Glycine and Folate Ameliorate Models of Congenital Sideroblastic Anemia.

Directory of Open Access Journals (Sweden)

J Pedro Fernández-Murray

2016-01-01

Full Text Available Sideroblastic anemias are acquired or inherited anemias that result in a decreased ability to synthesize hemoglobin in red blood cells and result in the presence of iron deposits in the mitochondria of red blood cell precursors. A common subtype of congenital sideroblastic anemia is due to autosomal recessive mutations in the SLC25A38 gene. The current treatment for SLC25A38 congenital sideroblastic anemia is chronic blood transfusion coupled with iron chelation. The function of SLC25A38 is not known. Here we report that the SLC25A38 protein, and its yeast homolog Hem25, are mitochondrial glycine transporters required for the initiation of heme synthesis. To do so, we took advantage of the fact that mitochondrial glycine has several roles beyond the synthesis of heme, including the synthesis of folate derivatives through the glycine cleavage system. The data were consistent with Hem25 not being the sole mitochondrial glycine importer, and we identify a second SLC25 family member Ymc1, as a potential secondary mitochondrial glycine importer. Based on these findings, we observed that high levels of exogenous glycine, or 5-aminolevulinic acid (5-Ala a metabolite downstream of Hem25 in heme biosynthetic pathway, were able to restore heme levels to normal in yeast cells lacking Hem25 function. While neither glycine nor 5-Ala could ameliorate SLC25A38 congenital sideroblastic anemia in a zebrafish model, we determined that the addition of folate with glycine was able to restore hemoglobin levels. This difference is likely due to the fact that yeast can synthesize folate, whereas in zebrafish folate is an essential vitamin that must be obtained exogenously. Given the tolerability of glycine and folate in humans, this study points to a potential novel treatment for SLC25A38 congenital sideroblastic anemia.

Xenopus reduced folate carrier regulates neural crest development epigenetically.

Directory of Open Access Journals (Sweden)

Jiejing Li

Full Text Available Folic acid deficiency during pregnancy causes birth neurocristopathic malformations resulting from aberrant development of neural crest cells. The Reduced folate carrier (RFC is a membrane-bound receptor for facilitating transfer of reduced folate into the cells. RFC knockout mice are embryonic lethal and develop multiple malformations, including neurocristopathies. Here we show that XRFC is specifically expressed in neural crest tissues in Xenopus embryos and knockdown of XRFC by specific morpholino results in severe neurocristopathies. Inhibition of RFC blocked the expression of a series of neural crest marker genes while overexpression of RFC or injection of 5-methyltetrahydrofolate expanded the neural crest territories. In animal cap assays, knockdown of RFC dramatically reduced the mono- and trimethyl-Histone3-K4 levels and co-injection of the lysine methyltransferase hMLL1 largely rescued the XRFC morpholino phenotype. Our data revealed that the RFC mediated folate metabolic pathway likely potentiates neural crest gene expression through epigenetic modifications.

Reduced folate carrier polymorphism determines methotrexate uptake by B cells and CD4+ T cells

DEFF Research Database (Denmark)

Baslund, B; Gregers, J; Nielsen, Claus Henrik

2008-01-01

To examine if polymorphism 80G --> A in the Reduced Folate Carrier (RFC) affects uptake of MTX in B- and CD4+ T-cells.......To examine if polymorphism 80G --> A in the Reduced Folate Carrier (RFC) affects uptake of MTX in B- and CD4+ T-cells....

Dynamics of antifolate transport via the reduced folate carrier and the membrane folate receptor in murine leukaemia cells in vitro and in vivo

NARCIS (Netherlands)

Mauritz, Robert; Peters, Godefridus; Kathmann, Ietje; Teshale, Habte; Noordhuis, Paul; Comijn, Elizabeth; Pinedo, Herbert; Jansen, Gerrit

Murine L1210 leukaemia cells expressing either the reduced folate carrier (RFC) or the membrane folate receptor (MFR) were studied in vitro and in vivo to assess the dynamics of membrane transport of two categories antifolates; folate-based inhibitors of dihydrofolate reductase (methotrexate,

A NOS3 polymorphism determines endothelial response to folate in children with type 1 diabetes or obesity.

Science.gov (United States)

Wiltshire, Esko J; Peña, Alexia S; MacKenzie, Karen; Bose-Sundernathan, Tulika; Gent, Roger; Couper, Jennifer J

2015-02-01

To determine the effect of polymorphisms in NOS3 and folate pathway enzymes on vascular function and folate status and endothelial response to folate in children with diabetes or obesity. A total of 244 subjects (age 13.8 ± 2.8 years, 125 males) were studied for NOS3 and/or folate pathway polymorphisms using polymerase chain reaction/restriction fragment length polymorphism, including at baseline: 139 with type 1 diabetes; 58 with obesity; and 47 controls. The effect of NOS3 genotype on endothelial response to folate (5 mg) was assessed in 85 subjects with diabetes and 28 obese subjects who received active treatment during intervention trials. Vascular function (flow-mediated dilatation [FMD] and glyceryl trinitrate-mediated dilatation), clinical, and biochemical measurements were assessed at baseline and 8 weeks in folate intervention studies. Folate pathway enzyme and NOS3 polymorphisms did not significantly affect baseline vascular function. The polymorphism in intron 4 of endothelial nitric oxide synthase altered endothelial response to folate significantly: in subjects with diabetes FMD improved by 6.4 ± 5% (insertion carriers) vs 2.3 ± 6.6% (deletion carriers), P = .01; in obese subjects FMD improved by 1.8 ± 5.4% (insertion carriers) and deteriorated by -3.2 ± 7.2% (deletion carriers), P = .05. More subjects carrying the insertion normalized FMD after folate supplementation (insertion 64% vs deletion 28%, χ(2) = 10.14, P = .001). A NOS3 polymorphism predicts endothelial response to folate in children with diabetes or obesity, with implications for vascular risk and folate intervention studies. Copyright © 2015 Elsevier Inc. All rights reserved.

Inhibition of SLC1A5 sensitizes colorectal cancer to cetuximab.

Science.gov (United States)

Ma, Huanrong; Wu, Zhenzhen; Peng, Jianjun; Li, Yang; Huang, Hongxiang; Liao, Yi; Zhou, Minyu; Sun, Li; Huang, Na; Shi, Min; Bin, Jianping; Liao, Yulin; Rao, Jinjun; Wang, Lin; Liao, Wangjun

2018-06-15

Cetuximab resistance is a key barrier in treating metastatic colorectal cancer (mCRC). Targeting of metabolic resources import could resensitize drug-resistant cancer cells to anticancer treatments. Here we showed that the expression of the glutamine transporter solute carrier 1 family member 5 (SLC1A5) in clinical CRC samples of patients resisted to cetuximab was significantly higher than in those of patients responded to cetuximab. Inhibition of SLC1A5 by shRNA-mediated gene silencing or pharmacological inhibitor significantly suppressed the growth of CRC. Moreover, inhibition of SLC1A5 significantly enhanced the inhibitory efficacy of cetuximab on CRC proliferation both in vitro and in vivo. Mechanistically, SLC1A5 inhibition facilitated EGFR degradation through the ubiquitin-proteasome pathway, and decreased the expression of nuclear EGFR, both of which might have contribution to the improved response to cetuximab. This study provides the metabolic molecule SLC1A5 as a potential therapeutic target to increase the efficacy of cetuximab on CRC. © 2018 UICC.

Missense mutation in exon 2 of SLC36A1 responsible for champagne dilution in horses.

Directory of Open Access Journals (Sweden)

Deborah Cook

2008-09-01

Full Text Available Champagne coat color in horses is controlled by a single, autosomal-dominant gene (CH. The phenotype produced by this gene is valued by many horse breeders, but can be difficult to distinguish from the effect produced by the Cream coat color dilution gene (CR. Three sires and their families segregating for CH were tested by genome scanning with microsatellite markers. The CH gene was mapped within a 6 cM region on horse chromosome 14 (LOD = 11.74 for theta = 0.00. Four candidate genes were identified within the region, namely SPARC [Secreted protein, acidic, cysteine-rich (osteonectin], SLC36A1 (Solute Carrier 36 family A1, SLC36A2 (Solute Carrier 36 family A2, and SLC36A3 (Solute Carrier 36 family A3. SLC36A3 was not expressed in skin tissue and therefore not considered further. The other three genes were sequenced in homozygotes for CH and homozygotes for the absence of the dilution allele (ch. SLC36A1 had a nucleotide substitution in exon 2 for horses with the champagne phenotype, which resulted in a transition from a threonine amino acid to an arginine amino acid (T63R. The association of the single nucleotide polymorphism (SNP with the champagne dilution phenotype was complete, as determined by the presence of the nucleotide variant among all 85 horses with the champagne dilution phenotype and its absence among all 97 horses without the champagne phenotype. This is the first description of a phenotype associated with the SLC36A1 gene.

The mammalian phosphate carrier SLC25A3 is a mitochondrial copper transporter required for cytochrome c oxidase biogenesis.

Science.gov (United States)

Boulet, Aren; Vest, Katherine E; Maynard, Margaret K; Gammon, Micah G; Russell, Antoinette C; Mathews, Alexander T; Cole, Shelbie E; Zhu, Xinyu; Phillips, Casey B; Kwong, Jennifer Q; Dodani, Sheel C; Leary, Scot C; Cobine, Paul A

2018-02-09

Copper is required for the activity of cytochrome c oxidase (COX), the terminal electron-accepting complex of the mitochondrial respiratory chain. The likely source of copper used for COX biogenesis is a labile pool found in the mitochondrial matrix. In mammals, the proteins that transport copper across the inner mitochondrial membrane remain unknown. We previously reported that the mitochondrial carrier family protein Pic2 in budding yeast is a copper importer. The closest Pic2 ortholog in mammalian cells is the mitochondrial phosphate carrier SLC25A3. Here, to investigate whether SLC25A3 also transports copper, we manipulated its expression in several murine and human cell lines. SLC25A3 knockdown or deletion consistently resulted in an isolated COX deficiency in these cells, and copper addition to the culture medium suppressed these biochemical defects. Consistent with a conserved role for SLC25A3 in copper transport, its heterologous expression in yeast complemented copper-specific defects observed upon deletion of PIC2 Additionally, assays in Lactococcus lactis and in reconstituted liposomes directly demonstrated that SLC25A3 functions as a copper transporter. Taken together, these data indicate that SLC25A3 can transport copper both in vitro and in vivo . © 2018 by The American Society for Biochemistry and Molecular Biology, Inc.

Growing Mouse Oocytes Transiently Activate Folate Transport via Folate Receptors As They Approach Full Size1

OpenAIRE

Meredith, Megan; MacNeil, Allison H.; Trasler, Jacquetta M.; Baltz, Jay M.

2016-01-01

The folate cycle is central to cellular one-carbon metabolism, where folates are carriers of one-carbon units that are critical for synthesis of purines, thymidylate, and S-adenosylmethionine, the universal methyl donor that forms the cellular methyl pool. Although folates are well-known to be important for early embryo and fetal development, their role in oogenesis has not been clearly established. Here, folate transport proteins were detected in developing neonatal ovaries and growing oocyt...

Folate deprivation induces cell cycle arrest at G0/G1 phase and apoptosis in hippocampal neuron cells through down-regulation of IGF-1 signaling pathway.

Science.gov (United States)

Yang, Yang; Li, Xi; Sun, Qinwei; He, Bin; Jia, Yimin; Cai, Demin; Zhao, Ruqian

2016-10-01

Folate deficiency contributes to impaired adult hippocampal neurogenesis, yet the mechanisms remain unclear. Here we use HT-22 hippocampal neuron cells as model to investigate the effect of folate deprivation (FD) on cell proliferation and apoptosis, and to elucidate the underlying mechanism. FD caused cell cycle arrest at G0/G1 phase and increased the rate of apoptosis, which was associated with disrupted expression of folate transport and methyl transfer genes. FOLR1 and SLC46A1 were (Pmethyl transfer pathway and hypermethylation of IGF-1 gene promoter. Copyright © 2016 Elsevier Ltd. All rights reserved.

Genetic and epigenetic alterations of the reduced folate carrier in untreated diffuse large B-cell lymphoma

DEFF Research Database (Denmark)

Kastrup, I.B.; Worm, J.; Ralfkiaer, E.

2008-01-01

The reduced folate carrier (RFC) is a transmembrane protein that mediates cellular uptake of reduced folates and antifolate drugs, including methotrexate (MTX). Acquired alterations of the RFC gene have been associated with resistance to MTX in cancer cell lines and primary osteosarcomas. Here, w...... with adverse outcome. In DLBCL, genetic and epigenetic alterations of RFC were detected at diagnosis in the absence of a selective MTX pressure, suggesting that these alterations may possibly contribute to the development of lymphoma Udgivelsesdato: 2008/1...

Genetic and epigenetic alterations of the reduced folate carrier in untreated diffuse large B-cell lymphoma

DEFF Research Database (Denmark)

Kastrup, Ingelise Bjerring; Worm, Jesper; Ralfkiaer, Elisabeth

2007-01-01

The reduced folate carrier (RFC) is a transmembrane protein that mediates cellular uptake of reduced folates and antifolate drugs, including methotrexate (MTX). Acquired alterations of the RFC gene have been associated with resistance to MTX in cancer cell lines and primary osteosarcomas. Here, we...

Brain calcification process and phenotypes according to age and sex: Lessons from SLC20A2, PDGFB, and PDGFRB mutation carriers.

Science.gov (United States)

Nicolas, Gaël; Charbonnier, Camille; de Lemos, Roberta Rodrigues; Richard, Anne-Claire; Guillin, Olivier; Wallon, David; Legati, Andrea; Geschwind, Daniel; Coppola, Giovanni; Frebourg, Thierry; Campion, Dominique; de Oliveira, João Ricardo Mendes; Hannequin, Didier

2015-10-01

Primary Familial Brain Calcification (PFBC) is a dominantly inherited cerebral microvascular calcifying disorder with diverse neuropsychiatric expression. Three causative genes have been identified: SLC20A2, PDGFRB and, recently, PDGFB, whose associated phenotype has not yet been extensively studied. We included in the largest published case series of genetically confirmed PFBC, 19 PDGFB (including three new mutations), 24 SLC20A2 (including 4 new mutations), and 14 PDGFRB mutation carriers, from two countries (France and Brazil). We studied clinical features and applied our visual rating scale on all 49 available CT scans. Among the symptomatic mutation carriers (33/57, 58%), the three most frequently observed categories of clinical features were psychiatric signs (72.7%, 76.5%, and 80% for PDGFB, SLC20A2, and PDGFRB, respectively), movement disorders (45.5%, 76.5%, and 40%), and cognitive impairment (54.6%, 64.7%, and 40%). The median age of clinical onset was 31 years, 25% had an early onset (before 18) and 25% a later onset (after 53). Patients with an early clinical onset exhibited mostly isolated psychiatric or cognitive signs, while patients with a later onset exhibited mostly movement disorders, especially in association with other clinical features. CT scans rating allowed identifying four patterns of calcification. The total calcification score was best predicted by the combined effects of gene (SLC20A2 > PDGFB > PDGFRB mutations), sex (male), and (increasing) age, defining three risk classes, which correlated with the four patterns of calcification. These calcification patterns could reflect the natural history of the calcifying process, with distinct risk classes characterized by different age at onset or rate of progression. © 2015 Wiley Periodicals, Inc.

Blood as a surrogate marker for tissue-specific DNA methylation and changes due to folate depletion in post-partum female mice.

Science.gov (United States)

McKay, Jill A; Xie, Long; Harris, Sarah; Wong, Yi K; Ford, Dianne; Mathers, John C

2011-07-01

DNA methylation patterns are tissue specific and may influence tissue-specific gene regulation. Human studies investigating DNA methylation in relation to environmental factors primarily use blood-derived DNA as a surrogate for DNA from target tissues. It is therefore important to know if DNA methylation changes in blood in response to environmental changes reflect those in target tissues. Folate intake can influence DNA methylation, via altered methyl donor supply. Previously, manipulations of maternal folate intake during pregnancy altered the patterns of DNA methylation in offspring but, to our knowledge, the consequences for maternal DNA methylation are unknown. Given the increased requirement for folate during pregnancy, mothers may be susceptible to aberrant DNA methylation due to folate depletion. Female mice were fed folate-adequate (2 mg folic acid/kg diet) or folate-deplete (0.4 mg folic acid/kg diet) diets prior to mating and during pregnancy and lactation. Following weaning, dams were killed and DNA methylation was assessed by pyrosequencing® in blood, liver, and kidney at the Esr1, Igf2 differentially methylated region (DMR)1, Igf2 DMR2, Slc39a4CGI1, and Slc39a4CGI2 loci. We observed tissue-specific differences in methylation at all loci. Folate depletion reduced Igf2 DMR1 and Slc39a4CGI1 methylation across all tissues and altered Igf2 DMR2 methylation in a tissue-specific manner (pmethylation measurements may not always reflect methylation within other tissues. Further measurements of blood-derived and tissue-specific methylation patterns are warranted to understand the complexity of tissue-specific responses to altered nutritional exposure. Copyright © 2011 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Application of Various Statistical Models to Explore Gene-Gene Interactions in Folate, Xenobiotic, Toll-Like Receptor and STAT4 Pathways that Modulate Susceptibility to Systemic Lupus Erythematosus.

Science.gov (United States)

Rupasree, Yedluri; Naushad, Shaik Mohammad; Varshaa, Ravi; Mahalakshmi, Govindaraj Swathika; Kumaraswami, Konda; Rajasekhar, Liza; Kutala, Vijay Kumar

2016-02-01

In view of our previous studies showing an independent association of genetic polymorphisms in folate, xenobiotic, and toll-like receptor (TLR) pathways with the risk for systemic lupus erythematosus (SLE), we have developed three statistical models to delineate complex gene-gene interactions between folate, xenobiotic, TLR, and signal transducer and activator of transcription 4 (STAT4) signaling pathways in association with the molecular pathophysiology of SLE. We developed additive, multifactor dimensionality reduction (MDR), and artificial neural network (ANN) models. The additive model, although the simplest, suggested a moderate predictability of 30 polymorphisms of these four pathways (area under the curve [AUC] 0.66). MDR analysis revealed significant gene-gene interactions among glutathione-S-transferase (GST)T1 and STAT4 (rs3821236 and rs7574865) polymorphisms, which account for moderate predictability of SLE. The MDR model for specific auto-antibodies revealed the importance of gene-gene interactions among cytochrome P450, family1, subfamily A, polypeptide 1 (CYP1A1) m1, catechol-O-methyltransferase (COMT) H108L, solute carrier family 19 (folate transporter), member 1 (SLC19A1) G80A, estrogen receptor 1 (ESR1), TLR5, 5-methyltetrahydrofolate-homocysteine methyltransferase reductase (MTRR), thymidylate synthase (TYMS). and STAT4 polymorphisms. The ANN model for disease prediction showed reasonably good predictability of SLE risk with 30 polymorphisms (AUC 0.76). These polymorphisms contribute towards the production of SSB and anti-dsDNA antibodies to the extent of 48 and 40%, respectively, while their contribution for the production of antiRNP, SSA, and anti-cardiolipin antibodies varies between 20 and 30%. The current study highlighted the importance of genetic polymorphisms in folate, xenobiotic, TLR, and STAT4 signaling pathways as moderate predictors of SLE risk and delineates the molecular pathophysiology associated with these single nucleotide

Metformin Is a Substrate and Inhibitor of the Human Thiamine Transporter, THTR-2 (SLC19A3).

Science.gov (United States)

Liang, Xiaomin; Chien, Huan-Chieh; Yee, Sook Wah; Giacomini, Marilyn M; Chen, Eugene C; Piao, Meiling; Hao, Jia; Twelves, Jolyn; Lepist, Eve-Irene; Ray, Adrian S; Giacomini, Kathleen M

2015-12-07

The biguanide metformin is widely used as first-line therapy for the treatment of type 2 diabetes. Predominately a cation at physiological pH's, metformin is transported by membrane transporters, which play major roles in its absorption and disposition. Recently, our laboratory demonstrated that organic cation transporter 1, OCT1, the major hepatic uptake transporter for metformin, was also the primary hepatic uptake transporter for thiamine, vitamin B1. In this study, we tested the reverse, i.e., that metformin is a substrate of thiamine transporters (THTR-1, SLC19A2, and THTR-2, SLC19A3). Our study demonstrated that human THTR-2 (hTHTR-2), SLC19A3, which is highly expressed in the small intestine, but not hTHTR-1, transports metformin (Km = 1.15 ± 0.2 mM) and other cationic compounds (MPP(+) and famotidine). The uptake mechanism for hTHTR-2 was pH and electrochemical gradient sensitive. Furthermore, metformin as well as other drugs including phenformin, chloroquine, verapamil, famotidine, and amprolium inhibited hTHTR-2 mediated uptake of both thiamine and metformin. Species differences in the substrate specificity of THTR-2 between human and mouse orthologues were observed. Taken together, our data suggest that hTHTR-2 may play a role in the intestinal absorption and tissue distribution of metformin and other organic cations and that the transporter may be a target for drug-drug and drug-nutrient interactions.

Polymorphisms in folate-metabolizing enzymes and response to 5-fluorouracil among patients with stage II or III rectal cancer (INT-0144; SWOG 9304).

Science.gov (United States)

Ulrich, Cornelia M; Rankin, Cathryn; Toriola, Adetunji T; Makar, Karen W; Altug-Teber, Özge; Benedetti, Jacqueline K; Holmes, Rebecca S; Smalley, Stephen R; Blanke, Charles D; Lenz, Heinz-Josef

2014-11-01

Recurrence and toxicity occur commonly among patients with rectal cancer who are treated with 5-fluorouracil (5-FU). The authors hypothesized that genetic variation in folate-metabolizing genes could play a role in interindividual variability. The objective of the current study was to evaluate the associations between genetic variants in folate-metabolizing genes and clinical outcomes among patients with rectal cancer treated with 5-FU. The authors investigated 8 functionally significant polymorphisms in 6 genes (methylenetetrahydrofolate reductase [MTHFR] [C677T, A1298C], SLC19A1 [G80A], SHMT1 [C1420T], dihydrofolate reductase [DHFR] [Del19bp], TS 1494del,and TSER) involved in folate metabolism in 745 patients with TNM stage II or III rectal cancer enrolled in a phase 3 adjuvant clinical trial of 3 regimens of 5-FU and radiotherapy (INT-0144 and SWOG 9304). There were no statistically significant associations noted between polymorphisms in any of the genes and overall survival, disease-free survival (DFS), and toxicity in the overall analyses. Nevertheless, there was a trend toward worse DFS among patients with the variant allele of MTHFR C677T compared with wild-type, particularly in treatment arm 2, in which patients with the MTHFR C677T TT genotype had worse overall survival (hazards ratio, 1.76; 95% confidence interval, 1.06-2.93 [P = .03]) and DFS (hazards ratio, 1.84; 95% confidence interval, 1.12-3.03 [P = .02]) compared with those with homozygous wild-type. In addition, there was a trend toward reduced hematological toxicity among patients with variants of SLC19A1 G80A in treatment arm 1 (P for trend, .06) and reduced esophagitis/stomatitis noted among patients with variants of TSER in treatment arm 3 (P for trend, .06). Genetic variability in folate-metabolizing enzymes was found to be associated only to a limited degree with clinical outcomes among patients with rectal cancer treated with 5-FU. © 2014 American Cancer Society.

Deletion of Slc26a1 and Slc26a7 Delays Enamel Mineralization in Mice

Directory of Open Access Journals (Sweden)

Kaifeng Yin

2017-05-01

Full Text Available Amelogenesis features two major developmental stages—secretory and maturation. During maturation stage, hydroxyapatite deposition and matrix turnover require delicate pH regulatory mechanisms mediated by multiple ion transporters. Several members of the Slc26 gene family (Slc26a1, Slc26a3, Slc26a4, Slc26a6, and Slc26a7, which exhibit bicarbonate transport activities, have been suggested by previous studies to be involved in maturation-stage amelogenesis, especially the key process of pH regulation. However, details regarding the functional role of these genes in enamel formation are yet to be clarified, as none of the separate mutant animal lines demonstrates any discernible enamel defects. Continuing with our previous investigation of Slc26a1−/− and Slc26a7−/− animal models, we generated a double-mutant animal line with the absence of both Slc26a1 and Slc26a7. We showed in the present study that the double-mutant enamel density was significantly lower in the regions that represent late maturation-, maturation- and secretory-stage enamel development in wild-type mandibular incisors. However, the “maturation” and “secretory” enamel microstructures in double-mutant animals resembled those observed in wild-type secretory and/or pre-secretory stages. Elemental composition analysis revealed a lack of mineral deposition and an accumulation of carbon and chloride in double-mutant enamel. Deletion of Slc26a1 and Slc26a7 did not affect the stage-specific morphology of the enamel organ. Finally, compensatory expression of pH regulator genes and ion transporters was detected in maturation-stage enamel organs of double-mutant animals when compared to wild-type. Combined with the findings from our previous study, these data indicate the involvement of SLC26A1and SLC26A7 as key ion transporters in the pH regulatory network during enamel maturation.

ASCT2 (SLC1A5-Deficient Mice Have Normal B-Cell Development, Proliferation, and Antibody Production

Directory of Open Access Journals (Sweden)

Etienne Masle-Farquhar

2017-05-01

Full Text Available SLC1A5 (solute carrier family 1, member 5 is a small neutral amino acid exchanger that is upregulated in rapidly proliferating lymphocytes but also in many primary human cancers. Furthermore, cancer cell lines have been shown to require SLC1A5 for their survival in vitro. One of SLC1A5’s primary substrates is the immunomodulatory amino acid glutamine, which plays an important role in multiple key processes, such as energy supply, macromolecular synthesis, nucleotide biosynthesis, redox homeostasis, and resistance against oxidative stress. These processes are also essential to immune cells, including neutrophils, macrophages, B and T lymphocytes. We show here that mice with a stop codon in Slc1a5 have reduced glutamine uptake in activated lymphocytes and primary fibroblasts. B and T cell populations and maturation in resting mice were not affected by absence of SLC1A5. Antibody production in resting and immunized mice and the germinal center response to immunization were also found to be normal. SLC1A5 has been recently described as a novel target for the treatment of a variety of cancers, and our results indicate that inhibition of SLC1A5 in cancer therapy may be tolerated well by the immune system of cancer patients.

Developmental expression of solute carrier family 26A member 4 (SLC26A4/pendrin) during amelogenesis in developing rodent teeth.

Science.gov (United States)

Bronckers, Antonius L J J; Guo, Jing; Zandieh-Doulabi, Behrouz; Bervoets, Theodore J; Lyaruu, Donacian M; Li, Xiangming; Wangemann, Philine; DenBesten, Pamela

2011-12-01

Ameloblasts need to regulate pH during the formation of enamel crystals, a process that generates protons. Solute carrier family 26A member 4 (SLC26A4, or pendrin) is an anion exchanger for chloride, bicarbonate, iodine, and formate. It is expressed in apical membranes of ion-transporting epithelia in kidney, inner ear, and thyroid where it regulates luminal pH and fluid transport. We hypothesized that maturation ameloblasts express SLC26A4 to neutralize acidification of enamel fluid in forming enamel. In rodents, secretory and maturation ameloblasts were immunopositive for SLC26A4. Staining was particularly strong in apical membranes of maturation ameloblasts facing forming enamel. RT-PCR confirmed the presence of mRNA transcripts for Slc26a4 in enamel organs. SLC26A4 immunostaining was also found in mineralizing connective tissues, including odontoblasts, osteoblasts, osteocytes, osteoclasts, bone lining cells, cellular cementoblasts, and cementocytes. However, Slc26a4-null mutant mice had no overt dental phenotype. The presence of SLC26A4 in apical plasma membranes of maturation ameloblasts is consistent with a potential function as a pH regulator. SLC26A4 does not appear to be critical for ameloblast function and is probably compensated by other pH regulators. © 2011 Eur J Oral Sci.

PCFT/SLC46A1 promoter methylation and restoration of gene expression in human leukemia cells

International Nuclear Information System (INIS)

Gonen, Nitzan; Bram, Eran E.; Assaraf, Yehuda G.

2008-01-01

The proton-coupled folate transporter (PCFT/SLC46A1) displays optimal and prominent folate and antifolate transport activity at acidic pH in human carcinoma cells but poor activity in leukemia cells. Consistently herein, human leukemia cell lines expressed poor PCFT transcript levels, whereas various carcinoma cell lines showed substantial PCFT gene expression. We identified a CpG island with high density at nucleotides -200 through +100 and explored its role in PCFT promoter silencing. Leukemia cells with barely detectable PCFT transcripts consistently harbored 85-100% methylation of this CpG island, whereas no methylation was found in carcinoma cells. Treatment with 5-Aza-2'-deoxycytidine which induced demethylation but not with the histone deacetylase inhibitor trichostatin A, restored 50-fold PCFT expression only in leukemia cells. These findings constitute the first demonstration of the dominant epigenetic silencing of the PCFT gene in leukemia cells. The potential translational implications of the restoration of PCFT expression in chemotherapy of leukemia are discussed

Inhibition of the Mitochondrial Glutamate Carrier SLC25A22 in Astrocytes Leads to Intracellular Glutamate Accumulation

Directory of Open Access Journals (Sweden)

Emmanuelle Goubert

2017-05-01

Full Text Available The solute carrier family 25 (SLC25 drives the import of a large diversity of metabolites into mitochondria, a key cellular structure involved in many metabolic functions. Mutations of the mitochondrial glutamate carrier SLC25A22 (also named GC1 have been identified in early epileptic encephalopathy (EEE and migrating partial seizures in infancy (MPSI but the pathophysiological mechanism of GC1 deficiency is still unknown, hampered by the absence of an in vivo model. This carrier is mainly expressed in astrocytes and is the principal gate for glutamate entry into mitochondria. A sufficient supply of energy is essential for the proper function of the brain and mitochondria have a pivotal role in maintaining energy homeostasis. In this work, we wanted to study the consequences of GC1 absence in an in vitro model in order to understand if glutamate catabolism and/or mitochondrial function could be affected. First, short hairpin RNA (shRNA designed to specifically silence GC1 were validated in rat C6 glioma cells. Silencing GC1 in C6 resulted in a reduction of the GC1 mRNA combined with a decrease of the mitochondrial glutamate carrier activity. Then, primary astrocyte cultures were prepared and transfected with shRNA-GC1 or mismatch-RNA (mmRNA constructs using the Neon® Transfection System in order to target a high number of primary astrocytes, more than 64%. Silencing GC1 in primary astrocytes resulted in a reduced nicotinamide adenine dinucleotide (Phosphate (NAD(PH formation upon glutamate stimulation. We also observed that the mitochondrial respiratory chain (MRC was functional after glucose stimulation but not activated by glutamate, resulting in a lower level of cellular adenosine triphosphate (ATP in silenced astrocytes compared to control cells. Moreover, GC1 inactivation resulted in an intracellular glutamate accumulation. Our results show that mitochondrial glutamate transport via GC1 is important in sustaining glutamate homeostasis in

Expression of solute carrier 7A4 (SLC7A4) in the plasma membrane is not sufficient to mediate amino acid transport activity.

OpenAIRE

Wolf, Sabine; Janzen, Annette; Vékony, Nicole; Martiné, Ursula; Strand, Dennis; Closs, Ellen I

2002-01-01

Member 4 of human solute carrier family 7 (SLC7A4) exhibits significant sequence homology with the SLC7 subfamily of human cationic amino acid transporters (hCATs) [Sperandeo, Borsani, Incerti, Zollo, Rossi, Zuffardi, Castaldo, Taglialatela, Andria and Sebastio (1998) Genomics 49, 230-236]. It is therefore often referred to as hCAT-4 even though no convincing transport activity has been shown for this protein. We expressed SLC7A4 in Xenopus laevis oocytes, but could not detect any transport a...

Novel SLC19A3 Promoter Deletion and Allelic Silencing in Biotin-Thiamine-Responsive Basal Ganglia Encephalopathy.

Directory of Open Access Journals (Sweden)

Irene Flønes

Full Text Available Biotin-thiamine responsive basal ganglia disease is a severe, but potentially treatable disorder caused by mutations in the SLC19A3 gene. Although the disease is inherited in an autosomal recessive manner, patients with typical phenotypes carrying single heterozygous mutations have been reported. This makes the diagnosis uncertain and may delay treatment.In two siblings with early-onset encephalopathy dystonia and epilepsy, whole-exome sequencing revealed a novel single heterozygous SLC19A3 mutation (c.337T>C. Although Sanger-sequencing and copy-number analysis revealed no other aberrations, RNA-sequencing in brain tissue suggested the second allele was silenced. Whole-genome sequencing resolved the genetic defect by revealing a novel 45,049 bp deletion in the 5'-UTR region of the gene abolishing the promoter. High dose thiamine and biotin therapy was started in the surviving sibling who remains stable. In another patient two novel compound heterozygous SLC19A3 mutations were found. He improved substantially on thiamine and biotin therapy.We show that large genomic deletions occur in the regulatory region of SLC19A3 and should be considered in genetic testing. Moreover, our study highlights the power of whole-genome sequencing as a diagnostic tool for rare genetic disorders across a wide spectrum of mutations including non-coding large genomic rearrangements.

The mitochondrial citrate carrier, SLC25A1, drives stemness and therapy resistance in non-small cell lung cancer.

Science.gov (United States)

Fernandez, Harvey R; Gadre, Shreyas M; Tan, Mingjun; Graham, Garrett T; Mosaoa, Rami; Ongkeko, Martin S; Kim, Kyu Ah; Riggins, Rebecca B; Parasido, Erika; Petrini, Iacopo; Pacini, Simone; Cheema, Amrita; Varghese, Rency; Ressom, Habtom W; Zhang, Yuwen; Albanese, Christopher; Üren, Aykut; Paige, Mikell; Giaccone, Giuseppe; Avantaggiati, Maria Laura

2018-04-12

Therapy resistance represents a clinical challenge for advanced non-small cell lung cancer (NSCLC), which still remains an incurable disease. There is growing evidence that cancer-initiating or cancer stem cells (CSCs) provide a reservoir of slow-growing dormant populations of cells with tumor-initiating and unlimited self-renewal ability that are left behind by conventional therapies reigniting post-therapy relapse and metastatic dissemination. The metabolic pathways required for the expansion of CSCs are incompletely defined, but their understanding will likely open new therapeutic opportunities. We show here that lung CSCs rely upon oxidative phosphorylation for energy production and survival through the activity of the mitochondrial citrate transporter, SLC25A1. We demonstrate that SLC25A1 plays a key role in maintaining the mitochondrial pool of citrate and redox balance in CSCs, whereas its inhibition leads to reactive oxygen species build-up thereby inhibiting the self-renewal capability of CSCs. Moreover, in different patient-derived tumors, resistance to cisplatin or to epidermal growth factor receptor (EGFR) inhibitor treatment is acquired through SLC25A1-mediated implementation of mitochondrial activity and induction of a stemness phenotype. Hence, a newly identified specific SLC25A1 inhibitor is synthetic lethal with cisplatin or with EGFR inhibitor co-treatment and restores antitumor responses to these agents in vitro and in animal models. These data have potential clinical implications in that they unravel a metabolic vulnerability of drug-resistant lung CSCs, identify a novel SLC25A1 inhibitor and, lastly, provide the first line of evidence that drugs, which block SLC25A1 activity, when employed in combination with selected conventional antitumor agents, lead to a therapeutic benefit.

Organic solute carrier 22 (SLC22 family: Potential for interactions with food, herbal/dietary supplements, endogenous compounds, and drugs

Directory of Open Access Journals (Sweden)

Raymond E. Lai

2018-04-01

Full Text Available Many drugs, hormones, components of herbal medicines, environmental pesticides and toxins are Solute Carrier family 22 (SLC22 substrates. The last twenty years has seen great progress in determining SLC22 tissue expression profiles, membrane localization, energetics, substrate profiles and biopharmaceutical significance. However, much still remains to be answered in terms of SLC22 family member's roles in ‘normal’ physiology as compared to pathophysiological states, as well as in drug interactions that impact pharmacokinetics, efficacy and toxicity. This review begins with a brief synopsis of SLC22 family discovery, function and tissue expression. Subsequent sections provide examples establishing a role for SLC22 transporters in food-drug, herbal supplement-drug, endogenous substrate-drug and drug–drug interactions. Keywords: Hepatic transport, Nephrotoxicity, Organic anion transporter, Organic cation transporter, Renal transport

Association between SLC19A1 gene polymorphism and high dose methotrexate toxicity in childhood acute lymphoblastic leukaemia and non Hodgkin malignant lymphoma: introducing a haplotype based approach

Directory of Open Access Journals (Sweden)

Kotnik Barbara Faganel

2017-09-01

Full Text Available We investigated the clinical relevance of SLC 19A1 genetic variability for high dose methotrexate (HD-MTX related toxicities in children and adolescents with acute lymphoblastic leukaemia (ALL and non Hodgkin malignant lymphoma (NHML.

Cryptophane-Folate Biosensor for 129Xe NMR

Science.gov (United States)

2014-12-01

normal adult tissue, but as the name implies, this low affinity folate carrier is specific for the physiological form of reduced folic acid, 5- methyl ...yield. Finally, 3 was treated with 1.5 equiv of 6 and N- methyl -1,5,9-triazabicyclo[4.4.0]-decene (MTBD) in dry DMSO to give the folate recognition moiety...Cryptophane- Folate Biosensor for 129Xe NMR Najat S. Khan, Brittany A. Riggle, Garry K. Seward, Yubin Bai, and Ivan J. Dmochowski* Department of

A functional polymorphism in the reduced folate carrier gene and DNA hypomethylation in mothers of children with autism.

Science.gov (United States)

James, S Jill; Melnyk, Stepan; Jernigan, Stefanie; Pavliv, Oleksandra; Trusty, Timothy; Lehman, Sara; Seidel, Lisa; Gaylor, David W; Cleves, Mario A

2010-09-01

The biologic basis of autism is complex and is thought to involve multiple and variable gene-environment interactions. While the logical focus has been on the affected child, the impact of maternal genetics on intrauterine microenvironment during pivotal developmental windows could be substantial. Folate-dependent one carbon metabolism is a highly polymorphic pathway that regulates the distribution of one-carbon derivatives between DNA synthesis (proliferation) and DNA methylation (cell-specific gene expression and differentiation). These pathways are essential to support the programmed shifts between proliferation and differentiation during embryogenesis and organogenesis. Maternal genetic variants that compromise intrauterine availability of folate derivatives could alter fetal cell trajectories and disrupt normal neurodevelopment. In this investigation, the frequency of common functional polymorphisms in the folate pathway was investigated in a large population-based sample of autism case-parent triads. In case-control analysis, a significant increase in the reduced folate carrier (RFC1) G allele frequency was found among case mothers, but not among fathers or affected children. Subsequent log linear analysis of the RFC1 A80G genotype within family trios revealed that the maternal G allele was associated with a significant increase in risk of autism whereas the inherited genotype of the child was not. Further, maternal DNA from the autism mothers was found to be significantly hypomethylated relative to reference control DNA. Metabolic profiling indicated that plasma homocysteine, adenosine, and S-adenosylhomocyteine were significantly elevated among autism mothers consistent with reduced methylation capacity and DNA hypomethylation. Together, these results suggest that the maternal genetics/epigenetics may influence fetal predisposition to autism. (c) 2010 Wiley-Liss, Inc.

