WorldWideScience

Sample records for food borne pathogens

  1. Food-borne pathogens

    International Nuclear Information System (INIS)

    Niemand, J.G.

    1985-01-01

    The Salmonella scare reinforced the importance of never taking chances when it comes to controlling pathogens. The issue has been resolved by radurisation. The article deals with the various pathogens that can effect food and argues the case for radurisation in dealing with them. It also looks at some of the other food products that can be treated using this process

  2. Bacterial food-borne pathogens in Indian food

    International Nuclear Information System (INIS)

    Bandekar, J.R.

    2015-01-01

    Food technology and food processing techniques have made tremendous advances in preservation of food and ensuring safety of food by killing food-borne pathogens. In addition to old techniques such as pasteurization, canning, dehydration, fermentation and salting, a number of new techniques such as radiation processing, high pressure technology and pulsed electric field technology are being applied for preservation of food and to ensure food safety. Total Quality Management (TQM) concepts have been developed to take care of food safety from farm to table. Hazard Analysis at Critical Control Points (HACCP) is being applied for mass scale production of food to make food free from pathogens. Despite these advances, food-borne diseases have become one of the most widespread public health problems in the world. About two thirds of all the outbreaks are traced to microbial contaminated food. According to World Health Organization (WHO) estimates, food-borne and waterborne diarrhoeal diseases kill an estimated 2 million people annually, including many children. Food safety is a major concern not only for developing countries but also for the developed countries. A number of factors such as emergence of new food-borne pathogens, development of drug resistance in pathogens, changing life style, globalization of the food supply etc. are responsible for the continuous persistence of food-borne diseases. The food-borne disease outbreaks due to E. coli O157:H7, Listeria monocytogenes, Salmonella and Campylobacter, are responsible for recall of many foods resulting in heavy losses to food industry. Due to consumer demand, a number of Ready-To-Eat (RTE) minimally processed foods are increasingly marketed; however, there is increased risk of foodborne diseases with these products. Food Technology Division of Bhabha Atomic Research Centre, Mumbai, has been working on food-borne bacterial pathogens particularly Salmonella, Campylobacter, Listeria monocytogenes, Vibrio and Aeromonasf

  3. Microbial Flora and Food Borne Pathogens on Minced Meat and ...

    African Journals Online (AJOL)

    BACKGROUND: Food-borne pathogens are the leading cause of illness and death in developing countries. Changes in eating habits, mass catering, unsafe food storage conditions and poor hygiene practices are major contributing factors to food associated illnesses. In Ethiopia, the widespread habit of raw beef ...

  4. DNA microarray technique for detecting food-borne pathogens

    Directory of Open Access Journals (Sweden)

    Xing GAO

    2012-08-01

    Full Text Available Objective To study the application of DNA microarray technique for screening and identifying multiple food-borne pathogens. Methods The oligonucleotide probes were designed by Clustal X and Oligo 6.0 at the conserved regions of specific genes of multiple food-borne pathogens, and then were validated by bioinformatic analyses. The 5' end of each probe was modified by amino-group and 10 Poly-T, and the optimized probes were synthesized and spotted on aldehyde-coated slides. The bacteria DNA template incubated with Klenow enzyme was amplified by arbitrarily primed PCR, and PCR products incorporated into Aminoallyl-dUTP were coupled with fluorescent dye. After hybridization of the purified PCR products with DNA microarray, the hybridization image and fluorescence intensity analysis was acquired by ScanArray and GenePix Pro 5.1 software. A series of detection conditions such as arbitrarily primed PCR and microarray hybridization were optimized. The specificity of this approach was evaluated by 16 different bacteria DNA, and the sensitivity and reproducibility were verified by 4 food-borne pathogens DNA. The samples of multiple bacteria DNA and simulated water samples of Shigella dysenteriae were detected. Results Nine different food-borne bacteria were successfully discriminated under the same condition. The sensitivity of genomic DNA was 102 -103pg/ μl, and the coefficient of variation (CV of the reproducibility of assay was less than 15%. The corresponding specific hybridization maps of the multiple bacteria DNA samples were obtained, and the detection limit of simulated water sample of Shigella dysenteriae was 3.54×105cfu/ml. Conclusions The DNA microarray detection system based on arbitrarily primed PCR can be employed for effective detection of multiple food-borne pathogens, and this assay may offer a new method for high-throughput platform for detecting bacteria.

  5. Food-borne pathogens, health and role of dietary phytochemicals.

    Science.gov (United States)

    Shetty, K; Labbe, R G

    1998-12-01

    Infectious diseases transmitted by food have become a major public health concern in recent years. In the USA alone, there are an estimated 6-33 million cases each year. The list of responsible agents continues to grow. In the past 20 years some dozen new pathogens that are primarily food-borne have been identified. Fruits and vegetables, often from the global food market, have been added to the traditional vehicles of food-borne illness; that is, undercooked meat, poultry, seafood, or unpasteurized milk. Such products are minimally processed and have fewer barriers to microbial growth such as salt, sugar or preservatives. The evolution of the epidemiology of food-borne illness requires a rethinking of traditional, though still valid, solutions for their prevention. Among various strategies to prevent food-borne pathogens, use of dietary phytochemicals is promising. The major obstacle in the use of dietary phytochemical is the consistency of phytochemicals in different foods due to their natural genetic variation. We have developed a novel tissue-culture-based selection strategy to isolate elite phenolic phytochemical-producing clonal lines of species belonging to the family Lamiaceae. Among several species we have targeted elite clonal lines of thyme (Thymus vulgaris) and oregano (Origanum vulgare) against Escherichia coli and Clostridium perfrigens in fresh and processed meats. We are also evaluating high phenolic profile-containing clonal lines of basil (Ocimum basilicum) to inhibit gastric ulcer-causing Helicobacter pylori. Other elite lines of the members of the family Lamiaceae, rosemary (Rosmarinus officinalis) and salvia (Salvia officinalis) also hold promise against a wide range of food pathogens such as Salmonella species in poultry products and Vibrio species in seafood.

  6. Food-borne pathogens. Is there a remedy

    Energy Technology Data Exchange (ETDEWEB)

    Niemand, J G

    1985-03-01

    The Salmonella scare reinforced the importance of never taking chances when it comes to controlling pathogens. The issue has been resolved by radurisation. The article deals with the various pathogens that can effect food and argues the case for radurisation in dealing with them. It also looks at some of the other food products that can be treated using this process.

  7. ANTIBACTERIAL ACTIVITY OF GINGER OIL AGAINST FOOD BORN PATHOGENS

    International Nuclear Information System (INIS)

    TAHA, S.M.A.

    2008-01-01

    This study was carried out to investigate the antibacterial activity of ginger oil against Food Born pathogens and the effect of heating, microwave heating and gamma irradiation on microbiological quality and antibacterial activity of ginger oil. Growth and survival of A. hydrophila and L. monocytogenes in broth media and carrot juice with different concentrations of ginger oil was also studied. Gram-negative bacteria were more resistant than gram-positive bacteria. Heating at 80 0 C for 10 min did not change the antibacterial activity of ginger oil, whereas heating at 100 0 C for 5 min and autoclaving at 121 0 C for 15 min caused slight reduction in antibacterial activity in most microorganisms tested. Heating by microwave of ginger oil destroyed its antibacterial activity against B. cereus although it still works against other microorganisms tested. The dose 6 kGy caused slight reduction in antibacterial activity of ginger oil, whereas the dose 10 kGy caused markedly reduction in antibacterial activity of ginger oil against most microorganisms tested. Ginger oil was more effective on L. monocytogenes as compared with its effect on A. hydrophila in tryptone soya broth at 4 0 C or 25 0 C. Supplementation of ginger oil with carrot juice was more effective on A. hydrophila and L. monocytogenes than in tryptone soya broth and this effect was increased with increasing the time of incubation and the concentration of ginger oil. These results support the notion that plant essential oils may have an important role as pharmaceuticals and food preservatives

  8. Radiation Sensitivity of some Food Borne Bacterial Pathogens in Animal Foods and Minced Meat

    International Nuclear Information System (INIS)

    Mohammed, W.S.; Ali, A.R.; Alexan, A.F.

    2010-01-01

    Bacteriological examination of 100 samples of animal food stuffs (fish meal and bone and meat meal; as models of dry food materials) and 50 samples of minced meat (as a model of moist food materials) revealed the isolation of different bacterial pathogens; Escherichia coli, Klebsiella spp., Pseudomonas aeruginosa, Proteus spp., Staph. aureus and Salmonella species, in a decreasing order of occurrence. In the experiment; the dry food stuffs were sterilized in autoclave and the minced meat was sterilized by gamma irradiation at 10 kGy. The efficacy of gamma irradiation against the inoculated bacterial isolates (E coli 0157: H7, Salmonella enteritidis and Staph. aureus) in animal food stuffs and minced meat was investigated. Irradiated samples were stored at room temperature (25 degree C) for 2 weeks. The food borne pathogens used in this study showed a difference in radiation sensitivity. E. coli 0157: H7, Staphylococcus aureus and Salmonella enteritidis were eradicated at 1, 2 and 3 kGy, respectively. Also, inoculated pathogens in minced meat were more sensitive to ionizing radiation than dry animal food stuffs. It could be concluded that low doses of gamma irradiation are effective means of inactivating pathogenic bacteria. This radiation sensitivity is related to the bacterial isolates and the evaluated growth

  9. Biocontrol and Rapid Detection of Food-borne Pathogens Using Bacteriophages and Endolysins

    Directory of Open Access Journals (Sweden)

    Jaewoo eBai

    2016-04-01

    Full Text Available Bacteriophages have been suggested as natural food preservatives as well as rapid detection materials for food-borne pathogens in various foods. Since Listeria monocytogenes-targeting phage cocktail (ListShield was approved for applications in foods, numerous phages have been screened and experimentally characterized for phage applications in foods. A single phage and phage cocktail treatments to various foods contaminated with food-borne pathogens including E. coli O157:H7, Salmonella enterica, Campylobacter jejuni, Listeria monocytogenes, Staphylococcus aureus, Cronobacter sakazakii, and Vibrio spp. revealed that they have great potential to control various food-borne pathogens and may be alternative for conventional food preservatives. In addition, phage-derived endolysins with high host specificity and host lysis activities may be preferred to food applications rather than phages. For rapid detection of food-borne pathogens, cell-wall binding domains (CBDs from endolysins have been suggested due to their high host-specific binding. Fluorescence-tagged CBDs have been successfully evaluated and suggested to be alternative materials of expensive antibodies for various detection applications. Most recently, reporter phage systems have been developed and tested to confirm their usability and accuracy for specific detection. These systems revealed some advantages like rapid detection of only viable pathogenic cells without interference by food components in a very short reaction time, suggesting that these systems may be suitable for monitoring of pathogens in foods. Consequently, phage is the next-generation biocontrol agent as well as rapid detection tool to confirm and even identify the food-borne pathogens present in various foods.

  10. SERS based point-of-care detection of food-borne pathogens

    International Nuclear Information System (INIS)

    Mungroo, Nawfal Adam; Oliveira, Gustavo; Neethirajan, Suresh

    2016-01-01

    The authors have developed a microfluidic platform for improved detection of pathogenic bacteria by using silver nanoparticles and new platforms for chemometric data analysis, viz. a combination of principle component analysis and linear discriminant analysis. The method can distinguish eight key food borne pathogens (E. coli, S. typhimirium, S. enteritis, Pseudomonas aeruginosa, L. monocytogenes, L. innocua, MRSA 35 and MRSA 86) and, hence, holds good promise for use in the food industry. (author)

  11. A quantum-dot-based fluoroassay for detection of food-borne pathogens.

    Science.gov (United States)

    Mohamadi, Elaheh; Moghaddasi, Mohammadali; Farahbakhsh, Afshin; Kazemi, Abbass

    2017-09-01

    Evaluation of the distribution capability of food-borne pathogens existing in food products by taking the advantage of quantum dots (QDs) for their photoluminescence properties was carried out. Bacteria namely Escherichia coli (E. coli) labelled with CdSe-QDs were examined both on an Agar nutrient and ground fish substrates in order to observe their growth rate in different environments in the Lab. A sample with an appropriate concentration ratio 10 7 CFU/mL of bacteria/CdSe-QDs was empirically selected from the samples which were grown on the Agar containing plates. The selected sample was also tested on a ground fish substrate as a real food sample. The bacterial growth was observed under the irradiation of UV light and the growth patterns were investigated for 3 successive days. The growth patterns indicated that E. coli can stay alive and can be distributed on food products so that the growth can be easily monitored. This approach makes bacterial growth on food products detectable so that it can be used as a bacteria-QD assay for an easy detection of food borne pathogens grown on a food sample. Copyright © 2017 Elsevier B.V. All rights reserved.

  12. Methicillin-resistant Staphylococcus aureus: a controversial food-borne pathogen.

    Science.gov (United States)

    Sergelidis, D; Angelidis, A S

    2017-06-01

    Methicillin-resistant Staphylococcus aureus (MRSA) is a major cause of severe healthcare-associated (HA) infections. Although during the last decade the incidence of HA invasive infections has dropped, the incidence of community-associated MRSA (CA-MRSA) infections has risen among the general population. Moreover, CA-MRSA, livestock-associated MRSA (LA-MRSA) and HA-MRSA (HA-MRSA) can be found in foods intended for human consumption. Several studies from different geographical areas have reported the presence of enterotoxin genes in several MRSA food isolates. Molecular typing studies have revealed genetic relatedness of these enterotoxigenic isolates with isolates incriminated in human infections. The contamination sources for foods, especially animal-origin foods, may be livestock as well as humans involved in animal husbandry and food-processing. Under favourable environmental conditions for growth and enterotoxin production, enterotoxigenic S. aureus isolates present in foods can cause staphylococcal food poisoning (SFP), irrespective of the contamination origin. Owing to the typically moderate clinical manifestations of SFP, the S. aureus strains responsible for SFP (cases or outbreaks) are frequently either not identified or not further characterized. Antimicrobial susceptibility testing is rarely performed, because administration of antimicrobial therapy is not required in the vast majority of cases. Staphylococcal food poisoning is the result of consumption of foods with preformed enterotoxins. Hence, similar to methicillin-sensitive enterotoxigenic S. aureus, enterotoxigenic MRSA can also act as food-borne pathogens upon favourable conditions for growth and enterotoxin production. The severity of the intoxication is not related to the antimicrobial resistance profile of the causative S. aureus strain and therefore MRSA food-borne outbreaks are not expected to be more severe. This review evaluates the potential of methicillin-resistant Staphylococcus

  13. Antibacterial and efflux pump inhibitors of thymol and carvacrol against food-borne pathogens.

    Science.gov (United States)

    Miladi, Hanene; Zmantar, Tarek; Chaabouni, Yassine; Fedhila, Kais; Bakhrouf, Amina; Mahdouani, Kacem; Chaieb, Kamel

    2016-10-01

    In this study thymol (THY) and carvacrol (CAR), two monoterpenic phenol produced by various aromatic plants, was tested for their antibacterial and efflux pump inhibitors potencies against a panel of clinical and foodborne pathogenes. Our results demonstrated a substantial susceptibility of the tested bacteria toward THY and CAR. Especially, THY displayed a strong inhibitory activity (MIC's values ranged from 32 to 64 μg/mL) against the majority of the tested strains compared to CAR. Moreover, a significant reduction in MIC's of TET and benzalkonium chloride (QAC) were noticed when tested in combinations with THY and CAR. Their synergic effect was more significant in the case of THY which resulted a reduction of MIC's values of TET (2-8 fold) and QAC (2-8 fold). We noted also that THY and CAR inhibited the ethidium bromide (EtBr) cell efflux in a concentration-dependent manner. The rate of EtBr accumulation in food-borne pathogen was enhanced with THY and CAR (0, 250 and 500 μg/mL). The lowest concentration causing 50% of EtBr efflux inhibition (IC 50) was noticed in Salmonella enteritidis (1129) at 150 μg/mL of THY and 190 μg/mL of CAR respectively. These findings indicate that THY and CAR may serve as potential sources of efflux pump inhibitor in food-borne pathogens. Copyright © 2016 Elsevier Ltd. All rights reserved.

  14. Establishment and Application of a Visual DNA Microarray for the Detection of Food-borne Pathogens.

    Science.gov (United States)

    Li, Yongjin

    2016-01-01

    The accurate detection and identification of food-borne pathogenic microorganisms is critical for food safety nowadays. In the present work, a visual DNA microarray was established and applied to detect pathogens commonly found in food, including Salmonella enterica, Shigella flexneri, E. coli O157:H7 and Listeria monocytogenes in food samples. Multiplex PCR (mPCR) was employed to simultaneously amplify specific gene fragments, fimY for Salmonella, ipaH for Shigella, iap for L. monocytogenes and ECs2841 for E. coli O157:H7, respectively. Biotinylated PCR amplicons annealed to the microarray probes were then reacted with a streptavidin-alkaline phosphatase conjugate and nitro blue tetrazolium/5-bromo-4-chloro-3'-indolylphosphate, p-toluidine salt (NBT/BCIP); the positive results were easily visualized as blue dots formatted on the microarray surface. The performance of a DNA microarray was tested against 14 representative collection strains and mock-contamination food samples. The combination of mPCR and a visual micro-plate chip specifically and sensitively detected Salmonella enterica, Shigella flexneri, E. coli O157:H7 and Listeria monocytogenes in standard strains and food matrices with a sensitivity of ∼10(2) CFU/mL of bacterial culture. Thus, the developed method is advantageous because of its high throughput, cost-effectiveness and ease of use.

  15. Silver Nanoparticles Synthesized Using Wild Mushroom Show Potential Antimicrobial Activities against Food Borne Pathogens

    Directory of Open Access Journals (Sweden)

    Yugal Kishore Mohanta

    2018-03-01

    Full Text Available The present study demonstrates an economical and eco-friendly method for the synthesis of silver nanoparticles (AgNPs using the wild mushroom Ganoderma sessiliforme. The synthesis of AgNPs was confirmed and the products characterized by UV-visible spectroscopy, dynamic light scattering spectroscopy and X-ray diffraction analysis. Furthermore, Fourier transform infrared spectroscopy (ATR-FTIR analysis was performed to identify the viable biomolecules involved in the capping and active stabilization of AgNPs. Moreover, the average sizes and morphologies of AgNPs were analyzed by field emission scanning electron microscopy (FE-SEM. The potential impacts of AgNPs on food safety and control were evaluated by the antimicrobial activity of the synthesized AgNPs against common food-borne bacteria, namely, Escherichia coli, Bacillus subtilis, Streptococcus faecalis, Listeria innocua and Micrococcus luteus. The results of this study revealed that the synthesized AgNPs can be used to control the growth of food-borne pathogens and have potential application in the food packaging industry. Moreover, the AgNPs were evaluated for antioxidant activity (DPPH, for biocompatibility (L-929, normal fibroblast cells, and for cytotoxic effects on human breast adenosarcoma cells (MCF-7 & MDA-MB231 to highlight their potential for use in a variety of bio-applications.

  16. [Development of molecular detection of food-borne pathogenic bacteria using miniaturized microfluidic devices].

    Science.gov (United States)

    Iván, Kristóf; Maráz, Anna

    2015-12-20

    Detection and identification of food-borne pathogenic bacteria are key points for the assurance of microbiological food safety. Traditional culture-based methods are more and more replaced by or supplemented with nucleic acid based molecular techniques, targeting specific (preferably virulence) genes in the genomes. Internationally validated DNA amplification - most frequently real-time polymerase chain reaction - methods are applied by the food microbiological testing laboratories for routine analysis, which will result not only in shortening the time for results but they also improve the performance characteristics (e.g. sensitivity, specificity) of the methods. Beside numerous advantages of the polymerase chain reaction based techniques for routine microbiological analysis certain drawbacks have to be mentioned, such as the high cost of the equipment and reagents, as well as the risk of contamination of the laboratory environment by the polymerase chain reaction amplicons, which require construction of an isolated laboratory system. Lab-on-a-chip systems can integrate most of these laboratory processes within a miniaturized device that delivers the same specificity and reliability as the standard protocols. The benefits of miniaturized devices are: simple - often automated - use, small overall size, portability, sterility due to single use possibility. These miniaturized rapid diagnostic tests are being researched and developed at the best research centers around the globe implementing various sample preparation and molecular DNA amplification methods on-chip. In parallel, the aim of the authors' research is to develop microfluidic Lab-on-a-chip devices for the detection and identification of food-borne pathogenic bacteria.

  17. Comparison of Three Different DNA Extraction Methods for Linguatula serrata as a Food Born Pathogen

    Directory of Open Access Journals (Sweden)

    Gilda ESLAMI

    2017-06-01

    Full Text Available Background: One of the most important items in molecular characterization of food-borne pathogens is high quality genomic DNA. In this study, we investigated three protocols and compared their simplicity, duration and costs for extracting genomic DNA from Linguatula serrata.Methods: The larvae were collected from the sheep’s visceral organs from the Yazd Slaughterhouse during May 2013. DNA extraction was done in three different methods, including commercial DNA extraction kit, Phenol Chloroform Isoamylalcohol (PCI, and salting out. Extracted DNA in each method was assessed for quantity and quality using spectrophotometery and agarose gel electrophoresis, respectively.Results: The less duration was regarding to commercial DNA extraction kit and then salting out protocol. The cost benefit one was salting out and then PCI method. The best quantity was regarding to PCI with 72.20±29.20 ng/μl, and purity of OD260/OD280 in 1.76±0.947. Agarose gel electrophoresis for assessing the quality found all the same.Conclusion: Salting out is introduced as the best method for DNA extraction from L. seratta as a food-borne pathogen with the least costand appropriate purity. Although, the best purity was regarding to PCI but PCI is not safe as salting out. In addition, the duration of salting out was less than PCI. The least duration was seen in commercial DNA extraction kit, but it is expensive and therefore is not recommended for developing countries where consumption of offal is common.

  18. Extreme Heat Resistance of Food Borne Pathogens Campylobacter jejuni, Escherichia coli, and Salmonella typhimurium on Chicken Breast Fillet during Cooking

    DEFF Research Database (Denmark)

    de Jong, Aarieke E I; van Asselt, Esther D; Zwietering, Marcel H

    2012-01-01

    cooking enlarged the heat resistance of the food borne pathogens. Additionally, a high challenge temperature or fast heating rate contributed to the level of heat resistance. The data were used to assess the probability of illness (campylobacteriosis) due to consumption of chicken fillet as a function...

  19. Interaction between Food-borne Pathogens (Campylobacter jejuni, Salmonella Typhimurium and Listeria monocytogenes) and a Common Soil Flagellate (Cercomonas sp.)

    DEFF Research Database (Denmark)

    Bui, Thanh Xuan; Wolff, Anders; Madsen, Mogens

    2012-01-01

    Free-living protozoa may harbor, protect, and disperse bacteria, including those ingested and passed in viable form in feces. The flagellates are very important predators on bacteria in soil, but their role in the survival of food-borne pathogens associated with fruits and vegetables is not well...

  20. Antimicrobial activities of commercial essential oils and their components against food-borne pathogens and food spoilage bacteria

    Science.gov (United States)

    Mith, Hasika; Duré, Rémi; Delcenserie, Véronique; Zhiri, Abdesselam; Daube, Georges; Clinquart, Antoine

    2014-01-01

    This study was undertaken to determine the in vitro antimicrobial activities of 15 commercial essential oils and their main components in order to pre-select candidates for potential application in highly perishable food preservation. The antibacterial effects against food-borne pathogenic bacteria (Listeria monocytogenes, Salmonella Typhimurium, and enterohemorrhagic Escherichia coli O157:H7) and food spoilage bacteria (Brochothrix thermosphacta and Pseudomonas fluorescens) were tested using paper disk diffusion method, followed by determination of minimum inhibitory (MIC) and bactericidal (MBC) concentrations. Most of the tested essential oils exhibited antimicrobial activity against all tested bacteria, except galangal oil. The essential oils of cinnamon, oregano, and thyme showed strong antimicrobial activities with MIC ≥ 0.125 μL/mL and MBC ≥ 0.25 μL/mL. Among tested bacteria, P. fluorescens was the most resistant to selected essential oils with MICs and MBCs of 1 μL/mL. The results suggest that the activity of the essential oils of cinnamon, oregano, thyme, and clove can be attributed to the existence mostly of cinnamaldehyde, carvacrol, thymol, and eugenol, which appear to possess similar activities against all the tested bacteria. These materials could be served as an important natural alternative to prevent bacterial growth in food products. PMID:25473498

  1. Screening food-borne and zoonotic pathogens associated with livestock practices in the Sumapaz region, Cundinamarca, Colombia.

    Science.gov (United States)

    Arenas, Nelson E; Abril, Diego A; Valencia, Paola; Khandige, Surabhi; Soto, Carlos Yesid; Moreno-Melo, Vilma

    2017-04-01

    Hazardous practices regarding antibiotics misuse, unsanitary milking procedures, and the commercial sales of raw milk and unpasteurized dairy products are currently being practiced by livestock farmers in the Sumapaz region (Colombia). The purpose of this study was to screen for food-borne and zoonotic pathogens associated with local livestock practices. We evaluated 1098 cows from 46 livestock farms in the Sumapaz region that were selected by random. Of the total population of cattle, 962 animals (88%) were tested for bovine TB using a caudal-fold tuberculin test and 546 (50%) for brucellosis by a competitive ELISA. In the population tested, 23 cows were positive for Brucella sp. representing a 4.2% seroprevalence and no cases of bovine tuberculosis were found. In addition, food-borne contamination with Escherichia coli and Staphylococcus aureus was assessed together with antibiotic susceptibility for ten different antibiotics in milk samples from 16 livestock farms. We found that 12 of the farms (75%) were contaminated with these food-borne pathogens. Noteworthy, all of the isolated pathogenic strains were resistant to multiple antibiotics, primarily to oxytetracycline and erythromycin. Our findings suggest that livestock products could be a source of exposure to Brucella and multidrug-resistant E. coli and S. aureus strains as a result of unhygienic livestock practices in the Sumapaz region. Training in good farming practices is the key to improving safety in food production.

  2. Antibacterial Potential of Jatropha curcas Synthesized Silver Nanoparticles against Food Borne Pathogens

    Science.gov (United States)

    Chauhan, Nitin; Tyagi, Amit K.; Kumar, Pushpendar; Malik, Anushree

    2016-01-01

    The aqueous leaf extract of Jatropha curcas was used for the synthesis of silver nanoparticles (Jc-AgNps) which were further evaluated for its antibacterial potential against food borne pathogens. J. curcas leaf extract could synthesize stable silver nanoparticles (Zeta potential: -23.4 mV) with absorption band at 430 nm. Fourier transform infrared spectroscopy indicated various biological compounds responsible for capping and stabilizing Jc-AgNps in suspension, while the presence of silver was authenticated by scanning electron microscopy (SEM) equipped with energy-dispersive X-ray. Jc-AgNps were confirmed to be uniform in shape, size and behavior through dynamic light scattering, transmission electron microscopy (TEM), X-ray diffraction, SEM, and atomic force microscopy (AFM) analysis. To investigate the antibacterial activity, disk diffusion and microplate dilution assays were performed and zone of inhibition (ZOI) as well as minimum inhibitory/bactericidal concentrations (MIC/MBCs) were evaluated against selected bacterial strains. Overall results showed that Escherichia coli (ZOI: 23 mm, MBC: 0.010 mg/ml) was the most sensitive organism, whereas Staphylococcus aureus (ZOI: 14.66 mm, MBC: 0.041 mg/ml) and Salmonella enterica (ZOI: 16.66 mm, MBC: 0.041 mg/ml) were the least sensitive against Jc-AgNps. The detailed microscopic investigations using SEM, TEM, and AFM were performed to understand the antibacterial impacts of Jc-AgNps against Listeria monocytogenes. SEM and TEM analysis showed the clear deformation and disintegration of treated L. monocytogenes cells, whereas AFM established a decrease in the height and cell surface roughness (root mean square value) in the treated L. monocytogenes. PMID:27877160

  3. Phytochemical profiles and antimicrobial activity of aromatic Malaysian herb extracts against food-borne pathogenic and food spoilage microorganisms.

    Science.gov (United States)

    Aziman, Nurain; Abdullah, Noriham; Noor, Zainon Mohd; Kamarudin, Wan Saidatul Syida Wan; Zulkifli, Khairusy Syakirah

    2014-04-01

    Preliminary phytochemical and flavonoid compounds of aqueous and ethanolic extracts of 6 aromatic Malaysian herbs were screened and quantified using Reverse-Phase High Performance Liquid Chromatography (RP-HPLC). The herbal extracts were tested for their antimicrobial activity against 10 food-borne pathogenic and food spoilage microorganisms using disk diffusion assay. The minimum inhibitory concentration (MIC) and minimum bactericidal concentration (MBC)/minimum fungicidal concentration (MFC) of herbal extracts were determined. In the phytochemical screening process, both aqueous and ethanolic extracts of P. hydropiper exhibited presence of all 7 tested phytochemical compounds. Among all herbal extracts, the aqueous P. hydropiper and E. elatior extracts demonstrated the highest antibacterial activity against 7 tested Gram-positive and Gram-negative bacteria with diameter ranging from 7.0 to 18.5 mm and 6.5 to 19 mm, respectively. The MIC values for aqueous and ethanolic extracts ranged from 18.75 to 175 mg/mL and 0.391 to 200 mg/mL, respectively while the MBC/MFC values for aqueous and ethanolic extracts ranged from 25 to 200 mg/mL and 3.125 to 50 mg/mL, respectively. Major types of bioactive compounds in aqueous P. hydropiper and E. elatior extracts were identified using RP-HPLC instrument. Flavonoids found in these plants were epi-catechin, quercetin, and kaempferol. The ability of aqueous Persicaria hydropiper (L.) H. Gross and Etlingera elatior (Jack) R.M. Sm. extracts to inhibit the growth of bacteria is an indication of its broad spectrum antimicrobial potential. Hence these herbal extracts may be used as natural preservative to improve the safety and shelf-life of food and pharmaceutical products. © 2014 Institute of Food Technologists®

  4. Combined effect of enterocin and lipase from Enterococcus faecium NCIM5363 against food borne pathogens: mode of action studies.

    Science.gov (United States)

    Ramakrishnan, Vrinda; Narayan, Bhaskar; Halami, Prakash M

    2012-08-01

    Food borne diseases have a major impact on public health whose epidemiology is rapidly changing. The whole cells of pathogens involved or their toxins/metabolites affect the human health apart from spoiling sensory properties of the food products finally affecting the food industry as well as consumer health. With pathogens developing mechanisms of antibiotic resistance, there has been an increased need to replace antibiotics as well as chemical additives with naturally occurring bacteriocins. Bacteriocins are known to act mainly against Gram-positive pathogens and with little or no effect towards Gram-negative enteric bacteria. In the present study, combination effect of lipase and bacteriocin produced by Enterococcus faecium NCIM5363, a highly lipolytic lactic acid bacterium against various food pathogens was assessed. The lipase in combination with enterocin exhibited a lethal effect against Gram-negative pathogens. Scanning electron microscopy studies carried out to ascertain the constitutive mode of action of lipase and enterocin revealed that the lipase degrades the cell wall of Gram-negative bacteria and creates a pore through which enterocin enters thereby resulting in cell death. The novelty of this work is the fact that this is the first report revealing the synergistic effect of lipase with enterocin against Gram-negative bacteria.

  5. Analysis of a food-borne fungal pathogen outbreak: virulence and genome of a Mucor circinelloides isolate from yogurt.

    Science.gov (United States)

    Lee, Soo Chan; Billmyre, R Blake; Li, Alicia; Carson, Sandra; Sykes, Sean M; Huh, Eun Young; Mieczkowski, Piotr; Ko, Dennis C; Cuomo, Christina A; Heitman, Joseph

    2014-07-08

    Food-borne pathogens are ongoing problems, and new pathogens are emerging. The impact of fungi, however, is largely underestimated. Recently, commercial yogurts contaminated with Mucor circinelloides were sold, and >200 consumers became ill with nausea, vomiting, and diarrhea. Mucoralean fungi cause the fatal fungal infection mucormycosis, whose incidence has been continuously increasing. In this study, we isolated an M. circinelloides strain from a yogurt container, and multilocus sequence typing identified the strain as Mucor circinelloides f. circinelloides. M. circinelloides f. circinelloides is the most virulent M. circinelloides subspecies and is commonly associated with human infections, whereas M. circinelloides f. lusitanicus and M. circinelloides f. griseocyanus are less common causes of infection. Whole-genome analysis of the yogurt isolate confirmed it as being close to the M. circinelloides f. circinelloides subgroup, with a higher percentage of divergence with the M. circinelloides f. lusitanicus subgroup. In mating assays, the yogurt isolate formed sexual zygospores with the (-) M. circinelloides f. circinelloides tester strain, which is congruent with its sex locus encoding SexP, the (+) mating type sex determinant. The yogurt isolate was virulent in murine and wax moth larva host systems. In a murine gastromucormycosis model, Mucor was recovered from fecal samples of infected mice for up to 10 days, indicating that Mucor can survive transit through the GI tract. In interactions with human immune cells, M. circinelloides f. lusitanicus induced proinflammatory cytokines but M. circinelloides f. circinelloides did not, which may explain the different levels of virulence in mammalian hosts. This study demonstrates that M. circinelloides can spoil food products and cause gastrointestinal illness in consumers and may pose a particular risk to immunocompromised patients. Importance: The U.S. FDA reported that yogurt products were contaminated with M

  6. Inactivation of food-borne pathogens by combined high hydrostatic pressure and irradiation- a model study

    International Nuclear Information System (INIS)

    Kamat, Anu; Thomas, Paul; Kesavan, P.C.; Fotedar, R.

    1997-01-01

    Application of radiation or high pressure as a food processing method is comparatively recent development in food industry. To investigate the response to hydrostatic pressure, cells of pathogens at logarithmic phase were exposed to 200 MPa for various time intervals in saline as model system. The cells of Salmonella were observed to be most sensitive whereas Listeria monocytogenes were most resistant as revealed by 7 and 2 log cycle inactivation respectively in 10 min. The cells of Bacillus cereus and Yersinia enterocolitica showed 3 long cycles reduction by the same treatment. Bacterial spores because of their resistant nature, are inactivated only at high radiation doses, which are technologically unfeasible. Studies carried out to examine the effectiveness of combination of pressure and radiation clearly suggested that combination treatment given in either sequence reduces the bacterial spore load more effectively than the individual treatment per se. (author)

  7. Intervention technologies for food safety on minimally processed produce:Perspectives on food-borne and plant pathogens

    Science.gov (United States)

    Produce contamination associated with enteric pathogens such Escherichia coli O157:H7, salmonella spp., Listeria monocytogenes, Shigella and others are significant challenges to food safety. This is due to the illnesses and economic impacts resulting from the outbreaks. Innovative technologies for i...

  8. Screening food-borne and zoonotic pathogens associated with livestock practices in the Sumapaz region, Cundinamarca, Colombia

    DEFF Research Database (Denmark)

    Arenas, Nelson E.; Abril, Diego A.; Valencia, Paola

    2017-01-01

    -borne and zoonotic pathogens associated with local livestock practices. We evaluated 1098 cows from 46 livestock farms in the Sumapaz region that were selected by random. Of the total population of cattle, 962 animals (88%) were tested for bovine TB using a caudal-fold tuberculin test and 546 (50%) for brucellosis...... findings suggest that livestock products could be a source of exposure to Brucella and multidrug-resistant E. coli and S. aureus strains as a result of unhygienic livestock practices in the Sumapaz region. Training in good farming practices is the key to improving safety in food production.......Hazardous practices regarding antibiotics misuse, unsanitary milking procedures, and the commercial sales of raw milk and unpasteurized dairy products are currently being practiced by livestock farmers in the Sumapaz region (Colombia). The purpose of this study was to screen for food...

  9. The β-defensin gallinacin-6 is expressed in the chicken digestive tract and has antimicrobial activity against food-borne pathogens

    NARCIS (Netherlands)

    van Dijk, A.; Veldhuizen, E.J.A.; Kalkhove, S.I.C.; Tjeerdsma-van Bokhoven, J.L.M.; Romijn, R.A.; Haagsman, H.P.

    2007-01-01

    Food-borne pathogens are responsible for most cases of food poisoning in developed countries and are often associated with poultry products, including chicken. Little is known about the role of ß-defensins in the chicken digestive tract and their efficacy. In this study, the expression of chicken

  10. Use of Lactobacillus plantarum Strains as a Bio-Control Strategy against Food-Borne Pathogenic Microorganisms

    Science.gov (United States)

    Arena, Mattia Pia; Silvain, Amandine; Normanno, Giovanni; Grieco, Francesco; Drider, Djamel; Spano, Giuseppe; Fiocco, Daniela

    2016-01-01

    . This study emphasizes the tempting use of the tested L. plantarum strains and/or their CFS as antimicrobial agents against food-borne pathogens. PMID:27148172

  11. Extreme Heat Resistance of Food Borne Pathogens Campylobacter jejuni, Escherichia coli, and Salmonella typhimurium on Chicken Breast Fillet during Cooking

    Directory of Open Access Journals (Sweden)

    Aarieke E.I. de Jong

    2012-01-01

    The surface temperature reached 70∘C within 30 sec and 85∘C within one minute. Extremely high decimal reduction times of 1.90, 1.97, and 2.20 min were obtained for C. jejuni, E. coli, and S. typhimurium, respectively. Chicken meat and refrigerated storage before cooking enlarged the heat resistance of the food borne pathogens. Additionally, a high challenge temperature or fast heating rate contributed to the level of heat resistance. The data were used to assess the probability of illness (campylobacteriosis due to consumption of chicken fillet as a function of cooking time. The data revealed that cooking time may be far more critical than previously assumed.

  12. Piecewise linear approximations to model the dynamics of adaptation to osmotic stress by food-borne pathogens.

    Science.gov (United States)

    Métris, Aline; George, Susie M; Ropers, Delphine

    2017-01-02

    Addition of salt to food is one of the most ancient and most common methods of food preservation. However, little is known of how bacterial cells adapt to such conditions. We propose to use piecewise linear approximations to model the regulatory adaptation of Escherichiacoli to osmotic stress. We apply the method to eight selected genes representing the functions known to be at play during osmotic adaptation. The network is centred on the general stress response factor, sigma S, and also includes a module representing the catabolic repressor CRP-cAMP. Glutamate, potassium and supercoiling are combined to represent the intracellular regulatory signal during osmotic stress induced by salt. The output is a module where growth is represented by the concentration of stable RNAs and the transcription of the osmotic gene osmY. The time course of gene expression of transport of osmoprotectant represented by the symporter proP and of the osmY is successfully reproduced by the network. The behaviour of the rpoS mutant predicted by the model is in agreement with experimental data. We discuss the application of the model to food-borne pathogens such as Salmonella; although the genes considered have orthologs, it seems that supercoiling is not regulated in the same way. The model is limited to a few selected genes, but the regulatory interactions are numerous and span different time scales. In addition, they seem to be condition specific: the links that are important during the transition from exponential to stationary phase are not all needed during osmotic stress. This model is one of the first steps towards modelling adaptation to stress in food safety and has scope to be extended to other genes and pathways, other stresses relevant to the food industry, and food-borne pathogens. The method offers a good compromise between systems of ordinary differential equations, which would be unmanageable because of the size of the system and for which insufficient data are available

  13. Antibacterial Activity of Fructus forsythia Essential Oil and the Application of EO-Loaded Nanoparticles to Food-Borne Pathogens

    Directory of Open Access Journals (Sweden)

    Na Guo

    2016-10-01

    Full Text Available Fructus forsythia essential oil (FEO with excellent antibacterial activity was rarely reported. The objective of the present study was to investigate the antibacterial activity and the antibacterial mechanism of FEO against two food-borne pathogenic bacteria, Escherichia coli (E. coli and Staphylococcus aureus (S. aureus in vitro. When treated FEO, the zones of inhibition (ZOI of E. coli (20.5 ± 0.25 mm and S. aureus (24.3 ± 0.21 mm were much larger than control (p < 0.05. The minimum inhibitory concentrations (MICs of FEO were 3.13 mg/mL and 1.56 mg/mL for E. coli and S. aureus, respectively. The antibacterial mechanism of FEO against E. coil was due to the changes in permeability and integrity of cell membrane leading to the leakage of nucleic acids and proteins. With the superior antibacterial activity of FEO, the nano-encapsulation method has been applied in FEO. When compared to FEO and blank chitosan nanoparticles, FEO-loaded nanoparticles (chitosan to FEO of 1:1 can effectively inhibit the growth of E. coil above 90% at room temperature. It is necessary to consider that FEO and FEO-loaded nanoparticles will become promising antibacterial additives for food preservative, cosmetic, and pharmaceutical applications.

  14. Real-time PCR Detection of Food-borne Pathogenic Salmonella spp

    DEFF Research Database (Denmark)

    Malorny, B.; Mäde, D.; Löfström, Charlotta

    2013-01-01

    Infections by Salmonella enterica are a significant public health concern worldwide. Salmonellae form a complex group of bacteria consisting of two species, six subspecies and more than 2500 serovars (serotypes). Mainly through ingestion of contaminated food or feed, they cause self-limiting gast......Infections by Salmonella enterica are a significant public health concern worldwide. Salmonellae form a complex group of bacteria consisting of two species, six subspecies and more than 2500 serovars (serotypes). Mainly through ingestion of contaminated food or feed, they cause self...

  15. In Vitro Evaluation of the Antibiogramic Activities of the Seeds of Myristica fragrans on Food Borne Pathogens

    Directory of Open Access Journals (Sweden)

    Emefo, O. T.

    2012-01-01

    Full Text Available Aims: Foodborne diseases have been shown to have direct impact on the health and welfare of a large number of the world population. The in vitro antibiogramic properties of natural spices (Myristica fragrans on common food borne pathogen became necessary both in improving food safety and development of new drugs. Methodology and Results: Test isolates (Staphylococcus aureus, S. epidermidis, Klebsiella pneumoniae, Bacillus cereus, Escherichia coli, Salmonella typhi and Pseudomonas aeruginosa were collected from the culture collection unit of the department of Microbiology, Benson Idahosa University, Nigeria. Seeds of M. fragrans were extracted by soxhlet extractor using ethanol and water, while the oil was obtained by steam distillation. The extracts and oil were tested against the bacterial isolates using agar well diffusion method at varying concentration (12.5, 25, 50 and 100 mg/mL. The oil of M. fragrans was found to have the highest antibiogramic activity on the selected isolates, followed by its ethanolic extract with zones of inhibition ranging from 0-24 mm and 0-16 mm respectively. The aqueous extract of M. fragrans was found to be effective against E. coli, P. aeruginosa and S. epidermidis only at 100 mg/mL. The MIC was also higher in oil extract of M. fragrans compared to its ethanolic and aqueous extracts. Conclusion, Significance and Impact of study: The oil and aqueous extract of M. fragrans showed antibiogramic properties against the bacterial isolates used at different concentrations. Thus, its oil can be used as an alternative to synthetic food preservative found to harbor toxic effects and could also serve as sources for development of new antibiotics.

  16. Food-borne human parasitic pathogens associated with household cockroaches and houseflies in Nigeria

    Directory of Open Access Journals (Sweden)

    Oyetunde T. Oyeyemi

    2016-03-01

    Full Text Available Cockroaches and houseflies pose significant public health threat owning to their ability to mechanically transmit human intestinal parasites and other disease-causing microorganisms. This study aims at assessing the vectoral capacity of cockroaches and houseflies in the transmission of human intestinal parasites. Intestinal parasite external surface contamination of 130 cockroaches and 150 houseflies caught within dwelling places in Ilishan-Remo town, Ogun State, Nigeria was determined. Cockroaches (six parasite species were more contaminated than houseflies (four parasite species. The most prevalent parasites were Trichuris trichiura (74.0% and hookworm (63.0% in houseflies and cockroaches respectively. There were significant differences in the prevalence of hookworm, T. trichiura and Taenia spp. isolated from cockroaches and houseflies (P < 0.05. There is high contamination of human intestinal parasites in cockroaches and houseflies in human dwelling places in the study area, thus they have the ability to transmit these parasites to unkempt food materials.

  17. Non-thermal plasma-activated water inactivation of food-borne pathogen on fresh produce

    International Nuclear Information System (INIS)

    Ma, Ruonan; Wang, Guomin; Tian, Ying; Wang, Kaile; Zhang, Jue; Fang, Jing

    2015-01-01

    Highlights: • We propose a new approach to treat S. aureus inoculated on strawberries by PAW. • PAW could inactivate S. aureus on strawberries via the Log Reduction results, further confirmed by CLSM and SEM. • The short-lived ROS in PAW are considered the most important agents in inactivation process. • No significant change was found in color, firmness and pH of the PAW treated strawberries. - Abstract: Non-thermal plasma has been widely considered to be an effective method for decontamination of foods. Recently, numerous studies report that plasma-activated water (PAW) also has outstanding antibacterial ability. This study presents the first report on the potential of PAW for the inactivation of Staphylococcus aureus (S. aureus) inoculated on strawberries. PAW treatments achieved a reduction of S. aureus ranging from 1.6 to 2.3 log at day-0 storage, while 1.7 to 3.4 log at day-4 storage. The inactivation efficiency depended on the plasma-activated time for PAW generation and PAW-treated time of strawberries inoculated with S. aureus. LIVE/DEAD staining and scanning electron microscopy results confirm that PAW could damage the bacterial cell wall. Moreover, optical emission spectra and oxidation reduction potential results demonstrate the inactivation is mainly attributed to oxidative stress induced by reactive oxygen species in PAW. In addition, no significant change was found in color, firmness and pH of the PAW treated strawberries. Thus, PAW can be a promising alternative to traditional sanitizers applied in the fresh produce industry.

  18. Non-thermal plasma-activated water inactivation of food-borne pathogen on fresh produce

    Energy Technology Data Exchange (ETDEWEB)

    Ma, Ruonan; Wang, Guomin; Tian, Ying; Wang, Kaile [Academy for Advanced Interdisciplinary Studies, Peking University, Beijing 100871 (China); Zhang, Jue, E-mail: zhangjue@pku.edu.cn [Academy for Advanced Interdisciplinary Studies, Peking University, Beijing 100871 (China); College of Engineering, Peking University, Beijing 100871 (China); Fang, Jing [Academy for Advanced Interdisciplinary Studies, Peking University, Beijing 100871 (China); College of Engineering, Peking University, Beijing 100871 (China)

    2015-12-30

    Highlights: • We propose a new approach to treat S. aureus inoculated on strawberries by PAW. • PAW could inactivate S. aureus on strawberries via the Log Reduction results, further confirmed by CLSM and SEM. • The short-lived ROS in PAW are considered the most important agents in inactivation process. • No significant change was found in color, firmness and pH of the PAW treated strawberries. - Abstract: Non-thermal plasma has been widely considered to be an effective method for decontamination of foods. Recently, numerous studies report that plasma-activated water (PAW) also has outstanding antibacterial ability. This study presents the first report on the potential of PAW for the inactivation of Staphylococcus aureus (S. aureus) inoculated on strawberries. PAW treatments achieved a reduction of S. aureus ranging from 1.6 to 2.3 log at day-0 storage, while 1.7 to 3.4 log at day-4 storage. The inactivation efficiency depended on the plasma-activated time for PAW generation and PAW-treated time of strawberries inoculated with S. aureus. LIVE/DEAD staining and scanning electron microscopy results confirm that PAW could damage the bacterial cell wall. Moreover, optical emission spectra and oxidation reduction potential results demonstrate the inactivation is mainly attributed to oxidative stress induced by reactive oxygen species in PAW. In addition, no significant change was found in color, firmness and pH of the PAW treated strawberries. Thus, PAW can be a promising alternative to traditional sanitizers applied in the fresh produce industry.

  19. Rapid immuno-analytical system physically integrated with lens-free CMOS image sensor for food-borne pathogens.

    Science.gov (United States)

    Jeon, Jin-Woo; Kim, Jee-Hyun; Lee, Jong-Mook; Lee, Won-Ho; Lee, Do-Young; Paek, Se-Hwan

    2014-02-15

    To realize an inexpensive, pocket-sized immunosensor system, a rapid test devise based on cross-flow immuno-chromatography was physically combined with a lens-free CMOS image sensor (CIS), which was then applied to the detection of the food-borne pathogen, Salmonella typhimurium (S. typhimurium). Two CISs, each retaining 1.3 mega pixel array, were mounted on a printed circuit board to fabricate a disposable sensing module, being connectable with a signal detection system. For the bacterial analysis, a cellulose membrane-based immunosensing platform, ELISA-on-a-chip (EOC), was employed, being integrated with the CIS module, and the antigen-antibody reaction sites were aligned with the respective sensor. In such sensor construction, the chemiluminescent signals produced from the EOC are transferred directly into the sensors and are converted to electric signals on the detector. The EOC-CIS integrated sensor was capable of detecting a traceable amount of the bacterium (4.22 × 10(3)CFU/mL), nearly comparable to that adopting a sophisticated detector such as cooled-charge-coupled device, while having greatly reduced dimensions and cost. Upon coupling with immuno-magnetic separation, the sensor showed an additional 67-fold enhancement in the detection limit. Furthermore, a real sample test was carried out for fish muscles inoculated with a sample of 3.3CFU S. typhimurium per 10 g, which was able to be detected earlier than 6h after the onset of pre-enrichment by culture. © 2013 Elsevier B.V. All rights reserved.

  20. Bacterial food-borne zoonoses.

    Science.gov (United States)

    Thorns, C J

    2000-04-01

    In many countries of the world, bacterial food-borne zoonotic infections are the most common cause of human intestinal disease. Salmonella and Campylobacter account for over 90% of all reported cases of bacteria-related food poisoning world-wide. Poultry and poultry products have been incriminated in the majority of traceable food-borne illnesses caused by these bacteria, although all domestic livestock are reservoirs of infection. In contrast to the enzootic nature of most Salmonella and Campylobacter infections, Salmonella Enteritidis caused a pandemic in both poultry and humans during the latter half of the 20th Century. Salmonella Typhimurium and Campylobacter appear to be more ubiquitous in the environment, colonising a greater variety of hosts and environmental niches. Verocytotoxin-producing Escherichia coli O157 (VTEC O157) also emerged as a major food-borne zoonotic pathogen in the 1980s and 1990s. Although infection is relatively rare in humans, clinical disease is often severe, with a significant mortality rate among the young and elderly. The epidemiology of VTEC O157 is poorly understood, although ruminants, especially cattle and sheep, appear to be the major source of infection. The dissemination of S. Enteritidis along the food chain is fairly well understood, and control programmes have been developed to target key areas of poultry meat and egg production. Recent evidence indicates that these control programmes have been associated with an overall reduction of S. Enteritidis along the food chain. Unfortunately, existing controls do not appear to reduce the levels of Campylobacter and VTEC O157 infections. Future control strategies need to consider variations in the epidemiologies of food-borne zoonotic infections, and apply a quantitative risk analysis approach to ensure that the most cost-effective programmes are developed.

  1. Antimicrobial activity of Piper nigrum L. and Cassia didymobotyra L. leaf extract on selected food borne pathogens

    Directory of Open Access Journals (Sweden)

    Mohd. Sayeed Akthar

    2014-09-01

    Full Text Available Objective: To investigate the antimicrobial activity of leaf extract of Piper nigrum (P. nigrum and Cassia didymobotyra (C. didymobotyra (aqueous, methanol, ethanol and petroleum ether against the food borne pathogenic bacteria [Staphylococcus aureus (S. aureus, Escherichia coli (E. coli, Salmonella typhimurium and Pseudomonas aeruginosa] and fungi [Aspergillus spp. and Candida albicans (C. albicans] and also to investigate the presence of various phytochemicals in the leaf extracts of tested plants. Methods: The antimicrobial activity was determined by disc diffusion method. Minimum inhibitory concentration (MIC, minimum bactericidal and fungicidal concentration were determined by serial dilution method. Results: Methanol leaf extract of test plants exhibited greater antimicrobial activity against the selected bacterial and fungal strains. The MIC results showed that ethanol, methanol and petroleum ether leaf extract of P. nigrum inhibited the growth of S. aureus and E. coli at concentration of 12.5 mg/mL. While, ethanol and methanol leaf extracts of C. didymobotyra inhibited the growth of S. aureus at concentration of 6.25 mg/mL. The MIC values for ethanol, methanol and petroleum ether leaf extract of P. nigrum inhibited the growth of C. albicans at concentration of 25.0 mg/mL. While, it was reported that at concentration of 12.5 mg/mL methanol leaf extract of P. nigrum was against the Aspergillus spp. The MIC values of methanol leaf extract of C. didymobotyra inhibited the growth of C. albicans and Aspergillus spp. at concentration of 12.5 mg/mL and 6.25 mg/mL, respectively. The minimum bactericidal concentration of ethanol, methanol leaf extract of P. nigrum for E. coli and ethanol, methanol leaf extract of C. didymobotyra for S. aureus was recorded at concentration 12.5 mg/mL. The minimum fungicidal concentration of ethanol and methanol leaf extract of P. nigrum and C. didymobotyra on C. albicans was recorded at concentration of 25.0 mg

  2. Design and Elementary Evaluation of a Highly-Automated Fluorescence-Based Instrument System for On-Site Detection of Food-Borne Pathogens

    Directory of Open Access Journals (Sweden)

    Zhan Lu

    2017-02-01

    Full Text Available A simple, highly-automated instrument system used for on-site detection of foodborne pathogens based on fluorescence was designed, fabricated, and preliminarily tested in this paper. A corresponding method has been proved effective in our previous studies. This system utilizes a light-emitting diode (LED to excite fluorescent labels and a spectrometer to record the fluorescence signal from samples. A rotation stage for positioning and switching samples was innovatively designed for high-throughput detection, ten at most in one single run. We also developed software based on LabVIEW for data receiving, processing, and the control of the whole system. In the test of using a pure quantum dot (QD solution as a standard sample, detection results from this home-made system were highly-relevant with that from a well-commercialized product and even slightly better reproducibility was found. And in the test of three typical kinds of food-borne pathogens, fluorescence signals recorded by this system are highly proportional to the variation of the sample concentration, with a satisfied limit of detection (LOD (nearly 102–103 CFU·mL−1 in food samples. Additionally, this instrument system is low-cost and easy-to-use, showing a promising potential for on-site rapid detection of food-borne pathogens.

  3. Potential Role of Diploscapter sp. Strain LKC25, a Bacterivorous Nematode from Soil, as a Vector of Food-Borne Pathogenic Bacteria to Preharvest Fruits and Vegetables

    Science.gov (United States)

    Gibbs, Daunte S.; Anderson, Gary L.; Beuchat, Larry R.; Carta, Lynn K.; Williams, Phillip L.

    2005-01-01

    Diploscapter, a thermotolerant, free-living soil bacterial-feeding nematode commonly found in compost, sewage, and agricultural soil in the United States, was studied to determine its potential role as a vehicle of Salmonella enterica serotype Poona, enterohemorrhagic Escherichia coli O157:H7, and Listeria monocytogenes in contaminating preharvest fruits and vegetables. The ability of Diploscapter sp. strain LKC25 to survive on agar media, in cow manure, and in composted turkey manure and to be attracted to, ingest, and disperse food-borne pathogens inoculated into soil or a mixture of soil and composted turkey manure was investigated. Diploscapter sp. strain LKC25 survived and reproduced in lawns of S. enterica serotype Poona, E. coli O157:H7, and L. monocytogenes on agar media and in cow manure and composted turkey manure. Attraction of Diploscapter sp. strain LKC25 to colonies of pathogenic bacteria on tryptic soy agar within 10, 20, 30, and 60 min and 24 h was determined. At least 85% of the worms initially placed 0.5 to 1 cm away from bacterial colonies migrated to the colonies within 1 h. Within 24 h, ≥90% of the worms were embedded in colonies. The potential of Diploscapter sp. strain LKC25 to shed pathogenic bacteria after exposure to bacteria inoculated into soil or a mixture of soil and composted turkey manure was investigated. Results indicate that Diploscapter sp. strain LKC25 can shed pathogenic bacteria after exposure to pathogens in these milieus. They also demonstrate its potential to serve as a vector of food-borne pathogenic bacteria in soil, with or without amendment with compost, to the surface of preharvest fruits and vegetables in contact with soil. PMID:15870330

  4. Arcobacter: an emerging food-borne zoonotic pathogen, its public health concerns and advances in diagnosis and control - a comprehensive review.

    Science.gov (United States)

    Ramees, Thadiyam Puram; Dhama, Kuldeep; Karthik, Kumaragurubaran; Rathore, Ramswaroop Singh; Kumar, Ashok; Saminathan, Mani; Tiwari, Ruchi; Malik, Yashpal Singh; Singh, Raj Kumar

    2017-12-01

    Arcobacter has emerged as an important food-borne zoonotic pathogen, causing sometimes serious infections in humans and animals. Newer species of Arcobacter are being incessantly emerging (presently 25 species have been identified) with novel information on the evolutionary mechanisms and genetic diversity among different Arcobacter species. These have been reported from chickens, domestic animals (cattle, pigs, sheep, horses, dogs), reptiles (lizards, snakes and chelonians), meat (poultry, pork, goat, lamb, beef, rabbit), vegetables and from humans in different countries. Arcobacters are implicated as causative agents of diarrhea, mastitis and abortion in animals, while causing bacteremia, endocarditis, peritonitis, gastroenteritis and diarrhea in humans. Three species including A. butzleri, A. cryaerophilus and A. skirrowii are predominantly associated with clinical conditions. Arcobacters are primarily transmitted through contaminated food and water sources. Identification of Arcobacter by biochemical tests is difficult and isolation remains the gold standard method. Current diagnostic advances have provided various molecular methods for efficient detection and differentiation of the Arcobacters at genus and species level. To overcome the emerging antibiotic resistance problem there is an essential need to explore the potential of novel and alternative therapies. Strengthening of the diagnostic aspects is also suggested as in most cases Arcobacters goes unnoticed and hence the exact epidemiological status remains uncertain. This review updates the current knowledge and many aspects of this important food-borne pathogen, namely etiology, evolution and emergence, genetic diversity, epidemiology, the disease in animals and humans, public health concerns, and advances in its diagnosis, prevention and control.

  5. Occurrence and characterization of food-borne pathogens isolated from fruit, vegetables and sprouts retailed in the Czech Republic.

    Science.gov (United States)

    Vojkovská, Hana; Myšková, Petra; Gelbíčová, Tereza; Skočková, Alena; Koláčková, Ivana; Karpíšková, Renáta

    2017-05-01

    Food of non-animal origin is a major component of the human diet and has been considered to pose a low risk from the point of view of bacteriological safety. However, an increase in the number of outbreaks of illness caused by such pathogens and linked to the consumption of fresh fruit and vegetables have been reported from around the world recently. Salmonella spp., STEC (Shiga toxin producing Escherichia coli) and Listeria monocytogenes are among the most frequently identified agents. Additionally, the transmission of antibiotic resistant strains including also the methicillin resistant S. aureus (MRSA) to humans via the food chain is one of the greatest public health problems being confronted today. Therefore, we focused on the bacterial safety of fruit, vegetables and sprouts on sale in the Czech Republic. One strain (0.3%) of Salmonella Enteritidis phage type PT8, one strain (0.3%) of MRSA and 17 strains (5.0%) of L. monocytogenes were isolated from a total of 339 collected samples. The most problematic commodities were frozen fruit and vegetables (packed and unpacked) and fresh-cut vegetables. Our findings indicate deficiencies in hygiene practices during harvesting, processing and distribution of these commodities. Although sprouts and berries are the most likely to be contaminated by human pathogens, only two samples were positive for the presence of L. monocytogenes. Copyright © 2016 Elsevier Ltd. All rights reserved.

  6. A multiplex PCR/LDR assay for simultaneous detection and identification of the NIAID category B bacterial food and water-borne pathogens.

    Science.gov (United States)

    Rundell, Mark S; Pingle, Maneesh; Das, Sanchita; Hussain, Aashiq; Ocheretina, Oksana; Charles, Macarthur; Larone, Davise H; Spitzer, Eric D; Golightly, Linnie; Barany, Francis

    2014-06-01

    Enteric pathogens that cause gastroenteritis remain a major global health concern. The goal of this study was to develop a multiplex PCR/ligation detection reaction (LDR) assay for the detection of all NIAID category B bacterial food and water-borne pathogens directly from stool specimens. To validate the PCR/LDR assay, clinical isolates of Campylobacter spp., Vibrio spp., Shigella spp., Salmonella spp., Listeria monocytogenes, Yersinia enterocolitica, and diarrheagenic Escherichia coli were tested. The sensitivity and specificity of the assay were assessed using a large number of seeded culture-negative stool specimens and a smaller set of clinical specimens from Haiti. The overall sensitivity ranged from 91% to 100% (median 100%) depending on the species. For the majority of organisms, the sensitivity was 100%. The overall specificity based on initial testing ranged from 98% to 100% depending on the species. After additional testing of discordant samples, the lowest specificity was 99.4%. PCR/LDR detected additional category B agents (particularly diarrheagenic E. coli) in 11/40 specimens from Haiti that were culture-positive for V. cholerae and in approximately 1% of routine culture-negative stool specimens from a hospital in New York. This study demonstrated the ability of the PCR/LDR assay to detect a large comprehensive panel of category B enteric bacterial pathogens as well as mixed infections. This type of assay has the potential to provide earlier warnings of possible public health threats and more accurate surveillance of food and water-borne pathogens. Copyright © 2014 Elsevier Inc. All rights reserved.

  7. Multiplex detection of nine food-borne pathogens by mPCR and capillary electrophoresis after using a universal pre-enrichment medium

    Science.gov (United States)

    Villamizar-Rodríguez, Germán; Fernández, Javier; Marín, Laura; Muñiz, Juan; González, Isabel; Lombó, Felipe

    2015-01-01

    Routine microbiological quality analyses in food samples require, in some cases, an initial incubation in pre-enrichment medium. This is necessary in order to ensure that small amounts of pathogenic strains are going to be detected. In this work, a universal pre-enrichment medium has been developed for the simultaneous growth of Bacillus cereus, Campylobacter jejuni, Clostridium perfringens, Cronobacter sakazakii, Escherichia coli, Enterobacteriaceae family (38 species, 27 genera), Listeria monocytogenes, Staphylococcus aureus, Salmonella spp. (two species, 13 strains). Growth confirmation for all these species was achieved in all cases, with excellent enrichments. This was confirmed by plating on the corresponding selective agar media for each bacterium. This GVUM universal pre-enrichment medium could be useful in food microbiological analyses, where different pathogenic bacteria must be detected after a pre-enrichment step. Following, a mPCR reaction for detection of all these pathogens was developed, after designing a set of nine oligonucleotide pairs from specific genetic targets on gDNA from each of these bacteria, covering all available strains already sequenced in GenBank for each pathogen type. The detection limits have been 1 Genome Equivalent (GE), with the exception of the Fam. Enterobacteriaceae (5 GEs). We obtained amplification for all targets (from 70 to 251 bp, depending on the bacteria type), showing the capability of this method to detect the most important industrial and sanitary food-borne pathogens from a universal pre-enrichment medium. This method includes an initial pre-enrichment step (18 h), followed by a mPCR (2 h) and a capillary electrophoresis (30 min); avoiding the tedious and long lasting growing on solid media required in traditional analysis (1–4 days, depending on the specific pathogen and verification procedure). An external testing of this method was conducted in order to compare classical and mPCR methods. This evaluation was

  8. Multiplex detection of nine food-borne pathogens by mPCR and capillary electrophoresis after using a universal pre-enrichment medium.

    Science.gov (United States)

    Villamizar-Rodríguez, Germán; Fernández, Javier; Marín, Laura; Muñiz, Juan; González, Isabel; Lombó, Felipe

    2015-01-01

    Routine microbiological quality analyses in food samples require, in some cases, an initial incubation in pre-enrichment medium. This is necessary in order to ensure that small amounts of pathogenic strains are going to be detected. In this work, a universal pre-enrichment medium has been developed for the simultaneous growth of Bacillus cereus, Campylobacter jejuni, Clostridium perfringens, Cronobacter sakazakii, Escherichia coli, Enterobacteriaceae family (38 species, 27 genera), Listeria monocytogenes, Staphylococcus aureus, Salmonella spp. (two species, 13 strains). Growth confirmation for all these species was achieved in all cases, with excellent enrichments. This was confirmed by plating on the corresponding selective agar media for each bacterium. This GVUM universal pre-enrichment medium could be useful in food microbiological analyses, where different pathogenic bacteria must be detected after a pre-enrichment step. Following, a mPCR reaction for detection of all these pathogens was developed, after designing a set of nine oligonucleotide pairs from specific genetic targets on gDNA from each of these bacteria, covering all available strains already sequenced in GenBank for each pathogen type. The detection limits have been 1 Genome Equivalent (GE), with the exception of the Fam. Enterobacteriaceae (5 GEs). We obtained amplification for all targets (from 70 to 251 bp, depending on the bacteria type), showing the capability of this method to detect the most important industrial and sanitary food-borne pathogens from a universal pre-enrichment medium. This method includes an initial pre-enrichment step (18 h), followed by a mPCR (2 h) and a capillary electrophoresis (30 min); avoiding the tedious and long lasting growing on solid media required in traditional analysis (1-4 days, depending on the specific pathogen and verification procedure). An external testing of this method was conducted in order to compare classical and mPCR methods. This evaluation was

  9. Multiplex detection of nine food-borne pathogens by mPCR and capillary electrophoresis after using a universal pre-enrichment medium

    Directory of Open Access Journals (Sweden)

    Germán eVillamizar-Rodríguez

    2015-11-01

    Full Text Available Routine microbiological quality analyses in food samples require, in some cases, an initial incubation in pre-enrichment medium. This is necessary in order to assure that small amounts of pathogenic strains are going to be detected. In this work, a universal pre-enrichment medium has been developed for simultaneous growth of Bacillus cereus, Campylobacter jejuni, Clostridium perfringens, Cronobacter sakazakii, Escherichia coli, Enterobacteriaceae family (thirty eight species, twenty seven genera, Listeria monocytogenes, Staphylococcus aureus, Salmonella spp. (two species, thirteen strains. Growth confirmation for all these species was achieved in all cases, with excellent enrichments. This was confirmed by plating on the corresponding selective agar media for each bacterium. This GVUM universal pre-enrichment medium could be useful in food microbiological analyses, where different pathogenic bacteria must be detected after a pre-enrichment step. Following, a mPCR reaction for detection of all these pathogens was developed, after designing a set of nine oligonucleotide pairs from specific genetic targets on gDNA from each of these bacteria, covering all available strains already sequenced in GenBank for them. The detection limits have been 1 Genome Equivalent, with the exception of Fam. Enterobacteriaceae (5 GEs. We obtained amplification for all targets (from 70 to 251 bp, depending on the bacteria type, showing the capability of this method to detect the most important industrial and sanitary food-borne pathogens from a universal pre-enrichment medium. This method includes an initial pre-enrichment step (18 h, followed by a mPCR (2 h and a capillary electrophoresis (30 min; avoiding the tedious and long lasting growing on solid media required in traditional analysis (1 to 4 days, depending on the specific pathogen and verification procedure. An external testing of this method was conducted in order to compare classical and mPCR methods. This

  10. Extreme Heat Resistance of Food Borne Pathogens Campylobacter jejuni, Escherichia coli, and Salmonella Typhimurium on Chicken Breast Fillet during Cooking

    NARCIS (Netherlands)

    Jong, de A.E.I.; Asselt, van E.D.; Zwietering, M.H.; Nauta, M.J.; Jonge, de R.

    2012-01-01

    The aim of this research was to determine the decimal reduction times of bacteria present on chicken fillet in boiling water. The experiments were conducted with Campylobacter jejuni, Salmonella, and Escherichia coli. Whole chicken breast fillets were inoculated with the pathogens, stored overnight

  11. TrpA1 Regulates Defecation of Food-Borne Pathogens under the Control of the Duox Pathway.

    Directory of Open Access Journals (Sweden)

    Eun Jo Du

    2016-01-01

    Full Text Available Pathogen expulsion from the gut is an important defense strategy against infection, but little is known about how interaction between the intestinal microbiome and host immunity modulates defecation. In Drosophila melanogaster, dual oxidase (Duox kills pathogenic microbes by generating the microbicidal reactive oxygen species (ROS, hypochlorous acid (HOCl in response to bacterially excreted uracil. The physiological function of enzymatically generated HOCl in the gut is, however, unknown aside from its anti-microbial activity. Drosophila TRPA1 is an evolutionarily conserved receptor for reactive chemicals like HOCl, but a role for this molecule in mediating responses to gut microbial content has not been described. Here we identify a molecular mechanism through which bacteria-produced uracil facilitates pathogen-clearing defecation. Ingestion of uracil increases defecation frequency, requiring the Duox pathway and TrpA1. The TrpA1(A transcript spliced with exon10b (TrpA1(A10b that is present in a subset of midgut enteroendocrine cells (EECs is critical for uracil-dependent defecation. TRPA1(A10b heterologously expressed in Xenopus oocytes is an excellent HOCl receptor characterized with elevated sensitivity and fast activation kinetics of macroscopic HOCl-evoked currents compared to those of the alternative TRPA1(A10a isoform. Consistent with TrpA1's role in defecation, uracil-excreting Erwinia carotovora showed higher persistence in TrpA1-deficient guts. Taken together, our results propose that the uracil/Duox pathway promotes bacteria expulsion from the gut through the HOCl-sensitive receptor, TRPA1(A10b, thereby minimizing the chances that bacteria adapt to survive host defense systems.

  12. Extreme Heat Resistance of Food Borne Pathogens Campylobacter jejuni, Escherichia coli, and Salmonella typhimurium on Chicken Breast Fillet during Cooking

    OpenAIRE

    de Jong, Aarieke E. I.; van Asselt, Esther D.; Zwietering, Marcel H.; Nauta, Maarten J.; de Jonge, Rob

    2012-01-01

    The aim of this research was to determine the decimal reduction times of bacteria present on chicken fillet in boiling water. The experiments were conducted with Campylobacter jejuni, Salmonella, and Escherichia coli. Whole chicken breast fillets were inoculated with the pathogens, stored overnight (4∘C), and subsequently cooked. The surface temperature reached 70∘C within 30 sec and 85∘C within one minute. Extremely high decimal reduction times of 1.90, 1.97, and 2.20 min were obtained fo...

  13. Use of multi-locus sequencing typing as identification method for the food-borne pathogen Listeria monocytogenes: a review

    Directory of Open Access Journals (Sweden)

    Sonia Lamon

    2015-01-01

    Full Text Available Listeria monocytogenes is an ubiquitous, intracellular pathogen which has been implicated within the past decade as the causative organism in several outbreaks of foodborne diseases. In this review, a new approach to molecular typing primarily designed for global epidemiology has been described: multi-locus sequencing typing (MLST. This approach is novel, in that it uses data that allow the unambiguous characterization of bacterial strains via the Internet. Our aim is to present the currently available selection of references on L. monocytogenes MLST detection methods and to discuss its use as gold standard to L. monocytogenes subtyping method.

  14. Study on the Chemical Constituents and Antibacterial Activity of Kelussia odoratissima and Teucrium polium Essential Oils against Some Food Borne Pathogens

    Directory of Open Access Journals (Sweden)

    mansour Mashreghi

    2015-05-01

    Full Text Available In this research the essential oils (EOs of Kelussia odoratissima and Teucrium polium were extracted by hydrodistillation. Extracted essential oils constituents were analyzed by gas chromatograph (GC and GC/mass spectrometry and the essential oils constituents identified according to retention time and mass spectrum. Then minimum inhibitory concentration (MIC and minimum bactericidal concentration (MBC of the essential oils against Staphylococcus aureus, Bacillus cereus, Listeria monocytogenes، Escherichia coli O157H7, Salmonella enterica, and Pseudomonas aureogenosa were determined by microdilution technique using ELISA reader. The results showed that there are differences between the essential oils constituents as the main constituents in Kelussia odoratissima were (Z-ligustilide, (Z-3-butylidene-phthalide, limonene+-phellandren B. The main constituents of Teucrium polium essential oils were β-caryophylene, Germacrene D, γ-cadinene, (Z- nerolidol, camphor, β-pinene, α- camphene, linalool, α-humulene. The MIC of Kelussia odoratissima EO was between 0.31 mg/ml (for S. aureus to 2.5 mg/ml (for Salmonella enterica but MIC of the Teucrium polium EO was between 0.16 mg/ml (for S. aureus and 1.25 mg/ml (for Salmonella enterica. In conclusion, indigenous medicinal plants could be used for effective control of food borne pathogens as a complementary method that has less unfavorable effect on organoleptic attitudes of each products

  15. Occurrence of emerging food-borne pathogenic Arcobacter spp. isolated from pre-cut (ready-to-eat) vegetables.

    Science.gov (United States)

    Mottola, Anna; Bonerba, Elisabetta; Bozzo, Giancarlo; Marchetti, Patrizia; Celano, Gaetano Vitale; Colao, Valeriana; Terio, Valentina; Tantillo, Giuseppina; Figueras, Maria José; Di Pinto, Angela

    2016-11-07

    Given that changes in consumer food behaviours have led to an increase in the demand for pre-cut ready-to-eat (RTE) vegetables, and that few data are currently available on the occurrence of Arcobacter spp. in such foods, the aim of the present study was to assess the occurrence of Arcobacter spp. that carry virulence-associated genes on pre-cut RTE vegetables, using cultural and molecular methods. Arcobacter was detected using biomolecular identification methods in 44/160 (27.5%) of the samples, of which 40/44 (90.9%) isolates corresponded to A. butzleri and 4/44 (9.1%) to A. cryaerophilus. Studying the incidence of 9 virulence-associated genes revealed the widespread distribution of these genes among the Arcobacter isolates tested. The results obtained in our research provided plenty of information on the health risks associated with the direct consumption of raw vegetables, and highlight the need to implement further studies at each level of the production chain, in order to obtain further information to help protect human health. Copyright © 2016 Elsevier B.V. All rights reserved.

  16. Invitro Evaluation Of Antibacterial Activity Of Lactic Acid Bacteria Isolated From Ergo And Qotchqotcha Ethiopian Traditional Fermented Foods Against Some Selected Food Borne Pathogens

    Directory of Open Access Journals (Sweden)

    Lamenew Fenta

    2017-09-01

    Full Text Available The prevention of pathogenic bacteria by lactic acid bacteria LAB isolated directly from foods is an innovative approach. With the aim of determining the anti-bacterial activity of Lactic acid bacteria isolated from ergo and qotchqotcha Ethiopian fermented food 12 samples of each were taken from the 4 different kebeles of Assosa town. Isolation of LAB from the selected samples were carried out using MRS media. The different set of isolates were characterized using primary biochemical tests. Isolates which were gram positive catalase negative and KOH negative were considered to be presumptive LAB and further characterized by using different biochemical tests for further identification. 16 isolates from ergo samples were isolated. Based on Bergeys manual of determinative bacteriology the 16 isolates belonged to four 4 LAB species namely Lactobacillus acidophilus 18.75 Lactobacillus casei 31.25 Streptococcus thermophiles 25 and Lactobacillus bulgaricus 25. Likewise 5 isolates were isolated from Qotchqotcha and the five isolates were found to be Lactobacillus acidophilus 80 and Pediococcus acidilactici 20. Cell free solution from MRS broth culture of theses LAB was prepared and tested against Escherichia coli O157H7 and Staphylococcus aureus using agar-well diffusion method. Of the 16 isolates isolated from ergo 9 of them show antimicrobial activity against E. coli O157H7 with a largest inhibition zone measured about 7.331.20mm by EK0101 and 12 of them show antimicrobial activity against S. aureus with a largest inhibition zone measured about 11.66 0.88mm by EK0201. On the basis of morphological and biochemical test done EK0101 was found to be presumptive Lactobacillus acidophilus and EK0201 to be Streptococcus thermophiles. All of the isolates isolated from Qotchqotcha showed antimicrobial activity against the tested organisms though there was a significant difference in their activity P0.05. The isolate QK0201 showed an inhibition zone of about 6

  17. [Antibacterial actin of vinegar against food-borne pathogenic bacteria including Escherichia coli O157:H7 (Part 2). Effect of sodium chloride and temperature on bactericidal activity].

