Directory of Open Access Journals (Sweden)
Naila Al Mahmuda
2016-05-01
Full Text Available Autism Spectrum Disorder (ASD is a group of neurodevelopmental disorders with complex genetic etiology. Recent studies have indicated that children with ASD may have altered folate or methionine metabolism, suggesting that the folate–methionine cycle may play a key role in the etiology of ASD. SLC19A1, also referred to as reduced folate carrier 1 (RFC1, is a member of the solute carrier group of transporters and is one of the key enzymes in the folate metabolism pathway. Findings from multiple genomic screens suggest the presence of an autism susceptibility locus on chromosome 21q22.3, which includes SLC19A1. Therefore, we performed a case-control study in a Japanese population. In this study, DNA samples obtained from 147 ASD patients at the Kanazawa University Hospital in Japan and 150 unrelated healthy Japanese volunteers were examined by the sequence-specific primer-polymerase chain reaction method pooled with fluorescence correlation spectroscopy. p < 0.05 was considered to represent a statistically significant outcome. Of 13 single nucleotide polymorphisms (SNPs examined, a significant p-value was obtained for AA genotype of one SNP (rs1023159, OR = 0.39, 95% CI = 0.16–0.91, p = 0.0394; Fisher’s exact test. Despite some conflicting results, our findings supported a role for the polymorphism rs1023159 of the SLC19A1 gene, alone or in combination, as a risk factor for ASD. However, the findings were not consistent after multiple testing corrections. In conclusion, although our results supported a role of the SLC19A1 gene in the etiology of ASD, it was not a significant risk factor for the ASD samples analyzed in this study.
Pei, Lijun; Zhu, Huiping; Ye, Rongwei; Wu, Jilei; Liu, Jianmeng; Ren, Aiguo; Li, Zhiwen; Zheng, Xiaoying
2015-01-01
Many studies have indicated that the reduced folate carrier gene (SLC19A1) is associated with an increased risk of neural tube defects (NTDs). However, the interaction between the SLC19A1 gene variant and maternal fever exposure and NTD risk remains unknown. The aim of this study was to investigate whether the risk for NTDs was influenced by the interactions between the SLC19A1 (rs1051266) variant and maternal first trimester fever. We investigated the potential interaction between maternal first trimester fever and maternal or offspring SLC19A1 polymorphism through a population-based case-control study. One hundred and four nuclear families with NTDs and 100 control families with nonmal newborns were included in the study. SLC19A1 polymorphism was determined using polymerase chain reaction-restricted fragment length polymorphism. Mothers who had the GG/GA genotype and first trimester fever had an elevated risk of NTDs (adjusted odds ratio, 11.73; 95% confidence interval, 3.02-45.58) as compared to absence of maternal first trimester fever and AA genotype after adjusting for maternal education, paternal education, and age, and had a significant interactive coefficient (γ = 3.17) between maternal GG/GA genotype and first trimester fever. However, there was no interaction between offspring's GG/GA genotype and maternal first trimester fever (the interactive coefficient γ = 0.97) after adjusting for confounding factors. Our findings suggested that the risk of NTDs was potentially influenced by a gene-environment interaction between maternal SLC19A1 rs1051266 GG/GA genotype and first trimester fever. Maternal GG/GA genotype may strengthen the effect of maternal fever exposure on NTD risk in this Chinese population. © 2014 Wiley Periodicals, Inc.
Directory of Open Access Journals (Sweden)
Fabio Coppedè
2014-01-01
Full Text Available Alzheimer’s disease (AD is the most common neurodegenerative disorder and the primary form of dementia in the elderly. Polymorphisms of genes involved in folate metabolism have been frequently suggested as risk factors for sporadic AD. A common c.80G>A polymorphism (rs1051266 in the gene coding for the reduced folate carrier (SLC19A1 gene, commonly known as RFC-1 gene was investigated as AD risk factor in Asian populations, yielding conflicting results. We screened a Caucasian population of Italian origin composed of 192 sporadic AD patients and 186 healthy matched controls, for the presence of the RFC-1 c.80G>A polymorphism, and searched for correlation with circulating levels of folate, homocysteine, and vitamin B12. No difference in the distribution of allele and genotype frequencies was observed between AD patients and controls. No correlation was observed among the genotypes generated by the RFC-1 c.80G>A polymorphism and circulating levels of folate, homocysteine, and vitamin B12 either in the whole cohort of subjects or after stratification into clinical subtypes. Present results do not support a role for the RFC-1 c.80G>A polymorphism as independent risk factor for sporadic AD in Italian Caucasians.
Expression of RFC/SLC19A1 is associated with tumor type in bladder cancer patients.
Directory of Open Access Journals (Sweden)
Alyaa M Abdel-Haleem
Full Text Available Urinary bladder cancer (UBC ranks ninth in worldwide cancer. In Egypt, the pattern of bladder cancer is unique in that both the transitional and squamous cell types prevail. Despite much research on the topic, it is still difficult to predict tumor progression, optimal therapy and clinical outcome. The reduced folate carrier (RFC/SLC19A1 is the major transport system for folates in mammalian cells and tissues. RFC is also the primary means of cellular uptake for antifolate cancer chemotherapeutic drugs, however, membrane transport of antifolates by RFC is considered as limiting to antitumor activity. The purpose of this study was to compare the mRNA expression level of RFC/SLC19A1 in urothelial and non-urothelial variants of bladder carcinomas. Quantification of RFC mRNA in the mucosa of 41 untreated bladder cancer patients was performed using RT-qPCR. RFC mRNA steady-state levels were ∼9-fold higher (N = 39; P<0.0001 in bladder tumor specimens relative to normal bladder mRNA. RFC upregulation was strongly correlated with tumor type (urothelial vs. non-urothelial; p<0.05 where median RFC mRNA expression was significantly (p<0.05 higher in the urothelial (∼14-fold compared to the non-urothelial (∼4-fold variant. This may account for the variation in response to antifolate-containing regimens used in the treatment of either type. RFC mRNA levels were not associated with tumor grade (I, II and III or stage (muscle-invasive vs. non-muscle invasive implying that RFC cannot be used for prognostic purposes in bladder carcinomas and its increased expression is an early event in human bladder tumors pathogenesis. Further, RFC can be considered as a potential marker for predicting response to antifolate chemotherapy in urothelial carcinomas.
Directory of Open Access Journals (Sweden)
Fausto Zaruma-Torres
2016-08-01
Full Text Available Acute lymphoblastic leukemia (ALL is a frequent neoplasia occurring in children. The most commonly used drug for the treatment of ALL is methotrexate (MTX, an anti-folate agent. Previous studies suggest that folate transporters play a role in ALL prognosis and that genetic polymorphism of genes encoding folate transporters may increase the risk of ALL. Therefore, the main goal of this study was to determine the associations among six genetic polymorphisms in four genes related with the folate transporter pathway to determine a relationship with the occurrence of ALL in Mexican children.A case-control study was performed in 73 ALL children and 133 healthy children from Northern and Northwestern Mexico. COL18A1 (rs2274808, SLC19A1 (rs2838956, ABCB1 (rs1045642 and rs1128503 and ABCC5 (rs9838667 and rs3792585. polymorphisms were assayed through qPCR.Our results showed an increased ALL risk in children carrying CT genotype (OR=2.55, CI 95% 1.11-5.83, p=0.0001 and TT genotype (OR=21.05, CI 95% 5.62-78.87, p<0.0001 of COL18A1 rs2274808; in SLC19A1 rs2838956 AG carriers (OR=44.69, CI 95% 10.42-191.63, p=0.0001; in ABCB1 rs1045642 TT carriers (OR=13.76, CI 95% 5.94-31.88, p=0.0001; in ABCC5 rs9838667 AC carriers (OR=2.61, CI 95% 1.05-6.48, p<0.05; and in ABCC5 rs3792585 CC carriers (OR=9.99, CI 95% 3.19-31.28, p=0.004. Moreover, several combinations of genetic polymorphisms were found to be significantly associated with a risk for ALL. Finally, two combinations of ABCC5 polymorphisms resulted in protection from this neoplasia.In conclusion, certain genetic polymorphisms related to the folate transport pathway, particularly COL18A1 rs2274808, SLC19A1 rs2838956, ABCB1 rs1045642 and ABCC5 rs3792585, were associated with an increased risk for ALL in Mexican children.
Methionine synthase A2756G and reduced folate carrier1 A80G ...
African Journals Online (AJOL)
Maha Moustafa
2015-10-09
Oct 9, 2015 ... folate carrier (RFC1) A80G gene polymorphisms on the maternal risk for DS. Patients: This ... Peer review under responsibility of Ain Shams University. ... Folate is the general term for a water-soluble B vitamin (vita- min B9) ...
Meredith, Megan; MacNeil, Allison H; Trasler, Jacquetta M; Baltz, Jay M
2016-06-01
The folate cycle is central to cellular one-carbon metabolism, where folates are carriers of one-carbon units that are critical for synthesis of purines, thymidylate, and S-adenosylmethionine, the universal methyl donor that forms the cellular methyl pool. Although folates are well-known to be important for early embryo and fetal development, their role in oogenesis has not been clearly established. Here, folate transport proteins were detected in developing neonatal ovaries and growing oocytes by immunohistochemistry, Western blot, and immunofluorescence. The folate receptors FOLR1 and FOLR2 as well as reduced folate carrier 1 (RFC1, SLC19A1 protein) each appeared to be present in follicular cells including granulosa cells. In growing oocytes, however, only FOLR2 immunoreactivity appeared abundant. Localization of apparent FOLR2 immunofluorescence near the plasma membrane increased with oocyte growth and peaked in oocytes as they neared full size. We assessed folate transport using the model folate leucovorin (folinic acid). Unexpectedly, there was a transient burst of folate transport activity for a brief period during oocyte growth as they neared full size, while folate transport was otherwise undetectable for the rest of oogenesis and in fully grown germinal vesicle stage oocytes. This folate transport was inhibited by dynasore, an inhibitor of endocytosis, but insensitive to the anion transport inhibitor stilbene 4-acetamido-40-isothiocyanato-stilbene-2,20-disulfonic acid, consistent with folate receptor-mediated transport but not with RFC1-mediated transport. Thus, near the end of their growth, growing oocytes may take up folates that could support the final stage of oogenesis or be stored to provide the endogenous folates needed in early embryogenesis. © 2016 by the Society for the Study of Reproduction, Inc.
International Nuclear Information System (INIS)
Lasry, Inbal; Berman, Bluma; Glaser, Fabian; Jansen, Gerrit; Assaraf, Yehuda G.
2009-01-01
The proton-coupled folate transporter (PCFT/SLC46A1) mediates intestinal folate uptake at acidic pH. Some loss of folic acid (FA) transport mutations in PCFT from hereditary folate malabsorption (HFM) patients cluster in R113, thereby suggesting a functional role for this residue. Herein, unlike non-conservative substitutions, an R113H mutant displayed 80-fold increase in the FA transport Km while retaining parental Vmax, hence indicating a major fall in folate substrate affinity. Furthermore, consistent with the preservation of 9% of parental transport activity, R113H transfectants displayed a substantial decrease in the FA growth requirement relative to mock transfectants. Homology modeling based on the crystal structures of the Escherichia coli transporter homologues EmrD and glycerol-3-phosphate transporter revealed that the R113H rotamer properly protrudes into the cytoplasmic face of the minor cleft normally occupied by R113. These findings constitute the first demonstration that a basic amino acid at position 113 is required for folate substrate binding.
Methionine synthase A2756G and reduced folate carrier1 A80G ...
African Journals Online (AJOL)
Background: Polymorphisms of genes encoding enzymes involved in folate metabolism have long been hypothesized to be maternal risk factors for Down syndrome, however, results are conflicting and inconclusive. Aim of the study: To analyze the effect of methionine synthase (MTR) A2756G, and reduced folate carrier ...
Methionine synthase A2756G and reduced folate carrier1 A80G ...
African Journals Online (AJOL)
Aim of the study: To analyze the effect of methionine synthase (MTR) A2756G, and reduced folate carrier (RFC1) A80G gene polymorphisms on the maternal risk for DS. Patients: This study was conducted in the Medical Genetics Center, Ain-Shams University hospitals, on a total of 170 mothers of children, diagnosed with ...
Di Noia, Maria Antonietta; Todisco, Simona; Cirigliano, Angela; Rinaldi, Teresa; Agrimi, Gennaro; Iacobazzi, Vito; Palmieri, Ferdinando
2014-01-01
The human genome encodes 53 members of the solute carrier family 25 (SLC25), also called the mitochondrial carrier family, many of which have been shown to transport inorganic anions, amino acids, carboxylates, nucleotides, and coenzymes across the inner mitochondrial membrane, thereby connecting cytosolic and matrix functions. Here two members of this family, SLC25A33 and SLC25A36, have been thoroughly characterized biochemically. These proteins were overexpressed in bacteria and reconstituted in phospholipid vesicles. Their transport properties and kinetic parameters demonstrate that SLC25A33 transports uracil, thymine, and cytosine (deoxy)nucleoside di- and triphosphates by an antiport mechanism and SLC25A36 cytosine and uracil (deoxy)nucleoside mono-, di-, and triphosphates by uniport and antiport. Both carriers also transported guanine but not adenine (deoxy)nucleotides. Transport catalyzed by both carriers was saturable and inhibited by mercurial compounds and other inhibitors of mitochondrial carriers to various degrees. In confirmation of their identity (i) SLC25A33 and SLC25A36 were found to be targeted to mitochondria and (ii) the phenotypes of Saccharomyces cerevisiae cells lacking RIM2, the gene encoding the well characterized yeast mitochondrial pyrimidine nucleotide carrier, were overcome by expressing SLC25A33 or SLC25A36 in these cells. The main physiological role of SLC25A33 and SLC25A36 is to import/export pyrimidine nucleotides into and from mitochondria, i.e. to accomplish transport steps essential for mitochondrial DNA and RNA synthesis and breakdown. PMID:25320081
Di Noia, Maria Antonietta; Todisco, Simona; Cirigliano, Angela; Rinaldi, Teresa; Agrimi, Gennaro; Iacobazzi, Vito; Palmieri, Ferdinando
2014-11-28
The human genome encodes 53 members of the solute carrier family 25 (SLC25), also called the mitochondrial carrier family, many of which have been shown to transport inorganic anions, amino acids, carboxylates, nucleotides, and coenzymes across the inner mitochondrial membrane, thereby connecting cytosolic and matrix functions. Here two members of this family, SLC25A33 and SLC25A36, have been thoroughly characterized biochemically. These proteins were overexpressed in bacteria and reconstituted in phospholipid vesicles. Their transport properties and kinetic parameters demonstrate that SLC25A33 transports uracil, thymine, and cytosine (deoxy)nucleoside di- and triphosphates by an antiport mechanism and SLC25A36 cytosine and uracil (deoxy)nucleoside mono-, di-, and triphosphates by uniport and antiport. Both carriers also transported guanine but not adenine (deoxy)nucleotides. Transport catalyzed by both carriers was saturable and inhibited by mercurial compounds and other inhibitors of mitochondrial carriers to various degrees. In confirmation of their identity (i) SLC25A33 and SLC25A36 were found to be targeted to mitochondria and (ii) the phenotypes of Saccharomyces cerevisiae cells lacking RIM2, the gene encoding the well characterized yeast mitochondrial pyrimidine nucleotide carrier, were overcome by expressing SLC25A33 or SLC25A36 in these cells. The main physiological role of SLC25A33 and SLC25A36 is to import/export pyrimidine nucleotides into and from mitochondria, i.e. to accomplish transport steps essential for mitochondrial DNA and RNA synthesis and breakdown. © 2014 by The American Society for Biochemistry and Molecular Biology, Inc.
Directory of Open Access Journals (Sweden)
Liu Huang
Full Text Available Rapid response to chemotherapy in metastatic colorectal cancer (mCRC patients (response within 12 weeks of chemotherapy may increase the chance of complete resection and improved survival. Few molecular markers predict irinotecan-induced rapid response and survival. Single-nucleotide polymorphisms (SNPs in solute carrier genes are reported to correlate with the variable pharmacokinetics of irinotecan and folate in cancer patients. This study aims to evaluate the predictive role of 3 SNPs in mCRC patients treated with irinotecan and fluoropyrimidine-containing regimens.Three SNPs were selected and genotyped in 137 mCRC patients from a Chinese prospective multicenter trial (NCT01282658. The chi-squared test, univariate and multivariable logistic regression model, and receiver operating characteristic analysis were used to evaluate correlations between the genotypes and rapid response. Kaplan-Meier survival analysis and Cox proportional hazard models were used to evaluate the associations between genotypes and survival outcomes. Benjamini and Hochberg False Discovery Rate correction was used in multiple testing.Genotype GA/AA of SNP rs2306283 of the gene SLCO1B1 and genotype GG of SNP rs1051266 of the gene SLC19A1 were associated with a higher rapid response rate (odds ratio [OR] =3.583 and 3.521, 95%CI =1.301-9.871 and 1.271-9.804, p=0.011 and p=0.013, respectively. The response rate was 70% in patients with both genotypes, compared with only 19.7% in the remaining patients (OR = 9.489, 95%CI = 2.191-41.093, Fisher's exact test p=0.002. Their significances were all maintained even after multiple testing (all p c < 0.05. The rs2306283 GA/AA genotype was also an independent prognostic factor of longer progression-free survival (PFS (hazard ratio = 0.402, 95%CI = 0.171-0.945, p=0.037. None of the SNPs predicted overall survival.Polymorphisms of solute carriers' may be useful to predict rapid response to irinotecan plus fluoropyrimidine and PFS in m
DEFF Research Database (Denmark)
Gregers, Jannie; Christensen, Ib Jarle; Dalhoff, Kim
2010-01-01
with chromosome 21 copy number in the leukemic clone. A total of 500 children with acute lymphoblastic leukemia treated according to the common Nordic treatment protocols were included, and we found that the RFC AA variant was associated with a 50% better chance of staying in remission compared with GG or GA......The reduced folate carrier (RFC) is involved in the transport of methotrexate (MTX) across the cell membrane. The RFC gene (SLC19A1) is located on chromosome 21, and we hypothesized that the RFC80 G>A polymorphism would affect outcome and toxicity in childhood leukemia and that this could interact...... variants (P = .046). Increased copy numbers of chromosome 21 appear to improve outcome also in children with GA or GG variant. In a subset of 182 children receiving 608 high-dose MTX courses, we observed higher degree of bone marrow toxicity in patients with the RFC AA variant compared with GA/GG variants...
Kotnik, Barbara Faganel; Jazbec, Janez; Grabar, Petra Bohanec; Rodriguez-Antona, Cristina
2017-01-01
Abstract Background We investigated the clinical relevance of SLC 19A1 genetic variability for high dose methotrexate (HD-MTX) related toxicities in children and adolescents with acute lymphoblastic leukaemia (ALL) and non Hodgkin malignant lymphoma (NHML). Patients and methods Eighty-eight children and adolescents with ALL/NHML were investigated for the influence of SLC 19A1 single nucleotide polymorphisms (SNPs) and haplotypes on HD-MTX induced toxicities. Results Patients with rs2838958 TT genotype had higher probability for mucositis development as compared to carriers of at least one rs2838958 C allele (OR 0.226 (0.071–0.725), p < 0.009). Haplotype TGTTCCG (H4) statistically significantly reduced the risk for the occurrence of adverse events during treatment with HD-MTX (OR 0.143 (0.023–0.852), p = 0.030). Conclusions SLC 19A1 SNP and haplotype analysis could provide additional information in a personalized HD-MTX therapy for children with ALL/NHML in order to achieve better treatment outcome. However further studies are needed to validate the results. PMID:29333125
Directory of Open Access Journals (Sweden)
Karen M Vernau
Full Text Available Alaskan Husky Encephalopathy (AHE has been previously proposed as a mitochondrial encephalopathy based on neuropathological similarities with human Leigh Syndrome (LS. We studied 11 Alaskan Husky dogs with AHE, but found no abnormalities in respiratory chain enzyme activities in muscle and liver, or mutations in mitochondrial or nuclear genes that cause LS in people. A genome wide association study was performed using eight of the affected dogs and 20 related but unaffected control AHs using the Illumina canine HD array. SLC19A3 was identified as a positional candidate gene. This gene controls the uptake of thiamine in the CNS via expression of the thiamine transporter protein THTR2. Dogs have two copies of this gene located within the candidate interval (SLC19A3.2 - 43.36-43.38 Mb and SLC19A3.1 - 43.411-43.419 Mb on chromosome 25. Expression analysis in a normal dog revealed that one of the paralogs, SLC19A3.1, was expressed in the brain and spinal cord while the other was not. Subsequent exon sequencing of SLC19A3.1 revealed a 4bp insertion and SNP in the second exon that is predicted to result in a functional protein truncation of 279 amino acids (c.624 insTTGC, c.625 C>A. All dogs with AHE were homozygous for this mutation, 15/41 healthy AH control dogs were heterozygous carriers while 26/41 normal healthy AH dogs were wild type. Furthermore, this mutation was not detected in another 187 dogs of different breeds. These results suggest that this mutation in SLC19A3.1, encoding a thiamine transporter protein, plays a critical role in the pathogenesis of AHE.
Singh, Nisha; Gedda, Mallikarjuna Rao; Tiwari, Neeraj; Singh, Suya P; Bajpai, Surabhi; Singh, Rakesh K
2017-09-01
Visceral leishmaniasis (kala-azar), a life threatening disease caused by L. donovani , is a latent threat to more than 147 million people living in disease endemic South East Asia region of the Indian subcontinent. The therapeutic option to control leishmanial infections are very limited, and at present comprise only two drugs, an antifungal amphotericin B and an antitumor miltefosine, which are also highly vulnerable for parasitic resistance. Therefore, identification and development of alternate control measures is an exigent requirement to control leishmanial infections. In this study, we report that functionally induced expression of solute carrier protein family 11 member 1 ( Slc11a1), a transmembrane divalent cationic transporter recruited on the surface of phagolysosomes after phagocytosis of parasites, effectively inhibits Leishmania donovani growth in host macrophages. Further, the increased Slc11a1 functionality also resulted in increased production of NOx, TNF-α and IL-12 by activated macrophages. The findings of this study signify the importance of interplay between Slc11a1 expression and macrophages activation that can be effectively used to control of Leishmania growth and survival.
Porcelli, Vito; Fiermonte, Giuseppe; Longo, Antonella; Palmieri, Ferdinando
2014-01-01
The human genome encodes 53 members of the solute carrier family 25 (SLC25), also called the mitochondrial carrier family, many of which have been shown to transport carboxylates, amino acids, nucleotides, and cofactors across the inner mitochondrial membrane, thereby connecting cytosolic and matrix functions. In this work, a member of this family, SLC25A29, previously reported to be a mitochondrial carnitine/acylcarnitine- or ornithine-like carrier, has been thoroughly characterized biochemically. The SLC25A29 gene was overexpressed in Escherichia coli, and the gene product was purified and reconstituted in phospholipid vesicles. Its transport properties and kinetic parameters demonstrate that SLC25A29 transports arginine, lysine, homoarginine, methylarginine and, to a much lesser extent, ornithine and histidine. Carnitine and acylcarnitines were not transported by SLC25A29. This carrier catalyzed substantial uniport besides a counter-exchange transport, exhibited a high transport affinity for arginine and lysine, and was saturable and inhibited by mercurial compounds and other inhibitors of mitochondrial carriers to various degrees. The main physiological role of SLC25A29 is to import basic amino acids into mitochondria for mitochondrial protein synthesis and amino acid degradation. PMID:24652292
Porcelli, Vito; Fiermonte, Giuseppe; Longo, Antonella; Palmieri, Ferdinando
2014-05-09
The human genome encodes 53 members of the solute carrier family 25 (SLC25), also called the mitochondrial carrier family, many of which have been shown to transport carboxylates, amino acids, nucleotides, and cofactors across the inner mitochondrial membrane, thereby connecting cytosolic and matrix functions. In this work, a member of this family, SLC25A29, previously reported to be a mitochondrial carnitine/acylcarnitine- or ornithine-like carrier, has been thoroughly characterized biochemically. The SLC25A29 gene was overexpressed in Escherichia coli, and the gene product was purified and reconstituted in phospholipid vesicles. Its transport properties and kinetic parameters demonstrate that SLC25A29 transports arginine, lysine, homoarginine, methylarginine and, to a much lesser extent, ornithine and histidine. Carnitine and acylcarnitines were not transported by SLC25A29. This carrier catalyzed substantial uniport besides a counter-exchange transport, exhibited a high transport affinity for arginine and lysine, and was saturable and inhibited by mercurial compounds and other inhibitors of mitochondrial carriers to various degrees. The main physiological role of SLC25A29 is to import basic amino acids into mitochondria for mitochondrial protein synthesis and amino acid degradation.
Reduced folate carrier polymorphism (80A-->G) and neural tube defects.
De Marco, Patrizia; Calevo, Maria Grazia; Moroni, Anna; Merello, Elisa; Raso, Alessandro; Finnell, Richard H; Zhu, Huiping; Andreussi, Luciano; Cama, Armando; Capra, Valeria
2003-03-01
Transport of folates in mammalian cells occurs by a carrier-mediated mechanism. The human folate carrier (RFC-1) gene has been isolated and characterized. Within this gene, a common polymorphism, 80A-->G, changing a histidine to an arginine in exon 2 (H27R), was recently identified. Defects in folate metabolism, such as defective carrier molecules, could be implicated in the etiology of neural tube defects (NTDs). In the present case-control study, we recruited 174 Italian probands with nonsyndromic NTD, 43 mothers, 53 fathers and 156 control individuals and evaluated the impact of RFC-1 variant on NTD risk. A statistically significant risk was calculated for the 80GG genotype of the NTD cases (OR=2.35; 95% CI 1.21-4.58) and mothers (OR=2.74; 95% CI 0.92-8.38). On the contrary, the heterozygous genotype of the mothers and both heterozygous and homozygous genotypes of the fathers did not seem to be significant NTD risk factors. Furthemore, according to the multifactorial inheritance of NTDs, we demonstrated that the combined genotypes for MTHFR 1298A-->C and RFC-1 80A-->G polymorphisms of cases resulted in greater NTD risk than heterozygosity or homozygosity for RFC-1 80A-->G variant alone. Conversely, our data provide no evidence for an association between NTD phenotype and combined MTHFR C677T/RFC-1 A80G genotypes. Moreover, here we describe the combinations of the two MTHFR polymorphic sites (677CT and 1298AC) with RFC-1 genotypes. We found that both patients and controls could have at most quadruple-mutation combinations. Interestingly, 27% (7/26) of the mothers and 18.75% (30/160) of the cases genotyped presented four mutant alleles in comparison with 8.5% (11/129) of the controls. Finally, the frequency of NTD cases and mothers carrying combined heterozygosity for the two MTHFR polymorphisms and RFC-1 80GG homozygosity (677CT/1298AC/80GG) (cases=11.3%; mothers 11.5%) was increased compared with controls (1.6%). Altogether, our findings support the hypothesis
Glycine and Folate Ameliorate Models of Congenital Sideroblastic Anemia.
Directory of Open Access Journals (Sweden)
J Pedro Fernández-Murray
2016-01-01
Full Text Available Sideroblastic anemias are acquired or inherited anemias that result in a decreased ability to synthesize hemoglobin in red blood cells and result in the presence of iron deposits in the mitochondria of red blood cell precursors. A common subtype of congenital sideroblastic anemia is due to autosomal recessive mutations in the SLC25A38 gene. The current treatment for SLC25A38 congenital sideroblastic anemia is chronic blood transfusion coupled with iron chelation. The function of SLC25A38 is not known. Here we report that the SLC25A38 protein, and its yeast homolog Hem25, are mitochondrial glycine transporters required for the initiation of heme synthesis. To do so, we took advantage of the fact that mitochondrial glycine has several roles beyond the synthesis of heme, including the synthesis of folate derivatives through the glycine cleavage system. The data were consistent with Hem25 not being the sole mitochondrial glycine importer, and we identify a second SLC25 family member Ymc1, as a potential secondary mitochondrial glycine importer. Based on these findings, we observed that high levels of exogenous glycine, or 5-aminolevulinic acid (5-Ala a metabolite downstream of Hem25 in heme biosynthetic pathway, were able to restore heme levels to normal in yeast cells lacking Hem25 function. While neither glycine nor 5-Ala could ameliorate SLC25A38 congenital sideroblastic anemia in a zebrafish model, we determined that the addition of folate with glycine was able to restore hemoglobin levels. This difference is likely due to the fact that yeast can synthesize folate, whereas in zebrafish folate is an essential vitamin that must be obtained exogenously. Given the tolerability of glycine and folate in humans, this study points to a potential novel treatment for SLC25A38 congenital sideroblastic anemia.
Xenopus reduced folate carrier regulates neural crest development epigenetically.
Directory of Open Access Journals (Sweden)
Jiejing Li
Full Text Available Folic acid deficiency during pregnancy causes birth neurocristopathic malformations resulting from aberrant development of neural crest cells. The Reduced folate carrier (RFC is a membrane-bound receptor for facilitating transfer of reduced folate into the cells. RFC knockout mice are embryonic lethal and develop multiple malformations, including neurocristopathies. Here we show that XRFC is specifically expressed in neural crest tissues in Xenopus embryos and knockdown of XRFC by specific morpholino results in severe neurocristopathies. Inhibition of RFC blocked the expression of a series of neural crest marker genes while overexpression of RFC or injection of 5-methyltetrahydrofolate expanded the neural crest territories. In animal cap assays, knockdown of RFC dramatically reduced the mono- and trimethyl-Histone3-K4 levels and co-injection of the lysine methyltransferase hMLL1 largely rescued the XRFC morpholino phenotype. Our data revealed that the RFC mediated folate metabolic pathway likely potentiates neural crest gene expression through epigenetic modifications.
Reduced folate carrier polymorphism determines methotrexate uptake by B cells and CD4+ T cells
DEFF Research Database (Denmark)
Baslund, B; Gregers, J; Nielsen, Claus Henrik
2008-01-01
To examine if polymorphism 80G --> A in the Reduced Folate Carrier (RFC) affects uptake of MTX in B- and CD4+ T-cells.......To examine if polymorphism 80G --> A in the Reduced Folate Carrier (RFC) affects uptake of MTX in B- and CD4+ T-cells....
Mauritz, Robert; Peters, Godefridus; Kathmann, Ietje; Teshale, Habte; Noordhuis, Paul; Comijn, Elizabeth; Pinedo, Herbert; Jansen, Gerrit
Murine L1210 leukaemia cells expressing either the reduced folate carrier (RFC) or the membrane folate receptor (MFR) were studied in vitro and in vivo to assess the dynamics of membrane transport of two categories antifolates; folate-based inhibitors of dihydrofolate reductase (methotrexate,
Wiltshire, Esko J; Peña, Alexia S; MacKenzie, Karen; Bose-Sundernathan, Tulika; Gent, Roger; Couper, Jennifer J
2015-02-01
To determine the effect of polymorphisms in NOS3 and folate pathway enzymes on vascular function and folate status and endothelial response to folate in children with diabetes or obesity. A total of 244 subjects (age 13.8 ± 2.8 years, 125 males) were studied for NOS3 and/or folate pathway polymorphisms using polymerase chain reaction/restriction fragment length polymorphism, including at baseline: 139 with type 1 diabetes; 58 with obesity; and 47 controls. The effect of NOS3 genotype on endothelial response to folate (5 mg) was assessed in 85 subjects with diabetes and 28 obese subjects who received active treatment during intervention trials. Vascular function (flow-mediated dilatation [FMD] and glyceryl trinitrate-mediated dilatation), clinical, and biochemical measurements were assessed at baseline and 8 weeks in folate intervention studies. Folate pathway enzyme and NOS3 polymorphisms did not significantly affect baseline vascular function. The polymorphism in intron 4 of endothelial nitric oxide synthase altered endothelial response to folate significantly: in subjects with diabetes FMD improved by 6.4 ± 5% (insertion carriers) vs 2.3 ± 6.6% (deletion carriers), P = .01; in obese subjects FMD improved by 1.8 ± 5.4% (insertion carriers) and deteriorated by -3.2 ± 7.2% (deletion carriers), P = .05. More subjects carrying the insertion normalized FMD after folate supplementation (insertion 64% vs deletion 28%, χ(2) = 10.14, P = .001). A NOS3 polymorphism predicts endothelial response to folate in children with diabetes or obesity, with implications for vascular risk and folate intervention studies. Copyright © 2015 Elsevier Inc. All rights reserved.
Inhibition of SLC1A5 sensitizes colorectal cancer to cetuximab.
Ma, Huanrong; Wu, Zhenzhen; Peng, Jianjun; Li, Yang; Huang, Hongxiang; Liao, Yi; Zhou, Minyu; Sun, Li; Huang, Na; Shi, Min; Bin, Jianping; Liao, Yulin; Rao, Jinjun; Wang, Lin; Liao, Wangjun
2018-06-15
Cetuximab resistance is a key barrier in treating metastatic colorectal cancer (mCRC). Targeting of metabolic resources import could resensitize drug-resistant cancer cells to anticancer treatments. Here we showed that the expression of the glutamine transporter solute carrier 1 family member 5 (SLC1A5) in clinical CRC samples of patients resisted to cetuximab was significantly higher than in those of patients responded to cetuximab. Inhibition of SLC1A5 by shRNA-mediated gene silencing or pharmacological inhibitor significantly suppressed the growth of CRC. Moreover, inhibition of SLC1A5 significantly enhanced the inhibitory efficacy of cetuximab on CRC proliferation both in vitro and in vivo. Mechanistically, SLC1A5 inhibition facilitated EGFR degradation through the ubiquitin-proteasome pathway, and decreased the expression of nuclear EGFR, both of which might have contribution to the improved response to cetuximab. This study provides the metabolic molecule SLC1A5 as a potential therapeutic target to increase the efficacy of cetuximab on CRC. © 2018 UICC.
Missense mutation in exon 2 of SLC36A1 responsible for champagne dilution in horses.
Directory of Open Access Journals (Sweden)
Deborah Cook
2008-09-01
Full Text Available Champagne coat color in horses is controlled by a single, autosomal-dominant gene (CH. The phenotype produced by this gene is valued by many horse breeders, but can be difficult to distinguish from the effect produced by the Cream coat color dilution gene (CR. Three sires and their families segregating for CH were tested by genome scanning with microsatellite markers. The CH gene was mapped within a 6 cM region on horse chromosome 14 (LOD = 11.74 for theta = 0.00. Four candidate genes were identified within the region, namely SPARC [Secreted protein, acidic, cysteine-rich (osteonectin], SLC36A1 (Solute Carrier 36 family A1, SLC36A2 (Solute Carrier 36 family A2, and SLC36A3 (Solute Carrier 36 family A3. SLC36A3 was not expressed in skin tissue and therefore not considered further. The other three genes were sequenced in homozygotes for CH and homozygotes for the absence of the dilution allele (ch. SLC36A1 had a nucleotide substitution in exon 2 for horses with the champagne phenotype, which resulted in a transition from a threonine amino acid to an arginine amino acid (T63R. The association of the single nucleotide polymorphism (SNP with the champagne dilution phenotype was complete, as determined by the presence of the nucleotide variant among all 85 horses with the champagne dilution phenotype and its absence among all 97 horses without the champagne phenotype. This is the first description of a phenotype associated with the SLC36A1 gene.
Boulet, Aren; Vest, Katherine E; Maynard, Margaret K; Gammon, Micah G; Russell, Antoinette C; Mathews, Alexander T; Cole, Shelbie E; Zhu, Xinyu; Phillips, Casey B; Kwong, Jennifer Q; Dodani, Sheel C; Leary, Scot C; Cobine, Paul A
2018-02-09
Copper is required for the activity of cytochrome c oxidase (COX), the terminal electron-accepting complex of the mitochondrial respiratory chain. The likely source of copper used for COX biogenesis is a labile pool found in the mitochondrial matrix. In mammals, the proteins that transport copper across the inner mitochondrial membrane remain unknown. We previously reported that the mitochondrial carrier family protein Pic2 in budding yeast is a copper importer. The closest Pic2 ortholog in mammalian cells is the mitochondrial phosphate carrier SLC25A3. Here, to investigate whether SLC25A3 also transports copper, we manipulated its expression in several murine and human cell lines. SLC25A3 knockdown or deletion consistently resulted in an isolated COX deficiency in these cells, and copper addition to the culture medium suppressed these biochemical defects. Consistent with a conserved role for SLC25A3 in copper transport, its heterologous expression in yeast complemented copper-specific defects observed upon deletion of PIC2 Additionally, assays in Lactococcus lactis and in reconstituted liposomes directly demonstrated that SLC25A3 functions as a copper transporter. Taken together, these data indicate that SLC25A3 can transport copper both in vitro and in vivo . © 2018 by The American Society for Biochemistry and Molecular Biology, Inc.
