeee OM 04eO 66 eeee OMe IM 12 14e9 1600 18 2M 22 66 .’.W 06 A 82 (DAY 82.M6) UIVERSAL TIrE WGL...lit’ 54437 1 S4571 55315 S32Sg9. .5 42871 F, .. . . . . . . .- - - 88 MW 82 (DAY 82.128) UIVERSAL TIME AFGL MAGN~ETEER PETUFlJ 135

  18. Spatial and kinematic structure of Monoceros star-forming region (United States)

    Costado, M. T.; Alfaro, E. J.


    The principal aim of this work is to study the velocity field in the Monoceros star-forming region using the radial velocity data available in the literature, as well as astrometric data from the Gaia first release. This region is a large star-forming complex formed by two associations named Monoceros OB1 and OB2. We have collected radial velocity data for more than 400 stars in the area of 8 × 12 deg2 and distance for more than 200 objects. We apply a clustering analysis in the subspace of the phase space formed by angular coordinates and radial velocity or distance data using the Spectrum of Kinematic Grouping methodology. We found four and three spatial groupings in radial velocity and distance variables, respectively, corresponding to the Local arm, the central clusters forming the associations and the Perseus arm, respectively.

  19. Multimolecular studies of Galactic star-forming regions

    NARCIS (Netherlands)

    Baan, W. A.; Loenen, A. F.; Spaans, M.


    Molecular emission-line observations of isolated Galactic star-forming regions are used to model the physical properties of the molecular interstellar medium in these systems. Observed line ratios are compared with the results predicted by models that incorporate gas-phase chemistry and the heating

  20. Forming the development program of industrial cooperation in the region

    Directory of Open Access Journals (Sweden)

    Aleksandr Viktorovich Makarov


    Full Text Available The paper defines the role of industrial cooperation in the process of ensuring the competitiveness of the Russian economy. Economic nature of this form of long-term cooperation specified subjects and objects of cooperatives, the effects of its introduction is disclosed. Formed concept of the Programme of development of industrial cooperation in the region, taking into account the state gained in building industrial complex and the differentiation of state support measures at various stages of development cooperation. Forecast parameters on implementation of cooperation development in Sverdlovsk region for the period up to 2020 are formed. According to the reported characteristics and conducted author's calculations, based on realistic projections of engineering enterprises of Sverdlovsk region, a four-indicator sectorgram for the performance evaluation of the program for the development of industrial and technological cooperation in the field of engineering is presented. The described approach to the establishment of a development program for the industrial cooperation in the region can monitor the situation, timely adjust regional performance standards and policies in this field


    International Nuclear Information System (INIS)

    Indriolo, Nick; Neufeld, D. A.; Seifahrt, A.; Richter, M. J.


    We present ground-based observations of the ν 1 and ν 3 fundamental bands of H 2 O toward the massive protostar AFGL 2136 IRS 1, identifying absorption features due to 47 different ro-vibrational transitions between 2.468 μm and 2.561 μm. Analysis of these features indicates the absorption arises in warm (T = 506 ± 25 K), very dense (n(H 2 ) > 5 × 10 9 cm –3 ) gas, suggesting an origin close to the central protostar. The total column density of warm water is estimated to be N(H 2 O) = (1.02 ± 0.02) × 10 19 cm –2 , giving a relative abundance of N(H 2 O)/N(H 2 ) ≈ 10 –4 . Our study represents the first extensive use of water vapor absorption lines in the near infrared, and demonstrates the utility of such observations in deriving physical parameters

  2. Form factors and QCD in spacelike and timelike region

    International Nuclear Information System (INIS)

    A.P. Bakulev; A.V. Radyushkin; N.G. Stefanis


    The authors analyze the basic hard exclusive processes: πγ * γ-transition, pion and nucleon electromagnetic form factors, and discuss the analytic continuation of QCD formulas from the spacelike q 2 2 > 0 of the relevant momentum transfers. They describe the construction of the timelike version of the coupling constant α s . They show that due to the analytic continuation of the collinear logarithms each eigenfunction of the evolution equation acquires a phase factor and investigate the resulting interference effects which are shown to be very small. They found no sources for the K-factor-type enhancements in the perturbative QCD contribution to the hadronic form factors. To study the soft part of the pion electromagnetic form factor, they use a QCD sum rule inspired model and show that there are non-canceling Sudakov double logarithms which result in a K-factor-type enhancement in the timelike region

  3. Form factors and QCD in spacelike and timelike regions

    International Nuclear Information System (INIS)

    Bakulev, A. P.; Radyushkin, A. V.; Stefanis, N. G.


    We analyze the basic hard exclusive processes, the πγ * γ-transition and the pion and nucleon electromagnetic form factors, and discuss the analytic continuation of QCD formulas from the spacelike q 2 2 >0 of the relevant momentum transfers. We describe the construction of the timelike version of the coupling constant α s . We show that due to the analytic continuation of the collinear logarithms, each eigenfunction of the evolution equation acquires a phase factor and investigate the resulting interference effects which are shown to be very small. We find no sources for the K-factor-type enhancements in the perturbative QCD contribution to the hadronic form factors. To study the soft part of the pion electromagnetic form factor, we use a QCD sum rule inspired model and show that there are noncanceling Sudakov double logarithms which result in a K-factor-type enhancement in the timelike region

  4. Areas and forms of regional cooperation in multi-structured (matreshka-style) regions (Tyumen region, Russia)




    The problem of the administrative, economic and social sustainability of a group consisting of neighboring regions with close ties has no clear solution yet. Should closely-tied regions in the long run form a centralized system of administrative bodies, compress their budgets into one, and construct unified social programs, or not? To answer this question, in the article we describe a case that represents the paramount form of cooperation amongst closely-tied regions. It is the case of the so...

  5. Dynamical evolution of star-forming regions - II. Basic kinematics (United States)

    Parker, Richard J.; Wright, Nicholas J.


    We follow the dynamical evolution of young star-forming regions with a wide range of initial conditions and examine how the radial velocity dispersion, σ, evolves over time. We compare this velocity dispersion to the theoretically expected value for the velocity dispersion if a region were in virial equilibrium, σvir and thus assess the virial state (σ/σvir) of these systems. We find that in regions that are initially subvirial, or in global virial equilibrium but subvirial on local scales, the system relaxes to virial equilibrium within several million years, or roughly 25-50 crossing times, according to the measured virial ratio. However, the measured velocity dispersion, σ, appears to be a bad diagnostic of the current virial state of these systems as it suggests that they become supervirial when compared to the velocity dispersion estimated from the virial mass, σvir. We suggest that this discrepancy is caused by the fact that the regions are never fully relaxed, and that the early non-equilibrium evolution is imprinted in the one-dimensional velocity dispersion at these early epochs. If measured early enough (interquartile range (IQR) dispersion, with measures of spatial structure, places stronger constraints on the dynamical history of a region than using the velocity dispersion in isolation.

  6. Academy panel proposes new form of regional institution

    International Nuclear Information System (INIS)

    Kloman, E.H.


    A panel of the National Academy of Public Administration has proposed development of a new form of interstate regional institution as an instrument for the siting, licensing, and regulating of nuclear facilities. Noting the danger that the nation's energy supplies may prove inadequate to meet basic needs of the economy despite increasing emphasis on greater use of coal and energy conservation, the panel pointed to the virtual stalemate in the national decision-making process for siting and licensing nuclear plants. A basic cause of the logjam is the growing conflict and overlap between federal and state agencies for authorizing nuclear development. The panel recommended setting up a new form of regional organization to fill an institutional void between federal and state levels of government. The proposed regional organizations would be established through federal legislation preempting to the Federal Government the regulation of siting, licensing, and construction of nuclear facilities. They would have jurisdiction over all matters in the operation of nuclear plants relating to public health and safety including those environmental factors and socio-economic factors covered in the preparation of environmental impact statements

  7. Do protostellar fountains shape the regional core mass function?

    International Nuclear Information System (INIS)

    Li Jin-Zeng; Huang Ya-Fang; Carlos Mallamaci Claudio; César Podestà Ricardo; Actis Vicente Eloy; Maria Pacheco Ana


    The emerging massive binary system associated with AFGL 961 signifies the latest generation of massive star and cluster formation in the Rosette Molecular Complex. We present the detection of a compact cluster of dusty cores toward the AFGL 961 region based on continuum imaging at 1.3 mm by the Submillimeter Array. The binary components of AFGL 961 are associated with the most intensive millimeter emission cores or envelopes, confirming that they are indeed in an early stage of evolution. The other massive cores, however, are found to congregate in the close vicinity of the central high-mass protostellar binary. They have no apparent infrared counterparts and are, in particular, well aligned transverse to the bipolar molecular outflows originating from AFGL 961. This provides evidence for a likely triggered origin of the massive cores. All 40 individual cores with masses ranging between 0.6 and 15 Msun were detected above a 3 σ level of 3.6 mJy beam −1 (or 0.4 Msun), based on which we derive a total core mass of 107 Msun in the AFGL 961 region. As compared to the stellar initial mass function, a shallow slope of 1.8 is, however, derived from the best fit to the mass spectrum of the millimeter cores with a prestellar and/or protostellar origin. The flatter core mass distribution in the AFGL 961 region is attributed here to dynamic perturbations from the massive molecular outflows that originated from the massive protostellar binary, which may have altered the otherwise more quiescent conditions of core or star formation, enhanced the formation of more massive cores and, as a result, influenced the core mass distribution in its close vicinity.

  8. The HIFI spectral survey of AFGL 2591 (CHESS). III. Chemical structure of the protostellar envelope (United States)

    Kaźmierczak-Barthel, M.; Semenov, D. A.; van der Tak, F. F. S.; Chavarría, L.; van der Wiel, M. H. D.


    Aims: The aim of this work is to understand the richness of chemical species observed in the isolated high-mass envelope of AFGL 2591, a prototypical object for studying massive star formation. Methods: Based on HIFI and JCMT data, the molecular abundances of species found in the protostellar envelope of AFGL 2591 were derived with a Monte Carlo radiative transfer code (Ratran), assuming a mixture of constant and 1D stepwise radial profiles for abundance distributions. The reconstructed 1D abundances were compared with the results of the time-dependent gas-grain chemical modeling, using the best-fit 1D power-law density structure. The chemical simulations were performed considering ages of 1-5 × 104 years, cosmic ray ionization rates of 5-500 × 10-17 s-1, uniformly-sized 0.1-1 μm dust grains, a dust/gas ratio of 1%, and several sets of initial molecular abundances with C/O 1. The most important model parameters varied one by one in the simulations are age, cosmic ray ionization rate, external UV intensity, and grain size. Results: Constant abundance models give good fits to the data for CO, CN, CS, HCO+, H2CO, N2H+, CCH, NO, OCS, OH, H2CS, O, C, C+, and CH. Models with an abundance jump at 100 K give good fits to the data for NH3, SO, SO2, H2S, H2O, HCl, and CH3OH. For HCN and HNC, the best models have an abundance jump at 230 K. The time-dependent chemical model can accurately explain abundance profiles of 15 out of these 24 species. The jump-like radial profiles for key species like HCO+, NH3, and H2O are consistent with the outcome of the time-dependent chemical modeling. The best-fit model has a chemical age of ~10-50 kyr, a solar C/O ratio of 0.44, and a cosmic-ray ionization rate of ~5 × 10-17 s-1. The grain properties and the intensity of the external UV field do not strongly affect the chemical structure of the AFGL 2591 envelope, whereas its chemical age, the cosmic-ray ionization rate, and the initial abundances play an important role. Conclusions: We

  9. Stellar Feedback in Massive Star-Forming Regions (United States)

    Baldwin, Jack; Pellegrini, Eric; Ferland, Gary; Murray, Norm; Hanson, Margaret


    Star formation rates and chemical evolution are controlled in part by the interaction of stellar radiation and winds with the remnant molecular gas from which the stars have formed. We are carrying out a detailed, panchromatic study in the two nearest giant star-forming regions to nail down the physics that produces the 10-20 parsec bubbles seen to surround young massive clusters in the Milky Way. This will determine if and how the clusters disrupt their natal giant molecular clouds (GMCs). Here we request 4 nights on the Blanco telescope to obtain dense grids of optical long-slit spectra criss-crossing each nebula. These will cover the [S II] doublet (to measure N_e) and also [O III], H(beta), [O I], H(alpha) and [N II] to measure the ionization mechanism and ionization parameter, at ~3000 different spots in each nebula. From this we can determine a number of dynamically important quantities, such as the gas density and temperature, hence pressure in and around these bubbles. These quantities can be compared to the dynamical (gravitationally induced) pressure, and the radiation pressure. All can be employed in dynamical models for the evolution of a GMC under the influence of an embedded massive star cluster. This research will elucidate the detailed workings of the star-forming regions which dominate the star formation rate in the Milky Way, and also will steadily improve our calibration and understanding of more distant, less well-resolved objects such as ULIRGS, Lyman break, and submillimeter galaxies.

  10. VLBA Changes Picture of Famous Star-Forming Region (United States)


    Using the supersharp radio "vision" of the National Science Foundation's Very Long Baseline Array (VLBA), astronomers have made the most precise measurement ever of the distance to a famous star-forming region. The measurement -- to the heavily studied Orion Nebula -- changes scientists' understanding of the characteristics of the young stars in the region. Parallax Diagram Trigonometric Parallax method determines distance to star by measuring its slight shift in apparent position as seen from opposite ends of Earth's orbit. CREDIT: Bill Saxton, NRAO/AUI/NSF Star Track Apparent track of star GMR A in the Orion Nebula Cluster, showing shift caused by Earth's orbital motion and star's movement in space. CREDIT: Sandstrom et al., NRAO/AUI/NSF Click on Images for Larger Files "This measurement is four times more precise than previous distance estimates. Because our measurement reduces the distance to this region, it tells us that the stars there are less bright than thought before, and changes the estimates of their ages," said Geoff Bower, an astronomer at the University of California at Berkeley. Bower, along with Karin Sandstrom, J.E.G. Peek, Alberto Bolatto and Richard Plambeck, all of Berkeley, published their findings in the October 10 edition of the Astrophysical Journal. The scientists determined the distance to a star called GMR A, one of a cluster of stars in the Orion Nebula, by measuring the slight shift in the star's apparent position in the sky caused by the Earth's motion around the Sun. Observing the star when the Earth is on opposite sides of its annual orbit allows astronomers to measure the angle of this small shift and thus provides a direct trigonometric calculation of its distance. "By using this technique, called parallax, we get a direct measurement that does not depend on various assumptions that are required to use less-direct methods," Bower said. "Only a telescope with the remarkable ability to see fine detail that is provided by the VLBA is


    International Nuclear Information System (INIS)

    Luhman, K. L.; Allen, P. R.; Espaillat, C.; Hartmann, L.; Calvet, N.


    We have analyzed nearly all images of the Taurus star-forming region at 3.6, 4.5, 5.8, 8.0, and 24 μm that were obtained during the cryogenic mission of the Spitzer Space Telescope (46 deg 2 ) and have measured photometry for all known members of the region that are within these data, corresponding to 348 sources, or 99% of the known stellar population. By combining these measurements with previous observations with the Spitzer Infrared Spectrograph and other facilities, we have classified the members of Taurus according to whether they show evidence of circumstellar disks and envelopes (classes I, II, and III). Through these classifications, we find that the disk fraction in Taurus, N(II)/N(II+III), is ∼75% for solar-mass stars and declines to ∼45% for low-mass stars and brown dwarfs (0.01-0.3 M sun ). This dependence on stellar mass is similar to that measured for Chamaeleon I, although the disk fraction in Taurus is slightly higher overall, probably because of its younger age (1 Myr versus 2-3 Myr). In comparison, the disk fraction for solar-mass stars is much lower (∼20%) in IC 348 and σ Ori, which are denser than Taurus and Chamaeleon I and are roughly coeval with the latter. These data indicate that disk lifetimes for solar-mass stars are longer in star-forming regions that have lower stellar densities. Through an analysis of multiple epochs of Spitzer photometry that are available for ∼200 Taurus members, we find that stars with disks exhibit significantly greater mid-infrared (mid-IR) variability than diskless stars, which agrees with the results of similar variability measurements for a smaller sample of stars in Chamaeleon I. The variability fraction for stars with disks is higher in Taurus than in Chamaeleon I, indicating that the IR variability of disks decreases with age. Finally, we have used our data in Taurus to refine the observational criteria for primordial, evolved, and transitional disks. The ratio of the number of evolved and

  12. H2O masers in star-forming regions

    International Nuclear Information System (INIS)

    Downes, D.


    Water vapour near star forming regions was first detected by Cheung et al. (1969) and shortly thereafter was recognised to be maser emission. In spite of this 15 year history of H 2 O observations, the problem of interpreting such strong H 2 O masers as W49 and Orion is still very acute. Not one of the models now available can explain in an unconstrained fashion why a very large maser flux can emanate from clouds of such small size. Whereas some models proposed to explain OH masers have retained their plausibility under the pressure of new observations, H 2 O models have not. The author outlines the background of the H 2 O problem, stating that the strongest of the masers discovered are still not satisfactorily explained today. (Auth.)



    NASA's Hubble Space Telescope has snapped a panoramic portrait of a vast, sculpted landscape of gas and dust where thousands of stars are being born. This fertile star-forming region, called the 30 Doradus Nebula, has a sparkling stellar centerpiece: the most spectacular cluster of massive stars in our cosmic neighborhood of about 25 galaxies. The mosaic picture shows that ultraviolet radiation and high-speed material unleashed by the stars in the cluster, called R136 [the large blue blob left of center], are weaving a tapestry of creation and destruction, triggering the collapse of looming gas and dust clouds and forming pillar-like structures that are incubators for nascent stars. The photo offers an unprecedented, detailed view of the entire inner region of 30 Doradus, measuring 200 light-years wide by 150 light-years high. The nebula resides in the Large Magellanic Cloud (a satellite galaxy of the Milky Way), 170,000 light-years from Earth. Nebulas like 30 Doradus are the 'signposts' of recent star birth. High-energy ultraviolet radiation from the young, hot, massive stars in R136 causes the surrounding gaseous material to glow. Previous Hubble telescope observations showed that R136 contains several dozen of the most massive stars known, each about 100 times the mass of the Sun and about 10 times as hot. These stellar behemoths all formed at the same time about 2 million years ago. The stars in R136 are producing intense 'stellar winds' (streams of material traveling at several million miles an hour), which are wreaking havoc on the gas and dust in the surrounding neighborhood. The winds are pushing the gas away from the cluster and compressing the inner regions of the surrounding gas and dust clouds [the pinkish material]. The intense pressure is triggering the collapse of parts of the clouds, producing a new generation of star formation around the central cluster. The new stellar nursery is about 30 to 50 light-years from R136. Most of the stars in the

  14. Preferential Pathway for Glycine Formation in Star-Forming Regions (United States)

    Pilling, S.; Boechat-Roberty, H. M.; Baptista, L.; Santos A. C., F.

    Interstellar clouds, similar to that from which the solar system was formed, contain many organic molecules including aldehydes, acids, ketones, and sugars Ehrenfreund & Charnley (2000). Those organic compounds have important functions in terrestrial biochemistry and could also have been important in prebiotic synthesis. The simplest amino acid, glycine (NH2CH2COOH), was recently detected in the hot molecular cores Sgr B2(N-LMH), Orion KL, and W51 e1/e2 Kuan et al. (2003). The formic acid (HCOOH) and acetic acid(CH3COOH) have also been detected in those regions Liu et al. (2002), Remijan et al. (2004). The goal of this work is to study experimentally photoionization and photodissociation processes of glycine precursor molecules, acetic acid and formic acid to elucidate a possible preferentially in the glycine synthesis between ice and gas phase. The measurements were taken at the Brazilian Synchrotron Light Laboratory (LNLS), employing soft X-ray photons from a toroidal grating monochromator TGM) beamline (100 - 310 eV). The experimental set up consists of a high vacuum chamber with a Time-Of-Flight Mass Spectrometer (TOF-MS). Mass spectra were obtained using PhotoElectron PhotoIon Coincidence (PEPICO) technique. Kinetic energy distributions and abundances for each ionic fragment have been obtained from the analysis of the corresponding peak shapes in the mass spectra. Dissociative and non-dissociative photoionization cross sections for both molecules were also determined Boechat-Roberty, Pilling & Santos (2005). Due to the high photodissociation cross section of formic acid it is possible that in PDRs regions, just after molecules evaporation from the grains surface, it is almost destructed by soft X-rays, justifying the observed low abundance of HCOOH in gaseous phase Ehrenfreund et al. (2001). Acetic acid have shown to be more stable to the ionizing field, and its main outcomes from dissociation process were the reactive ionic fragments COOH+ and CH3CO+. To

  15. Millimetre wavelength methanol masers survey towards massive star forming regions (United States)

    Umemoto, T.; Mochizuki, N.; Shibata, K. M.; Roh, D.-G.; Chung, H.-S.


    We present the results of a mm wavelength methanol maser survey towards massive star forming regions. We have carried out Class II methanol maser observations at 86.6 GHz, 86.9 GHz and 107.0 GHz, simultaneously, using the Nobeyama 45 m telescope. We selected 108 6.7 GHz methanol maser sources with declinations above -25 degrees and fluxes above 20 Jy. The detection limit of maser observations was ~3 Jy. Of the 93 sources surveyed so far, we detected methanol emission in 25 sources (27%) and “maser” emission in nine sources (10%), of which thre “maser” sources are new detections. The detection rate for maser emission is about half that of a survey of the southern sky (Caswell et al. 2000). There is a correlation between the maser flux of 107 GHz and 6.7 GHz/12 GHz emission, but no correlation with the “thermal” (non maser) emission. From results of other molecular line observations, we found that the sources with methanol emission show higher gas temperatures and twice the detection rate of SiO emission. This may suggest that dust evaporation and destruction by shock are responsible for the high abundance of methanol molecules, one of the required physical conditions for maser emission.

  16. Travel and urban form in the Greater Copenhagen region

    DEFF Research Database (Denmark)

    Nielsen, Thomas Alexander Sick

    of the economic upturn – with a later point in time where the financial crisis had radically changed the economic climate. It follows from the specificity of the historical events that an analysis of what happened to urban form and transport over the financial crisis is to be seen as a case study......Research into the associations between urban form and travel in the capital areal has focussed on subcenters and the stability of urban form correlates over time. A trend towards de-concentration and formation of subcenters in metropolitan areas has been acknowledged for decades. Studies have...... analyzed the new urban structure by identifying subcenters and their land value impacts. Others have focused on subcenters as a location attribute or ‘intervention’ that affects travel patterns and therefore may be employed in the context of urban and transportation demand management. The research has...

  17. Gemini Spectroscopic Survey of Young Intermediate-Mass Star-Forming Regions (United States)

    Lundquist, Michael; Kobulnicky, Henry


    The majority of stars form in embedded clusters. Current research into star formation has focused on either high-mass star-forming regions or low-mass star-forming regions. We present the results from a Gemini spectroscopic survey of young intermediate-mass star-forming regions. These are star forming regions selected to produce stars up to but not exceeding 8 solar masses. We obtained spectra of these regions with GNIRS on Gemini North and Flamingos-2 on Gemini South. We also combine this with near-infrared imaging from 2MASS, UKIDSS, and VVV to study the stellar content.

  18. Atomic hydrogen in the Orion star-forming region

    International Nuclear Information System (INIS)

    Chromey, F.R.; Elmegreen, B.G.; Elmegreen, D.M.


    A large-scale survey of atomic hydrogen in Orion reveals low-density material with a total mass comparable to that in dense molecular clouds. The atomic gas is sufficiently dense that it can shield the molecular material from photodissociative radiation and provide a pressure link to the low-density intercloud medium. An excess of H I emission comes from photodissociation fronts near the bright stars and from a giant shell in the Orion Belt region. This shell may have caused the apparent bifurcation between the Orion A and B clouds, and the associated pressures may have induced peculiar motions and star formation in NGC 2023 and 2024. 49 refs

  19. Measurement of weak meson form factors in spacelike regions

    CERN Document Server

    Brene, N


    With the construction of high energy, high intensity accelerators (NAL & CERN, SPS) investigation of neutrino scattering on virtual pions, a la Chew-Low, becomes experimentally possible. The process nu +N to mu /sup -/+K+ Delta is analysed to extract the usual K/sub l3/ form factor(s) for spacelike momentum transfer. A model calculation suggests that f/sub +/(T) can be determined reasonably well from a triple differential cross section, whereas only rough information on f /sub -/(T) may be obtained from the transverse polarization of the muon. The experiment proposed requires scanning of several millions of bubble chamber pictures. (14 refs).

  20. Molecular Diagnostics of the Interstellar Medium and Star Forming Regions (United States)

    Hartquist, T. W.; Dalgarno, A.


    Selected examples of the use of observationally inferred molecular level populations and chemical compositions in the diagnosis of interstellar sources and processes important in them (and in other diffuse astrophysical sources) are given. The sources considered include the interclump medium of a giant molecular cloud, dark cores which are the progenitors of star formation, material responding to recent star formation and which may form further stars, and stellar ejecta (including those of supernovae) about to merge with the interstellar medium. The measurement of the microwave background, mixing of material between different nuclear burning zones in evolved stars and turbulent boundary layers (which are present in and influence the structures and evolution of all diffuse astrophysical sources) are treated.

  1. Current correlators and form factors in the resonance region

    Energy Technology Data Exchange (ETDEWEB)

    Rosell, I. [Departamento de Ciencias Fisicas, Matematicas y de la Computacion, Universidad CEU Cardenal Herrera, c/Sant Bartomeu 55, E-46115 Alfara del Patriarca, Valencia (Spain); IFIC, Universitat de Valencia - CSIC, Apt. Correus 22085, E-46071 Valencia (Spain)


    Within Resonance Chiral Theory and in the context of QCD current correlators at next-to-leading order in 1/N{sub C}, we have analyzed the two-body form factors which include resonances as a final state. The short-distance constraints have been studied. One of the main motivations is the estimation of the chiral low-energy constants at subleading order, that is, keeping full control of the renormalization scale dependence. As an application we show the resonance estimation of some coupling, L{sub 10}{sup r}({mu}{sub 0})=(-4.4{+-}0.9).10{sup -3} and C{sub 87}{sup r}({mu}{sub 0})=(3.1{+-}1.1).10{sup -5}.

  2. The distribution of warm gas in the G327.3-0.6 star forming region

    NARCIS (Netherlands)

    Leurini, S.; Wyrowski, F.; van der Tak, F.; Herpin, F.; Herschel WISH Team, [Unknown

    Water is a key molecule for determining the physical chemical structure of star forming regions because of its large abundance variations between warm and cold regions. As a part of the HIFI-led Key Program WISH (P.I. E. van Dishoeck), we are mapping six massive star forming region in different H2O

  3. Problems forming innovative-technological image of russian regions

    Directory of Open Access Journals (Sweden)

    Irina Markovna Golova


    Full Text Available In this paper, actual problems of innovative-technological image as a key element of the mechanism of the healing sources of socioeconomic development of the Russian regionsare considered. The author gives an assessment of the level of differentiation of subjects of the Russian Federation on the potential for innovative development. Trends in spatial transformations of thescientific and technical and innovation capacities of the country are analyzedand reasons of low innovational activity of Russian enterprises are disclosed. Basic conditions for the success of actions to create an attractive image of innovative-technological territory are formulated. Special attention is paid to the position of regions as participants in the innovational processes, creating preconditions for creativity, harmonization of spatial priorities of innovation, technological and socio-economic development, support for the development of new high-tech industries, improvement of inter-budgetary relations. There are proved priority areas of state policy to reduce barriers to the realization of an innovative paradigm for development of Russian society and effective inclusion of local communities in the implementation of innovative changes.

  4. 77 FR 67792 - Proposed Information Collection; Comment Request; Northeast Region Permit Family of Forms (United States)


    ... Collection; Comment Request; Northeast Region Permit Family of Forms AGENCY: National Oceanic and Atmospheric... offered in the Northeast region. Exemption programs may allow a vessel to fish in an area that is limited.... Vessels are also required to request gillnet and lobster tags through the Northeast region permit office...

  5. 76 FR 41763 - Proposed Information Collection; Comment Request; Alaska Region Logbook Family of Forms (United States)


    ... Collection; Comment Request; Alaska Region Logbook Family of Forms AGENCY: National Oceanic and Atmospheric... (NMFS) Alaska Region manages the United States (U.S.) groundfish fisheries of the Exclusive Economic.... NMFS Alaska Region requests information from participating groundfish participants. This information...

  6. Determination of GMPE functional form for an active region with limited strong motion data: application to the Himalayan region (United States)

    Bajaj, Ketan; Anbazhagan, P.


    Advancement in the seismic networks results in formulation of different functional forms for developing any new ground motion prediction equation (GMPE) for a region. Till date, various guidelines and tools are available for selecting a suitable GMPE for any seismic study area. However, these methods are efficient in quantifying the GMPE but not for determining a proper functional form and capturing the epistemic uncertainty associated with selection of GMPE. In this study, the compatibility of the recent available functional forms for the active region is tested for distance and magnitude scaling. Analysis is carried out by determining the residuals using the recorded and the predicted spectral acceleration values at different periods. Mixed effect regressions are performed on the calculated residuals for determining the intra- and interevent residuals. Additionally, spatial correlation is used in mixed effect regression by changing its likelihood function. Distance scaling and magnitude scaling are respectively examined by studying the trends of intraevent residuals with distance and the trend of the event term with magnitude. Further, these trends are statistically studied for a respective functional form of a ground motion. Additionally, genetic algorithm and Monte Carlo method are used respectively for calculating the hinge point and standard error for magnitude and distance scaling for a newly determined functional form. The whole procedure is applied and tested for the available strong motion data for the Himalayan region. The functional form used for testing are five Himalayan GMPEs, five GMPEs developed under NGA-West 2 project, two from Pan-European, and one from Japan region. It is observed that bilinear functional form with magnitude and distance hinged at 6.5 M w and 300 km respectively is suitable for the Himalayan region. Finally, a new regression coefficient for peak ground acceleration for a suitable functional form that governs the attenuation

  7. 78 FR 19649 - Proposed Information Collection; Comment Request; Southwest Region Permit Family of Forms (United States)


    ... DEPARTMENT OF COMMERCE National Oceanic and Atmospheric Administration Proposed Information Collection; Comment Request; Southwest Region Permit Family of Forms AGENCY: National Oceanic and Atmospheric Administration (NOAA), Commerce. ACTION: Notice. SUMMARY: The Department of Commerce, as part of its continuing...

  8. 77 FR 47370 - Proposed Information Collection; Comment Request; Northeast Region Logbook Family of Forms (United States)


    ... DEPARTMENT OF COMMERCE National Oceanic and Atmospheric Administration Proposed Information Collection; Comment Request; Northeast Region Logbook Family of Forms AGENCY: National Oceanic and Atmospheric Administration (NOAA). ACTION: Notice. SUMMARY: The Department of Commerce, as part of its...

  9. Commuting behaviour and urban form: a longitudinal study of a polycentric urban region in Denmark

    DEFF Research Database (Denmark)

    Grunfelder, Julien; Nielsen, Thomas Alexander Sick


    is a polycentric urban region in Denmark. Data from the National Transport Survey of Denmark were used for this quantitative analysis and two time periods were selected to highlight any potential changes over time. Empirical findings indicate that urban form and location variables help to explain the three......This paper is an empirical investigation of the relation between urban form and commuting behaviour in a polycentric urban region. It explores to what extent urban form and location variables help to explain commuting time, distance and mode based on an empirical case, East Jutland, which...... selected aspects of commuting. However, urban form variables have greater explanatory power in explaining commuting modes than commuting time and commuting distance. No general trends in commuting were detectable from the data. Finally, the empirical findings revealed specificities of the case study...

  10. Wide-field Infrared Survey Explorer Observations of the Evolution of Massive Star-forming Regions


    Koenig, X. P.; Leisawitz, D. T.; Benford, D. J.; Rebull, L. M.; Padgett, D. L.; Assef, R. J.


    We present the results of a mid-infrared survey of 11 outer Galaxy massive star-forming regions and 3 open clusters with data from the Wide-field Infrared Survey Explorer (WISE). Using a newly developed photometric scheme to identify young stellar objects and exclude extragalactic contamination, we have studied the distribution of young stars within each region. These data tend to support the hypothesis that latter generations may be triggered by the interaction of winds and radiation from th...

  11. Form Characteristics of Regional Security Organizations - The Missing Link in the Explanation of the Democratic Peace


    Dembinski, Matthias; Freistein, Katja; Weiffen, Brigitte


    This paper contributes both to the debate on the effects of regional security organizations and to the debate on democratic peace. It argues that even if international organizations as such may not be able to influence the conflict behavior of their member states, the subgroup of interdemocratic institutions is well suited to do so. The form of interdemocratic institutions differs in two significant respects from the form of traditional institutions: they are more densely connected via transn...

  12. Wide-Field Infrared Survey Explorer Observations of the Evolution of Massive Star-Forming Regions (United States)

    Koenig, X. P.; Leisawitz, D. T.; Benford, D. J.; Rebull, L. M.; Padgett, D. L.; Asslef, R. J.


    We present the results of a mid-infrared survey of II outer Galaxy massive star-forming regions and 3 open clusters with data from the Wide-field Infrared Survey Explorer (WISE). Using a newly developed photometric scheme to identify young stellar objects and exclude extragalactic contamination, we have studied the distribution of young stars within each region. These data tend to support the hypothesis that latter generations may be triggered by the interaction of winds and radiation from the first burst of massive star formation with the molecular cloud material leftover from that earlier generation of stars. We dub this process the "fireworks hypothesis" since star formation by this mechanism would proceed rapidly and resemble a burst of fireworks. We have also analyzed small cutout WISE images of the structures around the edges of these massive star-forming regions. We observe large (1-3 pc size) pillar and trunk-like structures of diffuse emission nebulosity tracing excited polycyclic aromatic hydrocarbon molecules and small dust grains at the perimeter of the massive star-forming regions. These structures contain small clusters of emerging Class I and Class II sources, but some are forming only a single to a few new stars.

  13. Water in low-mass star-forming regions with Herschel

    DEFF Research Database (Denmark)

    Kristensen, L. E.; Visser, R.; Van Dishoeck, E. F.


    "Water In Star-forming regions with Herschel" (WISH) is a key programme dedicated to studying the role of water and related species during the star-formation process and constraining the physical and chemical properties of young stellar objects. The Heterodyne Instrument for the Far-Infrared (HIF...


    Energy Technology Data Exchange (ETDEWEB)

    Saral, G.; Hora, J. L.; Willis, S. E. [Harvard-Smithsonian Center for Astrophysics, 60 Garden Street, Cambridge, MA 02138 (United States); Koenig, X. P. [Yale University, Department of Astronomy, 208101, New Haven, CT 06520-8101 (United States); Gutermuth, R. A. [University of Massachusetts, Department of Astronomy, Amherst, MA 01003 (United States); Saygac, A. T., E-mail: [Istanbul University, Faculty of Science, Astronomy and Space Sciences Department, Istanbul-Turkey (Turkey)


    We present the initial results of our investigation of the star-forming complex W49, one of the youngest and most luminous massive star-forming regions in our Galaxy. We used Spitzer/Infrared Array Camera (IRAC) data to investigate massive star formation with the primary objective of locating a representative set of protostars and the clusters of young stars that are forming around them. We present our source catalog with the mosaics from the IRAC data. In this study we used a combination of IRAC, MIPS, Two Micron All Sky Survey, and UKIRT Deep Infrared Sky Survey (UKIDSS) data to identify and classify the young stellar objects (YSOs). We identified 232 Class 0/I YSOs, 907 Class II YSOs, and 74 transition disk candidate objects using color–color and color–magnitude diagrams. In addition, to understand the evolution of star formation in W49, we analyzed the distribution of YSOs in the region to identify clusters using a minimal spanning tree method. The fraction of YSOs that belong to clusters with ≥7 members is found to be 52% for a cutoff distance of 96″, and the ratio of Class II/I objects is 2.1. We compared the W49 region to the G305 and G333 star-forming regions and concluded that W49 has the richest population, with seven subclusters of YSOs.

  15. Anomalou OH emission in galactic star-forming regions - A clue to the megamaser phenomenon?

    International Nuclear Information System (INIS)

    Mirabel, I.F.; Rodriguez, L.F.; Ruiz, A.


    The detection of spatially extended, anomalous OH emission in galactic star-forming regions is reported. This OH emission is similar to, although much weaker than, that produced by extragalactic megamasers. This new type of galactic emission may provide clues to elucidate the nature of the extragalactic OH megamaser phenomenon observed in luminous IR galaxies. 10 refs

  16. Neutral and Ionized Hydrides in Star-forming Regions. Observations with Herschel/HIFI

    DEFF Research Database (Denmark)

    O. Benz, Arnold; Bruderer, Simon; F. van Dishoeck, Ewine


    of OH, CH, NH, SH and their ions OH+, CH+, NH+, SH+, H2O+, and H3O+ were observed in star-forming regions by the HIFI spectrometer onboard the Herschel Space Observatory. Molecular column densities are derived from observed ground-state lines, models, or rotational diagrams. We report here on two...


    International Nuclear Information System (INIS)

    Koenig, X. P.; Leisawitz, D. T.; Benford, D. J.; Padgett, D. L.; Rebull, L. M.; Assef, R. J.


    We present the results of a mid-infrared survey of 11 outer Galaxy massive star-forming regions and 3 open clusters with data from the Wide-field Infrared Survey Explorer (WISE). Using a newly developed photometric scheme to identify young stellar objects and exclude extragalactic contamination, we have studied the distribution of young stars within each region. These data tend to support the hypothesis that latter generations may be triggered by the interaction of winds and radiation from the first burst of massive star formation with the molecular cloud material leftover from that earlier generation of stars. We dub this process the 'fireworks hypothesis' since star formation by this mechanism would proceed rapidly and resemble a burst of fireworks. We have also analyzed small cutout WISE images of the structures around the edges of these massive star-forming regions. We observe large (1-3 pc size) pillar and trunk-like structures of diffuse emission nebulosity tracing excited polycyclic aromatic hydrocarbon molecules and small dust grains at the perimeter of the massive star-forming regions. These structures contain small clusters of emerging Class I and Class II sources, but some are forming only a single to a few new stars.

  18. The HIFI spectral survey of AFGL 2591 (CHESS). I. Highly excited linear rotor molecules in the high-mass protostellar envelope (United States)

    van der Wiel, M. H. D.; Pagani, L.; van der Tak, F. F. S.; Kaźmierczak, M.; Ceccarelli, C.


    Context. Linear rotor molecules such as CO, HCO+ and HCN are important probes of star-forming gas. For these species, temperatures of ≲ 50 K are sufficient to produce emission lines that are observable from the ground at (sub)millimeter wavelengths. Molecular gas in the environment of massive protostellar objects, however, is known to reach temperatures of several hundred K. To probe this, space-based far-infrared observations are required. Aims: We aim to reveal the gas energetics in the circumstellar environment of the prototypical high-mass protostellar object AFGL 2591. Methods: Rotational spectral line signatures of CO species, HCO+, CS, HCN and HNC from a 490-1240 GHz survey with Herschel/HIFI, complemented by ground-based JCMT and IRAM 30 m spectra, cover transitions in the energy range (Eup/k) between 5 K and ~ 300 K. Selected frequency settings in the highest frequency HIFI bands (up to 1850 GHz) extend this range to 750 K for 12C16O. The resolved spectral line profiles are used to separate and study various kinematic components. Observed line intensities are compared with a numerical model that calculates excitation balance and radiative transfer based on spherical geometry. Results: The line profiles show two emission components, the widest and bluest of which is attributed to an approaching outflow and the other to the envelope. We find evidence for progressively more redshifted and wider line profiles from the envelope gas with increasing energy level. This trend is qualitatively explained by residual outflow contribution picked up in the systematically decreasing beam size. Integrated line intensities for each species decrease as Eup/k increases from ≲ 50 to ~700 K. The H2 density and temperature of the outflow gas are constrained to ~105-106 cm-3 and 60-200 K. In addition, we derive a temperature between 9 and 17 K and N(H2) ~ 3 × 1021 cm-2 for a known foreground cloud seen in absorption, and N(H2) ≲ 1019 cm-2 for a second foreground component

  19. Orion star-forming region - far-infrared and radio molecular observations

    International Nuclear Information System (INIS)

    Thronson, H.A. Jr.; Harper, D.A.; Bally, J.; Dragovan, M.; Mozurkewich, D.; Yerkes Observatory, Williams Bay, WI; ATandT Bell Labs., Holmdel, NJ; Chicago Uni., IL; E. O. Hulburt Center for Space Research, Washington, DC)


    New J = 1-0 CO and far-infrared maps of the Orion star-forming region are presented and discussed. The total infrared luminosity of the Orion star-forming ridge is 250,000 solar luminosities. The material that is emitting strongly at 60 microns is traced and found to be highly centrally concentrated. However, the majority of the extended emission from this region comes from dust that is ultimately heated by the visible Trapezium cluster stars. The luminosity of IRc 2, the most luminous member of the infrared cluster, is estimated to be 40,000-50,000 solar luminosities. A schematic drawing of the Ori MC 1 region is presented. 30 references

  20. NGVLA Observations of Dense Gas Filaments in Star-Forming Regions (United States)

    Di Francesco, James; Chen, Mike; Keown, Jared; GAS Team, KEYSTONE Team


    Recent observations of continuum emission from nearby star-forming regions with Herschel and JCMT have revealed that filaments are ubiquitous structures within molecular clouds. Such filaments appear to be intimately connected to star formation, with those having column densities of AV > 8 hosting the majority of prestellar cores and young protostars in clouds. Indeed, this “threshold” can be explained simply as the result of supercritical cylinder fragmentation. How specifically star-forming filaments form in molecular clouds, however, remains unclear, though gravity and turbulence are likely involved. Observations of their kinematics are needed to understand how mass flows both onto and through these filaments. We show here results from two recent surveys, the Green Bank Ammonia Survey (GAS) and the K-band Examinations of Young Stellar Object Natal Environments (KEYSTONE) that have used the Green Bank Telescope’s K-band Focal Plane Array instrument to map NH3 (1,1) emission from dense gas in nearby star-forming regions. Data from both surveys show that NH3 emission traces extremely well the high column density gas across these star-forming regions. In particular, the GAS results for NGC 1333 show NH3-based velocity gradients either predominantly parallel or perpendicular to the filament spines. Though the GAS and KEYSTONE data are vital for probing filaments, higher resolutions than possible with the GBT alone are needed to examine the kinematic patterns on the 0.1-pc scales of star-forming cores within filaments. We describe how the Next Generation Very Large Array (NGVLA) will uniquely provide the key wide-field data of high sensitivity needed to explore how ambient gas in molecular clouds forms filaments that evolve toward star formation.

  1. Star Formation Activity Beyond the Outer Arm. I. WISE -selected Candidate Star-forming Regions

    Energy Technology Data Exchange (ETDEWEB)

    Izumi, Natsuko; Yasui, Chikako; Saito, Masao [National Astronomical Observatory of Japan, 2-21-1, Osawa, Mitaka, Tokyo 181-8588 (Japan); Kobayashi, Naoto; Hamano, Satoshi, E-mail: [Laboratory of Infrared High-resolution spectroscopy (LIH), Koyama Astronomical Observatory, Kyoto Sangyo University, Motoyama, Kamigamo, Kita-ku, Kyoto 603-8555 (Japan)


    The outer Galaxy beyond the Outer Arm provides a good opportunity to study star formation in an environment significantly different from that in the solar neighborhood. However, star-forming regions in the outer Galaxy have never been comprehensively studied or cataloged because of the difficulties in detecting them at such large distances. We studied 33 known young star-forming regions associated with 13 molecular clouds at R {sub G} ≥ 13.5 kpc in the outer Galaxy with data from the Wide-field Infrared Survey Explorer ( WISE ) mid-infrared all-sky survey. From their color distribution, we developed a simple identification criterion of star-forming regions in the outer Galaxy with the WISE color. We applied the criterion to all the WISE sources in the molecular clouds in the outer Galaxy at R {sub G} ≥ 13.5 kpc detected with the Five College Radio Astronomy Observatory (FCRAO) {sup 12}CO survey of the outer Galaxy, of which the survey region is 102.°49 ≤  l  ≤ 141.°54, −3.°03 ≤  b  ≤ 5.°41, and successfully identified 711 new candidate star-forming regions in 240 molecular clouds. The large number of samples enables us to perform the statistical study of star formation properties in the outer Galaxy for the first time. This study is crucial to investigate the fundamental star formation properties, including star formation rate, star formation efficiency, and initial mass function, in a primordial environment such as the early phase of the Galaxy formation.

  2. New far infrared images of bright, nearby, star-forming regions (United States)

    Harper, D. AL, Jr.; Cole, David M.; Dowell, C. Darren; Lees, Joanna F.; Lowenstein, Robert F.


    Broadband imaging in the far infrared is a vital tool for understanding how young stars form, evolve, and interact with their environment. As the sensitivity and size of detector arrays has increased, a richer and more detailed picture has emerged of the nearest and brightest regions of active star formation. We present data on M 17, M 42, and S 106 taken recently on the Kuiper Airborne Observatory with the Yerkes Observatory 60-channel far infrared camera, which has pixel sizes of 17 in. at 60 microns, 27 in. at 100 microns, and 45 in. at 160 and 200 microns. In addition to providing a clearer view of the complex central cores of the regions, the images reveal new details of the structure and heating of ionization fronts and photodissociation zones where radiation form luminous stars interacts with adjacent molecular clouds.

  3. Observations of star-forming regions with the Midcourse Space Experiment

    NARCIS (Netherlands)

    Kraemer, KE; Shipman, RF; Price, SD; Mizuno, DR; Kuchar, T; Carey, SJ

    We have imaged seven nearby star-forming regions, the Rosette Nebula, the Orion Nebula, W3, the Pleiades, G300.2-16.8, S263, and G159.6-18.5, with the Spatial Infrared Imaging Telescope on the Midcourse Space Experiment (MSX) satellite at 1800 resolution at 8.3, 12.1, 14.7, and 21.3 mum. The large


    Energy Technology Data Exchange (ETDEWEB)

    Romine, Gregory; Feigelson, Eric D.; Getman, Konstantin V. [Department of Astronomy and Astrophysics, Pennsylvania State University, 525 Davey Lab, University Park, PA 16802 (United States); Kuhn, Michael A. [Millennium Institute of Astrophysics, Camino El Observatorio 1515, Las Condes, Santiago (Chile); Povich, Matthew S., E-mail: [Department of Physics and Astronomy, California State Polytechnic University, 3801 West Temple Ave., Pomona, CA 91768 (United States)


    The Massive Young Star-Forming Complex in Infrared and X-ray (MYStIX) project provides a new census on stellar members of massive star-forming regions within 4 kpc. Here the MYStIX Infrared Excess catalog and Chandra -based X-ray photometric catalogs are mined to obtain high-quality samples of Class I protostars using criteria designed to reduce extragalactic and Galactic field star contamination. A total of 1109 MYStIX Candidate Protostars (MCPs) are found in 14 star-forming regions. Most are selected from protoplanetary disk infrared excess emission, but 20% are found from their ultrahard X-ray spectra from heavily absorbed magnetospheric flare emission. Two-thirds of the MCP sample is newly reported here. The resulting samples are strongly spatially associated with molecular cores and filaments on Herschel far-infrared maps. This spatial agreement and other evidence indicate that the MCP sample has high reliability with relatively few “false positives” from contaminating populations. But the limited sensitivity and sparse overlap among the infrared and X-ray subsamples indicate that the sample is very incomplete with many “false negatives.” Maps, tables, and source descriptions are provided to guide further study of star formation in these regions. In particular, the nature of ultrahard X-ray protostellar candidates without known infrared counterparts needs to be elucidated.


    International Nuclear Information System (INIS)

    Romine, Gregory; Feigelson, Eric D.; Getman, Konstantin V.; Kuhn, Michael A.; Povich, Matthew S.


    The Massive Young Star-Forming Complex in Infrared and X-ray (MYStIX) project provides a new census on stellar members of massive star-forming regions within 4 kpc. Here the MYStIX Infrared Excess catalog and Chandra -based X-ray photometric catalogs are mined to obtain high-quality samples of Class I protostars using criteria designed to reduce extragalactic and Galactic field star contamination. A total of 1109 MYStIX Candidate Protostars (MCPs) are found in 14 star-forming regions. Most are selected from protoplanetary disk infrared excess emission, but 20% are found from their ultrahard X-ray spectra from heavily absorbed magnetospheric flare emission. Two-thirds of the MCP sample is newly reported here. The resulting samples are strongly spatially associated with molecular cores and filaments on Herschel far-infrared maps. This spatial agreement and other evidence indicate that the MCP sample has high reliability with relatively few “false positives” from contaminating populations. But the limited sensitivity and sparse overlap among the infrared and X-ray subsamples indicate that the sample is very incomplete with many “false negatives.” Maps, tables, and source descriptions are provided to guide further study of star formation in these regions. In particular, the nature of ultrahard X-ray protostellar candidates without known infrared counterparts needs to be elucidated.

  6. Molecular line study of massive star-forming regions from the Red MSX Source survey (United States)

    Yu, Naiping; Wang, Jun-Jie


    In this paper, we have selected a sample of massive star-forming regions from the Red MSX Source survey, in order to study star formation activities (mainly outflow and inflow signatures). We have focused on three molecular lines from the Millimeter Astronomy Legacy Team Survey at 90 GHz: HCO+(1-0), H13CO+(1-0) and SiO(2-1). According to previous observations, our sources can be divided into two groups: nine massive young stellar object candidates (radio-quiet) and 10 H II regions (which have spherical or unresolved radio emissions). Outflow activities have been found in 11 sources, while only three show inflow signatures in all. The high outflow detection rate means that outflows are common in massive star-forming regions. The inflow detection rate was relatively low. We suggest that this was because of the beam dilution of the telescope. All three inflow candidates have outflow(s). The outward radiation and thermal pressure from the central massive star(s) do not seem to be strong enough to halt accretion in G345.0034-00.2240. Our simple model of G318.9480-00.1969 shows that it has an infall velocity of about 1.8 km s-1. The spectral energy distribution analysis agrees our sources are massive and intermediate-massive star formation regions.

  7. Global Infrared–Radio Spectral Energy Distributions of Galactic Massive Star-Forming Regions (United States)

    Povich, Matthew Samuel; Binder, Breanna Arlene


    We present a multiwavelength study of 30 Galactic massive star-forming regions. We fit multicomponent dust, blackbody, and power-law continuum models to 3.6 µm through 10 mm spectral energy distributions obtained from Spitzer, MSX, IRAS, Herschel, and Planck archival survey data. Averaged across our sample, ~20% of Lyman continuum photons emitted by massive stars are absorbed by dust before contributing to the ionization of H II regions, while ~50% of the stellar bolometric luminosity is absorbed and reprocessed by dust in the H II regions and surrounding photodissociation regions. The most luminous, infrared-bright regions that fully sample the upper stellar initial mass function (ionizing photon rates NC ≥ 1050 s–1 and total infrared luminosity LTIR ≥ 106.8 L⊙) have higher percentages of absorbed Lyman continuum photons (~40%) and dust-reprocessed starlight (~80%). The monochromatic 70-µm luminosity L70 is linearly correlated with LTIR, and on average L70/LTIR = 50%, in good agreement with extragalactic studies. Calibrated against the known massive stellar content in our sampled H II regions, we find that star formation rates based on L70 are in reasonably good agreement with extragalactic calibrations, when corrected for the smaller physical sizes of the Galactic regions. We caution that absorption of Lyman continuum photons prior to contributing to the observed ionizing photon rate may reduce the attenuation-corrected Hα emission, systematically biasing extragalactic calibrations toward lower star formation rates when applied to spatially-resolved studies of obscured star formation.This work was supported by the National Science Foundation under award CAREER-1454333.

  8. The Structure of the Nearby Giant Star-Forming Region 30 Doradus (United States)

    Pellegrini, Eric; Baldwin, Jack; Hanson, Margaret; Ferland, Gary; Troland, Thomas


    The rates of star formation and chemical evolution are controlled in part by the interaction of stellar radiation and winds with the remnant molecular gas from which the stars have formed. We are carrying out a detailed, panchromatic study of these processes in the two nearest giant star-forming regions, 30 Doradus and NGC 3603, as an aide in understanding the nature of Giant Extragalactic H II Regions, starbursts, and Ultra-Luminous IR Galaxies. We recently completed our observations of NGC 3603. Here we request 2 nights on the Blanco telescope to obtain a dense grid of optical long-slit spectra criss- crossing 30 Dor. These will cover the [S II] doublet (to measure N_e) and also [O III], H(beta), [O I], H(alpha) and [N II] to measure the ionization mechanism and ionization parameter, at ~3800 different spots in the nebula. We also request 3 nights on SOAR to take K-band long slit spectra covering H^+ Br(gamma) and several H_2 lines across three representative edge-on ionization fronts in 30 Dor. The IR spectra will be taken in locations also covered by the optical spectra, and will tell us about the structure, pressure support and heating mechanisms in the photo-dissociation regions (PDRs) at these points. Either half of this project can stand on its own, but both parts together will permit the PI to complete his PhD thesis.

  9. Broca's region and Visual Word Form Area activation differ during a predictive Stroop task

    DEFF Research Database (Denmark)

    Wallentin, Mikkel; Gravholt, Claus Højbjerg; Skakkebæk, Anne


    displayed in green or red (incongruent vs congruent colors). One of the colors, however, was presented three times as often as the other, making it possible to study both congruency and frequency effects independently. Auditory stimuli saying “GREEN” or “RED” had the same distribution, making it possible...... to study frequency effects across modalities. We found significant behavioral effects of both incongruency and frequency. A significant effect (p effect of frequency was observed and no interaction. Conjoined effects of incongruency...... and frequency were found in parietal regions as well as in the Visual Word Form Area (VWFA). No interaction between perceptual modality and frequency was found in VWFA suggesting that the region is not strictly visual. These findings speak against a strong version of the prediction error processing hypothesis...

  10. Radiocarbon ages of pedogenic calcic nodules formed within vertisols, Coimbatore region, Tamil Nadu, India

    International Nuclear Information System (INIS)

    Achyuthan, H.; Flora, O.; Braida, M.; Stenni, B.; Shankar, N.


    In this paper we discuss the limitation of radiocarbon dates on the pedogenic calcic nodules formed in situ within the vertisols in the upland region of Coimbatore, Tamil Nadu. The radiocarbon ages were obtained using low level scintillation counters and the ages range from ∼24 Ka to ∼31 Ka. The ages correlate well with the marine isotope stage of Late MIS3. Since the calcic nodules are pedogenised and formed in a terrestrial open system we express caution in the interpretation of the radiocarbon ages obtained on pedogenic carbonate nodules. The radiocarbon dates represent maximum ages and hence the ages measured should only be considered as age estimates and not absolute geologic ages. Multiple sub-mm size subsamples could provide more reliable estimates of soil chronology. (author)

  11. Diffuse Matter from Star Forming Regions to Active Galaxies A Volume Honouring John Dyson

    CERN Document Server

    Hartquist, T W


    John Dyson has contributed to the study of the hydrodynamic processes that govern a wide variety of astrophysical sources which he has helped explain. In this volume dedicated to him, introductory reviews to a number of the key processes and to the sources themselves are given by leading experts. The mechanisms in which the multi-component natures of media affect their dynamics receive particular attention, but the roles of hydromagnetic effects are also highlighted. The importance of cosmic ray moderation and mass transfer between different thermal phases for cosmic ray moderation and mass transfer between different thermal phases for the evolution of flows are amongst the topics treated. The main types of regions considered include those where stars form, the circumstellar environments of evolved stars, the larger scale interstellar structures caused by the mass loss of stars, and those where the lines of AGNs form. The reviews complement one another and together provide a coherent introduction to the astro...

  12. Complex organic molecules toward low-mass and high-mass star forming regions (United States)

    Favre, C.; Ceccarelli, C.; Lefloch, B.; Bergin, E.; Carvajal, M.; Brouillet, N.; Despois, D.; Jørgensen, J.; Kleiner, I.


    One of the most important questions in molecular astrophysics is how, when, and where complex organic molecules, COMs (≥ 6 atoms) are formed. In the Interstellar-Earth connection context, could this have a bearing on the origin of life on Earth? Formation mechanisms of COMs, which include potentially prebiotic molecules, are still debated and may include grain-mantle and/or gas-phase chemistry. Understanding the mechanisms that lead to the interstellar molecular complexification, along with the involved physicochemical processes, is mandatory to answer the above questions. In that context, active researches are ongoing in theory, laboratory experiment, chemical modeling and observations. Thanks to recent progress in radioastronomy instrumentation for both single-dish and millimeter array (e.g. Herschel, NOEMA, ALMA), new results have been obtained. I will review some notable results on the detection of COMs, including prebiotic molecules, towards star forming regions.

  13. Water in Star-forming Regions with Herschel (WISH): recent results and trends (United States)

    van Dishoeck, E. F.


    Water is a key molecule in the physics and chemistry of star- and planet-forming regions. In the `Water in Star-forming Regions with Herschel' (WISH) Key Program, we have obtained a comprehensive set of water data toward a large sample of well-characterized protostars, covering a wide range of masses and luminosities --from the lowest to the highest mass protostars--, as well as evolutionary stages --from pre-stellar cores to disks. Lines of both ortho- and para-H_2O and their isotopologues, as well as chemically related hydrides, are observed with the HIFI and PACS instruments. The data elucidate the physical processes responsible for the warm gas, probe dynamical processes associated with forming stars and planets (outflow, infall, expansion), test basic chemical processes and reveal the chemical evolution of water and the oxygen-reservoir into planet-forming disks. In this brief talk a few recent WISH highlights will be presented, including determinations of the water abundance in each of the different physical components (inner and outer envelope, outflow) and constraints on the ortho/para ratio. Special attention will be given to trends found across the sample, especially the similarity in profiles from low to high-mass protostars and the evolution of the gas-phase water abundance from prestellar cores to disks. More details can be found at, whereas overviews are given in van Dishoeck et al. (2011, PASP 123, 138), Kristensen & van Dishoeck (2011, Astronomische Nachrichten 332, 475) and Bergin & van Dishoeck (2012, Phil. Trans. Royal Soc. A).

  14. Young Stellar Objects in the Massive Star-forming Regions W51 and W43

    Energy Technology Data Exchange (ETDEWEB)

    Saral, G.; Audard, M. [Department of Astronomy, University of Geneva, Ch. d’Ecogia 16, 1290 Versoix (Switzerland); Hora, J. L.; Martínez-Galarza, J. R.; Smith, H. A. [Harvard-Smithsonian Center for Astrophysics, 60 Garden Street, Cambridge, MA 02138 (United States); Koenig, X. P. [Yale University, Department of Astronomy, 208101, New Haven, CT 06520-8101 (United States); Motte, F. [Institut de Plantologie et d’Astrophysique de Grenoble, Univ. Grenoble Alpes—CNRS-INSU, BP 53, F-38041 Grenoble Cedex 9 (France); Nguyen-Luong, Q. [National Astronomical Observatory of Japan, Chile Observatory, 2-21-1 Osawa, Mitaka, Tokyo 181-8588 (Japan); Saygac, A. T. [Istanbul University, Faculty of Science, Astronomy and Space Sciences Department, Istanbul-Turkey (Turkey)


    We present the results of our investigation of the star-forming complexes W51 and W43, two of the brightest in the first Galactic quadrant. In order to determine the young stellar object (YSO) populations in W51 and W43 we used color–magnitude relations based on Spitzer mid-infrared and 2MASS/UKIDSS near-infrared data. We identified 302 Class I YSOs and 1178 Class II/transition disk candidates in W51, and 917 Class I YSOs and 5187 Class II/transition disk candidates in W43. We also identified tens of groups of YSOs in both regions using the Minimal Spanning Tree (MST) method. We found similar cluster densities in both regions, even though Spitzer was not able to probe the densest part of W43. By using the Class II/I ratios, we traced the relative ages within the regions and, based on the morphology of the clusters, we argue that several sites of star formation are independent of one another in terms of their ages and physical conditions. We used spectral energy distribution-fitting to identify the massive YSO (MYSO) candidates since they play a vital role in the star formation process, and then examined them to see if they are related to any massive star formation tracers such as UCH ii regions, masers, or dense fragments. We identified 17 MYSO candidates in W51, and 14 in W43, respectively, and found that groups of YSOs hosting MYSO candidates are positionally associated with H ii regions in W51, though we do not see any MYSO candidates associated with previously identified massive dense fragments in W43.

  15. Zeeman effect in sulfur monoxide. A tool to probe magnetic fields in star forming regions (United States)

    Cazzoli, Gabriele; Lattanzi, Valerio; Coriani, Sonia; Gauss, Jürgen; Codella, Claudio; Ramos, Andrés Asensio; Cernicharo, José; Puzzarini, Cristina


    Context. Magnetic fields play a fundamental role in star formation processes and the best method to evaluate their intensity is to measure the Zeeman effect of atomic and molecular lines. However, a direct measurement of the Zeeman spectral pattern from interstellar molecular species is challenging due to the high sensitivity and high spectral resolution required. So far, the Zeeman effect has been detected unambiguously in star forming regions for very few non-masing species, such as OH and CN. Aims: We decided to investigate the suitability of sulfur monoxide (SO), which is one of the most abundant species in star forming regions, for probing the intensity of magnetic fields via the Zeeman effect. Methods: We investigated the Zeeman effect for several rotational transitions of SO in the (sub-)mm spectral regions by using a frequency-modulated, computer-controlled spectrometer, and by applying a magnetic field parallel to the radiation propagation (I.e., perpendicular to the oscillating magnetic field of the radiation). To support the experimental determination of the g factors of SO, a systematic quantum-chemical investigation of these parameters for both SO and O2 has been carried out. Results: An effective experimental-computational strategy for providing accurate g factors as well as for identifying the rotational transitions showing the strongest Zeeman effect has been presented. Revised g factors have been obtained from a large number of SO rotational transitions between 86 and 389 GHz. In particular, the rotational transitions showing the largest Zeeman shifts are: N,J = 2, 2 ← 1, 1 (86.1 GHz), N,J = 4, 3 ← 3, 2 (159.0 GHz), N,J = 1, 1 ← 0, 1 (286.3 GHz), N,J = 2, 2 ← 1, 2 (309.5 GHz), and N,J = 2, 1 ← 1, 0 (329.4 GHz). Our investigation supports SO as a good candidate for probing magnetic fields in high-density star forming regions. The complete list of measured Zeeman components is only available at the CDS via anonymous ftp to http


    International Nuclear Information System (INIS)

    Luhman, K. L.; Allen, P. R.; Mamajek, E. E.; Cruz, K. L.