    Science.gov (United States)

    Entani, E; Asai, M; Tsujihata, S; Tsukamoto, Y; Ohta, M

    1997-05-01

    Bactericidal effects of various kinds of AWASEZU (processed vinegar, 2.5% acidity) on food-borne pathogenic bacteria including Escherichia coli O157:H7 and other bacteria were examined. the order of bactericidal activities was NIHAIZU (3.5% NaCl was added) > SANBA-IZU (3.5% NaCl and 10% sucrose were added) > plain vinegar (spirit vinegar) > AMAZU (10% sucrose was added). This indicates that their activities were enhanced by the addition of sodium chloride and suppressed by the addition of sugar. On the other hand, when soy sauce was used instead of sodium chloride, the order of bactericidal activities was plain vinegar > AMAZU > NIHAIZU > SANBAIZU. This is mainly because their activities were suppressed by the increase in the pH value. The effect of sodium chloride (0.01-15%) and temperature (10-50 degrees C) on bactericidal activities against E. coli O157:H7 in spirit vinegar (0.5-2.5% acidity) was further examined. When vinegar was used in combination with sodium chloride, predominant synergism on the bactericidal activity was observed. Their activities were markedly enhanced by the addition of sodium chloride in proportion to the concentration. In addition to this, at higher temperatures spirit vinegar killed bacteria much more rapidly. It should be noted that the bactericidal activity of spirit vinegar was extremely enhanced by the combined use of the addition of sodium chloride and the rise of temperature. For example, in 2.5% acidity vinegar, the time required for 3 log decrease in viable cell numbers at 20 degrees C was shortened to 1/140-fold by the addition of 5% sodium chloride, shortened to 1/51-fold by the rise of the reaction temperature at 40 degrees C, and shortened to 1/830-fold; 0.89 minutes by both the addition of 5% sodium chloride and the rise of temperature at 40 degrees C. In order to propose the methods to prevent food poisoning by bacterial infection, bactericidal activities of vinegar solution containing sodium chloride on cooking tools and

  18. Detection of Seed-Borne Fungal pathogens on Soya beans

    International Nuclear Information System (INIS)

    Wanyera, R

    2002-01-01

    Soya beans (Glycine max max L.) are propagated by seed and are vulnerable to devastating seed-borne diseases where the importance of each disease varies greatly. Seed-borne diseases cause significant losses in seed, food production and quality of seed and grain. Studies on seed borne diseases in Kenya have not been given emphasis on very important seed crops among the soya beans. The identification and rejection of the seed crop is mainly based on visual appraisal in the field with little or no laboratory work undertaken. Three methods were used to analyse the health status of fifty two soyabean seed samples collected from the National Plant Breeding Research Centre-Njoro and farmers' fields in Bahati division of Nakuru district. The analysis was carried out in the laboratory. The objective of the analysis was to identify and inventory seed-borne fungal pathogens of soya beans grown in Kenya. The normal blotter, herbicide and germination test methods were used. The tests revealed the presence of several important fungal pathogens on soyabean seed samples. Among the pathogens recorded Phoma sp, phomopsis sp, fusarium sp, Hainesia lyhri and Cercospora kikuchii were frequently recorded on the seed samples. Results of the germination test between paper method showed low germination (0-6.7%) on the normal sedlings in all the test samples. Hainesia lyhri was a new record on the soyabean seeds

  19. The wild life of tick-borne pathogens

    OpenAIRE

    Hofmeester, Tim R.

    2016-01-01

    Diseases that are transmitted by arthropod vectors from animal hosts to humans – so called zoonotic vector-borne diseases – have increased in incidence in the last decades. In North America and Europe, tick-borne pathogens cause the majority of vector-borne diseases, including Lyme borreliosis and tick-borne encephalitis. The pathogens causing these diseases are transmitted by tick species within the Ixodes ricinus complex. These are generalist ticks that have a multi-year lifecycle with thre...

  20. The wild life of tick-borne pathogens

    NARCIS (Netherlands)

    Hofmeester, Tim R.

    2016-01-01

    Diseases that are transmitted by arthropod vectors from animal hosts to humans – so called zoonotic vector-borne diseases – have increased in incidence in the last decades. In North America and Europe, tick-borne pathogens cause the majority of vector-borne diseases, including Lyme borreliosis

  1. Evaluation of antibacterial effect of Rosmarinus officinalis L. essential oil on three food-borne pathogens in vegetables by propidium monoazide quantitative PCR

    Directory of Open Access Journals (Sweden)

    M Azizkhani

    2015-08-01

    Full Text Available Essential oils (EOs have long been applied as flavoring agents in foods. Nowadays, due to the antimicrobial properties of EOs, they have been used as natural food preservatives. In this study, initial experiments were performed in order to elucidate the minimum bactericidal concentration of Rosmarinus officinalis L.EO on Escherichia coli O157:H7, Salmonella enterica and Listeria monocytogenes. Thereafter, PMA-qPCR was applied in order to selectively quantify living cells within a bacterial population treated with rosemary EO. Inactivation was obtained at EO concentrations of 1%, 0.45%, 0.9% for L. monocytogenes, E. coli O157:H7 and S. enterica, respectively. L. monocytogenes were totally killed within 45 min while it took 90 min for E. coli O157:H7and S. enterica. It was concluded that rosemary EO has the potential to be used as a natural food additive or bio-preservative since it was able to irreversibly inactivate the three tested pathogens at lower concentrations and short exposition times in comparison with the other EOs. In addition, PMA-qPCR approach proved quantitatively precise and specific to selectively detect live pathogenic bacteria in vegetables following inactivation with rosemary EO.

  2. Antibacterial Activity of Clove ( Syzigium aromaticum L .) Essential Oil and Gamma Irradiation against Some Food-Borne Pathogens in Minced Chicken Meat

    International Nuclear Information System (INIS)

    Gibriel, A.Y.; ALI, H.G.M.; Abdeldaiem, M.H.

    2017-01-01

    Antibacterial activity of clove essential oil ( Syzigium aromaticum L.) against five strains of pathogenic bacteria namely, Pseudomonas aeruginosa, Staphylococcus aureus, Salmonella typhimurium, Escherichia coli and Bacillus cereus was investigated in vitro. The essential oil of clove exhibited antibacterial activity against tested microorganisms. Comparatively, 25, 50 and 100 ml/l concentrations of clove essential oil were of less inhibitory effect than 200, 300 and 500 ml/l concentrations. However, S. aureus showed less sensitivity towards clove essential oil inhibition; however Salmonella typhimurium was strongly inhibited by clove essential oil. Then, the effect of clove essential oil at two concentrations (3 and 5% v/w) and combined treatments between gamma irradiation at doses of 1, 2, 3, 4, 5 and 6 kGy and clove essential oil at concentrations as formerly on inactivation of Pseudomonas aeruginosa, Staphylococcus aureus, Salmonella typhimurium , Escherichia coli and Bacillus cereus inoculated into chicken minced meat was investigated. Addition of clove essential oil to samples of chicken minced meat inoculated with three pathogens reduced the counts of these pathogens, proportionally with increasing concentration. The irradiated samples at doses of 3, 4, 5 and 6 kGy and that irradiated at doses 2, 3, 4, 5 and 6 kGy of chicken minced and containing 3 and 5% completely inactivation of inoculated pathogens and not detected during cold storage at 4±1°C for 7 days. Accordingly, clove essential oil can be used as natural antimicrobial additive or in combination treatments with gamma irradiation for incorporation in various food products. Also, there is a possibility of using low doses gamma irradiation and low concentrations clove essential oil for treatment of meat products in order to this to reduce the economic cost of products and improving hygienic quality and extend its shelf-life. Therefore clove essential oil could be used as preservative ingredients in

  3. Methods for detecting pathogens in the beef food chain: detecting particular pathogens

    Science.gov (United States)

    The main food-borne pathogens of concern in the beef food chain are Shiga toxin-producing Escherichia coli (STEC) and Salmonella spp.; however, the presence of other pathogens, including Listeria monocytogenes, Campylobacter spp., Clostridium spp., Bacillus cereus, and Mycobacterium avium subsp. par...

  4. From ontology selection and semantic web to the integrated information system of food-borne diseases and food safety

    Science.gov (United States)

    Over the last three decades, the rapid explosion of information and resources on human food-borne diseases and food safety has provided the ability to rapidly determine and interpret the mechanisms of survival and pathogenesis of food-borne pathogens. However, several factors have hindered effective...

  5. The impact of food manufacturing practices on food borne diseases

    Directory of Open Access Journals (Sweden)

    Cristina Paiva de Sousa

    2008-08-01

    Full Text Available Food-borne illness is a major international problem and an important cause of reduced economic growth. The contamination of the food supply with the pathogens and its persistence, growth, multiplication and/or toxin production has emerged as an important public health concern. Most of these problems could be controlled with the efforts on the part of the food handlers, whether in a processing plant, a restaurant, and others. In contrast with most chemical hazardous compounds, the concentration of food pathogens changes during the processing, storage, and meal preparation, making it difficult to estimate the number of the microorganisms or the concentration of their toxins at the time of ingestion by the consumer. This review shows main microorganisms related to the manipulation practices such as Staphylococcus spp., Escherichia coli and Salmonella spp. and describes the factors regarding the food-borne illness highlighting the impact of good manipulation practices on the food safety and food quality.Doenças veiculadas por alimentos são um dos maiores problemas de Saúde Pública no mundo, sendo responsáveis por reduções no crescimento econômico global. A contaminação de alimentos com patógenos e sua persistência, crescimento, multiplicação e/ou produção de toxinas é de interesse da Saúde Pública. Estes problemas podem ser controlados com esforços e treinamento constante de manipuladores de alimentos. Em contraste com perigos químicos e físicos, a concentração de patógenos em alimentos é modificada durante etapas de processamento, acondicionamento e preparação, tornando difícil estimar e quantificar o número de microrganismos ou a concentração de suas toxinas no momento da ingestão do alimento. Esta revisão comenta sobre os principais microrganismos bacterianos relacionados à práticas de manipulação como Staphylococcus spp., Escherichia coli e Salmonella spp. ressaltando o consumo de alimentos em ruas, o

  6. Growth and membrane fluidity of food-borne pathogen Listeria monocytogenes in the presence of weak acid preservatives and hydrochloric acid

    Directory of Open Access Journals (Sweden)

    Ioannis eDiakogiannis

    2013-06-01

    Full Text Available This study addresses a major issue in microbial food safety, the elucidation of correlations between acid stress and changes in membrane fluidity of the pathogen Listeria monocytogenes. In order to assess the possible role that membrane fluidity changes play in L. monocytogenes tolerance to antimicrobial acids (acetic, lactic, hydrochloric acid at low pH or benzoic acid at neutral pH, the growth of the bacterium and the gel-to-liquid crystalline transition temperature point (Tm of cellular lipids of each adapted culture was measured and compared with unexposed cells. The Tm of extracted lipids was measured by Differential Scanning Calorimetry (DSC. A trend of increasing Tm values but not of equal extent was observed upon acid tolerance for all samples and this increase is not directly proportional to each acid antibacterial action. The smallest increase in Tm value was observed in the presence of lactic acid, which presented the highest antibacterial action. In the presence of acids with high antibacterial action such as acetic, hydrochloric acid or low antibacterial action such as benzoic acid, increased Tm values were measured. The Tm changes of lipids were also correlated with our previous data about fatty acid changes to acid adaptation. The results imply that the fatty acid changes are not the sole adaptation mechanism for decreased membrane fluidity (increased Tm. Therefore, this study indicates the importance of conducting an in-depth structural study on how acids commonly used in food systems affect the composition of individual cellular membrane lipid molecules.

  7. Human to human transmission of arthropod-borne pathogens

    NARCIS (Netherlands)

    Martina, Byron E.; Barzon, Luisa; Pijlman, Gorben P.; Fuente, de la José; Rizzoli, Annapaola; Wammes, Linda J.; Takken, Willem; Rij, van Ronald P.; Papa, Anna

    2017-01-01

    Human-to-human (H2H) transmitted arthropod-borne pathogens are a growing burden worldwide, with malaria and dengue being the most common mosquito-borne H2H transmitted diseases. The ability of vectors to get infected by humans during a blood meal to further propel an epidemic depends on complex

  8. Human to human transmission of arthropod-borne pathogens

    NARCIS (Netherlands)

    Martina, B.E.; Barzon, L.; Pijlman, G.P.; Fuente, J. de la; Rizzoli, A.; Wammes, L.J.; Takken, W.; Rij, R.P. van; Papa, A.

    2017-01-01

    Human-to-human (H2H) transmitted arthropod-borne pathogens are a growing burden worldwide, with malaria and dengue being the most common mosquito-borne H2H transmitted diseases. The ability of vectors to get infected by humans during a blood meal to further propel an epidemic depends on complex

  9. Chemical composition and in vitro antibacterial activity of essential oil and methanol extract of Echinophora platyloba D.C against some of food-borne pathogenic bacteria

    Directory of Open Access Journals (Sweden)

    Mohammad Hashemi

    2013-06-01

    Full Text Available Echinophora Platyloba D.C as a medicinal plant is used for preservation of foods and treatment of many diseases in different regions of Iran. The present study was undertaken to determine the chemical composition and investigation of the antibacterial effects of essential oil as well as methanol extract from aerial part of Echinophora Platyloba D.C against S. aureus, L. monocytogenes, S. Thyphimurium and E. coli. Chemical analysis using gas chromatography and mass spectrophotometry (GC/MS showed that ocimene (26.51%, 2,3-Dimethyl-cyclohexa- 1,3-diene (9.87%, alpha-pinene (7.69% and gamma-dodecanolactone (5.66% were dominant components of essential oil and the main constituents of methanol extract were o- Cymene (28.66%, methanol (8.50%, alpha-pinene (7.42% and gamma-decalactone (5.20%. The essential oil showed strong antimicrobial activity against tested bacteria, whereas the methanol extract almost remained inactive against gram-negative bacteria. The most sensitive bacteria to essential oil and extract of Echinophora Platyloba D.C were L. mono- cytogenes and S. aureus. Minimum inhibitory concentration (MIC values of essential oil against L. monocytogenes and S. aureus were 6250 and 12500 ppm, respectively. MIC of methanol extract against S. aureus and L. monocytogenes was 25000 ppm. Therefore, purifying and evaluation of antibacterial effects of the active substances of the essential oil and methanol extract of this plant for future application as antibacterial agents and food preservatives to combat pathogenic and toxigenic microorganisms is recommended.

  10. Impact of climate trends on tick-borne pathogen transmission

    Directory of Open Access Journals (Sweden)

    Agustin eEstrada-Pena

    2012-03-01

    Full Text Available Recent advances in climate research together with a better understanding of tick-pathogen interactions, the distribution of ticks and the diagnosis of tick-borne pathogens raise questions about the impact of environmental factors on tick abundance and spread and the prevalence and transmission of tick-borne pathogens. While undoubtedly climate plays a role in the changes in distribution and seasonal abundance of ticks, it is always difficult to disentangle factors impacting on the abundance of tick hosts from those exerted by human habits. All together, climate, host abundance and social factors may explain the upsurge of epidemics transmitted by ticks to humans. Herein we focused on tick-borne pathogens that affect humans with pandemic potential. Borrelia burgdorferi s.l. (Lyme disease, Anaplasma phagocytophilum (human granulocytic anaplasmosis and tick-borne encephalitis virus (tick-borne encephalitis are transmitted by Ixodes spp. Crimean-Congo hemorrhagic fever virus (Crimean-Congo hemorrhagic fever is transmitted by Hyalomma spp. In this review, we discussed how vector tick species occupy the habitat as a function of different climatic factors, and how these factors impact on tick survival and seasonality. How molecular events at the tick-pathogen interface impact on pathogen transmission is also discussed. Results from statistically and biologically derived models are compared to show that while statistical models are able to outline basic information about tick distributions, biologically derived models are necessary to evaluate pathogen transmission rates and understand the effect of climatic variables and host abundance patterns on pathogen transmission. The results of these studies could be used to build early alert systems able to identify the main factors driving the subtle changes in tick distribution and seasonality and the prevalence of tick-borne pathogens.

  11. Food-borne diseases - the challenges of 20 years ago still persist while new ones continue to emerge.

    NARCIS (Netherlands)

    Newell, D.G.; Koopmans, M.; Verhoef, L.; Duizer, E.; Aidara-Kane, A.; Sprong, H.; Opsteegh, M.; Langelaar, M.; Threfall, J.; Scheutz, F.; van der Giessen, J.; Kruse, H.

    2010-01-01

    The burden of diseases caused by food-borne pathogens remains largely unknown. Importantly data indicating trends in food-borne infectious intestinal disease is limited to a few industrialised countries, and even fewer pathogens. It has been predicted that the importance of diarrhoeal disease,

  12. Typing and virulence factors of food-borne Candida spp. isolates.

    Science.gov (United States)

    Rajkowska, Katarzyna; Kunicka-Styczyńska, Alina

    2018-08-20

    Food-borne yeasts, excluding yeasts used as starter cultures, are commonly considered as food spoilage microorganisms. However, the incidence of non-C. albicans Candida (NCAC) infections has increased considerably over the past two decades. Although 15 Candida species are frequently identified as pathogens, a threat to human from food-borne Candida is poorly recognized. In the present study food-borne NCAC were characterized for the virulence factors, known to be associated with yeast pathogenicity. All food-borne strains in planktonic forms and 89% in biofilm structures represented biotypes established for C. albicans, and 61% demonstrated hemolytic activity. 56-94% of food-borne isolates formed biofilms on glass and biomaterials at a level comparable to clinical C. albicans. Nine out of eighteen tested food-borne NCAC strains (C. krusei, C. lusitaniae, C. famata, C. colliculosa, C. parapsilosis, C. tropicalis) showed similarity to clinical C. albicans in terms of their biotypes and the tested virulence factors, allocating them in a group of risk of potential pathogens. However, their capacity to grow at 37 °C seems to be the preliminary criterion in the study of potential virulence of food-borne yeasts. Copyright © 2018 Elsevier B.V. All rights reserved.

  13. Protecting Adults and Children from Blood-Borne Pathogens.

    Science.gov (United States)

    Freeman, Nancy K.; Corning, Lisa L.

    2000-01-01

    Recommends universal precautions policies and procedures to minimize for children and adults in early childhood settings the risk of infection from exposure to blood-borne pathogens such as hepatitis B or HIV. Outlines symptoms of hepatitis B and HIV/AIDS. Discusses legal and ethical implications related to inclusion. Lists resources for teachers…

  14. Efficacy of UV-C irradiation for inactivation of food-borne pathogens on sliced cheese packaged with different types and thicknesses of plastic films.

    Science.gov (United States)

    Ha, Jae-Won; Back, Kyeong-Hwan; Kim, Yoon-Hee; Kang, Dong-Hyun

    2016-08-01

    In this study, the efficacy of using UV-C light to inactivate sliced cheese inoculated with Escherichia coli O157:H7, Salmonella Typhimurium, and Listeria monocytogenes and, packaged with 0.07 mm films of polyethylene terephthalate (PET), polyvinylchloride (PVC), polypropylene (PP), and polyethylene (PE) was investigated. The results show that compared with PET and PVC, PP and PE films showed significantly reduced levels of the three pathogens compared to inoculated but non-treated controls. Therefore, PP and PE films of different thicknesses (0.07 mm, 0.10 mm, and 0.13 mm) were then evaluated for pathogen reduction of inoculated sliced cheese samples. Compared with 0.10 and 0.13 mm, 0.07 mm thick PP and PE films did not show statistically significant reductions compared to non-packaged treated samples. Moreover, there were no statistically significant differences between the efficacy of PP and PE films. These results suggest that adjusted PP or PE film packaging in conjunction with UV-C radiation can be applied to control foodborne pathogens in the dairy industry. Copyright © 2016. Published by Elsevier Ltd.

  15. Prospects of eliminating pathogens by the process of food irradiation

    International Nuclear Information System (INIS)

    Kampelmacher, E.H.

    1981-01-01

    Food-borne diseases are an increasing health hazard throughout the world. Some of these diseases, such as salmonellosis, staphylo-entero-toxicosis, botulism, vibriosis and parasitic infections have always played an important role, whereas some other food-borne pathogens, such as Campylobacter, Vibrio parahaemolyticus and toxin-producing fungi have only been recognised in recent decades. Changing food-production methods, food processing and especially food habits, together with the enormous trade in foods and feeds from one part of the world to the other, are responsible for the increase of these diseases. To meet this situation, prevention and control of food-borne diseases, which involve large groups of persons and play a major socio-economic role in many parts of the world, are of utmost importance. In prevention and control programmes food irradiation can be applied successfully and may solve some of the food and feed contamination problems. The author summarizes to-day's most important food-borne diseases, the type of foods which are responsible for infections in man and animals, and the commodities in which low-dose food irradiation may be of great value in preventing these diseases. The advantages of irradiation versus the use of chemical additives and pesticides and with respect to the prevention of cross-contamination (which plays a very important role in initiating food-borne diseases) by pre-packaging, are emphasized. The required irradiaton doses to eliminate or reduce the number of pathogenic organisms which may be present in foods, the problem of radioresistance and the acceptability of irradiated food are discussed. Finally to-day's situation of irradiated foods with regard to legislation, consumers' information and economic feasibility is summarized. (author)

  16. Development of a novel approach for the production of dried genomic DNA for use as standards for qualitative PCR testing of food-borne pathogens

    DEFF Research Database (Denmark)

    Trapmann, S.; Catalani, P.; Hoorfar, Jeffrey

    2004-01-01

    As part of a multi-centre European project, FOOD-PCR, the feasibility of a novel approach for production of dried bacterial DNA that could be used as certified reference materials (CRM) was assessed. Selected strains of Salmonella typhimurium, Listeria monocytogenes, Escherichia coli O157...

  17. The food-borne pathogen Campylobacter jejuni depends on the AddAB DNA repair system to defend against bile in the intestinal environment.

    Science.gov (United States)

    Gourley, Christopher R; Negretti, Nicholas M; Konkel, Michael E

    2017-10-31

    Accurate repair of DNA damage is crucial to ensure genome stability and cell survival of all organisms. Bile functions as a defensive barrier against intestinal colonization by pathogenic microbes. Campylobacter jejuni, a leading bacterial cause of foodborne illness, possess strategies to mitigate the toxic components of bile. We recently found that growth of C. jejuni in medium with deoxycholate, a component of bile, caused DNA damage consistent with the exposure to reactive oxygen species. We hypothesized that C. jejuni must repair DNA damage caused by reactive oxygen species to restore chromosomal integrity. Our efforts focused on determining the importance of the putative AddAB DNA repair proteins. A C. jejuni addAB mutant demonstrated enhanced sensitivity to deoxycholate and was impaired in DNA double strand break repair. Complementation of the addAB mutant restored resistance to deoxycholate, as well as function of the DNA double strand break repair system. The importance of these findings translated to the natural host, where the AddAB system was found to be required for efficient C. jejuni colonization of the chicken intestine. This research provides new insight into the molecular mechanism utilized by C. jejuni, and possibly other intestinal pathogens, to survive in the presence of bile.

  18. Immobilization with Metal Hydroxides as a Means To Concentrate Food-Borne Bacteria for Detection by Cultural and Molecular Methods†

    OpenAIRE

    Lucore, Lisa A.; Cullison, Mark A.; Jaykus, Lee-Ann

    2000-01-01

    The application of nucleic acid amplification methods to the detection of food-borne pathogens could be facilitated by concentrating the organisms from the food matrix before detection. This study evaluated the utility of metal hydroxide immobilization for the concentration of bacterial cells from dairy foods prior to detection by cultural and molecular methods. Using reconstituted nonfat dry milk (NFDM) as a model, two food-borne pathogens (Listeria monocytogenes and Salmonella enterica sero...

  19. Food-borne bacteremic illnesses in febrile neutropenic children

    Directory of Open Access Journals (Sweden)

    Anselm Chi-wai Lee

    2011-08-01

    Full Text Available Bacteremia following febrile neutropenia is a serious complication in children with malignancies. Preventive measures are currently targeted at antimicrobial prophylaxis, amelioration of drug-induced neutropenia, and nosocomial spread of pathogens, with little attention to community-acquired infections. A retrospective study was conducted at a pediatric oncology center during a 3-year period to identify probable cases of food-borne infections with bacteremia. Twenty-one bacteremic illnesses affecting 15 children receiving chemotherapy or hematopoietic stem cell transplantation were reviewed. Three (14% episodes were highly suspected of a food-borne origin: a 17-year-old boy with osteosarcoma contracted Sphingomonas paucimobilis septicemia after consuming nasi lemak bought from a street hawker; a 2-year-old boy with acute lymphoblastic leukemia developed Chryseobacterium meningosepticum septicemia after a sushi dinner; a 2-year-old girl was diagnosed with acute lymphoblastic leukemia and Lactobacillus bacteremia suspected to be of probiotic origin. All of them were neutropenic at the time of the infections and the bacteremias were cleared with antibiotic treatment. Food-borne sepsis may be an important, but readily preventable, cause of bloodstream infections in pediatric oncology patients, especially in tropical countries with an abundance of culinary outlets.

  20. Human sparganosis, a neglected food borne zoonosis.

    Science.gov (United States)

    Liu, Quan; Li, Ming-Wei; Wang, Ze-Dong; Zhao, Guang-Hui; Zhu, Xing-Quan

    2015-10-01

    Human sparganosis is a food borne zoonosis caused by the plerocercoid larvae (spargana) of various diphyllobothroid tapeworms of the genus Spirometra. Human infections are acquired by ingesting the raw or undercooked meat of snakes or frogs, drinking untreated water, or using raw flesh in traditional poultices. More than 1600 cases of sparganosis have been documented worldwide, mostly in east and southeast Asia. Sporadic cases have been reported in South America, Europe, and Africa, and several cases have been described in travellers returning from endemic regions. Epidemiological data suggest that the increased effect of sparganosis on human health is because of greater consumption of raw meat of freshwater frogs and snakes. This Review provides information about the Spirometra parasites and their lifecycles, summarises clinical features, diagnosis, and treatment of human sparganosis, and describes geographical distribution and infection characteristics of Spirometra parasites in host animals. Copyright © 2015 Elsevier Ltd. All rights reserved.

  1. Tracing pathogens in the food chain

    NARCIS (Netherlands)

    Brul, S.; Fratamico, P.M.; McMeekin, T.A.

    2010-01-01

    Successful methods for the detection and investigation of outbreaks of foodborne disease are essential for ensuring consumer safety. Increased understanding of the transmission of pathogens in food chains will also assist efforts to safeguard public health. Tracing pathogens in the food chain

  2. PREVALENCE AND ANTIBIOTIC RESISTANCE OF FOOD BORNE BACTERIAL CONTAMINATION IN SOME EGYPTIAN FOOD food

    Directory of Open Access Journals (Sweden)

    Samy Selim

    2015-09-01

    Full Text Available This study was undertaken to investigate the prevalence and antibiotic resistance of food borne bacterial contamination in some Egyptian food. Total viable bacteria and total coliform bacteriawere isolated from different sources of food; carbohydrates (bread, flour and basbousa, vegetables (outer and inner tissues of potato and outer and inner tissues of cucumber and proteins (mincedmeat, cheese and milk. The study resulted in maximum value of total viable bacteria found in outer tissue of potato 68X104±1.0, while the minimum value found in inner tissues of potato andcucumber. The study resulted in total coliform was maximum value in minced meat 6.4X103±0.3. Basbousa and inner tissue of potato and cucumber were free from coliforms. The ability of isolatesto producing proteolytic enzymes was tested, we found that 326 isolate (63.92% from all isolates had this ability, thus we selected most 2 potent proteolytic isolates. The two isolates were identifiedas Bacillus cereus and Escherichia coli. The identification confirmed by microlog 34.20 system and 16SrRNA for two isolates and the same result was founded. Sensitivity tested for the most potentproteolytic species to 12 of the most commonly used antibiotics in the Egyptian pharmacy. The results showed that all species were sensitive to most of antibiotics, except B. cereus which was strongly susceptible to azteronam and ceftazidim. The data showed that raw meat, cooked food products, and raw milk were most commonly contaminated with foodborne pathogens and many pathogens were resistant to different antibiotics. The study provided useful information for assessment of the possible risk posed to consumers, which has significant public health impact.

  3. Antibacterial activity of Rosmarinus officinalis L. and Thymus vulgaris L. essential oils and their combination against food-borne pathogens and spoilage bacteria in ready-to-eat vegetables.

    Science.gov (United States)

    Iseppi, Ramona; Sabia, Carla; de Niederhäusern, Simona; Pellati, Federica; Benvenuti, Stefania; Tardugno, Roberta; Bondi, Moreno; Messi, Patrizia

    2018-06-06

    The antibacterial activity of Rosmarinus officinalis L. and Thymus vulgaris L. essential oils (EOs), and their combination against food-borne and spoilage bacteria (Listeria monocytogenes, Salmonella enteritidis, Yersinia enterocolitica, Escherichia coli and Pseudomonas spp.) was determined. The EOs inhibitory effect was evaluated both in vitro by using the disk diffusion assay and the minimum inhibitory concentration (MIC) determination, and on food by using an artificially contaminated ready-to-eat (RTE) vegetables. The results showed that the lowest MIC values were obtained with R. officinalis and T. vulgaris EOs against E. coli (4 and 8 μL/mL, respectively). The incorporation of the EOs alone or their combination in RTE vegetables reduced the viable counts of all the tested strains. Lastly, in the on food study we simulated the worst hygienic conditions, obtaining results that can be considered a warranty of safety.

  4. Seed-borne pathogens and electrical conductivity of soybean seeds

    Directory of Open Access Journals (Sweden)

    Adriana Luiza Wain-Tassi

    2012-02-01

    Full Text Available Adequate procedures to evaluate seed vigor are important. Regarding the electrical conductivity test (EC, the interference in the test results caused by seed-borne pathogens has not been clarified. This research was carried out to study the influence of Phomopsis sojae (Leh. and Colletotrichum dematium (Pers. ex Fr. Grove var. truncata (Schw. Arx. fungi on EC results. Soybean seeds (Glycine max L. were inoculated with those fungi using potato, agar and dextrose (PDA medium with manitol (-1.0 MPa and incubated for 20 h at 25 °C. The colony diameter, index of mycelial growth, seed water content, occurrence of seed-borne pathogens, physiological potential of the seeds, measured by germination and vigor tests (seed germination index, cold test, accelerated aging and electrical conductivity, and seedling field emergence were determined. The contents of K+, Ca2+, and Mg2+ in the seed and in the soaking solution were also determined. A complete 2 × 4 factorial design with two seed sizes (5.5 and 6.5 mm and four treatments (control, seeds incubated without fungi, seeds incubated with Phomopsis and seeds incubated with Colletotrichum were used with eight (5.5 mm large seeds and six (6.5 mm large seeds replications. All seeds submitted to PDA medium had their germination reduced in comparison to the control seeds. This reduction was also observed when seed vigor and leached ions were considered. The presence of Phomopsis sojae fungus in soybean seed samples submitted to the EC test may be the cause of misleading results.

  5. Assessment of survival of food-borne microorganisms in the food chain by fluorescence ratio imaging microscopy

    DEFF Research Database (Denmark)

    Siegumfeldt, Henrik; Arneborg, Nils

    2011-01-01

    Traditionally, many data on food–borne microorganisms are obtained as an average of a whole population, under the assumption that the individual cells are clonal and therefore identical. However, it is now acknowledged that there may be a large heterogeneity within an isogenic population......, and consequently new methods focus on the individual cells. This mini-review will give an overview of the response of food-borne microorganisms; i.e. pathogenic bacteria, lactic acid bacteria, and yeasts, at a single-cell level to various food-related stress conditions, comprising acid-, disinfection-, salt...

  6. Transport of Ixodid ticks and tick-borne pathogens by migratory birds.

    Directory of Open Access Journals (Sweden)

    Gunnar eHasle

    2013-09-01

    Full Text Available Birds, particularly passerines, can be parasitized by Ixodid ticks, which may be infected with tick-borne pathogens, like Borrelia spp., Babesia spp., Anaplasma, Rickettsia/Coxiella, and tick-borne encephalitis virus. The prevalence of ticks on birds varies over years, season, locality and different bird species. The prevalence of ticks on different species depends mainly on the degree of feeding on the ground. In Europe, the Turdus spp., especially the blackbird, Turdus merula, appears to be most important for harboring ticks. Birds can easily cross barriers, like fences, mountains, glaciers, desserts and oceans, which would stop mammals, and they can move much faster than the wingless hosts. Birds can potentially transport tick-borne pathogens by transporting infected ticks, by being infected with tick-borne pathogens and transmit the pathogens to the ticks, and possibly act as hosts for transfer of pathogens between ticks through co-feeding. Knowledge of the bird migration routes and of the spatial distribution of tick species and tick-borne pathogens is crucial for understanding the possible impact of birds as spreaders of ticks and tick-borne pathogens. Successful colonization of new tick species or introduction of new tick-borne pathogens will depend on suitable climate, vegetation and hosts. Although it has never been demonstrated that a new tick species, or a new tick pathogen, actually has been established in a new locality after being seeded there by birds, evidence strongly suggests that this could occur.

  7. Multidrug-resistant pattern of food borne illness associated bacteria ...

    African Journals Online (AJOL)

    This study aimed at determining anti-microbial resistance pattern of food borne illness ... bial drugs in the pharmaceutical pipeline.2 The effective- ness of ... Materials and methods ... selected based on local availability, clinical efficiency, liter-.

  8. Methods for detecting pathogens in the beef food chain: an overview

    Science.gov (United States)

    The main food-borne pathogens of concern in the beef chain are Shiga toxin-producing Escherichia coli (STEC) and Salmonella. Other pathogens, including Listeria monocytogenes and Campylobacter spp. may also be present and pose contamination concerns in both the cattle production environment and bee...

  9. Effect of soil solarization on soil-borne pathogens

    International Nuclear Information System (INIS)

    Sobh, Hana

    1995-01-01

    -knot indices nor yields were significantly different in both treatments. At present, fumigation with methyl bromide is the most common method adopted by Lebanese farmers to control soil-borne pathogens of high value crops in greenhouses. Since methyl bromide is extremely toxic and damage the ozone layer, and its use is banned in several countries and may be banned world wide in year 2001, these preliminary results prove that soil solarization may stand as a good alternative control measure

  10. (Cucumis melo L.) cultivars to soil-borne plant pathogenic fungi in Iran

    African Journals Online (AJOL)

    ajl11

    2012-10-30

    Oct 30, 2012 ... resistance of melon cultivars to three important soil-borne plant pathogens found worldwide. Key words: Melon ... use of cultivars resistant to plant diseases is one of the ..... emerging disease of melons worldwide. Plant Dis.

  11. Toxoplasmosis as a food-borne infection

    Science.gov (United States)

    Đurković-Đaković, O.

    2017-09-01

    Toxoplasma gondii is a globally distributed parasite that infects all mammals, including one third of the world population. Long known to cause disease in the developing foetus and in immunosuppressed individuals, a body of data that has emerged in the past decades suggests its role in human pathology may be even more important. The WHO and FAO have recently established toxoplasmosis as a foodborne infection of global concern, with a disease burden the greatest of all parasitic infections. Transmission of toxoplasmosis occurs by ingesting tissue cysts from undercooked meat and meat products, and oocysts from the environment with contaminated fresh produce or water. This review provides an update on the current understanding of toxoplasmosis, focusing on the risk of infection from food of animal origin, with particular reference to the risk in Serbia and the region of South-East Europe.

  12. Enhanced inactivation of food-borne pathogens in ready-to-eat sliced ham by near-infrared heating combined with UV-C irradiation and mechanism of the synergistic bactericidal action.

    Science.gov (United States)

    Ha, Jae-Won; Kang, Dong-Hyun

    2015-01-01

    The objective of the study described in this article was, first, to investigate the effect of the simultaneous application of near-infrared (NIR) heating and UV irradiation on inactivation of Escherichia coli O157:H7, Salmonella enterica serovar Typhimurium, and Listeria monocytogenes in ready-to-eat (RTE) sliced ham and as well as its effect on product quality and, second, to elucidate the underlying mechanisms of the synergistic bactericidal action of NIR heating and UV irradiation. With the inoculation amounts used, simultaneous NIR-UV combined treatment for 70 s achieved 3.62, 4.17, and 3.43 log CFU reductions of E. coli O157:H7, S. Typhimurium, and L. monocytogenes, respectively. For all three pathogens, the simultaneous application of both technologies resulted in an additional log unit reduction as a result of their synergism compared to the sum of the reductions obtained after the individual treatments. To investigate the mechanisms of NIR-UV synergistic injury for a particular microorganism in a food base, we evaluated the effect of four types of metabolic inhibitors using the overlay method and confirmed that damage to cellular membranes and the inability of cells to repair these structures due to ribosomal damage were the primary factors related to the synergistic lethal effect. Additionally, NIR-UV combined treatment for a maximum of 70 s did not alter the color values or texture parameters of ham slices significantly (P > 0.05). These results suggest that a NIR-UV combined process could be an innovative antimicrobial intervention for RTE meat products. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

  13. A hospital cafeteria-related food-borne outbreak due to Bacillus cereus: unique features.

    Science.gov (United States)

    Baddour, L M; Gaia, S M; Griffin, R; Hudson, R

    1986-09-01

    Although Bacillus cereus is a well-known cause of food-borne illness, hospital-related outbreaks of food-borne disease due to B. cereus have rarely been documented. We report a hospital employee cafeteria outbreak due to foods contaminated with B. cereus in which an outside caterer was employed to prepare the suspect meals. Data were collected from 249 of 291 employees who had eaten either of the two meals. With a mean incubation period of 12.5 hours, 64% (160 of 249) of employees manifested illness. Symptoms, which averaged 24.3 hours in duration, included diarrhea (96.3%), abdominal cramps (90%), nausea (50.6%), weakness (24.7%), and vomiting (13.8%). Eighty-seven employees sought medical attention, 84 of whom were seen in an emergency room. Although a significant difference was not demonstrated in food-specific attack rates, B. cereus was cultured from both rice and chicken items that were served at both meals. Sixty-three employees submitted stools for culture that grew no enteric pathogens, but none were examined for B. cereus. This food-borne outbreak demonstrates: the need for hospital kitchen supervisors to ensure proper handling of food when outside caterers are employed; that significant differences in food-specific attack rates may not be demonstrated in outbreaks, which may be related to several factors; and the importance of notifying microbiology laboratory personnel when B. cereus is a suspect enteric pathogen, since many laboratories do not routinely attempt to identify this organism in stool specimens.

  14. Predators indirectly control vector-borne disease: linking predator-prey and host-pathogen models.

    Science.gov (United States)

    Moore, Sean M; Borer, Elizabeth T; Hosseini, Parviez R

    2010-01-06

    Pathogens transmitted by arthropod vectors are common in human populations, agricultural systems and natural communities. Transmission of these vector-borne pathogens depends on the population dynamics of the vector species as well as its interactions with other species within the community. In particular, predation may be sufficient to control pathogen prevalence indirectly via the vector. To examine the indirect effect of predators on vectored-pathogen dynamics, we developed a theoretical model that integrates predator-prey and host-pathogen theory. We used this model to determine whether predation can prevent pathogen persistence or alter the stability of host-pathogen dynamics. We found that, in the absence of predation, pathogen prevalence in the host increases with vector fecundity, whereas predation on the vector causes pathogen prevalence to decline, or even become extinct, with increasing vector fecundity. We also found that predation on a vector may drastically slow the initial spread of a pathogen. The predator can increase host abundance indirectly by reducing or eliminating infection in the host population. These results highlight the importance of studying interactions that, within the greater community, may alter our predictions when studying disease dynamics. From an applied perspective, these results also suggest situations where an introduced predator or the natural enemies of a vector may slow the rate of spread of an emerging vector-borne pathogen.

  15. PCR evaluation of selected vector-borne pathogens in dogs with pericardial effusion.

    Science.gov (United States)

    Tabar, M-D; Movilla, R; Serrano, L; Altet, L; Francino, O; Roura, X

    2018-04-01

    To investigate evidence for selected vector-borne pathogen infections in dogs with pericardial effusion living in a Mediterranean area in which several canine vector-borne diseases are endemic. Archived EDTA blood (n=68) and pericardial fluid samples (n=58) from dogs with pericardial effusion (n=68) were included. Dogs without pericardial effusion examined for other reasons were included as controls (n=60). Pericardial effusion was classified as neoplastic in 40 dogs, idiopathic in 23 dogs and of unknown aetiology in 5 dogs. Real-time PCR was performed for Leishmania infantum, Ehrlichia/Anaplasma species, Hepatozoon canis, Babesia species, Rickettsia species and Bartonella species, and sequencing of PCR products from positive samples was used to confirm species specificity. Vector-borne pathogens were found in 18 dogs: 16 of 68 dogs with pericardial effusion (23·5%) and two of 60 control dogs (3·3%). Positive dogs demonstrated DNA of Leishmania infantum (n=7), Anaplasma platys (n=2, one dog coinfected with Leishmania infantum), Babesia canis (n=5), Babesia gibsoni (n=3) and Hepatozoon canis (n=2). Vector-borne pathogens were more commonly detected among dogs with pericardial effusion than controls (P=0·001). There was no relationship between aetiology of the pericardial effusion and evidence of vector-borne pathogens (P=0·932). Vector-borne pathogens are often detected in dogs with pericardial effusion and require further investigation, especially in dogs with idiopathic pericardial effusion. PCR can provide additional information about the potential role of vector-borne pathogens in dogs with pericardial effusion living in endemic areas. © 2018 British Small Animal Veterinary Association.

  16. Inactivation of dairy manure-borne pathogens by anaerobic digestion

    Science.gov (United States)

    Background: Anaerobic digestion of animal manure has the potential to inactivate enteric pathogens, thereby reducing exposures to livestock and humans when the products of digestion are disposed by land-spreading or irrigation or returned to livestock uses such as bedding. Data on digester effectiv...

  17. Interrelationships of food safety and plant pathology: the life cycle of human pathogens on plants.

    Science.gov (United States)

    Barak, Jeri D; Schroeder, Brenda K

    2012-01-01

    Bacterial food-borne pathogens use plants as vectors between animal hosts, all the while following the life cycle script of plant-associated bacteria. Similar to phytobacteria, Salmonella, pathogenic Escherichia coli, and cross-domain pathogens have a foothold in agricultural production areas. The commonality of environmental contamination translates to contact with plants. Because of the chronic absence of kill steps against human pathogens for fresh produce, arrival on plants leads to persistence and the risk of human illness. Significant research progress is revealing mechanisms used by human pathogens to colonize plants and important biological interactions between and among bacteria in planta. These findings articulate the difficulty of eliminating or reducing the pathogen from plants. The plant itself may be an untapped key to clean produce. This review highlights the life of human pathogens outside an animal host, focusing on the role of plants, and illustrates areas that are ripe for future investigation.

  18. Understanding the behavior of foodborne pathogens in the food chain

    DEFF Research Database (Denmark)

    Rantsiou, Kalliopi; Mataragas, Marios; Jespersen, Lene

    2011-01-01

    In recent years and with the significant advancements in instrumentation for molecular biology methods, the focus of food microbiologists, dealing with pathogenic microorganisms in foods, is shifting. Scientists specifically aim at elucidating the effect that the food composition, as well...

  19. (Cucumis melo L.) cultivars to soil-borne plant pathogenic fungi in Iran

    African Journals Online (AJOL)

    ajl11

    2012-10-30

    Oct 30, 2012 ... Melon is an important dessert fruit in the Sistan region of. Iran, but its cultivation is threatened by attacks of. Macrophomina phaseolina (Tassi), Monosporascus cannonballus (Pollack and Uecker) and Rhizoctonia solani (Kuhn) (Safarnezhad, 2004). Melon death induced by these soil-borne plant pathogenic ...

  20. Non- chemical methods of seed treatment for control of seed- borne pathogens on vegetables

    NARCIS (Netherlands)

    Amein, T.; Wright, S.A.I.; Wickstrom, M.; Schmitt, A.; Koch, E.; Wolf, van der J.M.; Groot, S.P.C.; Werner, S.; Jahn, M.

    2006-01-01

    The aim of EU-project "Seed Treatments for Organic Vegetable Production" (STOVE) was to evaluate non-chemical methods for control of seed-borne pathogens in organic vegetable production. Physical (hot air, hot water and electron) and biologi-cal (microorganisms and different agents of natural

  1. Identification of tick-borne pathogens in ticks feeding on humans in Turkey.

    Directory of Open Access Journals (Sweden)

    Ömer Orkun

    2014-08-01

    Full Text Available The importance of tick-borne diseases is increasing all over the world, including Turkey. The tick-borne disease outbreaks reported in recent years and the abundance of tick species and the existence of suitable habitats increase the importance of studies related to the epidemiology of ticks and tick-borne pathogens in Turkey. The aim of this study was to investigate the presence of and to determine the infection rates of some tick-borne pathogens, including Babesia spp., Borrelia burgdorferi sensu lato and spotted fever group rickettsiae in the ticks removed from humans in different parts of Ankara.A total of 169 ticks belonging to the genus Haemaphysalis, Hyalomma, Ixodes and Rhipicephalus were collected by removing from humans in different parts of Ankara. Ticks were molecularly screened for Babesia spp., Borrelia burgdorferi sensu lato and spotted fever group rickettsiae by PCR and sequencing analysis. We detected 4 Babesia spp.; B. crassa, B. major, B. occultans and B. rossi, one Borrelia spp.; B. burgdorferi sensu stricto and 3 spotted fever group rickettsiae; R. aeschlimannii, R. slovaca and R. hoogstraalii in the tick specimens analyzed. This is the report showing the presence of B. rossi in a region that is out of Africa and in the host species Ha. parva. In addition, B. crassa, for which limited information is available on its distribution and vector species, and B. occultans, for which no conclusive information is available on its presence in Turkey, were identified in Ha. parva and H. marginatum, respectively. Two human pathogenic rickettsia species (R. aeschlimannii and R. slovaca were detected with a high prevalence in ticks. Additionally, B. burgdorferi sensu stricto was detected in unusual tick species (H. marginatum, H. excavatum, Hyalomma spp. (nymph and Ha. parva.This study investigates both the distribution of several tick-borne pathogens affecting humans and animals, and the presence of new tick-borne pathogens in Turkey

  2. Effect of Extracts and Bacteria from Korean Fermented Foods on the Control of Sesame Seed-Borne Fungal Diseases

    Directory of Open Access Journals (Sweden)

    Yong-Ki Kim

    2015-12-01

    Full Text Available In order to control seed-borne diseases, we obtained extracts from commercial fermented food products of Kimchi, Gochujang, Doenjang, Ganjang and Makgeolli and their suppressive effects against seed-borne diseases were studied. In addition, the suppressive effects of bacterial strains isolated from the fermented foods were screened in vitro and in vivo. Among fifty food extracts, twenty food-extracts suppressed more than 92% incidence of seedling rots in vitro and seven food extracts increased 58.3-66.8% of healthy seedling in the greenhouse. Among 218 isolates from the fermented foods, 29 isolates showing high antifungal activity against seven seed-borne fungal pathogens were selected. Among 29 isolates, 13 isolates significantly reduced seedling rot and increased healthy seedlings. Sixteen isolates with high antifungal activity and suppressive effect against sesame seedling rots were identified by 16S rRNA sequencing. Fourteen of sixteen isolates were identified as Bacillus spp. and the other two isolates from Makgeolli were identified as Saccharomyces cerevisiae. It was confirmed that B. amyloliquifaciens was majority in the effective bacterial population of Korean fermented foods. In addition, when the bioformulations of the two selected effective microorganisms, B. amyloliquifacien Gcj2-1 and B. amyloliquifacien Gcj3-1, were prepared in powder forms using bentonite, kaolin, talc and zeolite, talc- and kaolin-bioformulation showed high control efficacy against sesame seed-borne disease, followed by zeolite-bioformulation. Meanwhile control efficacy of each bentonite-bioformulation of B. amyloliquifacien Gcj2-1 and B. amyloliquifacien Gcj3-1 was lower than that of bacterial suspension of them. It was found that the selected effective microorganisms from Korean fermented foods were effective for controlling seed-borne diseases of sesame in vitro and in the greenhouse. We think that Korean fermented food extracts and useful microorganisms

  3. Molecular Detection and Characterization of Tick-borne Pathogens in Dogs and Ticks from Nigeria

    Science.gov (United States)

    Kamani, Joshua; Baneth, Gad; Mumcuoglu, Kosta Y.; Waziri, Ndadilnasiya E.; Eyal, Osnat; Guthmann, Yifat; Harrus, Shimon

    2013-01-01

    Background Only limited information is currently available on the prevalence of vector borne and zoonotic pathogens in dogs and ticks in Nigeria. The aim of this study was to use molecular techniques to detect and characterize vector borne pathogens in dogs and ticks from Nigeria. Methodology/Principal Findings Blood samples and ticks (Rhipicephalus sanguineus, Rhipicephalus turanicus and Heamaphysalis leachi) collected from 181 dogs from Nigeria were molecularly screened for human and animal vector-borne pathogens by PCR and sequencing. DNA of Hepatozoon canis (41.4%), Ehrlichia canis (12.7%), Rickettsia spp. (8.8%), Babesia rossi (6.6%), Anaplasma platys (6.6%), Babesia vogeli (0.6%) and Theileria sp. (0.6%) was detected in the blood samples. DNA of E. canis (23.7%), H. canis (21.1%), Rickettsia spp. (10.5%), Candidatus Neoehrlichia mikurensis (5.3%) and A. platys (1.9%) was detected in 258 ticks collected from 42 of the 181 dogs. Co- infections with two pathogens were present in 37% of the dogs examined and one dog was co-infected with 3 pathogens. DNA of Rickettsia conorii israelensis was detected in one dog and Rhipicephalus sanguineus tick. DNA of another human pathogen, Candidatus N. mikurensis was detected in Rhipicephalus sanguineus and Heamaphysalis leachi ticks, and is the first description of Candidatus N. mikurensis in Africa. The Theileria sp. DNA detected in a local dog in this study had 98% sequence identity to Theileria ovis from sheep. Conclusions/Significance The results of this study indicate that human and animal pathogens are abundant in dogs and their ticks in Nigeria and portray the potential high risk of human exposure to infection with these agents. PMID:23505591

  4. Molecular detection and characterization of tick-borne pathogens in dogs and ticks from Nigeria.

    Directory of Open Access Journals (Sweden)

    Joshua Kamani

    Full Text Available BACKGROUND: Only limited information is currently available on the prevalence of vector borne and zoonotic pathogens in dogs and ticks in Nigeria. The aim of this study was to use molecular techniques to detect and characterize vector borne pathogens in dogs and ticks from Nigeria. METHODOLOGY/PRINCIPAL FINDINGS: Blood samples and ticks (Rhipicephalus sanguineus, Rhipicephalus turanicus and Heamaphysalis leachi collected from 181 dogs from Nigeria were molecularly screened for human and animal vector-borne pathogens by PCR and sequencing. DNA of Hepatozoon canis (41.4%, Ehrlichia canis (12.7%, Rickettsia spp. (8.8%, Babesia rossi (6.6%, Anaplasma platys (6.6%, Babesia vogeli (0.6% and Theileria sp. (0.6% was detected in the blood samples. DNA of E. canis (23.7%, H. canis (21.1%, Rickettsia spp. (10.5%, Candidatus Neoehrlichia mikurensis (5.3% and A. platys (1.9% was detected in 258 ticks collected from 42 of the 181 dogs. Co- infections with two pathogens were present in 37% of the dogs examined and one dog was co-infected with 3 pathogens. DNA of Rickettsia conorii israelensis was detected in one dog and Rhipicephalus sanguineus tick. DNA of another human pathogen, Candidatus N. mikurensis was detected in Rhipicephalus sanguineus and Heamaphysalis leachi ticks, and is the first description of Candidatus N. mikurensis in Africa. The Theileria sp. DNA detected in a local dog in this study had 98% sequence identity to Theileria ovis from sheep. CONCLUSIONS/SIGNIFICANCE: The results of this study indicate that human and animal pathogens are abundant in dogs and their ticks in Nigeria and portray the potential high risk of human exposure to infection with these agents.

  5. Zoonotic intestinal parasites and vector-borne pathogens in Italian shelter and kennel dogs.

    Science.gov (United States)

    Traversa, Donato; Di Cesare, Angela; Simonato, Giulia; Cassini, Rudi; Merola, Carmine; Diakou, Anastasia; Halos, Lénaïg; Beugnet, Frederic; Frangipane di Regalbono, Antonio

    2017-04-01

    This study investigated the presence of zoonotic parasites and vector-borne pathogens in dogs housed in kennels and shelters from four sites of Italy. A total of 150 adoptable dogs was examined with different microscopic, serological and molecular methods. Overall 129 dogs (86%) were positive for one or more parasites and/or pathogens transmitted by ectoparasites. Forty-eight (32%) were positive for one infection, while 81 (54%) for more than one pathogen. The most common zoonotic helminths recorded were hookworms, roundworms and Capillaria aerophila, followed by mosquito-borne Dirofilaria spp. and Dipylidium caninum. One hundred and thirteen (77.9%), 6 (4.1%) and 2 (1.4%) dogs were positive for Rickettsia spp., Leishmania infantum and Anaplasma spp., respectively. The results show that dogs living in rescue facilities from the studied areas may be infected by many zoonotic internal parasites and vector-borne pathogens, and that control measures should be implemented. Copyright © 2017 Elsevier Ltd. All rights reserved.

  6. Molecular investigation of tick-borne pathogens in dogs from Luanda, Angola.

    Science.gov (United States)

    Cardoso, Luís; Oliveira, Ana Cristina; Granada, Sara; Nachum-Biala, Yaarit; Gilad, Matan; Lopes, Ana Patrícia; Sousa, Sérgio Ramalho; Vilhena, Hugo; Baneth, Gad

    2016-05-10

    No molecular data have been available on tick-borne pathogens that infect dogs from Angola. The occurrence of agents from the genera Anaplasma, Babesia, Ehrlichia and Hepatozoon was assessed in 103 domestic dogs from Luanda, by means of the polymerase chain reaction (PCR) and DNA sequence analysis. Forty-six dogs (44.7 %) were positive for at least one pathogen. Twenty-one animals (20.4 %) were found infected with Anaplasma platys, 18 (17.5 %) with Hepatozoon canis, six (5.8 %) with Ehrlichia canis, six (5.8 %) with Babesia vogeli, one (1.0 %) with Babesia gibsoni and one (1.0 %) with an unnamed Babesia sp. The molecular frequency of single infections taken together was 37.9 % and that of co-infections with several combinations of two pathogens accounted for 6.8 % of the animals. This is the first report of A. platys, B. vogeli, B. gibsoni, E. canis and H. canis infections diagnosed by PCR in domestic dogs from Angola. The present study provides evidence that dogs in Luanda are widely exposed to, and at risk of becoming infected with, tick-borne pathogens. Further investigation is needed, including a larger number of animals, canine populations from other cities and provinces of the country, as well as potential vector ticks, aiming at better characterizing and controlling canine vector-borne diseases in Angola.

  7. Molecular survey of arthropod-borne pathogens in sheep keds (Melophagus ovinus), Central Europe.

    Science.gov (United States)

    Rudolf, Ivo; Betášová, Lenka; Bischof, Vlastimil; Venclíková, Kristýna; Blažejová, Hana; Mendel, Jan; Hubálek, Zdeněk; Kosoy, Michael

    2016-10-01

    In the study, we screened a total of 399 adult sheep keds (Melophagus ovinus) for the presence of RNA and DNA specific for arboviral, bacterial, and protozoan vector-borne pathogens. All investigated keds were negative for flaviviruses, phleboviruses, bunyaviruses, Borrelia burgdorferi, Rickettsia spp., Anaplasma phagocytophilum, "Candidatus Neoehrlichia mikurensis," and Babesia spp. All ked pools were positive for Bartonella DNA. The sequencing of the amplified fragments of the gltA and 16S-23S rRNA demonstrated a 100 % homology with Bartonella melophagi previously isolated from a sheep ked and from human blood in the USA. The identification of B. melophagi in sheep keds in Central Europe highlights needs extending a list of hematophagous arthropods beyond ticks and mosquitoes for a search of emerging arthropod-borne pathogens.

  8. Occurrence of Foodborne Pathogens and Molds in Turkish Foods

    OpenAIRE

    Sebnem Ozturkogu-Budak

    2016-01-01

    A survey of the occurrence of food pathogens like Salmonella, Listeria, Escherichia, Clostridium, Bacillus and Staphylococcus analyses were performed on 301 food samples from 8 different food categories such as dry legumes, milk products, meat products, fish, frozen foods, deserts, nuts and vegetables and fruits. Yeast and mold analyses were also performed on 364 food products from 9 main food categories such as dry legumes, milk products, meat products, seasonings, deserts, nuts, bee product...

  9. Prevalence and distribution of soil-borne zoonotic pathogens in Lahore district of Pakistan

    OpenAIRE

    Shabbir, Muhammad Z.; Jamil, Tariq; Ali, Asad A.; Ahmad, Arfan; Naeem, Muhammad; Chaudhary, Muhammad H.; Bilal, Muhammad; Ali, Muhammad A.; Muhammad, Khushi; Yaqub, Tahir; Bano, Asghari; Mirza, Ali I.; Shabbir, Muhammad A. B.; McVey, Walter R.; Patel, Ketan

    2015-01-01

    A multidisciplinary, collaborative project was conducted to determine the prevalence and distribution of soil-borne zoonotic pathogens in Lahore district of Pakistan and ascertain its Public Health Significance. Using a grid-based sampling strategy, soil samples (n = 145) were collected from villages (n = 29, 5 samples/village) and examined for Bacillus anthracis, Burkholderia mallei/pseudomallei, Coxiella burnetii, Francisella tularensis, and Yersinia pestis using real time PCR assays. Chemi...

  10. Synanthropic Mammals as Potential Hosts of Tick-Borne Pathogens in Panama.

    Directory of Open Access Journals (Sweden)

    Sergio E Bermúdez

    Full Text Available Synanthropic wild mammals can be important hosts for many vector-borne zoonotic pathogens. The aim of this study was determine the exposure of synanthropic mammals to two types of tick-borne pathogens in Panama, spotted fever group Rickettsia (SFGR and Borrelia relapsing fever (RF spirochetes. One hundred and thirty-one wild mammals were evaluated, including two gray foxes, two crab-eating foxes (from zoos, four coyotes, 62 opossum and 63 spiny rats captured close to rural towns. To evaluate exposure to SFGR, serum samples from the animals were tested by indirect immunofluorescence assay (IFA using Rickettsia rickettsii and Candidatus Rickettsia amblyommii antigen. Immunoblotting was performed using Borrelia turicatae protein lysates and rGlpQ, to assess infection caused by RF spirochetes. One coyote (25% and 27 (43% opossums showed seroreactivity to SFGR. Of these opossums, 11 were seroreactive to C. R. amblyommii. Serological reactivity was not detected to B. turicatae in mammal samples. These findings may reflect a potential role of both mammals in the ecology of tick-borne pathogens in Panama.

  11. A PCR survey of vector-borne pathogens in different dog populations from Turkey.

    Science.gov (United States)

    Guo, Huanping; Sevinc, Ferda; Ceylan, Onur; Sevinc, Mutlu; Ince, Ege; Gao, Yang; Moumouni, Paul Franck Adjou; Liu, Mingming; Efstratiou, Artemis; Wang, Guanbo; Cao, Shinuo; Zhou, Mo; Jirapattharasate, Charoonluk; Ringo, Aaron Edmond; Zheng, Weiqing; Xuan, Xuenan

    2017-09-26

    In the present study, a total of 192 blood samples were collected from pet dogs, kennel dogs and shepherd dogs in Konya district, Turkey, and tested by specific PCR for the presence of vector-borne pathogens. Several pathogens were identified, most of which can cause substantial morbidity in dogs. PCR results revealed that 54 (28.1%) dogs were infected with one or more pathogens. Positive results were obtained for Babesia spp. in 4 dogs (2.1%), Hepatozoon spp. in 8 dogs (4.2%) and Mycoplasma spp. in 46 dogs (24%). Three dogs (1.6%) were infected with two or three pathogens. The sequence analysis of the positive DNA samples revealed the presence of Babesia canis vogeli, Hepatozoon canis, Hepatozoon sp. MF, Mycoplasma haemocanis and Candidatus Mycoplasma haematoparvum. Ehrlichia canis and Anaplasma platys were not detected. Regardless of ownership status, vector-borne diseases were common in these dog populations. There was significant difference of pathogen prevalence among the different dog populations. Mycoplasma spp. was more frequent in the kennel dogs (31.9%) than in the pet (21.4%) and shepherd dogs (13.8%). Additionally, the frequency of Babesia spp. and Hepatozoon spp. was higher in the shepherd dogs which account for three quarters and half of the total number of Babesia spp. and Hepatozoon spp., respectively. To our knowledge, this is the first report of Mycoplasma infection in dogs in Turkey. The results of the present study provide a foundation for understanding the epidemiology of canine vector-borne diseases (CVBDs), and for strategies to control these diseases in Turkey.

  12. Modelling soil borne fungal pathogens of arable crops under climate change.

    Science.gov (United States)

    Manici, L M; Bregaglio, S; Fumagalli, D; Donatelli, M

    2014-12-01

    Soil-borne fungal plant pathogens, agents of crown and root rot, are seldom considered in studies on climate change and agriculture due both to the complexity of the soil system and to the incomplete knowledge of their response to environmental drivers. A controlled chamber set of experiments was carried out to quantify the response of six soil-borne fungi to temperature, and a species-generic model to simulate their response was developed. The model was linked to a soil temperature model inclusive of components able to simulate soil water content also as resulting from crop water uptake. Pathogen relative growth was simulated over Europe using the IPCC A1B emission scenario derived from the Hadley-CM3 global climate model. Climate scenarios of soil temperature in 2020 and 2030 were compared to the baseline centred in the year 2000. The general trend of the response of soil-borne pathogens shows increasing growth in the coldest areas of Europe; however, a larger rate of increase is shown from 2020 to 2030 compared to that of 2000 to 2020. Projections of pathogens of winter cereals indicate a marked increase of growth rate in the soils of northern European and Baltic states. Fungal pathogens of spring sowing crops show unchanged conditions for their growth in soils of the Mediterranean countries, whereas an increase of suitable conditions was estimated for the areals of central Europe which represent the coldest limit areas where the host crops are currently grown. Differences across fungal species are shown, indicating that crop-specific analyses should be ran.

  13. Tick-borne pathogens in ticks collected from birds in Taiwan

    Directory of Open Access Journals (Sweden)

    Chi-Chien Kuo

    2017-11-01

    Full Text Available Abstract Background A variety of human diseases transmitted by arthropod vectors, including ticks, are emerging around the globe. Birds are known to be hosts of ticks and can disperse exotic ticks and tick-borne pathogens. In Taiwan, previous studies have focused predominantly on mammals, leaving the role of birds in the maintenance of ticks and dissemination of tick-borne pathogens undetermined. Methods Ticks were collected opportunistically when birds were studied from 1995 to 2013. Furthermore, to improve knowledge on the prevalence and mean load of tick infestation on birds in Taiwan, ticks were thoroughly searched for when birds were mist-netted at seven sites between September 2014 and April 2016 in eastern Taiwan. Ticks were identified based on both morphological and molecular information and were screened for potential tick-borne pathogens, including the genera Anaplasma, Babesia, Borrelia, Ehrlichia and Rickettsia. Finally, a list of hard tick species collected from birds in Taiwan was compiled based on past work and the current study. Results Nineteen ticks (all larvae were recovered from four of the 3096 unique mist-netted bird individuals, yielding a mean load of 0.006 ticks/individual and an overall prevalence of 0.13%. A total of 139 ticks from birds, comprising 48 larvae, 35 nymphs, 55 adults and one individual of unknown life stage, were collected from 1995 to 2016, and 11 species of four genera were identified, including three newly recorded species (Haemaphysalis wellingtoni, Ixodes columnae and Ixodes turdus. A total of eight tick-borne pathogens were detected, with five species (Borrelia turdi, Anaplasma sp. clone BJ01, Ehrlichia sp. BL157-9, Rickettsia helvetica and Rickettsia monacensis not previously isolated in Taiwan. Overall, 16 tick species of five genera have been recorded feeding on birds, including nine species first discovered in this study. Conclusion Our study demonstrates the paucity of information on ticks of

  14. A gravity model for the spread of a pollinator-borne plant pathogen.

    Science.gov (United States)

    Ferrari, Matthew J; Bjørnstad, Ottar N; Partain, Jessica L; Antonovics, Janis

    2006-09-01

    Many pathogens of plants are transmitted by arthropod vectors whose movement between individual hosts is influenced by foraging behavior. Insect foraging has been shown to depend on both the quality of hosts and the distances between hosts. Given the spatial distribution of host plants and individual variation in quality, vector foraging patterns may therefore produce predictable variation in exposure to pathogens. We develop a "gravity" model to describe the spatial spread of a vector-borne plant pathogen from underlying models of insect foraging in response to host quality using the pollinator-borne smut fungus Microbotryum violaceum as a case study. We fit the model to spatially explicit time series of M. violaceum transmission in replicate experimental plots of the white campion Silene latifolia. The gravity model provides a better fit than a mean field model or a model with only distance-dependent transmission. The results highlight the importance of active vector foraging in generating spatial patterns of disease incidence and for pathogen-mediated selection for floral traits.

  15. Knowledge of Brucella as a food-borne pathogen

    Science.gov (United States)

    Although Brucella spp. are known for causing reproductive losses in domestic livestock, they are also capable of infecting humans and causing clinical disease. Human infection with Brucella is almost exclusively a result of direct contact with infected animals or consumption of products made from un...

  16. Smuggling across the border: how arthropod-borne pathogens evade and exploit the host defense system of the skin.

    Science.gov (United States)

    Bernard, Quentin; Jaulhac, Benoit; Boulanger, Nathalie

    2014-05-01

    The skin is a critical barrier between hosts and pathogens in arthropod-borne diseases. It harbors many resident cells and specific immune cells to arrest or limit infections by secreting inflammatory molecules or by directly killing pathogens. However, some pathogens are able to use specific skin cells and arthropod saliva for their initial development, to hide from the host immune system, and to establish persistent infection in the vertebrate host. A better understanding of the initial mechanisms taking place in the skin should allow the development of new strategies to fight these vector-borne pathogens that are spread worldwide and are of major medical importance.

  17. Food-borne illness an unwelcome guest at any tailgate party

    OpenAIRE

    Sutphin, Michael D.

    2007-01-01

    With the start of the new school year comes football season and tailgating. Make sure that food-borne illness doesn't spoil the fun by following sound food-safety advice from Virginia Cooperative Extension.

  18. Stress responses in pathogenic Yersinia enterocolitica with reference to the stability of the virulence plasmid in food

    Science.gov (United States)

    Yersinia enterocolitica has been associated with food-borne illness, most often due the ingestion of pork products. The pathogenic effects induced by a Y. enterocolitica infection are caused by the interplay of chromosomal genes and a virulence plasmid, pYV. Generally, the plasmid is lost during g...

  19. Tick-borne pathogen – Reversed and conventional discovery of disease

    Directory of Open Access Journals (Sweden)

    Ellen eTijsse Klasen

    2014-07-01

    Full Text Available Molecular methods have increased the number of known microorganisms associated with ticks significantly. Some of these newly identified microorganisms are readily linked to human disease while others are yet unknown to cause human disease. The face of tick-borne disease discovery has changed with more diseases now being discovered in a ‘reversed way’, detecting disease cases only years after the tick-borne microorganism was first discovered. Compared to the conventional discovery of infectious diseases, this order of discoveries presents researchers with new challenges. Especially estimating public health risks of such agents is challenging, as case definitions and diagnostic procedures may initially be missing. We discuss the advantages and shortcomings of molecular methods, serology, epidemiological studies that might be used to study some fundamental questions regarding newly identified tick-borne diseases. With increased tick-exposure and improved detection methods, more tick-borne microorganisms will be added to the list of pathogens causing disease in humans in future.

  20. Prevalence and Geographic Distribution of Vector-Borne Pathogens in Apparently Healthy Dogs in Croatia.

    Science.gov (United States)

    Mrljak, Vladimir; Kuleš, Josipa; Mihaljević, Željko; Torti, Marin; Gotić, Jelena; Crnogaj, Martina; Živičnjak, Tatjana; Mayer, Iva; Šmit, Iva; Bhide, Mangesh; Barić Rafaj, Renata

    2017-06-01

    Vector-borne pathogens (VBPs) are a group of globally extended and quickly spreading pathogens that are transmitted by various arthropod vectors. The aim of the present study was to investigate the seroprevalence against Babesia canis, Anaplasma phagocytophilum, Borrelia burgdorferi sensu lato, Leishmania infantum, Dirofilaria immitis, and Ehrlichia canis in dogs in Croatia. We investigated 435 randomly selected apparently healthy dogs in 13 different locations of Croatia for antibodies to B. canis by indirect immunofluorescence using a commercial IFA IgG Antibody Kit. All samples were also tested for qualitative detection of D. immitis antigen and for antibodies to A. phagocytophilum, B. burgdorferi sensu lato, L. infantum, and E. canis with two point-of-care assays. Overall, 112 dogs (25.74%, 95% confidence interval [CI] 21.70-30.12) were serologically positive for one or more of the pathogens. B. canis was the most prevalent pathogen (20.00%, 95% CI 16.34-24.07), followed by A. phagocytophilum (6.21%, 95% CI 4.12-8.90), L. infantum, (1.38%, 95% CI 0.51-2.97), and B. burgdorferi sensu lato (0.69%, 95% CI 0.01-2.00). The lowest seroprevalence was for D. immitis and E. canis (0.46%, 95% CI 0.01-1.65). Coinfection was determined in 12 dogs (2.76%, 95% CI 1.43-4.77), of which 10 were positive to two pathogens (7 with B. canis and A. phagocytophilum and 1 B. canis with B. burgdorferi sensu lato or L. infantum or E. canis). One dog was positive to three pathogens and another dog to four pathogens. Seroprevalence for babesia was age, breed, and lifestyle/use dependent. Purebred dogs had almost half the chance of developing disease than crossbred (OR = 0.58, p Croatia. Some of these VBPs are zoonotic and represent a potential risk to public health.

  1. Life history and demographic drivers of reservoir competence for three tick-borne zoonotic pathogens.

    Directory of Open Access Journals (Sweden)

    Richard S Ostfeld

    Full Text Available Animal and plant species differ dramatically in their quality as hosts for multi-host pathogens, but the causes of this variation are poorly understood. A group of small mammals, including small rodents and shrews, are among the most competent natural reservoirs for three tick-borne zoonotic pathogens, Borrelia burgdorferi, Babesia microti, and Anaplasma phagocytophilum, in eastern North America. For a group of nine commonly-infected mammals spanning >2 orders of magnitude in body mass, we asked whether life history features or surrogates for (unknown encounter rates with ticks, predicted reservoir competence for each pathogen. Life history features associated with a fast pace of life generally were positively correlated with reservoir competence. However, a model comparison approach revealed that host population density, as a proxy for encounter rates between hosts and pathogens, generally received more support than did life history features. The specific life history features and the importance of host population density differed somewhat between the different pathogens. We interpret these results as supporting two alternative but non-exclusive hypotheses for why ecologically widespread, synanthropic species are often the most competent reservoirs for multi-host pathogens. First, multi-host pathogens might adapt to those hosts they are most likely to experience, which are likely to be the most abundant and/or frequently bitten by tick vectors. Second, species with fast life histories might allocate less to certain immune defenses, which could increase their reservoir competence. Results suggest that of the host species that might potentially be exposed, those with comparatively high population densities, small bodies, and fast pace of life will often be keystone reservoirs that should be targeted for surveillance or management.

  2. Search for tick-borne pathogens in the Svalbard archipelago and Jan Mayen

    Czech Academy of Sciences Publication Activity Database

    Elsterová, Jana; Černý, Jiří; Müllerová, Jana; Šíma, Radek; Coulson, S.J.; Lorentzen, E.; Strøm, H.; Grubhoffer, Libor

    2015-01-01

    Roč. 34, 20 October 2015 (2015), s. 27466 ISSN 0800-0395 R&D Projects: GA MŠk(CZ) EE2.3.30.0032; GA ČR GAP502/11/2116; GA ČR GAP302/12/2490; GA ČR GP13-12816P EU Projects: European Commission(XE) 278976 Grant - others:GA MŠk(CZ) LM2010009 Institutional support: RVO:60077344 Keywords : tick * Ixodes uriae * tick-borne pathogens * arboviruses * Borrelia spirochetes * Babesia apicomplexans Subject RIV: EE - Microbiology, Virology Impact factor: 1.728, year: 2015

  3. Biocontrol efficacy of different isolates of Trichoderma against soil borne pathogen Rhizoctonia solani.

    Science.gov (United States)

    Asad, Saeed Ahmad; Ali, Naeem; Hameed, Abdul; Khan, Sabaz Ali; Ahmad, Rafiq; Bilal, Muhammad; Shahzad, Muhammad; Tabassum, Ayesha

    2014-01-01

    In this study, the biocontrol abilities of water-soluble and volatile metabolites of three different isolates of Trichoderma (T. asperellum, T. harzianum and Trichoderma spp.) against soil borne plant pathogen Rhizoctonia solani were investigated both in vitro and in vivo. The results showed for the first time that mycelial growth inhibition of the pathogen was 74.4-67.8% with water-soluble metabolites as compared to 15.3-10.6% with volatile metabolites in vitro. In vivo antagonistic activity of Trichoderma isolates against R. solani was evaluated on bean plants under laboratory and greenhouse conditions. We observed that T. asperellum was more effective and consistent, lowering disease incidence up to 19.3% in laboratory and 30.5% in green house conditions. These results showed that three isolates of Trichoderma could be used as effective biocontrol agents against R. solani.

  4. Modelling the wind-borne spread of highly pathogenic avian influenza virus between farms.

    Directory of Open Access Journals (Sweden)

    Amos Ssematimba

    Full Text Available A quantitative understanding of the spread of contaminated farm dust between locations is a prerequisite for obtaining much-needed insight into one of the possible mechanisms of disease spread between farms. Here, we develop a model to calculate the quantity of contaminated farm-dust particles deposited at various locations downwind of a source farm and apply the model to assess the possible contribution of the wind-borne route to the transmission of Highly Pathogenic Avian Influenza virus (HPAI during the 2003 epidemic in the Netherlands. The model is obtained from a Gaussian Plume Model by incorporating the dust deposition process, pathogen decay, and a model for the infection process on exposed farms. Using poultry- and avian influenza-specific parameter values we calculate the distance-dependent probability of between-farm transmission by this route. A comparison between the transmission risk pattern predicted by the model and the pattern observed during the 2003 epidemic reveals that the wind-borne route alone is insufficient to explain the observations although it could contribute substantially to the spread over short distance ranges, for example, explaining 24% of the transmission over distances up to 25 km.