Neuropathological characteristics of the brain in two patients with SLC19A3 mutations related to the biotin-thiamine-responsive basal ganglia disease

Directory of Open Access Journals (Sweden)

Maciej Pronicki

2017-06-01

Full Text Available Biotin-thiamine-responsive basal ganglia disease is a severe form of a rare neurogenetic disorder caused by pathogenic molecular variants in the thiamine transporter gene. Nowadays, a potentially effective treatment is known, therefore the early diagnosis is mandatory. The aim of the paper was to assess the contribution of neuropathological and magnetic resonance imaging (MRI studies to a proper diagnosis. We present the brain study of two Polish patients with SLC19A3 mutations, including (1 an infant with an intriguing “walnut” appearance of the brain autopsied many years before the discovery of the SLC19A3 defect, and (2 a one-year-old patient with clinical features of Leigh syndrome. In patient 2, biotin/thiamine responsiveness was not tested at the time of diagnosis and causal treatment started with one-year delay. The central nervous system lesions found in the patients displayed almost clearly a specific pattern for SLC19A3 defect, as previously proposed in diagnostic criteria. Our study presents a detailed description of neuropathological and MRI findings of both patients. We confirm that the autopsy and/or MRI of the brain is sufficient to qualify a patient with an unknown neuropathological disorder directly for SLC19A3 mutations testing and a prompt trial of specific treatment.

Three cysteine residues of SLC52A1, a receptor for the porcine endogenous retrovirus-A (PERV-A), play a critical role in cell surface expression and infectivity.

Science.gov (United States)

Colon-Moran, Winston; Argaw, Takele; Wilson, Carolyn A

2017-07-01

Porcine endogenous retrovirus-A (PERV-A), a gammaretrovirus, infects human cells in vitro, thus raising the potential risk of cross-species transmission in xenotransplantation. Two members of the solute carrier family 52 (SLC52A1 and SLC52A2) are PERV-A receptors. Site-directed mutagenesis of the cDNA encoding SLC52A1 identified that only one of two putative glycosylation signals is occupied by glycans. In addition, we showed that glycosylation of SLC52A1 is not necessary for PERV-A receptor function. We also identified that at a minimum, three cysteine residues are sufficient for SLC52A1 cell surface expression. Mutation of cysteine at position 365 and either of the two cysteine residues in the C-terminal tail at positions 442 or 446 reduced SLC52A1 surface expression and PERV-A infection suggesting that these residues may contribute to overall structural stability and receptor function. Understanding interactions between PERV-A and its cellular receptor may provide novel strategies to prevent zoonotic infection in the setting of xenotransplantation. Published by Elsevier Inc.

Hypoxic Stress Upregulates the Expression of Slc38a1 in Brown Adipocytes via Hypoxia-Inducible Factor-1α.

Science.gov (United States)

Horie, Tetsuhiro; Fukasawa, Kazuya; Iezaki, Takashi; Park, Gyujin; Onishi, Yuki; Ozaki, Kakeru; Kanayama, Takashi; Hiraiwa, Manami; Kitaguchi, Yuka; Kaneda, Katsuyuki; Hinoi, Eiichi

2018-01-01

The availability of amino acid in the brown adipose tissue (BAT) has been shown to be altered under various conditions; however, little is known about the possible expression and pivotal role of amino acid transporters in BAT under physiological and pathological conditions. The present study comprehensively investigated whether amino acid transporters are regulated by obesogenic conditions in BAT in vivo. Moreover, we investigated the mechanism underlying the regulation of the expression of amino acid transporters by various stressors in brown adipocytes in vitro. The expression of solute carrier family 38 member 1 (Slc38a1; gene encoding sodium-coupled neutral amino acid transporter 1) was preferentially upregulated in the BAT of both genetic and acquired obesity mice in vivo. Moreover, the expression of Slc38a1 was induced by hypoxic stress through hypoxia-inducible factor-1α, which is a master transcription factor of the adaptive response to hypoxic stress, in brown adipocytes in vitro. These results indicate that Slc38a1 is an obesity-associated gene in BAT and a hypoxia-responsive gene in brown adipocytes. © 2017 S. Karger AG, Basel.

Mechanistic Target of Rapamycin Is a Novel Molecular Mechanism Linking Folate Availability and Cell Function.

Science.gov (United States)

Silva, Elena; Rosario, Fredrick J; Powell, Theresa L; Jansson, Thomas

2017-07-01

Folate deficiency has been linked to a wide range of disorders, including cancer, neural tube defects, and fetal growth restriction. Folate regulates cellular function mediated by its involvement in the synthesis of nucleotides, which are needed for DNA synthesis, and its function as a methyl donor, which is critical for DNA methylation. Here we review current data showing that folate sensing by mechanistic target of rapamycin (mTOR) constitutes a novel and distinct pathway by which folate modulates cell functions such as nutrient transport, protein synthesis, and mitochondrial respiration. The mTOR signaling pathway responds to growth factors and changes in nutrient availability to control cell growth, proliferation, and metabolism. mTOR exists in 2 complexes, mTOR complex (mTORC) 1 and mTORC2, which have distinct upstream regulators and downstream targets. Folate deficiency in pregnant mice caused a marked inhibition of mTORC1 and mTORC2 signaling in multiple maternal and fetal tissues, downregulation of placental amino acid transporters, and fetal growth restriction. In addition, folate deficiency in primary human trophoblast (PHT) cells resulted in inhibition of mTORC1 and mTORC2 signaling and decreased the activity of key amino acid transporters. Folate sensing by mTOR in PHT cells is independent of the accumulation of homocysteine and requires the proton-coupled folate transporter (PCFT; solute carrier 46A1). Furthermore, mTORC1 and mTORC2 regulate trophoblast folate uptake by modulating the cell surface expression of folate receptor α and the reduced folate carrier. These findings, which provide a novel link between folate availability and cell function, growth, and proliferation, may have broad biological significance given the critical role of folate in normal cell function and the multiple diseases that have been associated with decreased or excessive folate availability. Low maternal folate concentrations are linked to restricted fetal growth, and we

A genetic-demographic approach reveals a gender-specific association of SLC6A3/DAT1 40 bp-VNTR with life-expectancy.

Science.gov (United States)

Hadi, Fazal; Dato, Serena; Carpi, Francesco M; Prontera, Paolo; Crucianelli, Francesca; Renda, Federica; Passarino, Giuseppe; Napolioni, Valerio

2015-06-01

Several recent lines of evidence are proving an important role for dopamine in the aging process and in the determination of life span. Components of the dopaminergic system may represent good candidates for longevity studies. Herein, we tested the possible association of the functional SLC6A3/DAT1 40-bp VNTR with life-expectancy in a healthy population of Central Italy (N = 993) by applying a genetic-demographic approach that takes into account the demographic information and different survival rates between sexes for modeling the survival of specific allele carriers in the population. Male carriers of S*/S* genotype showed a lower survival chance across most of the lifespan respect to the survival of DAT1*L-carriers (P = 0.021). The same analyses gave non-significant results in females. Several studies already reported significant sex differences in dopamine metabolism and its related biological pathways. Thus, we can hypothesize that the SLC6A3/DAT1 40 bp-VNTR may affect life expectancy in a sex-specific way. Moreover, it is conceivable that DAT1 S*/S* carriers, who are prone to assume "risk" type behaviors, may be dropped out of the "healthy" population by a sort of "demographic selection".

SLC37A1 and SLC37A2 are phosphate-linked, glucose-6-phosphate antiporters.

Directory of Open Access Journals (Sweden)

Chi-Jiunn Pan

Full Text Available Blood glucose homeostasis between meals depends upon production of glucose within the endoplasmic reticulum (ER of the liver and kidney by hydrolysis of glucose-6-phosphate (G6P into glucose and phosphate (P(i. This reaction depends on coupling the G6P transporter (G6PT with glucose-6-phosphatase-α (G6Pase-α. Only one G6PT, also known as SLC37A4, has been characterized, and it acts as a P(i-linked G6P antiporter. The other three SLC37 family members, predicted to be sugar-phosphate:P(i exchangers, have not been characterized functionally. Using reconstituted proteoliposomes, we examine the antiporter activity of the other SLC37 members along with their ability to couple with G6Pase-α. G6PT- and mock-proteoliposomes are used as positive and negative controls, respectively. We show that SLC37A1 and SLC37A2 are ER-associated, P(i-linked antiporters, that can transport G6P. Unlike G6PT, neither is sensitive to chlorogenic acid, a competitive inhibitor of physiological ER G6P transport, and neither couples to G6Pase-α. We conclude that three of the four SLC37 family members are functional sugar-phosphate antiporters. However, only G6PT/SLC37A4 matches the characteristics of the physiological ER G6P transporter, suggesting the other SLC37 proteins have roles independent of blood glucose homeostasis.

Na+-taurocholate cotransporting polypeptide (NTCP/SLC10A1) ortholog in the marine skate Leucoraja erinacea is not a physiological bile salt transporter.

Science.gov (United States)

Yu, Dongke; Zhang, Han; Lionarons, Daniel A; Boyer, James L; Cai, Shi-Ying

2017-04-01

The Na + -dependent taurocholate cotransporting polypeptide (NTCP/SLC10A1) is a hepatocyte-specific solute carrier, which plays an important role in maintaining bile salt homeostasis in mammals. The absence of a hepatic Na + -dependent bile salt transport system in marine skate and rainbow trout raises a question regarding the function of the Slc10a1 gene in these species. Here, we have characterized the Slc10a1 gene in the marine skate, Leucoraja erinacea The transcript of skate Slc10a1 (skSlc10a1) encodes 319 amino acids and shares 46% identity to human NTCP (hNTCP) with similar topology to mammalian NTCP. SkSlc10a1 mRNA was mostly confined to the brain and testes with minimal expression in the liver. An FXR-bile salt reporter assay indicated that skSlc10a1 transported taurocholic acid (TCA) and scymnol sulfate, but not as effectively as hNTCP. An [ 3 H]TCA uptake assay revealed that skSlc10a1 functioned as a Na + -dependent transporter, but with low affinity for TCA ( K m = 92.4 µM) and scymnol sulfate ( K i = 31 µM), compared with hNTCP (TCA, K m = 5.4 µM; Scymnol sulfate, K i = 3.5 µM). In contrast, the bile salt concentration in skate plasma was 2 µM, similar to levels seen in mammals. Interestingly, skSlc10a1 demonstrated transport activity for the neurosteroids dehydroepiandrosterone sulfate and estrone-3-sulfate at physiological concentration, similar to hNTCP. Together, our findings indicate that skSlc10a1 is not a physiological bile salt transporter, providing a molecular explanation for the absence of a hepatic Na + -dependent bile salt uptake system in skate. We speculate that Slc10a1 is a neurosteroid transporter in skate that gained its substrate specificity for bile salts later in vertebrate evolution. Copyright © 2017 the American Physiological Society.

Characterization of SLC transporters in human skin

Directory of Open Access Journals (Sweden)

Marion Alriquet

2015-03-01

Full Text Available Most identified drug transporters belong to the ATP-binding Cassette (ABC and Solute Carrier (SLC families. Recent research indicates that some of these transporters play an important role in the absorption, distribution and excretion of drugs, and are involved in clinically relevant drug-drug interactions for systemic drugs. However, very little is known about the role of drug transporters in human skin in the disposition of topically applied drugs and their involvement in drug-drug interactions. The aim of this work was to compare the expression in human skin (vs human hepatocytes and kidney of SLC transporters included in the EMA guidance as the most likely clinical sources of drug interactions. The expression of SLC transporters in human tissues was analyzed by quantitative RT-PCR. Modulation of SLC47A1 and SLC47A2 (MATE1 and MATE2 expression was analyzed after treatment of human skin in organ-culture with rifampicin and UV irradiation. The expression of SLCO2B1 (OATPB, SLCO3A1 (OATPD, SLCO4A1 (OATPE, SLC47A1 and SLC47A2 (MATE1 and MATE2 was detected in human skin, OATPE and MATE1 being the most expressed. OATPE is about 70 times more expressed in human skin than in human hepatocytes. Moreover, the expression of SLC47A1 and SLC47A2 was down-regulated after treatment with rifampicin or after exposure to UV light. The present findings demonstrate that SLCO4A1 (OATPE and SLC47A1 (MATE1 are highly expressed in human skin and suggest the involvement of SLC transporters in the disposition of topically applied drugs.

SLC1 and SLC4 encode partially redundant acyl-coenzyme A 1-acylglycerol-3-phosphate O-acyltransferases of budding yeast

DEFF Research Database (Denmark)

Benghezal, Mohammed; Roubaty, Carole; Veepuri, Vijayanath

2007-01-01

Phosphatidic acid is the intermediate, from which all glycerophospholipids are synthesized. In yeast, it is generated from lysophosphatidic acid, which is acylated by Slc1p, an sn-2-specific, acyl-coenzyme A-dependent 1-acylglycerol-3-phosphate O-acyltransferase. Deletion of SLC1 is not lethal...

SLC3A1 and SLC7A9 mutations in autosomal recessive or dominant canine cystinuria: a new classification system.

Science.gov (United States)

Brons, A-K; Henthorn, P S; Raj, K; Fitzgerald, C A; Liu, J; Sewell, A C; Giger, U

2013-01-01

Cystinuria, one of the first recognized inborn errors of metabolism, has been reported in many dog breeds. To determine urinary cystine concentrations, inheritance, and mutations in the SLC3A1 and SLC7A9 genes associated with cystinuria in 3 breeds. Mixed and purebred Labrador Retrievers (n = 6), Australian Cattle Dogs (6), Miniature Pinschers (4), and 1 mixed breed dog with cystine urolithiasis, relatives and control dogs. Urinary cystinuria and aminoaciduria was assessed and exons of the SLC3A1 and SLC7A9 genes were sequenced from genomic DNA. In each breed, male and female dogs, independent of neuter status, were found to form calculi. A frameshift mutation in SLC3A1 (c.350delG) resulting in a premature stop codon was identified in autosomal-recessive (AR) cystinuria in Labrador Retrievers and mixed breed dogs. A 6 bp deletion (c.1095_1100del) removing 2 threonines in SLC3A1 was found in autosomal-dominant (AD) cystinuria with a more severe phenotype in homozygous than in heterozygous Australian Cattle Dogs. A missense mutation in SLC7A9 (c.964G>A) was discovered in AD cystinuria in Miniature Pinschers with only heterozygous affected dogs observed to date. Breed-specific DNA tests were developed, but the prevalence of each mutation remains unknown. These studies describe the first AD inheritance and the first putative SLC7A9 mutation to cause cystinuria in dogs and expand our understanding of this phenotypically and genetically heterogeneous disease, leading to a new classification system for canine cystinuria and better therapeutic management and genetic control in these breeds. Copyright © 2013 by the American College of Veterinary Internal Medicine.

Upregulation of the Creatine Transporter Slc6A8 by Klotho

Directory of Open Access Journals (Sweden)

Ahmad Almilaji

2014-11-01

Full Text Available Background/Aims: The transmembrane Klotho protein contributes to inhibition of 1,25(OH2D3 formation. The extracellular domain of Klotho protein could function as an enzyme with e.g. β-glucuronidase activity, be cleaved off and be released into blood and cerebrospinal fluid. Klotho regulates several cellular transporters. Klotho protein deficiency accelerates the appearance of age related disorders including neurodegeneration and muscle wasting and eventually leads to premature death. The main site of Klotho protein expression is the kidney. Klotho protein is also appreciably expressed in other tissues including chorioid plexus. The present study explored the effect of Klotho protein on the creatine transporter CreaT (Slc6A8, which participates in the maintenance of neuronal function and survival. Methods: To this end cRNA encoding Slc6A8 was injected into Xenopus oocytes with and without additional injection of cRNA encoding Klotho protein. Creatine transporter CreaT (Slc6A8 activity was estimated from creatine induced current determined by two-electrode voltage-clamp. Results: Coexpression of Klotho protein significantly increased creatine-induced current in Slc6A8 expressing Xenopus oocytes. Coexpression of Klotho protein delayed the decline of creatine induced current following inhibition of carrier insertion into the cell membrane by brefeldin A (5 µM. The increase of creatine induced current by coexpression of Klotho protein in Slc6A8 expressing Xenopus oocytes was reversed by β-glucuronidase inhibitor (DSAL. Similarly, treatment of Slc6A8 expressing Xenopus oocytes with recombinant human alpha Klotho protein significantly increased creatine induced current. Conclusion: Klotho protein up-regulates the activity of creatine transporter CreaT (Slc6A8 by stabilizing the carrier protein in the cell membrane, an effect requiring β-glucuronidase activity of Klotho protein.

Examining the role of components of Slc11a1 (Nramp1 in the susceptibility of New Zealand sea lions (Phocarctos hookeri to disease.

Directory of Open Access Journals (Sweden)

Amy J Osborne

Full Text Available The New Zealand sea lion (NZSL, Phocarctos hookeri is a Threatened marine mammal with a restricted distribution and a small, declining, population size. The species is susceptible to bacterial pathogens, having suffered three mass mortality events since 1998. Understanding the genetic factors linked to this susceptibility is important in mitigating population decline. The gene solute carrier family 11 member a1 (Slc11a1 plays an important role in mammalian resistance or susceptibility to a wide range of bacterial pathogens. At present, Slc11a1 has not been characterised in many taxa, and despite its known roles in mediating the effects of infectious disease agents, has not been examined as a candidate gene in susceptibility or resistance in any wild population of conservation concern. Here we examine components of Slc11a1 in NZSLs and identify: i a polymorphic nucleotide in the promoter region; ii putative shared transcription factor binding motifs between canids and NZSLs; and iii a conserved polymorphic microsatellite in the first intron of Slc11a1, which together suggest conservation of Slc11a1 gene structure in otariids. At the promoter polymorphism, we demonstrate a shift away from normal allele frequency distributions and an increased likelihood of death from infectious causes with one allelic variant. While this increased likelihood is not statistically significant, lack of significance is potentially due to the complexity of genetic susceptibility to disease in wild populations. Our preliminary data highlight the potential significance of this gene in disease resistance in wild populations; further exploration of Slc11a1 will aid the understanding of susceptibility to infection in mammalian species of conservation significance.

Drug Clearance from Cerebrospinal Fluid Mediated by Organic Anion Transporters 1 (Slc22a6) and 3 (Slc22a8) at Arachnoid Membrane of Rats.

Science.gov (United States)

Zhang, Zhengyu; Tachikawa, Masanori; Uchida, Yasuo; Terasaki, Tetsuya

2018-03-05

Although arachnoid mater epithelial cells form the blood-arachnoid barrier (BAB), acting as a blood-CSF interface, it has been generally considered that the BAB is impermeable to water-soluble substances and plays a largely passive role. Here, we aimed to clarify the function of transporters at the BAB in regulating CSF clearance of water-soluble organic anion drugs based on quantitative targeted absolute proteomics (QTAP) and in vivo analyses. Protein expression levels of 61 molecules, including 19 ATP-binding-cassette (ABC) transporters and 32 solute-carrier (SLC) transporters, were measured in plasma membrane fraction of rat leptomeninges using QTAP. Thirty-three proteins were detected; others were under the quantification limits. Expression levels of multidrug resistance protein 1 (Mdr1a/P-gp/Abcb1a) and breast cancer resistance protein (Bcrp/Abcg2) were 16.6 and 3.27 fmol/μg protein (51.9- and 9.82-fold greater than in choroid plexus, respectively). Among those organic anion transporters detected only at leptomeninges, not choroid plexus, organic anion transporter 1 (oat1/Slc22a6) showed the greatest expression (2.73 fmol/μg protein). On the other hand, the protein expression level of oat3 at leptomeninges was 6.65 fmol/μg protein, and the difference from choroid plexus was within two-fold. To investigate oat1's role, we injected para-aminohippuric acid (PAH) with or without oat1 inhibitors into cisterna magna (to minimize the contribution of choroid plexus function) of rats. A bulk flow marker, FITC-inulin, was not taken up from CSF up to 15 min, whereas uptake clearance of PAH was 26.5 μL/min. PAH uptake was completely blocked by 3 mM cephalothin (inhibits both oat1 and oat3), while 17% of PAH uptake was inhibited by 0.2 mM cephalothin (selectively inhibits oat3). These results indicate that oat1 and oat3 at the BAB provide a distinct clearance pathway of organic anion drugs from CSF independently of choroid plexus.

Reduced levels of folate transporters (PCFT and RFC) in membrane lipid rafts result in colonic folate malabsorption in chronic alcoholism.

Science.gov (United States)

Wani, Nissar Ahmad; Kaur, Jyotdeep

2011-03-01

We studied the effect of chronic ethanol ingestion on folate transport across the colonic apical membranes (CAM) in rats. Male Wistar rats were fed 1 g/kg body weight/day ethanol (20%) solution orally for 3 months and folate transport was studied in the isolated colon apical membrane vesicles. The folate transport was found to be carrier mediated, saturable, with pH optima at 5.0. Chronic ethanol ingestion reduced the folate transport across the CAM by decreasing the affinity of transporters (high Km) for the substrate and by decreasing the number of transporter molecules (low Vmax) on the colon luminal surface. The decreased transport activity at the CAM was associated with down-regulation of the proton-coupled folate transporter (PCFT) and the reduced folate carrier (RFC) which resulted in decreased PCFT and RFC protein levels in the colon of rats fed alcohol chronically. Moreover, the PCFT and the RFC were found to be distributed in detergent insoluble fraction of the CAM in rats. Floatation experiments on Optiprep density gradients demonstrated the association of the PCFT and the RFC protein with lipid rafts (LR). Chronic alcoholism decreased the PCFT and the RFC protein levels in the CAM LR in accordance with the decreased synthesis. Hence, we propose that downregulation in the expression of the PCFT and the RFC in colon results in reduced levels of these transporters in colon apical membrane LR as a mechanism of folate malabsorption during chronic alcoholism. Copyright © 2010 Wiley-Liss, Inc.

Impaired nutrient signaling and body weight control in a Na+ neutral amino acid cotransporter (Slc6a19)-deficient mouse.

Science.gov (United States)

Bröer, Angelika; Juelich, Torsten; Vanslambrouck, Jessica M; Tietze, Nadine; Solomon, Peter S; Holst, Jeff; Bailey, Charles G; Rasko, John E J; Bröer, Stefan

2011-07-29

Amino acid uptake in the intestine and kidney is mediated by a variety of amino acid transporters. To understand the role of epithelial neutral amino acid uptake in whole body homeostasis, we analyzed mice lacking the apical broad-spectrum neutral (0) amino acid transporter B(0)AT1 (Slc6a19). A general neutral aminoaciduria was observed similar to human Hartnup disorder which is caused by mutations in SLC6A19. Na(+)-dependent uptake of neutral amino acids into the intestine and renal brush-border membrane vesicles was abolished. No compensatory increase of peptide transport or other neutral amino acid transporters was detected. Mice lacking B(0)AT1 showed a reduced body weight. When adapted to a standard 20% protein diet, B(0)AT1-deficient mice lost body weight rapidly on diets containing 6 or 40% protein. Secretion of insulin in response to food ingestion after fasting was blunted. In the intestine, amino acid signaling to the mammalian target of rapamycin (mTOR) pathway was reduced, whereas the GCN2/ATF4 stress response pathway was activated, indicating amino acid deprivation in epithelial cells. The results demonstrate that epithelial amino acid uptake is essential for optimal growth and body weight regulation.

Impact of genetic polymorphisms of SLC2A2, SLC2A5, and KHK on metabolic phenotypes in hypertensive individuals.

Directory of Open Access Journals (Sweden)

MyPhuong T Le

Full Text Available In the past few decades, consumption of added sugars has increased dramatically. Studies have linked high sugar intake with increased risk for a number of diseases. Importantly, fructose, a component of sugar, has been linked with the development of features of metabolic syndrome. This study determined if single nucleotide polymorphisms in genes involved in fructose transport (solute carrier family 2 facilitated glucose transporter, member 2 (SLC2A2 and solute carrier family 2 facilitated glucose/fructose transporter, member 5 (SLC2A5 and metabolism (ketohexokinase (KHK affect inter-individual variability in metabolic phenotypes, such as increased serum uric acid levels.The influence of SLC2A2, SLC2A5, and KHK SNPs on metabolic phenotypes was tested in 237 European Americans and 167 African Americans from the Pharmacogenomic Evaluation and Antihypertensive Responses (PEAR study. Using baseline untreated fasting data, associations were considered significant if p≤0.005. These SNPs were then evaluated for potential replication (p≤0.05 using data from the Genetic Epidemiology of Responses to Antihypertensives (GERA studies.SLC2A5 rs5438 was associated with an increase in serum uric acid in European American males. However, we were unable to replicate the association in GERA. The minor allele of SLC2A2 rs8192675 showed an association with lower high-density lipoproteins in European Americans (A/A: 51.0 mg/dL, A/G: 47.0 mg/dL, G/G: 41.5 mg/dL, p = 0.0034 in PEAR. The association between rs8192675 and lower high-density lipoproteins was replicated in the combined European American GERA study samples (A/A: 47.6 mg/dL, A/G: 48.6 mg/dL, G/G: 41.9 mg/dL, p = 0.0315.The association between SLC2A2 rs8192675 and high-density lipoproteins suggests the polymorphism may play a role in influencing high-density lipoproteins and thus metabolic risk of cardiovascular disease.

Structure of Bor1 supports an elevator transport mechanism for SLC4 anion exchangers.

Science.gov (United States)

Thurtle-Schmidt, Bryan H; Stroud, Robert M

2016-09-20

Boron is essential for plant growth because of its incorporation into plant cell walls; however, in excess it is toxic to plants. Boron transport and homeostasis in plants is regulated in part by the borate efflux transporter Bor1, a member of the solute carrier (SLC) 4 transporter family with homology to the human bicarbonate transporter Band 3. Here, we present the 4.1-Å resolution crystal structure of Arabidopsis thaliana Bor1. The structure displays a dimeric architecture in which dimerization is mediated by centralized Gate domains. Comparisons with a structure of Band 3 in an outward-open state reveal that the Core domains of Bor1 have rotated inwards to achieve an occluded state. Further structural comparisons with UapA, a xanthine transporter from the nucleobase-ascorbate transporter family, show that the downward pivoting of the Core domains relative to the Gate domains may access an inward-open state. These results suggest that the SLC4, SLC26, and nucleobase-ascorbate transporter families all share an elevator transport mechanism in which alternating access is provided by Core domains that carry substrates across a membrane.

A novel variant in the SLC12A1 gene in two families with antenatal Bartter syndrome.

Science.gov (United States)

Breinbjerg, Anders; Siggaard Rittig, Charlotte; Gregersen, Niels; Rittig, Søren; Hvarregaard Christensen, Jane

2017-01-01

Bartter syndrome is an autosomal-recessive inherited disease in which patients present with hypokalaemia and metabolic alkalosis. We present two apparently nonrelated cases with antenatal Bartter syndrome type I, due to a novel variant in the SLC12A1 gene encoding the bumetanide-sensitive sodium-(potassium)-chloride cotransporter 2 in the thick ascending limb of the loop of Henle. Blood samples were received from the two cases and 19 of their relatives, and deoxyribonucleic acid was extracted. The coding regions of the SLC12A1 gene were amplified using polymerase chain reaction, followed by bidirectional direct deoxyribonucleic acid sequencing. Each affected child in the two families was homozygous for a novel inherited variant in the SLC12A1gene, c.1614T>A. The variant predicts a change from a tyrosine codon to a stop codon (p.Tyr538Ter). The two cases presented antenatally and at six months of age, respectively. The two cases were homozygous for the same variant in the SLC12A1 gene, but presented clinically at different ages. This could eventually be explained by the presence of other gene variants or environmental factors modifying the phenotypes. The phenotypes of the patients were similar to other patients with antenatal Bartter syndrome. ©2016 Foundation Acta Paediatrica. Published by John Wiley & Sons Ltd.

Thiamine responsive megaloblastic anemia: a novel SLC19A2 compound heterozygous mutation in two siblings.

Science.gov (United States)

Mozzillo, Enza; Melis, Daniela; Falco, Mariateresa; Fattorusso, Valentina; Taurisano, Roberta; Flanagan, Sarah E; Ellard, Sian; Franzese, Adriana

2013-08-01

Thiamine responsive megaloblastic anemia (TRMA) is an autosomal recessive disease caused by loss of function mutations in the SLC19A2 gene. TRMA is characterized by anemia, deafness, and diabetes. In some cases, optic atrophy or more rarely retinitis pigmentosa is noted. We now report two sisters, the eldest of which presented to a different hospital during childhood with sensorineural deafness, which was treated with a hearing prosthesis, insulin requiring diabetes, retinitis pigmentosa, optic atrophy, and macrocytic anemia. These features initially suggested a clinical diagnosis of Wolfram syndrome (WS). Therapy with thiamine was initiated which resulted in the resolution of the anemia. The younger sister, who was affected with sensorineural deafness, was referred to our hospital for non-autoimmune diabetes. She was found to have macrocytosis and ocular abnormalities. Because a diagnosis of TRMA was suspected, therapy with insulin and thiamine was started. Sequencing analysis of the SLC19A2 gene identified a compound heterozygous mutation p.Y81X/p.L457X (c.242insA/c.1370delT) in both sisters. Non-autoimmune diabetes associated with deafness and macrocytosis, without anemia, suggests a diagnosis of TRMA. Patients clinically diagnosed with WS with anemia and/or macrocytosis should be reevaluated for TRMA. © 2012 John Wiley & Sons A/S.

Pathogenic mutations of the human mitochondrial citrate carrier SLC25A1 lead to impaired citrate export required for lipid, dolichol, ubiquinone and sterol synthesis.

Science.gov (United States)

Majd, Homa; King, Martin S; Smith, Anthony C; Kunji, Edmund R S

2018-01-01

Missense mutations of the human mitochondrial citrate carrier, encoded by the SLC25A1 gene, lead to an autosomal recessive neurometabolic disorder characterised by neonatal-onset encephalopathy with severe muscular weakness, intractable seizures, respiratory distress, and lack of psychomotor development, often resulting in early death. Here, we have measured the effect of all twelve known pathogenic mutations on the transport activity. The results show that nine mutations abolish transport of citrate completely, whereas the other three reduce the transport rate by >70%, indicating that impaired citrate transport is the most likely primary cause of the disease. Some mutations may be detrimental to the structure of the carrier, whereas others may impair key functional elements, such as the substrate binding site and the salt bridge network on the matrix side of the carrier. To understand the consequences of impaired citrate transport on metabolism, the substrate specificity was also determined, showing that the human citrate carrier predominantly transports citrate, isocitrate, cis-aconitate, phosphoenolpyruvate and malate. Although D-2- and L-2 hydroxyglutaric aciduria is a metabolic hallmark of the disease, it is unlikely that the citrate carrier plays a significant role in the removal of hydroxyglutarate from the cytosol for oxidation to oxoglutarate in the mitochondrial matrix. In contrast, computer simulations of central metabolism predict that the export of citrate from the mitochondrion cannot be fully compensated by other pathways, restricting the cytosolic production of acetyl-CoA that is required for the synthesis of lipids, sterols, dolichols and ubiquinone, which in turn explains the severe disease phenotypes. Copyright © 2017. Published by Elsevier B.V.

Deletions at SLC18A1 increased the risk of CRC and lower SLC18A1 expression associated with poor CRC outcome.

Science.gov (United States)

Zhang, Dandan; Li, Zhenli; Xu, Xiaohong; Zhou, Dan; Tang, Shunli; Yin, Xiaoyang; Xu, Fangying; Li, Hui; Zhou, Yuan; Zhu, Tao; Deng, Hong; Zhang, Shuai; Huang, Qiong; Wang, Jing; Yin, Wei; Zhu, Yimin; Lai, Maode

2017-10-26

Copy number variations (CNVs) contribute to the development of colorectal cancer (CRC). We conducted a two-stage association study to identify CNV risk loci for CRC. We performed a gene-based rare CNV study on 694 sporadic CRC and 1641 controls using Illumina Human-OmniExpress-12v1.0 BeadChips, and further replicated in 934 CRC cases and 2680 controls for risk CNVs by using TaqMan Copy Number Assay. Tumor buddings, cancer cells in the center of primary tumor and normal intestinal epithelial cells were captured using laser capture microdissection (LCM) and were assayed using AffymetrixGeneChip® Human Genome U133 Plus 2.0 Array. In addition, The Cancer Genome Atlas (TCGA) and Gene Expression Omnibus data were assessed for the effects of risk CNVs. We found that germline deletions affecting the last six exons of SLC18A1 significantly associated with CRC with a combined P value of 6.4 × 10-5 by a two-stage analysis. Both in TCGA CRC RNA seq dataset and GDS4382, SLC18A1 was significantly down regulated in CRC tissues than in paired normal tissues (N = 32 and 17 pairs, P = 0.004 and 0.009, respectively). In LCM samples, similar observations were obtained that the expression levels of SLC18A1 in the tumor buddings, cancer cells in the center of primary tumor, and stroma of both tumor budding and cancer cells were lower than normal intestinal epithelial and stromal cells (fold change = 0.17-0.62, 0.12-0.57 and 0.37-0.68, respectively). In summary, the germline deletions at SLC18A1 contributed to the development of CRC. The role of SLC18A1 required further exploration. © The Author 2017. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

Fructose Synthesis and Transport at the Uterine-Placental Interface of Pigs: Cell-Specific Localization of SLC2A5, SLC2A8, and Components of the Polyol Pathway.

Science.gov (United States)

Steinhauser, Chelsie B; Landers, McKinsey; Myatt, Louise; Burghardt, Robert C; Vallet, Jeffrey L; Bazer, Fuller W; Johnson, Greg A

2016-11-01

The fetal fluids and uterine flushings of pigs contain higher concentrations of fructose than glucose, but fructose is not detected in maternal blood. Fructose can be synthesized from glucose via enzymes of the polyol pathway, aldose reductase (AKR1B1) and sorbitol dehydrogenase (SORD), transported across cell membranes by solute carriers SLC2A5 and SLC2A8, and converted to fructose-1-phosphate by ketohexokinase (KHK). SLC2A8, SLC2A5, AKR1B1, SORD, and KHK mRNAs and proteins were analyzed using quantitative PCR and immunohistochemistry or in situ hybridization in endometria and placentae of cyclic and pregnant gilts, cyclic gilts injected with estrogen, and ovariectomized gilts injected with progesterone. Progesterone up-regulated SLC2A8 protein in uterine luminal (LE) and glandular epithelia during the peri-implantation period, and expression became exclusively placental, chorion and blood vessels, after Day 30. P4 up-regulated SLC2A5 mRNA in uterine LE and glandular epithelia after implantation, and the chorion expressed SLC2A5 between Days 30 and 85. AKR1B1 and SORD proteins localized to uterine LE during the peri-implantation period, but expression switched to chorion by Day 20 and was maintained through Day 85. Uterine expression of AKR1B1 mRNA was down-regulated by estrogen. KHK protein localized to trophectoderm/chorion throughout gestation. These results provide evidence that components for the conversion of glucose to fructose and for fructose transport are present at the uterine-placental interface of pigs. The shift in expression from LE to chorion during pregnancy suggests free-floating conceptuses are supported by fructose synthesized by the uterus, but after implantation, the chorion becomes self-sufficient for fructose synthesis and transport. © 2016 by the Society for the Study of Reproduction, Inc.

Genetic variants in the regulatory region of SLC10A1 are not associated with the risk of hepatitis B virus infection and clearance.

Science.gov (United States)

Chen, Xueqin; Wang, Ying; Chen, Xiaohua; Cheng, Kailiang; Li, Jiaoyuan; Lou, Jiao; Ke, Juntao; Yang, Yang; Gong, Yajie; Zhu, Ying; Wang, Li; Zhong, Rong

2016-10-01

The Na/taurocholate cotransporter NTCP (encoded by SLC10A1) was identified as a cellular entry receptor for the human hepatitis B virus (HBV), advancing our understanding of the molecular mechanism of HBV infection. An alternative hypothesis was put forward that regulatory variants in SLC10A1 might play an important role in HBV susceptibility by potentially influencing expression levels of NTCP. The three regulatory SNPs (rs8011311, rs7154439, rs111409076) were genotyped in 1023 HBV-persistent carriers, 735 subjects with HBV natural clearance and 732 HBV marker-negative subjects in a Han Chinese population. Real-time reverse transcription PCR analysis and luciferase assays have been performed to dissect the potential functionality. In logistic regression analysis, when subjects with HBV natural clearance were compared with HBV marker-negative subjects, no significant associations with the risk of HBV infection were observed for any of the three SNPs after adjusting for age, sex, smoking status and alcohol consumption (P>0.05). Similar negative results were also found for the three SNPs when HBV-persistent carriers were compared with HBV marker-negative subjects. Likewise, no significant associations with the risk of HBV clearance were observed when HBV-persistent carriers were compared with subjects with HBV natural clearance (P>0.05). Quantitative RT/PCR showed no significant difference in NTCP expression levels in normal liver tissue amongst individuals with different rs111409076 genotypes (P=0.317 for the general linear model). Moreover, no evident effect of the SLC10A1 rs111409076 AACA/- polymorphism on transcriptional activity was found by luciferase assay in either HepG2 (P=0.161) or Hep3b (P=0.129) cell lines. The present study indicated that the common variants in the regulatory region of SLC10A1 may not influence the expression of NTCP at the level of transcriptional regulation, and ultimately may not be associated with HBV susceptibility in this Chinese

Exonal deletion of SLC24A4 causes hypomaturation amelogenesis imperfecta.

Science.gov (United States)

Seymen, F; Lee, K-E; Tran Le, C G; Yildirim, M; Gencay, K; Lee, Z H; Kim, J-W

2014-04-01

Amelogenesis imperfecta is a heterogeneous group of genetic conditions affecting enamel formation. Recently, mutations in solute carrier family 24 member 4 (SLC24A4) have been identified to cause autosomal recessive hypomaturation amelogenesis imperfecta. We recruited a consanguineous family with hypomaturation amelogenesis imperfecta with generalized brown discoloration. Sequencing of the candidate genes identified a 10-kb deletion, including exons 15, 16, and most of the last exon of the SLC24A4 gene. Interestingly, this deletion was caused by homologous recombination between two 354-bp-long homologous sequences located in intron 14 and the 3' UTR. This is the first report of exonal deletion in SLC24A4 providing confirmatory evidence that the function of SLC24A4 in calcium transport has a crucial role in the maturation stage of amelogenesis.

Function and expression of the proton-coupled amino acid transporter Slc36a1 along the rat gastrointestinal tract

DEFF Research Database (Denmark)

Broberg, M. L.; Holm, Rasmus Koldborg; Tønsberg, H

2012-01-01

BACKGROUND AND PURPOSE: Intestinal absorption via membrane transporters may determine the pharmacokinetics of drug compounds. The hypothesis is that oral absorption of gaboxadol (4, 5, 6, 7-tetrahydroisoxazolo [5,4-c] pyridine-3-ol) in rats occurs via the proton-coupled amino acid transporter, r....... The intestinal expression of rSlc36a1 mRNA was measured by quantitative real-time PCR (q-RT-PCR). Furthermore, the hPAT1-/rPAT1-mediated transport of gaboxadol or L-proline was studied in hPAT1-expressing X. laevis oocytes, Caco-2 cell monolayers and excised segments of the rat intestine. KEY RESULTS......). The in vitro carrier-mediated uptake rate of L-proline in the excised intestinal segments was highest in the mid jejunum and low in the colon. The in vitro uptake and the in vivo absorption correlated with the expression of rSlc36a1 mRNA along the rat intestine. CONCLUSIONS AND IMPLICATIONS: The results...

Loss-of-function mutations in SLC30A8 protect against type 2 diabetes.