    We present the results of a search for new members of the Taurus star-forming region using data from the Spitzer Space Telescope and the XMM-Newton Observatory. We have obtained optical and near-infrared spectra of 44 sources that exhibit red Spitzer colors that are indicative of stars with circumstellar disks and 51 candidate young stars that were identified by Scelsi and coworkers using XMM-Newton. We also performed spectroscopy on four possible companions to members of Taurus that were reported by Kraus and Hillenbrand. Through these spectra, we have demonstrated the youth and membership of 41 sources, 10 of which were independently confirmed as young stars by Scelsi and coworkers. Five of the new Taurus members are likely to be brown dwarfs based on their late spectral types (>M6). One of the brown dwarfs has a spectral type of L0, making it the first known L-type member of Taurus and the least massive known member of the region (M ∼ 4-7 M Jup ). Another brown dwarf exhibits a flat infrared spectral energy distribution, which indicates that it could be in the protostellar class I stage (star+disk+envelope). Upon inspection of archival images from various observatories, we find that one of the new young stars has a large edge-on disk (r = 2.''5 = 350 AU). The scattered light from this disk has undergone significant variability on a timescale of days in optical images from the Canada-France-Hawaii Telescope. Using the updated census of Taurus, we have measured the initial mass function for the fields observed by XMM-Newton. The resulting mass function is similar to previous ones that we have reported for Taurus, showing a surplus of stars at spectral types of K7-M1 (0.6-0.8 M sun ) relative to other nearby star-forming regions, such as IC 348, Chamaeleon I, and the Orion Nebula Cluster.


    Energy Technology Data Exchange (ETDEWEB)

    Sarma, A. P.; Eftimova, M. [Physics Department, DePaul University, 2219 N. Kenmore Ave., Byrne Hall 211, Chicago, IL 60614 (United States); Brogan, C. L. [National Radio Astronomy Observatory, Charlottesville, VA 22903 (United States); Bourke, T. L. [Harvard-Smithsonian Center for Astrophysics, Cambridge, MA 02138 (United States); Troland, T. H., E-mail: [Department of Physics and Astronomy, University of Kentucky, Lexington, KY 40506 (United States)


    We present observations of the Zeeman effect in OH thermal absorption main lines at 1665 and 1667 MHz taken with the Very Large Array toward the star-forming region S88B. The OH absorption profiles toward this source are complicated, and contain several blended components toward a number of positions. Almost all of the OH absorbing gas is located in the eastern parts of S88B, toward the compact continuum source S88B-2 and the eastern parts of the extended continuum source S88B-1. The ratio of 1665/1667 MHz OH line intensities indicates the gas is likely highly clumped, in agreement with other molecular emission line observations in the literature. S88-B appears to present a similar geometry to the well-known star-forming region M17, in that there is an edge-on eastward progression from ionized to molecular gas. The detected magnetic fields appear to mirror this eastward transition; we detected line-of-sight magnetic fields ranging from 90 to 400 {mu}G, with the lowest values of the field to the southwest of the S88B-1 continuum peak, and the highest values to its northeast. We used the detected fields to assess the importance of the magnetic field in S88B by a number of methods; we calculated the ratio of thermal to magnetic pressures, we calculated the critical field necessary to completely support the cloud against self-gravity and compared it to the observed field, and we calculated the ratio of mass to magnetic flux in terms of the critical value of this parameter. All these methods indicated that the magnetic field in S88B is dynamically significant, and should provide an important source of support against gravity. Moreover, the magnetic energy density is in approximate equipartition with the turbulent energy density, again pointing to the importance of the magnetic field in this region.


    International Nuclear Information System (INIS)

    Sarma, A. P.; Eftimova, M.; Brogan, C. L.; Bourke, T. L.; Troland, T. H.


    We present observations of the Zeeman effect in OH thermal absorption main lines at 1665 and 1667 MHz taken with the Very Large Array toward the star-forming region S88B. The OH absorption profiles toward this source are complicated, and contain several blended components toward a number of positions. Almost all of the OH absorbing gas is located in the eastern parts of S88B, toward the compact continuum source S88B-2 and the eastern parts of the extended continuum source S88B-1. The ratio of 1665/1667 MHz OH line intensities indicates the gas is likely highly clumped, in agreement with other molecular emission line observations in the literature. S88-B appears to present a similar geometry to the well-known star-forming region M17, in that there is an edge-on eastward progression from ionized to molecular gas. The detected magnetic fields appear to mirror this eastward transition; we detected line-of-sight magnetic fields ranging from 90 to 400 μG, with the lowest values of the field to the southwest of the S88B-1 continuum peak, and the highest values to its northeast. We used the detected fields to assess the importance of the magnetic field in S88B by a number of methods; we calculated the ratio of thermal to magnetic pressures, we calculated the critical field necessary to completely support the cloud against self-gravity and compared it to the observed field, and we calculated the ratio of mass to magnetic flux in terms of the critical value of this parameter. All these methods indicated that the magnetic field in S88B is dynamically significant, and should provide an important source of support against gravity. Moreover, the magnetic energy density is in approximate equipartition with the turbulent energy density, again pointing to the importance of the magnetic field in this region.

  19. Shear viscosity of glass-forming melts in the liquid-glass transition region

    International Nuclear Information System (INIS)

    Sanditov, D. S.


    A new approach to interpreting the hole-activation model of a viscous flow of glass-forming liquids is proposed. This model underlies the development of the concept on the exponential temperature dependence of the free energy of activation of a flow within the range of the liquid-glass transition in complete agreement with available experimental data. The 'formation of a fluctuation hole' in high-heat glass-forming melts is considered as a small-scale low-activation local deformation of a structural network, i.e., the quasi-lattice necessary for the switching of the valence bond, which is the main elementary event of viscous flow of glasses and their melts. In this sense, the hole formation is a conditioned process. A drastic increase in the activation free energy of viscous flow in the liquid-glass transition region is explained by a structural transformation that is reduced to a limiting local elastic deformation of the structural network, which, in turn, originates from the excitation (critical displacement) of a bridging atom like the oxygen atom in the Si-O-Si bridge. At elevated temperatures, as a rule, a necessary amount of excited bridging atoms (locally deformed regions of the structural network) always exists, and the activation free energy of viscous flow is almost independent of temperature. The hole-activation model is closely connected with a number of well-known models describing the viscous flow of glass-forming liquids (the Avramov-Milchev, Nemilov, Ojovan, and other models).

  20. Periodic auroral forms and geomagnetic field oscillations in the 1400 MLT region

    International Nuclear Information System (INIS)

    Potemra, T.A.; Vo, H.; Venkatesan, D.; Cogger, L.L.; Erlandson, R.E.; Zanetti, L.J.; Bythrow, P.F.; Anderson, B.J.


    The UV images obtained with the Viking satellite often show bright features which resemble beads or pearls aligned in the east-west direction between noon and 1800 MLT. Viking acquired a series of 25 UV images during a 28-min period on July 29, 1986, which showed a distinct series of periodic bright features in this region. Magnetic field and hot plasma measurements obtained by Viking confirm that the UV emissions are colocated with the field line projection of an upward-flowing region 1 Birkeland current and precipitating energetic (∼200 eV) electrons. The magnetic field and electric field measurements show transverse oscillations with a nearly constant period of about 3.5 min from 67 degree invariant latitude equatorward up to the location of the large-scale Birkeland current system near 76 degree invariant latitude. The electric field oscillations lead the magnetic field oscillations by about a quarter-period. The authors interpret the observed oscillations as standing Alfven waves driven at a frequency near the local resonance frequency by a large-scale wave in the boundary layer. They propose that the energy flux of the precipitating low-energy electrons in this afternoon region is modulated by this boundary wave and produces the periodic UV emission features. The results of this study support the view that large-scale oscillations of magnetospheric boundaries, possibly associated with the Kelvin-Helmholtz instability, can modulate currents, particles, and auroral forms

  1. Functional modulation of cardiac form through regionally confined cell shape changes.

    Directory of Open Access Journals (Sweden)

    Heidi J Auman


    Full Text Available Developing organs acquire a specific three-dimensional form that ensures their normal function. Cardiac function, for example, depends upon properly shaped chambers that emerge from a primitive heart tube. The cellular mechanisms that control chamber shape are not yet understood. Here, we demonstrate that chamber morphology develops via changes in cell morphology, and we determine key regulatory influences on this process. Focusing on the development of the ventricular chamber in zebrafish, we show that cardiomyocyte cell shape changes underlie the formation of characteristic chamber curvatures. In particular, cardiomyocyte elongation occurs within a confined area that forms the ventricular outer curvature. Because cardiac contractility and blood flow begin before chambers emerge, cardiac function has the potential to influence chamber curvature formation. Employing zebrafish mutants with functional deficiencies, we find that blood flow and contractility independently regulate cell shape changes in the emerging ventricle. Reduction of circulation limits the extent of cardiomyocyte elongation; in contrast, disruption of sarcomere formation releases limitations on cardiomyocyte dimensions. Thus, the acquisition of normal cardiomyocyte morphology requires a balance between extrinsic and intrinsic physical forces. Together, these data establish regionally confined cell shape change as a cellular mechanism for chamber emergence and as a link in the relationship between form and function during organ morphogenesis.


    International Nuclear Information System (INIS)

    Furlan, E.; Watson, Dan M.; McClure, M. K.


    We analyze samples of Spitzer Infrared Spectrograph spectra of T Tauri stars in the Ophiuchus, Taurus, and Chamaeleon I star-forming regions, whose median ages lie in the <1-2 Myr range. The median mid-infrared spectra of objects in these three regions are similar in shape, suggesting, on average, similar disk structures. When normalized to the same stellar luminosity, the medians follow each other closely, implying comparable mid-infrared excess emission from the circumstellar disks. We use the spectral index between 13 and 31 μm and the equivalent width of the 10 μm silicate emission feature to identify objects whose disk configuration departs from that of a continuous, optically thick accretion disk. Transitional disks, whose steep 13-31 μm spectral slope and near-IR flux deficit reveal inner disk clearing, occur with about the same frequency of a few percent in all three regions. Objects with unusually large 10 μm equivalent widths are more common (20%-30%); they could reveal the presence of disk gaps filled with optically thin dust. Based on their medians and fraction of evolved disks, T Tauri stars in Taurus and Chamaeleon I are very alike. Disk evolution sets in early, since already the youngest region, the Ophiuchus core (L1688), has more settled disks with larger grains. Our results indicate that protoplanetary disks show clear signs of dust evolution at an age of a few Myr, even as early as ∼1 Myr, but age is not the only factor determining the degree of evolution during the first few million years of a disk's lifetime.

  3. Long-term Variability of H2CO Masers in Star-forming Regions (United States)

    Andreev, N.; Araya, E. D.; Hoffman, I. M.; Hofner, P.; Kurtz, S.; Linz, H.; Olmi, L.; Lorran-Costa, I.


    We present results of a multi-epoch monitoring program on variability of 6 cm formaldehyde (H2CO) masers in the massive star-forming region NGC 7538 IRS 1 from 2008 to 2015, conducted with the Green Bank Telescope, the Westerbork Radio Telescope , and the Very Large Array. We found that the similar variability behaviors of the two formaldehyde maser velocity components in NGC 7538 IRS 1 (which was pointed out by Araya and collaborators in 2007) have continued. The possibility that the variability is caused by changes in the maser amplification path in regions with similar morphology and kinematics is discussed. We also observed 12.2 GHz methanol and 22.2 GHz water masers toward NGC 7538 IRS 1. The brightest maser components of CH3OH and H2O species show a decrease in flux density as a function of time. The brightest H2CO maser component also shows a decrease in flux density and has a similar LSR velocity to the brightest H2O and 12.2 GHz CH3OH masers. The line parameters of radio recombination lines and the 20.17 and 20.97 GHz CH3OH transitions in NGC 7538 IRS 1 are also reported. In addition, we observed five other 6 cm formaldehyde maser regions. We found no evidence of significant variability of the 6 cm masers in these regions with respect to previous observations, the only possible exception being the maser in G29.96-0.02. All six sources were also observed in the {{{H}}}213{CO} isotopologue transition of the 6 cm H2CO line; {{{H}}}213{CO} absorption was detected in five of the sources. Estimated column density ratios [{{{H}}}212{CO}]/[{{{H}}}213{CO}] are reported.


    International Nuclear Information System (INIS)

    Moscadelli, L.; Reid, M. J.; Menten, K. M.; Brunthaler, A.; Xu, Y.; Zheng, X. W.


    We report trigonometric parallaxes for the sources NGC 7538 and Cep A, corresponding to distances of 2.65 +0.12 -0.11 and 0.70 +0.04 -0.04 kpc, respectively. The distance to NGC 7538 is considerably smaller than its kinematic distance and places it in the Perseus spiral arm. The distance to Cep A is also smaller than its kinematic distance and places it in the L ocalarm or spur. Combining the distance and proper motions with observed radial velocities gives the location and full space motion of the star-forming regions. We find significant deviations from circular galactic orbits for these sources: both sources show large peculiar motions (greater than 10 km s -1 ) counter to galactic rotation and NGC 7538 has a comparable peculiar motion toward the Galactic center.

  5. Molecular Hydrogen Images of Star Forming Regions in the Magellanic Clouds (United States)

    Probst, Ronald G.; Barba, R.; Bolatto, A.; Chu, Y.; Points, S.; Rubio, M.; Smith, C.


    The Large and Small Magellanic Clouds exhibit a variety of star formation physics with multiple phase components in low metallicity, gas rich environments. The 10 K, 100 K, and 104 K regimes are well explored. We are imaging LMC and SMC star forming regions in 2.12 micron H2 emission which arises in the 1000 K transition zone of molecular clouds. This is an NOAO Survey program using the widefield IR camera NEWFIRM on the CTIO 4-m Blanco telescope during its limited southern deployment. The data set will have immediate morphological applications and will provide target selection for followup infrared spectroscopy. We will provide a public archive of fully calibrated images with no proprietary period. NOAO is operated by the Association of Universities for Research in Astronomy, under cooperative agreement with the National Science Foundation.

  6. Mid-Infrared Observations of Possible Intergalactic Star Forming Regions in the Leo Ring (United States)

    Giroux, Mark; Smith, B.; Struck, C.


    Within the Leo group of galaxies lies a gigantic loop of intergalactic gas known as the Leo Ring. Not clearly associated with any particular galaxy, its origin remains uncertain. It may be a primordial intergalactic cloud alternatively, it may be a collision ring, or have a tidal origin. Combining archival Spitzer images of this structure with published UV and optical data, we investigate the mid-infrared properties of possible knots of star formation in the ring. These sources are very faint in the mid-infrared compared to star forming regions in the tidal features of interacting galaxies. This suggests they are either deficient in dust, or they may not be associated with the ring.


    Energy Technology Data Exchange (ETDEWEB)

    Hoq, Sadia; Jackson, James M.; Foster, Jonathan B.; Sanhueza, Patricio; Claysmith, Christopher [Institute for Astrophysical Research, Boston University, Boston, MA 02215 (United States); Guzmán, Andrés [Harvard-Smithsonian Center for Astrophysics, Cambridge, MA 02138 (United States); Whitaker, J. Scott [Physics Department, Boston University, Boston, MA 02215 (United States); Rathborne, Jill M. [Australia Telescope National Facility, CSIRO Astronomy and Space Science, Epping, NSW (Australia); Vasyunina, Tatiana; Vasyunin, Anton, E-mail:, E-mail:, E-mail:, E-mail:, E-mail:, E-mail:, E-mail:, E-mail:, E-mail:, E-mail: [Department of Chemistry, University of Virginia, Charlottesville, VA 22904 (United States)


    The chemical changes of high-mass star-forming regions provide a potential method for classifying their evolutionary stages and, ultimately, ages. In this study, we search for correlations between molecular abundances and the evolutionary stages of dense molecular clumps associated with high-mass star formation. We use the molecular line maps from Year 1 of the Millimetre Astronomy Legacy Team 90 GHz (MALT90) Survey. The survey mapped several hundred individual star-forming clumps chosen from the ATLASGAL survey to span the complete range of evolution, from prestellar to protostellar to H II regions. The evolutionary stage of each clump is classified using the Spitzer GLIMPSE/MIPSGAL mid-IR surveys. Where possible, we determine the dust temperatures and H{sub 2} column densities for each clump from Herschel/Hi-GAL continuum data. From MALT90 data, we measure the integrated intensities of the N{sub 2}H{sup +}, HCO{sup +}, HCN and HNC (1-0) lines, and derive the column densities and abundances of N{sub 2}H{sup +} and HCO{sup +}. The Herschel dust temperatures increase as a function of the IR-based Spitzer evolutionary classification scheme, with the youngest clumps being the coldest, which gives confidence that this classification method provides a reliable way to assign evolutionary stages to clumps. Both N{sub 2}H{sup +} and HCO{sup +} abundances increase as a function of evolutionary stage, whereas the N{sub 2}H{sup +} (1-0) to HCO{sup +} (1-0) integrated intensity ratios show no discernable trend. The HCN (1-0) to HNC(1-0) integrated intensity ratios show marginal evidence of an increase as the clumps evolve.


    International Nuclear Information System (INIS)

    Marion, G. H.; Foley, Ryan J.; Challis, Peter; Kirshner, Robert P.; Vinko, Jozsef; Wheeler, J. Craig; Silverman, Jeffrey M.; Hsiao, Eric Y.; Brown, Peter J.; Filippenko, Alexei V.; Garnavich, Peter; Landsman, Wayne B.; Parrent, Jerod T.; Pritchard, Tyler A.; Roming, Peter W. A.; Wang, Xiaofeng


    We report measurements and analysis of high-velocity (HVF) (>20,000 km s –1 ) and photospheric absorption features in a series of spectra of the Type Ia supernova (SN) 2009ig obtained between –14 days and +13 days with respect to the time of maximum B-band luminosity (B-max). We identify lines of Si II, Si III, S II, Ca II, and Fe II that produce both HVF and photospheric-velocity (PVF) absorption features. SN 2009ig is unusual for the large number of lines with detectable HVF in the spectra, but the light-curve parameters correspond to a slightly overluminous but unexceptional SN Ia (M B = –19.46 mag and Δm 15 (B) = 0.90 mag). Similarly, the Si II λ6355 velocity at the time of B-max is greater than 'normal' for an SN Ia, but it is not extreme (v Si = 13,400 km s –1 ). The –14 days and –13 days spectra clearly resolve HVF from Si II λ6355 as separate absorptions from a detached line forming region. At these very early phases, detached HVF are prevalent in all lines. From –12 days to –6 days, HVF and PVF are detected simultaneously, and the two line forming regions maintain a constant separation of about 8000 km s –1 . After –6 days all absorption features are PVF. The observations of SN 2009ig provide a complete picture of the transition from HVF to PVF. Most SNe Ia show evidence for HVF from multiple lines in spectra obtained before –10 days, and we compare the spectra of SN 2009ig to observations of other SNe. We show that each of the unusual line profiles for Si II λ6355 found in early-time spectra of SNe Ia correlate to a specific phase in a common development sequence from HVF to PVF

  9. A Study of THT Cold Cores Population in the Star-Forming Region in Serpens (United States)

    Fiorellino, Eleonora


    The purpose of this work is to produce the Core Mass Function (CMF) of the Serpens star-forming region and confront it with the Initial Mass Function (IMF), the statistical distribution of initial star mass. As Testi & Sergent (1998) discovered, the power-law index of the slope of the CMF is very close to the one of the Salpeter's IMF (Salpeter, 1955): dN/dM / M2.35. This strongly suggests that the stellar IMF results from the fragmentation process in turbulent cloud cores rather than from stellar accretion mechanisms and gives a huge contribute to undestanding the star formation. For this work, we started from the data delivered by the European satellite Herschel and produced the maps of the Serpens with Unimap code (Piazzo et al, 2015). Hence we obtained a core catalogue with two different softwares getsources (Men'shchikov et al, 2012) and CuTEx (Molinari et al, 2011) and we eliminated from it any source that is not a core. A full discussion of the cores physical propreties as well as the whole region is under preparation.

  10. Optical polarization maps of star-forming regions in Perseus, Taurus, and Ophiuchus

    International Nuclear Information System (INIS)

    Goodman, A.A.; Bastien, P.; Menard, F.; Myers, P.C.


    New optical linear polarization maps are presented of the star-forming regions near L1506 in Taurus, L1755 in Ophiuchus, and the complex of dark cloud which extends from L1448 in B5 in Perseus. The former two show a well-defined peak magnetic field direction in the plane of the sky with a finite dispersion about that peak which is smaller than would be expected for a random distribution of field distributions. The dispersion in the position angle of filamentary clouds within these complexes implies that clouds which appear elongated on the plane of the sky are not all associated with a pattern of polarization vectors particularly parallel or perpendicular to their geometry. Instead, clouds tend to be oriented at the angle formed by their axis and the mean direction of the local large-scale field. For the dark cloud complex, a bimodal distribution of the polarization vector angle is taken to result from at least two distributions of gas along the line of sight which appear as a complex in projection. 55 refs


    International Nuclear Information System (INIS)

    Mooley, Kunal; Hillenbrand, Lynne; Rebull, Luisa; Padgett, Deborah; Knapp, Gillian


    We describe the results of a search for early-type stars associated with the Taurus-Auriga molecular cloud complex, a diffuse nearby star-forming region noted as lacking young stars of intermediate and high mass. We investigate several sets of possible O, B, and early A spectral class members. The first is a group of stars for which mid-infrared images show bright nebulae, all of which can be associated with stars of spectral-type B. The second group consists of early-type stars compiled from (1) literature listings in SIMBAD, (2) B stars with infrared excesses selected from the Spitzer Space Telescope survey of the Taurus cloud, (3) magnitude- and color-selected point sources from the Two Micron All Sky Survey, and (4) spectroscopically identified early-type stars from the Sloan Digital Sky Survey coverage of the Taurus region. We evaluated stars for membership in the Taurus-Auriga star formation region based on criteria involving: spectroscopic and parallactic distances, proper motions and radial velocities, and infrared excesses or line emission indicative of stellar youth. For selected objects, we also model the scattered and emitted radiation from reflection nebulosity and compare the results with the observed spectral energy distributions to further test the plausibility of physical association of the B stars with the Taurus cloud. This investigation newly identifies as probable Taurus members three B-type stars: HR 1445 (HD 28929), τ Tau (HD 29763), 72 Tau (HD 28149), and two A-type stars: HD 31305 and HD 26212, thus doubling the number of stars A5 or earlier associated with the Taurus clouds. Several additional early-type sources including HD 29659 and HD 283815 meet some, but not all, of the membership criteria and therefore are plausible, though not secure, members.

  12. Escape of ionizing radiation from star-forming regions in Young galaxies

    DEFF Research Database (Denmark)

    Razoumov, A; Sommer-Larsen, Jesper


    Galaxies: Formation, Galaxies: Intergalactic Medium, ISM: H II Regions, Radiative Transfer Udgivelsesdato: Nov. 10......Galaxies: Formation, Galaxies: Intergalactic Medium, ISM: H II Regions, Radiative Transfer Udgivelsesdato: Nov. 10...

  13. A search for companions to brown dwarfs in the Taurus and Chamaeleon star-forming regions

    International Nuclear Information System (INIS)

    Todorov, K. O.; Luhman, K. L.; Konopacky, Q. M.; McLeod, K. K.; Apai, D.; Pascucci, I.; Ghez, A. M.; Robberto, M.


    We have used WFPC2 on board the Hubble Space Telescope to obtain images of 47 members of the Taurus and Chamaeleon I star-forming regions that have spectral types of M6-L0 (M ∼ 0.01-0.1 M ☉ ). An additional late-type member of Taurus, FU Tau (M7.25+M9.25), was also observed with adaptive optics at Keck Observatory. In these images, we have identified promising candidate companions to 2MASS J04414489+2301513 (ρ = 0.''105/15 AU), 2MASS J04221332+1934392 (ρ = 0.''05/7 AU), and ISO 217 (ρ = 0.''03/5 AU). We reported the first candidate in a previous study, showing that it has a similar proper motion as the primary in images from WFPC2 and Gemini adaptive optics. We have collected an additional epoch of data with Gemini that further supports that result. By combining our survey with previous high-resolution imaging in Taurus, Chamaeleon I, and Upper Sco (τ ∼ 10 Myr), we measure binary fractions of 14/93 = 0.15 −0.03 +0.05 for M4-M6 (M ∼ 0.1-0.3 M ☉ ) and 4/108 = 0.04 −0.01 +0.03 for >M6 (M ≲ 0.1 M ☉ ) at separations of >10 AU. Given the youth and low density of these regions, the lower binary fraction at later types is probably primordial rather than due to dynamical interactions among association members. The widest low-mass binaries (>100 AU) also appear to be more common in Taurus and Chamaeleon I than in the field, which suggests that the widest low-mass binaries are disrupted by dynamical interactions at >10 Myr, or that field brown dwarfs have been born predominantly in denser clusters where wide systems are disrupted or inhibited from forming.

  14. A search for companions to brown dwarfs in the Taurus and Chamaeleon star-forming regions

    Energy Technology Data Exchange (ETDEWEB)

    Todorov, K. O.; Luhman, K. L. [Department of Astronomy and Astrophysics, The Pennsylvania State University, University Park, PA 16802 (United States); Konopacky, Q. M. [Lawrence Livermore National Laboratory, 7000 East Avenue, Livermore, CA 94550 (United States); McLeod, K. K. [Whitin Observatory, Wellesley College, Wellesley, MA 02481 (United States); Apai, D.; Pascucci, I. [Department of Astronomy, University of Arizona, 933 N. Cherry Avenue, Tucson, AZ 85721 (United States); Ghez, A. M. [Division of Astronomy and Astrophysics, University of California, Los Angeles, CA 90095 (United States); Robberto, M., E-mail: [Space Telescope Science Institute, 3700 San Martin Drive, Baltimore, MD 21218 (United States)


    We have used WFPC2 on board the Hubble Space Telescope to obtain images of 47 members of the Taurus and Chamaeleon I star-forming regions that have spectral types of M6-L0 (M ∼ 0.01-0.1 M {sub ☉}). An additional late-type member of Taurus, FU Tau (M7.25+M9.25), was also observed with adaptive optics at Keck Observatory. In these images, we have identified promising candidate companions to 2MASS J04414489+2301513 (ρ = 0.''105/15 AU), 2MASS J04221332+1934392 (ρ = 0.''05/7 AU), and ISO 217 (ρ = 0.''03/5 AU). We reported the first candidate in a previous study, showing that it has a similar proper motion as the primary in images from WFPC2 and Gemini adaptive optics. We have collected an additional epoch of data with Gemini that further supports that result. By combining our survey with previous high-resolution imaging in Taurus, Chamaeleon I, and Upper Sco (τ ∼ 10 Myr), we measure binary fractions of 14/93 = 0.15{sub −0.03}{sup +0.05} for M4-M6 (M ∼ 0.1-0.3 M {sub ☉}) and 4/108 = 0.04{sub −0.01}{sup +0.03} for >M6 (M ≲ 0.1 M {sub ☉}) at separations of >10 AU. Given the youth and low density of these regions, the lower binary fraction at later types is probably primordial rather than due to dynamical interactions among association members. The widest low-mass binaries (>100 AU) also appear to be more common in Taurus and Chamaeleon I than in the field, which suggests that the widest low-mass binaries are disrupted by dynamical interactions at >10 Myr, or that field brown dwarfs have been born predominantly in denser clusters where wide systems are disrupted or inhibited from forming.

  15. Water in massive star-forming regions with Herschel Space Observatory (United States)

    Chavarria, L.; Herpin, F.; Bontemps, S.; Jacq, T.; Baudry, A.; Braine, J.; van der Tak, F.; Wyrowski, F.; van Dishoeck, E. F.


    High-mass stars formation process is much less understood than the low-mass case: short timescales, high opacities and long distance to the sources challenge the study of young massive stars. The instruments on board the Heschel Space Observatory permit us to investigate molecular species at high spectral resolution in the sub-milimeter wavelengths. Water, one of the most abundant molecules in the Universe, might elucidate key episodes in the process of stellar birth and it may play a major role in the formation of high-mass stars. This contribution presents the first results of the Heschel Space Observatory key-program WISH (Water In Star forming regions with Herschel) concerning high-mass protostars. The program main purpose is to follow the process of star formation during the various stages using the water molecule as a physical diagnostic throughout the evolution. In general, we aim to adress the following questions: How does protostars interact with their environment ? How and where water is formed ? How is it transported from cloud to disk ? When and where water becomes a dominant cooling or heating agent ? We use the HIFI and PACS instruments to obtain maps and spectra of ~20 water lines in ~20 massive protostars spanning a large range in physical parameters, from pre-stellar cores to UCHII regions. I will review the status of the program and focus specifically on the spectroscopic results. I will show how powerful are the HIFI high-resolution spectral observations to resolve different physical source components such as the dense core, the outflows and the extended cold cloud around the high-mass object. We derive water abundances between 10-7 and 10-9 in the outer envelope. The abundance variations derived from our models suggest that different chemical mechanisms are at work on these scales (e.g. evaporation of water-rich icy grain mantles). The detection and derived abundance ratios for rare isotopologues will be discussed. Finally, a comparison in tems

  16. The Depletion of Water During Dispersal of Planet-forming Disk Regions (United States)

    Banzatti, A.; Pontoppidan, K. M.; Salyk, C.; Herczeg, G. J.; van Dishoeck, E. F.; Blake, G. A.


    We present a new velocity-resolved survey of 2.9 μm spectra of hot H2O and OH gas emission from protoplanetary disks, obtained with the Cryogenic Infrared Echelle Spectrometer at the VLT (R ˜ 96,000). With the addition of archival Spitzer-IRS spectra, this is the most comprehensive spectral data set of water vapor emission from disks ever assembled. We provide line fluxes at 2.9-33 μm that probe from the dust sublimation radius at ˜0.05 au out to the region of the water snow line. With a combined data set for 55 disks, we find a new correlation between H2O line fluxes and the radius of CO gas emission, as measured in velocity-resolved 4.7 μm spectra (R {}{co}), which probes molecular gaps in inner disks. We find that H2O emission disappears from 2.9 μm (hotter water) to 33 μm (colder water) as {R}{co} increases and expands out to the snow line radius. These results suggest that the infrared water spectrum is a tracer of inside-out water depletion within the snow line. It also helps clarify an unsolved discrepancy between water observations and models by finding that disks around stars of {M}\\star > 1.5 {M}⊙ generally have inner gaps with depleted molecular gas content. We measure radial trends in H2O, OH, and CO line fluxes that can be used as benchmarks for models to study the chemical composition and evolution of planet-forming disk regions at 0.05-20 au. We propose that JWST spectroscopy of molecular gas may be used as a probe of inner disk gas depletion, complementary to the larger gaps and holes detected by direct imaging and by ALMA.

  17. Investigation of conspicuous infrared star cluster and star-forming region RCW 38 IR Cluster

    International Nuclear Information System (INIS)

    Gyulbudaghian, A.L.; May, J.


    An infrared star cluster RCW 38 IR Cluster, which is also a massive star-forming region, is investigated. The results of observations with SEST (Cerro is Silla, Chile) telescope on 2.6-mm 12 CO spectral line and with SIMBA on 1.2-mm continuum are given. The 12 CO observations revealed the existence of several molecular clouds, two of which (clouds I and 2) are connected with the object RCW 38 IR Cluster. Cloud 1 is a massive cloud, which has a depression in which the investigated object is embedded. It is not excluded that the depression was formed by the wind and/or emission from the young bright stars belonging to the star cluster. Rotation of cloud 2, around the axis having SE-NW direction, with an angular velocity ω 4.6 · 10 -14 s -1 is also found. A red-shifted outflow with velocity ∼+5.6 km/s, in the SE direction and perpendicular to the elongation of cloud 2 has been also found. The investigated cluster is associated with an IR point source IRAS 08573-4718, which has IR colours typical for a, non-evolved embedded (in the cloud) stellar object. The cluster is also connected with a water maser. The SIMBA image shoves the existence of a central bright condensation, coinciding with the cluster itself, and two extensions. One of these extensions (the one with SW-NE direction) coincides, both in place and shape, with cloud 2, so that it is not excluded the possibility that this extension might be also rotating like cloud 2. In the vicinity of these extensions there are condensations resembling HH objects

  18. Trigonometric parallaxes of high mass star forming regions: the structure and kinematics of the Milky Way

    Energy Technology Data Exchange (ETDEWEB)

    Reid, M. J.; Dame, T. M. [Harvard-Smithsonian Center for Astrophysics, 60 Garden Street, Cambridge, MA 02138 (United States); Menten, K. M.; Brunthaler, A.; Wu, Y.; Zhang, B.; Sanna, A.; Sato, M.; Choi, Y. K.; Immer, K. [Max-Planck-Institut für Radioastronomie, Auf dem Hügel 69, D-53121 Bonn (Germany); Zheng, X. W. [Department of Astronomy, Nanjing University Nanjing 210093 (China); Xu, Y. [Purple Mountain Observatory, Chinese Academy of Sciences, Nanjing 210008 (China); Hachisuka, K. [Shanghai Astronomical Observatory, 80 Nandan Rd., Shanghai (China); Moscadelli, L. [Arcetri Observatory, Firenze (Italy); Rygl, K. L. J. [European Space Agency (ESA-ESTEC), Keplerlaan 1, P.O. Box 299, 2200 AG, Noordwijk (Netherlands); Bartkiewicz, A. [Centre for Astronomy, Faculty of Physics, Astronomy and Informatics, Nicolaus Copernicus University, Grudziadzka 5, 87-100 Torun (Poland)


    Over 100 trigonometric parallaxes and proper motions for masers associated with young, high-mass stars have been measured with the Bar and Spiral Structure Legacy Survey, a Very Long Baseline Array key science project, the European VLBI Network, and the Japanese VLBI Exploration of Radio Astrometry project. These measurements provide strong evidence for the existence of spiral arms in the Milky Way, accurately locating many arm segments and yielding spiral pitch angles ranging from about 7° to 20°. The widths of spiral arms increase with distance from the Galactic center. Fitting axially symmetric models of the Milky Way with the three-dimensional position and velocity information and conservative priors for the solar and average source peculiar motions, we estimate the distance to the Galactic center, R {sub 0}, to be 8.34 ± 0.16 kpc, a circular rotation speed at the Sun, Θ{sub 0}, to be 240 ± 8 km s{sup –1}, and a rotation curve that is nearly flat (i.e., a slope of –0.2 ± 0.4 km s{sup –1} kpc{sup –1}) between Galactocentric radii of ≈5 and 16 kpc. Assuming a 'universal' spiral galaxy form for the rotation curve, we estimate the thin disk scale length to be 2.44 ± 0.16 kpc. With this large data set, the parameters R {sub 0} and Θ{sub 0} are no longer highly correlated and are relatively insensitive to different forms of the rotation curve. If one adopts a theoretically motivated prior that high-mass star forming regions are in nearly circular Galactic orbits, we estimate a global solar motion component in the direction of Galactic rotation, V {sub ☉} = 14.6 ± 5.0 km s{sup –1}. While Θ{sub 0} and V {sub ☉} are significantly correlated, the sum of these parameters is well constrained, Θ{sub 0} + V {sub ☉} = 255.2 ± 5.1 km s{sup –1}, as is the angular speed of the Sun in its orbit about the Galactic center, (Θ{sub 0} + V {sub ☉})/R {sub 0} = 30.57 ± 0.43 km s{sup –1} kpc{sup –1}. These parameters improve the accuracy

  19. Citizenship and the Forms of Political Support: A Case-Study of the Croatian Adriatic Regions

    Directory of Open Access Journals (Sweden)

    Zoran Radman


    Full Text Available The article is dealing with the issue of political support in Croatia, related to the issues of trust and legitimacy towards authority and institutions, as the elements of the political system. Previous research conducted in Croatia evidences a relatively low level of trust in the political authorities and institutions. In this paper we go by Easton’s dimensions of political support: authority support, support to institutions, support to democracy and support to community. All these forms of political support represent the subjective orientations of citizens towards the units of the political system. On the other hand, orientation and relationship of citizens towards the units of the political systems poses the question of citizenship. The paper is exploring the relation of subjective orientations of citizens towards the political systems units and different dimensions of political support in the specific context of Adriatic regions of Croatia, on the basis of the established models of citizenship developed by various authors. The results point out that the level of support rises as we go from the lower, specific types of support (support to authorities and support to institutions towards higher, diffuse modes of support (support to community. In the background of the political support, especially “support to democracy”, there are performances of the political system. In other words, political support is more instrumentally then intrinsically founded.

  20. Trigonometric parallaxes of star forming regions in the Scutum spiral arm

    International Nuclear Information System (INIS)

    Sato, M.; Wu, Y. W.; Immer, K.; Zhang, B.; Sanna, A.; Brunthaler, A.; Menten, K. M.; Reid, M. J.; Dame, T. M.


    We report measurements of trigonometric parallaxes for six high-mass star-forming regions in the Scutum spiral arm of the Milky Way as part of the BeSSeL Survey. Combining our measurements with 10 previous measurements from the BeSSeL Survey yields a total sample of 16 sources in the Scutum arm with trigonometric parallaxes in the Galactic longitude range from 5° to 32°. Assuming a logarithmic spiral model, we estimate a pitch angle of 19.°8 ± 3.°1 for the Scutum arm, which is larger than pitch angles reported for other spiral arms. The high pitch angle of the arm may be due to the arm's proximity to the Galactic bar. The Scutum arm sources show an average peculiar motion of 4 km s –1 slower than the Galactic rotation and 8 km s –1 toward the Galactic center. While the direction of this non-circular motion has the same sign as determined for sources in other spiral arms, the motion toward the Galactic center is greater for the Scutum arm sources.

  1. Insights from Synthetic Star-forming Regions. I. Reliable Mock Observations from SPH Simulations

    Energy Technology Data Exchange (ETDEWEB)

    Koepferl, Christine M.; Robitaille, Thomas P.; Biscani, Francesco [Max Planck Institute for Astronomy, Königstuhl 17, D-69117 Heidelberg (Germany); Dale, James E., E-mail: [University Observatory Munich, Scheinerstr. 1, D-81679 Munich (Germany)


    Through synthetic observations of a hydrodynamical simulation of an evolving star-forming region, we assess how the choice of observational techniques affects the measurements of properties that trace star formation. Testing and calibrating observational measurements requires synthetic observations that are as realistic as possible. In this part of the series (Paper I), we explore different techniques for mapping the distributions of densities and temperatures from the particle-based simulations onto a Voronoi mesh suitable for radiative transfer and consequently explore their accuracy. We further test different ways to set up the radiative transfer in order to produce realistic synthetic observations. We give a detailed description of all methods and ultimately recommend techniques. We have found that the flux around 20 μ m is strongly overestimated when blindly coupling the dust radiative transfer temperature with the hydrodynamical gas temperature. We find that when instead assuming a constant background dust temperature in addition to the radiative transfer heating, the recovered flux is consistent with actual observations. We present around 5800 realistic synthetic observations for Spitzer and Herschel bands, at different evolutionary time-steps, distances, and orientations. In the upcoming papers of this series (Papers II, III, and IV), we will test and calibrate measurements of the star formation rate, gas mass, and the star formation efficiency using our realistic synthetic observations.


    International Nuclear Information System (INIS)

    Romita, Krista Alexandra; Meixner, M.; Sewilo, M.; Shiao, B.; Carlson, Lynn Redding; Whitney, B.; Babler, B.; Meade, M.; Indebetouw, R.; Hora, J. L.


    We present analysis of the energetic star-forming region Henize 206 (N206) located near the southern edge of the Large Magellanic Cloud (LMC) based on photometric data from the Spitzer Surveying the Agents of Galaxy Evolution (SAGE-LMC; IRAC 3.6, 4.5, 5.8, 8.0 μm and MIPS 24 μm), Infrared Survey Facility near-infrared survey (J, H, K s ), and the Magellanic Clouds Photometric Survey (MCPS UBVI) covering a wavelength range of 0.36-24 μm. Young stellar object (YSO) candidates are identified based upon their location in infrared color-magnitude space and classified by the shapes of their spectral energy distributions in comparison with a pre-computed grid of YSO models. We identify 116 YSO candidates: 102 are well characterized by the YSO models, predominately Stage I, and 14 may be multiple sources or young sources with transition disks. Careful examination of the individual sources and their surrounding environment allows us to identify a factor of ∼14.5 more YSO candidates than have already been identified. The total mass of these well-fit YSO candidates is ∼520 M sun . We calculate a current star formation rate of 0.27 x 10 -1 M sun yr -1 kpc -2 . The distribution of YSO candidates appears to follow shells of neutral material in the interstellar medium.


    Energy Technology Data Exchange (ETDEWEB)

    Lindberg, Johan E.; Charnley, Steven B.; Cordiner, Martin A. [NASA Goddard Space Flight Center, Astrochemistry Laboratory, Mail Code 691, 8800 Greenbelt Road, Greenbelt, MD 20771 (United States); Jørgensen, Jes K.; Bjerkeli, Per, E-mail: [Centre for Star and Planet Formation, Niels Bohr Institute and Natural History Museum of Denmark, University of Copenhagen, Øster Voldgade 5-7, DK-1350 Copenhagen K (Denmark)


    We present APEX 218 GHz observations of molecular emission in a complete sample of embedded protostars in the Ophiuchus star-forming region. To study the physical properties of the cores, we calculate H{sub 2}CO and c -C{sub 3}H{sub 2} rotational temperatures, both of which are good tracers of the kinetic temperature of the molecular gas. We find that the H{sub 2}CO temperatures range between 16 K and 124 K, with the highest H{sub 2}CO temperatures toward the hot corino source IRAS 16293-2422 (69–124 K) and the sources in the ρ Oph A cloud (23–49 K) located close to the luminous Herbig Be star S1, which externally irradiates the ρ Oph A cores. On the other hand, the c -C{sub 3}H{sub 2} rotational temperature is consistently low (7–17 K) in all sources. Our results indicate that the c -C{sub 3}H{sub 2} emission is primarily tracing more shielded parts of the envelope whereas the H{sub 2}CO emission (at the angular scale of the APEX beam; 3600 au in Ophiuchus) mainly traces the outer irradiated envelopes, apart from in IRAS 16293-2422, where the hot corino emission dominates. In some sources, a secondary velocity component is also seen, possibly tracing the molecular outflow.

  4. YSOVAR: Mid-infrared variability in the star-forming region Lynds 1688

    Energy Technology Data Exchange (ETDEWEB)

    Günther, H. M.; Poppenhaeger, K.; Wolk, S. J.; Hora, J. L. [Harvard-Smithsonian Center for Astrophysics, 60 Garden Street, Cambridge, MA 02138 (United States); Cody, A. M. [Spitzer Science Center, California Institute of Technology, Pasadena, CA 91125 (United States); Covey, K. R. [Lowell Observatory, 1400 West Mars Hill Road, Flagstaff, AZ 86001 (United States); Hillenbrand, L. A. [Department of Astronomy, California Institute of Technology, Pasadena, CA 91125 (United States); Plavchan, P. [NASA Exoplanet Science Institute, California Institute of Technology, 770 South Wilson Avenue, Pasadena, CA 91125 (United States); Rebull, L. M.; Stauffer, J. R. [Spitzer Science Center/Caltech, 1200 East California Boulevard, Pasadena, CA 91125 (United States); Allen, L. [National Optical Astronomy Observatories, Tucson, AZ 85719 (United States); Bayo, A. [Max Planck Institut für Astronomie, Königstuhl 17, D-69117 Heidelberg (Germany); Gutermuth, R. A. [Department of Astronomy, University of Massachusetts, Amherst, MA 01003 (United States); Meng, H. Y. A. [Infrared Processing and Analysis Center, California Institute of Technology, MC 100-22, 770 South Wilson Avenue, Pasadena, CA 91125 (United States); Morales-Calderón, M. [Centro de Astrobiología (INTA-CSIC), ESAC Campus, P.O. Box 78, E-28691 Villanueva de la Canada (Spain); Parks, J. R. [Department of Physics and Astronomy, Georgia State University, 25 Park Place South, Atlanta, GA 30303 (United States); Song, Inseok, E-mail: [Physics and Astronomy Department, University of Georgia, Athens, GA 30602-2451 (United States)


    The emission from young stellar objects (YSOs) in the mid-infrared (mid-IR) is dominated by the inner rim of their circumstellar disks. We present IR data from the Young Stellar Object VARiability (YSOVAR) survey of ∼800 objects in the direction of the Lynds 1688 (L1688) star-forming region over four visibility windows spanning 1.6 yr using the Spitzer Space Telescope in its warm mission phase. Among all light curves, 57 sources are cluster members identified based on their spectral energy distribution and X-ray emission. Almost all cluster members show significant variability. The amplitude of the variability is larger in more embedded YSOs. Ten out of 57 cluster members have periodic variations in the light curves with periods typically between three and seven days, but even for those sources, significant variability in addition to the periodic signal can be seen. No period is stable over 1.6 yr. Nonperiodic light curves often still show a preferred timescale of variability that is longer for more embedded sources. About half of all sources exhibit redder colors in a fainter state. This is compatible with time-variable absorption toward the YSO. The other half becomes bluer when fainter. These colors can only be explained with significant changes in the structure of the inner disk. No relation between mid-IR variability and stellar effective temperature or X-ray spectrum is found.

  5. Abundances and Excitation of H2, H3+ & CO in Star-Forming Regions (United States)

    Kulesa, Craig A.

    Although most of the 123 reported interstellar molecules to date have been detected through millimeter-wave emission-line spectroscopy, this technique is inapplicable to non-polar molecules like H2 and H3+, which are central to our understanding of interstellar chemistry. Thus high resolution infrared absorption-line spectroscopy bears an important role in interstellar studies: chemically important non-polar molecules can be observed, and their abundances and excitation conditions can be referred to the same ``pencil beam'' absorbing column. In particular, through a weak quadrupole absorption line spectrum at near-infrared wavelengths, the abundance of cold H2 in dark molecular clouds and star forming regions can now be accurately measured and compared along the same ``pencil beam'' line of sight with the abundance of its most commonly cited surrogate, CO, and its rare isotopomers. Also detected via infrared line absorption is the pivotal molecular ion H3+, whose abundance provides the most direct measurement of the cosmic ray ionization rate in dark molecular clouds, a process that initiates the formation of many other observed molecules there. Our growing sample of H2 and CO detections now includes detailed multi-beam studies of the ρ Ophiuchi molecular cloud and NGC 2024 in Orion. We explore the excitation and degree of ortho- and para-H2 thermalization in dark clouds, variation of the CO abundance over a cloud, and the relation of H2 column density to infrared extinction mapping, far-infrared/submillimeter dust continuum emission, and large scale submillimeter CO, [C I] and HCO+ line emission -- all commonly invoked to indirectly trace H2 during the past 30+ years. For each of the distinct velocity components seen toward some embedded young stellar objects, we are also able to determine the temperature, density, and a CO/H2 abundance ratio, thus unraveling some of the internal structure of a star-forming cloud. H2 and H3+ continue to surprise and delight us


    Directory of Open Access Journals (Sweden)

    S.V. Orekhova


    Full Text Available This paper presents an estimation procedure of regional labor market influence on sustainability of internal labor market institutions. The paper refines the categories of regional and internal labor market. Internal labor market institutions have been classified and evaluated regarding the level of their sustainability (basing on cases of the Sverdlovsk region city-forming enterprises. As a result the model of labor expenses evaluation is elaborated for enterprises concerned.


    International Nuclear Information System (INIS)

    Daemgen, Sebastian; Bonavita, Mariangela; Jayawardhana, Ray; Lafrenière, David; Janson, Markus


    We present results from a large, high-spatial-resolution near-infrared imaging search for stellar and sub-stellar companions in the Taurus-Auriga star-forming region. The sample covers 64 stars with masses between those of the most massive Taurus members at ∼3 M ☉ and low-mass stars at ∼0.2 M ☉ . We detected 74 companion candidates, 34 of these reported for the first time. Twenty-five companions are likely physically bound, partly confirmed by follow-up observations. Four candidate companions are likely unrelated field stars. Assuming physical association with their host star, estimated companion masses are as low as ∼2 M Jup . The inferred multiplicity frequency within our sensitivity limits between ∼10-1500 AU is 26.3 −4.9 +6.6 %. Applying a completeness correction, 62% ± 14% of all Taurus stars between 0.7 and 1.4 M ☉ appear to be multiple. Higher order multiples were found in 1.8 −1.5 +4.2 % of the cases, in agreement with previous observations of the field. We estimate a sub-stellar companion frequency of ∼3.5%-8.8% within our sensitivity limits from the discovery of two likely bound and three other tentative very low-mass companions. This frequency appears to be in agreement with what is expected from the tail of the stellar companion mass ratio distribution, suggesting that stellar and brown dwarf companions share the same dominant formation mechanism. Further, we find evidence for possible evolution of binary parameters between two identified sub-populations in Taurus with ages of ∼2 Myr and ∼20 Myr, respectively


    Energy Technology Data Exchange (ETDEWEB)

    Daemgen, Sebastian [Department of Astronomy and Astrophysics, University of Toronto, 50 St. George Street, Toronto, ON M5H 3H4 (Canada); Bonavita, Mariangela [The University of Edinburgh, Royal Observatory, Blackford Hill, Edinburgh EH9 3HJ (United Kingdom); Jayawardhana, Ray [Physics and Astronomy, York University, Toronto, Ontario L3T 3R1 (Canada); Lafrenière, David [Department of Physics, University of Montréal, Montréal, QC (Canada); Janson, Markus, E-mail: [Department of Astronomy, Stockholm University, Stockholm (Sweden)


    We present results from a large, high-spatial-resolution near-infrared imaging search for stellar and sub-stellar companions in the Taurus-Auriga star-forming region. The sample covers 64 stars with masses between those of the most massive Taurus members at ∼3 M {sub ☉} and low-mass stars at ∼0.2 M {sub ☉}. We detected 74 companion candidates, 34 of these reported for the first time. Twenty-five companions are likely physically bound, partly confirmed by follow-up observations. Four candidate companions are likely unrelated field stars. Assuming physical association with their host star, estimated companion masses are as low as ∼2 M {sub Jup}. The inferred multiplicity frequency within our sensitivity limits between ∼10-1500 AU is 26.3{sub −4.9}{sup +6.6}%. Applying a completeness correction, 62% ± 14% of all Taurus stars between 0.7 and 1.4 M {sub ☉} appear to be multiple. Higher order multiples were found in 1.8{sub −1.5}{sup +4.2}% of the cases, in agreement with previous observations of the field. We estimate a sub-stellar companion frequency of ∼3.5%-8.8% within our sensitivity limits from the discovery of two likely bound and three other tentative very low-mass companions. This frequency appears to be in agreement with what is expected from the tail of the stellar companion mass ratio distribution, suggesting that stellar and brown dwarf companions share the same dominant formation mechanism. Further, we find evidence for possible evolution of binary parameters between two identified sub-populations in Taurus with ages of ∼2 Myr and ∼20 Myr, respectively.


    Energy Technology Data Exchange (ETDEWEB)

    Carrasco-Gonzalez, Carlos [Max-Planck-Institut fuer Radioastronomie (MPIfR), Auf dem Huegel 69, 53121 Bonn (Germany); Osorio, Mayra; Anglada, Guillem; Gomez, Jose F. [Instituto de Astrofisica de Andalucia, CSIC, Camino Bajo de Huetor 50, E-18008 Granada (Spain); D' Alessio, Paola; Rodriguez, Luis F. [Centro de Radioastronomia y Astrofisica UNAM, Apartado Postal 3-72 (Xangari), 58089 Morelia, Michoacan (Mexico); Torrelles, Jose M., E-mail: [Instituto de Ciencias del Espacio (CSIC)-UB/IEEC, Universitat de Barcelona, Marti i Franques 1, E-08028 Barcelona (Spain)


    We present centimeter (cm) and millimeter (mm) observations of the NGC 2071 star-forming region performed with the Very Large Array (VLA) and Combined Array for Research in Millimeter-wave Astronomy (CARMA). We detected counterparts at 3.6 cm and 3 mm for the previously known sources IRS 1, IRS 2, IRS 3, and VLA 1. All these sources show spectral energy distributions (SEDs) dominated by free-free thermal emission at cm wavelengths and thermal dust emission at mm wavelengths, suggesting that all of them are associated with young stellar objects (YSOs). IRS 1 shows a complex morphology at 3.6 cm, with changes in the direction of its elongation. We discuss two possible explanations to this morphology: the result of changes in the direction of a jet due to interactions with a dense ambient medium, or that we are actually observing the superposition of two jets arising from two components of a binary system. Higher angular resolution observations at 1.3 cm support the second possibility, since a double source is inferred at this wavelength. IRS 3 shows a clear jet-like morphology at 3.6 cm. Over a timespan of four years, we observed changes in the morphology of this source that we interpret as due to ejection of ionized material in a jet. The emission at 3 mm of IRS 3 is angularly resolved, with a deconvolved size (FWHM) of {approx}120 AU, and seems to be tracing a dusty circumstellar disk perpendicular to the radio jet. An irradiated accretion disk model around an intermediate-mass YSO can account for the observed SED and spatial intensity profile at 3 mm, supporting this interpretation.


    International Nuclear Information System (INIS)

    Carrasco-González, Carlos; Osorio, Mayra; Anglada, Guillem; Gómez, José F.; D'Alessio, Paola; Rodríguez, Luis F.; Torrelles, José M.


    We present centimeter (cm) and millimeter (mm) observations of the NGC 2071 star-forming region performed with the Very Large Array (VLA) and Combined Array for Research in Millimeter-wave Astronomy (CARMA). We detected counterparts at 3.6 cm and 3 mm for the previously known sources IRS 1, IRS 2, IRS 3, and VLA 1. All these sources show spectral energy distributions (SEDs) dominated by free-free thermal emission at cm wavelengths and thermal dust emission at mm wavelengths, suggesting that all of them are associated with young stellar objects (YSOs). IRS 1 shows a complex morphology at 3.6 cm, with changes in the direction of its elongation. We discuss two possible explanations to this morphology: the result of changes in the direction of a jet due to interactions with a dense ambient medium, or that we are actually observing the superposition of two jets arising from two components of a binary system. Higher angular resolution observations at 1.3 cm support the second possibility, since a double source is inferred at this wavelength. IRS 3 shows a clear jet-like morphology at 3.6 cm. Over a timespan of four years, we observed changes in the morphology of this source that we interpret as due to ejection of ionized material in a jet. The emission at 3 mm of IRS 3 is angularly resolved, with a deconvolved size (FWHM) of ∼120 AU, and seems to be tracing a dusty circumstellar disk perpendicular to the radio jet. An irradiated accretion disk model around an intermediate-mass YSO can account for the observed SED and spatial intensity profile at 3 mm, supporting this interpretation.

  11. Water deuteration in star-forming regions: Contribution of Herschel/HIFI spectroscopic data

    International Nuclear Information System (INIS)

    Coutens, Audrey


    cloud. The HDO/H_2O ratios as well as the D_2O/HDO ratios determined in IRAS 16293-2422 enable to constrain the conditions of water formation in this kind of objects and in particular suggest that water would be formed before the gravitational collapse of the cloud. This study was then extended to other solar-type protostars NGC1333 IRAS4A and NGC1333 IRAS4B, for which I estimated the abundances of deuterated water and noticed that an extended absorbing layer also surrounds these sources. The high HDO/H_2O ratios determined in IRAS 16293-2422 suggest that mechanisms are required between the Class 0 stage and the comets formation to decrease these isotopic ratios. It is however necessary to study a larger sample of protostars to know if this trend is observed in most of the sources. The HDO abundances obtained in NGC1333 IRAS4A and NGC1333 IRAS4B will consequently be useful to estimate their HDO/H_2O ratios. Finally, I also studied deuterated water in protostellar objects more massive and more luminous than solar-type protostars and show here the case of the ultra-compact HII region G34.26+0.15. (author) [fr

  12. Simulation study of the chemical forms of neptunium and plutonium in groundwater from a borehole in the northwest region

    International Nuclear Information System (INIS)

    Ma Yingming; Jin Yuren; Wang Zhiqiang; Liu Dongxu; Liu Wei; Liu Yan


    According to physics-chymistry characteristic of groundwater from a borehole in the northwest region, we performed simulation study of the chemical forms of neptunium and plutonium by the geochemistry modeling program EQ3/6. The main conclusions are as follows: the main chemical form of neptunium in the groundwater is Np(V)'s NpO 2 + , subordination chemical forms are NpO 2 Cl, NpO 2 CO 3 - , NpO 2 OH, NpO 2 SO 4 - ; the main existing form of plutonium in the groundwater is Pu(IV)'s Pu(OH)5-and subordination chemical form is Pu(V)'s PuO 2 + . In addition,the temperature, pH and Eh also have different impacts on the chemical form of neptunium and plutonium. (authors)

  13. A Comparative Observational Study of YSO Classification in Four Small Star-forming H ii Regions

    Energy Technology Data Exchange (ETDEWEB)

    Kang, Sung-Ju; Choi, Minho; Kang, Miju [Korea Astronomy and Space Science Institute, 776, Daedeokdae-ro, Yuseong-gu, Daejeon, 34055 (Korea, Republic of); Kerton, C. R., E-mail:, E-mail: [Department of Physics and Astronomy, Iowa State University, Ames, IA 50011 (United States)


    We have developed a new young stellar object (YSO) identification and classification technique using mid-infrared Wide-field Infrared Survey Explorer (WISE) data. We compare this new technique with previous WISE YSO detection and classification methods that used either infrared colors or spectral energy distribution slopes. In this study, we also use the new technique to detect and examine the YSO population associated with four small H ii regions: KR 7, KR 81, KR 120, and KR 140. The relatively simple structure of these regions allows us to effectively use both spatial and temporal constraints to identify YSOs that are potential products of triggered star formation. We are also able to identify regions of active star formation around these H ii regions that are clearly not influenced by the H ii region expansion, and thus demonstrate that star formation is on-going on megayear timescales in some of these molecular clouds.

  14. Radio continuum interferometry of dark clouds: A search for newly formed HII regions

    International Nuclear Information System (INIS)

    Gilmore, W.S.


    A search for compact HII regions embedded in dark clouds has been carried out in an effort to study local massive star formation. Approximately 20% of the total area of opaque dark cloud material in the sky with Av greater than or equal to 6 mag was surveyed with the NRAO three-element interferometer at 2695 MHz, and at least 5% more was surveyed with the NRAO 300-foot telescope at 4750 MHz. The regions surveyed include the dark cloud complexes in Perseus, Taurus, Orion, and Ophiuchus, as well as several smaller cloud complexes and individual clouds. No hidden compact HII regions embedded inside dark clouds were detected with certainty in the radio continuum. However, eleven HII regions with associated visible emission and eighteen other possible HII regions were detected. Five infrared sources thought to have the luminosities of early B stars were not detected in the radio continuum. These five sources showed high correlation with the presence of CO self-absorption, CO emission over a wide range of velocities, and type I OH masers, but an absence of coincident visible nebulosity and detectable radio continuum emission. Therefore, it is suggested that they represent an earlier evolutionary stage than those HII region detected in the radio continuum. This first evolutionary state marks the presence of ''pre-emergent'' (with respect to the molecular cloud) cocoon stars. HII regions in the second evolutionary state are marked by the presence of detectable radio continuum emission, i.e., they are stronger than 10 mJy at 2695 MHz. They have associated visible nebulosity, are relatively large, and appear to be located at the edges of molecular clouds. These are designated as ''emergent edge'' HII regions. The fact that many young HII regions are edge HII regions implies that massive stars are born near the edges of clouds, a phenomenon previously suggested by several other investigators

  15. Proposed measurement of the imaginary component of atomic form factor for medium Z-elements in regions exhibiting significant discrepancies

    International Nuclear Information System (INIS)

    De Jonge, M.; Dhal, B.B.; Tran, C.Q.; Barnea, Z.; Chantler, C.T.


    Full text: Discrepancies in measurements of the complex atomic form factor in regions of medium Z are alarmingly high for such a fundamental problem. The consequence of this is that any experiment reliant on the Beer-Lambert absorption law that uses the tabulated absorption coefficients assumes an immediate experimental uncertainty of 2-10%, depending on the element and the energy under consideration. We have begun to address this state of affairs in the medium Z-region through a series of precise determinations of attenuation coefficients. We will elaborate on a proposed method of measuring the atomic form factor to 0.2% absolute accuracy

  16. The life forms of lichens on different substrates in Yelanetsko-Ingulskiy region (Mikolayivska and Kirovogradska oblast, Ukraine

    Directory of Open Access Journals (Sweden)

    Tatyana O. Boiko


    Full Text Available The article reveals the issue of distribution of lichens life forms on different substrates, which are present in the Yelanetsko- Ingulskiy region. The largest number of life forms of the lichens is characteristic for granite outcrops, and the lowest – for gneisses. This fact is associated with features of substrate morphostructure and density, microclimatic conditions of different ecotopes in which lichens grow.

  17. Acceptance of alternative forms of family life by students of the Bialskie region [Akceptacja alternatywnych form życia rodzinnego przez studentów powiatu bialskiego

    Directory of Open Access Journals (Sweden)

    Marzena RUSZKOWSKA


    Full Text Available The article describes the popularity of alternative forms of family life among young people living in urban and rural settings of the Bialski region. It contains a discussion of the results of a survey conducted at the turn of 2013/2014, and an attempt to answer the question whether and, if so how, informal relationships are an alternative to marriage and family, whether young people are aware of the legal consequences of staying in socalled free relationships, and whether they have an impact on a child if it results from such a relationship.

  18. Conceptual Approach to Forming the Basic Code of Neo-Industrial Development of a Region

    Directory of Open Access Journals (Sweden)

    Elena Leonidovna Andreeva


    Full Text Available In the article, the authors propose the conceptual fundamentals of the “code approach” to the regional neo-industrial development. The purpose of the research is to reveal the essence of the transition to a new type of industrial and economic relations through a prism of “genetic codes” of the region. We consider these codes as a system of the “racial memory” of a territory, which determines the specificity and features of neo-industrialization realization. We substantiated the hypothesis about the influence of the “genetic codes” of the region on the effectiveness of the neo-industrialization. We have defined the participants, or else the carriers of the codes in the transformation of regional inheritance for the stimulation of the neoindustrial development of region’s economy. The subject matter of the research is the distinctive features of the functioning of the determinative region’s codes. Their content determines the socio-economic specificity of the region and the features of innovative, informational, value-based and competence-based development of the territory. The determinative codes generate the dynamic codes of the region, which are understood as their derivatives. They have a high probability of occurrence, higher speed of development and distribution, internal forces that make possible the self-development of the region. The scientific contribution is the substantiation of the basic code of the regional neo-industrial development. It represents the evolutionary accumulation of the rapid changes of its innovative, informational, value-based and competence-based codes stimulating the generation and implementation of new ideas regarding to economic entities adapted to the historical and cultural conditions. The article presents the code model of neo-industrial development of the region described by formulas. We applied the system analysis methods, historical and civilization approaches, evolutionary and

  19. On Issue of Algorithm Forming for Assessing Investment Attractiveness of Region Through Its Technospheric Security (United States)

    Filimonova, L. A.; Skvortsova, N. K.