Meredith, Megan; MacNeil, Allison H.; Trasler, Jacquetta M.; Baltz, Jay M.
2016-01-01
The folate cycle is central to cellular one-carbon metabolism, where folates are carriers of one-carbon units that are critical for synthesis of purines, thymidylate, and S-adenosylmethionine, the universal methyl donor that forms the cellular methyl pool. Although folates are well-known to be important for early embryo and fetal development, their role in oogenesis has not been clearly established. Here, folate transport proteins were detected in developing neonatal ovaries and growing oocyt...
Yang, Yang; Li, Xi; Sun, Qinwei; He, Bin; Jia, Yimin; Cai, Demin; Zhao, Ruqian
2016-10-01
Folate deficiency contributes to impaired adult hippocampal neurogenesis, yet the mechanisms remain unclear. Here we use HT-22 hippocampal neuron cells as model to investigate the effect of folate deprivation (FD) on cell proliferation and apoptosis, and to elucidate the underlying mechanism. FD caused cell cycle arrest at G0/G1 phase and increased the rate of apoptosis, which was associated with disrupted expression of folate transport and methyl transfer genes. FOLR1 and SLC46A1 were (Pmethyl transfer pathway and hypermethylation of IGF-1 gene promoter. Copyright © 2016 Elsevier Ltd. All rights reserved.
DEFF Research Database (Denmark)
Kastrup, I.B.; Worm, J.; Ralfkiaer, E.
2008-01-01
The reduced folate carrier (RFC) is a transmembrane protein that mediates cellular uptake of reduced folates and antifolate drugs, including methotrexate (MTX). Acquired alterations of the RFC gene have been associated with resistance to MTX in cancer cell lines and primary osteosarcomas. Here, w...... with adverse outcome. In DLBCL, genetic and epigenetic alterations of RFC were detected at diagnosis in the absence of a selective MTX pressure, suggesting that these alterations may possibly contribute to the development of lymphoma Udgivelsesdato: 2008/1...
DEFF Research Database (Denmark)
Kastrup, Ingelise Bjerring; Worm, Jesper; Ralfkiaer, Elisabeth
2007-01-01
The reduced folate carrier (RFC) is a transmembrane protein that mediates cellular uptake of reduced folates and antifolate drugs, including methotrexate (MTX). Acquired alterations of the RFC gene have been associated with resistance to MTX in cancer cell lines and primary osteosarcomas. Here, we...
Nicolas, Gaël; Charbonnier, Camille; de Lemos, Roberta Rodrigues; Richard, Anne-Claire; Guillin, Olivier; Wallon, David; Legati, Andrea; Geschwind, Daniel; Coppola, Giovanni; Frebourg, Thierry; Campion, Dominique; de Oliveira, João Ricardo Mendes; Hannequin, Didier
2015-10-01
Primary Familial Brain Calcification (PFBC) is a dominantly inherited cerebral microvascular calcifying disorder with diverse neuropsychiatric expression. Three causative genes have been identified: SLC20A2, PDGFRB and, recently, PDGFB, whose associated phenotype has not yet been extensively studied. We included in the largest published case series of genetically confirmed PFBC, 19 PDGFB (including three new mutations), 24 SLC20A2 (including 4 new mutations), and 14 PDGFRB mutation carriers, from two countries (France and Brazil). We studied clinical features and applied our visual rating scale on all 49 available CT scans. Among the symptomatic mutation carriers (33/57, 58%), the three most frequently observed categories of clinical features were psychiatric signs (72.7%, 76.5%, and 80% for PDGFB, SLC20A2, and PDGFRB, respectively), movement disorders (45.5%, 76.5%, and 40%), and cognitive impairment (54.6%, 64.7%, and 40%). The median age of clinical onset was 31 years, 25% had an early onset (before 18) and 25% a later onset (after 53). Patients with an early clinical onset exhibited mostly isolated psychiatric or cognitive signs, while patients with a later onset exhibited mostly movement disorders, especially in association with other clinical features. CT scans rating allowed identifying four patterns of calcification. The total calcification score was best predicted by the combined effects of gene (SLC20A2 > PDGFB > PDGFRB mutations), sex (male), and (increasing) age, defining three risk classes, which correlated with the four patterns of calcification. These calcification patterns could reflect the natural history of the calcifying process, with distinct risk classes characterized by different age at onset or rate of progression. © 2015 Wiley Periodicals, Inc.
McKay, Jill A; Xie, Long; Harris, Sarah; Wong, Yi K; Ford, Dianne; Mathers, John C
2011-07-01
DNA methylation patterns are tissue specific and may influence tissue-specific gene regulation. Human studies investigating DNA methylation in relation to environmental factors primarily use blood-derived DNA as a surrogate for DNA from target tissues. It is therefore important to know if DNA methylation changes in blood in response to environmental changes reflect those in target tissues. Folate intake can influence DNA methylation, via altered methyl donor supply. Previously, manipulations of maternal folate intake during pregnancy altered the patterns of DNA methylation in offspring but, to our knowledge, the consequences for maternal DNA methylation are unknown. Given the increased requirement for folate during pregnancy, mothers may be susceptible to aberrant DNA methylation due to folate depletion. Female mice were fed folate-adequate (2 mg folic acid/kg diet) or folate-deplete (0.4 mg folic acid/kg diet) diets prior to mating and during pregnancy and lactation. Following weaning, dams were killed and DNA methylation was assessed by pyrosequencing® in blood, liver, and kidney at the Esr1, Igf2 differentially methylated region (DMR)1, Igf2 DMR2, Slc39a4CGI1, and Slc39a4CGI2 loci. We observed tissue-specific differences in methylation at all loci. Folate depletion reduced Igf2 DMR1 and Slc39a4CGI1 methylation across all tissues and altered Igf2 DMR2 methylation in a tissue-specific manner (pmethylation measurements may not always reflect methylation within other tissues. Further measurements of blood-derived and tissue-specific methylation patterns are warranted to understand the complexity of tissue-specific responses to altered nutritional exposure. Copyright © 2011 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Rupasree, Yedluri; Naushad, Shaik Mohammad; Varshaa, Ravi; Mahalakshmi, Govindaraj Swathika; Kumaraswami, Konda; Rajasekhar, Liza; Kutala, Vijay Kumar
2016-02-01
In view of our previous studies showing an independent association of genetic polymorphisms in folate, xenobiotic, and toll-like receptor (TLR) pathways with the risk for systemic lupus erythematosus (SLE), we have developed three statistical models to delineate complex gene-gene interactions between folate, xenobiotic, TLR, and signal transducer and activator of transcription 4 (STAT4) signaling pathways in association with the molecular pathophysiology of SLE. We developed additive, multifactor dimensionality reduction (MDR), and artificial neural network (ANN) models. The additive model, although the simplest, suggested a moderate predictability of 30 polymorphisms of these four pathways (area under the curve [AUC] 0.66). MDR analysis revealed significant gene-gene interactions among glutathione-S-transferase (GST)T1 and STAT4 (rs3821236 and rs7574865) polymorphisms, which account for moderate predictability of SLE. The MDR model for specific auto-antibodies revealed the importance of gene-gene interactions among cytochrome P450, family1, subfamily A, polypeptide 1 (CYP1A1) m1, catechol-O-methyltransferase (COMT) H108L, solute carrier family 19 (folate transporter), member 1 (SLC19A1) G80A, estrogen receptor 1 (ESR1), TLR5, 5-methyltetrahydrofolate-homocysteine methyltransferase reductase (MTRR), thymidylate synthase (TYMS). and STAT4 polymorphisms. The ANN model for disease prediction showed reasonably good predictability of SLE risk with 30 polymorphisms (AUC 0.76). These polymorphisms contribute towards the production of SSB and anti-dsDNA antibodies to the extent of 48 and 40%, respectively, while their contribution for the production of antiRNP, SSA, and anti-cardiolipin antibodies varies between 20 and 30%. The current study highlighted the importance of genetic polymorphisms in folate, xenobiotic, TLR, and STAT4 signaling pathways as moderate predictors of SLE risk and delineates the molecular pathophysiology associated with these single nucleotide
Metformin Is a Substrate and Inhibitor of the Human Thiamine Transporter, THTR-2 (SLC19A3).
Liang, Xiaomin; Chien, Huan-Chieh; Yee, Sook Wah; Giacomini, Marilyn M; Chen, Eugene C; Piao, Meiling; Hao, Jia; Twelves, Jolyn; Lepist, Eve-Irene; Ray, Adrian S; Giacomini, Kathleen M
2015-12-07
The biguanide metformin is widely used as first-line therapy for the treatment of type 2 diabetes. Predominately a cation at physiological pH's, metformin is transported by membrane transporters, which play major roles in its absorption and disposition. Recently, our laboratory demonstrated that organic cation transporter 1, OCT1, the major hepatic uptake transporter for metformin, was also the primary hepatic uptake transporter for thiamine, vitamin B1. In this study, we tested the reverse, i.e., that metformin is a substrate of thiamine transporters (THTR-1, SLC19A2, and THTR-2, SLC19A3). Our study demonstrated that human THTR-2 (hTHTR-2), SLC19A3, which is highly expressed in the small intestine, but not hTHTR-1, transports metformin (Km = 1.15 ± 0.2 mM) and other cationic compounds (MPP(+) and famotidine). The uptake mechanism for hTHTR-2 was pH and electrochemical gradient sensitive. Furthermore, metformin as well as other drugs including phenformin, chloroquine, verapamil, famotidine, and amprolium inhibited hTHTR-2 mediated uptake of both thiamine and metformin. Species differences in the substrate specificity of THTR-2 between human and mouse orthologues were observed. Taken together, our data suggest that hTHTR-2 may play a role in the intestinal absorption and tissue distribution of metformin and other organic cations and that the transporter may be a target for drug-drug and drug-nutrient interactions.
Ulrich, Cornelia M; Rankin, Cathryn; Toriola, Adetunji T; Makar, Karen W; Altug-Teber, Özge; Benedetti, Jacqueline K; Holmes, Rebecca S; Smalley, Stephen R; Blanke, Charles D; Lenz, Heinz-Josef
2014-11-01
Recurrence and toxicity occur commonly among patients with rectal cancer who are treated with 5-fluorouracil (5-FU). The authors hypothesized that genetic variation in folate-metabolizing genes could play a role in interindividual variability. The objective of the current study was to evaluate the associations between genetic variants in folate-metabolizing genes and clinical outcomes among patients with rectal cancer treated with 5-FU. The authors investigated 8 functionally significant polymorphisms in 6 genes (methylenetetrahydrofolate reductase [MTHFR] [C677T, A1298C], SLC19A1 [G80A], SHMT1 [C1420T], dihydrofolate reductase [DHFR] [Del19bp], TS 1494del,and TSER) involved in folate metabolism in 745 patients with TNM stage II or III rectal cancer enrolled in a phase 3 adjuvant clinical trial of 3 regimens of 5-FU and radiotherapy (INT-0144 and SWOG 9304). There were no statistically significant associations noted between polymorphisms in any of the genes and overall survival, disease-free survival (DFS), and toxicity in the overall analyses. Nevertheless, there was a trend toward worse DFS among patients with the variant allele of MTHFR C677T compared with wild-type, particularly in treatment arm 2, in which patients with the MTHFR C677T TT genotype had worse overall survival (hazards ratio, 1.76; 95% confidence interval, 1.06-2.93 [P = .03]) and DFS (hazards ratio, 1.84; 95% confidence interval, 1.12-3.03 [P = .02]) compared with those with homozygous wild-type. In addition, there was a trend toward reduced hematological toxicity among patients with variants of SLC19A1 G80A in treatment arm 1 (P for trend, .06) and reduced esophagitis/stomatitis noted among patients with variants of TSER in treatment arm 3 (P for trend, .06). Genetic variability in folate-metabolizing enzymes was found to be associated only to a limited degree with clinical outcomes among patients with rectal cancer treated with 5-FU. © 2014 American Cancer Society.
Deletion of Slc26a1 and Slc26a7 Delays Enamel Mineralization in Mice
Directory of Open Access Journals (Sweden)
Kaifeng Yin
2017-05-01
Full Text Available Amelogenesis features two major developmental stages—secretory and maturation. During maturation stage, hydroxyapatite deposition and matrix turnover require delicate pH regulatory mechanisms mediated by multiple ion transporters. Several members of the Slc26 gene family (Slc26a1, Slc26a3, Slc26a4, Slc26a6, and Slc26a7, which exhibit bicarbonate transport activities, have been suggested by previous studies to be involved in maturation-stage amelogenesis, especially the key process of pH regulation. However, details regarding the functional role of these genes in enamel formation are yet to be clarified, as none of the separate mutant animal lines demonstrates any discernible enamel defects. Continuing with our previous investigation of Slc26a1−/− and Slc26a7−/− animal models, we generated a double-mutant animal line with the absence of both Slc26a1 and Slc26a7. We showed in the present study that the double-mutant enamel density was significantly lower in the regions that represent late maturation-, maturation- and secretory-stage enamel development in wild-type mandibular incisors. However, the “maturation” and “secretory” enamel microstructures in double-mutant animals resembled those observed in wild-type secretory and/or pre-secretory stages. Elemental composition analysis revealed a lack of mineral deposition and an accumulation of carbon and chloride in double-mutant enamel. Deletion of Slc26a1 and Slc26a7 did not affect the stage-specific morphology of the enamel organ. Finally, compensatory expression of pH regulator genes and ion transporters was detected in maturation-stage enamel organs of double-mutant animals when compared to wild-type. Combined with the findings from our previous study, these data indicate the involvement of SLC26A1and SLC26A7 as key ion transporters in the pH regulatory network during enamel maturation.
ASCT2 (SLC1A5-Deficient Mice Have Normal B-Cell Development, Proliferation, and Antibody Production
Directory of Open Access Journals (Sweden)
Etienne Masle-Farquhar
2017-05-01
Full Text Available SLC1A5 (solute carrier family 1, member 5 is a small neutral amino acid exchanger that is upregulated in rapidly proliferating lymphocytes but also in many primary human cancers. Furthermore, cancer cell lines have been shown to require SLC1A5 for their survival in vitro. One of SLC1A5’s primary substrates is the immunomodulatory amino acid glutamine, which plays an important role in multiple key processes, such as energy supply, macromolecular synthesis, nucleotide biosynthesis, redox homeostasis, and resistance against oxidative stress. These processes are also essential to immune cells, including neutrophils, macrophages, B and T lymphocytes. We show here that mice with a stop codon in Slc1a5 have reduced glutamine uptake in activated lymphocytes and primary fibroblasts. B and T cell populations and maturation in resting mice were not affected by absence of SLC1A5. Antibody production in resting and immunized mice and the germinal center response to immunization were also found to be normal. SLC1A5 has been recently described as a novel target for the treatment of a variety of cancers, and our results indicate that inhibition of SLC1A5 in cancer therapy may be tolerated well by the immune system of cancer patients.
Bronckers, Antonius L J J; Guo, Jing; Zandieh-Doulabi, Behrouz; Bervoets, Theodore J; Lyaruu, Donacian M; Li, Xiangming; Wangemann, Philine; DenBesten, Pamela
2011-12-01
Ameloblasts need to regulate pH during the formation of enamel crystals, a process that generates protons. Solute carrier family 26A member 4 (SLC26A4, or pendrin) is an anion exchanger for chloride, bicarbonate, iodine, and formate. It is expressed in apical membranes of ion-transporting epithelia in kidney, inner ear, and thyroid where it regulates luminal pH and fluid transport. We hypothesized that maturation ameloblasts express SLC26A4 to neutralize acidification of enamel fluid in forming enamel. In rodents, secretory and maturation ameloblasts were immunopositive for SLC26A4. Staining was particularly strong in apical membranes of maturation ameloblasts facing forming enamel. RT-PCR confirmed the presence of mRNA transcripts for Slc26a4 in enamel organs. SLC26A4 immunostaining was also found in mineralizing connective tissues, including odontoblasts, osteoblasts, osteocytes, osteoclasts, bone lining cells, cellular cementoblasts, and cementocytes. However, Slc26a4-null mutant mice had no overt dental phenotype. The presence of SLC26A4 in apical plasma membranes of maturation ameloblasts is consistent with a potential function as a pH regulator. SLC26A4 does not appear to be critical for ameloblast function and is probably compensated by other pH regulators. © 2011 Eur J Oral Sci.
PCFT/SLC46A1 promoter methylation and restoration of gene expression in human leukemia cells
International Nuclear Information System (INIS)
Gonen, Nitzan; Bram, Eran E.; Assaraf, Yehuda G.
2008-01-01
The proton-coupled folate transporter (PCFT/SLC46A1) displays optimal and prominent folate and antifolate transport activity at acidic pH in human carcinoma cells but poor activity in leukemia cells. Consistently herein, human leukemia cell lines expressed poor PCFT transcript levels, whereas various carcinoma cell lines showed substantial PCFT gene expression. We identified a CpG island with high density at nucleotides -200 through +100 and explored its role in PCFT promoter silencing. Leukemia cells with barely detectable PCFT transcripts consistently harbored 85-100% methylation of this CpG island, whereas no methylation was found in carcinoma cells. Treatment with 5-Aza-2'-deoxycytidine which induced demethylation but not with the histone deacetylase inhibitor trichostatin A, restored 50-fold PCFT expression only in leukemia cells. These findings constitute the first demonstration of the dominant epigenetic silencing of the PCFT gene in leukemia cells. The potential translational implications of the restoration of PCFT expression in chemotherapy of leukemia are discussed
Directory of Open Access Journals (Sweden)
Emmanuelle Goubert
2017-05-01
Full Text Available The solute carrier family 25 (SLC25 drives the import of a large diversity of metabolites into mitochondria, a key cellular structure involved in many metabolic functions. Mutations of the mitochondrial glutamate carrier SLC25A22 (also named GC1 have been identified in early epileptic encephalopathy (EEE and migrating partial seizures in infancy (MPSI but the pathophysiological mechanism of GC1 deficiency is still unknown, hampered by the absence of an in vivo model. This carrier is mainly expressed in astrocytes and is the principal gate for glutamate entry into mitochondria. A sufficient supply of energy is essential for the proper function of the brain and mitochondria have a pivotal role in maintaining energy homeostasis. In this work, we wanted to study the consequences of GC1 absence in an in vitro model in order to understand if glutamate catabolism and/or mitochondrial function could be affected. First, short hairpin RNA (shRNA designed to specifically silence GC1 were validated in rat C6 glioma cells. Silencing GC1 in C6 resulted in a reduction of the GC1 mRNA combined with a decrease of the mitochondrial glutamate carrier activity. Then, primary astrocyte cultures were prepared and transfected with shRNA-GC1 or mismatch-RNA (mmRNA constructs using the Neon® Transfection System in order to target a high number of primary astrocytes, more than 64%. Silencing GC1 in primary astrocytes resulted in a reduced nicotinamide adenine dinucleotide (Phosphate (NAD(PH formation upon glutamate stimulation. We also observed that the mitochondrial respiratory chain (MRC was functional after glucose stimulation but not activated by glutamate, resulting in a lower level of cellular adenosine triphosphate (ATP in silenced astrocytes compared to control cells. Moreover, GC1 inactivation resulted in an intracellular glutamate accumulation. Our results show that mitochondrial glutamate transport via GC1 is important in sustaining glutamate homeostasis in
Wolf, Sabine; Janzen, Annette; Vékony, Nicole; Martiné, Ursula; Strand, Dennis; Closs, Ellen I
2002-01-01
Member 4 of human solute carrier family 7 (SLC7A4) exhibits significant sequence homology with the SLC7 subfamily of human cationic amino acid transporters (hCATs) [Sperandeo, Borsani, Incerti, Zollo, Rossi, Zuffardi, Castaldo, Taglialatela, Andria and Sebastio (1998) Genomics 49, 230-236]. It is therefore often referred to as hCAT-4 even though no convincing transport activity has been shown for this protein. We expressed SLC7A4 in Xenopus laevis oocytes, but could not detect any transport a...
Directory of Open Access Journals (Sweden)
Irene Flønes
Full Text Available Biotin-thiamine responsive basal ganglia disease is a severe, but potentially treatable disorder caused by mutations in the SLC19A3 gene. Although the disease is inherited in an autosomal recessive manner, patients with typical phenotypes carrying single heterozygous mutations have been reported. This makes the diagnosis uncertain and may delay treatment.In two siblings with early-onset encephalopathy dystonia and epilepsy, whole-exome sequencing revealed a novel single heterozygous SLC19A3 mutation (c.337T>C. Although Sanger-sequencing and copy-number analysis revealed no other aberrations, RNA-sequencing in brain tissue suggested the second allele was silenced. Whole-genome sequencing resolved the genetic defect by revealing a novel 45,049 bp deletion in the 5'-UTR region of the gene abolishing the promoter. High dose thiamine and biotin therapy was started in the surviving sibling who remains stable. In another patient two novel compound heterozygous SLC19A3 mutations were found. He improved substantially on thiamine and biotin therapy.We show that large genomic deletions occur in the regulatory region of SLC19A3 and should be considered in genetic testing. Moreover, our study highlights the power of whole-genome sequencing as a diagnostic tool for rare genetic disorders across a wide spectrum of mutations including non-coding large genomic rearrangements.
Fernandez, Harvey R; Gadre, Shreyas M; Tan, Mingjun; Graham, Garrett T; Mosaoa, Rami; Ongkeko, Martin S; Kim, Kyu Ah; Riggins, Rebecca B; Parasido, Erika; Petrini, Iacopo; Pacini, Simone; Cheema, Amrita; Varghese, Rency; Ressom, Habtom W; Zhang, Yuwen; Albanese, Christopher; Üren, Aykut; Paige, Mikell; Giaccone, Giuseppe; Avantaggiati, Maria Laura
2018-04-12
Therapy resistance represents a clinical challenge for advanced non-small cell lung cancer (NSCLC), which still remains an incurable disease. There is growing evidence that cancer-initiating or cancer stem cells (CSCs) provide a reservoir of slow-growing dormant populations of cells with tumor-initiating and unlimited self-renewal ability that are left behind by conventional therapies reigniting post-therapy relapse and metastatic dissemination. The metabolic pathways required for the expansion of CSCs are incompletely defined, but their understanding will likely open new therapeutic opportunities. We show here that lung CSCs rely upon oxidative phosphorylation for energy production and survival through the activity of the mitochondrial citrate transporter, SLC25A1. We demonstrate that SLC25A1 plays a key role in maintaining the mitochondrial pool of citrate and redox balance in CSCs, whereas its inhibition leads to reactive oxygen species build-up thereby inhibiting the self-renewal capability of CSCs. Moreover, in different patient-derived tumors, resistance to cisplatin or to epidermal growth factor receptor (EGFR) inhibitor treatment is acquired through SLC25A1-mediated implementation of mitochondrial activity and induction of a stemness phenotype. Hence, a newly identified specific SLC25A1 inhibitor is synthetic lethal with cisplatin or with EGFR inhibitor co-treatment and restores antitumor responses to these agents in vitro and in animal models. These data have potential clinical implications in that they unravel a metabolic vulnerability of drug-resistant lung CSCs, identify a novel SLC25A1 inhibitor and, lastly, provide the first line of evidence that drugs, which block SLC25A1 activity, when employed in combination with selected conventional antitumor agents, lead to a therapeutic benefit.
Directory of Open Access Journals (Sweden)
Raymond E. Lai
2018-04-01
Full Text Available Many drugs, hormones, components of herbal medicines, environmental pesticides and toxins are Solute Carrier family 22 (SLC22 substrates. The last twenty years has seen great progress in determining SLC22 tissue expression profiles, membrane localization, energetics, substrate profiles and biopharmaceutical significance. However, much still remains to be answered in terms of SLC22 family member's roles in ‘normal’ physiology as compared to pathophysiological states, as well as in drug interactions that impact pharmacokinetics, efficacy and toxicity. This review begins with a brief synopsis of SLC22 family discovery, function and tissue expression. Subsequent sections provide examples establishing a role for SLC22 transporters in food-drug, herbal supplement-drug, endogenous substrate-drug and drug–drug interactions. Keywords: Hepatic transport, Nephrotoxicity, Organic anion transporter, Organic cation transporter, Renal transport
Directory of Open Access Journals (Sweden)
Kotnik Barbara Faganel
2017-09-01
Full Text Available We investigated the clinical relevance of SLC 19A1 genetic variability for high dose methotrexate (HD-MTX related toxicities in children and adolescents with acute lymphoblastic leukaemia (ALL and non Hodgkin malignant lymphoma (NHML.
Cryptophane-Folate Biosensor for 129Xe NMR
2014-12-01
normal adult tissue, but as the name implies, this low affinity folate carrier is specific for the physiological form of reduced folic acid, 5- methyl ...yield. Finally, 3 was treated with 1.5 equiv of 6 and N- methyl -1,5,9-triazabicyclo[4.4.0]-decene (MTBD) in dry DMSO to give the folate recognition moiety...Cryptophane- Folate Biosensor for 129Xe NMR Najat S. Khan, Brittany A. Riggle, Garry K. Seward, Yubin Bai, and Ivan J. Dmochowski* Department of
James, S Jill; Melnyk, Stepan; Jernigan, Stefanie; Pavliv, Oleksandra; Trusty, Timothy; Lehman, Sara; Seidel, Lisa; Gaylor, David W; Cleves, Mario A
2010-09-01
The biologic basis of autism is complex and is thought to involve multiple and variable gene-environment interactions. While the logical focus has been on the affected child, the impact of maternal genetics on intrauterine microenvironment during pivotal developmental windows could be substantial. Folate-dependent one carbon metabolism is a highly polymorphic pathway that regulates the distribution of one-carbon derivatives between DNA synthesis (proliferation) and DNA methylation (cell-specific gene expression and differentiation). These pathways are essential to support the programmed shifts between proliferation and differentiation during embryogenesis and organogenesis. Maternal genetic variants that compromise intrauterine availability of folate derivatives could alter fetal cell trajectories and disrupt normal neurodevelopment. In this investigation, the frequency of common functional polymorphisms in the folate pathway was investigated in a large population-based sample of autism case-parent triads. In case-control analysis, a significant increase in the reduced folate carrier (RFC1) G allele frequency was found among case mothers, but not among fathers or affected children. Subsequent log linear analysis of the RFC1 A80G genotype within family trios revealed that the maternal G allele was associated with a significant increase in risk of autism whereas the inherited genotype of the child was not. Further, maternal DNA from the autism mothers was found to be significantly hypomethylated relative to reference control DNA. Metabolic profiling indicated that plasma homocysteine, adenosine, and S-adenosylhomocyteine were significantly elevated among autism mothers consistent with reduced methylation capacity and DNA hypomethylation. Together, these results suggest that the maternal genetics/epigenetics may influence fetal predisposition to autism. (c) 2010 Wiley-Liss, Inc.
Directory of Open Access Journals (Sweden)
Maciej Pronicki
2017-06-01
Full Text Available Biotin-thiamine-responsive basal ganglia disease is a severe form of a rare neurogenetic disorder caused by pathogenic molecular variants in the thiamine transporter gene. Nowadays, a potentially effective treatment is known, therefore the early diagnosis is mandatory. The aim of the paper was to assess the contribution of neuropathological and magnetic resonance imaging (MRI studies to a proper diagnosis. We present the brain study of two Polish patients with SLC19A3 mutations, including (1 an infant with an intriguing “walnut” appearance of the brain autopsied many years before the discovery of the SLC19A3 defect, and (2 a one-year-old patient with clinical features of Leigh syndrome. In patient 2, biotin/thiamine responsiveness was not tested at the time of diagnosis and causal treatment started with one-year delay. The central nervous system lesions found in the patients displayed almost clearly a specific pattern for SLC19A3 defect, as previously proposed in diagnostic criteria. Our study presents a detailed description of neuropathological and MRI findings of both patients. We confirm that the autopsy and/or MRI of the brain is sufficient to qualify a patient with an unknown neuropathological disorder directly for SLC19A3 mutations testing and a prompt trial of specific treatment.
Colon-Moran, Winston; Argaw, Takele; Wilson, Carolyn A
2017-07-01
Porcine endogenous retrovirus-A (PERV-A), a gammaretrovirus, infects human cells in vitro, thus raising the potential risk of cross-species transmission in xenotransplantation. Two members of the solute carrier family 52 (SLC52A1 and SLC52A2) are PERV-A receptors. Site-directed mutagenesis of the cDNA encoding SLC52A1 identified that only one of two putative glycosylation signals is occupied by glycans. In addition, we showed that glycosylation of SLC52A1 is not necessary for PERV-A receptor function. We also identified that at a minimum, three cysteine residues are sufficient for SLC52A1 cell surface expression. Mutation of cysteine at position 365 and either of the two cysteine residues in the C-terminal tail at positions 442 or 446 reduced SLC52A1 surface expression and PERV-A infection suggesting that these residues may contribute to overall structural stability and receptor function. Understanding interactions between PERV-A and its cellular receptor may provide novel strategies to prevent zoonotic infection in the setting of xenotransplantation. Published by Elsevier Inc.
Horie, Tetsuhiro; Fukasawa, Kazuya; Iezaki, Takashi; Park, Gyujin; Onishi, Yuki; Ozaki, Kakeru; Kanayama, Takashi; Hiraiwa, Manami; Kitaguchi, Yuka; Kaneda, Katsuyuki; Hinoi, Eiichi
2018-01-01
The availability of amino acid in the brown adipose tissue (BAT) has been shown to be altered under various conditions; however, little is known about the possible expression and pivotal role of amino acid transporters in BAT under physiological and pathological conditions. The present study comprehensively investigated whether amino acid transporters are regulated by obesogenic conditions in BAT in vivo. Moreover, we investigated the mechanism underlying the regulation of the expression of amino acid transporters by various stressors in brown adipocytes in vitro. The expression of solute carrier family 38 member 1 (Slc38a1; gene encoding sodium-coupled neutral amino acid transporter 1) was preferentially upregulated in the BAT of both genetic and acquired obesity mice in vivo. Moreover, the expression of Slc38a1 was induced by hypoxic stress through hypoxia-inducible factor-1α, which is a master transcription factor of the adaptive response to hypoxic stress, in brown adipocytes in vitro. These results indicate that Slc38a1 is an obesity-associated gene in BAT and a hypoxia-responsive gene in brown adipocytes. © 2017 S. Karger AG, Basel.
Silva, Elena; Rosario, Fredrick J; Powell, Theresa L; Jansson, Thomas
2017-07-01
Folate deficiency has been linked to a wide range of disorders, including cancer, neural tube defects, and fetal growth restriction. Folate regulates cellular function mediated by its involvement in the synthesis of nucleotides, which are needed for DNA synthesis, and its function as a methyl donor, which is critical for DNA methylation. Here we review current data showing that folate sensing by mechanistic target of rapamycin (mTOR) constitutes a novel and distinct pathway by which folate modulates cell functions such as nutrient transport, protein synthesis, and mitochondrial respiration. The mTOR signaling pathway responds to growth factors and changes in nutrient availability to control cell growth, proliferation, and metabolism. mTOR exists in 2 complexes, mTOR complex (mTORC) 1 and mTORC2, which have distinct upstream regulators and downstream targets. Folate deficiency in pregnant mice caused a marked inhibition of mTORC1 and mTORC2 signaling in multiple maternal and fetal tissues, downregulation of placental amino acid transporters, and fetal growth restriction. In addition, folate deficiency in primary human trophoblast (PHT) cells resulted in inhibition of mTORC1 and mTORC2 signaling and decreased the activity of key amino acid transporters. Folate sensing by mTOR in PHT cells is independent of the accumulation of homocysteine and requires the proton-coupled folate transporter (PCFT; solute carrier 46A1). Furthermore, mTORC1 and mTORC2 regulate trophoblast folate uptake by modulating the cell surface expression of folate receptor α and the reduced folate carrier. These findings, which provide a novel link between folate availability and cell function, growth, and proliferation, may have broad biological significance given the critical role of folate in normal cell function and the multiple diseases that have been associated with decreased or excessive folate availability. Low maternal folate concentrations are linked to restricted fetal growth, and we
Hadi, Fazal; Dato, Serena; Carpi, Francesco M; Prontera, Paolo; Crucianelli, Francesca; Renda, Federica; Passarino, Giuseppe; Napolioni, Valerio
2015-06-01
Several recent lines of evidence are proving an important role for dopamine in the aging process and in the determination of life span. Components of the dopaminergic system may represent good candidates for longevity studies. Herein, we tested the possible association of the functional SLC6A3/DAT1 40-bp VNTR with life-expectancy in a healthy population of Central Italy (N = 993) by applying a genetic-demographic approach that takes into account the demographic information and different survival rates between sexes for modeling the survival of specific allele carriers in the population. Male carriers of S*/S* genotype showed a lower survival chance across most of the lifespan respect to the survival of DAT1*L-carriers (P = 0.021). The same analyses gave non-significant results in females. Several studies already reported significant sex differences in dopamine metabolism and its related biological pathways. Thus, we can hypothesize that the SLC6A3/DAT1 40 bp-VNTR may affect life expectancy in a sex-specific way. Moreover, it is conceivable that DAT1 S*/S* carriers, who are prone to assume "risk" type behaviors, may be dropped out of the "healthy" population by a sort of "demographic selection".
SLC37A1 and SLC37A2 are phosphate-linked, glucose-6-phosphate antiporters.
Directory of Open Access Journals (Sweden)
Chi-Jiunn Pan
Full Text Available Blood glucose homeostasis between meals depends upon production of glucose within the endoplasmic reticulum (ER of the liver and kidney by hydrolysis of glucose-6-phosphate (G6P into glucose and phosphate (P(i. This reaction depends on coupling the G6P transporter (G6PT with glucose-6-phosphatase-α (G6Pase-α. Only one G6PT, also known as SLC37A4, has been characterized, and it acts as a P(i-linked G6P antiporter. The other three SLC37 family members, predicted to be sugar-phosphate:P(i exchangers, have not been characterized functionally. Using reconstituted proteoliposomes, we examine the antiporter activity of the other SLC37 members along with their ability to couple with G6Pase-α. G6PT- and mock-proteoliposomes are used as positive and negative controls, respectively. We show that SLC37A1 and SLC37A2 are ER-associated, P(i-linked antiporters, that can transport G6P. Unlike G6PT, neither is sensitive to chlorogenic acid, a competitive inhibitor of physiological ER G6P transport, and neither couples to G6Pase-α. We conclude that three of the four SLC37 family members are functional sugar-phosphate antiporters. However, only G6PT/SLC37A4 matches the characteristics of the physiological ER G6P transporter, suggesting the other SLC37 proteins have roles independent of blood glucose homeostasis.
Yu, Dongke; Zhang, Han; Lionarons, Daniel A; Boyer, James L; Cai, Shi-Ying
2017-04-01
The Na + -dependent taurocholate cotransporting polypeptide (NTCP/SLC10A1) is a hepatocyte-specific solute carrier, which plays an important role in maintaining bile salt homeostasis in mammals. The absence of a hepatic Na + -dependent bile salt transport system in marine skate and rainbow trout raises a question regarding the function of the Slc10a1 gene in these species. Here, we have characterized the Slc10a1 gene in the marine skate, Leucoraja erinacea The transcript of skate Slc10a1 (skSlc10a1) encodes 319 amino acids and shares 46% identity to human NTCP (hNTCP) with similar topology to mammalian NTCP. SkSlc10a1 mRNA was mostly confined to the brain and testes with minimal expression in the liver. An FXR-bile salt reporter assay indicated that skSlc10a1 transported taurocholic acid (TCA) and scymnol sulfate, but not as effectively as hNTCP. An [ 3 H]TCA uptake assay revealed that skSlc10a1 functioned as a Na + -dependent transporter, but with low affinity for TCA ( K m = 92.4 µM) and scymnol sulfate ( K i = 31 µM), compared with hNTCP (TCA, K m = 5.4 µM; Scymnol sulfate, K i = 3.5 µM). In contrast, the bile salt concentration in skate plasma was 2 µM, similar to levels seen in mammals. Interestingly, skSlc10a1 demonstrated transport activity for the neurosteroids dehydroepiandrosterone sulfate and estrone-3-sulfate at physiological concentration, similar to hNTCP. Together, our findings indicate that skSlc10a1 is not a physiological bile salt transporter, providing a molecular explanation for the absence of a hepatic Na + -dependent bile salt uptake system in skate. We speculate that Slc10a1 is a neurosteroid transporter in skate that gained its substrate specificity for bile salts later in vertebrate evolution. Copyright © 2017 the American Physiological Society.