Science.gov (United States)

Flannick, Jason; Thorleifsson, Gudmar; Beer, Nicola L; Jacobs, Suzanne B R; Grarup, Niels; Burtt, Noël P; Mahajan, Anubha; Fuchsberger, Christian; Atzmon, Gil; Benediktsson, Rafn; Blangero, John; Bowden, Don W; Brandslund, Ivan; Brosnan, Julia; Burslem, Frank; Chambers, John; Cho, Yoon Shin; Christensen, Cramer; Douglas, Desirée A; Duggirala, Ravindranath; Dymek, Zachary; Farjoun, Yossi; Fennell, Timothy; Fontanillas, Pierre; Forsén, Tom; Gabriel, Stacey; Glaser, Benjamin; Gudbjartsson, Daniel F; Hanis, Craig; Hansen, Torben; Hreidarsson, Astradur B; Hveem, Kristian; Ingelsson, Erik; Isomaa, Bo; Johansson, Stefan; Jørgensen, Torben; Jørgensen, Marit Eika; Kathiresan, Sekar; Kong, Augustine; Kooner, Jaspal; Kravic, Jasmina; Laakso, Markku; Lee, Jong-Young; Lind, Lars; Lindgren, Cecilia M; Linneberg, Allan; Masson, Gisli; Meitinger, Thomas; Mohlke, Karen L; Molven, Anders; Morris, Andrew P; Potluri, Shobha; Rauramaa, Rainer; Ribel-Madsen, Rasmus; Richard, Ann-Marie; Rolph, Tim; Salomaa, Veikko; Segrè, Ayellet V; Skärstrand, Hanna; Steinthorsdottir, Valgerdur; Stringham, Heather M; Sulem, Patrick; Tai, E Shyong; Teo, Yik Ying; Teslovich, Tanya; Thorsteinsdottir, Unnur; Trimmer, Jeff K; Tuomi, Tiinamaija; Tuomilehto, Jaakko; Vaziri-Sani, Fariba; Voight, Benjamin F; Wilson, James G; Boehnke, Michael; McCarthy, Mark I; Njølstad, Pål R; Pedersen, Oluf; Groop, Leif; Cox, David R; Stefansson, Kari; Altshuler, David

2014-04-01

Loss-of-function mutations protective against human disease provide in vivo validation of therapeutic targets, but none have yet been described for type 2 diabetes (T2D). Through sequencing or genotyping of ~150,000 individuals across 5 ancestry groups, we identified 12 rare protein-truncating variants in SLC30A8, which encodes an islet zinc transporter (ZnT8) and harbors a common variant (p.Trp325Arg) associated with T2D risk and glucose and proinsulin levels. Collectively, carriers of protein-truncating variants had 65% reduced T2D risk (P = 1.7 × 10(-6)), and non-diabetic Icelandic carriers of a frameshift variant (p.Lys34Serfs*50) demonstrated reduced glucose levels (-0.17 s.d., P = 4.6 × 10(-4)). The two most common protein-truncating variants (p.Arg138* and p.Lys34Serfs*50) individually associate with T2D protection and encode unstable ZnT8 proteins. Previous functional study of SLC30A8 suggested that reduced zinc transport increases T2D risk, and phenotypic heterogeneity was observed in mouse Slc30a8 knockouts. In contrast, loss-of-function mutations in humans provide strong evidence that SLC30A8 haploinsufficiency protects against T2D, suggesting ZnT8 inhibition as a therapeutic strategy in T2D prevention.

A novel folate-modified self-microemulsifying drug delivery system of curcumin for colon targeting

Directory of Open Access Journals (Sweden)

Zhang L

2012-01-01

Full Text Available Lin Zhang1*, Weiwei Zhu2*, Chunfen Yang1, Hongxia Guo1, Aihua Yu1, Jianbo Ji3, Yan Gao1, Min Sun1, Guangxi Zhai11Department of Pharmaceutical Engineering, College of Pharmacy, Shandong University, Jinan; 2Department of Pharmacy, Yantai Yuhuangding Hospital, Yantai; 3Department of Pharmacology, College of Pharmacy, Shandong University, Jinan, China*These authors contributed equally to the workBackground: The objective of this study was to prepare, characterize, and evaluate a folate-modified self-microemulsifying drug delivery system (FSMEDDS with the aim to improve the solubility of curcumin and its delivery to the colon, facilitating endocytosis of FSMEDDS mediated by folate receptors on colon cancer cells.Methods: Ternary phase diagrams were constructed in order to obtain the most efficient self-emulsification region, and the formulation of curcumin-loaded SMEDDS was optimized by a simplex lattice experiment design. Then, three lipophilic folate derivatives (folate-polyethylene glycol-distearoylphosphatidylethanolamine, folate-polyethylene glycol-cholesteryl hemisuccinate, and folate-polyethylene glycol-cholesterol used as a surfactant were added to curcumin-loaded SMEDDS formulations. An in situ colon perfusion method in rats was used to optimize the formulation of FSMEDDS. Curcumin-loaded FSMEDDS was then filled into colon-targeted capsules and the in vitro release was investigated. Cytotoxicity studies and cellular uptake studies was used in this research.Results: The optimal formulation of FSMEDDS obtained with the established in situ colon perfusion method in rats was comprised of 57.5% Cremophor® EL, 32.5% Transcutol® HP, 10% Capryol™ 90, and a small amount of folate-polyethylene glycol-cholesteryl hemisuccinate (the weight ratio of folate materials to Cremophor EL was 1:100. The in vitro release results indicated that the obtained formulation of curcumin could reach the colon efficiently and release the drug immediately. Cellular

SLC22A1-ABCB1 haplotype profiles predict imatinib pharmacokinetics in Asian patients with chronic myeloid leukemia.

Directory of Open Access Journals (Sweden)

Onkar Singh

Full Text Available OBJECTIVE: This study aimed to explore the influence of SLC22A1, PXR, ABCG2, ABCB1 and CYP3A5 3 genetic polymorphisms on imatinib mesylate (IM pharmacokinetics in Asian patients with chronic myeloid leukemia (CML. PATIENTS AND METHODS: Healthy subjects belonging to three Asian populations (Chinese, Malay, Indian; n = 70 each and CML patients (n = 38 were enrolled in a prospective pharmacogenetics study. Imatinib trough (C(0h and clearance (CL were determined in the patients at steady state. Haplowalk method was applied to infer the haplotypes and generalized linear model (GLM to estimate haplotypic effects on IM pharmacokinetics. Association of haplotype copy numbers with IM pharmacokinetics was defined by Mann-Whitney U test. RESULTS: Global haplotype score statistics revealed a SLC22A1 sub-haplotypic region encompassing three polymorphisms (rs3798168, rs628031 and IVS7+850C>T, to be significantly associated with IM clearance (p = 0.013. Haplotype-specific GLM estimated that the haplotypes AGT and CGC were both associated with 22% decrease in clearance compared to CAC [CL (10(-2 L/hr/mg: CAC vs AGT: 4.03 vs 3.16, p = 0.017; CAC vs CGC: 4.03 vs 3.15, p = 0.017]. Patients harboring 2 copies of AGT or CGC haplotypes had 33.4% lower clearance and 50% higher C(0h than patients carrying 0 or 1 copy [CL (10(-2 L/hr/mg: 2.19 vs 3.29, p = 0.026; C(0h (10(-6 1/ml: 4.76 vs 3.17, p = 0.013, respectively]. Further subgroup analysis revealed SLC22A1 and ABCB1 haplotypic combinations to be significantly associated with clearance and C(0h (p = 0.002 and 0.009, respectively. CONCLUSION: This exploratory study suggests that SLC22A1-ABCB1 haplotypes may influence IM pharmacokinetics in Asian CML patients.

OCD candidate gene SLC1A1/EAAT3 impacts basal ganglia-mediated activity and stereotypic behavior.

Science.gov (United States)

Zike, Isaac D; Chohan, Muhammad O; Kopelman, Jared M; Krasnow, Emily N; Flicker, Daniel; Nautiyal, Katherine M; Bubser, Michael; Kellendonk, Christoph; Jones, Carrie K; Stanwood, Gregg; Tanaka, Kenji Fransis; Moore, Holly; Ahmari, Susanne E; Veenstra-VanderWeele, Jeremy

2017-05-30

Obsessive-compulsive disorder (OCD) is a chronic, disabling condition with inadequate treatment options that leave most patients with substantial residual symptoms. Structural, neurochemical, and behavioral findings point to a significant role for basal ganglia circuits and for the glutamate system in OCD. Genetic linkage and association studies in OCD point to SLC1A1 , which encodes the neuronal glutamate/aspartate/cysteine transporter excitatory amino acid transporter 3 (EAAT3)/excitatory amino acid transporter 1 (EAAC1). However, no previous studies have investigated EAAT3 in basal ganglia circuits or in relation to OCD-related behavior. Here, we report a model of Slc1a1 loss based on an excisable STOP cassette that yields successful ablation of EAAT3 expression and function. Using amphetamine as a probe, we found that EAAT3 loss prevents expected increases in ( i ) locomotor activity, ( ii ) stereotypy, and ( iii ) immediate early gene induction in the dorsal striatum following amphetamine administration. Further, Slc1a1 -STOP mice showed diminished grooming in an SKF-38393 challenge experiment, a pharmacologic model of OCD-like grooming behavior. This reduced grooming is accompanied by reduced dopamine D 1 receptor binding in the dorsal striatum of Slc1a1 -STOP mice. Slc1a1 -STOP mice also exhibit reduced extracellular dopamine concentrations in the dorsal striatum both at baseline and following amphetamine challenge. Viral-mediated restoration of Slc1a1 /EAAT3 expression in the midbrain but not in the striatum results in partial rescue of amphetamine-induced locomotion and stereotypy in Slc1a1 -STOP mice, consistent with an impact of EAAT3 loss on presynaptic dopaminergic function. Collectively, these findings indicate that the most consistently associated OCD candidate gene impacts basal ganglia-dependent repetitive behaviors.

Association of the solute carrier family 11 member 1 gene polymorphisms with susceptibility to leprosy in a Brazilian sample

Directory of Open Access Journals (Sweden)

Maria José Franco Brochado

2016-02-01

Full Text Available Natural resistance-associated macrophage protein 1/solute carrier family 11 member 1 gene (Nramp1/Slc11a1 is a gene that controls the susceptibility of inbred mice to intracellular pathogens. Polymorphisms in the human Slc11a1/Nramp1 gene have been associated with host susceptibility to leprosy. This study has evaluated nine polymorphisms of the Slc11a1/Nramp1 gene [(GTn, 274C/T, 469+14G/C, 577-18G/A, 823C/T, 1029 C/T, 1465-85G/A, 1703G/A, and 1729+55del4] in 86 leprosy patients (67 and 19 patients had the multibacillary and the paucibacillary clinical forms of the disease, respectively, and 239 healthy controls matched by age, gender, and ethnicity. The frequency of allele 2 of the (GTn polymorphism was higher in leprosy patients [p = 0.04, odds ratio (OR = 1.49], whereas the frequency of allele 3 was higher in the control group (p = 0.03; OR = 0.66. Patients carrying the 274T allele (p = 0.04; OR = 1.49 and TT homozygosis (p = 0.02; OR = 2.46, such as the 469+14C allele (p = 0.03; OR = 1.53 of the 274C/T and 469+14G/C polymorphisms, respectively, were more frequent in the leprosy group. The leprosy and control groups had similar frequency of the 577-18G/A, 823C/T, 1029C/T, 1465-85G/A, 1703G/A, and 1729+55del4 polymorphisms. The 274C/T polymorphism in exon 3 and the 469+14G/C polymorphism in intron 4 were associated with susceptibility to leprosy, while the allele 2 and 3 of the (GTn polymorphism in the promoter region were associated with susceptibility and protection to leprosy, respectively.

[Folates and fetal programming: role of epigenetics and epigenomics].

Science.gov (United States)

Guéant, Jean-Louis; Daval, Jean-Luc; Vert, Paul; Nicolas, Jean-Pierre

2012-12-01

Folates are needed for synthesis of methionine, the precursor of S-adenosyl methionine (SAM). They play therefore a key role in nutrition and epigenomics by fluxing monocarbons towards synthesis or methylation of DNA and RNA, and methylation of gene transregulators, respectively. The deficiency produces intrauterine growth retardation and birth dejects. Folate deficiency deregulates epigenomic mechanisms related to fetal programming through decreased cellular availability of SAM. Epigenetic mechanisms of folate deficiency are illustrated by inheritance of coat colour of agouti mice model and altered expression of Igf2/H19 imprinting genes. Dietary exposure to fumonisin FB1 acts synergistically with folate deficiency on alterations of heterochromatin assembly. Deficiency in folate and vitamin B12 produces impaired fatty acid oxidation in liver and heart through imbalanced methylation and acetylation of PGC1-alpha and decreased expression of SIRT1, and long-lasting cognitive disabilities through impaired hippocampal cell proliferation, differentiation and plasticity and atrophy of hippocampal CA1. Deciphering these mechanisms will help understand the discordances between experimental models and population studies on folate supplementation.

Folate overproduction in Lactobacillus plantarum WCFS1 causes methotrexate resistance

NARCIS (Netherlands)

Wegkamp, H.B.A.; Vos, de W.M.; Smid, E.J.

2009-01-01

Folate overproduction can serve as a mode of resistance against the folate antagonist methotrexate in Lactobacillus plantarum WCFS1. When compared with a wild-type control strain, an engineered high folate-producing strain was found to be insensitive to methotrexate. The growth rate and the viable

Quantifying the relative contributions of different solute carriers to aggregate substrate transport

Science.gov (United States)

Taslimifar, Mehdi; Oparija, Lalita; Verrey, Francois; Kurtcuoglu, Vartan; Olgac, Ufuk; Makrides, Victoria

2017-01-01

Determining the contributions of different transporter species to overall cellular transport is fundamental for understanding the physiological regulation of solutes. We calculated the relative activities of Solute Carrier (SLC) transporters using the Michaelis-Menten equation and global fitting to estimate the normalized maximum transport rate for each transporter (Vmax). Data input were the normalized measured uptake of the essential neutral amino acid (AA) L-leucine (Leu) from concentration-dependence assays performed using Xenopus laevis oocytes. Our methodology was verified by calculating Leu and L-phenylalanine (Phe) data in the presence of competitive substrates and/or inhibitors. Among 9 potentially expressed endogenous X. laevis oocyte Leu transporter species, activities of only the uniporters SLC43A2/LAT4 (and/or SLC43A1/LAT3) and the sodium symporter SLC6A19/B0AT1 were required to account for total uptake. Furthermore, Leu and Phe uptake by heterologously expressed human SLC6A14/ATB0,+ and SLC43A2/LAT4 was accurately calculated. This versatile systems biology approach is useful for analyses where the kinetics of each active protein species can be represented by the Hill equation. Furthermore, its applicable even in the absence of protein expression data. It could potentially be applied, for example, to quantify drug transporter activities in target cells to improve specificity. PMID:28091567

Physiological responses to folate overproduction in Lactobacillus plantarum WCFS1

Directory of Open Access Journals (Sweden)

de Vos Ric CH

2010-12-01

Full Text Available Abstract Background Using a functional genomics approach we addressed the impact of folate overproduction on metabolite formation and gene expression in Lactobacillus plantarum WCFS1. We focused specifically on the mechanism that reduces growth rates in folate-overproducing cells. Results Metabolite formation and gene expression were determined in a folate-overproducing- and wild-type strain. Differential metabolomics analysis of intracellular metabolite pools indicated that the pool sizes of 18 metabolites differed significantly between these strains. The gene expression profile was determined for both strains in pH-regulated chemostat culture and batch culture. Apart from the expected overexpression of the 6 genes of the folate gene cluster, no other genes were found to be differentially expressed both in continuous and batch cultures. The discrepancy between the low transcriptome and metabolome response and the 25% growth rate reduction of the folate overproducing strain was further investigated. Folate production per se could be ruled out as a contributing factor, since in the absence of folate production the growth rate of the overproducer was also reduced by 25%. The higher metabolic costs for DNA and RNA biosynthesis in the folate overproducing strain were also ruled out. However, it was demonstrated that folate-specific mRNAs and proteins constitute 8% and 4% of the total mRNA and protein pool, respectively. Conclusion Folate overproduction leads to very little change in metabolite levels or overall transcript profile, while at the same time the growth rate is reduced drastically. This shows that Lactobacillus plantarum WCFS1 is unable to respond to this growth rate reduction, most likely because the growth-related transcripts and proteins are diluted by the enormous amount of gratuitous folate-related transcripts and proteins.

SLC6A1 Mutation and Ketogenic Diet in Epilepsy With Myoclonic-Atonic Seizures.

Science.gov (United States)

Palmer, Samantha; Towne, Meghan C; Pearl, Phillip L; Pelletier, Renee C; Genetti, Casie A; Shi, Jiahai; Beggs, Alan H; Agrawal, Pankaj B; Brownstein, Catherine A

2016-11-01

Epilepsy with myoclonic-atonic seizures, also known as myoclonic-astatic epilepsy or Doose syndrome, has been recently linked to variants in the SLC6A1 gene. Epilepsy with myoclonic-atonic seizures is often refractory to antiepileptic drugs, and the ketogenic diet is known for treating medically intractable seizures, although the mechanism of action is largely unknown. We report a novel SLC6A1 variant in a patient with epilepsy with myoclonic-atonic seizures, analyze its effects, and suggest a mechanism of action for the ketogenic diet. We describe a ten-year-old girl with epilepsy with myoclonic-atonic seizures and a de novo SLC6A1 mutation who responded well to the ketogenic diet. She carried a c.491G>A mutation predicted to cause p.Cys164Tyr amino acid change, which was identified using whole exome sequencing and confirmed by Sanger sequencing. High-resolution structural modeling was used to analyze the likely effects of the mutation. The SLC6A1 gene encodes a transporter that removes gamma-aminobutyric acid from the synaptic cleft. Mutations in SLC6A1 are known to disrupt the gamma-aminobutyric acid transporter protein 1, affecting gamma-aminobutyric acid levels and causing seizures. The p.Cys164Tyr variant found in our study has not been previously reported, expanding on the variants linked to epilepsy with myoclonic-atonic seizures. A 10-year-old girl with a novel SLC6A1 mutation and epilepsy with myoclonic-atonic seizures had an excellent clinical response to the ketogenic diet. An effect of the diet on gamma-aminobutyric acid reuptake mediated by gamma-aminobutyric acid transporter protein 1 is suggested. A personalized approach to epilepsy with myoclonic-atonic seizures patients carrying SLC6A1 mutation and a relationship between epilepsy with myoclonic-atonic seizures due to SLC6A1 mutations, GABAergic drugs, and the ketogenic diet warrants further exploration. Copyright © 2016 Elsevier Inc. All rights reserved.

The association between atopy and factors influencing folate metabolism: is low folate status causally related to the development of atopy?

DEFF Research Database (Denmark)

Husemoen, LL; Toft, U.; Fenger, Mogens

2006-01-01

BACKGROUND: Deficiency of folate has been associated with several disorders characterized by enhanced activation of the cellular immune system (non-allergic th1 type immune response). Whether folate status is also associated with atopic disease (allergic th2 type immune response) is unknown. We....../CT individuals [odds ratio 1.76, 95% confidence interval (95% CI) 1.19-2.60]. Additionally, gene-diet interaction effects were identified. Dietary markers were negatively associated with risk of atopy in persons with the TT genotype. Total homocysteine was not related to atopy (odds ratio per 5 mumol/l = 1.......12, 95% CI 0.98-1.29). CONCLUSIONS: The results suggest that an impaired folate metabolism may be causally related to the development of atopy....

Chloride Anions Regulate Kinetics but Not Voltage-Sensor Qmax of the Solute Carrier SLC26a5.

Science.gov (United States)

Santos-Sacchi, Joseph; Song, Lei

2016-06-07

In general, SLC26 solute carriers serve to transport a variety of anions across biological membranes. However, prestin (SLC26a5) has evolved, now serving as a motor protein in outer hair cells (OHCs) of the mammalian inner ear and is required for cochlear amplification, a mechanical feedback mechanism to boost auditory performance. The mechanical activity of the OHC imparted by prestin is driven by voltage and controlled by anions, chiefly intracellular chloride. Current opinion is that chloride anions control the Boltzmann characteristics of the voltage sensor responsible for prestin activity, including Qmax, the total sensor charge moved within the membrane, and Vh, a measure of prestin's operating voltage range. Here, we show that standard narrow-band, high-frequency admittance measures of nonlinear capacitance (NLC), an alternate representation of the sensor's charge-voltage (Q-V) relationship, is inadequate for assessment of Qmax, an estimate of the sum of unitary charges contributed by all voltage sensors within the membrane. Prestin's slow transition rates and chloride-binding kinetics adversely influence these estimates, contributing to the prevalent concept that intracellular chloride level controls the quantity of sensor charge moved. By monitoring charge movement across frequency, using measures of multifrequency admittance, expanded displacement current integration, and OHC electromotility, we find that chloride influences prestin kinetics, thereby controlling charge magnitude at any particular frequency of interrogation. Importantly, however, this chloride dependence vanishes as frequency decreases, with Qmax asymptoting at a level irrespective of the chloride level. These data indicate that prestin activity is significantly low-pass in the frequency domain, with important implications for cochlear amplification. We also note that the occurrence of voltage-dependent charge movements in other SLC26 family members may be hidden by inadequate

Variation in the SLC23A1 gene does not influence cardiometabolic outcomes to the extent expected given its association with l-ascorbic acid 1 2 3 4

OpenAIRE

Wade, Kaitlin H; Forouhi, Nita G; Cook, Derek G; Johnson, Paul; McConnachie, Alex; Morris, Richard W; Rodriguez, Santiago; Ye, Zheng; Ebrahim, Shah; Padmanabhan, Sandosh; Watt, Graham; Bruckdorfer, K Richard; Wareham, Nick J; Whincup, Peter H; Chanock, Stephen

2014-01-01

Background: Observational studies showed that circulating l-ascorbic acid (vitamin C) is inversely associated with cardiometabolic traits. However, these studies were susceptible to confounding and reverse causation.\\ud \\ud Objectives:We assessed the relation between l-ascorbic acid and 10 cardiometabolic traits by using a single nucleotide polymorphism in the solute carrier family 23 member 1 (SLC23A1) gene (rs33972313) associated with circulating l-ascorbic acid concentrations. The observed...

The renal urate transporter SLC17A1 locus: confirmation of association with gout.

Science.gov (United States)

Hollis-Moffatt, Jade E; Phipps-Green, Amanda J; Chapman, Brett; Jones, Gregory T; van Rij, Andre; Gow, Peter J; Harrison, Andrew A; Highton, John; Jones, Peter B; Montgomery, Grant W; Stamp, Lisa K; Dalbeth, Nicola; Merriman, Tony R

2012-04-27

Two major gout-causing genes have been identified, the urate transport genes SLC2A9 and ABCG2. Variation within the SLC17A1 locus, which encodes sodium-dependent phosphate transporter 1, a renal transporter of uric acid, has also been associated with serum urate concentration. However, evidence for association with gout is equivocal. We investigated the association of the SLC17A1 locus with gout in New Zealand sample sets. Five variants (rs1165196, rs1183201, rs9358890, rs3799344, rs12664474) were genotyped across a New Zealand sample set totaling 971 cases and 1,742 controls. Cases were ascertained according to American Rheumatism Association criteria. Two population groups were studied: Caucasian and Polynesian. At rs1183201 (SLC17A1), evidence for association with gout was observed in both the Caucasian (odds ratio (OR) = 0.67, P = 3.0 × 10-6) and Polynesian (OR = 0.74, P = 3.0 × 10-3) groups. Meta-analysis confirmed association of rs1183201 with gout at a genome-wide level of significance (OR = 0.70, P = 3.0 × 10-8). Haplotype analysis suggested the presence of a common protective haplotype. We confirm the SLC17A1 locus as the third associated with gout at a genome-wide level of significance.

S113R mutation in SLC33A1 leads to neurodegeneration and augmented BMP signaling in a mouse model

Directory of Open Access Journals (Sweden)

Pingting Liu

2017-01-01

Full Text Available The S113R mutation (c.339T>G (MIM #603690.0001 in SLC33A1 (MIM #603690, an ER membrane acetyl-CoA transporter, has been previously identified in individuals with hereditary spastic paraplegia type 42 (SPG42; MIM #612539. SLC33A1 has also been shown to inhibit the bone morphogenetic protein (BMP signaling pathway in zebrafish. To better understand the function of SLC33A1, we generated and characterized Slc33a1S113R knock-in mice. Homozygous Slc33a1S113R mutant mice were embryonic lethal, whereas heterozygous Slc33a1 mutant mice (Slc33a1wt/mut exhibited behavioral abnormalities and central neurodegeneration, which is consistent with hereditary spastic paraplegia (HSP phenotypes. Importantly, we found an upregulation of BMP signaling in the nervous system and mouse embryonic fibroblasts of Slc33a1wt/mut mice. Using a sciatic nerve crush injury model in vivo and dorsal root ganglion (DRG culture in vitro we showed that injury-induced axonal regeneration in Slc33a1wt/mut mice was accelerated and mediated by upregulated BMP signaling. Exogenous addition of BMP signaling antagonist, noggin, could efficiently alleviate the accelerated injury-induced axonal regrowth. These results indicate that SLC33A1 can negatively regulate BMP signaling in mice, further supporting the notion that upregulation of BMP signaling is a common mechanism of a subset of hereditary spastic paraplegias.

Risk and protective genetic variants in suicidal behaviour: association with SLC1A2, SLC1A3, 5-HTR1B &NTRK2 polymorphisms.

LENUS (Irish Health Repository)

Murphy, Therese M

2012-02-01

BACKGROUND: Suicidal behaviour is known to aggregate in families. Patients with psychiatric disorders are at higher risk for suicide attempts (SA), however protective and risk genetic variants for suicide appear to be independent of underlying psychiatric disorders. Here we investigate genetic variants in genes important for neurobiological pathways linked to suicidal behaviour and\\/or associated endophenotypes, for association with SA among patients with co-existing psychiatric illness. Selected gene-gene and gene-environment interactions were also tested. METHODS: DNA was obtained from bloods of 159 patients (76 suicide attempters and 83 non-attempters), who were profiled for DSM-IV Axis I psychiatric diagnosis. Twenty-eight single nucleotide polymorphisms (SNPs) from 18 candidate genes (COMT, 5-HT2A, 5-HT1A, 5-HTR1B, TPH1, MAO-A, TPH2, DBH, CNR1, BDNF, ABCG1, GABRA5, GABRG2, GABRB2, SLC1A2, SLC1A3, NTRK2, CRHR1) were genotyped. Genotyping was performed by KBioscience. Tests of association between genetic variants and SA were conducted using Chi squared and Armitage Trend tests. Binary logistical regression analyses were performed to evaluate the contribution of individual genetic variants to the prediction of SA, and to examine SNPs for potential gene-gene and gene-environment interactions. RESULTS: Our analysis identified 4 SNPs (rs4755404, rs2269272, rs6296 and rs1659400), which showed evidence of association with SA compared to a non-attempter control group. We provide evidence of a 3-locus gene-gene interaction, and a putative gene-environment interaction, whereby genetic variation at the NTRK2 locus may moderate the risk associated with history of childhood abuse. CONCLUSION: Preliminary findings suggest that allelic variability in SLC1A2\\/3, 5-HTR1B and NTRK2 may be relevant to the underlying diathesis for suicidal acts.

Size-dependent internalisation of folate-decorated nanoparticles via the pathways of clathrin and caveolae-mediated endocytosis in ARPE-19 cells.

Science.gov (United States)

Langston Suen, Wai-Leung; Chau, Ying

2014-04-01

We aim to quantify the effect of size and degree of folate loading of folate-decorated polymeric nanoparticles (NPs) on the kinetics of cellular uptake and the selection of endocytic pathways in retinal pigment epithelium (RPE) cells. In this study, methoxy-poly(ethylene glycol)-b-polycaprolactone (mPEG-b-PCL) and folate-functionalized PEG-b-PCL were synthesized for assembling into nanoparticles with sizes ranging from 50 nm to 250 nm. These nanoparticles were internalized into ARPE-19 (human RPE cell line) via receptor-mediated endocytosis. A two-step endocytosis process mathematical model was adopted to quantify binding affinity and uptake kinetics of nanoparticles in RPE cells in uptake and inhibition studies. Nanoparticles with 100% folate loading have highest binding affinity and uptake rate in RPE cells. Maximum uptake rate (Vmax) of nanoparticles increased as the size of particles decreased from 250 nm to 50 nm. Endocytic pathway study was studied by using chlorpromazine and methyl-β-cyclodextran (MβCD), which are clathrin- and caveolae-mediated endocytosis inhibitors, respectively. Both chlorpromazine and MβCD inhibited the uptake of folate-decorated nanoparticles. Inhibition constant (Ki) and maximum uptake rate (Vmax) revealed that 50 nm and 120 nm folate-decorated nanoparticles were found to be internalized via both clathrin- and caveolae-mediated endocytosis. The 250 nm folate-decorated nanoparticles, however, were only internalized via caveolae-mediated pathway. Increased uptake rate of folate-decorated NPs into RPE cells is observed with increasing degree of folate modification. These NPs utilize both clathrin- and caveolae-mediated receptor-mediated endocytosis pathways to enter RPE cells upon size variation. The 50 nm NPs are internalized the fastest, with clathrin-mediated endocytosis as the preferred route. Uptake of 250 nm particles is the slowest and is dominated by caveolae-mediated endocytosis. © 2013 Royal Pharmaceutical

Developmental expression of SLC26A4 (Pendrin) during amelogenesis in developing rodent teeth

Science.gov (United States)

Bronckers, Antonius LJJ; Guo, Jing; Zandieh-Doulabi, Behrouz; Bervoets, Theodore J; Lyaruu, Donacian M.; Li, Xiangming; Wangemann, Philine; DenBesten, Pamela

2012-01-01

Ameloblasts need to regulate pH during formation of enamel crystals, a process that generates protons. Solute carrier family 26A member 4 (SLC26A4, or pendrin) is an anion exchanger for chloride, bicarbonate, iodine and formate. It is expressed in apical membranes of ion-transporting epithelia in kidney, inner ear and thyroid where it regulates luminal pH and fluid transport. We hypothesized that maturation ameloblasts express SLC26A4 to neutralize acidification of enamel fluid in forming enamel. In rodents, secretory and maturation ameloblasts were immunopositive for SLC26A4. Staining was particularly strong in apical membranes of maturation ameloblasts facing forming enamel. RT-PCR confirmed the presence of mRNA transcripts for Slc26a4 in enamel organs. SLC26A4 immunostaining was also found in mineralizing connective tissues including odontoblasts, osteoblasts, osteocytes, osteoclasts, bone lining cells, cellular cementoblasts and cementocytes. However, Slc26a4-null mutant mice had no overt dental phenotype. The presence of SLC26A4 in apical plasma membranes of maturation ameloblasts is consistent with a potential function as pH regulator. SLC26A4 does not appear critical for ameloblast functioning and is likely compensated by other pH regulators. PMID:22243245

Plasma Folate and Vitamin B12 Levels in Patients with Hepatocellular Carcinoma

Directory of Open Access Journals (Sweden)

Lian-Hua Cui

2016-06-01

Full Text Available Folate and vitamin B12 involved in the one-carbon metabolism may play a key role in carcinogenesis and progression of hepatocellular carcinoma (HCC through influencing DNA integrity. The purpose of this study is to evaluate the association of plasma folate and vitamin B12 levels with HCC in a case-control study on 312 HCC patients and 325 cancer-free controls. Plasma concentrations of folate and vitamin B12 in all the subjects were measured by electrochemiluminescence immunoassay. Meanwhile, the information of HCC patients’ clinical characteristics including tumor-node-metastasis (TNM stage, tumor size and tumor markers were collected. The patients of HCC had significantly lower folate levels than those of controls; there was no significant difference in the mean of plasma vitamin B12 levels. We also observed an inverse association between the levels of plasma folate and HCC: the adjusted odds ratios (OR (95% confidence intervals (CI of HCC from the highest to lowest quartile of folate were 0.30 (0.15–0.60, 0.33 (0.17–0.65, and 0.19 (0.09–0.38. Compared to the subjects in the lowest quartile of plasma vitamin B12, only the subjects in the highest quartile of vitamin B12 exhibited a significant positive relationship with HCC, the adjusted OR was 2.01 (95% CI, 1.02–3.98. HCC patients with Stage III and IV or bigger tumor size had lower folate and higher vitamin B12 levels. There was no significant difference in the mean plasma folate levels of the HCC cases in tumor markers status (AFP, CEA and CA19-9 levels, whereas patients with higher CEA or CA19-9 levels retained significantly more plasma vitamin B12 than those with normal-CEA or CA19-9 level. In conclusion, plasma folate and vitamin B12 levels could be associated with HCC, and might be used as predictors of clinical characteristics of HCC patients. However, further prospective studies are essential to confirm the observed results.

Validation of Folate-Enriched Eggs as a Functional Food for Improving Folate Intake in Consumers

Directory of Open Access Journals (Sweden)

Leslie Altic

2016-11-01

Full Text Available Functional foods enriched with folate may be beneficial as a means of optimizing folate status in consumers. We recently developed novel eggs enriched with folate through folic acid supplementation of the hen’s feed, but their potential to influence consumer folate status is unknown because the natural folate forms incorporated into the eggs may not necessarily be retained during storage and cooking. This study aimed to determine the stability of natural folates in folate-enriched eggs under typical conditions of storage and cooking. Total folate was determined by microbiological assay following tri-enzyme treatment in folate-enriched eggs and un-enriched (barn and free-range on the day they were laid, after storage (up to 27 days and after using four typical cooking methods (boiling, poaching, frying, scrambling for different durations. On the day of laying, the folate content of enriched eggs was found to be significantly higher than that of un-enriched barn or free-range eggs (mean ± SD; 123.2 ± 12.4 vs. 41.2 ± 2.8 vs. 65.6 ± 18.5 µg/100 g; p < 0.001. Storage at refrigerator and room temperature for periods up to the Best Before date resulted in no significant losses to the folate content of folate-enriched eggs. Furthermore, folate in enriched eggs remained stable when cooked by four typical methods for periods up to the maximum cooking time (e.g., 135 ± 22.5, 133.9 ± 23.0 and 132.5 ± 35.1; p = 0.73, for raw, scrambled for 50 s and scrambled for 2 min, respectively. Thus, natural folates in folate-enriched eggs remain highly stable with little or no losses following storage and cooking. These findings are important because they demonstrate the feasibility of introducing folate-enriched eggs into the diet of consumers as functional foods with enriched folate content. Further studies will confirm their effectiveness in optimizing the biomarker folate status of consumers.

Genome-wide association analysis confirms and extends the association of SLC2A9 with serum uric acid levels to Mexican Americans

Directory of Open Access Journals (Sweden)

Venkata Saroja eVoruganti

2013-12-01

Full Text Available Increased serum uric acid (SUA is a risk factor for gout and renal and cardiovascular disease. The purpose of this study was to identify genetic factors that affect the variation in SUA in 632 Mexican Americans participants of the San Antonio Family Heart Study (SAFHS. A genome-wide association analysis was performed using the Illumina Human Hap 550K single nucleotide polymorphism (SNP microarray. We used a linear regression-based association test under an additive model of allelic effect, while accounting for non-independence among family members via a kinship variance component. All analyses were performed in the software package SOLAR. SNPs rs6832439, rs13131257 and rs737267 in solute carrier protein 2 family, member 9 (SLC2A9 were associated with SUA at genome-wide significance (p <1.3×10-7. The minor alleles of these SNPs had frequencies of 36.2%, 36.2%, and 38.2 %, respectively, and were associated with decreasing SUA levels. All of these SNPs were located in introns 3-7 of SLC2A9, the location of the previously reported associations in European populations. When analyzed for association with cardiovascular-renal disease risk factors, conditional on SLC2A9 SNPs strongly associated with SUA, significant associations were found for SLC2A9 SNPs with BMI, body weight and waist circumference (p < 1.4 x 10-3 and suggestive associations with albumin-creatinine ratio and total antioxidant status. The SLC2A9 gene encodes an urate transporter that has considerable influence on variation in SUA. In addition to the primary association locus, suggestive evidence (p<1.9×10-6 for joint linkage/association was found at a previously-reported urate quantitative trait locus (Logarithm of odds score = 3.6 on 3p26.3. In summary, our GWAS extends and confirms the association of SLC2A9 with SUA for the first time in a Mexican American cohort and also shows for the first time its association with cardiovascular-renal disease risk factors.

The role of SLC2A1 in early onset and childhood absence epilepsies

DEFF Research Database (Denmark)

Muhle, Hiltrud; Helbig, Ingo; Frøslev, Tobias Guldberg

2013-01-01

Early Onset Absence Epilepsy constitutes an Idiopathic Generalized Epilepsy with absences starting before the age of four years. Mutations in SLC2A1, encoding the glucose transporter, account for approximately 10% of EOAE cases. The role of SLC2A1 mutations in absence epilepsies with a later onset...

Physiological responses to folate overproduction in Lactobacillus plantarum WCFS1

NARCIS (Netherlands)

Wegkamp, A.; Mars, A.E.; Faijes, M.; Molenaar, D.; Vos, de R.C.H.; Klaus, M.J.; Hanson, A.D.; Vos, de W.M.; Smid, E.J.

2010-01-01

Background Using a functional genomics approach we addressed the impact of folate overproduction on metabolite formation and gene expression in Lactobacillus plantarum WCFS1. We focused specifically on the mechanism that reduces growth rates in folate-overproducing cells. Results Metabolite

Positive selection in the SLC11A1 gene in the family Equidae

DEFF Research Database (Denmark)

Bayerova, Zuzana; Janova, Eva; Matiasovic, Jan

2016-01-01

Immunity-related genes are a suitable model for studying effects of selection at the genomic level. Some of them are highly conserved due to functional constraints and purifying selection, while others are variable and change quickly to cope with the variation of pathogens. The SLC11A1 gene encodes...... a transporter protein mediating antimicrobial activity of macrophages. Little is known about the patterns of selection shaping this gene during evolution. Although it is a typical evolutionarily conserved gene, functionally important polymorphisms associated with various diseases were identified in humans...... and other species. We analyzed the genomic organization, genetic variation, and evolution of the SLC11A1 gene in the family Equidae to identify patterns of selection within this important gene. Nucleotide SLC11A1 sequences were shown to be highly conserved in ten equid species, with more than 97 % sequence...

Mutations in the GABA Transporter SLC6A1 Cause Epilepsy with Myoclonic-Atonic Seizures

DEFF Research Database (Denmark)

Carvill, Gemma L; McMahon, Jacinta M; Schneider, Amy

2015-01-01

GAT-1, encoded by SLC6A1, is one of the major gamma-aminobutyric acid (GABA) transporters in the brain and is responsible for re-uptake of GABA from the synapse. In this study, targeted resequencing of 644 individuals with epileptic encephalopathies led to the identification of six SLC6A1 mutatio...

Dicty_cDB: SLC405 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC405 (Link to dictyBase) - - - Contig-U11279-1 | Contig-U16243-1 SLC4...05P (Link to Original site) SLC405F 536 SLC405Z 439 SLC405P 975 - - Show SLC405 Library SL (Link to library) Clone ID SLC4...79-1 | Contig-U16243-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-A/SLC4...05Q.Seq.d/ Representative seq. ID SLC405P (Link to Original site) Representative DNA sequence >SLC405 (SLC4...05Q) /CSM/SL/SLC4-A/SLC405Q.Seq.d/ ATAACTAATAAAATGTCATTCAATTCAAGAATTGAAACTATTTCTCGCCACTTAAGCACT

Major involvement of Na(+) -dependent multivitamin transporter (SLC5A6/SMVT) in uptake of biotin and pantothenic acid by human brain capillary endothelial cells.

Science.gov (United States)

Uchida, Yasuo; Ito, Katsuaki; Ohtsuki, Sumio; Kubo, Yoshiyuki; Suzuki, Takashi; Terasaki, Tetsuya

2015-07-01

The purpose of this study was to clarify the expression of Na(+) -dependent multivitamin transporter (SLC5A6/SMVT) and its contribution to the supply of biotin and pantothenic acid to the human brain via the blood-brain barrier. DNA microarray and immunohistochemical analyses confirmed that SLC5A6 is expressed in microvessels of human brain. The absolute expression levels of SLC5A6 protein in isolated human and monkey brain microvessels were 1.19 and 0.597 fmol/μg protein, respectively, as determined by a quantitative targeted absolute proteomics technique. Using an antibody-free method established by Kubo et al. (2015), we found that SLC5A6 was preferentially localized at the luminal membrane of brain capillary endothelium. Knock-down analysis using SLC5A6 siRNA showed that SLC5A6 accounts for 88.7% and 98.6% of total [(3) H]biotin and [(3) H]pantothenic acid uptakes, respectively, by human cerebral microvascular endothelial cell line hCMEC/D3. SLC5A6-mediated transport in hCMEC/D3 was markedly inhibited not only by biotin and pantothenic acid, but also by prostaglandin E2, lipoic acid, docosahexaenoic acid, indomethacin, ketoprofen, diclofenac, ibuprofen, phenylbutazone, and flurbiprofen. This study is the first to confirm expression of SLC5A6 in human brain microvessels and to provide evidence that SLC5A6 is a major contributor to luminal uptake of biotin and pantothenic acid at the human blood-brain barrier. In humans, it was unclear (not concluded) about what transport system at the blood-brain barrier (BBB) is responsible for the brain uptakes of two vitamins, biotin and pantothenic acid, which are necessary for brain proper function. This study clarified for the first time that the solute carrier 5A6/Na(+) -dependent multivitamin transporter SLC5A6/SMVT is responsible for the supplies of biotin and pantothenic acid into brain across the BBB in humans. DHA, docosahexaenoic acid; NSAID, non-steroidal anti-inflammatory drug; PGE2, prostaglandin E2. © 2015

Genetic variations in the MCT1 (SLC16A1) gene in the Chinese population of Singapore.