    The article examines the problematic aspects of assessing the investment attractiveness of a region associated with the consideration of methodological issues that require refinement from the point of view of its technospheric security. Such issues include the formation of a sound system of indicators for the assessment of man-made risk which has a particular impact on the level of investment attractiveness of the region. In the context of the instability of the economic situation in Russia, the problem of man-made risks assessing in the context of the regional investment attractiveness based on an integrated approach and taking into account such principles as flexibility, adaptability, innovative orientation has not only lost its relevance but was also transformed into one of the most important conditions for ensuring the effective management of all spheres of the regional activities. The article poses the classical problem of making decisions on the results of the assessment of the investment attractiveness of the region in a matrix format evaluating the utility function. The authors of the article recommended a universal risk assessment model with its subsequent synthesis into technospheric security for the comprehensive assessment of regional investment attractiveness. The principal distinguishing feature of the study results are the schemes for manipulation in the evaluation activity associated with the selection of the optimality criteria groups and models for their study. These iterations make it possible to substantiate the choice of the solution for preserving the technospheric security of the region, a field of compromises or an “ideal” solution to the problem of the regional investment attractiveness loss.

  20. Lower solar chromosphere-corona transition region. II - Wave pressure effects for a specific form of the heating function (United States)

    Woods, D. Tod; Holzer, Thomas E.; Macgregor, Keith B.


    Lower transition region models with a balance between mechanical heating and radiative losses are expanded to include wave pressure effects. The models are used to study the simple damping length form of the heating function. The results are compared to the results obtained by Woods et al. (1990) for solutions in the lower transition region. The results suggest that a mixture of fast-mode and slow-mode waves may provide the appropriate heating mechanism in the lower transition region, with the decline in effective vertical wave speed caused by the refraction and eventual total reflection of the fast-mode wave resulting from the decreasing atmospheric density.

  1. Feeding patterns of molestus and pipiens forms of Culex pipiens (Diptera: Culicidae) in a region of high hybridization. (United States)

    Gomes, Bruno; Sousa, Carla A; Vicente, José L; Pinho, Leonor; Calderón, Isabel; Arez, Eliane; Almeida, António Pg; Donnelly, Martin J; Pinto, João


    Two biological forms of the mosquito Culex pipiens s.s., denoted pipiens and molestus, display behavioural differences that may affect their role as vectors of arboviruses. In this study, the feeding patterns of molestus and pipiens forms were investigated in Comporta (Portugal), where high levels of inter-form admixture have been recorded. Indoor and outdoor mosquito collections were performed in the summer of 2010. Collected Cx. pipiens s.l. females were molecularly identified to species and form by PCR and genotyped for six microsatellites. The source of the blood meal in post-fed females was determined by ELISA and mitochondrial DNA sequencing. The distribution of the forms differed according to the collection method. The molestus form was present only in indoor collections, whereas pipiens and admixed individuals were sampled both indoors and outdoors. In both forms, over 90% of blood meals were made on avian hosts. These included blood meals taken from Passeriformes (Passer domesticus and Turdus merula) by females caught resting inside domestic shelters. Genetic structure and blood meal analyses suggest the presence of a bird biting molestus population in the study area. Both forms were found to rest indoors, mainly in avian shelters, but at least a proportion of females of the pipiens form may bite outdoors in sylvan habitats and then search for anthropogenic resting sites to complete their gonotrophic cycle. This behaviour may potentiate the accidental transmission of arboviruses to humans in the region.

  2. Delineating Partnerships from other Forms of Collaboration in Regional Development Planning

    DEFF Research Database (Denmark)

    Larsen, Peter Wilgaard


    The idea of an all-encompassing partnership has vindicated all sorts of collaboration models to be articulated as partnerships although not occurring as ones, leaving practitioners and politicians of regional development planning with suboptimal ways of collaborating. Reviewing the partnership...... of regional planning and development, this paper defines a partnership to be a promise of a promise denoting other collaborative models such as network, cluster and governance-partnership as a promise only. Based on qualitative interviews, discursive analyses and strategic documents, the comparative case...... analysis of two Danish regional development agencies shows how one remained as a governance-partnership while the other turned into a partnership by continuously creating possibilities for the groups of actors involved. This transformation from a promise only into a promise of a promise displays how...

  3. Investigation on the geographical distribution and life form of plant species in sub alpine zone Karsanak region, Shahrekord

    Directory of Open Access Journals (Sweden)

    Jahanbakhsh Pairanj


    Full Text Available This study was carried out in rangelands of Karsanak, Chaharmahal and Bakhtiari province, which is regarded as one of the rich rangelands. Phytogeographically, this region is located in Irano-Turanian (zone of sub alpine. Endemic and rare plants were identified and geographical distribution and life form of identified plant species were investigated as well. Overall, 100 species from 17 families were identified from which 20 percent of identified species was endemic element of Irano-Turanian region. Results indicated that 75.7 percent of identified plants belonged to the Irano-Turanian and only 3 and 2 percent belonged to Euro-Siberian and Mediterranean regions respectively. The reason of high percentage of Irano-Turanian elements is probably the long distance of this region from other regions. Similarities of Irano-Turanian and Mediterranean were included 6.1 percent of identified plants and Irano-Turanian and Euro-Siberian included 2 percent. Results of life forms showed hemichryptophytes including 60 percent of life forms which indicate the cold and mountainous weather.

  4. Changes to urban form and commuting patterns: trends in two Danish city regions

    DEFF Research Database (Denmark)

    Nielsen, Thomas Alexander Sick


    This paper compares indicators of polycentricity in a monocentric (MUR) and a polycentric urban region (PUR) in Denmark at two points in time (1982 and 2002). It describes how population, jobs and commuting indicators of polycentricity develop and interact over time. Both the MUR and the PUR tend...

  5. Innovative Forms of Regional Structural Policy in Europe: the Role of Dominant Concepts and Knowledge Flows

    NARCIS (Netherlands)

    Lagendijk, A.


    The last decade has witnessed a revival of regional structural policy in the Western world. The new style of policy-making which has emerged differs markedly from the top-down distributional models that dominated the post-war period, but is also more pro-active than the hands-off approach of the

  6. Distribution of various forms of Cd, Pb and Cu in the Wadge Bank region (Arabian Sea)

    Digital Repository Service at National Institute of Oceanography (India)

    George, M.D.

    Labile, nonlabile and particulate forms of Cd,Pb and Cu were determined in 29 water samples collected from a depth of 5 m, from the Wadge Bank area. Labile Cd varied from 0.1 to 0.2 mu g.l-1 while nonlabile fraction was in the range 0.1 to 0.3 mu gl...


    Energy Technology Data Exchange (ETDEWEB)

    Ybarra, Jason E.; Tapia, Mauricio; Román-Zúñiga, Carlos G. [Instituto de Astronomía, Universidad Nacional Autónoma de Mexíco, Unidad Académica en Ensenada, Km 103 Carr. Tijuana-Ensenada, 22860 Ensenada BC (Mexico); Lada, Elizabeth A., E-mail: [Department of Astronomy, University of Florida, 211 Bryant Space Science Center, Gainesville, FL 32611 (United States)


    The infrared data from the Spitzer Space Telescope are an invaluable tool for identifying physical processes in star formation. In this study, we calculate the Infrared Array Camera (IRAC) color space of UV fluorescent H{sub 2} and polycyclic aromatic hydrocarbon (PAH) emission in photodissociation regions (PDRs) using the Cloudy code with PAH opacities from Draine and Li. We create a set of color diagnostics that can be applied to study the structure of PDRs and to distinguish between FUV-excited and shock-excited H{sub 2} emission. To test this method, we apply these diagnostics to Spitzer IRAC data of NGC 2316. Our analysis of the structure of the PDR is consistent with previous studies of the region. In addition to UV excited emission, we identify shocked gas that may be part of an outflow originating from the cluster.


    International Nuclear Information System (INIS)

    Ybarra, Jason E.; Tapia, Mauricio; Román-Zúñiga, Carlos G.; Lada, Elizabeth A.


    The infrared data from the Spitzer Space Telescope are an invaluable tool for identifying physical processes in star formation. In this study, we calculate the Infrared Array Camera (IRAC) color space of UV fluorescent H 2 and polycyclic aromatic hydrocarbon (PAH) emission in photodissociation regions (PDRs) using the Cloudy code with PAH opacities from Draine and Li. We create a set of color diagnostics that can be applied to study the structure of PDRs and to distinguish between FUV-excited and shock-excited H 2 emission. To test this method, we apply these diagnostics to Spitzer IRAC data of NGC 2316. Our analysis of the structure of the PDR is consistent with previous studies of the region. In addition to UV excited emission, we identify shocked gas that may be part of an outflow originating from the cluster

  9. Does the Functional Form of the Association Between Education and Mortality Differ by U.S. Region? (United States)

    Sheehan, Connor; Montez, Jennifer Karas; Sasson, Isaac


    To understand the education-mortality association among U.S. adults, recent studies have documented its national functional form. However, the functional form of education-mortality relationship may vary across geographic contexts. The four U.S. Census regions differ considerably in their social and economic policies, employment opportunities, income levels, and other factors that may affect how education lowers the risk of mortality. Thus, we documented regional differences in the functional form of the education-mortality association and examined the role of employment and income in accounting for regional differences. We used data on non-Hispanic white adults (2,981,672, person years) aged 45-84 in the 2000-2009 National Health Interview Survey, with Linked Mortality File through 2011 (37,598 deaths) and estimated discrete-time hazard models. The functional form of education and adult mortality was best characterized by credentialism in the Midwest, Northeast, and for Western men. For Western women, the association was linear, consistent with the human capital model. In the South, we observed a combination of mechanisms, with mortality risk declining with each year of schooling and a step change with high school graduation, followed by steeper decline thereafter. Our work adds to the increasing body of research that stresses the importance of contexts in shaping the education-mortality relationship.

  10. Insights from Synthetic Star-forming Regions. III. Calibration of Measurement and Techniques of Star Formation Rates

    Energy Technology Data Exchange (ETDEWEB)

    Koepferl, Christine M.; Robitaille, Thomas P. [Max Planck Institute for Astronomy, Königstuhl 17, D-69117 Heidelberg (Germany); Dale, James E., E-mail: [University Observatory Munich, Scheinerstr. 1, D-81679 Munich (Germany)


    Through an extensive set of realistic synthetic observations (produced in Paper I), we assess in this part of the paper series (Paper III) how the choice of observational techniques affects the measurement of star formation rates (SFRs) in star-forming regions. We test the accuracy of commonly used techniques and construct new methods to extract the SFR, so that these findings can be applied to measure the SFR in real regions throughout the Milky Way. We investigate diffuse infrared SFR tracers such as those using 24 μ m, 70 μ m and total infrared emission, which have been previously calibrated for global galaxy scales. We set up a toy model of a galaxy and show that the infrared emission is consistent with the intrinsic SFR using extra-galactic calibrated laws (although the consistency does not prove their reliability). For local scales, we show that these techniques produce completely unreliable results for single star-forming regions, which are governed by different characteristic timescales. We show how calibration of these techniques can be improved for single star-forming regions by adjusting the characteristic timescale and the scaling factor and give suggestions of new calibrations of the diffuse star formation tracers. We show that star-forming regions that are dominated by high-mass stellar feedback experience a rapid drop in infrared emission once high-mass stellar feedback is turned on, which implies different characteristic timescales. Moreover, we explore the measured SFRs calculated directly from the observed young stellar population. We find that the measured point sources follow the evolutionary pace of star formation more directly than diffuse star formation tracers.

  11. The comparison of physical properties derived from gas and dust in a massive star-forming region

    Energy Technology Data Exchange (ETDEWEB)

    Battersby, Cara; Bally, John; Ginsburg, Adam; Darling, Jeremy [Center for Astrophysics and Space Astronomy, University of Colorado, UCB 389, Boulder, CO 80309 (United States); Dunham, Miranda [Department of Astronomy, Yale University, New Haven, CT 06520 (United States); Longmore, Steve [Astrophysics Research Institute, Liverpool John Moores University, Twelve Quays House, Egerton Wharf, Birkenhead CH41 1LD (United Kingdom)


    We explore the relationship between gas and dust in a massive star-forming region by comparing the physical properties derived from each. We compare the temperatures and column densities in a massive star-forming Infrared Dark Cloud (G32.02+0.05), which shows a range of evolutionary states, from quiescent to active. The gas properties were derived using radiative transfer modeling of the (1,1), (2,2), and (4,4) transitions of NH{sub 3} on the Karl G. Jansky Very Large Array, while the dust temperatures and column densities were calculated using cirrus-subtracted, modified blackbody fits to Herschel data. We compare the derived column densities to calculate an NH{sub 3} abundance, χ{sub NH{sub 3}} = 4.6 × 10{sup –8}. In the coldest star-forming region, we find that the measured dust temperatures are lower than the measured gas temperatures (mean and standard deviations T {sub dust,} {sub avg} ∼ 11.6 ± 0.2 K versus T {sub gas,} {sub avg} ∼ 15.2 ± 1.5 K), which may indicate that the gas and dust are not well-coupled in the youngest regions (∼0.5 Myr) or that these observations probe a regime where the dust and/or gas temperature measurements are unreliable. Finally, we calculate millimeter fluxes based on the temperatures and column densities derived from NH{sub 3}, which suggest that millimeter dust continuum observations of massive star-forming regions, such as the Bolocam Galactic Plane Survey or ATLASGAL, can probe hot cores, cold cores, and the dense gas lanes from which they form, and are generally not dominated by the hottest core.

  12. The comparison of physical properties derived from gas and dust in a massive star-forming region

    International Nuclear Information System (INIS)

    Battersby, Cara; Bally, John; Ginsburg, Adam; Darling, Jeremy; Dunham, Miranda; Longmore, Steve


    We explore the relationship between gas and dust in a massive star-forming region by comparing the physical properties derived from each. We compare the temperatures and column densities in a massive star-forming Infrared Dark Cloud (G32.02+0.05), which shows a range of evolutionary states, from quiescent to active. The gas properties were derived using radiative transfer modeling of the (1,1), (2,2), and (4,4) transitions of NH 3 on the Karl G. Jansky Very Large Array, while the dust temperatures and column densities were calculated using cirrus-subtracted, modified blackbody fits to Herschel data. We compare the derived column densities to calculate an NH 3 abundance, χ NH 3 = 4.6 × 10 –8 . In the coldest star-forming region, we find that the measured dust temperatures are lower than the measured gas temperatures (mean and standard deviations T dust, avg ∼ 11.6 ± 0.2 K versus T gas, avg ∼ 15.2 ± 1.5 K), which may indicate that the gas and dust are not well-coupled in the youngest regions (∼0.5 Myr) or that these observations probe a regime where the dust and/or gas temperature measurements are unreliable. Finally, we calculate millimeter fluxes based on the temperatures and column densities derived from NH 3 , which suggest that millimeter dust continuum observations of massive star-forming regions, such as the Bolocam Galactic Plane Survey or ATLASGAL, can probe hot cores, cold cores, and the dense gas lanes from which they form, and are generally not dominated by the hottest core.

  13. «Goroda-bliznecy»: novaja forma prigranichnogo sotrudnichestva v Baltijskom regione? [Twin cities: a new form of cross-border cooperation in the Baltic Sea Region?

    Directory of Open Access Journals (Sweden)

    Anishenko Anatoly


    Full Text Available The paper demonstrates the first attempt in Russian political studies to conduct a comprehensive analysis of the “twin city” movement as a form of cross-border cooperation in the Baltic region. This phenomenon emerged as a result of a global tendency towards more active involvement of municipal units in international cooperation, on the one hand, and aspirations of frontier cities and towns in the Baltic region to solve common problems together, on the other hand. This work is based on a comparative analysis method and a case study methodology. The authors consider four examples (city pairs: Tornio — Haparanda, Valga — Valka, Narva — Ivangorod and Imatra — Svetogorsk. The article specifies the terminological framework used in this field of research. The authors analyse achievements and failures of this type of international inter-municipal cooperation and emphasise that for twin cities it served not only as a means of survival in the difficult situation of the 1990s, but also as an experimental ground for new forms of crossborder cooperation. The authors arrive at the conclusion that this model proves to be promising for further development of integration processes in the Baltic region. This practice can be applied by Russian municipal, regional and federal authorities in promotion of cross-border cooperation not only in the Baltic region, but also in other regions of the country. Thus, influenced by the successful experience of Baltic frontier cities and towns, the Russian city of Nikel and the Norwegian city of Kirkenes decided to adopt this model for further development of their cooperation.

  14. Study of diffuse H II regions potentially forming part of the gas streams around Sgr A* (United States)

    Armijos-Abendaño, J.; López, E.; Martín-Pintado, J.; Báez-Rubio, A.; Aravena, M.; Requena-Torres, M. A.; Martín, S.; Llerena, M.; Aldás, F.; Logan, C.; Rodríguez-Franco, A.


    We present a study of diffuse extended ionized gas towards three clouds located in the Galactic Centre (GC). One line of sight (LOS) is towards the 20 km s-1 cloud (LOS-0.11) in the Sgr A region, another LOS is towards the 50 km s-1 cloud (LOS-0.02), also in Sgr A, while the third is towards the Sgr B2 cloud (LOS+0.693). The emission from the ionized gas is detected from Hnα and Hmβ radio recombination lines (RRLs). Henα and Hemβ RRL emission is detected with the same n and m as those from the hydrogen RRLs only towards LOS+0.693. RRLs probe gas with positive and negative velocities towards the two Sgr A sources. The Hmβ to Hnα ratios reveal that the ionized gas is emitted under local thermodynamic equilibrium conditions in these regions. We find a He to H mass fraction of 0.29±0.01 consistent with the typical GC value, supporting the idea that massive stars have increased the He abundance compared to its primordial value. Physical properties are derived for the studied sources. We propose that the negative velocity component of both Sgr A sources is part of gas streams considered previously to model the GC cloud kinematics. Associated massive stars with what are presumably the closest H II regions to LOS-0.11 (positive velocity gas), LOS-0.02, and LOS+0.693 could be the main sources of ultraviolet photons ionizing the gas. The negative velocity components of both Sgr A sources might be ionized by the same massive stars, but only if they are in the same gas stream.

  15. Dynamic positional fate map of the primary heart-forming region. (United States)

    Cui, Cheng; Cheuvront, Tracey J; Lansford, Rusty D; Moreno-Rodriguez, Ricardo A; Schultheiss, Thomas M; Rongish, Brenda J


    Here we show the temporal-spatial orchestration of early heart morphogenesis at cellular level resolution, in vivo, and reconcile conflicting positional fate mapping data regarding the primary heart-forming field(s). We determined the positional fates of precardiac cells using a precision electroporation approach in combination with wide-field time-lapse microscopy in the quail embryo, a warm-blooded vertebrate (HH Stages 4 through 10). Contrary to previous studies, the results demonstrate the existence of a "continuous" circle-shaped heart field that spans the midline, appearing at HH Stage 4, which then expands to form a wide arc of progenitors at HH Stages 5-7. Our time-resolved image data show that a subset of these cardiac progenitor cells do not overlap with the expression of common cardiogenic factors, Nkx-2.5 and Bmp-2, until HH Stage 10, when a tubular heart has formed, calling into question when cardiac fate is specified and by which key factors. Sub-groups and anatomical bands (cohorts) of heart precursor cells dramatically change their relative positions in a process largely driven by endodermal folding and other large-scale tissue deformations. Thus, our novel dynamic positional fate maps resolve the origin of cardiac progenitor cells in amniotes. The data also establish the concept that tissue motion contributes significantly to cellular position fate - i.e., much of the cellular displacement that occurs during assembly of a midline heart tube (HH Stage 9) is NOT due to "migration" (autonomous motility), a commonly held belief. Computational analysis of our time-resolved data lays the foundation for more precise analyses of how cardiac gene regulatory networks correlate with early heart tissue morphogenesis in birds and mammals.

  16. TADPOL: A 1.3 mm Survey of Dust Polarization in Star-forming Cores and Regions


    Hull, Charles L. H.; Plambeck, Richard L.; Kwon, Woojin; Bower, Geoffrey C.; Carpenter, John M.; Crutcher, Richard M.; Fiege, Jason D.; Franzmann, Erica; Hakobian, Nicholas S.; Heiles, Carl; Houde, Martin; Hughes, A. Meredith; Lamb, James W.; Looney, Leslie W.; Marrone, Daniel P.


    We present λ 1.3 mm Combined Array for Research in Millimeter-wave Astronomy observations of dust polarization toward 30 star-forming cores and eight star-forming regions from the TADPOL survey. We show maps of all sources, and compare the ~2".5 resolution TADPOL maps with ~20" resolution polarization maps from single-dish submillimeter telescopes. Here we do not attempt to interpret the detailed B-field morphology of each object. Rather, we use average B-field orientations to derive conclusi...

  17. Effect of the strange axial form factor on structure functions for neutral current neutrino scattering in the quasielastic region

    International Nuclear Information System (INIS)

    Kim, Kyungsik


    We study the effect of the strange axial form factor on various structure functions for the neutral reaction of neutrino-nucleus scattering in the quasielastic region within the framework of a relativistic single particle model. We use 12 C as the target nucleus, and the incident neutrino energy range is between 150 MeV and 1.5 GeV. The structure functions are extracted at a fixed three momentum transfer and energy transfer by using the intrinsic helicity of neutrino. While the effect of the strange axial form factor is very small, the effect on various structure functions is exhibited explicitly.

  18. Digitisation Project Planning in the Maribor City Library as a Form of Regional Cross Institutional Cooperation

    Directory of Open Access Journals (Sweden)

    Nina Hriberšek Vuk


    Full Text Available EXTENDED ABSTRACT:More and more Slovenian public libraries have been facing the question of selection criteria for digitisation of library materials as well as the issue of financial resources, copyright permission and the promotion of digitised materials. Libraries having long tradition of collecting valuable local history resources are more convinced about the selection criteria. Digitisation is, in spite of being expensive, time consuming and labour intensive, an easy method to enable quick access to library materials, to promote and preserve library collections. The mission of the central regional public library (cofinanced by the Ministry of Culture is not only to coordinate the collection, cataloguing and storage of local history resources but also to coordinate local history digital projects. Due to historical circumstances, the local history resources were first collected by the Maribor University Library. It is only in the recent past that the Maribor City Library has started to systematically collect these materials. Due to this fact, the Maribor City Library does not hold an extensive collection of rare and valuable local history items. It was initially faced with the problem of selection criteria for digitisation. However, it soon succeeded to establish the strategy to promote the local history collections in the region, regardless of their location. Thus the library started to cooperate with different regional institutions and the first partner projects were designed. In the year 2007 the library collaborated with the elementary school at Lovrenc na Pohorju and decided to digitise research papers of ex-pupils of the school. The first part of the project was accomplished in 2007 when 72 research papers were digitised, in the next two years their number was increased as the second part of the project was concluded. The papers were published on the KAMRA portal and the project was promoted at the summer annual meeting at Lovrenc na

  19. Characterization of Nitride Layers Formed by Nitrogen Ion Implantation into Surface Region of Iron

    International Nuclear Information System (INIS)

    Sudjatmoko; Subki, M. Iyos R.


    Ion implantation is a convenient means of modifying the physical and chemical properties of the near-surface region of materials. The nitrogen implantation into pure iron has been performed at room temperature with ion dose of 1.310 17 to 1.310 18 ions/cm 2 and ion energy of 20 to 100 keV. The optimum dose of nitrogen ions implanted into pure iron was around 2.2310 17 ions/cm 2 in order to get the maximum wear resistant. SEM micrographs and EDX show that the nitride layers were found on the surface of substrate. The nitrogen concentration profile was measured using EDX in combination with spot technique, and it can be shown that the depth profile of nitrogen implanted into substrate was nearly Gaussian. (author)

  20. The pion-nucleon form factor in space- and time-like regions

    International Nuclear Information System (INIS)

    Speth, J.; Tegen, R.


    We investigate the pion-nucleon vertex function in space- and time-like regions; these vertex functions appear as internal vertices in nucleon-antinucleon annihilations into n pions (n=2, 3, ..., 6). It is emphasised that only relativistic quark models can account for these vertices where one of the baryons/antibaryons is far off-shell with total energy close to zero. Using a novel 4-momentum projection technique we obtain results which generalize the usual (Breit frame) calculation of G πNN (k 2 ) (space-like) thereby removing completely the discrepancy in the Goldberger-Treiman relation. Our relativistic quark model calculation also explains the empirical suppression of antibaryonic contributions to the vertex functions Gsub(πNanti B) and Gsub(πBanti N) which enter in processes like Nanti N→ππ. (orig.)

  1. The infield varietu of available forms in the forest-steppe of western part Central Chernozemic region (United States)

    Belik, Anton; Devyatova, Tatiana; Bozhko, Svetlana; Gorbunova, Yulia


    The infield varietu of available forms in the forest-steppe of western part Central Chernozemic region The Central Chernozemic region of Russia has been a region with a strong agricultural industry and determines the food security of the state by most part. The soil cover of the region is represented mainly by chernozems and is favorable for the cultivation of major crops and produce high crop yields. However, the high development of agriculture in the territory of Central Chernozemic region are led to the development of agrogenic degradation processes which impacts on the growth of the soil cover complexity and contrast, and as a consequence a significant infield variety of soil fertility and yields of major crops. In this regard, very promising direction in CChR is the development and practical application technologies of precision agriculture, which implies the spatial variety of soil fertility analysis within specific fields and work areas, especially the content of available forms of nutrients. The aim of our research was a study of the agro-ecological characteristics of the spatial variety of the content by available forms to plants of major nutrients in representative areas of sloping agricultural landscapes with forest-steppe chernozems in the western part of Central Chernozemic region of Russia. The research of infield variety by content of available forms of major nutrients are carried in the fields of Russian Research Institute of Agriculture and Protect the Soil from Erosion experimental and industrial farm in Medvensky district of Kursk region. The area characterized by a complex organization of relief. The soil cover is represented by full-profile typical (conventional and carbonate), leached chernozems. The growth of contrast of the soil cover are largely determined by the appearance of eroded soils of these analogues, as well as zoogenic dug and accumulative soils All of the studied areas with the forest-steppe chernozems were characterized by


    Directory of Open Access Journals (Sweden)

    Ekaterina Ivanovna Lobyneva


    Full Text Available In the article the author deals with the socialist completion as demonstration of huge enthusiasm and creative initiative of the Krasnoyarsk region population in the 1960s. There were more than twenty shock Komsomol construction sites, which became an effective form of youth participating in the economy development.The aim of the work is to find out in what way socialist completion influences on developing different personal features, like abilities, knowledge, erudition, skills, experience, needs, call of duty, responsibility, etc.The methods of historical approach and objectivism are used in the article.The results of work are to considerate problems concerning with organization of the socialist competition in the Krasnoyarsk region. New materials and some documents of local archives are introduced during the research.The study of the socialist competition in the Krasnoyarsk region enables to make a conclusion that the socialist competition is a form of organizing cultural activities of the Krasnoyarsk region population in the 1960s.

  3. On the origin of phosphorus nitride in star-forming regions (United States)

    Mininni, C.; Fontani, F.; Rivilla, V. M.; Beltrán, M. T.; Caselli, P.; Vasyunin, A.


    We present multitransition observations of phosphorus nitride (PN) towards a sample of nine massive dense cores in different evolutionary stages. Using transitions with different excitation conditions, we have found for the first time that the excitation temperatures of PN are in the range ˜5-30 K. To investigate the main chemical route for the PN formation (surface-chemistry versus gas-phase chemistry), and the dominant desorption mechanism (thermal versus shock), we have compared our results with those obtained from molecules tracing different chemical and physical conditions (SiO, SO, CH3OH, and N2H+). We have found that the PN line profiles are very well correlated with those of SiO and SO in six out of the nine targets, which indicate that PN may be released by sputtering of dust grains due to shocks. This finding is corroborated by a faint but statistically significant positive trend between the PN abundance and those of SiO and SO. However, in three objects the PN lines have no hints of high-velocity wings, which indicates an alternative origin of PN. Overall, our results indicate that the origin of PN is not unique, as it can be formed not only in protostellar shocks, but also in colder and more quiescent gas through alternative pathways.


    Energy Technology Data Exchange (ETDEWEB)

    Barnes, Kate L.; Van Zee, Liese [Department of Astronomy, Indiana University, Bloomington, IN 47405 (United States); Dowell, Jayce D., E-mail:, E-mail:, E-mail: [Department of Physics and Astronomy, University of New Mexico, Albuquerque, NM 87131 (United States)


    We run stellar population synthesis models to examine the effects of a recently episodic star formation history (SFH) on UV and Hα colors of star forming regions. Specifically, the SFHs we use are an episodic sampling of an exponentially declining star formation rate (SFR; τ model) and are intended to simulate the SFHs in the outer disks of spiral galaxies. To enable comparison between our models and observational studies of star forming regions in outer disks, we include in our models sensitivity limits that are based on recent deep UV and Hα observations in the literature. We find significant dispersion in the FUV-NUV colors of simulated star forming regions with frequencies of star formation episodes of 1 × 10{sup –8} to 4 × 10{sup –9} yr{sup –1}. The dispersion in UV colors is similar to that found in the outer disk of nearby spiral galaxies. As expected, we also find large variations in L{sub H{sub α}}/L{sub FUV}. We interpret our models within the context of inside-out disk growth, and find that a radially increasing τ and decreasing metallicity with an increasing radius will only produce modest FUV-NUV color gradients, which are significantly smaller than what is found for some nearby spiral galaxies. However, including moderate extinction gradients with our models can better match the observations with steeper UV color gradients. We estimate that the SFR at which the number of stars emitting FUV light becomes stochastic is ∼2 × 10{sup –6} M{sub ☉} yr{sup –1}, which is substantially lower than the SFR of many star forming regions in outer disks. Therefore, we conclude that stochasticity in the upper end of the initial mass function is not likely to be the dominant cause of dispersion in the FUV-NUV colors of star forming regions in outer disks. Finally, we note that if outer disks have had an episodic SFH similar to that used in this study, this should be taken into account when estimating gas depletion timescales and modeling chemical

  5. New Insights into the Nature of Transition Disks from a Complete Disk Survey of the Lupus Star-forming Region (United States)

    van der Marel, Nienke; Williams, Jonathan P.; Ansdell, M.; Manara, Carlo F.; Miotello, Anna; Tazzari, Marco; Testi, Leonardo; Hogerheijde, Michiel; Bruderer, Simon; van Terwisga, Sierk E.; van Dishoeck, Ewine F.


    Transition disks with large dust cavities around young stars are promising targets for studying planet formation. Previous studies have revealed the presence of gas cavities inside the dust cavities, hinting at recently formed, giant planets. However, many of these studies are biased toward the brightest disks in the nearby star-forming regions, and it is not possible to derive reliable statistics that can be compared with exoplanet populations. We present the analysis of 11 transition disks with large cavities (≥20 au radius) from a complete disk survey of the Lupus star-forming region, using ALMA Band 7 observations at 0.″3 (22–30 au radius) resolution of the 345 GHz continuum, 13CO and C18O 3–2 observations, and the spectral energy distribution of each source. Gas and dust surface density profiles are derived using the physical–chemical modeling code DALI. This is the first study of transition disks of large cavities within a complete disk survey within a star-forming region. The dust cavity sizes range from 20 to 90 au radius, and in three cases, a gas cavity is resolved as well. The deep drops in gas density and large dust cavity sizes are consistent with clearing by giant planets. The fraction of transition disks with large cavities in Lupus is ≳ 11 % , which is inconsistent with exoplanet population studies of giant planets at wide orbits. Furthermore, we present a hypothesis of an evolutionary path for large massive disks evolving into transition disks with large cavities.

  6. Magnetized Converging Flows toward the Hot Core in the Intermediate/High-mass Star-forming Region NGC 6334 V

    Energy Technology Data Exchange (ETDEWEB)

    Juárez, Carmen; Girart, Josep M. [Institut de Ciències de l’Espai, (CSIC-IEEC), Campus UAB, Carrer de Can Magrans, S/N, E-08193 Cerdanyola del Vallès, Catalonia (Spain); Zamora-Avilés, Manuel; Palau, Aina; Ballesteros-Paredes, Javier [Instituto de Radioastronomía y Astrofísica, Universidad Nacional Autónoma de México, P.O. Box 3-72, 58090, Morelia, Michoacán (Mexico); Tang, Ya-Wen; Koch, Patrick M.; Liu, Hauyu Baobab [Academia Sinica Institute of Astronomy and Astrophysics, P.O. Box 23-141, Taipei, 10617, Taiwan (China); Zhang, Qizhou [Harvard-Smithsonian Center for Astrophysics, 60 Garden Street, Cambridge, MA 02138 (United States); Qiu, Keping, E-mail: [School of Astronomy and Space Science, Nanjing University, 163 Xianlin Avenue, Nanjing 210023 (China)


    We present Submillimeter Array (SMA) observations at 345 GHz toward the intermediate/high-mass cluster-forming region NGC 6334 V. From the dust emission we spatially resolve three dense condensations, the brightest one presenting the typical chemistry of a hot core. The magnetic field (derived from the dust polarized emission) shows a bimodal converging pattern toward the hot core. The molecular emission traces two filamentary structures at two different velocities, separated by 2 km s{sup −1}, converging to the hot core and following the magnetic field distribution. We compare the velocity field and the magnetic field derived from the SMA observations with magnetohydrodynamic simulations of star-forming regions dominated by gravity. This comparison allows us to show how the gas falls in from the larger-scale extended dense core (∼0.1 pc) of NGC 6334 V toward the higher-density hot core region (∼0.02 pc) through two distinctive converging flows dragging the magnetic field, whose strength seems to have been overcome by gravity.

  7. Magnetized Converging Flows toward the Hot Core in the Intermediate/High-mass Star-forming Region NGC 6334 V

    International Nuclear Information System (INIS)

    Juárez, Carmen; Girart, Josep M.; Zamora-Avilés, Manuel; Palau, Aina; Ballesteros-Paredes, Javier; Tang, Ya-Wen; Koch, Patrick M.; Liu, Hauyu Baobab; Zhang, Qizhou; Qiu, Keping


    We present Submillimeter Array (SMA) observations at 345 GHz toward the intermediate/high-mass cluster-forming region NGC 6334 V. From the dust emission we spatially resolve three dense condensations, the brightest one presenting the typical chemistry of a hot core. The magnetic field (derived from the dust polarized emission) shows a bimodal converging pattern toward the hot core. The molecular emission traces two filamentary structures at two different velocities, separated by 2 km s −1 , converging to the hot core and following the magnetic field distribution. We compare the velocity field and the magnetic field derived from the SMA observations with magnetohydrodynamic simulations of star-forming regions dominated by gravity. This comparison allows us to show how the gas falls in from the larger-scale extended dense core (∼0.1 pc) of NGC 6334 V toward the higher-density hot core region (∼0.02 pc) through two distinctive converging flows dragging the magnetic field, whose strength seems to have been overcome by gravity.

  8. Infall and outflow motions towards a sample of massive star-forming regions from the RMS survey (United States)

    Cunningham, N.; Lumsden, S. L.; Moore, T. J. T.; Maud, L. T.; Mendigutía, I.


    We present the results of an outflow and infall survey towards a distance-limited sample of 31 massive star-forming regions drawn from the Red MSX source (RMS) survey. The presence of young, active outflows is identified from SiO (8-7) emission and the infall dynamics are explored using HCO+/H13CO+ (4-3) emission. We investigate if the infall and outflow parameters vary with source properties, exploring whether regions hosting potentially young active outflows show similarities or differences with regions harbouring more evolved, possibly momentum-driven, `fossil' outflows. SiO emission is detected towards approximately 46 per cent of the sources. When considering sources with and without an SiO detection (i.e. potentially active and fossil outflows, respectively), only the 12CO outflow velocity shows a significant difference between samples, indicating SiO is more prevalent towards sources with higher outflow velocities. Furthermore, we find the SiO luminosity increases as a function of the Herschel 70 μm to WISE 22 μm flux ratio, suggesting the production of SiO is prevalent in younger, more embedded regions. Similarly, we find tentative evidence that sources with an SiO detection have a smaller bolometric luminosity-to-mass ratio, indicating SiO (8-7) emission is associated with potentially younger regions. We do not find a prevalence towards sources displaying signatures of infall in our sample. However, the higher energy HCO+ transitions may not be the best suited tracer of infall at this spatial resolution in these regions.


    International Nuclear Information System (INIS)

    Chen Yafeng; Yang Ji; Zeng Qin; Yao Yongqiang; Sato, Shuji


    Near-infrared JHK' and H 2 v = 1-0 S (1) imaging observations of the star-forming regions Sh2-157 and Sh2-152 are presented. The data reveal a cluster of young stars associated with H 2 line emission in each region. Additionally, many IR point sources are found in the dense core of each molecular cloud. Most of these sources exhibit infrared color excesses typical of T Tauri stars, Herbig Ae/Be stars, and protostars. Several display the characteristics of massive stars. We calculate histograms of the K'-magnitude and [H - K'] color for all sources, as well as two-color and color-magnitude diagrams. The stellar populations inside and outside the clusters are similar, suggesting that these systems are rather evolved. Shock-driven H 2 emission knots are also detected, which may be related to evident subclusters in an earlier evolutionary stage.

  10. Extended Gamma-Ray Emission from the G25.0+0.0 Region: A Star-forming Region Powered by the Newly Found OB Association?

    Energy Technology Data Exchange (ETDEWEB)

    Katsuta, J. [Department of Physical Sciences, Hiroshima University, Higashi-Hiroshima, Hiroshima 739-8526 (Japan); Uchiyama, Y. [Rikkyo University, Nishi-Ikebukuro, Toshima-ku, Tokyo 171-8501 (Japan); Funk, S., E-mail: [Erlangen Centre for Astroparticle Physics, D-91058 Erlangen (Germany)


    We report a study of extended γ -ray emission with the Large Area Telescope (LAT) on board the Fermi Gamma-ray Space Telescope , which is likely to be the second case of a γ -ray detection from a star-forming region (SFR) in our Galaxy. The LAT source is located in the G25 region, 1.°7 × 2.°1 around ( l , b ) = (25.°0, 0.°0). The γ -ray emission is found to be composed of two extended sources and one pointlike source. The extended sources have similar sizes of about 1.°4 × 0.°6. An ∼0.°4 diameter subregion of one has a photon index of Γ = 1.53 ± 0.15, and is spatially coincident with HESS J1837−069, likely a pulsar wind nebula. The other parts of the extended sources have a photon index of Γ = 2.1 ± 0.2 without significant spectral curvature. Given their spatial and spectral properties, they have no clear associations with sources at other wavelengths. Their γ -ray properties are similar to those of the Cygnus cocoon SFR, the only firmly established γ -ray detection of an SFR in the Galaxy. Indeed, we find bubble-like structures of atomic and molecular gas in G25, which may be created by a putative OB association/cluster. The γ -ray emitting regions appear confined in the bubble-like structure; similar properties are also found in the Cygnus cocoon. In addition, using observations with the XMM-Newton , we find a candidate young massive OB association/cluster G25.18+0.26 in the G25 region. We propose that the extended γ -ray emission in G25 is associated with an SFR driven by G25.18+0.26. Based on this scenario, we discuss possible acceleration processes in the SFR and compare them with the Cygnus cocoon.


    Energy Technology Data Exchange (ETDEWEB)

    Montes, V. A.; Hofner, P.; Anderson, C.; Rosero, V. [Physics Department, New Mexico Tech, 801 Leroy Place, Socorro, NM 87801 (United States)


    We present results from Chandra ACIS-I and Karl G. Jansky Very Large Array 6 cm continuum observations of the IRAS 20126+4104 massive star-forming region. We detect 150 X-ray sources within the 17′ × 17′ ACIS-I field, and a total of 13 radio sources within the 9.′2 primary beam at 4.9 GHz. Among these observtions are the first 6 cm detections of the central sources reported by Hofner et al., namely, I20N1, I20S, and I20var. A new variable radio source is also reported. Searching the 2MASS archive, we identified 88 near-infrared (NIR) counterparts to the X-ray sources. Only four of the X-ray sources had 6 cm counterparts. Based on an NIR color–color analysis and on the Besançon simulation of Galactic stellar populations, we estimate that approximately 80 X-ray sources are associated with this massive star-forming region. We detect an increasing surface density of X-ray sources toward the massive protostar and infer the presence of a cluster of at least 43 young stellar objects within a distance of 1.2 pc from the massive protostar.

  12. Polarization Properties and Magnetic Field Structures in the High-mass Star-forming Region W51 Observed with ALMA (United States)

    Koch, Patrick M.; Tang, Ya-Wen; Ho, Paul T. P.; Yen, Hsi-Wei; Su, Yu-Nung; Takakuwa, Shigehisa


    We present the first ALMA dust polarization observations toward the high-mass star-forming regions W51 e2, e8, and W51 North in Band 6 (230 GHz) with a resolution of about 0\\buildrel{\\prime\\prime}\\over{.} 26 (∼5 mpc). Polarized emission in all three sources is clearly detected and resolved. Measured relative polarization levels are between 0.1% and 10%. While the absolute polarization shows complicated structures, the relative polarization displays the typical anticorrelation with Stokes I, although with a large scatter. Inferred magnetic (B) field morphologies are organized and connected. Detailed substructures are resolved, revealing new features such as comet-shaped B-field morphologies in satellite cores, symmetrically converging B-field zones, and possibly streamlined morphologies. The local B-field dispersion shows some anticorrelation with the relative polarization. Moreover, the lowest polarization percentages together with largest dispersions coincide with B-field convergence zones. We put forward \\sin ω , where ω is the measurable angle between a local B-field orientation and local gravity, as a measure of how effectively the B field can oppose gravity. Maps of \\sin ω for all three sources show organized structures that suggest a locally varying role of the B field, with some regions where gravity can largely act unaffectedly, possibly in a network of narrow magnetic channels, and other regions where the B field can work maximally against gravity.

  13. Main internal dose-forming factors for inhabitants of contaminated regions at current phase of the Chernobyl nuclear power plant accident (Kyiv region as an example)

    International Nuclear Information System (INIS)

    Vasilenko, V.V.; Nechajev, S.Yu.; Tsigankov, M.Ya.; And others


    Objective of this work is revealing of main dose"forming factors of internal doses for inhabitants of contaminated regions of Kyiv region relying on the results of integral dosimetric monitoring. Three villages have been chosen for the investigation. They are: Raghivka, Zelena Poliana (Poliske district), Karpylivka (Ivankiv district). Twice a year, in May and in October those villages' residents were inspected for content of incorporated "1"3"7Cs. They were measured by direct method at the place of residence with the help of whole body counters (WBC). The principal food samples were collected for detection of "9"0Sr and "1"3"7Cs content. Those villages' inhabitants were interviewed about food consumption levels. Mathematical, dosimetric and radio-chemical methods were used in this work. The estimation of internal doses due to intake of "1"3"7Cs by ingestion of milk and potatoes are in the range 0.3-34% of doses estimated on the base of WBC data. The contribution to the dose of internal exposure from intake of "1"3"7Cs with the milk consumption is no more than two times higher than the contribution of potatoes consumption in the case of equal consumption levels of these products. Contributions to the dose of internal exposure from intake of "9"0Sr with milk and potatoes consumptions are approximately similar. Consumption of mushrooms and other wild nature products by inhabitants from the inspected settlements is the main forming factor of internal dose due to "1"3"7Cs intake

  14. Deuteron electromagnetic form factors in the transitional region between nucleon-meson and quark-gluon pictures

    International Nuclear Information System (INIS)

    Kobushkin, A.P.; Syamtomov, A.I.


    Experimental observables of the elastic ed-scattering in the region of intermediate energies are discussed. We offer the numerical analysis of the available experimental data, which reproduces the results of the calculations with popular NN-potentials at low energies (Q 2 2 ), but, at the same time, provides the right asymptotic behavior of the deuteron e.m. form factors, following from the quark counting rules, at high energies (Q 2 >>1(GeV/c) 2 ). The numerical analysis developed allows to make certain estimations of the characteristic energy scale, at what the consideration of quark-gluon degrees of freedom in the deuteron becomes essential. (author). 18 refs., 2 tab., 10 figs

  15. Age gradients in the stellar populations of massive star forming regions based on a new stellar chronometer

    Energy Technology Data Exchange (ETDEWEB)

    Getman, Konstantin V.; Feigelson, Eric D.; Kuhn, Michael A.; Broos, Patrick S.; Townsley, Leisa K.; Luhman, Kevin L. [Department of Astronomy and Astrophysics, 525 Davey Laboratory, Pennsylvania State University, University Park, PA 16802 (United States); Naylor, Tim [School of Physics and Astronomy, University of Exeter, Stocker Road, Exeter, EX4 4QL (United Kingdom); Povich, Matthew S. [Department of Physics and Astronomy, California State Polytechnic University, 3801 West Temple Avenue, Pomona, CA 91768 (United States); Garmire, Gordon P. [Huntingdon Institute for X-ray Astronomy, LLC, 10677 Franks Road, Huntingdon, PA 16652 (United States)


    A major impediment to understanding star formation in massive star-forming regions (MSFRs) is the absence of a reliable stellar chronometer to unravel their complex star formation histories. We present a new estimation of stellar ages using a new method that employs near-infrared (NIR) and X-ray photometry, Age {sub JX} . Stellar masses are derived from X-ray luminosities using the L{sub X} -M relation from the Taurus cloud. J-band luminosities are compared to mass-dependent pre-main-sequence (PMS) evolutionary models to estimate ages. Age {sub JX} is sensitive to a wide range of evolutionary stages, from disk-bearing stars embedded in a cloud to widely dispersed older PMS stars. The Massive Young Star-Forming Complex Study in Infrared and X-ray (MYStIX) project characterizes 20 OB-dominated MSFRs using X-ray, mid-infrared, and NIR catalogs. The Age {sub JX} method has been applied to 5525 out of 31,784 MYStIX Probable Complex Members. We provide a homogeneous set of median ages for over 100 subclusters in 15 MSFRs; median subcluster ages range between 0.5 Myr and 5 Myr. The important science result is the discovery of age gradients across MYStIX regions. The wide MSFR age distribution appears as spatially segregated structures with different ages. The Age {sub JX} ages are youngest in obscured locations in molecular clouds, intermediate in revealed stellar clusters, and oldest in distributed populations. The NIR color index J – H, a surrogate measure of extinction, can serve as an approximate age predictor for young embedded clusters.

  16. Precision Measurements of the Proton Electromagnetic Form Factors in the Time-Like Region and Vector Meson Spectroscopy

    CERN Multimedia


    The aim of this experiment is to measure with precision the electromagnetic form factors of the proton in the time-like region via the reaction: .ce @*p @A e|+e|- with antiprotons of momenta between 0 and 2 GeV/c. Up to @= 800 MeV/c, a continuous energy scan in @= 2 MeV (@]s) bins will be performed. The form factor !G(E)! and !G(M)! will be determined separately since large statistics can be collected with LEAR antiproton beams, so that angular distributions can be obtained at many momenta.\\\\ \\\\ In addition, e|+e|- pairs produced via the reaction: .ce @*p @A V|0 + neutrals, .ce !@A e|+e|- where the antiprotons are at rest, will be detected allowing the vector meson mass spectrum between @= 1 GeV and @= 1.7 GeV to be obtained with high statistics and in one run. \\\\ \\\\ The proposed apparatus consists of a central detector, surrounded by a gas Cerenkov counter, wire chambers, hodoscopes, and an electromagnetic calorimeter. The central detector consists of several layers of proportional chambers around a liquid-h...

  17. Modelling the impact of urban form on household energy demand and related CO2 emissions in the Greater Dublin Region

    International Nuclear Information System (INIS)

    Liu Xiaochen; Sweeney, John


    This study aims to investigate the relationship between household space heating energy use and urban form (land use characteristics) for the Greater Dublin Region. The geographical distributions of household energy use are evaluated at the Enumeration Districts (ED) level based on the building thermal balance model. Moreover, it estimates the impact of possible factors on the household space heating consumption. Results illustrate that the distribution profile of dwellings is a significant factor related to overall heating energy demand and individual dwelling energy consumption for space heating. Residents living in compact dwellings with small floor areas consume less energy for space heating than residents living in dwellings with big floor areas. Moreover, domestic heating energy demand per household was also estimated for two extreme urban development scenarios: the compact city scenario and the dispersed scenario. The results illustrate that the compact city scenario is likely to decrease the domestic heating energy consumption per household by 16.2% compared with the dispersed city scenario. Correspondingly, the energy-related CO 2 emissions could be significantly decreased by compact city scenario compared with the dispersed city scenario. - Highlights: ► A method was developed to investigate urban form impacts on energy demand. ► This study estimates impacts of possible factors on the household energy consumption. ► Household heating energy demand is sensitive to dwelling distribution profile. ► The compact case could reduce domestic energy demand compared with the dispersed case.


    International Nuclear Information System (INIS)

    Gómez de Castro, Ana I.; Lopez-Santiago, Javier; López-Martínez, Fatima; Sánchez, Néstor; Sestito, Paola; Gestoso, Javier Yañez; De Castro, Elisa; Cornide, Manuel


    In this work, we identify 63 bona fide new candidates to T Tauri stars (TTSs) in the Taurus-Auriga region, using its ultraviolet excess as our baseline. The initial data set was defined from the GALEX all sky survey (AIS). The GALEX satellite obtained images in the near-ultraviolet (NUV) and far-ultraviolet (FUV) bands where TTSs show a prominent excess compared with main-sequence or giants stars. GALEX AIS surveyed the Taurus-Auriga molecular complex, as well as a fraction of the California Nebula and the Perseus complex; bright sources and dark clouds were avoided. The properties of TTSs in the ultraviolet (GALEX), optical (UCAC4), and infrared (2MASS) have been defined using the TTSs observed with the International Ultraviolet Explorer reference sample. The candidates were identified by means of a mixed ultraviolet-optical-infrared excess set of colors; we found that the FUV-NUV versus J–K color-color diagram is ideally suited for this purpose. From an initial sample of 163,313 bona fide NUV sources, a final list of 63 new candidates to TTSs in the region was produced. The search procedure has been validated by its ability to detect all known TTSs in the area surveyed: 31 TTSs. Also, we show that the weak-lined TTSs are located in a well-defined stripe in the FUV-NUV versus J–K diagram. Moreover, in this work, we provide a list of TTSs photometric standards for future GALEX-based studies of the young stellar population in star forming regions


    Energy Technology Data Exchange (ETDEWEB)

    Gómez de Castro, Ana I.; Lopez-Santiago, Javier; López-Martínez, Fatima; Sánchez, Néstor; Sestito, Paola; Gestoso, Javier Yañez [AEGORA Research Group, Universidad Complutense de Madrid, Plaza de Ciencias 3, E-28040 Madrid (Spain); De Castro, Elisa; Cornide, Manuel [Fac. de CC. Físicas, Universidad Complutense de Madrid, Plaza de Ciencias 1, E-28040 Madrid (Spain)


    In this work, we identify 63 bona fide new candidates to T Tauri stars (TTSs) in the Taurus-Auriga region, using its ultraviolet excess as our baseline. The initial data set was defined from the GALEX all sky survey (AIS). The GALEX satellite obtained images in the near-ultraviolet (NUV) and far-ultraviolet (FUV) bands where TTSs show a prominent excess compared with main-sequence or giants stars. GALEX AIS surveyed the Taurus-Auriga molecular complex, as well as a fraction of the California Nebula and the Perseus complex; bright sources and dark clouds were avoided. The properties of TTSs in the ultraviolet (GALEX), optical (UCAC4), and infrared (2MASS) have been defined using the TTSs observed with the International Ultraviolet Explorer reference sample. The candidates were identified by means of a mixed ultraviolet-optical-infrared excess set of colors; we found that the FUV-NUV versus J–K color-color diagram is ideally suited for this purpose. From an initial sample of 163,313 bona fide NUV sources, a final list of 63 new candidates to TTSs in the region was produced. The search procedure has been validated by its ability to detect all known TTSs in the area surveyed: 31 TTSs. Also, we show that the weak-lined TTSs are located in a well-defined stripe in the FUV-NUV versus J–K diagram. Moreover, in this work, we provide a list of TTSs photometric standards for future GALEX-based studies of the young stellar population in star forming regions.

  20. Cannibalization and rebirth in the NGC 5387 system. I. The stellar stream and star-forming region

    Energy Technology Data Exchange (ETDEWEB)

    Beaton, Rachael L.; Majewski, Steven R.; Johnson, Kelsey E.; Verbiscer, Anne [Department of Astronomy, University of Virginia, Charlottesville, VA 22904 (United States); Martínez-Delgado, David [Max Planck Institut fur Astronomie, D-69117 Heidelberg (Germany); D' Onghia, Elena [Department of Astronomy, University of Wisconsin-Madison, Madison, WI 53706 (United States); Zibetti, Stefano [INAF-Osservatorio Astrofisico di Arcetri, I-50125 Firenze (Italy); Gabany, R. Jay [Black Bird II Observatory, Alder Springs, CA 93602 (United States); Blanton, Michael, E-mail: [Department of Physics, New York University, New York, NY 10003 (United States)


    We have identified a low surface brightness stellar stream from visual inspection of Sloan Digital Sky Survey (SDSS) imaging for the edge-on, spiral galaxy NGC 5387. An optically blue overdensity coincident with the stream intersection with the NGC 5387 disk was also identified in SDSS and in the Galaxy Evolution Explorer Deep Imaging Survey contributing 38% of the total far-UV integrated flux from NGC 5387. Deeper optical imaging was acquired with the Vatican Advanced Technology Telescope that confirmed the presence of both features. The stellar stream is red in color, (B – V) = 0.7, has a stellar mass of 6 × 10{sup 8} M{sub ☉}, which implies a 1:50 merger ratio, has a circular radius, R{sub circ} ∼ 11.7 kpc, formed in ∼240 Myr, and the progenitor had a total mass of ∼4 × 10{sup 10} M{sub ☉}. Spectroscopy from LBT+MODS1 was used to determine that the blue overdensity is at the same redshift as NGC 5387, consists of young stellar populations (∼10 Myr), is metal-poor (12 + log (O/H) = 8.03), and is forming stars at an enhanced rate (∼1-3 M{sub ☉} yr{sup –1}). The most likely interpretations are that the blue overdensity is (1) a region of enhanced star formation in the outer disk of NGC 5387 induced by the minor accretion event or (2) the progenitor of the stellar stream experiencing enhanced star formation. Additional exploration of these scenarios is presented in a companion paper.

  1. Cannibalization and rebirth in the NGC 5387 system. I. The stellar stream and star-forming region

    International Nuclear Information System (INIS)

    Beaton, Rachael L.; Majewski, Steven R.; Johnson, Kelsey E.; Verbiscer, Anne; Martínez-Delgado, David; D'Onghia, Elena; Zibetti, Stefano; Gabany, R. Jay; Blanton, Michael


    We have identified a low surface brightness stellar stream from visual inspection of Sloan Digital Sky Survey (SDSS) imaging for the edge-on, spiral galaxy NGC 5387. An optically blue overdensity coincident with the stream intersection with the NGC 5387 disk was also identified in SDSS and in the Galaxy Evolution Explorer Deep Imaging Survey contributing 38% of the total far-UV integrated flux from NGC 5387. Deeper optical imaging was acquired with the Vatican Advanced Technology Telescope that confirmed the presence of both features. The stellar stream is red in color, (B – V) = 0.7, has a stellar mass of 6 × 10 8 M ☉ , which implies a 1:50 merger ratio, has a circular radius, R circ ∼ 11.7 kpc, formed in ∼240 Myr, and the progenitor had a total mass of ∼4 × 10 10 M ☉ . Spectroscopy from LBT+MODS1 was used to determine that the blue overdensity is at the same redshift as NGC 5387, consists of young stellar populations (∼10 Myr), is metal-poor (12 + log (O/H) = 8.03), and is forming stars at an enhanced rate (∼1-3 M ☉ yr –1 ). The most likely interpretations are that the blue overdensity is (1) a region of enhanced star formation in the outer disk of NGC 5387 induced by the minor accretion event or (2) the progenitor of the stellar stream experiencing enhanced star formation. Additional exploration of these scenarios is presented in a companion paper.


    International Nuclear Information System (INIS)

    Hull, Charles L. H.; Plambeck, Richard L.; Bower, Geoffrey C.; Heiles, Carl; Kwon, Woojin; Carpenter, John M.; Lamb, James W.; Pillai, Thushara; Crutcher, Richard M.; Hakobian, Nicholas S.; Looney, Leslie W.; Fiege, Jason D.; Franzmann, Erica; Houde, Martin; Hughes, A. Meredith; Marrone, Daniel P.; Matthews, Brenda C.; Pound, Marc W.; Rahman, Nurur; Sandell, Göran


    We present λ 1.3 mm Combined Array for Research in Millimeter-wave Astronomy observations of dust polarization toward 30 star-forming cores and eight star-forming regions from the TADPOL survey. We show maps of all sources, and compare the ∼2.''5 resolution TADPOL maps with ∼20'' resolution polarization maps from single-dish submillimeter telescopes. Here we do not attempt to interpret the detailed B-field morphology of each object. Rather, we use average B-field orientations to derive conclusions in a statistical sense from the ensemble of sources, bearing in mind that these average orientations can be quite uncertain. We discuss three main findings. (1) A subset of the sources have consistent magnetic field (B-field) orientations between large (∼20'') and small (∼2.''5) scales. Those same sources also tend to have higher fractional polarizations than the sources with inconsistent large-to-small-scale fields. We interpret this to mean that in at least some cases B-fields play a role in regulating the infall of material all the way down to the ∼1000 AU scales of protostellar envelopes. (2) Outflows appear to be randomly aligned with B-fields; although, in sources with low polarization fractions there is a hint that outflows are preferentially perpendicular to small-scale B-fields, which suggests that in these sources the fields have been wrapped up by envelope rotation. (3) Finally, even at ∼2.''5 resolution we see the so-called polarization hole effect, where the fractional polarization drops significantly near the total intensity peak. All data are publicly available in the electronic edition of this article


    International Nuclear Information System (INIS)

    Roy, Arabindo; Netterfield, Calvin B.; Ade, Peter A. R.; Griffin, Matthew; Hargrave, Peter C.; Mauskopf, Philip; Bock, James J.; Brunt, Christopher M.; Chapin, Edward L.; Gibb, Andrew G.; Halpern, Mark; Marsden, Gaelen; Devlin, Mark J.; Dicker, Simon R.; Klein, Jeff; France, Kevin; Gundersen, Joshua O.; Hughes, David H.; Martin, Peter G.; Olmi, Luca


    We present an implementation of the iterative flux-conserving Lucy-Richardson (L-R) deconvolution method of image restoration for maps produced by the Balloon-borne Large Aperture Submillimeter Telescope (BLAST). Compared to the direct Fourier transform method of deconvolution, the L-R operation restores images with better-controlled background noise and increases source detectability. Intermediate iterated images are useful for studying extended diffuse structures, while the later iterations truly enhance point sources to near the designed diffraction limit of the telescope. The L-R method of deconvolution is efficient in resolving compact sources in crowded regions while simultaneously conserving their respective flux densities. We have analyzed its performance and convergence extensively through simulations and cross-correlations of the deconvolved images with available high-resolution maps. We present new science results from two BLAST surveys, in the Galactic regions K3-50 and IC 5146, further demonstrating the benefits of performing this deconvolution. We have resolved three clumps within a radius of 4.'5 inside the star-forming molecular cloud containing K3-50. Combining the well-resolved dust emission map with available multi-wavelength data, we have constrained the spectral energy distributions (SEDs) of five clumps to obtain masses (M), bolometric luminosities (L), and dust temperatures (T). The L-M diagram has been used as a diagnostic tool to estimate the evolutionary stages of the clumps. There are close relationships between dust continuum emission and both 21 cm radio continuum and 12 CO molecular line emission. The restored extended large-scale structures in the Northern Streamer of IC 5146 have a strong spatial correlation with both SCUBA and high-resolution extinction images. A dust temperature of 12 K has been obtained for the central filament. We report physical properties of ten compact sources, including six associated protostars, by fitting

  4. A Survey For Planetary-mass Brown Dwarfs in the Taurus and Perseus Star-forming Regions

    Energy Technology Data Exchange (ETDEWEB)

    Esplin, T. L.; Luhman, K. L., E-mail: [Department of Astronomy and Astrophysics, The Pennsylvania State University, University Park, PA 16802 (United States)


    We present the initial results from a survey for planetary-mass brown dwarfs in the Taurus star-forming region. We have identified brown dwarf candidates in Taurus using proper motions and photometry from several ground- and space-based facilities. Through spectroscopy of some of the more promising candidates, we have found 18 new members of Taurus. They have spectral types ranging from mid-M to early-L, and they include the four faintest known members in extinction-corrected K{sub s}, which should have masses as low as ∼4–5 M {sub Jup} according to evolutionary models. Two of the coolest new members (M9.25, M9.5) have mid-IR excesses that indicate the presence of disks. Two fainter objects with types of M9–L2 and M9–L3 also have red mid-IR colors relative to photospheres at ≤L0, but since the photospheric colors are poorly defined at >L0, it is unclear whether they have excesses from disks. We also have obtained spectra of candidate members of the IC 348 and NGC 1333 clusters in Perseus that were identified by Luhman et al. Eight candidates are found to be probable members, three of which are among the faintest and least-massive known members of the clusters (∼5 M{sub Jup}).


    International Nuclear Information System (INIS)

    Luhman, K. L.; Mamajek, E. E.; Shukla, S. J.; Loutrel, N. P.


    Previous studies have found that ∼1 deg 2 fields surrounding the stellar aggregates in the Taurus star-forming region exhibit a surplus of solar-mass stars relative to denser clusters like IC 348 and the Orion Nebula Cluster. To test whether this difference reflects mass segregation in Taurus or a variation in the initial mass function, we have performed a survey for members of Taurus across a large field (∼40 deg 2 ) that was imaged by the Sloan Digital Sky Survey (SDSS). We obtained optical and near-infrared spectra of candidate members identified with those images and the Two Micron All Sky Survey, as well as miscellaneous candidates that were selected with several other diagnostics of membership. We have classified 22 of the candidates as new members of Taurus, which includes one of the coolest known members (M9.75). Our updated census of members within the SDSS field shows a surplus of solar-mass stars relative to clusters, although it is less pronounced than in the smaller fields toward the stellar aggregates that were surveyed for previously measured mass functions in Taurus. In addition to spectra of our new members, we include in our study near-IR spectra of roughly half of the known members of Taurus, which are used to refine their spectral types and extinctions. We also present an updated set of near-IR standard spectra for classifying young stars and brown dwarfs at M and L types.

  6. The Tarantula Nebula as a template for extragalactic star forming regions from VLT/MUSE and HST/STIS (United States)

    Crowther, Paul A.; Caballero-Nieves, Saida M.; Castro, Norberto; Evans, Christopher J.