  5. Imported and travelling dogs as carriers of canine vector-borne pathogens in Germany

    Directory of Open Access Journals (Sweden)

    Lorentz Susanne

    2010-04-01

    Full Text Available Abstract Background With the import of pets and pets taken abroad, arthropod-borne diseases have increased in frequency in German veterinary practices. This is reflected by 4,681 dogs that have been either travelled to or relocated from endemic areas to Germany. The case history of these dogs and the laboratory findings have been compared with samples collected from 331 dogs living in an endemic area in Portugal. The various pathogens and the seroprevalences were examined to determine the occurrence of, and thus infection risk, for vector-borne pathogens in popular travel destinations. Results 4,681 dogs were examined serological for Leishmania infantum, Babesia canis and Ehrlichia canis. Buffy coats were detected for Hepatozoon canis and blood samples were examined for microfilariae via the Knott's test. The samples were sent in from animal welfare organizations or private persons via veterinary clinics. Upon individual requests, dogs were additionally examined serological for Anaplasma phagocytophilum, Borrelia burgdorferi and Rickettsia conorii. Overall B. canis was the most prevalent pathogen detected by antibody titers (23.4%, followed by L. infantum (12.2% and E. canis (10.1%. Microfilariae were detected in 7.7% and H. canis in 2.7% of the examined dogs. In 332/1862 dogs A. phagocytophilum, in 64/212 B. burgdorferi and in 20/58 R. conorii was detected. Of the 4,681 dogs, in total 4,226 were imported to Germany from endemic areas. Eighty seven dogs joined their owners for a vacation abroad. In comparison to the laboratory data from Germany, we examined 331 dogs from Portugal. The prevalence of antibodies/pathogens we detected was: 62.8% to R. conorii, 58% to B. canis, 30.5% to A. phagocytophilum, 24.8% to E. canis, 21.1% to H. canis (via PCR, 9.1% to L. infantum and 5.3% to microfilariae. Conclusions The examination of 4,681 dogs living in Germany showed pathogens like L. infantum that are non-endemic in Germany. Furthermore, the German

  6. Natural Mosquito-Pathogen Hybrid IgG4 Antibodies in Vector Borne Diseases: A Hypothesis

    Directory of Open Access Journals (Sweden)

    Berlin L. Londono-Renteria

    2016-09-01

    Full Text Available Chronic exposure to antigens may favor the production of IgG4 antibodies over other antibody types. Recent studies have shown that up to a 30% of normal human IgG4 is bi-specific and is able to recognize two antigens of different nature. A requirement for this specificity is the presence of both eliciting antigens in the same time and at the same place where the immune response is induced. During transmission of most vector-borne diseases, the pathogen is delivered to the vertebrate host along with the arthropod saliva during blood feeding and previous studies have shown the existence of IgG4 antibodies against mosquito salivary allergens. However, there is very little ongoing research or information available regarding IgG4 bi-specificity with regards to infectious disease, particularly during immune responses to vector-borne diseases such as malaria, filariasis or dengue virus infection. Here, we provide background information and present our hypothesis that IgG4 may not only be a useful tool to measure exposure to infected mosquito bites, but that these bi-specific antibodies may also play an important role in modulation of the immune response against malaria and other vector-borne diseases in endemic settings.

  7. An antivector vaccine protects against a lethal vector-borne pathogen.

    Directory of Open Access Journals (Sweden)

    Milan Labuda

    2006-04-01

    Full Text Available Vaccines that target blood-feeding disease vectors, such as mosquitoes and ticks, have the potential to protect against the many diseases caused by vector-borne pathogens. We tested the ability of an anti-tick vaccine derived from a tick cement protein (64TRP of Rhipicephalus appendiculatus to protect mice against tick-borne encephalitis virus (TBEV transmitted by infected Ixodes ricinus ticks. The vaccine has a "dual action" in immunized animals: when infested with ticks, the inflammatory and immune responses first disrupt the skin feeding site, resulting in impaired blood feeding, and then specific anti-64TRP antibodies cross-react with midgut antigenic epitopes, causing rupture of the tick midgut and death of engorged ticks. Three parameters were measured: "transmission," number of uninfected nymphal ticks that became infected when cofeeding with an infected adult female tick; "support," number of mice supporting virus transmission from the infected tick to cofeeding uninfected nymphs; and "survival," number of mice that survived infection by tick bite and subsequent challenge by intraperitoneal inoculation of a lethal dose of TBEV. We show that one dose of the 64TRP vaccine protects mice against lethal challenge by infected ticks; control animals developed a fatal viral encephalitis. The protective effect of the 64TRP vaccine was comparable to that of a single dose of a commercial TBEV vaccine, while the transmission-blocking effect of 64TRP was better than that of the antiviral vaccine in reducing the number of animals supporting virus transmission. By contrast, the commercial antitick vaccine (TickGARD that targets only the tick's midgut showed transmission-blocking activity but was not protective. The 64TRP vaccine demonstrates the potential to control vector-borne disease by interfering with pathogen transmission, apparently by mediating a local cutaneous inflammatory immune response at the tick-feeding site.

  8. Occurrence of Foodborne Pathogens and Molds in Turkish Foods

    Directory of Open Access Journals (Sweden)

    Sebnem Ozturkogu-Budak

    2016-06-01

    Full Text Available A survey of the occurrence of food pathogens like Salmonella, Listeria, Escherichia, Clostridium, Bacillus and Staphylococcus analyses were performed on 301 food samples from 8 different food categories such as dry legumes, milk products, meat products, fish, frozen foods, deserts, nuts and vegetables and fruits. Yeast and mold analyses were also performed on 364 food products from 9 main food categories such as dry legumes, milk products, meat products, seasonings, deserts, nuts, bee products, bakery products and dried fruits produced in Turkey. S. aureus and Salmonella were the most prevalent (1.33% of the six isolated pathogens. The species Cl. perfringens, L. monocytogenes and B. cereus were detected with the ratios of 1.00%, 0.66% and 0.66%, respectively. Total yeast and molds occurrence were 1.65% and 9.06%, respectively. Pathogens were detected in cream cheese, spinach, strawberry and cod fish most prevalently, whereas dried fig, chilli pepper, hazelnut and bakery products were determined as foods prone to the growth of molds. The results of this study suggest that faecal contamination of water needs to be prevented, and the production and storage conditions of food materials should be improved. These findings have implications for the use of these surveillance data in developing evidence-based food policy.

  9. Targeting cattle-borne zoonoses and cattle pathogens using a novel trypanosomatid-based delivery system.

    Directory of Open Access Journals (Sweden)

    G Adam Mott

    2011-10-01

    Full Text Available Trypanosomatid parasites are notorious for the human diseases they cause throughout Africa and South America. However, non-pathogenic trypanosomatids are also found worldwide, infecting a wide range of hosts. One example is Trypanosoma (Megatrypanum theileri, a ubiquitous protozoan commensal of bovids, which is distributed globally. Exploiting knowledge of pathogenic trypanosomatids, we have developed Trypanosoma theileri as a novel vehicle to deliver vaccine antigens and other proteins to cattle. Conditions for the growth and transfection of T. theileri have been optimised and expressed heterologous proteins targeted for secretion or specific localisation at the cell interior or surface using trafficking signals from Trypanosoma brucei. In cattle, the engineered vehicle could establish in the context of a pre-existing natural T. theileri population, was maintained long-term and generated specific immune responses to an expressed Babesia antigen at protective levels. Building on several decades of basic research into trypanosomatid pathogens, Trypanosoma theileri offers significant potential to target multiple infections, including major cattle-borne zoonoses such as Escherichia coli, Salmonella spp., Brucella abortus and Mycobacterium spp. It also has the potential to deliver therapeutics to cattle, including the lytic factor that protects humans from cattle trypanosomiasis. This could alleviate poverty by protecting indigenous African cattle from African trypanosomiasis.

  10. Identification of vector-borne pathogens in dogs and cats from Southern Brazil.

    Science.gov (United States)

    Malheiros, J; Costa, M M; do Amaral, R B; de Sousa, K C M; André, M R; Machado, R Z; Vieira, M I B

    2016-07-01

    Dogs and cats are often infected with vector-borne pathogens and play a crucial role as reservoirs and hosts in their life cycles. The aim of the present study was to investigate the occurrence of vector-borne pathogens among dogs and cats in the northwestern region of Rio Grande do Sul (RS) State, Brazil. One hundred and ten blood samples were collected from dogs (n=80) and cats (n=30). Laboratory analysis were carried out through stained blood smears, indirect enzyme-linked immunosorbent assay (ELISA) for Babesia vogeli and Ehrlichia canis (only for dogs) and polymerase chain reaction (PCR) aiming the detection of pathogens. The following pathogens were screened by PCR among dogs and cats: Babesia spp. and Hepatozoon spp. (18S rRNA gene), Anaplasma spp. (16S rRNA gene), and Ehrlichia spp. (dsb gene for dogs and 16S rRNA gene for cats) and Bartonella spp. (nuoG gene only for cats). Using blood smears structures morphologically compatible with piroplasms were found in 5.45% (6/110) of the samples. Anti-B. vogeli and anti-E. canis antibodies were detected in 91% (73/80) and 9% (7/80) of the dogs, respectively. All the seropositive dogs to E. canis were also to B. vogeli. Nineteen (17.3%) animals were positive to hemoparasites by PCR. After sequencing Rangelia vitalii 6/80 (7.5%), B. vogeli 3/80 (4%), Hepatozoon spp. 1/80 (1%), and Anaplasma spp. 1/80 (1%) were found in the dogs, and B. vogeli 2/30 (7%) and Bartonella spp. 6/30 (20%) were detected in the screened cats. No sample was positive for genes dsb and 16S rRNA of Ehrlichia spp. Only those animals which were positive for R. vitalii showed findings compatible with rangeliosis, such as anemia (100%), thrombocytopenia (67%), jaundice (50%), external bleeding (50%), and anorexia (50%). This is the first time that B. vogeli detected among cats in Southern Brazil. Copyright © 2016 Elsevier GmbH. All rights reserved.

  11. Co-infection with arthropod-borne pathogens in domestic cats.

    Science.gov (United States)

    André, Marcos Rogério; Filgueira, Kilder Dantas; Calchi, Ana Cláudia; Sousa, Keyla Carstens Marques de; Gonçalves, Luiz Ricardo; Medeiros, Vitor Brasil; Ximenes, Poliana Araújo; Lelis, Ivana Cristina Nunes Gadelha; Meireles, Maria Vanuza Nunes de; Machado, Rosangela Zacarias

    2017-01-01

    The role of several feline vector-borne pathogens (FVBP) as a cause of disease in cats has not been clearly determined. In fact, with the exception of Bartonella spp. and hemoplasmas, FVBP in cats has not been clearly determined in Brazil yet. The present study aimed at identifying, by using molecular methods, the presence of FVBP in three cats showing non-specific clinical signs and inclusions suggestive of hemoparasites in blood smears. Cytauxzoon felis, 'Candidatus Mycoplasma haemominutum', Ehrlichia sp. closely related to Ehrlichia canis, and Anaplasma sp. closely related to Anaplasma phagocytophilum were detected in blood samples from two out of three sampled cats. Both cats positive for multiple FVBP did not show hematological and biochemical abnormalities. The present work emphasizes the need for molecular confirmation of co-infection by multiple FVBP in cats presenting non-specific clinical signs and inclusions resembling hemoparasites in blood smears.

  12. Co-infection with arthropod-borne pathogens in domestic cats

    Directory of Open Access Journals (Sweden)

    Marcos Rogério André

    2017-11-01

    Full Text Available Abstract The role of several feline vector-borne pathogens (FVBP as a cause of disease in cats has not been clearly determined. In fact, with the exception of Bartonella spp. and hemoplasmas, FVBP in cats has not been clearly determined in Brazil yet. The present study aimed at identifying, by using molecular methods, the presence of FVBP in three cats showing non-specific clinical signs and inclusions suggestive of hemoparasites in blood smears. Cytauxzoon felis, ‘Candidatus Mycoplasma haemominutum’, Ehrlichia sp. closely related to Ehrlichia canis, and Anaplasma sp. closely related to Anaplasma phagocytophilum were detected in blood samples from two out of three sampled cats. Both cats positive for multiple FVBP did not show hematological and biochemical abnormalities. The present work emphasizes the need for molecular confirmation of co-infection by multiple FVBP in cats presenting non-specific clinical signs and inclusions resembling hemoparasites in blood smears.

  13. Survey on tick-borne pathogens in thoroughbred horses in the Hidaka district, Hokkaido, Japan.

    Science.gov (United States)

    Ybañez, Adrian Patalinghug; Sato, Fumio; Nambo, Yasuo; Fukui, Takashi; Masuzawa, Toshiyuki; Ohashi, Norio; Matsumoto, Kotaro; Kishimoto, Toshio; Inokuma, Hisashi

    2013-01-31

    A total of 87 Thoroughbred horses and 10 ixodid ticks from a ranch in Hidaka district, Hokkaido were tested for tick-borne diseases. Using the indirect fluorescent antibody (IFA) method, 3.4, 92.0 and 97.7% of the horses showed antibody titers of ≥ 80 against Anaplasma phagocytophilum, Rickettsia helvetica, and Borrelia garinii, respectively. This is the first report of infection with the 3 pathogens in horses in Japan. Using PCR, DNAs from the peripheral blood of all horses were found negative with any Anaplasma, Rickettsia and Borrelia spp., while those from Haemaphysalis megaspinosa ticks were found positive for Anaplasma sp. closely related to A. phagocytophilum in Japan, and A. bovis. B. japonica was also detected in an H. flava tick for the first time.

  14. Microbiological food safety issues in Brazil: bacterial pathogens.

    Science.gov (United States)

    Gomes, Bruna Carrer; Franco, Bernadette Dora Gombossy de Melo; De Martinis, Elaine Cristina Pereira

    2013-03-01

    The globalization of food supply impacts patterns of foodborne disease outbreaks worldwide, and consumers are having increased concern about microbiological food safety. In this sense, the assessment of epidemiological data of foodborne diseases in different countries has not only local impact, but it can also be of general interest, especially in the case of major global producers and exporters of several agricultural food products, such as Brazil. In this review, the most common agents of foodborne illnesses registered in Brazil will be presented, compiled mainly from official databases made available to the public. In addition, some representative examples of studies on foodborne bacterial pathogens commonly found in Brazilian foods are provided.

  15. Pathogen Decontamination of Food Crop Soil: A Review.

    Science.gov (United States)

    Gurtler, Joshua B

    2017-09-01

    The purpose of this review is to delineate means of decontaminating soil. This information might be used to mitigate soil-associated risks of foodborne pathogens. The majority of the research in the published literature involves inactivation of plant pathogens in soil, i.e., those pathogens harmful to fruit and vegetable production and ornamental plants. Very little has been published regarding the inactivation of foodborne human pathogens in crop soil. Nevertheless, because decontamination techniques for plant pathogens might also be useful methods for eliminating foodborne pathogens, this review also includes inactivation of plant pathogens, with appropriate discussion and comparisons, in the hopes that these methods may one day be validated against foodborne pathogens. Some of the major soil decontamination methods that have been investigated and are covered include chemical decontamination (chemigation), solarization, steaming, biofumigation, bacterial competitive exclusion, torch flaming, microwave treatment, and amendment with biochar. Other innovative means of inactivating foodborne pathogens in soils may be discovered and explored in the future, provided that these techniques are economically feasible in terms of chemicals, equipment, and labor. Food microbiology and food safety researchers should reach out to soil scientists and plant pathologists to create links where they do not currently exist and strengthen relationships where they do exist to take advantage of multidisciplinary skills. In time, agricultural output and the demand for fresh produce will increase. With advances in the sensitivity of pathogen testing and epidemiological tracebacks, the need to mitigate preharvest bacterial contamination of fresh produce will become paramount. Hence, soil decontamination technologies may become more economically feasible and practical in light of increasing the microbial safety of fresh produce.

  16. Molecular and serological detection of tick-borne pathogens in donkeys (Equus asinus) in Italy.

    Science.gov (United States)

    Veronesi, Fabrizia; Morganti, Giulia; Ravagnan, Silvia; Laus, Fulvio; Spaterna, Andrea; Diaferia, Manuela; Moretti, Annabella; Fioretti, Daniela Piergili; Capelli, Gioia

    2014-10-10

    Donkeys, owing to the frequent outdoor activity, are exposed to a high risk of infection with tick-borne pathogens. This work aimed to detect exposure to Theileria equi, Babesia caballi, Anaplasma phagocytophilum and Borrelia burgdorferi s.l. of donkeys reared in Central Italy. For this purpose 122 adult donkeys were selected within 11 herds and submitted to blood collection. IgG antibodies to T. equi, B. caballi, A. phagocytophilum and B. burgdorferi s.l. were detected by IFAT. Conventional PCRs targeting the genes MSP2 and the flagellin were used for the detection of A. phagocytophilum and B. burgdorferi s.l. respectively and a Real Time PCR Sybr Green was used to detect Babesia/Theileria spp…. The species identity was determined by amplicons sequencing. Forty eight (39.3%) and 58 (47.5%) animals tested positive for T. equi and B. caballi antibodies, respectively; nine animals (7.4%) were found positive for antibodies against A. phagocytophilum whereas negative results were obtained for B. burgdorferi s.l. Twenty-six (21.3%) animals showed antibodies for both T. equi and B. caballi. Twenty-three (18.8%) donkeys were positive to Babesia/Theileria spp. PCR assay. Out of 21 sequenced amplicons, 20 were identified as T. equi, belonging to three main groups designated A, B and D and one as B. caballi group A. Neither A. phagocytophilum nor B. burgdorferi PCR results were positive. The study showed a high exposure of donkeys to tick-borne pathogens and provides information on the genetic identity of the T. equi strains circulating in Central Italy. Copyright © 2014 Elsevier B.V. All rights reserved.

  17. Recasting the theory of mosquito-borne pathogen transmission dynamics and control

    Science.gov (United States)

    Smith, David L.; Perkins, T. Alex; Reiner, Robert C.; Barker, Christopher M.; Niu, Tianchan; Chaves, Luis Fernando; Ellis, Alicia M.; George, Dylan B.; Le Menach, Arnaud; Pulliam, Juliet R. C.; Bisanzio, Donal; Buckee, Caroline; Chiyaka, Christinah; Cummings, Derek A. T.; Garcia, Andres J.; Gatton, Michelle L.; Gething, Peter W.; Hartley, David M.; Johnston, Geoffrey; Klein, Eili Y.; Michael, Edwin; Lloyd, Alun L.; Pigott, David M.; Reisen, William K.; Ruktanonchai, Nick; Singh, Brajendra K.; Stoller, Jeremy; Tatem, Andrew J.; Kitron, Uriel; Godfray, H. Charles J.; Cohen, Justin M.; Hay, Simon I.; Scott, Thomas W.

    2014-01-01

    Mosquito-borne diseases pose some of the greatest challenges in public health, especially in tropical and sub-tropical regions of the world. Efforts to control these diseases have been underpinned by a theoretical framework developed for malaria by Ross and Macdonald, including models, metrics for measuring transmission, and theory of control that identifies key vulnerabilities in the transmission cycle. That framework, especially Macdonald's formula for R0 and its entomological derivative, vectorial capacity, are now used to study dynamics and design interventions for many mosquito-borne diseases. A systematic review of 388 models published between 1970 and 2010 found that the vast majority adopted the Ross–Macdonald assumption of homogeneous transmission in a well-mixed population. Studies comparing models and data question these assumptions and point to the capacity to model heterogeneous, focal transmission as the most important but relatively unexplored component in current theory. Fine-scale heterogeneity causes transmission dynamics to be nonlinear, and poses problems for modeling, epidemiology and measurement. Novel mathematical approaches show how heterogeneity arises from the biology and the landscape on which the processes of mosquito biting and pathogen transmission unfold. Emerging theory focuses attention on the ecological and social context for mosquito blood feeding, the movement of both hosts and mosquitoes, and the relevant spatial scales for measuring transmission and for modeling dynamics and control. PMID:24591453

  18. Recasting the theory of mosquito-borne pathogen transmission dynamics and control.

    Science.gov (United States)

    Smith, David L; Perkins, T Alex; Reiner, Robert C; Barker, Christopher M; Niu, Tianchan; Chaves, Luis Fernando; Ellis, Alicia M; George, Dylan B; Le Menach, Arnaud; Pulliam, Juliet R C; Bisanzio, Donal; Buckee, Caroline; Chiyaka, Christinah; Cummings, Derek A T; Garcia, Andres J; Gatton, Michelle L; Gething, Peter W; Hartley, David M; Johnston, Geoffrey; Klein, Eili Y; Michael, Edwin; Lloyd, Alun L; Pigott, David M; Reisen, William K; Ruktanonchai, Nick; Singh, Brajendra K; Stoller, Jeremy; Tatem, Andrew J; Kitron, Uriel; Godfray, H Charles J; Cohen, Justin M; Hay, Simon I; Scott, Thomas W

    2014-04-01

    Mosquito-borne diseases pose some of the greatest challenges in public health, especially in tropical and sub-tropical regions of the world. Efforts to control these diseases have been underpinned by a theoretical framework developed for malaria by Ross and Macdonald, including models, metrics for measuring transmission, and theory of control that identifies key vulnerabilities in the transmission cycle. That framework, especially Macdonald's formula for R0 and its entomological derivative, vectorial capacity, are now used to study dynamics and design interventions for many mosquito-borne diseases. A systematic review of 388 models published between 1970 and 2010 found that the vast majority adopted the Ross-Macdonald assumption of homogeneous transmission in a well-mixed population. Studies comparing models and data question these assumptions and point to the capacity to model heterogeneous, focal transmission as the most important but relatively unexplored component in current theory. Fine-scale heterogeneity causes transmission dynamics to be nonlinear, and poses problems for modeling, epidemiology and measurement. Novel mathematical approaches show how heterogeneity arises from the biology and the landscape on which the processes of mosquito biting and pathogen transmission unfold. Emerging theory focuses attention on the ecological and social context for mosquito blood feeding, the movement of both hosts and mosquitoes, and the relevant spatial scales for measuring transmission and for modeling dynamics and control.

  19. Application of bacteriophages in post-harvest control of human pathogenic and food spoiling bacteria.

    Science.gov (United States)

    Pérez Pulido, Rubén; Grande Burgos, Maria José; Gálvez, Antonio; Lucas López, Rosario

    2016-10-01

    Bacteriophages have attracted great attention for application in food biopreservation. Lytic bacteriophages specific for human pathogenic bacteria can be isolated from natural sources such as animal feces or industrial wastes where the target bacteria inhabit. Lytic bacteriophages have been tested in different food systems for inactivation of main food-borne pathogens including Listeria monocytogenes, Staphylococcus aureus, Escherichia coli O157:H7, Salmonella enterica, Shigella spp., Campylobacter jejuni and Cronobacter sakazkii, and also for control of spoilage bacteria. Application of lytic bacteriophages could selectively control host populations of concern without interfering with the remaining food microbiota. Bacteriophages could also be applied for inactivation of bacteria attached to food contact surfaces or grown as biofilms. Bacteriophages may receive a generally recognized as safe status based on their lack of toxicity and other detrimental effects to human health. Phage preparations specific for L. monocytogenes, E. coli O157:H7 and S. enterica serotypes have been commercialized and approved for application in foods or as part of surface decontamination protocols. Phage endolysins have a broader host specificity compared to lytic bacteriophages. Cloned endolysins could be used as natural preservatives, singly or in combination with other antimicrobials such as bacteriocins.

  20. Review of the trends and causes of food borne outbreaks in Malaysia from 1988 to 1997.

    Science.gov (United States)

    Meftahuddin, T

    2002-03-01

    This paper examines the trend and possible contributing factors for the occurrence of the food borne diseases outbreaks in Malaysia. These diseases mainly are cholera, typhoid fever, hepatitis A, dysentery and food poisoning. The outbreaks still occur sporadically in certain high risk areas throughout the country. The incidence rate of all the other three major food borne diseases steadily declined from the year 1988 to 1997 except for food poisoning and cholera. Statistic of food poisoning from the year 1996 to 1997 showed that 66.5% of the outbreak occurred in schools whereas only 0.4% originated from the contaminated food sold at various public food outlets. The school age group is always more affected than the general population. Amongst the contributing factors identified are related to unhygienic food handling practices followed by inadequate safe water supply and poor environmental sanitation. A multisectoral approach between Ministry of Health and other government agencies or private agents needs to be undertaken in the management of the food borne diseases in order to curb the incidences of food borne diseases in Malaysia.

  1. Arthropods and associated arthropod-borne diseases transmitted by migrating birds. The case of ticks and tick-borne pathogens.

    Science.gov (United States)

    Sparagano, Olivier; George, David; Giangaspero, Annunziata; Špitalská, Eva

    2015-09-30

    Geographic spread of parasites and pathogens poses a constant risk to animal health and welfare, particularly given that climate change is expected to potentially expand appropriate ranges for many key species. The spread of deleterious organisms via trade routes and human travelling is relatively closely controlled, though represents only one possible means of parasite/pathogen distribution. The transmission via natural parasite/pathogen movement between geographic locales, is far harder to manage. Though the extent of such movement may be limited by the relative inability of many parasites and pathogens to actively migrate, passive movement over long distances may still occur via migratory hosts. This paper reviews the potential role of migrating birds in the transfer of ectoparasites and pathogens between geographic locales, focusing primarily on ticks. Bird-tick-pathogen relationships are considered, and evidence provided of long-range parasite/pathogen transfer from one location to another during bird migration events. As shown in this paper not only many different arthropod species are carried by migrating birds but consequently these pests carry many different pathogens species which can be transmitted to the migrating birds or to other animal species when those arthropods are dropping during these migrations. Data available from the literature are provided highlighting the need to understand better dissemination paths and disease epidemiology. Copyright © 2015 Elsevier B.V. All rights reserved.

  2. Escherichia coli O157:H7 - An Emerging Pathogen in foods of Animal Origin

    Directory of Open Access Journals (Sweden)

    Ch. Bindu Kiranmayi

    Full Text Available Escherichia coli O157:H7 is an emerging public health concern in most countries of the world. E. coli O157:H7 was known to be a human pathogen for nearly 24 years. EHEC O157 infection is estimated to be the fourth most costly food borne disease in Canada and USA, not counting the cost of possible litigation. E. coli O157:H7 and Salmonella are the leading causes of produce related outbreaks, accounting for 20 and 30% respectively. The authority of the Federal Meat Inspection Act, FSIS (Food Safety and Inspection Service declared Escherichia coli O157:H7, an adulterant in raw ground beef and enforced “zero tolerance” (USDA-FSIS, 17 December 1998. Because of the severity of these illnesses and the apparent low infective dose (less than 10 cells, Escherichia coli O157:H7 is considered one of the most serious of known food borne pathogens. Escherichia coli O157:H7 is mainly pathogenic to human but in cattle and other animals, it did not induce any clinical disease except diarrhea. So, these animals act as carriers to Escherichia coli O157:H7. The majority transmission is through eating of undercooked contaminated ground meat and consumption of raw milk, raw vegetables, fruits contaminated by water, cheese, curd and also through consumption of sprouts, lettuce and juice. The conventional isolation procedure includes growth in enrichment broth like modified EC (E. coli broth or modified tryptic soy broth (mTSB Since the infection primarily occurs via faeco-oral route, the preventive measures include food hygiene measures like proper cooking of meat, consumption of pasteurized milk, washing fruits and vegetables especially those to be eaten raw and drinking chlorine treated water and personnel hygiene measures like washing hands after toilet visits. [Veterinary World 2010; 3(8.000: 382-389

  3. Urban Market Gardening and Rodent-Borne Pathogenic Leptospira in Arid Zones: A Case Study in Niamey, Niger.

    Science.gov (United States)

    Dobigny, Gauthier; Garba, Madougou; Tatard, Caroline; Loiseau, Anne; Galan, Max; Kadaouré, Ibrahima; Rossi, Jean-Pierre; Picardeau, Mathieu; Bertherat, Eric

    2015-01-01

    Leptospirosis essentially affects human following contact with rodent urine-contaminated water. As such, it was mainly found associated with rice culture, recreational activities and flooding. This is also the reason why it has mainly been investigated in temperate as well as warm and humid regions, while arid zones have been only very occasionally monitored for this disease. In particular, data for West African countries are extremely scarce. Here, we took advantage of an extensive survey of urban rodents in Niamey, Niger, in order to look for rodent-borne pathogenic Leptospira species presence and distribution across the city. To do so, we used high throughput bacterial 16S-based metabarcoding, lipL32 gene-targeting RT-PCR, rrs gene sequencing and VNTR typing as well as GIS-based multivariate spatial analysis. Our results show that leptospires seem absent from the core city where usual Leptospira reservoir rodent species (namely R. rattus and M. natalensis) are yet abundant. On the contrary, L. kirschneri was detected in Arvicanthis niloticus and Cricetomys gambianus, two rodent species that are restricted to irrigated cultures within the city. Moreover, the VNTR profiles showed that rodent-borne leptospires in Niamey belong to previously undescribed serovars. Altogether, our study points towards the importance of market gardening in maintain and circulation of leptospirosis within Sahelian cities. In Africa, irrigated urban agriculture constitutes a pivotal source of food supply, especially in the context of the ongoing extensive urbanization of the continent. With this in mind, we speculate that leptospirosis may represent a zoonotic disease of concern also in arid regions that would deserve to be more rigorously surveyed, especially in urban agricultural settings.

  4. Urban Market Gardening and Rodent-Borne Pathogenic Leptospira in Arid Zones: A Case Study in Niamey, Niger.

    Directory of Open Access Journals (Sweden)

    Gauthier Dobigny

    Full Text Available Leptospirosis essentially affects human following contact with rodent urine-contaminated water. As such, it was mainly found associated with rice culture, recreational activities and flooding. This is also the reason why it has mainly been investigated in temperate as well as warm and humid regions, while arid zones have been only very occasionally monitored for this disease. In particular, data for West African countries are extremely scarce. Here, we took advantage of an extensive survey of urban rodents in Niamey, Niger, in order to look for rodent-borne pathogenic Leptospira species presence and distribution across the city. To do so, we used high throughput bacterial 16S-based metabarcoding, lipL32 gene-targeting RT-PCR, rrs gene sequencing and VNTR typing as well as GIS-based multivariate spatial analysis. Our results show that leptospires seem absent from the core city where usual Leptospira reservoir rodent species (namely R. rattus and M. natalensis are yet abundant. On the contrary, L. kirschneri was detected in Arvicanthis niloticus and Cricetomys gambianus, two rodent species that are restricted to irrigated cultures within the city. Moreover, the VNTR profiles showed that rodent-borne leptospires in Niamey belong to previously undescribed serovars. Altogether, our study points towards the importance of market gardening in maintain and circulation of leptospirosis within Sahelian cities. In Africa, irrigated urban agriculture constitutes a pivotal source of food supply, especially in the context of the ongoing extensive urbanization of the continent. With this in mind, we speculate that leptospirosis may represent a zoonotic disease of concern also in arid regions that would deserve to be more rigorously surveyed, especially in urban agricultural settings.

  5. Recontamination as a source of pathogens in processed foods

    NARCIS (Netherlands)

    Reij, M.W.; Asselt-den Aantrekker, van E.D.

    2004-01-01

    Food products that have been submitted to an adequate heat-treatment during processing are free of vegetative pathogens and, depending on the treatments, of sporeformers and are generally regarded as safe. Processed products such as pate, ice cream, infant formulae and others have nevertheless been

  6. Small-scale shifting mosaics of two dominant grassland species: the possible role of soil-borne pathogens

    NARCIS (Netherlands)

    Olff, H.; Hoorens, B.; De Goede, R.G.M.; Van der Putten, W.H.; Gleichman, J.M.

    2000-01-01

    We analyzed the dynamics of dominant plant species in a grazed grassland over 17 years, and investigated whether local shifts in these dominant species, leading to vegetation mosaics, could be attributed to interactions between plants and soil-borne pathogens. We found that Festuca rubra and Carer

  7. Small-scale shifting mosaics of two dominant grassland species : the possible role of soil-borne pathogens

    NARCIS (Netherlands)

    Olff, H.; Hoorens, B.; Goede, R.G.M. de; Putten, W.H. van der; Gleichman, J.M.

    2000-01-01

    We analyzed the dynamics of dominant plant species in a grazed grassland over 17 years, and investigated whether local shifts in these dominant species, leading to vegetation mosaics, could be attributed to interactions between plants and soil-borne pathogens. We found that Festuca rubra and Carex

  8. Ticks and Tick-Borne Pathogens of the Caribbean: Current Understanding and Future Directions for More Comprehensive Surveillance

    Czech Academy of Sciences Publication Activity Database

    Gondard, M.; Cabezas Cruz, Alejandro; Charles, R. A.; Vayssier-Taussat, M.; Albina, E.; Moutailler, S.

    2017-01-01

    Roč. 7, NOV 29 (2017), č. článku 490. ISSN 2235-2988 Institutional support: RVO:60077344 Keywords : tick-borne pathogens * ticks * Caribbean * epidemiology * newhigh-throughput technologies * surveillance Subject RIV: EE - Microbiology, Virology OBOR OECD: Microbiology Impact factor: 4.300, year: 2016

  9. Chemical Composition and Antimicrobial Activities of Essential Oils from Nepeta cataria L. against Common Causes of Food-Borne Infections

    Science.gov (United States)

    Zomorodian, Kamiar; Saharkhiz, Mohammad Jamal; Shariati, Samaneh; Pakshir, Keyvan; Rahimi, Mohammad Javad; Khashei, Reza

    2012-01-01

    Nepeta cataria L. is traditionally consumed as a food additive. The effects of three different harvest stages of N. cataria essential oils (EOs) against most common causes of food-borne infections were evaluated by broth microdilution method as recommended by the Clinical and Laboratory Standards Institute (CLSI). The chemical composition of the EOs from N. cataria has been analyzed by gas chromatography/mass spectrometry (GC/MS). The analysis of the EOs indicated that 4a-α,7-α,7a-β-nepetalactone (55–58%) and 4a-α,7-β,7a-α-nepetalactone (30–31.2%) were the major compounds of the EOs at all developmental stages. The results showed that the tested EOs exhibited antimicrobial activities against the food-borne pathogens at concentrations of 0.125–2 μL/mL. Based on these results, the EO of N. cataria can possibly be used in food products as a natural preservative agent. PMID:22779012

  10. Intestinal parasites and vector-borne pathogens in stray and free-roaming cats living in continental and insular Greece

    Science.gov (United States)

    Diakou, Anastasia; Di Cesare, Angela; Accettura, Paolo Matteo; Barros, Luciano; Iorio, Raffaella; Paoletti, Barbara; Frangipane di Regalbono, Antonio; Halos, Lénaïg; Beugnet, Frederic; Traversa, Donato

    2017-01-01

    This survey investigated the distribution of various intestinal parasites and vector-borne pathogens in stray and free-roaming cats living in four regions of Greece. A total number of one hundred and fifty cats living in three Islands (Crete, Mykonos and Skopelos) and in Athens municipality was established as a realistic aim to be accomplished in the study areas. All cats were examined with different microscopic, serological and molecular assays aiming at evaluating the occurrence of intestinal parasites, and exposure to or presence of vector-borne infections. A total of 135 cats (90%) was positive for one or more parasites and/or pathogens transmitted by ectoparasites. Forty-four (29.3%) cats were positive for one single infection, while 91 (60.7%) for more than one pathogen. A high number of (n. 53) multiple infections caused by feline intestinal and vector-borne agents including at least one zoonotic pathogen was detected. Among them, the most frequently recorded helminths were roundworms (Toxocara cati, 24%) and Dipylidium caninum (2%), while a high number of examined animals (58.8%) had seroreaction for Bartonella spp., followed by Rickettsia spp. (43.2%) and Leishmania infantum (6.1%). DNA-based assays revealed the zoonotic arthropod-borne organisms Bartonella henselae, Bartonella clarridgeiae, Rickettsia spp., and L. infantum. These results show that free-ranging cats living in areas of Greece under examination may be exposed to a plethora of internal parasites and vector-borne pathogens, some of them potentially able to infect humans. Therefore, epidemiological vigilance and appropriate control measures are crucial for the prevention and control of these infections and to minimize the risk of infection for people. PMID:28141857

  11. Intestinal parasites and vector-borne pathogens in stray and free-roaming cats living in continental and insular Greece.

    Directory of Open Access Journals (Sweden)

    Anastasia Diakou

    2017-01-01

    Full Text Available This survey investigated the distribution of various intestinal parasites and vector-borne pathogens in stray and free-roaming cats living in four regions of Greece. A total number of one hundred and fifty cats living in three Islands (Crete, Mykonos and Skopelos and in Athens municipality was established as a realistic aim to be accomplished in the study areas. All cats were examined with different microscopic, serological and molecular assays aiming at evaluating the occurrence of intestinal parasites, and exposure to or presence of vector-borne infections. A total of 135 cats (90% was positive for one or more parasites and/or pathogens transmitted by ectoparasites. Forty-four (29.3% cats were positive for one single infection, while 91 (60.7% for more than one pathogen. A high number of (n. 53 multiple infections caused by feline intestinal and vector-borne agents including at least one zoonotic pathogen was detected. Among them, the most frequently recorded helminths were roundworms (Toxocara cati, 24% and Dipylidium caninum (2%, while a high number of examined animals (58.8% had seroreaction for Bartonella spp., followed by Rickettsia spp. (43.2% and Leishmania infantum (6.1%. DNA-based assays revealed the zoonotic arthropod-borne organisms Bartonella henselae, Bartonella clarridgeiae, Rickettsia spp., and L. infantum. These results show that free-ranging cats living in areas of Greece under examination may be exposed to a plethora of internal parasites and vector-borne pathogens, some of them potentially able to infect humans. Therefore, epidemiological vigilance and appropriate control measures are crucial for the prevention and control of these infections and to minimize the risk of infection for people.

  12. Intestinal parasites and vector-borne pathogens in stray and free-roaming cats living in continental and insular Greece.

    Science.gov (United States)

    Diakou, Anastasia; Di Cesare, Angela; Accettura, Paolo Matteo; Barros, Luciano; Iorio, Raffaella; Paoletti, Barbara; Frangipane di Regalbono, Antonio; Halos, Lénaïg; Beugnet, Frederic; Traversa, Donato

    2017-01-01

    This survey investigated the distribution of various intestinal parasites and vector-borne pathogens in stray and free-roaming cats living in four regions of Greece. A total number of one hundred and fifty cats living in three Islands (Crete, Mykonos and Skopelos) and in Athens municipality was established as a realistic aim to be accomplished in the study areas. All cats were examined with different microscopic, serological and molecular assays aiming at evaluating the occurrence of intestinal parasites, and exposure to or presence of vector-borne infections. A total of 135 cats (90%) was positive for one or more parasites and/or pathogens transmitted by ectoparasites. Forty-four (29.3%) cats were positive for one single infection, while 91 (60.7%) for more than one pathogen. A high number of (n. 53) multiple infections caused by feline intestinal and vector-borne agents including at least one zoonotic pathogen was detected. Among them, the most frequently recorded helminths were roundworms (Toxocara cati, 24%) and Dipylidium caninum (2%), while a high number of examined animals (58.8%) had seroreaction for Bartonella spp., followed by Rickettsia spp. (43.2%) and Leishmania infantum (6.1%). DNA-based assays revealed the zoonotic arthropod-borne organisms Bartonella henselae, Bartonella clarridgeiae, Rickettsia spp., and L. infantum. These results show that free-ranging cats living in areas of Greece under examination may be exposed to a plethora of internal parasites and vector-borne pathogens, some of them potentially able to infect humans. Therefore, epidemiological vigilance and appropriate control measures are crucial for the prevention and control of these infections and to minimize the risk of infection for people.

  13. Molecular mechanisms of toxicity of important food-borne phytotoxins

    NARCIS (Netherlands)

    Rietjens, I.M.C.M.; Martena, M.J.; Boersma, M.G.; Spiegelenberg, W.; Alink, G.M.

    2005-01-01

    At present, there is an increasing interest for plant ingredients and their use in drugs, for teas, or in food supplements. The present review describes the nature and mechanism of action of the phytochemicals presently receiving increased attention in the field of food toxicology. This relates to

  14. Microbes versus microbes: control of pathogens in the food chain.

    Science.gov (United States)

    Jordan, Kieran; Dalmasso, Marion; Zentek, Juergen; Mader, Anneluise; Bruggeman, Geert; Wallace, John; De Medici, Dario; Fiore, Alfonsina; Prukner-Radovcic, Estella; Lukac, Maja; Axelsson, Lars; Holck, Askild; Ingmer, Hanne; Malakauskas, Mindaugas

    2014-12-01

    Foodborne illness continues as a considerable threat to public health. Despite improved hygiene management systems and increased regulation, pathogenic bacteria still contaminate food, causing sporadic cases of illness and disease outbreaks worldwide. For many centuries, microbial antagonism has been used in food processing to improve food safety. An understanding of the mode of action of this microbial antagonism has been gained in recent years and potential applications in food and feed safety are now being explored. This review focuses on the potential opportunities presented, and the limitations, of using microbial antagonism as a biocontrol mechanism to reduce contamination along the food chain; including animal feed as its first link. © 2014 Society of Chemical Industry. © 2014 Society of Chemical Industry.

  15. Molecular detection of tick-borne pathogens in cattle from Southwestern Ethiopia.

    Directory of Open Access Journals (Sweden)

    Zerihun Hailemariam

    Full Text Available Tick-borne diseases (TBDs cause significant losses among livestock and impact the livelihoods of resource-poor farming communities worldwide. In Ethiopia, detailed studies on the epidemiology of tick-borne pathogens (TBPs in cattle using sensitive molecular detection methods are scarce. The objective of this study was to determine the prevalence and species composition of bovine TBPs of veterinary significance in local cattle populations. A comprehensive cross-sectional epidemiological study was conducted in cattle populations of Illubabor zone in Southwestern Ethiopia from June to August 2013. For this purpose, blood samples were collected from 392 cattle. A combination of polymerase chain reaction (PCR and a Reverse Line Blot (RLB hybridization assay was employed for the detection of TBPs in these samples. The PCR/RLB results of the 392 blood samples indicated a high overall prevalence of 96.9% for TBPs, including Theileria mutans (66.1%, Theileria orientalis (51.8%, Anaplasma sp. Omatjenne (25.5%, Anaplasma marginale (14.5%, Babesia bigemina (14.0% and Theileria velifera (13.0% and minor occurrences of Ehrlichia ruminantium (0.5% and Ehrlichia minasensis (0.26%. Moreover, three novel Anaplasma genotypes were detected in bovine blood samples. A phylogenetic analysis revealed that they most likely represent three, but at least two, new species. The prevalence of the three novel Anaplasma species, preliminary designated as Anaplasma sp. Hadesa, Anaplasma sp. Saso and Anaplasma sp. Dedessa, was 12.5%, 14.3% and 5.6%, respectively. Overall, a total of 227 cattle (57.9% were found to be co-infected with two or more TBPs simultaneously and 86 different species combinations were observed. The findings show a very high burden of infection of cattle with TBPs in Ethiopia. The high frequency of co-infections suggests that clinical manifestations might be complex. Further research is required to determine the pathogenicity, host cell types and vector of

  16. Poly(HEMA) brushes emerging as a new platform for direct detection of food pathogen in milk samples

    Czech Academy of Sciences Publication Activity Database

    Rodriguez-Emmenegger, Cesar Adolfo; Avramenko, Oxana; Brynda, Eduard; Škvor, J.; Bologna Alles, A.

    2011-01-01

    Roč. 26, č. 11 (2011), s. 4545-4551 ISSN 0956-5663 R&D Projects: GA AV ČR KAN200670701; GA ČR GAP503/10/0664 Institutional research plan: CEZ:AV0Z40500505 Keywords : surface plasmon resonance * food-borne pathogens * polymer brushes Subject RIV: JA - Electronics ; Optoelectronics, Electrical Engineering Impact factor: 5.602, year: 2011

  17. Inhibition of in vitro growth of soil-borne pathogens by compost-inhabiting indigenous bacteria and fungi

    International Nuclear Information System (INIS)

    Ramzan, N.; Noreen, N.; Shahzad, S.

    2014-01-01

    During the present studies, compost-inhabiting microorganisms including 44 fungi and 15 bacteria isolated from different compost samples were evaluated for their in vitro efficacy against soil-borne pathogens viz., Fusarium solani, Macrophomina phaseolina, Pythium aphanidermatum, Rhizoctonia solani, and Sclerotium rolfsii. Compost inhabiting microbes like Trichoderma harzianum, T. virens, Bacillus cereus, B. pumilus, B. subtilis, Micrococcus varians and Pseudomonas fluorescens were found to inhibit all the test pathogens. Acrophialophora fusispora and Penicillium citrinum reduced the mycelial growth of all the test pathogens except Sclerotium rolfsii. Bacillus licheniformis and Bacillus megaterium showed biocontrol activity against all the pathogens except Rhizoctonia solani. Trichoderma harzianum parasitized mycelia of all the tested pathogens and produced coiling around the mycelium. (author)

  18. Food-borne norovirus-outbreak at a military base, Germany, 2009.

    Science.gov (United States)

    Wadl, Maria; Scherer, Kathrin; Nielsen, Stine; Diedrich, Sabine; Ellerbroek, Lüppo; Frank, Christina; Gatzer, Renate; Hoehne, Marina; Johne, Reimar; Klein, Günter; Koch, Judith; Schulenburg, Jörg; Thielbein, Uta; Stark, Klaus; Bernard, Helen

    2010-02-17

    Norovirus is often transmitted from person-to-person. Transmission may also be food-borne, but only few norovirus outbreak investigations have identified food items as likely vehicles of norovirus transmission through an analytical epidemiological study.During 7-9 January, 2009, 36 persons at a military base in Germany fell ill with acute gastroenteritis. Food from the military base's canteen was suspected as vehicle of infection, norovirus as the pathogen causing the illnesses. An investigation was initiated to describe the outbreak's extent, to verify the pathogen, and to identify modes of transmission and source of infection to prevent further cases. For descriptive analysis, ill persons were defined as members of the military base with acute onset of diarrhoea or vomiting between 24 December 2008, and 3 February 2009, without detection of a pathogen other than norovirus in stools. We conducted a retrospective cohort study within the headquarters company. Cases were military base members with onset of diarrhoea or vomiting during 5-9 January. We collected information on demographics, food items eaten at the canteen and contact to ill persons or vomit, using a self-administered questionnaire. We compared attack rates (AR) in exposed and unexposed persons, using bivariable and multivariable logistic regression modelling. Stool specimens of ill persons and canteen employees, canteen food served during 5-7 January and environmental swabs were investigated by laboratory analysis. Overall, 101/815 (AR 12.4%) persons fell ill between 24 December 2008 and 3 February 2009. None were canteen employees. Most persons (n = 49) had disease onset during 7-9 January. Ill persons were a median of 22 years old, 92.9% were male. The response for the cohort study was 178/274 (72.1%). Of 27 cases (AR 15.2%), 25 had eaten at the canteen and 21 had consumed salad. Salad consumption on 6 January (aOR: 8.1; 95%CI: 1.5-45.4) and 7 January (aOR: 15.7; 95%CI: 2.2-74.1) were independently

  19. Food-borne norovirus-outbreak at a military base, Germany, 2009

    Directory of Open Access Journals (Sweden)

    Hoehne Marina

    2010-02-01

    Full Text Available Abstract Background Norovirus is often transmitted from person-to-person. Transmission may also be food-borne, but only few norovirus outbreak investigations have identified food items as likely vehicles of norovirus transmission through an analytical epidemiological study. During 7-9 January, 2009, 36 persons at a military base in Germany fell ill with acute gastroenteritis. Food from the military base's canteen was suspected as vehicle of infection, norovirus as the pathogen causing the illnesses. An investigation was initiated to describe the outbreak's extent, to verify the pathogen, and to identify modes of transmission and source of infection to prevent further cases. Methods For descriptive analysis, ill persons were defined as members of the military base with acute onset of diarrhoea or vomiting between 24 December 2008, and 3 February 2009, without detection of a pathogen other than norovirus in stools. We conducted a retrospective cohort study within the headquarters company. Cases were military base members with onset of diarrhoea or vomiting during 5-9 January. We collected information on demographics, food items eaten at the canteen and contact to ill persons or vomit, using a self-administered questionnaire. We compared attack rates (AR in exposed and unexposed persons, using bivariable and multivariable logistic regression modelling. Stool specimens of ill persons and canteen employees, canteen food served during 5-7 January and environmental swabs were investigated by laboratory analysis. Results Overall, 101/815 (AR 12.4% persons fell ill between 24 December 2008 and 3 February 2009. None were canteen employees. Most persons (n = 49 had disease onset during 7-9 January. Ill persons were a median of 22 years old, 92.9% were male. The response for the cohort study was 178/274 (72.1%. Of 27 cases (AR 15.2%, 25 had eaten at the canteen and 21 had consumed salad. Salad consumption on 6 January (aOR: 8.1; 95%CI: 1.5-45.4 and 7

  20. Molecular detection of vector-borne pathogens in dogs and cats from Qatar.

    Science.gov (United States)

    Alho, Ana Margarida; Lima, Clara; Latrofa, Maria Stefania; Colella, Vito; Ravagnan, Silvia; Capelli, Gioia; Madeira de Carvalho, Luís; Cardoso, Luís; Otranto, Domenico

    2017-06-20

    Vector-borne diseases (VBDs) have been increasingly reported in dogs and cats worldwide. However, no data are currently available regarding canine and feline VBDs in Qatar and limited information is available from other Persian Gulf countries. Blood samples from 98 client-owned animals (i.e. 64 dogs and 34 cats) living in Doha (Qatar) were collected and the presence of genomic DNA of Anaplasma spp., Babesia spp., Dirofilaria spp., Ehrlichia spp., Hepatozoon spp., Mycoplasma spp. and Rickettsia spp. was assessed by polymerase chain reaction (PCR), real time-PCR (rt-PCR) and sequence analysis. Of the 64 dogs, 12 (18.8%) were infected with at least one pathogen (i.e. 7.8% with Mycoplasma spp., 4.7% with Babesia vogeli, 3.1% with Ehrlichia canis, and 1.6% with Anaplasma platys, Babesia gibsoni and Hepatozoon canis, each). One of the 12 dogs was co-infected with B. vogeli and E. canis. Of the 34 cats, seven (20.6%) animals were infected with at least one pathogen (i.e. 5.9% were positive for Mycoplasma spp., and 2.9% for Babesia felis, B. vogeli, E. canis, "Candidatus Mycoplasma haemominutum" and Mycoplasma haemofelis, each). No dogs or cats were positive for Dirofilaria spp. or Rickettsia spp. Although the sample sizes of dogs and cats herein analysed was moderately small, data from this study report the occurrence of A. platys, B. vogeli, B. gibsoni, E. canis, H. canis and Mycoplasma spp. in domestic dogs and of B. felis, B. vogeli, "Candidatus M. haemominutum", E. canis and M. haemofelis in domestic cats from Qatar. Further investigations along with prophylactic measures are strongly recommended in order to reduce the risk of dogs and cats acquiring VBDs in Qatar.

  1. Genetic Diversity of Tick-Borne Rickettsial Pathogens; Insights Gained from Distant Strains

    Directory of Open Access Journals (Sweden)

    Sebastián Aguilar Pierlé

    2014-01-01

    Full Text Available The ability to capture genetic variation with unprecedented resolution improves our understanding of bacterial populations and their ability to cause disease. The goal of the pathogenomics era is to define genetic diversity that results in disease. Despite the economic losses caused by vector-borne bacteria in the Order Rickettsiales, little is known about the genetic variants responsible for observed phenotypes. The tick-transmitted rickettsial pathogen Anaplasma marginale infects cattle in tropical and subtropical regions worldwide, including Australia. Genomic analysis of North American A. marginale strains reveals a closed core genome defined by high levels of Single Nucleotide Polymorphisms (SNPs. Here we report the first genome sequences and comparative analysis for Australian strains that differ in virulence and transmissibility. A list of genetic differences that segregate with phenotype was evaluated for the ability to distinguish the attenuated strain from virulent field strains. Phylogenetic analyses of the Australian strains revealed a marked evolutionary distance from all previously sequenced strains. SNP analysis showed a strikingly reduced genetic diversity between these strains, with the smallest number of SNPs detected between any two A. marginale strains. The low diversity between these phenotypically distinct bacteria presents a unique opportunity to identify the genetic determinants of virulence and transmission.

  2. Dietary Sodium Intakes and Food Sources of Sodium in Canadian-Born and Asian-Born Individuals of Chinese Ethnicity at a Canadian University Campus

    Science.gov (United States)

    Yu, Yan Han; Farmer, Anna; Mager, Diana; Willows, Noreen

    2014-01-01

    Objective: To document the sodium intake and food sources of sodium of Canadian-born Chinese (CBC) and Asian-born Chinese (ABC) individuals at a Canadian university campus. Participants: Healthy adults aged 18-58 years originating from Canada, China, Hong Kong, or Taiwan were recruited from the University of Alberta (n = 40 CBC, n = 41 ABC)…

  3. Prioritisation of food-borne parasites in Europe, 2016.

    NARCIS (Netherlands)

    Bouwknegt, Martijn; Devleesschauwer, Brecht; Graham, Heather; Robertson, Lucy J; van der Giessen, Joke Wb; The Euro-Fbp Workshop Participants

    Background and aimsPriority setting is a challenging task for public health professionals. To support health professionals with this and in following a recommendation from the Food and Agriculture Organization of the United Nations (FAO) and World Health Organization (WHO), 35 European

  4. Small-scale shifting mosaics of two dominant grassland species: the possible role of soil-borne pathogens.

    Science.gov (United States)

    Olff, H; Hoorens, B; de Goede, R G M; van der Putten, W H; Gleichman, J M

    2000-10-01

    We analyzed the dynamics of dominant plant species in a grazed grassland over 17 years, and investigated whether local shifts in these dominant species, leading to vegetation mosaics, could be attributed to interactions between plants and soil-borne pathogens. We found that Festuca rubra and Carex arenaria locally alternated in abundance, with different sites close together behaving out of phase, resulting in a shifting mosaic. The net effect of killing all soil biota on the growth of these two species was investigated in a greenhouse experiment using gamma radiation, controlling for possible effects of sterilization on soil chemistry. Both plant species showed a strong net positive response to soil sterilization, indicating that pathogens (e.g., nematodes, pathogenic fungi) outweighed the effect of mutualists (e.g., mycorrhizae). This positive growth response towards soil sterilization appeared not be due to effects of sterilization on soil chemistry. Growth of Carex was strongly reduced by soil-borne pathogens (86% reduction relative to its growth on sterilized soil) on soil from a site where this species decreased during the last decade (and Festuca increased), while it was reduced much less (50%) on soil from a nearby site where it increased in abundance during the last decade. Similarly, Festuca was reduced more (67%) on soil from the site where it decreased (and Carex increased) than on soil from the site where it increased (55%, the site where Carex decreased). Plant-feeding nematodes showed high small-scale variation in densities, and we related this variation to the observed growth reductions in both plant species. Carex growth on unsterilized soil was significantly more reduced at higher densities of plant-feeding nematodes, while the growth reduction in Festuca was independent of plant-feeding nematode densities. At high plant-feeding nematode densities, growth of Carex was reduced more than Festuca, while at low nematode densities the opposite was found

  5. [Food borne outbreak caused by the well water contaminated norovirus].

    Science.gov (United States)

    Tokutake, Yumi; Kobayashi, Masato; Akiyama, Miho; Aiki, Chikako; Nishio, Osamu

    2006-05-01

    In May 2004, 65 people from 18 groups of visitors to guesthouse (a traditional Japanese guesthouse) in the Nagano Prefecture, Japan developed acute gastroenteritis. Although these cases originally attributed to food poisoning, based on epidemiological and dietary surveys, there was nothing that is associated as a cause food. The same wall water was used throughout the guesthouse except in the kitchen, so testing was conducted on this water. Lordsdale variant strain of Norovirus was detected from both of the well water and the feces of patients and staff. The well supplying to the guesthouse was only 10 meters deep and fecal coliform group was also detected in the well water from the guesthouse. This suggested that the water source was contaminated by human feces.

  6. Molecular mechanisms of toxicity of important food-borne phytotoxins.

    Science.gov (United States)

    Rietjens, Ivonne M C M; Martena, Martijn J; Boersma, Marelle G; Spiegelenberg, Wim; Alink, Gerrit M

    2005-02-01

    At present, there is an increasing interest for plant ingredients and their use in drugs, for teas, or in food supplements. The present review describes the nature and mechanism of action of the phytochemicals presently receiving increased attention in the field of food toxicology. This relates to compounds including aristolochic acids, pyrrolizidine alkaloids, beta-carotene, coumarin, the alkenylbenzenes safrole, methyleugenol and estragole, ephedrine alkaloids and synephrine, kavalactones, anisatin, St. John's wort ingredients, cyanogenic glycosides, solanine and chaconine, thujone, and glycyrrhizinic acid. It can be concluded that several of these phytotoxins cause concern, because of their bioactivation to reactive alkylating intermediates that are able to react with cellular macromolecules causing cellular toxicity, and, upon their reaction with DNA, genotoxicity resulting in tumors. Another group of the phytotoxins presented is active without the requirement for bioactivation and, in most cases, these compounds appear to act as neurotoxins interacting with one of the neurotransmitter systems. Altogether, the examples presented illustrate that natural does not equal safe and that in modern society adverse health effects, upon either acute or chronic exposure to phytochemicals, can occur as a result of use of plant- or herb-based foods, teas, or other extracts.

  7. Microbial profiling, neural network and semantic web: an integrated information system for human pathogen risk management, prevention and surveillance in food safety

    Science.gov (United States)

    It is estimated that food-borne pathogens cause approximately 76 million cases of gastrointestinal illnesses, 325,000 hospitalizations, and 5,000 deaths in the United States annually. Genomic, proteomic, and metabolomic studies, particularly, genome sequencing projects are providing valuable inform...

  8. River Networks As Ecological Corridors for Species, Populations and Pathogens of Water-Borne Disease

    Science.gov (United States)

    Rinaldo, A.

    2014-12-01

    River basins are a natural laboratory for the study of the integration of hydrological, ecological and geomorphological processes. Moving from morphological and functional analyses of dendritic geometries observed in Nature over a wide range of scales, this Lecture addresses essential ecological processes that take place along dendritic structures, hydrology-driven and controlled, like e.g.: population migrations and human settlements, that historically proceeded along river networks to follow water supply routes; riparian ecosystems composition that owing to their positioning along streams play crucial roles in their watersheds and in the loss of biodiversity proceeding at unprecedented rates; waterborne disease spreading, like epidemic cholera that exhibits epidemic patterns that mirror those of watercourses and of human mobility and resurgences upon heavy rainfall. Moreover, the regional incidence of Schistosomiasis, a parasitic waterborne disease, and water resources developments prove tightly related, and proliferative kidney disease in fish thrives differently in pristine and engineered watercourses: can we establish quantitatively the critical linkages with hydrologic drivers and controls? How does connectivity within a river network affect community composition or the spreading mechanisms? Does the river basin act as a template for biodiversity or for species' persistence? Are there hydrologic controls on epidemics of water-borne disease? Here, I shall focus on the noteworthy scientific perspectives provided by spatially explicit eco-hydrological studies centered on river networks viewed as ecological corridors for species, populations and pathogens of waterborne disease. A notable methodological coherence is granted by the mathematical description of river networks as the support for reactive transport. The Lecture overviews a number of topics idiosyncratically related to my own research work but ideally aimed at a coherent body of materials and methods. A

  9. Are your employees protected from blood-borne pathogens? OSHA standards charge textile rental companies with responsibility for worker safety.

    Science.gov (United States)

    Weller, S C

    1991-11-01

    Congress is putting pressure on OSHA to finalize its Universal Precaution standards by December. When the standards go into effect, textile rental companies that serve medical, dental, and outpatient care facilities--including private physician and dentist offices--must take steps to protect employees from blood-borne pathogens. Soiled linens, towels, gowns, and other items from any customer in risk categories link a textile rental facility and/or commercial laundry with the OSHA regulations. Read and heed this information.

  10. High-antibacterial activity of Urtica spp. seed extracts on food and plant pathogenic bacteria.

    Science.gov (United States)

    Körpe, Didem Aksoy; İşerı, Özlem Darcansoy; Sahin, Feride Iffet; Cabi, Evren; Haberal, Mehmet

    2013-05-01

    The aim of this study was to comparatively evaluate antibacterial activities of methanol (MetOH) and aqueous (dw) leaf (L), root (R) and seed (S) extracts of Urtica dioica L. (Ud; stinging nettle) and Urtica pilulifera L. (Up; Roman nettle) on both food- and plant-borne pathogens, with total phenolic contents and DPPH radical scavenging activities (DRSA). MetOH extracts of leaves and roots of U. dioica had the highest DRSA. Extracts with high antibacterial activity were in the order Up-LMetOH (13/16) > Ud-SMetOH (11/16) > Up-SMetOH (9/16). Results obtained with Up-SMetOH against food spoiling Bacillus pumilus, Shigella spp. and Enterococcus gallinarum with minimum inhibitory concentrations (MICs) in 128-1024 μg/ml range seem to be promising. Up-SMetOH also exerted strong inhibition against Clavibacter michiganensis with a considerably low MIC (32 μg/ml). Ud-SMetOH and Up-LMetOH were also effective against C. michiganensis (MIC = 256 and 1024 μg/ml, respectively). Ud-SMetOH and Ud-RMetOH had also antimicrobial activity against Xanthomonas vesicatoria (MIC = 512 and 1024 μg/ml, respectively). Results presented here demonstrate high-antibacterial activity of U. pilulifera extracts and U. dioica seed extract against phytopathogens for the first time, and provide the most comprehensive data on the antibacterial activity screening of U. pilulifera against food-borne pathogens. Considering limitations in plant disease control, antibacterial activities of these extracts would be of agricultural importance.

  11. Surveillance of vector-borne pathogens under imperfect detection: lessons from Chagas disease risk (mis)measurement.

    Science.gov (United States)

    Minuzzi-Souza, Thaís Tâmara Castro; Nitz, Nadjar; Cuba, César Augusto Cuba; Hagström, Luciana; Hecht, Mariana Machado; Santana, Camila; Ribeiro, Marcelle; Vital, Tamires Emanuele; Santalucia, Marcelo; Knox, Monique; Obara, Marcos Takashi; Abad-Franch, Fernando; Gurgel-Gonçalves, Rodrigo

    2018-01-09

    Vector-borne pathogens threaten human health worldwide. Despite their critical role in disease prevention, routine surveillance systems often rely on low-complexity pathogen detection tests of uncertain accuracy. In Chagas disease surveillance, optical microscopy (OM) is routinely used for detecting Trypanosoma cruzi in its vectors. Here, we use replicate T. cruzi detection data and hierarchical site-occupancy models to assess the reliability of OM-based T. cruzi surveillance while explicitly accounting for false-negative and false-positive results. We investigated 841 triatomines with OM slides (1194 fresh, 1192 Giemsa-stained) plus conventional (cPCR, 841 assays) and quantitative PCR (qPCR, 1682 assays). Detections were considered unambiguous only when parasitologists unmistakably identified T. cruzi in Giemsa-stained slides. qPCR was >99% sensitive and specific, whereas cPCR was ~100% specific but only ~55% sensitive. In routine surveillance, examination of a single OM slide per vector missed ~50-75% of infections and wrongly scored as infected ~7% of the bugs. qPCR-based and model-based infection frequency estimates were nearly three times higher, on average, than OM-based indices. We conclude that the risk of vector-borne Chagas disease may be substantially higher than routine surveillance data suggest. The hierarchical modelling approach we illustrate can help enhance vector-borne disease surveillance systems when pathogen detection is imperfect.

  12. [Molecular typing characterization of food-borne methicillin-resistant Staphylococcus aureus in China].

    Science.gov (United States)

    Bai, Y; Wang, W; Yan, L; Yang, S R; Yan, S F; Dong, Y P; Zhao, B C; Zhao, Y Y; Xu, J; Hu, Y J; Li, F Q

    2018-04-06

    Objective: To analyses the antimicrobial resistance and molecular characterization of 21 MRSA isolates cultured from retail foods from different provinces in China, and evaluate the molecular typing methods. Methods: Twenty-one MRSA isolates were obtained from national foodborne pathogen surveillance network in 2012 (Chinese salad, n= 3; milk, n= 1; cake, n= 2; rice, n= 1; cold noodle, n= 1; spiced beef, n= 1; dumpling, n= 1; packed meal, n= 1; salad, n= 1; raw pork, n= 9). The antimicrobial resistance of 21 strains to 12 antimicrobial agents was tested by broth dilution method. Polymerase chain reaction (PCR) and DNA sequencing were performed to obtain the genetic types of MLST (ST) and spa typing. The clonal complex (CC) was assigned by eBURST soft and the MLVA type (MT) and MLVA complex (MC) were identified via the database of the MLVA website (http://www.mlva.net). Sma I pulsed-field gel electrophoresis ( Sma Ⅰ-PFGE) was also carried out to obtain the PFGE patterns of 21 strains. The genetic diversity and discriminatory power of typing were calculated by the Simpson's index of diversity (diversity index, DI) to find out the best genotyping method for MRSA. Results: All MRSA isolates showed multi-drug resistance(MDR), and were resistant to oxacillin, benzylpenicillin, clindamycin and erythromycin, and 71.4% (15/21), 47.6% (10/21), 42.9% (9/21) and 28.6% (6/21) of the MRSA isolates were resistant to tetracycline, ciprofloxacin, trimethoprim/sulfamethoxazole and gentamicin, respectively. Moreover, one strain was found to be resistant to all three antimicrobials of levofloxacin, moxifloxacin and rifampicin. Great diversity was found in these food-associated MRSA (6 STs, 7 spa types, and 9 MTs). PFGE patterns were more diverse than those of other three molecular typing methods (19 pulse types). The index of diversity (DI) of PFGE, MLVA, spa typing and MLST was 0.99, 0.80, 0.73, and 0.61, respectively. Among the MRSA isolates, CC9-ST9-t899-MT929-MC2236 (PFGE

  13. Use of irradiation to control infectivity of food-borne parasites

    International Nuclear Information System (INIS)

    1993-01-01

    Food-borne parasitic diseases are common throughout the world, pose significant health problems and cause economic losses in terms of agricultural commodities and human productivity. The diseases usually occur through consumption of raw or partially cooked foods with are infected by various parasites (e.g. tapeworms, roundworms, flukes, parasitic protozoa, etc.). The problem is significant in developing countries where the population has the habit of consuming raw food of animal origin. Available data, with the exception of data on Trichinella spiralis, a parasitic nematode, were insufficient for the use of irradiation technology to control food-borne parasites. Therefore, a Co-ordinated Research Programme (CRP) on the Use of Irradiation to Control Infectivity of Food-Borne Parasites was implemented by the FAO/IAEA in 1986. The results of the work carried out over five years (1986-1991) by twelve researchers participating in the programme, have established conclusively the potential for application of food irradiation in the control of liver flukes, tapeworms, roundworms, trichinosis, toxoplasmosis, etc. This report includes the conclusions and recommendations of the participants concerning the results obtained and need for further research. Refs, figs and tabs

  14. Multidrug-resistant pathogens in the food supply.

    Science.gov (United States)

    Doyle, Marjorie E

    2015-04-01

    Antimicrobial resistance, including multidrug resistance (MDR), is an increasing problem globally. MDR bacteria are frequently detected in humans and animals from both more- and less-developed countries and pose a serious concern for human health. Infections caused by MDR microbes may increase morbidity and mortality and require use of expensive drugs and prolonged hospitalization. Humans may be exposed to MDR pathogens through exposure to environments at health-care facilities and farms, livestock and companion animals, human food, and exposure to other individuals carrying MDR microbes. The Centers for Disease Control and Prevention classifies drug-resistant foodborne bacteria, including Campylobacter, Salmonella Typhi, nontyphoidal salmonellae, and Shigella, as serious threats. MDR bacteria have been detected in both meat and fresh produce. Salmonellae carrying genes coding for resistance to multiple antibiotics have caused numerous foodborne MDR outbreaks. While there is some level of resistance to antimicrobials in environmental bacteria, the widespread use of antibiotics in medicine and agriculture has driven the selection of a great variety of microbes with resistance to multiple antimicrobials. MDR bacteria on meat may have originated in veterinary health-care settings or on farms where animals are given antibiotics in feed or to treat infections. Fresh produce may be contaminated by irrigation or wash water containing MDR bacteria. Livestock, fruits, and vegetables may also be contaminated by food handlers, farmers, and animal caretakers who carry MDR bacteria. All potential sources of MDR bacteria should be considered and strategies devised to reduce their presence in foods. Surveillance studies have documented increasing trends in MDR in many pathogens, although there are a few reports of the decline of certain multidrug pathogens. Better coordination of surveillance programs and strategies for controlling use of antimicrobials need to be implemented in

  15. Ticks and tick-borne pathogens at the cutaneous interface: host defenses, tick countermeasures, and a suitable environment for pathogen establishment

    Directory of Open Access Journals (Sweden)

    Stephen eWikel

    2013-11-01

    Full Text Available Ticks are unique among hematophagous arthropods by continuous attachment to host skin and blood feeding for days; complexity and diversity of biologically active molecules differentially expressed in saliva of tick species; their ability to modulate the host defenses of pain and itch, hemostasis, inflammation, innate and adaptive immunity, and wound healing; and, the diverse array of infectious agents they transmit. All of these interactions occur at the cutaneous interface in a complex sequence of carefully choreographed host defense responses and tick countermeasures resulting in an environment that facilitates successful blood feeding and establishment of tick-borne infectious agents within the host. Here, we examine diverse patterns of tick attachment to host skin, blood feeding mechanisms, salivary gland transcriptomes, bioactive molecules in tick saliva, timing of pathogen transmission, and host responses to tick bite. Ticks engage and modulate cutaneous and systemic immune defenses involving keratinocytes, natural killer cells, dendritic cells, T cell subpopulations (Th1, Th2, Th17, Treg , B cells, neutrophils, mast cells, basophils, endothelial cells, cytokines, chemokines, complement, and extracellular matrix. A framework is proposed that integrates tick induced changes of skin immune effectors with their ability to respond to tick-borne pathogens. Implications of these changes are addressed. What are the consequences of tick modulation of host cutaneous defenses? Does diversity of salivary gland transcriptomes determine differential modulation of host inflammation and immune defenses and therefore, in part, the clades of pathogens effectively transmitted by different tick species? Do ticks create an immunologically modified cutaneous environment that enhances specific pathogen establishment? Can tick saliva molecules be used to develop vaccines that block pathogen transmission?

  16. Prevalence of tick-borne pathogens in questing Ixodes ricinus ticks in urban and suburban areas of Switzerland

    Directory of Open Access Journals (Sweden)

    Corinne P. Oechslin

    2017-11-01

    Full Text Available Abstract Background Throughout Europe, Ixodes ricinus transmits numerous pathogens. Its widespread distribution is not limited to rural but also includes urbanized areas. To date, comprehensive data on pathogen carrier rates of I. ricinus ticks in urban areas of Switzerland is lacking. Results Ixodes ricinus ticks sampled at 18 (sub- urban collection sites throughout Switzerland showed carrier rates of 0% for tick-borne encephalitis virus, 18.0% for Borrelia burgdorferi (sensu lato, 2.5% for Borrelia miyamotoi, 13.5% for Rickettsia spp., 1.4% for Anaplasma phagocytophilum, 6.2% for "Candidatus Neoehrlichia mikurensis", and 0.8% for Babesia venatorum (Babesia sp., EU1. Site-specific prevalence at collection sites with n > 45 ticks (n = 9 significantly differed for B. burgdorferi (s.l., Rickettsia spp., and "Ca. N. mikurensis", but were not related to the habitat type. Three hundred fifty eight out of 1078 I. ricinus ticks (33.2% tested positive for at least one pathogen. Thereof, about 20% (71/358 were carrying two or three different potentially disease-causing agents. Using next generation sequencing, we could detect true pathogens, tick symbionts and organisms of environmental or human origin in ten selected samples. Conclusions Our data document the presence of pathogens in the (sub- urban I. ricinus tick population in Switzerland, with carrier rates as high as those in rural regions. Carriage of multiple pathogens was repeatedly observed, demonstrating the risk of acquiring multiple infections as a consequence of a tick bite.

  17. Food and soil-borne Penicillia in Arctic environments: Chemical diversity

    DEFF Research Database (Denmark)

    Frisvad, Jens Christian

    Penicillia are very common inhabitants of cold environments, including arctic soil, plants, animals, and foods. We have investigated the mycobiota of Greenland inland ice and soil, and found a very unique and pronounced diversity among the Penicillia. Nearly all species were new to science....... The species found in inland ice were both of the soil-borne type, and Penicillia that grow and sporulate well at 25°C. The latter group of Penicillia have been found earlier in refrigerated foods, including P. nordicum, and in glacier ice and melting water from Svalbard (se Sonjak et al., this conference......). This “food-borne group” of arctic fungi also contained some new species, but not as many as in arctic soil. The chemical diversity of the Penicillium species was remarkably high and in most cases even larger than the chemical diversity of Penicillia in the tropics. Several new secondary metabolites were...

  18. Vector-borne pathogens in dogs and red foxes from the federal state of Brandenburg, Germany.

    Science.gov (United States)

    Liesner, Jana M; Krücken, Jürgen; Schaper, Roland; Pachnicke, Stefan; Kohn, Barbara; Müller, Elisabeth; Schulze, Christoph; von Samson-Himmelstjerna, Georg

    2016-07-15

    Dirofilaria repens is endemic in eastern and southern European regions but was recently found in Germany in dogs, mosquitoes and one human patient. Since some of the positive dog and mosquito samples were collected in Brandenburg, it was aimed to systematically assess the prevalence of D. repens and other canine vector-borne pathogens in Brandenburg. Dog owners also received a questionnaire and were asked to provide more information about the dogs including travel history. In total, 1023 dog blood samples as well as 195 fox spleen and 179 fox blood samples were collected. DNA was analysed by PCR for the presence of filariae, piroplasms, anaplasmataceae and Rickettsia spp. Filariae were detected in six dogs (0.6%), two were positive for DNA from D. repens, two from Dirofilaria immitis and two from Acanthocheilonema reconditum. One of the D. repens positive dogs originated from an animal shelter in Brandenburg, but the origin of the other one remained unknown. Interestingly, both D. repens ITS-1 sequences showed 100% identity to a D. repens sample obtained from a Japanese woman that travelled in Europe and were 97% identical to a newly proposed species Dirofilaria sp. 'hongkongensis' described from Hong Kong. However, identity to other D. repens sequences from Thailand was considerably lower (81%). Identity of 12S rRNA and cytochrome oxidase I to D. repens samples from southern Europe was 99%. Due to the low number of Dirofilaria spp. positive dogs and since the origin of these was unknown, endemic occurrence of Dirofilaria in Brandenburg could not be confirmed. Anaplasma phagocytophilum was found in 15 dogs (1.5%), Candidatus Neoehrlichia mikurensis in three dogs (0.3%) and E. canis in one dog (0.1%), which was co-infected with D. repens. Rickettsia spp. were detected in 8 dogs (0.8%), seven were Rickettsia raoultii and one was Rickettsia felis. To the author's knowledge, R. raoultii DNA was detected for the first time in dogs in Germany in this study and Candidatus

  19. Emerging horizons for tick-borne pathogens: from the "one pathogen-one disease" vision to the pathobiome paradigm

    Czech Academy of Sciences Publication Activity Database

    Vayssier-Taussat, M.; Kazimírová, M.; Hubálek, Zdeněk; Hornok, S.; Farkas, R.; Cosson, J.-F.; Bonnet, S.; Vourch, G.; Gasqui, P.; Mihalca, A. D.; Plantard, O.; Silaghi, C.; Cutler, S.; Rizzoli, A.