Characterization of SLC transporters in human skin
Directory of Open Access Journals (Sweden)
Marion Alriquet
2015-03-01
Full Text Available Most identified drug transporters belong to the ATP-binding Cassette (ABC and Solute Carrier (SLC families. Recent research indicates that some of these transporters play an important role in the absorption, distribution and excretion of drugs, and are involved in clinically relevant drug-drug interactions for systemic drugs. However, very little is known about the role of drug transporters in human skin in the disposition of topically applied drugs and their involvement in drug-drug interactions. The aim of this work was to compare the expression in human skin (vs human hepatocytes and kidney of SLC transporters included in the EMA guidance as the most likely clinical sources of drug interactions. The expression of SLC transporters in human tissues was analyzed by quantitative RT-PCR. Modulation of SLC47A1 and SLC47A2 (MATE1 and MATE2 expression was analyzed after treatment of human skin in organ-culture with rifampicin and UV irradiation. The expression of SLCO2B1 (OATPB, SLCO3A1 (OATPD, SLCO4A1 (OATPE, SLC47A1 and SLC47A2 (MATE1 and MATE2 was detected in human skin, OATPE and MATE1 being the most expressed. OATPE is about 70 times more expressed in human skin than in human hepatocytes. Moreover, the expression of SLC47A1 and SLC47A2 was down-regulated after treatment with rifampicin or after exposure to UV light. The present findings demonstrate that SLCO4A1 (OATPE and SLC47A1 (MATE1 are highly expressed in human skin and suggest the involvement of SLC transporters in the disposition of topically applied drugs.
DEFF Research Database (Denmark)
Benghezal, Mohammed; Roubaty, Carole; Veepuri, Vijayanath
2007-01-01
Phosphatidic acid is the intermediate, from which all glycerophospholipids are synthesized. In yeast, it is generated from lysophosphatidic acid, which is acylated by Slc1p, an sn-2-specific, acyl-coenzyme A-dependent 1-acylglycerol-3-phosphate O-acyltransferase. Deletion of SLC1 is not lethal...
Brons, A-K; Henthorn, P S; Raj, K; Fitzgerald, C A; Liu, J; Sewell, A C; Giger, U
2013-01-01
Cystinuria, one of the first recognized inborn errors of metabolism, has been reported in many dog breeds. To determine urinary cystine concentrations, inheritance, and mutations in the SLC3A1 and SLC7A9 genes associated with cystinuria in 3 breeds. Mixed and purebred Labrador Retrievers (n = 6), Australian Cattle Dogs (6), Miniature Pinschers (4), and 1 mixed breed dog with cystine urolithiasis, relatives and control dogs. Urinary cystinuria and aminoaciduria was assessed and exons of the SLC3A1 and SLC7A9 genes were sequenced from genomic DNA. In each breed, male and female dogs, independent of neuter status, were found to form calculi. A frameshift mutation in SLC3A1 (c.350delG) resulting in a premature stop codon was identified in autosomal-recessive (AR) cystinuria in Labrador Retrievers and mixed breed dogs. A 6 bp deletion (c.1095_1100del) removing 2 threonines in SLC3A1 was found in autosomal-dominant (AD) cystinuria with a more severe phenotype in homozygous than in heterozygous Australian Cattle Dogs. A missense mutation in SLC7A9 (c.964G>A) was discovered in AD cystinuria in Miniature Pinschers with only heterozygous affected dogs observed to date. Breed-specific DNA tests were developed, but the prevalence of each mutation remains unknown. These studies describe the first AD inheritance and the first putative SLC7A9 mutation to cause cystinuria in dogs and expand our understanding of this phenotypically and genetically heterogeneous disease, leading to a new classification system for canine cystinuria and better therapeutic management and genetic control in these breeds. Copyright © 2013 by the American College of Veterinary Internal Medicine.
Upregulation of the Creatine Transporter Slc6A8 by Klotho
Directory of Open Access Journals (Sweden)
Ahmad Almilaji
2014-11-01
Full Text Available Background/Aims: The transmembrane Klotho protein contributes to inhibition of 1,25(OH2D3 formation. The extracellular domain of Klotho protein could function as an enzyme with e.g. β-glucuronidase activity, be cleaved off and be released into blood and cerebrospinal fluid. Klotho regulates several cellular transporters. Klotho protein deficiency accelerates the appearance of age related disorders including neurodegeneration and muscle wasting and eventually leads to premature death. The main site of Klotho protein expression is the kidney. Klotho protein is also appreciably expressed in other tissues including chorioid plexus. The present study explored the effect of Klotho protein on the creatine transporter CreaT (Slc6A8, which participates in the maintenance of neuronal function and survival. Methods: To this end cRNA encoding Slc6A8 was injected into Xenopus oocytes with and without additional injection of cRNA encoding Klotho protein. Creatine transporter CreaT (Slc6A8 activity was estimated from creatine induced current determined by two-electrode voltage-clamp. Results: Coexpression of Klotho protein significantly increased creatine-induced current in Slc6A8 expressing Xenopus oocytes. Coexpression of Klotho protein delayed the decline of creatine induced current following inhibition of carrier insertion into the cell membrane by brefeldin A (5 µM. The increase of creatine induced current by coexpression of Klotho protein in Slc6A8 expressing Xenopus oocytes was reversed by β-glucuronidase inhibitor (DSAL. Similarly, treatment of Slc6A8 expressing Xenopus oocytes with recombinant human alpha Klotho protein significantly increased creatine induced current. Conclusion: Klotho protein up-regulates the activity of creatine transporter CreaT (Slc6A8 by stabilizing the carrier protein in the cell membrane, an effect requiring β-glucuronidase activity of Klotho protein.
Directory of Open Access Journals (Sweden)
Amy J Osborne
Full Text Available The New Zealand sea lion (NZSL, Phocarctos hookeri is a Threatened marine mammal with a restricted distribution and a small, declining, population size. The species is susceptible to bacterial pathogens, having suffered three mass mortality events since 1998. Understanding the genetic factors linked to this susceptibility is important in mitigating population decline. The gene solute carrier family 11 member a1 (Slc11a1 plays an important role in mammalian resistance or susceptibility to a wide range of bacterial pathogens. At present, Slc11a1 has not been characterised in many taxa, and despite its known roles in mediating the effects of infectious disease agents, has not been examined as a candidate gene in susceptibility or resistance in any wild population of conservation concern. Here we examine components of Slc11a1 in NZSLs and identify: i a polymorphic nucleotide in the promoter region; ii putative shared transcription factor binding motifs between canids and NZSLs; and iii a conserved polymorphic microsatellite in the first intron of Slc11a1, which together suggest conservation of Slc11a1 gene structure in otariids. At the promoter polymorphism, we demonstrate a shift away from normal allele frequency distributions and an increased likelihood of death from infectious causes with one allelic variant. While this increased likelihood is not statistically significant, lack of significance is potentially due to the complexity of genetic susceptibility to disease in wild populations. Our preliminary data highlight the potential significance of this gene in disease resistance in wild populations; further exploration of Slc11a1 will aid the understanding of susceptibility to infection in mammalian species of conservation significance.
Zhang, Zhengyu; Tachikawa, Masanori; Uchida, Yasuo; Terasaki, Tetsuya
2018-03-05
Although arachnoid mater epithelial cells form the blood-arachnoid barrier (BAB), acting as a blood-CSF interface, it has been generally considered that the BAB is impermeable to water-soluble substances and plays a largely passive role. Here, we aimed to clarify the function of transporters at the BAB in regulating CSF clearance of water-soluble organic anion drugs based on quantitative targeted absolute proteomics (QTAP) and in vivo analyses. Protein expression levels of 61 molecules, including 19 ATP-binding-cassette (ABC) transporters and 32 solute-carrier (SLC) transporters, were measured in plasma membrane fraction of rat leptomeninges using QTAP. Thirty-three proteins were detected; others were under the quantification limits. Expression levels of multidrug resistance protein 1 (Mdr1a/P-gp/Abcb1a) and breast cancer resistance protein (Bcrp/Abcg2) were 16.6 and 3.27 fmol/μg protein (51.9- and 9.82-fold greater than in choroid plexus, respectively). Among those organic anion transporters detected only at leptomeninges, not choroid plexus, organic anion transporter 1 (oat1/Slc22a6) showed the greatest expression (2.73 fmol/μg protein). On the other hand, the protein expression level of oat3 at leptomeninges was 6.65 fmol/μg protein, and the difference from choroid plexus was within two-fold. To investigate oat1's role, we injected para-aminohippuric acid (PAH) with or without oat1 inhibitors into cisterna magna (to minimize the contribution of choroid plexus function) of rats. A bulk flow marker, FITC-inulin, was not taken up from CSF up to 15 min, whereas uptake clearance of PAH was 26.5 μL/min. PAH uptake was completely blocked by 3 mM cephalothin (inhibits both oat1 and oat3), while 17% of PAH uptake was inhibited by 0.2 mM cephalothin (selectively inhibits oat3). These results indicate that oat1 and oat3 at the BAB provide a distinct clearance pathway of organic anion drugs from CSF independently of choroid plexus.
Wani, Nissar Ahmad; Kaur, Jyotdeep
2011-03-01
We studied the effect of chronic ethanol ingestion on folate transport across the colonic apical membranes (CAM) in rats. Male Wistar rats were fed 1 g/kg body weight/day ethanol (20%) solution orally for 3 months and folate transport was studied in the isolated colon apical membrane vesicles. The folate transport was found to be carrier mediated, saturable, with pH optima at 5.0. Chronic ethanol ingestion reduced the folate transport across the CAM by decreasing the affinity of transporters (high Km) for the substrate and by decreasing the number of transporter molecules (low Vmax) on the colon luminal surface. The decreased transport activity at the CAM was associated with down-regulation of the proton-coupled folate transporter (PCFT) and the reduced folate carrier (RFC) which resulted in decreased PCFT and RFC protein levels in the colon of rats fed alcohol chronically. Moreover, the PCFT and the RFC were found to be distributed in detergent insoluble fraction of the CAM in rats. Floatation experiments on Optiprep density gradients demonstrated the association of the PCFT and the RFC protein with lipid rafts (LR). Chronic alcoholism decreased the PCFT and the RFC protein levels in the CAM LR in accordance with the decreased synthesis. Hence, we propose that downregulation in the expression of the PCFT and the RFC in colon results in reduced levels of these transporters in colon apical membrane LR as a mechanism of folate malabsorption during chronic alcoholism. Copyright © 2010 Wiley-Liss, Inc.
Bröer, Angelika; Juelich, Torsten; Vanslambrouck, Jessica M; Tietze, Nadine; Solomon, Peter S; Holst, Jeff; Bailey, Charles G; Rasko, John E J; Bröer, Stefan
2011-07-29
Amino acid uptake in the intestine and kidney is mediated by a variety of amino acid transporters. To understand the role of epithelial neutral amino acid uptake in whole body homeostasis, we analyzed mice lacking the apical broad-spectrum neutral (0) amino acid transporter B(0)AT1 (Slc6a19). A general neutral aminoaciduria was observed similar to human Hartnup disorder which is caused by mutations in SLC6A19. Na(+)-dependent uptake of neutral amino acids into the intestine and renal brush-border membrane vesicles was abolished. No compensatory increase of peptide transport or other neutral amino acid transporters was detected. Mice lacking B(0)AT1 showed a reduced body weight. When adapted to a standard 20% protein diet, B(0)AT1-deficient mice lost body weight rapidly on diets containing 6 or 40% protein. Secretion of insulin in response to food ingestion after fasting was blunted. In the intestine, amino acid signaling to the mammalian target of rapamycin (mTOR) pathway was reduced, whereas the GCN2/ATF4 stress response pathway was activated, indicating amino acid deprivation in epithelial cells. The results demonstrate that epithelial amino acid uptake is essential for optimal growth and body weight regulation.
Directory of Open Access Journals (Sweden)
MyPhuong T Le
Full Text Available In the past few decades, consumption of added sugars has increased dramatically. Studies have linked high sugar intake with increased risk for a number of diseases. Importantly, fructose, a component of sugar, has been linked with the development of features of metabolic syndrome. This study determined if single nucleotide polymorphisms in genes involved in fructose transport (solute carrier family 2 facilitated glucose transporter, member 2 (SLC2A2 and solute carrier family 2 facilitated glucose/fructose transporter, member 5 (SLC2A5 and metabolism (ketohexokinase (KHK affect inter-individual variability in metabolic phenotypes, such as increased serum uric acid levels.The influence of SLC2A2, SLC2A5, and KHK SNPs on metabolic phenotypes was tested in 237 European Americans and 167 African Americans from the Pharmacogenomic Evaluation and Antihypertensive Responses (PEAR study. Using baseline untreated fasting data, associations were considered significant if p≤0.005. These SNPs were then evaluated for potential replication (p≤0.05 using data from the Genetic Epidemiology of Responses to Antihypertensives (GERA studies.SLC2A5 rs5438 was associated with an increase in serum uric acid in European American males. However, we were unable to replicate the association in GERA. The minor allele of SLC2A2 rs8192675 showed an association with lower high-density lipoproteins in European Americans (A/A: 51.0 mg/dL, A/G: 47.0 mg/dL, G/G: 41.5 mg/dL, p = 0.0034 in PEAR. The association between rs8192675 and lower high-density lipoproteins was replicated in the combined European American GERA study samples (A/A: 47.6 mg/dL, A/G: 48.6 mg/dL, G/G: 41.9 mg/dL, p = 0.0315.The association between SLC2A2 rs8192675 and high-density lipoproteins suggests the polymorphism may play a role in influencing high-density lipoproteins and thus metabolic risk of cardiovascular disease.
Structure of Bor1 supports an elevator transport mechanism for SLC4 anion exchangers.
Thurtle-Schmidt, Bryan H; Stroud, Robert M
2016-09-20
Boron is essential for plant growth because of its incorporation into plant cell walls; however, in excess it is toxic to plants. Boron transport and homeostasis in plants is regulated in part by the borate efflux transporter Bor1, a member of the solute carrier (SLC) 4 transporter family with homology to the human bicarbonate transporter Band 3. Here, we present the 4.1-Å resolution crystal structure of Arabidopsis thaliana Bor1. The structure displays a dimeric architecture in which dimerization is mediated by centralized Gate domains. Comparisons with a structure of Band 3 in an outward-open state reveal that the Core domains of Bor1 have rotated inwards to achieve an occluded state. Further structural comparisons with UapA, a xanthine transporter from the nucleobase-ascorbate transporter family, show that the downward pivoting of the Core domains relative to the Gate domains may access an inward-open state. These results suggest that the SLC4, SLC26, and nucleobase-ascorbate transporter families all share an elevator transport mechanism in which alternating access is provided by Core domains that carry substrates across a membrane.
A novel variant in the SLC12A1 gene in two families with antenatal Bartter syndrome.
Breinbjerg, Anders; Siggaard Rittig, Charlotte; Gregersen, Niels; Rittig, Søren; Hvarregaard Christensen, Jane
2017-01-01
Bartter syndrome is an autosomal-recessive inherited disease in which patients present with hypokalaemia and metabolic alkalosis. We present two apparently nonrelated cases with antenatal Bartter syndrome type I, due to a novel variant in the SLC12A1 gene encoding the bumetanide-sensitive sodium-(potassium)-chloride cotransporter 2 in the thick ascending limb of the loop of Henle. Blood samples were received from the two cases and 19 of their relatives, and deoxyribonucleic acid was extracted. The coding regions of the SLC12A1 gene were amplified using polymerase chain reaction, followed by bidirectional direct deoxyribonucleic acid sequencing. Each affected child in the two families was homozygous for a novel inherited variant in the SLC12A1gene, c.1614T>A. The variant predicts a change from a tyrosine codon to a stop codon (p.Tyr538Ter). The two cases presented antenatally and at six months of age, respectively. The two cases were homozygous for the same variant in the SLC12A1 gene, but presented clinically at different ages. This could eventually be explained by the presence of other gene variants or environmental factors modifying the phenotypes. The phenotypes of the patients were similar to other patients with antenatal Bartter syndrome. ©2016 Foundation Acta Paediatrica. Published by John Wiley & Sons Ltd.
Mozzillo, Enza; Melis, Daniela; Falco, Mariateresa; Fattorusso, Valentina; Taurisano, Roberta; Flanagan, Sarah E; Ellard, Sian; Franzese, Adriana
2013-08-01
Thiamine responsive megaloblastic anemia (TRMA) is an autosomal recessive disease caused by loss of function mutations in the SLC19A2 gene. TRMA is characterized by anemia, deafness, and diabetes. In some cases, optic atrophy or more rarely retinitis pigmentosa is noted. We now report two sisters, the eldest of which presented to a different hospital during childhood with sensorineural deafness, which was treated with a hearing prosthesis, insulin requiring diabetes, retinitis pigmentosa, optic atrophy, and macrocytic anemia. These features initially suggested a clinical diagnosis of Wolfram syndrome (WS). Therapy with thiamine was initiated which resulted in the resolution of the anemia. The younger sister, who was affected with sensorineural deafness, was referred to our hospital for non-autoimmune diabetes. She was found to have macrocytosis and ocular abnormalities. Because a diagnosis of TRMA was suspected, therapy with insulin and thiamine was started. Sequencing analysis of the SLC19A2 gene identified a compound heterozygous mutation p.Y81X/p.L457X (c.242insA/c.1370delT) in both sisters. Non-autoimmune diabetes associated with deafness and macrocytosis, without anemia, suggests a diagnosis of TRMA. Patients clinically diagnosed with WS with anemia and/or macrocytosis should be reevaluated for TRMA. © 2012 John Wiley & Sons A/S.
Majd, Homa; King, Martin S; Smith, Anthony C; Kunji, Edmund R S
2018-01-01
Missense mutations of the human mitochondrial citrate carrier, encoded by the SLC25A1 gene, lead to an autosomal recessive neurometabolic disorder characterised by neonatal-onset encephalopathy with severe muscular weakness, intractable seizures, respiratory distress, and lack of psychomotor development, often resulting in early death. Here, we have measured the effect of all twelve known pathogenic mutations on the transport activity. The results show that nine mutations abolish transport of citrate completely, whereas the other three reduce the transport rate by >70%, indicating that impaired citrate transport is the most likely primary cause of the disease. Some mutations may be detrimental to the structure of the carrier, whereas others may impair key functional elements, such as the substrate binding site and the salt bridge network on the matrix side of the carrier. To understand the consequences of impaired citrate transport on metabolism, the substrate specificity was also determined, showing that the human citrate carrier predominantly transports citrate, isocitrate, cis-aconitate, phosphoenolpyruvate and malate. Although D-2- and L-2 hydroxyglutaric aciduria is a metabolic hallmark of the disease, it is unlikely that the citrate carrier plays a significant role in the removal of hydroxyglutarate from the cytosol for oxidation to oxoglutarate in the mitochondrial matrix. In contrast, computer simulations of central metabolism predict that the export of citrate from the mitochondrion cannot be fully compensated by other pathways, restricting the cytosolic production of acetyl-CoA that is required for the synthesis of lipids, sterols, dolichols and ubiquinone, which in turn explains the severe disease phenotypes. Copyright © 2017. Published by Elsevier B.V.
Zhang, Dandan; Li, Zhenli; Xu, Xiaohong; Zhou, Dan; Tang, Shunli; Yin, Xiaoyang; Xu, Fangying; Li, Hui; Zhou, Yuan; Zhu, Tao; Deng, Hong; Zhang, Shuai; Huang, Qiong; Wang, Jing; Yin, Wei; Zhu, Yimin; Lai, Maode
2017-10-26
Copy number variations (CNVs) contribute to the development of colorectal cancer (CRC). We conducted a two-stage association study to identify CNV risk loci for CRC. We performed a gene-based rare CNV study on 694 sporadic CRC and 1641 controls using Illumina Human-OmniExpress-12v1.0 BeadChips, and further replicated in 934 CRC cases and 2680 controls for risk CNVs by using TaqMan Copy Number Assay. Tumor buddings, cancer cells in the center of primary tumor and normal intestinal epithelial cells were captured using laser capture microdissection (LCM) and were assayed using AffymetrixGeneChip® Human Genome U133 Plus 2.0 Array. In addition, The Cancer Genome Atlas (TCGA) and Gene Expression Omnibus data were assessed for the effects of risk CNVs. We found that germline deletions affecting the last six exons of SLC18A1 significantly associated with CRC with a combined P value of 6.4 × 10-5 by a two-stage analysis. Both in TCGA CRC RNA seq dataset and GDS4382, SLC18A1 was significantly down regulated in CRC tissues than in paired normal tissues (N = 32 and 17 pairs, P = 0.004 and 0.009, respectively). In LCM samples, similar observations were obtained that the expression levels of SLC18A1 in the tumor buddings, cancer cells in the center of primary tumor, and stroma of both tumor budding and cancer cells were lower than normal intestinal epithelial and stromal cells (fold change = 0.17-0.62, 0.12-0.57 and 0.37-0.68, respectively). In summary, the germline deletions at SLC18A1 contributed to the development of CRC. The role of SLC18A1 required further exploration. © The Author 2017. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.
Steinhauser, Chelsie B; Landers, McKinsey; Myatt, Louise; Burghardt, Robert C; Vallet, Jeffrey L; Bazer, Fuller W; Johnson, Greg A
2016-11-01
The fetal fluids and uterine flushings of pigs contain higher concentrations of fructose than glucose, but fructose is not detected in maternal blood. Fructose can be synthesized from glucose via enzymes of the polyol pathway, aldose reductase (AKR1B1) and sorbitol dehydrogenase (SORD), transported across cell membranes by solute carriers SLC2A5 and SLC2A8, and converted to fructose-1-phosphate by ketohexokinase (KHK). SLC2A8, SLC2A5, AKR1B1, SORD, and KHK mRNAs and proteins were analyzed using quantitative PCR and immunohistochemistry or in situ hybridization in endometria and placentae of cyclic and pregnant gilts, cyclic gilts injected with estrogen, and ovariectomized gilts injected with progesterone. Progesterone up-regulated SLC2A8 protein in uterine luminal (LE) and glandular epithelia during the peri-implantation period, and expression became exclusively placental, chorion and blood vessels, after Day 30. P4 up-regulated SLC2A5 mRNA in uterine LE and glandular epithelia after implantation, and the chorion expressed SLC2A5 between Days 30 and 85. AKR1B1 and SORD proteins localized to uterine LE during the peri-implantation period, but expression switched to chorion by Day 20 and was maintained through Day 85. Uterine expression of AKR1B1 mRNA was down-regulated by estrogen. KHK protein localized to trophectoderm/chorion throughout gestation. These results provide evidence that components for the conversion of glucose to fructose and for fructose transport are present at the uterine-placental interface of pigs. The shift in expression from LE to chorion during pregnancy suggests free-floating conceptuses are supported by fructose synthesized by the uterus, but after implantation, the chorion becomes self-sufficient for fructose synthesis and transport. © 2016 by the Society for the Study of Reproduction, Inc.
Chen, Xueqin; Wang, Ying; Chen, Xiaohua; Cheng, Kailiang; Li, Jiaoyuan; Lou, Jiao; Ke, Juntao; Yang, Yang; Gong, Yajie; Zhu, Ying; Wang, Li; Zhong, Rong
2016-10-01
The Na/taurocholate cotransporter NTCP (encoded by SLC10A1) was identified as a cellular entry receptor for the human hepatitis B virus (HBV), advancing our understanding of the molecular mechanism of HBV infection. An alternative hypothesis was put forward that regulatory variants in SLC10A1 might play an important role in HBV susceptibility by potentially influencing expression levels of NTCP. The three regulatory SNPs (rs8011311, rs7154439, rs111409076) were genotyped in 1023 HBV-persistent carriers, 735 subjects with HBV natural clearance and 732 HBV marker-negative subjects in a Han Chinese population. Real-time reverse transcription PCR analysis and luciferase assays have been performed to dissect the potential functionality. In logistic regression analysis, when subjects with HBV natural clearance were compared with HBV marker-negative subjects, no significant associations with the risk of HBV infection were observed for any of the three SNPs after adjusting for age, sex, smoking status and alcohol consumption (P>0.05). Similar negative results were also found for the three SNPs when HBV-persistent carriers were compared with HBV marker-negative subjects. Likewise, no significant associations with the risk of HBV clearance were observed when HBV-persistent carriers were compared with subjects with HBV natural clearance (P>0.05). Quantitative RT/PCR showed no significant difference in NTCP expression levels in normal liver tissue amongst individuals with different rs111409076 genotypes (P=0.317 for the general linear model). Moreover, no evident effect of the SLC10A1 rs111409076 AACA/- polymorphism on transcriptional activity was found by luciferase assay in either HepG2 (P=0.161) or Hep3b (P=0.129) cell lines. The present study indicated that the common variants in the regulatory region of SLC10A1 may not influence the expression of NTCP at the level of transcriptional regulation, and ultimately may not be associated with HBV susceptibility in this Chinese
Exonal deletion of SLC24A4 causes hypomaturation amelogenesis imperfecta.
Seymen, F; Lee, K-E; Tran Le, C G; Yildirim, M; Gencay, K; Lee, Z H; Kim, J-W
2014-04-01
Amelogenesis imperfecta is a heterogeneous group of genetic conditions affecting enamel formation. Recently, mutations in solute carrier family 24 member 4 (SLC24A4) have been identified to cause autosomal recessive hypomaturation amelogenesis imperfecta. We recruited a consanguineous family with hypomaturation amelogenesis imperfecta with generalized brown discoloration. Sequencing of the candidate genes identified a 10-kb deletion, including exons 15, 16, and most of the last exon of the SLC24A4 gene. Interestingly, this deletion was caused by homologous recombination between two 354-bp-long homologous sequences located in intron 14 and the 3' UTR. This is the first report of exonal deletion in SLC24A4 providing confirmatory evidence that the function of SLC24A4 in calcium transport has a crucial role in the maturation stage of amelogenesis.
DEFF Research Database (Denmark)
Broberg, M. L.; Holm, Rasmus Koldborg; Tønsberg, H
2012-01-01
BACKGROUND AND PURPOSE: Intestinal absorption via membrane transporters may determine the pharmacokinetics of drug compounds. The hypothesis is that oral absorption of gaboxadol (4, 5, 6, 7-tetrahydroisoxazolo [5,4-c] pyridine-3-ol) in rats occurs via the proton-coupled amino acid transporter, r....... The intestinal expression of rSlc36a1 mRNA was measured by quantitative real-time PCR (q-RT-PCR). Furthermore, the hPAT1-/rPAT1-mediated transport of gaboxadol or L-proline was studied in hPAT1-expressing X. laevis oocytes, Caco-2 cell monolayers and excised segments of the rat intestine. KEY RESULTS......). The in vitro carrier-mediated uptake rate of L-proline in the excised intestinal segments was highest in the mid jejunum and low in the colon. The in vitro uptake and the in vivo absorption correlated with the expression of rSlc36a1 mRNA along the rat intestine. CONCLUSIONS AND IMPLICATIONS: The results...
Loss-of-function mutations in SLC30A8 protect against type 2 diabetes.
Flannick, Jason; Thorleifsson, Gudmar; Beer, Nicola L; Jacobs, Suzanne B R; Grarup, Niels; Burtt, Noël P; Mahajan, Anubha; Fuchsberger, Christian; Atzmon, Gil; Benediktsson, Rafn; Blangero, John; Bowden, Don W; Brandslund, Ivan; Brosnan, Julia; Burslem, Frank; Chambers, John; Cho, Yoon Shin; Christensen, Cramer; Douglas, Desirée A; Duggirala, Ravindranath; Dymek, Zachary; Farjoun, Yossi; Fennell, Timothy; Fontanillas, Pierre; Forsén, Tom; Gabriel, Stacey; Glaser, Benjamin; Gudbjartsson, Daniel F; Hanis, Craig; Hansen, Torben; Hreidarsson, Astradur B; Hveem, Kristian; Ingelsson, Erik; Isomaa, Bo; Johansson, Stefan; Jørgensen, Torben; Jørgensen, Marit Eika; Kathiresan, Sekar; Kong, Augustine; Kooner, Jaspal; Kravic, Jasmina; Laakso, Markku; Lee, Jong-Young; Lind, Lars; Lindgren, Cecilia M; Linneberg, Allan; Masson, Gisli; Meitinger, Thomas; Mohlke, Karen L; Molven, Anders; Morris, Andrew P; Potluri, Shobha; Rauramaa, Rainer; Ribel-Madsen, Rasmus; Richard, Ann-Marie; Rolph, Tim; Salomaa, Veikko; Segrè, Ayellet V; Skärstrand, Hanna; Steinthorsdottir, Valgerdur; Stringham, Heather M; Sulem, Patrick; Tai, E Shyong; Teo, Yik Ying; Teslovich, Tanya; Thorsteinsdottir, Unnur; Trimmer, Jeff K; Tuomi, Tiinamaija; Tuomilehto, Jaakko; Vaziri-Sani, Fariba; Voight, Benjamin F; Wilson, James G; Boehnke, Michael; McCarthy, Mark I; Njølstad, Pål R; Pedersen, Oluf; Groop, Leif; Cox, David R; Stefansson, Kari; Altshuler, David
2014-04-01
Loss-of-function mutations protective against human disease provide in vivo validation of therapeutic targets, but none have yet been described for type 2 diabetes (T2D). Through sequencing or genotyping of ~150,000 individuals across 5 ancestry groups, we identified 12 rare protein-truncating variants in SLC30A8, which encodes an islet zinc transporter (ZnT8) and harbors a common variant (p.Trp325Arg) associated with T2D risk and glucose and proinsulin levels. Collectively, carriers of protein-truncating variants had 65% reduced T2D risk (P = 1.7 × 10(-6)), and non-diabetic Icelandic carriers of a frameshift variant (p.Lys34Serfs*50) demonstrated reduced glucose levels (-0.17 s.d., P = 4.6 × 10(-4)). The two most common protein-truncating variants (p.Arg138* and p.Lys34Serfs*50) individually associate with T2D protection and encode unstable ZnT8 proteins. Previous functional study of SLC30A8 suggested that reduced zinc transport increases T2D risk, and phenotypic heterogeneity was observed in mouse Slc30a8 knockouts. In contrast, loss-of-function mutations in humans provide strong evidence that SLC30A8 haploinsufficiency protects against T2D, suggesting ZnT8 inhibition as a therapeutic strategy in T2D prevention.
A novel folate-modified self-microemulsifying drug delivery system of curcumin for colon targeting
Directory of Open Access Journals (Sweden)
Zhang L
2012-01-01
Full Text Available Lin Zhang1*, Weiwei Zhu2*, Chunfen Yang1, Hongxia Guo1, Aihua Yu1, Jianbo Ji3, Yan Gao1, Min Sun1, Guangxi Zhai11Department of Pharmaceutical Engineering, College of Pharmacy, Shandong University, Jinan; 2Department of Pharmacy, Yantai Yuhuangding Hospital, Yantai; 3Department of Pharmacology, College of Pharmacy, Shandong University, Jinan, China*These authors contributed equally to the workBackground: The objective of this study was to prepare, characterize, and evaluate a folate-modified self-microemulsifying drug delivery system (FSMEDDS with the aim to improve the solubility of curcumin and its delivery to the colon, facilitating endocytosis of FSMEDDS mediated by folate receptors on colon cancer cells.Methods: Ternary phase diagrams were constructed in order to obtain the most efficient self-emulsification region, and the formulation of curcumin-loaded SMEDDS was optimized by a simplex lattice experiment design. Then, three lipophilic folate derivatives (folate-polyethylene glycol-distearoylphosphatidylethanolamine, folate-polyethylene glycol-cholesteryl hemisuccinate, and folate-polyethylene glycol-cholesterol used as a surfactant were added to curcumin-loaded SMEDDS formulations. An in situ colon perfusion method in rats was used to optimize the formulation of FSMEDDS. Curcumin-loaded FSMEDDS was then filled into colon-targeted capsules and the in vitro release was investigated. Cytotoxicity studies and cellular uptake studies was used in this research.Results: The optimal formulation of FSMEDDS obtained with the established in situ colon perfusion method in rats was comprised of 57.5% Cremophor® EL, 32.5% Transcutol® HP, 10% Capryol™ 90, and a small amount of folate-polyethylene glycol-cholesteryl hemisuccinate (the weight ratio of folate materials to Cremophor EL was 1:100. The in vitro release results indicated that the obtained formulation of curcumin could reach the colon efficiently and release the drug immediately. Cellular
Directory of Open Access Journals (Sweden)
Onkar Singh
Full Text Available OBJECTIVE: This study aimed to explore the influence of SLC22A1, PXR, ABCG2, ABCB1 and CYP3A5 3 genetic polymorphisms on imatinib mesylate (IM pharmacokinetics in Asian patients with chronic myeloid leukemia (CML. PATIENTS AND METHODS: Healthy subjects belonging to three Asian populations (Chinese, Malay, Indian; n = 70 each and CML patients (n = 38 were enrolled in a prospective pharmacogenetics study. Imatinib trough (C(0h and clearance (CL were determined in the patients at steady state. Haplowalk method was applied to infer the haplotypes and generalized linear model (GLM to estimate haplotypic effects on IM pharmacokinetics. Association of haplotype copy numbers with IM pharmacokinetics was defined by Mann-Whitney U test. RESULTS: Global haplotype score statistics revealed a SLC22A1 sub-haplotypic region encompassing three polymorphisms (rs3798168, rs628031 and IVS7+850C>T, to be significantly associated with IM clearance (p = 0.013. Haplotype-specific GLM estimated that the haplotypes AGT and CGC were both associated with 22% decrease in clearance compared to CAC [CL (10(-2 L/hr/mg: CAC vs AGT: 4.03 vs 3.16, p = 0.017; CAC vs CGC: 4.03 vs 3.15, p = 0.017]. Patients harboring 2 copies of AGT or CGC haplotypes had 33.4% lower clearance and 50% higher C(0h than patients carrying 0 or 1 copy [CL (10(-2 L/hr/mg: 2.19 vs 3.29, p = 0.026; C(0h (10(-6 1/ml: 4.76 vs 3.17, p = 0.013, respectively]. Further subgroup analysis revealed SLC22A1 and ABCB1 haplotypic combinations to be significantly associated with clearance and C(0h (p = 0.002 and 0.009, respectively. CONCLUSION: This exploratory study suggests that SLC22A1-ABCB1 haplotypes may influence IM pharmacokinetics in Asian CML patients.
OCD candidate gene SLC1A1/EAAT3 impacts basal ganglia-mediated activity and stereotypic behavior.
Zike, Isaac D; Chohan, Muhammad O; Kopelman, Jared M; Krasnow, Emily N; Flicker, Daniel; Nautiyal, Katherine M; Bubser, Michael; Kellendonk, Christoph; Jones, Carrie K; Stanwood, Gregg; Tanaka, Kenji Fransis; Moore, Holly; Ahmari, Susanne E; Veenstra-VanderWeele, Jeremy
2017-05-30
Obsessive-compulsive disorder (OCD) is a chronic, disabling condition with inadequate treatment options that leave most patients with substantial residual symptoms. Structural, neurochemical, and behavioral findings point to a significant role for basal ganglia circuits and for the glutamate system in OCD. Genetic linkage and association studies in OCD point to SLC1A1 , which encodes the neuronal glutamate/aspartate/cysteine transporter excitatory amino acid transporter 3 (EAAT3)/excitatory amino acid transporter 1 (EAAC1). However, no previous studies have investigated EAAT3 in basal ganglia circuits or in relation to OCD-related behavior. Here, we report a model of Slc1a1 loss based on an excisable STOP cassette that yields successful ablation of EAAT3 expression and function. Using amphetamine as a probe, we found that EAAT3 loss prevents expected increases in ( i ) locomotor activity, ( ii ) stereotypy, and ( iii ) immediate early gene induction in the dorsal striatum following amphetamine administration. Further, Slc1a1 -STOP mice showed diminished grooming in an SKF-38393 challenge experiment, a pharmacologic model of OCD-like grooming behavior. This reduced grooming is accompanied by reduced dopamine D 1 receptor binding in the dorsal striatum of Slc1a1 -STOP mice. Slc1a1 -STOP mice also exhibit reduced extracellular dopamine concentrations in the dorsal striatum both at baseline and following amphetamine challenge. Viral-mediated restoration of Slc1a1 /EAAT3 expression in the midbrain but not in the striatum results in partial rescue of amphetamine-induced locomotion and stereotypy in Slc1a1 -STOP mice, consistent with an impact of EAAT3 loss on presynaptic dopaminergic function. Collectively, these findings indicate that the most consistently associated OCD candidate gene impacts basal ganglia-dependent repetitive behaviors.