    We present VLT/MUSE observations of NGC 2070, the dominant ionizing nebula of 30 Doradus in the LMC, plus HST/STIS spectroscopy of its central star cluster R136. Integral Field Spectroscopy (MUSE) and pseudo IFS (STIS) together provides a complete census of all massive stars within the central 30×30 parsec2 of the Tarantula. We discuss the integrated far-UV spectrum of R136, of particular interest for UV studies of young extragalactic star clusters. Strong He iiλ1640 emission at very early ages (1-2 Myr) from very massive stars cannot be reproduced by current population synthesis models, even those incorporating binary evolution and very massive stars. A nebular analysis of the integrated MUSE dataset implies an age of ~4.5 Myr for NGC 2070. Wolf-Rayet features provide alternative age diagnostics, with the primary contribution to the integrated Wolf-Rayet bumps arising from R140 rather than the more numerous H-rich WN stars in R136. Caution should be used when interpreting spatially extended observations of extragalactic star-forming regions.

  7. Emergence of recombinant forms in geographic regions with co-circulating HIV subtypes in the dynamic HIV-1 epidemic

    Energy Technology Data Exchange (ETDEWEB)

    Zhang, Ming [Los Alamos National Laboratory; Letiner, Thomas K [Los Alamos National Laboratory; Korber, Bette T [Los Alamos National Laboratory; Foley, Brian [Los Alamos National Laboratory


    We have reexamined the subtype designations of {approx}10,000 subtype A, B, C, G, and AG, BC, BF recombinant sequences, and compared the results of the new analysis with their published designations. Intersubtype recombinants dominate HIV epidemics in three different geographical regions. The circulating recombinant from (CRF) CRF02-AG, common in West Central Africa, appears to result from a recombination event that occurred early in the divergence between subtypes A and G, although additional more recent recombination events may have contributed to the breakpoint pattern in this recombinant lineage as well. The Chinese recombinant epidemic strains CRF07 and CRF08, in contrast, result from recent recombinations between more contemporary strains. Nevertheless, CRF07 and CRF08 contributed to many subsequent recombination events. The BF recombinant epidemics in two HIV-1 epicenters in South America are not independent and BF epidemics in South America have an unusually high fraction of unique recombinant forms (URFs) that have each been found only once and carry distinctive breakpoints. Taken together, these analyses reveal a complex and dynamic picture of the current HIV-1 epidemic, and suggest a means of grouping and tracking relationships between viruses through preservation of shared breakpints.

  8. A structural model of the pore-forming region of the skeletal muscle ryanodine receptor (RyR1.

    Directory of Open Access Journals (Sweden)

    Srinivas Ramachandran


    Full Text Available Ryanodine receptors (RyRs are ion channels that regulate muscle contraction by releasing calcium ions from intracellular stores into the cytoplasm. Mutations in skeletal muscle RyR (RyR1 give rise to congenital diseases such as central core disease. The absence of high-resolution structures of RyR1 has limited our understanding of channel function and disease mechanisms at the molecular level. Here, we report a structural model of the pore-forming region of RyR1. Molecular dynamics simulations show high ion binding to putative pore residues D4899, E4900, D4938, and D4945, which are experimentally known to be critical for channel conductance and selectivity. We also observe preferential localization of Ca(2+ over K(+ in the selectivity filter of RyR1. Simulations of RyR1-D4899Q mutant show a loss of preference to Ca(2+ in the selectivity filter as seen experimentally. Electrophysiological experiments on a central core disease mutant, RyR1-G4898R, show constitutively open channels that conduct K(+ but not Ca(2+. Our simulations with G4898R likewise show a decrease in the preference of Ca(2+ over K(+ in the selectivity filter. Together, the computational and experimental results shed light on ion conductance and selectivity of RyR1 at an atomistic level.

  9. A Survey For Planetary-mass Brown Dwarfs in the Taurus and Perseus Star-forming Regions

    International Nuclear Information System (INIS)

    Esplin, T. L.; Luhman, K. L.


    We present the initial results from a survey for planetary-mass brown dwarfs in the Taurus star-forming region. We have identified brown dwarf candidates in Taurus using proper motions and photometry from several ground- and space-based facilities. Through spectroscopy of some of the more promising candidates, we have found 18 new members of Taurus. They have spectral types ranging from mid-M to early-L, and they include the four faintest known members in extinction-corrected K s , which should have masses as low as ∼4–5 M Jup according to evolutionary models. Two of the coolest new members (M9.25, M9.5) have mid-IR excesses that indicate the presence of disks. Two fainter objects with types of M9–L2 and M9–L3 also have red mid-IR colors relative to photospheres at ≤L0, but since the photospheric colors are poorly defined at >L0, it is unclear whether they have excesses from disks. We also have obtained spectra of candidate members of the IC 348 and NGC 1333 clusters in Perseus that were identified by Luhman et al. Eight candidates are found to be probable members, three of which are among the faintest and least-massive known members of the clusters (∼5 M Jup ).


    Energy Technology Data Exchange (ETDEWEB)

    Luhman, K. L. [Department of Astronomy and Astrophysics, The Pennsylvania State University, University Park, PA 16802 (United States); Mamajek, E. E. [Department of Physics and Astronomy, The University of Rochester, Rochester, NY 14627 (United States); Shukla, S. J. [Institute of Astronomy, Madingley Road, Cambridge CB3 0HA (United Kingdom); Loutrel, N. P., E-mail: [eXtreme Gravity Institute, Department of Physics, Montana State University, Bozeman, MT 59715 (United States)


    Previous studies have found that ∼1 deg{sup 2} fields surrounding the stellar aggregates in the Taurus star-forming region exhibit a surplus of solar-mass stars relative to denser clusters like IC 348 and the Orion Nebula Cluster. To test whether this difference reflects mass segregation in Taurus or a variation in the initial mass function, we have performed a survey for members of Taurus across a large field (∼40 deg{sup 2}) that was imaged by the Sloan Digital Sky Survey (SDSS). We obtained optical and near-infrared spectra of candidate members identified with those images and the Two Micron All Sky Survey, as well as miscellaneous candidates that were selected with several other diagnostics of membership. We have classified 22 of the candidates as new members of Taurus, which includes one of the coolest known members (M9.75). Our updated census of members within the SDSS field shows a surplus of solar-mass stars relative to clusters, although it is less pronounced than in the smaller fields toward the stellar aggregates that were surveyed for previously measured mass functions in Taurus. In addition to spectra of our new members, we include in our study near-IR spectra of roughly half of the known members of Taurus, which are used to refine their spectral types and extinctions. We also present an updated set of near-IR standard spectra for classifying young stars and brown dwarfs at M and L types.

  11. Community-led local development approach principles implementation when forming a regional local development projects support system in Ukraine

    Directory of Open Access Journals (Sweden)

    Y. G. Udod


    Full Text Available The article contains a brief description of the Community-led local development approach (local development under the leadership of the community, CLLD and the main purpose of its use in the European Union. The study indicated periods of the major initiatives to support local development in EU. Moreover the article posted CLLD approach principles’ evolution and the basic principles of the LEADER method and its application in CLLD, which can be applied in Ukraine. Subject to the provisions of the European Economic and Social Committee (EESC for further CLLD-approach distribution the five trends were identified that must be considered when forming a Regional local development projects support system in Ukraine: Multi-fund financing; Unification; Networking and collaboration; Extending the approach; Simplifying the process. The characteristic of the present phase of CLLD-approach, in particular, of the European Network for Rural Development (ENRD, which attaches great importance to the dissemination of the most effective CLLD practices and establish partnerships between communities and territories where the approach is implemented. The study found out the relationship between Community-led local development and Community-driven development (CDD supported by the World Bank.

  12. Water in star-forming regions with Herschel (WISH) : IV. A survey of low-J H2O line profiles toward high-mass protostars

    NARCIS (Netherlands)

    van der Tak, F. F. S.; Chavarria, L.; Herpin, F.; Wyrowski, F.; Walmsley, C. M.; van Dishoeck, E. F.; Benz, A. O.; Bergin, E. A.; Caselli, P.; Hogerheijde, M. R.; Johnstone, D.; Kristensen, L. E.; Liseau, R.; Nisini, B.; Tafalla, M.

    Context. Water is a key constituent of star-forming matter, but the origin of its line emission and absorption during high-mass star formation is not well understood. Aims. We study the velocity profiles of low-excitation H2O lines toward 19 high-mass star-forming regions and search for trends with


    International Nuclear Information System (INIS)

    Wright, N. J.; Drake, J. J.; Drew, J. E.; Vink, J. S.


    Cygnus OB2 is the nearest example of a massive star-forming region (SFR), containing over 50 O-type stars and hundreds of B-type stars. We have analyzed the properties of young stars in two fields in Cyg OB2 using the recently published deep catalog of Chandra X-ray point sources with complementary optical and near-IR photometry. Our sample is complete to ∼1 M sun (excluding A- and B-type stars that do not emit X-rays), making this the deepest study of the stellar properties and star formation history in Cyg OB2 to date. From Siess et al. isochrone fits to the near-IR color-magnitude diagram, we derive ages of 3.5 +0.75 -1.0 and 5.25 +1.5 -1.0 Myr for sources in the two fields, both with considerable spreads around the pre-main-sequence isochrones. The presence of a stellar population somewhat older than the present-day O-type stars, also fits in with the low fraction of sources with inner circumstellar disks (as traced by the K-band excess) that we find to be very low, but appropriate for a population of age ∼5 Myr. We also find that the region lacks a population of highly embedded sources that is often observed in young SFRs, suggesting star formation in the vicinity has declined. We measure the stellar mass functions (MFs) in this limit and find a power-law slope of Γ = -1.09 ± 0.13, in good agreement with the global mean value estimated by Kroupa. A steepening of the slope at higher masses is observed and suggested as due to the presence of the previous generation of stars that have lost their most massive members. Finally, combining our MF and an estimate of the radial density profile of the association suggests a total mass of Cyg OB2 of ∼3 x 10 4 M sun , similar to that of many of our Galaxy's most massive SFRs.


    Energy Technology Data Exchange (ETDEWEB)

    Nandakumar, G.; Veena, V. S.; Vig, S.; Tej, A. [Indian Institute of Space Science and Technology, Thiruvananthapuram 695 547 (India); Ghosh, S. K.; Ojha, D. K. [Tata Institute of Fundamental Research, Mumbai (Bombay) 400 005 (India)


    We present a multiwavelength investigation of star formation activity toward the southern H ii regions associated with IRAS 17160–3707, located at a distance of 6.2 kpc with a bolometric luminosity of 8.3 × 10{sup 5} L {sub ⊙}. The ionized gas distribution and dust clumps in the parental molecular cloud are examined in detail using measurements at infrared, submillimeter and radio wavelengths. The radio continuum images at 1280 and 610 MHz obtained using the Giant Metrewave Radio Telescope reveal the presence of multiple compact sources as well as nebulous emission. At submillimeter wavelengths, we identify seven dust clumps and estimate their physical properties such as temperature: 24–30 K, mass: 300–4800 M {sub ⊙} and luminosity: 9–317 × 10{sup 2} L {sub ⊙} using modified blackbody fits to the spectral energy distributions (SEDs) between 70 and 870 μ m. We find 24 young stellar objects (YSOs) in the mid-infrared, with a few of them coincident with the compact radio sources. The SEDs of the YSOs have been fitted by the Robitaille models and the results indicate that those having radio compact sources as counterparts host massive objects in early evolutionary stages with best fit age ≤0.2 Myr. We compare the relative evolutionary stages of clumps using various signposts such as masers, ionized gas, presence of YSOs and infrared nebulosity, and find six massive star-forming clumps and one quiescent clump. Of the former, five are in a relatively advanced stage and one in an earlier stage.


    Energy Technology Data Exchange (ETDEWEB)

    Rosero, V.; Hofner, P. [Physics Department, New Mexico Tech, 801 Leroy Pl., Socorro, NM 87801 (United States); Claussen, M. [National Radio Astronomy Observatory, 1003 Lopezville Rd., Socorro, NM 87801 (United States); Kurtz, S.; Carrasco-González, C.; Rodríguez, L. F.; Loinard, L. [Instituto de Radioastronomía y Astrofísica, Universidad Nacional Autónoma de México, Morelia 58090, México (Mexico); Cesaroni, R. [INAF, Osservatorio Astrofisico di Arcetri, Largo E. Fermi 5, I-50125 Firenze (Italy); Araya, E. D. [Physics Department, Western Illinois University, 1 University Circle, Macomb, IL 61455 (United States); Menten, K. M.; Wyrowski, F. [Max-Planck-Institute für Radioastronomie, Auf dem Hügel 69, D-53121 Bonn (Germany); Ellingsen, S. P. [School of Physical Sciences, University of Tasmania, Private Bag 37, Hobart, Tasmania 7001 (Australia)


    We present a high-sensitivity radio continuum survey at 6 and 1.3 cm using the Karl G. Jansky Very Large Array toward a sample of 58 high-mass star-forming regions. Our sample was chosen from dust clumps within infrared dark clouds with and without IR sources (CMC–IRs and CMCs, respectively), and hot molecular cores (HMCs), with no previous, or relatively weak radio continuum detection at the 1 mJy level. Due to the improvement in the continuum sensitivity of the Very Large Array, this survey achieved map rms levels of ∼3–10  μ Jy beam{sup −1} at sub-arcsecond angular resolution. We extracted 70 continuum sources associated with 1.2 mm dust clumps. Most sources are weak, compact, and prime candidates for high-mass protostars. Detection rates of radio sources associated with the millimeter dust clumps for CMCs, CMC–IRs, and HMCs are 6%, 53%, and 100%, respectively. This result is consistent with increasing high-mass star formation activity from CMCs to HMCs. The radio sources located within HMCs and CMC–IRs occur close to the dust clump centers, with a median offset from it of 12,000 au and 4000 au, respectively. We calculated 5–25 GHz spectral indices using power-law fits and obtained a median value of 0.5 (i.e., flux increasing with frequency), suggestive of thermal emission from ionized jets. In this paper we describe the sample, observations, and detections. The analysis and discussion will be presented in Paper II.

  16. Search for OB stars running away from young star clusters. II. The NGC 6357 star-forming region (United States)

    Gvaramadze, V. V.; Kniazev, A. Y.; Kroupa, P.; Oh, S.


    Dynamical few-body encounters in the dense cores of young massive star clusters are responsible for the loss of a significant fraction of their massive stellar content. Some of the escaping (runaway) stars move through the ambient medium supersonically and can be revealed via detection of their bow shocks (visible in the infrared, optical or radio). In this paper, which is the second of a series of papers devoted to the search for OB stars running away from young ( ≲ several Myr) Galactic clusters and OB associations, we present the results of the search for bow shocks around the star-forming region NGC 6357. Using the archival data of the Midcourse Space Experiment (MSX) satellite and the Spitzer Space Telescope, and the preliminary data release of the Wide-Field Infrared Survey Explorer (WISE), we discovered seven bow shocks, whose geometry is consistent with the possibility that they are generated by stars expelled from the young (~1-2 Myr) star clusters, Pismis 24 and AH03 J1725-34.4, associated with NGC 6357. Two of the seven bow shocks are driven by the already known OB stars, HD 319881 and [N78] 34. Follow-up spectroscopy of three other bow-shock-producing stars showed that they are massive (O-type) stars as well, while the 2MASS photometry of the remaining two stars suggests that they could be B0 V stars, provided that both are located at the same distance as NGC 6357. Detection of numerous massive stars ejected from the very young clusters is consistent with the theoretical expectation that star clusters can effectively lose massive stars at the very beginning of their dynamical evolution (long before the second mechanism for production of runaway stars, based on a supernova explosion in a massive tight binary system, begins to operate) and lends strong support to the idea that probably all field OB stars have been dynamically ejected from their birth clusters. A by-product of our search for bow shocks around NGC 6357 is the detection of three circular


    International Nuclear Information System (INIS)

    Komugi, S.; Tateuchi, K.; Motohara, K.; Kato, N.; Konishi, M.; Koshida, S.; Morokuma, T.; Takahashi, H.; Tanabé, T.; Yoshii, Y.; Takagi, T.; Iono, D.; Kaneko, H.; Ueda, J.; Saitoh, T. R.


    In order to test a recent hypothesis that the dispersion in the Schmidt-Kennicutt law arises from variations in the evolutionary stage of star-forming molecular clouds, we compared molecular gas and recent star formation in an early-phase merger galaxy pair, Taffy I (UGC 12915/UGC 12914, VV 254) which went through a direct collision 20 Myr ago and whose star-forming regions are expected to have similar ages. Narrowband Paα image is obtained using the ANIR near-infrared camera on the mini-TAO 1 m telescope. The image enables us to derive accurate star formation rates within the galaxy directly. The total star formation rate, 22.2 M ☉ yr –1 , was found to be much higher than previous estimates. Ages of individual star-forming blobs estimated from equivalent widths indicate that most star-forming regions are ∼7 Myr old, except for a giant H II region at the bridge which is much younger. Comparison between star formation rates and molecular gas masses for the regions with the same age exhibits a surprisingly tight correlation, a slope of unity, and star formation efficiencies comparable to those of starburst galaxies. These results suggest that Taffy I has just evolved into a starburst system after the collision, and the star-forming sites are at a similar stage in their evolution from natal molecular clouds except for the bridge region. The tight Schmidt-Kennicutt law supports the scenario that dispersion in the star formation law is in large part due to differences in evolutionary stage of star-forming regions.

  18. Pathok Negoro mosque as the form of territorial defense region of Mataram Kingdom of Islam Java in Jogjakarta (United States)

    Setyowati, E.; Hardiman, G.; Murtini, T. W.


    Territory is the space boundary of ownership. Defense concepts of an area also include territory. The defense concept of a territory of power or ownership is usually in the form of fortress, ditch, river, road, alley or gate. Many of these are seen in the forms of old city of Dutch’s inheritances. Javanese Islamic Kingdom in Yogyakarta has territory in the form of mosque. The mosque is called the Pathok Negoro as consists of 4 mosques. This territorial not same with another Islamic kingdoms. The research problem is why mosque used as a form of defense? What is the uniqueness?The purpose of the research is to reveal the form of territory of Javanese Islamic Kingdom. The benefit of this research is to get the characteristic form of territory of Javanese Islamic Kingdom in Yogyakarta. Their located in Ploso Kuning, Mlangi, babadan, Dongkelan, and Wonokromo. The research method that was used was qualitative method with grounded research, by using history and map search.In the analysis was carried out identification and comparison between mosques.The results show that there are characteristics on the location, the building orientation, the landscape, the area pattern and the shape of the building.

  19. Extended high circular polarization in the Orion massive star forming region: implications for the origin of homochirality in the solar system. (United States)

    Fukue, Tsubasa; Tamura, Motohide; Kandori, Ryo; Kusakabe, Nobuhiko; Hough, James H; Bailey, Jeremy; Whittet, Douglas C B; Lucas, Philip W; Nakajima, Yasushi; Hashimoto, Jun


    We present a wide-field (approximately 6' x 6') and deep near-infrared (K(s) band: 2.14 mum) circular polarization image in the Orion nebula, where massive stars and many low-mass stars are forming. Our results reveal that a high circular polarization region is spatially extended (approximately 0.4 pc) around the massive star-forming region, the BN/KL nebula. However, other regions, including the linearly polarized Orion bar, show no significant circular polarization. Most of the low-mass young stars do not show detectable extended structure in either linear or circular polarization, in contrast to the BN/KL nebula. If our solar system formed in a massive star-forming region and was irradiated by net circularly polarized radiation, then enantiomeric excesses could have been induced, through asymmetric photochemistry, in the parent bodies of the meteorites and subsequently delivered to Earth. These could then have played a role in the development of biological homochirality on Earth.

  20. Water deuterium fractionation in the high-mass star-forming region G34.26+0.15 based on Herschel/HIFI data

    DEFF Research Database (Denmark)

    Coutens, Audrey; Vastel, C.; Hincelin, U.


    Understanding water deuterium fractionation is important for constraining the mechanisms of water formation in interstellar clouds. Observations of HDO and H_2^{18}O transitions were carried out towards the high-mass star-forming region G34.26+0.15 with the Heterodyne Instrument for the Far...... to an age of ˜105 yr after the infrared dark cloud stage....

  1. CH+(1-0) and 13CH+(1-0) absorption lines in the direction of massive star-forming regions

    NARCIS (Netherlands)

    Falgarone, E.; Godard, B.; Cernicharo, J.; de Luca, M.; Gerin, M.; Phillips, T. G.; Black, J. H.; Lis, D. C.; Bell, T. A.; Boulanger, F.; Coutens, A.; Dartois, E.; Encrenaz, P.; Giesen, T.; Goicoechea, J. R.; Goldsmith, P. F.; Gupta, H.; Gry, C.; Hennebelle, P.; Herbst, E.; Hily-Blant, P.; Joblin, C.; Kaźmierczak, M.; Kołos, R.; Krełowski, J.; Martin-Pintado, J.; Monje, R.; Mookerjea, B.; Neufeld, D. A.; Perault, M.; Pearson, J. C.; Persson, C.; Plume, R.; Salez, M.; Schmidt, M.; Sonnentrucker, P.; Stutzki, J.; Teyssier, D.; Vastel, C.; Yu, S.; Menten, K.; Geballe, T. R.; Schlemmer, S.; Shipman, R.; Tielens, A. G. G. M.; Philipp, S.; Cros, A.; Zmuidzinas, J.; Samoska, L. A.; Klein, K.; Lorenzani, A.; Szczerba, R.; Péron, I.; Cais, P.; Gaufre, P.; Ravera, L.; Morris, P.; Lord, S.; Planesas, P.


    We report the detection of the ground-state rotational transition of the methylidyne cation CH+ and its isotopologue 13CH+ toward the remote massive star-forming regions W33A, W49N, and W51 with the HIFI instrument onboard the Herschel satellite. Both lines are seen only in absorption against the

  2. The force-sensing device region of α-catenin is an intrinsically disordered segment in the absence of intramolecular stabilization of the autoinhibitory form. (United States)

    Hirano, Yoshinori; Amano, Yu; Yonemura, Shigenobu; Hakoshima, Toshio


    Mechanotransduction by α-catenin facilitates the force-dependent development of adherens junctions (AJs) by recruiting vinculin to reinforce actin anchoring of AJs. The α-catenin mechanotransducing action is facilitated by its force-sensing device region that autoinhibits the vinculin-binding site 1 (VBS1). Here, we report the high-resolution structure of the force-sensing device region of α-catenin, which shows the autoinhibited form comprised of helix bundles E, F and G. The cryptic VBS1 is embedded into helix bundle E stabilized by direct interactions with the autoinhibitory region forming helix bundles F and G. Our molecular dissection study showed that helix bundles F and G are stable in solution in each isolated form, whereas helix bundle E that contains VBS1 is unstable and intrinsically disordered in solution in the isolated form. We successfully identified key residues mediating the autoinhibition and produced mutated α-catenins that display variable force sensitivity and autoinhibition. Using these mutants, we demonstrate both in vitro and in vivo that, in the absence of this stabilization, the helix bundle containing VBS1 would adopt an unfolded form, thus exposing VBS for vinculin binding. We provide evidence for importance of mechanotransduction with the intrinsic force sensitivity for vinculin recruitment to adherens junctions of epithelial cell sheets with mutated α-catenins. © 2018 Molecular Biology Society of Japan and John Wiley & Sons Australia, Ltd.

  3. From Theory to Experiment: Hadron Electromagnetic Form Factors in Space-like and Time-like Regions

    International Nuclear Information System (INIS)

    Tomasi-Gustafsson, E.; Gakh, G.I.; Rekalo, A.P.


    Hadron electromagnetic form factors contain information on the intrinsic structure of the hadrons. The pioneering work developed at the Kharkov Physical-Technical Institute in the 60's on the relation between the polarized cross section and the proton form factors triggered a number of experiments. Such experiments could be performed only recently due to the progress in accelerator and polarimetry techniques. The principle of these measurements is recalled and surprise and very precise results obtained on proton are presented. The actual status of nucleon electromagnetic form factors is reviewed, with special attention to the basic work done in Kharkov Physical-Technical Institute. This Paper is devoted to the memory of Prof. M.P. Rekalo

  4. Indocyanine Green Angiographic and Multifocal Electroretinographic Features in the Diffuse and Regional Form of Bietti′s Crystalline Retinopathy

    Institute of Scientific and Technical Information of China (English)

    Libin Jiang; Feng Wen; Lezheng Wu; Hong Yan; Shixing Hu


    Prpose: To observe different features of indocyanine green angiography(ICGA) andtifocal electroretinography (ERG) in the diffuse and regional type of Bieti′sc stalline retinopathy (BCR). Thods: ICGA and the multifocal ERG were performed in two cases of the diffuse andregional type of BCR respectively. These data were compared with fluoresceinangiography (FA), standard Ganzfeld ERG, and visual field testing. Results: In the regional case, ICGA revealed reduced perfusion of the choroidalcirculation in the early phase and multiple hypofluorescent spots in the posterior pole in the late phase, due to choriocapillaris filling defect; the extent of choroiocapillaris losswas shown in early phase of ICGA and there were multifocal hyperfluorescent dotssurrounding hypofluorescent spots in late phase in the diffuse case. The multifocal ERGshowed that the central responses were markedly depressed, corresponding to the visualfield defects, while the findings of Ganzfeld ERG were normal in the regional BCR;however, both the multifocal ERG and Ganzfeld ERG were severely subnormal in thediffuse case.Conclusions: The features of ICGA and multifocal ERG are different between the diffuseand regional BCR. In the meantime, the two tools are also useful to differentiate the typeand assess the extentof evolution in BCR.

  5. Which visual functions depend on intermediate visual regions? Insights from a case of developmental visual form agnosia. (United States)

    Gilaie-Dotan, Sharon


    A key question in visual neuroscience is the causal link between specific brain areas and perceptual functions; which regions are necessary for which visual functions? While the contribution of primary visual cortex and high-level visual regions to visual perception has been extensively investigated, the contribution of intermediate visual areas (e.g. V2/V3) to visual processes remains unclear. Here I review more than 20 visual functions (early, mid, and high-level) of LG, a developmental visual agnosic and prosopagnosic young adult, whose intermediate visual regions function in a significantly abnormal fashion as revealed through extensive fMRI and ERP investigations. While expectedly, some of LG's visual functions are significantly impaired, some of his visual functions are surprisingly normal (e.g. stereopsis, color, reading, biological motion). During the period of eight-year testing described here, LG trained on a perceptual learning paradigm that was successful in improving some but not all of his visual functions. Following LG's visual performance and taking into account additional findings in the field, I propose a framework for how different visual areas contribute to different visual functions, with an emphasis on intermediate visual regions. Thus, although rewiring and plasticity in the brain can occur during development to overcome and compensate for hindering developmental factors, LG's case seems to indicate that some visual functions are much less dependent on strict hierarchical flow than others, and can develop normally in spite of abnormal mid-level visual areas, thereby probably less dependent on intermediate visual regions. Copyright © 2015 Elsevier Ltd. All rights reserved.


    Energy Technology Data Exchange (ETDEWEB)

    Lee, Seokho; Park, Yong-Sun [Astronomy Program, Department of Physics and Astronomy, Seoul National University, 1 Gwanak-ro, Gwanak-gu, Seoul 151-742 (Korea, Republic of); Lee, Jeong-Eun [Department of Astronomy and Space Science, Kyung Hee University, Yongin-shi, Kyungki-do 449-701 (Korea, Republic of); Bergin, Edwin A., E-mail: [Department of Astronomy, University of Michigan, 830 Dennison Building, 500 Church Street, Ann Arbor, MI 48109 (United States)


    A photon-dominated region (PDR) is one of the leading candidate mechanisms for the origin of warm CO gas with near universal ∼300 K rotational temperature inferred from the CO emission detected toward embedded protostars by Herschel/PACS. We have developed a PDR model in general coordinates, where we can use the most adequate coordinate system for an embedded protostar having outflow cavity walls, to solve chemistry and gas energetics self-consistently for given UV radiation fields with different spectral shapes. Simple one-dimensional tests and applications show that FIR mid-J (14 ≤ J ≤ 24) CO lines are emitted from close to the surface of a dense region exposed to high UV fluxes. We apply our model to HH46 and find that the UV-heated outflow cavity wall can reproduce the mid-J CO transitions observed by Herschel/PACS. A model with UV radiation corresponding to a blackbody of 10,000 K results in a rotational temperature lower than 300 K, while models with the Draine interstellar radiation field and the 15,000 K blackbody radiation field predict a rotational temperature similar to the observed one.

  7. Can regional strain and strain rate measurement be performed during both dobutamine and exercise echocardiography, and do regional deformation responses differ with different forms of stress testing? (United States)

    Davidavicius, Giedrius; Kowalski, Miroslaw; Williams, R Ian; D'hooge, Jan; Di Salvo, Giovanni; Pierre-Justin, Gilbert; Claus, Piet; Rademakers, Frank; Herregods, Marie-Christine; Fraser, Alan G; Pierard, Luc A; Bijnens, Bart; Sutherland, George R


    Regional strain (epsilon) and strain rate (SR) measurement could be the optimal approach to quantifying stress echocardiography images. However, signal noise could preclude their use. Study aims Our aim was to compare the feasibility of regional peak systolic (p) velocity (Vel), pSR/epsilon measurement, and their normal responses during upright (group 1, n = 10) and supine (group 2, n = 10) bicycle exercise and (group 3, n = 10) dobutamine stress. For each type of stress study, pVel/pSR/epsilon data were acquired at baseline, low (100-120 bpm), and peak (140-160 bpm) heart rate (HR); and during recovery. During dobutamine pVel/pSR/epsilon were interpretable in >95% of segments at every stress stage, whereas in groups 1 and 2 pSR/epsilon responses were noninterpretable in >36% of segments (P pVel and SR values increased linearly and reached maximal value at peak HR (P pVel increased linearly, whereas pepsilon response was biphasic as a result of the reduced filling at higher HRs.

  8. Regions of existence of two forms of the critical void fraction dependence on heat flux density at burnout

    International Nuclear Information System (INIS)

    Smolin, V.N.


    On the basis of the available experimental data considered is the burnout during the movement of steam-water flow in vertical heated tubes with internal diameter from 8 to 40 mm. Critical steam content Xsub(cr) dependences on the critical heat flux qsub(cr) in different tubes and under different pressure are analyzed. Two main regions of the weak and strong dependences Xsub(cr)=f(qsub(cr)) at burnout are found out [ru

  9. Influence of university network structures on forming the network environment of regional economy (on the example of national research universities of Tatarstan Republic

    Directory of Open Access Journals (Sweden)

    Darya-Anna Alekseevna Kaibiyainen


    Full Text Available Objective to elaborate theoretical and applied aspects of the processes of forming the new network institutional environment of the Russian regional economy under the influence of the developing integral educational network structures basing on the study of the experience of national research universities of Tatarstan Republic Methods general scientific logical methods of analysis and synthesis induction and deduction scientific abstraction as well as the method of systemicfunctional analysis. Results the practical examples are revealed and analyzed of introducing the new network integral principles into the functioning of national research universities which have a real economic effect and influencing such indicators of regional economy as the growth of employment reduction of unemployment etc. Scientific novelty problems of network structures development in the Russian education have not been thoroughly studied yet. The article analyzes the experience reveals and describes the methods and techniques of forming the network educational structures in the functioning of national research universities in Tatarstan Republic Practical value the author shows the ability of network university structures not only to play a significant role forming the new institutional environment of the regional economy but also to influence the macro and microeconomic indicators of development of the region and the country. nbsp

  10. The carbonate mineralogy and distribution of habitat-forming deep-sea corals in the southwest pacific region (United States)

    Bostock, Helen C.; Tracey, Dianne M.; Currie, Kim I.; Dunbar, Gavin B.; Handler, Monica R.; Mikaloff Fletcher, Sara E.; Smith, Abigail M.; Williams, Michael J. M.


    Habitat-forming deep-sea scleractinian and alcyonacean corals from around the southwest Pacific were analysed for their calcium carbonate mineralogy. Scleractinian coral species Solenosmilia variabilis, Enallopsammia rostrata, Goniocorella dumosa, Madrepora oculata and Oculina virgosa were all found to be 100% aragonitic, while some members of the alcyonacean taxa Keratoisis spp., Lepidisis spp., and Paragorgia spp. were determined to be high magnesium (Mg) calcite (with 8-11 mol% MgCO3) and Primnoa sp. is bimineralic with both aragonite and Mg calcite. The majority of these habitat-forming deep-sea corals are found at intermediate depths (800-1200 m) in the Antarctic Intermediate Waters (AAIW) with low salinities (~34.5), temperatures of 4-8 °C and high oxygen concentrations (>180 μmol/kg) and currently sitting above the aragonite saturation horizon (ASH). However, habitat-forming corals have been recorded from greater depths, in cooler waters (2-4 °C) that are undersaturated with respect to aragonite (Ωaragonite160 μmol/kg. To address the sampling depth bias the coral records were normalised by the number of benthic stations (sampling effort) in the same depth range. This shows that the highest number of corals per sampling effort is between 1000 and 1400 m with corals present in over 5% of the stations at these depths. The normalised records and Boot Strap analyses suggests that scleractinian corals, especially S. variabilis should be present in >1% of stations down to 1800 m water depth, with E. rostrata, M. oculata and G. dumosa slightly shallower. While alcyonacean corals are found in >1% down to 2600 m, with Keratoisis spp. the deepest down to 2600 m, while Lepidisis spp. and Paragorgia spp. found down to 1800 m. This suggests that most species can probably tolerate some undersaturation of aragonite (Ωaragonite=0.8-0.9), with several species/genera (S. variabilis; Keratoisis spp.) even more tolerant of lower carbonate concentrations ([CO3 2 -]), down

  11. Study of the pion electromagnetic form factor in the timelike region, from the production threshold to 900 MeV in the center of mass

    International Nuclear Information System (INIS)

    Quenzer, A.


    The pion form factor is measured in the reaction e + e - →π + π - for center of mass energies in the range 480-900 MeV. The results are first analysed in terms of the conventional Vector Meson Dominance formalism, and then taking into account the ωπ inelastic channel. The results of this later formalisms is a pion form factor (F) which fits quite well all the existing data on F both in the timelike and spacelike regions, and a pion mean square radius [fr

  12. Forecasting how residential urban form affects the regional carbon savings and costs of retrofitting and decentralized energy supply

    International Nuclear Information System (INIS)

    Hargreaves, Anthony; Cheng, Vicky; Deshmukh, Sandip; Leach, Matthew; Steemers, Koen


    Highlights: • An innovative model for testing combinations of spatial planning and decentralised energy supply. • An improved method of modelling the spatial variability of energy consumption per dwelling type. • Shows how spatial planning would affect the future carbon reduction of decentralised supply. • Forecasts the future carbon reduction and costs of retrofitting and decentralised supply. • A method of forecasting how residential space would affect the suitability of decentralised supply. - Abstract: Low carbon energy supply technologies are increasingly used at the building and community scale and are an important part of the government decarbonisation strategy. However, with their present state of development and costs, many of these decentralised technologies rely on public subsidies to be financially viable. It is questionable whether they are cost effective compared to other ways of reducing carbon emissions, such as decarbonisation of conventional supply and improving the energy efficiency of dwellings. Previous studies have found it difficult to reliably estimate the future potential of decentralised supply because this depends on the available residential space which varies greatly within a city region. To address this problem, we used an integrated modelling framework that converted the residential density forecasts of a regional model into a representation of the building dimensions and land of the future housing stock. This included a method of estimating the variability of the dwellings and residential land. We present the findings of a case study of the wider south east regions of England that forecasted the impacts of energy efficiency and decentralised supply scenarios to year 2031. Our novel and innovative method substantially improves the spatial estimates of energy consumption compared to building energy models that only use standard dwelling typologies. We tested the impact of an alternative spatial planning policy on the future

  13. Reversible Stress Cardiomyopathy Presenting as Acute Coronary Syndrome with Elevated Troponin in the Absence of Regional Wall Motion Abnormalities: A Forme Fruste of Stress Cardiomyopathy?

    Directory of Open Access Journals (Sweden)

    Mahesh Anantha Narayanan


    Full Text Available We present a case of reversible stress cardiomyopathy in a surgical patient, described here as a forme fruste due to its atypical features. It is important to recognize such unusual presentation of stress cardiomyopathy that mimics acute coronary syndrome. Stress cardiomyopathy commonly presents as acute coronary syndrome and is characterized by typical or atypical variants of regional wall motion abnormalities. We report a 60-year-old Caucasian male with reversible stress cardiomyopathy following a sternal fracture fixation. Although the patient had several typical features of stress cardiomyopathy including physical stress, ST-segment elevation, elevated cardiac biomarkers and normal epicardial coronaries, there were few features that were atypical, including unusual age, gender, absence of regional wall motion abnormalities, high lateral ST elevation, and high troponin-ejection fraction product. In conclusion, this could represent a forme fruste of stress cardiomyopathy.


    Directory of Open Access Journals (Sweden)

    Nadiia Kulchytska


    Full Text Available In the article the modern condition of decentralization and organizational legal forms of sustainable development of regions of Ukraine in the context of the global experience are analyzed, possible ways to overcome regional disparities are proved. A special place in scientific research article takes a significant number of modern researchers analyzed the theoretical and methodological foundations of a system of financial support of local authorities in the transition to decentralization of public administration. In this regard, particular relevance is the problem of defining the role of decentralization principles in forming the financial support of local government. The importance of decentralization in the process of local government reform is proved. The ways implementing decentralization in modern Ukraine are shown. The scientific approaches to determining the meaning and role of decentralization in a market economy are analyzed and summarized. Key words: decentralization, deconcentration of power, the territorial organization of government, local communities, dotatsiynist, sustainable development. JEL: H 70, R 58

  15. Atomic motions in the αβ-region of glass-forming polymers: molecular versus mode coupling theory approach

    International Nuclear Information System (INIS)

    Colmenero, Juan; Narros, Arturo; Alvarez, Fernando; Arbe, Arantxa; Moreno, Angel J


    We present fully atomistic molecular dynamics simulation results on a main-chain polymer, 1,4-polybutadiene, in the merging region of the α- and β-relaxations. A real-space analysis reveals the occurrence of localized motions ('β-like') in addition to the diffusive structural relaxation. A molecular approach provides a direct connection between the local conformational changes reflected in the atomic motions and the secondary relaxations in this polymer. Such local processes occur just in the time window where the β-process of the mode coupling theory is expected. We show that the application of this theory is still possible and yields an unusually large value of the exponent parameter. This result might originate from the competition between two mechanisms for dynamic arrest: intermolecular packing and intramolecular barriers for local conformational changes ('β-like')

  16. Introduction of the flora, life forms and chorology of plants of some regions in western Chabahar (Sistan and Baluchestan Province

    Directory of Open Access Journals (Sweden)

    Somayeh Salimi


    Full Text Available This study focused on Zarabad, Cheraghabad and Nogombecom plants of sub-basin watershed city of Chabahar, Iran. The studied flora included 78 species which belonged to 66 genera and 29 families. Poaceae with 16 genera and 19 species, Asteraceae with 7 genera and 8 species, Chenopodiaceae with 5 genera and 4 species, Papilionaceae, with 5 genera and 6 species, constituted the largest plant families respectively. The largest genera of the region were: Salsola, Heliotropium and Plantago, respectively. 42% of the flora belonged to Nobo-Sindian elements, 35%to Irano-Turanian, 18%were bioregional elements and 5% of the species were cosmopolitan. Flora of the studied area, included therophytes (56%, chamaephytes (15%, phanerophytes (14%, geophytes (12% and hemicryptophytes (3%.


    Bakaeva, E A; Eremeyshvili, A V


    With the use of the method of inversion voltammetry there was analyzed the content of movableforms of trace elements: (selenium, zinc, copper lead, cadmium) in soils in the Yaroslavl district of the Yaroslavl region, and also content of zinc, copper lead, cadmium in soils and snow cover in the city of Yaroslavl. According to values of concentrations of movable compounds in soils determined trace elements can be ranked into the following row: zinc > lead > copper > selenium > cadmium. There was revealed insufficient if compared with literature data concentrations, content of movable compounds of selenium, copper and zinc in examined explored soils. The maximal concentrations of lead are revealed in the close proximity to both the city of Yaroslavl and large highways of the city. It indicates to the anthropogenic pollution of soils by this element.

  18. The Features of Forming and Using the Finansial and Material Resources of Socially Oriented Non-Profit Organizations of Volgograd Region

    Directory of Open Access Journals (Sweden)

    Oleynik Olga Stepanovna


    Full Text Available The article deals with the problem of interaction of regional authorities and the institute of socially oriented non-profit organizations that carry out the activity aimed at solving social problems, the development of civil society in Russia. The forms and activities of socially oriented non-profit organizations are systematically presented. The authors reveal the directions and tools for supporting the activities of socially oriented non-profit organizations by public authorities and local self-government bodies. The authors aimed at fixing the peculiarities of organization and conduct of statistical observation over the activity of socially-oriented organizations in Volgograd region. The organizational events were arranged. They were necessary for the conduct of qualitative statistical analysis of the activity of socially oriented organizations. For the first time the official data on the activity of socially oriented non-profit organizations in Volgograd region, including the information on formation and use of money and other property, was received as a result of the statistical observation. The authors focus on the analysis of the sources of money and other property, reveal the composition of income in non-profit organizations of various organizational and legal forms. The forms of work in socially oriented non-profit organizations of Volgograd region and its results as of 2013 are thoroughly studied. The conducted statistical analysis showed that the significant public sector has been established in the region. It provides the necessary public social services, financial or social assistance to the most vulnerable members of society.

  19. A UKIDSS-based search for low-mass stars and small stellar clumps in off-cloud parts of young star-forming regions* **

    Directory of Open Access Journals (Sweden)

    Barrado y Navascués D.


    Full Text Available The form and universality of the mass function of young and nearby star-forming regions is still under debate. Its relation to the stellar density, its mass peak and the dependency on most recent models shows significant differencies for the various regions and remains unclear up to date. We aim to get a more complete census of two of such regions. We investigate yet unexplored areas of Orion and Taurus-Auriga, observed by the UKIDSS survey. In the latter, we search for low-mass stars via photometric and proper motion criteria and signs for variability. In Orion, we search for small stellar clumps via nearest-neighbor methods. Highlights in Taurus would be the finding of the missing low-mass stars and the detection of a young cluster T dwarf. In Orion, we discovered small stellar associations of its OB1b and OB1c populations. Combined with what is known in literature, we will provide by this investigations a general picture of the results of the star-forming processes in large areas of Taurus and Orion and probe the most recent models.

  20. Influence of urban form on landscape pattern and connectivity in metropolitan regions: a comparative case study of Phoenix, AZ, USA, and Izmir, Turkey. (United States)

    Park, Sohyun; Hepcan, Çiğdem C; Hepcan, Şerif; Cook, Edward A


    Although ecological connectivity conservation in urban areas has recently been recognized as an important issue, less is known about its relationship to urban form and landscape pattern. This study investigates how urban morphology influences regional ecosystem pattern and landscape connectivity. Two metropolitan landscapes, Phoenix, AZ, USA, and Izmir, Turkey, were compared, both of which are fast-growing regions in their national context. A wide range of variables were considered for identifying natural and urban properties. The natural characteristics include typology of urban ecosystems, urban to natural cover ratio, dominant habitat type, urban biodiversity, landscape context, and connectivity conservation efforts. Urban parameters examine urban form, urban extent, urban cover proportion, growth rate, populations, urban gradient, major drivers of urbanization, urban density, and mode/approach of urban development. Twelve landscape metrics were measured and compared across the natural patches. Results show that there is little difference in landscape connectivity in the rural zones of Phoenix and Izmir, although Phoenix has slightly higher connectivity values. The connectivity variance in urbanized areas, however, is significantly dependent on the region. For example, Phoenix urban zones have substantially lower connectivity than either urban or suburban zones in Izmir. Findings demonstrate that small and compact urban settlements with more dense populations are more likely to conserve landscape connectivity compared to multiple-concentric but amalgamated urban form spreading all over the landscape (aka urban sprawl).

  1. Identification and characterisation of a G-quadruplex forming sequence in the promoter region of nuclear factor (erythroid-derived 2)-like 2 (Nrf2)

    Energy Technology Data Exchange (ETDEWEB)

    Waller, Zoë A.E., E-mail:; Howell, Lesley A.; MacDonald, Colin J.; O’Connell, Maria A.; Searcey, Mark, E-mail:


    Highlights: • Discovery of a G-quadruplex forming sequence in the promoter sequence of Nrf2. • Characterisation of the G-quadruplex by UV, CD and NMR. • Conformational switching of G-quadruplex induced by 9-aminoacridine. - Abstract: The transcription factor nuclear factor (erythroid-derived 2)-like 2 (Nrf2) regulates multiple antioxidants, Phase II detoxification enzymes and other cytoprotective enzymes in cells. Activation of Nrf2 is recognised as being of potential therapeutic benefit in inflammatory-diseases whereas more recently, it has become clear that the inhibition of Nrf2 may have benefit in the alleviation of resistance in some tumour types. A potential G-quadruplex forming sequence was identified in the promoter region of Nrf2, close to a number of putative transcription factor binding sites. Characterisation of the sequence 5’-d[GGGAAGGGAGCAAGGGCGGGAGGG]-3’ using CD spectroscopy, imino proton NMR resonances and UV melting experiments demonstrated the formation of a parallel intramolecular G-quadruplex in the presence of K{sup +} ions. Incubation with 9-aminoacridine ligands induced a switch from antiparallel to parallel forms. The presence of a G-quadruplex forming sequence in the promoter region of Nrf2 suggests an approach to targeting the production of the protein through stabilisation of the structure, thereby avoiding resistance to antitumour drugs.

  2. Short forms of the Utrecht-Management of Identity Commitments Scale (U-MICS) with the domains of job, romantic relationship, and region. (United States)

    Schubach, Elisabeth; Zimmermann, Julia; Noack, Peter; Neyer, Franz J


    The U-MICS is a self-report questionnaire designed to assess the identity dimensions from a domain-specific perspective. The present study reports on the development of a short-form version for the domains of job and romantic relationship in young adults from Germany and extends this scale to include the domain of region (n Sample1  = 95, 84% female, mean age 22.45 years; n Sample2  = 1,795, 71% female, mean age 24.53 years). We found the short form to possess adequate psychometric properties and to demonstrate a factor structure congruent to the long-form version. Regarding validity, the small correlations across domains within dimensions support a domain-specific approach to identity. The associations between the different identity domains with personality traits are similar, indicating a consistent pattern of convergent validity for all domains. We conclude that "region" provides a valuable complement to the established domains that can all be reliably assessed with the U-MICS-Short Form. Copyright © 2016 The Foundation for Professionals in Services for Adolescents. Published by Elsevier Ltd. All rights reserved.

  3. The Gould's Belt Distances Survey (GOBELINS). IV. Distance, Depth, and Kinematics of the Taurus Star-forming Region (United States)

    Galli, Phillip A. B.; Loinard, Laurent; Ortiz-Léon, Gisela N.; Kounkel, Marina; Dzib, Sergio A.; Mioduszewski, Amy J.; Rodríguez, Luis F.; Hartmann, Lee; Teixeira, Ramachrisna; Torres, Rosa M.; Rivera, Juana L.; Boden, Andrew F.; Evans, Neal J., II; Briceño, Cesar; Tobin, John J.; Heyer, Mark


    We present new trigonometric parallaxes and proper motions of young stellar objects in the Taurus molecular cloud complex from observations collected with the Very Long Baseline Array as part of the Gould’s Belt Distances Survey. We detected 26 young stellar objects and derived trigonometric parallaxes for 18 stars with an accuracy of 0.3% to a few percent. We modeled the orbits of six binaries and determined the dynamical masses of the individual components in four of these systems (V1023 Tau, T Tau S, V807 Tau, and V1000 Tau). Our results are consistent with the first trigonometric parallaxes delivered by the Gaia satellite and reveal the existence of significant depth effects. We find that the central portion of the dark cloud Lynds 1495 is located at d =129.5 ± 0.3 pc, while the B216 clump in the filamentary structure connected to it is at d = 158.1 ± 1.2 pc. The closest and remotest stars in our sample are located at d = 126.6 ± 1.7 pc and d = 162.7 ± 0.8 pc, yielding a distance difference of about 36 pc. We also provide a new distance estimate for HL Tau that was recently imaged. Finally, we compute the spatial velocity of the stars with published radial velocity and investigate the kinematic properties of the various clouds and gas structures in this region.


    International Nuclear Information System (INIS)

    Anderson, C. N.; Hofner, P.; Creech-Eakman, M.; Shepherd, D.


    We present a 40 ks Chandra observation of the IRAS 20126+4104 core region. In the inner 6'' two X-ray sources were detected, which are coincident with the radio jet source I20S and the variable radio source I20Var. No X-ray emission was detected from the nearby massive protostar I20N. The spectra of both detected sources are hard and highly absorbed, with no emission below 3 keV. For I20S, the measured 0.5-8 keV count rate was 4.3 counts ks -1 . The X-ray spectrum was fitted with an absorbed 1T APEC model with an energy of kT =10 keV and an absorbing column of N H = 1.2 x 10 23 cm -2 . An unabsorbed X-ray luminosity of about 1.4 x 10 32 erg s -1 was estimated. The spectrum shows broad line emission between 6.4 and 6.7 keV, indicative of emission from both neutral and highly ionized iron. The X-ray light curve indicates that I20S is marginally variable; however, no flare emission was observed. The variable radio source I20Var was detected with a count rate of 0.9 counts ks -1 but there was no evidence of X-ray variability. The best-fit spectral model is a 1T APEC model with an absorbing hydrogen column of N H = 1.1 x 10 23 cm -2 and a plasma energy of kT = 6.0 keV. The unabsorbed X-ray luminosity is about 3 x 10 31 erg s -1 .

  5. Genetic characterization and phylogenetic relationships based on 18S rRNA and ITS1 region of small form of canine Babesia spp. from India. (United States)

    Mandal, M; Banerjee, P S; Garg, Rajat; Ram, Hira; Kundu, K; Kumar, Saroj; Kumar, G V P P S Ravi


    Canine babesiosis is a vector borne disease caused by intra-erythrocytic apicomplexan parasites Babesia canis (large form) and Babesia gibsoni (small form), throughout the globe. Apart from few sporadic reports on the occurrence of B. gibsoni infection in dogs, no attempt has been made to characterize Babesia spp. of dogs in India. Fifteen canine blood samples, positive for small form of Babesia, collected from northern to eastern parts of India, were used for amplification of 18S rRNA gene (∼1665bp) of Babesia sp. and partial ITS1 region (∼254bp) of B. gibsoni Asian genotype. Cloning and sequencing of the amplified products of each sample was performed separately. Based on sequences and phylogenetic analysis of 18S rRNA and ITS1 sequences, 13 were considered to be B. gibsoni. These thirteen isolates shared high sequence identity with each other and with B. gibsoni Asian genotype. The other two isolates could not be assigned to any particular species because of the difference(s) in 18S rRNA sequence with B. gibsoni and closer identity with Babesiaoccultans and Babesiaorientalis. In the phylogenetic tree, all the isolates of B. gibsoni Asian genotype formed a separate major clade named as Babesia spp. sensu stricto clade with high bootstrap support. The two unnamed Babesia sp. (Malbazar and Ludhiana isolates) clustered close together with B. orientalis, Babesia sp. (Kashi 1 isolate) and B. occultans of bovines. It can be inferred from this study that 18S rRNA gene and ITS1 region are highly conserved among 13 B. gibsoni isolates from India. It is the maiden attempt of genetic characterization by sequencing of 18S rRNA gene and ITS1 region of B. gibsoni from India and is also the first record on the occurrence of an unknown Babesia sp. of dogs from south and south-east Asia. Copyright © 2014 Elsevier B.V. All rights reserved.

  6. Insights from Synthetic Star-forming Regions. II. Verifying Dust Surface Density, Dust Temperature, and Gas Mass Measurements With Modified Blackbody Fitting

    Energy Technology Data Exchange (ETDEWEB)

    Koepferl, Christine M.; Robitaille, Thomas P. [Max Planck Institute for Astronomy, Königstuhl 17, D-69117 Heidelberg (Germany); Dale, James E., E-mail: [University Observatory Munich, Scheinerstr. 1, D-81679 Munich (Germany)


    We use a large data set of realistic synthetic observations (produced in Paper I of this series) to assess how observational techniques affect the measurement physical properties of star-forming regions. In this part of the series (Paper II), we explore the reliability of the measured total gas mass, dust surface density and dust temperature maps derived from modified blackbody fitting of synthetic Herschel observations. We find from our pixel-by-pixel analysis of the measured dust surface density and dust temperature a worrisome error spread especially close to star formation sites and low-density regions, where for those “contaminated” pixels the surface densities can be under/overestimated by up to three orders of magnitude. In light of this, we recommend to treat the pixel-based results from this technique with caution in regions with active star formation. In regions of high background typical in the inner Galactic plane, we are not able to recover reliable surface density maps of individual synthetic regions, since low-mass regions are lost in the far-infrared background. When measuring the total gas mass of regions in moderate background, we find that modified blackbody fitting works well (absolute error: + 9%; −13%) up to 10 kpc distance (errors increase with distance). Commonly, the initial images are convolved to the largest common beam-size, which smears contaminated pixels over large areas. The resulting information loss makes this commonly used technique less verifiable as now χ {sup 2} values cannot be used as a quality indicator of a fitted pixel. Our control measurements of the total gas mass (without the step of convolution to the largest common beam size) produce similar results (absolute error: +20%; −7%) while having much lower median errors especially for the high-mass stellar feedback phase. In upcoming papers (Paper III; Paper IV) of this series we test the reliability of measured star formation rate with direct and indirect

  7. Insights from Synthetic Star-forming Regions. II. Verifying Dust Surface Density, Dust Temperature, and Gas Mass Measurements with Modified Blackbody Fitting (United States)

    Koepferl, Christine M.; Robitaille, Thomas P.; Dale, James E.


    We use a large data set of realistic synthetic observations (produced in Paper I of this series) to assess how observational techniques affect the measurement physical properties of star-forming regions. In this part of the series (Paper II), we explore the reliability of the measured total gas mass, dust surface density and dust temperature maps derived from modified blackbody fitting of synthetic Herschel observations. We find from our pixel-by-pixel analysis of the measured dust surface density and dust temperature a worrisome error spread especially close to star formation sites and low-density regions, where for those “contaminated” pixels the surface densities can be under/overestimated by up to three orders of magnitude. In light of this, we recommend to treat the pixel-based results from this technique with caution in regions with active star formation. In regions of high background typical in the inner Galactic plane, we are not able to recover reliable surface density maps of individual synthetic regions, since low-mass regions are lost in the far-infrared background. When measuring the total gas mass of regions in moderate background, we find that modified blackbody fitting works well (absolute error: + 9%; -13%) up to 10 kpc distance (errors increase with distance). Commonly, the initial images are convolved to the largest common beam-size, which smears contaminated pixels over large areas. The resulting information loss makes this commonly used technique less verifiable as now χ 2 values cannot be used as a quality indicator of a fitted pixel. Our control measurements of the total gas mass (without the step of convolution to the largest common beam size) produce similar results (absolute error: +20%; -7%) while having much lower median errors especially for the high-mass stellar feedback phase. In upcoming papers (Paper III; Paper IV) of this series we test the reliability of measured star formation rate with direct and indirect techniques.

  8. Unequal-thickness billet optimization in transitional region during isothermal local loading forming of Ti-alloy rib-web component using response surface method

    Directory of Open Access Journals (Sweden)

    Ke WEI


    Full Text Available Avoiding the folding defect and improving the die filling capability in the transitional region are desired in isothermal local loading forming of a large-scale Ti-alloy rib-web component (LTRC. To achieve a high-precision LTRC, the folding evolution and die filling process in the transitional region were investigated by 3D finite element simulation and experiment using an equal-thickness billet (ETB. It is found that the initial volume distribution in the second-loading region can greatly affect the amount of material transferred into the first-loading region during the second-loading step, and thus lead to the folding defect. Besides, an improper initial volume distribution results in non-concurrent die filling in the cavities of ribs after the second-loading step, and then causes die underfilling. To this end, an unequal-thickness billet (UTB was employed with the initial volume distribution optimized by the response surface method (RSM. For a certain eigenstructure, the critical value of the percentage of transferred material determined by the ETB was taken as a constraint condition for avoiding the folding defect in the UTB optimization process, and the die underfilling rate was considered as the optimization objective. Then, based on the RSM models of the percentage of transferred material and the die underfilling rate, non-folding parameter combinations and optimum die filling were achieved. Lastly, an optimized UTB was obtained and verified by the simulation and experiment. Keywords: Die filling, Folding defect, Isothermal local loading forming, Transitional region, Unequal-thickness billet optimization


    International Nuclear Information System (INIS)

    Bik, A.; Henning, Th.; Vasyunina, T.; Beuther, H.; Linz, H.; Puga, E.; Waters, L.B.F.M.; Waelkens, Ch.; Horrobin, M.; Kaper, L.; De Koter, A.; Van den Ancker, M.; Comeron, F.; Lenorzer, A.; Churchwell, E.; Kurtz, S.; Kouwenhoven, M. B. N.; Stolte, A.; Thi, W. F.


    In this paper, we present VLT/SINFONI integral field spectroscopy of RCW 34 along with Spitzer/IRAC photometry of the surroundings. RCW 34 consists of three different regions. A large bubble has been detected in the IRAC images in which a cluster of intermediate- and low-mass class II objects is found. At the northern edge of this bubble, an H II region is located, ionized by 3 OB stars, of which the most massive star has spectral type O8.5V. Intermediate-mass stars (2-3 M sun ) are detected of G- and K-spectral type. These stars are still in the pre-main-sequence (PMS) phase. North of the H II region, a photon-dominated region is present, marking the edge of a dense molecular cloud traced by H 2 emission. Several class 0/I objects are associated with this cloud, indicating that star formation is still taking place. The distance to RCW 34 is revised to 2.5 ± 0.2 kpc and an age estimate of 2 ± 1 Myr is derived from the properties of the PMS stars inside the H II region. Between the class II sources in the bubble and the PMS stars in the H II region, no age difference could be detected with the present data. The presence of the class 0/I sources in the molecular cloud, however, suggests that the objects inside the molecular cloud are significantly younger. The most likely scenario for the formation of the three regions is that star formation propagated from south to north. First the bubble is formed, produced by intermediate- and low-mass stars only, after that, the H II region is formed from a dense core at the edge of the molecular cloud, resulting in the expansion similar to a champagne flow. More recently, star formation occurred in the rest of the molecular cloud. Two different formation scenarios are possible. (1) The bubble with the cluster of low- and intermediate-mass stars triggered the formation of the O star at the edge of the molecular cloud, which in its turn induces the current star formation in the molecular cloud. (2) An external triggering is

  10. The role of personality in the transmission of cultural forms an example of the bearer of regional traditions in central Moravia (the ethnographic area of Haná

    Directory of Open Access Journals (Sweden)

    Válka Miroslav


    Full Text Available The ethnographic area of Haná in Central Moravia (Czech Republic has been among distinctive ethnographic regions since the 16th century. Even though traditional regional forms had gradually disappeared as a consequence of the modernization of village life, these returned alongside new functions in terms of national consciousness from the late 19th century. It was the intelligentsia, mainly teachers, priests, physicians and artists, who contributed to the spread of these forms. The personalities´ activities did not stop even in the 20th century. The teacher Marie Pachtová (born 1932 is an example of one such person (in study by Miroslav Válka. She not only led a children´s folklore ensemble, moderated programmes aimed at presentation of folklore, and worked as a lector, but she also tries to involve older folk traditions of Haná in the present cultural calendar of the town where she lives. Among other things, she was instrumental in the preservation of the production of Easter eggs from Haná which are decorated with stuck-on straw. She paid similar attention to the ceremonial pastries. With the focus of this example, it is possible to prove the transformations of regional culture´s expression into the contemporary social life as well as the mechanism of the creation of a new tradition.

  11. Interorganisational networking as the principal form of technological, innovative and research cooperation between Russia and the European Union in the Baltic region

    Directory of Open Access Journals (Sweden)

    Bolychev Oleg


    Full Text Available This article concerns the role that international cooperation in research, technology, and innovation plays in ensuring innovative development and producing an innovative model of the Russian economy. One of the key objectives of the country’s integration into international research, technological, and innovative space is the development of Russia-EU cooperation in the Baltic region. It is established that, with the development of integration connections and regionalization processes, interorganizational networking takes on special importance in the organization and development of the innovative space. The authors analyze the existing typologies of forms of cooperation in the field of research, technology, and innovation, within which cases of networking are identified. The article gives a definition of interorganizational networks in view of the spatial and structural components of networking. The authors introduce the notion of international interorganizational networks as a special form of international cooperation. A study into the spatial form of interorganizational networks helps explain the effect of different levels and types of economic integration. Key areas of research on international interorganizational networks are identified in view of the features of integration processes in the development of network processes and in the framework of network approach in general.

  12. Interorganisational networking as the principal form of technological, innovative and research cooperation between Russia and the European Union in the Baltic region

    Directory of Open Access Journals (Sweden)

    Bolychev Oleg


    Full Text Available This article concerns the role that international cooperation in research, technology, and innovation plays in ensuring innovative development and producing an innovative model of the Russian economy. One of the key objectives of the country’s integration into international research, technological, and innovative space is the development of Russia-EU cooperation in the Baltic region. It is established that, with the development of integration connections and regionalization processes, interorganizational networking takes on special importance in the organization and development of the innovative space. The authors analyze the existing typologies of forms of cooperation in the field of research, technology, and innovation, within which cases of networking are identified. The article gives a definition of interorganizational networks in view of the spatial and structural components of networking. The authors introduce the notion of international interorganizational networks as a special form of international cooperation. A study into the spatial form of interorganizational networks helps explain the effect of different levels and types of economic integration. Key areas of research on international interorganizational networks are identified in view of the features of integration processes in the development of network processes and in the framework of network approach in general.

  13. Herschel/HIFI observations of high-J CO lines in the NGC 1333 low-mass star-forming region

    DEFF Research Database (Denmark)

    Yildiz, U. A.; van Dishoeck, E. F.; Kristensen, L. E.


    Herschel/HIFI observations of high-J lines (up to Ju = 10) of 12CO, 13CO and C18O are presented toward three deeply embedded low-mass protostars, NGC 1333 IRAS 2A, IRAS 4A, and IRAS 4B, obtained as part of the Water In Star-forming regions with Herschel (WISH) key program. The spectrally-resolved......Herschel/HIFI observations of high-J lines (up to Ju = 10) of 12CO, 13CO and C18O are presented toward three deeply embedded low-mass protostars, NGC 1333 IRAS 2A, IRAS 4A, and IRAS 4B, obtained as part of the Water In Star-forming regions with Herschel (WISH) key program. The spectrally....... Their intensities require a jump in the CO abundance at an evaporation temperature around 25 K, thus providing new direct evidence for a CO ice evaporation zone around low-mass protostars. Herschel is an ESA space observatory with science instruments provided by European-led Principal Investigator consortia...... and with important participation from NASA.Appendices and acknowledgements (pages 5 to 7) are only available in electronic form at

  14. Teaching Form as Form

    DEFF Research Database (Denmark)

    Keiding, Tina Bering


    understanding of form per se, or, to use an expression from this text, of form as form. This challenge can be reduced to one question: how can design teaching support students in achieving not only the ability to recognize and describe different form-related concepts in existing design (i.e. analytical...