    2015-01-01

    Roč. 10, č. 12 (2015), s. 2033-2043 ISSN 1746-0913 Institutional support: RVO:68081766 Keywords : co-infections * emerging diseases * Ixodes ricinus * new paradigm * next-generation sequencing * pathobiome * unknown pathogens * vector competence * zoonoses Subject RIV: FN - Epidemiology, Contagious Diseases ; Clinical Immunology Impact factor: 3.637, year: 2015

  20. Improving vector-borne pathogen surveillance: A laboratory-based study exploring the potential to detect dengue virus and malaria parasites in mosquito saliva.

    Science.gov (United States)

    Melanson, Vanessa R; Jochim, Ryan; Yarnell, Michael; Ferlez, Karen Bingham; Shashikumar, Soumya; Richardson, Jason H

    2017-01-01

    Vector-borne pathogen surveillance programmes typically rely on the collection of large numbers of potential vectors followed by screening protocols focused on detecting pathogens in the arthropods. These processes are laborious, time consuming, expensive, and require screening of large numbers of samples. To streamline the surveillance process, increase sample throughput, and improve cost-effectiveness, a method to detect dengue virus and malaria parasites (Plasmodium falciparum) by leveraging the sugar-feeding behaviour of mosquitoes and their habit of expectorating infectious agents in their saliva during feeding was investigated in this study. Dengue virus 2 (DENV-2) infected female Aedes aegypti mosquitoes and P. falciparum infected female Anopheles stephensi mosquitoes were allowed to feed on honey coated Flinders Technical Associates -FTA® cards dyed with blue food colouring. The feeding resulted in deposition of saliva containing either DENV-2 particles or P. falciparum sporozoites onto the FTA card. Nucleic acid was extracted from each card and the appropriate real-time PCR (qPCR) assay was run to detect the pathogen of interest. As little as one plaque forming unit (PFU) of DENV-2 and as few as 60 P. falciparum parasites deposited on FTA cards from infected mosquitoes were detected via qPCR. Hence, their use to collect mosquito saliva for pathogen detection is a relevant technique for vector surveillance. This study provides laboratory confirmation that FTA cards can be used to capture and stabilize expectorated DENV-2 particles and P. falciparum sporozoites from infectious, sugar-feeding mosquitoes in very low numbers. Thus, the FTA card-based mosquito saliva capture method offers promise to overcome current limitations and revolutionize traditional mosquito-based pathogen surveillance programmes. Field testing and further method development are required to optimize this strategy.

  1. The β-Defensin Gallinacin-6 Is Expressed in the Chicken Digestive Tract and Has Antimicrobial Activity against Food-Borne Pathogens▿

    Science.gov (United States)

    van Dijk, Albert; Veldhuizen, Edwin J. A.; Kalkhove, Stefanie I. C.; Tjeerdsma-van Bokhoven, Johanna L. M.; Romijn, Roland A.; Haagsman, Henk P.

    2007-01-01

    Food-borne pathogens are responsible for most cases of food poisoning in developed countries and are often associated with poultry products, including chicken. Little is known about the role of β-defensins in the chicken digestive tract and their efficacy. In this study, the expression of chicken β-defensin gallinacin-6 (Gal-6) and its antimicrobial activity against food-borne pathogens were investigated. Reverse transcription-PCR analysis showed high expression of Gal-6 mRNA in the esophagus and crop, moderate expression in the glandular stomach, and low expression throughout the intestinal tract. Putative transcription factor binding sites for nuclear factor kappa beta, activator protein 1, and nuclear factor interleukin-6 were found in the Gal-6 gene upstream region, which suggests a possible inducible nature of the Gal-6 gene. In colony-counting assays, strong bactericidal and fungicidal activity was observed, including bactericidal activity against food-borne pathogens Campylobacter jejuni, Salmonella enterica serovar Typhimurium, Clostridium perfringens, and Escherichia coli. Treatment with 16 μg/ml synthetic Gal-6 resulted in a 3 log unit reduction in Clostridium perfringens survival within 60 min, indicating fast killing kinetics. Transmission electron microscopy examination of synthetic-Gal-6-treated Clostridium perfringens cells showed dose-dependent changes in morphology after 30 min, including intracellular granulation, cytoplasm retraction, irregular septum formation in dividing cells, and cell lysis. The high expression in the proximal digestive tract and broad antimicrobial activity suggest that chicken β-defensin gallinacin-6 plays an important role in chicken innate host defense. PMID:17194828

  2. [Hazardous food-borne fungi and present and future approaches to the mycotoxin regulations in Japan].

    Science.gov (United States)

    Takatori, Kosuke; Aihara, Maki; Sugita-Konishi, Yoshiko

    2006-01-01

    In recent years, various food-related accidents and health scares have dissipated trust in the food industry. Health hazards resulting from food contaminated with fungi is increasing. Food contamination by fungi causes many problems, especially in Japan, which relies on foreign countries for about 60% of its food: the contamination of imported food by fungi and mycotoxins constitutes a serious problem. As the quantity of imported food increases and changes in food distribution have occurred, so too has the number and type of fungi causing food-related damages; osmophilic and thermotolerant fungi, in addition to the mainstream fungi of genera Cladosporium, Pecinillium, and Aspergillus, have become a problem. Although European countries and the U.S. have recently conducted risk assessments for mycotoxins, Japan has not attained an international level in the determination of baseline values. However, in addition to risk management for Aflatoxin M1, Ochratoxin, T-2 toxin/HT-2 toxin, and Fumonisin, determination of baseline values for mycotoxins is beginning in Japan. In this review, we summarize hazardous food-borne fungi, and present and future approaches to the mycotoxin regulations in Japan.

  3. Opportunities for optimization: fate of manure-borne pathogens during anaerobic digestion and solids separation

    Science.gov (United States)

    Anaerobic digestion can inactivate zoonotic pathogens present in cattle manure, which reduces transmission of these pathogens from farms to humans through the environment. However, the variability in extent of inactivation across farms and over time is unknown because most studies have examined pat...

  4. Listeriosis in animals, its public health significance (food-borne zoonosis) and advances in diagnosis and control: a comprehensive review.

    Science.gov (United States)

    Dhama, Kuldeep; Karthik, Kumaragurubaran; Tiwari, Ruchi; Shabbir, Muhammad Zubair; Barbuddhe, Sukhadeo; Malik, Satya Veer Singh; Singh, Raj Kumar

    2015-01-01

    Listeriosis is an infectious and fatal disease of animals, birds, fish, crustaceans and humans. It is an important food-borne zoonosis caused by Listeria monocytogenes, an intracellular pathogen with unique potential to spread from cell to cell, thereby crossing blood-brain, intestinal and placental barriers. The organism possesses a pile of virulence factors that help to infect the host and evade from host immune machinery. Though disease occurrence is sporadic throughout the world, it can result in severe damage during an outbreak. Listeriosis is characterized by septicaemia, encephalitis, meningitis, meningoencephalitis, abortion, stillbirth, perinatal infections and gastroenteritis with the incubation period varying with the form of infection. L. monocytogenes has been isolated worldwide from humans, animals, poultry, environmental sources like soil, river, decaying plants, and food sources like milk, meat and their products, seafood and vegetables. Since appropriate vaccines are not available and infection is mainly transmitted through foods in humans and animals, hygienic practices can prevent its spread. The present review describes etiology, epidemiology, transmission, clinical signs, post-mortem lesions, pathogenesis, public health significance, and advances in diagnosis, vaccines and treatment of this disease. Special attention has been given to novel as well as prospective emerging therapies that include bacteriophage and cytokine therapy, avian egg yolk antibodies and herbal therapy. Various vaccines, including advances in recombinant and DNA vaccines and their modes of eliciting immune response, are also discussed. Due focus has also been given regarding appropriate prevention and control strategies to be adapted for better management of this zoonotic disease.

  5. Incidence of Cercopithifilaria bainae in dogs and probability of co-infection with other tick-borne pathogens.

    Directory of Open Access Journals (Sweden)

    Rafael Antonio Nascimento Ramos

    Full Text Available BACKGROUND: Cercopithifilaria bainae is a filarioid parasite that infects dogs, being transmitted by Rhipicephalus sanguineus group ticks in many countries of the Mediterranean basin. This study assessed the incidence density rate (IDR of infection by C. bainae in dogs and the probability of co-infection with other tick-borne pathogens (i.e., Anaplasma platys, Babesia vogeli and Hepatozoon canis, in an area of high endemicity in southern Italy. METHODOLOGY/PRINCIPAL FINDINGS: From March 2011 to October 2012, a field study involving 58 young dogs naturally exposed to tick infestation was conducted. Skin and blood samples obtained from each dog six times during an 18-month period were tested for C. bainae by parasite detection within skin snip sediments, with subsequent confirmation through PCR and DNA sequencing. Dogs examined monthly for ticks and A. platys, B. vogeli and H. canis were microscopically and/or molecularly diagnosed and after the first and the second summer seasons, the IDR for positive animal-month at risk was 3.8% and 1.7% in November 2011 and October 2012, respectively. All 58 C. bainae-infected dogs were simultaneously infected with at least one other tick-borne pathogen. After the first summer season (assessment in November 2011, a C. bainae-infected dog had a 33% probability of being infected with H. canis or A. platys, whereas after the second tick season (assessment in October 2012 the probability of co-infection was 78%, 22% and 11% for H. canis, A. platys and B. vogeli, respectively. CONCLUSIONS: Our data indicate that tick-infested dogs are at risk of acquiring infection by C. bainae. In addition, the detection of C. bainae microfilariae indicates a prior tick exposure and, should stimulate testing for other tick-borne disease causing pathogens.

  6. Fibrinolysis and proliferative endarteritis: two related processes in chronic infections? The model of the blood-borne pathogen Dirofilaria immitis.

    Directory of Open Access Journals (Sweden)

    Javier González-Miguel

    Full Text Available The interaction between blood-borne pathogens and fibrinolysis is one of the most important mechanisms that mediate invasion and the establishment of infectious agents in their hosts. However, overproduction of plasmin (final product of the route has been related in other contexts to proliferation and migration of the arterial wall cells and degradation of the extracellular matrix. We have recently identified fibrinolysis-activating antigens from Dirofilaria immitis, a blood-borne parasite whose key pathological event (proliferative endarteritis is produced by similar mechanisms to those indicated above. The objective of this work is to study how two of this antigens [actin (ACT and fructose-bisphosphate aldolase (FBAL] highly conserved in pathogens, activate fibrinolysis and to establish a relationship between this activation and the development of proliferative endarteritis during cardiopulmonary dirofilariasis. We demonstrate that both proteins bind plasminogen, enhance plasmin generation, stimulate the expression of the fibrinolytic activators tPA and uPA in endothelial cell cultures and are located on the surface of the worm in contact with the host's blood. ELISA, western blot and immunofluorescence techniques were employed for this purpose. Additionally, the implication of lysine residues in this interaction was analyzed by bioinformatics. The involvement of plasmin generated by the ACT/FBAL and plasminogen binding in cell proliferation and migration, and degradation of the extracellular matrix were shown in an "in vitro" model of endothelial and smooth muscle cells in culture. The obtained results indicate that ACT and FBAL from D. immitis activate fibrinolysis, which could be used by the parasite like a survival mechanism to avoid the clot formation. However, long-term overproduction of plasmin can trigger pathological events similar to those described in the emergence of proliferative endarteritis. Due to the high degree of

  7. Nanosulfur: A Potent Fungicide Against Food Pathogen, Aspergillus niger

    International Nuclear Information System (INIS)

    Choudhury, Samrat Roy; Goswami, Arunava; Nair, Kishore K.; Kumar, Rajesh; Gopal, Madhuban; Devakumar, C.; Gogoi, Robin; Srivastava, Chitra; Subhramanyam, B. S.

    2010-01-01

    Elemental sulfur (S 0 ), man's oldest eco-friendly fungicide for curing fungal infections in plants and animals, is registered in India as a non-systemic and contact fungicide. However due to its high volume requirement, Indian agrochemical industry and farmers could not effectively use this product till date. We hypothesize that intelligent nanoscience applications might increase the visibility of nanosulfur in Indian agriculture as a potent and eco-safe fungicide. Sulfur nanoparticles (NPs) were synthesized bottom-up via a liquid synthesis method with average particle size in the range of 50-80 nm and the shapes of the NPs were spherical. A comparative study of elemental and nano-sulfur produced has been tested against facultative fungal food pathogen, Aspergillus niger. Results showed that nanosulfur is more efficacious than its elemental form.

  8. Nanosulfur: A Potent Fungicide Against Food Pathogen, Aspergillus niger

    Science.gov (United States)

    Choudhury, Samrat Roy; Nair, Kishore K.; Kumar, Rajesh; Gogoi, Robin; Srivastava, Chitra; Gopal, Madhuban; Subhramanyam, B. S.; devakumar, C.; Goswami, Arunava

    2010-10-01

    Elemental sulfur (S0), man's oldest eco-friendly fungicide for curing fungal infections in plants and animals, is registered in India as a non-systemic and contact fungicide. However due to its high volume requirement, Indian agrochemical industry and farmers could not effectively use this product till date. We hypothesize that intelligent nanoscience applications might increase the visibility of nanosulfur in Indian agriculture as a potent and eco-safe fungicide. Sulfur nanoparticles (NPs) were synthesized bottom-up via a liquid synthesis method with average particle size in the range of 50-80 nm and the shapes of the NPs were spherical. A comparative study of elemental and nano-sulfur produced has been tested against facultative fungal food pathogen, Aspergillus niger. Results showed that nanosulfur is more efficacious than its elemental form.

  9. Pathogenicity of two seed-borne fungi commonly involved in maize ...

    African Journals Online (AJOL)

    Nazar Hussain

    2013-03-20

    Mar 20, 2013 ... pathogenicity on seeds and 6.55% on seedlings, whilst Aspergillus niger had 62.87% .... Nigrospora oryzae .... PDA culture in test tubes slants; (b) Fusarium moniliforme PDA culture in test tubes slants; (c) Mycoflora culture of.

  10. Interplay between parasitism and host ontogenic resistance in the epidemiology of the soil-borne plant pathogen Rhizoctonia solani.

    Directory of Open Access Journals (Sweden)

    Thomas E Simon

    Full Text Available Spread of soil-borne fungal plant pathogens is mainly driven by the amount of resources the pathogen is able to capture and exploit should it behave either as a saprotroph or a parasite. Despite their importance in understanding the fungal spread in agricultural ecosystems, experimental data related to exploitation of infected host plants by the pathogen remain scarce. Using Rhizoctonia solani / Raphanus sativus as a model pathosystem, we have obtained evidence on the link between ontogenic resistance of a tuberizing host and (i its susceptibility to the pathogen and (ii after infection, the ability of the fungus to spread in soil. Based on a highly replicable experimental system, we first show that infection success strongly depends on the host phenological stage. The nature of the disease symptoms abruptly changes depending on whether infection occurred before or after host tuberization, switching from damping-off to necrosis respectively. Our investigations also demonstrate that fungal spread in soil still depends on the host phenological stage at the moment of infection. High, medium, or low spread occurred when infection was respectively before, during, or after the tuberization process. Implications for crop protection are discussed.

  11. Food-borne disease and climate change in the United Kingdom.

    Science.gov (United States)

    Lake, Iain R

    2017-12-05

    This review examined the likely impact of climate change upon food-borne disease in the UK using Campylobacter and Salmonella as example organisms. Campylobacter is an important food-borne disease and an increasing public health threat. There is a reasonable evidence base that the environment and weather play a role in its transmission to humans. However, uncertainty as to the precise mechanisms through which weather affects disease, make it difficult to assess the likely impact of climate change. There are strong positive associations between Salmonella cases and ambient temperature, and a clear understanding of the mechanisms behind this. However, because the incidence of Salmonella disease is declining in the UK, any climate change increases are likely to be small. For both Salmonella and Campylobacter the disease incidence is greatest in older adults and young children. There are many pathways through which climate change may affect food but only a few of these have been rigorously examined. This provides a high degree of uncertainty as to what the impacts of climate change will be. Food is highly controlled at the National and EU level. This provides the UK with resilience to climate change as well as potential to adapt to its consequences but it is unknown whether these are sufficient in the context of a changing climate.

  12. Minimum bactericidal concentration of phenols extracted from oil vegetation water on spoilers, starters and food-borne bacteria

    Directory of Open Access Journals (Sweden)

    Luca Fasolato

    2015-05-01

    Full Text Available The aim of the study was to assess the in vitro effect of phenols extracted from oil vegetation water (PEOW on several food-borne strains. Antibacterial activity of PEOW was based on the minimum bactericidal concentration (MBC on microtitre assay. The taxa tested were: Staphylococcus (n. 5, Listeria (n. 4, Escherichia (n. 2, Salmonella (n. 1, Pseudomonas (n. 3, Lactobacillus (n. 2 and Pediococcus (n. 1. S. aureus and L. monocytogens showed the lowest level of resistance to PEOW (MBC=1.5-3 mg/mL. In contrast, the Gram negative strains (e.g. S. Typhimurium and Pseudomonas spp. were in some cases unaffected by the tested doses and the MBCs ranged between 6 to 12 mg/mL. Starter cultures were dramatically reduced on growth (e.g. Staphylococcus xylosus; 0.75 mg/mL MBC. The thresholds for pathogenic strains could be considered for further applications of PEOW in food models (e.g. shelf life or challenge test studies.

  13. Epidemiology and morbidity of food-borne trematodiasis in Lao People's Democratic Republic with particular consideration to opisthorchiasis

    OpenAIRE

    Sayasone, Somphou

    2009-01-01

    Food-borne trematodes, parasitizing the liver, lung and intestinal tract of humans, are an emerging public health problem in countries of tropical regions. Today, an estimated 40 million people are infected worldwide. More than half of those occur in Asia, particularly in Southeast Asian countries. Infection with food-borne trematode is associated with divers and severe morbidity, i.e. a long-lasting infection with Opisthorchis viverrini gives rise to liver fibrosis, cholecysti...

  14. Microbial safety of foods

    International Nuclear Information System (INIS)

    Bandekar, J.R.

    2013-01-01

    Despite advances in hygiene, consumer knowledge and food treatment and processing, food-borne diseases have become one of the most widespread public health problems in the world to-day. About two thirds of all outbreaks are traced to microbial contaminated food - one of the most hazardous being Clostridium botulinum, E. coli 0157: H7 and Salmonella. The pathogens can be introduced in the food products anywhere in the food chain and hence it is of prime important to have microbial vigilance in the entire food chain. WHO estimates that food-borne and water-borne diarrhoeal diseases taken together kill about 2.2 million people annually. The infants, children, elderly and immune-compromised people are particularly susceptible to food-borne diseases. Unsafe food causes many acute and life-long diseases, ranging from diarrhoeal diseases to various forms of cancer. A number of factors such as emergence of new food-borne pathogens, development of drug resistance in the pathogens, changing life style, global trade of food etc. are responsible for the continued persistence of food-borne diseases. Due to consumer demand, a number of Ready-To-Eat (RTE) minimally processed foods are increasingly marketed. However, there is increased risk of food-borne diseases with these products. The food-borne disease outbreaks due to E. coli O157:H7, Listeria monocytogenes, Salmonella and Campylobacter are responsible for recall of many foods resulting in heavy losses to food industry. The development of multi drug resistant pathogens due to indiscriminate use of antibiotics is also a major problem. Food Technology Division of Bhabha Atomic Research Centre has been working on food-borne bacterial pathogens particularly Salmonella, Campylobacter, Vibrio and Aeromonas species, their prevalence in export quality seafood as well in foods sold in retail market such as poultry, fish, sprouts and salads. These pathogens from Indian foods have been characterized for the presence of virulence genes

  15. Molecular markers for improving control of soil-borne pathogen Fusarium oxysporum in sugar beet

    Science.gov (United States)

    Fusarium oxysporum f. sp. betae (FOB) is an important pathogen of sugar beet worldwide causing leaf yellowing and vascular discoloration. The use of tolerant varieties is one of the most effective methods for managing this disease. In this study, a large germplasm collection,comprised of 29 sugar be...

  16. DNA based methods used for characterization and detection of food ...

    African Journals Online (AJOL)

    Detection of food borne pathogen is of outmost importance in the food industries and related agencies. For the last few decades conventional methods were used to detect food borne pathogens based on phenotypic characters. At the advent of complementary base pairing and amplification of DNA, the diagnosis of food ...

  17. Ticks and tick-borne pathogens and putative symbionts of black bears (Ursus americanus floridanus) from Georgia and Florida.

    Science.gov (United States)

    Yabsley, Michael J; Nims, Todd N; Savage, Mason Y; Durden, Lance A

    2009-10-01

    Ticks were collected from 38 black bears (Ursus americanus floridanus) from northwestern Florida (n = 18) from 2003 to 2005 and southern Georgia (n = 20) in 2006. Five species (Amblyomma americanum, A. maculatum, Dermacentor variabilis, Ixodes scapularis, and I. affinis) were collected from Florida bears, and 4 species (A. americanum, A. maculatum, D. variabilis, I. scapularis) were collected from bears in Georgia. Ixodes scapularis was the most frequently collected tick, followed by D. variabilis, A. americanum, A. maculatum, and I. affinis. The collection of I. affinis from a Florida bear represents a new host record. A subset of ticks was screened for pathogens and putative symbionts by polymerase chain reaction (PCR). The zoonotic tick-borne pathogens Ehrlichia chaffeensis and Rickettsia parkeri were detected in 1 of 23 (4.3%) A. americanum and 1 of 12 (8.3%) A. maculatum, respectively. The putative zoonotic pathogen "Rickettsia amblyommii" was detected in 4 (17.4%) A. americanum and 1 (8.3%) A. maculatum. Other putative symbiotic rickettsiae detected included R. bellii and R. montanensis in D. variabilis, a Rickettsia cooleyi-like sp. and Rickettsia sp. Is-1 in I. scapularis, and Rickettsia TR39-like sp. in I. scapularis and A. americanum. All ticks were PCR-negative for Anaplasma phagocytophilum, Panola Mountain Ehrlichia sp., E. ewingii, Francisella tularensis, and Borrelia spp.

  18. Cost-of-illness and disease burden of food-related pathogens in the Netherlands, 2011

    NARCIS (Netherlands)

    Mangen, Marie Josée J; Bouwknegt, Martijn; Friesema, Ingrid H M; Haagsma, Juanita A.; Kortbeek, Laetitia M.; Tariq, Luqman; Wilson, Margaret; van Pelt, Wilfrid; Havelaar, Arie H.|info:eu-repo/dai/nl/072306122

    2015-01-01

    To inform risk management decisions on control and prevention of food-related disease, both the disease burden expressed in Disability Adjusted Life Years (DALY) and the cost-of-illness of food-related pathogens are estimated and presented. Disease burden of fourteen pathogens that can be

  19. Cytotoxic and genotoxic potential of food-borne nitriles in a liver in vitro model

    Science.gov (United States)

    Kupke, Franziska; Herz, Corinna; Hanschen, Franziska S.; Platz, Stefanie; Odongo, Grace A.; Helmig, Simone; Bartolomé Rodríguez, María M.; Schreiner, Monika; Rohn, Sascha; Lamy, Evelyn

    2016-01-01

    Isothiocyanates are the most intensively studied breakdown products of glucosinolates from Brassica plants and well recognized for their pleiotropic effects against cancer but also for their genotoxic potential. However, knowledge about the bioactivity of glucosinolate-borne nitriles in foods is very poor. As determined by GC-MS, broccoli glucosinolates mainly degrade to nitriles as breakdown products. The cytotoxicity of nitriles in human HepG2 cells and primary murine hepatocytes was marginal as compared to isothiocyanates. Toxicity of nitriles was not enhanced in CYP2E1-overexpressing HepG2 cells. In contrast, the genotoxic potential of nitriles was found to be comparable to isothiocyanates. DNA damage was persistent over a certain time period and CYP2E1-overexpression further increased the genotoxic potential of the nitriles. Based on actual in vitro data, no indications are given that food-borne nitriles could be relevant for cancer prevention, but could pose a certain genotoxic risk under conditions relevant for food consumption. PMID:27883018

  20. Adhesion of food-borne bacteria to stainless steel is reduced by food conditioning films

    DEFF Research Database (Denmark)

    Bernbom, Nete; Ng, Yin; Jorgensen, R.L.

    2009-01-01

    of proteins with similar molecular weight based in sodium dodecyl sulfate-polyacrylamide gel electrophoresis, in several extracts that reduced adhesion but also extracts not containing this protein reduced bacterial adhesion, indicating that several molecular species may be involved in the phenomenon....... It is a common perception that food materials facilitate bacterial adhesion to surfaces; however, this study demonstrates that aqueous coatings of food origin may actually reduce bacterial adhesion. Compounds from food extracts may potentially be used as nontoxic coatings to reduce bacterial attachment to inert...

  1. Antibacterial Activity of Lactic Acid Bacteria Isolated from Gastrointestinal Tract of “Ayam Kampung” Chicken Against Food Pathogens

    Science.gov (United States)

    Nur Jannah, Siti; Rini Saraswati, Tyas; Handayani, Dwi; Pujiyanto, Sri

    2018-05-01

    Food borne disease results from ingestion of water and wide variety of food contaminated with pathogenic organisms. The main causes of food borne diseases are bacteria, such as Escherichia coli and Staphylococcus aureus. The objective of this study was to determine antimicrobial activity of lactic acid bacteria (LAB) isolated from local chicken gastrointestinal tract with an emphasis on their probiotic properties. The colonies of bacteria that producing clear zone on MRSA plus 0.5% CaCO3, Gram-positive and catalase-negative were isolated as lactic acid bacteria. Some of the strains (10 isolates) were tested for their ability to inhibit growth of Escherichia coli and Staphylococcus aureus, and for acid pH and bile salt tolerance. The results showed that the all selected isolates producing antimicrobial compounds inhibits the growth of Escherichia coli and Staphylococcus aureus, both in the supernatant and supernatant plus 2M NaOH, and still growing in medium condition with pH 2.0 and 0.1% bile salt. It revealing the potential use of the lactic acid bacteria from chicken gastrointestinal tract for probiotics in food.

  2. Temporal and spatial scaling of the genetic structure of a vector-borne plant pathogen.

    Science.gov (United States)

    Coletta-Filho, Helvécio D; Francisco, Carolina S; Almeida, Rodrigo P P

    2014-02-01

    The ecology of plant pathogens of perennial crops is affected by the long-lived nature of their immobile hosts. In addition, changes to the genetic structure of pathogen populations may affect disease epidemiology and management practices; examples include local adaptation of more fit genotypes or introduction of novel genotypes from geographically distant areas via human movement of infected plant material or insect vectors. We studied the genetic structure of Xylella fastidiosa populations causing disease in sweet orange plants in Brazil at multiple scales using fast-evolving molecular markers (simple-sequence DNA repeats). Results show that populations of X. fastidiosa were regionally isolated, and that isolation was maintained for populations analyzed a decade apart from each other. However, despite such geographic isolation, local populations present in year 2000 were largely replaced by novel genotypes in 2009 but not as a result of migration. At a smaller spatial scale (individual trees), results suggest that isolates within plants originated from a shared common ancestor. In summary, new insights on the ecology of this economically important plant pathogen were obtained by sampling populations at different spatial scales and two different time points.

  3. A European network for food-borne parasites (Euro-FBP: meeting report on ‘Analytical methods for food-borne parasites in human and veterinary diagnostics and in food matrices’

    Directory of Open Access Journals (Sweden)

    Christian Klotz

    2017-11-01

    Full Text Available Abstract Food-borne parasites (FBPs are a neglected topic in food safety, partly due to a lack of awareness of their importance for public health, especially as symptoms tend not to develop immediately after exposure. In addition, methodological difficulties with both diagnosis in infected patients and detection in food matrices result in under-detection and therefore the potential for underestimation of their burden on our societies. This, in consequence, leads to lower prioritization for basic research, e.g. for development new and more advanced detection methods for different food matrices and diagnostic samples, and thus a vicious circle of neglect and lack of progress is propagated. The COST Action FA1408, A European Network for Foodborne Parasites (Euro-FBP aims to combat the impact of FBP on public health by facilitating the multidisciplinary cooperation and partnership between groups of researchers and between researchers and stakeholders. The COST Action TD1302, the European Network for cysticercosis/taeniosis, CYSTINET, has a specific focus on Taenia solium and T. saginata, two neglected FBPs, and aims to advance knowledge and understanding of these zoonotic disease complexes via collaborations in a multidisciplinary scientific network. This report summarizes the results of a meeting within the Euro-FBP consortium entitled ‘Analytical methods for food-borne parasites in human and veterinary diagnostics and in food matrices’ and of the joined Euro-FBP and CYSTINET meeting.

  4. Food-borne zoonoses, the EU zoonosis legislation and the prospects for food safety and consumer protection during primary animal production.

    Science.gov (United States)

    Smulders, Frans J M; Vågsholm, Ivar; Korkeala, Hannu

    2008-01-01

    Zoonoses are diseases that are transmitted naturally between animals and humans. The control of food-borne zoonoses within the European Union is a prerequisite for assuring a functional internal market and consequently represents an important item on the political agenda. Unfortunately, until recently, gaining a clear view of the current incidence of food-borne zoonoses and the prevalence of its causative agents has been frustrated by the absence of reliable monitoring and reporting systems. Similarly, it has become clear that, Europe wide, one has witnessed only limited success with regard to the control of important food-borne agents such as Salmonella spp. The European Union has adopted legislation to remedy this situation and to control food-borne zoonoses in primary production. This contribution discusses the incentives for introducing EU Directive 2003/99/EC and EU Regulation No. 2160/2003, summarises their essentials and discusses major ramifications of both pieces of legislation for the prevention of food-borne zoonoses. It is concluded that there is reason for cautious optimism concerning human salmonellosis, while for other food-borne zoonoses there should be a call for action.

  5. Survey of ticks (Acari: Ixodidae) and tick-borne pathogens in North Dakota.

    Science.gov (United States)

    Russart, Nathan M; Dougherty, Michael W; Vaughan, Jefferson A

    2014-09-01

    Ticks were sampled at nine locations throughout North Dakota during early summer of 2010, using flagging techniques and small mammals trapping. In total, 1,762 ticks were collected from eight of the nine locations. The dominant species were Dermacentor variabilis (Say) (82%), found throughout the state, and Ixodes scapularis Say (17%), found in northeastern counties. A few nymphal and adult I. scapularis tested positive for Borrelia burgdorferi (3%) and Anaplasma phagocytophilum (8%). This is the first report of I. scapularis and associated pathogens occurring in North Dakota and provides evidence for continued westward expansion of this important vector tick species in the United States.

  6. Monitoring of Soil-Borne Pathogens in the Agricultural Soils of the Pestrechinsky District (Tatarstan, Russia)

    Science.gov (United States)

    Dzhabarova, K. O.; Kuryntseva, P. A.; Galitskaya, P. Y.; Selivanovskaya, S. Y.

    2018-01-01

    A recent agricultural trend is aimed to develop organic farming technologies. Organic farming means no mineral fertilizers, pesticides, antibiotics and other chemical substances not characteristic of natural conditions should be used in farm production. When choosing the regions, where this technology can be successfully realized, it is important to evaluate not only the physical and chemical qualities of soils, but also the degree of their infestation with phytopathogens. The Pestrechinsky District of the Republic of Tatarstan, where transfer to organic farming is being planned, was chosen as such a region. Agricultural lands were marked at the map of the administrative region, 100 sampling site were generated using GIS Technologies. It was found out that soil microbial community was characterized by a typical ratio and count of yeast fungi (3.4·105 - 1.6·106 CFU•g-1), mold fungi (1.0·101 - 1.7·105 CFU·g-1) and bacteria (1.6·106 - 3.1·107 CFU·g-1). In all the selected soil samples plant pathogenic fungi of the Fusarium genus were found (26 to 250 CFU·g-1), and as for another genus of plant pathogenic fungi, Alternaria, their count was rather low (0 to 9 CFU·g-1, herewith in 46 samples out of 100 they were absent.

  7. Pathogenic psychrotolerant sporeformers: an emerging challenge for low-temperature storage of minimally processed foods.

    Science.gov (United States)

    Markland, Sarah M; Farkas, Daniel F; Kniel, Kalmia E; Hoover, Dallas G

    2013-05-01

    Sporeforming bacteria are a significant problem in the food industry as they are ubiquitous in nature and capable of resisting inactivation by heat and chemical treatments designed to inactivate them. Beyond spoilage issues, psychrotolerant sporeformers are becoming increasingly recognized as a potential hazard given the ever-expanding demand for refrigerated processed foods with extended shelf-life. In these products, the sporeforming pathogens of concern are Bacillus cereus, Bacillus weihenstephanensis, and Clostridium botulinum type E. This review article examines the foods, conditions, and organisms responsible for the food safety issue caused by the germination and outgrowth of psychrotolerant sporeforming pathogens in minimally processed refrigerated foods.

  8. Evaluation of methyl bromide alternatives efficacy against soil-borne pathogens, nematodes and soil microbial community.

    Directory of Open Access Journals (Sweden)

    Hongwei Xie

    Full Text Available Methyl bromide (MB and other alternatives were evaluated for suppression of Fusarium spp., Phytophthora spp., and Meloidogyne spp. and their influence on soil microbial communities. Both Fusarium spp. and Phytophthora spp. were significantly reduced by the MB (30.74 mg kg-1, methyl iodide (MI: 45.58 mg kg-1, metham sodium (MS: 53.92 mg kg-1 treatments. MS exhibited comparable effectiveness to MB in controlling Meloidogyne spp. and total nematodes, followed by MI at the tested rate. By contrast, sulfuryl fluoride (SF: 33.04 mg kg-1 and chloroform (CF: 23.68 mg kg-1 showed low efficacy in controlling Fusarium spp., Phytophthora spp., and Meloidogyne spp. MB, MI and MS significantly lowered the abundance of different microbial populations and microbial biomass in soil, whereas SF and CF had limited influence on them compared with the control. Diversity indices in Biolog studies decreased in response to fumigation, but no significant difference was found among treatments in PLFA studies. Principal component and cluster analyses of Biolog and PLFA data sets revealed that MB and MI treatments greatly influenced the soil microbial community functional and structural diversity compared with SF treatment. These results suggest that fumigants with high effectiveness in suppressing soil-borne disease could significantly influence soil microbial community.

  9. Granulin Secreted by the Food-Borne Liver Fluke Opisthorchis viverrini Promotes Angiogenesis in Human Endothelial Cells

    Directory of Open Access Journals (Sweden)

    Brandon Haugen

    2018-02-01

    Full Text Available The liver fluke Opisthorchis viverrini is a food-borne, zoonotic pathogen endemic to Thailand and adjacent countries in Southeast Asia. The adult developmental stage of the O. viverrini parasite excretes and secretes numerous proteins within the biliary tract including the gall bladder. Lesions caused by the feeding activities of the liver fluke represent wounds that undergo protracted cycles of healing and re-injury during chronic infection, which can last for decades. Components of the excretory/secretory (ES complement released by the worms capably drive proliferation of bile duct epithelial cells and are implicated in establishing the oncogenic milieu that leads to bile duct cancer, cholangiocarcinoma. An ES protein, the secreted granulin-like growth factor termed Ov-GRN-1, accelerates wound resolution in mice and in vitro. To investigate angiogenesis (blood vessel development that may contribute to wound healing promoted by liver fluke granulin and, by implication, to carcinogenesis during chronic opisthorchiasis, we employed an in vitro tubule formation assay (TFA where human umbilical vein endothelial cells were grown on gelled basement matrix. Ten and 40 nM Ov-GRN-1 significantly stimulated angiogenesis as monitored by cellular proliferation and by TFA in real time. This demonstration of potent angiogenic property of Ov-GRN-1 bolsters earlier reports on the therapeutic potential for chronic non-healing wounds of diabetics, tobacco users, and the elderly and, in addition, showcases another of the hallmark of cancer characteristic of this carcinogenic liver fluke.

  10. Antibacterial activity of sphagnum acid and other phenolic compounds found in Sphagnum papillosum against food-borne bacteria.

    Science.gov (United States)

    Mellegård, H; Stalheim, T; Hormazabal, V; Granum, P E; Hardy, S P

    2009-07-01

    To identify the phenolic compounds in the leaves of Sphagnum papillosum and examine their antibacterial activity at pH appropriate for the undissociated forms. Bacterial counts of overnight cultures showed that whilst growth of Staphylococcus aureus 50084 was impaired in the presence of milled leaves, the phenol-free fraction of holocellulose of S. papillosum had no bacteriostatic effect. Liquid chromatography-mass spectrometry analysis of an acetone-methanol extract of the leaves detected eight phenolic compounds. Antibacterial activity of the four dominating phenols specific to Sphagnum leaves, when assessed in vitro as minimal inhibitory concentrations (MICs), were generally >2.5 mg ml(-1). MIC values of the Sphagnum-specific compound 'sphagnum acid' [p-hydroxy-beta-(carboxymethyl)-cinnamic acid] were >5 mg ml(-1). No synergistic or antagonistic effects of the four dominating phenols were detected in plate assays. Sphagnum-derived phenolics exhibit antibacterial activity in vitro only at concentrations far in excess of those found in the leaves. We have both identified the phenolic compounds in S. papillosum and assessed their antibacterial activity. Our data indicate that phenolic compounds in isolation are not potent antibacterial agents and we question their potency against food-borne pathogens.

  11. Antimicrobial Activity of Kefir against Various Food Pathogens and Spoilage Bacteria.

    Science.gov (United States)

    Kim, Dong-Hyeon; Jeong, Dana; Kim, Hyunsook; Kang, Il-Byeong; Chon, Jung-Whan; Song, Kwang-Young; Seo, Kun-Ho

    2016-01-01

    Kefir is a unique fermented dairy product produced by a mixture of lactic acid bacteria, acetic acid bacteria, and yeast. Here, we compared the antimicrobial spectra of four types of kefirs (A, L, M, and S) fermented for 24, 36, 48, or 72 h against eight food-borne pathogens. Bacillus cereus , Staphylococcus aureus , Listeria monocytogenes , Enterococcus faecalis , Escherichia coli , Salmonella Enteritidis , Pseudomonas aeruginosa , and Cronobacter sakazakii were used as test strains, and antibacterial activity was investigated by the spot on lawn method. The spectra, potencies, and onsets of activity varied according to the type of kefir and the fermentation time. The broadest and strongest antimicrobial spectrum was obtained after at least 36-48 h of fermentation for all kefirs, although the traditional fermentation method of kefir is for 18-24 h at 25℃. For kefir A, B. cereus , E. coli , S . Enteritidis, P. aeruginosa , and C. sakazakii were inhibited, while B. cereus , S. aureus , E. coli , S . Enteritidis, P. aeruginosa , and C. sakazakii were inhibited to different extents by kefirs L, M, and S. Remarkably, S. aureus , S . Enteritidis, and C. sakazakii were only inhibited by kefirs L, M, and S, and L. monocytogenes by kefir M after fermentation for specific times, suggesting that the antimicrobial activity is attributable not only to a low pH but also to antimicrobial substances secreted during the fermentation.

  12. Determination of histamine in milkfish stick implicated in food-borne poisoning

    Directory of Open Access Journals (Sweden)

    Yi-Chen Lee

    2016-01-01

    Full Text Available An incident of food-borne poisoning causing illness in 37 victims due to ingestion of fried fish sticks occurred in September 2014, in Tainan city, southern Taiwan. Leftovers of the victims' fried fish sticks and 16 other raw fish stick samples from retail stores were collected and tested to determine the occurrence of histamine and histamine-forming bacteria. Two suspected fried fish samples contained 86.6 mg/100 g and 235.0 mg/100 g histamine; levels that are greater than the potential hazard action level (50 mg/100 g in most illness cases. Given the allergy-like symptoms of the victims and the high histamine content in the suspected fried fish samples, this food-borne poisoning was strongly suspected to be caused by histamine intoxication. Moreover, the fish species of suspected samples was identified as milkfish (Chanos chanos, using polymerase chain reaction direct sequence analysis. In addition, four of the 16 commercial raw milkfish stick samples (25% had histamine levels greater than the US Food & Drug Administration guideline of 5.0 mg/100 g for scombroid fish and/or products. Ten histamine-producing bacterial strains, capable of producing 373–1261 ppm of histamine in trypticase soy broth supplemented with 1.0% L-histidine, were identified as Enterobacter aerogenes (4 strains, Enterobacter cloacae (1 strain, Morganella morganii (2 strains, Serratia marcescens (1 strain, Hafnia alvei (1 strain, and Raoultella orithinolytica (1 strain, by 16S ribosomal DNA sequencing with polymerase chain reaction amplification.

  13. Study in vitro of origin radioprotective food the radioprotective effect in vitro of food borne; Estudio in vitro de radioprotectores de origen alimentario

    Energy Technology Data Exchange (ETDEWEB)

    Soraino, J. M.; Sebastia, N.; Almonacid, M.; Alonso, O.; Cervera, J.; Such, E.; Silla, M. A.; Villaescusa, J. I.; Montoro, A.

    2012-07-01

    Study in vitro of origin radioprotective food the radioprotective effect in vitro of food borne substances studied is a first step in developing effective radioprotectors that can prevent radiation damage to healthy tissue., cannot forget that these studies must be accompanied by in vitro studies of toxicity and bioavailability to profile designing radioprotective substance.

  14. Anaerobic digestion in mesophilic and room temperature conditions: Digestion performance and soil-borne pathogen survival.

    Science.gov (United States)

    Chen, Le; Jian, Shanshan; Bi, Jinhua; Li, Yunlong; Chang, Zhizhou; He, Jian; Ye, Xiaomei

    2016-05-01

    Tomato plant waste (TPW) was used as the feedstock of a batch anaerobic reactor to evaluate the effect of anaerobic digestion on Ralstonia solanacearum and Phytophthora capsici survival. Batch experiments were carried out for TS (total solid) concentrations of 2%, 4% and 6% respectively, at mesophilic (37±1°C) and room (20-25°C) temperatures. Results showed that higher digestion performance was achieved under mesophilic digestion temperature and lower TS concentration conditions. The biogas production ranged from 71 to 416L/kg VS (volatile solids). The inactivation of anaerobic digestion tended to increase as digestion performance improved. The maximum log copies reduction of R. solanacearum and P. capsici detected by quantitative PCR (polymerase chain reaction) were 3.80 and 4.08 respectively in reactors with 4% TS concentration at mesophilic temperatures. However, both in mesophilic and room temperature conditions, the lowest reduction of R. solanacearum was found in the reactors with 6% TS concentration, which possessed the highest VFA (volatile fatty acid) concentration. These findings indicated that simple accumulation of VFAs failed to restrain R. solanacearum effectively, although the VFAs were considered poisonous. P. capsici was nearly completely dead under all conditions. Based on the digestion performance and the pathogen survival rate, a model was established to evaluate the digestate biosafety. Copyright © 2015. Published by Elsevier B.V.

  15. Detection of foodborne pathogens by qPCR: A practical approach for food industry applications

    Directory of Open Access Journals (Sweden)

    María-José Chapela

    2015-12-01

    Full Text Available Microbiological analysis of food is an integrated part of microbial safety management in the food chain. Monitoring and controlling foodborne pathogens are traditionally carried out by conventional microbiological methods based on culture-dependent approaches in control laboratories and private companies. However, polymerase chain reaction (PCR has revolutionized microbiological analysis allowing detection of pathogenic microorganisms in food, without the necessity of classical isolation and identification. However, at present, PCR and quantitative polymerase chain reaction (qPCR are essential analytical tools for researchers working in the field of foodborne pathogens. This manuscript reviews recently described qPCR methods applied for foodborne bacteria detection, serving as economical, safe, and reliable alternatives for application in the food industry and control laboratories. Multiplex qPCR, which allows the simultaneous detection of more than one pathogen in one single reaction, saving considerable effort, time, and money, is emphasized in the article.

  16. Control of food-borne molds by combination of heat and radiation

    International Nuclear Information System (INIS)

    Padwal-Desai, S.R.; Bongirwar, D.R.

    1979-01-01

    After enumerating the fungi responsible for food spoilage, work done on the factors influencing growth of fungi in stored foods is reviewed and the methods using heat, radiation or chemicals for control of food-borne molds are briefly surveyed. Work on combination process employing heat treatment and radiation treatment is reviewed in detail. The review covers the following aspects: (1) theory and engineering aspects of combination process of heat and radiation including modes of heat transfer, radiation physics, radiation sources, heat radiation effect and calculation of energy balance of the process, (2) biological effects of heat, radiation and heat-radiation combination treatments on mold growth with special reference to DNA and (3) application of the process for mold control in cereal products, nuts and raisins and fruits. Heat treatment and radiation treatment have been found to complement each other and when given in proper sequence show synergism. Design requirements of radiation sources and heat transfer equipment are also surveyed. (M.G.B.)

  17. [Socioeconomic costs of food-borne disease using the cost-of-illness model: applying the QALY method].

    Science.gov (United States)

    Shin, Hosung; Lee, Suehyung; Kim, Jong Soo; Kim, Jinsuk; Han, Kyu Hong

    2010-07-01

    This study estimated the annual socioeconomic costs of food-borne disease in 2008 from a societal perspective and using a cost-of-illness method. Our model employed a comprehensive set of diagnostic disease codes to define food-borne diseases with using the Korea National Health Insurance (KNHI) reimbursement data. This study classified the food borne illness as three types of symptoms according to the severity of the illness: mild, moderate, severe. In addition to the traditional method of assessing the cost-of-illness, the study included measures to account for the lost quality of life. We estimated the cost of the lost quality of life using quality-adjusted life years and a visual analog scale. The direct cost included medical and medication costs, and the non-medical costs included transportation costs, caregiver's cost and administration costs. The lost productivity costs included lost workdays due to illness and lost earnings due to premature death. The study found the estimated annual socioeconomic costs of food-borne disease in 2008 were 954.9 billion won (735.3 billion won-996.9 billion won). The medical cost was 73.4 - 76.8% of the cost, the lost productivity cost was 22.6% and the cost of the lost quality of life was 26.0%. Most of the cost-of-illness studies are known to have underestimated the actual socioeconomic costs of the subjects, and these studies excluded many important social costs, such as the value of pain, suffering and functional disability. The study addressed the uncertainty related to estimating the socioeconomic costs of food-borne disease as well as the updated cost estimates. Our estimates could contribute to develop and evaluate policies for food-borne disease.

  18. Cold plasma inactivation of human pathogens on foods and regulatory status update

    Science.gov (United States)

    Contamination of foods with human pathogens such as Salmonella, Listeria monocytogenes, Escherichia coli O157:H7, norovirus, and other pathogens is an ongoing challenge for growers and processors. In recent years, cold plasma has emerged as a promising antimicrobial treatment for fresh and fresh-cut...

  19. Prebiotics in food animals, a potential to reduce foodborne pathogens and disease

    Science.gov (United States)

    Animals can be seriously impacted by bacterial pathogens that affect their growth efficiency and overall health, as well as food safety of animal-derived products. Some pathogenic bacteria, such as Salmonella, can be a shared problem for both human and animal health and can be found in many animal ...

  20. Prebiotics in food animals: A potential to reduce foodborne pathogens and disease

    Science.gov (United States)

    Animals can be seriously impacted by bacterial pathogens that affect their growth efficiency and overall health, as well as food safety of animal-derived products. Some pathogenic bacteria, such as Salmonella, can be a shared problem for both human and animal health and can be found in many animal ...

  1. Quantitative proteomics of food pathogenic Bacilli - a quest for biomarkers

    NARCIS (Netherlands)

    Stelder, S.K.

    2016-01-01

    Food manufacturers have a variety of methods at their disposal to ensure foods are microbially safe. However, due to increasing demands from consumers for minimally processed foods the severity of these treatments is frequently mild. Frequently being able to survive such treatments, bacteria of the

  2. Characterisation and antimicrobial resistance of sepsis pathogens in neonates born in tertiary care centres in Delhi, India: a cohort study.

    Science.gov (United States)

    2016-10-01

    Sepsis is one of the most common causes of neonatal deaths globally. Most sepsis-related deaths occur in low-income and middle-income countries, where the epidemiology of neonatal sepsis remains poorly understood. Most of these countries lack proper surveillance networks, hampering accurate assessment of the burden of sepsis, implementation of preventive measures, and investment in research. We report results of neonates born in hospital from a multicentre collaboration on neonatal sepsis. In this cohort study, dedicated research teams prospectively followed up neonates born in one of three tertiary care centres in Delhi, India (Vardhaman Mahavir Medical College, Maulana Azad Medical College, and All India Institute of Medical Sciences [coordinating centre]) and subsequently admitted to the intensive care unit. Neonates were followed up daily until discharge or death. On clinical suspicion, neonates underwent sepsis work-up including blood cultures. The isolated organisms were identified and tested for antimicrobial susceptibility. We defined Gram-negative isolates resistant to any three of five antibiotic classes (extended-spectrum cephalosporins, carbapenems, aminoglycosides, fluoroquinolones, and piperacillin-tazobactam) as multidrug resistant. 13 530 neonates of 88 636 livebirths were enrolled between July 18, 2011, and Feb 28, 2014. The incidence of total sepsis was 14·3% (95% CI 13·8-14·9) and of culture-positive sepsis was 6·2% (5·8-6·6). Nearly two-thirds of total episodes occurred at or before 72 h of life (defined as early onset; 1351 [83%] of 1980). Two-thirds (645 [64%]) of 1005 isolates were Gram-negative including, Acinetobacter spp (22%), Klebsiella spp (17%), and Escherichia coli (14%). The pathogen mix in early-onset sepsis did not differ from that of late-onset sepsis (ie, after 72 h). High rates of multidrug resistance were observed in Acinetobacter spp (181/222, 82%), Klebsiella spp (91/169, 54%), and Escherichia coli (52/137, 38

  3. Lab-on-a-Chip Pathogen Sensors for Food Safety

    Directory of Open Access Journals (Sweden)

    Bumsang Kim

    2012-08-01

    Full Text Available There have been a number of cases of foodborne illness among humans that are caused by pathogens such as Escherichia coli O157:H7, Salmonella typhimurium, etc. The current practices to detect such pathogenic agents are cell culturing, immunoassays, or polymerase chain reactions (PCRs. These methods are essentially laboratory-based methods that are not at all real-time and thus unavailable for early-monitoring of such pathogens. They are also very difficult to implement in the field. Lab-on-a-chip biosensors, however, have a strong potential to be used in the field since they can be miniaturized and automated; they are also potentially fast and very sensitive. These lab-on-a-chip biosensors can detect pathogens in farms, packaging/processing facilities, delivery/distribution systems, and at the consumer level. There are still several issues to be resolved before applying these lab-on-a-chip sensors to field applications, including the pre-treatment of a sample, proper storage of reagents, full integration into a battery-powered system, and demonstration of very high sensitivity, which are addressed in this review article. Several different types of lab-on-a-chip biosensors, including immunoassay- and PCR-based, have been developed and tested for detecting foodborne pathogens. Their assay performance, including detection limit and assay time, are also summarized. Finally, the use of optical fibers or optical waveguide is discussed as a means to improve the portability and sensitivity of lab-on-a-chip pathogen sensors.

  4. Microsporidia – Emergent Pathogens in the Global Food Chain

    Science.gov (United States)

    Intensi'cation of food production has the potential to drive increased disease prevalence in food plants and animals. Microsporidia are diversely distributed, opportunistic, and density-dependent parasites infecting hosts from almost all known animal taxa. They are frequent in highly managed aqua...

  5. Human enteric pathogen internalization by root uptake into food crops

    Science.gov (United States)

    With an increasing number of outbreaks and illnesses associated with pre-harvest contaminated produce, understanding the potential and mechanisms of produce contamination by enteric pathogens can aid in the development of preventative measures and post-harvest processing to reduce microbial populati...

  6. PulseNet International: Vision for the implementation of whole genome sequencing (WGS) for global food-borne disease surveillance.

    NARCIS (Netherlands)

    Nadon, Celine; Van Walle, Ivo; Gerner-Smidt, Peter; Campos, Josefina; Chinen, Isabel; Concepcion-Acevedo, Jeniffer; Gilpin, Brent; Smith, Anthony M; Man Kam, Kai; Perez, Enrique; Trees, Eija; Kubota, Kristy; Takkinen, Johanna; Nielsen, Eva Møller; Carleton, Heather

    2017-01-01

    PulseNet International is a global network dedicated to laboratory-based surveillance for food-borne diseases. The network comprises the national and regional laboratory networks of Africa, Asia Pacific, Canada, Europe, Latin America and the Caribbean, the Middle East, and the United States. The

  7. The response of foodborne pathogens to osmotic and desiccation stresses in the food chain

    DEFF Research Database (Denmark)

    Burgess, Catherine M.; Gianotti, Andrea; Gruzdev, Nadia

    2016-01-01

    In combination with other strategies, hyperosmolarity and desiccation are frequently used by the food processing industry as a means to prevent bacterial proliferation, and particularly that of foodborne pathogens, in food products. However, it is increasingly observed that bacteria, including...... human pathogens, encode mechanisms to survive and withstand these stresses. This review provides an overview of the mechanisms employed by Salmonella spp., Shiga toxin producing E. coli, Cronobacter spp., Listeria monocytogenes and Campylobacter spp. to tolerate osmotic and desiccation stresses...... and identifies gaps in knowledge which need to be addressed to ensure the safety of low water activity and desiccated food products....

  8. The use of nanoscale visible light-responsive photocatalyst TiO2-Pt for the elimination of soil-borne pathogens.

    Directory of Open Access Journals (Sweden)

    Ya-Lei Chen

    Full Text Available Exposure to the soil-borne pathogens Burkholderia pseudomallei and Burkholderia cenocepacia can lead to severe infections and even mortality. These pathogens exhibit a high resistance to antibiotic treatments. In addition, no licensed vaccine is currently available. A nanoscale platinum-containing titania photocatalyst (TiO(2-Pt has been shown to have a superior visible light-responsive photocatalytic ability to degrade chemical contaminants like nitrogen oxides. The antibacterial activity of the catalyst and its potential use in soil pathogen control were evaluated. Using the plating method, we found that TiO(2-Pt exerts superior antibacterial performance against Escherichia coli compared to other commercially available and laboratory prepared ultraviolet/visible light-responsive titania photocatalysts. TiO(2-Pt-mediated photocatalysis also affectively eliminates the soil-borne bacteria B. pseudomallei and B. cenocepacia. An air pouch infection mouse model further revealed that TiO(2-Pt-mediated photocatalysis could reduce the pathogenicity of both strains of bacteria. Unexpectedly, water containing up to 10% w/v dissolved soil particles did not reduce the antibacterial potency of TiO(2-Pt, suggesting that the TiO(2-Pt photocatalyst is suitable for use in soil-contaminated environments. The TiO(2-Pt photocatalyst exerted superior antibacterial activity against a broad spectrum of human pathogens, including B. pseudomallei and B. cenocepacia. Soil particles (<10% w/v did not significantly reduce the antibacterial activity of TiO(2-Pt in water. These findings suggest that the TiO(2-Pt photocatalyst may have potential applications in the development of bactericides for soil-borne pathogens.

  9. Incidence and pathogenicity profile of Listeria sp. isolated from food ...

    African Journals Online (AJOL)

    USER

    2010-07-26

    Jul 26, 2010 ... in the brain, adrenal glands, spleen, kidney, lungs and the gastrointestinal ..... Cryptogenic liver abscess due to Listeria monocytogenes. .... of foods in sporadic listeriosis I. Case – control study of dietry risk factors. J. Am. Med.

  10. Prevalence of ticks and tick-borne pathogens: Babesia and Borrelia species in ticks infesting cats of Great Britain.

    Science.gov (United States)

    Davies, Saran; Abdullah, Swaid; Helps, Chris; Tasker, Séverine; Newbury, Hannah; Wall, Richard

    2017-09-15

    In a study of tick and tick-borne pathogen prevalence, between May and October 2016, 278 veterinary practices in Great Britain examined 1855 cats. Six-hundred and one cats were found to have attached ticks. The most frequently recorded tick species was Ixodes ricinus (57.1%), followed by Ixodes hexagonus (41.4%) and Ixodes trianguliceps (1.5%). Male cats, 4-6 years of age living in rural areas were most likely to be carrying a tick; hair length and tick treatment history had no significant association with attachment. For cats that were parasitized by ticks in large urban areas, I. hexagonus was the most frequent species recorded. Molecular analysis was possible for 541 individual tick samples, others were too damaged for analysis; Babesia spp., and Borrelia burgdorferi sensu lato were identified in 1.1% (n=6) and 1.8% (n=10) of these, respectively. Babesia spp. included Babesia vulpes sp. nov./Babesia microti-like (n=4) in I. hexagonus and Babesia venatorum (n=2) in I. ricinus. Borrelia burgdorferi s.l. species included Borrelia garinii (n=6) and Borrelia afzelii (n=4). The majority of B. burgorferi s.l. cases were found in I. ricinus, with B. afzelii in one I. hexagonus nymph. No Borrelia or Babesia spp. were present in I. trianguliceps. To determine a true prevalence for ticks on cats, practices that only submitted questionnaires from cats with ticks and practices that submitted fewer than 5 returns per week were removed; amongst those considered to have adhered strictly to the collection protocol, feline tick prevalence amongst cats that had access to the outdoors was 6.6%. These results show that ticks can be found on cats throughout Great Britain, which harbour a range of species of Babesia and B. burgdorferi s.l. and that cats, particularly in green spaces within urban areas, may form an important host for I. hexagonus, a known vector of pathogens. Copyright © 2017 Elsevier B.V. All rights reserved.

  11. THE EFFECTS OF 1‰ STABILIZED LIQUID SOLUTION OF CHLORINE DIOXIDE (ClO2 ON SOME FOOD-BORN BACTERIA

    Directory of Open Access Journals (Sweden)

    Sead Hadziabdić

    2014-03-01

    Full Text Available The conducted research gives an overview of the results obtained after the application of 1‰ solution of stabilized liquid chlorine dioxide on some food-born related bacteria - E. coli, Staphylococcus aureus, S. Enteritidis and C. jejuni.  For this purpose,  reference strains of the aforementioned pathogens in decimal dilutions were exposed to 1 ml of 1‰ solution of stabilized liquid chlorine dioxide for one hour. Reduction of bacteria counts per mililitre (CFU/ml has been noticed for all bacteria, with total reduction of C. jejuni and Staphylococcus aureus in the fourth (1:104, and for S. Enteritidis and E. coli in the sixth (1:106 decimal dilution. Key words: chlorine dioxide, E. coli, S. aureus, S. Enteritidis, C. jejuni

  12. Pathogenic Escherichia coli and food handlers in luxury hotels in Nairobi, Kenya.

    Science.gov (United States)

    Onyango, Abel O; Kenya, Eucharia U; Mbithi, John J N; Ng'ayo, Musa O

    2009-11-01

    The epidemiology and virulence properties of pathogenic Escherichia coli among food handlers in tourist destination hotels in Kenya are largely uncharacterized. This cross-sectional study among consenting 885 food handlers working in nine luxurious tourist hotels in Nairobi, Kenya determined the epidemiology, virulence properties, antibiotics susceptibility profiles and conjugation abilities of pathogenic Escherichia coli. Pathogenic Escherichia coli was detected among 39 (4.4%) subjects, including 1.8% enteroaggregative Escherichia coli (EAEC) harboring aggR genes, 1.2% enterotoxigenic Escherichia coli (ETEC) expressing both LT and STp toxins, 1.1% enteropathogenic Escherichia coli (EPEC) and 0.2% Shiga-like Escherichia coli (EHEC) both harboring eaeA and stx2 genes respectively. All the pathotypes had increased surface hydrophobicity. Using multivariate analyses, food handlers with loose stools were more likely to be infected with pathogenic Escherichia coli. Majority 53.8% of the pathotypes were resistant to tetracycline with 40.2% being multi-drug resistant. About 85.7% pathotypes trans-conjugated with Escherichia coli K12 F(-) NA(r) LA. The carriage of multi-drug resistant, toxin expressing pathogenic Escherichia coli by this population is of public health concern because exposure to low doses can result in infection. Screening food handlers and implementing public awareness programs is recommended as an intervention to control transmission of enteric pathogens.

  13. Prevalence of foodborne pathogens in food from selected African countries – a meta-analysis

    DEFF Research Database (Denmark)

    Paudyal, Narayan; Anihouvi, Victor; Hounhouigan, Joseph

    2017-01-01

    for general analysis, while 66 papers on contamination of pathogenic bacteria were used for meta-analysis of prevalence. The food items were split into two categories: raw foods and ready-to-eat (RTE) foods (including street food and beverages) for meta-analysis. Majority of the reviewed studies (67.2%, 78....../116) dealt with food of animal origin: 38.8% for meat and eggs, 17.2% for dairy products and 11.2% for aquatic products. Only 8.6% examined foods of plant origin (fruits and vegetables). The remaining 24.1% was the composite RTE food and beverages. Enterobacteriaceae, Escherichia coli, Salmonella......Food safety information in the African region is insufficient and fragmented due to lack of surveillance, documentation and reporting, thereby resulting in inefficient utilization of resources, duplication of activities, and lack of synergy among the countries of the region. This paper reviews...

  14. Molecular and serological detection of tick-borne pathogens in dogs from an area endemic for Leishmania infantumin Mato Grosso do Sul, Brazil

    Directory of Open Access Journals (Sweden)

    Keyla Carstens Marques de Sousa

    Full Text Available Tick-borne pathogens affect a wide range of vertebrate hosts. To identify tick-borne pathogens among dogs from Campo Grande, MS, Brazil testing seropositive for Leishmania infantum (syn. L. chagasi, a serological and molecular study was conducted to detectEhrlichia canis, Anaplasma platys and Babesia vogeli in 60 serum and spleen samples. A confirmatory diagnosis ofL. infantum based on serological and molecular assays was also performed, as was sequence alignment and phylogenetic analysis to assess the identity of the parasite species infecting these animals. IgG antibodies toEhrlichia spp., B. vogeli and L. infantum were found, respectively, in 39 (65%, 49 (81.6% and 60 (100% of the sampled dogs. Twenty-seven (45%, fifty-four (90%, fifty-three (88.3%, two (3.3% and one (1.6% dog were positive, respectively, forE. canis, Leishmania spp., Leishmania donovani complex, Babesia sp. and Anaplasma sp. in PCR assays. After sequencing, the amplicons showed 99% of identity with E. canis, B. vogeli, A. platys andLeishmania chagasi isolates. The findings of this study indicate that L. infantum-seropositive dogs from Campo Grande are exposed to multiple tick-borne pathogens, which should therefore be included in the differential diagnosis of dogs with clinical suspicion of leishmaniasis.

  15. Susceptibilities to carbapenems and presence of cphA gene on food-borne Aeromonas

    Directory of Open Access Journals (Sweden)

    Bibiana María Martín Talavera

    2006-07-01

    Full Text Available The purpose of this study was to determine the susceptibilities of food-borne Aeromonas to carbapenems, as well as to investigate the presence of a metallo carbapenemase-encoding gene, named cphA. Minimum Inhibitory Concentration (MIC was determined following NCCLS standards. All the tested microorganisms were susceptible to imipenem, meropenem and biapenem. However, a strong inoculum size effect on carbapenem MICs was observed for most of the strains. Six strains, out of seven, showed the presence of metallo--beta-lactamases but cphA gene was detected in only two strains of A. veronii bv. sobria.O objetivo deste estudo foi determinar a suscetibilidade de aeromonas de origem alimentar a carbapenems bem como investigar a presença de um gene codificante de metalocarbapenemase, denominado "cph A". A suscetibilidade in vitro foi determinada pelo metodo de diluição em agar. Todas as cepas foram suscetíveis a Imipenem, Meropenem e Biapenem. Porém foi observado um forte efeito de tamanho do inóculo sobre as CIM das carbapenems na maioria das cepas. A detecção de metalo-beta-lactamase foi realizada pelo metodo lodometrico. Seis cepas das sete testadas demostraron a presença da enzima. A presença do gene cphA foi determinada por PCR e foi detectada em duas cepas de A veronii bv. sobria.

  16. A simple method for normalization of DNA extraction to improve the quantitative detection of soil-borne plant pathogenic oomycetes by real-time PCR.

    Science.gov (United States)

    Li, M; Ishiguro, Y; Kageyama, K; Zhu, Z

    2015-08-01

    Most of the current research into the quantification of soil-borne pathogenic oomycetes lacks determination of DNA extraction efficiency, probably leading to an incorrect estimation of DNA quantity. In this study, we developed a convenient method by using a 100 bp artificially synthesized DNA sequence derived from the mitochondrion NADH dehydrogenase subunit 2 gene of Thunnus thynnus as a control to determine the DNA extraction efficiency. The control DNA was added to soils and then co-extracted along with soil genomic DNA. DNA extraction efficiency was determined by the control DNA. Two different DNA extraction methods were compared and evaluated using different types of soils, and the commercial kit was proved to give more consistent results. We used the control DNA combined with real-time PCR to quantify the oomycete DNAs from 12 naturally infested soils. Detectable target DNA concentrations were three to five times higher after normalization. Our tests also showed that the extraction efficiencies varied on a sample-to-sample basis and were simple and useful for the accurate quantification of soil-borne pathogenic oomycetes. Oomycetes include many important plant pathogens. Accurate quantification of these pathogens is essential in the management of diseases. This study reports an easy method utilizing an external DNA control for the normalization of DNA extraction by real-time PCR. By combining two different efficient soil DNA extraction methods, the developed quantification method dramatically improved the results. This study also proves that the developed normalization method is necessary and useful for the accurate quantification of soil-borne plant pathogenic oomycetes. © 2015 The Society for Applied Microbiology.

  17. Efficacy of Sakacin on Selected Food Pathogenic Microorganisms ...

    African Journals Online (AJOL)

    USER

    technique and was characterized based on it colony, cell morphology and some ... De Man Rogosa Sharpe (MRS) broth for bacteriocin (sakacin) production. ... tremendous attention as potential bio preservatives in the food and dairy industries. .... positive result,-: Negative result, A : Acid production ,G :Gas production,.

  18. Rapid emergence of pathogens in agro-ecosystems: global threats to agricultural sustainability and food security.

    Science.gov (United States)

    McDonald, Bruce A; Stukenbrock, Eva H

    2016-12-05

    Agricultural ecosystems are composed of genetically depauperate populations of crop plants grown at a high density and over large spatial scales, with the regional composition of crop species changing little from year to year. These environments are highly conducive for the emergence and dissemination of pathogens. The uniform host populations facilitate the specialization of pathogens to particular crop cultivars and allow the build-up of large population sizes. Population genetic and genomic studies have shed light on the evolutionary mechanisms underlying speciation processes, adaptive evolution and long-distance dispersal of highly damaging pathogens in agro-ecosystems. These studies document the speed with which pathogens evolve to overcome crop resistance genes and pesticides. They also show that crop pathogens can be disseminated very quickly across and among continents through human activities. In this review, we discuss how the peculiar architecture of agro-ecosystems facilitates pathogen emergence, evolution and dispersal. We present four example pathosystems that illustrate both pathogen specialization and pathogen speciation, including different time frames for emergence and different mechanisms underlying the emergence process. Lastly, we argue for a re-design of agro-ecosystems that embraces the concept of dynamic diversity to improve their resilience to pathogens. This article is part of the themed issue 'Tackling emerging fungal threats to animal health, food security and ecosystem resilience'. © 2016 The Author(s).

  19. Prevalence of foodborne pathogens in food from selected African countries - A meta-analysis.

    Science.gov (United States)

    Paudyal, Narayan; Anihouvi, Victor; Hounhouigan, Joseph; Matsheka, Maitshwarelo Ignatius; Sekwati-Monang, Bonno; Amoa-Awua, Wisdom; Atter, Amy; Ackah, Nina Bernice; Mbugua, Samuel; Asagbra, Agnes; Abdelgadir, Warda; Nakavuma, Jesca; Jakobsen, Mogens; Fang, Weihuan

    2017-05-16

    Food safety information in the African region is insufficient and fragmented due to lack of surveillance, documentation and reporting, thereby resulting in inefficient utilization of resources, duplication of activities, and lack of synergy among the countries of the region. This paper reviews the prevalence of foodborne pathogens in seven African countries (Benin, Botswana, Ghana, Kenya, Nigeria, Sudan and Uganda) from papers in regional or international journals published between January 2000 and December 2015. One hundred and sixteen publications that dealt with food microbiology were reviewed for general analysis, while 66 papers on contamination of pathogenic bacteria were used for meta-analysis of prevalence. The food items were split into two categories: raw foods and ready-to-eat (RTE) foods (including street food and beverages) for meta-analysis. Majority of the reviewed studies (67.2%, 78/116) dealt with food of animal origin: 38.8% for meat and eggs, 17.2% for dairy products and 11.2% for aquatic products. Only 8.6% examined foods of plant origin (fruits and vegetables). The remaining 24.1% was the composite RTE food and beverages. Enterobacteriaceae, Escherichia coli, Salmonella, Staphylococcus aureus and Listeria monocytogenes were the most frequently reported organisms in those studies. Although the data were highly heterogeneous, a striking feature is high prevalence of the major pathogens in RTE foods, almost as high as in raw foods. E. coli averaged at 37.6% in raw foods and 31.6% in RTE foods. The corresponding prevalence for Salmonella was 19.9% vs 21.7%; S. aureus, 27.8% vs 25.1% and L. monocytogenes, 19.5% vs 6.7%. The average prevalence of foodborne pathogens in these countries was 34.2% (29.0-39.3%). Differences in food types as well as non-uniform protocols for sampling and identification might have contributed to high heterogeneity (I 2 >97%) although some high prevalence data could be factual with extensive varieties of raw and RTE foods

  20. Strategies for the detection of food pathogens and contaminants

    DEFF Research Database (Denmark)

    Hearty, Stephen; Leonard, Paul; Sheehan, Alfredo Darmanin

    2006-01-01

    We routinely use Biacore for affinity ranking and kinetic characterisation of diverse panels of hybridoma-derived and recombinant antibodies against a wide range of different clinically relevant antigens for diagnostic applications. Generally the analytes of interest are haptens or defined protei...... to date with using Biacore for analysis of food contaminants and in particular the challenges associated with large analyte detection...... molecules and once suitably high affinity antibodies have been isolated, it is relatively straightforward to design and optimise concentration-based assays using SPR. Recently we have investigated the potential of applying Biacore technology to routine food analysis. Our experiences have shown...... that molecular contaminants such as microbial toxins and drug/pesticide residues translate well onto Biacore-based assay formats. However, larger and more complex entities such as spores and whole bacterial cells represent an altogether more difficult challenge. Here, we present an overview of our experiences...

  1. Strategies for the detection of food pathogens and contaminants

    DEFF Research Database (Denmark)

    We routinely use Biacore for affinity ranking and kinetic characterisation of diverse panels of hybridoma-derived and recombinant antibodies against a wide range of different clinically relevant antigens for diagnostic applications. Generally the analytes of interest are haptens or defined protei...... to date with using Biacore for analysis of food contaminants and in particular the challenges associated with large analyte detection...... molecules and once suitably high affinity antibodies have been isolated, it is relatively straightforward to design and optimise concentration-based assays using SPR. Recently we have investigated the potential of applying Biacore technology to routine food analysis. Our experiences have shown...... that molecular contaminants such as microbial toxins and drug/pesticide residues translate well onto Biacore-based assay formats. However, larger and more complex entities such as spores and whole bacterial cells represent an altogether more difficult challenge. Here, we present an overview of our experiences...

  2. Plant innate immunity against human bacterial pathogens

    Directory of Open Access Journals (Sweden)

    Maeli eMelotto

    2014-08-01

    Full Text Available Certain human bacterial pathogens such as the enterohemorrhagic Escherichia coli and Salmonella enterica are not proven to be plant pathogens yet. Nonetheless, under certain conditions they can survive on, penetrate into, and colonize internal plant tissues causing serious food borne disease outbreaks. In this review, we highlight current understanding on the molecular mechanisms of plant responses against human bacterial pathogens and discuss salient common and contrasting themes of plant interactions with phytopathogens or human pathogens.

  3. Antimicrobial Activity of Kedawung Extract (Parkia Roxburghii G. Don on Food Borne Pathogens

    Directory of Open Access Journals (Sweden)

    Ervizal A. M Zuhud, Winiati Pudji Rahayu, C. Hanny Wijaya, Pipi Puspita Sari

    2001-04-01

    Full Text Available Kedawung is a Leguminosae/Fabaceae which. It is commonly used as traditional medicine for infection and stomach disoders, caused by bacteria.The aim of this study is to examine the potential antimicrobial activity of seed, bark, root and kedawung leaf. It is expected that the result will give information on characteristics and concentration of kedawung part which have the highest antimicrobial activity.The result showed that the bark has the highest antimicrobial activity on Escherichia coli, Vibrio cholerae, Staphylococcus aureus and Bacillus cereus. Extract made from kedawung plant and water (ratio 1:2,b/v was better than those made with ratios of 1 : 1 or 1 : 3 (b/v. Heat did not decrease its antimicrobial activity. Extract concentration of 10% (21.40 mg/ml with contact time of 24 hour decreased bacterial growth but did not inactivate them.

  4. Chemical Composition and Antibacterial Effect of Medicinal Plants against Some Food-Borne Pathogen

    Directory of Open Access Journals (Sweden)

    Hassan Habibi

    2017-05-01

    Conclusion: Antibacterial efficacy shown by these plants provides a scientific basis and thus validates their use as medicinal remedies. Isolation and purification of different phytochemicals may further yield significant antibacterial agents.

  5. Co-infection dynamics of a major food-borne zoonotic pathogen in chicken

    DEFF Research Database (Denmark)

    Skanseng, Beate; Trosvik, Pal; Zimonja, Monika

    2007-01-01

    , with an important reservoir in the gastrointestinal (GI) tract of chickens, was used as a model. We investigated the co-colonisation dynamics of seven C. jejuni strains in a chicken GI infection trial. The seven strains were isolated from an epidemiological study showing multiple strain infections at the farm level....... We analysed time-series data, following the Campylobacter colonisation, as well as the dominant background flora of chickens. Data were collected from the infection at day 16 until the last sampling point at day 36. Chickens with two different background floras were studied, mature ( treated...... with Broilact, which is a product consisting of bacteria from the intestinal flora of healthy hens) and spontaneous. The two treatments resulted in completely different background floras, yet similar Campylobacter colonisation patterns were detected in both groups. This suggests that it is the chicken host...

  6. Using lytic bacteriophages to eliminate or significantly reduce contamination of food by foodborne bacterial pathogens.