Science.gov (United States)

Lean, Choo Bee; Lee, Edmund Jon Deoon

2009-01-01

MCT1(SLC16A1) is the first member of the monocarboxylate transporter (MCT) and its family is involved in the transportation of metabolically important monocarboxylates such as lactate, pyruvate, acetate and ketone bodies. This study identifies genetic variations in SLC16A1 in the ethnic Chinese group of the Singaporean population (n=95). The promoter, coding region and exon-intron junctions of the SLC16A1 gene encoding the MCT1 transporter were screened for genetic variation in the study population by DNA sequencing. Seven genetic variations of SLC16A1, including 4 novel ones, were found: 2 in the promoter region, 2 in the coding exons (both nonsynonymous variations), 2 in the 3' untranslated region (3'UTR) and 1 in the intron. Of the two mutations detected in the promoter region, the -363-855T>C is a novel mutation. The 1282G>A (Val(428)Ile) is a novel SNP and was found as heterozygotic in 4 subjects. The 1470T>A (Asp(490)Glu) was found to be a common polymorphism in this study. Lastly, IVS3-17A>C in intron 3 and 2258 (755)A>G in 3'UTR are novel mutations found to be common polymorphisms in the local Chinese population. To our knowledge, this is the first report of a comprehensive analysis on the MCT1 gene in any population.

Synthesis and characterization of folate-poly(ethylene glycol ...

African Journals Online (AJOL)

polyethylenimine as a non-viral carrier for tumor-targeted gene delivery. ... It was concluded that FA-PEG-CHI-g-PEI, which has improved transfection efficiency and FRs specificity in vitro and in vivo, may be useful in gene therapy. Key words: Folate ...

Action Potential Shortening and Impairment of Cardiac Function by Ablation of Slc26a6.

Science.gov (United States)

Sirish, Padmini; Ledford, Hannah A; Timofeyev, Valeriy; Thai, Phung N; Ren, Lu; Kim, Hyo Jeong; Park, Seojin; Lee, Jeong Han; Dai, Gu; Moshref, Maryam; Sihn, Choong-Ryoul; Chen, Wei Chun; Timofeyeva, Maria Valeryevna; Jian, Zhong; Shimkunas, Rafael; Izu, Leighton T; Chiamvimonvat, Nipavan; Chen-Izu, Ye; Yamoah, Ebenezer N; Zhang, Xiao-Dong

2017-10-01

Intracellular pH (pH i ) is critical to cardiac excitation and contraction; uncompensated changes in pH i impair cardiac function and trigger arrhythmia. Several ion transporters participate in cardiac pH i regulation. Our previous studies identified several isoforms of a solute carrier Slc26a6 to be highly expressed in cardiomyocytes. We show that Slc26a6 mediates electrogenic Cl - /HCO 3 - exchange activities in cardiomyocytes, suggesting the potential role of Slc26a6 in regulation of not only pH i , but also cardiac excitability. To test the mechanistic role of Slc26a6 in the heart, we took advantage of Slc26a6 knockout ( Slc26a6 -/ - ) mice using both in vivo and in vitro analyses. Consistent with our prediction of its electrogenic activities, ablation of Slc26a6 results in action potential shortening. There are reduced Ca 2+ transient and sarcoplasmic reticulum Ca 2+ load, together with decreased sarcomere shortening in Slc26a6 -/ - cardiomyocytes. These abnormalities translate into reduced fractional shortening and cardiac contractility at the in vivo level. Additionally, pH i is elevated in Slc26a6 -/ - cardiomyocytes with slower recovery kinetics from intracellular alkalization, consistent with the Cl - /HCO 3 - exchange activities of Slc26a6. Moreover, Slc26a6 -/ - mice show evidence of sinus bradycardia and fragmented QRS complex, supporting the critical role of Slc26a6 in cardiac conduction system. Our study provides mechanistic insights into Slc26a6, a unique cardiac electrogenic Cl - /HCO 3 - transporter in ventricular myocytes, linking the critical roles of Slc26a6 in regulation of pH i , excitability, and contractility. pH i is a critical regulator of other membrane and contractile proteins. Future studies are needed to investigate possible changes in these proteins in Slc26a6 -/ - mice. © 2017 American Heart Association, Inc.

Contribution of SLC30A8 variants to the risk of type 2 diabetes in a multi-ethnic population: a case control study

OpenAIRE

Salem, Sameer D; Saif-Ali, Riyadh; Ismail, Ikram S; Al-Hamodi, Zaid; Muniandy, Sekaran

2014-01-01

Background Several studies have shown the association of solute carrier family 30 (zinc transporter) member 8 (SLC30A8) rs13266634 with type 2 diabetes (T2D). However, the association of alternative variants and haplotypes of SLC30A8 with T2D have not been studied in different populations. The aim of this study is to assess the association of the alternative SLC30A8 variants, rs7002176 and rs1995222 as well as the most common variant, rs13266634 and haplotypes with glutamic acid decarboxylase...

Validation of Folate-Enriched Eggs as a Functional Food for Improving Folate Intake in Consumers

OpenAIRE

Altic, Leslie; McNulty, Helene; Hoey, Leane; McAnena, Liadhan; Pentieva, Kristina

2016-01-01

Functional foods enriched with folate may be beneficial as a means of optimizing folate status in consumers. We recently developed novel eggs enriched with folate through folic acid supplementation of the hen’s feed, but their potential to influence consumer folate status is unknown because the natural folate forms incorporated into the eggs may not necessarily be retained during storage and cooking. This study aimed to determine the stability of natural folates in folate-enriched eggs under ...

Regulation of the human SLC25A20 expression by peroxisome proliferator-activated receptor alpha in human hepatoblastoma cells

International Nuclear Information System (INIS)

Tachibana, Keisuke; Takeuchi, Kentaro; Inada, Hirohiko; Yamasaki, Daisuke; Ishimoto, Kenji; Tanaka, Toshiya; Hamakubo, Takao; Sakai, Juro; Kodama, Tatsuhiko; Doi, Takefumi

2009-01-01

Solute carrier family 25, member 20 (SLC25A20) is a key molecule that transfers acylcarnitine esters in exchange for free carnitine across the mitochondrial membrane in the mitochondrial β-oxidation. The peroxisome proliferator-activated receptor alpha (PPARα) is a ligand-activated transcription factor that plays an important role in the regulation of β-oxidation. We previously established tetracycline-regulated human cell line that can be induced to express PPARα and found that PPARα induces the SLC25A20 expression. In this study, we analyzed the promoter region of the human slc25a20 gene and showed that PPARα regulates the expression of human SLC25A20 via the peroxisome proliferator responsive element.

Low molecular weight chitosan conjugated with folate for siRNA delivery in vitro: optimization studies

Science.gov (United States)

Fernandes, Julio C; Qiu, Xingping; Winnik, Francoise M; Benderdour, Mohamed; Zhang, Xiaoling; Dai, Kerong; Shi, Qin

2012-01-01

The low transfection efficiency of chitosan is one of its drawbacks as a gene delivery carrier. Low molecular weight chitosan may help to form small-sized polymer-DNA or small interfering RNA (siRNA) complexes. Folate conjugation may improve gene transfection efficiency because of the promoted uptake of folate receptor-bearing cells. In the present study, chitosan was conjugated with folate and investigated for its efficacy as a delivery vector for siRNA in vitro. We demonstrate that the molecular weight of chitosan has a major influence on its biological and physicochemical properties, and very low molecular weight chitosan (below 10 kDa) has difficulty in forming stable complexes with siRNA. In this study, chitosan 25 kDa and 50 kDa completely absorbed siRNA and formed nanoparticles (≤220 nm) at a chitosan to siRNA weight ratio of 50:1. The introduction of a folate ligand onto chitosan decreased nanoparticle toxicity. Compared with chitosan-siRNA, folate-chitosan-siRNA nanoparticles improved gene silencing transfection efficiency. Therefore, folate-chitosan shows potential as a viable candidate vector for safe and efficient siRNA delivery. PMID:23209368

Folate bioavailability

OpenAIRE

Öhrvik, Veronica

2009-01-01

An inadequate folate status is associated with increased risk of anaemia and neural tube defects. In many countries a folate intake below recommendations has been reported for women in childbearing age. However, data on folate intake and status are not always associated, since factors other than intake, e.g. bioavailability, affect folate status. This thesis studied the bioavailability of folate using in vivo and in vitro models. The effect of two pieces of Swedish nutritional advice on folat...

Dicty_cDB: SLC411 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC411 (Link to dictyBase) - - - Contig-U16272-1 SLC411Z (Link... to Original site) - - SLC411Z 486 - - - - Show SLC411 Library SL (Link to library) Clone ID SLC411 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-A/SLC411Q.Seq.d/ Representative seq. ID SLC41...1Z (Link to Original site) Representative DNA sequence >SLC411 (SLC411Q) /CSM/SL/SLC4-A/SLC411Q.Seq.d/ XXXXX...vacuolar 4.0 %: peroxisomal >> prediction for SLC411 is nuc 5' end seq. ID - 5' e

Dicty_cDB: SLC424 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC424 (Link to dictyBase) - G01086 DDB0231665 Contig-U08784-1 SLC4...24P (Link to Original site) SLC424F 169 SLC424Z 538 SLC424P 707 - - Show SLC424 Library SL (Link to library) Clone ID SLC4...ontig-U08784-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-A/SLC4...24Q.Seq.d/ Representative seq. ID SLC424P (Link to Original site) Representative DNA sequence >SLC424 (SLC424Q) /CSM/SL/SLC4...-A/SLC424Q.Seq.d/ GGATATTATAATTTCAAATTAAGTTTTATAAATTTGAAATAATATTGAAAAAAAAAAAAA ATAAAAAA

Dicty_cDB: SLC492 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC492 (Link to dictyBase) - - - Contig-U10734-1 | Contig-U12865-1 SLC4...92P (Link to Original site) SLC492F 645 SLC492Z 550 SLC492P 1195 - - Show SLC492 Library SL (Link to library) Clone ID SLC4...734-1 | Contig-U12865-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-D/SLC4...92Q.Seq.d/ Representative seq. ID SLC492P (Link to Original site) Representative DNA sequence >SLC492 (SLC4...92Q) /CSM/SL/SLC4-D/SLC492Q.Seq.d/ AAAAAAAAAATATACAAATAATGAATAAATTTTTAGCTTTGTTATTTGTTTTAGCTTTGT

Dicty_cDB: SLC432 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC432 (Link to dictyBase) - - - Contig-U09715-1 | Contig-U16382-1 SLC4...32P (Link to Original site) SLC432F 633 SLC432Z 188 SLC432P 821 - - Show SLC432 Library SL (Link to library) Clone ID SLC4...15-1 | Contig-U16382-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC4...32Q.Seq.d/ Representative seq. ID SLC432P (Link to Original site) Representative DNA sequence >SLC432 (SLC4...32Q) /CSM/SL/SLC4-B/SLC432Q.Seq.d/ ATTAAATTAAATAAAAAATAAAAATGGATGGTGAAGATGTTCAAGCTTTAGTTATTGATA

Dicty_cDB: SLC481 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC481 (Link to dictyBase) - - - Contig-U16358-1 SLC481Z (Link... to Original site) - - SLC481Z 393 - - - - Show SLC481 Library SL (Link to library) Clone ID SLC481 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-D/SLC481Q.Seq.d/ Representative seq. ID SLC48...1Z (Link to Original site) Representative DNA sequence >SLC481 (SLC481Q) /CSM/SL/SLC4-D/SLC481Q.Seq.d/ XXXXX...SL/SLG8-A/SLG820Q.Seq.d/ 708 0.0 SLC481 (SLC481Q) /CSM/SL/SLC4-D/SLC481Q.Seq.d/ 708 0.0 SLC178 (SLC178Q) /CS

Comprehensive evaluation of one-carbon metabolism pathway gene variants and renal cell cancer risk.

Directory of Open Access Journals (Sweden)

Todd M Gibson

Full Text Available Folate and one-carbon metabolism are linked to cancer risk through their integral role in DNA synthesis and methylation. Variation in one-carbon metabolism genes, particularly MTHFR, has been associated with risk of a number of cancers in epidemiologic studies, but little is known regarding renal cancer.Tag single nucleotide polymorphisms (SNPs selected to produce high genomic coverage of 13 gene regions of one-carbon metabolism (ALDH1L1, BHMT, CBS, FOLR1, MTHFR, MTR, MTRR, SHMT1, SLC19A1, TYMS and the closely associated glutathione synthesis pathway (CTH, GGH, GSS were genotyped for 777 renal cell carcinoma (RCC cases and 1,035 controls in the Central and Eastern European Renal Cancer case-control study. Associations of individual SNPs (n = 163 with RCC risk were calculated using unconditional logistic regression adjusted for age, sex and study center. Minimum p-value permutation (Min-P tests were used to identify gene regions associated with risk, and haplotypes were evaluated within these genes.The strongest associations with RCC risk were observed for SLC19A1 (P(min-P = 0.03 and MTHFR (P(min-P = 0.13. A haplotype consisting of four SNPs in SLC19A1 (rs12483553, rs2838950, rs2838951, and rs17004785 was associated with a 37% increased risk (p = 0.02, and exploratory stratified analysis suggested the association was only significant among those in the lowest tertile of vegetable intake.To our knowledge, this is the first study to comprehensively examine variation in one-carbon metabolism genes in relation to RCC risk. We identified a novel association with SLC19A1, which is important for transport of folate into cells. Replication in other populations is required to confirm these findings.

Language disorder with mild intellectual disability in a child affected by a novel mutation of SLC6A8 gene.

Science.gov (United States)

Battini, R; Chilosi, A M; Casarano, M; Moro, F; Comparini, A; Alessandrì, M G; Leuzzi, V; Tosetti, M; Cioni, G

2011-02-01

We describe the clinical and molecular features of a child harboring a novel mutation in SLC6A8 gene in association with a milder phenotype than other creatine transporter (CT1) deficient patients (OMIM 300352) [1-7]. The mutation c.757 G>C p.G253R in exon 4 of SLC6A8 was hemizygous in the child, aged 6 years and 6 months, who showed mild intellectual disability with severe speech and language delay. His carrier mother had borderline intellectual functioning. Although the neurochemical and biochemical parameters were fully consistent with those reported in the literature for subjects with CT1 deficit, in our patient within a general cognitive disability, a discrepancy between nonverbal and verbal skills was observed, confirming the peculiar vulnerability of language development under brain Cr depletion. Copyright © 2010 Elsevier Inc. All rights reserved.

Dicty_cDB: SLC420 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC420 (Link to dictyBase) - G01085 DDB0205634 Contig-U01169-1 | Contig-U15736-1 SLC4...20P (Link to Original site) SLC420F 333 SLC420Z 423 SLC420P 756 - - Show SLC420 Libra...ry SL (Link to library) Clone ID SLC420 (Link to dictyBase) Atlas ID - NBRP ID G01085 dictyBase ID DDB020563...cdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-A/SLC420Q.Seq.d/ Representative seq. ID SLC420P (Link to Original site) R...epresentative DNA sequence >SLC420 (SLC420Q) /CSM/SL/SLC4-A/SLC420Q.Seq.d/ GCTAGCACACACATAAATAATACATACACACAT

Endocytosis of GPI-linked membrane folate receptor-alpha.

Science.gov (United States)

Rijnboutt, S; Jansen, G; Posthuma, G; Hynes, J B; Schornagel, J H; Strous, G J

1996-01-01

GPI-linked membrane folate receptors (MFRs) have been implicated in the receptor-mediated uptake of reduced folate cofactors and folate-based chemotherapeutic drugs. We have studied the biosynthetic transport to and internalization of MFR isoform alpha in KB-cells. MFR-alpha was synthesized as a 32-kD protein and converted in a maturely glycosylated 36-38-kD protein 1 h after synthesis. 32-kD MFR-alpha was completely soluble in Triton X-100 at 0 degree C. In contrast, only 33% of the 36-38-kD species could be solubilized at these conditions whereas complete solubilization was obtained in Triton X-100 at 37 degrees C or in the presence of saponin at 0 degree C. Similar solubilization characteristics were found when MFR-alpha at the plasma membrane was labeled with a crosslinkable 125I-labeled photoaffinity-analog of folic acid as a ligand. Triton X-100-insoluble membrane domains containing MFR-alpha could be separated from soluble MFR-alpha on sucrose flotation gradients. Only Triton X-100 soluble MFR-alpha was internalized from the plasma membrane. The reduced-folate-carrier, an integral membrane protein capable of translocating (anti-)folates across membranes, was completely excluded from the Triton X-100-resistant membrane domains. Internalized MFR-alpha recycled slowly to the cell surface during which it remained soluble in Triton X-100 at 0 degree C. Using immunoelectron microscopy, we found MFR-alpha along the entire endocytic pathway: in clathrin-coated buds and vesicles, and in small and large endosomal vacuoles. In conclusion, our data indicate that a large fraction, if not all, of internalizing MFR-alpha bypasses caveolae.

Dicty_cDB: SLC419 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC419 (Link to dictyBase) - - - Contig-U03801-1 SLC419Z (Link... to Original site) - - SLC419Z 335 - - - - Show SLC419 Library SL (Link to library) Clone ID SLC419 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-A/SLC419Q.Seq.d/ Representative seq. ID SLC41...9Z (Link to Original site) Representative DNA sequence >SLC419 (SLC419Q) /CSM/SL/SLC4-A/SLC419Q.Seq.d/ XXXXX...I6-A/SSI602Q.Seq.d/ 490 e-138 SSD173 (SSD173Q) /CSM/SS/SSD1-D/SSD173Q.Seq.d/ 490 e-138 SLC419 (SLC4

Dicty_cDB: SLC409 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC409 (Link to dictyBase) - - - Contig-U14931-1 SLC409Z (Link... to Original site) - - SLC409Z 483 - - - - Show SLC409 Library SL (Link to library) Clone ID SLC409 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-A/SLC409Q.Seq.d/ Representative seq. ID SLC40...9Z (Link to Original site) Representative DNA sequence >SLC409 (SLC409Q) /CSM/SL/SLC4-A/SLC409Q.Seq.d/ XXXXX... SLH501 (SLH501Q) /CSM/SL/SLH5-A/SLH501Q.Seq.d/ 858 0.0 SLF191 (SLF191Q) /CSM/SL/SLF1-D/SLF191Q.Seq.d/ 858 0.0 SLC409 (SLC4

Na(+) dependent acid-base transporters in the choroid plexus; insights from slc4 and slc9 gene deletion studies

DEFF Research Database (Denmark)

Christensen, Henriette L; Nguyen, An T; Pedersen, Fredrik D

2013-01-01

The choroid plexus epithelium (CPE) is located in the ventricular system of the brain, where it secretes the majority of the cerebrospinal fluid (CSF) that fills the ventricular system and surrounds the central nervous system. The CPE is a highly vascularized single layer of cuboidal cells....... Genetically modified mice targeting slc4a2, slc4a5, slc4a7, slc4a10, and slc9a1 have been generated. Deletion of slc4a5, 7 or 10, or slc9a1 has numerous impacts on CP function and structure in these mice. Removal of the transporters affects brain ventricle size (slc4a5 and slc4a10) and intracellular p...

Assessing the Association between Natural Food Folate Intake and Blood Folate Concentrations: A Systematic Review and Bayesian Meta-Analysis of Trials and Observational Studies

Directory of Open Access Journals (Sweden)

Claire M. Marchetta

2015-04-01

Full Text Available Folate is found naturally in foods or as synthetic folic acid in dietary supplements and fortified foods. Adequate periconceptional folic acid intake can prevent neural tube defects. Folate intake impacts blood folate concentration; however, the dose-response between natural food folate and blood folate concentrations has not been well described. We estimated this association among healthy females. A systematic literature review identified studies (1 1992–3 2014 with both natural food folate intake alone and blood folate concentration among females aged 12–49 years. Bayesian methods were used to estimate regression model parameters describing the association between natural food folate intake and subsequent blood folate concentration. Seven controlled trials and 29 observational studies met the inclusion criteria. For the six studies using microbiologic assay (MA included in the meta-analysis, we estimate that a 6% (95% Credible Interval (CrI: 4%, 9% increase in red blood cell (RBC folate concentration and a 7% (95% CrI: 1%, 12% increase in serum/plasma folate concentration can occur for every 10% increase in natural food folate intake. Using modeled results, we estimate that a natural food folate intake of ≥450 μg dietary folate equivalents (DFE/day could achieve the lower bound of an RBC folate concentration (~1050 nmol/L associated with the lowest risk of a neural tube defect. Natural food folate intake affects blood folate concentration and adequate intakes could help women achieve a RBC folate concentration associated with a risk of 6 neural tube defects/10,000 live births.

Assessing the association between natural food folate intake and blood folate concentrations: a systematic review and Bayesian meta-analysis of trials and observational studies.

Science.gov (United States)

Marchetta, Claire M; Devine, Owen J; Crider, Krista S; Tsang, Becky L; Cordero, Amy M; Qi, Yan Ping; Guo, Jing; Berry, Robert J; Rosenthal, Jorge; Mulinare, Joseph; Mersereau, Patricia; Hamner, Heather C

2015-04-10

Folate is found naturally in foods or as synthetic folic acid in dietary supplements and fortified foods. Adequate periconceptional folic acid intake can prevent neural tube defects. Folate intake impacts blood folate concentration; however, the dose-response between natural food folate and blood folate concentrations has not been well described. We estimated this association among healthy females. A systematic literature review identified studies (1 1992-3 2014) with both natural food folate intake alone and blood folate concentration among females aged 12-49 years. Bayesian methods were used to estimate regression model parameters describing the association between natural food folate intake and subsequent blood folate concentration. Seven controlled trials and 29 observational studies met the inclusion criteria. For the six studies using microbiologic assay (MA) included in the meta-analysis, we estimate that a 6% (95% Credible Interval (CrI): 4%, 9%) increase in red blood cell (RBC) folate concentration and a 7% (95% CrI: 1%, 12%) increase in serum/plasma folate concentration can occur for every 10% increase in natural food folate intake. Using modeled results, we estimate that a natural food folate intake of ≥ 450 μg dietary folate equivalents (DFE)/day could achieve the lower bound of an RBC folate concentration (~ 1050 nmol/L) associated with the lowest risk of a neural tube defect. Natural food folate intake affects blood folate concentration and adequate intakes could help women achieve a RBC folate concentration associated with a risk of 6 neural tube defects/10,000 live births.

Effects of Polyethylene Glycol Spacer Length and Ligand Density on Folate Receptor Targeting of Liposomal Doxorubicin In Vitro

Directory of Open Access Journals (Sweden)

Kumi Kawano

2011-01-01

Full Text Available The folate receptor is an attractive target for selective tumor delivery of liposomal doxorubicin (DXR because it is abundantly expressed in a large percentage of tumors. This study examined the effect of polyethylene glycol (PEG spacer length and folate ligand density on the targeting ability of folate-modified liposomes. Liposomes were modified with folate-derivatized PEG-distearoylphosphatidylethanolamine with PEG molecular weights of 2000, 3400, or 5000. The association of DXR-loaded liposomes with KB cells, which overexpress the folate receptor, was evaluated by flow cytometry at various ratios of folate modification. A low ratio of folate modification with a sufficiently long PEG chain showed the highest folate receptor-mediated association with the cells, but did not show the highest in vitro cytotoxicity. DXR release from folate-modified liposomes in endosomes might be different. These findings will be useful for designing folate receptor-targeting carriers.

Validation of Folate-Enriched Eggs as a Functional Food for Improving Folate Intake in Consumers.

Science.gov (United States)

Altic, Leslie; McNulty, Helene; Hoey, Leane; McAnena, Liadhan; Pentieva, Kristina

2016-11-30

Functional foods enriched with folate may be beneficial as a means of optimizing folate status in consumers. We recently developed novel eggs enriched with folate through folic acid supplementation of the hen's feed, but their potential to influence consumer folate status is unknown because the natural folate forms incorporated into the eggs may not necessarily be retained during storage and cooking. This study aimed to determine the stability of natural folates in folate-enriched eggs under typical conditions of storage and cooking. Total folate was determined by microbiological assay following tri-enzyme treatment in folate-enriched eggs and un-enriched (barn and free-range) on the day they were laid, after storage (up to 27 days) and after using four typical cooking methods (boiling, poaching, frying, scrambling) for different durations. On the day of laying, the folate content of enriched eggs was found to be significantly higher than that of un-enriched barn or free-range eggs (mean ± SD; 123.2 ± 12.4 vs. 41.2 ± 2.8 vs. 65.6 ± 18.5 µg/100 g; p functional foods with enriched folate content. Further studies will confirm their effectiveness in optimizing the biomarker folate status of consumers.

Regulation of the human SLC25A20 expression by peroxisome proliferator-activated receptor alpha in human hepatoblastoma cells

Energy Technology Data Exchange (ETDEWEB)

Tachibana, Keisuke, E-mail: nya@phs.osaka-u.ac.jp [Graduate School of Pharmaceutical Sciences, Osaka University, 1-6 Yamadaoka, Suita, Osaka 565-0871 (Japan); Takeuchi, Kentaro; Inada, Hirohiko [Graduate School of Pharmaceutical Sciences, Osaka University, 1-6 Yamadaoka, Suita, Osaka 565-0871 (Japan); Yamasaki, Daisuke [Graduate School of Pharmaceutical Sciences, Osaka University, 1-6 Yamadaoka, Suita, Osaka 565-0871 (Japan); The Center for Advanced Medical Engineering and Informatics, Osaka University, 2-2 Yamadaoka, Suita, Osaka 565-0871 (Japan); Ishimoto, Kenji [Graduate School of Pharmaceutical Sciences, Osaka University, 1-6 Yamadaoka, Suita, Osaka 565-0871 (Japan); Graduate School of Medicine, Osaka University, 2-2 Yamadaoka, Suita, Osaka 565-0871 (Japan); Tanaka, Toshiya; Hamakubo, Takao; Sakai, Juro; Kodama, Tatsuhiko [Laboratory for System Biology and Medicine, Research Center for Advanced Science and Technology, University of Tokyo, 4-6-1 Komaba, Meguro, Tokyo 153-8904 (Japan); Doi, Takefumi [Graduate School of Pharmaceutical Sciences, Osaka University, 1-6 Yamadaoka, Suita, Osaka 565-0871 (Japan); The Center for Advanced Medical Engineering and Informatics, Osaka University, 2-2 Yamadaoka, Suita, Osaka 565-0871 (Japan); Graduate School of Medicine, Osaka University, 2-2 Yamadaoka, Suita, Osaka 565-0871 (Japan)

2009-11-20

Solute carrier family 25, member 20 (SLC25A20) is a key molecule that transfers acylcarnitine esters in exchange for free carnitine across the mitochondrial membrane in the mitochondrial {beta}-oxidation. The peroxisome proliferator-activated receptor alpha (PPAR{alpha}) is a ligand-activated transcription factor that plays an important role in the regulation of {beta}-oxidation. We previously established tetracycline-regulated human cell line that can be induced to express PPAR{alpha} and found that PPAR{alpha} induces the SLC25A20 expression. In this study, we analyzed the promoter region of the human slc25a20 gene and showed that PPAR{alpha} regulates the expression of human SLC25A20 via the peroxisome proliferator responsive element.

Polymorphisms in folate pathway and pemetrexed treatment outcome in patients with malignant pleural mesothelioma

International Nuclear Information System (INIS)

Goricar, Katja; Kovac, Viljem; Dolzan, Vita

2014-01-01

A combination of pemetrexed and cisplatin has been shown to improve the outcome in patients with malignant pleural mesothelioma (MPM), however, there is a great heterogeneity in treatment response among patients. The aim of our study was to evaluate the influence of polymorphisms in folate pathway and transporter genes on pemetrexed treatment outcome in Slovenian patients with MPM. MPM patients treated with pemetrexed in the course of a prospective randomized clinical trial were genotyped for nineteen polymorphisms in five genes of folate pathway and six transporter genes. Logistic regression was used to assess the influence of polymorphisms on treatment efficacy and toxicity, while Cox regression was used to determine their influence on progression-free and overall survival. Patients with at least one polymorphic MTHFD1 rs2236225 allele had a significantly lower response rate (p = 0.005; odds ratio [OR] = 0.12; 95% confidence interval [CI] = 0.03−0.54) and shorter progression-free survival (p = 0.032; hazard ratio [HR] = 3.10; 95% CI = 1.10−8.74) than non-carriers. Polymorphisms in transporter genes did not influence survival; however, several were associated with toxicity. Liver toxicity was significantly lower in carriers of polymorphic ABCC2 rs2273697 (p = 0.028; OR = 0.23; 95% CI = 0.06−0.85), SLCO1B1 rs4149056 (p = 0.028; OR = 0.23; 95% CI = 0.06−0.85) and rs11045879 (p = 0.014; OR = 0.18; 95% CI = 0.05−0.71) alleles compared to non-carriers, as well as in patients with SLCO1B1 GCAC haplotype (p = 0.048; OR = 0.17; 95% CI = 0.03−0.98). Gastrointestinal toxicity was much more common in patients with polymorphic ABCC2 rs717620 allele (p = 0.004; OR = 10.67; 95% CI = 2.15−52.85) and ABCC2 CAG haplotype (p = 0.006; OR = 5.67; 95% CI = 1.64−19.66). MTHFD1 polymorphism affected treatment response and survival, while polymorphisms in ABCC2 and SLCO1B1 transporter genes influenced the risk for toxicity. These polymorphisms could serve as potential

Dicty_cDB: SLC494 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC494 (Link to dictyBase) - - - Contig-U16260-1 SLC494Z (Link... to Original site) - - SLC494Z 451 - - - - Show SLC494 Library SL (Link to library) Clone ID SLC494 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-D/SLC494Q.Seq.d/ Representative seq. ID SLC49...4Z (Link to Original site) Representative DNA sequence >SLC494 (SLC494Q) /CSM/SL/SLC4-D/SLC494Q.Seq.d/ XXXXX...a: 0.00 m3b: 0.00 m_ : 1.00 52.0 %: cytoplasmic 36.0 %: nuclear 8.0 %: cytoskeletal 4.0 %: mitochondrial >> prediction for SLC4

Dicty_cDB: SLC418 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC418 (Link to dictyBase) - G01921 DDB0191271 Contig-U15820-1 SLC4...18E (Link to Original site) SLC418F 604 SLC418Z 554 SLC418P 1158 SLC418E 1076 Show SLC418 Library SL (L...ink to library) Clone ID SLC418 (Link to dictyBase) Atlas ID - NBRP ID G01921 dictyBase ID DDB0191271 Link t...o Contig Contig-U15820-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-A/SLC4...18Q.Seq.d/ Representative seq. ID SLC418E (Link to Original site) Representative DNA sequence >SLC418 (SLC4

Dicty_cDB: SLC451 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC451 (Link to dictyBase) - - - Contig-U16260-1 SLC451Z (Link... to Original site) - - SLC451Z 389 - - - - Show SLC451 Library SL (Link to library) Clone ID SLC451 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-C/SLC451Q.Seq.d/ Representative seq. ID SLC45...1Z (Link to Original site) Representative DNA sequence >SLC451 (SLC451Q) /CSM/SL/SLC4-C/SLC451Q.Seq.d/ XXXXX... producing significant alignments: (bits) Value SLC451 (SLC451Q) /CSM/SL/SLC4-C/SLC4

Genetic polymorphisms and haplotypes of the organic cation transporter 1 gene (SLC22A1 in the Xhosa population of South Africa

Directory of Open Access Journals (Sweden)

Clifford Jacobs

2014-06-01

Full Text Available Human organic cation transporter 1 is primarily expressed in hepatocytes and mediates the electrogenic transport of various endogenous and exogenous compounds, including clinically important drugs. Genetic polymorphisms in the gene coding for human organic cation transporter 1, SLC22A1, are increasingly being recognized as a possible mechanism explaining the variable response to clinical drugs, which are substrates for this transporter. The genotypic and allelic distributions of 19 nonsynonymous and one intronic SLC22A1 single nucleotide polymorphisms were determined in 148 healthy Xhosa participants from South Africa, using a SNAPshot® multiplex assay. In addition, haplotype structure for SLC22A1 was inferred from the genotypic data. The minor allele frequencies for S14F (rs34447885, P341L (rs2282143, V519F (rs78899680, and the intronic variant rs622342 were 1.7%, 8.4%, 3.0%, and 21.6%, respectively. None of the participants carried the variant allele for R61C (rs12208357, C88R (rs55918055, S189L (rs34104736, G220V (rs36103319, P283L (rs4646277, R287G (rs4646278, G401S (rs34130495, M440I (rs35956182, or G465R (rs34059508. In addition, no variant alleles were observed for A306T (COSM164365, A413V (rs144322387, M420V (rs142448543, I421F (rs139512541, C436F (rs139512541, V501E (rs143175763, or I542V (rs137928512 in the population. Eight haplotypes were inferred from the genotypic data. This study reports important genetic data that could be useful for future pharmacogenetic studies of drug transporters in the indigenous Sub-Saharan African populations.

SLC-2000: A luminosity upgrade for the SLC

International Nuclear Information System (INIS)

Breidenbach, M.; Decker, F.-J.; Helm, R.; Napoly, O.; Phinney, N.; Raimondi, P.; Raubenheimer, T.O.; Siemann, R.; Zimmermann, F.; Hertzbach, S.

1996-01-01

We discuss a possible upgrade to the Stanford Linear Collider (SLC), whose objective is to increase the SLC luminosity by at least a factor 7, to an average Z production rate of more than 35,000 per week. The centerpiece of the upgrade is the installation of a new superconducting final doublet with a field gradient of 240 T/m, which will be placed at a distance of only 70 cm from the interaction point. In addition, several bending magnets in each final focus will be lengthened and two octupole correctors are added. A complementary upgrade of damping rings and bunch compressors will allow optimum use of the modified final focus and can deliver, or exceed, the targeted luminosity. The proposed upgrade will place the SLC physics program in a very competitive position, and will also enable it to pursue its pioneering role as the first and only linear collider. (author)

mTORC1 Activator SLC38A9 Is Required to Efflux Essential Amino Acids from Lysosomes and Use Protein as a Nutrient.

Science.gov (United States)

Wyant, Gregory A; Abu-Remaileh, Monther; Wolfson, Rachel L; Chen, Walter W; Freinkman, Elizaveta; Danai, Laura V; Vander Heiden, Matthew G; Sabatini, David M

2017-10-19

The mTORC1 kinase is a master growth regulator that senses many environmental cues, including amino acids. Activation of mTORC1 by arginine requires SLC38A9, a poorly understood lysosomal membrane protein with homology to amino acid transporters. Here, we validate that SLC38A9 is an arginine sensor for the mTORC1 pathway, and we uncover an unexpectedly central role for SLC38A9 in amino acid homeostasis. SLC38A9 mediates the transport, in an arginine-regulated fashion, of many essential amino acids out of lysosomes, including leucine, which mTORC1 senses through the cytosolic Sestrin proteins. SLC38A9 is necessary for leucine generated via lysosomal proteolysis to exit lysosomes and activate mTORC1. Pancreatic cancer cells, which use macropinocytosed protein as a nutrient source, require SLC38A9 to form tumors. Thus, through SLC38A9, arginine serves as a lysosomal messenger that couples mTORC1 activation to the release from lysosomes of the essential amino acids needed to drive cell growth. Copyright © 2017 Elsevier Inc. All rights reserved.

Developmental consequences of in utero sodium arsenate exposure in mice with folate transport deficiencies

International Nuclear Information System (INIS)

Spiegelstein, Ofer; Gould, Amy; Wlodarczyk, Bogdan; Tsie, Marlene; Lu Xiufen; Le, Chris; Troen, Aron; Selhub, Jacob; Piedrahita, Jorge A.; Salbaum, J. Michael; Kappen, Claudia; Melnyk, Stepan; James, Jill; Finnell, Richard H.

2005-01-01

Previous studies have demonstrated that mice lacking a functional folate binding protein 2 gene (Folbp2 -/- ) were significantly more sensitive to in utero arsenic exposure than were the wild-type mice similarly exposed. When these mice were fed a folate-deficient diet, the embryotoxic effect of arsenate was further exacerbated. Contrary to expectations, studies on 24-h urinary speciation of sodium arsenate did not demonstrate any significant difference in arsenic biotransformation between Folbp2 -/- and Folbp2 +/+ mice. To better understand the influence of folate pathway genes on arsenic embryotoxicity, the present investigation utilized transgenic mice with disrupted folate binding protein 1 (Folbp1) and reduced folate carrier (RFC) genes. Because complete inactivation of Folbp1 and RFC genes results in embryonic lethality, we used heterozygous animals. Overall, no RFC genotype-related differences in embryonic susceptibility to arsenic exposure were observed. Embryonic lethality and neural tube defect (NTD) frequency in Folbp1 mice was dose-dependent and differed from the RFC mice; however, no genotype-related differences were observed. The RFC heterozygotes tended to have higher plasma levels of S-adenosylhomocysteine (SAH) than did the wild-type controls, although this effect was not robust. It is concluded that genetic modifications at the Folbp1 and RFC loci confers no particular sensitivity to arsenic toxicity compared to wild-type controls, thus disproving the working hypothesis that decreased methylating capacity of the genetically modified mice would put them at increased risk for arsenic-induced reproductive toxicity

Dicty_cDB: SLC441 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC441 (Link to dictyBase) - - - Contig-U00414-1 SLC441P (Link to Original site) SLC4...41F 207 SLC441Z 473 SLC441P 680 - - Show SLC441 Library SL (Link to library) Clone ID SLC4... URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC441Q.Seq.d/ Representative seq. ID SLC4...41P (Link to Original site) Representative DNA sequence >SLC441 (SLC441Q) /CSM/SL/SLC4-B/SLC4...Q) /CSM/SL/SLI1-C/SLI162Q.Seq.d/ 896 0.0 SLC441 (SLC441Q) /CSM/SL/SLC4-B/SLC441Q.Seq.d/ 896 0.0 AFK293 (AFK2

Estimated carrier frequency of creatine transporter deficiency in females in the general population using functional characterization of novel missense variants in the SLC6A8 gene.