  15. Substitutions in conserved regions preceding and within the linker affect activity and flexibility of tRNase ZL, the long form of tRNase Z.

    Directory of Open Access Journals (Sweden)

    Makenzie Saoura

    Full Text Available The enzyme tRNase Z, a member of the metallo-β-lactamase family, endonucleolytically removes 3' trailers from precursor tRNAs, preparing them for CCA addition and aminoacylation. The short form of tRNase Z, tRNase ZS, functions as a homodimer and is found in all prokaryotes and some eukaryotes. The long form, tRNase ZL, related to tRNase ZS through tandem duplication and found only in eukaryotes, possesses ~2,000-fold greater catalytic efficiency than tRNase ZS. tRNase ZL consists of related but diverged amino and carboxy domains connected by a flexible linker (also referred to as a flexible tether and functions as a monomer. The amino domain retains the flexible arm responsible for substrate recognition and binding while the carboxy domain retains the active site. The linker region was explored by Ala-scanning through two conserved regions of D. melanogaster tRNase Z: NdomTprox, located at the carboxy end of the amino domain proximal to the linker, and Tflex, a flexible site in the linker. Periodic substitutions in a hydrophobic patch (F329 and L332 at the carboxy end of NdomTprox show 2,700 and 670-fold impairment relative to wild type, respectively, accompanied by reduced linker flexibility at N-T inside the Ndom- linker boundary. The Ala substitution for N378 in the Tflex region has 10-fold higher catalytic efficiency than wild type and locally decreased flexibility, while the Ala substitution at R382 reduces catalytic efficiency ~50-fold. These changes in pre-tRNA processing kinetics and protein flexibility are interpreted in light of a recent crystal structure for S. cerevisiae tRNase Z, suggesting transmission of local changes in hydrophobicity into the skeleton of the amino domain.

  16. The Star Formation in Radio Survey: Jansky Very Large Array 33 GHz Observations of Nearby Galaxy Nuclei and Extranuclear Star-forming Regions (United States)

    Murphy, E. J.; Dong, D.; Momjian, E.; Linden, S.; Kennicutt, R. C., Jr.; Meier, D. S.; Schinnerer, E.; Turner, J. L.


    We present 33 GHz imaging for 112 pointings toward galaxy nuclei and extranuclear star-forming regions at ≈2″ resolution using the Karl G. Jansky Very Large Array (VLA) as part of the Star Formation in Radio Survey. A comparison with 33 GHz Robert C. Byrd Green Bank Telescope single-dish observations indicates that the interferometric VLA observations recover 78% ± 4% of the total flux density over 25″ regions (≈kpc scales) among all fields. On these scales, the emission being resolved out is most likely diffuse non-thermal synchrotron emission. Consequently, on the ≈30–300 pc scales sampled by our VLA observations, the bulk of the 33 GHz emission is recovered and primarily powered by free–free emission from discrete H II regions, making it an excellent tracer of massive star formation. Of the 225 discrete regions used for aperture photometry, 162 are extranuclear (i.e., having galactocentric radii r G ≥ 250 pc) and detected at >3σ significance at 33 GHz and in Hα. Assuming a typical 33 GHz thermal fraction of 90%, the ratio of optically-thin 33 GHz to uncorrected Hα star formation rates indicates a median extinction value on ≈30–300 pc scales of A Hα ≈ 1.26 ± 0.09 mag, with an associated median absolute deviation of 0.87 mag. We find that 10% of these sources are “highly embedded” (i.e., A Hα ≳ 3.3 mag), suggesting that on average, H II regions remain embedded for ≲1 Myr. Finally, we find the median 33 GHz continuum-to-Hα line flux ratio to be statistically larger within r G < 250 pc relative to the outer disk regions by a factor of 1.82 ± 0.39, while the ratio of 33 GHz to 24 μm flux densities is lower by a factor of 0.45 ± 0.08, which may suggest increased extinction in the central regions.


    International Nuclear Information System (INIS)

    Gouliermis, Dimitrios A.; Gennaro, Mario; Schmeja, Stefan; Dolphin, Andrew E.; Tognelli, Emanuele; Prada Moroni, Pier Giorgio


    Located at the tip of the wing of the Small Magellanic Cloud (SMC), the star-forming region NGC 602/N90 is characterized by the H II nebular ring N90 and the young cluster of pre-main-sequence (PMS) and early-type main-sequence stars NGC 602, located in the central area of the ring. We present a thorough cluster analysis of the stellar sample identified with Hubble Space Telescope/Advanced Camera for Surveys in the region. We show that apart from the central cluster low-mass PMS stars are congregated in 13 additional small, compact sub-clusters at the periphery of NGC 602, identified in terms of their higher stellar density with respect to the average background density derived from star counts. We find that the spatial distribution of the PMS stars is bimodal, with an unusually large fraction (∼60%) of the total population being clustered, while the remaining is diffusely distributed in the intercluster area, covering the whole central part of the region. From the corresponding color-magnitude diagrams we disentangle an age difference of ∼2.5 Myr between NGC 602 and the compact sub-clusters, which appear younger, on the basis of comparison of the brighter PMS stars with evolutionary models, which we accurately calculated for the metal abundance of the SMC. The diffuse PMS population appears to host stars as old as those in NGC 602. Almost all detected PMS sub-clusters appear to be centrally concentrated. When the complete PMS stellar sample, including both clustered and diffused stars, is considered in our cluster analysis, it appears as a single centrally concentrated stellar agglomeration, covering the whole central area of the region. Considering also the hot massive stars of the system, we find evidence that this agglomeration is hierarchically structured. Based on our findings, we propose a scenario according to which the region NGC 602/N90 experiences an active clustered star formation for the last ∼5 Myr. The central cluster NGC 602 was formed first

  18. Rapid intranasal delivery of chloramphenicol acetyltransferase in the active form to different brain regions as a model for enzyme therapy in the CNS. (United States)

    Appu, Abhilash P; Arun, Peethambaran; Krishnan, Jishnu K S; Moffett, John R; Namboodiri, Aryan M A


    The blood brain barrier (BBB) is critical for maintaining central nervous system (CNS) homeostasis by restricting entry of potentially toxic substances. However, the BBB is a major obstacle in the treatment of neurotoxicity and neurological disorders due to the restrictive nature of the barrier to many medications. Intranasal delivery of active enzymes to the brain has therapeutic potential for the treatment of numerous CNS enzyme deficiency disorders and CNS toxicity caused by chemical threat agents. The aim of this work is to provide a sensitive model system for analyzing the rapid delivery of active enzymes into various regions of the brain with therapeutic bioavailability. We tested intranasal delivery of chloramphenicol acetyltransferase (CAT), a relatively large (75kD) enzyme, in its active form into different regions of the brain. CAT was delivered intranasally to anaesthetized rats and enzyme activity was measured in different regions using a highly specific High Performance Thin Layer Chromatography (HP-TLC)-radiometry coupled assay. Active enzyme reached all examined areas of the brain within 15min (the earliest time point tested). In addition, the yield of enzyme activity in the brain was almost doubled in the brains of rats pre-treated with matrix metalloproteinase-9 (MMP-9). Intranasal administration of active enzymes in conjunction with MMP-9 to the CNS is both rapid and effective. The present results suggest that intranasal enzyme therapy is a promising method for counteracting CNS chemical threat poisoning, as well as for treating CNS enzyme deficiency disorders. Published by Elsevier B.V.

  19. Investigation of nucleon electromagnetic form factors in the unphysical region by means of the N bar N → πl+l- reactions

    International Nuclear Information System (INIS)

    Dubnickova, A.Z.; Dubnicka, S.; Rekalo, M.P.


    A theoretical investigation of N bar N → πl + l - processes is carried out. First, the general structure of the differential probability of annihilation of very slow antinucleons on nucleons at rest into pion and lepton pairs is derived, then the structure of the electromagnetic current of N bar N → πγ * transition in case of the S-state annihilation is restored and general properties of the corresponding form factors are demonstrated. Next, by using the three-diagram approximation of the amplitude, those form factors are calculated explicitly and for the special process (p bar p) → π 0 γ * → π 0 l + l - they are shown to be completely described by the magnetic form factor of the proton in the unphysical region. Finally, the effective mass spectra of lepton pairs and the integral coefficients of internal conversion for the p bar p → π 0 l + l - and p bar n → π - l + l - processes are predicted. 15 refs., 7 figs

  20. Physical and chemical differentiation of the luminous star-forming region W49A. Results from the JCMT Spectral Legacy Survey (United States)

    Nagy, Z.; van der Tak, F. F. S.; Fuller, G. A.; Plume, R.


    Context. The massive and luminous star-forming region W49A is a well-known Galactic candidate to probe the physical conditions and chemistry similar to those expected in external starburst galaxies. Aims: We aim to probe the physical and chemical structure of W49A on a spatial scale of ~0.8 pc based on the JCMT Spectral Legacy Survey, which covers the frequency range between 330 and 373 GHz. Methods: The wide 2 × 2 arcmin field and the high spectral resolution of the HARP instrument on JCMT provides information on the spatial structure and kinematics of the cloud traced by the observed molecular lines. For species where multiple transitions are available, we estimate excitation temperatures and column densities using a population diagram method that takes beam dilution and optical depth corrections into account. Results: We detected 255 transitions corresponding to 63 species in the 330-373 GHz range at the center position of W49A. Excitation conditions can be probed for 14 molecules, including the complex organic molecules CH3CCH, CH3CN, and CH3OH. The chemical composition suggests the importance of shock, photon-dominated region (PDR), and hot core chemistry. Many molecular lines show a significant spatial extent across the maps including CO and its isotopologues, high density tracers (e.g., HCN, HNC, CS, HCO+), and tracers of UV irradiation (e.g., CN and C2H). The spatially extended species reveal a complex velocity-structure of W49A with possible infall and outflow motions. Large variations are seen between the subregions with mostly blue-shifted emission toward the eastern tail, mostly red-shifted emission toward the northern clump, and emission peaking around the expected source velocity toward the southwest clump. Conclusions: A comparison of column density ratios of characteristic species observed toward W49A to Galactic PDRs suggests that while the chemistry toward the W49A center is driven by a combination of UV irradiation and shocks, UV irradiation

  1. Discontinuous drainage systems formed by highland precipitation and ground-water outflow in the Navua Valles and southwest Hadriacus Mons regions, Mars (United States)

    Hargitai, H. I.; Gulick, V. C.; Glines, N. H.


    The Navua Valles are systems of paleodrainages located north of Dao Vallis, which empty into Hellas Planitia, the largest impact basin on Mars. In this study, we mapped and characterized the Navua Valles Region's individual drainage systems, including drainages along the southwestern flank of Hadriacus Mons, and one valley network from the same source as Navua Valles but flowing in the opposite direction. The major drainage systems share morphological characteristics common to both outflow channels and valley networks. The slopes in this region are dissected by two major Navua drainage systems (here Navua A* and B*) and several shorter, sub-parallel valleys formed on the highest gradient (approximately 20 m/km [1.15°]) slopes, at the lowest part of Hellas Basin's rim. The two major drainage systems originate in the highlands, and empty into the basin. Our mapping suggests that water in Navua Valles reached the basin floor in a complicated descent and included several episodes of surface ponding, surface runoff, infiltration, subsurface flow and subsequent outflow. The most prominent channel system, Navua A, forms a repetitive sequence of deep incision into bedrock, followed by a transition into broad channels in erodible materials, and then into unconfined deposits. This successive erosion-transport-deposition sequence continues to repeat along the valley's entire length forming a discontinuous pattern that is consistent with classical fluvial process models. The channels cut into volcanic plains likely emplaced from the formation of Tyrrhenus and Hadriacus Montes. The dendritic source valleys of Navua A originate from the rim of a highland crater while the rest of this subsystem consists of a single, discontinuous channel which is consistent with a single water source zone that likely supplied water for all channels downslope. These drainages may have formed as discontinuous channels, revealing the potential existence of subsurface drainage pathways located

  2. Wiring assembly and method of forming a channel in a wiring assembly for receiving conductor and providing separate regions of conductor contact with the channel

    Energy Technology Data Exchange (ETDEWEB)

    Stelzer, Gerald; Meinke, Rainer; Senti, Mark


    A conductor assembly and method for constructing an assembly of the type which, when conducting current, generates a magnetic field or which, in the presence of a changing magnetic field, induces a voltage. In one embodiment the method provides a first insulative layer tubular in shape and including a surface along which a conductor segment may be positioned. A channel formed in the surface of the insulative layer defines a first conductor path and includes a surface of first contour in cross section along a first plane transverse to the conductor path. A segment of conductor having a surface of second contour in cross section is positioned at least partly in the channel and extends along the conductor path. Along the first plane, contact between the conductor surface of second contour and the channel surface of first contour includes at least two separate regions of contact.


    International Nuclear Information System (INIS)

    Torres, Rosa M.; Loinard, Laurent; Rodriguez, Luis F.; Mioduszewski, Amy J.


    Using multiepoch Very Long Baseline Array (VLBA) observations, we have measured the trigonometric parallax of the weak-line T Tauri star HP Tau/G2 in Taurus. The best fit yields a distance of 161.2 ± 0.9 pc, suggesting that the eastern portion of Taurus (where HP Tau/G2 is located) corresponds to the far side of the complex. Previous VLBA observations have shown that T Tau, to the south of the complex, is at an intermediate distance of about 147 pc, whereas the region around L1495 corresponds to the near side at roughly 130 pc. Our observations of only four sources are still too coarse to enable a reliable determination of the three-dimensional structure of the entire Taurus star-forming complex. They do demonstrate, however, that VLBA observations of multiple sources in a given star-forming region have the potential not only to provide a very accurate estimate of its mean distance, but also to reveal its internal structure. The proper motion measurements obtained simultaneously with the parallax allowed us to study the kinematics of the young stars in Taurus. Combining the four observations available so far, we estimate the peculiar velocity of Taurus to be about 10.6 km s -1 almost completely in a direction parallel to the Galactic plane. Using our improved distance measurement, we have refined the determination of the position on the H-R diagram of HP Tau/G2, and of two other members of the HP Tau group (HP Tau itself and HP Tau/G3). Most pre-main-sequence evolutionary models predict significantly discrepant ages (by 5 Myr) for those three stars-expected to be coeval. Only in the models of Palla and Stahler do they fall on a single isochrone (at 3 Myr).

  4. Innovative Model of Practice-Oriented Training of Employees of the Town-Forming Enterprise in the Mining Region (by the Example of JSC "SUEK-Kuzbass") (United States)

    Kulay, Svetlana; Kayachev, Gennady


    The article proposes to improve the system of training of employees of joint-stock company SUEK-Kuzbass in the educational institutions of the Kemerovo region according to the requirements of the company using practice-oriented training technology. The aim of the work is to substantiate the effectiveness of implementing practice-oriented training, identify priority directions and ways of its development. The main objectives of the study are: to identify the main advantages for the company and students; determine the criteria for the success and practical value of applying practice-oriented training for the company; conduct a comparative analysis of the target and practice-oriented model of training for the company. The real needs of the employer through the dual form of training were taking into account. The expansion of positive experience in training engineering personnel in higher education in technology-based training with the involvement of specialists from other regions of the company and expanding training in mining was also included.

  5. Far-infrared to Millimeter Data of Protoplanetary Disks: Dust Growth in the Taurus, Ophiuchus, and Chamaeleon I Star-forming Regions

    Energy Technology Data Exchange (ETDEWEB)

    Ribas, Álvaro; Espaillat, Catherine C.; Macías, Enrique [Department of Astronomy, Boston University, Boston, MA 02215 (United States); Bouy, Hervé [Laboratoire d’Astrophysique de Bordeaux, Univ. Bordeaux, CNRS, F-33615 Pessac (France); Andrews, Sean; Wilner, David [Harvard-Smithsonian Center for Astrophysics, Cambridge, MA 91023 (United States); Calvet, Nuria [Astronomy Department, University of Michigan, Ann Arbor, MI 48109 (United States); Naylor, David A.; Van der Wiel, Matthijs H. D. [Institute for Space Imaging Science, Department of Physics and Astronomy, University of Lethbridge (Canada); Riviere-Marichalar, Pablo, E-mail: [Instituto de Ciencia de Materiales de Madrid (CSIC). Calle Sor Juana Inés de la Cruz 3, E-28049 Cantoblanco, Madrid (Spain)


    Far-infrared and (sub)millimeter fluxes can be used to study dust in protoplanetary disks, the building blocks of planets. Here, we combine observations from the Herschel Space Observatory with ancillary data of 284 protoplanetary disks in the Taurus, Chamaeleon I, and Ophiuchus star-forming regions, covering from the optical to mm/cm wavelengths. We analyze their spectral indices as a function of wavelength and determine their (sub)millimeter slopes when possible. Most disks display observational evidence of grain growth, in agreement with previous studies. No correlation is found between other tracers of disk evolution and the millimeter spectral indices. A simple disk model is used to fit these sources, and we derive posterior distributions for the optical depth at 1.3 mm and 10 au, the disk temperature at this same radius, and the dust opacity spectral index β . We find the fluxes at 70 μ m to correlate strongly with disk temperatures at 10 au, as derived from these simple models. We find tentative evidence for spectral indices in Chamaeleon I being steeper than those of disks in Taurus/Ophiuchus, although more millimeter observations are needed to confirm this trend and identify its possible origin. Additionally, we determine the median spectral energy distribution of each region and find them to be similar across the entire wavelength range studied, possibly due to the large scatter in disk properties and morphologies.

  6. Different regions of the immunoglobulin heavy-chain locus are involved in chromosomal translocations in distinct pathogenic forms of Burkitt lymphoma

    Energy Technology Data Exchange (ETDEWEB)

    Neri, A.; Barriga, F.; Knowles, D.M.; Magrath, I.T.; Dalla-Favera, R.


    The authors show that endemic (eBL), sporadic (sBL), and acquired immunodeficiency syndrome-associated (AIDS-BL) forms of Burkitt lymphoma (BL) carrying t(8; 14) chromosomal translocations display different breakpoints within the immunoglobulin heavy-chain locus (IGH) on chromosome 14. In sBL (7 out of 11) and AIDS-BL (5 out of 6), the breakpoints occurred within or near the IGH switch (S/sub mu/) region on chromosome 14 and within the c-myc locus (MYC) on chromosome 8. In most eBL (13 out of 16) the breakpoints were mapped within or 5' to the IGH joining J/sub H/ region on chromosome 14 and outside the MYC locus on chromosome 8. Cloning and sequencing of the (8; 14) chromosomal junctions from two eBL cell lines and one eBL biopsy sample show that the recombination do not involve IGH-specific recombination signals on chromosome 14 or homologous sequences on chromosome 8, suggesting that these events are not likely to be mediated by the same mechanisms or enzymes as in IGH rearrangements. In general, these data have implications for the timing of occurrence of chromosomal translocations during B-cell differentiation in different BL types.

  7. A new crystal form of human tear lipocalin reveals high flexibility in the loop region and induced fit in the ligand cavity

    International Nuclear Information System (INIS)

    Breustedt, Daniel A.; Chatwell, Lorenz; Skerra, Arne


    The crystal structure of tear lipocalin determined in space group P2 1 revealed large structural deviations from the previously solved X-ray structure in space group C2, especially in the loop region and adjoining parts of the β-barrel which give rise to the ligand-binding site. These findings illustrate a novel mechanism for promiscuity in ligand recognition by the lipocalin protein family. Tear lipocalin (TLC) with the bound artificial ligand 1,4-butanediol has been crystallized in space group P2 1 with four protein molecules in the asymmetric unit and its X-ray structure has been solved at 2.6 Å resolution. TLC is a member of the lipocalin family that binds ligands with diverse chemical structures, such as fatty acids, phospholipids and cholesterol as well as microbial siderophores and the antibiotic rifampin. Previous X-ray structural analysis of apo TLC crystallized in space group C2 revealed a rather large bifurcated ligand pocket and a partially disordered loop region at the entrace to the cavity. Analysis of the P2 1 crystal form uncovered major conformational changes (i) in β-strands B, C and D, (ii) in loops 1, 2 and 4 at the open end of the β-barrel and (iii) in the extended C-terminal segment, which is attached to the β-barrel via a disulfide bridge. The structural comparison indicates high conformational plasticity of the loop region as well as of deeper parts of the ligand pocket, thus allowing adaptation to ligands that differ vastly in size and shape. This illustrates a mechanism for promiscuity in ligand recognition which may also be relevant for some other physiologically important members of the lipocalin protein family

  8. Radiative transfer modelling of W33A MM1: 3-D structure and dynamics of a complex massive star forming region (United States)

    Izquierdo, Andrés F.; Galván-Madrid, Roberto; Maud, Luke T.; Hoare, Melvin G.; Johnston, Katharine G.; Keto, Eric R.; Zhang, Qizhou; de Wit, Willem-Jan


    We present a composite model and radiative transfer simulations of the massive star forming core W33A MM1. The model was tailored to reproduce the complex features observed with ALMA at ≈0.2 arcsec resolution in CH3CN and dust emission. The MM1 core is fragmented into six compact sources coexisting within ˜1000 au. In our models, three of these compact sources are better represented as disc-envelope systems around a central (proto)star, two as envelopes with a central object, and one as a pure envelope. The model of the most prominent object (Main) contains the most massive (proto)star (M⋆ ≈ 7 M⊙) and disc+envelope (Mgas ≈ 0.4 M⊙), and is the most luminous (LMain ˜ 104 L⊙). The model discs are small (a few hundred au) for all sources. The composite model shows that the elongated spiral-like feature converging to the MM1 core can be convincingly interpreted as a filamentary accretion flow that feeds the rising stellar system. The kinematics of this filament is reproduced by a parabolic trajectory with focus at the center of mass of the region. Radial collapse and fragmentation within this filament, as well as smaller filamentary flows between pairs of sources are proposed to exist. Our modelling supports an interpretation where what was once considered as a single massive star with a ˜103 au disc and envelope, is instead a forming stellar association which appears to be virialized and to form several low-mass stars per high-mass object.

  9. Cloning of regions required for contact hemolysis and entry into LLC-MK2 cells from Shigella sonnei form I plasmid: virF is a positive regulator gene for these phenotypes.


    Kato, J; Ito, K; Nakamura, A; Watanabe, H


    Two distinct regions required for both contact hemolysis and entry into LLC-MK2 cells were cloned into Escherichia coli from the Shigella sonnei form I plasmid, pSS120. The first region was cloned into an E. coli HB101 strain containing noninvasive Tn1 insertion mutants of the form I plasmid, and expression of ipa (invasion plasmid antigen) gene products was restored. The plasmid carrying the first region was then transformed into E. coli lacking the form I plasmid, and additional DNA fragmen...


    Energy Technology Data Exchange (ETDEWEB)

    Favre, Cécile; Bergin, Edwin A.; Crockett, Nathan R.; Neill, Justin L. [Department of Astronomy, University of Michigan, 500 Church Street, Ann Arbor, MI 48109 (United States); Carvajal, Miguel [Dpto. Física Aplicada, Unidad Asociada CSIC, Facultad de Ciencias Experimentales, Universidad de Huelva, E-21071 Huelva (Spain); Field, David [Department of Physics and Astronomy, University of Aarhus, Ny Munkegade 120, DK-8000 Aarhus C (Denmark); Jørgensen, Jes K.; Bisschop, Suzanne E. [Centre for Star and Planet Formation, Niels Bohr Institute, University of Copenhagen, Juliane Maries Vej 30, DK-2100 Copenhagen Ø (Denmark); Brouillet, Nathalie; Despois, Didier; Baudry, Alain [Univ. Bordeaux, LAB, UMR 5804, F-33270, Floirac (France); Kleiner, Isabelle [Laboratoire Interuniversitaire des Systèmes Atmosphériques (LISA), CNRS, UMR 7583, Université de Paris-Est et Paris Diderot, 61, Av. du Général de Gaulle, F-94010 Créteil Cedex (France); Margulès, Laurent; Huet, Thérèse R.; Demaison, Jean, E-mail:, E-mail: [Laboratoire de Physique des Lasers, Atomes et Molécules, UMR CNRS 8523, Université Lille I, F-59655 Villeneuve d' Ascq Cedex (France)


    We have surveyed a sample of massive star-forming regions located over a range of distances from the Galactic center for methyl formate, HCOOCH{sub 3}, and its isotopologues H{sup 13}COOCH{sub 3} and HCOO{sup 13}CH{sub 3}. The observations were carried out with the APEX telescope in the frequency range 283.4-287.4 GHz. Based on the APEX observations, we report tentative detections of the {sup 13}C-methyl formate isotopologue HCOO{sup 13}CH{sub 3} toward the following four massive star-forming regions: Sgr B2(N-LMH), NGC 6334 IRS 1, W51 e2, and G19.61-0.23. In addition, we have used the 1 mm ALMA science verification observations of Orion-KL and confirm the detection of the {sup 13}C-methyl formate species in Orion-KL and image its spatial distribution. Our analysis shows that the {sup 12}C/{sup 13}C isotope ratio in methyl formate toward the Orion-KL Compact Ridge and Hot Core-SW components (68.4 ± 10.1 and 71.4 ± 7.8, respectively) are, for both the {sup 13}C-methyl formate isotopologues, commensurate with the average {sup 12}C/{sup 13}C ratio of CO derived toward Orion-KL. Likewise, regarding the other sources, our results are consistent with the {sup 12}C/{sup 13}C in CO. We also report the spectroscopic characterization, which includes a complete partition function, of the complex H{sup 13}COOCH{sub 3} and HCOO{sup 13}CH{sub 3} species. New spectroscopic data for both isotopomers H{sup 13}COOCH{sub 3} and HCOO{sup 13}CH{sub 3}, presented in this study, have made it possible to measure this fundamentally important isotope ratio in a large organic molecule for the first time.

  11. Is liberal independent dental practice in danger? Assessing forms of dental practice in the European Regional Organization (ERO) zone of the FDI World Dental Federation. (United States)

    Wolf, Thomas Gerhard; Seeberger, Gerhard Konrad; Callaway, Angelika; Briseño-Marroquín, Benjamín; Rusca, Philippe; Frank, Michael; Otterbach, Ernst-Jürgen


    A trend towards increasingly new forms of dental practice has been observed in the FDI World Dental Federation. Elementary foundations such as the free dentist and therapy choice, and independent, free, self-responsible professional practice may be undermined. The current study is aimed at analyzing the general training framework, organization, and professional types of dental practice in the European Regional Organization (ERO) zone and at critically discussing selected aspects of changes in the dental profession. A questionnaire was developed by the ERO Working-Group "Liberal Dental Practice." Information about dental schools, professional organizations, dental practice regulations, and ambulatory healthcare centers was analyzed. Self-employed dental practice is the most common type of practice (51.7%). Dentists are allowed to work independently immediately after graduation (72.7%). Approximately one-third are organized as compulsory members in chambers/corporations. The density of dentists has a mean of 1,570 inhabitants per dentist. In most countries, there are no special rules for founding dental ambulatory healthcare centers. In a total of 353 universities of the ERO countries surveyed, 16,619 dentists per year were trained, with a trend toward a higher percentage of female students (63%). Despite modern forms of dental practice, the charter of the individual liberal dental profession (CED et al, 2013) should be respected and taken into account on the basis of ethical principles. The commercialization of the dental profession can be neutralized only by establishing and following well-defined ethical principles; oral healthcare quality can thus be ensured without the influence of third parties.

  12. Origin of spinel lamella and/or inclusions in olivine of harzburgite form the Pauza ultramafic rocks from the Kurdistan region, northeastern Iraq (United States)

    Mohammad, Y.; Maekawa, H.; Karim, K.


    Exsolution lamellae and octahedral inclusions of chromian spinel occur in olivine of harzburgite of the Pauza ultramafic rocks, Kurdistan region, northeastern Iraq. The lamella is up to 80μm long and up to 50 μm wide. The lamellae and octahedral inclusions of chromian spinel are distributed heterogeneously in the host olivine crystal. They are depleted in Al2O3 relative to the subhedral spinel grains in the matrix and spinel lamella in orthopyroxene. Olivine (Fo92 - 93) with spinel lamellae occurs as fine-grained crystals around orthopyroxene, whereas olivine (Fo90-91) free from spinel is found in matrix. Based on back-scattered images analyses, enrichments of both Cr # and Fe+3 in the chromian spinel lamella in olivine (replacive olivine) relative to that in adjacent orthopyroxene. As well as the compositions of chromian spinel lamellae host olivine are more Mg-rich than the matrix olivine. Furthermore the restriction of olivine with spinel lamellae and octahedral inclusions on around orthopyroxene, and the similarity of spinel lamella orientations in both olivine and adjacent orthopyroxene. This study concludes that the spinel inclusions in olivine are remnant (inherited from former orthopyroxene) spinel exsolution lamella in orthopyroxene, that has been formed in upper mantle conditions ( T = 1200 °C, P = 2.5 GPa ). Replacive olivine are formed by reaction of ascending silica poor melt and orthopyroxene in harzburgite as pressure decrease the solubility of silica-rich phase (orthopyroxene) in the system increase, therefore ascending melt dissolve pyroxene with spinel exsolution lamella and precipitate replacive olivine with spinel inclusions. We can conclude that the olivines with spinel lamella are not necessary to be original and presenting ultrahigh-pressure and/or ultra deep-mantle conditions as previously concluded. It has been formed by melting of orthopyroxene (orthopyroxene with spinel exsolution lamella = olivine with spinel lamellae and octahedral

  13. A dearth of short-period massive binaries in the young massive star forming region M 17. Evidence for a large orbital separation at birth? (United States)

    Sana, H.; Ramírez-Tannus, M. C.; de Koter, A.; Kaper, L.; Tramper, F.; Bik, A.


    Aims: The formation of massive stars remains poorly understood and little is known about their birth multiplicity properties. Here, we aim to quantitatively investigate the strikingly low radial-velocity dispersion measured for a sample of 11 massive pre- and near-main-sequence stars (σ1D= 5.6 ± 0.2 km s-1) in the very young massive star forming region M 17, in order to obtain first constraints on the multiplicity properties of young massive stellar objects. Methods: We compute the radial-velocity dispersion of synthetic populations of massive stars for various multiplicity properties and we compare the obtained σ1D distributions to the observed value. We specifically investigate two scenarios: a low binary fraction and a dearth of short-period binary systems. Results: Simulated populations with low binary fractions () or with truncated period distributions (Pcutoff > 9 months) are able to reproduce the low σ1D observed within their 68%-confidence intervals. Furthermore, parent populations with fbin > 0.42 or Pcutoff < 47 d can be rejected at the 5%-significance level. Both constraints are in stark contrast with the high binary fraction and plethora of short-period systems in few Myr-old, well characterized OB-type populations. To explain the difference in the context of the first scenario would require a variation of the outcome of the massive star formation process. In the context of the second scenario, compact binaries must form later on, and the cut-off period may be related to physical length-scales representative of the bloated pre-main-sequence stellar radii or of their accretion disks. Conclusions: If the obtained constraints for the M 17's massive-star population are representative of the multiplicity properties of massive young stellar objects, our results may provide support to a massive star formation process in which binaries are initially formed at larger separations, then harden or migrate to produce the typical (untruncated) power-law period


    Energy Technology Data Exchange (ETDEWEB)

    Wolk, Scott J.; Rice, Thomas S. [Harvard-Smithsonian Center for Astrophysics, 60 Garden Street, Cambridge, MA 02138 (United States); Aspin, Colin A. [Institute for Astronomy, University of Hawaii at Manoa, 640 North Aohoku Place, Hilo, HI 96720 (United States)


    We present a subset of the results of a three-season, 124 night, near-infrared monitoring campaign of the dark clouds Lynds 1003 and Lynds 1004 in the Cygnus OB7 star-forming region. In this paper, we focus on the field star population. Using three seasons of UKIRT J, H, and K-band observations spanning 1.5 years, we obtained high-quality photometry on 9200 stars down to J = 17 mag, with photometric uncertainty better than 0.04 mag. After excluding known disk-bearing stars we identify 149 variables-1.6% of the sample. Of these, about 60 are strictly periodic, with periods predominantly <2 days. We conclude this group is dominated by eclipsing binaries. A few stars have long period signals of between 20 and 60 days. About 25 stars have weak modulated signals, but it was not clear if these were periodic. Some of the stars in this group may be diskless young stellar objects with relatively large variability due to cool starspots. The remaining {approx}60 stars showed variations which appear to be purely stochastic.

  15. Phylogenetic relationships within the cyst-forming nematodes (Nematoda, Heteroderidae) based on analysis of sequences from the ITS regions of ribosomal DNA. (United States)

    Subbotin, S A; Vierstraete, A; De Ley, P; Rowe, J; Waeyenberge, L; Moens, M; Vanfleteren, J R


    The ITS1, ITS2, and 5.8S gene sequences of nuclear ribosomal DNA from 40 taxa of the family Heteroderidae (including the genera Afenestrata, Cactodera, Heterodera, Globodera, Punctodera, Meloidodera, Cryphodera, and Thecavermiculatus) were sequenced and analyzed. The ITS regions displayed high levels of sequence divergence within Heteroderinae and compared to outgroup taxa. Unlike recent findings in root knot nematodes, ITS sequence polymorphism does not appear to complicate phylogenetic analysis of cyst nematodes. Phylogenetic analyses with maximum-parsimony, minimum-evolution, and maximum-likelihood methods were performed with a range of computer alignments, including elision and culled alignments. All multiple alignments and phylogenetic methods yielded similar basic structure for phylogenetic relationships of Heteroderidae. The cyst-forming nematodes are represented by six main clades corresponding to morphological characters and host specialization, with certain clades assuming different positions depending on alignment procedure and/or method of phylogenetic inference. Hypotheses of monophyly of Punctoderinae and Heteroderinae are, respectively, strongly and moderately supported by the ITS data across most alignments. Close relationships were revealed between the Avenae and the Sacchari groups and between the Humuli group and the species H. salixophila within Heteroderinae. The Goettingiana group occupies a basal position within this subfamily. The validity of the genera Afenestrata and Bidera was tested and is discussed based on molecular data. We conclude that ITS sequence data are appropriate for studies of relationships within the different species groups and less so for recovery of more ancient speciations within Heteroderidae. Copyright 2001 Academic Press.


    International Nuclear Information System (INIS)

    Dzib, Sergio; Loinard, Laurent; RodrIguez, Luis F.; Mioduszewski, Amy J.; Torres, Rosa M.


    Using the Very Long Baseline Array (VLBA), we have observed the radio continuum emission from the young stellar object HW 9 in the Cepheus A star-forming region at 10 epochs between 2007 February and 2009 November. Due to its strong radio variability, the source was detected at only four of the ten epochs. From these observations, the trigonometric parallax of HW 9 was determined to be π = 1.43 ± 0.07 mas, in excellent agreement with a recent independent determination by Moscadelli et al. of the trigonometric parallax of a methanol maser associated with the nearby young stellar source HW 2 (π = 1.43 ± 0.08 mas). This concordance in results, obtained in one case from continuum and in the other from line observations, confirms the reliability of VLBA trigonometric parallax measurements. By combining the two results, we constrain the distance to Cepheus A to be 700 +31 - 28 pc, an uncertainty of 3.5%.

  17. Receptor tyrosine kinase-like orphan receptor 2 (ROR2) and Indian hedgehog regulate digit outgrowth mediated by the phalanx-forming region. (United States)

    Witte, Florian; Chan, Danny; Economides, Aris N; Mundlos, Stefan; Stricker, Sigmar


    Elongation of the digit rays resulting in the formation of a defined number of phalanges is a process poorly understood in mammals, whereas in the chicken distal mesenchymal bone morphogenetic protein (BMP) signaling in the so-called phalanx-forming region (PFR) or digit crescent (DC) seems to be involved. The human brachydactylies (BDs) are inheritable conditions characterized by variable degrees of digit shortening, thus providing an ideal model to analyze the development and elongation of phalanges. We used a mouse model for BDB1 (Ror2(W749X/W749X)) lacking middle phalanges and show that a signaling center corresponding to the chick PFR exists in the mouse, which is diminished in BDB1 mice. This resulted in a strongly impaired elongation of the digit condensations due to reduced chondrogenic commitment of undifferentiated distal mesenchymal cells. We further show that a similar BMP-based mechanism accounts for digit shortening in a mouse model for the closely related condition BDA1 (Ihh(E95K/E95K)), altogether indicating the functional significance of the PFR in mammals. Genetic interaction experiments as well as pathway analysis in BDB1 mice suggest that Indian hedgehog and WNT/beta-catenin signaling, which we show is inhibited by receptor tyrosine kinase-like orphan receptor 2 (ROR2) in distal limb mesenchyme, are acting upstream of BMP signaling in the PFR.

  18. Pen Name as a Form of a Journalist’s Self-Presentation in the Late 19th — Early 20th Centuries Russian Regional Press

    Directory of Open Access Journals (Sweden)

    Tatiana A. Gridina


    Full Text Available The article investigates into the role of pen-names in the self-presentation of a regional newspaper’s journalist, the pen name being analyzed as a kind of micro-text that models the reporter’s image according to their position within the edition’s information field, its stylistic and generic strategies of presenting information. From the onomasiological point of view, the authors distinguish between four types of journalistic pseudonyms: 1 pen names intended to present the author as an unspecified individual; 2 pseudonyms patterned after speaking names whose internal form stresses the characteristics of the journalist’s image; 3 pen names based on the culturally specific associative meaning of the motivating name — such names impose cultural and historical presuppositions governing the perception of the journalist’s image; 4 pen names with various role specializations that manifest the journalist’s inclination to ludic self-presentation. Each type corresponds to several ways of name creation. The latter include abbreviation, onymization of common nouns, different techniques of language game. The authors also establish the generalized strategies of communicational interaction between journalists and their readers: strategy of distancing, strategy of adhesion, and strategy of game interaction. The paper argues that there is correlation between the choice of an interaction strategy and the journalist’s image reflected in their pen name.


    Energy Technology Data Exchange (ETDEWEB)

    Zhang, B.; Menten, K. M.; Brunthaler, A. [Max-Plank-Institut für Radioastronomie, Auf dem Hügel 69, D-53121 Bonn (Germany); Reid, M. J.; Dame, T. M. [Harvard-Smithsonian Center for Astrophysics, 60 Garden Street, Cambridge, MA 02138 (United States); Zheng, X. W. [Department of Astronomy, Nanjing University, Nanjing 210093 (China); Xu, Y. [Purple Mountain Observatory, Chinese Academy of Sciences, Nanjing 210008 (China)


    We report trigonometric parallax measurements of 22 GHz H{sub 2}O masers in two massive star-forming regions from Very Long Baseline Array observations as part of the Bar and Spiral Structure Legacy Survey. The distances of 11.11{sup +0.79}{sub -0.69} kpc to W49N (G043.16+0.01) and 10.75{sup +0.61}{sub -0.55} kpc to G048.60+0.02 locate them in a distant section of the Perseus arm near the solar circle in the first Galactic quadrant. This allows us to locate accurately the inner portion of the Perseus arm for the first time. Combining the present results with sources measured in the outer portion of the arm in the second and third quadrants yields a global pitch angle of 9.°5 ± 1.°3 for the Perseus arm. We have found almost no H{sub 2}O maser sources in the Perseus arm for 50°

  20. A novel chromosome region maintenance 1-independent nuclear export signal of the large form of hepatitis delta antigen that is required for the viral assembly. (United States)

    Lee, C H; Chang, S C; Wu, C H; Chang, M F


    Hepatitis delta virus (HDV) is a satellite virus of hepatitis B virus, as it requires hepatitis B virus for virion production and transmission. We have previously demonstrated that sequences within the C-terminal 19-amino acid domain flanking the isoprenylation motif of the large hepatitis delta antigen (HDAg-L) are important for virion assembly. In this study, site-directed mutagenesis and immunofluorescence staining demonstrated that in the absence of hepatitis B virus surface antigen (HBsAg), the wild-type HDAg-L was localized in the nuclei of transfected COS7 cells. Nevertheless, in the presence of HBsAg, the HDAg-L became both nuclei- and cytoplasm-distributed in about half of the cells. An HDAg-L mutant with a substitution of Pro-205 to alanine could neither form HDV-like particles nor shift the subcellular localization in the presence of HBsAg. In addition, nuclear trafficking of HDAg-L in heterokaryons indicated that HDAg-L is a nucleocytoplasmic shuttling protein. A proline-rich HDAg peptide spanning amino acid residues 198 to 210, designated NES(HDAg-L), can function as a nuclear export signal (NES) in Xenopus oocytes. Pro-205 is critical for the NES function. Furthermore, assembly of HDV is insensitive to leptomycin B, indicating that the NES(HDAg-L) directs nuclear export of HDAg-L to the cytoplasm via a chromosome region maintenance 1-independent pathway.


    International Nuclear Information System (INIS)

    Dunham, Miranda K.; Evans, Neal J.; Harvey, Paul; Merello, Manuel; Rosolowsky, Erik; Cyganowski, Claudia J.; Aguirre, James; Bally, John; Battersby, Cara; Ginsburg, Adam; Glenn, Jason; Stringfellow, Guy S.; Bradley, Eric Todd; Dowell, Darren; Drosback, Meredith; Schlingman, Wayne; Shirley, Yancy L.; Walawender, Josh; Williams, Jonathan P.


    We present the 1.1 mm Bolocam Galactic Plane Survey (BGPS) observations of the Gemini OB1 molecular cloud complex, and targeted NH 3 observations of the BGPS sources. When paired with molecular spectroscopy of a dense gas tracer, millimeter observations yield physical properties such as masses, radii, mean densities, kinetic temperatures, and line widths. We detect 34 distinct BGPS sources above 5σ = 0.37 Jy beam -1 with corresponding 5σ detections in the NH 3 (1,1) transition. Eight of the objects show water maser emission (20%). We find a mean millimeter source FWHM of 1.12 pc and a mean gas kinetic temperature of 20 K for the sample of 34 BGPS sources with detections in the NH 3 (1,1) line. The observed NH 3 line widths are dominated by non-thermal motions, typically found to be a few times the thermal sound speed expected for the derived kinetic temperature. We calculate the mass for each source from the millimeter flux assuming the sources are isothermal and find a mean isothermal mass within a 120'' aperture of 230 ± 180 M sun . We find a total mass of 8400 M sun for all BGPS sources in the Gemini OB1 molecular cloud, representing 6.5% of the cloud mass. By comparing the millimeter isothermal mass to the virial mass calculated from the NH 3 line widths within a radius equal to the millimeter source size, we find a mean virial parameter (M vir /M iso ) of 1.0 ± 0.9 for the sample. We find mean values for the distributions of column densities of 1.0 x 10 22 cm -2 for H 2 , and 3.0 x 10 14 cm -2 for NH 3 , giving a mean NH 3 abundance of 3.0 x 10 -8 relative to H 2 . We find volume-averaged densities on the order of 10 3 -10 4 cm -3 . The sizes and densities suggest that in the Gem OB1 region the BGPS is detecting the clumps from which stellar clusters form, rather than smaller, higher density cores where single stars or small multiple systems form.

  2. Forming of the regional core transport network taking into account the allocation of alternative energy sources based on artificial intelligence methods




    In the modern world the alternative energy sources, which considerably depend on a region, play more and more significant role. However, the transition of regions to new energy sources lead to the change of transport and logistic network configuration. The formation of optimal core transport network today is a guarantee of the successful economic development of a region tomorrow. The present article studies the issue of advanced core transport network development in a region based on the ...

  3. Fungal specificity and selectivity for algae play a major role in determining lichen partnerships across diverse ecogeographic regions in the lichen-forming family Parmeliaceae (Ascomycota). (United States)

    Leavitt, Steven D; Kraichak, Ekaphan; Nelsen, Matthew P; Altermann, Susanne; Divakar, Pradeep K; Alors, David; Esslinger, Theodore L; Crespo, Ana; Lumbsch, Thorsten


    Microbial symbionts are instrumental to the ecological and long-term evolutionary success of their hosts, and the central role of symbiotic interactions is increasingly recognized across the vast majority of life. Lichens provide an iconic group for investigating patterns in species interactions; however, relationships among lichen symbionts are often masked by uncertain species boundaries or an inability to reliably identify symbionts. The species-rich lichen-forming fungal family Parmeliaceae provides a diverse group for assessing patterns of interactions of algal symbionts, and our study addresses patterns of lichen symbiont interactions at the largest geographic and taxonomic scales attempted to date. We analysed a total of 2356 algal internal transcribed spacer (ITS) region sequences collected from lichens representing ten mycobiont genera in Parmeliaceae, two genera in Lecanoraceae and 26 cultured Trebouxia strains. Algal ITS sequences were grouped into operational taxonomic units (OTUs); we attempted to validate the evolutionary independence of a subset of the inferred OTUs using chloroplast and mitochondrial loci. We explored the patterns of symbiont interactions in these lichens based on ecogeographic distributions and mycobiont taxonomy. We found high levels of undescribed diversity in Trebouxia, broad distributions across distinct ecoregions for many photobiont OTUs and varying levels of mycobiont selectivity and specificity towards the photobiont. Based on these results, we conclude that fungal specificity and selectivity for algal partners play a major role in determining lichen partnerships, potentially superseding ecology, at least at the ecogeographic scale investigated here. To facilitate effective communication and consistency across future studies, we propose a provisional naming system for Trebouxia photobionts and provide representative sequences for each OTU circumscribed in this study. © 2015 John Wiley & Sons Ltd.

  4. Gas and dust in the star-forming region ρ Oph A. The dust opacity exponent β and the gas-to-dust mass ratio g2d (United States)

    Liseau, R.; Larsson, B.; Lunttila, T.; Olberg, M.; Rydbeck, G.; Bergman, P.; Justtanont, K.; Olofsson, G.; de Vries, B. L.


    Aims: We aim at determining the spatial distribution of the gas and dust in star-forming regions and address their relative abundances in quantitative terms. We also examine the dust opacity exponent β for spatial and/or temporal variations. Methods: Using mapping observations of the very dense ρ Oph A core, we examined standard 1D and non-standard 3D methods to analyse data of far-infrared and submillimetre (submm) continuum radiation. The resulting dust surface density distribution can be compared to that of the gas. The latter was derived from the analysis of accompanying molecular line emission, observed with Herschel from space and with APEX from the ground. As a gas tracer we used N2H+, which is believed to be much less sensitive to freeze-out than CO and its isotopologues. Radiative transfer modelling of the N2H+ (J = 3-2) and (J = 6-5) lines with their hyperfine structure explicitly taken into account provides solutions for the spatial distribution of the column density N(H2), hence the surface density distribution of the gas. Results: The gas-to-dust mass ratio is varying across the map, with very low values in the central regions around the core SM 1. The global average, = 88, is not far from the canonical value of 100, however. In ρ Oph A, the exponent β of the power-law description for the dust opacity exhibits a clear dependence on time, with high values of 2 for the envelope-dominated emission in starless Class -1 sources to low values close to 0 for the disk-dominated emission in Class III objects. β assumes intermediate values for evolutionary classes in between. Conclusions: Since β is primarily controlled by grain size, grain growth mostly occurs in circumstellar disks. The spatial segregation of gas and dust, seen in projection toward the core centre, probably implies that, like C18O, also N2H+ is frozen onto the grains. Based on observations with APEX, which is a 12 m diameter submillimetre telescope at 5100 m altitude on Llano Chajnantor

  5. Influence of the form of the magnetic axis on the regions of stability and their variations (1963); Influence de la forme de l'axe magnetique sur les plages de stabilite et leur variation (1963)

    Energy Technology Data Exchange (ETDEWEB)

    Mercier, C; Tasso, H [Commissariat a l' Energie Atomique, Fontenay-aux-Roses (France). Centre d' Etudes Nucleaires


    We study many cases of plane and twisted magnetic axis and we show for a set of regular magnetic axis tending to racetrack limit, the stability regions tend rapidly to the racetrack stability. But, for the case at two axis apparently not very far, we find that the corresponding regions of stability may be sometimes sensibly different. (authors) [French] Nous etudions plusieurs exemples d'axes magnetiques plans et gauches et montrons que pour une suite d'axes magnetiques qui converge vers une limite du type hippodrome, les plages de stabilite convergent rapidement vers la plage limite. Mais, si on prend deux axes apparemment peu eloignes, on trouve que les plages correspondantes peuvent etre parfois sensiblement differentes. (auteurs)

  6. Forming of the regional core transport network taking into account the allocation of alternative energy sources based on artificial intelligence methods

    Directory of Open Access Journals (Sweden)



    Full Text Available In the modern world the alternative energy sources, which considerably depend on a region, play more and more significant role. However, the transition of regions to new energy sources lead to the change of transport and logistic network configuration. The formation of optimal core transport network today is a guarantee of the successful economic development of a region tomorrow. The present article studies the issue of advanced core transport network development in a region based on the experience of European and Asian countries and the opportunity to adapt the best foreign experience to Russian conditions. On the basis of artificial intelligence methods for forest industry complex of Sverdlovskaya Oblast the algorithm of problem solution of an optimal logistic infrastructure allocation is offered and some results of a regional transport network are presented. These methods allowed to solve the set task in the conditions of information uncertainty. There are suggestions on the improvement of transport and logistic network in the territory of Sverdlovskaya Oblast. Traditionally the logistics of mineral fuel plays main role in regions development. Actually it is required to develop logistic strategic plans to be able to provide different possibilities of power-supply, flexible enough to change with the population density, transport infrastructure and demographics of different regions. The problem of logistic centers allocation was studied by many authors. The approach, offered by the authors of this paper is to solve the set of tasks by applying artificial intelligence methods, such as fuzzy set theory and genetic algorithms.

  7. Effects of Long-term and Continius Horticatural Practices on Distribution of Potassium Forms and their Adsorption Properties in Urmia Region

    Directory of Open Access Journals (Sweden)

    zahra amirpour


    Full Text Available Introduction: Multiple biological and physiological processes in the plant, including carbohydrates and proteins formation, activation of 50 enzymes for energy transmission as well as reducing water losses from leaf pores, are mostly affected by the presence of potassium in the plant. In order to test this hypothesis, five soil subgroups (TypicCalcixerepts, FluventicHaploxerepts, TypicEndoaquepts, TypicHalaquepts and VerticEndoaquepts belonging 15 series of gardened and adjoining virgin soils were described and sampled. The studied soils had been influenced under horticultural practices for over five decades. Materials and Methods: The soil samples were analyzed for different K forms, K adsorption and physico- chemical properties after air drying and grinding to pass through a 2 mm-sieve. The particle-size distribution was determined by the hydrometer method (Bouyoucos, 1962. The total carbonate in the soil expressed as the calcium carbonate equivalent (CCE was determined by a rapid titration method (Nelson, 1982. Organic matter (OM was measuredby the Walkley and Black (1934 dichromate oxidation method. The pH of the soil was analyzed in 2:1 CaCl2/soil suspension using glass electrode pH meter (Crockford and Norwell, 1956 and EC was detected in a saturated extract. The cation exchange capacity (CEC was measured using sodium acetate (1 M NaOAc at pH 8.2 (Chapman, 1965. Water soluble K was extracted with deionized water (1: 5 w/v after shaking for 30 minutes on a mechanical shaker and later contents were centrifuged to separate clear extract (Jackson 1973. Exchangeable K was determined by extracting the soil with neutral normal ammonium acetate, Non-exchangeable K was estimated as the difference between boiling 1N HNO3 –K and neutral normal ammonium acetate K (Thomas 1982. Results and Discussion: The result showed that for most of the studied soils, long-terms horticultural practices decreased the amount of different K forms as a result of

  8. Measurement of the pion form factor in the time-like region for q2 values between 0.1 (GeV/c)2 and 0.18 (GeV/c)2

    International Nuclear Information System (INIS)

    Amendolia, S.R.; Badelek, B.; Bertolucci, E.; Bettoni, D.; Bizzeti, A.; Bosisio, L.; Bradaschia, C.; Dell'Orso, M.; Foa, L.; Focardi, E.; Giannetti, P.; Giazotto, A.; Giorgi, M.A.; Marrocchesi, P.S.; Menzione, A.; Ristori, L.; Scribano, A.; Tenchini, R.; Tonelli, G.; Triggiani, G.; Frank, S.G.F.; Harvey, J.; Menasce, D.; Meroni, E.; Moroni, L.; Milan Univ.


    The EM form factor of the pion has been studied in the time-like region by measuring sigma(e + e - ->π + π - ) normalization to sigma(e + e - ->μ + μ - ). Results have been obtained for q 2 down to the physical threshold. (orig.)

  9. Evaluating Form and Function of Regional Partnerships: Applying Social Network Analysis to the "Network for a Healthy California", 2001-2007 (United States)

    Gregson, Jennifer; Sowa, Marcy; Flynn, Heather Kohler


    Objective: To evaluate the partnership structure of the "Network for a Healthy California" ("Network"), a social marketing program, from 2001-2007, to determine if California's program was able to establish and maintain partnerships that (1) provided access to a local audience, (2) facilitated regional collaboration, (3)…

  10. Sequential star formation in RCW 34: A spectroscopic census of the stellar content of high-mass star-forming regions

    NARCIS (Netherlands)

    Bik, A.; Puga, E.; Waters, L.B.F.M.; Horrobin, M.; Henning, Th.; Vasyunina, T.; Beuther, H.; Linz, H.; Kaper, L.; Van Den Ancker, M.; Lenorzer, A.; Churchwell, E.; Kurtz, S.; Kouwenhoven, M. B. N.; Stolte, A.; de Koter, A.; Thi, W. F.; Comerón, F.; Waelkens, Ch


    In this paper, we present VLT/SINFONI integral field spectroscopy of RCW 34 along with Spitzer/IRAC photometry of the surroundings. RCW 34 consists of three different regions. A large bubble has been detected in the IRAC images in which a cluster of intermediate- and low-mass class II objects is

  11. The GABA[subscript A] Receptor Agonist Muscimol Induces an Age- and Region-Dependent Form of Long-Term Depression in the Mouse Striatum (United States)

    Zhang, Xiaoqun; Yao, Ning; Chergui, Karima


    Several forms of long-term depression (LTD) of glutamatergic synaptic transmission have been identified in the dorsal striatum and in the nucleus accumbens (NAc). Such experience-dependent synaptic plasticity might play important roles in reward-related learning. The GABA[subscript A] receptor agonist muscimol was recently found to trigger a…


    Energy Technology Data Exchange (ETDEWEB)

    Palau, Aina; Girart, Josep M. [Institut de Ciencies de l' Espai (CSIC-IEEC), Campus UAB-Facultat de Ciencies, Torre C5-parell 2, 08193 Bellaterra, Catalunya (Spain); Fuente, Asuncion; Alonso-Albi, Tomas [Observatorio Astronomico Nacional, P.O. Box 112, 28803 Alcala de Henares, Madrid (Spain); Fontani, Francesco; Sanchez-Monge, Alvaro [Osservatorio Astrofisico di Arcetri, INAF, Largo E. Fermi 5, 50125 Firenze (Italy); Boissier, Jeremie [Istituto di Radioastronomia, INAF, Via Gobetti 101, Bologna (Italy); Pietu, Vincent; Neri, Roberto [IRAM, 300 Rue de la piscine, 38406 Saint Martin d' Heres (France); Busquet, Gemma [Istituto di Fisica dello Spazio Interplanetario, INAF, Area di Recerca di Tor Vergata, Via Fosso Cavaliere 100, 00133 Roma (Italy); Estalella, Robert [Departament d' Astronomia i Meteorologia (IEEC-UB), Institut Ciencies Cosmos, Universitat Barcelona, Marti Franques 1, 08028 Barcelona (Spain); Zapata, Luis A. [Centro de Radioastronomia y Astrofisica, Universidad Nacional Autonoma de Mexico, P.O. Box 3-72, 58090 Morelia, Michoacan (Mexico); Zhang, Qizhou; Ho, Paul T. P. [Harvard-Smithsonian Center for Astrophysics, 60 Garden Street, Cambridge, MA 02138 (United States); Audard, Marc, E-mail: [Geneva Observatory, University of Geneva, Ch. des Maillettes 51, 1290 Versoix (Switzerland)


    Observations with the Plateau de Bure Interferometer in the most extended configuration toward two intermediate-mass star-forming regions, IRAS 22198+6336 and AFGL 5142, reveal the presence of several complex organic molecules at {approx}500 AU scales, confirming the presence of hot cores in both regions. The hot cores are not rich in CN-bearing molecules, as often seen in massive hot cores, and are mainly traced by CH{sub 3}CH{sub 2}OH, (CH{sub 2}OH){sub 2}, CH{sub 3}COCH{sub 3}, and CH{sub 3}OH, with, additionally, CH{sub 3}CHO, CH{sub 3}OD, and HCOOD for IRAS 22198+6336, and C{sub 6}H and O{sup 13}CS for AFGL 5142. The emission of complex molecules is resolved down to sizes of {approx}300 and {approx}600 AU, for IRAS 22198+6336 and AFGL 5142, respectively, and most likely is tracing protostellar disks rather than flattened envelopes or toroids as is usually found. This is especially clear for the case of IRAS 22198+6336, where we detect a velocity gradient for all the mapped molecules perpendicular to the most chemically rich outflow of the region, yielding a dynamic mass {approx}> 4 M{sub Sun }. As for AFGL 5142, the hot core emission is resolved into two elongated cores separated {approx}1800 AU. A detailed comparison of the complex molecule peaks to the new CO (2-1) data and H{sub 2}O maser data from the literature suggests also that for AFGL 5142 the complex molecules are mainly associated with disks, except for a faint and extended molecular emission found to the west, which is possibly produced in the interface between one of the outflows and the dense surrounding gas.


    International Nuclear Information System (INIS)

    Palau, Aina; Girart, Josep M.; Fuente, Asunción; Alonso-Albi, Tomás; Fontani, Francesco; Sánchez-Monge, Álvaro; Boissier, Jérémie; Piétu, Vincent; Neri, Roberto; Busquet, Gemma; Estalella, Robert; Zapata, Luis A.; Zhang, Qizhou; Ho, Paul T. P.; Audard, Marc


    Observations with the Plateau de Bure Interferometer in the most extended configuration toward two intermediate-mass star-forming regions, IRAS 22198+6336 and AFGL 5142, reveal the presence of several complex organic molecules at ∼500 AU scales, confirming the presence of hot cores in both regions. The hot cores are not rich in CN-bearing molecules, as often seen in massive hot cores, and are mainly traced by CH 3 CH 2 OH, (CH 2 OH) 2 , CH 3 COCH 3 , and CH 3 OH, with, additionally, CH 3 CHO, CH 3 OD, and HCOOD for IRAS 22198+6336, and C 6 H and O 13 CS for AFGL 5142. The emission of complex molecules is resolved down to sizes of ∼300 and ∼600 AU, for IRAS 22198+6336 and AFGL 5142, respectively, and most likely is tracing protostellar disks rather than flattened envelopes or toroids as is usually found. This is especially clear for the case of IRAS 22198+6336, where we detect a velocity gradient for all the mapped molecules perpendicular to the most chemically rich outflow of the region, yielding a dynamic mass ∼> 4 M ☉ . As for AFGL 5142, the hot core emission is resolved into two elongated cores separated ∼1800 AU. A detailed comparison of the complex molecule peaks to the new CO (2-1) data and H 2 O maser data from the literature suggests also that for AFGL 5142 the complex molecules are mainly associated with disks, except for a faint and extended molecular emission found to the west, which is possibly produced in the interface between one of the outflows and the dense surrounding gas.

  14. The Evaluation of Cone Capsule as an Alternative Hull form for Portable Tsunami Lifeboat to Support Evacuation System in the Coastal Regions and Small Islands (United States)

    Fauzan Zakki, Ahmad; Suharto; Windyandari, Aulia


    Several attempts have been made to reduce the risk of tsunami disasters such as the development of early warning systems, evacuation procedures training, coastal protection and coastal spatial planning. Although many efforts to mitigate the impact of the tsunami in Indonesia was made, no one has developed a portable disaster rescue vehicle/shelter as well as a lifeboat on ships and offshore building, which is always available when a disaster occurs. The aim of the paper is to evaluate the performance of cone capsule shaped hull form that would be used for the portable tsunami lifeboat. The investigation of the boat resistance, intact stability, and seakeeping characteristics was made. The numerical analysis results indicate that the cone capsule is reliable as an alternative hull form for the portable tsunami lifeboat.


    Directory of Open Access Journals (Sweden)

    Oksana Vladimirovna Besschetnova


    Full Text Available This paper discusses the development and functioning of foster families, one of the priority interventions for children without parental care in Russia and abroad. The paper analyzes the current official statistics on the problem of child abandonment in Russia as a whole and in the Saratov and Belgorod regions of Russia in particular. The mechanism of social adaptation of children in foster care is based on the qualitative and quantitative methods (surveys and interviews of foster parents and foster children. The author identifies obstacles to the development of social institutions in the regions and the necessity of its active implementation in domestic social practices. The study found that foster care has been successful in areas where accepted legal basis allowed the recruiting, selecting candidates for adoptive parents, and foster care maintenance are carried out by social services. In addition, in order to reduce risk factors such as the secondary abandonment of foster children it is necessarily to increase assistance from the social guardianship bodies and professionals as well as building trusting parent-child relationships that use the democratic parenting style by foster parents.DOI:

  16. (EOI) Form

    International Development Research Centre (IDRC) Digital Library (Canada)

    Dorine Odongo

    COLLABORATING TECHNICAL AGENCIES: EXPRESSION OF INTEREST FORM. • Please read the information provided about the initiative and the eligibility requirements in the Prospectus before completing this application form. • Ensure all the sections of the form are accurately completed and saved in PDF format.

  17. Modular forms

    NARCIS (Netherlands)

    Edixhoven, B.; van der Geer, G.; Moonen, B.; Edixhoven, B.; van der Geer, G.; Moonen, B.