    Science.gov (United States)

    Sulakvelidze, Alexander

    2013-10-01

    Bacteriophages (also called 'phages') are viruses that kill bacteria. They are arguably the oldest (3 billion years old, by some estimates) and most ubiquitous (total number estimated to be 10(30) -10(32) ) known organisms on Earth. Phages play a key role in maintaining microbial balance in every ecosystem where bacteria exist, and they are part of the normal microflora of all fresh, unprocessed foods. Interest in various practical applications of bacteriophages has been gaining momentum recently, with perhaps the most attention focused on using them to improve food safety. That approach, called 'phage biocontrol', typically includes three main types of applications: (i) using phages to treat domesticated livestock in order to reduce their intestinal colonization with, and shedding of, specific bacterial pathogens; (ii) treatments for decontaminating inanimate surfaces in food-processing facilities and other food establishments, so that foods processed on those surfaces are not cross-contaminated with the targeted pathogens; and (iii) post-harvest treatments involving direct applications of phages onto the harvested foods. This mini-review primarily focuses on the last type of intervention, which has been gaining the most momentum recently. Indeed, the results of recent studies dealing with improving food safety, and several recent regulatory approvals of various commercial phage preparations developed for post-harvest food safety applications, strongly support the idea that lytic phages may provide a safe, environmentally-friendly, and effective approach for significantly reducing contamination of various foods with foodborne bacterial pathogens. However, some important technical and nontechnical problems may need to be addressed before phage biocontrol protocols can become an integral part of routine food safety intervention strategies implemented by food industries in the USA. © 2013 Society of Chemical Industry.

  7. Food-Borne Outbreak Investigation and Molecular Typing: High Diversity of Staphylococcus aureus Strains and Importance of Toxin Detection

    Science.gov (United States)

    Denayer, Sarah; Nia, Yacine; Botteldoorn, Nadine

    2017-01-01

    Staphylococcus aureus is an important aetiological agent of food intoxications in the European Union as it can cause gastro-enteritis through the production of various staphylococcal enterotoxins (SEs) in foods. Reported enterotoxin dose levels causing food-borne illness are scarce and varying. Three food poisoning outbreaks due to enterotoxin-producing S. aureus strains which occurred in 2013 in Belgium are described. The outbreaks occurred in an elderly home, at a barbecue event and in a kindergarten and involved 28, 18, and six cases, respectively. Various food leftovers contained coagulase positive staphylococci (CPS). Low levels of staphylococcal enterotoxins ranging between 0.015 ng/g and 0.019 ng/g for enterotoxin A (SEA), and corresponding to 0.132 ng/g for SEC were quantified in the food leftovers for two of the reported outbreaks. Molecular typing of human and food isolates using pulsed-field gel electrophoresis (PFGE) and enterotoxin gene typing, confirmed the link between patients and the suspected foodstuffs. This also demonstrated the high diversity of CPS isolates both in the cases and in healthy persons carrying enterotoxin genes encoding emetic SEs for which no detection methods currently exist. For one outbreak, the investigation pointed out to the food handler who transmitted the outbreak strain to the food. Tools to improve staphylococcal food poisoning (SFP) investigations are presented. PMID:29261162

  8. Food-Borne Outbreak Investigation and Molecular Typing: High Diversity of Staphylococcus aureus Strains and Importance of Toxin Detection.

    Science.gov (United States)

    Denayer, Sarah; Delbrassinne, Laurence; Nia, Yacine; Botteldoorn, Nadine

    2017-12-20

    Staphylococcus aureus is an important aetiological agent of food intoxications in the European Union as it can cause gastro-enteritis through the production of various staphylococcal enterotoxins (SEs) in foods. Reported enterotoxin dose levels causing food-borne illness are scarce and varying. Three food poisoning outbreaks due to enterotoxin-producing S. aureus strains which occurred in 2013 in Belgium are described. The outbreaks occurred in an elderly home, at a barbecue event and in a kindergarten and involved 28, 18, and six cases, respectively. Various food leftovers contained coagulase positive staphylococci (CPS). Low levels of staphylococcal enterotoxins ranging between 0.015 ng/g and 0.019 ng/g for enterotoxin A (SEA), and corresponding to 0.132 ng/g for SEC were quantified in the food leftovers for two of the reported outbreaks. Molecular typing of human and food isolates using pulsed-field gel electrophoresis (PFGE) and enterotoxin gene typing, confirmed the link between patients and the suspected foodstuffs. This also demonstrated the high diversity of CPS isolates both in the cases and in healthy persons carrying enterotoxin genes encoding emetic SEs for which no detection methods currently exist. For one outbreak, the investigation pointed out to the food handler who transmitted the outbreak strain to the food. Tools to improve staphylococcal food poisoning (SFP) investigations are presented.

  9. Pasteurization of milk: the heat inactivation kinetics of milk-borne dairy pathogens under commercial-type conditions of turbulent flow.

    Science.gov (United States)

    Pearce, L E; Smythe, B W; Crawford, R A; Oakley, E; Hathaway, S C; Shepherd, J M

    2012-01-01

    This is the first study to report kinetic data on the survival of a range of significant milk-borne pathogens under commercial-type pasteurization conditions. The most heat-resistant strain of each of the milk-borne pathogens Staphylococcus aureus, Yersinia enterocolitica, pathogenic Escherichia coli, Cronobacter sakazakii (formerly known as Enterobacter sakazakii), Listeria monocytogenes, and Salmonella was selected to obtain the worst-case scenario in heat inactivation trials using a pilot-plant-scale pasteurizer. Initially, approximately 30 of each species were screened using a submerged coil unit. Then, UHT milk was inoculated with the most heat-resistant pathogens at ~10(7)/mL and heat treated in a pilot-plant-scale pasteurizer under commercial-type conditions of turbulent flow for 15s over a temperature range from 56 to 66°C and at 72°C. Survivors were enumerated on nonselective media chosen for the highest efficiency of plating of heat-damaged bacteria of each of the chosen strains. The mean log(10) reductions and temperatures of inactivation of the 6 pathogens during a 15-s treatment were Staph. aureus >6.7 at 66.5°C, Y. enterocolitica >6.8 at 62.5°C, pathogenic E. coli >6.8 at 65°C, C. sakazakii >6.7 at 67.5°C, L. monocytogenes >6.9 at 65.5°C, and Salmonella ser. Typhimurium >6.9 at 61.5°C. The kinetic data from these experiments will be used by the New Zealand Ministry of Agriculture and Forestry to populate the quantitative risk assessment model being developed to investigate the risks to New Zealand consumers from pasteurized, compared with nonpasteurized, milk and milk products. Copyright © 2012 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

  10. Molecular detection of vector-borne pathogens in blood and splenic samples from dogs with splenic disease.

    Science.gov (United States)

    Movilla, Rebeca; Altet, Laura; Serrano, Lorena; Tabar, María-Dolores; Roura, Xavier

    2017-03-13

    The spleen is a highly perfused organ involved in the immunological control and elimination of vector-borne pathogens (VBP), which could have a fundamental role in the pathogenesis of splenic disease. This study aimed to evaluate certain VBP in samples from dogs with splenic lesions. Seventy-seven EDTA-blood and 64 splenic tissue samples were collected from 78 dogs with splenic disease in a Mediterranean area. Babesia spp., Bartonella spp., Ehrlichia/Anaplasma spp., Hepatozoon canis, Leishmania infantum, hemotropic Mycoplasma spp. and Rickettsia spp. were targeted using PCR assays. Sixty EDTA-blood samples from dogs without evidence of splenic lesions were included as a control group. More than half (51.56%) of the biopsies (33/64) were consistent with benign lesions and 48.43% (31/64) with malignancy, mostly hemangiosarcoma (25/31). PCR yielded positive results in 13 dogs with spleen alterations (16.67%), for Babesia canis (n = 3), Babesia gibsoni (n = 2), hemotropic Mycoplasma spp. (n = 2), Rickettsia massiliae (n = 1) and "Babesia vulpes" (n = 1), in blood; and for B. canis, B. gibsoni, Ehrlichia canis and L. infantum (n = 1 each), in spleen. Two control dogs (3.3%) were positive for B. gibsoni and H. canis (n = 1 each). Benign lesions were detected in the 61.54% of infected dogs (8/13); the remaining 38.46% were diagnosed with malignancies (5/13). Infection was significantly associated to the presence of splenic disease (P = 0.013). There was no difference in the prevalence of infection between dogs with benign and malignant splenic lesions (P = 0.69); however B. canis was more prevalent in dogs with hemangiosarcoma (P = 0.006). VBP infection could be involved in the pathogenesis of splenic disease. The immunological role of the spleen could predispose to alterations of this organ in infected dogs. Interestingly, all dogs with B. canis infection were diagnosed with hemangiosarcoma in the present survey. As previously

  11. Opportunities for mitigating pathogen contamination during on-farm food production.

    Science.gov (United States)

    Doyle, Michael P; Erickson, Marilyn C

    2012-01-16

    Fruits, vegetables, and meat are susceptible to contamination by foodborne pathogens at many points from production through preparation in the home. This review will largely highlight approaches and progress made in the last five years to address strategies to reduce pathogen contamination in animal production but will also touch on the emerging field of preharvest produce food safety. Mitigation strategies can be divided into those that address pathogen reduction in the environment and those that target reduction/elimination of pathogen contamination in animals or plants. The former strategy has been encompassed in studies evaluating sanitation treatments of facilities as well as in numerous epidemiologic risk assessment studies (both on-farm assessments and computer simulation models) that identify management practices that impact pathogen prevalence in animals. Interventions to significantly reduce pathogen exposure via feed or water are dependent on their role as a significant contributor to pathogen contamination in the animal production system. In addition, inconsistent results obtained with interventions of dietary additives or formulation modifications (grain versus forage; inclusion of distiller's grains) on pathogen prevalence in animals have been attributed to a range of factors including target organism, grain type, level of inclusion, the animal's health or stress level, and ability to survive the gastric acidic conditions. Recent attempts to microencapsulate organic acids or bacteriophage within feed have met with only marginal improvements in reducing pathogen carriage in animals but this approach may have greater potential with other antimicrobial additives (i.e., essential oils). Bacteriophage therapy, in general, can significantly reduce pathogen carriage in animals but based on its transient nature and the potential for development of phage-resistant subpopulations, this approach should be administered to animals just prior to slaughter and

  12. Sensitivity of spoiling and pathogen food-related bacteria to Origanum vulgare L. (Lamiaceae) essential oil

    OpenAIRE

    Souza,Evandro Leite de; Stamford,Tânia Lúcia Montenegro; Lima,Edeltrudes de Oliveira

    2006-01-01

    Origanum vulgare L. (oregano), Lamiaceae, has been known as plant specie with prominent biological properties for a long time. This study aimed to evaluate the antibacterial activity of Origanum vulgare essential oil on various Gram-positive and Gram-negative spoiling and/or pathogen food-related bacteria, as well as to observe its antimicrobial effectiveness in a food conservation micromodel. The results showed a strong antibacterial activity of the assayed essential oil noted by large growt...

  13. Validation of a PCR-based method for detection of food-borne thermotolerant Campylobacters in a multicenter collaborative trial

    DEFF Research Database (Denmark)

    Josefsen, Mathilde Hartmann; Cook, N.; D'Agostino, M.

    2004-01-01

    A PCR-based method for rapid detection of food-borne thermotolerant campylobacters was evaluated through a collaborative trial with 12 laboratories testing spiked carcass rinse samples. The method showed an interlaboratory diagnostic sensitivity of 96.7% and a diagnostic specificity of 100% for c......% for chicken samples, while these values were 94.2 and 83.3%, respectively, for pig samples....

  14. Antimicrobial properties of tropical plants against 12 pathogenic ...

    African Journals Online (AJOL)

    STORAGESEVER

    2008-07-04

    Jul 4, 2008 ... varies depending on bacterial species and type of extract. The average ... more species of bacteria. The most ..... 12 types of food borne bacteria including pathogens. ... the production of human collagen I, a protein associated.

  15. Strategies for the detection of food pathogens and contaminants

    DEFF Research Database (Denmark)

    Hearty, Stephen; Leonard, Paul; Sheehan, Alfredo Darmanin

    molecules and once suitably high affinity antibodies have been isolated, it is relatively straightforward to design and optimise concentration-based assays using SPR. Recently we have investigated the potential of applying Biacore technology to routine food analysis. Our experiences have shown......We routinely use Biacore for affinity ranking and kinetic characterisation of diverse panels of hybridoma-derived and recombinant antibodies against a wide range of different clinically relevant antigens for diagnostic applications. Generally the analytes of interest are haptens or defined protein...... that molecular contaminants such as microbial toxins and drug/pesticide residues translate well onto Biacore-based assay formats. However, larger and more complex entities such as spores and whole bacterial cells represent an altogether more difficult challenge. Here, we present an overview of our experiences...

  16. Inactivation of high concentration of pathogens in land-applied food ...

    African Journals Online (AJOL)

    In Mexico, as in other developing countries, the most important pollution and management problems of food-processing sludge are the high levels of pathogen microorganisms within the sludge and the lack of sites for its disposal. The aims of this study were to evaluate the effect of calcium oxide in the inactivation of ...

  17. Ticks and tick-borne pathogens in South Bohemia (Czech Republic) – Spatial variability in Ixodes ricinus abundance, Borrelia burgdorferi and tick-borne encephalitis virus prevalence

    Czech Academy of Sciences Publication Activity Database

    Hönig, Václav; Švec, P.; Halas, Petr; Vavrušková, Zuzana; Tykalová, Hana; Kilian, Patrik; Vetišková, Vendula; Dorňáková, Veronika; Štěrbová, Jarmila; Šimonová, Zuzana; Erhart, Jan; Štěrba, Ján; Golovchenko, Maryna; Rudenko, Natalia; Grubhoffer, Libor

    2015-01-01

    Roč. 6, č. 5 (2015), s. 559-567 ISSN 1877-959X R&D Projects: GA ČR GD206/09/H026; GA MŠk(CZ) EE2.3.30.0032 Institutional support: RVO:68145535 ; RVO:60077344 Keywords : tick * tick-borne encephalitis * ixodes ricinus * environmental factors * lyme borreliosis Subject RIV: FN - Epidemiology, Contagious Diseases ; Clinical Immunology; EB - Genetics ; Molecular Biology (BC-A) Impact factor: 2.690, year: 2015 http://ac.els-cdn.com/S1877959X15000783/1-s2.0-S1877959X15000783-main.pdf?_tid=8785a702-8de3-11e5-bd28-00000aacb35f&acdnat=1447844587_a91b4e4d404a70fda98b06e4950edb11

  18. Distribution Frequency and Incidence of Seed-borne Pathogens of Some Cereals and Industrial Crops in Serbia

    Directory of Open Access Journals (Sweden)

    Jelena Lević

    2012-01-01

    Full Text Available A total of 41 species of fungi were isolated from seed samples of barley, maize, soybean,and sunflower collected at different locations in Serbia. The majority of detected speciesoccurred on barley (35 of 41 species or 87.8% comparing to soybean (17 of 41 species or41.5%, sunflower (16 of 41 species or 39.0% and maize (15 of 41 species or 36.9%. Speciesbelonging to genera Alternaria, Chaetomium, Epicoccum, Fusarium, Penicillium and Rhizopuswere present on seeds of all four plant species. Alternaria species were dominant on soybean,barley and sunflower seeds (85.7%, 84.7% and 76.9%. F. verticillioides and Penicilliumspp. were mainly isolated from maize seeds (100 and 92.3% respectively, while other specieswere isolated up to 38.5% (Chaetomium spp. and Rhizopus spp.. F. graminearum, F. proliferatum,F. poae and F. sporotrichioides were the most common Fusarium species isolatedfrom barley (51.1-93.3%, while on the soybean seeds F. oxysporum (71.4%, F. semitectum(57.1% and F. sporotrichioides (57.1% were prevalent. Frequency of Fusarium species onsunflower seeds varied from 7% (F. equiseti, F. graminearum, F. proliferatum and F. subglutinansto 15.4% (F. verticillioides. Statistically significant negative correlation (r = –0.678* wasdetermined for the incidence of F. graminearum and Alternaria spp., as well as, Fusarium spp.and Alternaria spp. (r = –0.614*, on barley seeds. The obtained results revealed that seedbornepathogens were present in most seed samples of important cereals and industrialcrops grown under different agroecological conditions in Serbia. Some of the identifiedfungi are potential producers of mycotoxins, thus their presence is important in termsof reduced food safety for humans and animals. Therefore, an early and accurate diagnosisand pathogen surveillance will provide time for the development and the applicationof disease strategies.

  19. Effects of pulsed electric fields on pathogenic microorganisms of major concern in fluid foods: a review.

    Science.gov (United States)

    Mosqueda-Melgar, Jonathan; Elez-Martínez, Pedro; Raybaudi-Massilia, Rosa M; Martín-Belloso, Olga

    2008-09-01

    Pathogenic microorganisms such as Escherichia coli O157:H7, Salmonella spp., Listeria monocytogenes, Bacillus cereus, Staphylococcus aureus, Yersinia enterocolitica, and Campylobacter jejuni have been implicated in foodborne diseases and outbreaks worldwide. These bacteria have been associated with the consumption of fresh fruit juices, milk, and dairy products, which are foodstuff, highly demanded by consumers in retails and supermarkets. Nowadays, consumers require high quality, fresh-like, and safe foods. Pulsed electric field (PEF) is a non-thermal preservation method, able to inactivate pathogenic microorganisms without significant loss of the organoleptic and nutritional properties of food. The PEF treatment effectiveness to destroy bacteria such as Listeria innocua, E. coli, Salmonella Typhimurium, E. coli O157:H7 and E. coli 8739 at pasteurization levels (> or = 5.0 log(10) cycles) in some fluid foods was reported. However, data on the inactivation of some microorganisms such as Bacillus cereus, Staphylococcus aureus, Yersinia enterocolitica, and Campylobacter jejuni in fluid foods by PEF processing is very limited. Therefore, future works should be focused toward the inactivation of these pathogenic bacteria in real foods.

  20. Practical Value of Food Pathogen Traceability through Building a Whole-Genome Sequencing Network and Database.

    Science.gov (United States)

    Allard, Marc W; Strain, Errol; Melka, David; Bunning, Kelly; Musser, Steven M; Brown, Eric W; Timme, Ruth

    2016-08-01

    The FDA has created a United States-based open-source whole-genome sequencing network of state, federal, international, and commercial partners. The GenomeTrakr network represents a first-of-its-kind distributed genomic food shield for characterizing and tracing foodborne outbreak pathogens back to their sources. The GenomeTrakr network is leading investigations of outbreaks of foodborne illnesses and compliance actions with more accurate and rapid recalls of contaminated foods as well as more effective monitoring of preventive controls for food manufacturing environments. An expanded network would serve to provide an international rapid surveillance system for pathogen traceback, which is critical to support an effective public health response to bacterial outbreaks. Copyright © 2016, American Society for Microbiology. All Rights Reserved.

  1. Research and identification of pathogenic bacteria 'Salmonella and Listeria' in food

    International Nuclear Information System (INIS)

    Harizi Khalil

    2009-01-01

    The sums propose to evaluate the bacterial contamination of certain food taken randomly by two pathogenic bacteria (Salmonella and Listeria) considering the evolution of the diseases of food oignon. For that 78 food samples of different origins were analysed. 2 stocks of the Listeria kind and 3 stocks of the salmonella kind were insulated and identified by biochemical and molecular tests. The pathogenic isolates were identified by coloration gram, test catalase, insulation on specific culture media and Api (20 E for Salmonella and Api listeria. At the end, the PCR were realized to amplify the gene iap which codes for the protein p60 at listeria as well as a sequence clonee randomly specific of Salmonella.

  2. Persistence and survival of pathogens in dry foods and dry food processing environments

    NARCIS (Netherlands)

    Beuchat, L.; Komitopoulou, E.; Betts, R.; Beckers, H.; Bourdichon, F.; Joosten, H.; Fanning, S.; ter Kuile, B.

    2011-01-01

    Low-moisture foods and food ingredients, i.e., those appearing to be dry or that have been subjected to a drying process, represent important nutritional constituents of human diets. Some of these foods are naturally low in moisture, such as cereals, honey and nuts, whereas others are produced from

  3. FoodChain-Lab: A Trace-Back and Trace-Forward Tool Developed and Applied during Food-Borne Disease Outbreak Investigations in Germany and Europe.

    Directory of Open Access Journals (Sweden)

    Armin A Weiser

    Full Text Available FoodChain-Lab is modular open-source software for trace-back and trace-forward analysis in food-borne disease outbreak investigations. Development of FoodChain-Lab has been driven by a need for appropriate software in several food-related outbreaks in Germany since 2011. The software allows integrated data management, data linkage, enrichment and visualization as well as interactive supply chain analyses. Identification of possible outbreak sources or vehicles is facilitated by calculation of tracing scores for food-handling stations (companies or persons and food products under investigation. The software also supports consideration of station-specific cross-contamination, analysis of geographical relationships, and topological clustering of the tracing network structure. FoodChain-Lab has been applied successfully in previous outbreak investigations, for example during the 2011 EHEC outbreak and the 2013/14 European hepatitis A outbreak. The software is most useful in complex, multi-area outbreak investigations where epidemiological evidence may be insufficient to discriminate between multiple implicated food products. The automated analysis and visualization components would be of greater value if trading information on food ingredients and compound products was more easily available.

  4. FoodChain-Lab: A Trace-Back and Trace-Forward Tool Developed and Applied during Food-Borne Disease Outbreak Investigations in Germany and Europe.

    Science.gov (United States)

    Weiser, Armin A; Thöns, Christian; Filter, Matthias; Falenski, Alexander; Appel, Bernd; Käsbohrer, Annemarie

    2016-01-01

    FoodChain-Lab is modular open-source software for trace-back and trace-forward analysis in food-borne disease outbreak investigations. Development of FoodChain-Lab has been driven by a need for appropriate software in several food-related outbreaks in Germany since 2011. The software allows integrated data management, data linkage, enrichment and visualization as well as interactive supply chain analyses. Identification of possible outbreak sources or vehicles is facilitated by calculation of tracing scores for food-handling stations (companies or persons) and food products under investigation. The software also supports consideration of station-specific cross-contamination, analysis of geographical relationships, and topological clustering of the tracing network structure. FoodChain-Lab has been applied successfully in previous outbreak investigations, for example during the 2011 EHEC outbreak and the 2013/14 European hepatitis A outbreak. The software is most useful in complex, multi-area outbreak investigations where epidemiological evidence may be insufficient to discriminate between multiple implicated food products. The automated analysis and visualization components would be of greater value if trading information on food ingredients and compound products was more easily available.

  5. PFGE: importance in food quality.

    Science.gov (United States)

    Vernile, Anna; Giammanco, Giovanni; Massa, Salvatore

    2009-11-01

    In late 19 century, great interest has arisen for food quality. This is referred as absence of pathogens in food (safety for consumers) and as nutritional quality of food (organoleptic characteristics). Pulsed-field gel electrophoresis (PFGE) is, among the molecular techniques developed in the last years, one of the most reliable, discriminative and reproducible technique. It can be used in clinical field for the identification of pathogens and the origin of outbreaks, and in food microbiology for the identification of pathogens (food borne disease surveillance) or of microorganisms responsible for the organoleptic characteristics of food. The present article shows some useful patents related to PFGE and importance in food quality.

  6. Impact of Pathogen Population Heterogeneity and Stress-Resistant Variants on Food Safety.

    Science.gov (United States)

    Abee, T; Koomen, J; Metselaar, K I; Zwietering, M H; den Besten, H M W

    2016-01-01

    This review elucidates the state-of-the-art knowledge about pathogen population heterogeneity and describes the genotypic and phenotypic analyses of persister subpopulations and stress-resistant variants. The molecular mechanisms underlying the generation of persister phenotypes and genetic variants are identified. Zooming in on Listeria monocytogenes, a comparative whole-genome sequence analysis of wild types and variants that enabled the identification of mutations in variants obtained after a single exposure to lethal food-relevant stresses is described. Genotypic and phenotypic features are compared to those for persistent strains isolated from food processing environments. Inactivation kinetics, models used for fitting, and the concept of kinetic modeling-based schemes for detection of variants are presented. Furthermore, robustness and fitness parameters of L. monocytogenes wild type and variants are used to model their performance in food chains. Finally, the impact of stress-resistant variants and persistence in food processing environments on food safety is discussed.

  7. The occurrence of Ixodes ricinus ticks and important tick-borne pathogens in areas with high tick-borne encephalitis prevalence in different altitudinal levels of the Czech Republic. Part I. Ixodes ricinus ticks and tick-borne encephalitis virus

    Czech Academy of Sciences Publication Activity Database

    Daniel, M.; Danielová, V.; Kříž, B.; Růžek, Daniel; Fialová, A.; Malý, M.; Materna, J.; Pejčoch, M.; Erhart, Jan

    2016-01-01

    Roč. 65, č. 2 (2016), s. 118-128 ISSN 1210-7913 Institutional support: RVO:60077344 Keywords : Ixodes ricinus * tick-borne encephalitis virus * occurence * altitude * region * season Subject RIV: GJ - Animal Vermins ; Diseases, Veterinary Medicine Impact factor: 0.500, year: 2016

  8. FISHing for bacteria in food--a promising tool for the reliable detection of pathogenic bacteria?

    Science.gov (United States)

    Rohde, Alexander; Hammerl, Jens Andre; Appel, Bernd; Dieckmann, Ralf; Al Dahouk, Sascha

    2015-04-01

    Foodborne pathogens cause millions of infections every year and are responsible for considerable economic losses worldwide. The current gold standard for the detection of bacterial pathogens in food is still the conventional cultivation following standardized and generally accepted protocols. However, these methods are time-consuming and do not provide fast information about food contaminations and thus are limited in their ability to protect consumers in time from potential microbial hazards. Fluorescence in situ hybridization (FISH) represents a rapid and highly specific technique for whole-cell detection. This review aims to summarize the current data on FISH-testing for the detection of pathogenic bacteria in different food matrices and to evaluate its suitability for the implementation in routine testing. In this context, the use of FISH in different matrices and their pretreatment will be presented, the sensitivity and specificity of FISH tests will be considered and the need for automation shall be discussed as well as the use of technological improvements to overcome current hurdles for a broad application in monitoring food safety. In addition, the overall economical feasibility will be assessed in a rough calculation of costs, and strengths and weaknesses of FISH are considered in comparison with traditional and well-established detection methods. Copyright © 2014 The Authors. Published by Elsevier Ltd.. All rights reserved.

  9. EFSA BIOHAZ Panel (EFSA Panel on Biological Hazards) , 2013 . Scientific Opinion on the evaluation of molecular typing methods for major food-borne microbiological hazards and their use for attribution modelling, outbreak investigation and scanning surveillance: Part 1 (evaluation of methods

    DEFF Research Database (Denmark)

    Hald, Tine; Baggesen, Dorte Lau

    An evaluation of molecular typing methods that can be applied to the food-borne pathogens Salmonella, Campylobacter, Shiga toxin-producing Escherichia coli and Listeria monocytogenes is presented. This evaluation is divided in two parts. Firstly, commonly used molecular typing methods are assessed...... against a set of predefined criteria relating to discriminatory capacity, reproducibility, repeatability and current or potential suitability for international harmonisation. Secondly, the methods are evaluated for their appropriateness for use in different public health-related applications...... and potential for use of molecular characterisation methods, including whole genome sequencing technologies, in microbial food safety. Recommendations are also made in order to encourage a holistic and structured approach to the use of molecular characterisation methods for food-borne pathogens; in particular...

  10. Variability of Effective Micro-organisms (EM) in bokashi and soil and effects on soil-borne plant pathogens

    NARCIS (Netherlands)

    Shin, Keumchul; Diepen, van G.; Blok, W.; Bruggen, van A.H.C.

    2017-01-01

    The microbial inoculant ‘Effective Microorganisms’ (EM) has been used to promote soil fertility and plant growth in agriculture. We tested effects of commercial EM products on suppression of soil-borne diseases, microbial activity and bacterial composition in organically managed sandy soils. EM was

  11. Microbial diversity and prevalence of foodborne pathogens in cheap and junk foods consumed by primary schoolchildren.

    Science.gov (United States)

    Kim, M J; Kim, S A; Kang, Y S; Hwang, I G; Rhee, M S

    2013-07-01

    Aerobic plate counts (APC), coliforms, Bacillus cereus, Escherichia coli and eight foodborne pathogens were tested in 1008 cheap and junk foods, including candies, dried cakes, chewing gum, chocolate, dried and seasoned seafood, ice cream, and sugary foods. APCs were positive for 342 samples (33·9%), and the majority of the counts were 2-3 log CFU g(-1) or ml(-1) (average: 1·10 log CFU g(-1) or ml(-1) ). Most samples (97·3%) contained no coliforms (average: 0·07 log CFU g(-1) or ml(-1) ). Bacillus cereus was detected in 68 samples (average: 0·14 log CFU g(-1) or ml(-1) ). Escherichia coli and Listeria monocytogenes were detected in 6 and 1 samples, respectively, whereas other foodborne pathogens were not isolated. The highest bacterial counts were associated with dried and seasoned seafood products and dried cakes, suggesting that appropriate regulations of these food types should be considered. Cheap and junk foods were produced mainly in developing countries, but there were no significant differences in the bacterial counts among different countries of origin. The presence of foodborne pathogens may pose a risk for children. These results suggest that there is cause for deeper concern about the safety of these foods and that effective countermeasures should be established to improve their microbiological safety. Food safety is especially important for children, but only limited information is available about the microbiological quality of cheap and junk foods that are consumed frequently by primary schoolchildren (e.g. dried cakes, candies and chocolates). The present study investigated the microbial quality of cheap and junk foods, and our results indicate that these foods are a potential health risk for children, therefore, deeper concern about the safety of these foods and effective countermeasures should be established to improve their microbiological safety. The present study may contribute to the development of an appropriate child food

  12. In vitro screening of probiotic properties of Saccharomyces cerevisiae var. boulardii and food-borne Saccharomyces cerevisiae strains.

    Science.gov (United States)

    van der Aa Kühle, Alis; Skovgaard, Kerstin; Jespersen, Lene

    2005-05-01

    The probiotic potential of 18 Saccharomyces cerevisiae strains used for production of foods or beverages or isolated from such, and eight strains of Saccharomyces cerevisiae var. boulardii, was investigated. All strains included were able to withstand pH 2.5 and 0.3% Oxgall. Adhesion to the nontumorigenic porcine jejunal epithelial cell line (IPEC-J2) was investigated by incorporation of 3H-methionine into the yeast cells and use of liquid scintillation counting. Only few of the food-borne S. cerevisiae strains exhibited noteworthy adhesiveness with the strongest levels of adhesion (13.6-16.8%) recorded for two isolates from blue veined cheeses. Merely 25% of the S. cerevisiae var. boulardii strains displayed good adhesive properties (16.2-28.0%). The expression of the proinflammatory cytokine IL-1alpha decreased strikingly in IPEC-J2 cells exposed to a Shiga-like toxin 2e producing Escherichia coli strain when the cells were pre- and coincubated with S. cerevisiae var. boulardii even though this yeast strain was low adhesive (5.4%), suggesting that adhesion is not a mandatory prerequisite for such a probiotic effect. A strain of S. cerevisiae isolated from West African sorghum beer exerted similar effects hence indicating that food-borne strains of S. cerevisiae may possess probiotic properties in spite of low adhesiveness.

  13. Development of genetic methods for detection of pathogenic microorganisms in irradiated food

    International Nuclear Information System (INIS)

    2010-01-01

    The existence of injured microorganisms in food and their recovery during culturing procedures is critical. Injured microorganisms present a potential threat in food safety since they may repair themselves under suitable conditions. This study provides development of recovery methods for detection of injured foodborne microorganisms, after irradiation treatment at different doses. For this purpose, iniatially the methods of recovery were compared at different irradiation doses. At the second step, antibiotic resistance of foodborne pathogens was determined. After determination of antibiotic resistance, recovery methods were modified for reversibly injured foodborne pathogens at different doses after irradiation treatment . Finally, damages of DNA were detected by a spectrophotometric method after 1.0 kGy irradiation treatment

  14. Study on coinfecting vector-borne pathogens in dogs and ticks in Rio Grande do Norte, Brazil

    Directory of Open Access Journals (Sweden)

    Luiz Ricardo Gonçalves

    Full Text Available Since dogs presenting several vector borne diseases can show none or nonspecific clinical signs depending on the phase of infection, the assessment of the particular agents involved is mandatory. The present study aimed to investigate the presence of Babesia spp., Ehrlichia spp., Anaplasma spp., Hepatozoon spp. and Leishmania spp. in blood samples and ticks, collected from two dogs from Rio Grande do Norte showing suggestive tick-borne disease by using molecular techniques. DNA of E. canis, H. canis and L. infantum were detected in blood samples and R. sanguineus ticks collected from dogs. Among all samples analyzed, two showed the presence of multiple infections with E. canis, H. canis and L. infantum chagasi. Here we highlighted the need for molecular differential diagnosis in dogs showing nonspecific clinical signs.

  15. New trends in emerging pathogens.

    Science.gov (United States)

    Skovgaard, Niels

    2007-12-15

    The emergence of pathogens is the result of a number of impact in all parts of the food chain. The emerging technologies in food production explain how new pathogens can establish themselves in the food chain and compromise food safety. The impact of the food technology is analysed for several bacteria, such as Yersinia, Campylobacter, Arcobacter, Helicobacter pullorum, Enterobacter sakazakii, Mycobacterium avium spp. paratuberculosis, prions related to vCJD and others. The importance of the ability of many microbes to form VBNC forms is elaborated on. Research on culture independent methods may address this outstanding issue to the better understanding of emerging pathogens. The "demerging" of pathogens also occur, and examples of this are explained. The reaction of bacteria to stresses and sublethal treatments, and how exposure to one stress factor can confer resistance to other stresses, literally speaking causing contagious resistance, are explained. The implication of this e.g. in modern approaches of food preservation, such as Minimally processed Foods, is considerable. Intestinal colonization of EHEC may be regulated by Quorum sensing, and this ability of microbes plays an important role in the colonization of microbes in food and on food processing equipment, an important factor in the emergence of pathogens. The emergence of Saccharomyces cerevisiae, as an opportunistic human pathogen, used for centuries for food and production of alcoholic beverages, calls for research in molecular tools to distinguish between probiotic and clinical strains. Cyclospora cayetanensis and Norovirus outbreaks can no longer be designated as emerging pathogens, they share however one characteristic in the epidemiology of emerging nature, the importance of the hygiene in the primary production stage, including supply of potable water, and the application of GMP and the HACCP principles in the beginning of the food chain. Hepatitis E virus is a potential emerging food borne

  16. THE USE OF PLANTS TO PROTECT PLANTS AND FOOD AGAINST FUNGAL PATHOGENS: A REVIEW.

    Science.gov (United States)

    Shuping, D S S; Eloff, J N

    2017-01-01

    Plant fungal pathogens play a crucial role in the profitability, quality and quantity of plant production. These phytopathogens are persistent in avoiding plant defences causing diseases and quality losses around the world that amount to billions of US dollars annually. To control the scourge of plant fungal diseases, farmers have used fungicides to manage the damage of plant pathogenic fungi. Drawbacks such as development of resistance and environmental toxicity associated with these chemicals have motivated researchers and cultivators to investigate other possibilities. Several databases were accessed to determine work done on protecting plants against plant fungal pathogens with plant extracts using search terms "plant fungal pathogen", "plant extracts" and "phytopathogens". Proposals are made on the best extractants and bioassay techniques to be used. In addition to chemical fungicides, biological agents have been used to deal with plant fungal diseases. There are many examples where plant extracts or plant derived compounds have been used as commercial deterrents of fungi on a large scale in agricultural and horticultural setups. One advantage of this approach is that plant extracts usually contain more than one antifungal compound. Consequently the development of resistance of pathogens may be lower if the different compounds affect a different metabolic process. Plants cultivated using plants extracts may also be marketed as organically produced. Many papers have been published on effective antimicrobial compounds present in plant extracts focusing on applications in human health. More research is required to develop suitable, sustainable, effective, cheaper botanical products that can be used to help overcome the scourge of plant fungal diseases. Scientists who have worked only on using plants to control human and animal fungal pathogens should consider the advantages of focusing on plant fungal pathogens. This approach could not only potentially increase

  17. Comparison of three Listeria monocytogenes strains in a guinea-pig model simulating food-borne exposure

    DEFF Research Database (Denmark)

    Roldgaard, Bent; Andersen, Jens Bo; Hansen, Tina Beck

    2009-01-01

    Three different Listeria monocytogenes strains, LO28 (a laboratory strain with truncated InlA), 4446 (a clinical isolate) and 7291 (a food isolate), were compared in a guinea-pig model designed to mimic food-borne exposure. The objectives were (1) to verify the applicability of the animal model...... for distinguishing between Listeria with different virulence properties and (2) to explore whether it was possible to reduce the required number of animals by dosing with mixed cultures instead of monocultures. Consistent with in vitro observations of infectivity in Caco-2 cells, faecal densities and presence...... of Listeria strains gave similar results as dosage with a mixture of the three strains; thus, the mixed infection approach was a feasible way to reduce the number of animals needed for determination of listerial virulence....

  18. [Survey of the presence of bacterial pathogens in foods sold at retail stores in the city of Cassino].

    Science.gov (United States)

    Langiano, E; Atrei, P; La Torre, G; De Vito, E; Ricciardi, G

    2002-01-01

    The presence of bacterial food pathogens was evaluated in 154 food samples collected from supermarkets and butchers in the city of Cassino (South-Central Italy). Food pathogens were identified in 17.5% of the total food samples. In the raw meat samples, 24.6% tested positives for Listeria monocytogenes, 4.3% for Salmonella and 2.9% for Escherichia coli O157. Y. enterocolitica, only investigated in pork meat, was identified in 7.4% of the samples. In poultry, L. monocytogenes was identified in 55% of the samples.

  19. Determination of Bacterial Pathogen in Foods for Export and their Raw Material

    Energy Technology Data Exchange (ETDEWEB)

    Marambio, E.; Cordano, A. M.; Insunza, M.; Fernández, M.; Astorga, J. [Sección Microbiología de Alimentos, Instituto de Salud Pública de Chile (Chile)

    2005-01-15

    Chile is a South American country with an important fish and shellfish production. These products are some of the most important items for the economy of the country. From 1998 to 2001, Chile exported $1 137 625 788 of fish and shellfish. Statistics also show that frozen vegetables are fast becoming high on the food export list. During recent years (1998 to 2001) $223 312 248 worth of frozen vegetables were exported to different countries. This study was performed to trace the presence of pathogens in some of these Chilean foods to be exported: 97 samples of salmon and 84 samples of different frozen vegetables (asparagus, peas and corn) were analyzed in order to determine their levels of microbial contamination. Total bacteria counts (mesophilic aerobes bacteria), Escherichia coli, Staphylococcus aureus, Bacillus cereus, Clostridium perfringens, Salmonella spp. and Listeria monocytogenes were tested. Vibrio cholerae was tested only in salmon samples. The analysis of salmon samples showed that the raw material presented a very good quality. However, during the filleting process the fish was contaminated, presenting higher total bacteria counts. Only one of the 48 final product samples presented contamination with a pathogenic bacteria (Listeria monocytogenes (<100 cfu/g)). Frozen vegetable samples (raw material and final products) did not present any of the pathogen bacteria studied. The mesophilic aerobes bacteria counts were reduced during processing due to the effectiveness of the good manufacturing practices and the technological process used. (author)

  20. Determination of Bacterial Pathogen in Foods for Export and their Raw Material

    International Nuclear Information System (INIS)

    Marambio, E.; Cordano, A.M.; Insunza, M.; Fernández, M.; Astorga, J.

    2005-01-01

    Chile is a South American country with an important fish and shellfish production. These products are some of the most important items for the economy of the country. From 1998 to 2001, Chile exported $1 137 625 788 of fish and shellfish. Statistics also show that frozen vegetables are fast becoming high on the food export list. During recent years (1998 to 2001) $223 312 248 worth of frozen vegetables were exported to different countries. This study was performed to trace the presence of pathogens in some of these Chilean foods to be exported: 97 samples of salmon and 84 samples of different frozen vegetables (asparagus, peas and corn) were analyzed in order to determine their levels of microbial contamination. Total bacteria counts (mesophilic aerobes bacteria), Escherichia coli, Staphylococcus aureus, Bacillus cereus, Clostridium perfringens, Salmonella spp. and Listeria monocytogenes were tested. Vibrio cholerae was tested only in salmon samples. The analysis of salmon samples showed that the raw material presented a very good quality. However, during the filleting process the fish was contaminated, presenting higher total bacteria counts. Only one of the 48 final product samples presented contamination with a pathogenic bacteria (Listeria monocytogenes (<100 cfu/g)). Frozen vegetable samples (raw material and final products) did not present any of the pathogen bacteria studied. The mesophilic aerobes bacteria counts were reduced during processing due to the effectiveness of the good manufacturing practices and the technological process used. (author)

  1. [Detection of biofilm formation by selected pathogens relevant to the food industry].

    Science.gov (United States)

    Šilhová-Hrušková, L; Moťková, P; Šilha, D; Vytřasová, J

    2015-09-01

    Detection of biofilm formation by microbial pathogens relevant to the food industry and comparison of biofilm formation under different conditions of culture. The following microorganisms were selected for the study: Staphylococcus aureus, Listeria innocua, Listeria ivanovii, Cronobacter sakazakii, Cronobacter muytjensii, Arcobacter butzleri, Arcobacter cryaerophilus, Campylobacter jejuni, and Campylobacter coli. To detect biofilm formation the microtiter plate assay, as described by Christensen and culture on stainless steel coupons were used. The biofilm forming capacity was confirmed in all microorganisms tested, both on the microtiter plates and stainless steel coupons. Biofilm formation was influenced by the culture medium, material used, and culture duration as well as by the test microorganism. It was found that different species and strains of the same genus differ in biofilm formation. Differences were also found between the collection strains and isolates from the environment. Some bacteria tended to form biofilm more readily on the surface of the polyethylene microtiter plates and less readily on stainless steel coupons while others appeared to have an opposite tendency. Some pathogens were able to increase the planktonic cell density in the initial suspension even by three orders of magnitude within 72 hours while producing plenty of biofilm. The study of biofilm formation by high risk pathogens is of utmost importance, not only to the food industry. From the obtained results, it is evident that bacterial biofilms form rapidly (within 24 hours in the present study). Due to their architecture, these biofilms are difficult to eradicate, and therefore, it is crucial to prevent biofilm formation.

  2. Sporothrix chilensis sp. nov. (Ascomycota: Ophiostomatales), a soil-borne agent of human sporotrichosis with mild-pathogenic potential to mammals.

    Science.gov (United States)

    Rodrigues, Anderson Messias; Cruz Choappa, Rodrigo; Fernandes, Geisa Ferreira; de Hoog, G Sybren; de Camargo, Zoilo Pires

    2016-02-01

    A combination of phylogeny, evolution, morphologies and ecologies has enabled major advances in understanding the taxonomy of Sporothrix species, including members exhibiting distinct lifestyles such as saprobes, human/animal pathogens, and insect symbionts. Phylogenetic analyses of ITS1/2 + 5.8s sequences split Sporothrix genus in two well-defined groups with dissimilar ecologies. Species embedded in the Sporothrix schenckii complex are frequently agents of human and animal sporotrichosis, and some of these are responsible for large sapronoses and zoonoses around the warmer temperate regions of the world. At the other extreme, basal saprophytic species evolved in association with decaying wood and soil, and are rarely found to cause human disease. We propose to create a new taxa, Sporothrix chilensis sp. nov., to accommodate strains collected from a clinical case of onychomycosis as well as from environmental origins in Chile. Multigene analyses based on ITS1/2 + 5.8s region, beta-tubulin, calmodulin and translation elongation factor 1α revealed that S. chilensis is a member of the Sporothrix pallida complex, and the nearest taxon is Sporothrix mexicana, a rare soil-borne species, non-pathogenic to humans. The ITS region serves as a primary barcode marker, while each one of the protein-coding loci easily recognized species boundaries providing sufficient information for species identification. A disseminated model of murine sporotrichosis revealed a mild-pathogenic potential, with lung invasion. Although S. chilensis is not a primary pathogen, accidental infection may have an impact in the immunosuppressed population. With the introduction of distinct species with similar routes of transmission but different virulence, identification of Sporothrix agents at the species level is mandatory. Copyright © 2015 The British Mycological Society. Published by Elsevier Ltd. All rights reserved.

  3. PCR diagnosis of tick-borne pathogens in Maharashtra state, India indicates fitness cost associated with carrier infections is greater for crossbreed than native cattle breeds.

    Directory of Open Access Journals (Sweden)

    Sunil W Kolte

    Full Text Available Tick-borne pathogens (TBP are responsible for significant economic losses to cattle production, globally. This is particularly true in countries like India where TBP constrain rearing of high yielding Bos taurus, as they show susceptibility to acute tick borne disease (TBD, most notably tropical theileriosis caused by Theileria annulata. This has led to a programme of cross breeding Bos taurus (Holstein-Friesian or Jersey with native Bos indicus (numerous breeds to generate cattle that are more resistant to disease. However, the cost to fitness of subclinical carrier infection in crossbreeds relative to native breeds is unknown, but could represent a significant hidden economic cost. In this study, a total of 1052 bovine blood samples, together with associated data on host type, sex and body score, were collected from apparently healthy animals in four different agro-climatic zones of Maharashtra state. Samples were screened by PCR for detection of five major TBPs: T. annulata, T. orientalis, B. bigemina, B. bovis and Anaplasma spp.. The results demonstrated that single and co-infection with TBP are common, and although differences in pathogen spp. prevalence across the climatic zones were detected, simplistic regression models predicted that host type, sex and location are all likely to impact on prevalence of TBP. In order to remove issues with autocorrelation between variables, a subset of the dataset was modelled to assess any impact of TBP infection on body score of crossbreed versus native breed cattle (breed type. The model showed significant association between infection with TBP (particularly apicomplexan parasites and poorer body condition for crossbreed animals. These findings indicate potential cost of TBP carrier infection on crossbreed productivity. Thus, there is a case for development of strategies for targeted breeding to combine productivity traits with disease resistance, or to prevent transmission of TBP in India for economic

  4. PCR diagnosis of tick-borne pathogens in Maharashtra state, India indicates fitness cost associated with carrier infections is greater for crossbreed than native cattle breeds.

    Science.gov (United States)

    Kolte, Sunil W; Larcombe, Stephen D; Jadhao, Suresh G; Magar, Swapnil P; Warthi, Ganesh; Kurkure, Nitin V; Glass, Elizabeth J; Shiels, Brian R

    2017-01-01

    Tick-borne pathogens (TBP) are responsible for significant economic losses to cattle production, globally. This is particularly true in countries like India where TBP constrain rearing of high yielding Bos taurus, as they show susceptibility to acute tick borne disease (TBD), most notably tropical theileriosis caused by Theileria annulata. This has led to a programme of cross breeding Bos taurus (Holstein-Friesian or Jersey) with native Bos indicus (numerous) breeds to generate cattle that are more resistant to disease. However, the cost to fitness of subclinical carrier infection in crossbreeds relative to native breeds is unknown, but could represent a significant hidden economic cost. In this study, a total of 1052 bovine blood samples, together with associated data on host type, sex and body score, were collected from apparently healthy animals in four different agro-climatic zones of Maharashtra state. Samples were screened by PCR for detection of five major TBPs: T. annulata, T. orientalis, B. bigemina, B. bovis and Anaplasma spp.. The results demonstrated that single and co-infection with TBP are common, and although differences in pathogen spp. prevalence across the climatic zones were detected, simplistic regression models predicted that host type, sex and location are all likely to impact on prevalence of TBP. In order to remove issues with autocorrelation between variables, a subset of the dataset was modelled to assess any impact of TBP infection on body score of crossbreed versus native breed cattle (breed type). The model showed significant association between infection with TBP (particularly apicomplexan parasites) and poorer body condition for crossbreed animals. These findings indicate potential cost of TBP carrier infection on crossbreed productivity. Thus, there is a case for development of strategies for targeted breeding to combine productivity traits with disease resistance, or to prevent transmission of TBP in India for economic benefit.

  5. Search and molecular identification of two pathogenic bacteria (Salmonella and Listeria) in different food matrices

    International Nuclear Information System (INIS)

    Wislati, Mohamed Amine

    2010-01-01

    A food is a substance consumed in the natural state or after a cooking. The essential role of food is the apport of essential elements in the growth and in the energy needs as well as in the reserves of the body. Foodstuffs may be contaminated by microorganisms such as the viruses, the parasites, the bacteria at the different steps of production, transformation, transport and manipulation being able to engender food collective toxi-infections (T.I.A.C), infections. This study contains a research directed by two pathogenic germs; Listeria and Salmonella as food contaminants, ending at the man's respectively in two diseases: the Listeriosis and the Salmonellosis and the enumeration of the fecal coliform as indicators of lack of hygiene and a contamination of fecal origin. 90 samples of various types and origins are analyzed in the laboratory of biology and molecular microbiology of the (CNSTN) and are identified by Api (Listeria, 20E) and by PCR. Three origins of Listeria and four origins of Salmonella were isolated. Then, the healthiness of various lots was estimated (dairy products, produced meat-based and produced ready to be eaten) according to the plan of interpretation of the result (plan 2 classes) and (plan 3 classes).The obtained results confirm the contamination of our products taken from the market of public consumption. So the strengthen measures of prevention and health control are very important in the food industry.

  6. Dual effects of Metarhizium spp. and Clonostachys rosea against an insect and a seed-borne pathogen in wheat.

    Science.gov (United States)

    Keyser, Chad A; Jensen, Birgit; Meyling, Nicolai V

    2016-03-01

    Crops are often prone to both insect herbivory and disease, which necessitate multiple control measures. Ideally, an efficacious biological control agent must adequately control the target organism and not be inhibited by other biological control agents when applied simultaneously. Wheat seeds infected with the plant pathogen Fusarium culmorum were treated with Metarhizium brunneum or M. flavoviride and Clonostachys rosea individually and in combination, with the expectation to control both root-feeding insects and the pathogen. Emerging roots were evaluated for disease and then placed with Tenebrio molitor larvae, which were monitored for infection. Plant disease symptoms were nearly absent for seeds treated with C. rosea, both individually and in combination with Metarhizium spp. Furthermore, roots grown from seeds treated with Metarhizium spp. caused significant levels of fungal infection in larvae when used individually or combined with C. rosea. However, cotreated seeds showed reduced virulence towards T. molitor when compared with treatments using Metarhizium spp. only. This study clearly shows that seed treatments with both the entomopathogenic fungus M. brunneum and the mycoparasitic fungus C. rosea can protect plant roots from insects and disease. The dual-treatment approach to biological control presented here is consistent with the ideals of IPM strategies. © 2015 Society of Chemical Industry.

  7. Research regarding the antimicrobial activity of essential oils against food borne bacteria and toxigenic fungi

    Directory of Open Access Journals (Sweden)

    ALINA A. DOBRE

    2011-12-01

    Full Text Available The aim of this research was to evaluate the in vitro antimicrobial activity of seven essential oils against four different bacterial and five fungal strains that are involved in food poisoning and/or food decay: Staphylococcus aureus, Bacillus cereus, Escherichia coli, Salmonella enteritidis, Fusarium graminearum, Fusarium culmorum, Aspergillus flavus, Aspergillus oryzae and Aspergillus brasiliensis, using two methods: agar disc diffusion method and disc volatilization method. The majority of the selected essential oils presented inhibitory activity against all the microorganisms tested but essential oils of oregano, thyme and clove proved to develop the best antibacterial and antifungal activity both in direct contact and volatilization method and could be used for further investigation in active packaging of food.

  8. Study on the overview on food borne bacteria in food with animal origin in Iran; Part three: seafood

    Directory of Open Access Journals (Sweden)

    S.S Shekarforoush

    2013-02-01

    Full Text Available The current retrospective study was focused on the contamination of seafood in Iran during the years 1999 to 2012. The isolates were Clostridium botulinum, Clostridium perferingense, Escherichia coli, Listeria monocytogenes, Salmonella, Shigella, Staphylococcus aureus and Vibrio parahemolyticus. C. botulinum type E was the most prevalent type of bacteria in the fisheries products, responsible for the most cases of botulinal food poisoning. The presence of coliforms and E. coli in the seafood was due to environmental pollution. Additionally, in the processed food, the contamination of potable water and poor handling of the products are the main sources. L. monocytogenes was isolated from fresh, frozen and processed food. The microorganism is able to grow in the refrigeration condition and multiply in the processed food. The temperature of cold smoking (20-30 ºC cannot stop growing of Listeria. High prevalence of Salmonella in water and fisheries product was mainly because of the low environmental sanitation and various geographical conditions. However, Compost fertilizer and flowing of the swages through the farms were considered as the major source of contamination. S. aureus is not a typical microorganism of the fisheries farms but may contaminate them during the processing or in-appropriate handling of the products. V. Parahemolyticus is a normal habitant organism of the pelagic area. The organism usually find in the warm water and presents in the tropical conditions. Different species of Vibrio may contaminate the salty water in the warm seasons and so contaminate the aquatics farms in these areas. In general, the prevalence of vibriosis was associated with the consumption of semi-cooked food stuff and/or the secondary contamination of the processed ones.

  9. Real-time pathogen monitoring during enrichment: a novel nanotechnology-based approach to food safety testing.

    Science.gov (United States)

    Weidemaier, Kristin; Carruthers, Erin; Curry, Adam; Kuroda, Melody; Fallows, Eric; Thomas, Joseph; Sherman, Douglas; Muldoon, Mark

    2015-04-02

    We describe a new approach for the real-time detection and identification of pathogens in food and environmental samples undergoing culture. Surface Enhanced Raman Scattering (SERS) nanoparticles are combined with a novel homogeneous immunoassay to allow sensitive detection of pathogens in complex samples such as stomached food without the need for wash steps or extensive sample preparation. SERS-labeled immunoassay reagents are present in the cultural enrichment vessel, and the signal is monitored real-time through the wall of the vessel while culture is ongoing. This continuous monitoring of pathogen load throughout the enrichment process enables rapid, hands-free detection of food pathogens. Furthermore, the integration of the food pathogen immunoassay directly into the enrichment vessel enables fully biocontained food safety testing, thereby significantly reducing the risk of contaminating the surrounding environment with enriched pathogens. Here, we present experimental results showing the detection of E. coli, Salmonella, or Listeria in several matrices (raw ground beef, raw ground poultry, chocolate milk, tuna salad, spinach, brie cheese, hot dogs, deli turkey, orange juice, cola, and swabs and sponges used to sample a stainless steel surface) using the SERS system and demonstrate the accuracy of the approach compared to plating results. Copyright © 2014 Elsevier B.V. All rights reserved.

  10. Tick (Amblyomma chabaudi) infestation of endemic tortoises in southwest Madagascar and investigation of tick-borne pathogens.

    Science.gov (United States)

    Ehlers, Julian; Ganzhorn, Jörg U; Silaghi, Cornelia; Krüger, Andreas; Pothmann, Daniela; Ratovonamana, R Yedidya; Veit, Alexandra; Keller, Christian; Poppert, Sven

    2016-03-01

    Little is known about the role of endemic ticks as vectors for bacterial and protozoan pathogens for animals and humans in Madagascar and their interaction in anthropogenic habitats where humans, their livestock and native Malagasy species (vectors and hosts) come into more frequent contact than in natural forest ecosystems. The aims of the study were (1) to test whether habitat degradation is associated with increased infestation of tortoises by ticks and (2) to investigate whether ticks carried Babesia, Borrelia or Rickettsia species that might be pathogenic for humans and livestock. We studied hard ticks of two endemic Malagasy tortoises, Astrochelys radiata and Pyxis arachnoides in March and April 2013 in southwest Madagascar. Two tortoise habitats were compared, the National Park of Tsimanampetsotsa and the adjacent degraded pasture and agricultural land at the end of the wet season. Ticks were screened for protozoan and bacterial pathogens via PCR on DNA isolated from ticks using genus-specific primers. Only one out of 42 A. radiata collected from both habitats had ticks. The low prevalence did not allow further analyses of the effect of habitat degradation. Forty-two P. arachnoides were found in the anthropogenic habitat and 36 individuals in the national park. Tick infestation rates of P. arachnoides differed significantly between the two study sites. Tortoises inside the park had lower tick prevalence than outside (8 of 36 (22%) versus 32 of 42 individuals (76%)) and infected animals tended to have fewer ticks inside than outside the park. All ticks collected in both habitats were adults of the ixodid tick Amblyomma chabaudi, which is supposed to be a host-specific tick of P. arachnoides. Screening for Borrelia sp. and Babesia sp. was negative in all ticks. But all A. chabaudi ticks were infected with Rickettsia africae, known to cause spotted fever in humans. Thus, habitat degradation seems to be linked to higher infestation of tortoises with ticks with

  11. Mathematical modeling the cross-contamination of food pathogens on the surface of ready-to-eat meats while slicing

    Science.gov (United States)

    The knowledge regarding food pathogens (Listeria monocytogenes, Escherichia coli O157:H7 and Salmonella spp.) surface transfer on ready-to-eat (RTE) deli meat and the slicer used for slicing different RTE products are needed to ensure RTE food safety. The objectives of this study were to investigat...

  12. Learning about Foodborne Pathogens: Evaluation of Student Perceptions of Group Project Work in a Food Microbiology Course

    Science.gov (United States)

    Turner, Mark S.

    2009-01-01

    This study examined the experiences of students in an active learning group work exercise in an introductory food microbiology course involving the study of foodborne pathogens. Small groups were required to access, analyze, and present information regarding a single food poisoning bacterium. The presentations contained features and…

  13. Role of Waterborne Pathogens in the Food Supply Chain: Implications to Risk Management with Local and Global Perspectives

    Science.gov (United States)

    Microbial risk assessment (MRA) in the food industry is used to support HACCP – which largely focuses on bacterial pathogen control in processing foodstuffs Potential role of microbially-contaminated water used in food production is not as well understood Emergence...

  14. A proteomic approach provides new insights into the control of soil-borne plant pathogens by Bacillus species.

    Directory of Open Access Journals (Sweden)

    Omür Baysal

    Full Text Available Beneficial microorganisms (also known as biopesticides are considered to be one of the most promising methods for more rational and safe crop management practices. We used Bacillus strains EU07, QST713 and FZB24, and investigated their inhibitory effect on Fusarium. Bacterial cell cultures, cell-free supernatants and volatiles displayed varying degrees of suppressive effect. Proteomic analysis of secreted proteins from EU07 and FZB24 revealed the presence of lytic enzymes, cellulases, proteases, 1,4-β-glucanase and hydrolases, all of which contribute to degradation of the pathogen cell wall. Further proteomic investigations showed that proteins involved in metabolism, protein folding, protein degradation, translation, recognition and signal transduction cascade play an important role in the control of Fusarium oxysporum. Our findings provide new knowledge on the mechanism of action of Bacillus species and insight into biocontrol mechanisms.

  15. Metabolomes of Potato Root Exudates: Compounds That Stimulate Resting Spore Germination of the Soil-Borne Pathogen Spongospora subterranea.

    Science.gov (United States)

    Balendres, Mark A; Nichols, David S; Tegg, Robert S; Wilson, Calum R

    2016-10-12

    Root exudation has importance in soil chemical ecology influencing rhizosphere microbiota. Prior studies reported root exudates from host and nonhost plants stimulated resting spore germination of Spongospora subterranea, the powdery scab pathogen of potato, but the identities of stimulatory compounds were unknown. This study showed that potato root exudates stimulated S. subterranea resting spore germination, releasing more zoospores at an earlier time than the control. We detected 24 low molecular weight organic compounds within potato root exudates and identified specific amino acids, sugars, organic acids, and other compounds that were stimulatory to S. subterranea resting spore germination. Given that several stimulatory compounds are commonly found in exudates of diverse plant species, we support observations of nonhost-specific stimulation. We provide knowledge of S. subterranea resting spore biology and chemical ecology that may be useful in formulating new disease management strategies.

  16. Beneficial effects of probiotic and food borne yeasts on human health

    DEFF Research Database (Denmark)

    Moslehi Jenabian, Saloomeh; Pedersen, Line Lindegaard; Jespersen, Lene

    2010-01-01

    Besides being important in the fermentation of foods and beverages, yeasts have shown numerous beneficial effects on human health. Among these, propiotic effects are the most well known health effects including prevention and treatment of intestinal diseases and immunomodulatory effects. Other...

  17. Biological control of strawberry soil-borne pathogens Macrophomina phaseolina and Fusarium solani, using Trichoderma asperellum and Bacillus spp.

    Directory of Open Access Journals (Sweden)

    Ana María PASTRANA

    2016-05-01

    Full Text Available In south-western Spain, Macrophomina phaseolina and Fusarium solani were found to be associated in strawberry plants with, respectively, charcoal rot, and crown and root rot symptoms. For management of both fungal diseases, the antagonistic effects of two commercial formulations, one based on Trichoderma asperellum T18 strain (Prodigy® and the other on Bacillus megaterium and B. laterosporus (Fusbact®, were evaluated in vitro and under controlled environment and field conditions. Two inoculation methods (root-dipping and soil application and two application times (pre- and post-pathogen inoculation, as preventive and curative treatments, respectively were assessed. Dual plate confrontation experiments demonstrated the antagonistic effects of T. asperellum and Bacillus spp. by inhibiting radial growth of M. phaseolina and F. solani by more than 36%. Preventive application of T. asperellum by root-dipping reduced the incidence of charcoal rot (up to 44% in a growth chamber and up to 65% under field conditions and also reduced disease progression, the percentage of crown necrosis, as well as the level of infection measured as ng of pathogen DNA g-1 plant by quantitative real-time PCR. This treatment was also the most effective for reduction of crown and root rot caused by F. solani (up to 100% in a greenhouse and up to 81% under field conditions. These results were nearly comparable with the control achieved using chemical fungicides. The Bacillus spp.-based formulation was also effective for control of charcoal rot and showed variable results for control of F. solani, depending on the growth conditions.

  18. Diarrhoeal Health Risks Attributable to Water-Borne-Pathogens in Arsenic-Mitigated Drinking Water in West Bengal are Largely Independent of the Microbiological Quality of the Supplied Water

    Directory of Open Access Journals (Sweden)

    Debapriya Mondal

    2014-04-01

    Full Text Available There is a growing discussion about the possibility of arsenic mitigation measures in Bengal and similar areas leading to undesirable substitution of water-borne-pathogen attributable risks pathogens for risks attributable to arsenic, in part because of uncertainties in relative pathogen concentrations in supplied and end-use water. We try to resolve this discussion, by assessing the relative contributions of water supply and end-user practices to water-borne-pathogen-attributable risks for arsenic mitigation options in a groundwater arsenic impacted area of West Bengal. Paired supplied arsenic-mitigated water and end-use drinking water samples from 102 households were collected and analyzed for arsenic and thermally tolerant coliforms [TTC], used as a proxy for microbiological water quality, We then estimated the DALYs related to key sequelae, diarrheal diseases and cancers, arising from water-borne pathogens and arsenic respectively. We found [TTC] in end-use drinking water to depend only weakly on [TTC] in source-water. End-user practices far outweighed the microbiological quality of supplied water in determining diarrheal disease burden. [TTC] in source water was calculated to contribute <1% of total diarrheal disease burden. No substantial demonstrable pathogen-for-arsenic risk substitution attributable to specific arsenic mitigation of supplied waters was observed, illustrating the benefits of arsenic mitigation measures in the area studied.

  19. Beneficial Effects of Probiotic and Food Borne Yeasts on Human Health

    Directory of Open Access Journals (Sweden)

    Saloomeh Moslehi-Jenabian

    2010-04-01

    Full Text Available Besides being important in the fermentation of foods and beverages, yeasts have shown numerous beneficial effects on human health. Among these, probiotic effects are the most well known health effects including prevention and treatment of intestinal diseases and immunomodulatory effects. Other beneficial functions of yeasts are improvement of bioavailability of minerals through the hydrolysis of phytate, folate biofortification and detoxification of mycotoxins due to surface binding to the yeast cell wall.

  20. Study on the interaction of chemopreventive compounds and food born carcinogens with cytochrome P450 enzymes

    OpenAIRE

    Brabencová, Eliška

    2013-01-01

    The use of food supplements containing natural chemopreventive compounds increased in recent years. Some of the most popular chemopreventive compounds are flavonoids. Due to their natural origin, flavonoids are generally accepted as safe compounds. They exert antioxidant, anti-cancer and anti-inflammatory properties. However, flavonoids should be considered as foreign compounds (xenobiotics). Flavonoids interact with many enzymes, among the most important belong cytochromes P450 (CYPs), key e...

  1. Outbreaks where food workers have been implicated in the spread of foodborne disease. Part 4. Infective doses and pathogen carriage.

    Science.gov (United States)

    Todd, Ewen C D; Greig, Judy D; Bartleson, Charles A; Michaels, Barry S

    2008-11-01

    In this article, the fourth in a series reviewing the role of food workers in foodborne outbreaks, background information on the presence of enteric pathogens in the community, the numbers of organisms required to initiate an infection, and the length of carriage are presented. Although workers have been implicated in outbreaks, they were not always aware of their infections, either because they were in the prodromic phase before symptoms began or because they were asymptomatic carriers. Pathogens of fecal, nose or throat, and skin origin are most likely to be transmitted by the hands, highlighting the need for effective hand hygiene and other barriers to pathogen contamination, such as no bare hand contact with ready-to-eat food. The pathogens most likely to be transmitted by food workers are norovirus, hepatitis A virus, Salmonella, Shigella, and Staphylococcus aureus. However, other pathogens have been implicated in worker-associated outbreaks or have the potential to be implicated. In this study, the likelihood of pathogen involvement in foodborne outbreaks where infected workers have been implicated was examined, based on infectious dose, carriage rate in the community, duration of illness, and length of pathogen excretion. Infectious dose estimates are based on volunteer studies (mostly early experiments) or data from outbreaks. Although there is considerable uncertainty associated with these data, some pathogens appear to be able to infect at doses as low as 1 to 100 units, including viruses, parasites, and some bacteria. Lengthy postsymptomatic shedding periods and excretion by asymptomatic individuals of many enteric pathogens is an important issue for the hygienic management of food workers.

  2. Molecular Detection of Tick-Borne Pathogen Diversities in Ticks from Livestock and Reptiles along the Shores and Adjacent Islands of Lake Victoria and Lake Baringo, Kenya

    Directory of Open Access Journals (Sweden)

    David Omondi

    2017-06-01

    Full Text Available Although diverse tick-borne pathogens (TBPs are endemic to East Africa, with recognized impact on human and livestock health, their diversity and specific interactions with tick and vertebrate host species remain poorly understood in the region. In particular, the role of reptiles in TBP epidemiology remains unknown, despite having been implicated with TBPs of livestock among exported tortoises and lizards. Understanding TBP ecologies, and the potential role of common reptiles, is critical for the development of targeted transmission control strategies for these neglected tropical disease agents. During the wet months (April–May; October–December of 2012–2013, we surveyed TBP diversity among 4,126 ticks parasitizing livestock and reptiles at homesteads along the shores and islands of Lake Baringo and Lake Victoria in Kenya, regions endemic to diverse neglected tick-borne diseases. After morphological identification of 13 distinct Rhipicephalus, Amblyomma, and Hyalomma tick species, ticks were pooled (≤8 individuals by species, host, sampling site, and collection date into 585 tick pools. By supplementing previously established molecular assays for TBP detection with high-resolution melting analysis of PCR products before sequencing, we identified high frequencies of potential disease agents of ehrlichiosis (12.48% Ehrlichia ruminantium, 9.06% Ehrlichia canis, anaplasmosis (6.32% Anaplasma ovis, 14.36% Anaplasma platys, and 3.08% Anaplasma bovis,, and rickettsiosis (6.15% Rickettsia africae, 2.22% Rickettsia aeschlimannii, 4.27% Rickettsia rhipicephali, and 4.95% Rickettsia spp., as well as Paracoccus sp. and apicomplexan hemoparasites (0.51% Theileria sp., 2.56% Hepatozoon fitzsimonsi, and 1.37% Babesia caballi among tick pools. Notably, we identified E. ruminantium in both Amblyomma and Rhipicephalus pools of ticks sampled from livestock in both study areas as well as in Amblyomma falsomarmoreum (66.7% and Amblyomma nuttalli (100

  3. Molecular Detection of Tick-Borne Pathogen Diversities in Ticks from Livestock and Reptiles along the Shores and Adjacent Islands of Lake Victoria and Lake Baringo, Kenya.

    Science.gov (United States)

    Omondi, David; Masiga, Daniel K; Fielding, Burtram C; Kariuki, Edward; Ajamma, Yvonne Ukamaka; Mwamuye, Micky M; Ouso, Daniel O; Villinger, Jandouwe

    2017-01-01

    Although diverse tick-borne pathogens (TBPs) are endemic to East Africa, with recognized impact on human and livestock health, their diversity and specific interactions with tick and vertebrate host species remain poorly understood in the region. In particular, the role of reptiles in TBP epidemiology remains unknown, despite having been implicated with TBPs of livestock among exported tortoises and lizards. Understanding TBP ecologies, and the potential role of common reptiles, is critical for the development of targeted transmission control strategies for these neglected tropical disease agents. During the wet months (April-May; October-December) of 2012-2013, we surveyed TBP diversity among 4,126 ticks parasitizing livestock and reptiles at homesteads along the shores and islands of Lake Baringo and Lake Victoria in Kenya, regions endemic to diverse neglected tick-borne diseases. After morphological identification of 13 distinct Rhipicephalus, Amblyomma , and Hyalomma tick species, ticks were pooled (≤8 individuals) by species, host, sampling site, and collection date into 585 tick pools. By supplementing previously established molecular assays for TBP detection with high-resolution melting analysis of PCR products before sequencing, we identified high frequencies of potential disease agents of ehrlichiosis (12.48% Ehrlichia ruminantium , 9.06% Ehrlichia canis ), anaplasmosis (6.32% Anaplasma ovis , 14.36% Anaplasma platys , and 3.08% Anaplasma bovis ,), and rickettsiosis (6.15% Rickettsia africae , 2.22% Rickettsia aeschlimannii , 4.27% Rickettsia rhipicephali , and 4.95% Rickettsia spp.), as well as Paracoccus sp. and apicomplexan hemoparasites (0.51% Theileria sp., 2.56% Hepatozoon fitzsimonsi , and 1.37% Babesia caballi ) among tick pools. Notably, we identified E. ruminantium in both Amblyomma and Rhipicephalus pools of ticks sampled from livestock in both study areas as well as in Amblyomma falsomarmoreum (66.7%) and Amblyomma nuttalli (100%) sampled

  4. Two food-borne heterocyclic amines: Metabolism and DNA adduct formation of amino-alpha-carbolines

    DEFF Research Database (Denmark)

    Frederiksen, Hanne

    2005-01-01

    or proteins of animal or vegetable origin, furthermore they are found in many cooked foods, such as fish, meat, and chicken. The specific mutagenicity of the amino-a-carbolines are lower in the Ames Salmonella assay than other heterocyclic amines, but in rodent studies the carcinogenicity of the aminoa, alpha......The amino-alpha-carbolines 2-amino-9H-pyrido[2,3-b]indole (A alpha C) and 2-amino-3-methyl-9H-pyrido-[2,3-b]indole (MeA alpha C) are two mutagenic and carcinogenic heterocyclic amines formed during ordinary cooking. Amino-alpha-carbolines can be formed in model systems by pyrolyzing tryptophan...

  5. PEF and UV combined system for pathogen microorganisms inactivation in liquid food products

    Energy Technology Data Exchange (ETDEWEB)

    Cramariuc, R [Competence Center in Electrostatics and Electrotechnologies, Bucharest (Romania); Popa, M; Mitelut, A; Geicu, M [University of Agronomic Science and Veterinary Medicine, Bucharest (Romania); Tudorache, A; Brinduse, E; Kontek, A; Fotescu, L [Research and Development Institute in Viticulture and Vinification Valea Calugareasca (Romania); Cramariuc, B [IT Center for Science and Technology, Bucharest (Romania); Nisiparu, L, E-mail: raducramariuc@yahoo.com [Carol Davila University of Medicine and Pharmacy, Bucharest (Romania)

    2011-06-23

    Pulsed electrical field (PEF) treatment is a non-thermal food preservation technology based on the use of the electrical field in impulses applied in order to inactivate and control pathogen microorganisms in foods. This technology is highly appreciated for its ability to prolong the shelf life of the treated product without the use of heat and also for its ability to preserve the product's sensory qualities and nutritional value as well as for the microbiological control of the treated products. This paper presents the PEF and UV treatment methods, or a combination between the two, for microbe inactivation in liquid products. The experiments were carried out using yeasts, lactic bacteria and acetic bacteria in the following systems: stand-alone treatments (PEF or UV) or in combination (UV+PEF or PEF+UV). The results of these experiments showed that one can obtain total inactivation of microorganisms using the combined UV+PEF system, thus leading to the possibility of increasing liquid food products quality as compared to the quality obtained using thermal pasteurization.

  6. PEF and UV combined system for pathogen microorganisms inactivation in liquid food products

    Science.gov (United States)

    Cramariuc, R.; Popa, M.; Tudorache, A.; Brînduşe, E.; Kontek, A.; Mitelut, A.; Fotescu, L.; Cramariuc, B.; Geicu, M.; Nisiparu, L.

    2011-06-01

    Pulsed electrical field (PEF) treatment is a non-thermal food preservation technology based on the use of the electrical field in impulses applied in order to inactivate and control pathogen microorganisms in foods. This technology is highly appreciated for its ability to prolong the shelf life of the treated product without the use of heat and also for its ability to preserve the product's sensory qualities and nutritional value as well as for the microbiological control of the treated products. This paper presents the PEF and UV treatment methods, or a combination between the two, for microbe inactivation in liquid products. The experiments were carried out using yeasts, lactic bacteria and acetic bacteria in the following systems: stand-alone treatments (PEF or UV) or in combination (UV+PEF or PEF+UV). The results of these experiments showed that one can obtain total inactivation of microorganisms using the combined UV+PEF system, thus leading to the possibility of increasing liquid food products quality as compared to the quality obtained using thermal pasteurization.

  7. PEF and UV combined system for pathogen microorganisms inactivation in liquid food products

    International Nuclear Information System (INIS)

    Cramariuc, R; Popa, M; Mitelut, A; Geicu, M; Tudorache, A; Brinduse, E; Kontek, A; Fotescu, L; Cramariuc, B; Nisiparu, L

    2011-01-01

    Pulsed electrical field (PEF) treatment is a non-thermal food preservation technology based on the use of the electrical field in impulses applied in order to inactivate and control pathogen microorganisms in foods. This technology is highly appreciated for its ability to prolong the shelf life of the treated product without the use of heat and also for its ability to preserve the product's sensory qualities and nutritional value as well as for the microbiological control of the treated products. This paper presents the PEF and UV treatment methods, or a combination between the two, for microbe inactivation in liquid products. The experiments were carried out using yeasts, lactic bacteria and acetic bacteria in the following systems: stand-alone treatments (PEF or UV) or in combination (UV+PEF or PEF+UV). The results of these experiments showed that one can obtain total inactivation of microorganisms using the combined UV+PEF system, thus leading to the possibility of increasing liquid food products quality as compared to the quality obtained using thermal pasteurization.

  8. Enteric Pathogen-Plant Interactions: Molecular Connections Leading to Colonization and Growth and Implications for Food Safety

    OpenAIRE

    Martínez-Vaz, Betsy M.; Fink, Ryan C.; Diez-Gonzalez, Francisco; Sadowsky, Michael J.

    2014-01-01

    Leafy green vegetables have been identified as a source of foodborne illnesses worldwide over the past decade. Human enteric pathogens, such as Escherichia coli O157:H7 and Salmonella, have been implicated in numerous food poisoning outbreaks associated with the consumption of fresh produce. An understanding of the mechanisms responsible for the establishment of pathogenic bacteria in or on vegetable plants is critical for understanding and ameliorating this problem as well as ensuring the sa...

  9. Lactobacillus brevis strains from fermented aloe vera survive gastroduodenal environment and suppress common food borne enteropathogens.