Directory of Open Access Journals (Sweden)
Maria José Franco Brochado
2016-02-01
Full Text Available Natural resistance-associated macrophage protein 1/solute carrier family 11 member 1 gene (Nramp1/Slc11a1 is a gene that controls the susceptibility of inbred mice to intracellular pathogens. Polymorphisms in the human Slc11a1/Nramp1 gene have been associated with host susceptibility to leprosy. This study has evaluated nine polymorphisms of the Slc11a1/Nramp1 gene [(GTn, 274C/T, 469+14G/C, 577-18G/A, 823C/T, 1029 C/T, 1465-85G/A, 1703G/A, and 1729+55del4] in 86 leprosy patients (67 and 19 patients had the multibacillary and the paucibacillary clinical forms of the disease, respectively, and 239 healthy controls matched by age, gender, and ethnicity. The frequency of allele 2 of the (GTn polymorphism was higher in leprosy patients [p = 0.04, odds ratio (OR = 1.49], whereas the frequency of allele 3 was higher in the control group (p = 0.03; OR = 0.66. Patients carrying the 274T allele (p = 0.04; OR = 1.49 and TT homozygosis (p = 0.02; OR = 2.46, such as the 469+14C allele (p = 0.03; OR = 1.53 of the 274C/T and 469+14G/C polymorphisms, respectively, were more frequent in the leprosy group. The leprosy and control groups had similar frequency of the 577-18G/A, 823C/T, 1029C/T, 1465-85G/A, 1703G/A, and 1729+55del4 polymorphisms. The 274C/T polymorphism in exon 3 and the 469+14G/C polymorphism in intron 4 were associated with susceptibility to leprosy, while the allele 2 and 3 of the (GTn polymorphism in the promoter region were associated with susceptibility and protection to leprosy, respectively.
[Folates and fetal programming: role of epigenetics and epigenomics].
Guéant, Jean-Louis; Daval, Jean-Luc; Vert, Paul; Nicolas, Jean-Pierre
2012-12-01
Folates are needed for synthesis of methionine, the precursor of S-adenosyl methionine (SAM). They play therefore a key role in nutrition and epigenomics by fluxing monocarbons towards synthesis or methylation of DNA and RNA, and methylation of gene transregulators, respectively. The deficiency produces intrauterine growth retardation and birth dejects. Folate deficiency deregulates epigenomic mechanisms related to fetal programming through decreased cellular availability of SAM. Epigenetic mechanisms of folate deficiency are illustrated by inheritance of coat colour of agouti mice model and altered expression of Igf2/H19 imprinting genes. Dietary exposure to fumonisin FB1 acts synergistically with folate deficiency on alterations of heterochromatin assembly. Deficiency in folate and vitamin B12 produces impaired fatty acid oxidation in liver and heart through imbalanced methylation and acetylation of PGC1-alpha and decreased expression of SIRT1, and long-lasting cognitive disabilities through impaired hippocampal cell proliferation, differentiation and plasticity and atrophy of hippocampal CA1. Deciphering these mechanisms will help understand the discordances between experimental models and population studies on folate supplementation.
Folate overproduction in Lactobacillus plantarum WCFS1 causes methotrexate resistance
Wegkamp, H.B.A.; Vos, de W.M.; Smid, E.J.
2009-01-01
Folate overproduction can serve as a mode of resistance against the folate antagonist methotrexate in Lactobacillus plantarum WCFS1. When compared with a wild-type control strain, an engineered high folate-producing strain was found to be insensitive to methotrexate. The growth rate and the viable
Quantifying the relative contributions of different solute carriers to aggregate substrate transport
Taslimifar, Mehdi; Oparija, Lalita; Verrey, Francois; Kurtcuoglu, Vartan; Olgac, Ufuk; Makrides, Victoria
2017-01-01
Determining the contributions of different transporter species to overall cellular transport is fundamental for understanding the physiological regulation of solutes. We calculated the relative activities of Solute Carrier (SLC) transporters using the Michaelis-Menten equation and global fitting to estimate the normalized maximum transport rate for each transporter (Vmax). Data input were the normalized measured uptake of the essential neutral amino acid (AA) L-leucine (Leu) from concentration-dependence assays performed using Xenopus laevis oocytes. Our methodology was verified by calculating Leu and L-phenylalanine (Phe) data in the presence of competitive substrates and/or inhibitors. Among 9 potentially expressed endogenous X. laevis oocyte Leu transporter species, activities of only the uniporters SLC43A2/LAT4 (and/or SLC43A1/LAT3) and the sodium symporter SLC6A19/B0AT1 were required to account for total uptake. Furthermore, Leu and Phe uptake by heterologously expressed human SLC6A14/ATB0,+ and SLC43A2/LAT4 was accurately calculated. This versatile systems biology approach is useful for analyses where the kinetics of each active protein species can be represented by the Hill equation. Furthermore, its applicable even in the absence of protein expression data. It could potentially be applied, for example, to quantify drug transporter activities in target cells to improve specificity. PMID:28091567
Physiological responses to folate overproduction in Lactobacillus plantarum WCFS1
Directory of Open Access Journals (Sweden)
de Vos Ric CH
2010-12-01
Full Text Available Abstract Background Using a functional genomics approach we addressed the impact of folate overproduction on metabolite formation and gene expression in Lactobacillus plantarum WCFS1. We focused specifically on the mechanism that reduces growth rates in folate-overproducing cells. Results Metabolite formation and gene expression were determined in a folate-overproducing- and wild-type strain. Differential metabolomics analysis of intracellular metabolite pools indicated that the pool sizes of 18 metabolites differed significantly between these strains. The gene expression profile was determined for both strains in pH-regulated chemostat culture and batch culture. Apart from the expected overexpression of the 6 genes of the folate gene cluster, no other genes were found to be differentially expressed both in continuous and batch cultures. The discrepancy between the low transcriptome and metabolome response and the 25% growth rate reduction of the folate overproducing strain was further investigated. Folate production per se could be ruled out as a contributing factor, since in the absence of folate production the growth rate of the overproducer was also reduced by 25%. The higher metabolic costs for DNA and RNA biosynthesis in the folate overproducing strain were also ruled out. However, it was demonstrated that folate-specific mRNAs and proteins constitute 8% and 4% of the total mRNA and protein pool, respectively. Conclusion Folate overproduction leads to very little change in metabolite levels or overall transcript profile, while at the same time the growth rate is reduced drastically. This shows that Lactobacillus plantarum WCFS1 is unable to respond to this growth rate reduction, most likely because the growth-related transcripts and proteins are diluted by the enormous amount of gratuitous folate-related transcripts and proteins.
SLC6A1 Mutation and Ketogenic Diet in Epilepsy With Myoclonic-Atonic Seizures.
Palmer, Samantha; Towne, Meghan C; Pearl, Phillip L; Pelletier, Renee C; Genetti, Casie A; Shi, Jiahai; Beggs, Alan H; Agrawal, Pankaj B; Brownstein, Catherine A
2016-11-01
Epilepsy with myoclonic-atonic seizures, also known as myoclonic-astatic epilepsy or Doose syndrome, has been recently linked to variants in the SLC6A1 gene. Epilepsy with myoclonic-atonic seizures is often refractory to antiepileptic drugs, and the ketogenic diet is known for treating medically intractable seizures, although the mechanism of action is largely unknown. We report a novel SLC6A1 variant in a patient with epilepsy with myoclonic-atonic seizures, analyze its effects, and suggest a mechanism of action for the ketogenic diet. We describe a ten-year-old girl with epilepsy with myoclonic-atonic seizures and a de novo SLC6A1 mutation who responded well to the ketogenic diet. She carried a c.491G>A mutation predicted to cause p.Cys164Tyr amino acid change, which was identified using whole exome sequencing and confirmed by Sanger sequencing. High-resolution structural modeling was used to analyze the likely effects of the mutation. The SLC6A1 gene encodes a transporter that removes gamma-aminobutyric acid from the synaptic cleft. Mutations in SLC6A1 are known to disrupt the gamma-aminobutyric acid transporter protein 1, affecting gamma-aminobutyric acid levels and causing seizures. The p.Cys164Tyr variant found in our study has not been previously reported, expanding on the variants linked to epilepsy with myoclonic-atonic seizures. A 10-year-old girl with a novel SLC6A1 mutation and epilepsy with myoclonic-atonic seizures had an excellent clinical response to the ketogenic diet. An effect of the diet on gamma-aminobutyric acid reuptake mediated by gamma-aminobutyric acid transporter protein 1 is suggested. A personalized approach to epilepsy with myoclonic-atonic seizures patients carrying SLC6A1 mutation and a relationship between epilepsy with myoclonic-atonic seizures due to SLC6A1 mutations, GABAergic drugs, and the ketogenic diet warrants further exploration. Copyright © 2016 Elsevier Inc. All rights reserved.
DEFF Research Database (Denmark)
Husemoen, LL; Toft, U.; Fenger, Mogens
2006-01-01
BACKGROUND: Deficiency of folate has been associated with several disorders characterized by enhanced activation of the cellular immune system (non-allergic th1 type immune response). Whether folate status is also associated with atopic disease (allergic th2 type immune response) is unknown. We....../CT individuals [odds ratio 1.76, 95% confidence interval (95% CI) 1.19-2.60]. Additionally, gene-diet interaction effects were identified. Dietary markers were negatively associated with risk of atopy in persons with the TT genotype. Total homocysteine was not related to atopy (odds ratio per 5 mumol/l = 1.......12, 95% CI 0.98-1.29). CONCLUSIONS: The results suggest that an impaired folate metabolism may be causally related to the development of atopy....
Chloride Anions Regulate Kinetics but Not Voltage-Sensor Qmax of the Solute Carrier SLC26a5.
Santos-Sacchi, Joseph; Song, Lei
2016-06-07
In general, SLC26 solute carriers serve to transport a variety of anions across biological membranes. However, prestin (SLC26a5) has evolved, now serving as a motor protein in outer hair cells (OHCs) of the mammalian inner ear and is required for cochlear amplification, a mechanical feedback mechanism to boost auditory performance. The mechanical activity of the OHC imparted by prestin is driven by voltage and controlled by anions, chiefly intracellular chloride. Current opinion is that chloride anions control the Boltzmann characteristics of the voltage sensor responsible for prestin activity, including Qmax, the total sensor charge moved within the membrane, and Vh, a measure of prestin's operating voltage range. Here, we show that standard narrow-band, high-frequency admittance measures of nonlinear capacitance (NLC), an alternate representation of the sensor's charge-voltage (Q-V) relationship, is inadequate for assessment of Qmax, an estimate of the sum of unitary charges contributed by all voltage sensors within the membrane. Prestin's slow transition rates and chloride-binding kinetics adversely influence these estimates, contributing to the prevalent concept that intracellular chloride level controls the quantity of sensor charge moved. By monitoring charge movement across frequency, using measures of multifrequency admittance, expanded displacement current integration, and OHC electromotility, we find that chloride influences prestin kinetics, thereby controlling charge magnitude at any particular frequency of interrogation. Importantly, however, this chloride dependence vanishes as frequency decreases, with Qmax asymptoting at a level irrespective of the chloride level. These data indicate that prestin activity is significantly low-pass in the frequency domain, with important implications for cochlear amplification. We also note that the occurrence of voltage-dependent charge movements in other SLC26 family members may be hidden by inadequate
Wade, Kaitlin H; Forouhi, Nita G; Cook, Derek G; Johnson, Paul; McConnachie, Alex; Morris, Richard W; Rodriguez, Santiago; Ye, Zheng; Ebrahim, Shah; Padmanabhan, Sandosh; Watt, Graham; Bruckdorfer, K Richard; Wareham, Nick J; Whincup, Peter H; Chanock, Stephen
2014-01-01
Background: Observational studies showed that circulating l-ascorbic acid (vitamin C) is inversely associated with cardiometabolic traits. However, these studies were susceptible to confounding and reverse causation.\\ud \\ud Objectives:We assessed the relation between l-ascorbic acid and 10 cardiometabolic traits by using a single nucleotide polymorphism in the solute carrier family 23 member 1 (SLC23A1) gene (rs33972313) associated with circulating l-ascorbic acid concentrations. The observed...
The renal urate transporter SLC17A1 locus: confirmation of association with gout.
Hollis-Moffatt, Jade E; Phipps-Green, Amanda J; Chapman, Brett; Jones, Gregory T; van Rij, Andre; Gow, Peter J; Harrison, Andrew A; Highton, John; Jones, Peter B; Montgomery, Grant W; Stamp, Lisa K; Dalbeth, Nicola; Merriman, Tony R
2012-04-27
Two major gout-causing genes have been identified, the urate transport genes SLC2A9 and ABCG2. Variation within the SLC17A1 locus, which encodes sodium-dependent phosphate transporter 1, a renal transporter of uric acid, has also been associated with serum urate concentration. However, evidence for association with gout is equivocal. We investigated the association of the SLC17A1 locus with gout in New Zealand sample sets. Five variants (rs1165196, rs1183201, rs9358890, rs3799344, rs12664474) were genotyped across a New Zealand sample set totaling 971 cases and 1,742 controls. Cases were ascertained according to American Rheumatism Association criteria. Two population groups were studied: Caucasian and Polynesian. At rs1183201 (SLC17A1), evidence for association with gout was observed in both the Caucasian (odds ratio (OR) = 0.67, P = 3.0 × 10-6) and Polynesian (OR = 0.74, P = 3.0 × 10-3) groups. Meta-analysis confirmed association of rs1183201 with gout at a genome-wide level of significance (OR = 0.70, P = 3.0 × 10-8). Haplotype analysis suggested the presence of a common protective haplotype. We confirm the SLC17A1 locus as the third associated with gout at a genome-wide level of significance.
S113R mutation in SLC33A1 leads to neurodegeneration and augmented BMP signaling in a mouse model
Directory of Open Access Journals (Sweden)
Pingting Liu
2017-01-01
Full Text Available The S113R mutation (c.339T>G (MIM #603690.0001 in SLC33A1 (MIM #603690, an ER membrane acetyl-CoA transporter, has been previously identified in individuals with hereditary spastic paraplegia type 42 (SPG42; MIM #612539. SLC33A1 has also been shown to inhibit the bone morphogenetic protein (BMP signaling pathway in zebrafish. To better understand the function of SLC33A1, we generated and characterized Slc33a1S113R knock-in mice. Homozygous Slc33a1S113R mutant mice were embryonic lethal, whereas heterozygous Slc33a1 mutant mice (Slc33a1wt/mut exhibited behavioral abnormalities and central neurodegeneration, which is consistent with hereditary spastic paraplegia (HSP phenotypes. Importantly, we found an upregulation of BMP signaling in the nervous system and mouse embryonic fibroblasts of Slc33a1wt/mut mice. Using a sciatic nerve crush injury model in vivo and dorsal root ganglion (DRG culture in vitro we showed that injury-induced axonal regeneration in Slc33a1wt/mut mice was accelerated and mediated by upregulated BMP signaling. Exogenous addition of BMP signaling antagonist, noggin, could efficiently alleviate the accelerated injury-induced axonal regrowth. These results indicate that SLC33A1 can negatively regulate BMP signaling in mice, further supporting the notion that upregulation of BMP signaling is a common mechanism of a subset of hereditary spastic paraplegias.
LENUS (Irish Health Repository)
Murphy, Therese M
2012-02-01
BACKGROUND: Suicidal behaviour is known to aggregate in families. Patients with psychiatric disorders are at higher risk for suicide attempts (SA), however protective and risk genetic variants for suicide appear to be independent of underlying psychiatric disorders. Here we investigate genetic variants in genes important for neurobiological pathways linked to suicidal behaviour and\\/or associated endophenotypes, for association with SA among patients with co-existing psychiatric illness. Selected gene-gene and gene-environment interactions were also tested. METHODS: DNA was obtained from bloods of 159 patients (76 suicide attempters and 83 non-attempters), who were profiled for DSM-IV Axis I psychiatric diagnosis. Twenty-eight single nucleotide polymorphisms (SNPs) from 18 candidate genes (COMT, 5-HT2A, 5-HT1A, 5-HTR1B, TPH1, MAO-A, TPH2, DBH, CNR1, BDNF, ABCG1, GABRA5, GABRG2, GABRB2, SLC1A2, SLC1A3, NTRK2, CRHR1) were genotyped. Genotyping was performed by KBioscience. Tests of association between genetic variants and SA were conducted using Chi squared and Armitage Trend tests. Binary logistical regression analyses were performed to evaluate the contribution of individual genetic variants to the prediction of SA, and to examine SNPs for potential gene-gene and gene-environment interactions. RESULTS: Our analysis identified 4 SNPs (rs4755404, rs2269272, rs6296 and rs1659400), which showed evidence of association with SA compared to a non-attempter control group. We provide evidence of a 3-locus gene-gene interaction, and a putative gene-environment interaction, whereby genetic variation at the NTRK2 locus may moderate the risk associated with history of childhood abuse. CONCLUSION: Preliminary findings suggest that allelic variability in SLC1A2\\/3, 5-HTR1B and NTRK2 may be relevant to the underlying diathesis for suicidal acts.
Langston Suen, Wai-Leung; Chau, Ying
2014-04-01
We aim to quantify the effect of size and degree of folate loading of folate-decorated polymeric nanoparticles (NPs) on the kinetics of cellular uptake and the selection of endocytic pathways in retinal pigment epithelium (RPE) cells. In this study, methoxy-poly(ethylene glycol)-b-polycaprolactone (mPEG-b-PCL) and folate-functionalized PEG-b-PCL were synthesized for assembling into nanoparticles with sizes ranging from 50 nm to 250 nm. These nanoparticles were internalized into ARPE-19 (human RPE cell line) via receptor-mediated endocytosis. A two-step endocytosis process mathematical model was adopted to quantify binding affinity and uptake kinetics of nanoparticles in RPE cells in uptake and inhibition studies. Nanoparticles with 100% folate loading have highest binding affinity and uptake rate in RPE cells. Maximum uptake rate (Vmax) of nanoparticles increased as the size of particles decreased from 250 nm to 50 nm. Endocytic pathway study was studied by using chlorpromazine and methyl-β-cyclodextran (MβCD), which are clathrin- and caveolae-mediated endocytosis inhibitors, respectively. Both chlorpromazine and MβCD inhibited the uptake of folate-decorated nanoparticles. Inhibition constant (Ki) and maximum uptake rate (Vmax) revealed that 50 nm and 120 nm folate-decorated nanoparticles were found to be internalized via both clathrin- and caveolae-mediated endocytosis. The 250 nm folate-decorated nanoparticles, however, were only internalized via caveolae-mediated pathway. Increased uptake rate of folate-decorated NPs into RPE cells is observed with increasing degree of folate modification. These NPs utilize both clathrin- and caveolae-mediated receptor-mediated endocytosis pathways to enter RPE cells upon size variation. The 50 nm NPs are internalized the fastest, with clathrin-mediated endocytosis as the preferred route. Uptake of 250 nm particles is the slowest and is dominated by caveolae-mediated endocytosis. © 2013 Royal Pharmaceutical
Developmental expression of SLC26A4 (Pendrin) during amelogenesis in developing rodent teeth
Bronckers, Antonius LJJ; Guo, Jing; Zandieh-Doulabi, Behrouz; Bervoets, Theodore J; Lyaruu, Donacian M.; Li, Xiangming; Wangemann, Philine; DenBesten, Pamela
2012-01-01
Ameloblasts need to regulate pH during formation of enamel crystals, a process that generates protons. Solute carrier family 26A member 4 (SLC26A4, or pendrin) is an anion exchanger for chloride, bicarbonate, iodine and formate. It is expressed in apical membranes of ion-transporting epithelia in kidney, inner ear and thyroid where it regulates luminal pH and fluid transport. We hypothesized that maturation ameloblasts express SLC26A4 to neutralize acidification of enamel fluid in forming enamel. In rodents, secretory and maturation ameloblasts were immunopositive for SLC26A4. Staining was particularly strong in apical membranes of maturation ameloblasts facing forming enamel. RT-PCR confirmed the presence of mRNA transcripts for Slc26a4 in enamel organs. SLC26A4 immunostaining was also found in mineralizing connective tissues including odontoblasts, osteoblasts, osteocytes, osteoclasts, bone lining cells, cellular cementoblasts and cementocytes. However, Slc26a4-null mutant mice had no overt dental phenotype. The presence of SLC26A4 in apical plasma membranes of maturation ameloblasts is consistent with a potential function as pH regulator. SLC26A4 does not appear critical for ameloblast functioning and is likely compensated by other pH regulators. PMID:22243245
Plasma Folate and Vitamin B12 Levels in Patients with Hepatocellular Carcinoma
Directory of Open Access Journals (Sweden)
Lian-Hua Cui
2016-06-01
Full Text Available Folate and vitamin B12 involved in the one-carbon metabolism may play a key role in carcinogenesis and progression of hepatocellular carcinoma (HCC through influencing DNA integrity. The purpose of this study is to evaluate the association of plasma folate and vitamin B12 levels with HCC in a case-control study on 312 HCC patients and 325 cancer-free controls. Plasma concentrations of folate and vitamin B12 in all the subjects were measured by electrochemiluminescence immunoassay. Meanwhile, the information of HCC patients’ clinical characteristics including tumor-node-metastasis (TNM stage, tumor size and tumor markers were collected. The patients of HCC had significantly lower folate levels than those of controls; there was no significant difference in the mean of plasma vitamin B12 levels. We also observed an inverse association between the levels of plasma folate and HCC: the adjusted odds ratios (OR (95% confidence intervals (CI of HCC from the highest to lowest quartile of folate were 0.30 (0.15–0.60, 0.33 (0.17–0.65, and 0.19 (0.09–0.38. Compared to the subjects in the lowest quartile of plasma vitamin B12, only the subjects in the highest quartile of vitamin B12 exhibited a significant positive relationship with HCC, the adjusted OR was 2.01 (95% CI, 1.02–3.98. HCC patients with Stage III and IV or bigger tumor size had lower folate and higher vitamin B12 levels. There was no significant difference in the mean plasma folate levels of the HCC cases in tumor markers status (AFP, CEA and CA19-9 levels, whereas patients with higher CEA or CA19-9 levels retained significantly more plasma vitamin B12 than those with normal-CEA or CA19-9 level. In conclusion, plasma folate and vitamin B12 levels could be associated with HCC, and might be used as predictors of clinical characteristics of HCC patients. However, further prospective studies are essential to confirm the observed results.
Validation of Folate-Enriched Eggs as a Functional Food for Improving Folate Intake in Consumers
Directory of Open Access Journals (Sweden)
Leslie Altic
2016-11-01
Full Text Available Functional foods enriched with folate may be beneficial as a means of optimizing folate status in consumers. We recently developed novel eggs enriched with folate through folic acid supplementation of the hen’s feed, but their potential to influence consumer folate status is unknown because the natural folate forms incorporated into the eggs may not necessarily be retained during storage and cooking. This study aimed to determine the stability of natural folates in folate-enriched eggs under typical conditions of storage and cooking. Total folate was determined by microbiological assay following tri-enzyme treatment in folate-enriched eggs and un-enriched (barn and free-range on the day they were laid, after storage (up to 27 days and after using four typical cooking methods (boiling, poaching, frying, scrambling for different durations. On the day of laying, the folate content of enriched eggs was found to be significantly higher than that of un-enriched barn or free-range eggs (mean ± SD; 123.2 ± 12.4 vs. 41.2 ± 2.8 vs. 65.6 ± 18.5 µg/100 g; p < 0.001. Storage at refrigerator and room temperature for periods up to the Best Before date resulted in no significant losses to the folate content of folate-enriched eggs. Furthermore, folate in enriched eggs remained stable when cooked by four typical methods for periods up to the maximum cooking time (e.g., 135 ± 22.5, 133.9 ± 23.0 and 132.5 ± 35.1; p = 0.73, for raw, scrambled for 50 s and scrambled for 2 min, respectively. Thus, natural folates in folate-enriched eggs remain highly stable with little or no losses following storage and cooking. These findings are important because they demonstrate the feasibility of introducing folate-enriched eggs into the diet of consumers as functional foods with enriched folate content. Further studies will confirm their effectiveness in optimizing the biomarker folate status of consumers.
Directory of Open Access Journals (Sweden)
Venkata Saroja eVoruganti
2013-12-01
Full Text Available Increased serum uric acid (SUA is a risk factor for gout and renal and cardiovascular disease. The purpose of this study was to identify genetic factors that affect the variation in SUA in 632 Mexican Americans participants of the San Antonio Family Heart Study (SAFHS. A genome-wide association analysis was performed using the Illumina Human Hap 550K single nucleotide polymorphism (SNP microarray. We used a linear regression-based association test under an additive model of allelic effect, while accounting for non-independence among family members via a kinship variance component. All analyses were performed in the software package SOLAR. SNPs rs6832439, rs13131257 and rs737267 in solute carrier protein 2 family, member 9 (SLC2A9 were associated with SUA at genome-wide significance (p <1.3×10-7. The minor alleles of these SNPs had frequencies of 36.2%, 36.2%, and 38.2 %, respectively, and were associated with decreasing SUA levels. All of these SNPs were located in introns 3-7 of SLC2A9, the location of the previously reported associations in European populations. When analyzed for association with cardiovascular-renal disease risk factors, conditional on SLC2A9 SNPs strongly associated with SUA, significant associations were found for SLC2A9 SNPs with BMI, body weight and waist circumference (p < 1.4 x 10-3 and suggestive associations with albumin-creatinine ratio and total antioxidant status. The SLC2A9 gene encodes an urate transporter that has considerable influence on variation in SUA. In addition to the primary association locus, suggestive evidence (p<1.9×10-6 for joint linkage/association was found at a previously-reported urate quantitative trait locus (Logarithm of odds score = 3.6 on 3p26.3. In summary, our GWAS extends and confirms the association of SLC2A9 with SUA for the first time in a Mexican American cohort and also shows for the first time its association with cardiovascular-renal disease risk factors.
The role of SLC2A1 in early onset and childhood absence epilepsies
DEFF Research Database (Denmark)
Muhle, Hiltrud; Helbig, Ingo; Frøslev, Tobias Guldberg
2013-01-01
Early Onset Absence Epilepsy constitutes an Idiopathic Generalized Epilepsy with absences starting before the age of four years. Mutations in SLC2A1, encoding the glucose transporter, account for approximately 10% of EOAE cases. The role of SLC2A1 mutations in absence epilepsies with a later onset...
Physiological responses to folate overproduction in Lactobacillus plantarum WCFS1
Wegkamp, A.; Mars, A.E.; Faijes, M.; Molenaar, D.; Vos, de R.C.H.; Klaus, M.J.; Hanson, A.D.; Vos, de W.M.; Smid, E.J.
2010-01-01
Background Using a functional genomics approach we addressed the impact of folate overproduction on metabolite formation and gene expression in Lactobacillus plantarum WCFS1. We focused specifically on the mechanism that reduces growth rates in folate-overproducing cells. Results Metabolite
Positive selection in the SLC11A1 gene in the family Equidae
DEFF Research Database (Denmark)
Bayerova, Zuzana; Janova, Eva; Matiasovic, Jan
2016-01-01
Immunity-related genes are a suitable model for studying effects of selection at the genomic level. Some of them are highly conserved due to functional constraints and purifying selection, while others are variable and change quickly to cope with the variation of pathogens. The SLC11A1 gene encodes...... a transporter protein mediating antimicrobial activity of macrophages. Little is known about the patterns of selection shaping this gene during evolution. Although it is a typical evolutionarily conserved gene, functionally important polymorphisms associated with various diseases were identified in humans...... and other species. We analyzed the genomic organization, genetic variation, and evolution of the SLC11A1 gene in the family Equidae to identify patterns of selection within this important gene. Nucleotide SLC11A1 sequences were shown to be highly conserved in ten equid species, with more than 97 % sequence...
Mutations in the GABA Transporter SLC6A1 Cause Epilepsy with Myoclonic-Atonic Seizures
DEFF Research Database (Denmark)
Carvill, Gemma L; McMahon, Jacinta M; Schneider, Amy
2015-01-01
GAT-1, encoded by SLC6A1, is one of the major gamma-aminobutyric acid (GABA) transporters in the brain and is responsible for re-uptake of GABA from the synapse. In this study, targeted resequencing of 644 individuals with epileptic encephalopathies led to the identification of six SLC6A1 mutatio...
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC405 (Link to dictyBase) - - - Contig-U11279-1 | Contig-U16243-1 SLC4...05P (Link to Original site) SLC405F 536 SLC405Z 439 SLC405P 975 - - Show SLC405 Library SL (Link to library) Clone ID SLC4...79-1 | Contig-U16243-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-A/SLC4...05Q.Seq.d/ Representative seq. ID SLC405P (Link to Original site) Representative DNA sequence >SLC405 (SLC4...05Q) /CSM/SL/SLC4-A/SLC405Q.Seq.d/ ATAACTAATAAAATGTCATTCAATTCAAGAATTGAAACTATTTCTCGCCACTTAAGCACT
Uchida, Yasuo; Ito, Katsuaki; Ohtsuki, Sumio; Kubo, Yoshiyuki; Suzuki, Takashi; Terasaki, Tetsuya
2015-07-01
The purpose of this study was to clarify the expression of Na(+) -dependent multivitamin transporter (SLC5A6/SMVT) and its contribution to the supply of biotin and pantothenic acid to the human brain via the blood-brain barrier. DNA microarray and immunohistochemical analyses confirmed that SLC5A6 is expressed in microvessels of human brain. The absolute expression levels of SLC5A6 protein in isolated human and monkey brain microvessels were 1.19 and 0.597 fmol/μg protein, respectively, as determined by a quantitative targeted absolute proteomics technique. Using an antibody-free method established by Kubo et al. (2015), we found that SLC5A6 was preferentially localized at the luminal membrane of brain capillary endothelium. Knock-down analysis using SLC5A6 siRNA showed that SLC5A6 accounts for 88.7% and 98.6% of total [(3) H]biotin and [(3) H]pantothenic acid uptakes, respectively, by human cerebral microvascular endothelial cell line hCMEC/D3. SLC5A6-mediated transport in hCMEC/D3 was markedly inhibited not only by biotin and pantothenic acid, but also by prostaglandin E2, lipoic acid, docosahexaenoic acid, indomethacin, ketoprofen, diclofenac, ibuprofen, phenylbutazone, and flurbiprofen. This study is the first to confirm expression of SLC5A6 in human brain microvessels and to provide evidence that SLC5A6 is a major contributor to luminal uptake of biotin and pantothenic acid at the human blood-brain barrier. In humans, it was unclear (not concluded) about what transport system at the blood-brain barrier (BBB) is responsible for the brain uptakes of two vitamins, biotin and pantothenic acid, which are necessary for brain proper function. This study clarified for the first time that the solute carrier 5A6/Na(+) -dependent multivitamin transporter SLC5A6/SMVT is responsible for the supplies of biotin and pantothenic acid into brain across the BBB in humans. DHA, docosahexaenoic acid; NSAID, non-steroidal anti-inflammatory drug; PGE2, prostaglandin E2. © 2015
Genetic variations in the MCT1 (SLC16A1) gene in the Chinese population of Singapore.
Lean, Choo Bee; Lee, Edmund Jon Deoon
2009-01-01
MCT1(SLC16A1) is the first member of the monocarboxylate transporter (MCT) and its family is involved in the transportation of metabolically important monocarboxylates such as lactate, pyruvate, acetate and ketone bodies. This study identifies genetic variations in SLC16A1 in the ethnic Chinese group of the Singaporean population (n=95). The promoter, coding region and exon-intron junctions of the SLC16A1 gene encoding the MCT1 transporter were screened for genetic variation in the study population by DNA sequencing. Seven genetic variations of SLC16A1, including 4 novel ones, were found: 2 in the promoter region, 2 in the coding exons (both nonsynonymous variations), 2 in the 3' untranslated region (3'UTR) and 1 in the intron. Of the two mutations detected in the promoter region, the -363-855T>C is a novel mutation. The 1282G>A (Val(428)Ile) is a novel SNP and was found as heterozygotic in 4 subjects. The 1470T>A (Asp(490)Glu) was found to be a common polymorphism in this study. Lastly, IVS3-17A>C in intron 3 and 2258 (755)A>G in 3'UTR are novel mutations found to be common polymorphisms in the local Chinese population. To our knowledge, this is the first report of a comprehensive analysis on the MCT1 gene in any population.
Synthesis and characterization of folate-poly(ethylene glycol ...
African Journals Online (AJOL)
polyethylenimine as a non-viral carrier for tumor-targeted gene delivery. ... It was concluded that FA-PEG-CHI-g-PEI, which has improved transfection efficiency and FRs specificity in vitro and in vivo, may be useful in gene therapy. Key words: Folate ...
Action Potential Shortening and Impairment of Cardiac Function by Ablation of Slc26a6.
Sirish, Padmini; Ledford, Hannah A; Timofeyev, Valeriy; Thai, Phung N; Ren, Lu; Kim, Hyo Jeong; Park, Seojin; Lee, Jeong Han; Dai, Gu; Moshref, Maryam; Sihn, Choong-Ryoul; Chen, Wei Chun; Timofeyeva, Maria Valeryevna; Jian, Zhong; Shimkunas, Rafael; Izu, Leighton T; Chiamvimonvat, Nipavan; Chen-Izu, Ye; Yamoah, Ebenezer N; Zhang, Xiao-Dong
2017-10-01
Intracellular pH (pH i ) is critical to cardiac excitation and contraction; uncompensated changes in pH i impair cardiac function and trigger arrhythmia. Several ion transporters participate in cardiac pH i regulation. Our previous studies identified several isoforms of a solute carrier Slc26a6 to be highly expressed in cardiomyocytes. We show that Slc26a6 mediates electrogenic Cl - /HCO 3 - exchange activities in cardiomyocytes, suggesting the potential role of Slc26a6 in regulation of not only pH i , but also cardiac excitability. To test the mechanistic role of Slc26a6 in the heart, we took advantage of Slc26a6 knockout ( Slc26a6 -/ - ) mice using both in vivo and in vitro analyses. Consistent with our prediction of its electrogenic activities, ablation of Slc26a6 results in action potential shortening. There are reduced Ca 2+ transient and sarcoplasmic reticulum Ca 2+ load, together with decreased sarcomere shortening in Slc26a6 -/ - cardiomyocytes. These abnormalities translate into reduced fractional shortening and cardiac contractility at the in vivo level. Additionally, pH i is elevated in Slc26a6 -/ - cardiomyocytes with slower recovery kinetics from intracellular alkalization, consistent with the Cl - /HCO 3 - exchange activities of Slc26a6. Moreover, Slc26a6 -/ - mice show evidence of sinus bradycardia and fragmented QRS complex, supporting the critical role of Slc26a6 in cardiac conduction system. Our study provides mechanistic insights into Slc26a6, a unique cardiac electrogenic Cl - /HCO 3 - transporter in ventricular myocytes, linking the critical roles of Slc26a6 in regulation of pH i , excitability, and contractility. pH i is a critical regulator of other membrane and contractile proteins. Future studies are needed to investigate possible changes in these proteins in Slc26a6 -/ - mice. © 2017 American Heart Association, Inc.
Salem, Sameer D; Saif-Ali, Riyadh; Ismail, Ikram S; Al-Hamodi, Zaid; Muniandy, Sekaran
2014-01-01
Background Several studies have shown the association of solute carrier family 30 (zinc transporter) member 8 (SLC30A8) rs13266634 with type 2 diabetes (T2D). However, the association of alternative variants and haplotypes of SLC30A8 with T2D have not been studied in different populations. The aim of this study is to assess the association of the alternative SLC30A8 variants, rs7002176 and rs1995222 as well as the most common variant, rs13266634 and haplotypes with glutamic acid decarboxylase...
Validation of Folate-Enriched Eggs as a Functional Food for Improving Folate Intake in Consumers
Altic, Leslie; McNulty, Helene; Hoey, Leane; McAnena, Liadhan; Pentieva, Kristina
2016-01-01
Functional foods enriched with folate may be beneficial as a means of optimizing folate status in consumers. We recently developed novel eggs enriched with folate through folic acid supplementation of the hen’s feed, but their potential to influence consumer folate status is unknown because the natural folate forms incorporated into the eggs may not necessarily be retained during storage and cooking. This study aimed to determine the stability of natural folates in folate-enriched eggs under ...