Science.gov (United States)

DesRoches, Caro-Lyne; Patel, Jaina; Wang, Peixiang; Minassian, Berge; Salomons, Gajja S; Marshall, Christian R; Mercimek-Mahmutoglu, Saadet

2015-07-10

Creatine transporter deficiency (CRTR-D) is an X-linked inherited disorder of creatine transport. All males and about 50% of females have intellectual disability or cognitive dysfunction. Creatine deficiency on brain proton magnetic resonance spectroscopy and elevated urinary creatine to creatinine ratio are important biomarkers. Mutations in the SLC6A8 gene occur de novo in 30% of males. Despite reports of high prevalence of CRTR-D in males with intellectual disability, there are no true prevalence studies in the general population. To determine carrier frequency of CRTR-D in the general population we studied the variants in the SLC6A8 gene reported in the Exome Variant Server database and performed functional characterization of missense variants. We also analyzed synonymous and intronic variants for their predicted pathogenicity using in silico analysis tools. Nine missense variants were functionally analyzed using transient transfection by site-directed mutagenesis with In-Fusion HD Cloning in HeLa cells. Creatine uptake was measured by liquid chromatography tandem mass spectrometry for creatine measurement. The c.1654G>T (p.Val552Leu) variant showed low residual creatine uptake activity of 35% of wild type transfected HeLa cells and was classified as pathogenic. Three variants (c.808G>A; p.Val270Met, c.942C>G; p.Phe314Leu and c.952G>A; p.Ala318Thr) were predicted to be pathogenic based on in silico analysis, but proved to be non-pathogenic by our functional analysis. The estimated carrier frequency of CRTR-D was 0.024% in females in the general population. We recommend functional studies for all novel missense variants by transient transfection followed by creatine uptake measurement by liquid chromatography tandem mass spectrometry as fast and cost effective method for the functional analysis of missense variants in the SLC6A8 gene. Crown Copyright © 2015. Published by Elsevier B.V. All rights reserved.

Dicty_cDB: SLC431 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC431 (Link to dictyBase) - - - Contig-U15865-1 SLC431Z (Link... to Original site) - - SLC431Z 405 - - - - Show SLC431 Library SL (Link to library) Clone ID SLC431 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC431Q.Seq.d/ Representative seq. ID SLC43...1Z (Link to Original site) Representative DNA sequence >SLC431 (SLC431Q) /CSM/SL/SLC4-B/SLC431Q.Seq.d/ XXXXX...omology vs CSM-cDNA Score E Sequences producing significant alignments: (bits) Value SLC431 (SLC4

Dicty_cDB: SLC465 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC465 (Link to dictyBase) - G01923 DDB0190872 Contig-U14177-1 SLC4...65P (Link to Original site) SLC465F 725 SLC465Z 393 SLC465P 1118 - - Show SLC465 Library SL (Link to library) Clone ID SLC4...Contig-U14177-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-C/SLC4...65Q.Seq.d/ Representative seq. ID SLC465P (Link to Original site) Representative DNA sequence >SLC465 (SLC465Q) /CSM/SL/SLC4...-C/SLC465Q.Seq.d/ CGTTAACAGATTTTAATATTACTAATATTGTAGAAAATGATTTTAAATAAAGTAGCAAAA TGTTATG

Dicty_cDB: SLC426 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC426 (Link to dictyBase) - G01922 DDB0233225 Contig-U14991-1 SLC4...26E (Link to Original site) SLC426F 335 SLC426Z 320 SLC426P 655 SLC426E 335 Show SLC426 Library SL (Lin...Contig Contig-U14991-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC4...26Q.Seq.d/ Representative seq. ID SLC426E (Link to Original site) Representative DNA sequence >SLC426 (SLC4...26Q) /CSM/SL/SLC4-B/SLC426Q.Seq.d/ AAATAATAAATAGTAAATAATAAATAATAATAAATAATAATAATAATATTTNAAAATGGG

Dicty_cDB: SLC403 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC403 (Link to dictyBase) - - - Contig-U16252-1 SLC403Z (Link... to Original site) - - SLC403Z 492 - - - - Show SLC403 Library SL (Link to library) Clone ID SLC403 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-A/SLC403Q.Seq.d/ Representative seq. ID SLC40...3Z (Link to Original site) Representative DNA sequence >SLC403 (SLC403Q) /CSM/SL/SLC4-A/SLC403Q.Seq.d/ XXXXX...-B/SLE731Q.Seq.d/ 902 0.0 SLC403 (SLC403Q) /CSM/SL/SLC4-A/SLC403Q.Seq.d/ 902 0.0 SLC241 (SLC241Q) /CSM/SL/SL

Identification and functional characterization of a solute carrier family 15, member 4 gene in Litopenaeus vannamei.

Science.gov (United States)

Chen, Yong-Gui; Yuan, Kai; Zhang, Ze-Zhi; Yuan, Feng-Hua; Weng, Shao-Ping; Yue, Hai-Tao; He, Jian-Guo; Chen, Yi-Hong

2016-04-01

Innate immunity in shrimp is important in resisting bacterial infection. The NF-κB pathway is pivotal in such an immune response. This study cloned and functionally characterized the solute carrier family (SLC) 15 member A 4 (LvSLC15A4) gene in Litopenaeus vannamei. The open reading frame of LvSLC15A4 is 1, 902 bp long and encodes a putative 633-amino acid protein, which is localized in the plasma membrane and intracellular vesicular compartments. Results of the reporter gene assay showed that LvSLC15A4 upregulated NF-κB target genes, including the immediate-early gene 1 of white spot syndrome virus, as well as several antimicrobial peptide genes, such as pen4, CecA, AttA, and Mtk in S2 cells. Moreover, knocked-down expression of LvSLC15A4 reduced pen4 expression in L. vannamei. LvSLC15A4 down-regulation also increased the cumulative mortality of Vibrio parahemolyticus-infected L. vannamei. Furthermore, LvSLC15A4 expression was induced by unfolded protein response (UPR) in L. vannamei hematocytes. These results suggest that LvSLC15A4 participates in L. vannamei innate immunity via the NF-κB pathway and thus may be related to UPR. Copyright © 2015 Elsevier Ltd. All rights reserved.

Dicty_cDB: SLC413 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC413 (Link to dictyBase) - - - Contig-U15735-1 SLC413P (Link to Original site) SLC4...13F 686 SLC413Z 466 SLC413P 1152 - - Show SLC413 Library SL (Link to library) Clone ID SLC4...e URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-A/SLC413Q.Seq.d/ Representative seq. ID SLC4...13P (Link to Original site) Representative DNA sequence >SLC413 (SLC413Q) /CSM/SL/SLC4-A/SLC4...iknkikkknikqkkkk Homology vs CSM-cDNA Score E Sequences producing significant alignments: (bits) Value SLC413 (SLC413Q) /CSM/SL/SLC4

Dicty_cDB: SLC487 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC487 (Link to dictyBase) - - - Contig-U12865-1 SLC487Z (Link... to Original site) - - SLC487Z 404 - - - - Show SLC487 Library SL (Link to library) Clone ID SLC487 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-D/SLC487Q.Seq.d/ Representative seq. ID SLC48...7Z (Link to Original site) Representative DNA sequence >SLC487 (SLC487Q) /CSM/SL/SLC4-D/SLC487Q.Seq.d/ XXXXX...1 0.0 SSF377 (SSF377Q) /CSM/SS/SSF3-D/SSF377Q.Seq.d/ 801 0.0 SLC492 (SLC492Q) /CSM/SL/SLC4-D/SLC4

Dicty_cDB: SLC404 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC404 (Link to dictyBase) - G22406 DDB0190371 Contig-U03918-1 SLC4...04E (Link to Original site) - - - - - - SLC404E 229 Show SLC404 Library SL (Link to library) Clone ID SLC4...riginal site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-A/SLC404Q.Seq.d/ ...Representative seq. ID SLC404E (Link to Original site) Representative DNA sequence >SLC404 (SLC404Q) /CSM/SL/SLC4-A/SLC4...y vs CSM-cDNA Score E Sequences producing significant alignments: (bits) Value SLC404 (SLC404Q) /CSM/SL/SLC4-A/SLC4

Dicty_cDB: SLC461 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC461 (Link to dictyBase) - - - Contig-U16382-1 SLC461Z (Link... to Original site) - - SLC461Z 386 - - - - Show SLC461 Library SL (Link to library) Clone ID SLC461 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-C/SLC461Q.Seq.d/ Representative seq. ID SLC46...1Z (Link to Original site) Representative DNA sequence >SLC461 (SLC461Q) /CSM/SL/SLC4-C/SLC461Q.Seq.d/ XXXXX...e-155 2 ( AU034553 ) Dictyostelium discoideum slug cDNA, clone SLC461. 531 e-155 2 ( AU052473 ) Dictyosteliu

Dicty_cDB: SLC437 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC437 (Link to dictyBase) - - - Contig-U16397-1 SLC437Z (Link... to Original site) - - SLC437Z 622 - - - - Show SLC437 Library SL (Link to library) Clone ID SLC437 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC437Q.Seq.d/ Representative seq. ID SLC43...7Z (Link to Original site) Representative DNA sequence >SLC437 (SLC437Q) /CSM/SL/SLC4-B/SLC437Q.Seq.d/ XXXXX...scoideum slug cDNA, clone SLC437. 1158 0.0 1 ( AU033994 ) Dictyostelium discoideum slug cDNA, clone SLB708.

Dicty_cDB: SLC433 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC433 (Link to dictyBase) - - - Contig-U16397-1 SLC433Z (Link... to Original site) - - SLC433Z 613 - - - - Show SLC433 Library SL (Link to library) Clone ID SLC433 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC433Q.Seq.d/ Representative seq. ID SLC43...3Z (Link to Original site) Representative DNA sequence >SLC433 (SLC433Q) /CSM/SL/SLC4-B/SLC433Q.Seq.d/ XXXXX...tyostelium discoideum slug cDNA, clone SLH872. 1134 0.0 1 ( AU034279 ) Dictyostelium discoideum slug cDNA, clone SLC4

Dicty_cDB: SLC440 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC440 (Link to dictyBase) - G22407 DDB0231506 Contig-U13322-1 | Contig-U16512-1 SLC4...40P (Link to Original site) SLC440F 491 SLC440Z 449 SLC440P 940 - - Show SLC440 Libra...ry SL (Link to library) Clone ID SLC440 (Link to dictyBase) Atlas ID - NBRP ID G22407 dictyBase ID DDB023150...cdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC440Q.Seq.d/ Representative seq. ID SLC440P (Link to Original site) R...epresentative DNA sequence >SLC440 (SLC440Q) /CSM/SL/SLC4-B/SLC440Q.Seq.d/ GGAGATTTCACCACCACCAACAGAACAACACCA

Dicty_cDB: SLC402 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC402 (Link to dictyBase) - - - Contig-U16327-1 SLC402E (Link to Original site) SLC4...02F 661 SLC402Z 395 SLC402P 1056 SLC402E 674 Show SLC402 Library SL (Link to library) Clone ID SLC4...inal site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-A/SLC402Q.Seq.d/ Representative seq. ID SLC4...02E (Link to Original site) Representative DNA sequence >SLC402 (SLC402Q) /CSM/SL/SLC4-A/SLC4...lignments: (bits) Value SSC554 (SSC554Q) /CSM/SS/SSC5-C/SSC554Q.Seq.d/ 1128 0.0 SLC402 (SLC4

Dicty_cDB: SLC415 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC415 (Link to dictyBase) - - - Contig-U16521-1 SLC415E (Link... to Original site) - - - - - - SLC415E 210 Show SLC415 Library SL (Link to library) Clone ID SLC415 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-A/SLC415Q.Seq.d/ Representative seq. ID SLC41...5E (Link to Original site) Representative DNA sequence >SLC415 (SLC415Q) /CSM/SL/SLC4-A/SLC415Q.Seq.d/ CCAAC...lkprdpskfqakkllpsk *iilfsl*k Homology vs CSM-cDNA Score E Sequences producing significant alignments: (bits) Value SLC415 (SLC4

Dietary and other lifestyle correlates of serum folate concentrations in a healthy adult population in Crete, Greece: a cross-sectional study

Directory of Open Access Journals (Sweden)

Scott John M

2006-02-01

Full Text Available Abstract Background Folate has emerged as a key nutrient for optimising health. Impaired folate status has been identified as a risk factor for cardiovascular disease, various types of cancers, and neurocognitive disorders. The study aimed at examining the distribution and determinants of serum folate concentrations in a healthy adult population in Crete, Greece. Methods A cross-sectional sample of 486 healthy adults (250 men, 236 women aged 39 ± 14 years, personnel of the Medical School and the University Hospital of Crete in Greece, was examined. Serum folate and vitamin B12 concentrations were measured by microbiological assay, and total homocysteine was determined fluorometrically and by high-pressure liquid chromatography. Lifestyle questionnaires were completed, and nutrient intakes and food consumption were assessed by 24-h dietary recalls. Multivariate analyses were performed using SPSS v10.1. Results The geometric mean (95% confidence interval concentrations of serum folate were 15.6 μmol/l (14.6–16.8 in men and 19.2 μmol/l (17.9–20.7 in women (p 1, and B6 were positively associated with serum folate. Consumption of potatoes, legumes, fruits, and vegetables were favourably related to the serum folate status. Conclusion Serum folate concentrations were associated with various demographic, lifestyle and dietary factors in healthy Cretan adults. Large-scale epidemiological studies should be conducted within the general Greek adult population to assess the prevalence of impaired folate status and further examine associations with dietary patterns and chronic disease risk. Considering the importance of folate in health maintenance, it is important to increase the public's awareness of modifiable lifestyle patterns and diet and tobacco use in particular, which may be associated with improved folate status.

Assessing the Association between Natural Food Folate Intake and Blood Folate Concentrations: A Systematic Review and Bayesian Meta-Analysis of Trials and Observational Studies

OpenAIRE

Marchetta, Claire M.; Devine, Owen J.; Crider, Krista S.; Tsang, Becky L.; Cordero, Amy M.; Qi, Yan Ping; Guo, Jing; Berry, Robert J.; Rosenthal, Jorge; Mulinare, Joseph; Mersereau, Patricia; Hamner, Heather C.

2015-01-01

Folate is found naturally in foods or as synthetic folic acid in dietary supplements and fortified foods. Adequate periconceptional folic acid intake can prevent neural tube defects. Folate intake impacts blood folate concentration; however, the dose-response between natural food folate and blood folate concentrations has not been well described. We estimated this association among healthy females. A systematic literature review identified studies (1 1992–3 2014) with both natural food folat...

Dicty_cDB: SLC407 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC407 (Link to dictyBase) - - - Contig-U16560-1 SLC407Z (Link... to Original site) - - SLC407Z 365 - - - - Show SLC407 Library SL (Link to library) Clone ID SLC407 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-A/SLC407Q.Seq.d/ Representative seq. ID SLC40...7Z (Link to Original site) Representative DNA sequence >SLC407 (SLC407Q) /CSM/SL/SLC4-A/SLC407Q.Seq.d/ XXXXX...vvtkf*cqt e** Homology vs CSM-cDNA Score E Sequences producing significant alignments: (bits) Value SLC407 (SLC407Q) /CSM/SL/SLC4

Folate mediated self-assembled phytosterol-alginate nanoparticles for targeted intracellular anticancer drug delivery.

Science.gov (United States)

Wang, Jianting; Wang, Ming; Zheng, Mingming; Guo, Qiong; Wang, Yafan; Wang, Heqing; Xie, Xiangrong; Huang, Fenghong; Gong, Renmin

2015-05-01

Self-assembled core/shell nanoparticles (NPs) were synthesized from water-soluble alginate substituted by hydrophobic phytosterols. Folate, a cancer-cell-specific ligand, was conjugated to the phytosterol-alginate (PA) NPs for targeting folate-receptor-overexpressing cancer cells. The physicochemical properties of folate-phytosterol-alginate (FPA) NPs were characterized by nuclear magnetic resonance, transmission electron microscopy, dynamic light scattering, electrophoretic light scattering, and fluorescence spectroscopy. Doxorubicin (DOX), an anticancer drug, was entrapped inside prepared NPs by dialysis method. The identification of prepared FPA NPs to folate-receptor-overexpressing cancer cells (KB cells) was confirmed by cytotoxicity and folate competition assays. Compared to the pure DOX and DOX/PA NPs, the DOX/FPA NPs had lower IC50 value to KB cells because of folate-receptor-mediated endocytosis process and the cytotoxicity of DOX/FPA NPs to KB cells could be competitively inhibited by free folate. The cellular uptake and internalization of pure DOX and DOX/FPA NPs was confirmed by confocal laser scanning microscopy image and the higher intracellular uptake of drug for DOX/FPA NPs over pure DOX was observed. The FPA NPs had the potential as a promising carrier to target drugs to cancer cells overexpressing folate receptors and avoid cytotoxicity to normal tissues. Copyright © 2015 Elsevier B.V. All rights reserved.

How well do blood folate concentrations predict dietary folate intakes in a sample of Canadian lactating women exposed to high levels of folate? An observational study.

Science.gov (United States)

Houghton, Lisa A; Sherwood, Kelly L; O'Connor, Deborah L

2007-10-25

In 1998, mandatory folic acid fortification of white flour and select cereal grain products was implemented in Canada with the intention to increase dietary folate intakes of reproducing women. Folic acid fortification has produced a dramatic increase in blood folate concentrations among reproductive age women, and a reduction in neural tube defect (NTD)-affected pregnancies. In response to improved blood folate concentrations, many health care professionals are asking whether a folic acid supplement is necessary for NTD prevention among women with high blood folate values, and how reliably high RBC folate concentrations predict folate intakes shown in randomized controlled trials to be protective against NTDs. The objective of this study was to determine how predictive blood folate concentrations and folate intakes are of each other in a sample of well-educated lactating Canadian women exposed to high levels of synthetic folate. The relationship between blood folate concentrations and dietary folate intakes, determined by weighed food records, were assessed in a sample of predominantly university-educated lactating women (32 +/- 4 yr) at 4-(n = 53) and 16-wk postpartum (n = 55). Median blood folate concentrations of all participants were well above plasma and RBC folate cut-off levels indicative of deficiency (6.7 and 317 nmol/L, respectively) and all, except for 2 subjects, were above the cut-off for NTD-risk reduction (>906 nmol/L). Only modest associations existed between total folate intakes and plasma (r = 0.46, P consuming 151-410 microg/d of synthetic folate (2nd quartile of intake) did not differ from that of women consuming >410 microg/d (3rd and 4th quartile). Folate intakes, estimated by food composition tables, and blood folate concentrations are not predictive of each other in Canadian lactating women exposed to high levels of folate. Synthetic intakes > 151-410 microg/d in these women produced little additional benefit in terms of maximizing RBC

Dicty_cDB: SLC435 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC435 (Link to dictyBase) - - - Contig-U16260-1 SLC435E (Link... to Original site) - - - - - - SLC435E 373 Show SLC435 Library SL (Link to library) Clone ID SLC435 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC435Q.Seq.d/ Representative seq. ID SLC43...5E (Link to Original site) Representative DNA sequence >SLC435 (SLC435Q) /CSM/SL/SLC4-B/SLC435Q.Seq.d/ GGAGA...I815Q) /CSM/SL/SLI8-A/SLI815Q.Seq.d/ 694 0.0 SLC435 (SLC435Q) /CSM/SL/SLC4-B/SLC4

Significance of downregulation of renal organic cation transporter (SLC47A1 in cisplatin-induced proximal tubular injury

Directory of Open Access Journals (Sweden)

Mizuno T

2015-07-01

Full Text Available Tomohiro Mizuno,1–3 Waichi Sato,2,3 Kazuhiro Ishikawa,4 Yuki Terao,1 Kazuo Takahashi,2 Yukihiro Noda,5 Yukio Yuzawa,2 Tadashi Nagamatsu1 1Department of Analytical Pharmacology, Meijo University Faculty of Pharmacy, Nagoya, 2Department of Nephrology, School of Medicine, Fujita Health University, Toyoake, 3Department of Nephrology, Nagoya University School of Medicine, Nagoya, 4Department of Neuropsychopharmacology and Hospital Pharmacy, Nagoya University Graduate School of Medicine, Nagoya, 5Division of Clinical Sciences and Neuropsychopharmacology, Meijo University Faculty of Pharmacy, Nagoya, Japan Background/aim: To elucidate the mechanism responsible for developing acute kidney injury in patients with diabetes mellitus, we also evaluated the issue of whether advanced glycation endproducts (AGEs influence the expressions of multi antimicrobial extrusion protein (MATE1/SLC47A1 in tubular cells. Materials and methods: To detect changing expression of MATE1/SLC47A1 in dose- and time-dependent manners, human proximal tubular epithelial cells were incubated with AGE-aggregated-human serum albumin. As a function assay for MATE1/SLC47A1, human proximal tubular epithelial cells were incubated with cisplatin or carboplatin. Results: On incubation with AGEs, the expressions of MATE1/SLC47A1 were decreased in tubular cells. In addition, the toxicities of cisplatin were increased in tubular cells that had been pretreated with AGEs. However, the toxicities of carboplatin were smaller than that of cisplatin in proximal tubular epithelial cells. Conclusion: The expression of the MATE1/SLC47A1 is decreased by AGEs, which increases the risk for proximal tubular injury. Keywords: advanced glycation endproducts, cisplatin, SLC47A1, diabetes mellitus, acute kidney injury

Differential SLC1A2 Promoter Methylation in Bipolar Disorder With or Without Addiction

Directory of Open Access Journals (Sweden)

Yun-Fang Jia

2017-07-01

Full Text Available While downregulation of excitatory amino acid transporter 2 (EAAT2, the main transporter removing glutamate from the synapse, has been recognized in bipolar disorder (BD, the underlying mechanisms of downregulation have not been elucidated. BD is influenced by environmental factors, which may, via epigenetic modulation of gene expression, differentially affect illness presentation. This study thus focused on epigenetic DNA methylation regulation of SLC1A2, encoding for EAAT2, in BD with variable environmental influences of addiction. High resolution melting PCR (HRM-PCR and thymine–adenine (TA cloning with sequence analysis were conducted to examine methylation of the promoter region of the SLC1A2. DNA was isolated from blood samples drawn from BD patients (N = 150 with or without addiction to alcohol, nicotine, or food, defined as binge eating, and matched controls (N = 32. In comparison to controls, the SLC1A2 promoter region was hypermethylated in BD without addiction but was hypomethylated in BD with addiction. After adjusting for age and sex, the association of methylation levels with nicotine addiction (p = 0.0009 and binge eating (p = 0.0002 remained significant. Consistent with HRM-PCR, direct sequencing revealed increased methylation in CpG site 6 in BD, but decreased methylation in three CpG sites (6, 48, 156 in BD with alcohol and nicotine addictions. These results suggest that individual point methylation within the SLC1A2 promoter region may be modified by exogenous addiction and may have a potential for developing clinically valuable epigenetic biomarkers for BD diagnosis and monitoring.

Linking chronic infection and autoimmune diseases: Mycobacterium avium subspecies paratuberculosis, SLC11A1 polymorphisms and type-1 diabetes mellitus.

Directory of Open Access Journals (Sweden)

Daniela Paccagnini

2009-09-01

Full Text Available The etiology of type 1 diabetes mellitus (T1DM is still unknown; numerous studies are performed to unravel the environmental factors involved in triggering the disease. SLC11A1 is a membrane transporter that is expressed in late endosomes of antigen presenting cells involved in the immunopathogenic events leading to T1DM. Mycobacterium avium subsp. paratuberculosis (MAP has been reported to be a possible trigger in the development of T1DM.Fifty nine T1DM patients and 79 healthy controls were genotyped for 9 polymorphisms of SLC11A1 gene, and screened for the presence of MAP by PCR. Differences in genotype frequency were evaluated for both T1DM patients and controls. We found a polymorphism in the SLC11A1 gene (274C/T associated to type 1 diabetic patients and not to controls. The presence of MAP DNA was also significantly associated with T1DM patients and not with controls.The 274C/T SCL11A1 polymorphism was found to be associated with T1DM as well as the presence of MAP DNA in blood. Since MAP persists within macrophages and it is also processed by dendritic cells, further studies are necessary to evaluate if mutant forms of SLC11A1 alter the processing or presentation of MAP antigens triggering thereby an autoimmune response in T1DM patients.

Solute Carrier Family 26 Member a2 (slc26a2 Regulates Otic Development and Hair Cell Survival in Zebrafish.

Directory of Open Access Journals (Sweden)

Fei Liu

Full Text Available Hearing loss is one of the most prevalent human birth defects. Genetic factors contribute to the pathogenesis of deafness. It is estimated that one-third of deafness genes have already been identified. The current work is an attempt to find novel genes relevant to hearing loss using guilt-by-profiling and guilt-by-association bioinformatics analyses of approximately 80 known non-syndromic hereditary hearing loss (NSHL genes. Among the 300 newly identified candidate deafness genes, slc26a2 were selected for functional studies in zebrafish. The slc26a2 gene was knocked down using an antisense morpholino (MO, and significant defects were observed in otolith patterns, semicircular canal morphology, and lateral neuromast distributions in morphants. Loss-of-function defects are caused primarily by apoptosis, and morphants are insensitive to sound stimulation and imbalanced swimming behaviours. Morphant defects were found to be partially rescued by co-injection of human SLC26A2 mRNA. All the results suggest that bioinformatics is capable of predicting new deafness genes and this showed slc26a2 is to be a critical otic gene whose dysfunction may induce hearing impairment.

Preparation of a folate-mediated tumor targeting ultraparamagnetic polymeric micelles and its in vitro experimental study

International Nuclear Information System (INIS)

Hong Guobin; Zhou Jingxing; Shen Jun; Liang Biling; Yuan Renxu; Shuai Xintao

2008-01-01

Objective: To evaluate the tumor targeting characteristic of the Folate-SPIO-DOX- Micelles by in vitro studies, and to test the feasibility of monitor tumor targeting using it and clinical MRI. Methods: The polymeric micelles, Folate-SPIO-DOXO-Micelles were prepared. The in vitro tumor cell targeting efficacy of these folate modified and DOX or SPIO-loaded micelles (Folate-SPIO-DOX- MiceUes) was evaluated by observing the cellular uptake of micelles by human hepatic carcinoma cells (Bel 7402 cells) which overexpressed folate surface receptors. Cell suspensions were incubated with Folate-SPIO- DOXO-Micelles for 1 h. Prussian blue staining was performed to show intracellular irons. Flow cytometry was used to further quantify the cellular uptake of the nanoparticles into Bel 7402 cells. MRI was performed to show the signal intensity changes by using T 2 WI sequences at a clinical 1.5 T MR system. Results Prussian blue staining showed much more intracellular iron in cells incubated with Folate-SPIO-DOX- Micelles than the cells incubated with the non-targeting SPIO-DOX-Micelles. As revealed by flow cytometry, the mean fluorescence intensity of cells in the folate group and the non-folate group were 117.88 and 46. 33, respectively. The T 2 signal intensity in MRI of cells treated with the folate targeting micelles decreased significantly(when the concentration of SPIO in cell culture medium was 5, 10, 20, 40, and 80 μg/ml, respectively, T 2 signal intensity decreased by -5.02%, -23.58%, -45.89%, -70.34%, and -92.41%, respectively). In contrast, T 2 signal intensity did not show obvious decrease for cells treated with the folate-free micelles (when the concentration of SPIO in cell culture medium was at 5, 10, 20, 40, and 80 μg/ml, respectively, T 2 signal intensity decreased by -3.77%, -2.16%, -2.18%, -2.74% and -19.77%, respectively). Conclusion: The polymeric micelles, Folate-SPIO-DOX-Micelles has good targeting ability to the hepatic carcinoma cells in vitro, and

Dicty_cDB: SLC489 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC489 (Link to dictyBase) - - - Contig-U16255-1 SLC489P (Link to Original site) SLC4...89F 628 SLC489Z 172 SLC489P 800 - - Show SLC489 Library SL (Link to library) Clone ID SLC4... URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-D/SLC489Q.Seq.d/ Representative seq. ID SLC4...89P (Link to Original site) Representative DNA sequence >SLC489 (SLC489Q) /CSM/SL/SLC4-D/SLC4...SSD212Q.Seq.d/ 1001 0.0 SLE207 (SLE207Q) /CSM/SL/SLE2-A/SLE207Q.Seq.d/ 1001 0.0 SLC489 (SLC489Q) /CSM/SL/SLC4-D/SLC4

How well do blood folate concentrations predict dietary folate intakes in a sample of Canadian lactating women exposed to high levels of folate? An observational study

Directory of Open Access Journals (Sweden)

Sherwood Kelly L

2007-10-01

Full Text Available Abstract Background In 1998, mandatory folic acid fortification of white flour and select cereal grain products was implemented in Canada with the intention to increase dietary folate intakes of reproducing women. Folic acid fortification has produced a dramatic increase in blood folate concentrations among reproductive age women, and a reduction in neural tube defect (NTD-affected pregnancies. In response to improved blood folate concentrations, many health care professionals are asking whether a folic acid supplement is necessary for NTD prevention among women with high blood folate values, and how reliably high RBC folate concentrations predict folate intakes shown in randomized controlled trials to be protective against NTDs. The objective of this study was to determine how predictive blood folate concentrations and folate intakes are of each other in a sample of well-educated lactating Canadian women exposed to high levels of synthetic folate. Methods The relationship between blood folate concentrations and dietary folate intakes, determined by weighed food records, were assessed in a sample of predominantly university-educated lactating women (32 ± 4 yr at 4-(n = 53 and 16-wk postpartum (n = 55. Results Median blood folate concentrations of all participants were well above plasma and RBC folate cut-off levels indicative of deficiency (6.7 and 317 nmol/L, respectively and all, except for 2 subjects, were above the cut-off for NTD-risk reduction (>906 nmol/L. Only modest associations existed between total folate intakes and plasma (r = 0.46, P P nd quartile of intake did not differ from that of women consuming >410 μg/d (3rd and 4th quartile. Conclusion Folate intakes, estimated by food composition tables, and blood folate concentrations are not predictive of each other in Canadian lactating women exposed to high levels of folate. Synthetic intakes > 151–410 μg/d in these women produced little additional benefit in terms of maximizing

Identification of seven novel mutations including the first two genomic rearrangements in SLC26A3 mutated in congenital chloride diarrhea.

Science.gov (United States)

Höglund, P; Sormaala, M; Haila, S; Socha, J; Rajaram, U; Scheurlen, W; Sinaasappel, M; de Jonge, H; Holmberg, C; Yoshikawa, H; Kere, J

2001-09-01

Congenital chloride diarrhea (CLD) is an autosomal recessive disorder characterized by defective intestinal electrolyte absorption, resulting in voluminous osmotic diarrhea with high chloride content. A variety of mutations in the solute carrier family 26, member 3 gene (SLC26A3, previously known as CLD or DRA) are responsible for the disease. Since the identification of the SLC26A3 gene and the determination of its genomic structure, altogether three founder and 17 private mutations have been characterized within miscellaneous ethnic groups. We screened for mutations in seven unrelated families with CLD. The diagnoses were confirmed by fecal chloride measurements. The combined PCR-SSCP and sequencing analyses revealed altogether seven novel mutations including two missense mutations (S206P, D468V), two splicing defects (IVS12-1G>C, IVS13-2delA), one nonsense mutation (Q436X), one insertion/deletion mutation (2104-2105delGGins29-bp), and an intragenic deletion of SLC26A3 exons 7 and 8. Two previously identified mutations were also found. This is the first report of rearrangement mutations in SLC26A3. Molecular features predisposing SLC26A3 for the two rearrangements may include repetitive elements and palindromic-like sequences. The increasingly wide diversity of SLC26A3 mutations suggests that mutations in the SLC26A3 gene may not be rare events. Copyright 2001 Wiley-Liss, Inc.

Dicty_cDB: SLC485 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC485 (Link to dictyBase) - - - Contig-U16358-1 SLC485Z (Link... to Original site) - - SLC485Z 452 - - - - Show SLC485 Library SL (Link to library) Clone ID SLC485 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-D/SLC485Q.Seq.d/ Representative seq. ID SLC48...5Z (Link to Original site) Representative DNA sequence >SLC485 (SLC485Q) /CSM/SL/SLC4-D/SLC485Q.Seq.d/ XXXXX... 825 0.0 SLG820 (SLG820Q) /CSM/SL/SLG8-A/SLG820Q.Seq.d/ 825 0.0 SLC485 (SLC485Q) /CSM/SL/SLC4-D/SLC4

SLC30A9 mutation affecting intracellular zinc homeostasis causes a novel cerebro-renal syndrome.

Science.gov (United States)

Perez, Yonatan; Shorer, Zamir; Liani-Leibson, Keren; Chabosseau, Pauline; Kadir, Rotem; Volodarsky, Michael; Halperin, Daniel; Barber-Zucker, Shiran; Shalev, Hanna; Schreiber, Ruth; Gradstein, Libe; Gurevich, Evgenia; Zarivach, Raz; Rutter, Guy A; Landau, Daniel; Birk, Ohad S

2017-04-01

A novel autosomal recessive cerebro-renal syndrome was identified in consanguineous Bedouin kindred: neurological deterioration was evident as of early age, progressing into severe intellectual disability, profound ataxia, camptocormia and oculomotor apraxia. Brain MRI was normal. Four of the six affected individuals also had early-onset nephropathy with features of tubulo-interstitial nephritis, hypertension and tendency for hyperkalemia, though none had rapid deterioration of renal function. Genome wide linkage analysis identified an ∼18 Mb disease-associated locus on chromosome 4 (maximal logarithm of odds score 4.4 at D4S2971; θ = 0). Whole exome sequencing identified a single mutation in SLC30A9 within this locus, segregating as expected within the kindred and not found in a homozygous state in 300 Bedouin controls. We showed that SLC30A9 (solute carrier family 30 member 9; also known as ZnT-9) is ubiquitously expressed with high levels in cerebellum, skeletal muscle, thymus and kidney. Confocal analysis of SH-SY5Y cells overexpressing SLC30A9 fused to enhanced green fluorescent protein demonstrated vesicular cytosolic localization associated with the endoplasmic reticulum, not co-localizing with endosomal or Golgi markers. SLC30A9 encodes a putative zinc transporter (by similarity) previously associated with Wnt signalling. However, using dual-luciferase reporter assay in SH-SY5Y cells we showed that Wnt signalling was not affected by the mutation. Based on protein modelling, the identified mutation is expected to affect SLC30A9's highly conserved cation efflux domain, putatively disrupting its transmembrane helix structure. Cytosolic Zn2+ measurements in HEK293 cells overexpressing wild-type and mutant SLC30A9 showed lower zinc concentration within mutant rather than wild-type SLC30A9 cells. This suggests that SLC30A9 has zinc transport properties affecting intracellular zinc homeostasis, and that the molecular mechanism of the disease is through

Prenatal exposure to maternal depressed mood and the MTHFR C677T variant affect SLC6A4 methylation in infants at birth.

Directory of Open Access Journals (Sweden)

Angela M Devlin

2010-08-01

Full Text Available Prenatal and early postnatal exposure to maternal depression may "program" childhood behavior via epigenetic processes such as DNA methylation. Methylenetetrahydro-folate reductase (MTHFR is an important enzyme in the generation of methyl groups for DNA methylation. The common MTHFR C677T variant is associated with depression in men and non-pregnant women, and with global changes in DNA methylation. This study investigated the effect of maternal MTHFR C677T genotype on antenatal maternal mood, and their impact on the gene-specific methylation in pregnant women and their newborn infants. The methylation status of SLC6A4, which encodes the transmembrane serotonin transporter, and BDNF, which encodes brain derived neurotrophic factor, were assessed because of their potential role in behaviour.Depressed mood was assessed by the Edinburgh Postnatal Depression Scale (EPDS and the Hamilton Rating Scale for Depression (HAM-D in women (n = 82, all taking folate during the 2(nd and 3(rd trimesters of pregnancy. The methylation status of SLC6A4 and BDNF were assessed in 3rd trimester maternal peripheral leukocytes and in umbilical cord leukocytes collected from their infants at birth. Women with the MTHFR 677TT genotype had greater 2(nd trimester depressed mood (p<0.05. Increased 2(nd trimester maternal depressed mood (EPDS scores was associated with decreased maternal and infant SLC6A4 promoter methylation (p<0.05, but had no effect on BDNF promoter methylation.These findings show that the MTHFR C677T variant is associated with greater depressed mood during pregnancy. We further showed that prenatal exposure to maternal depressed mood affects gene-specific DNA methylation patterns. These findings support the concept that alterations in epigenetic processes may contribute to developmental programming of behaviour by maternal depression.

The Effect of Turmeric (Curcuma longa Extract on the Functionality of the Solute Carrier Protein 22 A4 (SLC22A4 and Interleukin-10 (IL-10 Variants Associated with Inflammatory Bowel Disease

Directory of Open Access Journals (Sweden)

Mark J. McCann

2014-10-01

Full Text Available Inflammatory bowel disease (IBD is a chronic relapsing disease. Genetic predisposition to the disease reduces an individual’s capacity to respond appropriately to environmental challenges in the intestine leading to inappropriate inflammation. IBD patients often modify their diet to mitigate or reduce the severity of inflammation. Turmeric (Curcuma longa L., Zingiberaceae has historically been used in Chinese, Hindu, and Ayurvedic medicine over several centuries to treat inflammatory disorders. To understand how turmeric may influence the consequences of a genetic predisposition to inappropriate inflammation, we used HEK293 cells to examine the in vitro capacity of turmeric extract and fractions to affect the functionality of two gene variants, solute carrier protein 22 A4 (SLC22A4, rs1050152 and interleukin-10 (IL-10, rs1800896 associated with IBD. We found that a turmeric extract and several chromatographically separated fractions beneficially affected the variants of SLC22A4 and IL-10 associated with IBD, by reducing inappropriate epithelial cell transport (SLC22A4, 503F and increasing anti-inflammatory cytokine gene promoter activity (IL-10, −1082A. The effect of turmeric on the IL-10 variant was strongly associated with the curcumin content of the extract and its fractions.

The effect of turmeric (Curcuma longa) extract on the functionality of the solute carrier protein 22 A4 (SLC22A4) and interleukin-10 (IL-10) variants associated with inflammatory bowel disease.

Science.gov (United States)

McCann, Mark J; Johnston, Sarah; Reilly, Kerri; Men, Xuejing; Burgess, Elaine J; Perry, Nigel B; Roy, Nicole C

2014-10-13

Inflammatory bowel disease (IBD) is a chronic relapsing disease. Genetic predisposition to the disease reduces an individual's capacity to respond appropriately to environmental challenges in the intestine leading to inappropriate inflammation. IBD patients often modify their diet to mitigate or reduce the severity of inflammation. Turmeric (Curcuma longa L., Zingiberaceae) has historically been used in Chinese, Hindu, and Ayurvedic medicine over several centuries to treat inflammatory disorders. To understand how turmeric may influence the consequences of a genetic predisposition to inappropriate inflammation, we used HEK293 cells to examine the in vitro capacity of turmeric extract and fractions to affect the functionality of two gene variants, solute carrier protein 22 A4 (SLC22A4, rs1050152) and interleukin-10 (IL-10, rs1800896) associated with IBD. We found that a turmeric extract and several chromatographically separated fractions beneficially affected the variants of SLC22A4 and IL-10 associated with IBD, by reducing inappropriate epithelial cell transport (SLC22A4, 503F) and increasing anti-inflammatory cytokine gene promoter activity (IL-10, -1082A). The effect of turmeric on the IL-10 variant was strongly associated with the curcumin content of the extract and its fractions.

Dicty_cDB: SLC443 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC443 (Link to dictyBase) - - - Contig-U16518-1 SLC443P (Link to Original site) SLC4...43F 466 SLC443Z 304 SLC443P 770 - - Show SLC443 Library SL (Link to library) Clone ID SLC4... URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC443Q.Seq.d/ Representative seq. ID SLC4...43P (Link to Original site) Representative DNA sequence >SLC443 (SLC443Q) /CSM/SL/SLC4-B/SLC4...Homology vs CSM-cDNA Score E Sequences producing significant alignments: (bits) Value SLC443 (SLC443Q) /CSM/SL/SLC4-B/SLC4

Dicty_cDB: SLC429 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC429 (Link to dictyBase) - - - Contig-U09691-1 SLC429Z (Link... to Original site) - - SLC429Z 419 - - - - Show SLC429 Library SL (Link to library) Clone ID SLC429 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC429Q.Seq.d/ Representative seq. ID SLC42...9Z (Link to Original site) Representative DNA sequence >SLC429 (SLC429Q) /CSM/SL/SLC4-B/SLC429Q.Seq.d/ XXXXX... significant alignments: (bits) Value SLC429 (SLC429Q) /CSM/SL/SLC4-B/SLC429Q.Seq.d/ 708 0.0 SLC392 (SLC392Q

Dicty_cDB: SLC428 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC428 (Link to dictyBase) - - - Contig-U10963-1 SLC428P (Link to Original site) SLC4...28F 573 SLC428Z 307 SLC428P 880 - - Show SLC428 Library SL (Link to library) Clone ID SLC4... URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC428Q.Seq.d/ Representative seq. ID SLC4...28P (Link to Original site) Representative DNA sequence >SLC428 (SLC428Q) /CSM/SL/SLC4-B/SLC4...nces producing significant alignments: (bits) Value SLC428 (SLC428Q) /CSM/SL/SLC4-B/SLC428Q.Seq.d/ 1526 0.0

The effect of folate status on the uptake of physiologically relevant compounds by Caco-2 cells.