    Modular forms are functions with an enormous amount of symmetry that play a central role in number theory, connecting it with analysis and geometry. They have played a prominent role in mathematics since the 19th century and their study continues to flourish today. Modular forms formed the

  18. Binding labour and capital: moral obligation and forms of regulation in a regional economy Ligando o trabalho e o capital: obrigação moral e formas de regulação numa economia regional

    Directory of Open Access Journals (Sweden)

    Susana Narotzky


    Full Text Available The article is a critique of models of successful economic development in Europe based on the "economic region" idea. These models stress the usefulness of embedding economic relations in the social fabric ("social capital". The ethnography reveals, however, a conflict-laden space where increased embeddedness produces increased tension within the family and the community. In this "modelic" regional economy in Southern Alicante (Spain, recent violent events have involved local actors in the shoe-wear industry, with resident Chinese entrepreneurs. I will show how this confrontation underlines the rise of local modalities of conflict that build upon the organic and culturally bounded elements of economic production that the model stresses: local homogeneity and common interest. The ethnographic evidence shows the complexity of a "regional economy" in a globalized context where appeals to the State to strengthen and enforce some regulations coexist with appeals to de-regulate other areas of the economy.Este artigo é uma crítica aos modelos de sucesso de desenvolvimento económico na Europa baseados na ideia de "região económica". Estes modelos acentuam a utilidade do encastramento das relações económicas no tecido social ("capital social". No entanto, a etnografia mostra-nos um espaço de conflito onde um crescente encastramento produz um aumento da tensão na família e na comunidade. Nesta economia regional "modelar" do sul de Alicante (Espanha, episódios recentes de violência envolveram actores locais da indústria do calçado com empresários chineses aí residentes. Mostrarei como este confronto ilustra o surgimento de modalidades locais de conflito que se exprimem na base dos elementos orgânicos e de enraizamento cultural da produção económica sublinhados pelo modelo: a homogeneidade local e o interesse comum. A investigação etnográfica mostra a complexidade da "economia regional" num contexto globalizado, onde apelos dirigidos


    International Nuclear Information System (INIS)

    Terebey, Susan; Fich, Michel; Noriega-Crespo, Alberto; Padgett, Deborah L.; Brooke, Tim; Carey, Sean; McCabe, Caer-Eve; Rebull, Luisa; Fukagawa, Misato; Audard, Marc; Evans, Neal J.; Guedel, Manuel; Hines, Dean; Huard, Tracy; Knapp, Gillian R.; Menard, Francois; Monin, Jean-Louis


    We investigate the environment of the very low luminosity object L1521F-IRS using data from the Taurus Spitzer Legacy Survey. The MIPS 160 μm image shows both extended emission from the Taurus cloud and emission from multiple cold cores over a 1 0 x 2 0 region. Analysis shows that the cloud dust temperature is 14.2 ± 0.4 K and the extinction ratio is A 160 /A K = 0.010 ± 0.001 up to A V ∼ 4 mag. We find κ 160 = 0.23 ± 0.046 cm 2 g -1 for the specific opacity of the gas-dust mixture. Therefore, for dust in the Taurus cloud we find that the 160 μm opacity is significantly higher than that measured for the diffuse interstellar medium, but not too different from dense cores, even at modest extinction values. Furthermore, the 160 μm image shows features that do not appear in the IRAS 100 μm image. We identify six regions as cold cores, i.e., colder than 14.2 K, all of which have counterparts in extinction maps or C 18 O maps. Three of the six cores contain embedded young stellar objects, which demonstrates the cores are sites of current star formation. We compare the effects of L1521F-IRS on its natal core and find there is no evidence for dust heating at 160 or 100 μm by the embedded source. From the infrared luminosity L TIR = 0.024 L sun we find L bol-int =0.034-0.046 L odot , thus confirming the source's low luminosity. Comparison of L1521F-IRS with theoretical simulations for the very early phases of star formation appears to rule out the first core collapse phase. The evolutionary state appears similar to or younger than the class 0 phase, and the estimated mass is likely to be substellar.

  20. Insulin-like growth factor II (IGF II) in human brain: regional distribution of IGF II and of higher molecular mass forms

    International Nuclear Information System (INIS)

    Haselbacher, G.K.; Schwab, M.E.; Pasi, A.; Humbel, R.E.


    Twenty-four distinct areas of human brain were analyzed for the presence of insulin-like growth factor (IGF). As reported for cerebrospinal fluid, only IGF II-like immunoreactivity, but no significant amounts of IGF I-like immunoreactivity, could be found. Upon gel permeation chromatography, two to five distinct size classes were separated on the basis of their immunoreactivity. Radioimmunoassays and a bioassay also gave results indistinguishable from those of serum IGF II. The highest amounts of IGF II-like immunoreactivity occur in the anterior pituitary. This is up to 100 times more than in most other brain regions analyzed. The higher molecular mass immunoreactive species were partially characterized. After immunoaffinity purification, the 38- and 26-kDa species are active in a bioassay. Specific IGF-binding protein activity could be shown after purification of the 38- and 26-kDa species on an IGF-affinity column. The 13-kDa species released significant amounts of 7.5-kDa material. The results are interpreted as evidence for the presence of IGF II synthesized locally in human brain

  1. Probing the End of the IMF in NGC 2024 with NIRCam on JWST: Assessing the Impact of Nebular Emission in Galactic Star Forming Regions (United States)

    Suri, Veenu; Meyer, Michael; Greenbaum, Alexandra Z.; Bell, Cameron; Beichman, Charles; Gordon, Karl D.; Greene, Thomas P.; Hodapp, K.; Horner, Scott; Johnstone, Doug; Leisenring, Jarron; Manara, Carlos; Mann, Rita; Misselt, K.; Raileanu, Roberta; Rieke, Marcia; Roellig, Thomas


    We describe observations of the embedded young cluster associated with the HII region NGC 2024 planned as part of the guaranteed time observing program for the James Webb Space Telescope with the NIRCam (Near Infrared Camera) instrument. Our goal is to obtain a census of the cluster down to 2 Jupiter masses, viewed through 10-20 magnitudes of extinction, using multi-band filter photometry, both broadband filters and intermediate band filters that are expected to be sensitive to temperature and surface gravity. The cluster contains several bright point sources as well as extended emission due to reflected light, thermal emission from warm dust, as well as nebular line emission. We first developed techniques to better understand which point sources would saturate in our target fields when viewed through several JWST NIRCam filters. Using images of the field with the WISE satellite in filters W1 and W2, as well as 2MASS (J and H) bands, we devised an algorithm that takes the K-band magnitudes of point sources in the field, and the known saturation limits of several NIRCam filters to estimate the impact of the extended emission on survey sensitivity. We provide an overview of our anticipated results, detecting the low mass end of the IMF as well as planetary mass objects likely liberated through dynamical interactions.

  2. Floodplain inundation response to climate, valley form, and flow regulation on a gravel-bed river in a Mediterranean-climate region (United States)

    Cienciala, P.; Pasternack, G. B.


    Floodplain inundation regime defines hydrological connectivity between river channel and floodplain and thus strongly controls structure and function of these highly diverse and productive ecosystems. We combined an extensive LiDAR data set on topography and vegetation, long-term hydrological records, as well as the outputs of hydrological and two-dimensional hydraulic models to examine how floodplain inundation regimes in a dynamic, regulated, gravel-cobble river in a Mediterranean-climate region are controlled by reach-scale valley morphology, hydroclimatic conditions, and flow regulation. Estimated relative differences in the extent, duration, and cumulative duration of inundation events were often as large as an order of magnitude and generally greatest for large and long duration events. The relative impact of flow regulation was greatest under dry hydroclimatic conditions. Although the effects of hydroclimate and flow impairment are larger than that of valley floor topography, the latter controls sensitivity of floodplain hydroperiod to flow regime changes and should not be ignored. These quantitative estimates of the relative importance of factors that control floodplain processes in Mediterranean, semiarid rivers contributes to better understanding of hydrology and geomorphology of this important class of channels. We also discuss implications of our findings for processes that shape floodplain habitat for riparian vegetation and salmonid fish, especially in the context of ecological restoration.

  3. Constraining the Molecular Complexity in the Interstellar Medium—The Formation of Ethyl Methyl Ether (CH3OCH2CH3) in Star-forming Regions (United States)

    Bergantini, Alexandre; Frigge, Robert; Kaiser, Ralf I.


    We report the first confirmed synthesis of ethyl methyl ether (EME, CH3CH2OCH3) within astrophysical model ices containing water (H2O) and methane (CH4) exposed to ionizing radiation at ultra-low temperatures of 5 K. EME (also known as methoxyethane), was recently observed toward Orion KL and currently is the largest confirmed oxygen-bearing molecule found in the interstellar medium. Exploiting isomer-selective photoionization (PI) of the subliming molecules in the temperature-programmed desorption phase at 10.49, 9.92, and 9.70 eV, coupled with reflectron time-of-flight mass spectrometry and isotopic substitution experiments (H2 18O–CH4), the detection of fragment ions of EME at m/z = 45 (C2H5O+) and m/z = 59 (C3H7O+), and probing the proton transfer in subliming ethanol–EME complexes via m/z = 61 (C3H9O+), the present study reveals that EME can be formed from suprathermal reactions initiated by cosmic rays and secondary electrons generated within astrophysical ices. The detection of EME in our experiments represents a significant advance in the understanding of formation pathways of complex organic molecules present in hot cores and helps to constrain astrochemical models on the formation of such species within molecular clouds.

  4. Herschel HIFI GOT C+ Survey: CII, HI, and CO Emissions in a Sample of Transition Clouds and Star-Forming regions in the Inner Galaxy (United States)

    Pineda, Jorge; Velusamy, Thangasamy; Langer, William D.; Goldsmith, Paul; Li, Di; Yorke, Harold

    The GOT C+ a HIFI Herschel Key Project, studies the diffuse ISM throughout the Galactic Plane, using C+ as cloud tracer. The C+ line at 1.9 THz traces a so-far poorly studied stage in ISM cloud evolution -the transitional clouds going from atomic HI to molecular H2. This transition cloud phase, which is difficult to observe in HI and CO alone, may be best characterized via CII emission or absorption. The C+ line is also an excellent tracer of the warm diffuse gas and the warm, dense gas in the Photon Dominated Regions (PDRs). We can, therefore, use the CII emission as a probe to understand the effects of star formation on their interstellar environment. We present our first results on the transition between dense and hot gas (traced by CII) and dense and cold gas (traced by 12CO and 13CO) along a few representative lines of sight in the inner Galaxy from longitude 325 degrees to 25 degrees, taken during the HIFI Priority Science Phase. Comparisons of the high spectral resolution ( 1 km/s) HIFI data on C+ with HI, 12CO, and 13CO spectra allow us to separate out the different ISM components along each line of sight. Our results provide detailed information about the transition of diffuse atomic to molecular gas clouds needed to understand star formation and the lifecycle of the interstellar gas. These observations are being carried out with the Herschel Space Observatory, which is an ESA cornerstone mission, with contributions from NASA. This research was conducted at the Jet Propulsion Laboratory, California Institute of Technology under contract with the National Aeronautics and Space Administration. JLP was supported under the NASA Postdoctoral Program at JPL, Caltech, administered by Oak Ridge Associated Universities through a contract with NASA, and is currently supported as a Caltech-JPL Postdoctoral associate.

  5. Exploring the role of cognitive and structural forms of social capital in HIV/AIDS trends in the Kagera region of Tanzania - a grounded theory study. (United States)

    Frumence, Gasto; Eriksson, Malin; Nystrom, Lennarth; Killewo, Japhet; Emmelin, Maria


    The article presents a synthesis of data from three village case studies focusing on how structural and cognitive social capital may have influenced the progression of the HIV epidemic in the Kagera region of Tanzania. Grounded theory was used to develop a theoretical model describing the possible links between structural and cognitive social capital and the impact on sexual health behaviours. Focus group discussions and key informant interviews were carried out to represent the range of experiences of existing social capital. Both structural and cognitive social capital were active avenues for community members to come together, empower each other, and develop norms, values, trust and reciprocal relations. This empowerment created an enabling environment in which members could adopt protective behaviours against HIV infection. On the one hand, we observed that involvement in formal and informal organisations resulted in a reduction of numbers of sexual partners, led people to demand abstinence from sexual relations until marriage, caused fewer opportunities for casual sex, and gave individuals the agency to demand the use of condoms. On the other hand, strict membership rules and regulations excluded some members, particularly excessive alcohol drinkers and debtors, from becoming members of the social groups, which increased their vulnerability in terms of exposure to HIV. Social gatherings (especially those organised during the night) were also found to increase youths' risk of HIV infection through instances of unsafe sex. We conclude that even though social capital may at times have negative effects on individuals' HIV-prevention efforts, this study provides initial evidence that social capital is largely protective through empowering vulnerable groups such as women and the poor to protect against HIV infection and by promoting protective sexual behaviours.


    Energy Technology Data Exchange (ETDEWEB)

    Torres, Rosa M.; Franco-Hernandez, Ramiro; Vlemmings, Wouter H. T. [Argelander-Institut fuer Astronomie, Universitaet Bonn, Auf dem Huegel 71, D-53121 Bonn (Germany); Loinard, Laurent [Max-Planck-Institut fuer Radioastronomie, Auf dem Huegel 69, D-53121 Bonn (Germany); Mioduszewski, Amy J. [Dominici Science Operations Center, National Radio Astronomy Observatory, 1003 Lopezville Road, Socorro, NM 87801 (United States); Boden, Andrew F. [Division of Physics, Math, and Astronomy, California Institute of Technology, 1200 East California Boulevard, Pasadena, CA 91125 (United States); Rodriguez, Luis F., E-mail: [Centro de Radiostronomia y Astrofisica, Universidad Nacional Autonoma de Mexico, Apartado Postal 72-3 (Xangari), 58089 Morelia, Michoacan (Mexico)


    We present multi-epoch Very Long Baseline Array (VLBA) observations of V773 Tau A, the 51 day binary subsystem in the multiple young stellar system V773 Tau. Combined with previous interferometric and radial velocity measurements, these new data enable us to improve the characterization of the physical orbit of the A subsystem. In particular, we infer updated dynamical masses for the primary and the secondary components of 1.55 {+-} 0.11 M{sub Sun} and 1.293 {+-} 0.068 M{sub Sun }, respectively, and an updated orbital parallax distance to the system of 135.7 {+-} 3.2 pc, all consistent with previous estimates. Using the improved orbit, we can calculate the absolute coordinates of the barycenter of V773 Tau A at each epoch of our VLBA observations, and fit for its trigonometric parallax and proper motion. This provides a direct measurement of the distance to the system almost entirely independent of the orbit modeling. The best fit yields a distance of 129.9 {+-} 3.2 pc, in good agreement (i.e., within 1{sigma}) with the distance estimate based on the orbital fit. Taking the mean value of the orbital and trigonometric parallaxes, we conclude that V773 Tau is located at d = 132.8 {+-} 2.3 pc. The accuracy of this determination is nearly one order of magnitude better than that of previous estimates. In projection, V773 Tau and two other young stars (Hubble 4 and HDE 283572) recently observed with the VLBA are located toward the dark cloud Lynds 1495, in the central region of Taurus. These three stars appear to have similar trigonometric parallaxes, radial velocities, and proper motions, and we argue that the weighted mean and dispersion of their distances (d = 131.4 pc and {sigma}{sub d} = 2.4 pc) provide a good estimate of the distance to and depth of Lynds 1495 and its associated stellar population. The radio emission from the two sources in V773 Tau A is largely of gyrosynchrotron origin. Interestingly, both sources are observed to become typically five times

  7. Regionalism, Regionalization and Regional Development

    Directory of Open Access Journals (Sweden)

    Liviu C. Andrei


    Full Text Available Sustained development is a concept associating other concepts, in its turn, in the EU practice, e.g. regionalism, regionalizing and afferent policies, here including structural policies. This below text, dedicated to integration concepts, will limit on the other hand to regionalizing, otherwise an aspect typical to Europe and to the EU. On the other hand, two aspects come up to strengthen this field of ideas, i.e. the region (al-regionalism-(regional development triplet has either its own history or precise individual outline of terms.

  8. Characterizing filaments in regions of high-mass star formation: High-resolution submilimeter imaging of the massive star-forming complex NGC 6334 with ArTéMiS (United States)

    André, Ph.; Revéret, V.; Könyves, V.; Arzoumanian, D.; Tigé, J.; Gallais, P.; Roussel, H.; Le Pennec, J.; Rodriguez, L.; Doumayrou, E.; Dubreuil, D.; Lortholary, M.; Martignac, J.; Talvard, M.; Delisle, C.; Visticot, F.; Dumaye, L.; De Breuck, C.; Shimajiri, Y.; Motte, F.; Bontemps, S.; Hennemann, M.; Zavagno, A.; Russeil, D.; Schneider, N.; Palmeirim, P.; Peretto, N.; Hill, T.; Minier, V.; Roy, A.; Rygl, K. L. J.


    Context. Herschel observations of nearby molecular clouds suggest that interstellar filaments and prestellar cores represent two fundamental steps in the star formation process. The observations support a picture of low-mass star formation according to which filaments of ~0.1 pc width form first in the cold interstellar medium, probably as a result of large-scale compression of interstellar matter by supersonic turbulent flows, and then prestellar cores arise from gravitational fragmentation of the densest filaments. Whether this scenario also applies to regions of high-mass star formation is an open question, in part because the resolution of Herschel is insufficient to resolve the inner width of filaments in the nearest regions of massive star formation. Aims: In an effort to characterize the inner width of filaments in high-mass star-forming regions, we imaged the central part of the NGC 6334 complex at a resolution higher by a factor of >3 than Herschel at 350 μm. Methods: We used the large-format bolometer camera ArTéMiS on the APEX telescope and combined the high-resolution ArTéMiS data at 350 μm with Herschel/HOBYS data at 70-500 μm to ensure good sensitivity to a broad range of spatial scales. This allowed us to study the structure of the main narrow filament of the complex with a resolution of 8″ or Radioastronomie, the European Southern Observatory, and the Onsala Space Observatory.The final ArTéMiS+SPIRE 350 μm map (Fig. 1b) is available at the CDS via anonymous ftp to ( or via

  9. Further studies of the role of dense molecular clouds around outflow sources

    International Nuclear Information System (INIS)

    Verdes-Montenegro, L.; Torrelles, J.M.; Rodriguez, L.F.; Anglada, G.; Lopez, R.


    The (J,K) = (1,1) and (2,2) ammonia inversion transitions toward six regions with active star formation and evidence of gas outflows have been observed. Ammonia emission has been detected and mapped in five of these regions: AFGL 5142, AFGL 5157, AFGL 6366S, HHL 73, and S140N. NH3 (2,2) emission was detected toward the peak of the NH3 (1,1) core of AFGL 5157 and S140N. A rotational temperature of T(R) (2,2;1,1) = about 16 K was estimated for the two regions. Two new H2O masers of intense emission, S(nu) greater or equal 40 Jy, were detected toward the ammonia cores of AFGL 5142 and AFGL 5157. It is clear that the dense NH3 gas is closely associated with the star formation activities, since the ammonia cores in all peak close to the centers of activity. In particular, the AFGL 5157 ammonia condensation coincides with the geometrical center of a bipolar molecular outflow, suggesting that the exciting source is embedded in the ammonia core. In contrast, the molecular outflow in the AFGL 6366S region is located at the southeast edge of the NH3 condensation, suggesting that the exciting source is outside the ammonia core and that the morphology of the outflow may be influenced by the interaction with the dense ambient gas. 52 refs

  10. A Pan-STARRS1 Proper-Motion Survey for Young Brown Dwarfs in the Nearest Star-Forming Regions and a Reddening-Free Classification Method for Ultracool Dwarfs (United States)

    Zhang, Zhoujian; Liu, Michael C.; Best, William M. J.; Magnier, Eugene; Aller, Kimberly


    Young brown dwarfs are of prime importance to investigate the universality of the initial mass function (IMF). Based on photometry and proper motions from the Pan-STARRS1 (PS1) 3π survey, we are conducting the widest and deepest brown dwarf survey in the nearby star-forming regions, Taurus–Auriga (Taurus) and Upper Scorpius (USco). Our work is the first to measure proper motions, a robust proxy of membership, for brown dwarf candidates in Taurus and USco over such a large area and long time baseline (≈ 15 year) with such high precision (≈ 4 mas yr-1). Since extinction complicates spectral classification, we have developed a new approach to quantitatively determine reddening-free spectral types, extinctions, and gravity classifications for mid-M to late-L ultracool dwarfs (≈ 100–5 MJup), using low-resolution near-infrared spectra. So far, our IRTF/SpeX spectroscopic follow-up has increased the substellar and planetary-mass census of Taurus by ≈ 50% and almost doubled the substellar census of USco, constituting the largest single increases of brown dwarfs and free-floating planets found in both regions to date. Most notably, our new discoveries reveal an older (> 10 Myr) low-mass population in Taurus, in accord with recent studies of the higher-mass stellar members. In addition, the mass function appears to differ between the younger and older Taurus populations, possibly due to incompleteness of the older stellar members or different star formation processes. Upon completion, our survey will establish the most complete substellar and planetary-mass census in both Taurus and USco associations, make a significant addition to the low-mass IMF in both regions, and deliver more comprehensive pictures of star formation histories.

  11. Molecular clouds toward three Spitzer bubbles S116, S117, and S118: Evidence for a cloud-cloud collision which formed the three H II regions and a 10 pc scale molecular cavity (United States)

    Fukui, Yasuo; Ohama, Akio; Kohno, Mikito; Torii, Kazufumi; Fujita, Shinji; Hattori, Yusuke; Nishimura, Atsushi; Yamamoto, Hiroaki; Tachihara, Kengo


    We carried out a molecular-line study toward the three Spitzer bubbles S116, S117, and S118, which show active formation of high-mass stars. We found molecular gas consisting of two components with a velocity difference of ˜5 km s-1. One of them, the small cloud, has a typical velocity of -63 km s-1 and the other, the large cloud, has one of -58 km s-1. The large cloud has a nearly circular intensity depression, the size of which is similar to that of the small cloud. We present an interpretation that its cavity was created by a collision between the two clouds and that this collision compressed the gas into a dense layer elongating along the western rim of the small cloud. In this scenario, the O stars including those in the three Spitzer bubbles were formed in the interface layer compressed by the collision. Assuming that the relative motion of the clouds has a tilt of 45° to the line of sight, we estimate that the collision continued for the last 1 Myr at a relative velocity of ˜10 km s-1. In the S116-S117-S118 system the H II regions are located outside of the cavity. This morphology is ascribed to the density-bound distribution of the large cloud which caused the H II regions to expand more easily toward the outer part of the large cloud than towards the inside of the cavity. The present case proves that a cloud-cloud collision creates a cavity without the action of O-star feedback, and suggests that the collision-compressed layer is highly filamentary.

  12. Contributor Form

    Directory of Open Access Journals (Sweden)

    Chief Editor


    to produce preprints or reprints and translate into languages other than English for sale or free distribution; and 4 the right to republish the work in a collection of articles in any other mechanical or electronic format. We give the rights to the corresponding author to make necessary changes as per the request of the journal, do the rest of the correspondence on our behalf and he/she will act as the guarantor for the manuscript on our behalf. All persons who have made substantial contributions to the work reported in the manuscript, but who are not contributors, are named in the Acknowledgment and have given me/us their written permission to be named. If I/we do not include an Acknowledgment that means I/we have not received substantial contributions from non-contributors and no contributor has been omitted.S NoAuthors' NamesContribution (IJCME Guidelines{1 substantial contributions to conception and design, acquisition of data, or analysis and interpretation of data; 2 drafting the article or revising it critically for important intellectual content; and 3 final approval of the version to be published. Authors should meet conditions 1, 2, and 3}.SignatureDate                              Note: All the authors are required to sign independently in this form in the sequence given above. In case an author has left the institution/country and whose whereabouts are not known, the senior author may sign on his/her behalf taking the responsibility.No addition/deletion/ or any change in the sequence of the authorship will be permissible at a later stage, without valid reasons and permission of the Editor.If the authorship is contested at any stage, the article will be either returned or will not be processed for publication till the issue is solved.Maximum up to 4 authors for short communication and up to 6 authors for original article.

  13. Contributors Form

    Directory of Open Access Journals (Sweden)

    Chief Editor


    to produce preprints or reprints and translate into languages other than English for sale or free distribution; and 4 the right to republish the work in a collection of articles in any other mechanical or electronic format. We give the rights to the corresponding author to make necessary changes as per the request of the journal, do the rest of the correspondence on our behalf and he/she will act as the guarantor for the manuscript on our behalf. All persons who have made substantial contributions to the work reported in the manuscript, but who are not contributors, are named in the Acknowledgment and have given me/us their written permission to be named. If I/we do not include an Acknowledgment that means I/we have not received substantial contributions from non-contributors and no contributor has been omitted.S NoAuthors' NamesContribution (IJCME Guidelines{1 substantial contributions to conception and design, acquisition of data, or analysis and interpretation of data; 2 drafting the article or revising it critically for important intellectual content; and 3 final approval of the version to be published. Authors should meet conditions 1, 2, and 3}.SignatureDate                              Note: All the authors are required to sign independently in this form in the sequence given above. In case an author has left the institution/country and whose whereabouts are not known, the senior author may sign on his/her behalf taking the responsibility.No addition/deletion/ or any change in the sequence of the authorship will be permissible at a later stage, without valid reasons and permission of the Editor.If the authorship is contested at any stage, the article will be either returned or will not be processed for publication till the issue is solved.Maximum up to 4 authors for short communication and up to 6 authors for original article.


    Directory of Open Access Journals (Sweden)



    Full Text Available The article has as main field the project management, specifically, identifying the negative factors on European projects. The article assumes that there is a connection between the absorption of European funds and the maturity of the Romanian society in terms of project management. The main objective of the research is to identify the problems faced by public institutions from Centre Region in accessing European funds. The purpose of the research is to identify the causes that led to the low absorption of European funds, with devastating effects on the current economic situation. The present research is based on a preliminary analysis performed by the author on the rate of accessing European funds published in an article entitled “The current state of European funds absorption through funding programmes – measure of the Romanian performances in the project management practice”. The small degree of absorption of European funds resulting from the analysis shows a poor practice of the theory on project management. To identify the causes of this problem, a research was carried out to recognise the issues that led to this situation. The investigation included two successive surveys, the first one qualitative, exploratory type, interview-based, meant to demonstrate the qualitative aspects of the investigated phenomena and the other one, quantitative, based on a questionnaire in the form of occasional surveys. The qualitative and quantitative research methods are used in combination; this approach has become necessary especially due to the very complex reality whose trueness cannot be captured through one method. The investigation has however a highly quantitative character, the purpose of the qualitative research being to provide the prerequisites for achieving the quantitative research. The qualitative research revealed the existence of some problems faced by institutions in relation to accessing and developing projects that focus

  15. Pion form factor

    Energy Technology Data Exchange (ETDEWEB)

    Ryong Ji, C.; Pang, A.; Szczepaniak, A. [North Carolina State Univ., Raleigh, NC (United States)


    It is pointed out that the correct criterion to define the legal PQCD contribution to the exclusive processes in the lightcone perturbative expansion should be based on the large off-shellness of the lightcone energy in the intermediate states. In the lightcone perturbative QCD calculation of the pion form factor, the authors find that the legal PQCD contribution defined by the lightcone energy cut saturates in the smaller Q{sup 2} region compared to that defined by the gluon four-momentum square cut. This is due to the contribution by the highly off-energy-shell gluons in the end point regions of the phase space, indicating that the gluon four-momentum-square cut may have cut too much to define the legal PQCD.

  16. Densified waste form and method for forming (United States)

    Garino, Terry J.; Nenoff, Tina M.; Sava Gallis, Dorina Florentina


    Materials and methods of making densified waste forms for temperature sensitive waste material, such as nuclear waste, formed with low temperature processing using metallic powder that forms the matrix that encapsulates the temperature sensitive waste material. The densified waste form includes a temperature sensitive waste material in a physically densified matrix, the matrix is a compacted metallic powder. The method for forming the densified waste form includes mixing a metallic powder and a temperature sensitive waste material to form a waste form precursor. The waste form precursor is compacted with sufficient pressure to densify the waste precursor and encapsulate the temperature sensitive waste material in a physically densified matrix.

  17. Report on Research at AFGL, January 1979-December 1980. (United States)


    accuracy of’ the AAMS and muth references. A Porro prism , an optical astrono~mic measurements wvas about 2 arc cube in the main gyro test table, and an...One of these mirrors is a plane mir- procedure can be improved. The immedi- * ror, the other a retroreflecting prism . Each ate goal of tests a large tectonic signal, tions as focusing of seismic waves and which should be present in this earth- resonant responses. Two contract research

  18. A Climatological Study of the AFGL Mesonetwork. Volume 2 (United States)


    zt - .! A-w -.. -4 CU?;u ATIVE PECE :4T3: FR:.)uENcY OF EXTINCT!C,14 COSFFICI7,-.(XIO-4 t -I’H Ti5 OF DAY(G.-Ti STATION ? NIP APR 0000-0200 0300-0500...jA: 0000-0200 03oo- OSeo 0600-080f0 0900-1100 1200-1400 1500-1700 1O-2000 2100-2300 TOT CALM 10.06 7.10 3.14 S.17 2.53 .50 6.44 5.13 1-3 35.79 43.63

  19. AFGL Fiscal Year 1984 Air Force Technical Objectives Document. (United States)


    magnetic fields and environmental ions and electrons. High latitude cur- rents, particle precipitation , wave-plasma instabilities, and ionization ir...These Drograms are directed toward meeting the goals of the geodetic and gravimetri contributions to future missile error budgets established by the...turbulence, lightning, wind shear, tornadoes and heavy precipitation ; and (2) the development of techniques to predict the atmospheric transport and

  20. Conceptual Foundations of Improving the Living Standards of Territorial Community Based on the Introduction and Development of New Forms of Innovation and Investment Cooperation Between Regional Authorities and the Local Community

    Directory of Open Access Journals (Sweden)

    Popadynets, V.I.


    Full Text Available The main provisions have been formulated for elaboration, implementation and development of the regional target programs based on new methodological and financial resources and realization of sales of the most significant products of regional companies and organizations for the sustainable improvement of the local community living standards.

  1. Forming Spirals From Shadows (United States)

    Kohler, Susanna


    What causes the large-scale spiral structures found in some protoplanetary disks? Most models assume theyre created by newly-forming planets, but a new study suggests that planets might have nothing to do with it.Perturbations from Planets?In some transition disks protoplanetary disks with gaps in their inner regions weve directly imaged large-scale spiral arms. Many theories currently attribute the formation of these structures to young planets: either the direct perturbations of a planet embedded in the disk cause the spirals, or theyre indirectly caused by the orbit of a planetary body outside of the arms.Another example of spiral arms detected in a protoplanetary disk, MWC 758. [NASA/ESA/ESO/M. Benisty et al.]But what if you could get spirals without any planets? A team of scientists led by Matas Montesinos (University of Chile) have recently published a study in which they examine what happens to a shadowed protoplanetary disk.Casting Shadows with WarpsIn the teams setup, they envision a protoplanetary disk that is warped: the inner region is slightly tilted relative to the outer region. As the central star casts light out over its protoplanetary disk, this disk warping would cause some regions of the disk to be shaded in a way that isnt axially symmetric with potentially interesting implications.Montesinos and collaborators ran 2D hydrodynamics simulations to determine what happens to the motion of particles within the disk when they pass in and out of the shadowed regions. Since the shadowed regions are significantly colder than the illuminated disk, the pressure in these regions is much lower. Particles are therefore accelerated and decelerated as they pass through these regions, and the lack of axial symmetry causes spiral density waves to form in the disk as a result.Initial profile for the stellar heating rate per unit area for one of the authors simulations. The regions shadowed as a result of the disk warp subtend 0.5 radians each (shown on the left


    Directory of Open Access Journals (Sweden)

    Valentina F. Tarasova


    Full Text Available Article is devoted questions of formation of tax incomes of budgetary system of the Russian Federation. Approaches of a regional tax policy are proved by granting of tax privileges. The system of factors allowing quantitatively to estimate value of tax payments in formation own and aggregate prots of the budget is offered; approbation on an example of the budget of the Belgorod region is spent.

  3. Electromagnetic form factors of hadrons

    International Nuclear Information System (INIS)

    Zidell, V.S.


    A vector meson dominance model of the electromagnetic form factors of hadrons is developed which is based on the use of unstable particle propagators. Least-square fits are made to the proton, neutron, pion and kaon form factor data in both the space and time-like regions. A good fit to the low-energy nucleon form factor data is obtained using only rho, ω, and phi dominance, and leads to a determination of the vector meson resonance parameters in good agreement with experiment. The nucleon-vector meson coupling constants obey simple sum rules indicating that there exists no hard core contribution to the form factors within theoretical uncertainties. The prediction for the electromagnetic radii of the proton is in reasonable agreement with recent experiments. The pion and kaon charge form factors as deduced from the nucleon form factors assuming vector meson universality are compared to the data. The pion form factor agrees with the data in both the space and time-like regions. The pion charge radius is in agreement with the recent Dubna result, but the isovector P-wave pion-pion phase shift calculated from the theory disagrees with experiment. A possible contribution to the form factors from a heavy rho meson is also evaluated

  4. Harmonic Maass forms and mock modular forms

    CERN Document Server

    Bringmann, Kathrin; Ono, Ken


    Modular forms and Jacobi forms play a central role in many areas of mathematics. Over the last 10-15 years, this theory has been extended to certain non-holomorphic functions, the so-called "harmonic Maass forms". The first glimpses of this theory appeared in Ramanujan's enigmatic last letter to G. H. Hardy written from his deathbed. Ramanujan discovered functions he called "mock theta functions" which over eighty years later were recognized as pieces of harmonic Maass forms. This book contains the essential features of the theory of harmonic Maass forms and mock modular forms, together with a wide variety of applications to algebraic number theory, combinatorics, elliptic curves, mathematical physics, quantum modular forms, and representation theory.

  5. On good ETOL forms

    DEFF Research Database (Denmark)

    Skyum, Sven


    This paper continues the study of ETOL forms and good EOL forms done by Maurer, Salomaa and Wood. It is proven that binary very complete ETOL forms exist, good synchronized ETOL forms exist and that no propagating or synchronized ETOL form can be very complete.......This paper continues the study of ETOL forms and good EOL forms done by Maurer, Salomaa and Wood. It is proven that binary very complete ETOL forms exist, good synchronized ETOL forms exist and that no propagating or synchronized ETOL form can be very complete....

  6. Electroweak form factors

    International Nuclear Information System (INIS)

    Singh, S.K.


    The present status of electroweak nucleon form factors and the N - Δ transition form factors is reviewed. Particularly the determination of dipole mass M A in the axial vector form factor is discussed

  7. Les villes frontalières thaïlandaises dans la régionalisation Thai Bordertowns in the Regionalization Process: Spatial Planing and Production of New Urban Forms

    Directory of Open Access Journals (Sweden)

    Elsa Lainé


    decentralization process initiated in the 1970’s and regional cooperation are two dynamics deeply affecting the role of international borders and putting emphasize on border regions and towns, which used to be land-locked areas at the national scale. Following this idea, bordertowns have been included in governmental spatial planning and public funds have been invested since the beginning of the 1990’s in order to upgrade infrastructures in these cities. Even if Thai bordertowns differ drastically in the national urban frame, as far as demography, economy or infrastructures level are concerned, they are nowadays facing an unprecedented dynamism sustained by regional cooperation. Case studies of three towns located on economic corridors and targeted by national plans show that their spatial organization is changing: new urban centers are emerging, interactions with the areas located on the other side of the border are being reorganized and news actors, private as public, are impacting the urban landscape and functions. These modifications are creating new challenges for local authorities, as they are also likely to promote these cities at the national and regional scales.

  8. Did the Kiruna iron ores form as a result of a metasomatic or igneous process? New U-Pb and Nd data for the iron oxide apatite ores and their host rocks in the Norrbotten region of northern Sweden (United States)

    Westhues, A.; Hanchar, J. M.; Whitehouse, M. J.; Fisher, C. M.


    A number of iron deposits near Kiruna in the Norrbotten region of northern Sweden are of the iron oxide apatite (IOA) type of deposits; also referred to as Kiruna-type deposits. They are commonly considered a subgroup or end-member of iron oxide copper gold (IOCG) deposits, containing no economic grades of copper or gold. Both IOCG and IOA deposits are characterized by abundant low-Ti Fe oxides, an enrichment in REE, and intense sodium and potassium wall-rock alteration adjacent to the ores. Deposits of these types are of a great economic importance, not only for iron, but also for other elements such as rare earth elements (REE) or uranium. Kiruna, the type locality of the IOA type of mineral deposits, is the focus of this study. Despite a century-long mining history and 2500 Mt of iron ore produced in the region to date (with grades of 30 to 70 wt.% Fe), the genesis of these deposits is poorly understood: theories of a magmatic vs. a hydrothermal or metasomatic origin have been debated, and the timing of mineralization of the ores in the Norbotten region has never been directly dated. The results anticipated from this study will provide a better understanding of the nature of the IOA type of mineral deposits and their relation to IOCG deposits such as Olympic Dam in Australia. An array of geochemical methods is used in order to gain insights on the emplacement history of the host rocks, their subsequent alteration, and the ore genesis of these deposits. This includes in situ U/Pb geochronology of zircon, monazite, and titanite to constrain the timing between host rock emplacement, alteration and mineralization. Isotopic data from whole rocks and in situ at mineral scale will provide constraints on the involvement of hydrothermal fluids and their possible sources, as well as on the sources of Fe, U, and the REE. Newly obtained Sm-Nd isotopic data points to distinct source differences between host rocks, ore and alteration related samples. Preliminary in situ U

  9. Adaptive municipal electronic forms

    NARCIS (Netherlands)

    Kuiper, Pieternel; van Dijk, Elisabeth M.A.G.; Bondarouk, Tatiana; Ruel, Hubertus Johannes Maria; Guiderdoni-Jourdain, Karine; Oiry, Ewan

    Adaptation of electronic forms (e-forms) seems to be a step forward to reduce the burden for people who fill in forms. Municipalities more and more offer e-forms online that can be used by citizens to request a municipal product or service or by municipal employees to place a request on behalf of a

  10. Org Areo Boreal Forest Sources, compositions and properties of newly formed and regional organic aerosol in a boreal forest during the Biogenic Aerosol: Effects on Clouds and Climate Campaign

    Energy Technology Data Exchange (ETDEWEB)

    Thornton, Joel A [Univ. of Washington, Seattle, WA (United States)


    The major goals of this project were to make unique measurements, as part of the DOE sponsored Biogenic Aerosol Effects on Clouds and Climate (BAECC) campaign, of the volatility and molecular composition of organic aerosol, as well as gas-phase concentrations of oxygenated organic compounds that interact and affect organic aerosol. In addition, we aimed to conduct a similar set of measurements as part of a collaborative set of environmental simulation chamber experiments at PNNL, the aim of which was to simulate the atmospheric oxidation of key biogenic volatile organic compounds (BVOC) and study the associated formation and evolution of secondary organic aerosol (SOA). The target BVOC were a set of monoterpenes, isoprene, and related intermediates such as IEPOX. The ultimate goal of such measurements are to develop a more detailed mechanistic understanding of the sensitivity of SOA mass formation and lifetime to precursor and environmental conditions. Molecular composition and direct volatility measurements provide robust tracers of chemical processing and properties. As such, meeting these goals will allow for stronger constraints on the types of processes and their fundamental descriptions needed to simulate aerosol particle number and size, and cloud nucleating ability in regional and global earth system models.

  11. Violence Affected Family – Possibilities and Forms of Assistance Based on the Research of Specialist Centers of Support for Victims of Domestic Violence in the Region of Lower Silesia

    Directory of Open Access Journals (Sweden)



    Full Text Available Family has always created an indispensable environment for a man to fulfill his needs and for his development. Family makes our lives meaningful, helps to put plans into practice and to assign goals. The need for belonging to a family constitutes a value dear to all communities. In the literature of the subject there exists a general division into functional and non-functional families. One of the factors determining a family's capability is violence. It influences the quality of the offspring upbringing, family relationships and bonds. In its air social competence of parents declines and their attitude to family-related responsibilities deteriorates. The issue of domestic violence is tackles by specialists of the area of law, psychology, sociology, pedagogy and medicine, who are studying sources and methods of fighting with this phenomenon. Its social damage is so devastating that its unambiguous definition is almost impossible. In the face of a serious threat generated by domestic violence in recent years, there have been held campaigns, workshops, local and nationwide conferences to promote assistance to violence-stricken victims. Preventive schemes have also been developed to restrain violence in schools and local community. Violence affected individuals can seek help in centers founded especially for this purpose and maintained by local councils (MOPS or county councils (PCPR, as well as non-government organizations and associations. A comprehensive support for families suffering from domestic violence is provided by Emergency Intervention Centers and Specialist Centers of Support for Victims of domestic Violence. In the region of Lower Silesia there exist two institutions of such a character, one inWroclaw and the other one in Walbrzych. Their activity involves therapeutic tasks, aid and provision for victims of domestic violence


    International Nuclear Information System (INIS)

    Dzib, Sergio; Loinard, Laurent; Rodriguez, Luis F.; Mioduszewski, Amy J.; Boden, Andrew F.; Torres, Rosa M.


    Using the Very Long Base Array, we observed the young stellar object EC 95 in the Serpens cloud core at eight epochs from 2007 December to 2009 December. Two sources are detected in our field and are shown to form a tight binary system. The primary (EC 95a) is a 4-5 M sun proto-Herbig AeBe object (arguably the youngest such object known), whereas the secondary (EC 95b) is most likely a low-mass T Tauri star. Interestingly, both sources are non-thermal emitters. While T Tauri stars are expected to power a corona because they are convective while they go down the Hayashi track, intermediate-mass stars approach the main sequence on radiative tracks. Thus, they are not expected to have strong superficial magnetic fields, and should not be magnetically active. We review several mechanisms that could produce the non-thermal emission of EC 95a and argue that the observed properties of EC 95a might be most readily interpreted if it possessed a corona powered by a rotation-driven convective layer. Using our observations, we show that the trigonometric parallax of EC 95 is π = 2.41 ± 0.02 mas, corresponding to a distance of 414.9 +4.4 -4.3 pc. We argue that this implies a distance to the Serpens core of 415 ± 5 pc and a mean distance to the Serpens cloud of 415 ± 25 pc. This value is significantly larger than previous estimates (d ∼ 260 pc) based on measurements of the extinction suffered by stars in the direction of Serpens. A possible explanation for this discrepancy is that these previous observations picked out foreground dust clouds associated with the Aquila Rift system rather than Serpens itself.

  13. Against Logical Form

    Directory of Open Access Journals (Sweden)

    P N Johnson-Laird


    Full Text Available An old view in logic going back to Aristotle is that an inference is valid in virtue of its logical form. Many psychologists have adopted the same point of view about human reasoning: the first step is to recover the logical form of an inference, and the second step is to apply rules of inference that match these forms in order to prove that the conclusion follows from the premises. The present paper argues against this idea. The logical form of an inference transcends the grammatical forms of the sentences used to express it, because logical form also depends on context. Context is not readily expressed in additional premises. And the recovery of logical form leads ineluctably to the need for infinitely many axioms to capture the logical properties of relations. An alternative theory is that reasoning depends on mental models, and this theory obviates the need to recover logical form.

  14. Forms of Arthritis (United States)

    ... this page please turn Javascript on. Forms of Arthritis Past Issues / Fall 2006 Table of Contents Today, ... of Linda Saisselin Osteoarthritis (OA) — the form of arthritis typically occurring during middle or old age, this ...

  15. Forms Management Policy (United States)

    To establish EPA’s Forms Management Program; to describe the requisite roles, responsibilities, and procedures necessary for the successful management of EPA forms; and to more clearly fulfill EPA’s obligations in this regard.



    Moisã Claudia Olimpia; Moisã Claudia Olimpia


    Taking into account the suite of motivation that youth has when practicing tourism, it can be said that the youth travel takes highly diverse forms. These forms are educational tourism, volunteer programs and “work and travel”, cultural exchanges or sports tourism and adventure travel. In this article, we identified and analyzed in detail the main forms of youth travel both internationally and in Romania. We also illustrated for each form of tourism the specific tourism products targeting you...

  17. Unified form language

    DEFF Research Database (Denmark)

    Alnæs, Martin S.; Logg, Anders; Ølgaard, Kristian Breum


    We present the Unied Form Language (UFL), which is a domain-specic language for representing weak formulations of partial dierential equations with a view to numerical approximation. Features of UFL include support for variational forms and functionals, automatic dierentiation of forms and expres...... libraries to generate concrete low-level implementations. Some application examples are presented and libraries that support UFL are highlighted....

  18. Method for forming ammonia (United States)

    Kong, Peter C.; Pink, Robert J.; Zuck, Larry D.


    A method for forming ammonia is disclosed and which includes the steps of forming a plasma; providing a source of metal particles, and supplying the metal particles to the plasma to form metal nitride particles; and providing a substance, and reacting the metal nitride particles with the substance to produce ammonia, and an oxide byproduct.

  19. Mesonic Form Factors

    Energy Technology Data Exchange (ETDEWEB)

    Frederic D. R. Bonnet; Robert G. Edwards; George T. Fleming; Randal Lewis; David Richards


    We have started a program to compute the electromagnetic form factors of mesons. We discuss the techniques used to compute the pion form factor and present preliminary results computed with domain wall valence fermions on MILC asqtad lattices, as well as Wilson fermions on quenched lattices. These methods can easily be extended to rho-to-gamma-pi transition form factors.

  20. Regions Matter

    DEFF Research Database (Denmark)

    Laursen, Keld; Masciarelli, Francesca; Prencipe, Andrea


    capital at the regional level, with a large-scale data set of the innovative activities of a representative sample of 2,413 Italian manufacturing firms from 21 regions, and controlling for a large set of firm and regional characteristics, we find that being located in a region characterized by a high...

  1. Regional development and regional policy


    Šabić, Dejan; Vujadinović, Snežana


    Economic polarization is a process that is present at global, national and regional level. Economic activity is extremely spatially concentrated. Cities and developed regions use the agglomeration effect to attract labor and capital, thus achieving more favorable economic conditions than the agrarian region. Scientific research and European experiences over the past decades have contributed to the discrepancy among theorists about the causes and consequences of regional inequalities. Regional...

  2. Fiscal 1999 achievement report on regional consortium research and development project. Regional consortium on energy research in its 3rd year (Development of metal forming technology using new energy-efficient process); 1999 nendo sho energy gata shingata process ni yoru kinzoku seikei gijutsu no kaihatsu seika hokokusho. 3

    Energy Technology Data Exchange (ETDEWEB)



    An energy-efficient forming technology is developed for heat-resistant hard materials which are difficult to cut and demand much energy for their precision forming. It is hoped that a material Hv1000 in hardness if obtained will enable the manufacture of cutting tools for use under severe conditions. Under the circumstances, a material based on Fe-4.5%Mo-1.5%V-3%Cr is produced with high reproducibility, where a carbide dispersion carburization (CDC) method (vacuum carburization at 1,040 degrees C, second quenching at 800-850 degrees C, and tempering at 160 degrees C) is employed for realizing a very fine structure. This as the tip is combined with the tool, which is then tested for abrasion. As compared with the control material, it is found that the abrasion of the new material is but 33% of that of the control material. Studies are under way for a commercially acceptable constitution which will exhibit Hv1000 after heat treatment and for conditions of CDC treatment. An intermetallic compound TiAlCr, to be obtained by a process of mechanical alloying and pulse discharge sintering, is found to be superplastic. An automobile engine valve is manufactured by an extrusion process and by near-net shape forming, cutting, and grinding. In the manufacture of tungsten bonded ion gun parts by the pulse discharge sintering method, sufficiently high strength is obtained. (NEDO)

  3. Forms of Life, Forms of Reality

    Directory of Open Access Journals (Sweden)

    Piergiorgio Donatelli


    Full Text Available The article explores aspects of the notion of forms of life in the Wittgensteinian tradition especially following Iris Murdoch’s lead. On the one hand, the notion signals the hardness and inexhaustible character of reality, as the background needed in order to make sense of our lives in various ways. On the other, the hardness of reality is the object of a moral work of apprehension and deepening to the point at which its distinctive character dissolves into the family of connections we have gained for ourselves. The two movements of thought are connected and necessary.

  4. Micro metal forming

    CERN Document Server


    Micro Metal Forming, i. e. forming of parts and features with dimensions below 1 mm, is a young area of research in the wide field of metal forming technologies, expanding the limits for applying metal forming towards micro technology. The essential challenges arise from the reduced geometrical size and the increased lot size. In order to enable potential users to apply micro metal forming in production, information about the following topics are given: tribological behavior: friction between tool and work piece as well as tool wear mechanical behavior: strength and formability of the work piece material, durability of the work pieces size effects: basic description of effects occurring due to the fact, that the quantitative relation between different features changes with decreasing size process windows and limits for forming processes tool making methods numerical modeling of processes and process chains quality assurance and metrology All topics are discussed with respect to the questions relevant to micro...

  5. Gravitation and quadratic forms

    International Nuclear Information System (INIS)

    Ananth, Sudarshan; Brink, Lars; Majumdar, Sucheta; Mali, Mahendra; Shah, Nabha


    The light-cone Hamiltonians describing both pure (N=0) Yang-Mills and N=4 super Yang-Mills may be expressed as quadratic forms. Here, we show that this feature extends to theories of gravity. We demonstrate how the Hamiltonians of both pure gravity and N=8 supergravity, in four dimensions, may be written as quadratic forms. We examine the effect of residual reparametrizations on the Hamiltonian and the resulting quadratic form.

  6. Three forms of relativity

    International Nuclear Information System (INIS)

    Strel'tsov, V.N.


    The physical sense of three forms of the relativity is discussed. The first - instant from - respects in fact the traditional approach based on the concept of instant distance. The normal form corresponds the radar formulation which is based on the light or retarded distances. The front form in the special case is characterized by 'observable' variables, and the known method of k-coefficient is its obvious expression. 16 refs

  7. Neutron electromagnetic form factors

    International Nuclear Information System (INIS)

    Finn, J.M.; Madey, R.; Eden, T.; Markowitz, P.; Rutt, P.M.; Beard, K.; Anderson, B.D.; Baldwin, A.R.; Keane, D.; Manley, D.M.; Watson, J.W.; Zhang, W.M.; Kowalski, S.; Bertozzi, W.; Dodson, G.; Farkhondeh, M.; Dow, K.; Korsch, W.; Tieger, D.; Turchinetz, W.; Weinstein, L.; Gross, F.; Mougey, J.; Ulmer, P.; Whitney, R.; Reichelt, T.; Chang, C.C.; Kelly, J.J.; Payerle, T.; Cameron, J.; Ni, B.; Spraker, M.; Barkhuff, D.; Lourie, R.; Verst, S.V.; Hyde-Wright, C.; Jiang, W.-D.; Flanders, B.; Pella, P.; Arenhoevel, H.


    Nucleon form factors provide fundamental input for nuclear structure and quark models. Current knowledge of neutron form factors, particularly the electric form factor of the neutron, is insufficient to meet these needs. Developments of high-duty-factor accelerators and polarization-transfer techniques permit new experiments that promise results with small sensitivities to nuclear models. We review the current status of the field, our own work at the MIT/Bates linear accelerator, and future experimental efforts

  8. Gravitation and quadratic forms

    Energy Technology Data Exchange (ETDEWEB)

    Ananth, Sudarshan [Indian Institute of Science Education and Research,Pune 411008 (India); Brink, Lars [Department of Physics, Chalmers University of Technology,S-41296 Göteborg (Sweden); Institute of Advanced Studies and Department of Physics & Applied Physics,Nanyang Technological University,Singapore 637371 (Singapore); Majumdar, Sucheta [Indian Institute of Science Education and Research,Pune 411008 (India); Mali, Mahendra [School of Physics, Indian Institute of Science Education and Research,Thiruvananthapuram, Trivandrum 695016 (India); Shah, Nabha [Indian Institute of Science Education and Research,Pune 411008 (India)


    The light-cone Hamiltonians describing both pure (N=0) Yang-Mills and N=4 super Yang-Mills may be expressed as quadratic forms. Here, we show that this feature extends to theories of gravity. We demonstrate how the Hamiltonians of both pure gravity and N=8 supergravity, in four dimensions, may be written as quadratic forms. We examine the effect of residual reparametrizations on the Hamiltonian and the resulting quadratic form.

  9. Electronic Capitalization Asset Form - (United States)

    Department of Transportation — National Automated Capitalization Authorization Form used by ATO Engineering Services, Logistics, Accounting for the purpose of identifying and capturing FAA project...

  10. Forming of superplastic ceramics

    Energy Technology Data Exchange (ETDEWEB)

    Lesuer, D.R.; Wadsworth, J.; Nieh, T.G.


    Superplasticity in ceramics has now advanced to the stage that technologically viable superplastic deformation processing can be performed. In this paper, examples of superplastic forming and diffusion bonding of ceramic components are given. Recent work in biaxial gas-pressure forming of several ceramics is provided. These include yttria-stabilized, tetragonal zirconia (YTZP), a 20% alumina/YTZP composite, and silicon. In addition, the concurrent superplastic forming and diffusion bonding of a hybrid ceramic-metal structure are presented. These forming processes offer technological advantages of greater dimensional control and increased variety and complexity of shapes than is possible with conventional ceramic shaping technology.

  11. Cooperative Station History Forms (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — Various forms, photographs and correspondence documenting the history of Cooperative station instrumentation, location changes, inspections, and...

  12. Water in star-forming regions with Herschel (WISH)

    DEFF Research Database (Denmark)

    E. Kristensen, L.; F. van Dishoeck, E.; A. Bergin, E.


    was observed in the ground-state transition at 557 GHz with HIFI on Herschel in 29 embedded Class 0 and I protostars. Complementary far-IR and sub-mm continuum data (including PACS data from our program) are used to constrain the spectral energy distribution of each source. H2O intensities are compared...... sources, increasing from 10^-3 at 10^-1 at >10 km/s. The H2O abundance in the outer envelope is low, ~10^-10. The different H2O profile components show a clear evolutionary trend: in the Class 0 sources, emission is dominated by outflow components originating inside an infalling envelope. When the infall...

  13. The HNC/HCN ratio in star-forming regions

    International Nuclear Information System (INIS)

    Graninger, Dawn M.; Öberg, Karin I.; Herbst, Eric; Vasyunin, Anton I.


    HNC and HCN, typically used as dense gas tracers in molecular clouds, are a pair of isomers that have great potential as a temperature probe because of temperature dependent, isomer-specific formation and destruction pathways. Previous observations of the HNC/HCN abundance ratio show that the ratio decreases with increasing temperature, something that standard astrochemical models cannot reproduce. We have undertaken a detailed parameter study on which environmental characteristics and chemical reactions affect the HNC/HCN ratio and can thus contribute to the observed dependence. Using existing gas and gas-grain models updated with new reactions and reaction barriers, we find that in static models the H + HNC gas-phase reaction regulates the HNC/HCN ratio under all conditions, except for very early times. We quantitatively constrain the combinations of H abundance and H + HNC reaction barrier that can explain the observed HNC/HCN temperature dependence and discuss the implications in light of new quantum chemical calculations. In warm-up models, gas-grain chemistry contributes significantly to the predicted HNC/HCN ratio and understanding the dynamics of star formation is therefore key to model the HNC/HCN system.

  14. New Herbig-Haro objects in star-forming regions (United States)

    Reipurth, BO; Graham, J. A.


    A list of 25 new Herbig-Haro objects, HH 58 to HH 82, in the Orion molecular clouds and in southern molecular cloud complexes has been compiled. CCD images in the S II 6717, 6731 forbidden lines are presented for the objects, together with a few spectra and some IR observations. The individual objects and, when identified, their energy sources are discussed. HH 65 is located in the red lobe of the bipolar outflow associated with the highly variable reflection nebula Re 50. HH 67 is a 22-arcsec long sinusoidal jet. HH 68/69 consists of a long, linear chain of four HH knots. HH 72 emerges from a 120-solar luminosity IRAS source embedded in a Bok globule. HH 79 is the first HH object discovered in the Ophiuchus clouds. HH 80/81 in Sagittarius are among the brightest HH objects known, have complex velocities, high excitation conditions and emerge from a 6000-solar luminosity young B-star. HH 82 is associated with the bright variable star S Coronae Australis.

  15. Structural region

    Indian Academy of Sciences (India)

    First page Back Continue Last page Overview Graphics. Structural region. The two groups had 4 substitutions similar to Yawat strain. The Yawat strain had 5 unique mutations. 3 in the E2 region and 2 in the E1 region. The mutation, I702V (E2), though different from all the recent Indian and Reunion sequences was similar ...

  16. Regional planning without means - search for regional leadership

    DEFF Research Database (Denmark)

    Groth, Niels Boje; Fertner, Christian

    and stakeholders, not least due to its polycentric urban structure with several medium-sized towns. Besides the regional authority and the regions 22 municipalities, sub-regional collaboration is gaining momentum. Furthermore, different fora, councils and associations are engaging in regional issues. However......, collaboration is often focused on specific sectors or sub-regions, while the joint development of the region is left behind. The regional authority has changed its focus from planning to the provision of knowledge, suitable to kick-off joint action with regional stakeholders, while municipalities keep focus...... on their own territories, eventually in the context of one of the new sub-regional collaborations. Based on an empirical analysis of the regional interplay in Southern Denmark and results from the ESPON ReSSI project, we go through these new settings of regional collaboration in the search for new forms...

  17. Giro form reading machine (United States)

    Minh Ha, Thien; Niggeler, Dieter; Bunke, Horst; Clarinval, Jose


    Although giro forms are used by many people in daily life for money remittance in Switzerland, the processing of these forms at banks and post offices is only partly automated. We describe an ongoing project for building an automatic system that is able to recognize various items printed or written on a giro form. The system comprises three main components, namely, an automatic form feeder, a camera system, and a computer. These components are connected in such a way that the system is able to process a bunch of forms without any human interactions. We present two real applications of our system in the field of payment services, which require the reading of both machine printed and handwritten information that may appear on a giro form. One particular feature of giro forms is their flexible layout, i.e., information items are located differently from one form to another, thus requiring an additional analysis step to localize them before recognition. A commercial optical character recognition software package is used for recognition of machine-printed information, whereas handwritten information is read by our own algorithms, the details of which are presented. The system is implemented by using a client/server architecture providing a high degree of flexibility to change. Preliminary results are reported supporting our claim that the system is usable in practice.

  18. PowerForms

    DEFF Research Database (Denmark)

    Brabrand, Claus; Møller, Anders; Ricky, Mikkel


    All uses of HTML forms may benefit from validation of the specified input field values. Simple validation matches individual values against specified formats, while more advanced validation may involve interdependencies of form fields. There is currently no standard for specifying or implementing...

  19. Mastering HTML5 forms

    CERN Document Server

    Gupta, Gaurav


    This tutorial will show you how to create stylish forms, not only visually appealing, but interactive and customized, in order to gather valuable user inputs and information.Enhance your skills in building responsive and dynamic web forms using HTML5, CSS3, and related technologies. All you need is a basic understanding of HTML and PHP.

  20. Soil Forming Factors (United States)

    It! What is Soil? Chip Off the Old Block Soil Forming Factors Matters of Life and Death Underneath It All Wise Choices A World of Soils Soil Forming Factors 2 A Top to Bottom Guide 3 Making a Soil Monolith 4 Soil Orders 5 State Soil Monoliths 6 Where in the Soil World Are You? >> A Top to

  1. Method for forming materials (United States)

    Tolle, Charles R [Idaho Falls, ID; Clark, Denis E [Idaho Falls, ID; Smartt, Herschel B [Idaho Falls, ID; Miller, Karen S [Idaho Falls, ID


    A material-forming tool and a method for forming a material are described including a shank portion; a shoulder portion that releasably engages the shank portion; a pin that releasably engages the shoulder portion, wherein the pin defines a passageway; and a source of a material coupled in material flowing relation relative to the pin and wherein the material-forming tool is utilized in methodology that includes providing a first material; providing a second material, and placing the second material into contact with the first material; and locally plastically deforming the first material with the material-forming tool so as mix the first material and second material together to form a resulting material having characteristics different from the respective first and second materials.

  2. On the Formation of the C{sub 2}H{sub 6}O Isomers Ethanol (C{sub 2}H{sub 5}OH) and Dimethyl Ether (CH{sub 3}OCH{sub 3}) in Star-forming Regions

    Energy Technology Data Exchange (ETDEWEB)

    Bergantini, Alexandre; Maksyutenko, Pavlo; Kaiser, Ralf I., E-mail: [Department of Chemistry, University of Hawaii at Mānoa, Honolulu, HI 96822 (United States)


    The structural isomers ethanol (CH{sub 3}CH{sub 2}OH) and dimethyl ether (CH{sub 3}OCH{sub 3}) were detected in several low-, intermediate-, and high-mass star-forming regions, including Sgr B2, Orion, and W33A, with the relative abundance ratios of ethanol/dimethyl ether varying from about 0.03 to 3.4. Until now, no experimental data regarding the formation mechanisms and branching ratios of these two species in laboratory simulation experiments could be provided. Here, we exploit tunable photoionization reflectron time-of-flight mass spectrometry (PI-ReTOF-MS) to detect and analyze the production of complex organic molecules (COMs) resulting from the exposure of water/methane (H{sub 2}O/CH{sub 4}) ices to energetic electrons. The main goal is to understand the formation mechanisms in star-forming regions of two C{sub 2}H{sub 6}O isomers: ethanol (CH{sub 3}CH{sub 2}OH) and dimethyl ether (CH{sub 3}OCH{sub 3}). The results show that the experimental branching ratios favor the synthesis of ethanol versus dimethyl ether (31 ± 11:1). This finding diverges from the abundances observed toward most star-forming regions, suggesting that production routes on interstellar grains to form dimethyl ether might be missing; alternatively, ethanol can be overproduced in the present simulation experiments, such as via radical–radical recombination pathways involving ethyl and hydroxyl radicals. Finally, the PI-ReTOF-MS data suggest the formation of methylacetylene (C{sub 3}H{sub 4}), ketene (CH{sub 2}CO), propene (C{sub 3}H{sub 6}), vinyl alcohol (CH{sub 2}CHOH), acetaldehyde (CH{sub 3}CHO), and methyl hydroperoxide (CH{sub 3}OOH), in addition to ethane (C{sub 2}H{sub 6}), methanol (CH{sub 3}OH), and CO{sub 2} detected from infrared spectroscopy. The yield of all the confirmed species is also determined.