International Nuclear Information System (INIS)
Tachibana, Keisuke; Takeuchi, Kentaro; Inada, Hirohiko; Yamasaki, Daisuke; Ishimoto, Kenji; Tanaka, Toshiya; Hamakubo, Takao; Sakai, Juro; Kodama, Tatsuhiko; Doi, Takefumi
2009-01-01
Solute carrier family 25, member 20 (SLC25A20) is a key molecule that transfers acylcarnitine esters in exchange for free carnitine across the mitochondrial membrane in the mitochondrial β-oxidation. The peroxisome proliferator-activated receptor alpha (PPARα) is a ligand-activated transcription factor that plays an important role in the regulation of β-oxidation. We previously established tetracycline-regulated human cell line that can be induced to express PPARα and found that PPARα induces the SLC25A20 expression. In this study, we analyzed the promoter region of the human slc25a20 gene and showed that PPARα regulates the expression of human SLC25A20 via the peroxisome proliferator responsive element.
Fernandes, Julio C; Qiu, Xingping; Winnik, Francoise M; Benderdour, Mohamed; Zhang, Xiaoling; Dai, Kerong; Shi, Qin
2012-01-01
The low transfection efficiency of chitosan is one of its drawbacks as a gene delivery carrier. Low molecular weight chitosan may help to form small-sized polymer-DNA or small interfering RNA (siRNA) complexes. Folate conjugation may improve gene transfection efficiency because of the promoted uptake of folate receptor-bearing cells. In the present study, chitosan was conjugated with folate and investigated for its efficacy as a delivery vector for siRNA in vitro. We demonstrate that the molecular weight of chitosan has a major influence on its biological and physicochemical properties, and very low molecular weight chitosan (below 10 kDa) has difficulty in forming stable complexes with siRNA. In this study, chitosan 25 kDa and 50 kDa completely absorbed siRNA and formed nanoparticles (≤220 nm) at a chitosan to siRNA weight ratio of 50:1. The introduction of a folate ligand onto chitosan decreased nanoparticle toxicity. Compared with chitosan-siRNA, folate-chitosan-siRNA nanoparticles improved gene silencing transfection efficiency. Therefore, folate-chitosan shows potential as a viable candidate vector for safe and efficient siRNA delivery. PMID:23209368
Öhrvik, Veronica
2009-01-01
An inadequate folate status is associated with increased risk of anaemia and neural tube defects. In many countries a folate intake below recommendations has been reported for women in childbearing age. However, data on folate intake and status are not always associated, since factors other than intake, e.g. bioavailability, affect folate status. This thesis studied the bioavailability of folate using in vivo and in vitro models. The effect of two pieces of Swedish nutritional advice on folat...
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC411 (Link to dictyBase) - - - Contig-U16272-1 SLC411Z (Link... to Original site) - - SLC411Z 486 - - - - Show SLC411 Library SL (Link to library) Clone ID SLC411 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-A/SLC411Q.Seq.d/ Representative seq. ID SLC41...1Z (Link to Original site) Representative DNA sequence >SLC411 (SLC411Q) /CSM/SL/SLC4-A/SLC411Q.Seq.d/ XXXXX...vacuolar 4.0 %: peroxisomal >> prediction for SLC411 is nuc 5' end seq. ID - 5' e
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC424 (Link to dictyBase) - G01086 DDB0231665 Contig-U08784-1 SLC4...24P (Link to Original site) SLC424F 169 SLC424Z 538 SLC424P 707 - - Show SLC424 Library SL (Link to library) Clone ID SLC4...ontig-U08784-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-A/SLC4...24Q.Seq.d/ Representative seq. ID SLC424P (Link to Original site) Representative DNA sequence >SLC424 (SLC424Q) /CSM/SL/SLC4...-A/SLC424Q.Seq.d/ GGATATTATAATTTCAAATTAAGTTTTATAAATTTGAAATAATATTGAAAAAAAAAAAAA ATAAAAAA
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC492 (Link to dictyBase) - - - Contig-U10734-1 | Contig-U12865-1 SLC4...92P (Link to Original site) SLC492F 645 SLC492Z 550 SLC492P 1195 - - Show SLC492 Library SL (Link to library) Clone ID SLC4...734-1 | Contig-U12865-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-D/SLC4...92Q.Seq.d/ Representative seq. ID SLC492P (Link to Original site) Representative DNA sequence >SLC492 (SLC4...92Q) /CSM/SL/SLC4-D/SLC492Q.Seq.d/ AAAAAAAAAATATACAAATAATGAATAAATTTTTAGCTTTGTTATTTGTTTTAGCTTTGT
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC432 (Link to dictyBase) - - - Contig-U09715-1 | Contig-U16382-1 SLC4...32P (Link to Original site) SLC432F 633 SLC432Z 188 SLC432P 821 - - Show SLC432 Library SL (Link to library) Clone ID SLC4...15-1 | Contig-U16382-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC4...32Q.Seq.d/ Representative seq. ID SLC432P (Link to Original site) Representative DNA sequence >SLC432 (SLC4...32Q) /CSM/SL/SLC4-B/SLC432Q.Seq.d/ ATTAAATTAAATAAAAAATAAAAATGGATGGTGAAGATGTTCAAGCTTTAGTTATTGATA
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC481 (Link to dictyBase) - - - Contig-U16358-1 SLC481Z (Link... to Original site) - - SLC481Z 393 - - - - Show SLC481 Library SL (Link to library) Clone ID SLC481 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-D/SLC481Q.Seq.d/ Representative seq. ID SLC48...1Z (Link to Original site) Representative DNA sequence >SLC481 (SLC481Q) /CSM/SL/SLC4-D/SLC481Q.Seq.d/ XXXXX...SL/SLG8-A/SLG820Q.Seq.d/ 708 0.0 SLC481 (SLC481Q) /CSM/SL/SLC4-D/SLC481Q.Seq.d/ 708 0.0 SLC178 (SLC178Q) /CS
Comprehensive evaluation of one-carbon metabolism pathway gene variants and renal cell cancer risk.
Directory of Open Access Journals (Sweden)
Todd M Gibson
Full Text Available Folate and one-carbon metabolism are linked to cancer risk through their integral role in DNA synthesis and methylation. Variation in one-carbon metabolism genes, particularly MTHFR, has been associated with risk of a number of cancers in epidemiologic studies, but little is known regarding renal cancer.Tag single nucleotide polymorphisms (SNPs selected to produce high genomic coverage of 13 gene regions of one-carbon metabolism (ALDH1L1, BHMT, CBS, FOLR1, MTHFR, MTR, MTRR, SHMT1, SLC19A1, TYMS and the closely associated glutathione synthesis pathway (CTH, GGH, GSS were genotyped for 777 renal cell carcinoma (RCC cases and 1,035 controls in the Central and Eastern European Renal Cancer case-control study. Associations of individual SNPs (n = 163 with RCC risk were calculated using unconditional logistic regression adjusted for age, sex and study center. Minimum p-value permutation (Min-P tests were used to identify gene regions associated with risk, and haplotypes were evaluated within these genes.The strongest associations with RCC risk were observed for SLC19A1 (P(min-P = 0.03 and MTHFR (P(min-P = 0.13. A haplotype consisting of four SNPs in SLC19A1 (rs12483553, rs2838950, rs2838951, and rs17004785 was associated with a 37% increased risk (p = 0.02, and exploratory stratified analysis suggested the association was only significant among those in the lowest tertile of vegetable intake.To our knowledge, this is the first study to comprehensively examine variation in one-carbon metabolism genes in relation to RCC risk. We identified a novel association with SLC19A1, which is important for transport of folate into cells. Replication in other populations is required to confirm these findings.
Battini, R; Chilosi, A M; Casarano, M; Moro, F; Comparini, A; Alessandrì, M G; Leuzzi, V; Tosetti, M; Cioni, G
2011-02-01
We describe the clinical and molecular features of a child harboring a novel mutation in SLC6A8 gene in association with a milder phenotype than other creatine transporter (CT1) deficient patients (OMIM 300352) [1-7]. The mutation c.757 G>C p.G253R in exon 4 of SLC6A8 was hemizygous in the child, aged 6 years and 6 months, who showed mild intellectual disability with severe speech and language delay. His carrier mother had borderline intellectual functioning. Although the neurochemical and biochemical parameters were fully consistent with those reported in the literature for subjects with CT1 deficit, in our patient within a general cognitive disability, a discrepancy between nonverbal and verbal skills was observed, confirming the peculiar vulnerability of language development under brain Cr depletion. Copyright © 2010 Elsevier Inc. All rights reserved.
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC420 (Link to dictyBase) - G01085 DDB0205634 Contig-U01169-1 | Contig-U15736-1 SLC4...20P (Link to Original site) SLC420F 333 SLC420Z 423 SLC420P 756 - - Show SLC420 Libra...ry SL (Link to library) Clone ID SLC420 (Link to dictyBase) Atlas ID - NBRP ID G01085 dictyBase ID DDB020563...cdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-A/SLC420Q.Seq.d/ Representative seq. ID SLC420P (Link to Original site) R...epresentative DNA sequence >SLC420 (SLC420Q) /CSM/SL/SLC4-A/SLC420Q.Seq.d/ GCTAGCACACACATAAATAATACATACACACAT
Endocytosis of GPI-linked membrane folate receptor-alpha.
Rijnboutt, S; Jansen, G; Posthuma, G; Hynes, J B; Schornagel, J H; Strous, G J
1996-01-01
GPI-linked membrane folate receptors (MFRs) have been implicated in the receptor-mediated uptake of reduced folate cofactors and folate-based chemotherapeutic drugs. We have studied the biosynthetic transport to and internalization of MFR isoform alpha in KB-cells. MFR-alpha was synthesized as a 32-kD protein and converted in a maturely glycosylated 36-38-kD protein 1 h after synthesis. 32-kD MFR-alpha was completely soluble in Triton X-100 at 0 degree C. In contrast, only 33% of the 36-38-kD species could be solubilized at these conditions whereas complete solubilization was obtained in Triton X-100 at 37 degrees C or in the presence of saponin at 0 degree C. Similar solubilization characteristics were found when MFR-alpha at the plasma membrane was labeled with a crosslinkable 125I-labeled photoaffinity-analog of folic acid as a ligand. Triton X-100-insoluble membrane domains containing MFR-alpha could be separated from soluble MFR-alpha on sucrose flotation gradients. Only Triton X-100 soluble MFR-alpha was internalized from the plasma membrane. The reduced-folate-carrier, an integral membrane protein capable of translocating (anti-)folates across membranes, was completely excluded from the Triton X-100-resistant membrane domains. Internalized MFR-alpha recycled slowly to the cell surface during which it remained soluble in Triton X-100 at 0 degree C. Using immunoelectron microscopy, we found MFR-alpha along the entire endocytic pathway: in clathrin-coated buds and vesicles, and in small and large endosomal vacuoles. In conclusion, our data indicate that a large fraction, if not all, of internalizing MFR-alpha bypasses caveolae.
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC419 (Link to dictyBase) - - - Contig-U03801-1 SLC419Z (Link... to Original site) - - SLC419Z 335 - - - - Show SLC419 Library SL (Link to library) Clone ID SLC419 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-A/SLC419Q.Seq.d/ Representative seq. ID SLC41...9Z (Link to Original site) Representative DNA sequence >SLC419 (SLC419Q) /CSM/SL/SLC4-A/SLC419Q.Seq.d/ XXXXX...I6-A/SSI602Q.Seq.d/ 490 e-138 SSD173 (SSD173Q) /CSM/SS/SSD1-D/SSD173Q.Seq.d/ 490 e-138 SLC419 (SLC4
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC409 (Link to dictyBase) - - - Contig-U14931-1 SLC409Z (Link... to Original site) - - SLC409Z 483 - - - - Show SLC409 Library SL (Link to library) Clone ID SLC409 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-A/SLC409Q.Seq.d/ Representative seq. ID SLC40...9Z (Link to Original site) Representative DNA sequence >SLC409 (SLC409Q) /CSM/SL/SLC4-A/SLC409Q.Seq.d/ XXXXX... SLH501 (SLH501Q) /CSM/SL/SLH5-A/SLH501Q.Seq.d/ 858 0.0 SLF191 (SLF191Q) /CSM/SL/SLF1-D/SLF191Q.Seq.d/ 858 0.0 SLC409 (SLC4
DEFF Research Database (Denmark)
Christensen, Henriette L; Nguyen, An T; Pedersen, Fredrik D
2013-01-01
The choroid plexus epithelium (CPE) is located in the ventricular system of the brain, where it secretes the majority of the cerebrospinal fluid (CSF) that fills the ventricular system and surrounds the central nervous system. The CPE is a highly vascularized single layer of cuboidal cells....... Genetically modified mice targeting slc4a2, slc4a5, slc4a7, slc4a10, and slc9a1 have been generated. Deletion of slc4a5, 7 or 10, or slc9a1 has numerous impacts on CP function and structure in these mice. Removal of the transporters affects brain ventricle size (slc4a5 and slc4a10) and intracellular p...
Directory of Open Access Journals (Sweden)
Claire M. Marchetta
2015-04-01
Full Text Available Folate is found naturally in foods or as synthetic folic acid in dietary supplements and fortified foods. Adequate periconceptional folic acid intake can prevent neural tube defects. Folate intake impacts blood folate concentration; however, the dose-response between natural food folate and blood folate concentrations has not been well described. We estimated this association among healthy females. A systematic literature review identified studies (1 1992–3 2014 with both natural food folate intake alone and blood folate concentration among females aged 12–49 years. Bayesian methods were used to estimate regression model parameters describing the association between natural food folate intake and subsequent blood folate concentration. Seven controlled trials and 29 observational studies met the inclusion criteria. For the six studies using microbiologic assay (MA included in the meta-analysis, we estimate that a 6% (95% Credible Interval (CrI: 4%, 9% increase in red blood cell (RBC folate concentration and a 7% (95% CrI: 1%, 12% increase in serum/plasma folate concentration can occur for every 10% increase in natural food folate intake. Using modeled results, we estimate that a natural food folate intake of ≥450 μg dietary folate equivalents (DFE/day could achieve the lower bound of an RBC folate concentration (~1050 nmol/L associated with the lowest risk of a neural tube defect. Natural food folate intake affects blood folate concentration and adequate intakes could help women achieve a RBC folate concentration associated with a risk of 6 neural tube defects/10,000 live births.
Marchetta, Claire M; Devine, Owen J; Crider, Krista S; Tsang, Becky L; Cordero, Amy M; Qi, Yan Ping; Guo, Jing; Berry, Robert J; Rosenthal, Jorge; Mulinare, Joseph; Mersereau, Patricia; Hamner, Heather C
2015-04-10
Folate is found naturally in foods or as synthetic folic acid in dietary supplements and fortified foods. Adequate periconceptional folic acid intake can prevent neural tube defects. Folate intake impacts blood folate concentration; however, the dose-response between natural food folate and blood folate concentrations has not been well described. We estimated this association among healthy females. A systematic literature review identified studies (1 1992-3 2014) with both natural food folate intake alone and blood folate concentration among females aged 12-49 years. Bayesian methods were used to estimate regression model parameters describing the association between natural food folate intake and subsequent blood folate concentration. Seven controlled trials and 29 observational studies met the inclusion criteria. For the six studies using microbiologic assay (MA) included in the meta-analysis, we estimate that a 6% (95% Credible Interval (CrI): 4%, 9%) increase in red blood cell (RBC) folate concentration and a 7% (95% CrI: 1%, 12%) increase in serum/plasma folate concentration can occur for every 10% increase in natural food folate intake. Using modeled results, we estimate that a natural food folate intake of ≥ 450 μg dietary folate equivalents (DFE)/day could achieve the lower bound of an RBC folate concentration (~ 1050 nmol/L) associated with the lowest risk of a neural tube defect. Natural food folate intake affects blood folate concentration and adequate intakes could help women achieve a RBC folate concentration associated with a risk of 6 neural tube defects/10,000 live births.
Directory of Open Access Journals (Sweden)
Kumi Kawano
2011-01-01
Full Text Available The folate receptor is an attractive target for selective tumor delivery of liposomal doxorubicin (DXR because it is abundantly expressed in a large percentage of tumors. This study examined the effect of polyethylene glycol (PEG spacer length and folate ligand density on the targeting ability of folate-modified liposomes. Liposomes were modified with folate-derivatized PEG-distearoylphosphatidylethanolamine with PEG molecular weights of 2000, 3400, or 5000. The association of DXR-loaded liposomes with KB cells, which overexpress the folate receptor, was evaluated by flow cytometry at various ratios of folate modification. A low ratio of folate modification with a sufficiently long PEG chain showed the highest folate receptor-mediated association with the cells, but did not show the highest in vitro cytotoxicity. DXR release from folate-modified liposomes in endosomes might be different. These findings will be useful for designing folate receptor-targeting carriers.
Validation of Folate-Enriched Eggs as a Functional Food for Improving Folate Intake in Consumers.
Altic, Leslie; McNulty, Helene; Hoey, Leane; McAnena, Liadhan; Pentieva, Kristina
2016-11-30
Functional foods enriched with folate may be beneficial as a means of optimizing folate status in consumers. We recently developed novel eggs enriched with folate through folic acid supplementation of the hen's feed, but their potential to influence consumer folate status is unknown because the natural folate forms incorporated into the eggs may not necessarily be retained during storage and cooking. This study aimed to determine the stability of natural folates in folate-enriched eggs under typical conditions of storage and cooking. Total folate was determined by microbiological assay following tri-enzyme treatment in folate-enriched eggs and un-enriched (barn and free-range) on the day they were laid, after storage (up to 27 days) and after using four typical cooking methods (boiling, poaching, frying, scrambling) for different durations. On the day of laying, the folate content of enriched eggs was found to be significantly higher than that of un-enriched barn or free-range eggs (mean ± SD; 123.2 ± 12.4 vs. 41.2 ± 2.8 vs. 65.6 ± 18.5 µg/100 g; p functional foods with enriched folate content. Further studies will confirm their effectiveness in optimizing the biomarker folate status of consumers.
Energy Technology Data Exchange (ETDEWEB)
Tachibana, Keisuke, E-mail: nya@phs.osaka-u.ac.jp [Graduate School of Pharmaceutical Sciences, Osaka University, 1-6 Yamadaoka, Suita, Osaka 565-0871 (Japan); Takeuchi, Kentaro; Inada, Hirohiko [Graduate School of Pharmaceutical Sciences, Osaka University, 1-6 Yamadaoka, Suita, Osaka 565-0871 (Japan); Yamasaki, Daisuke [Graduate School of Pharmaceutical Sciences, Osaka University, 1-6 Yamadaoka, Suita, Osaka 565-0871 (Japan); The Center for Advanced Medical Engineering and Informatics, Osaka University, 2-2 Yamadaoka, Suita, Osaka 565-0871 (Japan); Ishimoto, Kenji [Graduate School of Pharmaceutical Sciences, Osaka University, 1-6 Yamadaoka, Suita, Osaka 565-0871 (Japan); Graduate School of Medicine, Osaka University, 2-2 Yamadaoka, Suita, Osaka 565-0871 (Japan); Tanaka, Toshiya; Hamakubo, Takao; Sakai, Juro; Kodama, Tatsuhiko [Laboratory for System Biology and Medicine, Research Center for Advanced Science and Technology, University of Tokyo, 4-6-1 Komaba, Meguro, Tokyo 153-8904 (Japan); Doi, Takefumi [Graduate School of Pharmaceutical Sciences, Osaka University, 1-6 Yamadaoka, Suita, Osaka 565-0871 (Japan); The Center for Advanced Medical Engineering and Informatics, Osaka University, 2-2 Yamadaoka, Suita, Osaka 565-0871 (Japan); Graduate School of Medicine, Osaka University, 2-2 Yamadaoka, Suita, Osaka 565-0871 (Japan)
2009-11-20
Solute carrier family 25, member 20 (SLC25A20) is a key molecule that transfers acylcarnitine esters in exchange for free carnitine across the mitochondrial membrane in the mitochondrial {beta}-oxidation. The peroxisome proliferator-activated receptor alpha (PPAR{alpha}) is a ligand-activated transcription factor that plays an important role in the regulation of {beta}-oxidation. We previously established tetracycline-regulated human cell line that can be induced to express PPAR{alpha} and found that PPAR{alpha} induces the SLC25A20 expression. In this study, we analyzed the promoter region of the human slc25a20 gene and showed that PPAR{alpha} regulates the expression of human SLC25A20 via the peroxisome proliferator responsive element.
International Nuclear Information System (INIS)
Goricar, Katja; Kovac, Viljem; Dolzan, Vita
2014-01-01
A combination of pemetrexed and cisplatin has been shown to improve the outcome in patients with malignant pleural mesothelioma (MPM), however, there is a great heterogeneity in treatment response among patients. The aim of our study was to evaluate the influence of polymorphisms in folate pathway and transporter genes on pemetrexed treatment outcome in Slovenian patients with MPM. MPM patients treated with pemetrexed in the course of a prospective randomized clinical trial were genotyped for nineteen polymorphisms in five genes of folate pathway and six transporter genes. Logistic regression was used to assess the influence of polymorphisms on treatment efficacy and toxicity, while Cox regression was used to determine their influence on progression-free and overall survival. Patients with at least one polymorphic MTHFD1 rs2236225 allele had a significantly lower response rate (p = 0.005; odds ratio [OR] = 0.12; 95% confidence interval [CI] = 0.03−0.54) and shorter progression-free survival (p = 0.032; hazard ratio [HR] = 3.10; 95% CI = 1.10−8.74) than non-carriers. Polymorphisms in transporter genes did not influence survival; however, several were associated with toxicity. Liver toxicity was significantly lower in carriers of polymorphic ABCC2 rs2273697 (p = 0.028; OR = 0.23; 95% CI = 0.06−0.85), SLCO1B1 rs4149056 (p = 0.028; OR = 0.23; 95% CI = 0.06−0.85) and rs11045879 (p = 0.014; OR = 0.18; 95% CI = 0.05−0.71) alleles compared to non-carriers, as well as in patients with SLCO1B1 GCAC haplotype (p = 0.048; OR = 0.17; 95% CI = 0.03−0.98). Gastrointestinal toxicity was much more common in patients with polymorphic ABCC2 rs717620 allele (p = 0.004; OR = 10.67; 95% CI = 2.15−52.85) and ABCC2 CAG haplotype (p = 0.006; OR = 5.67; 95% CI = 1.64−19.66). MTHFD1 polymorphism affected treatment response and survival, while polymorphisms in ABCC2 and SLCO1B1 transporter genes influenced the risk for toxicity. These polymorphisms could serve as potential
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC494 (Link to dictyBase) - - - Contig-U16260-1 SLC494Z (Link... to Original site) - - SLC494Z 451 - - - - Show SLC494 Library SL (Link to library) Clone ID SLC494 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-D/SLC494Q.Seq.d/ Representative seq. ID SLC49...4Z (Link to Original site) Representative DNA sequence >SLC494 (SLC494Q) /CSM/SL/SLC4-D/SLC494Q.Seq.d/ XXXXX...a: 0.00 m3b: 0.00 m_ : 1.00 52.0 %: cytoplasmic 36.0 %: nuclear 8.0 %: cytoskeletal 4.0 %: mitochondrial >> prediction for SLC4
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC418 (Link to dictyBase) - G01921 DDB0191271 Contig-U15820-1 SLC4...18E (Link to Original site) SLC418F 604 SLC418Z 554 SLC418P 1158 SLC418E 1076 Show SLC418 Library SL (L...ink to library) Clone ID SLC418 (Link to dictyBase) Atlas ID - NBRP ID G01921 dictyBase ID DDB0191271 Link t...o Contig Contig-U15820-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-A/SLC4...18Q.Seq.d/ Representative seq. ID SLC418E (Link to Original site) Representative DNA sequence >SLC418 (SLC4
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC451 (Link to dictyBase) - - - Contig-U16260-1 SLC451Z (Link... to Original site) - - SLC451Z 389 - - - - Show SLC451 Library SL (Link to library) Clone ID SLC451 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-C/SLC451Q.Seq.d/ Representative seq. ID SLC45...1Z (Link to Original site) Representative DNA sequence >SLC451 (SLC451Q) /CSM/SL/SLC4-C/SLC451Q.Seq.d/ XXXXX... producing significant alignments: (bits) Value SLC451 (SLC451Q) /CSM/SL/SLC4-C/SLC4
Directory of Open Access Journals (Sweden)
Clifford Jacobs
2014-06-01
Full Text Available Human organic cation transporter 1 is primarily expressed in hepatocytes and mediates the electrogenic transport of various endogenous and exogenous compounds, including clinically important drugs. Genetic polymorphisms in the gene coding for human organic cation transporter 1, SLC22A1, are increasingly being recognized as a possible mechanism explaining the variable response to clinical drugs, which are substrates for this transporter. The genotypic and allelic distributions of 19 nonsynonymous and one intronic SLC22A1 single nucleotide polymorphisms were determined in 148 healthy Xhosa participants from South Africa, using a SNAPshot® multiplex assay. In addition, haplotype structure for SLC22A1 was inferred from the genotypic data. The minor allele frequencies for S14F (rs34447885, P341L (rs2282143, V519F (rs78899680, and the intronic variant rs622342 were 1.7%, 8.4%, 3.0%, and 21.6%, respectively. None of the participants carried the variant allele for R61C (rs12208357, C88R (rs55918055, S189L (rs34104736, G220V (rs36103319, P283L (rs4646277, R287G (rs4646278, G401S (rs34130495, M440I (rs35956182, or G465R (rs34059508. In addition, no variant alleles were observed for A306T (COSM164365, A413V (rs144322387, M420V (rs142448543, I421F (rs139512541, C436F (rs139512541, V501E (rs143175763, or I542V (rs137928512 in the population. Eight haplotypes were inferred from the genotypic data. This study reports important genetic data that could be useful for future pharmacogenetic studies of drug transporters in the indigenous Sub-Saharan African populations.
SLC-2000: A luminosity upgrade for the SLC
International Nuclear Information System (INIS)
Breidenbach, M.; Decker, F.-J.; Helm, R.; Napoly, O.; Phinney, N.; Raimondi, P.; Raubenheimer, T.O.; Siemann, R.; Zimmermann, F.; Hertzbach, S.
1996-01-01
We discuss a possible upgrade to the Stanford Linear Collider (SLC), whose objective is to increase the SLC luminosity by at least a factor 7, to an average Z production rate of more than 35,000 per week. The centerpiece of the upgrade is the installation of a new superconducting final doublet with a field gradient of 240 T/m, which will be placed at a distance of only 70 cm from the interaction point. In addition, several bending magnets in each final focus will be lengthened and two octupole correctors are added. A complementary upgrade of damping rings and bunch compressors will allow optimum use of the modified final focus and can deliver, or exceed, the targeted luminosity. The proposed upgrade will place the SLC physics program in a very competitive position, and will also enable it to pursue its pioneering role as the first and only linear collider. (author)
Wyant, Gregory A; Abu-Remaileh, Monther; Wolfson, Rachel L; Chen, Walter W; Freinkman, Elizaveta; Danai, Laura V; Vander Heiden, Matthew G; Sabatini, David M
2017-10-19
The mTORC1 kinase is a master growth regulator that senses many environmental cues, including amino acids. Activation of mTORC1 by arginine requires SLC38A9, a poorly understood lysosomal membrane protein with homology to amino acid transporters. Here, we validate that SLC38A9 is an arginine sensor for the mTORC1 pathway, and we uncover an unexpectedly central role for SLC38A9 in amino acid homeostasis. SLC38A9 mediates the transport, in an arginine-regulated fashion, of many essential amino acids out of lysosomes, including leucine, which mTORC1 senses through the cytosolic Sestrin proteins. SLC38A9 is necessary for leucine generated via lysosomal proteolysis to exit lysosomes and activate mTORC1. Pancreatic cancer cells, which use macropinocytosed protein as a nutrient source, require SLC38A9 to form tumors. Thus, through SLC38A9, arginine serves as a lysosomal messenger that couples mTORC1 activation to the release from lysosomes of the essential amino acids needed to drive cell growth. Copyright © 2017 Elsevier Inc. All rights reserved.
International Nuclear Information System (INIS)
Spiegelstein, Ofer; Gould, Amy; Wlodarczyk, Bogdan; Tsie, Marlene; Lu Xiufen; Le, Chris; Troen, Aron; Selhub, Jacob; Piedrahita, Jorge A.; Salbaum, J. Michael; Kappen, Claudia; Melnyk, Stepan; James, Jill; Finnell, Richard H.
2005-01-01
Previous studies have demonstrated that mice lacking a functional folate binding protein 2 gene (Folbp2 -/- ) were significantly more sensitive to in utero arsenic exposure than were the wild-type mice similarly exposed. When these mice were fed a folate-deficient diet, the embryotoxic effect of arsenate was further exacerbated. Contrary to expectations, studies on 24-h urinary speciation of sodium arsenate did not demonstrate any significant difference in arsenic biotransformation between Folbp2 -/- and Folbp2 +/+ mice. To better understand the influence of folate pathway genes on arsenic embryotoxicity, the present investigation utilized transgenic mice with disrupted folate binding protein 1 (Folbp1) and reduced folate carrier (RFC) genes. Because complete inactivation of Folbp1 and RFC genes results in embryonic lethality, we used heterozygous animals. Overall, no RFC genotype-related differences in embryonic susceptibility to arsenic exposure were observed. Embryonic lethality and neural tube defect (NTD) frequency in Folbp1 mice was dose-dependent and differed from the RFC mice; however, no genotype-related differences were observed. The RFC heterozygotes tended to have higher plasma levels of S-adenosylhomocysteine (SAH) than did the wild-type controls, although this effect was not robust. It is concluded that genetic modifications at the Folbp1 and RFC loci confers no particular sensitivity to arsenic toxicity compared to wild-type controls, thus disproving the working hypothesis that decreased methylating capacity of the genetically modified mice would put them at increased risk for arsenic-induced reproductive toxicity
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC441 (Link to dictyBase) - - - Contig-U00414-1 SLC441P (Link to Original site) SLC4...41F 207 SLC441Z 473 SLC441P 680 - - Show SLC441 Library SL (Link to library) Clone ID SLC4... URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC441Q.Seq.d/ Representative seq. ID SLC4...41P (Link to Original site) Representative DNA sequence >SLC441 (SLC441Q) /CSM/SL/SLC4-B/SLC4...Q) /CSM/SL/SLI1-C/SLI162Q.Seq.d/ 896 0.0 SLC441 (SLC441Q) /CSM/SL/SLC4-B/SLC441Q.Seq.d/ 896 0.0 AFK293 (AFK2
DesRoches, Caro-Lyne; Patel, Jaina; Wang, Peixiang; Minassian, Berge; Salomons, Gajja S; Marshall, Christian R; Mercimek-Mahmutoglu, Saadet
2015-07-10
Creatine transporter deficiency (CRTR-D) is an X-linked inherited disorder of creatine transport. All males and about 50% of females have intellectual disability or cognitive dysfunction. Creatine deficiency on brain proton magnetic resonance spectroscopy and elevated urinary creatine to creatinine ratio are important biomarkers. Mutations in the SLC6A8 gene occur de novo in 30% of males. Despite reports of high prevalence of CRTR-D in males with intellectual disability, there are no true prevalence studies in the general population. To determine carrier frequency of CRTR-D in the general population we studied the variants in the SLC6A8 gene reported in the Exome Variant Server database and performed functional characterization of missense variants. We also analyzed synonymous and intronic variants for their predicted pathogenicity using in silico analysis tools. Nine missense variants were functionally analyzed using transient transfection by site-directed mutagenesis with In-Fusion HD Cloning in HeLa cells. Creatine uptake was measured by liquid chromatography tandem mass spectrometry for creatine measurement. The c.1654G>T (p.Val552Leu) variant showed low residual creatine uptake activity of 35% of wild type transfected HeLa cells and was classified as pathogenic. Three variants (c.808G>A; p.Val270Met, c.942C>G; p.Phe314Leu and c.952G>A; p.Ala318Thr) were predicted to be pathogenic based on in silico analysis, but proved to be non-pathogenic by our functional analysis. The estimated carrier frequency of CRTR-D was 0.024% in females in the general population. We recommend functional studies for all novel missense variants by transient transfection followed by creatine uptake measurement by liquid chromatography tandem mass spectrometry as fast and cost effective method for the functional analysis of missense variants in the SLC6A8 gene. Crown Copyright © 2015. Published by Elsevier B.V. All rights reserved.
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC431 (Link to dictyBase) - - - Contig-U15865-1 SLC431Z (Link... to Original site) - - SLC431Z 405 - - - - Show SLC431 Library SL (Link to library) Clone ID SLC431 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC431Q.Seq.d/ Representative seq. ID SLC43...1Z (Link to Original site) Representative DNA sequence >SLC431 (SLC431Q) /CSM/SL/SLC4-B/SLC431Q.Seq.d/ XXXXX...omology vs CSM-cDNA Score E Sequences producing significant alignments: (bits) Value SLC431 (SLC4
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC465 (Link to dictyBase) - G01923 DDB0190872 Contig-U14177-1 SLC4...65P (Link to Original site) SLC465F 725 SLC465Z 393 SLC465P 1118 - - Show SLC465 Library SL (Link to library) Clone ID SLC4...Contig-U14177-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-C/SLC4...65Q.Seq.d/ Representative seq. ID SLC465P (Link to Original site) Representative DNA sequence >SLC465 (SLC465Q) /CSM/SL/SLC4...-C/SLC465Q.Seq.d/ CGTTAACAGATTTTAATATTACTAATATTGTAGAAAATGATTTTAAATAAAGTAGCAAAA TGTTATG
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC426 (Link to dictyBase) - G01922 DDB0233225 Contig-U14991-1 SLC4...26E (Link to Original site) SLC426F 335 SLC426Z 320 SLC426P 655 SLC426E 335 Show SLC426 Library SL (Lin...Contig Contig-U14991-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC4...26Q.Seq.d/ Representative seq. ID SLC426E (Link to Original site) Representative DNA sequence >SLC426 (SLC4...26Q) /CSM/SL/SLC4-B/SLC426Q.Seq.d/ AAATAATAAATAGTAAATAATAAATAATAATAAATAATAATAATAATATTTNAAAATGGG
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC403 (Link to dictyBase) - - - Contig-U16252-1 SLC403Z (Link... to Original site) - - SLC403Z 492 - - - - Show SLC403 Library SL (Link to library) Clone ID SLC403 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-A/SLC403Q.Seq.d/ Representative seq. ID SLC40...3Z (Link to Original site) Representative DNA sequence >SLC403 (SLC403Q) /CSM/SL/SLC4-A/SLC403Q.Seq.d/ XXXXX...-B/SLE731Q.Seq.d/ 902 0.0 SLC403 (SLC403Q) /CSM/SL/SLC4-A/SLC403Q.Seq.d/ 902 0.0 SLC241 (SLC241Q) /CSM/SL/SL
Chen, Yong-Gui; Yuan, Kai; Zhang, Ze-Zhi; Yuan, Feng-Hua; Weng, Shao-Ping; Yue, Hai-Tao; He, Jian-Guo; Chen, Yi-Hong
2016-04-01
Innate immunity in shrimp is important in resisting bacterial infection. The NF-κB pathway is pivotal in such an immune response. This study cloned and functionally characterized the solute carrier family (SLC) 15 member A 4 (LvSLC15A4) gene in Litopenaeus vannamei. The open reading frame of LvSLC15A4 is 1, 902 bp long and encodes a putative 633-amino acid protein, which is localized in the plasma membrane and intracellular vesicular compartments. Results of the reporter gene assay showed that LvSLC15A4 upregulated NF-κB target genes, including the immediate-early gene 1 of white spot syndrome virus, as well as several antimicrobial peptide genes, such as pen4, CecA, AttA, and Mtk in S2 cells. Moreover, knocked-down expression of LvSLC15A4 reduced pen4 expression in L. vannamei. LvSLC15A4 down-regulation also increased the cumulative mortality of Vibrio parahemolyticus-infected L. vannamei. Furthermore, LvSLC15A4 expression was induced by unfolded protein response (UPR) in L. vannamei hematocytes. These results suggest that LvSLC15A4 participates in L. vannamei innate immunity via the NF-κB pathway and thus may be related to UPR. Copyright © 2015 Elsevier Ltd. All rights reserved.