Science.gov (United States)

Tavares, Sandra; Sousa, Joana; Gonçalves, Pedro; Araújo, João R; Martel, Fátima

2010-08-25

The aim of this work was to investigate the effect of folate status on the uptake of several physiologically relevant substances by Caco-2 cells. For this, Caco-2 cells cultured in high-folate conditions (HF) and low-folate conditions (LF) were compared. Growth rates of HF and LF Caco-2 cells were similar. However, proliferation rate of LF cells was greater than that of HF cells during the first 2days of culture and slightly smaller thereafter, viability of LF cells was greater than that of HF cells, and apoptosis index was similar in both cell cultures. We verified that in LF cells, comparatively to HF cells: (1) uptake of [3H]folic acid is upregulated, via an increase in the Vmax of uptake; (2) uptake of [3H]deoxy-glucose, [3H]O-methyl-glucose and [3H]1-methyl-4-phenylpyridinium (MPP+) is downregulated, via a decrease in the Vmax of uptake; additionally, a reduction in Km was observed for [3H]O-methyl-glucose; (3) uptake of [3H]5-hydroxytryptamine and [14C]butyrate is not changed; and (4) the steady-state mRNA levels of the folic acid transporters RFC (reduced folate carrier), PCFT (proton-coupled folate transporter) and FRalpha (folate receptor alpha), of the organic cation transporter OCT1 (organic cation transporter type 1), of the glucose transporter GLUT2 (facilitative glucose transporter type 2) and of the butyrate transporter MCT1 (monocarboxylate transporter type 1) were decreased. In conclusion, folate deficiency produces substrate-specific changes in the uptake of bioactive compounds by Caco-2 cells. Moreover, these changes are associated with alterations in the mRNA levels of specific transporters for these compounds. Copyright (c) 2010 Elsevier B.V. All rights reserved.

Dicty_cDB: SLC458 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC458 (Link to dictyBase) - - - Contig-U16279-1 SLC458Z (Link... to Original site) - - SLC458Z 508 - - - - Show SLC458 Library SL (Link to library) Clone ID SLC458 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-C/SLC458Q.Seq.d/ Representative seq. ID SLC45...8Z (Link to Original site) Representative DNA sequence >SLC458 (SLC458Q) /CSM/SL/SLC4-C/SLC458Q.Seq.d/ XXXXX...icant alignments: (bits) Value SLC458 (SLC458Q) /CSM/SL/SLC4-C/SLC458Q.Seq.d/ 743

Dicty_cDB: SLC474 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC474 (Link to dictyBase) - - - Contig-U01121-1 SLC474Z (Link... to Original site) - - SLC474Z 431 - - - - Show SLC474 Library SL (Link to library) Clone ID SLC474 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-D/SLC474Q.Seq.d/ Representative seq. ID SLC47...4Z (Link to Original site) Representative DNA sequence >SLC474 (SLC474Q) /CSM/SL/SLC4-D/SLC474Q.Seq.d/ XXXXX... Score E Sequences producing significant alignments: (bits) Value SLC474 (SLC474Q) /CSM/SL/SLC4-D/SLC474Q.Se

Dicty_cDB: SLC425 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC425 (Link to dictyBase) - - - Contig-U16276-1 SLC425Z (Link... to Original site) - - SLC425Z 515 - - - - Show SLC425 Library SL (Link to library) Clone ID SLC425 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC425Q.Seq.d/ Representative seq. ID SLC42...5Z (Link to Original site) Representative DNA sequence >SLC425 (SLC425Q) /CSM/SL/SLC4-B/SLC425Q.Seq.d/ XXXXX...producing significant alignments: (bits) Value SLC425 (SLC425Q) /CSM/SL/SLC4-B/SLC4

Dicty_cDB: SLC495 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC495 (Link to dictyBase) - - - Contig-U03919-1 SLC495E (Link to Original site) SLC4...95F 337 SLC495Z 295 SLC495P 632 SLC495E 337 Show SLC495 Library SL (Link to library) Clone ID SLC4...nal site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-D/SLC495Q.Seq.d/ Representative seq. ID SLC4...95E (Link to Original site) Representative DNA sequence >SLC495 (SLC495Q) /CSM/SL/SLC4-D/SLC4...ficant alignments: (bits) Value SLC495 (SLC495Q) /CSM/SL/SLC4-D/SLC495Q.Seq.d/ 446 e-124 VSF494 (VSF494Q) /C

SLC6 Neurotransmitter Transporters: Structure, Function, and Regulation

DEFF Research Database (Denmark)

Kristensen, Anders S; Andersen, Jacob; Jørgensen, Trine N

2011-01-01

The neurotransmitter transporters (NTTs) belonging to the solute carrier 6 (SLC6) gene family (also referred to as the neurotransmitter-sodium-symporter family or Na(+)/Cl(-)-dependent transporters) comprise a group of nine sodium- and chloride-dependent plasma membrane transporters...... for the monoamine neurotransmitters serotonin (5-hydroxytryptamine), dopamine, and norepinephrine, and the amino acid neurotransmitters GABA and glycine. The SLC6 NTTs are widely expressed in the mammalian brain and play an essential role in regulating neurotransmitter signaling and homeostasis by mediating uptake...... of released neurotransmitters from the extracellular space into neurons and glial cells. The transporters are targets for a wide range of therapeutic drugs used in treatment of psychiatric diseases, including major depression, anxiety disorders, attention deficit hyperactivity disorder and epilepsy...

Mitochondrial glutamate carriers from Drosophila melanogaster: biochemical, evolutionary and modeling studies.

Science.gov (United States)

Lunetti, Paola; Cappello, Anna Rita; Marsano, René Massimiliano; Pierri, Ciro Leonardo; Carrisi, Chiara; Martello, Emanuela; Caggese, Corrado; Dolce, Vincenza; Capobianco, Loredana

2013-10-01

The mitochondrial carriers are members of a family of transport proteins that mediate solute transport across the inner mitochondrial membrane. Two isoforms of the glutamate carriers, GC1 and GC2 (encoded by the SLC25A22 and SLC25A18 genes, respectively), have been identified in humans. Two independent mutations in SLC25A22 are associated with severe epileptic encephalopathy. In the present study we show that two genes (CG18347 and CG12201) phylogenetically related to the human GC encoding genes are present in the D. melanogaster genome. We have functionally characterized the proteins encoded by CG18347 and CG12201, designated as DmGC1p and DmGC2p respectively, by overexpression in Escherichia coli and reconstitution into liposomes. Their transport properties demonstrate that DmGC1p and DmGC2p both catalyze the transport of glutamate across the inner mitochondrial membrane. Computational approaches have been used in order to highlight residues of DmGC1p and DmGC2p involved in substrate binding. Furthermore, gene expression analysis during development and in various adult tissues reveals that CG18347 is ubiquitously expressed in all examined D. melanogaster tissues, while the expression of CG12201 is strongly testis-biased. Finally, we identified mitochondrial glutamate carrier orthologs in 49 eukaryotic species in order to attempt the reconstruction of the evolutionary history of the glutamate carrier function. Comparison of the exon/intron structure and other key features of the analyzed orthologs suggests that eukaryotic glutamate carrier genes descend from an intron-rich ancestral gene already present in the common ancestor of lineages that diverged as early as bilateria and radiata. © 2013.

Affinity labeling of the folate-methotrexate transporter from Leishmania donovani

International Nuclear Information System (INIS)

Beck, J.T.; Ullman, B.

1989-01-01

An affinity labeling technique has been developed to identify the folate-methotrexate transporter of Leishmania donovani promastigotes using activated derivatives of the ligands. These activated derivatives were synthesized by incubating folate and methotrexate with a 10-fold excess of 1-ethyl-3-[3-(dimethylamino)propyl]carbodiimide (EDC) for 10 min at ambient temperature in dimethyl sulfoxide. When intact wild-type (DI700) Leishmania donovani or preparations of their membranes were incubated with a 0.4 μM concentration of either activated [ 3 H]folate or activated [ 3 H]methotrexate, the radiolabeled ligands were covalently incorporated into a polypeptide with a molecular weight of approximately 46,000, as demonstrated by SDS-polyacrylamide gel electrophoresis. No affinity labeling of a 46,000-dalton protein was observed when equimolar concentrations of activated radiolabeled ligands were incubated with intact cells or membranes prepared from a methotrexate-resistant mutant clone of Leishmania donovani, MTXA5, that is genetically defective in folate-methotrexate transport capability. Time course studies indicated that maximal labeling of the 46,000-dalton protein occurred within 5-10 min of incubation of intact cells with activated ligand. These studies provide biochemical evidence that the folate-methotrexate transporter of Leishmania donovani can be identified in crude extracts by an affinity labeling technique and serve as a prerequisite to further analysis of the transport protein by providing a vehicle for subsequent purification of this membrane carrier. Moreover, these investigations suggest that the affinity labeling technique using EDC-activated ligands may be exploitable to analyze other cell surface binding proteins in Leishmania donovani, as well as in other organisms

Differential expression of the Slc4 bicarbonate transporter family in murine corneal endothelium and cell culture.

Science.gov (United States)

Shei, William; Liu, Jun; Htoon, Hla M; Aung, Tin; Vithana, Eranga N

2013-01-01

To characterize the relative expression levels of all the solute carrier 4 (Slc4) transporter family members (Slc4a1-Slc4a11) in murine corneal endothelium using real-time quantitative (qPCR), to identify further important members besides Slc4a11 and Slc4a4, and to explore how close to the baseline levels the gene expressions remain after cells have been subjected to expansion and culture. Descemet's membrane-endothelial layers of 8-10-week-old C57BL6 mice were stripped from corneas and used for both primary cell culture and direct RNA extraction. Total RNA (from uncultured cells as well as cultured cells at passages 2 and 7) was reverse transcribed, and the cDNA was used for real time qPCR using specific primers for all the Slc4 family members. The geNorm method was applied to determine the most stable housekeeping genes and normalization factor, which was calculated from multiple housekeeping genes for more accurate and robust quantification. qPCR analyses revealed that all Slc4 bicarbonate transporter family members were expressed in mouse corneal endothelium. Slc4a11 showed the highest expression, which was approximately three times higher than that of Slc4a4 (3.4±0.3; p=0.004). All Slc4 genes were also expressed in cultured cells, and interestingly, the expression of Slc4a11 in cultured cells was significantly reduced by approximately 20-fold (0.05±0.001; p=0.000001) in early passage and by approximately sevenfold (0.14±0.002; p=0.000002) in late passage cells. Given the known involvement of SLC4A4 and SLC4A11 in corneal dystrophies, we speculate that the other two highly expressed genes in the uncultured corneal endothelium, SLC4A2 and SLC4A7, are worthy of being considered as potential candidate genes for corneal endothelial diseases. Moreover, as cell culture can affect expression levels of Slc4 genes, caution and careful design of experiments are necessary when undertaking studies of Slc4-mediated ion transport in cultured cells.

Dicty_cDB: SLC473 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC473 (Link to dictyBase) - - - Contig-U16054-1 SLC473F (Link to Original site) SLC4...73F 698 - - - - - - Show SLC473 Library SL (Link to library) Clone ID SLC473 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-D/SLC473Q.Seq.d/ Representative seq. ID SLC47...3F (Link to Original site) Representative DNA sequence >SLC473 (SLC473Q) /CSM/SL/SLC4-D/SLC473Q.Seq.d/ AGAAA... CSM-cDNA Score E Sequences producing significant alignments: (bits) Value SLC473 (SLC473Q) /CSM/SL/SLC4

Dicty_cDB: SLC483 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC483 (Link to dictyBase) - - - Contig-U16486-1 SLC483F (Link to Original site) SLC4...83F 718 - - - - - - Show SLC483 Library SL (Link to library) Clone ID SLC483 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-D/SLC483Q.Seq.d/ Representative seq. ID SLC48...3F (Link to Original site) Representative DNA sequence >SLC483 (SLC483Q) /CSM/SL/SLC4-D/SLC483Q.Seq.d/ AAAAA...roducing significant alignments: (bits) Value SLC483 (SLC483Q) /CSM/SL/SLC4-D/SLC483Q.Seq.d/ 1423 0.0 SLE651

Dicty_cDB: SLC434 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC434 (Link to dictyBase) - - - Contig-U15434-1 SLC434Z (Link... to Original site) - - SLC434Z 438 - - - - Show SLC434 Library SL (Link to library) Clone ID SLC434 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC434Q.Seq.d/ Representative seq. ID SLC43...4Z (Link to Original site) Representative DNA sequence >SLC434 (SLC434Q) /CSM/SL/SLC4-B/SLC434Q.Seq.d/ XXXXX...logy vs CSM-cDNA Score E Sequences producing significant alignments: (bits) Value SLC434 (SLC434Q) /CSM/SL/SLC4-B/SLC4

Dicty_cDB: SLC450 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC450 (Link to dictyBase) - - - Contig-U16382-1 SLC450Z (Link... to Original site) - - SLC450Z 416 - - - - Show SLC450 Library SL (Link to library) Clone ID SLC450 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-C/SLC450Q.Seq.d/ Representative seq. ID SLC45...0Z (Link to Original site) Representative DNA sequence >SLC450 (SLC450Q) /CSM/SL/SLC4-C/SLC450Q.Seq.d/ XXXXX...cant alignments: (bits) Value SLC450 (SLC450Q) /CSM/SL/SLC4-C/SLC450Q.Seq.d/ 678 0.0 VFO858 (VFO858Q) /CSM/V

Dicty_cDB: SLC469 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC469 (Link to dictyBase) - - - Contig-U16584-1 SLC469P (Link to Original site) SLC4...69F 676 SLC469Z 397 SLC469P 1073 - - Show SLC469 Library SL (Link to library) Clone ID SLC4...e URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-C/SLC469Q.Seq.d/ Representative seq. ID SLC4...69P (Link to Original site) Representative DNA sequence >SLC469 (SLC469Q) /CSM/SL/SLC4-C/SLC4...sfflc sklvvik*ncynyp Homology vs CSM-cDNA Score E Sequences producing significant alignments: (bits) Value SLC469 (SLC4

Dicty_cDB: SLC452 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC452 (Link to dictyBase) - - - Contig-U08358-1 SLC452E (Link to Original site) SLC4...52F 537 SLC452Z 347 SLC452P 884 SLC452E 537 Show SLC452 Library SL (Link to library) Clone ID SLC4...nal site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-C/SLC452Q.Seq.d/ Representative seq. ID SLC4...52E (Link to Original site) Representative DNA sequence >SLC452 (SLC452Q) /CSM/SL/SLC4-C/SLC4...slvtpplffq*skk Homology vs CSM-cDNA Score E Sequences producing significant alignments: (bits) Value SLC4

Effects of fasting and refeeding on gene expression of slc15a1a, a gene encoding an oligopeptide transporter (PepT1), in the intestine of Mozambique tilapia.

Science.gov (United States)

Orozco, Zenith Gaye A; Soma, Satoshi; Kaneko, Toyoji; Watanabe, Soichi

2017-01-01

The tissue distribution of slc15a1a, a gene that encodes an oligopeptide transporter, PepT1, and its response to fasting and refeeding were investigated in the intestinal epithelium of Mozambique tilapia for a better understanding of its role on nutrient absorption. The slc15a1a was predominantly expressed in the absorptive epithelia of the anterior part of the intestine, suggesting that digested oligopeptides are primarily absorbed in the anterior intestine. The response of slc15a1a to fasting was evaluated at 1, 2, 4, 7 and 14days after the last feeding. Fasting revealed a biphasic effect, where short-term fasting significantly upregulated slc15a1a expression and long-term fasting resulted in downregulation. The expression level continued to decrease and fell below the pre-fasted level from day 4 to 14. Proximal (the hepatic loop, HL) and distal parts (the proximal major coil, PMC) of the anterior intestine showed different magnitudes of responses to fasting; slc15a1a expression in the PMC showed greater upregulation and downregulation than that in the HL. Refeeding significantly stimulated slc15a1a expression at day 3, although the expression did not exceed the pre-fasted level. Observed responses of slc15a1a to fasting and refeeding suggest that the expression level of this gene can serve as a sensitive indicator of the changes that may occur in altering nutritional conditions. These findings contribute to a better understanding of the role of PepT1 in nutrition and of the complex mechanisms underlying the absorption of oligopeptides and amino acids in the intestine, and may lead to development of possible means to manipulate the absorption processes for the improvement of growth and other metabolic and physiological conditions in fish. Copyright © 2016. Published by Elsevier Inc.

Dicty_cDB: SLC436 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC436 (Link to dictyBase) - - - Contig-U16460-1 SLC436Z (Link... to Original site) - - SLC436Z 344 - - - - Show SLC436 Library SL (Link to library) Clone ID SLC436 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC436Q.Seq.d/ Representative seq. ID SLC43...6Z (Link to Original site) Representative DNA sequence >SLC436 (SLC436Q) /CSM/SL/SLC4-B/SLC436Q.Seq.d/ XXXXX.../CSM/SL/SLE2-C/SLE258Q.Seq.d/ 470 e-132 SLC773 (SLC773Q) /CSM/SL/SLC7-D/SLC773Q.Seq.d/ 470 e-132 SLC4

Dicty_cDB: SLC442 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC442 (Link to dictyBase) - - - Contig-U16430-1 SLC442Z (Link... to Original site) - - SLC442Z 467 - - - - Show SLC442 Library SL (Link to library) Clone ID SLC442 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC442Q.Seq.d/ Representative seq. ID SLC44...2Z (Link to Original site) Representative DNA sequence >SLC442 (SLC442Q) /CSM/SL/SLC4-B/SLC442Q.Seq.d/ XXXXX... 4.0 %: extracellular, including cell wall 4.0 %: peroxisomal >> prediction for SLC4

Dicty_cDB: SLC478 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC478 (Link to dictyBase) - - - Contig-U16419-1 SLC478Z (Link... to Original site) - - SLC478Z 400 - - - - Show SLC478 Library SL (Link to library) Clone ID SLC478 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-D/SLC478Q.Seq.d/ Representative seq. ID SLC47...8Z (Link to Original site) Representative DNA sequence >SLC478 (SLC478Q) /CSM/SL/SLC4-D/SLC478Q.Seq.d/ XXXXX... %: cytoplasmic 28.0 %: nuclear 24.0 %: mitochondrial 12.0 %: cytoskeletal >> prediction for SLC4

Dicty_cDB: SLC448 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC448 (Link to dictyBase) - - - Contig-U15118-1 SLC448E (Link... to Original site) - - - - - - SLC448E 245 Show SLC448 Library SL (Link to library) Clone ID SLC448 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC448Q.Seq.d/ Representative seq. ID SLC44...8E (Link to Original site) Representative DNA sequence >SLC448 (SLC448Q) /CSM/SL/SLC4-B/SLC448Q.Seq.d/ GGTAA... %: nuclear 12.0 %: mitochondrial 8.0 %: cytoskeletal 4.0 %: endoplasmic reticulum >> prediction for SLC4

Dicty_cDB: SLC456 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC456 (Link to dictyBase) - - - Contig-U16272-1 SLC456Z (Link... to Original site) - - SLC456Z 483 - - - - Show SLC456 Library SL (Link to library) Clone ID SLC456 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-C/SLC456Q.Seq.d/ Representative seq. ID SLC45...6Z (Link to Original site) Representative DNA sequence >SLC456 (SLC456Q) /CSM/SL/SLC4-C/SLC456Q.Seq.d/ XXXXX...0 %: vacuolar 4.0 %: peroxisomal >> prediction for SLC456 is nuc 5' end seq. ID -

Dicty_cDB: SLC455 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC455 (Link to dictyBase) - - - Contig-U16584-1 SLC455Z (Link... to Original site) - - SLC455Z 379 - - - - Show SLC455 Library SL (Link to library) Clone ID SLC455 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-C/SLC455Q.Seq.d/ Representative seq. ID SLC45...5Z (Link to Original site) Representative DNA sequence >SLC455 (SLC455Q) /CSM/SL/SLC4-C/SLC455Q.Seq.d/ XXXXX...57 ) Dictyostelium discoideum slug cDNA, clone SLC469. 468 e-177 3 ( AU034549 ) Dictyostelium discoideum slug cDNA, clone SLC4

Dicty_cDB: SLC464 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC464 (Link to dictyBase) - - - Contig-U00917-1 SLC464Z (Link... to Original site) - - SLC464Z 406 - - - - Show SLC464 Library SL (Link to library) Clone ID SLC464 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-C/SLC464Q.Seq.d/ Representative seq. ID SLC46...4Z (Link to Original site) Representative DNA sequence >SLC464 (SLC464Q) /CSM/SL/SLC4-C/SLC464Q.Seq.d/ XXXXX... Homology vs CSM-cDNA Score E Sequences producing significant alignments: (bits) Value SLC464 (SLC4

Dicty_cDB: SLC477 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC477 (Link to dictyBase) - - - Contig-U16260-1 SLC477Z (Link... to Original site) - - SLC477Z 326 - - - - Show SLC477 Library SL (Link to library) Clone ID SLC477 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-D/SLC477Q.Seq.d/ Representative seq. ID SLC47...7Z (Link to Original site) Representative DNA sequence >SLC477 (SLC477Q) /CSM/SL/SLC4-D/SLC477Q.Seq.d/ XXXXX...hfefsnivikskkkkkkkkkkkkkk Homology vs CSM-cDNA Score E Sequences producing significant alignments: (bits) Value SLC477 (SLC4

Folate-modified lipid–polymer hybrid nanoparticles for targeted paclitaxel delivery

Directory of Open Access Journals (Sweden)

Zhang L

2015-03-01

Full Text Available Linhua Zhang,1 Dunwan Zhu,1 Xia Dong,1 Hongfan Sun,1 Cunxian Song,1 Chun Wang,2 Deling Kong1 1Tianjin Key Laboratory of Biomaterials, Institute of Biomedical Engineering, Peking Union Medical College and Chinese Academy of Medical Sciences, Tianjin, People’s Republic of China; 2Department of Biomedical Engineering, University of Minnesota, Minneapolis, MN, USA Abstract: The purpose of this study was to develop a novel lipid–polymer hybrid drug carrier comprised of folate (FA modified lipid-shell and polymer-core nanoparticles (FLPNPs for sustained, controlled, and targeted delivery of paclitaxel (PTX. The core-shell NPs consist of 1 a poly(ε-caprolactone hydrophobic core based on self-assembly of poly(ε-caprolactone–poly(ethylene glycol–poly(ε-caprolactone (PCL-PEG-PCL amphiphilic copolymers, 2 a lipid monolayer formed with 1,2-distearoyl-sn-glycero-3-phosphoethanolamine-N-[methoxy (polyethylene glycol-2000] (DSPE-PEG2000, 3 a targeting ligand (FA on the surface, and were prepared using a thin-film hydration and ultrasonic dispersion method. Transmission electron microscopy and dynamic light scattering analysis confirmed the coating of the lipid monolayer on the hydrophobic polymer core. Physicochemical characterizations of PTX-loaded FLPNPs, such as particle size and size distribution, zeta potential, morphology, drug loading content, encapsulation efficiency, and in vitro drug release, were also evaluated. Fluorescent microscopy proved the internalization efficiency and targeting ability of the folate conjugated on the lipid monolayer for the EMT6 cancer cells which overexpress folate receptor. In vitro cytotoxicity assay demonstrated that the cytotoxic effect of PTX-loaded FLPNPs was lower than that of Taxol®, but higher than that of PTX-loaded LPNPs (without folate conjugation. In EMT6 breast tumor model, intratumoral administration of PTX-loaded FLPNPs showed similar antitumor efficacy but low toxicity compared to Taxol®. More

Dicty_cDB: SLC486 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC486 (Link to dictyBase) - - - Contig-U16480-1 SLC486E (Link... to Original site) - - - - - - SLC486E 451 Show SLC486 Library SL (Link to library) Clone ID SLC486 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-D/SLC486Q.Seq.d/ Representative seq. ID SLC48...6E (Link to Original site) Representative DNA sequence >SLC486 (SLC486Q) /CSM/SL/SLC4-D/SLC486Q.Seq.d/ GTCAT...7Q.Seq.d/ 868 0.0 SLD427 (SLD427Q) /CSM/SL/SLD4-B/SLD427Q.Seq.d/ 868 0.0 SLC486 (SLC486Q) /CSM/SL/SLC4-D/SLC4

Dicty_cDB: SLC470 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC470 (Link to dictyBase) - - - Contig-U15735-1 SLC470Z (Link... to Original site) - - SLC470Z 386 - - - - Show SLC470 Library SL (Link to library) Clone ID SLC470 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-C/SLC470Q.Seq.d/ Representative seq. ID SLC47...0Z (Link to Original site) Representative DNA sequence >SLC470 (SLC470Q) /CSM/SL/SLC4-C/SLC470Q.Seq.d/ XXXXX...Seq.d/ 533 e-151 SLF229 (SLF229Q) /CSM/SL/SLF2-B/SLF229Q.Seq.d/ 533 e-151 SLC470 (SLC470Q) /CSM/SL/SLC4-C/SLC4

Dicty_cDB: SLC466 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC466 (Link to dictyBase) - - - Contig-U16381-1 SLC466Z (Link... to Original site) - - SLC466Z 427 - - - - Show SLC466 Library SL (Link to library) Clone ID SLC466 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-C/SLC466Q.Seq.d/ Representative seq. ID SLC46...6Z (Link to Original site) Representative DNA sequence >SLC466 (SLC466Q) /CSM/SL/SLC4-C/SLC466Q.Seq.d/ XXXXX... AU034556 ) Dictyostelium discoideum slug cDNA, clone SLC466. 176 2e-77 2 ( AU033496 ) Dictyostelium discoid

Dicty_cDB: SLC444 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC444 (Link to dictyBase) - - - Contig-U16368-1 SLC444Z (Link... to Original site) - - SLC444Z 462 - - - - Show SLC444 Library SL (Link to library) Clone ID SLC444 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC444Q.Seq.d/ Representative seq. ID SLC44...4Z (Link to Original site) Representative DNA sequence >SLC444 (SLC444Q) /CSM/SL/SLC4-B/SLC444Q.Seq.d/ XXXXX...tochondrial 8.0 %: nuclear 4.0 %: cytoskeletal 4.0 %: cytoplasmic >> prediction for SLC444 is mit 5' end seq

Dicty_cDB: SLC490 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC490 (Link to dictyBase) - - - Contig-U16444-1 SLC490Z (Link... to Original site) - - SLC490Z 427 - - - - Show SLC490 Library SL (Link to library) Clone ID SLC490 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-D/SLC490Q.Seq.d/ Representative seq. ID SLC49...0Z (Link to Original site) Representative DNA sequence >SLC490 (SLC490Q) /CSM/SL/SLC4-D/SLC490Q.Seq.d/ XXXXX...itochondrial 24.0 %: cytoplasmic 24.0 %: nuclear 4.0 %: cytoskeletal 4.0 %: plasma membrane 4.0 %: peroxisomal >> prediction for SLC4

Dicty_cDB: SLC484 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC484 (Link to dictyBase) - - - Contig-U15497-1 SLC484Z (Link... to Original site) - - SLC484Z 462 - - - - Show SLC484 Library SL (Link to library) Clone ID SLC484 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-D/SLC484Q.Seq.d/ Representative seq. ID SLC48...4Z (Link to Original site) Representative DNA sequence >SLC484 (SLC484Q) /CSM/SL/SLC4-D/SLC484Q.Seq.d/ XXXXX...mic 32.0 %: mitochondrial 16.0 %: nuclear 4.0 %: peroxisomal 4.0 %: endoplasmic reticulum >> prediction for SLC4

Multicenter cohort association study of SLC2A1 single nucleotide polymorphisms and age-related macular degeneration

Science.gov (United States)

Baas, Dominique C.; Ho, Lintje; Tanck, Michael W.T.; Fritsche, Lars G.; Merriam, Joanna E.; van het Slot, Ruben; Koeleman, Bobby P.C.; Gorgels, Theo G.M.F.; van Duijn, Cornelia M.; Uitterlinden, André G.; de Jong, Paulus T.V.M.; Hofman, Albert; ten Brink, Jacoline B.; Vingerling, Johannes R.; Klaver, Caroline C.W.; Dean, Michael; Weber, Bernhard H. F.; Allikmets, Rando; Hageman, Gregory S.

2012-01-01

Purpose Age-related macular degeneration (AMD) is a major cause of blindness in older adults and has a genetically complex background. This study examines the potential association between single nucleotide polymorphisms (SNPs) in the glucose transporter 1 (SLC2A1) gene and AMD. SLC2A1 regulates the bioavailability of glucose in the retinal pigment epithelium (RPE), which might influence oxidative stress–mediated AMD pathology. Methods Twenty-two SNPs spanning the SLC2A1 gene were genotyped in 375 cases and 199 controls from an initial discovery cohort (the Amsterdam-Rotterdam-Netherlands study). Replication testing was performed in The Rotterdam Study (the Netherlands) and study populations from Würzburg (Germany), the Age Related Eye Disease Study (AREDS; United States), Columbia University (United States), and Iowa University (United States). Subsequently, a meta-analysis of SNP association was performed. Results In the discovery cohort, significant genotypic association between three SNPs (rs3754219, rs4660687, and rs841853) and AMD was found. Replication in five large independent (Caucasian) cohorts (4,860 cases and 4,004 controls) did not yield consistent association results. The genotype frequencies for these SNPs were significantly different for the controls and/or cases among the six individual populations. Meta-analysis revealed significant heterogeneity of effect between the studies. Conclusions No overall association between SLC2A1 SNPs and AMD was demonstrated. Since the genotype frequencies for the three SLC2A1 SNPs were significantly different for the controls and/or cases between the six cohorts, this study corroborates previous evidence that population dependent genetic risk heterogeneity in AMD exists. PMID:22509097

Dicty_cDB: SLC438 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC438 (Link to dictyBase) - - - Contig-U10771-1 SLC438Z (Link... to Original site) - - SLC438Z 549 - - - - Show SLC438 Library SL (Link to library) Clone ID SLC438 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC438Q.Seq.d/ Representative seq. ID SLC43...8Z (Link to Original site) Representative DNA sequence >SLC438 (SLC438Q) /CSM/SL/SLC4-B/SLC438Q.Seq.d/ XXXXX...es producing significant alignments: (bits) Value SSM825 (SSM825Q) /CSM/SS/SSM8-B/SSM825Q.Seq.d/ 948 0.0 SLC438 (SLC4

Dicty_cDB: SLC480 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC480 (Link to dictyBase) - - - Contig-U13538-1 SLC480Z (Link... to Original site) - - SLC480Z 455 - - - - Show SLC480 Library SL (Link to library) Clone ID SLC480 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-D/SLC480Q.Seq.d/ Representative seq. ID SLC48...0Z (Link to Original site) Representative DNA sequence >SLC480 (SLC480Q) /CSM/SL/SLC4-D/SLC480Q.Seq.d/ XXXXX...ial 8.0 %: peroxisomal >> prediction for SLC480 is nuc 5' end seq. ID - 5' end seq. - Length of 5' end seq. - 3' end seq. ID SLC4

Folate-decorated chitosan/doxorubicin poly(butyl)cyanoacrylate nanoparticles for tumor-targeted drug delivery

Energy Technology Data Exchange (ETDEWEB)

Duan Jinghua [Xiangya Hospital, Central South University, Hepatobiliary and Enteric Surgery Research Center (China); Liu Mujun [Central South University, School of Biological Science and Technology (China); Zhang Yangde; Zhao Jinfeng; Pan Yifeng [Xiangya Hospital, Central South University, Hepatobiliary and Enteric Surgery Research Center (China); Yang Xiyun, E-mail: bax_2007@126.com [Central South University, School of Metallurgical Science and Engineering (China)

2012-03-15

A novel chitosan coated poly(butyl cyanoacrylate) (PBCA) nanoparticles loaded doxorubicin (DOX) were synthesized and then conjugated with folic acid to produce a folate-targeted drug carrier for tumor-specific drug delivery. Prepared nanoparticles were surface modified by folate for targeting cancer cells, which is confirmed by FTIR spectroscopy and characterized for shape, size, and zeta potential measurements. The size and zeta potential of prepared DOX-PBCA nanoparticles (DOX-PBCA NPs) were almost 174 {+-} 8.23 nm and +23.14 {+-} 4.25 mV, respectively with 46.8 {+-} 3.32% encapsulation capacity. The transmission electron microscopy study revealed that preparation allowed the formation of spherical nanometric and homogeneous. Fluorescent microscopy imaging and flow cytometry analysis revealed that DOX-PBCA NPs were endocytosed into MCF-7 cells through the interaction with overexpressed folate receptors on the surface of the cancer cells. The results demonstrate that folate-conjugated DOX-PBCA NPs drug delivery system could provide increased therapeutic benefit by delivering the encapsulated drug to the folate receptor positive cancer cells.

Common breast cancer susceptibility alleles and the risk of breast cancer for BRCA1 and BRCA2 mutation carriers: implications for risk prediction

DEFF Research Database (Denmark)

Antoniou, Antonis C; Beesley, Jonathan; McGuffog, Lesley

2010-01-01

The known breast cancer susceptibility polymorphisms in FGFR2, TNRC9/TOX3, MAP3K1, LSP1, and 2q35 confer increased risks of breast cancer for BRCA1 or BRCA2 mutation carriers. We evaluated the associations of 3 additional single nucleotide polymorphisms (SNPs), rs4973768 in SLC4A7/NEK10, rs650495...

Dicty_cDB: SLC832 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC832 (Link to dictyBase) - - - Contig-U13922-1 SLC832Z (Link... to Original site) - - SLC832Z 638 - - - - Show SLC832 Library SL (Link to library) Clone ID SLC832 (Link to dic..._1( EU565733 |pid:none) Uncultured soil bacterium clone gl... 35 2.4 CP000010_276....1 AP009385_2728( AP009385 |pid:none) Burkholderia multivorans ATCC 1... 33 5.3 A... 20.0 %: nuclear 16.0 %: vesicles of secretory system 12.0 %: mitochondrial 8.0 %: Golgi 8.0 %: endoplasmic reticul

SLC2A3 single-nucleotide polymorphism and duplication influence cognitive processing and population-specific risk for attention-deficit/hyperactivity disorder.

Science.gov (United States)

Merker, Sören; Reif, Andreas; Ziegler, Georg C; Weber, Heike; Mayer, Ute; Ehlis, Ann-Christine; Conzelmann, Annette; Johansson, Stefan; Müller-Reible, Clemens; Nanda, Indrajit; Haaf, Thomas; Ullmann, Reinhard; Romanos, Marcel; Fallgatter, Andreas J; Pauli, Paul; Strekalova, Tatyana; Jansch, Charline; Vasquez, Alejandro Arias; Haavik, Jan; Ribasés, Marta; Ramos-Quiroga, Josep Antoni; Buitelaar, Jan K; Franke, Barbara; Lesch, Klaus-Peter

2017-07-01

Attention-deficit/hyperactivity disorder (ADHD) is a common, highly heritable neurodevelopmental disorder with profound cognitive, behavioral, and psychosocial impairments with persistence across the life cycle. Our initial genome-wide screening approach for copy number variants (CNVs) in ADHD implicated a duplication of SLC2A3, encoding glucose transporter-3 (GLUT3). GLUT3 plays a critical role in cerebral glucose metabolism, providing energy for the activity of neurons, which, in turn, moderates the excitatory-inhibitory balance impacting both brain development and activity-dependent neural plasticity. We therefore aimed to provide additional genetic and functional evidence for GLUT3 dysfunction in ADHD. Case-control association analyses of SLC2A3 single-nucleotide polymorphisms (SNPs) and CNVs were conducted in several European cohorts of patients with childhood and adult ADHD (SNP, n = 1,886 vs. 1,988; CNV, n = 1,692 vs. 1,721). These studies were complemented by SLC2A3 expression analyses in peripheral cells, functional EEG recordings during neurocognitive tasks, and ratings of food energy content. Meta-analysis of all cohorts detected an association of SNP rs12842 with ADHD. While CNV analysis detected a population-specific enrichment of SLC2A3 duplications only in German ADHD patients, the CNV + rs12842 haplotype influenced ADHD risk in both the German and Spanish cohorts. Duplication carriers displayed elevated SLC2A3 mRNA expression in peripheral blood cells and altered event-related potentials reflecting deficits in working memory and cognitive response control, both endophenotypic traits of ADHD, and an underestimation of energy units of high-caloric food. Taken together, our results indicate that both common and rare SLC2A3 variation impacting regulation of neuronal glucose utilization and energy homeostasis may result in neurocognitive deficits known to contribute to ADHD risk. © 2017 Association for Child and Adolescent Mental Health.

Erythrocyte folate, plasma folate and plasma homocysteine during normal pregnancy and postpartum: a longitudinal study comprising 404 danish women

DEFF Research Database (Denmark)

Milman, N; Byg, KE; Hvas, Anne-Mette

2006-01-01

OBJECTIVE: To assess folate and homocysteine status during normal pregnancy and postpartum in a longitudinal setting. METHODS: This study, performed in 1995-1996, comprised 404 healthy pregnant Danish Caucasian women residential in Copenhagen County. Women taking folic acid tablets or vitamin B12...... injections were not included. Dietary multivitamin supplements containing folic acid 100 microg or vitamin B12 1 microg, taken by 34%, were discontinued at inclusion. Participants had normal renal function. Folate status [erythrocyte (Ery-) folate, plasma (P-) folate, P-homocysteine] was measured at 18, 32...... new guidelines for folic acid supplement since 1997, only 13% of pregnant women followed the guidelines in 2003. The official recommendations for periconceptional folic acid supplement should be reconsidered and reinforced....

Solute carrier transporters: potential targets for digestive system neoplasms.

Science.gov (United States)

Xie, Jing; Zhu, Xiao Yan; Liu, Lu Ming; Meng, Zhi Qiang

2018-01-01

Digestive system neoplasms are the leading causes of cancer-related death all over the world. Solute carrier (SLC) superfamily is composed of a series of transporters that are ubiquitously expressed in organs and tissues of digestive systems and mediate specific uptake of small molecule substrates in facilitative manner. Given the important role of SLC proteins in maintaining normal functions of digestive system, dysregulation of these protein in digestive system neoplasms may deliver biological and clinical significance that deserves systemic studies. In this review, we critically summarized the recent advances in understanding the role of SLC proteins in digestive system neoplasms. We highlighted that several SLC subfamilies, including metal ion transporters, transporters of glucose and other sugars, transporters of urea, neurotransmitters and biogenic amines, ammonium and choline, inorganic cation/anion transporters, transporters of nucleotide, amino acid and oligopeptide organic anion transporters, transporters of vitamins and cofactors and mitochondrial carrier, may play important roles in mediating the initiation, progression, metastasis, and chemoresistance of digestive system neoplasms. Proteins in these SLC subfamilies may also have diagnostic and prognostic values to particular cancer types. Differential expression of SLC proteins in tumors of digestive system was analyzed by extracting data from human cancer database, which revealed that the roles of SLC proteins may either be dependent on the substrates they transport or be tissue specific. In addition, small molecule modulators that pharmacologically regulate the functions of SLC proteins were discussed for their possible application in the treatment of digestive system neoplasms. This review highlighted the potential of SLC family proteins as drug target for the treatment of digestive system neoplasms.

Distribution and expression of SLC45A2 in the skin of sheep with different coat colors.