    Directory of Open Access Journals (Sweden)

    Ronaldo Drescher


    Full Text Available O presente trabalho foi desenvolvido com o propósito de estudar o fator de forma artificial de Pinus elliottii Engelm para a região da Serra do Sudeste do Estado do Rio Grande do Sul. Para tanto, estudou-se o desenvolvimento do fator de forma artificial em função de variáveis dendrométricas, além da confecção de tabelas de fator de forma para uso regional. Dentre os modelos estudados, o que melhor ajustou à variável dependente foi o expresso por, sendo: d o diâmetro à altura do peito, d0,5 e d0,3 os diâmetros relativos de Hohenadl, tendo apresentado um coeficiente de determinação igual a 0,89 e um coeficiente de variação de 3,59%. Os diâmetros relativos de Hohenald da equação de fator de forma foram estimados através das equações: ln(d0,5 = -0,27211 + 0,97542* ln(d e ln(d0,3 = -0,62082 + 0,26949 * ln(d² + 0,22483* ln(d*h, tendo apresentado coeficiente de determinação de 0,91 e 0,99 e coeficiente de variação 4,23 e 8,21%, respectivamente.The present research was established with the purpose of studying form factors of Pinus elliottii Engelm for the region of Serra do Sudeste, Rio Grande do Sul. Thus, the development of artificial form factors in function of dendrometrical variables were studied. Furthermore tables of form factors for regional use were established. Of the tested models, the model that best adjusted the dependent variable can be expressed as follows: being: d= diameter at breast height, d0,5 and d0,3=diameters of Hohenadl, with a coefficient of determination of 0.89 and a coefficient of variation of 3.59%. The relative diameters of Hohenald of the equation of form factor were estimated through the equations: ln(d0.5 = -0.27211 + 0.97542 * ln(d and ln(d0.3 = -0.62082 + 0.26949 * ln(d2 + 0.22483 * ln(d*h, showing a coefficient of determination of 0.91 and 0.99 and a coefficient of variation of 4.23 and 8.21%, respectively.

  4. Package materials, waste form

    International Nuclear Information System (INIS)



    The schedules for waste package development for the various host rocks were presented. The waste form subtask activities were reviewed, with the papers focusing on high-level waste, transuranic waste, and spent fuel. The following ten papers were presented: (1) Waste Package Development Approach; (2) Borosilicate Glass as a Matrix for Savannah River Plant Waste; (3) Development of Alternative High-Level Waste Forms; (4) Overview of the Transuranic Waste Management Program; (5) Assessment of the Impacts of Spent Fuel Disassembly - Alternatives on the Nuclear Waste Isolation System; (6) Reactions of Spent Fuel and Reprocessing Waste Forms with Water in the Presence of Basalt; (7) Spent Fuel Stabilizer Screening Studies; (8) Chemical Interactions of Shale Rock, Prototype Waste Forms, and Prototype Canister Metals in a Simulated Wet Repository Environment; (9) Impact of Fission Gas and Volatiles on Spent Fuel During Geologic Disposal; and (10) Spent Fuel Assembly Decay Heat Measurement and Analysis

  5. Getting in-formed

    DEFF Research Database (Denmark)

    Hansbøl, Mikala

    det vi undersøger på form gennem vores beskrivelser. Paperet tager afsæt i empiriske eksempler fra et postdoc projekt om et såkaldt 'serious game' - Mingoville. Projektet følger circuleringer og etableringer af Mingoville 'på en global markedsplads'. I paperet diskuteres hvordan vi som forskere samler....../performer de fænomener vi forsker i. Aktør-Netværks-Teoretiker Bruno Latour (2005) pointerer at enhver beskrivelse også er en form for forklaring. En form for forklaring, der putter ting ind i et skript og dermed også putter ting på form. Paperet diskuterer to tilgange til at gøre serious games og derved skabe viden om...... engagementer med disse fænomener i serious games forskning: experimentel og etnografisk....

  6. NOAA Form 370 Database (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — The data set contains information from submitted NOAA Form 370s, also known as the Fisheries Certificate of Origin, for imported shipments of frozen and/or processed...

  7. MAPS Appraisal Report Form

    CERN Multimedia

    HR Department


    As announced in Weekly Bulletin 48/2004, from now onwards, the paper MAPS appraisal report form has been replaced by an electronic form, which is available via EDH (on the EDH desktop under Other Tasks / HR & Training) No changes have been made to the contents of the form. Practical information will be available on the web page, and information meetings will be held on the following dates: 18 January 2005: MAIN AUDITORIUM (500-1-001) from 14:00 to 15:30. 20 January 2005: AB AUDITORIUM II (864-1-D02) from14:00 to 15:30. 24 January 2005: AT AUDITORIUM (30-7-018) from 10:00 to 11:30. Human Resources Department Tel. 73566

  8. VMS forms Output Tables (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — These output tables contain parsed and format validated data from the various VMS forms that are sent from any given vessel, while at sea, from the VMS devices on...

  9. Science on form

    International Nuclear Information System (INIS)

    Ishizaka, Shozo; Kato, Yoshihiro; Takaki, Ryuji; Toriwaki, Jun-ichiro


    The purpose of the Symposium was to discuss interdisciplinal science aspects of form. 'Form' depends on the material and the changes. But, it is the form that appears evident at once and endures. Form is absorbed from every field as media of information. One part of the work covers the description of non-periodic phenomena, morphogenesis or evolution. Irreducible stubborn facts as diseases or social problems, or whatever else that could not be analyzed are integrally challenged to be systematized by computer simulation. The other part covers the finding of laws for determining how systems behave. Attention should be paid to pattern recognition, image processing and pattern formation. The Symposium proceeded with no parallel sessions, and participants from various fields made exciting discussions in an interdisciplinal atmosphere. (Auth.)

  10. Access Customized Forms


    Cosma Emil; Jeflea Victor


    By using Word, Excel or PowerPoint one can automate routine operations using the VBA language (Visual Basic for Applications). This language is also used in Access, allowing access to data stored in tables or queries. Thus, Access and VBA resources can be used together. Access is designed for programming forms and reports (among other things), so there won’t be found any of the VBA editor’s specific forms.

  11. Polyphony and verb forms

    Directory of Open Access Journals (Sweden)

    Jelena Rajić


    Full Text Available This paper examines some special uses of indicative and subjunctive verb forms in Spanish, which contemporary linguistics explains using the notions of polyphony, evidentials, echoic representation, quotatives, etc. These terms, even though they refer to different characteristics and belong to different theoretical frameworks, share one common feature: they all refer to diverse linguistic forms (discourse markers, linguistic negation, quotatives, echoic utterances, etc. characterized by the presence and interaction of different voices or points of view in one discourse sequence. In this study we are interested in a description of quotative or polyphonic meanings expressed by specific verb forms and tenses, the imperfect and the conditional, and also by indicative forms in subordinate substantive clauses with a negative main verb and by subjunctive forms in subordinate concessive clauses. Our research focuses on the analysis of the linguistic conditions that make possible the evidential use of the conditional, the imperfect and the echoic (metarepresentative interpretation of indicative and subjunctive forms in the above-mentioned contexts. The examples we discuss show that evidential and echoic interpretations are inferential meanings derived from the extralinguistic situation and the knowledge that speakers have of the world.

  12. Forms of global governence

    Directory of Open Access Journals (Sweden)

    Maxim V. Kharkevich


    Full Text Available Global governance as a concept defines the meaning of contemporary world politics both as a discipline and as reality. Interdependent and globalized world requires governance, and a global government has not been formed yet. The theoretical possibility of global governance without global government is proved and justified. The purpose of this article is to analytically identify possible forms of global governance. Three such forms of global governance are identified: hierarchical, market and network. In a hierarchy the governance is due to the asymmetry of power between the parties. Market control happens via anonymous pricing mechanism. Network, in contrast to the market is characterized by a closer value link between the actors, but unlike the hierarchical relationship actors are free to leave the network. Global governance takes three forms and is being implemented by different actors. To determine the most efficient form of global governance is impossible. Efficiency depends on the match between a form and an object of government. It should be noted that meta governance is likely to remain a monopoly of institutionally strong states in global governance.

  13. Comparative waste forms study

    International Nuclear Information System (INIS)

    Wald, J.W.; Lokken, R.O.; Shade, J.W.; Rusin, J.M.


    A number of alternative process and waste form options exist for the immobilization of nuclear wastes. Although data exists on the characterization of these alternative waste forms, a straightforward comparison of product properties is difficult, due to the lack of standardized testing procedures. The characterization study described in this report involved the application of the same volatility, mechanical strength and leach tests to ten alternative waste forms, to assess product durability. Bulk property, phase analysis and microstructural examination of the simulated products, whose waste loading varied from 5% to 100% was also conducted. The specific waste forms investigated were as follows: Cold Pressed and Sintered PW-9 Calcine; Hot Pressed PW-9 Calcine; Hot Isostatic Pressed PW-9 Calcine; Cold Pressed and Sintered SPC-5B Supercalcine; Hot Isostatic pressed SPC-5B Supercalcine; Sintered PW-9 and 50% Glass Frit; Glass 76-68; Celsian Glass Ceramic; Type II Portland Cement and 10% PW-9 Calcine; and Type II Portland Cement and 10% SPC-5B Supercalcine. Bulk property data were used to calculate and compare the relative quantities of waste form volume produced at a spent fuel processing rate of 5 metric ton uranium/day. This quantity ranged from 3173 L/day (5280 Kg/day) for 10% SPC-5B supercalcine in cement to 83 L/day (294 Kg/day) for 100% calcine. Mechanical strength, volatility, and leach resistance tests provide data related to waste form durability. Glass, glass-ceramic and supercalcine ranked high in waste form durability where as the 100% PW-9 calcine ranked low. All other materials ranked between these two groupings

  14. Regional Externalities

    NARCIS (Netherlands)

    Heijman, W.J.M.


    The book offers practical and theoretical insights in regional externalities. Regional externalities are a specific subset of externalities that can be defined as externalities where space plays a dominant role. This class of externalities can be divided into three categories: (1) externalities

  15. Chemical forms of radioiodine

    International Nuclear Information System (INIS)

    Tachikawa, Enzo


    Release of radioiodine built-up during reactor operations presents a potential problem from the standpoint of environmental safety. Among the chemical forms of radioiodine, depending upon the circumstances, organic iodides cast a most serious problem because of its difficulties in the trapping and because of its stability compared to other chemical forms. Furthermore, pellet-cladding interaction (PCl) fuel failures in LWR fuel rods are believed to be stress corrosion cracks caused by embrittling fission product species, radioiodine. To deal with these problems, knowledge is required on the chemical behaviors of radioiodine in and out of fuels, as well as the release behaviors from fuels. Here a brief review is given of these respects, in aiming at clearing-up the questions still remaining unknown. The data seem to indicate that radioiodine exists as a combined form in fuels. upon heating slightly irradiated fuels, the iodine atoms are released in a chemical form associated with uranium atoms. Experiments, however, as needed with specimen of higher burnup, where the interactions of radioiodine with metallic fission products could be favored. The dominant release mechanism of radioiodine under normal operating temperatures will be diffusion to grain boundaries leading to open surfaces. Radiation-induced internal traps, however, after the rate of diffusion significantly. The carbon sources of organic iodides formed under various conditions and its formation mechanisms have also been considered. (author)

  16. Methods for forming particles (United States)

    Fox, Robert V.; Zhang, Fengyan; Rodriguez, Rene G.; Pak, Joshua J.; Sun, Chivin


    Single source precursors or pre-copolymers of single source precursors are subjected to microwave radiation to form particles of a I-III-VI.sub.2 material. Such particles may be formed in a wurtzite phase and may be converted to a chalcopyrite phase by, for example, exposure to heat. The particles in the wurtzite phase may have a substantially hexagonal shape that enables stacking into ordered layers. The particles in the wurtzite phase may be mixed with particles in the chalcopyrite phase (i.e., chalcopyrite nanoparticles) that may fill voids within the ordered layers of the particles in the wurtzite phase thus produce films with good coverage. In some embodiments, the methods are used to form layers of semiconductor materials comprising a I-III-VI.sub.2 material. Devices such as, for example, thin-film solar cells may be fabricated using such methods.

  17. Physical forms of MIPs. (United States)

    Biffis, Andrea; Dvorakova, Gita; Falcimaigne-Cordin, Aude


    The current state of the art in the development of methodologies for the preparation of MIPs in predetermined physical forms is critically reviewed, with particular attention being paid to the forms most widely employed in practical applications, such as spherical beads in the micro- to nanometer range, microgels, monoliths, membranes. Although applications of the various MIP physical forms are mentioned, the focus of the paper is mainly on the description of the various preparative methods. The aim is to provide the reader with an overview of the latest achievements in the field, as well as with a mean for critically evaluating the various proposed methodologies towards an envisaged application. The review covers the literature up to early 2010, with special emphasis on the developments of the last 10 years.

  18. Sixth form pure mathematics

    CERN Document Server

    Plumpton, C


    Sixth Form Pure Mathematics, Volume 1, Second Edition, is the first of a series of volumes on Pure Mathematics and Theoretical Mechanics for Sixth Form students whose aim is entrance into British and Commonwealth Universities or Technical Colleges. A knowledge of Pure Mathematics up to G.C.E. O-level is assumed and the subject is developed by a concentric treatment in which each new topic is used to illustrate ideas already treated. The major topics of Algebra, Calculus, Coordinate Geometry, and Trigonometry are developed together. This volume covers most of the Pure Mathematics required for t

  19. Waste-form development

    International Nuclear Information System (INIS)

    Neilson, R.M. Jr.; Colombo, P.


    Contemporary solidification agents are being investigated relative to their applications to major fuel cycle and non-fuel cycle low-level waste (LLW) streams. Work is being conducted to determine the range of conditions under which these solidification agents can be applied to specific LLW streams. These studies are directed primarily towards defining operating parameters for both improved solidification of problem wastes and solidification of new LLW streams generated from advanced volume reduction technologies. Work is being conducted to measure relevant waste form properties. These data will be compiled and evaluated to demonstrate compliance with waste form performance and shallow land burial acceptance criteria and transportation requirements

  20. Many Forms of Culture (United States)

    Cohen, Adam B.


    Psychologists interested in culture have focused primarily on East-West differences in individualism-collectivism, or independent-interdependent self-construal. As important as this dimension is, there are many other forms of culture with many dimensions of cultural variability. Selecting from among the many understudied cultures in psychology,…

  1. Inequalities for Differential Forms

    CERN Document Server

    Agarwal, Ravi P


    Presents a series of local and global estimates and inequalities for differential forms, in particular the ones that satisfy the A-harmonic equations. This work focuses on the Hardy-Littlewood, Poincare, Cacciooli, imbedded and reverse Holder inequalities. It is for researchers, instructors and graduate students

  2. Disconnected electromagnetic form factors

    International Nuclear Information System (INIS)

    Wilcox, Walter


    Preliminary results of a calculation of disconnected nucleon electromagnetic factors factors on the lattice are presented. The implementation of the numerical subtraction scheme is outlined. A comparison of results for electric and magnetic disconnected form factors on two lattice sizes with those of the Kentucky group is presented. Unlike previous results, the results found in this calculation are consistent with zero in these sectors

  3. Documentary form no. 1

    International Nuclear Information System (INIS)


    This first documentary form, edited by the national association of local commissions of information about nuclear activities (ANCLI), briefly presents the radioactivity phenomenon, the ionising radiations, the characteristics of radiation sources (activity, half life, energy), and the dosimetry (absorbed, equivalent, efficient doses). (J.S.)

  4. Metal forming and lubrication

    DEFF Research Database (Denmark)

    Bay, Niels


    Lubrication is essential in most metal forming processes. The lubricant film has two basic functions, [1]: i. to separate the work piece and tool surfaces and ii. to cool the workpiece and the tool. Separation of the two surfaces implies lower friction facilitating deformation and lowering the tool...

  5. Circle of Form

    DEFF Research Database (Denmark)

    Jaeger, Thomas Arvid


    a common professional language like in mathematics, colour and music. The result is a weaker professionalism in the aesthetic competences compared to the professionalism and competences in other areas. A research project [1] on contrasts or opposites in form investigated the phenomenon in the fields...

  6. Forms of Inattentiveness

    DEFF Research Database (Denmark)

    Knudsen, Morten


    and kept out of sight in the decision processes by looking at a specific case study involving the construction of a model intended to control, and render transparent, the quality of health services in Denmark. This paper outlines the forms of inattentiveness which make communication blind to information...

  7. Wars of Forms

    DEFF Research Database (Denmark)

    Clausen, Lars


    , both political and military, war between the two forms, the post-napoleonic, Fichtean notion of nationality (1807-8) and the historical notion of imperium. “Nationality” entered the political semantics witch such a force and shook the existing political order of empires to the ground because of its...

  8. Discover new cooperation forms

    International Nuclear Information System (INIS)



    In spite of the good forecasts concerning the supply and demand, the gas market is full of uncertainties because of the competition and the industrial reorganizing. Producers and operators try to define new forms of cooperation allowing the attainments protection and at the same time allowing to take advantage of the market opportunities with a shared risk. (A.L.B.)

  9. Personal Information Request Form

    International Development Research Centre (IDRC) Digital Library (Canada)

    PC Forms Inc. 834-4048

    To apply for information under the Privacy Act, complete this form or a written request mentioning the Act. Describe the information being sought and provide any relevant details necessary to help the. International Development Research Centre. (IDRC) find it. If you require assistance, refer to. Info Source (Sources of ...



    Markova V. D.; Trapeznikov I. S.


    The article examines tendencies of the development of new organizational forms of partnership and marks several problems of their usage in Russian conditions by the example of the Novosibirsk region. Modern forms of networking and partnership of commercial companies and universities, research institutes and other organizations, such as clusters, strategic alliances, technology platforms, business ecosystems and other, are focused on the development of new market opportunities and gaining comp...

  11. The Landform Regions of Iowa (United States)

    Iowa State University GIS Support and Research Facility — A landscape is a collection of land shapes or land forms. Landform regions are a grouping of individual landscape features that have a common geomophology. In Iowa,...

  12. Article, component, and method of forming an article (United States)

    Lacy, Benjamin Paul; Itzel, Gary Michael; Kottilingam, Srikanth Chandrudu; Dutta, Sandip; Schick, David Edward


    An article and method of forming an article are provided. The article includes a body portion separating an inner region and an outer region, an aperture in the body portion, the aperture fluidly connecting the inner region to the outer region, and a conduit extending from an outer surface of the body portion at the aperture and being arranged and disposed to controllably direct fluid from the inner region to the outer region. The method includes providing a body portion separating an inner region and an outer region, providing an aperture in the body portion, and forming a conduit over the aperture, the conduit extending from an outer surface of the body portion and being arranged and disposed to controllably direct fluid from the inner region to the outer region. The article is arranged and disposed for insertion within a hot gas path component.

  13. Electromagnetic form factors

    International Nuclear Information System (INIS)

    Desplanques, B.


    Electromagnetic form factors, in first approximation, are sensitive to spatial distribution of nucleons and to their current. In second approximation, more precise effects are concerned, whose role is increasing with momentum transfer and participating essentially of short range nuclei description. They concern of course the nucleon-nucleon interaction while approaching each other and keeping their free-state identity, but also mutually polarizing one the other. In this last effect, radial and orbital excitations of nucleon, the nucleon mesonic cloud modification and the nucleon antinucleon pair excitation are included. In this paper, these contributions are discussed while trying to find the important elements for a good description of form factors. Current questions are also discussed. Light nuclei are essentially concerned [fr

  14. Waste form development

    International Nuclear Information System (INIS)

    Neilson, R.M. Jr.; Colombo, P.


    In this program, contemporary solidification agents are being investigated relative to their applications to major fuel cycle and non-fuel cycle low-level waste (LLW) streams. Work is being conducted to determine the range of conditions under which these solidification agents can be applied to specific LLW streams. These studies are directed primarily towards defining operating parameters for both improved solidification of problem wastes and solidification of new LLW streams generated from advanced volume reduction technologies. Work is being conducted to measure relevant waste form properties. These data will be compiled and evaluated to demonstrate compliance with waste form performance and shallow land burial acceptance criteria and transportation requirements (both as they exist and as they are modified with time). 6 tables

  15. GRACE with FORM

    International Nuclear Information System (INIS)

    Fujimoto, J.; Ishikawa, T.; Kato, K.; Kaneko, T.; Nakazawa, N..; Shimizu, Y.; Vermaseren, J.; Yasui, Y.


    A new version of GRACE/1-loop, a system for the automatic calculation of 1-loop Feynman diagrams, has been developed after the replacement of its symbolic manipulation engine from REDUCE to FORM. This enables us the efficient memory management that is essential for the handling of a tremendous number of Feynman diagrams, so that the performance of GRACE/1-loop is significantly improved as demonstrated in the text

  16. Differential forms of supermanifolds

    International Nuclear Information System (INIS)

    Beresin, P.A.


    The theory of differential and pseUdo-differential forms on supermanifolds is constructed. The definition and notations of superanalogy of the Pontryagin and Chern characteristic classes are given. The theory considered is purely local. The scheme suggested here generalizes the so-called Weil homomorphism for superspace which lays on the basis of the Chern and Potryagin characteristic class theory. The theory can be extended to the global supermanifolds

  17. Forms of Life

    Directory of Open Access Journals (Sweden)

    Peter Hacker


    Full Text Available The phrase ‘Lebensform’ (form of life had a long and varied history prior to Wittgenstein’s use of it on a mere three occasions in the Philosophical Investigations. It is not a pivotal concept in Wittgenstein’s philosophy. But it is a minor signpost of a major reorientation of philosophy, philosophy of language and logic, and philosophy of mathematics that Wittgenstein instigated. For Wittgenstein sought to replace the conception of a language as a meaning calculus (Frege, Russell, the Tractatus by an anthropological or ethnological conception. A language is not a class of sentences that can be formed from a set of axioms (definitions, formation and transformation rules and the meanings of which is given by their truth-conditions, but an open-ended series of interlocking language-games constituting a form of life or way of living (a culture. Wittgenstein’s uses of ‘Lebensform’ and its cognates, both in the Investigations and in his Nachlass are severally analysed, and various exegetical misinterpretations are clarified.

  18. Form finding in elastic gridshells (United States)

    Baek, Changyeob; Sageman-Furnas, Andrew O.; Jawed, Mohammad K.; Reis, Pedro M.


    Elastic gridshells comprise an initially planar network of elastic rods that are actuated into a shell-like structure by loading their extremities. The resulting actuated form derives from the elastic buckling of the rods subjected to inextensibility. We study elastic gridshells with a focus on the rational design of the final shapes. Our precision desktop experiments exhibit complex geometries, even from seemingly simple initial configurations and actuation processes. The numerical simulations capture this nonintuitive behavior with excellent quantitative agreement, allowing for an exploration of parameter space that reveals multistable states. We then turn to the theory of smooth Chebyshev nets to address the inverse design of hemispherical elastic gridshells. The results suggest that rod inextensibility, not elastic response, dictates the zeroth-order shape of an actuated elastic gridshell. As it turns out, this is the shape of a common household strainer. Therefore, the geometry of Chebyshev nets can be further used to understand elastic gridshells. In particular, we introduce a way to quantify the intrinsic shape of the empty, but enclosed regions, which we then use to rationalize the nonlocal deformation of elastic gridshells to point loading. This justifies the observed difficulty in form finding. Nevertheless, we close with an exploration of concatenating multiple elastic gridshell building blocks.

  19. Parametric form of QCD travelling waves


    Peschanski, R.


    We derive parametric travelling-wave solutions of non-linear QCD equations. They describe the evolution towards saturation in the geometric scaling region. The method, based on an expansion in the inverse of the wave velocity, leads to a solvable hierarchy of differential equations. A universal parametric form of travelling waves emerges from the first two orders of the expansion.

  20. Fra tanke til form

    DEFF Research Database (Denmark)

    Der er gået 20 år siden Aalborg og Nordjylland i 1997 fik sin egen, unikke civilingeniøruddannelse i form af Arkitektur & Design-uddannelsen ved Aalborg Universitet. Hele forløbet er nu dokumenteret i en jubilæumsbog, der fortæller om hvordan uddannelsen i sin tid blev etableret; hvordan undervis...... størrelse på over 500 studerende, de fleste med daglig gang i den store CREATE-bygning på havnefronten i Aalborg....

  1. Robustness Regions for Dichotomous Decisions. (United States)

    Vijn, Pieter; Molenaar, Ivo W.


    In the case of dichotomous decisions, the total set of all assumptions/specifications for which the decision would have been the same is the robustness region. Inspection of this (data-dependent) region is a form of sensitivity analysis which may lead to improved decision making. (Author/BW)

  2. Metropolitan region of Copenhagen, Denmark

    DEFF Research Database (Denmark)

    Fertner, Christian

    the boundaries of the city further out. With the opening of the suburban train lines in 1934, the until today known finger structure was consolidated. A regional strategy, the “Fingerplan”, incorporating this structure was elaborated in 1947, but individual motorisation eroded some of the principles. Still...... in Sweden, forming a cross-border region with around 3.5 mio. inhabitants....

  3. Bipolar pulse forming line (United States)

    Rhodes, Mark A.


    A bipolar pulse forming transmission line module for linear induction accelerators having first, second, third, fourth, and fifth planar conductors which form an interleaved stack with dielectric layers between the conductors. Each conductor has a first end, and a second end adjacent an acceleration axis. The first and second planar conductors are connected to each other at the second ends, the fourth and fifth planar conductors are connected to each other at the second ends, and the first and fifth planar conductors are connected to each other at the first ends via a shorting plate adjacent the first ends. The third planar conductor is electrically connectable to a high voltage source, and an internal switch functions to short a high voltage from the first end of the third planar conductor to the first end of the fourth planar conductor to produce a bipolar pulse at the acceleration axis with a zero net time integral. Improved access to the switch is enabled by an aperture through the shorting plate and the proximity of the aperture to the switch.


    African Journals Online (AJOL)

    This study investigates the contribution of school curriculum committee in facilitating and coordinating ... schools of Amhara Region' ln undertaking the study the descriptive survey method was used. .... pupil and the teacher are available. ... prepared for each level and grade has ..... the principals have the opinion that the.

  5. Atlantic Region

    NARCIS (Netherlands)

    Elands, B.H.M.; Bell, S.; Blok, J.


    Chapter 2 explores recreation and tourism practices in forest areas in the Atlantic region, which refers to the geographical area close to the North Sea and the Atlantic Ocean. The Atlantic countries described in this section are Belgium (Flanders and Wallonia), Denmark, Iceland, Ireland, the

  6. Nuclear power regional analysis

    International Nuclear Information System (INIS)

    Parera, María Delia


    In this study, a regional analysis of the Argentine electricity market was carried out considering the effects of regional cooperation, national and international interconnections; additionally, the possibilities of insertion of new nuclear power plants in different regions were evaluated, indicating the most suitable areas for these facilities to increase the penetration of nuclear energy in national energy matrix. The interconnection of electricity markets and natural gas due to the linkage between both energy forms was also studied. With this purpose, MESSAGE program was used (Model for Energy Supply Strategy Alternatives and their General Environmental Impacts), promoted by the International Atomic Energy Agency (IAEA). This model performs a country-level economic optimization, resulting in the minimum cost for the modelling system. Regionalization executed by the Wholesale Electricity Market Management Company (CAMMESA, by its Spanish acronym) that divides the country into eight regions. The characteristics and the needs of each region, their respective demands and supplies of electricity and natural gas, as well as existing and planned interconnections, consisting of power lines and pipelines were taken into account. According to the results obtained through the model, nuclear is a competitive option. (author) [es

  7. Diode having trenches in a semiconductor region

    Energy Technology Data Exchange (ETDEWEB)

    Palacios, Tomas Apostol; Lu, Bin; Matioli, Elison de Nazareth


    An electrode structure is described in which conductive regions are recessed into a semiconductor region. Trenches may be formed in a semiconductor region, such that conductive regions can be formed in the trenches. The electrode structure may be used in semiconductor devices such as field effect transistors or diodes. Nitride-based power semiconductor devices are described including such an electrode structure, which can reduce leakage current and otherwise improve performance.


    Directory of Open Access Journals (Sweden)

    Maximiliano Emanuel Korstanje


    Full Text Available Modern studies emphasized on the needs of researching the hospitality as relevant aspects of tourism and hospitality fields. Anyway, these approaches are inextricably intertwined to the industry of tourism and do not take seriously the anthropological and sociological roots of hospitality. In fact, the hotel seems to be a partial sphere of hospitality at all. Under this context, the present paper explores the issue of hospitality enrooted in the political and economic indo-European principle of free-transit which is associated to a much broader origin.  Starting from the premise etymologically hostel and hospital share similar origins, we follow the contributions of J Derrida to determine the elements that formed the hospitality up to date.

  9. Nucleon Electromagnetic Form Factors

    Energy Technology Data Exchange (ETDEWEB)

    Marc Vanderhaeghen; Charles Perdrisat; Vina Punjabi


    There has been much activity in the measurement of the elastic electromagnetic proton and neutron form factors in the last decade, and the quality of the data has greatly improved by performing double polarization experiments, in comparison with previous unpolarized data. Here we review the experimental data base in view of the new results for the proton, and neutron, obtained at JLab, MAMI, and MIT-Bates. The rapid evolution of phenomenological models triggered by these high-precision experiments will be discussed, including the recent progress in the determination of the valence quark generalized parton distributions of the nucleon, as well as the steady rate of improvements made in the lattice QCD calculations.

  10. Spray-formed tooling (United States)

    McHugh, K. M.; Key, J. F.

    The United States Council for Automotive Research (USCAR) has formed a partnership with the Idaho National Engineering Laboratory (INEL) to develop a process for the rapid production of low-cost tooling based on spray forming technology developed at the INEL. Phase 1 of the program will involve bench-scale system development, materials characterization, and process optimization. In Phase 2, prototype systems will be designed, constructed, evaluated, and optimized. Process control and other issues that influence commercialization will be addressed during this phase of the project. Technology transfer to USCAR, or a tooling vendor selected by USCAR, will be accomplished during Phase 3. The approach INEL is using to produce tooling, such as plastic injection molds and stamping dies, combines rapid solidification processing and net-shape materials processing into a single step. A bulk liquid metal is pressure-fed into a de Laval spray nozzle transporting a high velocity, high temperature inert gas. The gas jet disintegrates the metal into fine droplets and deposits them onto a tool pattern made from materials such as plastic, wax, clay, ceramics, and metals. The approach is compatible with solid freeform fabrication techniques such as stereolithography, selective laser sintering, and laminated object manufacturing. Heat is extracted rapidly, in-flight, by convection as the spray jet entrains cool inert gas to produce undercooled and semi-solid droplets. At the pattern, the droplets weld together while replicating the shape and surface features of the pattern. Tool formation is rapid; deposition rates in excess of 1 ton/h have been demonstrated for bench-scale nozzles.

  11. 17 CFR 259.0-1 - Availability of forms. (United States)


    ... may inspect the forms at this address and at the Commission's regional and district offices. (See... 17 Commodity and Securities Exchanges 3 2010-04-01 2010-04-01 false Availability of forms. 259.0-1 Section 259.0-1 Commodity and Securities Exchanges SECURITIES AND EXCHANGE COMMISSION (CONTINUED) FORMS...

  12. 17 CFR 209.0-1 - Availability of forms. (United States)


    ... may inspect the forms at this address and at the Commission's regional offices. (See § 200.11 of this... 17 Commodity and Securities Exchanges 2 2010-04-01 2010-04-01 false Availability of forms. 209.0-1 Section 209.0-1 Commodity and Securities Exchanges SECURITIES AND EXCHANGE COMMISSION FORMS PRESCRIBED...

  13. GRTgaz and the regions

    International Nuclear Information System (INIS)


    GRTgaz is a European leader in natural gas transmission, a world expert in gas transmission networks and systems, and an operator firmly committed to the energy transition. It owns and operates the gas transmission network throughout most of France and it manages the transmission network in Germany, thereby helping to ensure correct operation of the French and European gas market. It contributes to the energy security of regional supply systems and performs a public service mission to ensure the continuity of consumer supply. This document presents the regional activities of GRTgaz in France in the form of 12 regional fact sheets summarizing the key data by the end of 2016: network structure, financial indicators (investments, orders), public and industrial gas consumptions, 2017 projects, institutional and environmental partnerships

  14. Moon (Form-Origin) (United States)

    Tsiapas, Elias; Soumelidou, Despina; Tsiapas, Christos


    When the Earth was formed, it was in a state of burning heat. As time went by, temperature on the planet's surface was falling due to radiation and heat transfer, and various components (crusts) began taking solid form at the Earth's poles. The formation of crusts took place at the Earth's poles, because the stirring of burning and fluid masses on the surface of the Earth was significantly slighter there than it was on the equator. Due to centrifugal force and Coriolis Effect, these solid masses headed towards the equator; those originating from the North Pole followed a south-western course, while those originating from the South Pole followed a north-western course and there they rotated from west to east at a lower speed than the underlying burning and liquid earth, because of their lower initial linear velocity, their solid state and inertia. Because inertia is proportional to mass, the initially larger solid body swept all new solid ones, incorporating them to its western side. The density of the new solid masses was higher, because the components on the surface would freeze and solidify first, before the underlying thicker components. As a result, the western side of the initial islet of solid rocks submerged, while the east side elevated. . As a result of the above, this initial islet began to spin in reverse, and after taking on the shape of a sphere, it formed the "heart" of the Moon. The Moon-sphere, rolling on the equator, would sink the solid rocks that continued to descend from the Earth's poles. The sinking rocks partially melted because of higher temperatures in the greater depths that the Moon descended to, while part of the rocks' mass bonded with the Moon and also served as a heat-insulating material, preventing the descended side of the sphere from melting. Combined with the Earth's liquid mass that covered its emerging eastern surface, new sphere-shaped shells were created, with increased density and very powerful structural cohesion. During the

  15. How desert varnish forms? (United States)

    Perry, Randall S.; Kolb, Vera M.; Lynne, Bridget Y.; Sephton, Mark A.; Mcloughlin, Nicola; Engel, Michael H.; Olendzenski, Lorraine; Brasier, Martin; Staley, James T., Jr.


    Desert varnish is a black, manganese-rich rock coating that is widespread on Earth. The mechanism underlying its formation, however, has remained unresolved. We present here new data and an associated model for how desert varnish forms, which substantively challenges previously accepted models. We tested both inorganic processes (e.g. clays and oxides cementing coatings) and microbial methods of formation. Techniques used in this preliminary study include SEM-EDAX with backscatter, HRTEM of focused ion beam prepared (FIB) wafers and several other methods including XRPD, Raman spectroscopy, XPS and Tof-SIMS. The only hypothesis capable of explaining a high water content, the presence of organic compounds, an amorphous silica phase (opal-A) and lesser quantities of clays than previously reported, is a mechanism involving the mobilization and redistribution of silica. The discovery of silica in desert varnish suggests labile organics are preserved by interaction with condensing silicic acid. Organisms are not needed for desert varnish formation but Bacteria, Archaea, Eukarya, and other organic compounds are passively incorporated and preserved as organominerals. The rock coatings thus provide useful records of past environments on Earth and possibly other planets. Additionally this model also helps to explain the origin of key varnish and rock glaze features, including their hardness, the nature of the "glue" that binds heterogeneous components together, its layered botryoidal morphology, and its slow rate of formation.

  16. How delusion is formed? (United States)

    Park, Jong Suk; Kang, Ung Gu


    Traditionally, delusions have been considered to be the products of misinterpretation and irrationality. However, some theorists have argued that delusions are normal or rational cognitive responses to abnormal experiences. That is, when a recently experienced peculiar event is more plausibly explained by an extraordinary hypothesis, confidence in the veracity of this extraordinary explanation is reinforced. As the number of such experiences, driven by the primary disease process in the perceptual domain, increases, this confidence builds and solidifies, forming a delusion. We tried to understand the formation of delusions using a simulation based on Bayesian inference. We found that (1) even if a delusional explanation is only marginally more plausible than a non-delusional one, the repetition of the same experience results in a firm belief in the delusion. (2) The same process explains the systematization of delusions. (3) If the perceived plausibility of the explanation is not consistent but varies over time, the development of a delusion is delayed. Additionally, this model may explain why delusions are not corrected by persuasion or rational explanation. This Bayesian inference perspective can be considered a way to understand delusions in terms of rational human heuristics. However, such experiences of "rationality" can lead to irrational conclusions, depending on the characteristics of the subject. Copyright © 2015 Elsevier Ltd. All rights reserved.

  17. Image forming apparatus

    DEFF Research Database (Denmark)


    An image H(x, y) for displaying a target image G(x, y) is displayed on a liquid-crystal display panel and illumination light from an illumination light source is made to pass therethrough to form an image on a PALSLM. Read light hv is radiated to the PALSLM and a phase-modulated light image alpha...... (x, y) read out of the PALSLM is subjected to Fourier transform by a lens. A phase contrast filter gives a predetermined phase shift to only the zero-order light component of Fourier light image alpha f(x, y). The phase-shifted light image is subjected to inverse Fourier transform by a lens...... to project an output image O(x, y) to an output plane. A light image O'(x, y) branched by a beam sampler is picked up by a pickup device and an evaluation value calculating unit evaluates conformity between the image O(x, y) and the image G(x, y).; A control unit performs feedback control of optical...

  18. Interaction region

    International Nuclear Information System (INIS)



    The Interaction Region Group addressed the basic questions of how to collide the SLC beams, how to maximize and monitor the luminosity, and how to minimize the detector backgrounds at the interaction region. In practice, five subgroups evolved to study these questions. The final focus group provided three alternative designs to acheive the 1 to 2 micron beam spot size required by the SLC, as well as studying other problems including: eta, eta' matching from the collider arcs, the implementation of soft bends near the interaction region, beam emittance growth, and magnet tolerances in the final focus. The beam position monitor group proposed two devices, a strip line monitor, and a beamstrahlung monitor, to bring the beams into collision. The luminosity monitor group reviewed the possible QED processes that would be insensitive to weak interaction (Z 0 ) effects. The beam dumping group proposed locations for kicker and septum magnets in the final focus that would achieve a high dumping efficiency and would meet the desired beam tolerances at the Moller scattering target in the beam dump line. Working with the Polarization Group, the Moller experiment was designed into the beam dump beam line. A beam dump was proposed that would maintain radiation backgrounds (penetrating muons) at acceptible levels. The detector backgrounds group proposed soft-bend and masking configurations to shield the detector from synchrotron radiation from the hard/soft bends and from the final focus quadrupoles and evaluated the effectiveness of these designs for the three final focus optics designs. Backgrounds were also estimated from: large angle synchrotron radiation, local and distant beam-gas interactions, 2-photon interactions, and from neutrons and backscattered photons from the beamstrahlung dump

  19. Transition region

    International Nuclear Information System (INIS)

    Jordan, C.


    The Glossary is designed to be a technical dictionary that will provide solar workers of various specialties, students, other astronomers and theoreticians with concise information on the nature and the properties of phenomena of solar and solar-terrestrial physics. Each term, or group of related terms, is given a concise phenomenological and quantitative description, including the relationship to other phenomena and an interpretation in terms of physical processes. The references are intended to lead the non-specialist reader into the literature. This section deals with: transition region; di-electronic recombination; intersystem or intercombination lines; satellite lines; grazing-incidence optics; and crystal spectrometers. (B.R.H.)

  20. Forms of War

    Energy Technology Data Exchange (ETDEWEB)

    Vogel, H. [Asklepios Klinik St. Georg, Roentgenabteilung, Lohmuehlenstrasse 5, 20099 Hamburg (Germany)], E-mail:; Bartelt, D. [Asklepios Klinik St. Georg, Roentgenabteilung, Lohmuehlenstrasse 5, 20099 Hamburg (Germany)


    Purpose: Under war conditions, employed weapons can be identified on radiographs obtained in X-ray diagnostic. The analysis of such X-ray films allows concluding that there are additional information about the conditions of transport and treatment; it shall be shown that there are X-ray findings which are typical and characteristic for certain forms of warfare. Material and method: The radiograms have been collected during thirty years; they come from hospitals, where war casualties had been treated, and personal collections. Results: The material is selected, because in war X-ray diagnostic will be limited and the interest of the opposing parties influence the access to the material; furthermore the possibilities to publish or to communicate facts and thoughts are different. Citizens of the USA, GB, France, or Israel will have easier access to journals than those of Vietnam, Chad, and Zimbabwe. Under war conditions, poor countries, like North Vietnam may develop own concepts of medical care. There are X-ray findings which are typical or even characteristic for air warfare, guerrilla warfare, gas war, desert warfare, conventional warfare, and annihilation warfare, and city guerrilla warfare/civil war. The examples demonstrate that weapons and the conditions of transport and treatment can be recognized by X-ray findings. The radiogram can be read like a document. Conclusion: In War, there are differences between a treatment and imaging diagnostic in countries, which control the air space and in those who do not. Medical care of the poor, i.e. in countries (in general those opposing the western nations) will hardly be published, and poverty has no advocate.

  1. Forms of War

    International Nuclear Information System (INIS)

    Vogel, H.; Bartelt, D.


    Purpose: Under war conditions, employed weapons can be identified on radiographs obtained in X-ray diagnostic. The analysis of such X-ray films allows concluding that there are additional information about the conditions of transport and treatment; it shall be shown that there are X-ray findings which are typical and characteristic for certain forms of warfare. Material and method: The radiograms have been collected during thirty years; they come from hospitals, where war casualties had been treated, and personal collections. Results: The material is selected, because in war X-ray diagnostic will be limited and the interest of the opposing parties influence the access to the material; furthermore the possibilities to publish or to communicate facts and thoughts are different. Citizens of the USA, GB, France, or Israel will have easier access to journals than those of Vietnam, Chad, and Zimbabwe. Under war conditions, poor countries, like North Vietnam may develop own concepts of medical care. There are X-ray findings which are typical or even characteristic for air warfare, guerrilla warfare, gas war, desert warfare, conventional warfare, and annihilation warfare, and city guerrilla warfare/civil war. The examples demonstrate that weapons and the conditions of transport and treatment can be recognized by X-ray findings. The radiogram can be read like a document. Conclusion: In War, there are differences between a treatment and imaging diagnostic in countries, which control the air space and in those who do not. Medical care of the poor, i.e. in countries (in general those opposing the western nations) will hardly be published, and poverty has no advocate

  2. Asymptotics of Heavy-Meson Form Factors

    CERN Document Server

    Grozin, A.G.; Grozin, Andrey G.; Neubert, Matthias


    Using methods developed for hard exclusive QCD processes, we calculate the asymptotic behaviour of heavy-meson form factors at large recoil. It is determined by the leading- and subleading-twist meson wave functions. For $1\\ll |v\\cdot v'|\\ll m_Q/\\Lambda$, the form factors are dominated by the Isgur--Wise function, which is determined by the interference between the wave functions of leading and subleading twist. At $|v\\cdot v'|\\gg m_Q/\\Lambda$, they are dominated by two functions arising at order $1/m_Q$ in the heavy-quark expansion, which are determined by the leading-twist wave function alone. The sum of these contributions describes the form factors in the whole region $|v\\cdot v'|\\gg 1$. As a consequence, there is an exact zero in the form factor for the scattering of longitudinally polarized $B^*$ mesons at some value $v\\cdot v'\\sim m_b/\\Lambda$, and an approximate zero in the form factor of $B$ mesons in the timelike region ($v\\cdot v'\\sim -m_b/\\Lambda$). We obtain the evolution equations and sum rules ...

  3. Forms of memory in Andean queros

    Directory of Open Access Journals (Sweden)

    Alfredo Cordiviola


    Full Text Available In colonial times, queros were used to drink chicha and to formalize pacts in ritual ceremonies by the indigenous Andean elites. They had been manufactured for centuries, long before the Incas dominated the region, and continued to be made after Spanish domination and compulsory evangelization had been established. During the Inca empire, the surface of the queros was covered just with incisions and geometric forms; in the viceroyalty of Peru they were covered instead with figurative images. In this work we analyze the evolution of these forms and the different ways in which these ceremonial vessels were used to evoke the Andean pasts.

  4. Venus - Phoebe Region (United States)


    This Magellan radar image is of part of the Phoebe region of Venus. It is a mosaic of parts of revolutions 146 and 147 acquired in the first radar test on Aug. 16, 1990. The area in the image is located at 291 degrees east longitude, 19 degrees south latitude. The image shows an area 30 kilometers (19.6 miles) wide and 76 km (47 miles) long. On the basis of Pioneer Venus and Arecibo data, it is known that two major rift zones occur in southern Phoebe Regio and that they terminate at about 20 to 25 degrees south latitude, about 2,000 km (1,240 miles) apart. This image is of an area just north of the southern end of the western rift zone. The region is characterized by a complex geologic history involving both volcanism and faulting. Several of the geologic units show distinctive overlapping or cross cutting relationships that permit identification and separation of geologic events and construction of the geologic history of the region. The oldest rocks in this image form the complexly deformed and faulted, radar bright, hilly terrain in the northern half. Faults of a variety of orientations are observed. A narrow fault trough (about one-half to one km (three tenths to six tenths of a mile) wide is seen crossing the bright hills near the lower part in the middle of the image. This is one of the youngest faults in the faulted, hilly unit as it is seen to cut across many other structures. The fault trough in turn appears to be embayed and flooded by the darker plains that appear in the south half of the image. These plains are interpreted to be of volcanic origin. The dark plains may be formed of a complex of overlapping volcanic flows. For example, the somewhat darker region of plains in the lower left (southwest) corner of the image may be a different age series of plains forming volcanic lava flows. Finally, the narrow bright line crossing the image in its lower part is interpreted to be a fault which cross cuts both plains units and is thus the youngest event in

  5. Midwest regional management plan

    International Nuclear Information System (INIS)

    Paton, R.F.


    In response to the Low-Level Radioactive Waste Policy Act of 1980, the States of Indiana, Iowa, Michigan, Minnesota, Missouri, Ohio and Wisconsin formed the Midwest Interstate Low-Level Radioactive Waste Compact. One of the top priorities of the Compact Commission is the development of a comprehensive regional waste management plan. The plan consists of five major elements: (1) waste inventory; (2) waste stream projections; (3) analysis of waste management and disposal options; (4) development of a regional waste management system; and (5) selection of a host state(s) for future low-level waste facilities. When completed, the Midwest Management Plan will serve as the framework for future low-level radioactive waste management and disposal decisions

  6. Urban Form, Air Pollution, and Health. (United States)

    Hankey, Steve; Marshall, Julian D


    Urban form can impact air pollution and public health. We reviewed health-related articles that assessed (1) the relationships among urban form, air pollution, and health as well as (2) aspects of the urban environment (i.e., green space, noise, physical activity) that may modify those relationships. Simulation and empirical studies demonstrate an association between compact growth, improved regional air quality, and health. Most studies are cross-sectional and focus on connections between transportation emissions and land use. The physical and mental health impacts of green space, public spaces that promote physical activity, and noise are well-studied aspects of the urban environment and there is evidence that these factors may modify the relationship between air pollution and health. Urban form can support efforts to design clean, health-promoting cities. More work is needed to operationalize specific strategies and to elucidate the causal pathways connecting various aspects of health.

  7. Advances in metal forming expert system for metal forming

    CERN Document Server

    Hingole, Rahulkumar Shivajirao


    This comprehensive book offers a clear account of the theory and applications of advanced metal forming. It provides a detailed discussion of specific forming processes, such as deep drawing, rolling, bending extrusion and stamping. The author highlights recent developments of metal forming technologies and explains sound, new and powerful expert system techniques for solving advanced engineering problems in metal forming. In addition, the basics of expert systems, their importance and applications to metal forming processes, computer-aided analysis of metalworking processes, formability analysis, mathematical modeling and case studies of individual processes are presented.

  8. Electromagnetic Hadronic Form-Factors

    International Nuclear Information System (INIS)

    Edwards, Robert G.


    We present a calculation of the nucleon electromagnetic form-factors as well as the pion and rho to pion transition form-factors in a hybrid calculation with domain wall valence quarks and improved staggered (Asqtad) sea quarks

  9. Why are Trade Agreements Regional?


    Zissimos, Ben


    This paper shows how distance may be used to coordinate on a unique equilibrium in which trade agreements are regional. Trade agreement formation is modeled as coalition formation. In a standard trade model with no distance between countries, a familiar problem of coordination failure arises giving rise to multiple equilibria; any one of many possible trade agreements can form. With distance between countries, and through strategic interaction in tariff setting, regional trade agreements gene...

  10. Intern Perceptions of Dialect and Regionalism (United States)

    O'Hara, Hunter


    Interns at The University of Tampa investigate how perceptions of dialect and regionalism may impact the learning environment and more precisely, the learner. Regionalism is defined as a belief that one's region of origin is a primary determinant of the quality of one's standards of living, social forms, customary beliefs, levels of…

  11. A compiler for variational forms


    Kirby, Robert C.; Logg, Anders


    As a key step towards a complete automation of the finite element method, we present a new algorithm for automatic and efficient evaluation of multilinear variational forms. The algorithm has been implemented in the form of a compiler, the FEniCS Form Compiler FFC. We present benchmark results for a series of standard variational forms, including the incompressible Navier-Stokes equations and linear elasticity. The speedup compared to the standard quadrature-based approach is impressive; in s...

  12. Adaptive Municipal e-forms

    NARCIS (Netherlands)

    Kuiper, P.M.; van Dijk, Elisabeth M.A.G.; Boerma, A.K.; Weibelzahl, S.; Cristea, A.


    Adaptation of electronic forms seems to be a step forward to reduce the burden for people who fill in forms. Municipalities more and more offer eforms online that can be used to request a municipal product or service. To create adaptive e-forms that satisfy the need of end-users, involvement of

  13. Forms of address in Isizulu



    M.A. (African Studies) The study deals with forms of address in isiZulu. Therefore, the various aspects of speech that play roles when addressing a person, the factors affecting forms of address in isiZulu and the effect of languages such as English, Afrikaans and other African languages on the forms of address in isiZulu are of interest. Research was conducted on forms of address in isiZulu in parts of Soweto and it was discovered that form of address are determined by different factors i...

  14. U-Form vs. M-Form: How to Understand Decision Autonomy Under Healthcare Decentralization? (United States)

    Bustamante, Arturo Vargas


    For more than three decades healthcare decentralization has been promoted in developing countries as a way of improving the financing and delivery of public healthcare. Decision autonomy under healthcare decentralization would determine the role and scope of responsibility of local authorities. Jalal Mohammed, Nicola North, and Toni Ashton analyze decision autonomy within decentralized services in Fiji. They conclude that the narrow decision space allowed to local entities might have limited the benefits of decentralization on users and providers. To discuss the costs and benefits of healthcare decentralization this paper uses the U-form and M-form typology to further illustrate the role of decision autonomy under healthcare decentralization. This paper argues that when evaluating healthcare decentralization, it is important to determine whether the benefits from decentralization are greater than its costs. The U-form and M-form framework is proposed as a useful typology to evaluate different types of institutional arrangements under healthcare decentralization. Under this model, the more decentralized organizational form (M-form) is superior if the benefits from flexibility exceed the costs of duplication and the more centralized organizational form (U-form) is superior if the savings from economies of scale outweigh the costly decision-making process from the center to the regions. Budgetary and financial autonomy and effective mechanisms to maintain local governments accountable for their spending behavior are key decision autonomy variables that could sway the cost-benefit analysis of healthcare decentralization. PMID:27694684

  15. Transient regional osteoporosis. (United States)

    Cano-Marquina, Antonio; Tarín, Juan J; García-Pérez, Miguel-Ángel; Cano, Antonio


    Transient regional osteoporosis (TRO) is a disease that predisposes to fragility fracture in weight bearing joints of mid-life women and men. Pregnant women may also suffer the process, usually at the hip. The prevalence of TRO is lower than the systemic form, associated with postmenopause and advanced age, but may be falsely diminished by under-diagnosis. The disease may be uni- or bilateral, and may migrate to distinct joints. One main feature of TRO is spontaneous recovery. Pain and progressive limitation in the functionality of the affected joint(s) are key symptoms. In the case of the form associated with pregnancy, difficulties in diagnosis derive from the relatively young age at presentation and from the clinical overlapping with the frequent aches during gestation. Densitometric osteoporosis in the affected region is not always present, but bone marrow edema, with or without joint effusion, is detected by magnetic resonance. There are not treatment guidelines, but the association of antiresorptives to symptomatic treatment seems to be beneficial. Surgery or other orthopedic interventions can be required for specific indications, like hip fracture, intra-medullary decompression, or other. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

  16. Community Psychology, Diversity, and the Many Forms of Culture (United States)

    Tebes, Jacob Kraemer


    Comments on the original article, "Many forms of culture," by A. B. Cohen. Cohen argued that psychology must broaden its conceptualization of culture to consider its many forms, such as religion, socioeconomic status, and region. The current author could not agree more with Cohen's proposed conceptualization of culture and its potential impact on…


    Directory of Open Access Journals (Sweden)

    Denys Yu. Lapigin


    Full Text Available Currently the tools to identify strategicallyimportant objectives of regional development is not enough to build a developmentperspective, relying on something special,what distinguishes each region from therest. The article discusses approaches to the formation of the regional developmentstrategy, which is based on goals set by the results of the analysis of the main factors inthe development of the region. The study is based on the methodology of systems theoryand methods of strategic management. The most important results should include tools tobuild the tree of strategic objectives resultingfrom the implementation of the algorithm forconstructing planes of analysis and development of the region. The results can be used to develop a strategy for the developmentof socio-economic systems of various typesand forms.

  18. Bedforms formed by experimental supercritical density flows (United States)

    Naruse, Hajime; Izumi, Norihiro; Yokokawa, Miwa; Muto, Tetsuji


    This study reveals characteristics and formative conditions of bedforms produced by saline density flows in supercritical flow conditions, especially focusing on the mechanism of the formation of plane bed. The motion of sediment particles forming bedforms was resolved by high-speed cameras (1/1000 frame/seconds). Experimental density flows were produced by mixtures of salt water (1.01-1.04 in density) and plastic particles (1.5 in specific density, 140 or 240 mm in diameter). Salt water and plastic particles are analogue materials of muddy water and sand particles in turbidity currents respectively. Acrylic flume (4.0 m long, 2.0 cm wide and 0.5 m deep) was submerged in an experimental tank (6.0 m long, 1.8 m wide and 1.2 m deep) that was filled by clear water. Features of bedforms were observed when the bed state in the flume reached equilibrium condition. The experimental conditions range 1.5-4.2 in densimetric Froude number and 0.2-0.8 in Shields dimensionless stress. We report the two major discoveries as a result of the flume experiments: (1) Plane bed under Froude-supercritical flows and (2) Geometrical characteristics of cyclic steps formed by density flows. (1) Plane bed was formed under the condition of supercritical flow regime. In previous studies, plane bed has been known to be formed by subcritical unidirectional flows (ca. 0.8 in Froude number). However, this study implies that plane bed can also be formed by supercritical conditions with high Shields dimensionless stress (>0.4) and very high Froude number (> 4.0). This discovery may suggest that previous estimations of paleo-hydraulic conditions of parallel lamination in turbidites should be reconsidered. The previous experimental studies and data from high-speed camera suggest that the region of plane bed formation coincides with the region of the sheet flow developments. The particle transport in sheet flow (thick bedload layer) induces transform of profile of flow shear stress, which may be

  19. Transformation of the Zagreb urban region

    Directory of Open Access Journals (Sweden)

    Milan Ilić


    Full Text Available Several aspects of the transformation of theZagreb urban region are considered in this work: change in the regionćssize and form, socio-economic transformation, functional transformation andphysiognomic or morphological transformation. It was established that theregionćs form has changed: it is moving from the classic star-like form,characteristic of the early developmental phase of the urban region, to acircular form. The region has experienced evolution in the developmentalsense and reached a phase of absolute decentralization. The process oftransformation in the region is continuing at full pace, while onlyperipheral, mainly small and poorly linked settlements with an unfavorabledemographic balance and processes are lagging behind.

  20. Process and structures for fabrication of solar cells with laser ablation steps to form contact holes (United States)

    Harley, Gabriel; Smith, David D; Dennis, Tim; Waldhauer, Ann; Kim, Taeseok; Cousins, Peter John


    Contact holes of solar cells are formed by laser ablation to accomodate various solar cell designs. Use of a laser to form the contact holes is facilitated by replacing films formed on the diffusion regions with a film that has substantially uniform thickness. Contact holes may be formed to deep diffusion regions to increase the laser ablation process margins. The laser configuration may be tailored to form contact holes through dielectric films of varying thickness.

  1. Undercuts by Laser Shock Forming

    International Nuclear Information System (INIS)

    Wielage, Hanna; Vollertsen, Frank


    In laser shock forming TEA-CO 2 -laser induced shock waves are used to form metal foils, such as aluminum or copper. The process utilizes an initiated plasma shock wave on the target surface, which leads to a forming of the foil. A challenge in forming technologies is the manufacturing of undercuts. By conventional forming methods these special forms are not feasible. In this article, it is presented that undercuts in the micro range can be produced by laser shock deep drawing. Different drawing die diameters, drawing die depths and the material aluminum in the thicknesses 20 and 50 μm were investigated. It will be presented that smaller die diameters facilitate undercuts compared to bigger die diameters. The phenomena can be explained by Barlow's formula. Furthermore, it is shown which maximum undercut depth at different die diameters can be reached. To this end, cross-sections of the different parameter combinations are displayed.

  2. Forming processes and mechanics of sheet metal forming

    NARCIS (Netherlands)

    Burchitz, I.A.


    The report is dealing with the numerical analysis of forming processes. Forming processes is the large group of manufacturing processes used to obtain various product shapes by means of plastic deformations. The report is organized as follows. An overview of the deformation processes and the

  3. Confectionery-based dose forms. (United States)

    Tangso, Kristian J; Ho, Quy Phuong; Boyd, Ben J


    Conventional dosage forms such as tablets, capsules and syrups are prescribed in the normal course of practice. However, concerns about patient preferences and market demands have given rise to the exploration of novel unconventional dosage forms. Among these, confectionery-based dose forms have strong potential to overcome compliance problems. This report will review the availability of these unconventional dose forms used in treating the oral cavity and for systemic drug delivery, with a focus on medicated chewing gums, medicated lollipops, and oral bioadhesive devices. The aim is to stimulate increased interest in the opportunities for innovative new products that are available to formulators in this field, particularly for atypical patient populations.

  4. Tectonics: The meaning of form

    DEFF Research Database (Denmark)

    Christiansen, Karl; Brandt, Per Aage

    Tectonics – The meaning of form deals with one of the core topics of architecture: the relationship between form and content. In the world of architecture, form is not only made from brick, glass and wood. Form means something. When a material is processed with sufficient technical skill and insi...... perspectives. You can read the chapters in any order you like – from the beginning, end or the middle. There is no correct order. The project is methodologically inductive: the more essays you read, the broader your knowledge of tectonics get....

  5. Amorphous drugs and dosage forms

    DEFF Research Database (Denmark)

    Grohganz, Holger; Löbmann, K.; Priemel, P.


    The transformation to an amorphous form is one of the most promising approaches to address the low solubility of drug compounds, the latter being an increasing challenge in the development of new drug candidates. However, amorphous forms are high energy solids and tend to recry stallize. New...... formulation principles are needed to ensure the stability of amorphous drug forms. The formation of solid dispersions is still the most investigated approach, but additional approaches are desirable to overcome the shortcomings of solid dispersions. Spatial separation by either coating or the use of micro-containers...... before single molecules are available for the formation of crystal nuclei, thus stabilizing the amorphous form....


    Directory of Open Access Journals (Sweden)

    Kovalenko V.F.


    Full Text Available The study was conducted by method of light scattering of laser emission. The influence of the form field, mutual influence of mental informational and form torsional fields as well as the following exposure of water samples in the form field after the cease of informational influence on water structure were examined. Paper forms of a pyramid, a cylinder, and a prism were used. The experimental findings show that mechanism of mutual influence on water structure of the form and informational torsional fields depended on the initial conditions of spin restructuring process – the configuration of a form, the type of the form field (internal and external ones, and the initial water structure. The influence of the form field on informational aftereffect was determined, the character of which was defined by ratio of intensities of torsional form field and an informational soliton. The phenomenon of the abnormally large amplification of the informational aftereffect in the internal field of a pyramid demonstrating the attributes of positive reverse connection between the informational soliton and torsional field of water structure and selection of generated cluster sizes were discovered.

  7. Improving the forming capability of laser dynamic forming by using rubber as a forming medium (United States)

    Shen, Zongbao; Liu, Huixia; Wang, Xiao; Wang, Cuntang


    Laser dynamic forming (LDF) is a novel high velocity forming technique, which employs laser-generated shock wave to load the sample. The forming velocity induced by the high energy laser pulse may exceed the critical forming velocity, resulting in the occurrence of premature fracture. To avoid the above premature fracture, rubber is introduced in LDF as a forming medium to prolong the loading duration in this paper. Laser induced shock wave energy is transferred to the sample in different forming stages, so the forming velocity can be kept below the critical forming velocity when the initial laser energy is high for fracture. Bulge forming experiments with and without rubber were performed to study the effect of rubber on loading duration. The experimental results show that, the shock wave energy attenuates during the propagation through the rubber layer, the rubber can avoid the premature fracture. So the plastic deformation can continue, the forming capability of LDF is improved. Due to the severe plastic deformation under rubber compression, adiabatic shear bands (ASB) occur in LDF with rubber. The material softening in ASB leads to the irregular fracture, which is different from the premature fracture pattern (regular fracture) in LDF without rubber. To better understand this deformation behavior, Johnson-Cook model is used to simulate the dynamic response and the evolution of ASB of copper sample. The simulation results also indicate the rubber can prolong the loading duration.

  8. The AFGL (Air Force Geophysics Laboratory) Absolute Gravity System’s Error Budget Revisted. (United States)


    also be induced by equipment not associated with the system. A systematic bias of 68 pgal was observed by the Istituto di Metrologia "G. Colonnetti...Laboratory Astrophysics, Univ. of Colo., Boulder, Colo. IMGC: Istituto di Metrologia "G. Colonnetti", Torino, Italy Table 1. Absolute Gravity Values...measurements were made with three Model D and three Model G La Coste-Romberg gravity meters. These instruments were operated by the following agencies

  9. Daily Magnetograms for 1978 from the AFGL (Air Force Geophysics Laboratory) Network. (United States)


    rj4TE Y rCCE#i~nT * 9 vEflEL(6-1"i( LI"ISI( td HEUs 813 7..8... ... .... M 5 3 ... . .. .. .... .. . .. ... .. .. ... .... .. .. .. . .. .. I?’ a 7...Y LS 7 .. .. . .. . . . .. . . . . . . . . .. . - ’ - S U E . . ... . . . .. . . . .. . . . . . . .. . .. . . 534S 4349QO L.~ El jIjI -2 td [w1.2...8M) iHQ ’~LTP FLMAfEOEO EUR FLUNG.ATE X CLVRC8ET 40 HIfMO1SLAM’TVUOR DIVISION 18S33 172707 81%6 TPA 2595 .’g 977 FL-ttTY-C4FLVA()T 40 tbMTES-LAS#1’VUOR

  10. Returning "Region" to World Regional Geography (United States)

    Rees, Peter W.; Legates, Margaret


    World regional geography textbooks rarely focus on the process of region formation, despite frequent calls to reincorporate a regional approach to teaching global geography. An instructional strategy using problem-based learning in a small honors section of a large world regional geography course is described. Using a hypothetical scenario…


    DEFF Research Database (Denmark)


    Network coding by beam forming in networks, for example, in single frequency networks, can provide aid in increasing spectral efficiency. When network coding by beam forming and user cooperation are combined, spectral efficiency gains may be achieved. According to certain embodiments, a method...... cooperating with the plurality of user equipment to decode the received data....