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC413 (Link to dictyBase) - - - Contig-U15735-1 SLC413P (Link to Original site) SLC4...13F 686 SLC413Z 466 SLC413P 1152 - - Show SLC413 Library SL (Link to library) Clone ID SLC4...e URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-A/SLC413Q.Seq.d/ Representative seq. ID SLC4...13P (Link to Original site) Representative DNA sequence >SLC413 (SLC413Q) /CSM/SL/SLC4-A/SLC4...iknkikkknikqkkkk Homology vs CSM-cDNA Score E Sequences producing significant alignments: (bits) Value SLC413 (SLC413Q) /CSM/SL/SLC4
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC487 (Link to dictyBase) - - - Contig-U12865-1 SLC487Z (Link... to Original site) - - SLC487Z 404 - - - - Show SLC487 Library SL (Link to library) Clone ID SLC487 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-D/SLC487Q.Seq.d/ Representative seq. ID SLC48...7Z (Link to Original site) Representative DNA sequence >SLC487 (SLC487Q) /CSM/SL/SLC4-D/SLC487Q.Seq.d/ XXXXX...1 0.0 SSF377 (SSF377Q) /CSM/SS/SSF3-D/SSF377Q.Seq.d/ 801 0.0 SLC492 (SLC492Q) /CSM/SL/SLC4-D/SLC4
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC404 (Link to dictyBase) - G22406 DDB0190371 Contig-U03918-1 SLC4...04E (Link to Original site) - - - - - - SLC404E 229 Show SLC404 Library SL (Link to library) Clone ID SLC4...riginal site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-A/SLC404Q.Seq.d/ ...Representative seq. ID SLC404E (Link to Original site) Representative DNA sequence >SLC404 (SLC404Q) /CSM/SL/SLC4-A/SLC4...y vs CSM-cDNA Score E Sequences producing significant alignments: (bits) Value SLC404 (SLC404Q) /CSM/SL/SLC4-A/SLC4
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC461 (Link to dictyBase) - - - Contig-U16382-1 SLC461Z (Link... to Original site) - - SLC461Z 386 - - - - Show SLC461 Library SL (Link to library) Clone ID SLC461 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-C/SLC461Q.Seq.d/ Representative seq. ID SLC46...1Z (Link to Original site) Representative DNA sequence >SLC461 (SLC461Q) /CSM/SL/SLC4-C/SLC461Q.Seq.d/ XXXXX...e-155 2 ( AU034553 ) Dictyostelium discoideum slug cDNA, clone SLC461. 531 e-155 2 ( AU052473 ) Dictyosteliu
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC437 (Link to dictyBase) - - - Contig-U16397-1 SLC437Z (Link... to Original site) - - SLC437Z 622 - - - - Show SLC437 Library SL (Link to library) Clone ID SLC437 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC437Q.Seq.d/ Representative seq. ID SLC43...7Z (Link to Original site) Representative DNA sequence >SLC437 (SLC437Q) /CSM/SL/SLC4-B/SLC437Q.Seq.d/ XXXXX...scoideum slug cDNA, clone SLC437. 1158 0.0 1 ( AU033994 ) Dictyostelium discoideum slug cDNA, clone SLB708.
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC433 (Link to dictyBase) - - - Contig-U16397-1 SLC433Z (Link... to Original site) - - SLC433Z 613 - - - - Show SLC433 Library SL (Link to library) Clone ID SLC433 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC433Q.Seq.d/ Representative seq. ID SLC43...3Z (Link to Original site) Representative DNA sequence >SLC433 (SLC433Q) /CSM/SL/SLC4-B/SLC433Q.Seq.d/ XXXXX...tyostelium discoideum slug cDNA, clone SLH872. 1134 0.0 1 ( AU034279 ) Dictyostelium discoideum slug cDNA, clone SLC4
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC440 (Link to dictyBase) - G22407 DDB0231506 Contig-U13322-1 | Contig-U16512-1 SLC4...40P (Link to Original site) SLC440F 491 SLC440Z 449 SLC440P 940 - - Show SLC440 Libra...ry SL (Link to library) Clone ID SLC440 (Link to dictyBase) Atlas ID - NBRP ID G22407 dictyBase ID DDB023150...cdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC440Q.Seq.d/ Representative seq. ID SLC440P (Link to Original site) R...epresentative DNA sequence >SLC440 (SLC440Q) /CSM/SL/SLC4-B/SLC440Q.Seq.d/ GGAGATTTCACCACCACCAACAGAACAACACCA
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC402 (Link to dictyBase) - - - Contig-U16327-1 SLC402E (Link to Original site) SLC4...02F 661 SLC402Z 395 SLC402P 1056 SLC402E 674 Show SLC402 Library SL (Link to library) Clone ID SLC4...inal site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-A/SLC402Q.Seq.d/ Representative seq. ID SLC4...02E (Link to Original site) Representative DNA sequence >SLC402 (SLC402Q) /CSM/SL/SLC4-A/SLC4...lignments: (bits) Value SSC554 (SSC554Q) /CSM/SS/SSC5-C/SSC554Q.Seq.d/ 1128 0.0 SLC402 (SLC4
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC415 (Link to dictyBase) - - - Contig-U16521-1 SLC415E (Link... to Original site) - - - - - - SLC415E 210 Show SLC415 Library SL (Link to library) Clone ID SLC415 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-A/SLC415Q.Seq.d/ Representative seq. ID SLC41...5E (Link to Original site) Representative DNA sequence >SLC415 (SLC415Q) /CSM/SL/SLC4-A/SLC415Q.Seq.d/ CCAAC...lkprdpskfqakkllpsk *iilfsl*k Homology vs CSM-cDNA Score E Sequences producing significant alignments: (bits) Value SLC415 (SLC4
Directory of Open Access Journals (Sweden)
Scott John M
2006-02-01
Full Text Available Abstract Background Folate has emerged as a key nutrient for optimising health. Impaired folate status has been identified as a risk factor for cardiovascular disease, various types of cancers, and neurocognitive disorders. The study aimed at examining the distribution and determinants of serum folate concentrations in a healthy adult population in Crete, Greece. Methods A cross-sectional sample of 486 healthy adults (250 men, 236 women aged 39 ± 14 years, personnel of the Medical School and the University Hospital of Crete in Greece, was examined. Serum folate and vitamin B12 concentrations were measured by microbiological assay, and total homocysteine was determined fluorometrically and by high-pressure liquid chromatography. Lifestyle questionnaires were completed, and nutrient intakes and food consumption were assessed by 24-h dietary recalls. Multivariate analyses were performed using SPSS v10.1. Results The geometric mean (95% confidence interval concentrations of serum folate were 15.6 μmol/l (14.6–16.8 in men and 19.2 μmol/l (17.9–20.7 in women (p 1, and B6 were positively associated with serum folate. Consumption of potatoes, legumes, fruits, and vegetables were favourably related to the serum folate status. Conclusion Serum folate concentrations were associated with various demographic, lifestyle and dietary factors in healthy Cretan adults. Large-scale epidemiological studies should be conducted within the general Greek adult population to assess the prevalence of impaired folate status and further examine associations with dietary patterns and chronic disease risk. Considering the importance of folate in health maintenance, it is important to increase the public's awareness of modifiable lifestyle patterns and diet and tobacco use in particular, which may be associated with improved folate status.
Marchetta, Claire M.; Devine, Owen J.; Crider, Krista S.; Tsang, Becky L.; Cordero, Amy M.; Qi, Yan Ping; Guo, Jing; Berry, Robert J.; Rosenthal, Jorge; Mulinare, Joseph; Mersereau, Patricia; Hamner, Heather C.
2015-01-01
Folate is found naturally in foods or as synthetic folic acid in dietary supplements and fortified foods. Adequate periconceptional folic acid intake can prevent neural tube defects. Folate intake impacts blood folate concentration; however, the dose-response between natural food folate and blood folate concentrations has not been well described. We estimated this association among healthy females. A systematic literature review identified studies (1 1992–3 2014) with both natural food folat...
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC407 (Link to dictyBase) - - - Contig-U16560-1 SLC407Z (Link... to Original site) - - SLC407Z 365 - - - - Show SLC407 Library SL (Link to library) Clone ID SLC407 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-A/SLC407Q.Seq.d/ Representative seq. ID SLC40...7Z (Link to Original site) Representative DNA sequence >SLC407 (SLC407Q) /CSM/SL/SLC4-A/SLC407Q.Seq.d/ XXXXX...vvtkf*cqt e** Homology vs CSM-cDNA Score E Sequences producing significant alignments: (bits) Value SLC407 (SLC407Q) /CSM/SL/SLC4
Wang, Jianting; Wang, Ming; Zheng, Mingming; Guo, Qiong; Wang, Yafan; Wang, Heqing; Xie, Xiangrong; Huang, Fenghong; Gong, Renmin
2015-05-01
Self-assembled core/shell nanoparticles (NPs) were synthesized from water-soluble alginate substituted by hydrophobic phytosterols. Folate, a cancer-cell-specific ligand, was conjugated to the phytosterol-alginate (PA) NPs for targeting folate-receptor-overexpressing cancer cells. The physicochemical properties of folate-phytosterol-alginate (FPA) NPs were characterized by nuclear magnetic resonance, transmission electron microscopy, dynamic light scattering, electrophoretic light scattering, and fluorescence spectroscopy. Doxorubicin (DOX), an anticancer drug, was entrapped inside prepared NPs by dialysis method. The identification of prepared FPA NPs to folate-receptor-overexpressing cancer cells (KB cells) was confirmed by cytotoxicity and folate competition assays. Compared to the pure DOX and DOX/PA NPs, the DOX/FPA NPs had lower IC50 value to KB cells because of folate-receptor-mediated endocytosis process and the cytotoxicity of DOX/FPA NPs to KB cells could be competitively inhibited by free folate. The cellular uptake and internalization of pure DOX and DOX/FPA NPs was confirmed by confocal laser scanning microscopy image and the higher intracellular uptake of drug for DOX/FPA NPs over pure DOX was observed. The FPA NPs had the potential as a promising carrier to target drugs to cancer cells overexpressing folate receptors and avoid cytotoxicity to normal tissues. Copyright © 2015 Elsevier B.V. All rights reserved.
Houghton, Lisa A; Sherwood, Kelly L; O'Connor, Deborah L
2007-10-25
In 1998, mandatory folic acid fortification of white flour and select cereal grain products was implemented in Canada with the intention to increase dietary folate intakes of reproducing women. Folic acid fortification has produced a dramatic increase in blood folate concentrations among reproductive age women, and a reduction in neural tube defect (NTD)-affected pregnancies. In response to improved blood folate concentrations, many health care professionals are asking whether a folic acid supplement is necessary for NTD prevention among women with high blood folate values, and how reliably high RBC folate concentrations predict folate intakes shown in randomized controlled trials to be protective against NTDs. The objective of this study was to determine how predictive blood folate concentrations and folate intakes are of each other in a sample of well-educated lactating Canadian women exposed to high levels of synthetic folate. The relationship between blood folate concentrations and dietary folate intakes, determined by weighed food records, were assessed in a sample of predominantly university-educated lactating women (32 +/- 4 yr) at 4-(n = 53) and 16-wk postpartum (n = 55). Median blood folate concentrations of all participants were well above plasma and RBC folate cut-off levels indicative of deficiency (6.7 and 317 nmol/L, respectively) and all, except for 2 subjects, were above the cut-off for NTD-risk reduction (>906 nmol/L). Only modest associations existed between total folate intakes and plasma (r = 0.46, P consuming 151-410 microg/d of synthetic folate (2nd quartile of intake) did not differ from that of women consuming >410 microg/d (3rd and 4th quartile). Folate intakes, estimated by food composition tables, and blood folate concentrations are not predictive of each other in Canadian lactating women exposed to high levels of folate. Synthetic intakes > 151-410 microg/d in these women produced little additional benefit in terms of maximizing RBC
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC435 (Link to dictyBase) - - - Contig-U16260-1 SLC435E (Link... to Original site) - - - - - - SLC435E 373 Show SLC435 Library SL (Link to library) Clone ID SLC435 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC435Q.Seq.d/ Representative seq. ID SLC43...5E (Link to Original site) Representative DNA sequence >SLC435 (SLC435Q) /CSM/SL/SLC4-B/SLC435Q.Seq.d/ GGAGA...I815Q) /CSM/SL/SLI8-A/SLI815Q.Seq.d/ 694 0.0 SLC435 (SLC435Q) /CSM/SL/SLC4-B/SLC4
Directory of Open Access Journals (Sweden)
Mizuno T
2015-07-01
Full Text Available Tomohiro Mizuno,1–3 Waichi Sato,2,3 Kazuhiro Ishikawa,4 Yuki Terao,1 Kazuo Takahashi,2 Yukihiro Noda,5 Yukio Yuzawa,2 Tadashi Nagamatsu1 1Department of Analytical Pharmacology, Meijo University Faculty of Pharmacy, Nagoya, 2Department of Nephrology, School of Medicine, Fujita Health University, Toyoake, 3Department of Nephrology, Nagoya University School of Medicine, Nagoya, 4Department of Neuropsychopharmacology and Hospital Pharmacy, Nagoya University Graduate School of Medicine, Nagoya, 5Division of Clinical Sciences and Neuropsychopharmacology, Meijo University Faculty of Pharmacy, Nagoya, Japan Background/aim: To elucidate the mechanism responsible for developing acute kidney injury in patients with diabetes mellitus, we also evaluated the issue of whether advanced glycation endproducts (AGEs influence the expressions of multi antimicrobial extrusion protein (MATE1/SLC47A1 in tubular cells. Materials and methods: To detect changing expression of MATE1/SLC47A1 in dose- and time-dependent manners, human proximal tubular epithelial cells were incubated with AGE-aggregated-human serum albumin. As a function assay for MATE1/SLC47A1, human proximal tubular epithelial cells were incubated with cisplatin or carboplatin. Results: On incubation with AGEs, the expressions of MATE1/SLC47A1 were decreased in tubular cells. In addition, the toxicities of cisplatin were increased in tubular cells that had been pretreated with AGEs. However, the toxicities of carboplatin were smaller than that of cisplatin in proximal tubular epithelial cells. Conclusion: The expression of the MATE1/SLC47A1 is decreased by AGEs, which increases the risk for proximal tubular injury. Keywords: advanced glycation endproducts, cisplatin, SLC47A1, diabetes mellitus, acute kidney injury
Differential SLC1A2 Promoter Methylation in Bipolar Disorder With or Without Addiction
Directory of Open Access Journals (Sweden)
Yun-Fang Jia
2017-07-01
Full Text Available While downregulation of excitatory amino acid transporter 2 (EAAT2, the main transporter removing glutamate from the synapse, has been recognized in bipolar disorder (BD, the underlying mechanisms of downregulation have not been elucidated. BD is influenced by environmental factors, which may, via epigenetic modulation of gene expression, differentially affect illness presentation. This study thus focused on epigenetic DNA methylation regulation of SLC1A2, encoding for EAAT2, in BD with variable environmental influences of addiction. High resolution melting PCR (HRM-PCR and thymine–adenine (TA cloning with sequence analysis were conducted to examine methylation of the promoter region of the SLC1A2. DNA was isolated from blood samples drawn from BD patients (N = 150 with or without addiction to alcohol, nicotine, or food, defined as binge eating, and matched controls (N = 32. In comparison to controls, the SLC1A2 promoter region was hypermethylated in BD without addiction but was hypomethylated in BD with addiction. After adjusting for age and sex, the association of methylation levels with nicotine addiction (p = 0.0009 and binge eating (p = 0.0002 remained significant. Consistent with HRM-PCR, direct sequencing revealed increased methylation in CpG site 6 in BD, but decreased methylation in three CpG sites (6, 48, 156 in BD with alcohol and nicotine addictions. These results suggest that individual point methylation within the SLC1A2 promoter region may be modified by exogenous addiction and may have a potential for developing clinically valuable epigenetic biomarkers for BD diagnosis and monitoring.
Directory of Open Access Journals (Sweden)
Daniela Paccagnini
2009-09-01
Full Text Available The etiology of type 1 diabetes mellitus (T1DM is still unknown; numerous studies are performed to unravel the environmental factors involved in triggering the disease. SLC11A1 is a membrane transporter that is expressed in late endosomes of antigen presenting cells involved in the immunopathogenic events leading to T1DM. Mycobacterium avium subsp. paratuberculosis (MAP has been reported to be a possible trigger in the development of T1DM.Fifty nine T1DM patients and 79 healthy controls were genotyped for 9 polymorphisms of SLC11A1 gene, and screened for the presence of MAP by PCR. Differences in genotype frequency were evaluated for both T1DM patients and controls. We found a polymorphism in the SLC11A1 gene (274C/T associated to type 1 diabetic patients and not to controls. The presence of MAP DNA was also significantly associated with T1DM patients and not with controls.The 274C/T SCL11A1 polymorphism was found to be associated with T1DM as well as the presence of MAP DNA in blood. Since MAP persists within macrophages and it is also processed by dendritic cells, further studies are necessary to evaluate if mutant forms of SLC11A1 alter the processing or presentation of MAP antigens triggering thereby an autoimmune response in T1DM patients.
Directory of Open Access Journals (Sweden)
Fei Liu
Full Text Available Hearing loss is one of the most prevalent human birth defects. Genetic factors contribute to the pathogenesis of deafness. It is estimated that one-third of deafness genes have already been identified. The current work is an attempt to find novel genes relevant to hearing loss using guilt-by-profiling and guilt-by-association bioinformatics analyses of approximately 80 known non-syndromic hereditary hearing loss (NSHL genes. Among the 300 newly identified candidate deafness genes, slc26a2 were selected for functional studies in zebrafish. The slc26a2 gene was knocked down using an antisense morpholino (MO, and significant defects were observed in otolith patterns, semicircular canal morphology, and lateral neuromast distributions in morphants. Loss-of-function defects are caused primarily by apoptosis, and morphants are insensitive to sound stimulation and imbalanced swimming behaviours. Morphant defects were found to be partially rescued by co-injection of human SLC26A2 mRNA. All the results suggest that bioinformatics is capable of predicting new deafness genes and this showed slc26a2 is to be a critical otic gene whose dysfunction may induce hearing impairment.
International Nuclear Information System (INIS)
Hong Guobin; Zhou Jingxing; Shen Jun; Liang Biling; Yuan Renxu; Shuai Xintao
2008-01-01
Objective: To evaluate the tumor targeting characteristic of the Folate-SPIO-DOX- Micelles by in vitro studies, and to test the feasibility of monitor tumor targeting using it and clinical MRI. Methods: The polymeric micelles, Folate-SPIO-DOXO-Micelles were prepared. The in vitro tumor cell targeting efficacy of these folate modified and DOX or SPIO-loaded micelles (Folate-SPIO-DOX- MiceUes) was evaluated by observing the cellular uptake of micelles by human hepatic carcinoma cells (Bel 7402 cells) which overexpressed folate surface receptors. Cell suspensions were incubated with Folate-SPIO- DOXO-Micelles for 1 h. Prussian blue staining was performed to show intracellular irons. Flow cytometry was used to further quantify the cellular uptake of the nanoparticles into Bel 7402 cells. MRI was performed to show the signal intensity changes by using T 2 WI sequences at a clinical 1.5 T MR system. Results Prussian blue staining showed much more intracellular iron in cells incubated with Folate-SPIO-DOX- Micelles than the cells incubated with the non-targeting SPIO-DOX-Micelles. As revealed by flow cytometry, the mean fluorescence intensity of cells in the folate group and the non-folate group were 117.88 and 46. 33, respectively. The T 2 signal intensity in MRI of cells treated with the folate targeting micelles decreased significantly(when the concentration of SPIO in cell culture medium was 5, 10, 20, 40, and 80 μg/ml, respectively, T 2 signal intensity decreased by -5.02%, -23.58%, -45.89%, -70.34%, and -92.41%, respectively). In contrast, T 2 signal intensity did not show obvious decrease for cells treated with the folate-free micelles (when the concentration of SPIO in cell culture medium was at 5, 10, 20, 40, and 80 μg/ml, respectively, T 2 signal intensity decreased by -3.77%, -2.16%, -2.18%, -2.74% and -19.77%, respectively). Conclusion: The polymeric micelles, Folate-SPIO-DOX-Micelles has good targeting ability to the hepatic carcinoma cells in vitro, and
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC489 (Link to dictyBase) - - - Contig-U16255-1 SLC489P (Link to Original site) SLC4...89F 628 SLC489Z 172 SLC489P 800 - - Show SLC489 Library SL (Link to library) Clone ID SLC4... URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-D/SLC489Q.Seq.d/ Representative seq. ID SLC4...89P (Link to Original site) Representative DNA sequence >SLC489 (SLC489Q) /CSM/SL/SLC4-D/SLC4...SSD212Q.Seq.d/ 1001 0.0 SLE207 (SLE207Q) /CSM/SL/SLE2-A/SLE207Q.Seq.d/ 1001 0.0 SLC489 (SLC489Q) /CSM/SL/SLC4-D/SLC4
Directory of Open Access Journals (Sweden)
Sherwood Kelly L
2007-10-01
Full Text Available Abstract Background In 1998, mandatory folic acid fortification of white flour and select cereal grain products was implemented in Canada with the intention to increase dietary folate intakes of reproducing women. Folic acid fortification has produced a dramatic increase in blood folate concentrations among reproductive age women, and a reduction in neural tube defect (NTD-affected pregnancies. In response to improved blood folate concentrations, many health care professionals are asking whether a folic acid supplement is necessary for NTD prevention among women with high blood folate values, and how reliably high RBC folate concentrations predict folate intakes shown in randomized controlled trials to be protective against NTDs. The objective of this study was to determine how predictive blood folate concentrations and folate intakes are of each other in a sample of well-educated lactating Canadian women exposed to high levels of synthetic folate. Methods The relationship between blood folate concentrations and dietary folate intakes, determined by weighed food records, were assessed in a sample of predominantly university-educated lactating women (32 ± 4 yr at 4-(n = 53 and 16-wk postpartum (n = 55. Results Median blood folate concentrations of all participants were well above plasma and RBC folate cut-off levels indicative of deficiency (6.7 and 317 nmol/L, respectively and all, except for 2 subjects, were above the cut-off for NTD-risk reduction (>906 nmol/L. Only modest associations existed between total folate intakes and plasma (r = 0.46, P P nd quartile of intake did not differ from that of women consuming >410 μg/d (3rd and 4th quartile. Conclusion Folate intakes, estimated by food composition tables, and blood folate concentrations are not predictive of each other in Canadian lactating women exposed to high levels of folate. Synthetic intakes > 151–410 μg/d in these women produced little additional benefit in terms of maximizing
Höglund, P; Sormaala, M; Haila, S; Socha, J; Rajaram, U; Scheurlen, W; Sinaasappel, M; de Jonge, H; Holmberg, C; Yoshikawa, H; Kere, J
2001-09-01
Congenital chloride diarrhea (CLD) is an autosomal recessive disorder characterized by defective intestinal electrolyte absorption, resulting in voluminous osmotic diarrhea with high chloride content. A variety of mutations in the solute carrier family 26, member 3 gene (SLC26A3, previously known as CLD or DRA) are responsible for the disease. Since the identification of the SLC26A3 gene and the determination of its genomic structure, altogether three founder and 17 private mutations have been characterized within miscellaneous ethnic groups. We screened for mutations in seven unrelated families with CLD. The diagnoses were confirmed by fecal chloride measurements. The combined PCR-SSCP and sequencing analyses revealed altogether seven novel mutations including two missense mutations (S206P, D468V), two splicing defects (IVS12-1G>C, IVS13-2delA), one nonsense mutation (Q436X), one insertion/deletion mutation (2104-2105delGGins29-bp), and an intragenic deletion of SLC26A3 exons 7 and 8. Two previously identified mutations were also found. This is the first report of rearrangement mutations in SLC26A3. Molecular features predisposing SLC26A3 for the two rearrangements may include repetitive elements and palindromic-like sequences. The increasingly wide diversity of SLC26A3 mutations suggests that mutations in the SLC26A3 gene may not be rare events. Copyright 2001 Wiley-Liss, Inc.
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC485 (Link to dictyBase) - - - Contig-U16358-1 SLC485Z (Link... to Original site) - - SLC485Z 452 - - - - Show SLC485 Library SL (Link to library) Clone ID SLC485 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-D/SLC485Q.Seq.d/ Representative seq. ID SLC48...5Z (Link to Original site) Representative DNA sequence >SLC485 (SLC485Q) /CSM/SL/SLC4-D/SLC485Q.Seq.d/ XXXXX... 825 0.0 SLG820 (SLG820Q) /CSM/SL/SLG8-A/SLG820Q.Seq.d/ 825 0.0 SLC485 (SLC485Q) /CSM/SL/SLC4-D/SLC4
SLC30A9 mutation affecting intracellular zinc homeostasis causes a novel cerebro-renal syndrome.
Perez, Yonatan; Shorer, Zamir; Liani-Leibson, Keren; Chabosseau, Pauline; Kadir, Rotem; Volodarsky, Michael; Halperin, Daniel; Barber-Zucker, Shiran; Shalev, Hanna; Schreiber, Ruth; Gradstein, Libe; Gurevich, Evgenia; Zarivach, Raz; Rutter, Guy A; Landau, Daniel; Birk, Ohad S
2017-04-01
A novel autosomal recessive cerebro-renal syndrome was identified in consanguineous Bedouin kindred: neurological deterioration was evident as of early age, progressing into severe intellectual disability, profound ataxia, camptocormia and oculomotor apraxia. Brain MRI was normal. Four of the six affected individuals also had early-onset nephropathy with features of tubulo-interstitial nephritis, hypertension and tendency for hyperkalemia, though none had rapid deterioration of renal function. Genome wide linkage analysis identified an ∼18 Mb disease-associated locus on chromosome 4 (maximal logarithm of odds score 4.4 at D4S2971; θ = 0). Whole exome sequencing identified a single mutation in SLC30A9 within this locus, segregating as expected within the kindred and not found in a homozygous state in 300 Bedouin controls. We showed that SLC30A9 (solute carrier family 30 member 9; also known as ZnT-9) is ubiquitously expressed with high levels in cerebellum, skeletal muscle, thymus and kidney. Confocal analysis of SH-SY5Y cells overexpressing SLC30A9 fused to enhanced green fluorescent protein demonstrated vesicular cytosolic localization associated with the endoplasmic reticulum, not co-localizing with endosomal or Golgi markers. SLC30A9 encodes a putative zinc transporter (by similarity) previously associated with Wnt signalling. However, using dual-luciferase reporter assay in SH-SY5Y cells we showed that Wnt signalling was not affected by the mutation. Based on protein modelling, the identified mutation is expected to affect SLC30A9's highly conserved cation efflux domain, putatively disrupting its transmembrane helix structure. Cytosolic Zn2+ measurements in HEK293 cells overexpressing wild-type and mutant SLC30A9 showed lower zinc concentration within mutant rather than wild-type SLC30A9 cells. This suggests that SLC30A9 has zinc transport properties affecting intracellular zinc homeostasis, and that the molecular mechanism of the disease is through
Directory of Open Access Journals (Sweden)
Angela M Devlin
2010-08-01
Full Text Available Prenatal and early postnatal exposure to maternal depression may "program" childhood behavior via epigenetic processes such as DNA methylation. Methylenetetrahydro-folate reductase (MTHFR is an important enzyme in the generation of methyl groups for DNA methylation. The common MTHFR C677T variant is associated with depression in men and non-pregnant women, and with global changes in DNA methylation. This study investigated the effect of maternal MTHFR C677T genotype on antenatal maternal mood, and their impact on the gene-specific methylation in pregnant women and their newborn infants. The methylation status of SLC6A4, which encodes the transmembrane serotonin transporter, and BDNF, which encodes brain derived neurotrophic factor, were assessed because of their potential role in behaviour.Depressed mood was assessed by the Edinburgh Postnatal Depression Scale (EPDS and the Hamilton Rating Scale for Depression (HAM-D in women (n = 82, all taking folate during the 2(nd and 3(rd trimesters of pregnancy. The methylation status of SLC6A4 and BDNF were assessed in 3rd trimester maternal peripheral leukocytes and in umbilical cord leukocytes collected from their infants at birth. Women with the MTHFR 677TT genotype had greater 2(nd trimester depressed mood (p<0.05. Increased 2(nd trimester maternal depressed mood (EPDS scores was associated with decreased maternal and infant SLC6A4 promoter methylation (p<0.05, but had no effect on BDNF promoter methylation.These findings show that the MTHFR C677T variant is associated with greater depressed mood during pregnancy. We further showed that prenatal exposure to maternal depressed mood affects gene-specific DNA methylation patterns. These findings support the concept that alterations in epigenetic processes may contribute to developmental programming of behaviour by maternal depression.
Directory of Open Access Journals (Sweden)
Mark J. McCann
2014-10-01
Full Text Available Inflammatory bowel disease (IBD is a chronic relapsing disease. Genetic predisposition to the disease reduces an individual’s capacity to respond appropriately to environmental challenges in the intestine leading to inappropriate inflammation. IBD patients often modify their diet to mitigate or reduce the severity of inflammation. Turmeric (Curcuma longa L., Zingiberaceae has historically been used in Chinese, Hindu, and Ayurvedic medicine over several centuries to treat inflammatory disorders. To understand how turmeric may influence the consequences of a genetic predisposition to inappropriate inflammation, we used HEK293 cells to examine the in vitro capacity of turmeric extract and fractions to affect the functionality of two gene variants, solute carrier protein 22 A4 (SLC22A4, rs1050152 and interleukin-10 (IL-10, rs1800896 associated with IBD. We found that a turmeric extract and several chromatographically separated fractions beneficially affected the variants of SLC22A4 and IL-10 associated with IBD, by reducing inappropriate epithelial cell transport (SLC22A4, 503F and increasing anti-inflammatory cytokine gene promoter activity (IL-10, −1082A. The effect of turmeric on the IL-10 variant was strongly associated with the curcumin content of the extract and its fractions.
McCann, Mark J; Johnston, Sarah; Reilly, Kerri; Men, Xuejing; Burgess, Elaine J; Perry, Nigel B; Roy, Nicole C
2014-10-13
Inflammatory bowel disease (IBD) is a chronic relapsing disease. Genetic predisposition to the disease reduces an individual's capacity to respond appropriately to environmental challenges in the intestine leading to inappropriate inflammation. IBD patients often modify their diet to mitigate or reduce the severity of inflammation. Turmeric (Curcuma longa L., Zingiberaceae) has historically been used in Chinese, Hindu, and Ayurvedic medicine over several centuries to treat inflammatory disorders. To understand how turmeric may influence the consequences of a genetic predisposition to inappropriate inflammation, we used HEK293 cells to examine the in vitro capacity of turmeric extract and fractions to affect the functionality of two gene variants, solute carrier protein 22 A4 (SLC22A4, rs1050152) and interleukin-10 (IL-10, rs1800896) associated with IBD. We found that a turmeric extract and several chromatographically separated fractions beneficially affected the variants of SLC22A4 and IL-10 associated with IBD, by reducing inappropriate epithelial cell transport (SLC22A4, 503F) and increasing anti-inflammatory cytokine gene promoter activity (IL-10, -1082A). The effect of turmeric on the IL-10 variant was strongly associated with the curcumin content of the extract and its fractions.
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC443 (Link to dictyBase) - - - Contig-U16518-1 SLC443P (Link to Original site) SLC4...43F 466 SLC443Z 304 SLC443P 770 - - Show SLC443 Library SL (Link to library) Clone ID SLC4... URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC443Q.Seq.d/ Representative seq. ID SLC4...43P (Link to Original site) Representative DNA sequence >SLC443 (SLC443Q) /CSM/SL/SLC4-B/SLC4...Homology vs CSM-cDNA Score E Sequences producing significant alignments: (bits) Value SLC443 (SLC443Q) /CSM/SL/SLC4-B/SLC4
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC429 (Link to dictyBase) - - - Contig-U09691-1 SLC429Z (Link... to Original site) - - SLC429Z 419 - - - - Show SLC429 Library SL (Link to library) Clone ID SLC429 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC429Q.Seq.d/ Representative seq. ID SLC42...9Z (Link to Original site) Representative DNA sequence >SLC429 (SLC429Q) /CSM/SL/SLC4-B/SLC429Q.Seq.d/ XXXXX... significant alignments: (bits) Value SLC429 (SLC429Q) /CSM/SL/SLC4-B/SLC429Q.Seq.d/ 708 0.0 SLC392 (SLC392Q
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC428 (Link to dictyBase) - - - Contig-U10963-1 SLC428P (Link to Original site) SLC4...28F 573 SLC428Z 307 SLC428P 880 - - Show SLC428 Library SL (Link to library) Clone ID SLC4... URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC428Q.Seq.d/ Representative seq. ID SLC4...28P (Link to Original site) Representative DNA sequence >SLC428 (SLC428Q) /CSM/SL/SLC4-B/SLC4...nces producing significant alignments: (bits) Value SLC428 (SLC428Q) /CSM/SL/SLC4-B/SLC428Q.Seq.d/ 1526 0.0
The effect of folate status on the uptake of physiologically relevant compounds by Caco-2 cells.
Tavares, Sandra; Sousa, Joana; Gonçalves, Pedro; Araújo, João R; Martel, Fátima
2010-08-25
The aim of this work was to investigate the effect of folate status on the uptake of several physiologically relevant substances by Caco-2 cells. For this, Caco-2 cells cultured in high-folate conditions (HF) and low-folate conditions (LF) were compared. Growth rates of HF and LF Caco-2 cells were similar. However, proliferation rate of LF cells was greater than that of HF cells during the first 2days of culture and slightly smaller thereafter, viability of LF cells was greater than that of HF cells, and apoptosis index was similar in both cell cultures. We verified that in LF cells, comparatively to HF cells: (1) uptake of [3H]folic acid is upregulated, via an increase in the Vmax of uptake; (2) uptake of [3H]deoxy-glucose, [3H]O-methyl-glucose and [3H]1-methyl-4-phenylpyridinium (MPP+) is downregulated, via a decrease in the Vmax of uptake; additionally, a reduction in Km was observed for [3H]O-methyl-glucose; (3) uptake of [3H]5-hydroxytryptamine and [14C]butyrate is not changed; and (4) the steady-state mRNA levels of the folic acid transporters RFC (reduced folate carrier), PCFT (proton-coupled folate transporter) and FRalpha (folate receptor alpha), of the organic cation transporter OCT1 (organic cation transporter type 1), of the glucose transporter GLUT2 (facilitative glucose transporter type 2) and of the butyrate transporter MCT1 (monocarboxylate transporter type 1) were decreased. In conclusion, folate deficiency produces substrate-specific changes in the uptake of bioactive compounds by Caco-2 cells. Moreover, these changes are associated with alterations in the mRNA levels of specific transporters for these compounds. Copyright (c) 2010 Elsevier B.V. All rights reserved.
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC458 (Link to dictyBase) - - - Contig-U16279-1 SLC458Z (Link... to Original site) - - SLC458Z 508 - - - - Show SLC458 Library SL (Link to library) Clone ID SLC458 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-C/SLC458Q.Seq.d/ Representative seq. ID SLC45...8Z (Link to Original site) Representative DNA sequence >SLC458 (SLC458Q) /CSM/SL/SLC4-C/SLC458Q.Seq.d/ XXXXX...icant alignments: (bits) Value SLC458 (SLC458Q) /CSM/SL/SLC4-C/SLC458Q.Seq.d/ 743
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC474 (Link to dictyBase) - - - Contig-U01121-1 SLC474Z (Link... to Original site) - - SLC474Z 431 - - - - Show SLC474 Library SL (Link to library) Clone ID SLC474 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-D/SLC474Q.Seq.d/ Representative seq. ID SLC47...4Z (Link to Original site) Representative DNA sequence >SLC474 (SLC474Q) /CSM/SL/SLC4-D/SLC474Q.Seq.d/ XXXXX... Score E Sequences producing significant alignments: (bits) Value SLC474 (SLC474Q) /CSM/SL/SLC4-D/SLC474Q.Se
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC425 (Link to dictyBase) - - - Contig-U16276-1 SLC425Z (Link... to Original site) - - SLC425Z 515 - - - - Show SLC425 Library SL (Link to library) Clone ID SLC425 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC425Q.Seq.d/ Representative seq. ID SLC42...5Z (Link to Original site) Representative DNA sequence >SLC425 (SLC425Q) /CSM/SL/SLC4-B/SLC425Q.Seq.d/ XXXXX...producing significant alignments: (bits) Value SLC425 (SLC425Q) /CSM/SL/SLC4-B/SLC4
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC495 (Link to dictyBase) - - - Contig-U03919-1 SLC495E (Link to Original site) SLC4...95F 337 SLC495Z 295 SLC495P 632 SLC495E 337 Show SLC495 Library SL (Link to library) Clone ID SLC4...nal site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-D/SLC495Q.Seq.d/ Representative seq. ID SLC4...95E (Link to Original site) Representative DNA sequence >SLC495 (SLC495Q) /CSM/SL/SLC4-D/SLC4...ficant alignments: (bits) Value SLC495 (SLC495Q) /CSM/SL/SLC4-D/SLC495Q.Seq.d/ 446 e-124 VSF494 (VSF494Q) /C
SLC6 Neurotransmitter Transporters: Structure, Function, and Regulation
DEFF Research Database (Denmark)
Kristensen, Anders S; Andersen, Jacob; Jørgensen, Trine N
2011-01-01
The neurotransmitter transporters (NTTs) belonging to the solute carrier 6 (SLC6) gene family (also referred to as the neurotransmitter-sodium-symporter family or Na(+)/Cl(-)-dependent transporters) comprise a group of nine sodium- and chloride-dependent plasma membrane transporters...... for the monoamine neurotransmitters serotonin (5-hydroxytryptamine), dopamine, and norepinephrine, and the amino acid neurotransmitters GABA and glycine. The SLC6 NTTs are widely expressed in the mammalian brain and play an essential role in regulating neurotransmitter signaling and homeostasis by mediating uptake...... of released neurotransmitters from the extracellular space into neurons and glial cells. The transporters are targets for a wide range of therapeutic drugs used in treatment of psychiatric diseases, including major depression, anxiety disorders, attention deficit hyperactivity disorder and epilepsy...