    Science.gov (United States)

    Kim, Young-Wook; Jeong, Young-Ju; Kim, Ah-Young; Son, Hyun-Hee; Lee, Jong-Am; Jung, Cheong-Hwan; Kim, Chae-Hyun; Kim, Jaeman

    2014-01-01

    Five novel Lactobacillus brevis strains were isolated from naturally fermented Aloe vera leaf flesh. Each strain was identified by Random Amplified Polymorphic DNA (RAPD) analysis and 16S rRNA sequence comparison. These strains were highly tolerant to acid, surviving in pH2.5 for up to 4 hours, and resistant to 5% bile salts at 37°C for 18 hours. Due to its tolerance to acid and bile salts, one strain passed through the gastric barrier and colonised the intestine after oral administration. All five strains inhibited the growth of many harmful enteropathogens without restraining most of normal commensals in the gut and hence named POAL (Probiotics Originating from Aloe Leaf) strains. Additionally, each strain exhibited discriminative resistance to a wide range of antibiotics. The L. brevis POAL strains, moreover, expressed high levels of the glutamate decarboxylase (GAD) gene which produces a beneficial neurotransmitter, γ-aminobutyric acid (GABA). These characteristics in all suggest that the novel L. brevis strains should be considered as potential food additives and resources for pharmaceutical research.

  10. Lactobacillus brevis strains from fermented aloe vera survive gastroduodenal environment and suppress common food borne enteropathogens.

    Directory of Open Access Journals (Sweden)

    Young-Wook Kim

    Full Text Available Five novel Lactobacillus brevis strains were isolated from naturally fermented Aloe vera leaf flesh. Each strain was identified by Random Amplified Polymorphic DNA (RAPD analysis and 16S rRNA sequence comparison. These strains were highly tolerant to acid, surviving in pH2.5 for up to 4 hours, and resistant to 5% bile salts at 37°C for 18 hours. Due to its tolerance to acid and bile salts, one strain passed through the gastric barrier and colonised the intestine after oral administration. All five strains inhibited the growth of many harmful enteropathogens without restraining most of normal commensals in the gut and hence named POAL (Probiotics Originating from Aloe Leaf strains. Additionally, each strain exhibited discriminative resistance to a wide range of antibiotics. The L. brevis POAL strains, moreover, expressed high levels of the glutamate decarboxylase (GAD gene which produces a beneficial neurotransmitter, γ-aminobutyric acid (GABA. These characteristics in all suggest that the novel L. brevis strains should be considered as potential food additives and resources for pharmaceutical research.

  11. A comparison of DNA extraction protocols from blood spotted on FTA cards for the detection of tick-borne pathogens by Reverse Line Blot hybridization.

    Science.gov (United States)

    Hailemariam, Zerihun; Ahmed, Jabbar Sabir; Clausen, Peter-Henning; Nijhof, Ard Menzo

    2017-01-01

    An essential step in the molecular detection of tick-borne pathogens (TBPs) in blood is the extraction of DNA. When cooled storage of blood under field conditions prior to DNA extraction in a dedicated laboratory is not possible, the storage of blood on filter paper forms a promising alternative. We evaluated six DNA extraction methods from blood spotted on FTA Classic ® cards (FTA cards), to determine the optimal protocol for the subsequent molecular detection of TBPs by PCR and the Reverse Line Blot hybridization assay (RLB). Ten-fold serial dilutions of bovine blood infected with Babesia bovis, Theileria mutans, Anaplasma marginale or Ehrlichia ruminantium were made by dilution with uninfected blood and spotted on FTA cards. Subsequently, DNA was extracted from FTA cards using six different DNA extraction protocols. DNA was also isolated from whole blood dilutions using a commercial kit. PCR/RLB results showed that washing of 3mm discs punched from FTA cards with FTA purification reagent followed by DNA extraction using Chelex ® resin was the most sensitive procedure. The detection limit could be improved when more discs were used as starting material for the DNA extraction, whereby the use of sixteen 3mm discs proved to be most practical. The presented best practice method for the extraction of DNA from blood spotted on FTA cards will facilitate epidemiological studies on TBPs. It may be particularly useful for field studies where a cold chain is absent. Copyright © 2016 Elsevier GmbH. All rights reserved.

  12. Industrialization development of food irradiation in China

    International Nuclear Information System (INIS)

    Chen Dianhua

    2004-01-01

    This report introduces present status on food irradiation at home and abroad in detail. It also introduces the scientific research and application in reducing diseases caused by food borne pathogens, quarantine control of import and export products, grain store and killing insects in traditional Chinese medicine. The report also analyzes the problems in developing food irradiation in China and gives some suggestions

  13. Pathogenic potential of Listeria monocytogenes isolated from cattle ...

    African Journals Online (AJOL)

    Listeria monocytogenes is an opportunistic food-borne pathogen causing listeriosis especially among immune-compromised persons. Its high rate of morbidity and mortality has classed the organism among the top watch list in foods. It is known to produce several virulence factors which aid its survival in harsh conditions ...

  14. Detection of food-borne bacteria in ready to eat betel leaf sold at local markets in Mymensingh.

    Science.gov (United States)

    Haque, Md Mazedul; Sarker, Md Atiqur Rahman; Rifa, Rafia Afroze; Islam, Md Ariful; Khatun, Mst Minara

    2017-09-01

    The present study was undertaken to determine bacterial load as well as characterize bacterial flora of ready to eat (RTE) betel leaf sold at local markets in Mymensingh city. A total of 25 RTE betel leaf samples were collected from five local markets such as Kamal-Ranjit (KR) market, Shesh more, Kewatkhali, Jobber more, and Ganginar par. Total viable count of bacteria in betel leaf (log 10 mean colony forming unit±standard deviation/ml) was 7.58±0.04 for KR market, 7.72±0.06 for Shesh more, 7.62±0.04 for Kewatkhali, 7.40±0.03 for Jobber more, and 7.60±0.06 for Ganginar par. A total of 98 bacterial isolates belong to five genera ( Escherichia coli , Salmonella spp., Vibrio spp., Bacillus spp., and Staphylococcus spp.) were identified. The prevalence of E. coli was 17.34%, Salmonella spp. was 25.51%, Vibrio spp. was 19.39%, Bacillus spp. was 18.37%, and Staphylococcus spp. was 19.39%. Antibiotic sensitivity test showed that all isolates were sensitive to two antibiotics such as ciprofloxacin and gentamicin. Four isolates ( E. coli , Salmonella spp., Vibrio spp., and Staphylococcus spp.) were resistant to two antibiotics (ampicillin and cephalexin). Antibiogram profile of bacterial isolates of betel leaf suggests that they were multidrug resistance. Data of this study indicate that betel leaf sold at local market harbors multidrug resistance food-borne bacteria which might cause public health hazards if these antibiotic resistant transfer to human through food chain.

  15. Detection of food-borne bacteria in ready to eat betel leaf sold at local markets in Mymensingh

    Directory of Open Access Journals (Sweden)

    Md. Mazedul Haque

    2017-09-01

    Full Text Available Aim: The present study was undertaken to determine bacterial load as well as characterize bacterial flora of ready to eat (RTE betel leaf sold at local markets in Mymensingh city. Materials and Methods: A total of 25 RTE betel leaf samples were collected from five local markets such as Kamal-Ranjit (KR market, Shesh more, Kewatkhali, Jobber more, and Ganginar par. Results: Total viable count of bacteria in betel leaf (log10 mean colony forming unit±standard deviation/ml was 7.58±0.04 for KR market, 7.72±0.06 for Shesh more, 7.62±0.04 for Kewatkhali, 7.40±0.03 for Jobber more, and 7.60±0.06 for Ganginar par. A total of 98 bacterial isolates belong to five genera (Escherichia coli, Salmonella spp., Vibrio spp., Bacillus spp., and Staphylococcus spp. were identified. The prevalence of E. coli was 17.34%, Salmonella spp. was 25.51%, Vibrio spp. was 19.39%, Bacillus spp. was 18.37%, and Staphylococcus spp. was 19.39%. Antibiotic sensitivity test showed that all isolates were sensitive to two antibiotics such as ciprofloxacin and gentamicin. Four isolates (E. coli, Salmonella spp., Vibrio spp., and Staphylococcus spp. were resistant to two antibiotics (ampicillin and cephalexin. Antibiogram profile of bacterial isolates of betel leaf suggests that they were multidrug resistance. Conclusion: Data of this study indicate that betel leaf sold at local market harbors multidrug resistance food-borne bacteria which might cause public health hazards if these antibiotic resistant transfer to human through food chain.

  16. Listeria monocytogenes infection in poultry and its public health importance with special reference to food borne zoonoses.

    Science.gov (United States)

    Dhama, Kuldeep; Verma, Amit Kumar; Rajagunalan, S; Kumar, Amit; Tiwari, Ruchi; Chakraborty, Sandip; Kumar, Rajesh

    2013-04-01

    Listeriosis is a disease that causes septicemia or encephalitis in humans, animals and birds. Although, the disease is rare and sporadic in poultry but if occurs then causes septicemia or sometimes localized encephalitis. Occasionally, the disease is seen in young chicks and the causative agent, like in humans and animals, is Listeria monocytogenes. The organism is capable to infect almost all animals and poultry; however, outbreaks of listeriosis are infrequent in birds. It is widely distributed among avian species and chickens, turkeys, waterfowl (geese, ducks), game birds, pigeons, parrots, wood grouse, snowy owl, eagle, canaries, which appear to be the most commonly affected. Chickens are thought to be the carriers of Listeria and also the prime reservoirs for the infection and thus contaminate the litter and environment of the poultry production units. Listeriosis is often noticed along with other poultry diseases such as coccidiosis, infectious coryza, salmonellosis, campylobacteriosis and parasitic infections, signifying the opportunistic nature of the organism. Intestinal colonization of poultry and the presence of L. monocytogenes in feces represent a potential source of the organism for listeriosis in ruminants. Man gets infection from raw broiler meat due to Listeria contamination and unhygienic conditions of the processing area, rather than acquiring direct infection from birds. With the changing food habits of the people, the health consciousness is also increasing and since listeriosis has now been recognized as an emerging food borne zoonoses. Therefore, this review has been compiled to make aware the poultry producers and the consumers of poultry meat/products regarding the importance of the disease and its public health significance.

  17. EFSA Panel on Biological Hazards (BIOHAZ) Panel; Scientific Opinion on the risk posed by pathogens in food of non-animal origin. Part 1 (outbreak data analysis and risk ranking of food/pathogen combinations)

    DEFF Research Database (Denmark)

    Hald, Tine; Baggesen, Dorte Lau

    shelf life. Shortcomings in the approach using outbreak data were discussed. The top ranking food/pathogen combination was Salmonellaspp. and leafy greens eaten raw followed by (in equal rank) Salmonellaspp. and bulb and stem vegetables, Salmonellaspp. and tomatoes, Salmonellaspp. and melons...

  18. Viral agents that cause infection through the consumption and handling of food

    International Nuclear Information System (INIS)

    Gomez Murillo, Ileana

    2014-01-01

    Viral agents: Norovirus, Rotavirus, Hepatitis A and E, Nipah virus, highly pathogenic avian influenza and coronavirus that cause the SARS are studied as protagonists in the production of food-borne infectious processes. The most common sources of pollution, viral characteristics that influence the control, routes, methods of detection and prevention of pathogens in food are analyzed. Methodological techniques are investigated to improve early detection of viral pathogens in food, control measures and prevention of food contamination [es

  19. Determination of human pathogen profiles in food by quality assured microbial assays. Proceedings of a final Research Coordination Meeting

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    2005-01-15

    This publication includes the results of a Coordinated Research Project (CRP). Major food microbial contaminants were identified in some of the main foods exported in the international food market. Thousands of samples in a wide variety of foods were selected to be studied during different points of the food chain: meat (chicken, beef and pork), seafood (shellfish such as shrimp, prawns, scampi, squid, and lobsters, and different types of fish such as salmon, cuttle fish, rohu, fin herring, catfish, milkfish, and tilapia), spices (pepper, paprika), frozen vegetables (asparagus, peas and corn) and other products (coconut and dairy products). The analysis included pathogenic bacteria such as Salmonella spp. (several serotypes), Escherichia coli, E. coli 0157:H7, Staphylococcus aureus, Clostridium perfringens, Bacillus cereus, Vibrio choleare, Vibrio parahaemolitycus and Yersinia enterolítica. This publication includes data that may be used to conduct better risk assessments on food by importing as well as exporting countries.

  20. Immunogenicity in chickens with orally administered recombinant chicken-borne Lactobacillus saerimneri expressing FimA and OmpC antigen of O78 avian pathogenic Escherichia coli.

    Science.gov (United States)

    Ma, Sun-Ting; Ding, Guo-Jie; Huang, Xue-Wei; Wang, Zi-Wei; Wang, Li; Yu, Mei-Ling; Shi, Wen; Jiang, Yan-Ping; Tang, Li-Jie; Xu, Yi-Gang; Li, Yi-Jing

    2018-03-01

    Avian colibacillosis is responsible for economic losses to poultry producers worldwide. To combat this, we aimed to develop an effective oral vaccine for chicken against O78 avian pathogenic Escherichia coli (APEC) infection through a Lactobacillus delivery system. Eight Lactobacillus strains isolated from the intestines of broiler chickens were evaluated based on their in vitro adherence ability to assess their potential as a delivery vector. Fimbrial subunit A (FimA) and outer-membrane protein C (OmpC) of APEC with and without fusion to dendritic cell-targeting peptide (DCpep) and microfold cell-targeting peptide (Co1) were displayed on the surface of Lactobacillus saerimneri M-11 and yielded vaccine groups (pPG-ompC-fimA/M-11 and pPG-ompC-fimA-Co1-DCpep/M-11, respectively). The colonization of the recombinant strains in vivo was assessed and the immunogenicity and protective efficacy of orally administered recombinant strains in chickens were evaluated. The colonization of the recombinant strains in vivo revealed no significant differences between the recombinant and wild-type strains. Chickens orally administered with vaccine groups showed significantly higher levels of OmpC/FimA-specific IgG in serum and mucosal IgA in cecum lavage, nasal lavage and stool compared to the pPG/M-11 group. After challenge with APEC CVCC1553, better protective efficacy was observed in chickens orally immunized with pPG-ompC-fimA/M-11 and pPG-ompC-fimA-Co1-DCpep/M-11, but no significant differences were observed between the two groups. Recombinant chicken-borne L. saerimneri M-11 showed good immunogenicity in chickens, suggesting that it may be a promising vaccine candidate against APEC infections. However, the activity of mammalian DCpep and Co1 was not significant in chickens.

  1. Evaluation of Suppressiveness of Soils Exhibiting Soil-Borne Disease Suppression after Long-Term Application of Organic Amendments by the Co-cultivation Method of Pathogenic Fusarium oxysporum and Indigenous Soil Microorganisms.

    Science.gov (United States)

    Mitsuboshi, Masahiro; Kioka, Yuuzou; Noguchi, Katsunori; Asakawa, Susumu

    2018-03-29

    Preventive measures against soil-borne diseases need to be implemented before cultivation because very few countermeasures are available after the development of diseases. Some soils suppress soil-borne diseases despite the presence of a high population density of pathogens. If the suppressiveness of soil against soil-borne diseases may be predicted and diagnosed for crop fields, it may be possible to reduce the labor and cost associated with excessive disinfection practices. We herein evaluated the suppressiveness of soils in fields with the long-term application of organic amendments by examining the growth of pathogenic Fusarium oxysporum co-cultivated with indigenous soil microorganisms on agar plates. Soils treated with coffee residue compost or rapeseed meal showed suppressiveness against spinach wilt disease by F. oxysporum f. sp. spinaciae or spinach wilt and lettuce root rot diseases by F. oxysporum f. sp. spinaciae and F. oxysporum f. sp. lactucae, respectively, and the growth of pathogenic Fusarium spp. on agar plates was suppressed when co-cultured with microorganisms in a suspension from these soils before crop cultivation. These results indicate the potential of the growth degree of pathogenic F. oxysporum estimated by this method as a diagnostic indicator of the suppressiveness of soil associated with the inhabiting microorganisms. A correlation was found between the incidence of spinach wilt disease in spinach and the growth degree of F. oxysporum f. sp. spinaciae by this co-cultivation method, indicating that suppressiveness induced by organic amendment applications against F. oxysporum f. sp. spinaciae is evaluable by this method. The co-cultivation method may be useful for predicting and diagnosing suppressiveness against soil-borne diseases.

  2. [An epidemiological investigation on a food-born outbreak of noroviru caused by Sydney 2012 G II.4 strain].

    Science.gov (United States)

    Cai, Wen-Feng; Xie, Hua-Ping; Liu, Yu-Fei; Yuan, Jun; Xiao, Xin-Cai; Ding, Peng; Chen, Chun; Zhang, Du; Chen, Jian-Dong; Ma, Xiao-Wei; Geng, Jin-Mei; Lin, Dong-Ming; Lian, Gui-Xiong; Yang, Zhi-Cong

    2013-08-01

    To identify the source of infection, route of transmission and risk factors related to a cluster of acute gastroenteritis cases in a university of Guangzhou. Cases were identified according to the definition. Descriptive epidemiological approaches and case-control study designs were employed in the analysis. All the samples were tested for norovirus by RT-PCR. Positive samples were subjected to both nucleotide sequence and homology analysis. A total of 141 cases related to norovirus gastroenteritis were identified in January 8 to 21, 2013, with the attack rate as 8.5 per thousand (141/16,600). The peak in morbidity was seen on January 8 to 9. No clustering was found in different classes or dormitories. Results from the case-control study revealed that early cases were infected in Restaurant A (OR = 3.46, 95% CI: 1.07-11.16) and the cold shredded chicken set meal (OR = 17.82, 95% CI: 4.46-78.17) served at lunch (OR = 4.34, 95% CI: 1.18 -17.37) on January 7 was under suspicion. A total of 266 samples, including rectal swabs from the patients and kitchen wokers, leftover food and environmental swabs, were collected. Twenty-one samples (collected from 17 persons) were positive for norovirus by RT-PCR. About 29.6% (8/27) of the kitchen workers in the Restaurant A were tested positive for the virus. The pathogen was identified as the new norovirus genotype II.4 variant, termed Sydney 2012. The virus strains isolated from the patients among student and staff and the kitchen workers were 100% identical in their nucleotide sequence. This was the first reported acute gastroenteritis outbreak caused by the new norovirus genotype II.4 variant, Sydney 2012, which showed that the food was contaminated by the asymptomatic kitchen workers who carried the virus.

  3. Ecophysiological characterization of common food-borne fungi in relation to pH and water activity under various atmospheric compositions

    DEFF Research Database (Denmark)

    Haasum, Iben; Nielsen, Per Væggemose

    1998-01-01

    The combined effect of pH, water activity (aw), oxygen (O2) and carbon dioxide (CO2) levels on growth and sporulation of 10 common food-borne fungi were studied. The use of a multivariate statistical method (PLS) for the analysis of data showed, that the fungi could be grouped according to their ......The combined effect of pH, water activity (aw), oxygen (O2) and carbon dioxide (CO2) levels on growth and sporulation of 10 common food-borne fungi were studied. The use of a multivariate statistical method (PLS) for the analysis of data showed, that the fungi could be grouped according......% and from 52 to 100% respectively. Sporulation of the fungi was sensitive to all tested factors. Furthermore, interaction of CO2 and aw displayed a significant effect on sporulation. It was shown that different fungal species associated with the same ecosystem responded similarly to changes in the tested...

  4. Rapid detection of food-borne Salmonella contamination using IMBs-qPCR method based on pagC gene

    Directory of Open Access Journals (Sweden)

    Jiashun Wang

    Full Text Available Abstract Detection of Salmonella is very important to minimize the food safety risk. In this study, the recombinant PagC protein and PagC antibody were prepared and coupled with immunomagnetic beads (IMBs to capture Salmonella cells from pork and milk samples. And then the SYBR Green qualitative PCR was developed to detect the pathogenic Salmonella. The results showed that the PagC polyclonal antiserum is of good specificity and the capture rate of 0.1 mg IMBs for Salmonella tended to be stable at the range of 70-74% corresponding to the concentrations between 101 and 104 CFU/mL. The method developed demonstrated high specificity for the positive Salmonella samples when compared to non-specific DNA samples, such as Escherichia coli, Staphylococcus aureus, Yersinia enterocolitica, and Yersinia pseudotuberculosis. The limit of detection of this assay was 18 CFU/mL. Detection and quantitative enumeration of Salmonella in samples of pork or milk shows good recoveries of 54.34% and 52.07%. In conclusion, the polyclonal antibody of recombinant PagC protein is effective to capture Salmonella from detected samples. The developed pagC antibody IMBs-qPCR method showed efficiency, sensitivity and specificity for 30 Salmonella detection, enabling detection within 10 h, which is a promising rapid method to detect Salmonella in emergency.

  5. A protein microarray for the rapid screening of patients suspected of infection with various food-borne helminthiases.

    Directory of Open Access Journals (Sweden)

    Jia-Xu Chen

    Full Text Available BACKGROUND: Food-borne helminthiases (FBHs have become increasingly important due to frequent occurrence and worldwide distribution. There is increasing demand for developing more sensitive, high-throughput techniques for the simultaneous detection of multiple parasitic diseases due to limitations in differential clinical diagnosis of FBHs with similar symptoms. These infections are difficult to diagnose correctly by conventional diagnostic approaches including serological approaches. METHODOLOGY/PRINCIPAL FINDINGS: In this study, antigens obtained from 5 parasite species, namely Cysticercus cellulosae, Angiostrongylus cantonensis, Paragonimus westermani, Trichinella spiralis and Spirometra sp., were semi-purified after immunoblotting. Sera from 365 human cases of helminthiasis and 80 healthy individuals were assayed with semi-purified antigens by both a protein microarray and the enzyme-linked immunosorbent assay (ELISA. The sensitivity, specificity and simplicity of each test for the end-user were evaluated. The specificity of the tests ranged from 97.0% (95% confidence interval (CI: 95.3-98.7% to 100.0% (95% CI: 100.0% in the protein microarray and from 97.7% (95% CI: 96.2-99.2% to 100.0% (95% CI: 100.0% in ELISA. The sensitivity varied from 85.7% (95% CI: 75.1-96.3% to 92.1% (95% CI: 83.5-100.0% in the protein microarray, while the corresponding values for ELISA were 82.0% (95% CI: 71.4-92.6% to 92.1% (95% CI: 83.5-100.0%. Furthermore, the Youden index spanned from 0.83 to 0.92 in the protein microarray and from 0.80 to 0.92 in ELISA. For each parasite, the Youden index from the protein microarray was often slightly higher than the one from ELISA even though the same antigen was used. CONCLUSIONS/SIGNIFICANCE: The protein microarray platform is a convenient, versatile, high-throughput method that can easily be adapted to massive FBH screening.

  6. Vector-borne pathogens in dogs from Costa Rica: first molecular description of Babesia vogeli and Hepatozoon canis infections with a high prevalence of monocytic ehrlichiosis and the manifestations of co-infection.

    Science.gov (United States)

    Rojas, Alicia; Rojas, Diana; Montenegro, Víctor; Gutiérrez, Ricardo; Yasur-Landau, Daniel; Baneth, Gad

    2014-01-31

    Infection with canine vector-borne pathogens was evaluated in dogs from four different regions of Costa Rica by PCR. Demographic data, clinical signs, packed cell volume values, and the presence of tick infestation were recorded for each dog. Forty seven percent (69/146) of the dogs were infected with at least one pathogen and 12% were co-infected with two pathogens. Ehrlichia canis was detected in 34%, Anaplasma platys in 10%, Babesia vogeli in 8%, and Hepatozoon canis in 7.5% of the blood samples. No infection was detected with Leishmania spp. in blood, skin scrapings or conjunctival swabs. Thirty percent of the dogs presented at least one clinical sign compatible with vector-borne disease, and of those, 66% were infected with a pathogen. Subclinical infections were determined in 58% of the infected dogs including 82% (9/11), 58% (29/50), 42% (5/12) and 36% (5/14) of the dogs with H. canis, E. canis, B. vogeli and A. platys infections, respectively. A distinct relationship was found between infection and anemia. The mean PCV values were 34.4% in dogs with no infection, 31.5% in those who had a single infection and 23% in those with co-infection. Co-infected dogs had significantly lower PCV values compared to non-infected and single-infected dogs (pcanis were significantly associated with R. sanguineus s.l. infestation (pcanis in Costa Rica as well as in Central America. The results of this study indicate that multiple vector-borne pathogens responsible for severe diseases infect dogs in Costa Rica and therefore, increased owner and veterinarian awareness are needed. Moreover, prevention of tick infestation is recommended to decrease the threat of these diseases to the canine population. Copyright © 2013 Elsevier B.V. All rights reserved.

  7. Variations in the radiation sensitivity of foodborne pathogens associated with complex ready-to-eat food products

    International Nuclear Information System (INIS)

    Sommers, Christopher H.; Boyd, Glenn

    2006-01-01

    Foodborne illness outbreaks and product recalls are occasionally associated with ready-to-eat (RTE) sandwiches and other 'heat and eat' multi-component RTE products. Ionizing radiation can inactivate foodborne pathogens on meat and poultry, fruits and vegetables, seafood, and RTE meat products. However, less data are available on the ability of low-dose ionizing radiation, doses under 5 kGy typically used for pasteurization purposes, to inactivate pathogenic bacteria on complex multi-component food products. In this study, the efficacy of ionizing radiation to inactivate Salmonella spp., Listeria monocytogenes, Staphylococcus aureus, Escherichia coli O157:H7, and Yersinia enterocolitica on RTE foods including a 'frankfurter on a roll', a 'beef cheeseburger on a bun' and a 'vegetarian cheeseburger on a bun' was investigated. The average D-10 values, the radiation dose needed to inactivate 1 log 1 of pathogen, by bacterium species, were 0.61, 0.54, 0.47, 0.36 and 0.15 kGy for Salmonella spp., S. aureus, L. monocytogenes, E. coli O157:H7, and Y. enterocolitica, respectively when inoculated onto the three product types. These results indicate that irradiation may be an effective means for inactivating common foodborne pathogens including Salmonella spp, S. aureus, L. monocytogenes, E. coli O157:H7 and Y. enterocolitica in complex RTE food products such as 'heat and eat' sandwich products

  8. Isolation, antibiogram and pathogenicity of Salmonella spp. Recovered from slaughtered food animals in Nagpur region of Central India

    Directory of Open Access Journals (Sweden)

    D. G. Kalambhe

    2016-02-01

    Full Text Available Aim: To determine the prevalence, antibiogram and pathogenicity of Salmonella spp. in the common food animals slaughtered for consumption purpose at government approved slaughter houses located in and around Nagpur region during a period of 2010-2012. Materials and Methods: A total of 400 samples comprising 50 each of blood and meat from each slaughtered male cattle, buffaloes, pigs and goats were collected. Isolation was done by pre-enrichment in buffered peptone water and enrichment in Rappaport-Vassiliadis broth with subsequent selective plating onto xylose lysine deoxycholate agar. Presumptive Salmonella colonies were biochemically confirmed and analyzed for pathogenicity by hemolysin production and Congo red dye binding assay (CRDA. An antibiotic sensitivity test was performed to assess the antibiotic resistance pattern of the isolates. Results: A total of 10 isolates of Salmonella spp. from meat (3 from cattle, 1 from buffaloes and 6 from pigs with an overall prevalence of 5% among food animals was recorded. No isolation was reported from any blood samples. Pathogenicity assays revealed 100% and 80% positivity for CRDA and hemolytic activity, respectively. Antimicrobial sensitivity test showed multi-drug resistance. The overall resistance of 50% was noted for trimethoprim followed by ampicillin (20%. A maximum sensitivity (80% was reported to gentamycin followed by 40% each to ampicillin and trimethoprim, 30% to amikacin and 10% to kanamycin. Conclusion: The presence of multidrug resistant and potentially pathogenic Salmonella spp. in slaughtered food animals in Nagpur region can be a matter of concern for public health.

  9. Variations in the radiation sensitivity of foodborne pathogens associated with complex ready-to-eat food products

    Science.gov (United States)

    Sommers, Christopher H.; Boyd, Glenn

    2006-07-01

    Foodborne illness outbreaks and product recalls are occasionally associated with ready-to-eat (RTE) sandwiches and other "heat and eat" multi-component RTE products. Ionizing radiation can inactivate foodborne pathogens on meat and poultry, fruits and vegetables, seafood, and RTE meat products. However, less data are available on the ability of low-dose ionizing radiation, doses under 5 kGy typically used for pasteurization purposes, to inactivate pathogenic bacteria on complex multi-component food products. In this study, the efficacy of ionizing radiation to inactivate Salmonella spp., Listeria monocytogenes, Staphylococcus aureus, Escherichia coli O157:H7, and Yersinia enterocolitica on RTE foods including a "frankfurter on a roll", a "beef cheeseburger on a bun" and a "vegetarian cheeseburger on a bun" was investigated. The average D-10 values, the radiation dose needed to inactivate 1 log 10 of pathogen, by bacterium species, were 0.61, 0.54, 0.47, 0.36 and 0.15 kGy for Salmonella spp., S. aureus, L. monocytogenes, E. coli O157:H7, and Y. enterocolitica, respectively when inoculated onto the three product types. These results indicate that irradiation may be an effective means for inactivating common foodborne pathogens including Salmonella spp, S. aureus, L. monocytogenes, E. coli O157:H7 and Y. enterocolitica in complex RTE food products such as 'heat and eat" sandwich products.

  10. An Outbreak of Food-Borne Typhoid Fever Due to Salmonella enterica Serotype Typhi in Japan Reported for the First Time in 16 Years

    Science.gov (United States)

    Kobayashi, Tetsuro; Kutsuna, Satoshi; Hayakawa, Kayoko; Kato, Yasuyuki; Ohmagari, Norio; Uryu, Hideko; Yamada, Ritsuko; Kashiwa, Naoyuki; Nei, Takahito; Ehara, Akihito; Takei, Reiko; Mori, Nobuaki; Yamada, Yasuhiro; Hayasaka, Tomomi; Kagawa, Narito; Sugawara, Momoko; Suzaki, Ai; Takahashi, Yuno; Nishiyama, Hiroyuki; Morita, Masatomo; Izumiya, Hidemasa; Ohnishi, Makoto

    2016-01-01

    For the first time in 16 years, a food-borne outbreak of typhoid fever due to Salmonella enterica serotype Typhi was reported in Japan. Seven patients consumed food in an Indian buffet at a restaurant in the center of Tokyo, while one was a Nepali chef in the restaurant, an asymptomatic carrier and the implicated source of this outbreak. The multiple-locus variable-number tandem repeat analysis showed 100% consistency in the genomic sequence for five of the eight cases. PMID:26621565

  11. Pathogenicity determinants and antibiotic resistance profiles of enterococci from foods of animal origin in Turkey.

    Science.gov (United States)

    Elal Mus, Tulay; Cetinkaya, Figen; Cibik, Recep; Soyutemiz, Gul Ece; Simsek, Husniye; Coplu, Nilay

    2017-12-01

    In this study, the presence of genes responsible for the pathogenicity and antibiotic resistance profile of enterococci isolated from various foodstuffs of animal origin was investigated. The percentage prevalence of enterococci was 54.1% (203/375) and the average count was found to be 3.81 log cfu/ml-g. Species-specific primers revealed Enterococcus faecalis as the predominant species carrying one or more virulence-associated traits of efa, gelE, ace, esp and agg genetic markers. Only one E. faecium isolate (from milk) was positive for the esp gene. Regarding antibiotic resistance, the highest frequency of resistance was observed for tetracycline (21.7%), followed by quinupristin/dalfopristin (13.3%), ciprofloxacin (2.0%), penicillin (2.0%), linezolid (1.0%), ampicillin (1.0%), streptomycin (1.0%), and gentamicin (0.5%). Enterococcus faecalis showed a higher prevalence of antibiotic resistance than other enterococci. The percentage of multidrug resistance among the isolates was 3.4%. Twenty-nine E. faecalis isolates (26.6%) carrying one of the virulence-associated traits were at the same time resistant to at least one antibiotic. Our results show that foods of animal origin, including ready-to-eat products, may be reservoirs of antibiotic-resistant and potentially virulent enterococci.

  12. Rapid detection of food pathogens using RNA aptamers-immobilized slide.

    Science.gov (United States)

    Maeng, Jin-Soo; Kim, Namsoo; Kim, Chong-Tai; Han, Seung Ryul; Lee, Young Ju; Lee, Seong-Wook; Lee, Myung-Hyun; Cho, Yong-Jin

    2012-07-01

    The purpose of this study was to develop a simple and rapid detection system for foodborne bacteria, which consisted of an optical microscope and its slide chip with artificial antibodies, or RNA aptamers. From an RNA pool, three each RNA aptamers were built by the method of SELEX (systematic evolution of ligands by exponential enrichment) for components of cell wall, LPS (lipopolysaccharide) from E. coli O157:H7, teichoic acid from Staphylococcus aureus and a cell membrane protein of OmpC from Salmonella typhimurium, respectively. These aptamers were hybridized with thiol-conjugated 16 dT-linker molecules in order to be immobilized on silver surface which was, in advance, fabricated on glass slide, using a spin-coating method. To confirm that each aptamers retained its specific binding activities to their antigenic live bacteria, microscopic view of bound cells immobilized on silver film were observed. Furthermore, we observed the fluorescence-emitting bacteria-aptamer complex immobilized on silver film after adding RNA aptamers hybridized with fluorophore, FAM-conjugated 16 dT-linker molecules. As a result, the RNA aptamers-immobilized slide system developed in this study was a useful new tool to rapidly monitor individual food pathogens.

  13. Dual-excitation upconverting nanoparticle and quantum dot aptasensor for multiplexed food pathogen detection.

    Science.gov (United States)

    Kurt, Hasan; Yüce, Meral; Hussain, Babar; Budak, Hikmet

    2016-07-15

    In this report, a dual-excitation sensing method was developed using aptamer-functionalized quantum dots and upconverting nanoparticles, exhibiting Stokes and anti-Stokes type excitation profiles, respectively. Conjugation of the aptamer-functionalized luminescent nanoparticles with the magnetic beads, comprising short DNA sequences that were partially complementary to the aptamer sequences, enabled facile separation of the analyte-free conjugates for fluorescent measurement. UV-Visible spectroscopy, Circular Dichroism spectroscopy, Dynamic Light Scattering and Polyacrylamide Gel Electrophoresis techniques were used to characterize the aptamer probes developed. The target-specific luminescent conjugates were applied for multiplex detection of model food pathogens, Salmonella typhimurium, and Staphylococcus aureus, in which the fluorescent emission spectra were obtained under UV excitation at 325nm for quantum dots and NIR excitation at 980nm for upconverting nanoparticles, respectively. The dual-excitation strategy was aimed to minimize cross-talk between the luminescent signals for multiplexed detection, and yielded limit of detection values of 16 and 28cfumL(-1) for Staphylococcus aureus, and Salmonella typhimurium, respectively. By employing a greater number of quantum dots and upconverting nanoparticles with non-overlapping fluorescent emissions, the proposed methodology might be exploited further to detect several analytes, simultaneously. Copyright © 2016 Elsevier B.V. All rights reserved.

  14. Coffee and spent coffee extracts protect against cell mutagens and inhibit growth of food-borne pathogen microorganisms

    OpenAIRE

    Cid, C. (Concepción); Peña, M.P. (María Paz) de; Arbillaga, L. (Leire); Vitas, A.I. (Ana Isabel); Bravo, J. (Jimena); Monente, C. (Carmen)

    2015-01-01

    Coffee consumption decreases the risk of oxidative stress-related diseases. The by-product obtained after brewing process (spent coffee) also has antioxidant capacity. Spent coffee and coffee brews (filter and espresso) extracts were obtained from Arabica and Robusta coffees, respectively. Spent coffee showed slightly high amounts in chlorogenic acids, but caffeine content was similar to their respective coffee brew. All samples exhibited strong protection activity against indirect acting mut...

  15. A novel CMOS image sensor system for quantitative loop-mediated isothermal amplification assays to detect food-borne pathogens.

    Science.gov (United States)

    Wang, Tiantian; Kim, Sanghyo; An, Jeong Ho

    2017-02-01

    Loop-mediated isothermal amplification (LAMP) is considered as one of the alternatives to the conventional PCR and it is an inexpensive portable diagnostic system with minimal power consumption. The present work describes the application of LAMP in real-time photon detection and quantitative analysis of nucleic acids integrated with a disposable complementary-metal-oxide semiconductor (CMOS) image sensor. This novel system works as an amplification-coupled detection platform, relying on a CMOS image sensor, with the aid of a computerized circuitry controller for the temperature and light sources. The CMOS image sensor captures the light which is passing through the sensor surface and converts into digital units using an analog-to-digital converter (ADC). This new system monitors the real-time photon variation, caused by the color changes during amplification. Escherichia coli O157 was used as a proof-of-concept target for quantitative analysis, and compared with the results for Staphylococcus aureus and Salmonella enterica to confirm the efficiency of the system. The system detected various DNA concentrations of E. coli O157 in a short time (45min), with a detection limit of 10fg/μL. The low-cost, simple, and compact design, with low power consumption, represents a significant advance in the development of a portable, sensitive, user-friendly, real-time, and quantitative analytic tools for point-of-care diagnosis. Copyright © 2016 Elsevier B.V. All rights reserved.

  16. Food insecurity and socio-demographic characteristics in two UK ethnic groups: an analysis of women in the Born in Bradford cohort.

    Science.gov (United States)

    Power, Madeleine; Uphoff, Eleonora P; Stewart-Knox, Barbara; Small, Neil; Doherty, Bob; Pickett, Kate E

    2018-03-01

    The use of foodbanks has risen sharply in the UK; however, the epidemiology of UK food insecurity is undeveloped. This study contributes to the field by analysing socio-demographic risk factors for food insecurity in a female, ethnically diverse population. Data from the Born in Bradford (BiB) cohort were matched with data on food insecurity from the nested BiB1000 study (N = 1280). Logistic regression was used to model food insecurity in relation to ethnicity and socio-demographic factors. Food insecurity, reported by 13.98% of the sample, was more likely among White British than Pakistani women (crude Odds Ratio (OR) 1.94, 95% CI: 1.37; 2.74, adjusted OR 2.37, 95% CI: 1.57; 3.59). In fully adjusted analyses, food insecurity was associated with a range of socio-economic measures, particularly the receipt of mean-tested benefits (adjusted OR 2.11, 95% CI: 1.41; 3.15) and perception of financial insecurity (adjusted OR 8.91, 95% CI: 4.14; 19.16 for finding it difficult/very difficult compared to living comfortably). The finding that food insecurity prevalence may be higher than previously thought and that food insecurity is highly associated with socio-economic status, notably benefit receipt, is a cause for concern necessitating an urgent policy response.

  17. Long interspersed element-1 is differentially regulated by food-borne carcinogens via the aryl hydrocarbon receptor.

    Science.gov (United States)

    Okudaira, N; Okamura, T; Tamura, M; Iijma, K; Goto, M; Matsunaga, A; Ochiai, M; Nakagama, H; Kano, S; Fujii-Kuriyama, Y; Ishizaka, Y

    2013-10-10

    A single human cell contains more than 5.0 × 10(5) copies of long interspersed element-1 (L1), 80-100 of which are competent for retrotransposition (L1-RTP). Recent observations have revealed the presence of de novo L1 insertions in various tumors, but little is known about its mechanism. Here, we found that 2-amino-1-methyl-6-phenylimidazo[4,5-b]pyridine (PhIP) and 2-amino-3,8-dimethyl-imidazo[4,5-f]quinoxaline (MeIQx), food-borne carcinogens that are present in broiled meats, induced L1-RTP. This induction was dependent on a cellular cascade comprising the aryl hydrocarbon receptor (AhR), a mitogen-activated protein kinase, and CCAAT/enhancer-binding protein β. Notably, these compounds exhibited differential induction of L1-RTP. MeIQx-induced L1-RTP was dependent on AhR nuclear translocator 1 (ARNT1), a counterpart of AhR required for gene expression in response to environmental pollutants. By contrast, PhIP-induced L1-RTP did not require ARNT1 but was dependent on estrogen receptor α (ERα) and AhR repressor. In vivo studies using transgenic mice harboring the human L1 gene indicated that PhIP-induced L1-RTP was reproducibly detected in the mammary gland, which is a target organ of PhIP-induced carcinoma. Moreover, picomolar levels of each compound induced L1-RTP, which is comparable to the PhIP concentration detected in human breast milk. Data suggest that somatic cells possess machineries that induce L1-RTP in response to the carcinogenic compounds. Together with data showing that micromolar levels of heterocyclic amines (HCAs) were non-genotoxic, our observations indicate that L1-RTP by environmental compounds is a novel type of genomic instability, further suggesting that analysis of L1-RTP by HCAs is a novel approach to clarification of modes of carcinogenesis.

  18. Inactivation of pathogenic bacteria in food matrices: high pressure processing, photodynamic inactivation and pressure-assisted photodynamic inactivation

    Science.gov (United States)

    Cunha, A.; Couceiro, J.; Bonifácio, D.; Martins, C.; Almeida, A.; Neves, M. G. P. M. S.; Faustino, M. A. F.; Saraiva, J. A.

    2017-09-01

    Traditional food processing methods frequently depend on the application of high temperature. However, heat may cause undesirable changes in food properties and often has a negative impact on nutritional value and organoleptic characteristics. Therefore, reducing the microbial load without compromising the desirable properties of food products is still a technological challenge. High-pressure processing (HPP) can be classified as a cold pasteurization technique, since it is a non-thermal food preservation method that uses hydrostatic pressure to inactivate spoilage microorganisms. At the same time, it increases shelf life and retains the original features of food. Photodynamic inactivation (PDI) is also regarded as promising approach for the decontamination of food matrices. In this case, the inactivation of bacterial cells is achieved by the cytotoxic effects of reactive oxygens species (ROS) produced from the combined interaction of a photosensitizer molecule, light and oxygen. This short review examines some recent developments on the application of HPP and PDI with food-grade photosensitizers for the inactivation of listeriae, taken as a food pathogen model. The results of a proof-of-concept trial of the use of high-pressure as a coadjutant to increase the efficiency of photodynamic inactivation of bacterial endospores is also addressed.

  19. Food irradiation: Applications, public acceptance and global trade

    African Journals Online (AJOL)

    USER

    2010-05-17

    May 17, 2010 ... Atomic Energy Organization of Iran, Nuclear Science and Technology ... “the irradiation of any food commodity up to an overall average dose of 10 KGy presents no ... years in the wake of food-borne disease caused by pathogenic organisms. In fact ... quality of food consumed within the region (Ahari and.

  20. A review on the beneficial aspects of food processing.

    NARCIS (Netherlands)

    Boekel, van M.A.J.S.; Fogliano, V.; Pellegrini, N.; Stanton, C.; Scholz, G.; Lalljie, S.P.D.; Somoza, V.; Knorr, D.; Rao Jasti, P.; Eisenbrand, G.

    2010-01-01

    The manuscript reviews beneficial aspects of food processing with main focus on cooking/heat treatment, including other food-processing techniques (e.g. fermentation). Benefits of thermal processing include inactivation of food-borne pathogens, natural toxins or other detrimental constituents,

  1. Fluorescence-Free Biosensor Methods in Detection of Food Pathogens with a Special Focus on Listeria monocytogenes

    Directory of Open Access Journals (Sweden)

    Rajeswaran Radhakrishnan

    2017-12-01

    Full Text Available Food pathogens contaminate food products that allow their growth on the shelf and also under refrigerated conditions. Therefore, it is of utmost importance to lower the limit of detection (LOD of the method used and to obtain the results within hours to few days. Biosensor methods exploit the available technologies to individuate and provide an approximate quantification of the bacteria present in a sample. The main bottleneck of these methods depends on the aspecific binding to the surfaces and on a change in sensitivity when bacteria are in a complex food matrix with respect to bacteria in a liquid food sample. In this review, we introduce surface plasmon resonance (SPR, new advancements in SPR techniques, and electrochemical impedance spectroscopy (EIS, as fluorescence-free biosensing technologies for detection of L. monocytogenes in foods. The application of the two methods has facilitated L. monocytogenes detection with LOD of 1 log CFU/mL. Further advancements are envisaged through the combination of biosensor methods with immunoseparation of bacteria from larger volumes, application of lab-on-chip technologies, and EIS sensing methods for multiplex pathogen detection. Validation efforts are being conducted to demonstrate the robustness of detection, reproducibility and variability in multi-site installations.

  2. Effects of combined treatments of irradiation and antimicrobial coatings on reduction of food pathogens in broccoli florets

    Energy Technology Data Exchange (ETDEWEB)

    Takala, P.N.; Salmieri, S.; Vu, K.D. [INRS-Institut Armand-Frappier, Research Laboratories in Sciences Applied to Food, Canadian Irradiation Centre, 531, Blvd des Prairies, Laval, QC, H7V 1B7 (Canada); Lacroix, M., E-mail: Monique.Lacroix@iaf.inrs.ca [INRS-Institut Armand-Frappier, Research Laboratories in Sciences Applied to Food, Canadian Irradiation Centre, 531, Blvd des Prairies, Laval, QC, H7V 1B7 (Canada)

    2011-12-15

    The effect of combined treatment of antimicrobial coatings and {gamma}-radiation on reduction of food pathogens such as Listeria monocytogenes, Escherichia coli, and Salmonella Typhimurium was evaluated in broccoli florets. Broccoli florets were inoculated with pathogenic bacteria at 10{sup 6} CFU/g. Inoculated florets were then coated with methylcellulose-based coating containing various mixtures of antimicrobial agents: organic acids (OAs) plus lactic acid bacteria metabolites (LABs), OA plus citrus extract (CE), OA plus CE plus spice mixture (SM), and OA plus rosemary extract (RE). Coated florets were irradiated with various doses (0-3.3 kGy), and microbial analyses were used to calculate the D{sub 10} value and radiosensitive relative. The coating containing OA plus CE was the most effective formulation for increasing the sensitization of Escherichia coli by 2.4 times as compared to the control without the antimicrobial coating. For Salmonella Typhimurium, coating containing OA plus LAB was the most effective formulation, increasing radiosensitivity by 2.4 times as well. All antimicrobial coatings had almost the same effect of increasing the sensitivity of Listeria monocytogenes (from 1.31 to 1.45 times) to {gamma}-irradiation. - Highlights: > Demonstrate scientifically the synergistic effect of the combined treatment of gamma-irradiation and natural antimicrobial coating in reduction of food pathogens in broccoli. > The coating containing organic acids plus citrus extract was the most efficient formulation for increasing the sensitization of E. coli by 2.40 times as compared to the control. > The coating containing organic acids plus lactic acid bacteria metabolites was the most effective formulation causing the sensitization of S. Typhimurium to {gamma}-irradiation by 2.4 times. > Potential in application of developed formulations to protect food products against food pathogens.

  3. Effects of combined treatments of irradiation and antimicrobial coatings on reduction of food pathogens in broccoli florets

    International Nuclear Information System (INIS)

    Takala, P.N.; Salmieri, S.; Vu, K.D.; Lacroix, M.

    2011-01-01

    The effect of combined treatment of antimicrobial coatings and γ-radiation on reduction of food pathogens such as Listeria monocytogenes, Escherichia coli, and Salmonella Typhimurium was evaluated in broccoli florets. Broccoli florets were inoculated with pathogenic bacteria at 10 6 CFU/g. Inoculated florets were then coated with methylcellulose-based coating containing various mixtures of antimicrobial agents: organic acids (OAs) plus lactic acid bacteria metabolites (LABs), OA plus citrus extract (CE), OA plus CE plus spice mixture (SM), and OA plus rosemary extract (RE). Coated florets were irradiated with various doses (0-3.3 kGy), and microbial analyses were used to calculate the D 10 value and radiosensitive relative. The coating containing OA plus CE was the most effective formulation for increasing the sensitization of Escherichia coli by 2.4 times as compared to the control without the antimicrobial coating. For Salmonella Typhimurium, coating containing OA plus LAB was the most effective formulation, increasing radiosensitivity by 2.4 times as well. All antimicrobial coatings had almost the same effect of increasing the sensitivity of Listeria monocytogenes (from 1.31 to 1.45 times) to γ-irradiation. - Highlights: → Demonstrate scientifically the synergistic effect of the combined treatment of gamma-irradiation and natural antimicrobial coating in reduction of food pathogens in broccoli. → The coating containing organic acids plus citrus extract was the most efficient formulation for increasing the sensitization of E. coli by 2.40 times as compared to the control. → The coating containing organic acids plus lactic acid bacteria metabolites was the most effective formulation causing the sensitization of S. Typhimurium to γ-irradiation by 2.4 times. → Potential in application of developed formulations to protect food products against food pathogens.

  4. Description of Clean and Healthy Behavior of Food Borne Disease Among by School Children Age in Babat Jerawat I Elementary School, District Pakal Surabaya

    Directory of Open Access Journals (Sweden)

    Hidayat Heny Sholikhah

    2014-08-01

    Full Text Available Background: Incidence of food borne disease, such as diarrhea, typhoid and hookworm infection in school childrenwere still sufficient susceptible. Lack of clean and healthy behavior became primary cause, so that the agent can easilyenter to the body through the food consumed. The purpose of this study was to descript the clean and healthy behaviors by school children age at Babat Jerawat I Elementary School, District Pakal Surabaya. Methods: This study was a crosssectional study. The sample of this study were 112 of fifth grade students at Babat Jerawat I Elementary school, District Pakal Surabaya, selected by purposive sampling of 121 students who met the inclusion criteria. Data of clean and healthy behavior were collected by observation and interviews focused on a group of school children using questionnaires, checklists and interview guides. Data analysis was done by using descriptive analysis. Results: The results showed that the clean and healthy behaviors about food borne disease, the majority of school children in Elementary school Babat Jerawat I District Pakal Surabaya included in good criteria (51.8% and small portion of these included less category (48.2%. Conclusion:Clean and Healthy Behavior of food borne disease in school children age had good criteria, but still need attention formany factors that influence it, such as the availability of facilities, affordability snacks outside of school and examples ofunhealthy behaviors in family environment. Recommendation: Improve the cooperation between the school and localhealth officials to tighten rules on the management of snack vending around schools, and do continuous education both within the school and the child’s school community.

  5. Recent Advances in Molecular Technologies and Their Application in Pathogen Detection in Foods with Particular Reference to Yersinia

    Directory of Open Access Journals (Sweden)

    Jin Gui

    2011-01-01

    Full Text Available Yersinia enterocolitica is an important zoonotic pathogen that can cause yersiniosis in humans and animals. Food has been suggested to be the main source of yersiniosis. It is critical for the researchers to be able to detect Yersinia or any other foodborne pathogen with increased sensitivity and specificity, as well as in real-time, in the case of a foodborne disease outbreak. Conventional detection methods are known to be labor intensive, time consuming, or expensive. On the other hand, more sensitive molecular-based detection methods like next generation sequencing, microarray, and many others are capable of providing faster results. DNA testing is now possible on a single molecule, and high-throughput analysis allows multiple detection reactions to be performed at once, thus allowing a range of characteristics to be rapidly and simultaneously determined. Despite better detection efficiencies, results derived using molecular biology methods can be affected by the various food matrixes. With the improvements in sample preparation, data analysis, and testing procedures, molecular detection techniques will likely continue to simplify and increase the speed of detection while simultaneously improving the sensitivity and specificity for tracking pathogens in food matrices.

  6. RFID technologies for imported foods inspection

    Science.gov (United States)

    Food-borne illness typically occurs due to contamination of food products with Escherichia coli, Salmonella spp., Listeria monocytogenes and other pathogens. Unfortunately, it takes several weeks to identify the source of such contamination, possibly due to lack of a central database system that is ...

  7. EFSA Panel on Biological Hazards (BIOHAZ); Scientific Opinion on a review on the European Union Summary reports on trends and sources zoonoses, zoonotic agents and food-borne outbreaks in 2009 and 2010 – specifically for the data on Salmonella, Campylobacter, verotoxigenic Escherichia coli

    DEFF Research Database (Denmark)

    Hald, Tine

    health problems related to food and animal sources in the EU, it is desirable to differentiate between travel within and outside the EU. This would also be useful to better evaluate the public health impact of EU-wide food safety measures. Whenever possible the data/results should be analysed using......The European Union (EU) Summary Reports on trends and sources of zoonoses, zoonotic agents and food-borne outbreaks in 2009 and 2010 – specifically for the data on Salmonella, Campylobacter, verotoxigenic Escherichia coli, Listeria monocytogenes and foodborne outbreaks was reviewed. The main...... insight. Ultimately, summary measures of public health such as disability adjusted life years (DALYs) and cost-of-illness estimates should be presented. Travel information was found to be still incomplete in many MSs. For many pathogens this hampers source attribution. To better understand the public...

  8. Are pathogenic bacteria just looking for food? Metabolism and microbial pathogenesis

    Science.gov (United States)

    Rohmer, Laurence; Hocquet, Didier; Miller, Samuel I.

    2011-01-01

    It is interesting to speculate that the evolutionary drive of microbes to develop pathogenic characteristics was to access the nutrient resources that animals provided. Environments in animals that pathogens colonize have also driven the evolution of new bacterial characteristics to maximize these new nutritional opportunities. This review focuses on genomic and functional aspects of pathogen metabolism that allow efficient utilization of nutrient resources provided by animals. Similar to genes encoding specific virulence traits, some genes encoding metabolic functions have been horizontally acquired by pathogens to provide a selective advantage in host tissues. Selective advantage in host tissues can also be gained in some circumstances by loss of function due to mutations that alter metabolic capabilities. Greater understanding of bacterial metabolism within host tissues should be important for increased understanding of host-pathogen interactions and the development of future therapeutic strategies. PMID:21600774

  9. Tracking Foodborne Pathogenic Bacteria in Raw and Ready-to-Eat Food Illegally Sold at the Eastern EU Border.

    Science.gov (United States)

    Ciolacu, Luminita; Stessl, Beatrix; Bolocan, Andrei Sorin; Oniciuc, Elena Alexandra; Wagner, Martin; Rychli, Kathrin; Nicolau, Anca Ioana

    2016-03-01

    Food illegally brought into the European Union, mainly in the personal luggage of travelers, represents a potential threat to consumers' health. The aim of this study was to investigate the presence of five pathogens in food brought into the European Union by Moldavian citizens as personal goods and illegally sold in Romania in the vicinity of the border. The occurrence of Staphylococcus aureus and Listeria monocytogenes was 7.5% and 8%, while Campylobacter spp., Escherichia coli O157:H7, and Salmonella spp. were absent in all samples. L. monocytogenes sequence type 2, 9, 121, and 155, highly prevalent among foodstuffs worldwide, was also present among isolates from ready-to-eat food illegally sold in Romania, even at the same date of sampling, indicating cross-contamination during food handling. S. aureus spa types t449, t304, and t524 were most often isolated from raw-milk cheeses contaminated with 10(3)-10(5) colony-forming units per gram, evidencing a contamination at herd level or unhygienic conditions during processing. S. aureus t011 and t3625, both included in the livestock-associated CC398, were isolated from pork lard and poultry meat. This study shows that cross-border trade from nonmember states represents a neglected route of transmission of foodborne pathogens into the European Union that could lead to sporadic or family-associated cases of disease.

  10. Management of soil-borne diseases of organic vegetables

    Directory of Open Access Journals (Sweden)

    Shafique Hafiza Asma

    2016-07-01

    Full Text Available With the rising awareness of the adverse effects of chemical pesticides, people are looking for organically grown vegetables. Consumers are increasingly choosing organic foods due to the perception that they are healthier than those conventionally grown. Vegetable crops are vulnerable to a range of pathogenic organisms that reduce yield by killing the plant or damaging the product, thus making it unmarketable. Soil-borne diseases are among the major factors contributing to low yields of organic produce. Apart from chemical pesticides there are several methods that can be used to protect crops from soil-borne pathogens. These include the introduction of biocontrol agents against soil-borne plant pathogens, plants with therapeutic effects and organic soil amendments that stimulate antagonistic activities of microorganisms to soil-borne diseases. The decomposition of organic matter in soil also results in the accumulation of specific compounds that may be antifungal or nematicidal. With the growing interest in organic vegetables, it is necessary to find non chemical means of plant disease control. This review describes the impact of soil-borne diseases on organic vegetables and methods used for their control.

  11. Variations in the radiation sensitivity of foodborne pathogens associated with complex ready-to-eat food products

    Energy Technology Data Exchange (ETDEWEB)

    Sommers, Christopher H. [Food Safety Intervention Technologies Research Unit, Eastern Regional Research Center, Agricultural Research Service, US Department of Agriculture, 600 East Mermaid Lane, Wyndmoor, PA 19038 (United States)]. E-mail: csommers@errc.ars.usda.gov; Boyd, Glenn [Food Safety Intervention Technologies Research Unit, Eastern Regional Research Center, Agricultural Research Service, US Department of Agriculture, 600 East Mermaid Lane, Wyndmoor, PA 19038 (United States)

    2006-07-15

    Foodborne illness outbreaks and product recalls are occasionally associated with ready-to-eat (RTE) sandwiches and other 'heat and eat' multi-component RTE products. Ionizing radiation can inactivate foodborne pathogens on meat and poultry, fruits and vegetables, seafood, and RTE meat products. However, less data are available on the ability of low-dose ionizing radiation, doses under 5 kGy typically used for pasteurization purposes, to inactivate pathogenic bacteria on complex multi-component food products. In this study, the efficacy of ionizing radiation to inactivate Salmonella spp., Listeria monocytogenes, Staphylococcus aureus, Escherichia coli O157:H7, and Yersinia enterocolitica on RTE foods including a 'frankfurter on a roll', a 'beef cheeseburger on a bun' and a 'vegetarian cheeseburger on a bun' was investigated. The average D-10 values, the radiation dose needed to inactivate 1 log{sub 1} of pathogen, by bacterium species, were 0.61, 0.54, 0.47, 0.36 and 0.15 kGy for Salmonella spp., S. aureus, L. monocytogenes, E. coli O157:H7, and Y. enterocolitica, respectively when inoculated onto the three product types. These results indicate that irradiation may be an effective means for inactivating common foodborne pathogens including Salmonella spp, S. aureus, L. monocytogenes, E. coli O157:H7 and Y. enterocolitica in complex RTE food products such as 'heat and eat' sandwich products.

  12. Use of physiologically based kinetic modelling facilitated read-across in risk assessment of botanical food-borne alkenylbenzenes

    NARCIS (Netherlands)

    Al-Malahmeh, Amer

    2017-01-01

    Botanicals and botanical preparations have become widely available on the market in the form of food supplements and other food preparations. In Europe the safety of botanicals and derived food products placed on the market has to comply with the general requirements set out in regulation (EC) No

  13. Food insecurity and mental health: an analysis of routine primary care data of pregnant women in the Born in Bradford cohort.

    Science.gov (United States)

    Power, Madeleine; Uphoff, Eleonora; Kelly, Brian; Pickett, Kate E

    2017-04-01

    Since 2008, use of food banks has risen sharply in the UK; however, evidence on the epidemiology of UK food insecurity is sparse. The aim of this study was to describe the trajectory of common mental disorder across the pre-pregnancy, pregnancy and postnatal period for food secure compared with food insecure women. Data from the Born in Bradford (BiB) cohort, the nested BiB1000 study and primary care records were linked based on National Health Service (NHS) numbers. Data linkage was completed for 1297, and primary care records were available from 18 months prior to 40 months after birth of the cohort child. Incidence rates of common mental disorders per 1000 patient years at risk were compared between food secure and insecure women, and for Pakistani compared with white British women, in 10 6-month periods around pregnancy. Poisson regression was used to calculate incidence rate ratios, adjusted for ethnicity and exposure. Food insecurity was significantly associated with an increased risk of common mental disorder before and during pregnancy (incidence rate ratio 1.9, 95% confidence interval 1.3 to 2.8, p=0.001) and after giving birth (incidence rate ratio 1.3, 95% confidence interval 1.0 to 1.7, p=0.029). Our study shows that food insecure women have worse mental health than food secure women, and that this difference is most pronounced for white British pregnant women. These findings provide evidence for concerns expressed by public health experts that food insecurity may become the next public health emergency. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://www.bmj.com/company/products-services/rights-and-licensing/.

  14. Vector-borne Infections

    Centers for Disease Control (CDC) Podcasts

    2011-04-18

    This podcast discusses emerging vector-borne pathogens, their role as prominent contributors to emerging infectious diseases, how they're spread, and the ineffectiveness of mosquito control methods.  Created: 4/18/2011 by National Center for Emerging Zoonotic and Infectious Diseases (NCEZID).   Date Released: 4/27/2011.

  15. Survival and High-Hydrostatic Pressure Inactivation of Foodborne Pathogens in Salmorejo, a Traditional Ready-to-Eat Food.

    Science.gov (United States)

    Toledo Del Árbol, Julia; Pérez Pulido, Rubén; Grande, Ma José; Gálvez, Antonio; Lucas, Rosario

    2015-11-01

    Salmorejo is a traditional tomato-based creamy product. Because salmorejo is not heat-processed, there is a risk of contamination with foodborne pathogens from raw materials. Even though bacterial growth in salmorejo is strongly inhibited because of its acidic pH (close to 3.9), the growth and survival of 3 foodborne pathogens in this food has not been studied before. In this study, 3 cocktails consisting of Escherichia coli O157, Salmonella enterica serovar Enteritidis, and Listeria monocytogenes strains were inoculated in freshly prepared salmorejo. The food was treated by high hydrostatic pressure (HHP) at 400, 500, or 600 MPa for 8 min, or left untreated, and stored at 4 °C for 30 d. Viable cell counts were determined on selective media and also by the triple-layer agar method in order to detect sublethally injured cells. In control samples, L. monocytogenes viable cells decreased by 2.4 log cycles at day 7 and were undetectable by day 15. S. enterica cells decreased by 0.5 or 2.4 log cycles at days 7 and 15 respectively, but still were detectable at day 30. E. coli O157 cells survived much better in salmorejo, decreasing only by 1.5 log cycles at day 30. Treatments at pressures of 400 MPa or higher reduced viable counts of L. monocytogenes and S. enterica to undetectable levels. HHP treatments significantly (P food, usually produced on a small scale. HHP treatment at 600 MPa for 8 min can be an efficient nonthermal method for industrial-scale preparation of preservative-free salmorejo with improved safety against transmission of foodborne pathogens L. monocytogenes serotyes 4a and 4b, S. enterica serovar Enteritidis, and E. coli O157. © 2015 Institute of Food Technologists®

  16. Autoclave mediated one-pot-one-minute synthesis of AgNPs and Au-Ag nanocomposite from Melia azedarach bark extract with antimicrobial activity against food pathogens.

    Science.gov (United States)

    Pani, Alok; Lee, Joong Hee; Yun, Soon-Ii

    2016-01-01

    The increasing use of nanoparticles and nanocomposite in pharmaceutical and processed food industry have increased the demand for nontoxic and inert metallic nanostructures. Chemical and physical method of synthesis of nanostructures is most popular in industrial production, despite the fact that these methods are labor intensive and/or generate toxic effluents. There has been an increasing demand for rapid, ecofriendly and relatively cheaper synthesis of nanostructures. Here, we propose a strategy, for one-minute green synthesis of AgNPs and a one-pot one-minute green synthesis of Au-Ag nanocomposite, using Melia azedarach bark aqueous extract as reducing agent. The hydrothermal mechanism of the autoclave technology has been successfully used in this study to accelerate the nucleation and growth of nano-crystals. The study also presents high antimicrobial potential of the synthesized nano solutions against common food and water born pathogens. The multistep characterization and analysis of the synthesized nanomaterial samples, using UV-visible spectroscopy, ICP-MS, FT-IR, EDX, XRD, HR-TEM and FE-SEM, also reveal the reaction dynamics of AgNO3, AuCl3 and plant extract in synthesis of the nanoparticles and nanocomposite. The antimicrobial effectiveness of the synthesized Au-Ag nanocomposite, with high gold to silver ratio, reduces the dependency on the AgNPs, which is considered to be environmentally more toxic than the gold counterpart. We hope that this new strategy will change the present course of green synthesis. The rapidity of synthesis will also help in industrial scale green production of nanostructures using Melia azedarach.

  17. High throughput screening strategies and technology platforms for detection of pathogens: An Introduction

    Science.gov (United States)

    Globally, foodborne pathogens are a major public health concern. In this chapter, we provide a broad description of the problem of food-borne diseases and current and future detection technologies for food safety assurance and prevention of foodborne illnesses. Current detection approaches include s...

  18. Human pathogens in plant biofilms: Formation, physiology, and detection

    Science.gov (United States)

    Fresh produce, viewed as an essential part of a healthy life style is usually consumed in the form of raw or minimally processed fruits and vegetables, and is a potentially important source of food-borne human pathogenic bacteria and viruses. These are passed on to the consumer since the bacteria ca...

  19. Molecular techniques for detection and identification of pathogens in food: advantages and limitations

    OpenAIRE

    Palomino-Camargo, Carolina; Instituto de Ciencia y Tecnología de Alimentos, Facultad de Ciencias, Universidad Central de Venezuela. Caracas, Venezuela. Magíster en Ciencia y Tecnología de los Alimentos licenciada en Biología; González-Muñoz, Yuniesky; Instituto de Ciencia y Tecnología de Alimentos, Facultad de Ciencias, Universidad Central de Venezuela. Caracas, Venezuela. Ministerio del Poder Popular para la Alimentación. Caracas, Venezuela. licenciado en Ciencias de los Alimentos.

    2014-01-01

    Foodborne diseases, caused by pathogenic microorganisms, are a major public health problem worldwide. Microbiological methods commonly used in the detection of these foodborne pathogens are laborious and time consuming. This situation, coupled with the demand for immediate results and with technological advances, has led to the development of a wide range of rapid methods in recent decades. On this basis, this review describes the advantages and limitations of the main molecular methods used ...

  20. Reviews on Food Safety

    International Nuclear Information System (INIS)

    Wilkins, E.

    2004-01-01

    Food safety is an increasing concern. The desire for rapid, specific methods for the detection of viable potential pathogens has grown into a necessity. Microbial contamination of meat, fresh fruits, and vegetables has become a mounting concern during the last decade due to emphasis on their importance in a healthy diet and the recognition of new food borne pathogens such as Campylobacter jejuni, Escherichia coli 0157:H7, and Listeria monocytogenes. This paper presents an overview of different commercial techniques for identification of bacteria such as: III-nitride on Silicon Chips for detection of live bacteria, Optical Biosensors, Piezoelectric-based acoustic wave devices, Electrochemical Biosensors, Immunogenic Techniques, Polymerase chain reaction

  1. Reviews on Food Safety

    Energy Technology Data Exchange (ETDEWEB)

    Wilkins, E [Department of Chemical and Nuclear Engineering. University orNew Mexico. 209 Farris Engineering Center. Albuquerque. NM 117131 (Ukraine)

    2004-07-01

    Food safety is an increasing concern. The desire for rapid, specific methods for the detection of viable potential pathogens has grown into a necessity. Microbial contamination of meat, fresh fruits, and vegetables has become a mounting concern during the last decade due to emphasis on their importance in a healthy diet and the recognition of new food borne pathogens such as Campylobacter jejuni, Escherichia coli 0157:H7, and Listeria monocytogenes. This paper presents an overview of different commercial techniques for identification of bacteria such as: III-nitride on Silicon Chips for detection of live bacteria, Optical Biosensors, Piezoelectric-based acoustic wave devices, Electrochemical Biosensors, Immunogenic Techniques, Polymerase chain reaction.

  2. Escherichia coli and other Enterobacteriaceae: Food poisoning and health effects

    Science.gov (United States)

    The family Enterobactericeae consists of rod-shaped, Gram-negative, facultatively anaerobic, non-spore forming bacteria and also includes the food-borne pathogens, Cronobacter spp., Escherichia coli, Salmonella enterica, Shigella spp., and Yersinia spp. Illness caused by these pathogens is acquired...

  3. Intake assessment of the food additives nitrite (E 249 and E 250) and nitrate (E 251 and E 252)

    NARCIS (Netherlands)

    Sprong RC; Niekerk EM; Beukers MH; VVH; V&Z

    2017-01-01

    Nitrate and nitrite are authorised as preservatives in certain food products, such as salami, ham (nitrite) and cheese (nitrate). They prevent food spoilage and protect the consumer against food-borne pathogens. Next to that, nitrate and nitrite play a role in food colour retention and contribute to

  4. A global assembly of adult female mosquito mark-release-recapture data to inform the control of mosquito-borne pathogens

    NARCIS (Netherlands)

    Guerra, C.A.; Reiner Jr, R.C.; Perkins, T.A.; Lindsay, S.W.; Midega, J.T.; Brady, O.J.; Barker, C.M.; Reisen, W.K.; Harrington, L.C.; Takken, W.; Kitron, U.; Lloyd, A.L.; Hay, S.I.; Scott, T.W.; Smith, D.L.

    2014-01-01

    Background Pathogen transmission by mosquitos is known to be highly sensitive to mosquito bionomic parameters. Mosquito mark-release-recapture (MMRR) experiments are a standard method for estimating such parameters including dispersal, population size and density, survival, blood feeding frequency

  5. Tick-borne encephalitis virus-specific RT-PCR - a rapid test for detection of the pathogen without viral RNA purification

    Czech Academy of Sciences Publication Activity Database

    Rudenko, Natalia; Golovchenko, Maryna; Cihlářová, Věra; Grubhoffer, Libor

    2004-01-01

    Roč. 48, č. 3 (2004), s. 167-171 ISSN 0001-723X R&D Projects: GA ČR GA524/03/1326 Institutional research plan: CEZ:AV0Z6022909 Keywords : Ixodes ricinus * tick-borne encephalitis virus * RT-PCR Subject RIV: GJ - Animal Vermins ; Diseases, Veterinary Medicine Impact factor: 0.605, year: 2004

  6. Vertical distribution of the tick Ixodes ricinus and tick-borne pathogens in the Northern Moravian mountaines correlated with climate warming (Jeseníky mts., Czech Republic)

    Czech Academy of Sciences Publication Activity Database

    Daniel, M.; Materna, J.; Hönig, Václav; Metelka, L.; Danielová, V.; Harčarik, J.; Kliegrová, S.; Grubhoffer, Libor

    2009-01-01

    Roč. 17, č. 3 (2009), s. 139-145 ISSN 1210-7778 R&D Projects: GA MŠk(CZ) LC06009 Institutional research plan: CEZ:AV0Z60220518 Keywords : Ixodes ricinus * Borrelia burgdorferi genospecies * tick-borne encephalitis virus * vertical distribution * climate warming Subject RIV: FN - Epidemiology, Contagious Diseases ; Clinical Immunology

  7. Association of food security status with overweight and dietary intake: exploration of White British and Pakistani-origin families in the Born in Bradford cohort.

    Science.gov (United States)

    Yang, T C; Sahota, P; Pickett, K E; Bryant, M

    2018-04-24

    Food insecurity has been associated with dietary intake and weight status in UK adults and children although results have been mixed and ethnicity has not been explored. We aimed to compare prevalence and trajectories of weight and dietary intakes among food secure and insecure White British and Pakistani-origin families. At 12 months postpartum, mothers in the Born in Bradford cohort completed a questionnaire on food security status and a food frequency questionnaire (FFQ) assessing their child's intake in the previous month; at 18 months postpartum, mothers completed a short-form FFQ assessing dietary intake in the previous 12 months. Weights and heights of mothers and infants were assessed at 12-, 24-, and 36-months postpartum, with an additional measurement of children taken at 4-5 years. Associations between food security status and dietary intakes were assessed using Wilcoxon-Mann-Whitney for continuous variables and χ 2 or Fisher's exact tests for categorical variables. Quantile and logistic regression were used to determine dietary intakes adjusting for mother's age. Linear mixed effects models were used to assess longitudinal changes in body mass index (BMI) in mothers and BMI z-scores in children. At 12 months postpartum, White British mothers reported more food insecurity than Pakistani-origin mothers (11% vs 7%; p secure (β = 0.44 units, 95% CI: 0.33, 0.55). This was also found in Pakistani-origin children (BMI z-score: food insecure β = 0.40 units, 95% CI: 0.22, 0.59; food secure β = 0.25 units, 95% CI: 0.20, 0.29). No significant increases in BMI were observed for food secure or insecure White British mothers while BMI z-score increased by 0.17 (95% CI: 0.13, 0.21) for food secure White British children. Food insecure mothers and children had dietary intakes of poorer quality, with fewer vegetables and higher consumption of sugar-sweetened drinks. Food security status is associated with body weight and dietary intakes

  8. Discharge-based QMRA for estimation of public health risks from exposure to stormwater-borne pathogens in recreational waters in the United States.

    Science.gov (United States)

    McBride, Graham B; Stott, Rebecca; Miller, Woutrina; Bambic, Dustin; Wuertz, Stefan

    2013-09-15

    This study is the first to report a quantitative microbial risk assessment (QMRA) on pathogens detected in stormwater discharges-of-concern, rather than relying on pathogen measurements in receiving waters. The pathogen concentrations include seven "Reference Pathogens" identified by the U.S. EPA: Cryptosporidium, Giardia, Salmonella, Norovirus, Rotavirus, Enterovirus, and Adenovirus. Data were collected from 12 sites representative of seven discharge types (including residential, commercial/industrial runoff, agricultural runoff, combined sewer overflows, and forested land), mainly during wet weather conditions during which times human health risks can be substantially elevated. The risks calculated herein therefore generally apply to short-term conditions (during and just after rainfall events) and so the results can be used by water managers to potentially inform the public, even for waters that comply with current criteria (based as they are on a 30-day mean risk). Using an example waterbody and mixed source, pathogen concentrations were used in QMRA models to generate risk profiles for primary and secondary water contact (or inhalation) by adults and children. A number of critical assumptions and considerations around the QMRA analysis are highlighted, particularly the harmonization of the pathogen concentrations measured in discharges during this project with those measured (using different methods) during the published dose-response clinical trials. Norovirus was the most dominant predicted health risk, though further research on its dose-response for illness (cf. infection) is needed. Even if the example mixed-source concentrations of pathogens had been reduced 30 times (by inactivation and mixing), the predicted swimming-associated illness rates - largely driven by Norovirus infections - can still be appreciable. Rotavirus generally induced the second-highest incidence of risk among the tested pathogens while risks for the other Reference Pathogens

  9. Toxicity of Food-Grade TiO2 to Commensal Intestinal and Transient Food-Borne Bacteria: New Insights Using Nano-SIMS and Synchrotron UV Fluorescence Imaging

    Science.gov (United States)

    Radziwill-Bienkowska, Joanna M.; Talbot, Pauline; Kamphuis, Jasper B. J.; Robert, Véronique; Cartier, Christel; Fourquaux, Isabelle; Lentzen, Esther; Audinot, Jean-Nicolas; Jamme, Frédéric; Réfrégiers, Matthieu; Bardowski, Jacek K.; Langella, Philippe; Kowalczyk, Magdalena; Houdeau, Eric; Thomas, Muriel; Mercier-Bonin, Muriel

    2018-01-01

    Titanium dioxide (TiO2) is commonly used as a food additive (E171 in the EU) for its whitening and opacifying properties. However, a risk of intestinal barrier disruption, including dysbiosis of the gut microbiota, is increasingly suspected because of the presence of a nano-sized fraction in this additive. We hypothesized that food-grade E171 and Aeroxyde P25 (identical to the NM-105 OECD reference nanomaterial in the European Union Joint Research Centre) interact with both commensal intestinal bacteria and transient food-borne bacteria under non-UV-irradiated conditions. Based on differences in their physicochemical properties, we expect a difference in their respective effects. To test these hypotheses, we chose a panel of eight Gram-positive/Gram-negative bacterial strains, isolated from different biotopes and belonging to the species Escherichia coli, Lactobacillus rhamnosus, Lactococcus lactis (subsp. lactis and cremoris), Streptococcus thermophilus, and Lactobacillus sakei. Bacterial cells were exposed to food-grade E171 vs. P25 in vitro and the interactions were explored with innovative (nano)imaging methods. The ability of bacteria to trap TiO2 was demonstrated using synchrotron UV fluorescence imaging with single cell resolution. Subsequent alterations in the growth profiles were shown, notably for the transient food-borne L. lactis and the commensal intestinal E. coli in contact with food-grade TiO2. However, for both species, the reduction in cell cultivability remained moderate, and the morphological and ultrastructural damages, observed with electron microscopy, were restricted to a small number of cells. E. coli exposed to food-grade TiO2 showed some internalization of TiO2 (7% of cells), observed with high-resolution nano-secondary ion mass spectrometry (Nano-SIMS) chemical imaging. Taken together, these data show that E171 may be trapped by commensal and transient food-borne bacteria within the gut. In return, it may induce some physiological

  10. Toxicity of Food-Grade TiO2 to Commensal Intestinal and Transient Food-Borne Bacteria: New Insights Using Nano-SIMS and Synchrotron UV Fluorescence Imaging.