Science.gov (United States)

Wang, Haidong; Xue, Linli; Li, Yanan; Zhao, Bingling; Chen, Tianzhi; Liu, Ying; Chang, Lucheng; Wang, Juan

2016-01-01

To investigate whether the membrane-associated transporter protein SLC45A2 is differentially expressed in the skin of sheep with different coat colors and to determine its correlation with coat color establishment in sheep. The expression of SLC45A2 in sheep skin samples with different coat colors was qualitatively and quantitatively analyzed by PCR amplification, RT-PCR, immunohistochemical staining and Western blotting. A 193-bp SLC45A2 CDS sequence was successfully amplified from sheep skin samples with diverse coat colors. RT-PCR analysis revealed that SLC45A2 mRNA was expressed in all sheep skin samples tested, with relative expression levels of 512.74 ± 121.51 in black skin, 143.38 ± 119.31 and 1.36 ± 0.09 in black dots and white dots of piebald skin, respectively, and 1.02 ± 0.23 in white skin (p coat colors. These patterns were quantified by optical density (OD) analysis, which yielded relative expression levels of 0.23 ± 0.11 in black skin, 0.19 ± 0.09 and 0.10 ± 0.03 in black dots and white dots of piebald skin, respectively, and 0.08 ± 0.01 in white skin (p coat colors, though at significantly different levels. SLC45A2 may participate in the establishment of coat color by regulating the synthesis and trafficking of melanin.

Sequence variation and linkage disequilibrium in the GABA transporter-1 gene (SLC6A1 in five populations: implications for pharmacogenetic research

Directory of Open Access Journals (Sweden)

Sughondhabirom Atapol

2007-10-01

Full Text Available Abstract Background GABA transporter-1 (GAT-1; genetic locus SLC6A1 is emerging as a novel target for treatment of neuropsychiatric disorders. To understand how population differences might influence strategies for pharmacogenetic studies, we identified patterns of genetic variation and linkage disequilibrium (LD in SLC6A1 in five populations representing three continental groups. Results We resequenced 12.4 kb of SLC6A1, including the promoters, exons and flanking intronic regions in African-American, Thai, Hmong, Finnish, and European-American subjects (total n = 40. LD in SLC6A1 was examined by genotyping 16 SNPs in larger samples. Sixty-three variants were identified through resequencing. Common population-specific variants were found in African-Americans, including a novel 21-bp promoter region variable number tandem repeat (VNTR, but no such variants were found in any of the other populations studied. Low levels of LD and the absence of major LD blocks were characteristic of all five populations. African-Americans had the highest genetic diversity. European-Americans and Finns did not differ in genetic diversity or LD patterns. Although the Hmong had the highest level of LD, our results suggest that a strategy based on the use of tag SNPs would not translate to a major improvement in genotyping efficiency. Conclusion Owing to the low level of LD and presence of recombination hotspots, SLC6A1 may be an example of a problematic gene for association and haplotype tagging-based genetic studies. The 21-bp promoter region VNTR polymorphism is a putatively functional candidate allele for studies focusing on variation in GAT-1 function in the African-American population.

Nutritional status of iron, vitamin B12, folate, retinol and anemia in children 1 to 11 years old. Results of the Ensanut 2012

Directory of Open Access Journals (Sweden)

Salvador Villalpando

2015-09-01

Full Text Available Objective. To describe the frequency of anemia, iron, vitamin B12, folate, retinol and predictors of anemia among Mexican children from Ensanut 2012. Materials and methods. Hemoglobin, ferritin, CRP, vitamin B12, retinol and folate concentrations were measured in 2 678 children aged 1-4 y and 4 275 children aged 5-11 y. Adjusted logistic regression models were constructed to assess the risk for anemia and micronutrient deficiencies. Results. In preschoolers and scholars, the overall prevalence of anemia was 20.4 and 9.7%, iron deficiency 14 and 9.3%, low vitamin B12 (LB12S 1.9 and 2.6%; Folate 0.30 and 0%, and retinol depletion (VADp 15.7 and 2.3%, respectively. ID and VADp were negatively associated with Hb (coefficient: -0.38 and -0.45, p<0.05; a higher log-CRP was associated with higher risk for anemia and VADp (OR=1.13 and OR=2.1, p<0.05, respectively. Conclusions. Iron deficiency, anemia and VADp are some of the main nutritional problems among Mexican infants

Nutritional status of iron, vitamin B12, folate, retinol and anemia in children 1 to 11 years old: Results of the Ensanut 2012.

Science.gov (United States)

Villalpando, Salvador; Cruz, Vanessa de la; Shamah-Levy, Teresa; Rebollar, Rosario; Contreras-Manzano, Alejandra

2015-01-01

To describe the frequency of anemia, iron, vitamin B12, folate, retinol and predictors of anemia among Mexican children from Ensanut 2012. Hemoglobin, ferritin, CRP, vitamin B12, retinol and folate concentrations were measured in 2 678 children aged 1-4 y and 4 275 children aged 5-11 y. Adjusted logistic regression models were constructed to assess the risk for anemia and micronutrient deficiencies. In preschoolers and scholars, the overall prevalence of anemia was 20.4 and 9.7%, iron deficiency 14 and 9.3%, low vitamin B12 (LB12S) 1.9 and 2.6%; Folate 0.30 and 0%, and retinol depletion (VADp) 15.7 and 2.3%, respectively. ID and VADp were negatively associated with Hb (coefficient: -0.38 and -0.45, p<0.05); a higher log-CRP was associated with higher risk for anemia and VADp (OR=1.13 and OR=2.1, p<0.05, respectively). Iron deficiency, anemia and VADp are some of the main nutritional problems among Mexican infants.

Folate status and concentrations of serum folate forms in the US population: National Health and Nutrition Examination Survey 2011–2

Science.gov (United States)

Pfeiffer, Christine M.; Sternberg, Maya R.; Fazili, Zia; Lacher, David A.; Zhang, Mindy; Johnson, Clifford L.; Hamner, Heather C.; Bailey, Regan L.; Rader, Jeanne I.; Yamini, Sedigheh; Berry, R. J.; Yetley, Elizabeth A.

2016-01-01

Serum and red blood cell (RBC) total folate are indicators of folate status. No nationally representative population data exist for folate forms. We measured serum folate forms [5-methyltetrahydrofolate (5-methylTHF), unmetabolized folic acid (UMFA), non-methyl folate (sum of THF, 5-formylTHF, 5,10-methenylTHF), and MeFox (5-methylTHF oxidation product)] by HPLC-MS/MS and RBC total folate by microbiologic assay in US persons ≥1 year (n ~7500) participating in the National Health and Nutrition Examination Survey 2011–2. Data analysis for serum total folate was conducted including and excluding MeFox. Concentrations (geometric mean; detection rate) of 5-methylTHF (37.5 nmol/L; 100%), UMFA (1.21 nmol/L; 99.9%), MeFox (1.53 nmol/L; 98.8%), and THF (1.01 nmol/L; 85.2%) were mostly detectable. 5-FormylTHF (3.6%) and 5,10-methenylTHF (4.4%) were rarely detected. The biggest contributor to serum total folate was 5-methylTHF (86.7%); UMFA (4.0%), non-methyl folate (4.7%), and MeFox (4.5%) contributed smaller amounts. Age was positively related to MeFox but showed a U-shaped pattern for other folates. We generally noted sex and race-ethnic biomarker differences and weak (Spearman r folates. All biomarkers showed significantly higher concentrations with recent folic acid-containing dietary supplement use. These first-time population data for serum folate forms generally show similar associations with demographic, physiologic, and lifestyle variables as serum total folate. Patterns observed for MeFox may suggest altered folate metabolism dependent on biological characteristics. PMID:25917925

Response to crizotinib in a lung adenocarcinoma patient harboring a novel SLC34A2-ROS1 fusion variant

Science.gov (United States)

Zhao, Zheng; Song, Zhangjun; Wang, Xuwei; Sun, Haifeng; Yang, Xiaomin; Yuan, Yong; Yu, Pan

2017-01-01

ROS1 fusion is a common genetic alteration in non-small-cell lung cancer. Crizotinib, an anaplastic lymphoma kinase inhibitor, shows efficacy in the treatment of lung cancer cases with ROS1 translocation. We report the response to crizotinib of a lung adenocarcinoma patient harboring a novel SLC34A2-ROS1 fusion variant, which was different from the two common SLC34A2-ROS1 fusion types reported in the literature. After crizotinib administration, overall recovery was good in this patient; the primary lesion was successfully treated, the lymph node metastases had disappeared, and the metabolism was normal. PMID:28860822

Folate status and concentrations of serum folate forms in the US population: National Health and Nutrition Examination Survey 2011-2.

Science.gov (United States)

Pfeiffer, Christine M; Sternberg, Maya R; Fazili, Zia; Lacher, David A; Zhang, Mindy; Johnson, Clifford L; Hamner, Heather C; Bailey, Regan L; Rader, Jeanne I; Yamini, Sedigheh; Berry, R J; Yetley, Elizabeth A

2015-06-28

Serum and erythrocyte (RBC) total folate are indicators of folate status. No nationally representative population data exist for folate forms. We measured the serum folate forms (5-methyltetrahydrofolate (5-methylTHF), unmetabolised folic acid (UMFA), non-methyl folate (sum of tetrahydrofolate (THF), 5-formyltetrahydrofolate (5-formylTHF), 5,10-methenyltetrahydrofolate (5,10-methenylTHF)) and MeFox (5-methylTHF oxidation product)) by HPLC-MS/MS and RBC total folate by microbiologic assay in US population ≥ 1 year (n approximately 7500) participating in the National Health and Nutrition Examination Survey 2011-2. Data analysis for serum total folate was conducted including and excluding MeFox. Concentrations (geometric mean; detection rate) of 5-methylTHF (37·5 nmol/l; 100 %), UMFA (1·21 nmol/l; 99·9 %), MeFox (1·53 nmol/l; 98·8 %), and THF (1·01 nmol/l; 85·2 %) were mostly detectable. 5-FormylTHF (3·6 %) and 5,10-methenylTHF (4·4 %) were rarely detected. The biggest contributor to serum total folate was 5-methylTHF (86·7 %); UMFA (4·0 %), non-methyl folate (4·7 %) and MeFox (4·5 %) contributed smaller amounts. Age was positively related to MeFox, but showed a U-shaped pattern for other folates. We generally noted sex and race/ethnic biomarker differences and weak (Spearman's rfolates. All biomarkers showed significantly higher concentrations with recent folic acid-containing dietary supplement use. These first-time population data for serum folate forms generally show similar associations with demographic, physiological and lifestyle variables as serum total folate. Patterns observed for MeFox may suggest altered folate metabolism dependent on biological characteristics.

Neurosteroid Transport in the Brain: Role of ABC and SLC Transporters

Directory of Open Access Journals (Sweden)

Markus Grube

2018-04-01

Full Text Available Neurosteroids, comprising pregnane, androstane, and sulfated steroids can alter neuronal excitability through interaction with ligand-gated ion channels and other receptors and have therefore a therapeutic potential in several brain disorders. They can be formed in brain cells or are synthesized by an endocrine gland and reach the brain by penetrating the blood–brain barrier (BBB. Especially sulfated steroids such as pregnenolone sulfate (PregS and dehydroepiandrosterone sulfate (DHEAS depend on transporter proteins to cross membranes. In this review, we discuss the involvement of ATP-binding cassette (ABC- and solute carrier (SLC-type membrane proteins in the transport of these compounds at the BBB and in the choroid plexus (CP, but also in the secretion from neurons and glial cells. Among the ABC transporters, especially BCRP (ABCG2 and several MRP/ABCC subfamily members (MRP1, MRP4, MRP8 are expressed in the brain and known to efflux conjugated steroids. Furthermore, several SLC transporters have been shown to mediate cellular uptake of steroid sulfates. These include members of the OATP/SLCO subfamily, namely OATP1A2 and OATP2B1, as well as OAT3 (SLC22A3, which have been reported to be expressed at the BBB, in the CP and in part in neurons. Furthermore, a role of the organic solute transporter OSTα-OSTβ (SLC51A/B in brain DHEAS/PregS homeostasis has been proposed. This transporter was reported to be localized especially in steroidogenic cells of the cerebellum and hippocampus. To date, the impact of transporters on neurosteroid homeostasis is still poorly understood. Further insights are desirable also with regard to the therapeutic potential of these compounds.

Study on folate receptor PET imaging agent 18F-flurophenethyl folate

International Nuclear Information System (INIS)

Guo Congying; Zhu Jianhua; Qian Jun; Yang Yang; Shen Haixing; Zhang Zhengwei

2009-01-01

This work is aimed at synthesizing an 18 F-labelled folate derivative that can be used as folate-receptor induced tumor PET imaging agent. Under the optimal reaction and testing specification formulated during the cold-labeling experiments, 18 F labeling of folic acid was achieved in three steps of 18 F pre-labeling,bromination and esterification. The receptor binding property of the newly-synthesized folate radio-derivative was studied through β-lactoglobulin binding test. Tumor-bearing nude mice injected with the new compound were used to study whether the derivative can accumulate within tumor issue. Preliminary studies in vitro and in vivo showed that this new PET agent still possessed receptor binding qualities of folic acid. 18 F-flurophenethyl folate remained good affinity and specificity with β-lactoglobulin. Accumulation of activities in tumor tissues was found in tumor-bearing nude mice. A new folate receptor ligand: 18 F-flurophenethyl folate was synthesized,with high yield and good stability. Since the pre-labeling method was used, the fluorine labeling was not directly imposed upon folic acid.In this way, the structure destruction, which happens in high temperature reaction of folic acid, can be avoided. The synthesized folate derivative remained the binding structural quality of folic acid and could bind with the folate-binding protein: β-lactoglobulin. Through the folate receptors located on tumor tissues, 18 F-flurophenethyl folate accumulated in the tumor tissue, exhibiting its potential as a tumor PET imaging agent. (authors)

Association between SLC2A9 (GLUT9) gene polymorphisms and gout susceptibility: an updated meta-analysis.

Science.gov (United States)

Zhang, Xu; Yang, Xiao; Wang, Mengmeng; Li, Xiaona; Xia, Qing; Xu, Shengqian; Xu, Jianhua; Cai, Guoqi; Wang, Li; Xin, Lihong; Zou, Yanfeng; Pan, Faming

2016-08-01

The relationship between the SLC2A9 (solute carrier family 2, member 9) gene polymorphisms and gout was still inconsistent among the individual genetic association studies. Therefore, this present research was aimed to systematically evaluate the association between SLC2A9 gene polymorphisms and gout susceptibility. Relevant studies were enrolled by searching databases systematically. The pooled odds ratios (ORs) with 95 % confidence intervals (CIs) were used to assess the associations. The heterogeneity between each of the studies was calculated by using the Q statistic methods, and Begg's funnel plot and Egger's tests were performed to evaluate publication bias. A total of 13 studies investigated four single nucleotide polymorphisms (SNPs) in SLC2A9 were included. In this study, we found that the allele C of rs3733591 was higher in patients than in controls in both all-pooled population [C vs. T: OR (95 % CI) = 1.432 (1.213-1.691)] and Asians-pooled population [C vs. T: OR (95 % CI) = 1.583 (1.365-1.835)]. The allele frequency C of s6449213 was lower in the gout patients than in controls in both all-pooled population and Caucasians-pooled population. Additionally, the allele frequency T of rs16890979 and the allele frequency C of rs1014290 were lower in gout patients than in controls. This study demonstrated that the genetic susceptibility for gout is associated with the SLC2A9 gene polymorphisms. Four of them except for the rs3733591 are protective SNPs in Caucasians, and rs16890979 and rs1014290 are protective SNPs in both Caucasians and Asians, while rs3733591 may be susceptibility SNP in Asians.

Radioassay of folates

International Nuclear Information System (INIS)

Givas, J.K.; Gutcho, S.

1976-01-01

In the radioassay of folates, the standard is prepared by using folic acid (pteroyl glutamic acid; PGA) as the standard folate at a pH of 9.2 to 9.4. At such pH values, folic acid and 5-methyltetrahydrofolic acid (the predominant folate in human serum) have essentially identical reactivity towards folate binders, whereby folic acid can replace unstable 5-methyltetrahydrofolic acid standard for such assays

Elevated SLC26A4 gene promoter methylation is associated with the risk of presbycusis in men.

Science.gov (United States)

Xu, Jin; Zheng, Jiachen; Shen, Wanjing; Ma, Lili; Zhao, Ming; Wang, Xubo; Tang, Jiyuan; Yan, Jihong; Wu, Zhenhua; Zou, Zuquan; Bu, Shizhong; Xi, Yang

2017-07-01

Presbycusis affects approximately one-third of people over the age of 65 and is a worldwide health problem. In the current study, whether the methylation level of solute carrier family 26 member 4 (SLC26A4) predicted an increased risk of presbycusis was investigated. Peripheral blood samples from 102 patients with presbycusis and 104 controls were collected, and the methylation of the CpG sites of SLC26A4 was measured by applying pyrosequencing technology combined with sodium bisulfate DNA conversion chemistry. Within the SLC26A4 promoter region, one CpG site (CpG3) exhibited a significantly (Ppresbycusis (26.5±5.56%) compared with the controls (23.8±3.85%). Significantly different CpG3 methylation levels were observed between the patients with presbycusis and the controls among the male participants (P=0.0004). In addition, a significant decrease in the transcriptional level of SLC26A4 in peripheral blood was observed in the patients with presbycusis compared with the controls. Furthermore, analyses of the receiver operating characteristic (ROC) curves indicated that CpG3 methylation at the SLC26A4 promoter predicted the risk of presbycusis in the male participants (AUC=0.684, 95% CI=0.584‑0.784, P=0.001). The results demonstrated the significance of the CpG site methylation level of SLC26A4, and thus provides a potential marker for the diagnosis of presbycusis.

[The association of polymorphisms in SLC18A1, TPH1 and RELN genes with risk of paranoid schizophrenia].

Science.gov (United States)

Galaktionova, D Iu; Gareeva, A E; Khusnutdinova, E K; Nasedkina, T V

2014-01-01

We have developed a biochip for the analysis of polymorphisms in candidate genes for schizophrenia: DISC1, RELN, ZNF804A, PLXNA2, COMT, SLC18A41, CACNA1C, ANK3, TPH1, PLAA and SNAP-25. Using biochip the allele and genotype frequencies in 198 patients with schizophrenia and 192 healthy individuals have been obtained. For SLC18A1 polymorphism rs2270641 A>C, the frequencies of A allele (p = 0.007) and AA genotype (p = 0.002) were lower in patients compared with healthy individuals. A significant association was found between AA genotype (p = 0.036) of the TPH1 polymorphism rs1800532 C>A and schizophrenia. The C allele (p = 0.039) of the RELNpolymorphism rs7341475 C>T were lower in patients with schizophrenia compared with healthy individuals in a tatar population. Genotype AA of the TPH1 polymorphism rs1800532 C>A were more frequent in patients with schizophrenia compared with healthy individuals. Ithas been shown that the C allele (p = 0.0001) and GC (p = = 0.0001) genotype of the PLXNA2 polymorphism rs1327175 G>C are associated with the family history in patients with paranoid schizophrenia. The obtained data suggest that SLC18A1, TPH1 and RELN gene polymorphisms are associated with the risk of paranoid schizophrenia.

Changes in oil content of transgenic soybeans expressing the yeast SLC1 gene.

Science.gov (United States)

Rao, Suryadevara S; Hildebrand, David

2009-10-01

The wild type (Wt) and mutant form of yeast (sphingolipid compensation) genes, SLC1 and SLC1-1, have been shown to have lysophosphatidic acid acyltransferase (LPAT) activities (Nageic et al. in J Biol Chem 269:22156-22163, 1993). Expression of these LPAT genes was reported to increase oil content in transgenic Arabidopsis and Brassica napus. It is of interest to determine if the TAG content increase would also be seen in soybeans. Therefore, the wild type SLC1 was expressed in soybean somatic embryos under the control of seed specific phaseolin promoter. Some transgenic somatic embryos and in both T2 and T3 transgenic seeds showed higher oil contents. Compared to controls, the average increase in triglyceride values went up by 1.5% in transgenic somatic embryos. A maximum of 3.2% increase in seed oil content was observed in a T3 line. Expression of the yeast Wt LPAT gene did not alter the fatty acid composition of the seed oil.

MBL, P2X7, and SLC11A1 gene polymorphisms in patients with oropharyngeal tularemia.

Science.gov (United States)

Somuk, Battal Tahsin; Koc, Sema; Ates, Omer; Göktas, Göksel; Soyalic, Harun; Uysal, Ismail Onder; Gurbuzler, Levent; Sapmaz, Emrah; Sezer, Saime; Eyibilen, Ahmet

2016-11-01

A significant association was found of oropharyngeal tularemia with SLC11A1 allele polymorphism (INT4 G/C) and MBL2 C + 4T (P/Q). These results indicate C allele and Q allele might be a risk factor for the development of oropharyngeal tularemia. This study aimed to investigate the relationship of SLC11A1, MBL, and P2X 7 gene polymorphism with oropharyngeal tularemia. The study included totally 120 patients who were diagnosed with oropharyngeal tularemia. Frequencies of polymorphisms in the following genes were analyzed both in the patient and control groups in the study: SLC11A1 (5'(GT) n Allele 2/3, Int4 G/C, 3' UTR, D543N G/A), MBL (MBL2 C + 4T (P/Q), and P2X 7 (-762 C/T and 1513 A/C). Among all polymorphisms that were investigated in this study, SLC11A1 gene showed a significance in the distriburtion of polymorphism allelle frequency at the INT4 region. Frequency of C allele was 54 (28%) in patients with oropharyngeal tularemia, and 31 (13%) in the control group (p = 0.006 and OR = 1.96 (1.21-3.20)). An association was detected between MBL2 C + 4T (P/Q) gene polymorphism and oropharyngeal tularemia (p tularemia in this study (p > 0.05).

Screening of SLC26A4, FOXI1, KCNJ10, and GJB2 in bilateral deafness patients with inner ear malformation.

Science.gov (United States)

Chen, Kaitian; Wang, Xianren; Sun, Liang; Jiang, Hongyan

2012-06-01

Bilateral nonsyndromic sensorineural hearing loss associated with inner ear malformation is closely related to genetics. SLC26A4 is considered to be the major involved gene. Recently, FOXI1 and KCNJ10 mutations have been linked to enlarged vestibular aqueducts and GJB2 mutations linked to temporal bone malformation. The authors aimed to investigate the mutation spectrums of these genes in Chinese patients with bilateral hearing impairment associated with inner ear malformation. Cross-sectional study. Affiliated hospital of the university. The authors analyzed the GJB2, SLC26A4, FOXI1, and KCNJ10 gene sequences in 43 patients presenting with bilateral hearing impairment associated with inner ear malformation using pyrosequencing and direct DNA sequencing. In total, 74.4% (32/43) of patients carried at least 1 of 14 pathogenic SLC26A4 mutations, including 6 novel mutations and 4 polymorphisms. Patients with enlarged vestibular aqueducts had a higher rate of SLC26A4 mutation than Mondini dysplasia patients. No FOXI1 or KCNJ10 potential pathogenic mutation was present, and GJB2 biallelic pathogenic mutations were uncommon (2.3%; 1/43). No significant correlation was observed between the genotype and phenotype of SLC26A4 mutations. SLC26A4 accounts for 74.4% of inner ear malformations in our cohort, whereas FOXI1, KCNJ10, and GJB2 mutations are not common. Other possible genes or external factors may contribute to this multibranch abnormality.

Positive selection in the SLC11A1 gene in the family Equidae.

Science.gov (United States)

Bayerova, Zuzana; Janova, Eva; Matiasovic, Jan; Orlando, Ludovic; Horin, Petr

2016-05-01

Immunity-related genes are a suitable model for studying effects of selection at the genomic level. Some of them are highly conserved due to functional constraints and purifying selection, while others are variable and change quickly to cope with the variation of pathogens. The SLC11A1 gene encodes a transporter protein mediating antimicrobial activity of macrophages. Little is known about the patterns of selection shaping this gene during evolution. Although it is a typical evolutionarily conserved gene, functionally important polymorphisms associated with various diseases were identified in humans and other species. We analyzed the genomic organization, genetic variation, and evolution of the SLC11A1 gene in the family Equidae to identify patterns of selection within this important gene. Nucleotide SLC11A1 sequences were shown to be highly conserved in ten equid species, with more than 97 % sequence identity across the family. Single nucleotide polymorphisms (SNPs) were found in the coding and noncoding regions of the gene. Seven codon sites were identified to be under strong purifying selection. Codons located in three regions, including the glycosylated extracellular loop, were shown to be under diversifying selection. A 3-bp indel resulting in a deletion of the amino acid 321 in the predicted protein was observed in all horses, while it has been maintained in all other equid species. This codon comprised in an N-glycosylation site was found to be under positive selection. Interspecific variation in the presence of predicted N-glycosylation sites was observed.

The role of SLC2A1 mutations in myoclonic astatic epilepsy and absence epilepsy, and the estimated frequency of GLUT1 deficiency syndrome

DEFF Research Database (Denmark)

Larsen, Jan; Johannesen, Katrine Marie; Ek, Jakob

2015-01-01

The first mutations identified in SLC2A1, encoding the glucose transporter type 1 (GLUT1) protein of the blood-brain barrier, were associated with severe epileptic encephalopathy. Recently, dominant SLC2A1 mutations were found in rare autosomal dominant families with various forms of epilepsy inc...

Elevated homocysteine levels indicate suboptimal folate status in pediatric sickle cell patients

NARCIS (Netherlands)

van der Dijs, FPL; Schnog, JJB; Brouwer, DAJ; Velvis, HJR; van den Berg, GA; Bakker, AJ; Duits, AJ; Muskiet, FD

1998-01-01

We investigated whether pediatric patients with sickle cell disease (SCD) (9 +/- 4 years; 27 homozygous SCD [HbSS]; 19 sickle-C disease [HbSC]) have different folate status compared with age-, sex-, and race-matched normal hemoglobin (HbAA) controls (n = 20), and whether their folate status can be

Iron, folate and cobalamin deficiency in anaemic pregnant females in tertiary care centre at Rawalpindi

Energy Technology Data Exchange (ETDEWEB)

Khan, D A; Fatima, S; Imran, R; Khan, F A [National Univ. of Science and Technology, Army Medical College, Rawalpindi (Pakistan). Department of Pathology

2010-01-15

Background: Anaemia in pregnancy is a common clinical problem contributing to increased maternal and foetal morbidity. This study was carried out to determine frequency of iron, folate and cobalamin deficiency and associated risk factors in the anaemic pregnant females who reported first time during second and third trimester for antenatal check-up in the tertiary care hospital at Rawalpindi. Methods: This case control study was carried out in a tertiary care hospital at Rawalpindi. Two hundred and fifty pregnant women (age: 19-43 years) consisting of 125 anaemic (Hb< 110 g/L) and 125 non-anaemic who reported first time at antenatal clinic were included. Data on socio-demographic characteristics, parity and dietary intake were collected. Complete blood counts were done. Serum ferritin, folate and cobalamin assays were performed by using DPC kits on Immulite-1000. Results: The pregnant women were categorised having mild (Hb up to 54%), moderate (Hb up to 36%), or severe (Hb up to 10%) anaemia during antennal visit. They had significantly lower median (range) levels of haemoglobin 96 (40-110) g/L, ferritin 8 (3-54) nu mu/L, folate 15 (3-54) mu mol/L and cobalamin 171 (111-629) mu mol/L than controls (p=<0.01). Micro nutrient analysis revealed secondary pregnancy related deficiency of Iron (57%), folate (20%), combined iron and folate (19%) and cobalamin (4%) in the female. Among the risk factors, low income (OR: 7.69), multi party (OR: 2.93), lack of iron/folate supplementation (OR 2.91) and inadequate dietary intakes (OR 2.51) were associated with anaemia. Conclusion: The pregnant anaemic women had iron (57%); folate (20%), followed by combined iron folate (19%), and cobalamin (4%) deficiency during first antenatal visit. Low income, multi party, poor diet and lack of supplements are the main contributor in development of anaemia during pregnancy. (author)

Iron, folate and cobalamin deficiency in anaemic pregnant females in tertiary care centre at Rawalpindi

International Nuclear Information System (INIS)

Khan, D.A.; Fatima, S.; Imran, R.; Khan, F.A.

2010-01-01

Background: Anaemia in pregnancy is a common clinical problem contributing to increased maternal and foetal morbidity. This study was carried out to determine frequency of iron, folate and cobalamin deficiency and associated risk factors in the anaemic pregnant females who reported first time during second and third trimester for antenatal check-up in the tertiary care hospital at Rawalpindi. Methods: This case control study was carried out in a tertiary care hospital at Rawalpindi. Two hundred and fifty pregnant women (age: 19-43 years) consisting of 125 anaemic (Hb< 110 g/L) and 125 non-anaemic who reported first time at antenatal clinic were included. Data on socio-demographic characteristics, parity and dietary intake were collected. Complete blood counts were done. Serum ferritin, folate and cobalamin assays were performed by using DPC kits on Immulite-1000. Results: The pregnant women were categorised having mild (Hb up to 54%), moderate (Hb up to 36%), or severe (Hb up to 10%) anaemia during antennal visit. They had significantly lower median (range) levels of haemoglobin 96 (40-110) g/L, ferritin 8 (3-54) nu mu/L, folate 15 (3-54) mu mol/L and cobalamin 171 (111-629) mu mol/L than controls (p=<0.01). Micro nutrient analysis revealed secondary pregnancy related deficiency of Iron (57%), folate (20%), combined iron and folate (19%) and cobalamin (4%) in the female. Among the risk factors, low income (OR: 7.69), multi party (OR: 2.93), lack of iron/folate supplementation (OR 2.91) and inadequate dietary intakes (OR 2.51) were associated with anaemia. Conclusion: The pregnant anaemic women had iron (57%); folate (20%), followed by combined iron folate (19%), and cobalamin (4%) deficiency during first antenatal visit. Low income, multi party, poor diet and lack of supplements are the main contributor in development of anaemia during pregnancy. (author)

Mutations in the GABA Transporter SLC6A1 Cause Epilepsy with Myoclonic-Atonic Seizures

Science.gov (United States)

Carvill, Gemma L.; McMahon, Jacinta M.; Schneider, Amy; Zemel, Matthew; Myers, Candace T.; Saykally, Julia; Nguyen, John; Robbiano, Angela; Zara, Federico; Specchio, Nicola; Mecarelli, Oriano; Smith, Robert L.; Leventer, Richard J.; Møller, Rikke S.; Nikanorova, Marina; Dimova, Petia; Jordanova, Albena; Petrou, Steven; Helbig, Ingo; Striano, Pasquale; Weckhuysen, Sarah; Berkovic, Samuel F.; Scheffer, Ingrid E.; Mefford, Heather C.

2015-01-01

GAT-1, encoded by SLC6A1, is one of the major gamma-aminobutyric acid (GABA) transporters in the brain and is responsible for re-uptake of GABA from the synapse. In this study, targeted resequencing of 644 individuals with epileptic encephalopathies led to the identification of six SLC6A1 mutations in seven individuals, all of whom have epilepsy with myoclonic-atonic seizures (MAE). We describe two truncations and four missense alterations, all of which most likely lead to loss of function of GAT-1 and thus reduced GABA re-uptake from the synapse. These individuals share many of the electrophysiological properties of Gat1-deficient mice, including spontaneous spike-wave discharges. Overall, pathogenic mutations occurred in 6/160 individuals with MAE, accounting for ∼4% of unsolved MAE cases. PMID:25865495

Molecular Properties of Drugs Interacting with SLC22 Transporters OAT1, OAT3, OCT1, and OCT2: A Machine-Learning Approach.

Science.gov (United States)

Liu, Henry C; Goldenberg, Anne; Chen, Yuchen; Lun, Christina; Wu, Wei; Bush, Kevin T; Balac, Natasha; Rodriguez, Paul; Abagyan, Ruben; Nigam, Sanjay K

2016-10-01

Statistical analysis was performed on physicochemical descriptors of ∼250 drugs known to interact with one or more SLC22 "drug" transporters (i.e., SLC22A6 or OAT1, SLC22A8 or OAT3, SLC22A1 or OCT1, and SLC22A2 or OCT2), followed by application of machine-learning methods and wet laboratory testing of novel predictions. In addition to molecular charge, organic anion transporters (OATs) were found to prefer interacting with planar structures, whereas organic cation transporters (OCTs) interact with more three-dimensional structures (i.e., greater SP3 character). Moreover, compared with OAT1 ligands, OAT3 ligands possess more acyclic tetravalent bonds and have a more zwitterionic/cationic character. In contrast, OCT1 and OCT2 ligands were not clearly distinquishable form one another by the methods employed. Multiple pharmacophore models were generated on the basis of the drugs and, consistent with the machine-learning analyses, one unique pharmacophore created from ligands of OAT3 possessed cationic properties similar to OCT ligands; this was confirmed by quantitative atomic property field analysis. Virtual screening with this pharmacophore, followed by transport assays, identified several cationic drugs that selectively interact with OAT3 but not OAT1. Although the present analysis may be somewhat limited by the need to rely largely on inhibition data for modeling, wet laboratory/in vitro transport studies, as well as analysis of drug/metabolite handling in Oat and Oct knockout animals, support the general validity of the approach-which can also be applied to other SLC and ATP binding cassette drug transporters. This may make it possible to predict the molecular properties of a drug or metabolite necessary for interaction with the transporter(s), thereby enabling better prediction of drug-drug interactions and drug-metabolite interactions. Furthermore, understanding the overlapping specificities of OATs and OCTs in the context of dynamic transporter tissue

SLC25A13 gene analysis in citrin deficiency: sixteen novel mutations in East Asian patients, and the mutation distribution in a large pediatric cohort in China.

Directory of Open Access Journals (Sweden)

Yuan-Zong Song

Full Text Available BACKGROUND: The human SLC25A13 gene encodes citrin, the liver-type mitochondrial aspartate/glutamate carrier isoform 2 (AGC2, and SLC25A13 mutations cause citrin deficiency (CD, a disease entity that encompasses different age-dependant clinical phenotypes such as Adult-onset Citrullinemia Type II (CTLN2 and Neonatal Intrahepatic Cholestasis caused by Citrin Deficiency (NICCD. The analyses of SLC25A13 gene and its protein/mRNA products remain reliable tools for the definitive diagnoses of CD patients, and so far, the SLC25A13 mutation spectrum in Chinese CD patients has not been well-characterized yet. METHODS AND RESULTS: By means of direct DNA sequencing, cDNA cloning and SNP analyses, 16 novel pathogenic mutations, including 9 missense, 4 nonsense, 1 splice-site, 1 deletion and 1 large transposal insertion IVS4ins6kb (GenBank accession number KF425758, were identified in CTLN2 or NICCD patients from China, Japan and Malaysia, respectively, making the SLC25A13 variations worldwide reach the total number of 81. A large NICCD cohort of 116 Chinese cases was also established, and the 4 high-frequency mutations contributed a much larger proportion of the mutated alleles in the patients from south China than in those from the north (χ(2 = 14.93, P<0.01, with the latitude of 30°N as the geographic dividing line in mainland China. CONCLUSIONS: This paper further enriched the SLC25A13 variation spectrum worldwide, and formed a substantial contribution to the in-depth understanding of the genotypic feature of Chinese CD patients.

The SLC4A7 variant rs4973768 is associated with breast cancer risk: evidence from a case-control study and a meta-analysis.

Science.gov (United States)

Chen, Wei; Zhong, Rong; Ming, Jie; Zou, Li; Zhu, Beibei; Lu, Xuzai; Ke, Juntao; Zhang, Yu; Liu, Li; Miao, Xiaoping; Huang, Tao

2012-12-01

Recent genome-wide association study has identified a genetic variant rs4973768, located in 3'-UTR of solute carrier family 4, sodium bicarbonate cotransporter, member 7 (SLC4A7), was associated with increased risk of breast cancer (BC). However, several following replication studies cannot yield consistent results. We thus conducted a hospital-based case-control study including 485 patients and 514 controls, combined a meta-analysis including 108,632 cases and 135,818 controls to explore the relationship between this variant and BC risk. Our case-control study showed that rs4973768 was significantly associated with increased BC risk with the odds ratio (OR) of 1.29 (95 % confidence interval [CI]: 1.04-1.60) under the allelic model. In addition, the meta-analysis also indicated that the variant slightly increased the risk of BC with the pooled OR of the per-allele effect being 1.08 (95 % CI: 1.04-1.11) although with significant heterogeneity between studies. Stratified analyses showed that ethnicity, sample size, and study design may explain part of the heterogeneity. Moreover, the bioinformatics analysis suggested that this variant may influence the transcriptional capacity of SLC4A7. In summary, our results showed that the SLC4A7 variant, rs4973768, is associated with risk of BC although the underlying biologic mechanism warrants further studies.

Additive composite ABCG2, SLC2A9 and SLC22A12 scores of high-risk alleles with alcohol use modulate gout risk.

Science.gov (United States)

Tu, Hung-Pin; Chung, Chia-Min; Min-Shan Ko, Albert; Lee, Su-Shin; Lai, Han-Ming; Lee, Chien-Hung; Huang, Chung-Ming; Liu, Chiu-Shong; Ko, Ying-Chin

2016-09-01

The aim of the present study was to evaluate the contribution of urate transporter genes and alcohol use to the risk of gout/tophi. Eight variants of ABCG2, SLC2A9, SLC22A12, SLC22A11 and SLC17A3 were genotyped in male individuals in a case-control study with 157 gout (33% tophi), 106 asymptomatic hyperuricaemia and 295 control subjects from Taiwan. The multilocus profiles of the genetic risk scores for urate gene variants were used to evaluate the risk of asymptomatic hyperuricaemia, gout and tophi. ABCG2 Q141K (T), SLC2A9 rs1014290 (A) and SLC22A12 rs475688 (C) under an additive model and alcohol use independently predicted the risk of gout (respective odds ratio for each factor=2.48, 2.03, 1.95 and 2.48). The additive composite Q141K, rs1014290 and rs475688 scores of high-risk alleles were associated with gout risk (Pgout and tophi risk (P for interaction=0.0452, 0.0033). The synergistic effect of genetic urate score 5-6 and alcohol use indicates that these combined factors correlate with gout and tophi occurrence.

Plasma folate levels and associated factors in women planning to become pregnant in a population with high prevalence of neural tube defects.

Science.gov (United States)

Ma, Rui; Wang, Linlin; Jin, Lei; Li, Zhiwen; Ren, Aiguo

2017-07-17

Optimal blood folate levels of women before pregnancy are critical to the prevention of neural tube defects (NTDs). However, few studies have focused on blood folate levels of women planning to become pregnant. The aims of this study were to assess plasma folate levels in women who planned to become pregnant in a population with high prevalence of NTDs, to identify factors associated with plasma folate levels, and to evaluate the risk of NTDs at the population level. A total of 2065 women were enrolled at the time of premarital health check-up in two rural counties in northern China from November 2009 to December 2012. Fasting venous blood samples were collected and plasma folate concentrations were measured by microbiological method. The overall median of plasma folate was 10.5 nmol/L. 50% of the women had a plasma folate level below 10.5 nmol/L, a cutoff for megaloblastic anemia, and 88% below 18 nmol/L, a proposed optimal plasma folate level for the prevention of NTDs. Folic acid supplementation was the only factor to be associated with plasma folate concentrations, but only 1.9% of the women reported having taken folic acid supplements. A population risk of 29.3 NTD cases per 10,000 births was predicted. Women who planned to become pregnant had very low plasma folate in the population. Folic acid supplementation was the only factor to be associated with a high plasma folate concentration. High NTD risk would remain if women would get pregnant without having taken folic acid supplements. Birth Defects Research 109:1039-1047, 2017. © 2017 Wiley Periodicals, Inc. © 2017 Wiley Periodicals, Inc.

The role of SCL2A1 in Early Onset and Childhood Absence Epilepsies

DEFF Research Database (Denmark)

Brusgaard, Klaus

brother and the paternal grandmother. Conclusion: Our study confirmed the role of SLC2A1 mutation carriers in EOAE and demonstrated that SLC2A1 do not seem to play a major role in CAE and JAE. Since ketogenic diet is a well known treatment option in GLUT-1-deficiency, pediatricians as well as neurologists...