Lunetti, Paola; Cappello, Anna Rita; Marsano, René Massimiliano; Pierri, Ciro Leonardo; Carrisi, Chiara; Martello, Emanuela; Caggese, Corrado; Dolce, Vincenza; Capobianco, Loredana
2013-10-01
The mitochondrial carriers are members of a family of transport proteins that mediate solute transport across the inner mitochondrial membrane. Two isoforms of the glutamate carriers, GC1 and GC2 (encoded by the SLC25A22 and SLC25A18 genes, respectively), have been identified in humans. Two independent mutations in SLC25A22 are associated with severe epileptic encephalopathy. In the present study we show that two genes (CG18347 and CG12201) phylogenetically related to the human GC encoding genes are present in the D. melanogaster genome. We have functionally characterized the proteins encoded by CG18347 and CG12201, designated as DmGC1p and DmGC2p respectively, by overexpression in Escherichia coli and reconstitution into liposomes. Their transport properties demonstrate that DmGC1p and DmGC2p both catalyze the transport of glutamate across the inner mitochondrial membrane. Computational approaches have been used in order to highlight residues of DmGC1p and DmGC2p involved in substrate binding. Furthermore, gene expression analysis during development and in various adult tissues reveals that CG18347 is ubiquitously expressed in all examined D. melanogaster tissues, while the expression of CG12201 is strongly testis-biased. Finally, we identified mitochondrial glutamate carrier orthologs in 49 eukaryotic species in order to attempt the reconstruction of the evolutionary history of the glutamate carrier function. Comparison of the exon/intron structure and other key features of the analyzed orthologs suggests that eukaryotic glutamate carrier genes descend from an intron-rich ancestral gene already present in the common ancestor of lineages that diverged as early as bilateria and radiata. © 2013.
Affinity labeling of the folate-methotrexate transporter from Leishmania donovani
International Nuclear Information System (INIS)
Beck, J.T.; Ullman, B.
1989-01-01
An affinity labeling technique has been developed to identify the folate-methotrexate transporter of Leishmania donovani promastigotes using activated derivatives of the ligands. These activated derivatives were synthesized by incubating folate and methotrexate with a 10-fold excess of 1-ethyl-3-[3-(dimethylamino)propyl]carbodiimide (EDC) for 10 min at ambient temperature in dimethyl sulfoxide. When intact wild-type (DI700) Leishmania donovani or preparations of their membranes were incubated with a 0.4 μM concentration of either activated [ 3 H]folate or activated [ 3 H]methotrexate, the radiolabeled ligands were covalently incorporated into a polypeptide with a molecular weight of approximately 46,000, as demonstrated by SDS-polyacrylamide gel electrophoresis. No affinity labeling of a 46,000-dalton protein was observed when equimolar concentrations of activated radiolabeled ligands were incubated with intact cells or membranes prepared from a methotrexate-resistant mutant clone of Leishmania donovani, MTXA5, that is genetically defective in folate-methotrexate transport capability. Time course studies indicated that maximal labeling of the 46,000-dalton protein occurred within 5-10 min of incubation of intact cells with activated ligand. These studies provide biochemical evidence that the folate-methotrexate transporter of Leishmania donovani can be identified in crude extracts by an affinity labeling technique and serve as a prerequisite to further analysis of the transport protein by providing a vehicle for subsequent purification of this membrane carrier. Moreover, these investigations suggest that the affinity labeling technique using EDC-activated ligands may be exploitable to analyze other cell surface binding proteins in Leishmania donovani, as well as in other organisms
Shei, William; Liu, Jun; Htoon, Hla M; Aung, Tin; Vithana, Eranga N
2013-01-01
To characterize the relative expression levels of all the solute carrier 4 (Slc4) transporter family members (Slc4a1-Slc4a11) in murine corneal endothelium using real-time quantitative (qPCR), to identify further important members besides Slc4a11 and Slc4a4, and to explore how close to the baseline levels the gene expressions remain after cells have been subjected to expansion and culture. Descemet's membrane-endothelial layers of 8-10-week-old C57BL6 mice were stripped from corneas and used for both primary cell culture and direct RNA extraction. Total RNA (from uncultured cells as well as cultured cells at passages 2 and 7) was reverse transcribed, and the cDNA was used for real time qPCR using specific primers for all the Slc4 family members. The geNorm method was applied to determine the most stable housekeeping genes and normalization factor, which was calculated from multiple housekeeping genes for more accurate and robust quantification. qPCR analyses revealed that all Slc4 bicarbonate transporter family members were expressed in mouse corneal endothelium. Slc4a11 showed the highest expression, which was approximately three times higher than that of Slc4a4 (3.4±0.3; p=0.004). All Slc4 genes were also expressed in cultured cells, and interestingly, the expression of Slc4a11 in cultured cells was significantly reduced by approximately 20-fold (0.05±0.001; p=0.000001) in early passage and by approximately sevenfold (0.14±0.002; p=0.000002) in late passage cells. Given the known involvement of SLC4A4 and SLC4A11 in corneal dystrophies, we speculate that the other two highly expressed genes in the uncultured corneal endothelium, SLC4A2 and SLC4A7, are worthy of being considered as potential candidate genes for corneal endothelial diseases. Moreover, as cell culture can affect expression levels of Slc4 genes, caution and careful design of experiments are necessary when undertaking studies of Slc4-mediated ion transport in cultured cells.
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC473 (Link to dictyBase) - - - Contig-U16054-1 SLC473F (Link to Original site) SLC4...73F 698 - - - - - - Show SLC473 Library SL (Link to library) Clone ID SLC473 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-D/SLC473Q.Seq.d/ Representative seq. ID SLC47...3F (Link to Original site) Representative DNA sequence >SLC473 (SLC473Q) /CSM/SL/SLC4-D/SLC473Q.Seq.d/ AGAAA... CSM-cDNA Score E Sequences producing significant alignments: (bits) Value SLC473 (SLC473Q) /CSM/SL/SLC4
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC483 (Link to dictyBase) - - - Contig-U16486-1 SLC483F (Link to Original site) SLC4...83F 718 - - - - - - Show SLC483 Library SL (Link to library) Clone ID SLC483 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-D/SLC483Q.Seq.d/ Representative seq. ID SLC48...3F (Link to Original site) Representative DNA sequence >SLC483 (SLC483Q) /CSM/SL/SLC4-D/SLC483Q.Seq.d/ AAAAA...roducing significant alignments: (bits) Value SLC483 (SLC483Q) /CSM/SL/SLC4-D/SLC483Q.Seq.d/ 1423 0.0 SLE651
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC434 (Link to dictyBase) - - - Contig-U15434-1 SLC434Z (Link... to Original site) - - SLC434Z 438 - - - - Show SLC434 Library SL (Link to library) Clone ID SLC434 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC434Q.Seq.d/ Representative seq. ID SLC43...4Z (Link to Original site) Representative DNA sequence >SLC434 (SLC434Q) /CSM/SL/SLC4-B/SLC434Q.Seq.d/ XXXXX...logy vs CSM-cDNA Score E Sequences producing significant alignments: (bits) Value SLC434 (SLC434Q) /CSM/SL/SLC4-B/SLC4
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC450 (Link to dictyBase) - - - Contig-U16382-1 SLC450Z (Link... to Original site) - - SLC450Z 416 - - - - Show SLC450 Library SL (Link to library) Clone ID SLC450 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-C/SLC450Q.Seq.d/ Representative seq. ID SLC45...0Z (Link to Original site) Representative DNA sequence >SLC450 (SLC450Q) /CSM/SL/SLC4-C/SLC450Q.Seq.d/ XXXXX...cant alignments: (bits) Value SLC450 (SLC450Q) /CSM/SL/SLC4-C/SLC450Q.Seq.d/ 678 0.0 VFO858 (VFO858Q) /CSM/V
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC469 (Link to dictyBase) - - - Contig-U16584-1 SLC469P (Link to Original site) SLC4...69F 676 SLC469Z 397 SLC469P 1073 - - Show SLC469 Library SL (Link to library) Clone ID SLC4...e URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-C/SLC469Q.Seq.d/ Representative seq. ID SLC4...69P (Link to Original site) Representative DNA sequence >SLC469 (SLC469Q) /CSM/SL/SLC4-C/SLC4...sfflc sklvvik*ncynyp Homology vs CSM-cDNA Score E Sequences producing significant alignments: (bits) Value SLC469 (SLC4
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC452 (Link to dictyBase) - - - Contig-U08358-1 SLC452E (Link to Original site) SLC4...52F 537 SLC452Z 347 SLC452P 884 SLC452E 537 Show SLC452 Library SL (Link to library) Clone ID SLC4...nal site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-C/SLC452Q.Seq.d/ Representative seq. ID SLC4...52E (Link to Original site) Representative DNA sequence >SLC452 (SLC452Q) /CSM/SL/SLC4-C/SLC4...slvtpplffq*skk Homology vs CSM-cDNA Score E Sequences producing significant alignments: (bits) Value SLC4
Orozco, Zenith Gaye A; Soma, Satoshi; Kaneko, Toyoji; Watanabe, Soichi
2017-01-01
The tissue distribution of slc15a1a, a gene that encodes an oligopeptide transporter, PepT1, and its response to fasting and refeeding were investigated in the intestinal epithelium of Mozambique tilapia for a better understanding of its role on nutrient absorption. The slc15a1a was predominantly expressed in the absorptive epithelia of the anterior part of the intestine, suggesting that digested oligopeptides are primarily absorbed in the anterior intestine. The response of slc15a1a to fasting was evaluated at 1, 2, 4, 7 and 14days after the last feeding. Fasting revealed a biphasic effect, where short-term fasting significantly upregulated slc15a1a expression and long-term fasting resulted in downregulation. The expression level continued to decrease and fell below the pre-fasted level from day 4 to 14. Proximal (the hepatic loop, HL) and distal parts (the proximal major coil, PMC) of the anterior intestine showed different magnitudes of responses to fasting; slc15a1a expression in the PMC showed greater upregulation and downregulation than that in the HL. Refeeding significantly stimulated slc15a1a expression at day 3, although the expression did not exceed the pre-fasted level. Observed responses of slc15a1a to fasting and refeeding suggest that the expression level of this gene can serve as a sensitive indicator of the changes that may occur in altering nutritional conditions. These findings contribute to a better understanding of the role of PepT1 in nutrition and of the complex mechanisms underlying the absorption of oligopeptides and amino acids in the intestine, and may lead to development of possible means to manipulate the absorption processes for the improvement of growth and other metabolic and physiological conditions in fish. Copyright © 2016. Published by Elsevier Inc.
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC436 (Link to dictyBase) - - - Contig-U16460-1 SLC436Z (Link... to Original site) - - SLC436Z 344 - - - - Show SLC436 Library SL (Link to library) Clone ID SLC436 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC436Q.Seq.d/ Representative seq. ID SLC43...6Z (Link to Original site) Representative DNA sequence >SLC436 (SLC436Q) /CSM/SL/SLC4-B/SLC436Q.Seq.d/ XXXXX.../CSM/SL/SLE2-C/SLE258Q.Seq.d/ 470 e-132 SLC773 (SLC773Q) /CSM/SL/SLC7-D/SLC773Q.Seq.d/ 470 e-132 SLC4
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC442 (Link to dictyBase) - - - Contig-U16430-1 SLC442Z (Link... to Original site) - - SLC442Z 467 - - - - Show SLC442 Library SL (Link to library) Clone ID SLC442 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC442Q.Seq.d/ Representative seq. ID SLC44...2Z (Link to Original site) Representative DNA sequence >SLC442 (SLC442Q) /CSM/SL/SLC4-B/SLC442Q.Seq.d/ XXXXX... 4.0 %: extracellular, including cell wall 4.0 %: peroxisomal >> prediction for SLC4
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC478 (Link to dictyBase) - - - Contig-U16419-1 SLC478Z (Link... to Original site) - - SLC478Z 400 - - - - Show SLC478 Library SL (Link to library) Clone ID SLC478 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-D/SLC478Q.Seq.d/ Representative seq. ID SLC47...8Z (Link to Original site) Representative DNA sequence >SLC478 (SLC478Q) /CSM/SL/SLC4-D/SLC478Q.Seq.d/ XXXXX... %: cytoplasmic 28.0 %: nuclear 24.0 %: mitochondrial 12.0 %: cytoskeletal >> prediction for SLC4
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC448 (Link to dictyBase) - - - Contig-U15118-1 SLC448E (Link... to Original site) - - - - - - SLC448E 245 Show SLC448 Library SL (Link to library) Clone ID SLC448 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC448Q.Seq.d/ Representative seq. ID SLC44...8E (Link to Original site) Representative DNA sequence >SLC448 (SLC448Q) /CSM/SL/SLC4-B/SLC448Q.Seq.d/ GGTAA... %: nuclear 12.0 %: mitochondrial 8.0 %: cytoskeletal 4.0 %: endoplasmic reticulum >> prediction for SLC4
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC456 (Link to dictyBase) - - - Contig-U16272-1 SLC456Z (Link... to Original site) - - SLC456Z 483 - - - - Show SLC456 Library SL (Link to library) Clone ID SLC456 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-C/SLC456Q.Seq.d/ Representative seq. ID SLC45...6Z (Link to Original site) Representative DNA sequence >SLC456 (SLC456Q) /CSM/SL/SLC4-C/SLC456Q.Seq.d/ XXXXX...0 %: vacuolar 4.0 %: peroxisomal >> prediction for SLC456 is nuc 5' end seq. ID -
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC455 (Link to dictyBase) - - - Contig-U16584-1 SLC455Z (Link... to Original site) - - SLC455Z 379 - - - - Show SLC455 Library SL (Link to library) Clone ID SLC455 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-C/SLC455Q.Seq.d/ Representative seq. ID SLC45...5Z (Link to Original site) Representative DNA sequence >SLC455 (SLC455Q) /CSM/SL/SLC4-C/SLC455Q.Seq.d/ XXXXX...57 ) Dictyostelium discoideum slug cDNA, clone SLC469. 468 e-177 3 ( AU034549 ) Dictyostelium discoideum slug cDNA, clone SLC4
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC464 (Link to dictyBase) - - - Contig-U00917-1 SLC464Z (Link... to Original site) - - SLC464Z 406 - - - - Show SLC464 Library SL (Link to library) Clone ID SLC464 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-C/SLC464Q.Seq.d/ Representative seq. ID SLC46...4Z (Link to Original site) Representative DNA sequence >SLC464 (SLC464Q) /CSM/SL/SLC4-C/SLC464Q.Seq.d/ XXXXX... Homology vs CSM-cDNA Score E Sequences producing significant alignments: (bits) Value SLC464 (SLC4
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC477 (Link to dictyBase) - - - Contig-U16260-1 SLC477Z (Link... to Original site) - - SLC477Z 326 - - - - Show SLC477 Library SL (Link to library) Clone ID SLC477 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-D/SLC477Q.Seq.d/ Representative seq. ID SLC47...7Z (Link to Original site) Representative DNA sequence >SLC477 (SLC477Q) /CSM/SL/SLC4-D/SLC477Q.Seq.d/ XXXXX...hfefsnivikskkkkkkkkkkkkkk Homology vs CSM-cDNA Score E Sequences producing significant alignments: (bits) Value SLC477 (SLC4
Folate-modified lipid–polymer hybrid nanoparticles for targeted paclitaxel delivery
Directory of Open Access Journals (Sweden)
Zhang L
2015-03-01
Full Text Available Linhua Zhang,1 Dunwan Zhu,1 Xia Dong,1 Hongfan Sun,1 Cunxian Song,1 Chun Wang,2 Deling Kong1 1Tianjin Key Laboratory of Biomaterials, Institute of Biomedical Engineering, Peking Union Medical College and Chinese Academy of Medical Sciences, Tianjin, People’s Republic of China; 2Department of Biomedical Engineering, University of Minnesota, Minneapolis, MN, USA Abstract: The purpose of this study was to develop a novel lipid–polymer hybrid drug carrier comprised of folate (FA modified lipid-shell and polymer-core nanoparticles (FLPNPs for sustained, controlled, and targeted delivery of paclitaxel (PTX. The core-shell NPs consist of 1 a poly(ε-caprolactone hydrophobic core based on self-assembly of poly(ε-caprolactone–poly(ethylene glycol–poly(ε-caprolactone (PCL-PEG-PCL amphiphilic copolymers, 2 a lipid monolayer formed with 1,2-distearoyl-sn-glycero-3-phosphoethanolamine-N-[methoxy (polyethylene glycol-2000] (DSPE-PEG2000, 3 a targeting ligand (FA on the surface, and were prepared using a thin-film hydration and ultrasonic dispersion method. Transmission electron microscopy and dynamic light scattering analysis confirmed the coating of the lipid monolayer on the hydrophobic polymer core. Physicochemical characterizations of PTX-loaded FLPNPs, such as particle size and size distribution, zeta potential, morphology, drug loading content, encapsulation efficiency, and in vitro drug release, were also evaluated. Fluorescent microscopy proved the internalization efficiency and targeting ability of the folate conjugated on the lipid monolayer for the EMT6 cancer cells which overexpress folate receptor. In vitro cytotoxicity assay demonstrated that the cytotoxic effect of PTX-loaded FLPNPs was lower than that of Taxol®, but higher than that of PTX-loaded LPNPs (without folate conjugation. In EMT6 breast tumor model, intratumoral administration of PTX-loaded FLPNPs showed similar antitumor efficacy but low toxicity compared to Taxol®. More
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC486 (Link to dictyBase) - - - Contig-U16480-1 SLC486E (Link... to Original site) - - - - - - SLC486E 451 Show SLC486 Library SL (Link to library) Clone ID SLC486 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-D/SLC486Q.Seq.d/ Representative seq. ID SLC48...6E (Link to Original site) Representative DNA sequence >SLC486 (SLC486Q) /CSM/SL/SLC4-D/SLC486Q.Seq.d/ GTCAT...7Q.Seq.d/ 868 0.0 SLD427 (SLD427Q) /CSM/SL/SLD4-B/SLD427Q.Seq.d/ 868 0.0 SLC486 (SLC486Q) /CSM/SL/SLC4-D/SLC4
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC470 (Link to dictyBase) - - - Contig-U15735-1 SLC470Z (Link... to Original site) - - SLC470Z 386 - - - - Show SLC470 Library SL (Link to library) Clone ID SLC470 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-C/SLC470Q.Seq.d/ Representative seq. ID SLC47...0Z (Link to Original site) Representative DNA sequence >SLC470 (SLC470Q) /CSM/SL/SLC4-C/SLC470Q.Seq.d/ XXXXX...Seq.d/ 533 e-151 SLF229 (SLF229Q) /CSM/SL/SLF2-B/SLF229Q.Seq.d/ 533 e-151 SLC470 (SLC470Q) /CSM/SL/SLC4-C/SLC4
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC466 (Link to dictyBase) - - - Contig-U16381-1 SLC466Z (Link... to Original site) - - SLC466Z 427 - - - - Show SLC466 Library SL (Link to library) Clone ID SLC466 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-C/SLC466Q.Seq.d/ Representative seq. ID SLC46...6Z (Link to Original site) Representative DNA sequence >SLC466 (SLC466Q) /CSM/SL/SLC4-C/SLC466Q.Seq.d/ XXXXX... AU034556 ) Dictyostelium discoideum slug cDNA, clone SLC466. 176 2e-77 2 ( AU033496 ) Dictyostelium discoid
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC444 (Link to dictyBase) - - - Contig-U16368-1 SLC444Z (Link... to Original site) - - SLC444Z 462 - - - - Show SLC444 Library SL (Link to library) Clone ID SLC444 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC444Q.Seq.d/ Representative seq. ID SLC44...4Z (Link to Original site) Representative DNA sequence >SLC444 (SLC444Q) /CSM/SL/SLC4-B/SLC444Q.Seq.d/ XXXXX...tochondrial 8.0 %: nuclear 4.0 %: cytoskeletal 4.0 %: cytoplasmic >> prediction for SLC444 is mit 5' end seq
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC490 (Link to dictyBase) - - - Contig-U16444-1 SLC490Z (Link... to Original site) - - SLC490Z 427 - - - - Show SLC490 Library SL (Link to library) Clone ID SLC490 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-D/SLC490Q.Seq.d/ Representative seq. ID SLC49...0Z (Link to Original site) Representative DNA sequence >SLC490 (SLC490Q) /CSM/SL/SLC4-D/SLC490Q.Seq.d/ XXXXX...itochondrial 24.0 %: cytoplasmic 24.0 %: nuclear 4.0 %: cytoskeletal 4.0 %: plasma membrane 4.0 %: peroxisomal >> prediction for SLC4
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC484 (Link to dictyBase) - - - Contig-U15497-1 SLC484Z (Link... to Original site) - - SLC484Z 462 - - - - Show SLC484 Library SL (Link to library) Clone ID SLC484 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-D/SLC484Q.Seq.d/ Representative seq. ID SLC48...4Z (Link to Original site) Representative DNA sequence >SLC484 (SLC484Q) /CSM/SL/SLC4-D/SLC484Q.Seq.d/ XXXXX...mic 32.0 %: mitochondrial 16.0 %: nuclear 4.0 %: peroxisomal 4.0 %: endoplasmic reticulum >> prediction for SLC4
Baas, Dominique C.; Ho, Lintje; Tanck, Michael W.T.; Fritsche, Lars G.; Merriam, Joanna E.; van het Slot, Ruben; Koeleman, Bobby P.C.; Gorgels, Theo G.M.F.; van Duijn, Cornelia M.; Uitterlinden, André G.; de Jong, Paulus T.V.M.; Hofman, Albert; ten Brink, Jacoline B.; Vingerling, Johannes R.; Klaver, Caroline C.W.; Dean, Michael; Weber, Bernhard H. F.; Allikmets, Rando; Hageman, Gregory S.
2012-01-01
Purpose Age-related macular degeneration (AMD) is a major cause of blindness in older adults and has a genetically complex background. This study examines the potential association between single nucleotide polymorphisms (SNPs) in the glucose transporter 1 (SLC2A1) gene and AMD. SLC2A1 regulates the bioavailability of glucose in the retinal pigment epithelium (RPE), which might influence oxidative stress–mediated AMD pathology. Methods Twenty-two SNPs spanning the SLC2A1 gene were genotyped in 375 cases and 199 controls from an initial discovery cohort (the Amsterdam-Rotterdam-Netherlands study). Replication testing was performed in The Rotterdam Study (the Netherlands) and study populations from Würzburg (Germany), the Age Related Eye Disease Study (AREDS; United States), Columbia University (United States), and Iowa University (United States). Subsequently, a meta-analysis of SNP association was performed. Results In the discovery cohort, significant genotypic association between three SNPs (rs3754219, rs4660687, and rs841853) and AMD was found. Replication in five large independent (Caucasian) cohorts (4,860 cases and 4,004 controls) did not yield consistent association results. The genotype frequencies for these SNPs were significantly different for the controls and/or cases among the six individual populations. Meta-analysis revealed significant heterogeneity of effect between the studies. Conclusions No overall association between SLC2A1 SNPs and AMD was demonstrated. Since the genotype frequencies for the three SLC2A1 SNPs were significantly different for the controls and/or cases between the six cohorts, this study corroborates previous evidence that population dependent genetic risk heterogeneity in AMD exists. PMID:22509097
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC438 (Link to dictyBase) - - - Contig-U10771-1 SLC438Z (Link... to Original site) - - SLC438Z 549 - - - - Show SLC438 Library SL (Link to library) Clone ID SLC438 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC438Q.Seq.d/ Representative seq. ID SLC43...8Z (Link to Original site) Representative DNA sequence >SLC438 (SLC438Q) /CSM/SL/SLC4-B/SLC438Q.Seq.d/ XXXXX...es producing significant alignments: (bits) Value SSM825 (SSM825Q) /CSM/SS/SSM8-B/SSM825Q.Seq.d/ 948 0.0 SLC438 (SLC4
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC480 (Link to dictyBase) - - - Contig-U13538-1 SLC480Z (Link... to Original site) - - SLC480Z 455 - - - - Show SLC480 Library SL (Link to library) Clone ID SLC480 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-D/SLC480Q.Seq.d/ Representative seq. ID SLC48...0Z (Link to Original site) Representative DNA sequence >SLC480 (SLC480Q) /CSM/SL/SLC4-D/SLC480Q.Seq.d/ XXXXX...ial 8.0 %: peroxisomal >> prediction for SLC480 is nuc 5' end seq. ID - 5' end seq. - Length of 5' end seq. - 3' end seq. ID SLC4
Energy Technology Data Exchange (ETDEWEB)
Duan Jinghua [Xiangya Hospital, Central South University, Hepatobiliary and Enteric Surgery Research Center (China); Liu Mujun [Central South University, School of Biological Science and Technology (China); Zhang Yangde; Zhao Jinfeng; Pan Yifeng [Xiangya Hospital, Central South University, Hepatobiliary and Enteric Surgery Research Center (China); Yang Xiyun, E-mail: bax_2007@126.com [Central South University, School of Metallurgical Science and Engineering (China)
2012-03-15
A novel chitosan coated poly(butyl cyanoacrylate) (PBCA) nanoparticles loaded doxorubicin (DOX) were synthesized and then conjugated with folic acid to produce a folate-targeted drug carrier for tumor-specific drug delivery. Prepared nanoparticles were surface modified by folate for targeting cancer cells, which is confirmed by FTIR spectroscopy and characterized for shape, size, and zeta potential measurements. The size and zeta potential of prepared DOX-PBCA nanoparticles (DOX-PBCA NPs) were almost 174 {+-} 8.23 nm and +23.14 {+-} 4.25 mV, respectively with 46.8 {+-} 3.32% encapsulation capacity. The transmission electron microscopy study revealed that preparation allowed the formation of spherical nanometric and homogeneous. Fluorescent microscopy imaging and flow cytometry analysis revealed that DOX-PBCA NPs were endocytosed into MCF-7 cells through the interaction with overexpressed folate receptors on the surface of the cancer cells. The results demonstrate that folate-conjugated DOX-PBCA NPs drug delivery system could provide increased therapeutic benefit by delivering the encapsulated drug to the folate receptor positive cancer cells.
DEFF Research Database (Denmark)
Antoniou, Antonis C; Beesley, Jonathan; McGuffog, Lesley
2010-01-01
The known breast cancer susceptibility polymorphisms in FGFR2, TNRC9/TOX3, MAP3K1, LSP1, and 2q35 confer increased risks of breast cancer for BRCA1 or BRCA2 mutation carriers. We evaluated the associations of 3 additional single nucleotide polymorphisms (SNPs), rs4973768 in SLC4A7/NEK10, rs650495...
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC832 (Link to dictyBase) - - - Contig-U13922-1 SLC832Z (Link... to Original site) - - SLC832Z 638 - - - - Show SLC832 Library SL (Link to library) Clone ID SLC832 (Link to dic..._1( EU565733 |pid:none) Uncultured soil bacterium clone gl... 35 2.4 CP000010_276....1 AP009385_2728( AP009385 |pid:none) Burkholderia multivorans ATCC 1... 33 5.3 A... 20.0 %: nuclear 16.0 %: vesicles of secretory system 12.0 %: mitochondrial 8.0 %: Golgi 8.0 %: endoplasmic reticul
Merker, Sören; Reif, Andreas; Ziegler, Georg C; Weber, Heike; Mayer, Ute; Ehlis, Ann-Christine; Conzelmann, Annette; Johansson, Stefan; Müller-Reible, Clemens; Nanda, Indrajit; Haaf, Thomas; Ullmann, Reinhard; Romanos, Marcel; Fallgatter, Andreas J; Pauli, Paul; Strekalova, Tatyana; Jansch, Charline; Vasquez, Alejandro Arias; Haavik, Jan; Ribasés, Marta; Ramos-Quiroga, Josep Antoni; Buitelaar, Jan K; Franke, Barbara; Lesch, Klaus-Peter
2017-07-01
Attention-deficit/hyperactivity disorder (ADHD) is a common, highly heritable neurodevelopmental disorder with profound cognitive, behavioral, and psychosocial impairments with persistence across the life cycle. Our initial genome-wide screening approach for copy number variants (CNVs) in ADHD implicated a duplication of SLC2A3, encoding glucose transporter-3 (GLUT3). GLUT3 plays a critical role in cerebral glucose metabolism, providing energy for the activity of neurons, which, in turn, moderates the excitatory-inhibitory balance impacting both brain development and activity-dependent neural plasticity. We therefore aimed to provide additional genetic and functional evidence for GLUT3 dysfunction in ADHD. Case-control association analyses of SLC2A3 single-nucleotide polymorphisms (SNPs) and CNVs were conducted in several European cohorts of patients with childhood and adult ADHD (SNP, n = 1,886 vs. 1,988; CNV, n = 1,692 vs. 1,721). These studies were complemented by SLC2A3 expression analyses in peripheral cells, functional EEG recordings during neurocognitive tasks, and ratings of food energy content. Meta-analysis of all cohorts detected an association of SNP rs12842 with ADHD. While CNV analysis detected a population-specific enrichment of SLC2A3 duplications only in German ADHD patients, the CNV + rs12842 haplotype influenced ADHD risk in both the German and Spanish cohorts. Duplication carriers displayed elevated SLC2A3 mRNA expression in peripheral blood cells and altered event-related potentials reflecting deficits in working memory and cognitive response control, both endophenotypic traits of ADHD, and an underestimation of energy units of high-caloric food. Taken together, our results indicate that both common and rare SLC2A3 variation impacting regulation of neuronal glucose utilization and energy homeostasis may result in neurocognitive deficits known to contribute to ADHD risk. © 2017 Association for Child and Adolescent Mental Health.
DEFF Research Database (Denmark)
Milman, N; Byg, KE; Hvas, Anne-Mette
2006-01-01
OBJECTIVE: To assess folate and homocysteine status during normal pregnancy and postpartum in a longitudinal setting. METHODS: This study, performed in 1995-1996, comprised 404 healthy pregnant Danish Caucasian women residential in Copenhagen County. Women taking folic acid tablets or vitamin B12...... injections were not included. Dietary multivitamin supplements containing folic acid 100 microg or vitamin B12 1 microg, taken by 34%, were discontinued at inclusion. Participants had normal renal function. Folate status [erythrocyte (Ery-) folate, plasma (P-) folate, P-homocysteine] was measured at 18, 32...... new guidelines for folic acid supplement since 1997, only 13% of pregnant women followed the guidelines in 2003. The official recommendations for periconceptional folic acid supplement should be reconsidered and reinforced....
Solute carrier transporters: potential targets for digestive system neoplasms.
Xie, Jing; Zhu, Xiao Yan; Liu, Lu Ming; Meng, Zhi Qiang
2018-01-01
Digestive system neoplasms are the leading causes of cancer-related death all over the world. Solute carrier (SLC) superfamily is composed of a series of transporters that are ubiquitously expressed in organs and tissues of digestive systems and mediate specific uptake of small molecule substrates in facilitative manner. Given the important role of SLC proteins in maintaining normal functions of digestive system, dysregulation of these protein in digestive system neoplasms may deliver biological and clinical significance that deserves systemic studies. In this review, we critically summarized the recent advances in understanding the role of SLC proteins in digestive system neoplasms. We highlighted that several SLC subfamilies, including metal ion transporters, transporters of glucose and other sugars, transporters of urea, neurotransmitters and biogenic amines, ammonium and choline, inorganic cation/anion transporters, transporters of nucleotide, amino acid and oligopeptide organic anion transporters, transporters of vitamins and cofactors and mitochondrial carrier, may play important roles in mediating the initiation, progression, metastasis, and chemoresistance of digestive system neoplasms. Proteins in these SLC subfamilies may also have diagnostic and prognostic values to particular cancer types. Differential expression of SLC proteins in tumors of digestive system was analyzed by extracting data from human cancer database, which revealed that the roles of SLC proteins may either be dependent on the substrates they transport or be tissue specific. In addition, small molecule modulators that pharmacologically regulate the functions of SLC proteins were discussed for their possible application in the treatment of digestive system neoplasms. This review highlighted the potential of SLC family proteins as drug target for the treatment of digestive system neoplasms.
Distribution and expression of SLC45A2 in the skin of sheep with different coat colors.
Wang, Haidong; Xue, Linli; Li, Yanan; Zhao, Bingling; Chen, Tianzhi; Liu, Ying; Chang, Lucheng; Wang, Juan
2016-01-01
To investigate whether the membrane-associated transporter protein SLC45A2 is differentially expressed in the skin of sheep with different coat colors and to determine its correlation with coat color establishment in sheep. The expression of SLC45A2 in sheep skin samples with different coat colors was qualitatively and quantitatively analyzed by PCR amplification, RT-PCR, immunohistochemical staining and Western blotting. A 193-bp SLC45A2 CDS sequence was successfully amplified from sheep skin samples with diverse coat colors. RT-PCR analysis revealed that SLC45A2 mRNA was expressed in all sheep skin samples tested, with relative expression levels of 512.74 ± 121.51 in black skin, 143.38 ± 119.31 and 1.36 ± 0.09 in black dots and white dots of piebald skin, respectively, and 1.02 ± 0.23 in white skin (p coat colors. These patterns were quantified by optical density (OD) analysis, which yielded relative expression levels of 0.23 ± 0.11 in black skin, 0.19 ± 0.09 and 0.10 ± 0.03 in black dots and white dots of piebald skin, respectively, and 0.08 ± 0.01 in white skin (p coat colors, though at significantly different levels. SLC45A2 may participate in the establishment of coat color by regulating the synthesis and trafficking of melanin.
Directory of Open Access Journals (Sweden)
Sughondhabirom Atapol
2007-10-01
Full Text Available Abstract Background GABA transporter-1 (GAT-1; genetic locus SLC6A1 is emerging as a novel target for treatment of neuropsychiatric disorders. To understand how population differences might influence strategies for pharmacogenetic studies, we identified patterns of genetic variation and linkage disequilibrium (LD in SLC6A1 in five populations representing three continental groups. Results We resequenced 12.4 kb of SLC6A1, including the promoters, exons and flanking intronic regions in African-American, Thai, Hmong, Finnish, and European-American subjects (total n = 40. LD in SLC6A1 was examined by genotyping 16 SNPs in larger samples. Sixty-three variants were identified through resequencing. Common population-specific variants were found in African-Americans, including a novel 21-bp promoter region variable number tandem repeat (VNTR, but no such variants were found in any of the other populations studied. Low levels of LD and the absence of major LD blocks were characteristic of all five populations. African-Americans had the highest genetic diversity. European-Americans and Finns did not differ in genetic diversity or LD patterns. Although the Hmong had the highest level of LD, our results suggest that a strategy based on the use of tag SNPs would not translate to a major improvement in genotyping efficiency. Conclusion Owing to the low level of LD and presence of recombination hotspots, SLC6A1 may be an example of a problematic gene for association and haplotype tagging-based genetic studies. The 21-bp promoter region VNTR polymorphism is a putatively functional candidate allele for studies focusing on variation in GAT-1 function in the African-American population.