    Science.gov (United States)

    Radziwill-Bienkowska, Joanna M; Talbot, Pauline; Kamphuis, Jasper B J; Robert, Véronique; Cartier, Christel; Fourquaux, Isabelle; Lentzen, Esther; Audinot, Jean-Nicolas; Jamme, Frédéric; Réfrégiers, Matthieu; Bardowski, Jacek K; Langella, Philippe; Kowalczyk, Magdalena; Houdeau, Eric; Thomas, Muriel; Mercier-Bonin, Muriel

    2018-01-01

    Titanium dioxide (TiO 2 ) is commonly used as a food additive (E171 in the EU) for its whitening and opacifying properties. However, a risk of intestinal barrier disruption, including dysbiosis of the gut microbiota, is increasingly suspected because of the presence of a nano-sized fraction in this additive. We hypothesized that food-grade E171 and Aeroxyde P25 (identical to the NM-105 OECD reference nanomaterial in the European Union Joint Research Centre) interact with both commensal intestinal bacteria and transient food-borne bacteria under non-UV-irradiated conditions. Based on differences in their physicochemical properties, we expect a difference in their respective effects. To test these hypotheses, we chose a panel of eight Gram-positive/Gram-negative bacterial strains, isolated from different biotopes and belonging to the species Escherichia coli , Lactobacillus rhamnosus , Lactococcus lactis (subsp. lactis and cremoris ), Streptococcus thermophilus , and Lactobacillus sakei . Bacterial cells were exposed to food-grade E171 vs. P25 in vitro and the interactions were explored with innovative (nano)imaging methods. The ability of bacteria to trap TiO 2 was demonstrated using synchrotron UV fluorescence imaging with single cell resolution. Subsequent alterations in the growth profiles were shown, notably for the transient food-borne L. lactis and the commensal intestinal E. coli in contact with food-grade TiO 2 . However, for both species, the reduction in cell cultivability remained moderate, and the morphological and ultrastructural damages, observed with electron microscopy, were restricted to a small number of cells. E. coli exposed to food-grade TiO 2 showed some internalization of TiO 2 (7% of cells), observed with high-resolution nano-secondary ion mass spectrometry (Nano-SIMS) chemical imaging. Taken together, these data show that E171 may be trapped by commensal and transient food-borne bacteria within the gut. In return, it may induce some

  11. Toxicity of Food-Grade TiO2 to Commensal Intestinal and Transient Food-Borne Bacteria: New Insights Using Nano-SIMS and Synchrotron UV Fluorescence Imaging

    Directory of Open Access Journals (Sweden)

    Joanna M. Radziwill-Bienkowska

    2018-04-01

    Full Text Available Titanium dioxide (TiO2 is commonly used as a food additive (E171 in the EU for its whitening and opacifying properties. However, a risk of intestinal barrier disruption, including dysbiosis of the gut microbiota, is increasingly suspected because of the presence of a nano-sized fraction in this additive. We hypothesized that food-grade E171 and Aeroxyde P25 (identical to the NM-105 OECD reference nanomaterial in the European Union Joint Research Centre interact with both commensal intestinal bacteria and transient food-borne bacteria under non-UV-irradiated conditions. Based on differences in their physicochemical properties, we expect a difference in their respective effects. To test these hypotheses, we chose a panel of eight Gram-positive/Gram-negative bacterial strains, isolated from different biotopes and belonging to the species Escherichia coli, Lactobacillus rhamnosus, Lactococcus lactis (subsp. lactis and cremoris, Streptococcus thermophilus, and Lactobacillus sakei. Bacterial cells were exposed to food-grade E171 vs. P25 in vitro and the interactions were explored with innovative (nanoimaging methods. The ability of bacteria to trap TiO2 was demonstrated using synchrotron UV fluorescence imaging with single cell resolution. Subsequent alterations in the growth profiles were shown, notably for the transient food-borne L. lactis and the commensal intestinal E. coli in contact with food-grade TiO2. However, for both species, the reduction in cell cultivability remained moderate, and the morphological and ultrastructural damages, observed with electron microscopy, were restricted to a small number of cells. E. coli exposed to food-grade TiO2 showed some internalization of TiO2 (7% of cells, observed with high-resolution nano-secondary ion mass spectrometry (Nano-SIMS chemical imaging. Taken together, these data show that E171 may be trapped by commensal and transient food-borne bacteria within the gut. In return, it may induce some

  12. Epidemiological investigation of a food-borne gastroenteritis outbreak caused by Norwalk-like virus in 30 day-care centres.

    Science.gov (United States)

    Götz, Hannelore; de Jong, Birgitta; Lindbäck, Johan; Parment, Per Arne; Hedlund, Kjell Olof; Torvén, Maria; Ekdahl, Karl

    2002-01-01

    In March 1999, an outbreak of gastroenteritis occurred affecting 30 day-care centres served by the same caterer. A retrospective cohort study was performed in 13 randomly selected day-care centres to determine the source and mode of transmission. Electron microscopy and PCR were used to verify the diagnosis. The overall attack rate (AR) was 37% (195/524): 30% in children and 62% in adults. Modified by the age of the patient, eating pumpkin salad served on 1 March was associated with becoming an early case (odds ratio = 3.9; 95% confidence interval 1.8-8.8). No significant association was found between food consumption and becoming a late case. The primary food-borne AR was 27% and the secondary AR was 14%. The same genotype of Norwalk-like virus was found in 5 cases and in 1 ill and 1 asymptomatic food-handler. Contamination by 1 of the food-handlers seems the most likely route of spread of the virus and underlines the importance of strict hygienic routines.

  13. The effects of global change on the threat of exotic arthropods and arthropod-borne pathogens to livestock in the United States.

    Science.gov (United States)

    George, John E

    2008-12-01

    Arthropod-borne diseases are an important part of the group of foreign animal diseases that command attention from federal, state, and local animal health authorities in the United States because of the potential for adverse local and regional animal health impacts and also because of possible losses of export markets. Diseases of concern are listed by the US Animal Health Association and also by the Office International des Epizooties. Global change is causing the emergence of newly recognized diseases and altering enzootic and epizootic circumstances for known disease problems. Selected examples of arthropod-borne diseases of importance are discussed in terms of their potential for introduction, spread, and impact on livestock and human health in the United States.

  14. The use of plants to protect plants and food against fungal pathogens

    African Journals Online (AJOL)

    Background: Plant fungal pathogens play a crucial role in the profitability, quality and quantity of plant production. These phytopathogens are persistent in avoiding plant defences causing diseases and quality losses around the world that amount to billions of US dollars annually. To control the scourge of plant fungal ...

  15. From the ground up: groundwater, surface water runoff, and air as pathogen routes for food contamination

    Science.gov (United States)

    Foodborne infectious disease transmission of 31 pathogen types is estimated to account for 9.4 million illnesses, 56,000 hospitalizations, and 1,300 deaths in the United States annually (Scallan et al. 2011). The economic costs from foodborne illness in the United States are more than $50 billion pe...

  16. Migrating birds and carnivores introduce ticks and tick borne pathogens to Denmark – but are they also a public health risk?

    DEFF Research Database (Denmark)

    Bødker, Rene; Vrbová, Erika; Højgaard, Jesper

    Since the end of the ice age, spring migrating birds from Africa and Europe and autumn migrating birds from Northern Scandinavia have entered Denmark, and recently a small wave of long migrating carnivores have started arriving in Denmark from Central Europe. Theoretically, migrating birds could...... introduce new tick species as well as tick-associated pathogens to Denmark. These migrating animals may also carry ticks and pathogens which already exist in native tick populations in Denmark. The potential supplement of native ticks and existing pathogens to the established high density tick populations...... in Danish forest and nature areas can be expected to be of little practical importance. However, some of the infected ticks, introduced by migrating birds, may be deposited in private gardens and public parks that are otherwise not able to sustain a viable tick population. Migrating birds may therefore...

  17. EFSA BIOHAZ Panel (EFSA Panel on Biological Hazards), 2014. Scientific Opinion on the evaluation of molecular typing methods for major food-borne microbiological hazards and their use for attribution modelling, outbreak investigation and scanning surveillance: Part 2 (surveillance and data

    DEFF Research Database (Denmark)

    Hald, Tine; Baggesen, Dorte Lau

    as epidemiologically-related. Molecular typing data should be coupled with a minimum required set of epidemiological data and datasets should be comparable to facilitate joint analyses in conjunction with human case data. Rules for assembling strain collections and associated provenance data should be agreed...... and introduced as EU standards. The data collection process and the characteristics of the data repository should ensure reproducibility and maximise compatibility and interoperability between different datasets. Molecular bacterial characterisation developments, particularly Whole Genome Sequencing (WGS......), should be harmonised with those used for surveillance in the human population and food industry. Reference methods and materials, including sequence data, should be adopted for typing of food-borne pathogens. Upload of molecular data should only be allowed for approved laboratories and should be subject...

  18. Bactericidal and antibiofilm activity of bactenecin-derivative peptides against the food-pathogen Listeria monocytogenes: New perspectives for food processing industry.

    Science.gov (United States)

    Palmieri, Gianna; Balestrieri, Marco; Capuano, Federico; Proroga, Yolande T R; Pomilio, Francesco; Centorame, Patrizia; Riccio, Alessia; Marrone, Raffaele; Anastasio, Aniello

    2018-08-20

    Antimicrobial peptides have received great attention for their potential benefits to extend the shelf-life of food-products. Innate defense regulator peptide-1018 (IDR-1018) represents a promising candidate for such applications, due to its broad-spectrum antimicrobial activity, although food-isolated pathogens have been poorly investigated. Herein, we describe the design and the structural-functional characterization of a new 1018-derivative peptide named 1018-K6, in which the alanine in position 6 was replaced with a lysine. Spectroscopic analysis revealed a noticeable switch from β-sheet to helical conformations of 1018-K6 respect to IDR-1018, with a faster folding kinetic and increased structural stability. Moreover, 1018-K6 evidenced a significant antibiofilm/bactericidal efficiency specifically against Listeria monocytogenes isolates from food-products and food-processing environments, belonging to serotype 4b involved in the majority of human-listeriosis cases, with EC 50 values two- five-fold lower than those measured for IDR-1018. Therefore, a single amino-acid substitution in IDR-1018 sequence produced severe changes in peptide conformation and antimicrobial performances. Published by Elsevier B.V.

  19. A food-borne outbreak of gastroenteritis caused by norovirus GII in a university located in Xiamen City, China

    Directory of Open Access Journals (Sweden)

    Zhinan Guo

    2014-11-01

    Conclusions: The outbreak of gastroenteritis was caused mainly by bread products contaminated with norovirus GII. A food handler with an asymptomatic norovirus GII infection was the possible source of infection.

  20. Sporothrix chilensis sp. nov. (Ascomycota : Ophiostomatales), a soil-borne agent of human sporotrichosis with mild-pathogenic potential to mammals

    NARCIS (Netherlands)

    Rodrigues, Anderson Messias; Cruz Choappa, Rodrigo; Fernandes, Geisa Ferreira; de Hoog, G Sybren; de Camargo, Zoilo Pires

    A combination of phylogeny, evolution, morphologies and ecologies has enabled major advances in understanding the taxonomy of Sporothrix species, including members exhibiting distinct lifestyles such as saprobes, human/animal pathogens, and insect symbionts. Phylogenetic analyses of ITS1/2 + 5.8s

  1. Inactivation of high concentration of pathogens in land-applied food ...

    African Journals Online (AJOL)

    2008-10-16

    Oct 16, 2008 ... In Mexico, as in other developing countries, the most important pollution and management problems of food-processing sludge are the high levels .... or ammonia is reduced due to its dilution in the water contained in sludge.

  2. Assessing the Groundwater Quality at a Saudi Arabian Agricultural Site and the Occurrence of Opportunistic Pathogens on Irrigated Food Produce

    KAUST Repository

    Alsalah, Dhafer

    2015-10-05

    This study examines the groundwater quality in wells situated near agricultural fields in Saudi Arabia. Fruits (e.g., tomato and green pepper) irrigated with groundwater were also assessed for the occurrence of opportunistic pathogens to determine if food safety was compromised by the groundwater. The amount of total nitrogen in most of the groundwater samples exceeded the 15 mg/L permissible limit for agricultural irrigation. Fecal coliforms in densities > 12 MPN/100 mL were detected in three of the groundwater wells that were in close proximity to a chicken farm. These findings, coupled with qPCR-based fecal source tracking, show that groundwater in wells D and E, which were nearest to the chicken farm, had compromised quality. Anthropogenic contamination resulted in a shift in the predominant bacterial phyla within the groundwater microbial communities. For example, there was an elevated presence of Proteobacteria and Cyanobacteria in wells D and E but a lower overall microbial richness in the groundwater perturbed by anthropogenic contamination. In the remaining wells, the genus Acinetobacter was detected at high relative abundance ranging from 1.5% to 48% of the total groundwater microbial community. However, culture-based analysis did not recover any antibiotic-resistant bacteria or opportunistic pathogens from these groundwater samples. In contrast, opportunistic pathogenic Enterococcus faecalis and Pseudomonas aeruginosa were isolated from the fruits irrigated with the groundwater from wells B and F. Although the groundwater was compromised, quantitative microbial risk assessment suggests that the annual risk incurred from accidental consumption of E. faecalis on these fruits was within the acceptable limit of 10−4. However, the annual risk arising from P. aeruginosa was 9.55 × 10−4, slightly above the acceptable limit. Our findings highlight that the groundwater quality at this agricultural site in western Saudi Arabia is not pristine and that better

  3. Antimicrobial resistance prevalence of pathogenic and commensal Escherichia coli in food-producing animals in Belgium

    OpenAIRE

    Chantziaras, Ilias; Dewulf, Jeroen; Boyen, Filip; Callens, Benedicte; Butaye, Patrick

    2014-01-01

    In this article, detailed studies on antimicrobial resistance to commensal E. coli (in pigs, meat-producing bovines, broiler chickens and veal calves) and pathogenic E. coli (in pigs and bovines) in Belgium are presented for 2011. Broiler chicken and veal calf isolates of commensal E. coli demonstrated higher antimicrobial resistance prevalence than isolates from pigs and bovines. Fifty percent of E. coli isolates from broiler chickens were resistant to at least five antimicrobials, whereas s...

  4. Interventions to prevent and control food-borne diseases associated with a reduction in traveler's diarrhea in tourists to Jamaica.

    Science.gov (United States)

    Ashley, David V M; Walters, Christine; Dockery-Brown, Cheryl; McNab, André; Ashley, Deanna E C

    2004-01-01

    In 1996 a study found that approximately one in four tourists to Jamaica were affected with traveler's diarrhea (TD) during their stay. That year the Ministry of Health initiated a program for the prevention and control of TD. The aim of this ongoing program was to reduce attack rates of TD from 25% to 12% over a 5-year period by improving the environmental health and food safety standards of hotels. Hotel-based surveillance procedures for TD were implemented in sentinel hotels in Negril and Montego Bay in 1996, Ocho Rios in 1997, and Kingston in 1999. A structured program provided training and technical assistance to nurses, food and beverage staff, and environmental sanitation personnel in the implementation of Hazard Analysis Critical Control Point principles for monitoring food safety standards. The impact of interventions on TD was assessed in a survey of tourists departing from the international airport in Montego Bay in 1997-1998 and from the international airport in Kingston in 1999-2000. The impact of the training and technical assistance program on food safety standards and practices was assessed in hotels in Ocho Rios as of 1998 and in Kingston from 1999. At the end of May 2002, TD incidence rates were 72% lower than in 1996, when the Ministry of Health initiated its program for the prevention and control of TD. Both hotel surveillance data and airport surveillance data suggest that the vast majority of travelers to Kingston and southern regions are not afflicted with TD during their stay. The training and technical assistance program improved compliance to food safety standards over time. Interventions to prevent and control TD in visitors to Jamaica are positively associated with a reduction in TD in the visitor population and improvements in food safety standards and practices in hotels.

  5. IRIDOID GLYCOSIDES FROM LINARIA GENISTIFOLIA (L. MILL. IN BIOLOGICAL CONTROL OF SOIL-BORNE FUNGAL PATHOGENS OF WHEAT AND SOME STRUCTURE CONSIDERATIONS

    Directory of Open Access Journals (Sweden)

    Natalia Mashcenko

    2015-06-01

    Full Text Available Biological activity of the iridoid glycosides extract from Linaria genistifolia (L. Mill. has been investigated, namely its influence on the resistance of the winter wheat Odesschi 51 plant to the caused by the Fusarium oxysporum and Helminthosporium avenae pathogenic fungi root rot. Our results indicate that summary iridoid glycosides from this plant, containing four major known compounds: 5-O-allosylantirrinoside, antirrinoside, linarioside and 6-β-hidroxiantirride, can be successfully employed in biological control of the afore-mentioned wheat pathogens: it stimulates wheat grains germination and embryonic root growth in conditions of fungal infection. 1H and 13C NMR characteristics of 5-O-allosylantirrinoside in Py-d5 are for the first time presented. Structures of two conformers of 5-O-allosylantirrinoside in D2O and Py-d5 solutions are proposed, based on the experimental NMR evidence and molecular modelling studies.

  6. Effect of root exudates of various plants on composition of bacteria and fungi communities with special regard to pathogenic soil-borne fungi

    OpenAIRE

    Danuta Piętka; Elżbieta Patkowska

    2013-01-01

    The purpose of the studies conducted in the years 1996 - 1998 was to determine the composition of bacteria and fungi populations in the rhizosphere of winter wheat, spring wheat, soybean and potato, and in non-rhizosphere soil. Besides, the effect of root exudates of these plants on the formation of pathogenic fungi communities was established. The microbiological analysis showed that the greatest tolal number of bacteria was found in the rhizospheres of potato and soybean, and the lowest num...

  7. Comparative Resistance of Bacterial Foodborne Pathogens to Non-thermal Technologies for Food Preservation.

    Science.gov (United States)

    Cebrián, Guillermo; Mañas, Pilar; Condón, Santiago

    2016-01-01

    In this paper the resistance of bacterial foodborne pathogens to manosonication (MS), pulsed electric fields (PEFs), high hydrostatic pressure (HHP), and UV-light (UV) is reviewed and compared. The influence of different factors on the resistance of bacterial foodborne pathogens to these technologies is also compared and discussed. Only results obtained under harmonized experimental conditions have been considered. This has allowed us to establish meaningful comparisons and draw significant conclusions. Among the six microorganisms here considered, Staphyloccocus aureus is the most resistant foodborne pathogen to MS and HHP and Listeria monocytogenes to UV. The target microorganism of PEF would change depending on the treatment medium pH. Thus, L. monocytogenes is the most PEF resistant microorganism at neutral pH but Gram-negatives (Escherichia coli, Salmonella spp., Cronobacter sakazakii, Campylobacter jejuni) would display a similar or even higher resistance at acidic pH. It should be noted that, in acidic products, the baroresistance of some E. coli strains would be comparable to that of S. aureus. The factors affecting the resistance of bacterial foodborne pathogens, as well as the magnitude of the effect, varied depending on the technology considered. Inter- and intra-specific differences in microbial resistance to PEF and HHP are much greater than to MS and UV. Similarly, both the pH and aw of the treatment medium highly condition microbial resistance to PEF and HHP but no to MS or UV. Growth phase also drastically affected bacterial HHP resistance. Regarding UV, the optical properties of the medium are, by far, the most influential factor affecting its lethal efficacy. Finally, increasing treatment temperature leads to a significant increase in lethality of the four technologies, what opens the possibility of the development of combined processes including heat. The appearance of sublethally damaged cells following PEF and HHP treatments could also be

  8. Comparative Resistance of Bacterial Foodborne Pathogens to Non-thermal Technologies for Food Preservation

    Science.gov (United States)

    Cebrián, Guillermo; Mañas, Pilar; Condón, Santiago

    2016-01-01

    In this paper the resistance of bacterial foodborne pathogens to manosonication (MS), pulsed electric fields (PEFs), high hydrostatic pressure (HHP), and UV-light (UV) is reviewed and compared. The influence of different factors on the resistance of bacterial foodborne pathogens to these technologies is also compared and discussed. Only results obtained under harmonized experimental conditions have been considered. This has allowed us to establish meaningful comparisons and draw significant conclusions. Among the six microorganisms here considered, Staphyloccocus aureus is the most resistant foodborne pathogen to MS and HHP and Listeria monocytogenes to UV. The target microorganism of PEF would change depending on the treatment medium pH. Thus, L. monocytogenes is the most PEF resistant microorganism at neutral pH but Gram-negatives (Escherichia coli, Salmonella spp., Cronobacter sakazakii, Campylobacter jejuni) would display a similar or even higher resistance at acidic pH. It should be noted that, in acidic products, the baroresistance of some E. coli strains would be comparable to that of S. aureus. The factors affecting the resistance of bacterial foodborne pathogens, as well as the magnitude of the effect, varied depending on the technology considered. Inter- and intra-specific differences in microbial resistance to PEF and HHP are much greater than to MS and UV. Similarly, both the pH and aw of the treatment medium highly condition microbial resistance to PEF and HHP but no to MS or UV. Growth phase also drastically affected bacterial HHP resistance. Regarding UV, the optical properties of the medium are, by far, the most influential factor affecting its lethal efficacy. Finally, increasing treatment temperature leads to a significant increase in lethality of the four technologies, what opens the possibility of the development of combined processes including heat. The appearance of sublethally damaged cells following PEF and HHP treatments could also be

  9. COMPARATIVE RESISTANCE OF BACTERIAL FOODBORNE PATHOGENS TO NON-THERMAL TECHNOLOGIES FOR FOOD PRESERVATION

    Directory of Open Access Journals (Sweden)

    Guillermo eCebrián

    2016-05-01

    Full Text Available In this paper the resistance of bacterial foodborne pathogens to manosonication (MS, pulsed electric fields (PEF, high hydrostatic pressure (HHP and UV-light (UV is reviewed and compared. The influence of different factors on the resistance of bacterial foodborne pathogens to these technologies is also compared and discussed. Only results obtained under harmonized experimental conditions have been considered. This has allowed us to establish meaningful comparisons and draw significant conclusions. Among the six microorganisms here considered, Staphyloccocus aureus is the most resistant foodborne pathogen to MS and HHP and Listeria monocytogenes to UV. The target microorganism of PEF would change depending on the treatment medium pH. Thus, L. monocytogenes is the most PEF resistant microorganism at neutral pH but Gram-negatives (Escherichia coli, Salmonella spp., Cronobacter sakazakii, Campylobacter jejuni would display a similar or even higher resistance at acidic pH. It should be noted that, in acidic products, the baroresistance of some E. coli strains would be comparable to that of S. aureus. The factors affecting the resistance of bacterial foodborne pathogens, as well as the magnitude of the effect, varied depending on the technology considered. Inter- and intra-specific differences in microbial resistance to PEF and HHP are much greater than to MS and UV. Similarly, both the pH and aw of the treatment medium highly condition microbial resistance to PEF and HHP but no to MS or UV. Growth phase also drastically affected bacterial HHP resistance. Regarding UV, the optical properties of the medium are, by far, the most influential factor affecting its lethal efficacy. Finally, increasing treatment temperature leads to a significant increase in lethality of the four technologies, what opens the possibility of the development of combined processes including heat. The appearance of sublethally damaged cells following PEF and HHP treatments could

  10. Vector borne diseases

    OpenAIRE

    Melillo Fenech, Tanya

    2010-01-01

    A vector-borne disease is one in which the pathogenic microorganism is transmitted from an infected individual to another individual by an arthropod or other agent. The transmission depends upon the attributes and requirements of at least three different Iiving organisms : the pathologic agent which is either a virus, protozoa, bacteria or helminth (worm); the vector, which is commonly an arthropod such as ticks or mosquitoes; and the human host.

  11. Prevalence of potentially pathogenic Bacillus cereus in food commodities in The Netherlands

    NARCIS (Netherlands)

    Wijnands, L.M.; Dufrenne, J.B.; Rombouts, F.M.; Veld, in 't P.H.; Leusden, van F.M.

    2006-01-01

    Randomly selected food commodities, categorized in product groups, were investigated for the presence and number of Bacillus cereus bacteria. If positive, and when possible, five separate colonies were isolated and investigated for the presence of four virulence factors: presence of genes encoding

  12. Effect of Origanum heracleoticum L. essential oil on food-borne Penicillium aurantiogriseum and Penicilium chrysogenum isolates

    Directory of Open Access Journals (Sweden)

    Čabarkapa Ivana S.

    2011-01-01

    Full Text Available Molds are ubiquitously distributed in nature and their spores can be found in the atmosphere even at high altitudes. The difficulty of controlling these undesirable molds, as well as the growing interest of the consumers in natural products, have been forcing the industry to find new alternatives for food preservation. The modern trends in nutrition suggest the limitation of synthetic food additives or substitution with natural ones. Aromatic herbs are probably the most important source of natural antimicrobial agents. Origanum heracleoticum L. essential oil has been known as an interesting source of antimicrobial compounds to be applied in food preservation. In the this work, we have investigated the effect of essential oil obtained from O. heracleoticum on growth of six isolates of Penicillium aurantiogriseum and four isolates of Penicillium chrysogenum isolated from meat plant for traditional Petrovacka sausage (Petrovská klobása production. The findings reveal that the essential oil of O. heracleoticum provides inhibition of all of fungal isolates tested. O. heracleoticum L. essential oil exhibited higher antifungal activity against the isolates of P. chrysogenum than the isolates of P. aurantiogriseum. O. heracleoticum essential oil showed a MIC value ranging from 25 to 100 μL/mL. The fungi cultivated in the medium with higher concentration of essential oil showed certain morphological changes. The alterations included lack of sporulation and loss of pigmentation.

  13. Successful Use of Advertisement Pictures to Assist Recall in a Food-Borne Hepatitis A Outbreak in The Netherlands, 2017.

    Science.gov (United States)

    Mollers, Madelief; Boxman, Ingeborg L A; Vennema, Harry; Slegers-Fitz-James, Ife A; Brandwagt, Diederik; Friesema, Ingrid H; Batstra, Jenny S; Te Wierik, Margreet J M

    2018-05-04

    This study describes an outbreak investigation of 14 hepatitis A cases in the Netherlands. The hepatitis A virus (HAV) genotype IB sequences in cases were highly similar (459/460 nt). The origin of strains could be narrowed to Bulgaria based on information from EPIS-FWD. As an association with consumption of soft fruit was suspected, a case-control study was initiated using a questionnaire and a list of pictures of soft fruit available at the supermarket chain involved. Twelve out of 13 cases consumed a specific frozen raspberry/blueberry product shown on the list (OR 46.0, 95% CI 5.0-27). In multivariable regression analysis this product was the only risk factor (aOR 26.6, 95% CI 2.0-263). Laboratory analyses could not demonstrate HAV-RNA in batches that had been on the market in the incubation period of patients. Trace back of frozen fruit showed that raspberries had been traded by a producer in Bulgaria. After withdrawal of the product from the supermarket no new cases were reported. Use of advertisement pictures of consumed food was helpful in this investigation. Suspicion of the source was strengthened by data from molecular typing and food trace back activities, underlining the importance of good (inter)national cooperation between public health and food safety organisations.

  14. Negligible colon cancer risk from food-borne acrylamide exposure in male F344 rats and nude (nu/nu mice-bearing human colon tumor xenografts.

    Directory of Open Access Journals (Sweden)

    Jayadev Raju

    Full Text Available Acrylamide, a possible human carcinogen, is formed in certain carbohydrate-rich foods processed at high temperature. We evaluated if dietary acrylamide, at doses (0.5, 1.0 or 2.0 mg/kg diet reflecting upper levels found in human foods, modulated colon tumorigenesis in two rodent models. Male F344 rats were randomized to receive diets without (control or with acrylamide. 2-weeks later, rats in each group received two weekly subcutaneous injections of either azoxymethane (AOM or saline, and were killed 20 weeks post-injections; colons were assessed for tumors. Male athymic nude (nu/nu mice bearing HT-29 human colon adenocarcinoma cells-derived tumor xenografts received diets without (control or with acrylamide; tumor growth was monitored and mice were killed 4 weeks later. In the F344 rat study, no tumors were found in the colons of the saline-injected rats. However, the colon tumor incidence was 54.2% and 66.7% in the control and the 2 mg/kg acrylamide-treated AOM-injected groups, respectively. While tumor multiplicity was similar across all diet groups, tumor size and burden were higher in the 2 mg/kg acrylamide group compared to the AOM control. These results suggest that acrylamide by itself is not a "complete carcinogen", but acts as a "co-carcinogen" by exacerbating the effects of AOM. The nude mouse study indicated no differences in the growth of human colon tumor xenografts between acrylamide-treated and control mice, suggesting that acrylamide does not aid in the progression of established tumors. Hence, food-borne acrylamide at levels comparable to those found in human foods is neither an independent carcinogen nor a tumor promoter in the colon. However, our results characterize a potential hazard of acrylamide as a colon co-carcinogen in association with known and possibly other environmental tumor initiators/promoters.

  15. Hepatitis A in Hispanic children who live along the United States-Mexico border: the role of international travel and food-borne exposures.

    Science.gov (United States)

    Weinberg, Michelle; Hopkins, Jackie; Farrington, Leigh; Gresham, Louise; Ginsberg, Michele; Bell, Beth P

    2004-07-01

    Hispanic children who live along the United States-Mexico border historically have had among the highest hepatitis A rates in the United States, but risk factors have not been well characterized. The objective of this study was to examine risk factors associated with acute hepatitis A virus (HAV) infection in Hispanic children who live along the United States-Mexico border in San Diego County, California. In this case-control study, hepatitis A cases among Hispanic children who were younger than 18 years reported from June 1998 through August 2000 were matched by age group and exposure period to Hispanic children who were susceptible to HAV infection. Participants and their families were interviewed about demographic information and potential sources of HAV infection, including attending child care, food and waterborne exposures, cross-border and other international travel, and travel-related activities. Participants included 132 children with hepatitis A and 354 control subjects. The median age of study participants was 7 years (range: 1-17). Sixty-seven percent of case-patients traveled outside the United States during the incubation period, compared with 25% of the children without hepatitis A (odds ratio [OR]: 6.3; 95% confidence interval [CI]: 4.0-9.7); all children, except 1, had traveled to Mexico. In multivariate analysis, hepatitis A was associated with having eaten food from a taco stand or street food vendor (adjusted OR: 17.0; 95% CI: 4.1-71.1) and having eaten salad/lettuce (adjusted OR: 5.2; 95% CI: 1.3-20.1) during travel. Hepatitis A among Hispanic children who live in an urban area of the United States-Mexico border is associated with cross-border travel to Mexico and food-borne exposures during travel. Travelers to areas where hepatitis A is endemic should receive hepatitis A vaccine before travel.

  16. Use of ionising radiation for food processing applications

    International Nuclear Information System (INIS)

    Ninjoor, V.

    1989-01-01

    Food irradiation is a recently developed technique used to sterilize and preserve food. Food products are exposed to ionising radiations such as X-rays, gamma rays or high energy electrons which destroy food borne pathogens and parasites and inhibit sprouting. Shelf life of food is extended. The following aspects of radiation processing of food are discussed in the monograph: radiation sources, choice of dose for specific results, safety and nutritional quality of radiation processed food, international status of acceptance of food irradiation, and cost. (M.G.B.). 6 tabs

  17. Effects of combined treatments of irradiation and antimicrobial coatings on reduction of food pathogens in broccoli florets

    Science.gov (United States)

    Takala, P. N.; Salmieri, S.; Vu, K. D.; Lacroix, M.

    2011-12-01

    The effect of combined treatment of antimicrobial coatings and γ-radiation on reduction of food pathogens such as Listeria monocytogenes, Escherichia coli, and Salmonella Typhimurium was evaluated in broccoli florets. Broccoli florets were inoculated with pathogenic bacteria at 10 6 CFU/g. Inoculated florets were then coated with methylcellulose-based coating containing various mixtures of antimicrobial agents: organic acids (OAs) plus lactic acid bacteria metabolites (LABs), OA plus citrus extract (CE), OA plus CE plus spice mixture (SM), and OA plus rosemary extract (RE). Coated florets were irradiated with various doses (0-3.3 kGy), and microbial analyses were used to calculate the D10 value and radiosensitive relative. The coating containing OA plus CE was the most effective formulation for increasing the sensitization of Escherichia coli by 2.4 times as compared to the control without the antimicrobial coating. For Salmonella Typhimurium, coating containing OA plus LAB was the most effective formulation, increasing radiosensitivity by 2.4 times as well. All antimicrobial coatings had almost the same effect of increasing the sensitivity of Listeria monocytogenes (from 1.31 to 1.45 times) to γ-irradiation.

  18. High occurrence of Helicobacter pylori in raw goat, sheep and cow milk inferred by glmM gene: a risk of food-borne infection?

    Science.gov (United States)

    Quaglia, N C; Dambrosio, A; Normanno, G; Parisi, A; Patrono, R; Ranieri, G; Rella, A; Celano, G V

    2008-05-10

    Helicobacter pylori is an organism widespread in humans and sometimes responsible for serious illnesses, such as gastric and duodenal ulcers, MALToma and even gastric cancer. It has been hypothesized that the infection route by H. pylori involves multiple pathways including food-borne transmission, as the microorganism has been detected from foods such as sheep and cow milk. This work reports the results of a survey conducted in order to investigate the presence of H. pylori in raw goat, sheep and cow milk produced in Southern Italy, employing a Nested Polymerase Chain Reaction (Nested-PCR) assay for the detection of the phosphoglucosamine mutase gene (glmM), as screening method followed by conventional bacteriological isolation. Out of the 400 raw milk samples examined, 139 (34.7%) resulted positive for the presence of glmM gene, but no strains were isolated. In this work H. pylori DNA has been firstly detected from 41 (25.6%) raw goat milk samples. The results deserve further investigations on the contamination source/s of the milk samples and on the major impact that it may have on consumers.

  19. Synergism between hydrogen peroxide and seventeen acids against five agri-food-borne fungi and one yeast strain.

    Science.gov (United States)

    Martin, H; Maris, P

    2012-12-01

    The objective of this study was to evaluate fungicidal efficacy of hydrogen peroxide administered in combination with 17 mineral and organic acids authorized for use in the food industry. The assays were performed on a 96-well microplate using a microdilution technique based on the checkerboard titration method. The six selected strains (one yeast and five fungi) were reference strains and strains representative of contaminating fungi found in the food industry. Each synergistic hydrogen peroxide/acid combination found after fifteen minutes contact time at 20 °C in distilled water was then tested in conditions simulating four different use conditions. Twelve combinations were synergistic in distilled water, eleven of these remained synergistic with one or more of the four mineral and organic interfering substances selected. Hydrogen peroxide/formic acid combination remained effective against four strains and was never antagonistic against the other two fungi. Combinations with propionic acid and acetic acid stayed synergistic against two strains. Those with oxalic acid and lactic acid kept their synergism only against Candida albicans. No synergism was detected against Penicillium cyclopium. Synergistic combinations of disinfectants were revealed, among them the promising hydrogen peroxide/formic acid combination. A rapid screening method developed in our laboratory for bacteria was adapted to fungi and used to reveal the synergistic potential of disinfectants and/or sanitizers combinations. © 2012 The Society for Applied Microbiology.

  20. Impact of genomics on microbial food safety

    NARCIS (Netherlands)

    Abee, T.; Schaik, van W.; Siezen, R.J.

    2004-01-01

    Genome sequences are now available for many of the microbes that cause food-borne diseases. The information contained in pathogen genome sequences, together with the development of themed and whole-genome DNA microarrays and improved proteomics techniques, might provide tools for the rapid detection

  1. Main Concerns of Pathogenic Microorganisms in Meat

    Science.gov (United States)

    Nørrung, Birgit; Andersen, Jens Kirk; Buncic, Sava

    Although various foods can serve as sources of foodborne illness, meat and meat products are important sources of human infections with a variety of foodborne pathogens, i.e. Salmonella spp., Campylobacter jejuni/coli, Yersinia enterocolitica, Verotoxigenic E. coli and, to some extent, Listeria monocytogenes. All these may be harboured in the gastrointestinal tract of food-producing animals. The most frequent chain of events leading to meat-borne illness involves food animals, which are healthy carriers of the pathogens that are subsequently transferred to humans through production, handling and consumption of meat and meat products. Occurrences of Salmonella spp., C. jejuni/coli, Y. enterocolitica and Verotoxigenic E. coli in fresh red meat vary relatively widely, although most often are between 1 and 10%, depending on a range of factors including the organism, geographical factors, farming and/or meat production practices.

  2. Scientific Opinion on Review of the European Union Summary Report on trends and sources of zoonoses, zoonotic agents and food-borne outbreaks—Terms of reference 2 to 7

    OpenAIRE

    EFSA Panel on Animal Health and Welfare (AHAW)

    2013-01-01

    The Animal Health and Welfare (AHAW) Panel of the European Food Safety Authority (EFSA) has evaluated the European Union Summary Report on Trends and Sources of Zoonoses, Zoonotic Agents and Food-borne Outbreaks by EFSA and ECDC (the report) with regard to data needs and subsequent analyses that will minimise the impact of existing data gaps and inconsistencies. Specific assessments performed for bovine tuberculosis, echinococcosis, Q fever, brucellosis, rabies, cysticercosis and tularaemia s...

  3. In vitro detection of pathogenic Listeria monocytogenes from food sources by conventional, molecular and cell culture method

    Directory of Open Access Journals (Sweden)

    J.A. Khan

    2013-09-01

    Full Text Available Among current in vitro methods for identification of pathogenic Listeria monocytogenes (L. monocytogenes rely on growth in culture media, followed by isolation, and biochemical and serological identification. Now PCR (Polymerase Chain Reaction has been used for the rapid, sensitive and specific detection of pathogenic L. monocytogenes. The pathogenicity of the organism is highly correlated with haemolytic factor known as listeriolysin O (LLO. A total of 400 samples from meat and 250 samples from raw milk and their products were collected from various local dairy farms, dairy units and butcheries in Bareilly, India. Pure isolates of L. monocytogenes obtained after enrichment in Buffered Listeria enrichment broth (BLEB followed by plating onto Listeria oxford agar. The DNA extracted from pure isolates and used for the detection of bacterial pathogen. The oligonucleotide primer pairs (F: CGGAGGTTCCGCAAAAGATG; R: CCTCCAGAGTGATCGATGTT complementary to the nucleotide sequence of the hlyA gene selected for detection of L. monocytogenes using polymerase chain reaction (PCR. PCR products of 234 bp generated with DNA from all of L. monocytogenes isolates. The highest occurrence of haemolytic L. monocytogenes isolates from various meat samples was in raw chicken (6.0%, followed by fish meat (4.0%, and then beef (2.5%. Among various milk and milk products, curd (2.0% showed the highest prevalence, followed by raw milk (1.3%. The cytotoxic effects of haemolytic L. monocytogenes isolates were screened on vero cell lines. The cell lines with cell free culture supernatant (CFCS examined at 1 min, 10 min, 30 min, and 60 min. The significant changes in vero cells were observed at 30 min with both 30 µL and 50 µL of volume. We conclude that application of PCR approaches can provide critical information on distribution of haemolytic strains of L. monocytogenes in food processing environments. Vero cell cytotoxicity assay (in vitro resulted positive in twenty four

  4. Report on ticks collected in the Southeast and Mid-West regions of Brazil: analyzing the potential transmission of tick-borne pathogens to man

    Directory of Open Access Journals (Sweden)

    Figueiredo Luiz Tadeu Moraes

    1999-01-01

    Full Text Available Specimens of ticks were collected in 1993, 1996, 1997, and 1998, mostly from wild and domestic animals in the Southeast and Mid-West regions of Brazil. Nine species of Amblyommidae were identified: Anocentor nitens, Amblyomma cajennense, Amblyomma ovale, Amblyomma fulvum, Amblyomma striatum, Amblyomma rotundatum, Boophilus microplus, Boophilus annulatus, and Rhipicephalus sanguineus. The potential of these tick species as transmitters of pathogens to man was analyzed. A Flaviviridade Flavivirus was isolated from Amblyomma cajennense specimens collected from a sick capybara (Hydrochaeris hydrochaeris. Amblyomma cajennense is the main transmitter of Rickettsia rickettsii (=R. rickettsi, the causative agent of spotted fever in Brazil. Wild mammals, mainly capybaras and deer, infested by ticks and living in close contact with cattle, horses and dogs, offer the risk of transmission of wild zoonosis to these domestic animals and to man.

  5. Two Pathogens and One Disease: Detection and Identification of Flea-Borne Rickettsiae in Areas Endemic for Murine Typhus in California

    Science.gov (United States)

    EREMEEVA, MARINA E.; KARPATHY, SANDOR E.; KRUEGER, LAURA; HAYES, ERICA K.; WILLIAMS, ASHLEY M.; ZALDIVAR, YAMITZEL; BENNETT, STEPHEN; CUMMINGS, ROBERT; TILZER, ART; VELTEN, ROBERT K.; KERR, NELSON; DASCH, GREGORY A.; HU, RENJIE

    2018-01-01

    Results of an environmental assessment conducted in a newly emergent focus of murine typhus in southern California are described. Opossums, Didelphis virginiana Kerr, infested with cat fleas, Ctenocephalides felis Buché, in the suburban area were abundant. Animal and flea specimens were tested for the DNA of two flea-borne rickettsiae, Rickettsia typhi and Rickettsia felis. R. felis was commonly detected in fleas collected throughout this area while R. typhi was found at a much lower prevalence in the vicinity of just 7 of 14 case-patient homes identified. DNA of R. felis, but not R. typhi, was detected in renal, hepatic, and pulmonary tissues of opossums. In contrast, there were no hematologic polymerase chain reaction findings of R. felis or R. typhi in opossums, rats, and cats within the endemic area studied. Our data suggest a significant probability of human exposure to R. felis in the area studied; however, disease caused by this agent is not recognized by the medical community and may be misdiagnosed as murine typhus using nondiscriminatory serologic methods. PMID:23270180

  6. In vitro screening of probiotic properties of Saccharomyces cerevisiae var. boulardii and food-borne Saccharomyces cerevisiae strains

    DEFF Research Database (Denmark)

    van der Aa Kuhle, Alis; Skovgaard, Kerstin; Jespersen, Lene

    2005-01-01

    .6-16.8%) recorded for two isolates from blue veined cheeses. Merely 25% of the S. cerevisiae var. boulardii strains displayed good adhesive properties (16.2-28.0%). The expression of the proinflammatory cytokine IL-1α decreased strikingly in IPEC-J2 cells exposed to a Shiga-like toxin 2e producing Escherichia coli...... strain when the cells were pre- and coincubated with S. cerevisiae var. boulardii even though this yeast strain was low adhesive (5.4%), suggesting that adhesion is not a mandatory prerequisite for such a probiotic effect. A strain of S. cerevisiae isolated from West African sorghum beer exerted similar......The probiotic potential of IS Saccharomyces cerevisiae strains used for production of foods or bevel-ages or isolated from such, and eight strains of Saccharomyces cerevisiae var. boulardii, was investigated. All strains included were able to withstand pH 2.5 and 0.3% Ox-all. Adhesion...

  7. Food-borne outbreaks, distributions, virulence, and antibiotic resistance profiles of Vibrio parahaemolyticus in Korea from 2003 to 2016: a review

    Directory of Open Access Journals (Sweden)

    Kunbawui Park

    2018-02-01

    Full Text Available Abstract Background Vibrio parahaemolyticus is one of the most common causes of seafood-borne illnesses in Korea, either directly or indirectly, by consuming infected seafood. Many studies have demonstrated the antibiotic susceptibility profile of V. parahaemolyticus. This strain has developed multiple antibiotic resistance, which has raised serious public health and economic concerns. This article reviews the food-borne outbreaks, distributions, virulence, and antibiotic resistance profiles of V. parahaemolyticus in Korea during 2003–2016. Main body V. parahaemolyticus infections appeared to be seasonally dependent, because 69.7% of patient infections occurred in both August and September during 2003–2016. In addition, the occurrence of V. parahaemolyticus in marine environments varies seasonally but is particularly high in July, August, and September. V. parahaemolyticus isolated from aquaculture sources on the Korean coast varied in association with virulence genes, some did not possess either the tdh (thermostable direct hemolysin or trh (tdh-related hemolysin genes, and a few were positive for only the trh gene or both genes. The high percentage of ampicillin resistance against V. parahaemolyticus in the aquatic environment suggests that ampicillin cannot be used to effectively treat infections caused by this organism. Short conclusion This study shows that the observed high percentage of multiple antibiotic resistance to V. parahaemolyticus is due to conventionally used antibiotics. Therefore, monitoring the antimicrobial resistance patterns at a national level and other solutions are needed to control aquaculture infections, ensure seafood safety, and avoid threats to public health caused by massive misuse of antibiotics.

  8. Surface-enhanced Raman spectroscopy introduced into the International Standard Organization (ISO) regulations as an alternative method for detection and identification of pathogens in the food industry.

    Science.gov (United States)

    Witkowska, Evelin; Korsak, Dorota; Kowalska, Aneta; Księżopolska-Gocalska, Monika; Niedziółka-Jönsson, Joanna; Roźniecka, Ewa; Michałowicz, Weronika; Albrycht, Paweł; Podrażka, Marta; Hołyst, Robert; Waluk, Jacek; Kamińska, Agnieszka

    2017-02-01

    We show that surface-enhanced Raman spectroscopy (SERS) coupled with principal component analysis (PCA) can serve as a fast, reliable, and easy method for detection and identification of food-borne bacteria, namely Salmonella spp., Listeria monocytogenes, and Cronobacter spp., in different types of food matrices (salmon, eggs, powdered infant formula milk, mixed herbs, respectively). The main aim of this work was to introduce the SERS technique into three ISO (6579:2002; 11290-1:1996/A1:2004; 22964:2006) standard procedures required for detection of these bacteria in food. Our study demonstrates that the SERS technique is effective in distinguishing very closely related bacteria within a genus grown on solid and liquid media. The advantages of the proposed ISO-SERS method for bacteria identification include simplicity and reduced time of analysis, from almost 144 h required by standard methods to 48 h for the SERS-based approach. Additionally, PCA allows one to perform statistical classification of studied bacteria and to identify the spectrum of an unknown sample. Calculated first and second principal components (PC-1, PC-2) account for 96, 98, and 90% of total variance in the spectra and enable one to identify the Salmonella spp., L. monocytogenes, and Cronobacter spp., respectively. Moreover, the presented study demonstrates the excellent possibility for simultaneous detection of analyzed food-borne bacteria in one sample test (98% of PC-1 and PC-2) with a goal of splitting the data set into three separated clusters corresponding to the three studied bacteria species. The studies described in this paper suggest that SERS represents an alternative to standard microorganism diagnostic procedures. Graphical Abstract New approach of the SERS strategy for detection and identification of food-borne bacteria, namely S. enterica, L. monocytogenes, and C. sakazakii in selected food matrices.

  9. Hierarchical Bayesian models to assess between- and within-batch variability of pathogen contamination in food.

    Science.gov (United States)

    Commeau, Natalie; Cornu, Marie; Albert, Isabelle; Denis, Jean-Baptiste; Parent, Eric

    2012-03-01

    Assessing within-batch and between-batch variability is of major interest for risk assessors and risk managers in the context of microbiological contamination of food. For example, the ratio between the within-batch variability and the between-batch variability has a large impact on the results of a sampling plan. Here, we designed hierarchical Bayesian models to represent such variability. Compatible priors were built mathematically to obtain sound model comparisons. A numeric criterion is proposed to assess the contamination structure comparing the ability of the models to replicate grouped data at the batch level using a posterior predictive loss approach. Models were applied to two case studies: contamination by Listeria monocytogenes of pork breast used to produce diced bacon and contamination by the same microorganism on cold smoked salmon at the end of the process. In the first case study, a contamination structure clearly exists and is located at the batch level, that is, between batches variability is relatively strong, whereas in the second a structure also exists but is less marked. © 2012 Society for Risk Analysis.

  10. Antimicrobial effects of Turkish propolis, pollen, and laurel on spoilage and pathogenic food-related microorganisms.

    Science.gov (United States)

    Erkmen, Osman; Ozcan, Mehmet Musa

    2008-09-01

    The antimicrobial activities of propolis extract, pollen extract, and essential oil of laurel (Laurus nobilis L.) at concentrations from 0.02% to 2.5% (vol/vol) were investigated on bacteria (Bacillus cereus, Bacillus subtilis, Escherichia coli, Salmonella typhimurium, Staphylococcus aureus, Yersinia enterocolitica, Enterococcus faecalis, and Listeria monocytogenes), yeasts (Saccharomyces cerevisiae and Candida rugosa), and molds (Aspergillus niger and Rhizopus oryzae). Pollen has no antimicrobial effects on the bacteria and fungi tested in the concentrations used. Propolis showed a bactericidal effect at 0.02% on B. cereus and B. subtilis, at 1.0% on S. aureus and E. faecalis, and at 0.2% on L. monocytogenes. The minimum inhibitory concentration of propolis for fungi was 2.5%. Propolis and laurel were ineffective against E. coli and S. typhimurium at the concentrations tested. The results showed that the antimicrobial activity were concentration dependent. Propolis and essential oil of laurel may be used as biopreservative agents in food processing and preservation.

  11. Multidrug Efflux Pumps from Enterobacteriaceae, Vibrio cholerae and Staphylococcus aureus Bacterial Food Pathogens

    Science.gov (United States)

    Andersen, Jody L.; He, Gui-Xin; Kakarla, Prathusha; KC, Ranjana; Kumar, Sanath; Lakra, Wazir Singh; Mukherjee, Mun Mun; Ranaweera, Indrika; Shrestha, Ugina; Tran, Thuy; Varela, Manuel F.

    2015-01-01

    Foodborne illnesses caused by bacterial microorganisms are common worldwide and constitute a serious public health concern. In particular, microorganisms belonging to the Enterobacteriaceae and Vibrionaceae families of Gram-negative bacteria, and to the Staphylococcus genus of Gram-positive bacteria are important causative agents of food poisoning and infection in the gastrointestinal tract of humans. Recently, variants of these bacteria have developed resistance to medically important chemotherapeutic agents. Multidrug resistant Escherichia coli, Salmonella enterica, Vibrio cholerae, Enterobacter spp., and Staphylococcus aureus are becoming increasingly recalcitrant to clinical treatment in human patients. Of the various bacterial resistance mechanisms against antimicrobial agents, multidrug efflux pumps comprise a major cause of multiple drug resistance. These multidrug efflux pump systems reside in the biological membrane of the bacteria and actively extrude antimicrobial agents from bacterial cells. This review article summarizes the evolution of these bacterial drug efflux pump systems from a molecular biological standpoint and provides a framework for future work aimed at reducing the conditions that foster dissemination of these multidrug resistant causative agents through human populations. PMID:25635914

  12. Multidrug Efflux Pumps from Enterobacteriaceae, Vibrio cholerae and Staphylococcus aureus Bacterial Food Pathogens

    Directory of Open Access Journals (Sweden)

    Jody L. Andersen

    2015-01-01

    Full Text Available Foodborne illnesses caused by bacterial microorganisms are common worldwide and constitute a serious public health concern. In particular, microorganisms belonging to the Enterobacteriaceae and Vibrionaceae families of Gram-negative bacteria, and to the Staphylococcus genus of Gram-positive bacteria are important causative agents of food poisoning and infection in the gastrointestinal tract of humans. Recently, variants of these bacteria have developed resistance to medically important chemotherapeutic agents. Multidrug resistant Escherichia coli, Salmonella enterica, Vibrio cholerae, Enterobacter spp., and Staphylococcus aureus are becoming increasingly recalcitrant to clinical treatment in human patients. Of the various bacterial resistance mechanisms against antimicrobial agents, multidrug efflux pumps comprise a major cause of multiple drug resistance. These multidrug efflux pump systems reside in the biological membrane of the bacteria and actively extrude antimicrobial agents from bacterial cells. This review article summarizes the evolution of these bacterial drug efflux pump systems from a molecular biological standpoint and provides a framework for future work aimed at reducing the conditions that foster dissemination of these multidrug resistant causative agents through human populations.

  13. Social and Economic Aspects of the Transmission of Pathogenic Bacteria between Wildlife and Food Animals: A Thematic Analysis of Published Research Knowledge.

    Science.gov (United States)

    Fournier, A; Young, I; Rajić, A; Greig, J; LeJeune, J

    2015-09-01

    Wildlife is a known reservoir of pathogenic bacteria, including Mycobacterium bovis and Brucella spp. Transmission of these pathogens between wildlife and food animals can lead to damaging impacts on the agri-food industry and public health. Several international case studies have highlighted the complex and cross-sectoral challenges involved in preventing and managing these potential transmission risks. The objective of our study was to develop a better understanding of the socio-economic aspects of the transmission of pathogenic bacteria between wildlife and food animals to support more effective and sustainable risk mitigation strategies. We conducted qualitative thematic analysis on a purposive sample of 30/141 articles identified in a complementary scoping review of the literature in this area and identified two key themes. The first related to the framing of this issue as a 'wicked problem' that depends on a complex interaction of social factors and risk perceptions, governance and public policy, and economic implications. The second theme consisted of promising approaches and strategies to prevent and mitigate the potential risks from transmission of pathogenic bacteria between wildlife and food animals. These included participatory, collaborative and multidisciplinary decision-making approaches and the proactive incorporation of credible scientific evidence and local contextual factors into solutions. The integration of these approaches to address 'wicked problems' in this field may assist stakeholders and decision-makers in improving the acceptability and sustainability of future strategies to reduce the transmission of pathogenic bacteria between wildlife and food animals. © 2015 Zoonoses and Public Health © 2015 Her Majesty the Queen in Right of Canada Reproduced with the permission of the Minister of the Public Health Agency of Canada.

  14. Molecular detection of feline arthropod-borne pathogens in cats in Cuiabá, state of Mato Grosso, central-western region of Brazil

    Directory of Open Access Journals (Sweden)

    Natasha Gandolfi Miceli

    Full Text Available Hemotrophic mycoplasmas (hemoplasmas, Bartonellasp., Hepatozoon sp. and Cytauxzoon felis are prominent pathogens that circulate between cats and invertebrate hosts. The present study aimed to detect the presence of DNA from hemoplasmas,Bartonella sp., Hepatozoon sp. andCytauxzoon felis, and then confirm it by means of sequencing, in blood samples from cats in Cuiabá, MT, Brazil. From February 2009 to February 2011, blood samples with added EDTA were collected from 163 cats that were being housed in four different animal shelters in the city of Cuiabá, state of Mato Grosso, Brazil and from 15 cats that were admitted to the veterinary hospital of the Federal University of Mato Grosso (UFMT. Out of the 178 cats sampled, 15 (8.4% were positive for hemoplasmas: four (2.2% forMycoplasma haemofelis, 12 (6.7% for ‘Candidatus M. haemominutum’ and one (0.5% for ‘Candidatus M. turicensis’. One cat (0.5%, a patient that was attended at the veterinary hospital, was coinfected with M. haemofelis, ‘Candidatus M. haemominutum’ and ‘Candidatus M. turicensis’, based on sequencing confirmation. Four cats were positive for Bartonella spp.: three (1.7% for B. henselae and one (0.5% for B. clarridgeiae. None of the animals showedCytauxzoon sp. or Hepatozoon sp. DNA in their blood samples. This study showed that cats housed in animal shelters in the city of Cuiabá, state of Mato Grosso, are exposed to hemoplasmas andBartonella species.

  15. An integrated QSAR-PBK/D modelling approach for predicting detoxification and DNA adduct formation of 18 acyclic food-borne α,β-unsaturated aldehydes

    Energy Technology Data Exchange (ETDEWEB)

    Kiwamoto, R., E-mail: reiko.kiwamoto@wur.nl; Spenkelink, A.; Rietjens, I.M.C.M.; Punt, A.

    2015-01-01

    Acyclic α,β-unsaturated aldehydes present in food raise a concern because the α,β-unsaturated aldehyde moiety is considered a structural alert for genotoxicity. However, controversy remains on whether in vivo at realistic dietary exposure DNA adduct formation is significant. The aim of the present study was to develop physiologically based kinetic/dynamic (PBK/D) models to examine dose-dependent detoxification and DNA adduct formation of a group of 18 food-borne acyclic α,β-unsaturated aldehydes without 2- or 3-alkylation, and with no more than one conjugated double bond. Parameters for the PBK/D models were obtained using quantitative structure–activity relationships (QSARs) defined with a training set of six selected aldehydes. Using the QSARs, PBK/D models for the other 12 aldehydes were defined. Results revealed that DNA adduct formation in the liver increases with decreasing bulkiness of the molecule especially due to less efficient detoxification. 2-Propenal (acrolein) was identified to induce the highest DNA adduct levels. At realistic dietary intake, the predicted DNA adduct levels for all aldehydes were two orders of magnitude lower than endogenous background levels observed in disease free human liver, suggesting that for all 18 aldehydes DNA adduct formation is negligible at the relevant levels of dietary intake. The present study provides a proof of principle for the use of QSAR-based PBK/D modelling to facilitate group evaluations and read-across in risk assessment. - Highlights: • Physiologically based in silico models were made for 18 α,β-unsaturated aldehydes. • Kinetic parameters were determined by in vitro incubations and a QSAR approach. • DNA adduct formation was negligible at levels relevant for dietary intake. • The use of QSAR-based PBK/D modelling facilitates group evaluations and read-across.

  16. Tick-borne disease.

    Science.gov (United States)

    Bratton, Robert L; Corey, Ralph

    2005-06-15

    Tick-borne diseases in the United States include Rocky Mountain spotted fever, Lyme disease, ehrlichiosis, tularemia, babesiosis, Colorado tick fever, and relapsing fever. It is important for family physicians to consider these illnesses when patients present with influenza-like symptoms. A petechial rash initially affecting the palms and soles of the feet is associated with Rocky Mountain spotted fever, whereas erythema migrans (annular macule with central clearing) is associated with Lyme disease. Various other rashes or skin lesions accompanied by fever and influenza-like illness also may signal the presence of a tick-borne disease. Early, accurate diagnosis allows treatment that may help prevent significant morbidity and possible mortality. Because 24 to 48 hours of attachment to the host are required for infection to occur, early removal can help prevent disease. Treatment with doxycycline or tetracycline is indicated for Rocky Mountain spotted fever, Lyme disease, ehrlichiosis, and relapsing fever. In patients with clinical findings suggestive of tick-borne disease, treatment should not be delayed for laboratory confirmation. If no symptoms follow exposure to tick bites, empiric treatment is not indicated. The same tick may harbor different infectious pathogens and transmit several with one bite. Advising patients about prevention of tick bites, especially in the summer months, may help prevent exposure to dangerous vector-borne diseases.

  17. Dynamic sporulation gene co-expression networks for Bacillus subtilis 168 and the food-borne isolate Bacillus amyloliquefaciens: a transcriptomic model.

    Science.gov (United States)

    Omony, Jimmy; de Jong, Anne; Krawczyk, Antonina O; Eijlander, Robyn T; Kuipers, Oscar P

    2018-02-09

    Sporulation is a survival strategy, adapted by bacterial cells in response to harsh environmental adversities. The adaptation potential differs between strains and the variations may arise from differences in gene regulation. Gene networks are a valuable way of studying such regulation processes and establishing associations between genes. We reconstructed and compared sporulation gene co-expression networks (GCNs) of the model laboratory strain Bacillus subtilis 168 and the food-borne industrial isolate Bacillus amyloliquefaciens. Transcriptome data obtained from samples of six stages during the sporulation process were used for network inference. Subsequently, a gene set enrichment analysis was performed to compare the reconstructed GCNs of B. subtilis 168 and B. amyloliquefaciens with respect to biological functions, which showed the enriched modules with coherent functional groups associated with sporulation. On basis of the GCNs and time-evolution of differentially expressed genes, we could identify novel candidate genes strongly associated with sporulation in B. subtilis 168 and B. amyloliquefaciens. The GCNs offer a framework for exploring transcription factors, their targets, and co-expressed genes during sporulation. Furthermore, the methodology described here can conveniently be applied to other species or biological processes.

  18. Hospitalization records as a tool for evaluating performance of food- and water-borne disease surveillance systems: a Massachusetts case study.

    Science.gov (United States)

    Mor, Siobhan M; DeMaria, Alfred; Naumova, Elena N

    2014-01-01

    We outline a framework for evaluating food- and water-borne surveillance systems using hospitalization records, and demonstrate the approach using data on salmonellosis, campylobacteriosis and giardiasis in persons aged ≥65 years in Massachusetts. For each infection, and for each reporting jurisdiction, we generated smoothed standardized morbidity ratios (SMR) and surveillance to hospitalization ratios (SHR) by comparing observed surveillance counts with expected values or the number of hospitalized cases, respectively. We examined the spatial distribution of SHR and related this to the mean for the entire state. Through this approach municipalities that deviated from the typical experience were identified and suspected of under-reporting. Regression analysis revealed that SHR was a significant predictor of SMR, after adjusting for population age-structure. This confirms that the spatial "signal" depicted by surveillance is in part influenced by inconsistent testing and reporting practices since municipalities that reported fewer cases relative to the number of hospitalizations had a lower relative risk (as estimated by SMR). Periodic assessment of SHR has potential in assessing the performance of surveillance systems.

  19. Hospitalization records as a tool for evaluating performance of food- and water-borne disease surveillance systems: a Massachusetts case study.

    Directory of Open Access Journals (Sweden)

    Siobhan M Mor

    Full Text Available We outline a framework for evaluating food- and water-borne surveillance systems using hospitalization records, and demonstrate the approach using data on salmonellosis, campylobacteriosis and giardiasis in persons aged ≥65 years in Massachusetts. For each infection, and for each reporting jurisdiction, we generated smoothed standardized morbidity ratios (SMR and surveillance to hospitalization ratios (SHR by comparing observed surveillance counts with expected values or the number of hospitalized cases, respectively. We examined the spatial distribution of SHR and related this to the mean for the entire state. Through this approach municipalities that deviated from the typical experience were identified and suspected of under-reporting. Regression analysis revealed that SHR was a significant predictor of SMR, after adjusting for population age-structure. This confirms that the spatial "signal" depicted by surveillance is in part influenced by inconsistent testing and reporting practices since municipalities that reported fewer cases relative to the number of hospitalizations had a lower relative risk (as estimated by SMR. Periodic assessment of SHR has potential in assessing the performance of surveillance systems.

  20. Volatile sulfur compounds in foods as a result of ionizing radiation

    Science.gov (United States)

    Ionizing radiation improves food safety and extends shelf life by inactivating food-borne pathogens and spoilage microorganisms. However, irradiation may induce the development of an off-odor, particularly at high doses. The off-odor has been called “irradiation odor”. Substantial evidence suggests ...

  1. Isolation, characterization and comparative analysis of plant-associated bacteria for suppression of soil-borne diseases of field-grown groundnut in Vietnam

    NARCIS (Netherlands)

    Le, C.N.; Hoang, T.K.; Thai, T.H.; Tran, T.L.; Phan, T.P.N.; Raaijmakers, J.M.

    2018-01-01

    Abstract Groundnut (Arachis hypogaea L.) is an important oil seed crop worldwide and used extensively for feed and food. In Vietnam, groundnut cultivation is hampered by several soil-borne fungal pathogens, in particular Sclerotium rolfsii. To develop sustainable measures to control stem rot disease

  2. Technology of food preservation by irradiation

    International Nuclear Information System (INIS)

    Thomas, Paul

    1997-01-01

    Food Technology Division, Bhabha Atomic Research Centre, Mumbai has demonstrated that radiation processing of foods can contribute to nations food security by reducing post-harvest losses caused by insect infestation, microbial-spoilage and physiological changes. The technology has commercial potential for the conservation of cereals, pulses and their products, spices, onions, potatoes, garlic, some tropical fruits, sea foods, meat and poultry. Irradiation can ensure hygienic quality in foods including frozen foods by eliminating food borne pathogens and parasitic organisms. It offers a viable environment friendly alternative to chemical fumigants for quarantine treatment against insect pests in agricultural and horticultural products entering international trade. The safety and nutritional adequacy of irradiated foods for human consumption is well established. About 40 countries including India have regulations permitting irradiation of foods and 28 countries are irradiating foods for processing industries and institutional catering

  3. The Role of Stress and Stress Adaptations in Determining the Fate of the Bacterial Pathogen Listeria monocytogenes in the Food Chain

    Science.gov (United States)

    NicAogáin, Kerrie; O’Byrne, Conor P.

    2016-01-01

    The foodborne pathogen Listeria monocytogenes is a highly adaptable organism that can persist in a wide range of environmental and food-related niches. The consumption of contaminated ready-to-eat foods can cause infections, termed listeriosis, in vulnerable humans, particularly those with weakened immune systems. Although these infections are comparatively rare they are associated with high mortality rates and therefore this pathogen has a significant impact on food safety. L. monocytogenes can adapt to and survive a wide range of stress conditions including low pH, low water activity, and low temperature, which makes it problematic for food producers who rely on these stresses for preservation. Stress tolerance in L. monocytogenes can be explained partially by the presence of the general stress response (GSR), a transcriptional response under the control of the alternative sigma factor sigma B (σB) that reconfigures gene transcription to provide homeostatic and protective functions to cope with the stress. Within the host σB also plays a key role in surviving the harsh conditions found in the gastrointestinal tract. As the infection progresses beyond the GI tract L. monocytogenes uses an intracellular infectious cycle to propagate, spread and remain protected from the host’s humoral immunity. Many of the virulence genes that facilitate this infectious cycle are under the control of a master transcriptional regulator called PrfA. In this review we consider the environmental reservoirs that enable L. monocytogenes to gain access to the food chain and discuss the stresses that the pathogen must overcome to survive and grow in these environments. The overlap that exists between stress tolerance and virulence is described. We review the principal measures that are used to control the pathogen and point to exciting new approaches that might provide improved means of control in the future. PMID:27933042

  4. The Role of Stress and Stress Adaptations in Determining the Fate of the Bacterial Pathogen Listeria monocytogenes in the Food Chain.

    Science.gov (United States)

    NicAogáin, Kerrie; O'Byrne, Conor P

    2016-01-01

    The foodborne pathogen Listeria monocytogenes is a highly adaptable organism that can persist in a wide range of environmental and food-related niches. The consumption of contaminated ready-to-eat foods can cause infections, termed listeriosis, in vulnerable humans, particularly those with weakened immune systems. Although these infections are comparatively rare they are associated with high mortality rates and therefore this pathogen has a significant impact on food safety. L. monocytogenes can adapt to and survive a wide range of stress conditions including low pH, low water activity, and low temperature, which makes it problematic for food producers who rely on these stresses for preservation. Stress tolerance in L. monocytogenes can be explained partially by the presence of the general stress response (GSR), a transcriptional response under the control of the alternative sigma factor sigma B (σ B ) that reconfigures gene transcription to provide homeostatic and protective functions to cope with the stress. Within the host σ B also plays a key role in surviving the harsh conditions found in the gastrointestinal tract. As the infection progresses beyond the GI tract L. monocytogenes uses an intracellular infectious cycle to propagate, spread and remain protected from the host's humoral immunity. Many of the virulence genes that facilitate this infectious cycle are under the control of a master transcriptional regulator called PrfA. In this review we consider the environmental reservoirs that enable L. monocytogenes to gain access to the food chain and discuss the stresses that the pathogen must overcome to survive and grow in these environments. The overlap that exists between stress tolerance and virulence is described. We review the principal measures that are used to control the pathogen and point to exciting new approaches that might provide improved means of control in the future.

  5. Histopathological changes induced in an animal model by potentially pathogenic Enterococcus faecalis strains recovered from ready-to-eat food outlets in Osun State, Nigeria.

    Science.gov (United States)

    Olawale, Adetunji Kola; David, Oluwole Moses; Oluyege, Adekemi Olubukunola; Osuntoyinbo, Richard Temitope; Laleye, Solomon Anjuwon; Famurewa, Oladiran

    2015-01-01

    Enterococci have been implicated as an emerging important cause of several diseases and multiple antibiotic resistance. However, there is little information about the prevalence of pathogenic and/or antibiotic-resistant Enterococcus faecalis in ready-to-eat foods in Nigeria. Here we report the pathogenic potential of three selected antibiotic-resistant E. faecalis strains isolated from food canteens and food outlets with different virulence determinant genes, including EFC 12 (with gel (+), esp (+), cylA (+), and asa1 (+)), EFT 148 (with gel (+), ace (+), and asa1 (+)), and EFS 18 (with esp (+) and cylA (+)) in an animal model. Enterococcemia, hematological parameters, and histopathological changes in organ tissues were examined in experimental animals. The results showed differences in enterococcemia and hematological parameters between the control group and experimental animal group. Enterococcemia was observed for 7 days, and the animal group infected with EFC 12 showed the highest growth rate, followed by EFT 148, with the lowest growth rate seen in the EFS 18-infected group. White blood cell count, packed cell volume, and platelets were significantly reduced (Pfood canteens and food outlets; hence, there is a need for strict adherence to good hygiene practices in the study area owing to the epidemiological significance of foods.

  6. Eubiotics for Food Security at Farm Level: Yeast Cell Wall Products and Their Antimicrobial Potential Against Pathogenic Bacteria.

    Science.gov (United States)

    Santovito, Elisa; Greco, Donato; Logrieco, Antonio F; Avantaggiato, Giuseppina

    2018-06-06

    The population increase in the last century was the first cause of the industrialization of animal productions, together with the necessity to satisfy the high food demand and the lack of space and land for the husbandry practices. As a consequence, the farmers moved from extensive to intensive agricultural systems and introduced new practices, such as the administration of antimicrobial drugs. Antibiotics were then used as growth promoters and for disease prevention. The uncontrolled and continuous use of antibiotics contributed to the spread of antibiotic resistance in animals, and this had adverse impacts on human health. This emergence led the European Union, in 2003, to ban the marketing and use of antibiotics as growth promoters, and for prophylaxis purposes from January 2006. This ban caused problems in farms, due to the decrease in animal performances (weight gain, feed conversion ratio, reproduction, etc.), and the rise in the incidence of certain diseases, such as those induced by Clostridium perfringens, Salmonella, Escherichia coli, and Listeria monocytogenes. The economic losses due to the ban increased the interest in researching alternative strategies for the prophylaxis of infectious diseases and for health and growth promotion, such as feed additives. Yeast-based materials, such as cell wall extract, represent promising alternatives to antibiotics, on the base of their prebiotic activity and their claimed capacity to bind enteropathogenic bacteria. Several authors reported examples of the effectiveness of yeast cell wall products in adsorbing bacteria, but there is a lack of knowledge on the mechanisms involved in this interaction. The purpose of this review is to provide an overview of the current approaches used for the control of pathogenic bacteria in feed, with a particular focus on the use of yeast-derived materials proposed to control zoonoses at farm level, and on their effect on animal health.

  7. 78 FR 35155 - Establishing a List of Qualifying Pathogens Under the Food and Drug Administration Safety and...

    Science.gov (United States)

    2013-06-12

    ... is thought to be a chromosomally encoded mutation in the target enzyme, although alternative... of qualifying pathogens. E. Candida Species Candida species are fungi (specifically, yeast) that are...

  8. Compilation of Microbiological Testing Results for Human Pathogens And Indicators Bacteria in Foods Imported by Australia During Recent Years

    Energy Technology Data Exchange (ETDEWEB)

    Newton, K. [Australian Government Analytical Laboratories, Pymble, NSW (Australia)

    2005-01-15

    Australia is a net food exporting country, but also imports a considerable quantity of food from worldwide sources. Monitoring for safety of foods imported into Australia is the responsibility of the Australian Quarantine Inspection Service (AQIS). AQIS carries out the inspection and testing of food imports under the Imported Foods Inspection Program (IFIP). An advisory committee which contains food safety experts, conducts risk assessments on foods and advises AQIS on risk categorisation of the foods, and on the testing to be conducted. The rate of testing of individual food types is determined initially by the risk category, with high risk foods undergoing a higher rate of sampling than do lower risk foods. When a good safety history is established through the testing program for a high risk product from a particular producer, testing frequency is reduced. Sampling rates switch from sampling of all shipments to random sampling. The inspection and testing program is designed to comply with WTO requirements. (author)

  9. Foodborne pathogens

    Directory of Open Access Journals (Sweden)

    Thomas Bintsis

    2017-06-01

    Full Text Available Foodborne pathogens are causing a great number of diseases with significant effects on human health and economy. The characteristics of the most common pathogenic bacteria (Bacillus cereus, Campylobacter jejuni, Clostridium botulinum, Clostridium perfringens, Cronobacter sakazakii, Esherichia coli, Listeria monocytogenes, Salmonella spp., Shigella spp., Staphylococccus aureus, Vibrio spp. and Yersinia enterocolitica, viruses (Hepatitis A and Noroviruses and parasites (Cyclospora cayetanensis, Toxoplasma gondii and Trichinella spiralis, together with some important outbreaks, are reviewed. Food safety management systems based on to classical hazard-based approach has been proved to be inefficient, and risk-based food safety approach is now suggested from leading researchers and organizations. In this context, a food safety management system should be designed in a way to estimate the risks to human health from food consumption and to identify, select and implement mitigation strategies in order to control and reduce these risks. In addition, the application of suitable food safety education programs for all involved people in the production and consumption of foods is suggested.

  10. Ready-to-eat street-vended food as a potential vehicle of bacterial pathogens and antimicrobial resistance: An exploratory study in Porto region, Portugal.