  12. Automated Test-Form Generation (United States)

    van der Linden, Wim J.; Diao, Qi


    In automated test assembly (ATA), the methodology of mixed-integer programming is used to select test items from an item bank to meet the specifications for a desired test form and optimize its measurement accuracy. The same methodology can be used to automate the formatting of the set of selected items into the actual test form. Three different…

  13. [Galenic forms for oral medication]. (United States)

    El Semman, Ousseid; Certain, Agnès; Bouziane, Faouzia; Arnaud, Philippe


    Galenic science is interested in the art and the way of formulating an active principle with an excipient in order for it to be administered to the patient. The pharmaceutical forms envisage different administration routes, including by mouth. Nurses need to handle and sometimes modify the pharmaceutical form of a drug to make it easier for the patient to take. This requires vigilance.


    Directory of Open Access Journals (Sweden)

    Markova V. D.


    Full Text Available The article examines tendencies of the development of new organizational forms of partnership and marks several problems of their usage in Russian conditions by the example of the Novosibirsk region. Modern forms of networking and partnership of commercial companies and universities, research institutes and other organizations, such as clusters, strategic alliances, technology platforms, business ecosystems and other, are focused on the development of new market opportunities and gaining competitive advantage through the sharing of assets and expertise. Two groups of strategic partnership initiatives in the business were emphasized: some initiatives are shown by the state, while some come from the companies. It has been shown that the development of digital technologies, which allows to establish connection between geographically separated participants, promotes the formation of new partnership tools, such as the technology platforms and business ecosystems built on their basis.

  15. Nucleon form factors. Probing the chiral limit

    Energy Technology Data Exchange (ETDEWEB)

    Goeckeler, M. [Regensburg Univ. (Germany). Inst. fuer Theoretische Physik; Haegler, P. [Technische Univ. Muenchen, Garching (Germany). Physik-Dept.; Horsley, R. [Edinburgh Univ. (GB). School of Physics] (and others)


    The electromagnetic form factors provide important hints for the internal structure of the nucleon and continue to be of major interest for experimentalists. For an intermediate range of momentum transfers the form factors can be calculated on the lattice. However, reliability of the results is limited by systematic errors due to the required extrapolation to physical quark masses. Chiral effective field theories predict a rather strong quark mass dependence in a range which was yet unaccessible for lattice simulations. We give an update on recent results from the QCDSF collaboration using gauge configurations with Nf=2, non-perturbatively O(a)-improved Wilson fermions at very small quark masses down to 340 MeV pion mass, where we start to probe the relevant quark mass region. (orig.)

  16. Nucleon form factors. Probing the chiral limit

    International Nuclear Information System (INIS)

    Goeckeler, M.; Haegler, P.; Horsley, R.


    The electromagnetic form factors provide important hints for the internal structure of the nucleon and continue to be of major interest for experimentalists. For an intermediate range of momentum transfers the form factors can be calculated on the lattice. However, reliability of the results is limited by systematic errors due to the required extrapolation to physical quark masses. Chiral effective field theories predict a rather strong quark mass dependence in a range which was yet unaccessible for lattice simulations. We give an update on recent results from the QCDSF collaboration using gauge configurations with Nf=2, non-perturbatively O(a)-improved Wilson fermions at very small quark masses down to 340 MeV pion mass, where we start to probe the relevant quark mass region. (orig.)

  17. Contemporary forms of international movement of capital

    Directory of Open Access Journals (Sweden)

    Sanja Šovran


    Full Text Available International movement of capital is one of the most important forms of international economic cooperation and achievement of strategic goals of enterprises. It leads to international diversification of business activities, strengthening of competitive advantage, changes in economic structures, employment rates and economic stability of participating countries. The present research addresses the contemporary forms of international movement of capital, with an emphasis on the public-private partnerships and concessions. The creation of different forms of public-private partnerships (PPPs in Serbia gained in importance in the early ‘90s of the 20th century. PPP implies joint activities within the framework of which the public and private sector pool resources, especially financial capital and expertise in order to meet the public needs of local, regional or national significance for adequate resource allocation. This type of partnership between the public and private sector has become an effective way towards a more rational use of limited resources and development of business entities from different sectors. The partnership of the public and private sector is particularly important in the construction and maintenance of transportation and other infrastructure facilities. Concessions represent a special form of public-private partnerships.

  18. "Mature Regionalism" and the Genesis of "Functional Projects": "Educational Regionalism" in Small (and Micro-States) (United States)

    Jules, Tavis D.


    This article advances that the movement towards "deeper" Caribbean integration has generated a shift from "immature" regionalism to a "mature" form of regionalism. Thus, mature regionalism, a new governance mechanism, in regulating the institutional and legal framework of Caribbean Single Market and Economy is…

  19. Cold-formed steel design

    CERN Document Server

    Yu, Wei-Wen


    The definitive text in the field, thoroughly updated and expanded Hailed by professionals around the world as the definitive text on the subject, Cold-Formed Steel Design is an indispensable resource for all who design for and work with cold-formed steel. No other book provides such exhaustive coverage of both the theory and practice of cold-formed steel construction. Updated and expanded to reflect all the important developments that have occurred in the field over the past decade, this Fourth Edition of the classic text provides you with more of the detailed, up-to-the-minute techni

  20. Differential forms theory and practice

    CERN Document Server

    Weintraub, Steven H


    Differential forms are utilized as a mathematical technique to help students, researchers, and engineers analyze and interpret problems where abstract spaces and structures are concerned, and when questions of shape, size, and relative positions are involved. Differential Forms has gained high recognition in the mathematical and scientific community as a powerful computational tool in solving research problems and simplifying very abstract problems through mathematical analysis on a computer. Differential Forms, 2nd Edition, is a solid resource for students and professionals needing a solid g

  1. Waste forms for plutonium disposition

    International Nuclear Information System (INIS)

    Johnson, S.G.; O'Holleran, T.P.; Frank, S.M.; Meyer, M.K.; Hanson, M.; Staples, B.A.; Knecht, D.A.; Kong, P.C.


    The field of plutonium disposition is varied and of much importance, since the Department of Energy has decided on the hybrid option for disposing of the weapons materials. This consists of either placing the Pu into mixed oxide fuel for reactors or placing the material into a stable waste form such as glass. The waste form used for Pu disposition should exhibit certain qualities: (1) provide for a suitable deterrent to guard against proliferation; (2) be of minimal volume, i.e., maximize the loading; and (3) be reasonably durable under repository-like conditions. This paper will discuss several Pu waste forms that display promising characteristics

  2. Strengthening regional safeguards

    International Nuclear Information System (INIS)

    Palhares, L.; Almeida, G.; Mafra, O.


    Nuclear cooperation between Argentina and Brazil has been growing since the early 1980's and as it grew, so did cooperation with the US Department of Energy (DOE). The Brazilian-Argentine Agency for Accounting and Control of Nuclear Materials (ABACC) was formed in December 1991 to operate the Common System of Accounting and Control of Nuclear Materials (SCCC). In April 1994, ABACC and the DOE signed an Agreement of Cooperation in nuclear material safeguards. This cooperation has included training safeguards inspectors, exchanging nuclear material measurement and containment and surveillance technology, characterizing reference materials, and studying enrichment plant safeguards. The goal of the collaboration is to exchange technology, evaluate new technology in Latin American nuclear facilities, and strengthen regional safeguards. This paper describes the history of the cooperation, its recent activities, and future projects. The cooperation is strongly supported by all three governments: the Republics of Argentina and Brazil and the United States

  3. Regional transmission subsystem planning

    Energy Technology Data Exchange (ETDEWEB)

    Costa Bortoni, Edson da [Quadrante Softwares Especializados Ltda., Itajuba, MG (Brazil); Bajay, Sergio Valdir; Barros Correia, Paulo de [Universidade Estadual de Campinas, SP (Brazil). Faculdade de Engenharia Mecanica; Santos, Afonso Henriques Moreira; Haddad, Jamil [Escola Federal de Engenharia de Itajuba, MG (Brazil)


    This work presents an approach for the planning of transmission systems by employing mixed--integer linear programming to obtain a cost and operating characteristics optimized system. The voltage loop equations are written in a modified form, so that, at the end of the analysis, the model behaves as a DC power flow, with the help of the two Kirchhoff`s laws, exempting the need of interaction with an external power flow program for analysis of the line loading. The model considers the occurrence of contingencies, so that the final result is a network robust to the most severe contingencies. This whole technique is adapted to the regional electric power transmission subsystems. (author) 9 refs., 4 figs.

  4. Acoustic holograms of active regions

    International Nuclear Information System (INIS)

    Chou, Dean-Yi


    We propose a method to study solar magnetic regions in the solar interior with the principle of optical holography. A magnetic region in the solar interior scatters the solar background acoustic waves. The scattered waves and background waves could form an interference pattern on the solar surface. We investigate the feasibility of detecting this interference pattern on the solar surface, and using it to construct the three-dimensional scattered wave from the magnetic region with the principle of optical holography. In solar acoustic holography, the background acoustic waves play the role of reference wave; the magnetic region plays the role of the target object; the interference pattern, acoustic power map, on the solar surface plays the role of the hologram.

  5. Acoustic holograms of active regions

    Energy Technology Data Exchange (ETDEWEB)

    Chou, Dean-Yi [Physics Department, National Tsing Hua University, Hsinchu, 30013, Taiwan (China)], E-mail:


    We propose a method to study solar magnetic regions in the solar interior with the principle of optical holography. A magnetic region in the solar interior scatters the solar background acoustic waves. The scattered waves and background waves could form an interference pattern on the solar surface. We investigate the feasibility of detecting this interference pattern on the solar surface, and using it to construct the three-dimensional scattered wave from the magnetic region with the principle of optical holography. In solar acoustic holography, the background acoustic waves play the role of reference wave; the magnetic region plays the role of the target object; the interference pattern, acoustic power map, on the solar surface plays the role of the hologram.

  6. Myositis ossificans localisata pseudomalignant Form

    International Nuclear Information System (INIS)

    Grunt, J.; Jankovich, E.; Vasovicova, M.


    Authors presents computer tomography and angiographic findings of rare pseudomalignant form of myositis ossificans. Correct diagnosis achieved by complex evaluation of ascertain findings, including biopsy, enables proper treatment with excluding too radical therapy. 3 figs., 4 refs

  7. Forming lead-based anodes

    Energy Technology Data Exchange (ETDEWEB)

    Ogorodnichuk, V I; Voitsekhovich, R I


    Lead-based anodes can be produced by forming a layer of lead dioxide by chemical treatment in a solution of sulfuric acid in potassium permanganate at 80 to 100/sup 0/. The solution is mixed by compressed air. (RWR)

  8. Calculation of pion form factor

    International Nuclear Information System (INIS)

    Vahedi, N.; Amirarjomand, S.


    The pion form factor is calculated using the structure function Wsub(2), which incorporates kinematical constraints, threshold behaviour and scaling. The Bloom-Gilman sum rule is used and only the two leading Regge trajectories are taken into account

  9. Microdomain forming proteins in oncogenesis

    Directory of Open Access Journals (Sweden)

    I. B. Zborovskaya


    Full Text Available Lipid rafts are lateral assembles of cholesterol, sphingomyelin, glicosphingolipids and specific proteins within cell plasma membrane. These microdomains are involved into a number of important cellular processes including membrane rearrangement, protein internalization, signal transduction, entry of viruses into the cell. Some of lipid rafts are stabilized by special microdomain-forming proteins such as caveolins, SPFH domain containing superfamily, tetraspanins, galectins, which maintain integrity of rafts and regulate signal transduction via forming of “signalosomes”. Involvement of the different lipid rafts is necessary in many situations such as binding of growth factors with their receptors, integrin regulation, cytoskeleton and extracellular matrix rearrangements, vesicular transport, etc. However, such classes of microdomain-forming proteins are still considered separately from each other. In this review we tried to perform complex analysis of microdomain-forming proteins in regulation of cancer assotiated processes.

  10. Forms of Approximate Radiation Transport

    CERN Document Server

    Brunner, G


    Photon radiation transport is described by the Boltzmann equation. Because this equation is difficult to solve, many different approximate forms have been implemented in computer codes. Several of the most common approximations are reviewed, and test problems illustrate the characteristics of each of the approximations. This document is designed as a tutorial so that code users can make an educated choice about which form of approximate radiation transport to use for their particular simulation.

  11. Flexible forms of working hours


    Knapp, Viktor


    66 Abstract - Flexible forms of working hours This diploma thesis deals with the flexible forms of working hours and its goal is to describe this issue in intelligible and comprehensive way. It is being very interesting and current theme which is to a great extent not subject to direct legal regulations and provides its contracting parties with a big amount of freedom of contract. This fact assists in bigger flexibilization of labour market and represents a significant instrument in the fight...

  12. Star-forming Filament Models

    International Nuclear Information System (INIS)

    Myers, Philip C.


    New models of star-forming filamentary clouds are presented in order to quantify their properties and to predict their evolution. These 2D axisymmetric models describe filaments that have no core, one low-mass core, and one cluster-forming core. They are based on Plummer-like cylinders and spheroids that are bounded by a constant-density surface of finite extent. In contrast to 1D Plummer-like models, they have specific values of length and mass, they approximate observed column density maps, and their distributions of column density ( N -pdfs) are pole-free. Each model can estimate the star-forming potential of a core-filament system by identifying the zone of gas dense enough to form low-mass stars and by counting the number of enclosed thermal Jeans masses. This analysis suggests that the Musca central filament may be near the start of its star-forming life, with enough dense gas to make its first ∼3 protostars, while the Coronet filament is near the midpoint of its star formation, with enough dense gas to add ∼8 protostars to its ∼20 known stars. In contrast, L43 appears to be near the end of its star-forming life, since it lacks enough dense gas to add any new protostars to the two young stellar objectsalready known.

  13. Standardized waste form test methods

    International Nuclear Information System (INIS)

    Slate, S.C.


    The Materials Characterization Center (MCC) is developing standard tests to characterize nuclear waste forms. Development of the first thirteen tests was originally initiated to provide data to compare different high-level waste (HLW) forms and to characterize their basic performance. The current status of the first thirteen MCC tests and some sample test results is presented: The radiation stability tests (MCC-6 and 12) and the tensile-strength test (MCC-11) are approved; the static leach tests (MCC-1, 2, and 3) are being reviewed for full approval; the thermal stability (MCC-7) and microstructure evaluation (MCC-13) methods are being considered for the first time; and the flowing leach tests methods (MCC-4 and 5), the gas generation methods (MCC-8 and 9), and the brittle fracture method (MCC-10) are indefinitely delayed. Sample static leach test data on the ARM-1 approved reference material are presented. Established tests and proposed new tests will be used to meet new testing needs. For waste form production, tests on stability and composition measurement are needed to provide data to ensure waste form quality. In transportation, data are needed to evaluate the effects of accidents on canisterized waste forms. The new MCC-15 accident test method and some data are presented. Compliance testing needs required by the recent draft repository waste acceptance specifications are described. These specifications will control waste form contents, processing, and performance. 2 references, 2 figures

  14. Standardized waste form test methods

    International Nuclear Information System (INIS)

    Slate, S.C.


    The Materials Characterization Center (MCC) is developing standard tests to characterize nuclear waste forms. Development of the first thirteen tests was originally initiated to provide data to compare different high-level waste (HLW) forms and to characterize their basic performance. The current status of the first thirteen MCC tests and some sample test results are presented: the radiation stability tests (MCC-6 and 12) and the tensile-strength test (MCC-11) are approved; the static leach tests (MCC-1, 2, and 3) are being reviewed for full approval; the thermal stability (MCC-7) and microstructure evaluation (MCC-13) methods are being considered for the first time; and the flowing leach test methods (MCC-4 and 5), the gas generation methods (MCC-8 and 9), and the brittle fracture method (MCC-10) are indefinitely delayed. Sample static leach test data on the ARM-1 approved reference material are presented. Established tests and proposed new tests will be used to meet new testing needs. For waste form production, tests on stability and composition measurement are needed to provide data to ensure waste form quality. In transporation, data are needed to evaluate the effects of accidents on canisterized waste forms. The new MCC-15 accident test method and some data are presented. Compliance testing needs required by the recent draft repository waste acceptance specifications are described. These specifications will control waste form contents, processing, and performance

  15. Form 6 - gas balancing agreement

    International Nuclear Information System (INIS)



    In 1988, a special Committee of the Rocky Mountain Mineral Law Foundation undertook a project to draft a model from gas balancing agreement. This project was initiated at the request of a number of Foundation members who felt that a model form gas balancing agreement would facilitate the negotiation of operating agreement, since gas balancing issues had become sticking points in the process. The Committee was composed of attorneys representing a wide cross-section of the oil and gas industry including both major and independent oil companies, production companies with interstate pipeline affiliates, and private practitioners. The Committee attempted to address the more controversial issues in gas balancing with optional provisions in the Form. To facilitate the negotiation process, the number of optional provisions was minimized. This form may be used as an Appendix to the new A.A.P.L. Form 610-1989 Model Form Operating Agreement. This book includes provision of this Form which are: Ownership of gas production; Balancing of production accounts; Cash balancing upon depletion; Deliverability tests; Nominations; Statements; Payment of taxes; Operating expenses; Overproducing allowable; Payment of leasehold burdens; Operator's liability; Successors and assigns; Audits; Arbitration; and Operator's fees

  16. Star-forming Filament Models

    Energy Technology Data Exchange (ETDEWEB)

    Myers, Philip C., E-mail: [Harvard-Smithsonian Center for Astrophysics, 60 Garden Street, Cambridge, MA 02138 (United States)


    New models of star-forming filamentary clouds are presented in order to quantify their properties and to predict their evolution. These 2D axisymmetric models describe filaments that have no core, one low-mass core, and one cluster-forming core. They are based on Plummer-like cylinders and spheroids that are bounded by a constant-density surface of finite extent. In contrast to 1D Plummer-like models, they have specific values of length and mass, they approximate observed column density maps, and their distributions of column density ( N -pdfs) are pole-free. Each model can estimate the star-forming potential of a core-filament system by identifying the zone of gas dense enough to form low-mass stars and by counting the number of enclosed thermal Jeans masses. This analysis suggests that the Musca central filament may be near the start of its star-forming life, with enough dense gas to make its first ∼3 protostars, while the Coronet filament is near the midpoint of its star formation, with enough dense gas to add ∼8 protostars to its ∼20 known stars. In contrast, L43 appears to be near the end of its star-forming life, since it lacks enough dense gas to add any new protostars to the two young stellar objectsalready known.

  17. Conjoint Forming - Technologies for Simultaneous Forming and Joining

    International Nuclear Information System (INIS)

    Groche, P; Wohletz, S; Mann, A; Krech, M; Monnerjahn, V


    The market demand for new products optimized for e. g. lightweight applications or smart components leads to new challenges in production engineering. Hybrid structures represent one promising approach. They aim at higher product performance by using a suitable combination of different materials. The developments of hybrid structures stimulate the research on joining of dissimilar materials. Since they allow for joining dissimilar materials without external heating technologies based on joining by plastic deformation seem to be of special attractiveness. The paper at hand discusses the conjoint forming approach. This approach combines forming and joining in one process. Two or more workpieces are joined while at least one workpiece is plastically deformed. After presenting the fundamental joining mechanisms, the conjoint forming approach is discussed comprehensively. Examples of conjoint processes demonstrate the effectiveness and reveal the underlying phenomena. (paper)

  18. Voice as Form of Life and Life Form

    Directory of Open Access Journals (Sweden)

    Sandra Laugier


    Full Text Available This paper studies the concept of form of life as central to ordinary language philosophy (as understood in Wittgenstein’s, Austin’s and Stanley Cavell’s work: philosophy of our language as spoken; pronounced by a human voice within a form of life. Such an approach to Wittgenstein’s later philosophy shifts the question of the common use of language – central to Wittgenstein’s Investigations – to the definition of the subject as voice, and to the reinvention of subjectivity in language. The voice is both a subjective and common expression: it is what makes it possible for my individual voice, or claim, to become shared and for our forms of life to be intertwined with a lifeform.

  19. Regional Courts as Judicial Brakes?

    Directory of Open Access Journals (Sweden)

    Metcalf Katrin Nyman


    Full Text Available The article examines how regional integration courts can act as judicial brakes, at a time when “constitutional coups” – leaders staying in power past constitutional time limits or other forms of actions against the spirit if not always the letter of the constitution – are alarmingly common. The article discusses how regional courts can be used to modify or protect national rule of law and the constitutional order from the outside (i.e. from the regional integration aspect and the extent to which this can be valid particularly to promote a uniform interpretation and application of human rights. Although this trend is visible in Europe, it is more striking, because less expected, on other continents, in particular Africa and the Americas, where the developments take place in less than perfect democratic environments. The article contains evidence from cases dealt with in the various regional courts, supporting that a system of political and judicial oversight, especially in regions with weak or fragile democratic systems, can be a useful addition to national judicial or other mechanisms of protection of rule of law and control of the executive. Action by regional courts helps defeat perceptions of majoritarian politics, which in many countries allow for the winner to take all. Under a system of regional oversight, states become aware of the limits they themselves have set and citizens become aware of their possibilities to challenge political power.

  20. Regional alternative transportation evaluation report - Region 4 (United States)


    The U.S. Fish and Wildlife Service (FWS) and the U.S. Department of Transportation (DOT) Volpe Center (Volpe Center) conducted a regional alternative transportation evaluation (RATE) in Region 4, which is comprised of Alabama, Arkansas, Florida, Geor...

  1. Regional alternative transportation evaluation report - region 2 (United States)


    The U.S. Fish and Wildlife Service (FWS) and the U.S. Department of Transportation (DOT) Volpe : Center (Volpe Center) conducted a regional alternative transportation evaluation (RATE) in Region 2, : which is comprised of Arizona, Oklahoma, New Mexic...

  2. Regional alternative transportation evaluation report - region 5 (United States)


    The U.S. Fish and Wildlife Service (FWS) and the U.S. Department of Transportation (DOT) Volpe Center (Volpe Center) conducted a regional alternative transportation evaluation (RATE) in Region 3, which is comprised of Illinois, Indiana, Iowa, Michiga...

  3. TRASYS form factor matrix normalization (United States)

    Tsuyuki, Glenn T.


    A method has been developed for adjusting a TRASYS enclosure form factor matrix to unity. This approach is not limited to closed geometries, and in fact, it is primarily intended for use with open geometries. The purpose of this approach is to prevent optimistic form factors to space. In this method, nodal form factor sums are calculated within 0.05 of unity using TRASYS, although deviations as large as 0.10 may be acceptable, and then, a process is employed to distribute the difference amongst the nodes. A specific example has been analyzed with this method, and a comparison was performed with a standard approach for calculating radiation conductors. In this comparison, hot and cold case temperatures were determined. Exterior nodes exhibited temperature differences as large as 7 C and 3 C for the hot and cold cases, respectively when compared with the standard approach, while interior nodes demonstrated temperature differences from 0 C to 5 C. These results indicate that temperature predictions can be artificially biased if the form factor computation error is lumped into the individual form factors to space.

  4. Pre-exposure to moving form enhances static form sensitivity.

    Directory of Open Access Journals (Sweden)

    Thomas S A Wallis

    Full Text Available BACKGROUND: Motion-defined form can seem to persist briefly after motion ceases, before seeming to gradually disappear into the background. Here we investigate if this subjective persistence reflects a signal capable of improving objective measures of sensitivity to static form. METHODOLOGY/PRINCIPAL FINDINGS: We presented a sinusoidal modulation of luminance, masked by a background noise pattern. The sinusoidal luminance modulation was usually subjectively invisible when static, but visible when moving. We found that drifting then stopping the waveform resulted in a transient subjective persistence of the waveform in the static display. Observers' objective sensitivity to the position of the static waveform was also improved after viewing moving waveforms, compared to viewing static waveforms for a matched duration. This facilitation did not occur simply because movement provided more perspectives of the waveform, since performance following pre-exposure to scrambled animations did not match that following pre-exposure to smooth motion. Observers did not simply remember waveform positions at motion offset, since removing the waveform before testing reduced performance. CONCLUSIONS/SIGNIFICANCE: Motion processing therefore interacts with subsequent static visual inputs in a way that can improve performance in objective sensitivity measures. We suggest that the brief subjective persistence of motion-defined forms that can occur after motion offsets is a consequence of the decay of a static form signal that has been transiently enhanced by motion processing.

  5. Form Filling with SCC in a Vertical Form

    DEFF Research Database (Denmark)

    Thrane, Lars Nyholm


    This paper presents the results obtained from two different vertical form filling experiments with SCC that have been completed as part of the experimental work in an ongoing Ph.D project. The project is carried out at the Danish Technological Institute in collaboration with the Technical...

  6. Automorphic Forms and Mock Modular Forms in String Theory (United States)

    Nazaroglu, Caner

    We study a variety of modular invariant objects in relation to string theory. First, we focus on Jacobi forms over generic rank lattices and Siegel forms that appear in N = 2, D = 4 compactifications of heterotic string with Wilson lines. Constraints from low energy spectrum and modularity are employed to deduce the relevant supersymmetric partition functions entirely. This procedure is applied on models that lead to Jacobi forms of index 3, 4, 5 as well as Jacobi forms over root lattices A2 and A3. These computations are then checked against an explicit orbifold model which can be Higgsed to the models under question. Models with a single Wilson line are then studied in detail with their relation to paramodular group Gammam as T-duality group made explicit. These results on the heterotic string side are then turned into predictions for geometric invariants using TypeII - Heterotic duality. Secondly, we study theta functions for indenite signature lattices of generic signature. Building on results in literature for signature (n-1,1) and (n-2,2) lattices, we work out the properties of generalized error functions which we call r-tuple error functions. We then use these functions to build such indenite theta functions and describe their modular completions.

  7. Sundhedsprofil for region og kommuner 2008

    DEFF Research Database (Denmark)

    Glümer, Charlotte; Hilding-Nørkjær, Helle; Jensen, Helene Nordahl


    Denne første sundhedsprofil for Region Hovedstaden dækker samtlige 29 kommuner i regionen og bidrager med detaljeret viden om de voksne borgeres sundhed, sygelighed og sundhedsadfærd. Formålet med sundhedsprofilen er at fungere som et planlægningsredskab både for kommuner og region. Sundhedsprofi...

  8. Siberian Regional Identity in the Context of Historical Consciousness (Content Analysis of Tomsk Regional Media

    Directory of Open Access Journals (Sweden)

    A V Bocharov


    Full Text Available The article presents a model to study the Siberian regional identity in the context of historical consciousness, as well as the results of its practical application in the content analysis of the publications by the Tomsk regional media. On the basis of the content analysis procedures the author demonstrates how, through historical memory, the regional identity is formed and manifested in the regional media in various spheres of society.

  9. Induction interview form in EDH

    CERN Multimedia

    Information technology Department, AIS (Administrative Information Services) Group,


    As part of the efforts to rationalise administrative procedures, the IT and HR Departments have developed a new EDH form for induction interviews, which can be accessed using the link below. In accordance with Administrative Circular No. 2 ('Recruitment, Appointment and possible developments regarding the contractual position of Staff Members', Rev. 3), the work and training objectives to be achieved during the probation period shall be specified in writing to all new staff members during an induction interview. The interview shall take place between the new staff member and his supervisor within six weeks of him taking up his duties at the latest. (or from the EDH desktop, by clicking on 'Other Tasks' and going to the 'HR & Training' heading) Please note that this form is to be used exclusively for new staff members. A separate EDH form will be developed for fellows. Information technology Department, AIS (Administrative Information Services) Group Human...

  10. Induction interview form in EDH

    CERN Document Server

    Information technology Department, AIS (Administrative Information Services) Group


    As part of the efforts to rationalise administrative procedures, the IT and HR Departments have developed a new EDH form for induction interviews, which can be accessed using the link below. In accordance with Administrative Circular No. 2 ('Recruitment, Appointment and possible developments regarding the contractual position of Staff Members', Rev. 3), the work and training objectives to be achieved during the probation period shall be specified in writing to all new staff members during an induction interview. The interview shall take place between the new staff member and his supervisor within six weeks of his taking up his duties at the latest. (or from the EDH desktop, by clicking on 'Other Tasks' and going to the 'HR & Training' heading) Please note that this form is to be used exclusively for new staff members. A separate EDH form will be developed for fellows.Information technology Department, AIS (Administrative Information Services) Group Human Re...

  11. Mathematics and Forms of Life

    Directory of Open Access Journals (Sweden)

    Severin Schroeder


    Full Text Available According to Wittgenstein, mathematics is embedded in, and partly constituting, a form of life. Hence, to imagine different, alternative forms of elementary mathematics, we should have to imagine different practices, different forms of life in which they could play a role. If we tried to imagine a radically different arithmetic we should think either of a strange world (in which objects unaccountably vanish or appear or of people acting and responding in very peculiar ways. If such was their practice, a calculus expressing the norms of representation they applied could not be called false. Rather, our criticism could only be to dismiss such a practice as foolish and to dismiss their norms as too different from ours to be called ‘mathematics’.

  12. Toroidal helical quartz forming machine

    International Nuclear Information System (INIS)

    Hanks, K.W.; Cole, T.R.


    The Scyllac fusion experimental machine used 10 cm diameter smooth bore discharge tubes formed into a simple toroidal shape prior to 1974. At about that time, it was discovered that a discharge tube was required to follow the convoluted shape of the load coil. A machine was designed and built to form a fused quartz tube with a toroidal shape. The machine will accommodate quartz tubes from 5 cm to 20 cm diameter forming it into a 4 m toroidal radius with a 1 to 5 cm helical displacement. The machine will also generate a helical shape on a linear tube. Two sets of tubes with different helical radii and wavelengths have been successfully fabricated. The problems encountered with the design and fabrication of this machine are discussed

  13. Diffusion from cylindrical waste forms

    International Nuclear Information System (INIS)

    Thomas, G.F.


    The diffusion of a single component material from a finite cylindrical waste form, initially containing a uniform concentration of the material, is investigated. Under the condition that the cylinder is maintained in a well-stirred bath, expressions for the fractional inventory leached and the leach rate are derived with allowance for the possible permanent immobilization of the diffusant through its decay to a stable product and/or its irreversible reaction with the waste form matrix. The usefulness of the reported results in nuclear waste disposal applications is emphasized. The results reported herein are related to those previously derived at Oak Ridge National Laboratory by Bell and Nestor. A numerical scheme involving the partial decoupling of nested infinite summations and the use of rapidly converging rational approximants is recommended for the efficient implementation of the expressions derived to obtain reliable estimates of the bulk diffusion constant and the rate constant describing the diffusant-waste form interaction from laboratory data

  14. Substrate system for spray forming

    Energy Technology Data Exchange (ETDEWEB)

    Chu, Men G. (Export, PA); Chernicoff, William P. (Harrisburg, PA)


    A substrate system for receiving a deposit of sprayed metal droplets including a movable outer substrate on which the sprayed metal droplets are deposited. The substrate system also includes an inner substrate disposed adjacent the outer substrate where the sprayed metal droplets are deposited on the outer substrate. The inner substrate includes zones of differing thermal conductivity to resist substrate layer porosity and to resist formation of large grains and coarse constituent particles in a bulk layer of the metal droplets which have accumulated on the outer substrate. A spray forming apparatus and associated method of spray forming a molten metal to form a metal product using the substrate system of the invention is also provided.

  15. Hereditary forms of breast cancer

    International Nuclear Information System (INIS)

    Bella, V.


    Breast cancer is the most common oncologic disease in the female population. Besides the sporadic occurrence it occurs in the familial and hereditary form. Persons with the occurrence of positive family anamnesis of breast cancer should be actively investigated. In the indicated cases it is necessary to send the woman to genetic examination. In case that the hereditary form of breast cancer is affirmed it is necessary to examine her family relatives. Women with the hereditary form of breast cancer occur in about 5 – 10 % portion from all women diagnosed with breast cancer. Nowadays we already know that 80 % of hereditary breast cancers are due to germ mutations in BRCA 1 and BRCA 2 gene. Persons with detected gene mutations must be dispensarized in the centres intended for it. (author)

  16. New directions in Dirichlet forms

    CERN Document Server

    Jost, Jürgen; Mosco, Umberto; Rockner, Michael; Sturm, Karl-Theodor


    The theory of Dirichlet forms brings together methods and insights from the calculus of variations, stochastic analysis, partial differential and difference equations, potential theory, Riemannian geometry and more. This book features contributions by leading experts and provides up-to-date, authoritative accounts on exciting developments in the field and on new research perspectives. Topics covered include the following: stochastic analysis on configuration spaces, specifically a mathematically rigorous approach to the stochastic dynamics of Gibbs measures and infinite interacting particle systems; subelliptic PDE, homogenization, and fractals; geometric aspects of Dirichlet forms on metric spaces and function theory on such spaces; generalized harmonic maps as nonlinear analogues of Dirichlet forms, with an emphasis on non-locally compact situations; and a stochastic approach based on Brownian motion to harmonic maps and their regularity. Various new connections between the topics are featured, and it is de...

  17. FORM version 4.0 (United States)

    Kuipers, J.; Ueda, T.; Vermaseren, J. A. M.; Vollinga, J.


    We present version 4.0 of the symbolic manipulation system FORM. The most important new features are manipulation of rational polynomials and the factorization of expressions. Many other new functions and commands are also added; some of them are very general, while others are designed for building specific high level packages, such as one for Gröbner bases. New is also the checkpoint facility, that allows for periodic backups during long calculations. Finally, FORM 4.0 has become available as open source under the GNU General Public License version 3. Program summaryProgram title: FORM. Catalogue identifier: AEOT_v1_0 Program summary URL: Program obtainable from: CPC Program Library, Queen's University, Belfast, N. Ireland Licensing provisions: GNU General Public License, version 3 No. of lines in distributed program, including test data, etc.: 151599 No. of bytes in distributed program, including test data, etc.: 1 078 748 Distribution format: tar.gz Programming language: The FORM language. FORM itself is programmed in a mixture of C and C++. Computer: All. Operating system: UNIX, LINUX, Mac OS, Windows. Classification: 5. Nature of problem: FORM defines a symbolic manipulation language in which the emphasis lies on fast processing of very large formulas. It has been used successfully for many calculations in Quantum Field Theory and mathematics. In speed and size of formulas that can be handled it outperforms other systems typically by an order of magnitude. Special in this version: The version 4.0 contains many new features. Most important are factorization and rational arithmetic. The program has also become open source under the GPL. The code in CPC is for reference. You are encouraged to upload the most recent sources from because of frequent bug fixes. Solution method: See "Nature of Problem", above. Additional comments: NOTE: The code in CPC is for reference. You are encouraged

  18. Differential forms on electromagnetic networks

    CERN Document Server

    Balasubramanian, N V; Sen Gupta, D P


    Differential Forms on Electromagnetic Networks deals with the use of combinatorial techniques in electrical circuit, machine analysis, and the relationship between circuit quantities and electromagnetic fields. The monograph is also an introduction to the organization of field equations by the methods of differential forms. The book covers topics such as algebraic structural relations in an electric circuit; mesh and node-pair analysis; exterior differential structures; generalized Stoke's theorem and tensor analysis; and Maxwell's electromagnetic equation. Also covered in the book are the app

  19. The Textile Form of Sound

    DEFF Research Database (Denmark)

    Bendixen, Cecilie

    Sound is a part of architecture, and sound is complex. Upon this, sound is invisible. How is it then possible to design visual objects that interact with the sound? This paper addresses the problem of how to get access to the complexity of sound and how to make textile material revealing the form...... goemetry by analysing the sound pattern at a specific spot. This analysis is done theoretically with algorithmic systems and practical with waves in water. The paper describes the experiments and the findings, and explains how an analysis of sound can be catched in a textile form....


    Directory of Open Access Journals (Sweden)

    I. V. Morozov


    Full Text Available The article reveals the possibility of the Southern Federal District to form regional network structures. The prospects for the formation of networks in the region in relation to the Olympic Winter Games Sochi 2014.

  1. Users guide to REGIONAL-1: a regional assessment model

    International Nuclear Information System (INIS)

    Davis, W.E.; Eadie, W.J.; Powell, D.C.


    A guide was prepared to allow a user to run the PNL long-range transport model, REGIONAL 1. REGIONAL 1 is a computer model set up to run atmospheric assessments on a regional basis. The model has the capability of being run in three modes for a single time period. The three modes are: (1) no deposition, (2) dry deposition, (3) wet and dry deposition. The guide provides the physical and mathematical basis used in the model for calculating transport, diffusion, and deposition for all three modes. Also the guide includes a program listing with an explanation of the listings and an example in the form of a short-term assessment for 48 hours. The purpose of the example is to allow a person who has past experience with programming and meteorology to operate the assessment model and compare his results with the guide results. This comparison will assure the user that the program is operating in a proper fashion

  2. Dispersive analysis of the pion transition form factor (United States)

    Hoferichter, M.; Kubis, B.; Leupold, S.; Niecknig, F.; Schneider, S. P.


    We analyze the pion transition form factor using dispersion theory. We calculate the singly-virtual form factor in the time-like region based on data for the cross section, generalizing previous studies on decays and scattering, and verify our result by comparing to data. We perform the analytic continuation to the space-like region, predicting the poorly-constrained space-like transition form factor below , and extract the slope of the form factor at vanishing momentum transfer . We derive the dispersive formalism necessary for the extension of these results to the doubly-virtual case, as required for the pion-pole contribution to hadronic light-by-light scattering in the anomalous magnetic moment of the muon.

  3. Conformal symmetry and pion form factor: Soft and hard contributions

    International Nuclear Information System (INIS)

    Choi, Ho-Meoyng; Ji, Chueng-Ryong


    We discuss a constraint of conformal symmetry in the analysis of the pion form factor. The usual power-law behavior of the form factor obtained in the perturbative QCD analysis can also be attained by taking negligible quark masses in the nonperturbative quark model analysis, confirming the recent AdS/CFT correspondence. We analyze the transition from soft to hard contributions in the pion form factor considering a momentum-dependent dynamical quark mass from an appreciable constituent quark mass at low momentum region to a negligible current quark mass at high momentum region. We find a correlation between the shape of nonperturbative quark distribution amplitude and the amount of soft and hard contributions to the pion form factor

  4. Regional Management Plan: Summary report

    International Nuclear Information System (INIS)

    Drobny, N.L.


    This summary report describes the results of a 16-month project to develop a Regional Management Plan for low-level radioactive waste management in a seven-state area. The seven states are Indiana, Iowa, Michigan, Minnesota, Missouri, Ohio, and Wisconsin. These states have formed the Midwest Interstate Low-Level Radioactive Waste Commission in accord with Congressional requirements established in 1980. 14 refs., 13 figs., 9 tabs

  5. Measurement of the Charged Pion Electromagnetic Form Factor

    International Nuclear Information System (INIS)

    J. Volmer; David Abbott; H. Anklin; Chris Armstrong; John Arrington; K. Assamagan; Steven Avery; Oliver K. Baker; Henk Blok; C. Bochna; Ed Brash; Herbert Breuer; Nicholas Chant; Jim Dunne; Tom Eden; Rolf Ent; David Gaskell; Ron Gilman; Kenneth Gustafsson; Wendy Hinton; Garth Huber; Hal Jackson; Mark K. Jones; Cynthia Keppel; P.H. Kim; Wooyoung Kim; Andi Klein; Doug Koltenuk; Meme Liang; George Lolos; Allison Lung; David Mack; D. McKee; David Meekins; Joseph Mitchell; H. Mkrtchian; B. Mueller; Gabriel Niculescu; Ioana Niculescu; D. Pitz; D. Potterveld; Liming Qin; Juerg Reinhold; I.K. Shin; Stepan Stepanyan; V. Tadevosian; L.G. Tang; R.L.J. van der Meer; K. Vansyoc; D. Van Westrum; Bill Vulcan; Stephen Wood; Chen Yan; W.X. Zhao; Beni Zihlmann


    Separated longitudinal and transverse structure functions for the reaction 1H(e,eprime pi+)n were measured in the momentum transfer region Q2=0.6-1.6 (GeV/c)**2 at a value of the invariant mass W=1.95 GeV. New values for the pion charge form factor were extracted from the longitudinal cross section by using a recently developed Regge model. The results indicate that the pion form factor in this region is larger than previously assumed and is consistent with a monopole parameterization fitted to very low Q2 elastic data

  6. Form factors and structure functions of hadrons in parton model

    International Nuclear Information System (INIS)

    Volkonskij, N.Yu.


    The hadron charge form factors and their relation to the deep-inelastic lepton-production structure functions in the regions of asymptotically high and small momentum transfer Q 2 are studied. The nucleon and pion charge radii are calculated. The results of calculations are in good agreement with the experimental data. The K- and D-meson charge radii are estimated. In the region of asymptotically high Q 2 the possibility of Drell-Yan-West relation violation is analyzed. It is shown, that for pseudoscalar mesons this relation is violated. The relation between the proton and neutron form factor asymptotics is obtained


    International Nuclear Information System (INIS)

    Boquien, M.; Calzetti, D.; Hong, S.; Kennicutt, R.; Dale, D.; Engelbracht, C.; Portouw, J.; Gordon, K. D.; Lee, J. C.


    Compared to starburst galaxies, normal star-forming galaxies have been shown to display a much larger dispersion of the dust attenuation at fixed reddening through studies of the IRX-β diagram (the IR/UV ratio 'IRX' versus the UV color 'β'). To investigate the causes of this larger dispersion and attempt to isolate second parameters, we have used GALEX UV, ground-based optical, and Spitzer infrared imaging of eight nearby galaxies, and examined the properties of individual UV and 24 μm selected star-forming regions. We concentrated on star-forming regions, in order to isolate simpler star formation histories than those that characterize whole galaxies. We find that (1) the dispersion is not correlated with the mean age of the stellar populations; (2) a range of dust geometries and dust extinction curves are the most likely causes for the observed dispersion in the IRX-β diagram, (3) together with some potential dilution of the most recent star-forming population by older unrelated bursts, at least in the case of star-forming regions within galaxies; and (4) we also recover some general characteristics of the regions, including a tight positive correlation between the amount of dust attenuation and the metal content. Although generalizing our results to whole galaxies may not be immediate, the possibility of a range of dust extinction laws and geometries should be accounted for in the latter systems as well.

  8. QCD constraints for the electromagnetic form factor of the pion

    International Nuclear Information System (INIS)

    Machet, B.


    Using the modulus representation, we derive constraints for the behaviour of the electromagnetic form factor of the pion in the time like region [1 GeV 2 , + infinity[, from information given by perturbative QCD in the space like region [-μ 2 , - infinity[. A phenomenological μ dependent upper bound for the exponent of the first non leading logarithmic correction is deduced. Restrictions and problems of the method are discussed

  9. Severe forms of food allergy

    Directory of Open Access Journals (Sweden)

    Emanuel Sarinho


    Conclusion: Severe food allergy may occur in the form of anaphylaxis and food‐protein‐induced enterocolitis syndrome, which are increasingly observed in the pediatric emergency room; hence, pediatricians must be alert so they can provide the immediate diagnosis and treatment.

  10. Fabrication Aware Form-finding

    DEFF Research Database (Denmark)

    Egholm Pedersen, Ole; Larsen, Niels Martin; Pigram, Dave


    This paper describes a design and construction method that combines two distinct material systems with fabrication aware form-finding and file-to-factory workflows. The method enables the fluent creation of complex materially efficient structures comprising high populations of geometrically uniqu...

  11. Normal forms in Poisson geometry

    NARCIS (Netherlands)

    Marcut, I.T.


    The structure of Poisson manifolds is highly nontrivial even locally. The first important result in this direction is Conn's linearization theorem around fixed points. One of the main results of this thesis (Theorem 2) is a normal form theorem in Poisson geometry, which is the Poisson-geometric

  12. Education fees – New forms

    CERN Multimedia


    The application forms for the payment of education fees have been updated and are now available in the Admin e-guide (under the “Useful Documents” heading):   Payment of education fees (including language course fees) – AC12A (form to be used by staff members recruited before 1 January 2007, with the exception of former “local staff”).   Payment of education fees – AC12B (form to be used by staff members recruited on or after 1 January 2007, by fellows, scientific associates and guest professors and by former “local staff” whose contracts started before 1 January 2007). The Education Fees service will continue to accept the old forms until the end of the current academic year, i.e. until 31 August 2015. Members of the personnel are reminded that any false declaration or failure to declare information with a view to deceiving others or achieving a gain that would result in a financial loss for CERN or...

  13. Smooth functors vs. differential forms

    NARCIS (Netherlands)

    Schreiber, U.; Waldorf, K.


    We establish a relation between smooth 2-functors defined on the path 2-groupoid of a smooth manifold and differential forms on this manifold. This relation can be understood as a part of a dictionary between fundamental notions from category theory and differential geometry. We show that smooth

  14. Green Lubricants for Metal Forming

    DEFF Research Database (Denmark)

    Bay, Niels


    The increasing focus on legislation towards diminishing the impact on working environment as well as external environment has driven efforts to develop new, environmentally benign lubricants for metal forming. The present paper gives an overview of these efforts to substitute environmentally...

  15. How Public Opinion is Formed (United States)

    Block, Edward M.


    Investigates the evolution of the definition of public relations by examining cultural and personal determinants of public opinion. Outlines functions of communicators and opinionmakers in forming and influencing public opinion. Available from: Public Relations Review, Ray Hiebert, Dean, College of Journalism, University of Maryland, College Park,…

  16. Models for Textile Composites Forming

    NARCIS (Netherlands)

    Akkerman, Remko; ten Thije, R.H.W.


    Drape of dry fabrics or prepregs was recognised as an important feature in composites forming operations from the start. In the 1950s the first mathematical models were developed based on purely kinematic arguments. The assumption of zero fibre strains and trellis deformations led to the socalled

  17. Technetium Immobilization Forms Literature Survey

    Energy Technology Data Exchange (ETDEWEB)

    Westsik, Joseph H.; Cantrell, Kirk J.; Serne, R. Jeffrey; Qafoku, Nikolla


    Of the many radionuclides and contaminants in the tank wastes stored at the Hanford site, technetium-99 (99Tc) is one of the most challenging to effectively immobilize in a waste form for ultimate disposal. Within the Hanford Tank Waste Treatment and Immobilization Plant (WTP), the Tc will partition between both the high-level waste (HLW) and low-activity waste (LAW) fractions of the tank waste. The HLW fraction will be converted to a glass waste form in the HLW vitrification facility and the LAW fraction will be converted to another glass waste form in the LAW vitrification facility. In both vitrification facilities, the Tc is incorporated into the glass waste form but a significant fraction of the Tc volatilizes at the high glass-melting temperatures and is captured in the off-gas treatment systems at both facilities. The aqueous off-gas condensate solution containing the volatilized Tc is recycled and is added to the LAW glass melter feed. This recycle process is effective in increasing the loading of Tc in the LAW glass but it also disproportionally increases the sulfur and halides in the LAW melter feed which increases both the amount of LAW glass and either the duration of the LAW vitrification mission or the required supplemental LAW treatment capacity.

  18. Temporal form in interaction design

    DEFF Research Database (Denmark)

    Vallgårda, Anna; Winther, Morten Trøstrup; Mørch, Nina


    temporal forms by letting a series of expert designers reflect upon them. We borrow a framework from Boorstin’s film theory in which he distinguishes between the voyeuristic, the vicarious, and the visceral experience. We show how to use rhythms, complexity, gentle or forceful behavior, etc., to create...

  19. Spin-forming Project Report

    Energy Technology Data Exchange (ETDEWEB)

    Switzner, Nathan; Henry, Dick


    In a second development order, spin-forming equipment was again evaluated using the test shape, a hemispherical shell. In this second development order, pure vanadium and alloy titanium (Ti-6Al-4V) were spin-formed, as well as additional copper and 21-6-9 stainless. In the first development order the following materials had been spin-formed: copper (alloy C11000 ETP), 6061 aluminum, 304L stainless steel, 21-6-9 stainless steel, and tantalum-2.5% tungsten. Significant challenges included properly adjusting the rotations-per-minute (RPM), cracking at un-beveled edges and laser marks, redressing of notches, surface cracking, non-uniform temperature evolution in the titanium, and cracking of the tailstock. Lessons learned were that 300 RPM worked better than 600 RPM for most materials (at the feed rate of 800 mm/min); beveling the edges to lower the stress reduces edge cracking; notches, laser marks, or edge defects in the preform doom the process to cracking and failure; coolant is required for vanadium spin-forming; increasing the number of passes to nine or more eliminates surface cracking for vanadium; titanium develops a hot zone in front of the rollers; and the tailstock should be redesigned to eliminate the cylindrical stress concentrator in the center.

  20. Nanodiamond particles forming photonic structures

    International Nuclear Information System (INIS)

    Grichko, Varvara; Tyler, Talmage; Grishko, Victor I; Shenderova, Olga


    Colloid suspensions of irregularly shaped, highly charged detonation nanodiamond particles are found to have unexpected optical properties, similar to those of photonic crystals. This finding is all the more surprising since the particles used in this work are far more polydisperse than those typically forming photonic crystals. Intensely iridescent structures have been fabricated using the centrifugation of aqueous suspensions of nanodiamonds

  1. Nanodiamond particles forming photonic structures

    Energy Technology Data Exchange (ETDEWEB)

    Grichko, Varvara; Tyler, Talmage; Grishko, Victor I; Shenderova, Olga [International Technology Center, 8100 Brownleigh Drive, Suite 120, Raleigh, NC 27617 (United States)], E-mail:


    Colloid suspensions of irregularly shaped, highly charged detonation nanodiamond particles are found to have unexpected optical properties, similar to those of photonic crystals. This finding is all the more surprising since the particles used in this work are far more polydisperse than those typically forming photonic crystals. Intensely iridescent structures have been fabricated using the centrifugation of aqueous suspensions of nanodiamonds.

  2. SuperFormLab: showing SuperFormLab

    DEFF Research Database (Denmark)


    bachelor program, followed by two years of master studies. The courses are offered equally to students from other design disciplines, e.g. industrial design. Teaching is mainly in English as the program is attended by a relatively large group of non-Danish students, who seek exactly this combination......3D-printing in clay and ceramic objects shaped by your own sounds and movements! Digital form transferred via CNC-milling to ornamental ceramic wall-cladding. Brave New World… Students and their teacher at SuperFormLab, the new ceramic workshop of the School of Design at the Royal Danish Academy...... of Fine Arts in Copenhagen, will be showing results of their investigations into the potential of combining digital technologies with ceramic materials. It is now possible to shape the most complex mathematical, virtual 3D objects through the use of advanced software-programs. And more than that – you can...

  3. Nanocomposites formed by ion implantation: Recent developments and future opportunities

    International Nuclear Information System (INIS)

    Meldrum, A.; Boatner, L.A.; White, C.W.


    Ion implantation is a versatile and powerful technique for forming many types of nanocrystalline precipitates embedded in the near-surface region of a wide variety of crystalline and amorphous host materials. The unique optical, electronic and magnetic properties of these nanocomposites has stimulated considerable recent research interest. In this review, we discuss recent developments in the field as well as some of the problems that currently hinder the potential applications of nanocomposites formed by ion implantation

  4. Regional cooperation prospects in Korea

    International Nuclear Information System (INIS)

    Yoon, Wan Ki


    The Republic of Korea follows a well-established nuclear nonproliferation policy and could consider regional cooperation as proposed by many nuclear experts over the years. Real problems exist in establishing cooperation, but as the nuclear industry continues to grow, the motivation increases. The US should be a partner in the regional cooperation also. This paper summarizes significant advances made by the NNCA in applying remote monitoring technologies to support international safeguards in the ROK, providing the technical foundation for the use of these technologies for transparency between partner countries. Concrete steps are proposed to form an institutional and then a governmental approach for transparency in the use of nuclear material and even, eventual establishment of a regional safeguards inspection regime. (author)

  5. Security assurances and regional stability

    International Nuclear Information System (INIS)

    Sanders, B.


    This paper discusses whether and how security assurances affect political stability in geographic regions. Before embarking on what is necessarily a limited analysis of a complex subject, I point out that the subject is by no means new. For centuries, vast areas of the world have been affected by forces used against them by more powerful States, which at one time or another incorporated large parts of them into overseas colonies or contiguous empires. The new factors are the emancipation of those areas into independent regions, made up of States that play their own parts in international affairs, and the possession by a handful of Powers, outside or on the edge of those regions, of a specific form of superior force: nuclear weapons. (author)

  6. Central Region Regionally Ecological Significant Areas (United States)

    Minnesota Department of Natural Resources — This is an analysis of regionally significant Terrestrial and Wetland Ecological Areas in the seven county metropolitan area. Individual forest, grassland and...

  7. Ecological sustainability and urban form


    Ivan Muñiz; Anna Galindo


    One controversial idea present in the debate on urban sustainability is that urban sprawl is an ecological stressing problem. We have tested this popular assumption by measuring the ecological footprint of commuting and housing of the 163 municipalities of the Barcelona Metropolitan Region and by relating the estimated values with residential density and accessibility, the fundamental determinant of residential density according to the Monocentric City Model.

  8. Unsplit bipolar pulse forming line (United States)

    Rhodes, Mark A [Pleasanton, CA


    A bipolar pulse forming transmission line module and system for linear induction accelerators having first, second, third, and fourth planar conductors which form a sequentially arranged interleaved stack having opposing first and second ends, with dielectric layers between the conductors. The first and second planar conductors are connected to each other at the first end, and the first and fourth planar conductors are connected to each other at the second end via a shorting plate. The third planar conductor is electrically connectable to a high voltage source, and an internal switch functions to short at the first end a high voltage from the third planar conductor to the fourth planar conductor to produce a bipolar pulse at the acceleration axis with a zero net time integral. Improved access to the switch is enabled by an aperture through the shorting plate and the proximity of the aperture to the switch.

  9. Strange mesonic transition form factor

    International Nuclear Information System (INIS)

    Goity, J.L.; Musolf, M.J.


    The strange-quark vector current ρ-to-π meson transition form factor is computed at one-loop order using strange meson intermediate states. A comparison is made with a φ-meson dominance model estimate. We find that one-loop contributions are comparable in magnitude to those predicted by φ-meson dominance. It is possible that the one-loop contribution can make the matrix element as large as those of the electromagnetic current mediating vector meson radiative decays. However, due to the quadratic dependence of the one-loop results on the hadronic form factor cutoff mass, a large uncertainty in the estimate of the loops is unavoidable. These results indicate that non-nucleonic strange quarks could contribute appreciable in moderate-parallel Q 2 parallel parity-violating electron-nucleus scattering measurements aimed at probing the strange-quark content of the nucleon. copyright 1996 The American Physical Society

  10. Terra firma-forme dermatosis

    Directory of Open Access Journals (Sweden)

    Emel Erkek


    Full Text Available Terra firma-forme dermatosis is characterized by ′dirty′ brown-grey cutaneous patches and plaques that can simply be eradicated by forceful swabbing with alcohol pads. The pathogenesis has been attributed to abnormal and delayed keratinization. Although affected patients present with typical lesions, the disorder is not well-known by dermatologists. In this report, we describe two patients with terra firma-forme dermatosis in the setting of xerosis cutis and atopic dermatitis. From a clinical point of view, we lay emphasis on its unique expression and diagnosis/treatment. From a histological perspective, we highlight its resemblance to dermatosis neglecta and speculate on the role of ′neglect′ in a patient with seemingly adequate hygiene. The role of urea containing emollients in the development of this disorder remains to be determined.

  11. The integral form of supergravity

    Energy Technology Data Exchange (ETDEWEB)

    Castellani, L. [Dipartimento di Scienze e Innovazione Tecnologica, Università del Piemonte Orientale,Viale T. Michel, 11, 15121 Alessandria (Italy); INFN - Sezione di Torino,via P. Giuria 1, 10125 Torino (Italy); Catenacci, R. [Dipartimento di Scienze e Innovazione Tecnologica, Università del Piemonte Orientale,Viale T. Michel, 11, 15121 Alessandria (Italy); Gruppo Nazionale di Fisica Matematica, INdAM,P.le Aldo Moro 5, 00185 Roma (Italy); Grassi, P.A. [Dipartimento di Scienze e Innovazione Tecnologica, Università del Piemonte Orientale,Viale T. Michel, 11, 15121 Alessandria (Italy); INFN - Sezione di Torino,via P. Giuria 1, 10125 Torino (Italy)


    By using integral forms we derive the superspace action of D=3,N=1 supergravity as an integral on a supermanifold. The construction is based on target space picture changing operators, here playing the rôle of Poincaré duals to the lower-dimensional spacetime surfaces embedded into the supermanifold. We show how the group geometrical action based on the group manifold approach interpolates between the superspace and the component supergravity actions, thus providing another proof of their equivalence.

  12. The FORM version of MINCER

    International Nuclear Information System (INIS)

    Larin, S.A.; Academy of Sciences of the USSR, Moscow; Tkachov, F.V.; McGill Univ., Montreal, PQ; Academy of Sciences of the USSR, Moscow; Vermaseren, J.A.M.


    The program MINCER for massless three-loop Feynman diagrams of the propagator type has been reprogrammed in the language of FORM. The new version is thoroughly optimized and can be run from a utility like the UNIX make, which allows one to conveniently process large numbers of diagrams. It has been used for some calculations that were previously not practical. (author). 22 refs.; 14 figs

  13. Urban Form and City Life


    Luque-Valdivia, J. (José)


    The compact city is often presented as an answer to sustainable urban development, the paper tries to stress the influence of urban form of the compact city itself in the kind of civic life La ciudad compacta se presenta con frecuencia como una respuesta al desarrollo urbano sostenible; el paper trata de identificar la influencia la forma urbana propia de la ciudad compacta en el tipo de vida ciudadana

  14. Forming a multinational joint venture

    International Nuclear Information System (INIS)

    Bhatia, N.K.; Garb, R.H.; Statton, T.D.


    This paper discusses the basis and mechanics for forming a multinational joint venture. The topics of the paper include the motivations for a joint venture, selection of the appropriate co-venturer, management of the multinational joint venture, and the joint venture agreement. The authors state that a joint venture is not applicable or desirable in all instances and to be successful, must be carefully planned

  15. A higher form (of) mediation

    International Nuclear Information System (INIS)

    Verlinde, Herman; Wang, L-T; Yavin, Itay; Wijnholt, Martijn


    We exhibit a simple and robust mechanism for bulk mediation of supersymmetry breaking between hidden and visible sectors localized on geometrically separated D-branes in type II string theory. The mediation proceeds via RR p-forms that couple via linear Chern-Simons terms to the abelian vector bosons on the branes. From a 4-d low energy perspective, the mechanism reduces to U(1) mediation

  16. Recall in extensive form games


    Klaus Ritzberger


    This paper considers characterizations of perfect recall in extensive form games. It is shown that perfect recall can be expressed in terms of choices without any reference to infomation sets. When information sets are taken into account, it is decomposable into an ordering of information sets and that players do not forget what they knew nor what they did. Thus, if information sets are partially ordered, then perfect recall is implied by the player's inability to refine her information from ...

  17. New Organizational Forms and IT


    Schwarzer, Bettina;Zerbe, Stefan;Krcmar, Helmut


    The availability of powerful IT/IS is percieved as a driving force as well as a necessary prerequisite for new organizational solutions. However, even though the close interre-latedness of organizational structure and IT/IS has been widely recognized for a long time, a thorough understanding of their linkage is still missing. The research project NOF (New Organizational Forms) aims at closing the gap between the organizational and IS discipline in order to further the understanding and provid...

  18. Status of waste form testing

    International Nuclear Information System (INIS)

    Lawroski, H.


    The promulgation of the amendment of 10 CFR Part 61 by the Nuclear Regulatory Commission of December 27, 1982 by Federal Register Notice with an effective date of December 27, 1983 established the criteria for licensing requirements, paragraph 60.56, contained the description to provide adequate stability of the site through the use of suitable waste forms. In May, 1983, the NRC published a final Branch Technical Position (BTP) paper on waste form. The position taken by the BTP was considerably more severe than indicated in 10 CFR Part 61. An extensive and expensive testing program was started in 1983. As an interim measure, the presently utilized solidification processes such as cement, Dow binder, Envirostone and bitumen, and the presently qualified High Integrity containers (HICs) were considered acceptable with the caveat that acceptable process control programs were being utilized. The NRC requested that topical reports for licenses be submitted. The topical reports were to contain test results to substantiate the acceptability of the waste forms. The test results to date show that the volume of wastes will have to increase to meet the position taken by the NRC in the BTP. This position will cause more waste to be generated which is contrary to the emphasis by states and others to reduce the volume of waste. The details of testing will be discussed in the paper to be presented

  19. Fuzzy logic of Aristotelian forms

    Energy Technology Data Exchange (ETDEWEB)

    Perlovsky, L.I. [Nichols Research Corp., Lexington, MA (United States)


    Model-based approaches to pattern recognition and machine vision have been proposed to overcome the exorbitant training requirements of earlier computational paradigms. However, uncertainties in data were found to lead to a combinatorial explosion of the computational complexity. This issue is related here to the roles of a priori knowledge vs. adaptive learning. What is the a-priori knowledge representation that supports learning? I introduce Modeling Field Theory (MFT), a model-based neural network whose adaptive learning is based on a priori models. These models combine deterministic, fuzzy, and statistical aspects to account for a priori knowledge, its fuzzy nature, and data uncertainties. In the process of learning, a priori fuzzy concepts converge to crisp or probabilistic concepts. The MFT is a convergent dynamical system of only linear computational complexity. Fuzzy logic turns out to be essential for reducing the combinatorial complexity to linear one. I will discuss the relationship of the new computational paradigm to two theories due to Aristotle: theory of Forms and logic. While theory of Forms argued that the mind cannot be based on ready-made a priori concepts, Aristotelian logic operated with just such concepts. I discuss an interpretation of MFT suggesting that its fuzzy logic, combining a-priority and adaptivity, implements Aristotelian theory of Forms (theory of mind). Thus, 2300 years after Aristotle, a logic is developed suitable for his theory of mind.

  20. Organizational forms and knowledge absorption

    Directory of Open Access Journals (Sweden)

    Radovanović Nikola


    Full Text Available Managing the entire portion of knowledge in an organization is a challenging task. At the organizational level, there can be enormous quantities of unknown, poorly valued or inefficiently applied knowledge. This is normally followed with the underdeveloped potential or inability of organizations to absorb knowledge from external sources. Facilitation of the efficient internal flow of knowledge within the established communication network may positively affect organizational capacity to absorb or identify, share and subsequently apply knowledge to commercial ends. Based on the evidences that the adoption of different organizational forms affects knowledge flows within an organization, this research analyzed the relationship between common organizational forms and absorptive capacity of organizations. In this paper, we test the hypothesis stating that the organizational structure affects knowledge absorption and exploitation in the organization. The methodology included quantitative and qualitative research method based on a questionnaire, while the data has been statistically analyzed and the hypothesis has been tested with the use of cross-tabulation and chi-square tests. The findings suggest that the type of organizational form affects knowledge absorption capacity and that having a less formalized and more flexible structure in an organization increases absorbing and exploiting opportunities of potentially valuable knowledge.