Studies on folate binding and a radioassay for serum and whole-blood folate using goat milk as binding agent

International Nuclear Information System (INIS)

Piyasena, R.D.; Weerasekera, D.A.; Hettiaratchi, N.; Wikramanayake, T.W.

1978-01-01

Preparations of cow, goat, buffalo and human milk in addition to pig plasma were tested for folate binding properties. Of these, only pig plasma and goat milk showed sufficient binding to enable them to be used as binding agents in a radioassay for serum and whole-blood folate. The binding of folate by cow milk preparations in particular was found to be very poor. Goat milk was preferred to pig plasma as a binder for folate radioassay for reasons of convenience, economy and greater stability, and because pteroylglutamic acid (PGA) can be used both as tracer and standard. Where pig plasma is used with the inclusion of folate-free serum in the standard tubes, differences were observed between the standard and serum blanks which themselves varied from sample to sample. By contrast, with goat milk, all blank readings were normally 3% or less. Five out of eight samples of goat milk were seen to contain 'releasing factor' necessary to liberate folate from endogenous binder (FABP). Where present, the factor was found to be stable for at least three months when the partially purified milk was stored freeze dried at 4 0 C. Goat milk binder was found unable to distinguish between PGA and methyltetrahydrofolic acid (MTFA) at pH9.3. This enabled PGA rather than the more unstable MTFA to be used as tracer and standard. The assay employs a one-step incubation procedure at room temperature. It is sensitive to about 0.1 ng of PGA and is reproducible to less than 5% variation. The mean % recovery of inactive added folate was 101+-4%. (author)

Serum uric acid concentrations and SLC2A9 genetic variation in Hispanic children: the Viva La Familia Study.

Science.gov (United States)

Voruganti, V Saroja; Laston, Sandra; Haack, Karin; Mehta, Nitesh R; Cole, Shelley A; Butte, Nancy F; Comuzzie, Anthony G

2015-04-01

Elevated concentrations of serum uric acid are associated with increased risk of gout and renal and cardiovascular diseases. Genetic studies in adults have consistently identified associations of solute carrier family 2, member 9 (SLC2A9), polymorphisms with variation in serum uric acid. However, it is not known whether the association of serum uric acid with SLC2A9 polymorphisms manifests in children. The aim was to investigate whether variation in serum uric acid is under genetic influence and whether the association with SLC2A9 polymorphisms generalizes to Hispanic children of the Viva La Familia Study. We conducted a genomewide association study with 1.1 million genetic markers in 815 children. We found serum uric acid to be significantly heritable [h(2) ± SD = 0.45 ± 0.08, P = 5.8 × 10(-11)] and associated with SLC2A9 variants (P values between 10(-16) and 10(-7)). Several of the significantly associated polymorphisms were previously identified in studies in adults. We also found positive genetic correlations between serum uric acid and BMI z score (ρG = 0.45, P = 0.002), percentage of body fat (ρG = 0.28, P = 0.04), fat mass (ρG = 0.34, P = 0.02), waist circumference (ρG = 0.42, P = 0.003), and waist-to-height ratio (ρG = 0.46, P = 0.001). Our results show that variation in serum uric acid in Hispanic children is under considerable genetic influence and is associated with obesity-related phenotypes. As in adults, genetic variation in SLC2A9 is associated with serum uric acid concentrations, an important biomarker of renal and cardiovascular disease risk, in Hispanic children. © 2015 American Society for Nutrition.

Development of new folate-based PET radiotracers: preclinical evaluation of 68Ga-DOTA-folate conjugates

International Nuclear Information System (INIS)

Fani, Melpomeni; Maecke, Helmut R.; Wang, Xuejuan; Nicolas, Guillaume; Medina, Christelle; Raynal, Isabelle; Port, Marc

2011-01-01

A number of 111 In- and 99m Tc-folate-based tracers have been evaluated as diagnostic agents for imaging folate receptor (FR)-positive tumours. A 68 Ga-folate-based radiopharmaceutical would be of great interest, combining the advantages of PET technology and the availability of 68 Ga from a generator. The aim of the study was to develop a new 68 Ga-folate-based PET radiotracer. Two new DOTA-folate conjugates, named P3026 and P1254, were synthesized using the 1,2-diaminoethane and 3-{2-[2-(3-amino-propoxy)-ethoxy]-ethoxy}-propylamine as a spacer, respectively. Both conjugates were labelled with 67/68 Ga. Binding affinity, internalization and externalization studies were performed using the FR-positive KB cell line. Biodistribution and PET/CT imaging studies were performed in nude mice, on a folate-deficient diet, bearing KB and HT1080 (FR-negative) tumours, concurrently. The new radiotracers were evaluated comparatively to the reference molecule 111 In-DTPA-folate ( 111 In-P3139). The K d values of 67/68 Ga-P3026 (4.65 ± 0.82 nM) and 67/68 Ga-P1254 (4.27 ± 0.42 nM) showed high affinity for the FR. The internalization rate followed the order 67/68 Ga-P3026 > 67/68 Ga-P1254 > 111 In-P3139, while almost double cellular retention was found for 67/68 Ga-P3026 and 67/68 Ga-P1254, compared to 111 In-P3139. The biodistribution data of 67/68 Ga-DOTA-folates showed high and receptor-mediated uptake on the FR-positive tumours and kidneys, with no significant differences compared to 111 In-P3139. PET/CT images, performed with 68 Ga-P3026, showed high uptake in the kidneys and clear visualization of the FR-positive tumours. The DOTA-folate conjugates can be efficiently labelled with 68 Ga in labelling yields and specific activities which allow clinical application. The characteristics of the 67/68 Ga-DOTA-folates are comparable to 111 In-DTPA-folate, which has already been used in clinical trials, showing that the new conjugates are promising candidates as PET radiotracers

Extremely high concentration of folates in premature newborns.

Science.gov (United States)

Zikavska, T; Brucknerova, I

2014-01-01

Extremely high concentration of folates in premature newborns: case reports. Folates are a group of water soluble compounds, which are important for metabolic processes in human body. These are important during periods of rapid cell growth. The most accurate indicator of long-term folate level status in the body is the determination of red blood cell (RBC) folate concentrations. The optimal level of RBC folate is not known in neonatal period. Authors discuss the reasons for extremely high level of RBC folate concentrations. In our work we present the cases of two premature newborns with extremely high level of RBC folate concentrations, which were analyzed immunochemically on the first day of life and after six weeks of life. In both cases we measured RBC folate concentrations on the 1st day of life. After 6 weeks we found extremely high RBC folate concentration level (5516.67 ng/ml) in the first case after RBC transfusions. In second case after two months of life the RBC folate concentration level was doubled (2335.1 ng/ml) until 24 hours after RBC transfusion compared to levels after birth. The normal range of RBC folate values vary in newborns. The upper limit of daily dose of folic acid in pregnancy and neonatal period is not known. On the other hand it is an easily excreted water-soluble vitamin but in premature newborn it can lead to the disruption of metabolic balance and slow its degradation. Some factors can have an impact on RBC folate concentration. Blood transfusion can be one of the main influences on RBC folate concentration. To clarify these mechanisms further studies are required (Ref. 29).

Prevalence of iron, folate, and vitamin B12 deficiencies in 20 to 49 years old women: Ensanut 2012.

Science.gov (United States)

Shamah-Levy, Teresa; Villalpando, Salvador; Mejía-Rodríguez, Fabiola; Cuevas-Nasu, Lucía; Gaona-Pineda, Elsa Berenice; Rangel-Baltazar, Eduardo; Zambrano-Mujica, Norma

2015-01-01

To describe the prevalence of iron, folate, and B12 deficiencies in Mexican women of reproductive age from the National Health and Nutrition Survey (Ensanut) 2012. Data came from a national probabilistic survey, representative from rural and urban areas, and different age groups. Blood samples were obtained from 4 263, 20 to 49 years old women for serum ferritin, vitamin B12 and serum folate concentrations. The prevalence of deficiencies, was assessed using adjusted logistic regression models. The deficiency of folate was 1.9% (95%CI 1.3-2.8), B12 deficiency was 8.5% (95%CI 6.7-10.1) and iron deficiency was 29.4% (95%CI 26.5-32.2). No differences were found when compared with 2006, 24.8% (95%CI 22.3-27.2). The vitamin B12 deficiency is still a problem for women of reproductive age and their offspring in Mexico, while folate deficiency disappeared as a problem. Iron deficiency needs prevention and fortification strategies.

Folate status and concentrations of serum folate forms in the US population: National Health and Nutrition Examination Survey 2011–2

OpenAIRE

Pfeiffer, Christine M.; Sternberg, Maya R.; Fazili, Zia; Lacher, David A.; Zhang, Mindy; Johnson, Clifford L.; Hamner, Heather C.; Bailey, Regan L.; Rader, Jeanne I.; Yamini, Sedigheh; Berry, R. J.; Yetley, Elizabeth A.

2015-01-01

Serum and red blood cell (RBC) total folate are indicators of folate status. No nationally representative population data exist for folate forms. We measured serum folate forms [5-methyltetrahydrofolate (5-methylTHF), unmetabolized folic acid (UMFA), non-methyl folate (sum of THF, 5-formylTHF, 5,10-methenylTHF), and MeFox (5-methylTHF oxidation product)] by HPLC-MS/MS and RBC total folate by microbiologic assay in US persons ≥1 year (n ~7500) participating in the National Health and Nutrition...

Activation of lysosomal P2X4 by ATP transported into lysosomes via VNUT/SLC17A9 using V‐ATPase generated voltage gradient as the driving force

Science.gov (United States)

Zhong, Xi Zoë; Cao, Qi; Sun, Xue

2016-01-01

Key points SLC17A9 proteins function as a lysosomal ATP transporter responsible for lysosomal ATP accumulation.P2X4 receptors act as lysosomal ion channels activated by luminal ATP.SLC17A9‐mediated ATP transport across the lysosomal membrane is suppressed by Bafilomycin A1, the V‐ATPase inhibitor.SLC17A9 mainly uses voltage gradient but not pH gradient generated by the V‐ATPase as the driving force to transport ATP into the lysosome to activate P2X4. Abstract The lysosome contains abundant ATP which plays important roles in lysosome functions and in cell signalling. Recently, solute carrier family 17 member 9 (SLC17A9, also known as VNUT for vesicular nucleotide transporter) proteins were suggested to function as a lysosomal ATP transporter responsible for lysosomal ATP accumulation, and P2X4 receptors were suggested to be lysosomal ion channels that are activated by luminal ATP. However, the molecular mechanism of SLC17A9 transporting ATP and the regulatory mechanism of lysosomal P2X4 are largely unknown. In this study, we report that SLC17A9‐mediated ATP transport across lysosomal membranes is suppressed by Bafilomycin A1, the V‐ATPase inhibitor. By measuring P2X4 activity, which is indicative of ATP transport across lysosomal membranes, we further demonstrated that SLC17A9 mainly uses voltage gradient but not pH gradient as the driving force to transport ATP into lysosomes. This study provides a molecular mechanism for lysosomal ATP transport mediated by SLC17A9. It also suggests a regulatory mechanism of lysosomal P2X4 by SLC17A9. PMID:27477609

Folate and Colorectal Cancer in Rodents: A Model of DNA Repair Deficiency

Directory of Open Access Journals (Sweden)

Rita Rosati

2012-01-01

Full Text Available Fortification of grains has resulted in a positive public health outcome vis-a-vis reduced incidence of neural tube defects. Whether folate has a correspondingly beneficial effect on other disease outcomes is less clear. A role for dietary folate in the prevention of colorectal cancer has been established through epidemiological data. Experimental data aiming to further elucidate this relationship has been somewhat equivocal. Studies report that folate depletion increases DNA damage, mutagenesis, and chromosomal instability, all suggesting inhibited DNA repair. While these data connecting folate depletion and inhibition of DNA repair are convincing, we also present data demonstrating that genetic inhibition of DNA repair is protective in the development of preneoplastic colon lesions, both when folate is depleted and when it is not. The purpose of this paper is to (1 give an overview of the data demonstrating a DNA repair defect in response to folate depletion, and (2 critically compare and contrast the experimental designs utilized in folate/colorectal cancer research and the corresponding impact on tissue folate status and critical colorectal cancer endpoints. Our analysis suggests that there is still an important need for a comprehensive evaluation of the impact of differential dietary prescriptions on blood and tissue folate status.

Consumer preferences for micronutrient strategies in China. A comparison between folic acid supplementation and folate biofortification.

Science.gov (United States)

De Steur, Hans; Feng, Shuyi; Xiaoping, Shi; Gellynck, Xavier

2014-06-01

Despite public health efforts, folate deficiency is still largely prevalent in poor, rural populations and continues to cause a large burden of disease. The present paper determines and compares consumer preferences for two folate strategies: folic acid supplementation v. folate biofortification, i.e. the enhancement of the folate content in staple crops. Experimental auctions with non-repeated information rounds are applied to rice in order to obtain willingness-to-pay for folate products. Thereby, GM or non-GM folate-biofortified rice (FBR) is auctioned together with rice that is supplemented with free folic acid pills (FAR). Shanxi Province (China) as a high-risk region of folate deficiency. One hundred and twenty-six women of childbearing age, divided into a school (n 60) and market sample (n 66). Despite differences according to the targeted sample, a general preference for folate biofortification is observed, regardless of the applied breeding technology. Premiums vary between 33·9 % (GM FBR), 36·5 % (non-GM FBR) and 19·0 % (FAR). Zero bidding behaviour as well as the product choice question, respectively, support and validate these findings. The targeted sample, the timing of the auction, the intention to consume GM food and the responsibility for rice purchases are considered key determinants of product choice. A novel ex-post negative valuation procedure shows low consistency in zero bidding. While the low attractiveness of FAR provides an additional argument for the limited effectiveness of past folic acid supplementation programmes, the positive reactions towards GM FBR further support its potential as a possible complementary micronutrient intervention.

A 40-bp VNTR polymorphism in the 3'-untranslated region of DAT1/SLC6A3 is associated with ADHD but not with alcoholism.

Science.gov (United States)

Šerý, Omar; Paclt, Ivo; Drtílková, Ivana; Theiner, Pavel; Kopečková, Marta; Zvolský, Petr; Balcar, Vladimir J

2015-06-11

ADHD and alcoholism are psychiatric diseases with pathophysiology related to dopamine system. DAT1 belongs to the SLC6 family of transporters and is involved in the regulation of extracellular dopamine levels. A 40 bp variable number tandem repeat (VNTR) polymorphism in the 3'-untranslated region of DAT1/SLC6A3 gene was previously reported to be associated with various phenotypes involving disturbed regulation of dopaminergic neurotransmission. A total of 1312 subjects were included and genotyped for 40 bp VNTR polymorphism of DAT1/SLC6A3 gene in this study (441 alcoholics, 400 non-alcoholic controls, 218 ADHD children and 253 non ADHD children). Using miRBase software, we have performed a computer analysis of VNTR part of DAT1 gene for presence of miRNA binding sites. We have found significant relationships between ADHD and the 40 bp VNTR polymorphisms of DAT1/SLC6A3 gene (P VNTR polymorphism of DAT1/SLC6A3 gene has been detected. We have found an association between 40 bp VNTR polymorphism of DAT1/SLC6A3 gene and ADHD in the Czech population; in a broad agreement with studies in other population samples. Furthermore, we detected rare genotypes 8/10, 7/10 and 10/11 present in ADHD boys only and identified miRNAs that should be looked at as potential novel targets in the research on ADHD.

Receptor-mediated targeting of 67Ga-Deferoxamine-Folate to folate-receptor-positive human kb tumor xenografts

International Nuclear Information System (INIS)

Mathias, Carla J.; Wang, Susan; Low, Philip S.; Waters, David J.; Green, Mark A.

1999-01-01

The radiochemical synthesis and stability of 67 Ga-deferoxamine-folate ([ 67 Ga]Ga-DF-Folate) were examined as a function of DF-Folate concentration. Optimal labeling occurred at DF-Folate concentrations ≥2.5 μg/mL. To define the possible biological significance of variations in product formulation, the biodistribution of [ 67 Ga]Ga-DF-Folate was examined as a function of administered deferoxamine-folate dose in an athymic mouse KB tumor model. The folate-receptor-positive KB tumors were found to concentrate the 67 Ga radiolabel in a dose-dependent fashion, consistent with saturable involvement of the folate receptor in mediating tumor accumulation of the radiopharmaceutical

Association of SLC11A1 gene polymorphism with caprine ...

Indian Academy of Sciences (India)

Navya

2017-01-16

Jan 16, 2017 ... RESEARCH ARTICLE. Evaluation of the ..... Nramp2 (Slc11a2) expressed at the plasma membrane. Blood, 102 ... Received 21 November 2016, in final revised form 11 January 2017; accepted 12 January 2017. Unedited ...

Serum uric acid concentrations and SLC2A9 genetic variation in Hispanic children: The Viva La Familia Study

Science.gov (United States)

Elevated concentrations of serum uric acid are associated with increased risk of gout and renal and cardiovascular diseases. Genetic studies in adults have consistently identified associations of solute carrier family 2, member 9 (SLC2A9), polymorphisms with variation in serum uric acid. However, it...

Partial deletion of the sulfate transporter SLC13A1 is associated with an osteochondrodysplasia in the Miniature Poodle breed.

Directory of Open Access Journals (Sweden)

Mark W Neff

Full Text Available A crippling dwarfism was first described in the Miniature Poodle in Great Britain in 1956. Here, we resolve the genetic basis of this recessively inherited disorder. A case-control analysis (8:8 of genotype data from 173 k SNPs revealed a single associated locus on CFA14 (P(raw <10(-8. All affected dogs were homozygous for an ancestral haplotype consistent with a founder effect and an identical-by-descent mutation. Systematic failure of nine, nearly contiguous SNPs, was observed solely in affected dogs, suggesting a deletion was the causal mutation. A 130-kb deletion was confirmed both by fluorescence in situ hybridization (FISH analysis and by cloning the physical breakpoints. The mutation was perfectly associated in all cases and obligate heterozygotes. The deletion ablated all but the first exon of SLC13A1, a sodium/sulfate symporter responsible for regulating serum levels of inorganic sulfate. Our results corroborate earlier findings from an Slc13a1 mouse knockout, which resulted in hyposulfatemia and syndromic defects. Interestingly, the metabolic disorder in Miniature Poodles appears to share more clinical signs with a spectrum of human disorders caused by SLC26A2 than with the mouse Slc13a1 model. SLC26A2 is the primary sodium-independent sulfate transporter in cartilage and bone and is important for the sulfation of proteoglycans such as aggregan. We propose that disruption of SLC13A1 in the dog similarly causes undersulfation of proteoglycans in the extracellular matrix (ECM, which impacts the conversion of cartilage to bone. A co-dominant DNA test of the deletion was developed to enable breeders to avoid producing affected dogs and to selectively eliminate the mutation from the gene pool.

Physical activity modifies the effect of SNPs in the SLC2A2 (GLUT2) and ABCC8 (SUR1) genes on the risk of developing type 2 diabetes

DEFF Research Database (Denmark)

Oskari Kilpeläinen, Tuomas; Lakka, T A; Laaksonen, D E

2007-01-01

. The interaction of the SNPs with the change in PA on the conversion to T2D was assessed using Cox regression with adjustments for the other components of the intervention (dietary changes, weight reduction). The carriers of the common homozygous genotype of rs5393, rs5394, or rs5404 of SLC2A2 and rs3758947...

Synthesis and biological assessment of folate-accepted developer (99m)Tc-DTPA-folate-polymer.

Science.gov (United States)

Chen, Fei; Shao, Kejing; Zhu, Bao; Jiang, Mengjun

2016-05-15

A novel cancer-targetable folate-poly(2-hydroxyethyl methacrylate) (PFDH) copolymer containing DTPA segment was prepared by conventional chemical synthesis and labeled with (99m)Tc subsequently. The (99m)Tc-labled PFDH could be produced easily with high radiochemical yield of 91% and radiochemical purity of 95%. The LogP octanol-water value for the (99m)Tc-labled PFDH was -2.19 and the radiotracer was stable in phosphate-buffered saline and human serum for 2h (>95% in PBS or ∼90% in human serum). To investigate (99m)Tc-labled PFDH tumor targeting, the in vitro and in vivo stability, cell uptake, in vivo biodistribution, and SPECT imaging were evaluated, respectively. These preliminary results strongly suggest that the novel folate conjugated dendrimer maybe developed to be potential for delivery of therapeutic radionuclides. Copyright © 2016 Elsevier Ltd. All rights reserved.

Feedback systems in the SLC

International Nuclear Information System (INIS)

Thompson, K.A.; Jobe, R.K.; Johnson, R.; Phinney, N.

1987-02-01

Two classes of computer-controlled feedback have been implemented to stabilize parameters in subsystems of the SLC: (1) ''slow'' (time scales ∼ minutes) feedback, and (2) ''fast'', i.e., pulse-to-pulse, feedback. The slow loops run in a single FEEDBACK process in the SLC host VAX, which acquires signals and sets control parameters via communication with the database and the network of normal SLC microprocessors. Slow loops exist to stabilize beam energy and energy spread, beam position and angle, and timing of kicker magnets, and to compensate for changes in the phase length of the rf drive line. The fast loops run in dedicated microprocessors, and may sample and/or feedback on particular parameters as often as every pulse of the SLC beam. The first implementations of fast feedback are to control transverse beam blow-up and to stabilize the energy and energy spread of bunches going into the SLC arcs. The overall architecture of the feedback software and the operator interface for controlling loops are discussed

SLC2A9 is a high-capacity urate transporter in humans.

Directory of Open Access Journals (Sweden)

Mark J Caulfield

2008-10-01

] 0.9 to 1.05, p > 0.33 by meta-analysis of an SLC2A9 variant in six case-control studies including 11,897 participants. In a separate meta-analysis of four population studies including 11,629 participants we found no association of SLC2A9 with systolic (effect size -0.12 mm Hg, 95% CI -0.68 to 0.43, p = 0.664 or diastolic blood pressure (effect size -0.03 mm Hg, 95% CI -0.39 to 0.31, p = 0.82.This study provides evidence that SLC2A9 splice variants act as high-capacity urate transporters and is one of the first functional characterisations of findings from genome-wide association scans. We did not find an association of the SLC2A9 gene with blood pressure in this study. Our findings suggest potential pathogenic mechanisms that could offer a new drug target for gout.

Two novel mutations in the SLC40A1 and HFE genes implicated in iron overload in a Spanish man.

Science.gov (United States)

Del-Castillo-Rueda, Alejandro; Moreno-Carralero, María-Isabel; Alvarez-Sala-Walther, Luis-Antonio; Cuadrado-Grande, Nuria; Enríquez-de-Salamanca, Rafael; Méndez, Manuel; Morán-Jiménez, María-Josefa

2011-03-01

The most common form of hemochromatosis is caused by mutations in the HFE gene. Rare forms of the disease are caused by mutations in other genes. We present a patient with hyperferritinemia and iron overload, and facial flushing. Magnetic resonance imaging was performed to measure hepatic iron overload, and a molecular study of the genes involved in iron metabolism was undertaken. The iron overload was similar to that observed in HFE hemochromatosis, and the patient was double heterozygous for two novel mutations, c.-20G>A and c.718A>G (p.K240E), in the HFE and ferroportin (FPN1 or SLC40A1) genes, respectively. Hyperferritinemia and facial flushing improved after phlebotomy. Two of the patient's children were also studied, and the daughter was heterozygous for the mutation in the SLC40A1 gene, although she did not have hyperferritinemia. The patient presented a mild iron overload phenotype probably because of the two novel mutations in the HFE and SLC40A1 genes. © 2011 John Wiley & Sons A/S.

Serum uric acid concentrations and SLC2A9 genetic variation in Hispanic children: the Viva La Familia Study1234

Science.gov (United States)

Voruganti, V Saroja; Laston, Sandra; Haack, Karin; Mehta, Nitesh R; Cole, Shelley A; Butte, Nancy F; Comuzzie, Anthony G

2015-01-01

Background: Elevated concentrations of serum uric acid are associated with increased risk of gout and renal and cardiovascular diseases. Genetic studies in adults have consistently identified associations of solute carrier family 2, member 9 (SLC2A9), polymorphisms with variation in serum uric acid. However, it is not known whether the association of serum uric acid with SLC2A9 polymorphisms manifests in children. Objective: The aim was to investigate whether variation in serum uric acid is under genetic influence and whether the association with SLC2A9 polymorphisms generalizes to Hispanic children of the Viva La Familia Study. Design: We conducted a genomewide association study with 1.1 million genetic markers in 815 children. Results: We found serum uric acid to be significantly heritable [h2 ± SD = 0.45 ± 0.08, P = 5.8 × 10−11] and associated with SLC2A9 variants (P values between 10−16 and 10−7). Several of the significantly associated polymorphisms were previously identified in studies in adults. We also found positive genetic correlations between serum uric acid and BMI z score (ρG = 0.45, P = 0.002), percentage of body fat (ρG = 0.28, P = 0.04), fat mass (ρG = 0.34, P = 0.02), waist circumference (ρG = 0.42, P = 0.003), and waist-to-height ratio (ρG = 0.46, P = 0.001). Conclusions: Our results show that variation in serum uric acid in Hispanic children is under considerable genetic influence and is associated with obesity-related phenotypes. As in adults, genetic variation in SLC2A9 is associated with serum uric acid concentrations, an important biomarker of renal and cardiovascular disease risk, in Hispanic children. PMID:25833971

Folate Production by Probiotic Bacteria

Directory of Open Access Journals (Sweden)

Stefano Raimondi

2011-01-01

Full Text Available Probiotic bacteria, mostly belonging to the genera Lactobacillus and Bifidobacterium, confer a number of health benefits to the host, including vitamin production. With the aim to produce folate-enriched fermented products and/or develop probiotic supplements that accomplish folate biosynthesis in vivo within the colon, bifidobacteria and lactobacilli have been extensively studied for their capability to produce this vitamin. On the basis of physiological studies and genome analysis, wild-type lactobacilli cannot synthesize folate, generally require it for growth, and provide a negative contribution to folate levels in fermented dairy products. Lactobacillus plantarum constitutes an exception among lactobacilli, since it is capable of folate production in presence of para-aminobenzoic acid (pABA and deserves to be used in animal trials to validate its ability to produce the vitamin in vivo. On the other hand, several folate-producing strains have been selected within the genus Bifidobacterium, with a great variability in the extent of vitamin released in the medium. Most of them belong to the species B. adolescentis and B. pseudocatenulatum, but few folate producing strains are found in the other species as well. Rats fed a probiotic formulation of folate-producing bifidobacteria exhibited increased plasma folate level, confirming that the vitamin is produced in vivo and absorbed. In a human trial, the same supplement raised folate concentration in feces. The use of folate-producing probiotic strains can be regarded as a new perspective in the specific use of probiotics. They could more efficiently confer protection against inflammation and cancer, both exerting the beneficial effects of probiotics and preventing the folate deficiency that is associated with premalignant changes in the colonic epithelia.

Two Variants in SLC24A5 Are Associated with “Tiger-Eye” Iris Pigmentation in Puerto Rican Paso Fino Horses

Directory of Open Access Journals (Sweden)

Maura Mack

2017-08-01

Full Text Available A unique eye color, called tiger-eye, segregates in the Puerto Rican Paso Fino (PRPF horse breed and is characterized by a bright yellow, amber, or orange iris. Pedigree analysis identified a simple autosomal recessive mode of inheritance for this trait. A genome-wide association study (GWAS with 24 individuals identified a locus on ECA 1 reaching genome-wide significance (Pcorrected = 1.32 × 10−5. This ECA1 locus harbors the candidate gene, Solute Carrier Family 24 (Sodium/Potassium/Calcium Exchanger, Member 5 (SLC24A5, with known roles in pigmentation in humans, mice, and zebrafish. Humans with compound heterozygous mutations in SLC24A5 have oculocutaneous albinism (OCA type 6 (OCA6, which is characterized by dilute skin, hair, and eye pigmentation, as well as ocular anomalies. Twenty tiger-eye horses were homozygous for a nonsynonymous mutation in exon 2 (p.Phe91Tyr of SLC24A5 (called here Tiger-eye 1, which is predicted to be deleterious to protein function. Additionally, eight of the remaining 12 tiger-eye horses heterozygous for the p.Phe91Tyr variant were also heterozygous for a 628 bp deletion encompassing all of exon 7 of SLC24A5 (c.875-340_1081+82del, which we will call here the Tiger-eye 2 allele. None of the 122 brown-eyed horses were homozygous for either tiger-eye-associated allele or were compound heterozygotes. Further, neither variant was detected in 196 horses from four related breeds not known to have the tiger-eye phenotype. Here, we propose that two mutations in SLC24A5 affect iris pigmentation in tiger-eye PRPF horses. Further, unlike OCA6 in humans, the Tiger-eye 1 mutation in its homozygous state or as a compound heterozygote (Tiger-eye 1/Tiger-eye 2 does not appear to cause ocular anomalies or a change in coat color in the PRPF horse.

The solute carrier 6 family of transporters

DEFF Research Database (Denmark)

Bröer, Stefan; Gether, Ulrik

2012-01-01

of these transporters is associated with a variety of diseases. Pharmacological inhibition of the neurotransmitter transporters in this family is an important strategy in the management of neurological and psychiatric disorders. This review provides an overview of the biochemical and pharmacological properties......The solute carrier 6 (SLC6) family of the human genome comprises transporters for neurotransmitters, amino acids, osmolytes and energy metabolites. Members of this family play critical roles in neurotransmission, cellular and whole body homeostasis. Malfunction or altered expression...... of the SLC6 family transporters....

The D543N polymorphism of the SLC11A1/NRAMP1 gene is associated with treatment failure in male patients with pulmonary tuberculosis.

Science.gov (United States)

Salinas-Delgado, Yvain; Galaviz-Hernández, Carlos; Toral, René García; Ávila Rejón, Carmen A; Reyes-Lopez, Miguel A; Martínez, Antonio Rojas; Martínez-Aguilar, Gerardo; Sosa-Macías, Martha

2015-09-01

Polymorphisms in SLC11A1/NRAMP1 have shown an important association with susceptibility to tuberculosis and progression to active disease. However, whether there is an association of these polymorphisms with treatment failure is unknown. The aim of this study was to determine the association of SLC11A1 polymorphisms with treatment failure in Mexican subjects with pulmonary tuberculosis. Thirty-three subjects with treatment failure were paired by age and body mass index with 33 patients who successfully completed treatment and were considered cured. We assessed the polymorphisms of SLC11A1 in the regions of D543N and INT4 via polymerase chain reaction real-time TaqMan® single nucleotide polymorphism (SNP) genotyping. We found that D543N (G/A genotype) was associated with treatment failure in patients with pulmonary tuberculosis [odds ratio (OR) 11.61, 95% confidence interval (CI) 3.66-36.78]. When adjusted by gender, this association remained significant in males (OR 11.09, 95% CI 3.46-35.51). In our male population, the presence of the D543N polymorphism of SLC11A1 is a risk factor for treatment failure. This finding should be confirmed in other populations.

Quantitative correlation between promoter methylation and messenger RNA levels of the reduced folate carrier

Directory of Open Access Journals (Sweden)

Kheradpour Albert

2008-05-01

Full Text Available Abstract Background Methotrexate (MTX uptake is mediated by the reduced folate carrier (RFC. Defective drug uptake in association with decreased RFC expression is a common mechanism of MTX resistance in many tumor types. Heavy promoter methylation was previously identified as a basis for the complete silencing of RFC in MDA-MB-231 breast cancer cells, its role and prevalence in RFC transcription regulation are, however, not widely studied. Methods In the current study, RFC promoter methylation was assessed using methylation specific PCR in a panel of malignant cell lines (n = 8, including MDA-MB-231, and M805, a MTX resistant cell line directly established from the specimen of a patient with malignant fibrohistocytoma, whom received multiple doses of MTX. A quantitative approach of real-time PCR for measuring the extent of RFC promoter methylation was developed, and was validated by direct bisulfite genomic sequencing. RFC mRNA levels were determined by quantitative real-time RT-PCR and were related to the extent of promoter methylation in these cell lines. Results A partial promoter methylation and RFC mRNA down-regulation were observed in M805. Using the quantitative approach, a reverse correlation (correlation coefficient = -0.59, p Conclusion This study further suggests that promoter methylation is a potential basis for MTX resistance. The quantitative correlation identified in this study implies that promoter methylation is possibly a mechanism involved in the fine regulation of RFC transcription.

De Novo Mutations in SLC25A24 Cause a Craniosynostosis Syndrome with Hypertrichosis, Progeroid Appearance, and Mitochondrial Dysfunction.

Science.gov (United States)

Ehmke, Nadja; Graul-Neumann, Luitgard; Smorag, Lukasz; Koenig, Rainer; Segebrecht, Lara; Magoulas, Pilar; Scaglia, Fernando; Kilic, Esra; Hennig, Anna F; Adolphs, Nicolai; Saha, Namrata; Fauler, Beatrix; Kalscheuer, Vera M; Hennig, Friederike; Altmüller, Janine; Netzer, Christian; Thiele, Holger; Nürnberg, Peter; Yigit, Gökhan; Jäger, Marten; Hecht, Jochen; Krüger, Ulrike; Mielke, Thorsten; Krawitz, Peter M; Horn, Denise; Schuelke, Markus; Mundlos, Stefan; Bacino, Carlos A; Bonnen, Penelope E; Wollnik, Bernd; Fischer-Zirnsak, Björn; Kornak, Uwe

2017-11-02

Gorlin-Chaudhry-Moss syndrome (GCMS) is a dysmorphic syndrome characterized by coronal craniosynostosis and severe midface hypoplasia, body and facial hypertrichosis, microphthalmia, short stature, and short distal phalanges. Variable lipoatrophy and cutis laxa are the basis for a progeroid appearance. Using exome and genome sequencing, we identified the recurrent de novo mutations c.650G>A (p.Arg217His) and c.649C>T (p.Arg217Cys) in SLC25A24 in five unrelated girls diagnosed with GCMS. Two of the girls had pronounced neonatal progeroid features and were initially diagnosed with Wiedemann-Rautenstrauch syndrome. SLC25A24 encodes a mitochondrial inner membrane ATP-Mg/P i carrier. In fibroblasts from affected individuals, the mutated SLC25A24 showed normal stability. In contrast to control cells, the probands' cells showed mitochondrial swelling, which was exacerbated upon treatment with hydrogen peroxide (H 2 O 2 ). The same effect was observed after overexpression of the mutant cDNA. Under normal culture conditions, the mitochondrial membrane potential of the probands' fibroblasts was intact, whereas ATP content in the mitochondrial matrix was lower than that in control cells. However, upon H 2 O 2 exposure, the membrane potential was significantly elevated in cells harboring the mutated SLC25A24. No reduction of mitochondrial DNA copy number was observed. These findings demonstrate that mitochondrial dysfunction with increased sensitivity to oxidative stress is due to the SLC25A24 mutations. Our results suggest that the SLC25A24 mutations induce a gain of pathological function and link mitochondrial ATP-Mg/P i transport to the development of skeletal and connective tissue. Copyright © 2017 American Society of Human Genetics. All rights reserved.

An experimental study of the diagnosing value to nude mice model of transplanted human gastric cancer with folate-receptor MR contrast agent

International Nuclear Information System (INIS)

Ding Jianhui; Zeng Mengsu; Zhou Kangrong; Shen Jizhang; Chen Caizhong; Zhong Gaoren; Xue Qiong; Gu Haiyan

2005-01-01

Objective: To evaluate the tumor targeting characteristic by observing signal varying of human gastric cancer transplanted nude mice (SGC-7901 ) using Folate-Receptor MR contrast agent. Methods: As a Folate-Receptor MR contrast agent, Gd-DTPA-Folate was obtained by conjugation of DTPA-Folate and GdCl 3 under specific conditions. Nude mice of subcutaneously transplanted human gastric cancer (SGC-7901) were used as animal models, 12 mice were divided into experimental group (n=6) and control group (n=6) randomly. Both were injected with Gd-DTPA-Folate and Gd-DTPA (contained same gadolinium) via abdominal cavity respectively. Tumor signal varying was observed by T 1 WI after injection of contrast agent immediately, 1, 2, 3, 4, 6, 12 and 24 h, and tumor signal changing of experimental group was compared with that of control group. CNR (contrast noise ratio) was regarded as evaluating mark. Results: Tumor signal intensity of experimental group was increased evidently between 1-2 hours after injecting Gd-DTPA-Folate. Comparison with pre-injection, there was a significant difference (evaluating mark is CNR: q 1 =5.80, q 2 =4.64; P 1 =0.64, q 2 =1.19, P>0.05). Conclusion: Gd-DTPA-Folate shows definite characteristic of tumor targeting effect to nude mice of subcutaneously transplanted human gastric cancer (SGC-7901). (authors)

Chronic Nicotine Exposure In Vivo and In Vitro Inhibits Vitamin B1 (Thiamin Uptake by Pancreatic Acinar Cells.

Directory of Open Access Journals (Sweden)

Padmanabhan Srinivasan

Full Text Available Thiamin (vitamin B1, a member of the water-soluble family of vitamins, is essential for normal cellular functions; its deficiency results in oxidative stress and mitochondrial dysfunction. Pancreatic acinar cells (PAC obtain thiamin from the circulation using a specific carrier-mediated process mediated by both thiamin transporters -1 and -2 (THTR-1 and THTR-2; encoded by the SLC19A2 and SLC19A3 genes, respectively. The aim of the current study was to examine the effect of chronic exposure of mouse PAC in vivo and human PAC in vitro to nicotine (a major component of cigarette smoke that has been implicated in pancreatic diseases on thiamin uptake and to delineate the mechanism involved. The results showed that chronic exposure of mice to nicotine significantly inhibits thiamin uptake in murine PAC, and that this inhibition is associated with a marked decrease in expression of THTR-1 and THTR-2 at the protein, mRNA and hnRNAs level. Furthermore, expression of the important thiamin-metabolizing enzyme, thiamin pyrophosphokinase (TPKase, was significantly reduced in PAC of mice exposed to nicotine. Similarly, chronic exposure of cultured human PAC to nicotine (0.5 μM, 48 h significantly inhibited thiamin uptake, which was also associated with a decrease in expression of THTR-1 and THTR-2 proteins and mRNAs. This study demonstrates that chronic exposure of PAC to nicotine impairs the physiology and the molecular biology of the thiamin uptake process. Furthermore, the study suggests that the effect is, in part, mediated through transcriptional mechanism(s affecting the SLC19A2 and SLC19A3 genes.

Prevalence of iron, folate, and vitamin B12 deficiencies in 20 to 49 years old women: Ensanut 2012

Directory of Open Access Journals (Sweden)

Teresa Shamah-Levy

2015-09-01

Full Text Available Objective. To describe the prevalence of iron, folate, and B12 deficiencies in Mexican women of reproductive age from the National Health and Nutrition Survey (Ensanut 2012.Materials and methods. Data came from a  ationalprobabilistic survey, representative from rural and urban areas,and different age groups. Blood samples were obtained from 4 263, 20 to 49 years old women for serum ferritin, vitamin B12 and serum folate oncentrations. The prevalence of deficiencies, was assessed using adjusted logistic regression models. Results. The deficiency of folate was 1.9% (95%CI1.3-2.8, B12 deficiency was 8.5% (95%CI 6.7-10.1 and iron deficiency was 29.4% (95%CI 26.5-32.2. No differences were found when compared with 2006, 24.8% (95%CI 22.3-27.2.Conclusions. The vitamin B12 deficiency is still a problem for women of reproductive age and their offspring in Mexico,while folate deficiency disappeared as a problem. Iron deficiency needs prevention and fortification strategies.

The Role of Na:K:2Cl Cotransporter 1 (NKCC1/SLC12A2) in Dental Epithelium during Enamel Formation in Mice

Science.gov (United States)