    Science.gov (United States)

    Campos, Joana; Gil, Joana; Mourão, Joana; Peixe, Luísa; Antunes, Patrícia

    2015-08-03

    The ready-to-eat street vending commerce, as street mobile food vendors, has grown exponentially worldwide, representing in some countries a significant proportion of food consumed by the urban population. However, the microbiological food safety hazards of mobile vending units in industrialized countries are scarcely evaluated. To assess the microbiological quality and safety of this type of food and try to achieve the connection of its contamination with hygienic conditions of food-handlers, we analyzed hotdogs (n = 10), hamburgers (n = 10) and hands (n = 9) from ten street-vending trailers in the Porto region. Food and food-handler samples were tested for Enterobacteriaceae and coliform counts, Escherichia coli and coagulase-positive staphylococci counts/detection and presence of Salmonella. Aerobic mesophilic counts and detection of Listeria monocytogenes (Pulsed Field Gel Electrophoresis-PFGE and serotyping) were also tested in food samples. E. coli isolates were confirmed by MALDI-TOF and characterized for clonality (phylogenetic groups-PhG, PFGE and Multilocus Sequence Typing), antibiotic resistance (disk diffusion, PCR/sequencing) and intestinal pathogenic virulence factors (PCR/sequencing). All food samples presented poor microbiological quality (100% Enterobacteriaceae and coliforms; 20% E. coli (4 hamburgers, 4 trailers) and 20% (2 hamburgers/2 hotdogs, 3 trailers) were positive for L. monocytogenes (2 PFGE-types belonging to serotype 1/2a and 4b). Salmonella and coagulase-positive staphylococci were not detected. Food-handlers carried Enterobacteriaceae and coliforms (100%), E. coli (11%) and/or coagulase-positive staphylococci (44%). E. coli was detected in 12 samples (n = 30-food/food-handlers; phylogenetic groups A0/A1/B1) with 33% resistant to one or more antibiotics. Two multidrug resistant atypical E. coli pathotype strains (astA-ST165(CC165)/food-handler, eaeA-ST327/food) were detected. Three out of eight E. coli clonal lineages [ST409/ST976(CC10

  11. Risk-analysis of human pathogen spread in the vegetable industry: a comparison between organic and conventional production chains

    NARCIS (Netherlands)

    Franz, E.; Bruggen, van A.H.C.; Semenov, A.M.

    2004-01-01

    An overview is given of recent problems with food-borne enteric human pathogens originating from contaminated agricultural animals. The need for risk analysis is indicated, and the generally accepted procedure for risk assessment is outlined. Two main approaches to probability and risk calculations,

  12. Histopathological changes induced in an animal model by potentially pathogenic Enterococcus faecalis strains recovered from ready-to-eat food outlets in Osun State, Nigeria

    Directory of Open Access Journals (Sweden)

    Olawale AK

    2015-06-01

    Full Text Available Adetunji Kola Olawale,1,2 Oluwole Moses David,2,3 Adekemi Olubukunola Oluyege,2 Richard Temitope Osuntoyinbo,4 Solomon Anjuwon Laleye,5 Oladiran Famurewa,21Department of Applied Sciences, Osun State Polytechnic, Iree, 2Department of Microbiology, University of Ado-Ekiti, Ado-Ekiti, Nigeria; 3Phytomedicine Research Centre, Department of Botany, University of Fort Hare, Alice, South Africa; 4Department of Microbiology, Waterford Regional Hospital, Waterford, Republic of Ireland; 5Department of Microbiology, Adekunle Ajasin University, Akungba-Akoko, NigeriaAbstract: Enterococci have been implicated as an emerging important cause of several diseases and multiple antibiotic resistance. However, there is little information about the prevalence of pathogenic and/or antibiotic-resistant Enterococcus faecalis in ready-to-eat foods in Nigeria. Here we report the pathogenic potential of three selected antibiotic-resistant E. faecalis strains isolated from food canteens and food outlets with different virulence determinant genes, including EFC 12 (with gel+, esp+, cylA+, and asa1+, EFT 148 (with gel+, ace+, and asa1+, and EFS 18 (with esp+ and cylA+ in an animal model. Enterococcemia, hematological parameters, and histopathological changes in organ tissues were examined in experimental animals. The results showed differences in enterococcemia and hematological parameters between the control group and experimental animal group. Enterococcemia was observed for 7 days, and the animal group infected with EFC 12 showed the highest growth rate, followed by EFT 148, with the lowest growth rate seen in the EFS 18-infected group. White blood cell count, packed cell volume, and platelets were significantly reduced (P<0.05 in the experimental animals compared with the controls. White blood cells decreased drastically during the study period in rats challenged with EFC 12 (from 7,800 to 6,120 per mm3 but levels remained higher in the control group (from 9,228 to 9

  13. A scoping review of the role of wildlife in the transmission of bacterial pathogens and antimicrobial resistance to the food Chain.

    Science.gov (United States)

    Greig, J; Rajić, A; Young, I; Mascarenhas, M; Waddell, L; LeJeune, J

    2015-06-01

    Wildlife can contribute to environmental contamination with bacterial pathogens and their transfer to the human food chain. Global usage and frequent misuse of antimicrobials contribute to emergence of new antimicrobial resistant (AMR) strains of foodborne pathogens. We conducted a scoping review of published research to identify and characterize the evidence on wildlife's role in transmission of AMR and/or bacterial pathogens to the food chain. An advisory group (AG) of 13 North American experts from diverse disciplines was surveyed to solicit insight in the review scope, priority topics and research characteristics. A pre-tested search strategy was implemented in seven bibliographic databases (1990 to January 2013). Citations were relevance screened, and key characteristics on priority topics extracted independently by two reviewers. Analysis identified topic areas with solid evidence and main knowledge gaps. North America reported 30% of 866 relevant articles. The prevalence of five targeted bacterial pathogens and/or AMR in any pathogen in wildlife was reported in 582 articles. Transmission risk factors for selected bacteria or AMR in any bacteria were reported in 300. Interventions to control transmission were discussed in 124 articles and formally evaluated in 50. The majority of primary research investigated birds, cervids, rodents, feral pigs, opossums, E. coli (n = 329), Salmonella (n = 293) and Campylobacter (n = 124). An association between wildlife and transmission of bacterial pathogens and/or AMR to the food chain was supported in 122 studies. The scoping review identified a significant body of research on the role of wild birds in the prevalence and transmission of E. coli, Salmonella and Campylobacter. There was little research employing molecular methods contributing to the evidence concerning the importance and direction of transmission of wildlife/pathogen combinations. Given the advancements of these methods, future research should focus in this

  14. Effects of tick control by acaricide self-treatment of white-tailed deer on host-seeking tick infection prevalence and entomologic risk for Ixodes scapularis-borne pathogens.

    Science.gov (United States)

    Hoen, Anne Gatewood; Rollend, Lindsay G; Papero, Michele A; Carroll, John F; Daniels, Thomas J; Mather, Thomas N; Schulze, Terry L; Stafford, Kirby C; Fish, Durland

    2009-08-01

    We evaluated the effects of tick control by acaricide self-treatment of white-tailed deer on the infection prevalence and entomologic risk for three Ixodes scapularis-borne bacteria in host-seeking ticks. Ticks were collected from vegetation in areas treated with the "4-Poster" device and from control areas over a 6-year period in five geographically diverse study locations in the Northeastern United States and tested for infection with two known agents of human disease, Borrelia burgdorferi and Anaplasma phagocytophilum, and for a novel relapsing fever-group spirochete related to Borrelia miyamotoi. Overall, 38.2% of adults and 12.5% of nymphs were infected with B. burgdorferi; 8.5% of adults and 4.2% of nymphs were infected with A. phagocytophilum; and 1.9% of adults and 0.8% of nymphs were infected with B. miyamotoi. In most cases, treatment with the 4-Poster device was not associated with changes in the prevalence of infection with any of these three microorganisms among nymphal or adult ticks. However, the density of nymphs infected with B. burgdorferi, and consequently the entomologic risk for Lyme disease, was reduced overall by 68% in treated areas compared to control areas among the five study sites at the end of the study. The frequency of bacterial coinfections in ticks was generally equal to the product of the proportion of ticks infected with a single bacterium, indicating that enzootic maintenance of these pathogens is independent. We conclude that controlling ticks on deer by self-application of acaricide results in an overall decrease in the human risk for exposure to these three bacterial agents, which is due solely to a reduction in tick density.

  15. It is safe from O-157 and salmonellae. Food hygiene and food irradiation

    International Nuclear Information System (INIS)

    Ito, Hitoshi

    1998-01-01

    Despite the improvement of the systems of food hygiene and food distribution on the markets compared with old times, food-borne diseases are increasing and spreading in the world. Food-borne diseases by pathogenic Escherichia coli O-157:H7 are also increasing seriously. Japan has been importing the large amount of foodstuffs which sometimes contaminating with pathogens or parasites. Many types of food-borne diseases have been caused by non-spore forming bacteria such as salmonellae, V. parahaemolyticus, pathogenic E. coli, Campylobacter and Staphylococcus aureus, and these bacteria can inactivate at dose in the range of 1 - 3 kGy in chilled meat. These pathogenic bacteria can also inactivate in the range of 2 - 5 kGy in frozen condition of meat. For the inactivation of Bacillus cereus or Clostridium botulinum, necessary doses should be more than 10 kGy, however, a dose of 3 kGy is also effective to control the growth at storage below 10degC. Food-borne diseases have been caused also by mycotoxins of fungi in Japan. Aflatoxins and sterigmatocystin are carcinogens and are stable to radiation. However, many fungi for responsible to produce mycotoxins are radiation sensitive and should be easily inactivated in the range of 3 - 5 kGy. If moisture content is controlled below 15%, low dose irradiation is also effective in the range of 0.2 - 0.5 kGy to control the growth of fungi and pests in grain or other dried foods. (author)

  16. Application of low dose radiation for preservation of sea foods

    International Nuclear Information System (INIS)

    Venugopal, V.; Nair, P.M.

    1994-01-01

    Treatment of food with low doses of gamma radiation has been recognized to have two main advantages. These consist of: (1) improvement of food safety by elimination of pathogens and (2) reduction of microbial spoilage and extension of shelf life of perishable items by reducing the number of viable spoilage organisms. Studies during the last few decades have conclusively proved the beneficial effects of radiation with respect to fishery products. The three potential areas of application to fish products include: (i) radurization for shelf life extension (ii) radicidation to eliminate food borne pathogens in the products and (iii) radiation treatment to dried products to control insects

  17. A systematic review of the clinical, public health and cost-effectiveness of rapid diagnostic tests for the detection and identification of bacterial intestinal pathogens in faeces and food.

    Science.gov (United States)

    Abubakar, I; Irvine, L; Aldus, C F; Wyatt, G M; Fordham, R; Schelenz, S; Shepstone, L; Howe, A; Peck, M; Hunter, P R

    2007-09-01

    analysis, on many occasions the rapid test outperforms culture, detecting additional 'truly' positive cases of food-borne illness. The significance of these additional positives requires further investigation. Economic modelling suggests that adoption of rapid tests in combination with routine culture is unlikely to be cost-effective, however, as the cost of rapid technologies decreases; total replacement with rapid technologies may be feasible. Despite the relatively poor quality of reporting of studies evaluating rapid detection methods, the reviewed evidence shows that PCR for Campylobacter, Salmonella and E. coli O157 is potentially very successful in identifying pathogens, possibly detecting more than the number currently reported using culture. Less is known about the benefits of testing for B. cereus, C. perfringens and S. aureus. Further investigation is needed on how clinical outcomes may be altered if test results are available more quickly and at a greater precision than in the current practice of bacterial culture.

  18. Pathogenic Vibrio parahaemolyticus isolated from biofouling on commercial vessels and harbor structures.

    Science.gov (United States)

    Revilla-Castellanos, Valeria J; Guerrero, Abraham; Gomez-Gil, Bruno; Navarro-Barrón, Erick; Lizárraga-Partida, Marcial L

    2015-01-01

    Ballast water is a significant vector of microbial dissemination; however, biofouling on commercial vessel hulls has been poorly studied with regard to pathogenic bacteria transport. Biofouling on three commercial vessels and seven port structures in Ensenada, Baja California, Mexico, was examined by qPCR to identify and quantify Vibrio parahaemolyticus, a worldwide recognized food-borne human pathogen. Pathogenic variants (trh+, tdh+) of V. parahaemolyticus were detected in biofouling homogenates samples from several docks in Ensenada and on the hulls of ships with Japanese and South Korean homeports, but not in reference sampling stations. A total of 26 tdh+ V. parahaemolyticus colonies and 1 ORF8+/O3:K6 strain were also isolated from enriched biofouling homogenate samples confirming the qPCR analysis. Our results suggest that biofouling is an important reservoir of pathogenic vibrios. Thus, ship biofouling might be an overlooked vector with regard to the dissemination of pathogens, primarily pathogenic V. parahaemolyticus.

  19. The pathogenic potential of different pulsed-field gel electrophoresis types of Listeria monocytogenes strains isolated from food in Northeast Bosnia and Herzegovina.

    Science.gov (United States)

    Hodžić, Snjezana; Hukić, Mirsada; Franciosa, Giovanna; Aureli, Paolo

    2011-09-01

    Listeria monocytogenes is often present in meat and meat products that are sold in the area of northeast Bosnia and Herzegovina. The major objective of this study was to examine the virulence of L. monocytogenes strains isolated from these types of food in that geographic area. Polymerase chain reaction was used to detect eight genes responsible for virulence of this pathogen, namely, prfA, inlA, inlB, hly, plcA, plcB, actA, and mpl. All examined isolates were confirmed to possess the eight virulence genes. Ten different pulsed-field gel electrophoresis (PFGE) macrorestriction profiles were recognized among 19 L. monocytogenes strains after restriction with two different endonucleases (ApaI and AscI). The pathogenicity of three different PFGE types of L. monocytogenes was confirmed through in vivo tests, which were performed on female white mice (Pasteur strain), and it ranged from 3.55 × 10(8) LD50 to 1.58 × 10(10) LD50. All of the three different PFGE types of L. monocytogenes were regarded as moderately virulent in relation to the reference strain L. monocytogenes Scott A. This result might be one of the reasons for the absence of reported listeriosis in northeast Bosnia and Herzegovina, despite the high degree of food contamination with this pathogen.

  20. In vitro study on the composition and antibacterial effects of aqueous and methanol extracts of on some of food-borne pathogens

    Directory of Open Access Journals (Sweden)

    A. Barati

    2016-08-01

    Full Text Available Scrophularia khorassanica belongs to the Scrophulariaceae family that geographically grows wild only in Iran-Khorasan. There is insufficient information about its composition and antibacterial activity. Due to the application of S. khorassanica and related species in traditional medicine, the aim of this study was to determine antimicrobial effect of S. khorassanica aqueous and methanolic extracts on the growth of Escherichia coli and Staphylococcus aureus and also to determine the composition of the essential oil in-vitro. Extracts and the essential oil were prepared respectively by maceration and hydro-distillation methods. The composition of the essential oil examined by GC/MS and the minimum inhibitory concentration (MIC and minimum bactericidal concentration (MBC determined by broth micro-dilution assay. Composition analysis identified a total of 28 various components in which the main components were 1,3-Bis (trimethylsilyl, benzene (34.93%, р-Cymene (12.55%, Palmitic acid (6.79, Thymol (6.22%, Linalool (4.59%, 2-undecanone(4.35%, Sorbitol(1.87%, Carvacrol (1.74%, γ-Terpinene (1.06%, β -Elemene (1.03% and α-Pinene (0.3%. The MIC for methanolic extract against E. coli and S. aureus was 12.5 and 25 mg/ml, respectively. In the case of aqueous extract, it was estimated at 6.25 and 12.5 mg/ml, respectively. Based on these results, the aqueous extract had the strongest antibacterial effect. It was concluded that Scrophularia khorassanica extract can be used as an natural preservative.

  1. AuNP-RF sensor: An innovative application of RF technology for sensing pathogens electrically in liquids (SPEL) within the food supply chain.

    Science.gov (United States)

    Matta, Leann Lerie; Karuppuswami, Saranraj; Chahal, Premjeet; Alocilja, Evangelyn C

    2018-07-15

    Rapid detection techniques of pathogenic bacteria in the liquid food supply chain are of significant research interest due to their pivotal role in preventing foodborne outbreaks, and in maintaining high standards of public health and safety. Milk and dairy products are of particular interest due to their widespread consumption across the globe. In this paper, a biosensor for detecting pathogenic bacteria in milk using dextrin-capped gold nanoparticles (d-AuNP) as labels decoded at microwave frequencies is presented. The SPEL (sensing pathogens electrically in liquids) biosensor consists of a 3D printed vial and uses an RF reader and an RFID (radio-frequency identification) compatible Split Ring Resonator (SRR) based tag. The SPEL biosensor is capable of detecting bacteria at 5 log CFU/mL within 75 min, with the possibility of testing multiple concurrent samples. Detection is based on impedance loading of SRR by d-AuNP bound to pathogenic bacteria. Spectrophotometry, along with carbohydrate-functionalized magnetic nanoparticle (MNP) cell capture, is used to verify the sensitivity of the SPEL biosensor with respect to d-AuNP presence. The proof-of-concept device, along with challenges and opportunities for commercialization, are also outlined. Copyright © 2018. Published by Elsevier B.V.

  2. Genome Sequencing of Bacillus subtilis SC-8, Antagonistic to the Bacillus cereus Group, Isolated from Traditional Korean Fermented-Soybean Food

    OpenAIRE

    Yeo, In-Cheol; Lee, Nam Keun; Hahm, Young Tae

    2012-01-01

    Bacillus subtilis SC-8 is a Gram-positive bacterium displaying narrow antagonistic activity for the Bacillus cereus group. B. subtilis SC-8 was isolated from Korean traditional fermented-soybean food. Here we report the draft genome sequence of B. subtilis SC-8, including biosynthetic genes for antibiotics that may have beneficial effects for control of food-borne pathogens.

  3. Application of MALDI-TOF MS fingerprinting as a quick tool for identification and clustering of foodborne pathogens isolated from food products.

    Science.gov (United States)

    Elbehiry, Ayman; Marzouk, Eman; Hamada, Mohamed; Al-Dubaib, Musaad; Alyamani, Essam; Moussa, Ihab M; AlRowaidhan, Anhar; Hemeg, Hassan A

    2017-10-01

    Foodborne pathogens can be associated with a wide variety of food products and it is very important to identify them to supply safe food and prevent foodborne infections. Since traditional techniques are timeconsuming and laborious, this study was designed for rapid identification and clustering of foodborne pathogens isolated from various restaurants in Al-Qassim region, Kingdom of Saudi Arabia (KSA) using matrix-assisted laser desorption ionization-time of flight mass spectrometry (MALDI-TOF MS). Sixty-nine bacterial and thirty-two fungal isolates isolated from 80 food samples were used in this study. Preliminary identification was carried out through culture and BD Phoenix™ methods. A confirmatory identification technique was then performed using MALDI-TOF MS. The BD Phoenix results revealed that 97% (67/69 isolates) of bacteria were correctly identified as 75% Enterobacter cloacae, 95.45% Campylobacter jejuni and 100% for Escherichia coli, Salmonella enterica, Staphylococcus aureus, Acinetobacter baumannii, and Klebsiella pneumoniae. While 94.44% (29/32 isolates) of fungi were correctly identified as 77.77% Alternaria alternate, 88.88% Aspergillus niger and 100% for Aspergillus flavus, Penicillium digitatum, Candida albicans and Debaryomyces hansenii. However, all bacterial and fungal isolates were 100% properly identified by MALDI-TOF MS fingerprinting with a score value ≥2.00. A gel view illustrated that the spectral peaks for the identified isolates fluctuate between 3,000 and 10,000 Da. The results of main spectra library (MSP) dendrogram showed that the bacterial and fungal isolates matched with 19 and 9 reference strains stored in the Bruker taxonomy, respectively. Our results indicated that MALDI-TOF MS is a promising technique for fast and accurate identification of foodborne pathogens.

  4. ENHANCING FOOD SAFETY AND STABILITY THROUGH IRRADIATION: A REVIEW

    Directory of Open Access Journals (Sweden)

    Manzoor Ahmad Shah

    2014-04-01

    Full Text Available Food irradiation is one of the non thermal food processing methods. It is the process of exposing food materials to the controlled amounts of ionizing radiations such as gamma rays, X-rays and accelerated electrons, to improve microbiological safety and stability. Irradiation disrupts the biological processes that lead to decay of food quality. It is an effective tool to reduce food-borne pathogens, spoilage microorganisms and parasites; to extend shelf-life and for insect disinfection. The safety and consumption of irradiated foods have been extensively studied at national levels and in international cooperations and have concluded that foods irradiated under appropriate technologies are both safe and nutritionally adequate. Specific applications of food irradiation have been approved by national legislations of more than 55 countries worldwide. This review aims to discuss the applications of irradiation in food processing with the emphasis on food safety and stability.

  5. Ionizing radiations in food industry

    International Nuclear Information System (INIS)

    Adamo, M.; Tata, A.

    1999-01-01

    Foodstuffs treatment by ionization is able to produce both a shelf-life extension and/or a food borne diseases control through the pathogenic population reduction/elimination. The main process goal is to ensure the hygienic quality and the wholesomeness of products to be marketed, in order to limit food borne diseases originated mainly through the cross contamination process. In fact several products may contain pathogenic agents or bacteria (e.g. Salmonella and Campylbacter in poultry meat), whose associated pathologies are world-wide increasing. At present, over 40 countries provide clearances for the treatment of about 45 different types of foodstuffs and in over 20 of them the ionizing process is already industrially utilized for spices, poultry, shrimps and vegetables. As it refers to process economic aspects, market researches have shown cost figures ranging from few tens to some hundreds Lit/kg, depending on the dose to products. The costs are competitive with alternative treatments, beyond the recovery of economic productivity reduction caused by food borne diseases

  6. Incidence and Trends of Infections with Pathogens Transmitted Commonly Through Food and the Effect of Increasing Use of Culture-Independent Diagnostic Tests on Surveillance - Foodborne Diseases Active Surveillance Network, 10 U.S. Sites, 2013-2016.

    Science.gov (United States)

    Marder, Ellyn P; Cieslak, Paul R; Cronquist, Alicia B; Dunn, John; Lathrop, Sarah; Rabatsky-Ehr, Therese; Ryan, Patricia; Smith, Kirk; Tobin-D'Angelo, Melissa; Vugia, Duc J; Zansky, Shelley; Holt, Kristin G; Wolpert, Beverly J; Lynch, Michael; Tauxe, Robert; Geissler, Aimee L

    2017-04-21

    Foodborne diseases represent a substantial public health concern in the United States. CDC's Foodborne Diseases Active Surveillance Network (FoodNet) monitors cases reported from 10 U.S. sites* of laboratory-diagnosed infections caused by nine enteric pathogens commonly transmitted through food. This report describes preliminary surveillance data for 2016 on the nine pathogens and changes in incidences compared with 2013-2015. In 2016, FoodNet identified 24,029 infections, 5,512 hospitalizations, and 98 deaths caused by these pathogens. The use of culture-independent diagnostic tests (CIDTs) by clinical laboratories to detect enteric pathogens has been steadily increasing since FoodNet began surveying clinical laboratories in 2010 (1). CIDTs complicate the interpretation of FoodNet surveillance data because pathogen detection could be affected by changes in health care provider behaviors or laboratory testing practices (2). Health care providers might be more likely to order CIDTs because these tests are quicker and easier to use than traditional culture methods, a circumstance that could increase pathogen detection (3). Similarly, pathogen detection could also be increasing as clinical laboratories adopt DNA-based syndromic panels, which include pathogens not often included in routine stool culture (4,5). In addition, CIDTs do not yield isolates, which public health officials rely on to distinguish pathogen subtypes, determine antimicrobial resistance, monitor trends, and detect outbreaks. To obtain isolates for infections identified by CIDTs, laboratories must perform reflex culture † ; if clinical laboratories do not, the burden of culturing falls to state public health laboratories, which might not be able to absorb that burden as the adoption of these tests increases (2). Strategies are needed to preserve access to bacterial isolates for further characterization and to determine the effect of changing trends in testing practices on surveillance.

  7. Effect of Food Residues in Biofilm Formation on Stainless Steel and Polystyrene Surfaces by Salmonella enterica Strains Isolated from Poultry Houses

    OpenAIRE

    Paz-Méndez, Alba María; Lamas, Alexandre; Vázquez, Beatriz; Miranda, José Manuel; Cepeda, Alberto; Franco, Carlos Manuel

    2017-01-01

    Salmonella spp. is a major food-borne pathogen around the world. The ability of Salmonella to produce biofilm is one of the main obstacles in reducing the prevalence of these bacteria in the food chain. Most of Salmonella biofilm studies found in the literature used laboratory growth media. However, in the food chain, food residues are the principal source of nutrients of Salmonella. In this study, the biofilm formation, morphotype, and motility of 13 Salmonella strains belonging to three dif...

  8. Identification of human-pathogenic strains of Shiga toxin-producing Escherichia coli from food by a combination of serotyping and molecular typing of Shiga toxin genes.

    Science.gov (United States)

    Beutin, Lothar; Miko, Angelika; Krause, Gladys; Pries, Karin; Haby, Sabine; Steege, Katja; Albrecht, Nadine

    2007-08-01

    We examined 219 Shiga toxin-producing Escherichia coli (STEC) strains from meat, milk, and cheese samples collected in Germany between 2005 and 2006. All strains were investigated for their serotypes and for genetic variants of Shiga toxins 1 and 2 (Stx1 and Stx2). stx(1) or variant genes were detected in 88 (40.2%) strains and stx(2) and variants in 177 (80.8%) strains. Typing of stx genes was performed by stx-specific PCRs and by analysis of restriction fragment length polymorphisms (RFLP) of PCR products. Major genotypes of the Stx1 (stx(1), stx(1c), and stx(1d)) and the Stx2 (stx(2), stx(2d), stx(2-O118), stx(2e), and stx(2g)) families were detected, and multiple types of stx genes coexisted frequently in STEC strains. Only 1.8% of the STEC strains from food belonged to the classical enterohemorrhagic E. coli (EHEC) types O26:H11, O103:H2, and O157:H7, and only 5.0% of the STEC strains from food were positive for the eae gene, which is a virulence trait of classical EHEC. In contrast, 95 (43.4%) of the food-borne STEC strains carried stx(2) and/or mucus-activatable stx(2d) genes, an indicator for potential high virulence of STEC for humans. Most of these strains belonged to serotypes associated with severe illness in humans, such as O22:H8, O91:H21, O113:H21, O174:H2, and O174:H21. stx(2) and stx(2d) STEC strains were found frequently in milk and beef products. Other stx types were associated more frequently with pork (stx(2e)), lamb, and wildlife meat (stx(1c)). The combination of serotyping and stx genotyping was found useful for identification and for assignment of food-borne STEC to groups with potential lower and higher levels of virulence for humans.

  9. Chemistry, Antimicrobial Mechanisms, and Antibiotic Activities of Cinnamaldehyde against Pathogenic Bacteria in Animal Feeds and Human Foods.

    Science.gov (United States)

    Friedman, Mendel

    2017-12-06

    Cinnamaldehyde is a major constituent of cinnamon essential oils produced by aromatic cinnamon plants. This compound has been reported to exhibit antimicrobial properties in vitro in laboratory media and in animal feeds and human foods contaminated with disease-causing bacteria including Bacillus cereus, Campylobacter jejuni, Clostridium perfringens, Escherichia coli, Listeria monocytogenes, and Salmonella enterica. This integrated review surveys and interprets our current knowledge of the chemistry, analysis, safety, mechanism of action, and antibiotic activities of cinnamaldehyde in food animal (cattle, lambs, calves, pigs, poultry) diets and in widely consumed liquid (apple, carrot, tomato, and watermelon juices, milk) and solid foods. Solid foods include various fruits (bayberries, blueberries, raspberries, and strawberries), vegetables (carrots, celery, lettuce, spinach, cucumbers, and tomatoes), meats (beef, ham, pork, and frankfurters), poultry (chickens and turkeys), seafood (oysters and shrimp), bread, cheese, eggs, infant formula, and peanut paste. The described findings are not only of fundamental interest but also have practical implications for food safety, nutrition, and animal and human health. The collated information and suggested research needs will hopefully facilitate and guide further studies needed to optimize the use of cinnamaldehyde alone and in combination with other natural antimicrobials and medicinal antibiotics to help prevent and treat food animal and human diseases.

  10. Microbial source tracking: a tool for identifying sources of microbial contamination in the food chain.

    Science.gov (United States)

    Fu, Ling-Lin; Li, Jian-Rong

    2014-01-01

    The ability to trace fecal indicators and food-borne pathogens to the point of origin has major ramifications for food industry, food regulatory agencies, and public health. Such information would enable food producers and processors to better understand sources of contamination and thereby take corrective actions to prevent transmission. Microbial source tracking (MST), which currently is largely focused on determining sources of fecal contamination in waterways, is also providing the scientific community tools for tracking both fecal bacteria and food-borne pathogens contamination in the food chain. Approaches to MST are commonly classified as library-dependent methods (LDMs) or library-independent methods (LIMs). These tools will have widespread applications, including the use for regulatory compliance, pollution remediation, and risk assessment. These tools will reduce the incidence of illness associated with food and water. Our aim in this review is to highlight the use of molecular MST methods in application to understanding the source and transmission of food-borne pathogens. Moreover, the future directions of MST research are also discussed.

  11. Foodborne Pathogens Recovered from Ready-to-Eat Foods from Roadside Cafeterias and Retail Outlets in Alice, Eastern Cape Province, South Africa: Public Health Implications

    Science.gov (United States)

    Nyenje, Mirriam E.; Odjadjare, Collins E.; Tanih, Nicoline F.; Green, Ezekiel; Ndip, Roland N.

    2012-01-01

    This study assessed the microbiological quality of various ready-to-eat foods sold in Alice, South Africa. Microbiological analysis was conducted on 252 samples which included vegetables, potatoes, rice, pies, beef and chicken stew. The isolates were identified using biochemical tests and the API 20E, API 20NE and API Listeria kits; results were analyzed using the one-way-ANOVA test. Bacterial growth was present in all the food types tested; high levels of total aerobic count were observed in vegetables, 6.8 ± 0.07 followed by rice, 6.7 ± 1.7 while pies had the lowest count (2.58 ± 0.24). Organisms isolated included: Listeria spp. (22%), Enterobacter spp. (18%), Aeromonas hydrophila (12%), Klebsiella oxytoca (8%), Proteus mirabilis (6.3%), Staphylococcus aureus (3.2%) and Pseudomonas luteola (2.4%). Interestingly, Salmonella spp. and Escherichia coli were not isolated in any of the samples. There was a statistically significant difference (p < 0.05) in the prevalence of foodborne pathogens from hygienic and unhygienic cafeterias. The results indicated that most of the ready-to-eat food samples examined in this study did not meet bacteriological quality standards, therefore posing potential risks to consumers. This should draw the attention of the relevant authorities to ensure that hygienic standards are improved to curtain foodborne infections. PMID:23066386

  12. Effects of tick control by acaricide self-treatement of white-tailed deer on host-seeking tick infection prevalence and entomologic risk for Ixodes scapularis-borne pathogens

    Science.gov (United States)

    We evaluated the effects of tick control by acaricide self-treatment of white-tailed deer on the infection prevalence and entomologic risk for three I. scapularis-borne bacteria in host-seeking ticks. Ticks were collected from vegetation in areas treated with the ‘4-Poster’ device and from control a...

  13. Bacillus cereus un patógeno importante en el control microbiológico de los alimentos / Bacillus cereus an important pathogen the microbiological control of food

    Directory of Open Access Journals (Sweden)

    Jennifer Sánchez

    2016-05-01

    Full Text Available Resumen Bacillus cereus es una bacteria genéticamente diversa que se encuentra comúnmente en el ambiente. Contamina los alimentos afectando la salud humana, al ingerir el microorganismo y/o sus toxinas, la emética o las enterotoxinas. En Colombia son escasos los reportes de intoxicación por B. cereus y se estima que hay un gran subregistro. Por lo anterior, se recomienda aumentar la vigilancia de este patógeno y realizar estudios sobre aspectos relevantes que permitan aplicar medidas de control para disminuir las intoxicaciones por B. cereus. El objetivo de esta revisión bibliográfica es presentar información actualizada sobre B. cereus, que incluye aspectos de su biología, taxonomía, toxinas, alimentos que contamina y metodologías para detectar, prevenir y controlar este microorganismo. La información presentada es de utilidad para el público en general, especialmente personas vinculadas al sector de alimentos, inocuidad alimentaria y control de procesos. / Abstract Bacillus cereus is a genetically diverse bacterium commonly found in the environment. It contaminates food, thus affecting human health upon ingestion of the microorganism and/or its toxins, the emetic or enterotoxins. In Colombia, reports of intoxication by B. cereus are scarce and under-registration is presumed. Because of this, it is recommended to increase surveillance of this pathogen and to develop studies on relevant aspects that allow the application of control measures to reduce intoxications by B. cereus. The aim of this review is to present current information on B. cereus, including aspects of its biology, taxonomy, toxins, food that it contaminates and methodologies for the detection, prevention and control of this microorganism. This information is useful for the general public, especially people involved with the food sector, food safety and process control.

  14. Evaluation of a Recirculating Dipper Well Combined with Ozone Sanitizer for Control of Foodborne Pathogens in Food Service Operations.

    Science.gov (United States)

    Almeida, Giselle; Gibson, Kristen E

    2016-09-01

    In the retail food service industry, small countertop sinks, or dipper wells, are utilized to rinse and store serving utensils between uses. These dipper wells are designed to operate under a constant flow of water, which serves both to prevent the accumulation of microorganisms and to aid in the cleanliness of the dipper well itself. Here, a recirculating dipper well ozone sanitation system (DWOSS) was evaluated for the control and inactivation of Escherichia coli , Listeria innocua , PRD1 bacteriophage, and Staphylococcus aureus present on a stainless steel disher. In a low ozone (O 3 ) demand medium, the DWOSS achieved over a 5-log reduction for E. coli , L. innocua , and PRD1 at 30 s when exposed to 0.45 to 0.55 ppm of residual O 3 . A greater than 5-log total CFU reduction was achieved for S. aureus at a 600-s exposure time and 0.50 ppm of residual O 3 . When evaluated in the presence of high O 3 demand medium (10% skim milk), the DWOSS performed significantly better (P food service. To our knowledge, a dipper well with a cleaning-in-place sanitizing system is not currently available for use in the food service industry; and, thus, this is the first study to evaluate the efficacy of a cleaning-in-place dipper well.

  15. Subboiling Moist Heat Favors the Selection of Enteric Pathogen Clostridium difficile PCR Ribotype 078 Spores in Food

    Directory of Open Access Journals (Sweden)

    Alexander Rodriguez-Palacios

    2016-01-01

    Full Text Available Emerging enteric pathogens could have not only more antibiotic resistance or virulence traits; they could also have increased resistance to heat. We quantified the effects of minimum recommended cooking and higher temperatures, individually on a collection of C. difficile isolates and on the survival probability of a mixture of emerging C. difficile strains. While minimum recommended cooking time/temperature combinations (63–71°C allowed concurrently tested strains to survive, higher subboiling temperatures reproducibly favored the selection of newly emerging C. difficile PCR ribotype 078. Survival ratios for “ribotypes 078” :  “other ribotypes” (n=49 : 45 isolates from the mid-2000s increased from 1 : 1 and 0.7 : 1 at 85°C (for 5 and 10 minutes, resp. to 2.3 : 1 and 3 : 1 with heating at 96°C (for 5 and 10 minutes, resp. indicating an interaction effect between the heating temperature and survival of C. difficile genotypes. In multistrain heating experiments, with PCR ribotypes 027 and 078 from 2004 and reference type strain ATCC 9689 banked in the 1970s, multinomial logistic regression (P<0.01 revealed PCR ribotype 078 was the most resistant to increasing lethal heat treatments. Thermal processes (during cooking or disinfection may contribute to the selection of emergent specific virulent strains of C. difficile. Despite growing understanding of the role of cooking on human evolution, little is known about the role of cooking temperatures on the selection and evolution of enteric pathogens, especially spore-forming bacteria.

  16. Physiologically based in silico modelling to examine DNA adduct formation by different food-borne a,ß-unsaturated aldehydes at realistic low dietary exposure levels

    NARCIS (Netherlands)

    Kiwamoto, R.

    2015-01-01

    Abstract (R.Kiwamoto ISBN 978-94-6257-284-3)

    Various α,β-unsaturated aldehydes are present in fruits, vegetables, spices, or processed products containing these items as natural constituents or as added food flavouring agents. Because of the α,β-unsaturated aldehyde moiety the β carbon in

  17. Application of the Central Limit Theorem in microbial risk assessment: High number of serving reduces the Coefficient of Variation of food-borne burden-of-illness

    NARCIS (Netherlands)

    Pérez-Rodríguez, F.; Zwietering, M.H.

    2012-01-01

    The Central Limit Theorem (CLT) is proposed as a means of understanding microbial risk in foods from a Public Health perspective. One variant of the CLT states that as the number of random variables, each with a finite mean and variance, increases (¿8), the distribution of the sum (or mean) of those

  18. EFSA BIOHAZ Panel (EFSA Panel on Biological Hazards), 2014. Scientific Opinion on the risk posed by pathogens in food of non-animal origin. Part 2 (Salmonella and Norovirus in berries)

    DEFF Research Database (Denmark)

    Hald, Tine; Baggesen, Dorte Lau

    Berries are a perishable food which can be consumed as fresh or minimally-processed as well as a frozen ingredient added to many foods. Strawberries, raspberries, blackberries and blueberries are the most commonly consumed in the EU. Risk factors for berry contamination by Salmonella and Norovirus...... were considered in the context of the whole food chain. Available estimates of the prevalence of these pathogens in berries were evaluated together with mitigation options relating to prevention of contamination and the relevance of microbiological criteria. It was concluded that each farm environment...... represents a unique combination of risk factors that can influence occurrence and persistence of pathogens in berry production. Appropriate implementation of food safety management systems including Good Agricultural Practices (GAP), Good Hygiene Practices (GHP) and Good Manufacturing Practices (GMP), should...

  19. Predictive Food Microbiology

    DEFF Research Database (Denmark)

    Østergaard, Nina Bjerre

    Listeria monocytogenes is a well-known food borne pathogen that potentially causes listeriosis. No outbreaks or cases of listeriosis have been associated with cottage cheese, but several confirmed cases and outbreaks in the EU and the US have been related to dairy products made from raw...... or pasteurised milk. This, in combination with the fact that cottage cheese support growth of Listeria monocytogenes, induces a documentation requirement on the food producer. In the EU regulatory framework, mathematical models are recognised as a suitable supplement to traditional microbiological methods....... The models can be used for documentation of compliance with microbiological criteria for Listeria monocytogenes under reasonably foreseeable conditions. Cottage cheese is a fresh, fermented dairy product. It consists of a fermented cheese curd mixed with a fresh or cultured cream dressing. The product...

  20. Survey of spatial distribution of vector-borne disease in ...

    African Journals Online (AJOL)

    Neighborhood dogs may act as reservoirs and disseminators of vector-borne diseases in urban areas. Accordingly, the aim of this study was to ascertain the health status and the vector-borne pathogens infecting dogs living in public areas with high levels of human movement in the city of Curitiba, southern Brazil.

  1. Detection of Food Spoilage and Pathogenic Bacteria Based on Ligation Detection Reaction Coupled to Flow-Through Hybridization on Membranes

    Directory of Open Access Journals (Sweden)

    K. Böhme

    2014-01-01

    Full Text Available Traditional culturing methods are still commonly applied for bacterial identification in the food control sector, despite being time and labor intensive. Microarray technologies represent an interesting alternative. However, they require higher costs and technical expertise, making them still inappropriate for microbial routine analysis. The present study describes the development of an efficient method for bacterial identification based on flow-through reverse dot-blot (FT-RDB hybridization on membranes, coupled to the high specific ligation detection reaction (LDR. First, the methodology was optimized by testing different types of ligase enzymes, labeling, and membranes. Furthermore, specific oligonucleotide probes were designed based on the 16S rRNA gene, using the bioinformatic tool Oligonucleotide Retrieving for Molecular Applications (ORMA. Four probes were selected and synthesized, being specific for Aeromonas spp., Pseudomonas spp., Shewanella spp., and Morganella morganii, respectively. For the validation of the probes, 16 reference strains from type culture collections were tested by LDR and FT-RDB hybridization using universal arrays spotted onto membranes. In conclusion, the described methodology could be applied for the rapid, accurate, and cost-effective identification of bacterial species, exhibiting special relevance in food safety and quality.

  2. Foodborne Pathogens Recovered from Ready-to-Eat Foods from Roadside Cafeterias and Retail Outlets in Alice, Eastern Cape Province, South Africa: Public Health Implications

    Directory of Open Access Journals (Sweden)

    Roland N. Ndip

    2012-07-01

    Full Text Available This study assessed the microbiological quality of various ready-to-eat foods sold in Alice, South Africa. Microbiological analysis was conducted on 252 samples which included vegetables, potatoes, rice, pies, beef and chicken stew. The isolates were identified using biochemical tests and the API 20E, API 20NE and API Listeria kits; results were analyzed using the one-way-ANOVA test. Bacterial growth was present in all the food types tested; high levels of total aerobic count were observed in vegetables, 6.8 ± 0.07 followed by rice, 6.7 ± 1.7 while pies had the lowest count (2.58 ± 0.24. Organisms isolated included: Listeria spp. (22%, Enterobacter spp. (18%, Aeromonas hydrophila (12%, Klebsiella oxytoca (8%, Proteus mirabilis (6.3%, Staphylococcus aureus (3.2% and Pseudomonas luteola (2.4%. Interestingly, Salmonella spp. and Escherichia coli were not isolated in any of the samples. There was a statistically significant difference (p < 0.05 in the prevalence of foodborne pathogens from hygienic and unhygienic cafeterias. The results indicated that most of the ready-to-eat food samples examined in this study did not meet bacteriological quality standards, therefore posing potential risks to consumers. This should draw the attention of the relevant authorities to ensure that hygienic standards are improved to curtain foodborne infections.

  3. Food irradiation: advantages and limitations

    International Nuclear Information System (INIS)

    Hernandes, N.K.; Vital, H. de C.; Sabaa-Srur, A.U.O.

    2003-01-01

    Food irradiation is a physical method of processing food (e.g. freezing, canning). It has been thoroughly researched over the last four decades and is recognized as a safe and wholesome method. It has the potential both of disinfesting dried food to reduce storage losses and disinfesting fruits and vegetables to meet quarantine requirements for export trade. Low doses of irradiation inhibit spoilage losses due to sprouting of root and tuber crops. Food- borne diseases due to contamination by pathogenic microorganisms and parasites of meat, poultry, fish, fishery products and spices are on the increase. Irradiation of these solid foods can decontaminate them of pathogenic organisms and thus provide safe food to the consumer. Irradiation can successfully replace the fumigation treatment of cocoa beans and coffee beans and disinfest dried fish, dates, dried fruits, etc. One of the most important advantages of food irradiation processing is that it is a coldprocess which does not significantly alter physico-chemical characters of the treated product. It can be applied to food after its final packaging. Similar to other physical processes of food processing, (e.g. canning, freezing), irradiation is a capital intensive process. Thus, adequate product volume must be made available in order to maximize the use of the facility and minimize the unit cost of treatment. Lack of harmonization of regulations among the countries which have approved irradiated foods hampers the introduction of this technique for international trade. Action at the international level has to be taken in order to remedy this situation. One of the important limitations of food irradiation processing is its slow acceptance by consumers, due inter alia to a perceived association with radioactivity. The food industry tends to be reluctant to use the technology in view of uncertainties regarding consumer acceptance of treated foods. Several market testing and consumer acceptance studies have been carried

  4. Societal benefits of food irradiation

    International Nuclear Information System (INIS)

    Prakash, Anuradha

    2013-01-01

    Food irradiation has a direct impact on society by reducing the occurrence of food-borne illness, decreasing food spoilage and waste, and facilitating global trade. Food irradiation is approved in 40 countries around the world to decontaminate food of disease and spoilage causing microorganisms, sterilize insect pests, and inhibit sprouting. A recent estimate suggests that 500,000 metric of food is currently irradiated worldwide, primarily to decontaminate spices. Since its first use in the 1960s the use of irradiation for food has grown slowly, but it remains the major technology of choice for certain applications. The largest growth sector in recent years has been phytosanitary irradiation of fruit to disinfest fruit intended for international shipment. For many countries which have established strict quarantine standards, irradiation offers as an effective alternative to chemical fumigants some of which are being phased out due to their effects on the ozone layer. Insects can be sterilized at very low dose levels, thus quality of fruit can be maintained. Irradiation is also highly effective in destroying microbial pathogens such as Salmonella spp., E. coli, and Listeria, hence its application for treatment of spices, herbs, dried vegetables, frozen seafood, poultry, and meat and its contribution to reducing foodborne illnesses. Unfortunately the use of irradiation for improving food safety has been under-exploited. This presentation will provide details on the use, benefits, opportunities, and challenges of food irradiation. (author)

  5. Antimicrobial food packaging: potential and pitfalls

    Science.gov (United States)

    Malhotra, Bhanu; Keshwani, Anu; Kharkwal, Harsha

    2015-01-01

    Nowadays food preservation, quality maintenance, and safety are major growing concerns of the food industry. It is evident that over time consumers’ demand for natural and safe food products with stringent regulations to prevent food-borne infectious diseases. Antimicrobial packaging which is thought to be a subset of active packaging and controlled release packaging is one such promising technology which effectively impregnates the antimicrobial into the food packaging film material and subsequently delivers it over the stipulated period of time to kill the pathogenic microorganisms affecting food products thereby increasing the shelf life to severe folds. This paper presents a picture of the recent research on antimicrobial agents that are aimed at enhancing and improving food quality and safety by reduction of pathogen growth and extension of shelf life, in a form of a comprehensive review. Examination of the available antimicrobial packaging technologies is also presented along with their significant impact on food safety. This article entails various antimicrobial agents for commercial applications, as well as the difference between the use of antimicrobials under laboratory scale and real time applications. Development of resistance amongst microorganisms is considered as a future implication of antimicrobials with an aim to come up with actual efficacies in extension of shelf life as well as reduction in bacterial growth through the upcoming and promising use of antimicrobials in food packaging for the forthcoming research down the line. PMID:26136740

  6. EFSA BIOHAZ Panel (EFSA Panel on Biological Hazards), 2014. Scientific Opinion on the risk posed by pathogens in food of non-animal origin. Part 2 (Salmonella and Norovirus in leafy greens eaten raw as salads)

    DEFF Research Database (Denmark)

    Hald, Tine; Baggesen, Dorte Lau

    Leafy greens eaten raw as salads are minimally processed and widely consumed foods. Risk factors for leafy greens contamination by Salmonella spp. and Norovirus were considered in the context of the whole food chain including agricultural production and processing. Available estimates...... combination of numerous characteristics that can influence occurrence and persistence of pathogens in leafy greens production. Appropriate implementation of food safety management systems, including Good Agricultural Practices (GAP), Good Hygiene Practices (GHP) and Good Manufacturing Practices (GMP), should...... of the prevalence of these pathogens (together with the use of Escherichia coli as an indicator organism) in leafy greens were evaluated. Specific mitigation options relating to contamination of leafy greens were considered and qualitatively assessed. It was concluded that each farm environment represents a unique...

  7. EFSA (European Food Safety Authority) and ECDC (European Centre for Disease Prevention and Control), 2015. The European Union summary report on trends and sources of zoonoses, zoonotic agents and food-borne outbreaks in 2014

    DEFF Research Database (Denmark)

    Helwigh, Birgitte; Porsbo, Lone Jannok; Boysen, Louise

    This report of the European Food Safety Authority and the European Centre for Disease Prevention and Control presents the results of the zoonoses monitoring activities carried out in 2014 in 32 European countries (28 Member States (MS) and four non-MS). Campylobacteriosis was the most commonly re......, molluscs and products thereof’. The report further summarises trends and sources along the food chain of tuberculosis due to Mycobacterium bovis, Brucella, Trichinella, Echinococcus, Toxoplasma, rabies, Coxiella burnetii (Q fever), West Nile virus and tularaemia....

  8. EFSA and ECDC (European Food Safety Authority and European Centre for Disease Prevention and Control), 2015. The European Union Summary Report on Trends and Sources of Zoonoses, Zoonotic Agents and Food-borne Outbreaks in 2013

    OpenAIRE

    Helwigh, Birgitte

    2015-01-01

    This report of the European Food Safety Authority and the European Centre for Disease Prevention and Control presents the results of the zoonoses monitoring activities carried out in 2013 in 32 European countries (28 Member States and four non-Member States). Campylobacter iosis was the most commonly reported zoonosis. After several years of an increasing European Union (EU) trend, the human Campylobacter iosis notification rate has stabilised. In food and animals no EU trends were observed a...

  9. EFSA (European Food Safety Authority) and ECDC (European Centre for Disease Prevention and Control), 2015. The European Union summary report on trends and sources of zoonoses, zoonotic agents and food-borne outbreaks in 2014

    OpenAIRE

    Helwigh, Birgitte; Porsbo, Lone Jannok; Boysen, Louise; Bager, Flemming

    2015-01-01

    This report of the European Food Safety Authority and the European Centre for Disease Prevention and Control presents the results of the zoonoses monitoring activities carried out in 2014 in 32 European countries (28 Member States (MS) and four non-MS). Campylobacteriosis was the most commonly reported zoonosis with an increase in confirmed human cases in the European Union (EU) since 2008. In food the occurrence of Campylobacter remained high in broiler meat. The decreasing EU trend for conf...

  10. Contamination of water resources by pathogenic bacteria

    Science.gov (United States)

    2014-01-01

    Water-borne pathogen contamination in water resources and related diseases are a major water quality concern throughout the world. Increasing interest in controlling water-borne pathogens in water resources evidenced by a large number of recent publications clearly attests to the need for studies that synthesize knowledge from multiple fields covering comparative aspects of pathogen contamination, and unify them in a single place in order to present and address the problem as a whole. Providing a broader perceptive of pathogen contamination in freshwater (rivers, lakes, reservoirs, groundwater) and saline water (estuaries and coastal waters) resources, this review paper attempts to develop the first comprehensive single source of existing information on pathogen contamination in multiple types of water resources. In addition, a comprehensive discussion describes the challenges associated with using indicator organisms. Potential impacts of water resources development on pathogen contamination as well as challenges that lie ahead for addressing pathogen contamination are also discussed. PMID:25006540

  11. Food safety knowledge, attitudes and practices of institutional food-handlers in Ghana.

    Science.gov (United States)

    Akabanda, Fortune; Hlortsi, Eli Hope; Owusu-Kwarteng, James

    2017-01-06

    In large scale cooking, food is handled by many individuals, thereby increasing the chances of food contamination due to improper handling. Deliberate or accidental contamination of food during large scale production might endanger the health of consumers, and have very expensive repercussions on a country. The purpose of this study was to evaluate the food safety knowledge, attitudes, and practices among institutional food- handlers in Ghana. The study was conducted using a descriptive, cross-sectional survey of 29 institutions by conducting face to face interview and administration of questionnaire to two hundred and thirty-five (235) institutional food-handlers. The questionnaire was peer-reviewed and pilot tested in three institutions in the Upper East Region of Ghana, before the final version was distributed to food-handlers. The questionnaire was structured into five distinctive parts to collect information on (i) demographic characteristics, (ii) employees' work satisfaction, (iii) knowledge on food safety, (iv) attitudes towards food safety and (v) food hygiene practices. Majority of the food-handlers were between 41-50 years (39.1%). Female respondents were (76.6%). In our study, the food-handlers were knowledgeable about hygienic practices, cleaning and sanitation procedures. Almost all of the food-handlers were aware of the critical role of general sanitary practices in the work place, such as hand washing (98.7% correct answers), using gloves (77.9%), proper cleaning of the instruments/utensils (86.4%) and detergent use (72.8%). On disease transmission, the results indicates that 76.2% of the food- handlers did not know that Salmonella is a food borne pathogens and 70.6% did not know that hepatitis A is a food borne pathogen. However, 81.7% handlers agreed that typhoid fever is transmitted by food and 87.7% agreed that bloody diarrhea is transmitted by food. Logistic regression analysis testing four models showed statistically significant differences

  12. Food safety knowledge, attitudes and practices of institutional food-handlers in Ghana

    Directory of Open Access Journals (Sweden)

    Fortune Akabanda

    2017-01-01

    Full Text Available Abstract Background In large scale cooking, food is handled by many individuals, thereby increasing the chances of food contamination due to improper handling. Deliberate or accidental contamination of food during large scale production might endanger the health of consumers, and have very expensive repercussions on a country. The purpose of this study was to evaluate the food safety knowledge, attitudes, and practices among institutional food- handlers in Ghana. Methods The study was conducted using a descriptive, cross-sectional survey of 29 institutions by conducting face to face interview and administration of questionnaire to two hundred and thirty-five (235 institutional food-handlers. The questionnaire was peer-reviewed and pilot tested in three institutions in the Upper East Region of Ghana, before the final version was distributed to food-handlers. The questionnaire was structured into five distinctive parts to collect information on (i demographic characteristics, (ii employees’ work satisfaction, (iii knowledge on food safety, (iv attitudes towards food safety and (v food hygiene practices. Results Majority of the food-handlers were between 41–50 years (39.1%. Female respondents were (76.6%. In our study, the food-handlers were knowledgeable about hygienic practices, cleaning and sanitation procedures. Almost all of the food-handlers were aware of the critical role of general sanitary practices in the work place, such as hand washing (98.7% correct answers, using gloves (77.9%, proper cleaning of the instruments/utensils (86.4% and detergent use (72.8%. On disease transmission, the results indicates that 76.2% of the food- handlers did not know that Salmonella is a food borne pathogens and 70.6% did not know that hepatitis A is a food borne pathogen. However, 81.7% handlers agreed that typhoid fever is transmitted by food and 87.7% agreed that bloody diarrhea is transmitted by food. Logistic regression analysis testing four models

  13. Bioluminescence lights the way to food safety

    Science.gov (United States)

    Brovko, Lubov Y.; Griffiths, Mansel W.

    2003-07-01

    The food industry is increasingly adopting food safety and quality management systems that are more proactive and preventive than those used in the past which have tended to rely on end product testing and visual inspection. The regulatory agencies in many countries are promoting one such management tool, Hazard Analysis Critical Control Point (HACCP), as a way to achieve a safer food supply and as a basis for harmonization of trading standards. Verification that the process is safe must involve microbiological testing but the results need not be generated in real-time. Of all the rapid microbiological tests currently available, the only ones that come close to offering real-time results are bioluminescence-based methods. Recent developments in application of bioluminescence for food safety issues are presented in the paper. These include the use of genetically engineered microorganisms with bioluminescent and fluorescent phenotypes as a real time indicator of physiological state and survival of food-borne pathogens in food and food processing environments as well as novel bioluminescent-based methods for rapid detection of pathogens in food and environmental samples. Advantages and pitfalls of the methods are discussed.

  14. Food Safety as a contributor to Food Security: global policy concerns & challenges

    Directory of Open Access Journals (Sweden)

    Vijay Kumar Chattu

    2015-12-01

    Full Text Available The theme for World Health Day campaign for this year 2015 is “Food safety: from farm to plate, make food safe”. The day focuses on demonstrating the importance of food safety along the whole length of the food chain in a globalized world, from production and transport, to preparation and consumption (1. Everyone needs food and needs it every day either plant sources or animal sources or both. The food we eat must be nutritious and safe but we often ignore or overlook the issue of food safety. Many cases of food borne diseases either acute poisoning or chronic exposure are largely under reported. In this globalized world, though the food chain extends over thousands of miles from different continents, an error or contamination in one country can affect the health of consumers on the other part of the world. To ensure full impact, these actions must build on principles of government stewardship, engagement of civil society, (2.According to UN, access to a safe and secure food supply is a basic human right. Food safety and food security are interrelated concepts which have an impact on the health outcomes and quality of human lives. As per Food and Agricultural Organization (FAO, Food security is a situation that exists when all people, at all times, have physical, social and economic access to sufficient, safe and nutritious food that meets their dietary needs and food preferences for an active and healthy life, (3. Based on the definition of Food security, four food security dimensions can be identified: food availability, economic and physical access to food, food utilization and stability over time. Apart from that food security is also affected by Poverty and Climate change.Food safety is an umbrella term that encompasses many aspects like food items handling, preparation and storage of food to prevent illness and injury. The other important issues are chemical, microphysical and microbiological aspects of food safety, (4. Control of

  15. [Tick-borne diseases].

    Science.gov (United States)

    Tissot Dupont, H; Raoult, D

    1993-05-01

    Due to their worldwide distribution, from hottest to coldest climates, and due to their behaviour, ticks are capable of transmitting numerous human and animal bacterial viral or parasitous diseases. Depending on the disease, they play the role of biological vector or intermediate host. In France, six tick borne diseases are of epidemiologic importance. Q fever (not often tick-borne), Mediterranean Spotted Fever, Lyme disease, Turalemia (human and animal), Babesiosis and Tick-borne Viral Encephalitis.

  16. Proteomic analyses of host and pathogen responses during bovine mastitis.

    Science.gov (United States)

    Boehmer, Jamie L

    2011-12-01

    The pursuit of biomarkers for use as clinical screening tools, measures for early detection, disease monitoring, and as a means for assessing therapeutic responses has steadily evolved in human and veterinary medicine over the past two decades. Concurrently, advances in mass spectrometry have markedly expanded proteomic capabilities for biomarker discovery. While initial mass spectrometric biomarker discovery endeavors focused primarily on the detection of modulated proteins in human tissues and fluids, recent efforts have shifted to include proteomic analyses of biological samples from food animal species. Mastitis continues to garner attention in veterinary research due mainly to affiliated financial losses and food safety concerns over antimicrobial use, but also because there are only a limited number of efficacious mastitis treatment options. Accordingly, comparative proteomic analyses of bovine milk have emerged in recent years. Efforts to prevent agricultural-related food-borne illness have likewise fueled an interest in the proteomic evaluation of several prominent strains of bacteria, including common mastitis pathogens. The interest in establishing biomarkers of the host and pathogen responses during bovine mastitis stems largely from the need to better characterize mechanisms of the disease, to identify reliable biomarkers for use as measures of early detection and drug efficacy, and to uncover potentially novel targets for the development of alternative therapeutics. The following review focuses primarily on comparative proteomic analyses conducted on healthy versus mastitic bovine milk. However, a comparison of the host defense proteome of human and bovine milk and the proteomic analysis of common veterinary pathogens are likewise introduced.

  17. Applications of nanotechnology in food packaging and food safety: barrier materials, antimicrobials and sensors.

    Science.gov (United States)

    Duncan, Timothy V

    2011-11-01

    In this article, several applications of nanomaterials in food packaging and food safety are reviewed, including: polymer/clay nanocomposites as high barrier packaging materials, silver nanoparticles as potent antimicrobial agents, and nanosensors and nanomaterial-based assays for the detection of food-relevant analytes (gasses, small organic molecules and food-borne pathogens). In addition to covering the technical aspects of these topics, the current commercial status and understanding of health implications of these technologies are also discussed. These applications were chosen because they do not involve direct addition of nanoparticles to consumed foods, and thus are more likely to be marketed to the public in the short term. Published by Elsevier Inc.

  18. Rapid Detection of Salmonella enterica in Food Using a Compact Disc-Shaped Device

    Directory of Open Access Journals (Sweden)

    Shunsuke Furutani

    2016-01-01

    Full Text Available Rapid detection of food-borne pathogens is essential to public health and the food industry. Although the conventional culture method is highly sensitive, it takes at least a few days to detect food-borne pathogens. Even though polymerase chain reaction (PCR can detect food-borne pathogens in a few hours, it is more expensive and unsatisfactorily sensitive relative to the culture method. We have developed a method to rapidly detect Salmonella enterica by using a compact disc (CD-shaped device that can reduce reagent consumption in conventional PCR. The detection method, which combines culture and PCR, is more rapid than the conventional culture method and is more sensitive and cheaper than PCR. In this study, we also examined a sample preparation method that involved collecting bacterial cells from food. The bacteria collected from chicken meat spiked with S. enterica were mixed with PCR reagents, and PCR was performed on the device. At a low concentration of S. enterica, the collected S. enterica was cultured before PCR for sensitive detection. After cultivation for 4 h, S. enterica at 1.7 × 104 colony-forming units (CFUs·g−1 was detected within 8 h, which included the time needed for sample preparation and detection. Furthermore, the detection of 30 CFUs·g−1 of S. enterica was possible within 12 h including 8 h for cultivation.

  19. Wildlife reservoirs for vector-borne canine, feline and zoonotic infections in Austria

    Science.gov (United States)

    Duscher, Georg G.; Leschnik, Michael; Fuehrer, Hans-Peter; Joachim, Anja

    2014-01-01

    Austria's mammalian wildlife comprises a large variety of species, acting and interacting in different ways as reservoir and intermediate and definitive hosts for different pathogens that can be transmitted to pets and/or humans. Foxes and other wild canids are responsible for maintaining zoonotic agents, e.g. Echinococcus multilocularis, as well as pet-relevant pathogens, e.g. Hepatozoon canis. Together with the canids, and less commonly felids, rodents play a major role as intermediate and paratenic hosts. They carry viruses such as tick-borne encephalitis virus (TBEV), bacteria including Borrelia spp., protozoa such as Toxoplasma gondii, and helminths such as Toxocara canis. The role of wild ungulates, especially ruminants, as reservoirs for zoonotic disease on the other hand seems to be negligible, although the deer filaroid Onchocerca jakutensis has been described to infect humans. Deer may also harbour certain Anaplasma phagocytophilum strains with so far unclear potential to infect humans. The major role of deer as reservoirs is for ticks, mainly adults, thus maintaining the life cycle of these vectors and their distribution. Wild boar seem to be an exception among the ungulates as, in their interaction with the fox, they can introduce food-borne zoonotic agents such as Trichinella britovi and Alaria alata into the human food chain. PMID:25830102

  20. Is there poison in any food

    Energy Technology Data Exchange (ETDEWEB)

    Diehl, J.F.

    1983-04-29

    With increasing frequency the public is exposed to reports in the mass media and to book publications which claim that today's food supply is not nutritious, worse yet, that the consumer is being poisoned. Some sections of the industry try to take advantage of this situation by labeling their products as natural, organic, biologic, or free of additives. While many forces combine to dramatize some real and numerous imagined problems, indicators of public health show improvement (e.g. increasing life expectancy or no change (e.g. cancer incidence). In contrast to widely held opinions, levels of heavy metal residues in food are constant or declining. Residues of chlorinated hydrocarbons have declined substantially. Again in contrast to public opinion, the consumer can be assured of the safety of food additives. The real nutrition-related health risks are due to overeating, abuse of alcohol, food-borne pathogenic microorganism and natural toxicants.

  1. Pathogenic agents in freshwater resources

    Science.gov (United States)

    Geldreich, Edwin E.

    1996-02-01

    Numerous pathogenic agents have been found in freshwaters used as sources for water supplies, recreational bathing and irrigation. These agents include bacterial pathogens, enteric viruses, several protozoans and parasitic worms more common to tropical waters. Although infected humans are a major source of pathogens, farm animals (cattle, sheep, pigs), animal pets (dogs, cats) and wildlife serve as significant reservoirs and should not be ignored. The range of infected individuals within a given warm-blooded animal group (humans included) may range from 1 to 25%. Survival times for pathogens in the water environment may range from a few days to as much as a year (Ascaris, Taenia eggs), with infective dose levels varying from one viable cell for several primary pathogenic agents to many thousands of cells for a given opportunistic pathogen.As pathogen detection in water is complex and not readily incorporated into routine monitoring, a surrogate is necessary. In general, indicators of faecal contamination provide a positive correlation with intestinal pathogen occurrences only when appropriate sample volumes are examined by sensitive methodology.Pathways by which pathogens reach susceptible water users include ingestion of contaminated water, body contact with polluted recreational waters and consumption of salad crops irrigated by polluted freshwaters. Major contributors to the spread of various water-borne pathogens are sewage, polluted surface waters and stormwater runoff. All of these contributions are intensified during periods of major floods. Several water-borne case histories are cited as examples of breakdowns in public health protection related to water supply, recreational waters and the consumption of contaminated salad crops. In the long term, water resource management must focus on pollution prevention from point sources of waste discharges and the spread of pathogens in watershed stormwater runoff.

  2. THE OCCURRENCE, GROWTH AND CONTROL OF PATHOGENS ...

    African Journals Online (AJOL)

    Fermented foods have many advantageous attributes such as improved nutritional value and safety against bacterial pathogens. These foods are also important for weaning purposes and hence play a role in protecting infants against foodborne diseases. However, pathogens have been isolated from some fermented foods ...

  3. Food irradiation technology

    International Nuclear Information System (INIS)

    Cetinkaya, N.

    1999-01-01

    Trade in food and agricultural products is important to all countries, the economies of many developing countries would be significantly improved if they were able to export more food and agricultural products. Unfortunately, many products can not be traded because they are infested with, or hosts to, harmful pests, contaminated with microorganisms, or spoil quickly. Foods contaminated with microorganisms cause economic losses, widespread illness and death. Several technologies and products have been developed to resolve problems in trading food and to improve food safety, but none can provide all the solutions. Irradiation is an effective technology to resolve technical problems in trade of many food and agricultural products, either as a stand- alone technology or in combination with others. As a disinfestation treatment it allows different levels of quarantine security to be targeted and it is one of few methods to control internal pests. The ability of irradiation virtually to eliminate key pathogenic organisms from meat, poultry, and spices is an important public health advantage. In addition to controlling pests and eliminating harmful bacteria, irradiation also extends the storage life of many foods. In the laboratories of Turkish Atomic Energy Authority, many research projects were completed on the effects of gamma irradiation to the storage life of chicken meat, anchovy, Turkish fermented sausage, dried and fresh fruits and vegetables and also research projects were conducted on the effects of gamma irradiation on microorganisms (Salmonella, Campylo-bacteria, E.coli and S.aureus in white and red meat) and parasites (food-borne, trichostrongylus spp. and Nematodes spp.)

  4. EFSA and ECDC (European Food Safety Authority and European Centre for Disease Prevention and Control), 2015. The European Union Summary Report on Trends and Sources of Zoonoses, Zoonotic Agents and Food-borne Outbreaks in 2013

    DEFF Research Database (Denmark)

    Helwigh, Birgitte

    This report of the European Food Safety Authority and the European Centre for Disease Prevention and Control presents the results of the zoonoses monitoring activities carried out in 2013 in 32 European countries (28 Member States and four non-Member States). Campylobacter iosis was the most comm...... chain of tuberculosis due to Mycobacterium bovis, Brucella, Trichinella, Echinococcus, Toxoplasma , rabies, Coxiella burnetii (Q fever), West Nile Virus and tularaemia....

  5. Public health aspects of food irradiation

    International Nuclear Information System (INIS)

    Kaferstein, F.

    1997-01-01

    Post-harvest losses due to sprouting, insect infestation and spoilage by microorganisms is a serious problem in many countries and commonly aggravates the problem of food shortages. In addition, many developing countries also depend largely on agricultural produce, such as grain, tuber and tropical fruit, as major export crops to earn foreign exchange. The use of ionizing radiation as an effective means of disinfecting and/or prolonging the self-life of several food products has been well documented in a number of developing countries. The World health organization (WHO) encourages its Member States to consider all measures to eliminate or reduce food borne pathogens in food and improve their supplies of safe and nutritious food. In regard to its contribution to food safety, food irradiation may be one of the most significant contributions to public health to be made by food science and technology since the introduction of pasteurization. Because the promotion of a safe, nutritious and adequate food supply is an essential component of its primary health care strategy, WHO is concerned that the unwarranted rejection or limitation of this process may endanger public health and deprive consumers of the choice of foods processed for safety. (Author)

  6. Public health aspects of food irradiation

    Energy Technology Data Exchange (ETDEWEB)

    Kaferstein, F [Director, Programme of Food Safety and Food Aid, WHO, CH-1211, Geneva 27, (Switzerland)

    1998-12-31

    Post-harvest losses due to sprouting, insect infestation and spoilage by microorganisms is a serious problem in many countries and commonly aggravates the problem of food shortages. In addition, many developing countries also depend largely on agricultural produce, such as grain, tuber and tropical fruit, as major export crops to earn foreign exchange. The use of ionizing radiation as an effective means of disinfecting and/or prolonging the self-life of several food products has been well documented in a number of developing countries. The World health organization (WHO) encourages its Member States to consider all measures to eliminate or reduce food borne pathogens in food and improve their supplies of safe and nutritious food. In regard to its contribution to food safety, food irradiation may be one of the most significant contributions to public health to be made by food science and technology since the introduction of pasteurization. Because the promotion of a safe, nutritious and adequate food supply is an essential component of its primary health care strategy, WHO is concerned that the unwarranted rejection or limitation of this process may endanger public health and deprive consumers of the choice of foods processed for safety. (Author)

  7. Public health aspects of food irradiation

    Energy Technology Data Exchange (ETDEWEB)

    Kaferstein, F. [Director, Programme of Food Safety and Food Aid, WHO, CH-1211, Geneva 27, (Switzerland)

    1997-12-31

    Post-harvest losses due to sprouting, insect infestation and spoilage by microorganisms is a serious problem in many countries and commonly aggravates the problem of food shortages. In addition, many developing countries also depend largely on agricultural produce, such as grain, tuber and tropical fruit, as major export crops to earn foreign exchange. The use of ionizing radiation as an effective means of disinfecting and/or prolonging the self-life of several food products has been well documented in a number of developing countries. The World health organization (WHO) encourages its Member States to consider all measures to eliminate or reduce food borne pathogens in food and improve their supplies of safe and nutritious food. In regard to its contribution to food safety, food irradiation may be one of the most significant contributions to public health to be made by food science and technology since the introduction of pasteurization. Because the promotion of a safe, nutritious and adequate food supply is an essential component of its primary health care strategy, WHO is concerned that the unwarranted rejection or limitation of this process may endanger public health and deprive consumers of the choice of foods processed for safety. (Author)

  8. Biocontrol interventions for inactivation of foodborne pathogens on produce

    Science.gov (United States)

    Post-harvest interventions for control of foodborne pathogens on minimally processed foods are crucial for food safety. Biocontrol interventions have the primary objective of developing novel antagonists in combinations with physical and chemical interventions to inactivate pathogenic microbes. Ther...

  9. Potential impact of climate change on emerging vector-borne and other infections in the UK.

    Science.gov (United States)

    Baylis, Matthew

    2017-12-05

    Climate is one of several causes of disease emergence. Although half or more of infectious diseases are affected by climate it appears to be a relatively infrequent cause of human disease emergence. Climate mostly affects diseases caused by pathogens that spend part of their lifecycle outside of the host, exposed to the environment. The most important routes of transmission of climate sensitive diseases are by arthropod (insect and tick) vectors, in water and in food. Given the sensitivity of many diseases to climate, it is very likely that at least some will respond to future climate change. In the case of vector-borne diseases this response will include spread to new areas. Several vector-borne diseases have emerged in Europe in recent years; these include vivax malaria, West Nile fever, dengue fever, Chikungunya fever, leishmaniasis, Lyme disease and tick-borne encephalitis. The vectors of these diseases are mosquitoes, sand flies and ticks. The UK has endemic mosquito species capable of transmitting malaria and probably other pathogens, and ticks that transmit Lyme disease. The UK is also threatened by invasive mosquito species known to be able to transmit West Nile, dengue, chikungunya and Zika, and sand flies that spread leishmaniasis. Warmer temperatures in the future will increase the suitability of the UK's climate for these invasive species, and increase the risk that they may spread disease. While much attention is on invasive species, it is important to recognize the threat presented by native species too. Proposed actions to reduce the future impact of emerging vector-borne diseases in the UK include insect control activity at points of entry of vehicles and certain goods, wider surveillance for mosquitoes and sand flies, research into the threat posed by native species, increased awareness of the medical profession of the threat posed by specific diseases, regular risk assessments, and increased preparedness for the occurrence of a disease emergency.

  10. Processes for managing pathogens.

    Science.gov (United States)

    Godfree, Alan; Farrell, Joseph

    2005-01-01

    Wastewater contains human, animal, and plant pathogens capable of causing viral, bacterial, or parasitic infections. There are several routes whereby sewage pathogens may affect human health, including direct contact, contamination of food crops, zoonoses, and vectors. The range and numbers of pathogens in municipal wastewater vary with the level of endemic disease in the community, discharges from commercial activities, and seasonal factors. Regulations to control pathogen risk in the United States and Europe arising from land application of biosolids are based on the concept of multiple barriers to the prevention of transmission. The barriers are (i) treatment to reduce pathogen content and vector attraction, (ii) restrictions on crops grown on land to which biosolids have been applied, and (iii) minimum intervals following application and grazing or harvesting. Wastewater treatment reduces number of pathogens in the wastewater by concentrating them with the solids in the sludge. Although some treatment processes are designed specifically to inactivate pathogens, many are not, and the actual mechanisms of microbial inactivation are not fully understood for all processes. Vector attraction is reduced by stabilization (reduction of readily biodegradable material) and/or incorporation immediately following application. Concerns about health risks have renewed interest in the effects of treatment (on pathogens) and advanced treatment methods, and work performed in the United States suggests that Class A pathogen reduction can be achieved less expensively than previously thought. Effective pathogen risk management requires control to the complete chain of sludge treatment, biosolids handling and application, and post-application activities. This may be achieved by adherence to quality management systems based on hazard analysis critical control point (HACCP) principles.

  11. Irradiation of ready-to-eat foods at USDA'S Eastern Regional Reasearch Center - 2003 update

    International Nuclear Information System (INIS)

    Sommers, Christopher; Fan Xuetong; Niemira, Brendan; Rajkowski, Kathleen

    2004-01-01

    Ionizing radiation is a safe and effective method for eliminating bacterial pathogens from food products and disinfestation of fruits and vegetables. Since 1980 research has been conducted at USDA's Eastern Regional Research Center pertaining to the elimination of food-borne pathogens from meat, poultry, fruit and vegetable products. Recent work has focused on elimination of pathogens such as Escherichia coli O157:H7, Salmonella spp., and Listeria monocytogenes from ready-to-eat (RTE) food products including hot dogs, bologna, lettuce, cilantro, sprouts and seeds, and frozen vegetables. The ionizing radiation dose required to eliminate those pathogens from RTE foods has been found to be commodity, formulation and temperature dependent. The need to eliminate bacterial pathogens from RTE food products must always be balanced with the maintenance of product quality. In addition to determining the effective ionizing radiation doses required for pathogen elimination the effects of irradiation on product chemistry, nutritional value and organoleptic quality have also been determined. A review of the studies conducted at USDA's Eastern Regional Research Center in 2002 and 2003 is presented in this article

  12. Irradiation of ready-to-eat foods at USDA'S Eastern Regional Reasearch Center-2003 update

    Science.gov (United States)

    Sommers, Christopher; Fan, Xuetong; Niemira, Brendan; Rajkowski, Kathleen

    2004-09-01

    Ionizing radiation is a safe and effective method for eliminating bacterial pathogens from food products and disinfestation of fruits and vegetables. Since 1980 research has been conducted at USDA's Eastern Regional Research Center pertaining to the elimination of food-borne pathogens from meat, poultry, fruit and vegetable products. Recent work has focused on elimination of pathogens such as Escherichia coli O157:H7, Salmonella spp., and Listeria monocytogenes from ready-to-eat (RTE) food products including hot dogs, bologna, lettuce, cilantro, sprouts and seeds, and frozen vegetables. The ionizing radiation dose required to eliminate those pathogens from RTE foods has been found to be commodity, formulation and temperature dependent. The need to eliminate bacterial pathogens from RTE food products must always be balanced with the maintenance of product quality. In addition to determining the effective ionizing radiation doses required for pathogen elimination the effects of irradiation on product chemistry, nutritional value and organoleptic quality have also been determined. A review of the studies conducted at USDA's Eastern Regional Research Center in 2002 and 2003 is presented in this article.

  13. Innovative Born Globals

    DEFF Research Database (Denmark)

    Kraus, Sascha; Brem, Alexander; Muench, Miriam