Directory of Open Access Journals (Sweden)
Salvador Villalpando
2015-09-01
Full Text Available Objective. To describe the frequency of anemia, iron, vitamin B12, folate, retinol and predictors of anemia among Mexican children from Ensanut 2012. Materials and methods. Hemoglobin, ferritin, CRP, vitamin B12, retinol and folate concentrations were measured in 2 678 children aged 1-4 y and 4 275 children aged 5-11 y. Adjusted logistic regression models were constructed to assess the risk for anemia and micronutrient deficiencies. Results. In preschoolers and scholars, the overall prevalence of anemia was 20.4 and 9.7%, iron deficiency 14 and 9.3%, low vitamin B12 (LB12S 1.9 and 2.6%; Folate 0.30 and 0%, and retinol depletion (VADp 15.7 and 2.3%, respectively. ID and VADp were negatively associated with Hb (coefficient: -0.38 and -0.45, p<0.05; a higher log-CRP was associated with higher risk for anemia and VADp (OR=1.13 and OR=2.1, p<0.05, respectively. Conclusions. Iron deficiency, anemia and VADp are some of the main nutritional problems among Mexican infants
Villalpando, Salvador; Cruz, Vanessa de la; Shamah-Levy, Teresa; Rebollar, Rosario; Contreras-Manzano, Alejandra
2015-01-01
To describe the frequency of anemia, iron, vitamin B12, folate, retinol and predictors of anemia among Mexican children from Ensanut 2012. Hemoglobin, ferritin, CRP, vitamin B12, retinol and folate concentrations were measured in 2 678 children aged 1-4 y and 4 275 children aged 5-11 y. Adjusted logistic regression models were constructed to assess the risk for anemia and micronutrient deficiencies. In preschoolers and scholars, the overall prevalence of anemia was 20.4 and 9.7%, iron deficiency 14 and 9.3%, low vitamin B12 (LB12S) 1.9 and 2.6%; Folate 0.30 and 0%, and retinol depletion (VADp) 15.7 and 2.3%, respectively. ID and VADp were negatively associated with Hb (coefficient: -0.38 and -0.45, p<0.05); a higher log-CRP was associated with higher risk for anemia and VADp (OR=1.13 and OR=2.1, p<0.05, respectively). Iron deficiency, anemia and VADp are some of the main nutritional problems among Mexican infants.
Pfeiffer, Christine M.; Sternberg, Maya R.; Fazili, Zia; Lacher, David A.; Zhang, Mindy; Johnson, Clifford L.; Hamner, Heather C.; Bailey, Regan L.; Rader, Jeanne I.; Yamini, Sedigheh; Berry, R. J.; Yetley, Elizabeth A.
2016-01-01
Serum and red blood cell (RBC) total folate are indicators of folate status. No nationally representative population data exist for folate forms. We measured serum folate forms [5-methyltetrahydrofolate (5-methylTHF), unmetabolized folic acid (UMFA), non-methyl folate (sum of THF, 5-formylTHF, 5,10-methenylTHF), and MeFox (5-methylTHF oxidation product)] by HPLC-MS/MS and RBC total folate by microbiologic assay in US persons ≥1 year (n ~7500) participating in the National Health and Nutrition Examination Survey 2011–2. Data analysis for serum total folate was conducted including and excluding MeFox. Concentrations (geometric mean; detection rate) of 5-methylTHF (37.5 nmol/L; 100%), UMFA (1.21 nmol/L; 99.9%), MeFox (1.53 nmol/L; 98.8%), and THF (1.01 nmol/L; 85.2%) were mostly detectable. 5-FormylTHF (3.6%) and 5,10-methenylTHF (4.4%) were rarely detected. The biggest contributor to serum total folate was 5-methylTHF (86.7%); UMFA (4.0%), non-methyl folate (4.7%), and MeFox (4.5%) contributed smaller amounts. Age was positively related to MeFox but showed a U-shaped pattern for other folates. We generally noted sex and race-ethnic biomarker differences and weak (Spearman r folates. All biomarkers showed significantly higher concentrations with recent folic acid-containing dietary supplement use. These first-time population data for serum folate forms generally show similar associations with demographic, physiologic, and lifestyle variables as serum total folate. Patterns observed for MeFox may suggest altered folate metabolism dependent on biological characteristics. PMID:25917925
Zhao, Zheng; Song, Zhangjun; Wang, Xuwei; Sun, Haifeng; Yang, Xiaomin; Yuan, Yong; Yu, Pan
2017-01-01
ROS1 fusion is a common genetic alteration in non-small-cell lung cancer. Crizotinib, an anaplastic lymphoma kinase inhibitor, shows efficacy in the treatment of lung cancer cases with ROS1 translocation. We report the response to crizotinib of a lung adenocarcinoma patient harboring a novel SLC34A2-ROS1 fusion variant, which was different from the two common SLC34A2-ROS1 fusion types reported in the literature. After crizotinib administration, overall recovery was good in this patient; the primary lesion was successfully treated, the lymph node metastases had disappeared, and the metabolism was normal. PMID:28860822
Pfeiffer, Christine M; Sternberg, Maya R; Fazili, Zia; Lacher, David A; Zhang, Mindy; Johnson, Clifford L; Hamner, Heather C; Bailey, Regan L; Rader, Jeanne I; Yamini, Sedigheh; Berry, R J; Yetley, Elizabeth A
2015-06-28
Serum and erythrocyte (RBC) total folate are indicators of folate status. No nationally representative population data exist for folate forms. We measured the serum folate forms (5-methyltetrahydrofolate (5-methylTHF), unmetabolised folic acid (UMFA), non-methyl folate (sum of tetrahydrofolate (THF), 5-formyltetrahydrofolate (5-formylTHF), 5,10-methenyltetrahydrofolate (5,10-methenylTHF)) and MeFox (5-methylTHF oxidation product)) by HPLC-MS/MS and RBC total folate by microbiologic assay in US population ≥ 1 year (n approximately 7500) participating in the National Health and Nutrition Examination Survey 2011-2. Data analysis for serum total folate was conducted including and excluding MeFox. Concentrations (geometric mean; detection rate) of 5-methylTHF (37·5 nmol/l; 100 %), UMFA (1·21 nmol/l; 99·9 %), MeFox (1·53 nmol/l; 98·8 %), and THF (1·01 nmol/l; 85·2 %) were mostly detectable. 5-FormylTHF (3·6 %) and 5,10-methenylTHF (4·4 %) were rarely detected. The biggest contributor to serum total folate was 5-methylTHF (86·7 %); UMFA (4·0 %), non-methyl folate (4·7 %) and MeFox (4·5 %) contributed smaller amounts. Age was positively related to MeFox, but showed a U-shaped pattern for other folates. We generally noted sex and race/ethnic biomarker differences and weak (Spearman's rfolates. All biomarkers showed significantly higher concentrations with recent folic acid-containing dietary supplement use. These first-time population data for serum folate forms generally show similar associations with demographic, physiological and lifestyle variables as serum total folate. Patterns observed for MeFox may suggest altered folate metabolism dependent on biological characteristics.
Neurosteroid Transport in the Brain: Role of ABC and SLC Transporters
Directory of Open Access Journals (Sweden)
Markus Grube
2018-04-01
Full Text Available Neurosteroids, comprising pregnane, androstane, and sulfated steroids can alter neuronal excitability through interaction with ligand-gated ion channels and other receptors and have therefore a therapeutic potential in several brain disorders. They can be formed in brain cells or are synthesized by an endocrine gland and reach the brain by penetrating the blood–brain barrier (BBB. Especially sulfated steroids such as pregnenolone sulfate (PregS and dehydroepiandrosterone sulfate (DHEAS depend on transporter proteins to cross membranes. In this review, we discuss the involvement of ATP-binding cassette (ABC- and solute carrier (SLC-type membrane proteins in the transport of these compounds at the BBB and in the choroid plexus (CP, but also in the secretion from neurons and glial cells. Among the ABC transporters, especially BCRP (ABCG2 and several MRP/ABCC subfamily members (MRP1, MRP4, MRP8 are expressed in the brain and known to efflux conjugated steroids. Furthermore, several SLC transporters have been shown to mediate cellular uptake of steroid sulfates. These include members of the OATP/SLCO subfamily, namely OATP1A2 and OATP2B1, as well as OAT3 (SLC22A3, which have been reported to be expressed at the BBB, in the CP and in part in neurons. Furthermore, a role of the organic solute transporter OSTα-OSTβ (SLC51A/B in brain DHEAS/PregS homeostasis has been proposed. This transporter was reported to be localized especially in steroidogenic cells of the cerebellum and hippocampus. To date, the impact of transporters on neurosteroid homeostasis is still poorly understood. Further insights are desirable also with regard to the therapeutic potential of these compounds.
Study on folate receptor PET imaging agent 18F-flurophenethyl folate
International Nuclear Information System (INIS)
Guo Congying; Zhu Jianhua; Qian Jun; Yang Yang; Shen Haixing; Zhang Zhengwei
2009-01-01
This work is aimed at synthesizing an 18 F-labelled folate derivative that can be used as folate-receptor induced tumor PET imaging agent. Under the optimal reaction and testing specification formulated during the cold-labeling experiments, 18 F labeling of folic acid was achieved in three steps of 18 F pre-labeling,bromination and esterification. The receptor binding property of the newly-synthesized folate radio-derivative was studied through β-lactoglobulin binding test. Tumor-bearing nude mice injected with the new compound were used to study whether the derivative can accumulate within tumor issue. Preliminary studies in vitro and in vivo showed that this new PET agent still possessed receptor binding qualities of folic acid. 18 F-flurophenethyl folate remained good affinity and specificity with β-lactoglobulin. Accumulation of activities in tumor tissues was found in tumor-bearing nude mice. A new folate receptor ligand: 18 F-flurophenethyl folate was synthesized,with high yield and good stability. Since the pre-labeling method was used, the fluorine labeling was not directly imposed upon folic acid.In this way, the structure destruction, which happens in high temperature reaction of folic acid, can be avoided. The synthesized folate derivative remained the binding structural quality of folic acid and could bind with the folate-binding protein: β-lactoglobulin. Through the folate receptors located on tumor tissues, 18 F-flurophenethyl folate accumulated in the tumor tissue, exhibiting its potential as a tumor PET imaging agent. (authors)
Zhang, Xu; Yang, Xiao; Wang, Mengmeng; Li, Xiaona; Xia, Qing; Xu, Shengqian; Xu, Jianhua; Cai, Guoqi; Wang, Li; Xin, Lihong; Zou, Yanfeng; Pan, Faming
2016-08-01
The relationship between the SLC2A9 (solute carrier family 2, member 9) gene polymorphisms and gout was still inconsistent among the individual genetic association studies. Therefore, this present research was aimed to systematically evaluate the association between SLC2A9 gene polymorphisms and gout susceptibility. Relevant studies were enrolled by searching databases systematically. The pooled odds ratios (ORs) with 95 % confidence intervals (CIs) were used to assess the associations. The heterogeneity between each of the studies was calculated by using the Q statistic methods, and Begg's funnel plot and Egger's tests were performed to evaluate publication bias. A total of 13 studies investigated four single nucleotide polymorphisms (SNPs) in SLC2A9 were included. In this study, we found that the allele C of rs3733591 was higher in patients than in controls in both all-pooled population [C vs. T: OR (95 % CI) = 1.432 (1.213-1.691)] and Asians-pooled population [C vs. T: OR (95 % CI) = 1.583 (1.365-1.835)]. The allele frequency C of s6449213 was lower in the gout patients than in controls in both all-pooled population and Caucasians-pooled population. Additionally, the allele frequency T of rs16890979 and the allele frequency C of rs1014290 were lower in gout patients than in controls. This study demonstrated that the genetic susceptibility for gout is associated with the SLC2A9 gene polymorphisms. Four of them except for the rs3733591 are protective SNPs in Caucasians, and rs16890979 and rs1014290 are protective SNPs in both Caucasians and Asians, while rs3733591 may be susceptibility SNP in Asians.
International Nuclear Information System (INIS)
Givas, J.K.; Gutcho, S.
1976-01-01
In the radioassay of folates, the standard is prepared by using folic acid (pteroyl glutamic acid; PGA) as the standard folate at a pH of 9.2 to 9.4. At such pH values, folic acid and 5-methyltetrahydrofolic acid (the predominant folate in human serum) have essentially identical reactivity towards folate binders, whereby folic acid can replace unstable 5-methyltetrahydrofolic acid standard for such assays
Elevated SLC26A4 gene promoter methylation is associated with the risk of presbycusis in men.
Xu, Jin; Zheng, Jiachen; Shen, Wanjing; Ma, Lili; Zhao, Ming; Wang, Xubo; Tang, Jiyuan; Yan, Jihong; Wu, Zhenhua; Zou, Zuquan; Bu, Shizhong; Xi, Yang
2017-07-01
Presbycusis affects approximately one-third of people over the age of 65 and is a worldwide health problem. In the current study, whether the methylation level of solute carrier family 26 member 4 (SLC26A4) predicted an increased risk of presbycusis was investigated. Peripheral blood samples from 102 patients with presbycusis and 104 controls were collected, and the methylation of the CpG sites of SLC26A4 was measured by applying pyrosequencing technology combined with sodium bisulfate DNA conversion chemistry. Within the SLC26A4 promoter region, one CpG site (CpG3) exhibited a significantly (Ppresbycusis (26.5±5.56%) compared with the controls (23.8±3.85%). Significantly different CpG3 methylation levels were observed between the patients with presbycusis and the controls among the male participants (P=0.0004). In addition, a significant decrease in the transcriptional level of SLC26A4 in peripheral blood was observed in the patients with presbycusis compared with the controls. Furthermore, analyses of the receiver operating characteristic (ROC) curves indicated that CpG3 methylation at the SLC26A4 promoter predicted the risk of presbycusis in the male participants (AUC=0.684, 95% CI=0.584‑0.784, P=0.001). The results demonstrated the significance of the CpG site methylation level of SLC26A4, and thus provides a potential marker for the diagnosis of presbycusis.
Galaktionova, D Iu; Gareeva, A E; Khusnutdinova, E K; Nasedkina, T V
2014-01-01
We have developed a biochip for the analysis of polymorphisms in candidate genes for schizophrenia: DISC1, RELN, ZNF804A, PLXNA2, COMT, SLC18A41, CACNA1C, ANK3, TPH1, PLAA and SNAP-25. Using biochip the allele and genotype frequencies in 198 patients with schizophrenia and 192 healthy individuals have been obtained. For SLC18A1 polymorphism rs2270641 A>C, the frequencies of A allele (p = 0.007) and AA genotype (p = 0.002) were lower in patients compared with healthy individuals. A significant association was found between AA genotype (p = 0.036) of the TPH1 polymorphism rs1800532 C>A and schizophrenia. The C allele (p = 0.039) of the RELNpolymorphism rs7341475 C>T were lower in patients with schizophrenia compared with healthy individuals in a tatar population. Genotype AA of the TPH1 polymorphism rs1800532 C>A were more frequent in patients with schizophrenia compared with healthy individuals. Ithas been shown that the C allele (p = 0.0001) and GC (p = = 0.0001) genotype of the PLXNA2 polymorphism rs1327175 G>C are associated with the family history in patients with paranoid schizophrenia. The obtained data suggest that SLC18A1, TPH1 and RELN gene polymorphisms are associated with the risk of paranoid schizophrenia.
Changes in oil content of transgenic soybeans expressing the yeast SLC1 gene.
Rao, Suryadevara S; Hildebrand, David
2009-10-01
The wild type (Wt) and mutant form of yeast (sphingolipid compensation) genes, SLC1 and SLC1-1, have been shown to have lysophosphatidic acid acyltransferase (LPAT) activities (Nageic et al. in J Biol Chem 269:22156-22163, 1993). Expression of these LPAT genes was reported to increase oil content in transgenic Arabidopsis and Brassica napus. It is of interest to determine if the TAG content increase would also be seen in soybeans. Therefore, the wild type SLC1 was expressed in soybean somatic embryos under the control of seed specific phaseolin promoter. Some transgenic somatic embryos and in both T2 and T3 transgenic seeds showed higher oil contents. Compared to controls, the average increase in triglyceride values went up by 1.5% in transgenic somatic embryos. A maximum of 3.2% increase in seed oil content was observed in a T3 line. Expression of the yeast Wt LPAT gene did not alter the fatty acid composition of the seed oil.
MBL, P2X7, and SLC11A1 gene polymorphisms in patients with oropharyngeal tularemia.
Somuk, Battal Tahsin; Koc, Sema; Ates, Omer; Göktas, Göksel; Soyalic, Harun; Uysal, Ismail Onder; Gurbuzler, Levent; Sapmaz, Emrah; Sezer, Saime; Eyibilen, Ahmet
2016-11-01
A significant association was found of oropharyngeal tularemia with SLC11A1 allele polymorphism (INT4 G/C) and MBL2 C + 4T (P/Q). These results indicate C allele and Q allele might be a risk factor for the development of oropharyngeal tularemia. This study aimed to investigate the relationship of SLC11A1, MBL, and P2X 7 gene polymorphism with oropharyngeal tularemia. The study included totally 120 patients who were diagnosed with oropharyngeal tularemia. Frequencies of polymorphisms in the following genes were analyzed both in the patient and control groups in the study: SLC11A1 (5'(GT) n Allele 2/3, Int4 G/C, 3' UTR, D543N G/A), MBL (MBL2 C + 4T (P/Q), and P2X 7 (-762 C/T and 1513 A/C). Among all polymorphisms that were investigated in this study, SLC11A1 gene showed a significance in the distriburtion of polymorphism allelle frequency at the INT4 region. Frequency of C allele was 54 (28%) in patients with oropharyngeal tularemia, and 31 (13%) in the control group (p = 0.006 and OR = 1.96 (1.21-3.20)). An association was detected between MBL2 C + 4T (P/Q) gene polymorphism and oropharyngeal tularemia (p tularemia in this study (p > 0.05).
Chen, Kaitian; Wang, Xianren; Sun, Liang; Jiang, Hongyan
2012-06-01
Bilateral nonsyndromic sensorineural hearing loss associated with inner ear malformation is closely related to genetics. SLC26A4 is considered to be the major involved gene. Recently, FOXI1 and KCNJ10 mutations have been linked to enlarged vestibular aqueducts and GJB2 mutations linked to temporal bone malformation. The authors aimed to investigate the mutation spectrums of these genes in Chinese patients with bilateral hearing impairment associated with inner ear malformation. Cross-sectional study. Affiliated hospital of the university. The authors analyzed the GJB2, SLC26A4, FOXI1, and KCNJ10 gene sequences in 43 patients presenting with bilateral hearing impairment associated with inner ear malformation using pyrosequencing and direct DNA sequencing. In total, 74.4% (32/43) of patients carried at least 1 of 14 pathogenic SLC26A4 mutations, including 6 novel mutations and 4 polymorphisms. Patients with enlarged vestibular aqueducts had a higher rate of SLC26A4 mutation than Mondini dysplasia patients. No FOXI1 or KCNJ10 potential pathogenic mutation was present, and GJB2 biallelic pathogenic mutations were uncommon (2.3%; 1/43). No significant correlation was observed between the genotype and phenotype of SLC26A4 mutations. SLC26A4 accounts for 74.4% of inner ear malformations in our cohort, whereas FOXI1, KCNJ10, and GJB2 mutations are not common. Other possible genes or external factors may contribute to this multibranch abnormality.
Positive selection in the SLC11A1 gene in the family Equidae.
Bayerova, Zuzana; Janova, Eva; Matiasovic, Jan; Orlando, Ludovic; Horin, Petr
2016-05-01
Immunity-related genes are a suitable model for studying effects of selection at the genomic level. Some of them are highly conserved due to functional constraints and purifying selection, while others are variable and change quickly to cope with the variation of pathogens. The SLC11A1 gene encodes a transporter protein mediating antimicrobial activity of macrophages. Little is known about the patterns of selection shaping this gene during evolution. Although it is a typical evolutionarily conserved gene, functionally important polymorphisms associated with various diseases were identified in humans and other species. We analyzed the genomic organization, genetic variation, and evolution of the SLC11A1 gene in the family Equidae to identify patterns of selection within this important gene. Nucleotide SLC11A1 sequences were shown to be highly conserved in ten equid species, with more than 97 % sequence identity across the family. Single nucleotide polymorphisms (SNPs) were found in the coding and noncoding regions of the gene. Seven codon sites were identified to be under strong purifying selection. Codons located in three regions, including the glycosylated extracellular loop, were shown to be under diversifying selection. A 3-bp indel resulting in a deletion of the amino acid 321 in the predicted protein was observed in all horses, while it has been maintained in all other equid species. This codon comprised in an N-glycosylation site was found to be under positive selection. Interspecific variation in the presence of predicted N-glycosylation sites was observed.
DEFF Research Database (Denmark)
Larsen, Jan; Johannesen, Katrine Marie; Ek, Jakob
2015-01-01
The first mutations identified in SLC2A1, encoding the glucose transporter type 1 (GLUT1) protein of the blood-brain barrier, were associated with severe epileptic encephalopathy. Recently, dominant SLC2A1 mutations were found in rare autosomal dominant families with various forms of epilepsy inc...
Elevated homocysteine levels indicate suboptimal folate status in pediatric sickle cell patients
van der Dijs, FPL; Schnog, JJB; Brouwer, DAJ; Velvis, HJR; van den Berg, GA; Bakker, AJ; Duits, AJ; Muskiet, FD
1998-01-01
We investigated whether pediatric patients with sickle cell disease (SCD) (9 +/- 4 years; 27 homozygous SCD [HbSS]; 19 sickle-C disease [HbSC]) have different folate status compared with age-, sex-, and race-matched normal hemoglobin (HbAA) controls (n = 20), and whether their folate status can be
Energy Technology Data Exchange (ETDEWEB)
Khan, D A; Fatima, S; Imran, R; Khan, F A [National Univ. of Science and Technology, Army Medical College, Rawalpindi (Pakistan). Department of Pathology
2010-01-15
Background: Anaemia in pregnancy is a common clinical problem contributing to increased maternal and foetal morbidity. This study was carried out to determine frequency of iron, folate and cobalamin deficiency and associated risk factors in the anaemic pregnant females who reported first time during second and third trimester for antenatal check-up in the tertiary care hospital at Rawalpindi. Methods: This case control study was carried out in a tertiary care hospital at Rawalpindi. Two hundred and fifty pregnant women (age: 19-43 years) consisting of 125 anaemic (Hb< 110 g/L) and 125 non-anaemic who reported first time at antenatal clinic were included. Data on socio-demographic characteristics, parity and dietary intake were collected. Complete blood counts were done. Serum ferritin, folate and cobalamin assays were performed by using DPC kits on Immulite-1000. Results: The pregnant women were categorised having mild (Hb up to 54%), moderate (Hb up to 36%), or severe (Hb up to 10%) anaemia during antennal visit. They had significantly lower median (range) levels of haemoglobin 96 (40-110) g/L, ferritin 8 (3-54) nu mu/L, folate 15 (3-54) mu mol/L and cobalamin 171 (111-629) mu mol/L than controls (p=<0.01). Micro nutrient analysis revealed secondary pregnancy related deficiency of Iron (57%), folate (20%), combined iron and folate (19%) and cobalamin (4%) in the female. Among the risk factors, low income (OR: 7.69), multi party (OR: 2.93), lack of iron/folate supplementation (OR 2.91) and inadequate dietary intakes (OR 2.51) were associated with anaemia. Conclusion: The pregnant anaemic women had iron (57%); folate (20%), followed by combined iron folate (19%), and cobalamin (4%) deficiency during first antenatal visit. Low income, multi party, poor diet and lack of supplements are the main contributor in development of anaemia during pregnancy. (author)
International Nuclear Information System (INIS)
Khan, D.A.; Fatima, S.; Imran, R.; Khan, F.A.
2010-01-01
Background: Anaemia in pregnancy is a common clinical problem contributing to increased maternal and foetal morbidity. This study was carried out to determine frequency of iron, folate and cobalamin deficiency and associated risk factors in the anaemic pregnant females who reported first time during second and third trimester for antenatal check-up in the tertiary care hospital at Rawalpindi. Methods: This case control study was carried out in a tertiary care hospital at Rawalpindi. Two hundred and fifty pregnant women (age: 19-43 years) consisting of 125 anaemic (Hb< 110 g/L) and 125 non-anaemic who reported first time at antenatal clinic were included. Data on socio-demographic characteristics, parity and dietary intake were collected. Complete blood counts were done. Serum ferritin, folate and cobalamin assays were performed by using DPC kits on Immulite-1000. Results: The pregnant women were categorised having mild (Hb up to 54%), moderate (Hb up to 36%), or severe (Hb up to 10%) anaemia during antennal visit. They had significantly lower median (range) levels of haemoglobin 96 (40-110) g/L, ferritin 8 (3-54) nu mu/L, folate 15 (3-54) mu mol/L and cobalamin 171 (111-629) mu mol/L than controls (p=<0.01). Micro nutrient analysis revealed secondary pregnancy related deficiency of Iron (57%), folate (20%), combined iron and folate (19%) and cobalamin (4%) in the female. Among the risk factors, low income (OR: 7.69), multi party (OR: 2.93), lack of iron/folate supplementation (OR 2.91) and inadequate dietary intakes (OR 2.51) were associated with anaemia. Conclusion: The pregnant anaemic women had iron (57%); folate (20%), followed by combined iron folate (19%), and cobalamin (4%) deficiency during first antenatal visit. Low income, multi party, poor diet and lack of supplements are the main contributor in development of anaemia during pregnancy. (author)
Mutations in the GABA Transporter SLC6A1 Cause Epilepsy with Myoclonic-Atonic Seizures
Carvill, Gemma L.; McMahon, Jacinta M.; Schneider, Amy; Zemel, Matthew; Myers, Candace T.; Saykally, Julia; Nguyen, John; Robbiano, Angela; Zara, Federico; Specchio, Nicola; Mecarelli, Oriano; Smith, Robert L.; Leventer, Richard J.; Møller, Rikke S.; Nikanorova, Marina; Dimova, Petia; Jordanova, Albena; Petrou, Steven; Helbig, Ingo; Striano, Pasquale; Weckhuysen, Sarah; Berkovic, Samuel F.; Scheffer, Ingrid E.; Mefford, Heather C.
2015-01-01
GAT-1, encoded by SLC6A1, is one of the major gamma-aminobutyric acid (GABA) transporters in the brain and is responsible for re-uptake of GABA from the synapse. In this study, targeted resequencing of 644 individuals with epileptic encephalopathies led to the identification of six SLC6A1 mutations in seven individuals, all of whom have epilepsy with myoclonic-atonic seizures (MAE). We describe two truncations and four missense alterations, all of which most likely lead to loss of function of GAT-1 and thus reduced GABA re-uptake from the synapse. These individuals share many of the electrophysiological properties of Gat1-deficient mice, including spontaneous spike-wave discharges. Overall, pathogenic mutations occurred in 6/160 individuals with MAE, accounting for ∼4% of unsolved MAE cases. PMID:25865495
Liu, Henry C; Goldenberg, Anne; Chen, Yuchen; Lun, Christina; Wu, Wei; Bush, Kevin T; Balac, Natasha; Rodriguez, Paul; Abagyan, Ruben; Nigam, Sanjay K
2016-10-01
Statistical analysis was performed on physicochemical descriptors of ∼250 drugs known to interact with one or more SLC22 "drug" transporters (i.e., SLC22A6 or OAT1, SLC22A8 or OAT3, SLC22A1 or OCT1, and SLC22A2 or OCT2), followed by application of machine-learning methods and wet laboratory testing of novel predictions. In addition to molecular charge, organic anion transporters (OATs) were found to prefer interacting with planar structures, whereas organic cation transporters (OCTs) interact with more three-dimensional structures (i.e., greater SP3 character). Moreover, compared with OAT1 ligands, OAT3 ligands possess more acyclic tetravalent bonds and have a more zwitterionic/cationic character. In contrast, OCT1 and OCT2 ligands were not clearly distinquishable form one another by the methods employed. Multiple pharmacophore models were generated on the basis of the drugs and, consistent with the machine-learning analyses, one unique pharmacophore created from ligands of OAT3 possessed cationic properties similar to OCT ligands; this was confirmed by quantitative atomic property field analysis. Virtual screening with this pharmacophore, followed by transport assays, identified several cationic drugs that selectively interact with OAT3 but not OAT1. Although the present analysis may be somewhat limited by the need to rely largely on inhibition data for modeling, wet laboratory/in vitro transport studies, as well as analysis of drug/metabolite handling in Oat and Oct knockout animals, support the general validity of the approach-which can also be applied to other SLC and ATP binding cassette drug transporters. This may make it possible to predict the molecular properties of a drug or metabolite necessary for interaction with the transporter(s), thereby enabling better prediction of drug-drug interactions and drug-metabolite interactions. Furthermore, understanding the overlapping specificities of OATs and OCTs in the context of dynamic transporter tissue
Directory of Open Access Journals (Sweden)
Yuan-Zong Song
Full Text Available BACKGROUND: The human SLC25A13 gene encodes citrin, the liver-type mitochondrial aspartate/glutamate carrier isoform 2 (AGC2, and SLC25A13 mutations cause citrin deficiency (CD, a disease entity that encompasses different age-dependant clinical phenotypes such as Adult-onset Citrullinemia Type II (CTLN2 and Neonatal Intrahepatic Cholestasis caused by Citrin Deficiency (NICCD. The analyses of SLC25A13 gene and its protein/mRNA products remain reliable tools for the definitive diagnoses of CD patients, and so far, the SLC25A13 mutation spectrum in Chinese CD patients has not been well-characterized yet. METHODS AND RESULTS: By means of direct DNA sequencing, cDNA cloning and SNP analyses, 16 novel pathogenic mutations, including 9 missense, 4 nonsense, 1 splice-site, 1 deletion and 1 large transposal insertion IVS4ins6kb (GenBank accession number KF425758, were identified in CTLN2 or NICCD patients from China, Japan and Malaysia, respectively, making the SLC25A13 variations worldwide reach the total number of 81. A large NICCD cohort of 116 Chinese cases was also established, and the 4 high-frequency mutations contributed a much larger proportion of the mutated alleles in the patients from south China than in those from the north (χ(2 = 14.93, P<0.01, with the latitude of 30°N as the geographic dividing line in mainland China. CONCLUSIONS: This paper further enriched the SLC25A13 variation spectrum worldwide, and formed a substantial contribution to the in-depth understanding of the genotypic feature of Chinese CD patients.
Chen, Wei; Zhong, Rong; Ming, Jie; Zou, Li; Zhu, Beibei; Lu, Xuzai; Ke, Juntao; Zhang, Yu; Liu, Li; Miao, Xiaoping; Huang, Tao
2012-12-01
Recent genome-wide association study has identified a genetic variant rs4973768, located in 3'-UTR of solute carrier family 4, sodium bicarbonate cotransporter, member 7 (SLC4A7), was associated with increased risk of breast cancer (BC). However, several following replication studies cannot yield consistent results. We thus conducted a hospital-based case-control study including 485 patients and 514 controls, combined a meta-analysis including 108,632 cases and 135,818 controls to explore the relationship between this variant and BC risk. Our case-control study showed that rs4973768 was significantly associated with increased BC risk with the odds ratio (OR) of 1.29 (95 % confidence interval [CI]: 1.04-1.60) under the allelic model. In addition, the meta-analysis also indicated that the variant slightly increased the risk of BC with the pooled OR of the per-allele effect being 1.08 (95 % CI: 1.04-1.11) although with significant heterogeneity between studies. Stratified analyses showed that ethnicity, sample size, and study design may explain part of the heterogeneity. Moreover, the bioinformatics analysis suggested that this variant may influence the transcriptional capacity of SLC4A7. In summary, our results showed that the SLC4A7 variant, rs4973768, is associated with risk of BC although the underlying biologic mechanism warrants further studies.
Tu, Hung-Pin; Chung, Chia-Min; Min-Shan Ko, Albert; Lee, Su-Shin; Lai, Han-Ming; Lee, Chien-Hung; Huang, Chung-Ming; Liu, Chiu-Shong; Ko, Ying-Chin
2016-09-01
The aim of the present study was to evaluate the contribution of urate transporter genes and alcohol use to the risk of gout/tophi. Eight variants of ABCG2, SLC2A9, SLC22A12, SLC22A11 and SLC17A3 were genotyped in male individuals in a case-control study with 157 gout (33% tophi), 106 asymptomatic hyperuricaemia and 295 control subjects from Taiwan. The multilocus profiles of the genetic risk scores for urate gene variants were used to evaluate the risk of asymptomatic hyperuricaemia, gout and tophi. ABCG2 Q141K (T), SLC2A9 rs1014290 (A) and SLC22A12 rs475688 (C) under an additive model and alcohol use independently predicted the risk of gout (respective odds ratio for each factor=2.48, 2.03, 1.95 and 2.48). The additive composite Q141K, rs1014290 and rs475688 scores of high-risk alleles were associated with gout risk (Pgout and tophi risk (P for interaction=0.0452, 0.0033). The synergistic effect of genetic urate score 5-6 and alcohol use indicates that these combined factors correlate with gout and tophi occurrence.
Ma, Rui; Wang, Linlin; Jin, Lei; Li, Zhiwen; Ren, Aiguo
2017-07-17
Optimal blood folate levels of women before pregnancy are critical to the prevention of neural tube defects (NTDs). However, few studies have focused on blood folate levels of women planning to become pregnant. The aims of this study were to assess plasma folate levels in women who planned to become pregnant in a population with high prevalence of NTDs, to identify factors associated with plasma folate levels, and to evaluate the risk of NTDs at the population level. A total of 2065 women were enrolled at the time of premarital health check-up in two rural counties in northern China from November 2009 to December 2012. Fasting venous blood samples were collected and plasma folate concentrations were measured by microbiological method. The overall median of plasma folate was 10.5 nmol/L. 50% of the women had a plasma folate level below 10.5 nmol/L, a cutoff for megaloblastic anemia, and 88% below 18 nmol/L, a proposed optimal plasma folate level for the prevention of NTDs. Folic acid supplementation was the only factor to be associated with plasma folate concentrations, but only 1.9% of the women reported having taken folic acid supplements. A population risk of 29.3 NTD cases per 10,000 births was predicted. Women who planned to become pregnant had very low plasma folate in the population. Folic acid supplementation was the only factor to be associated with a high plasma folate concentration. High NTD risk would remain if women would get pregnant without having taken folic acid supplements. Birth Defects Research 109:1039-1047, 2017. © 2017 Wiley Periodicals, Inc. © 2017 Wiley Periodicals, Inc.
The role of SCL2A1 in Early Onset and Childhood Absence Epilepsies
DEFF Research Database (Denmark)
Brusgaard, Klaus
brother and the paternal grandmother. Conclusion: Our study confirmed the role of SLC2A1 mutation carriers in EOAE and demonstrated that SLC2A1 do not seem to play a major role in CAE and JAE. Since ketogenic diet is a well known treatment option in GLUT-1-deficiency, pediatricians as well as neurologists...
International Nuclear Information System (INIS)
Piyasena, R.D.; Weerasekera, D.A.; Hettiaratchi, N.; Wikramanayake, T.W.
1978-01-01
Preparations of cow, goat, buffalo and human milk in addition to pig plasma were tested for folate binding properties. Of these, only pig plasma and goat milk showed sufficient binding to enable them to be used as binding agents in a radioassay for serum and whole-blood folate. The binding of folate by cow milk preparations in particular was found to be very poor. Goat milk was preferred to pig plasma as a binder for folate radioassay for reasons of convenience, economy and greater stability, and because pteroylglutamic acid (PGA) can be used both as tracer and standard. Where pig plasma is used with the inclusion of folate-free serum in the standard tubes, differences were observed between the standard and serum blanks which themselves varied from sample to sample. By contrast, with goat milk, all blank readings were normally 3% or less. Five out of eight samples of goat milk were seen to contain 'releasing factor' necessary to liberate folate from endogenous binder (FABP). Where present, the factor was found to be stable for at least three months when the partially purified milk was stored freeze dried at 4 0 C. Goat milk binder was found unable to distinguish between PGA and methyltetrahydrofolic acid (MTFA) at pH9.3. This enabled PGA rather than the more unstable MTFA to be used as tracer and standard. The assay employs a one-step incubation procedure at room temperature. It is sensitive to about 0.1 ng of PGA and is reproducible to less than 5% variation. The mean % recovery of inactive added folate was 101+-4%. (author)
Voruganti, V Saroja; Laston, Sandra; Haack, Karin; Mehta, Nitesh R; Cole, Shelley A; Butte, Nancy F; Comuzzie, Anthony G
2015-04-01
Elevated concentrations of serum uric acid are associated with increased risk of gout and renal and cardiovascular diseases. Genetic studies in adults have consistently identified associations of solute carrier family 2, member 9 (SLC2A9), polymorphisms with variation in serum uric acid. However, it is not known whether the association of serum uric acid with SLC2A9 polymorphisms manifests in children. The aim was to investigate whether variation in serum uric acid is under genetic influence and whether the association with SLC2A9 polymorphisms generalizes to Hispanic children of the Viva La Familia Study. We conducted a genomewide association study with 1.1 million genetic markers in 815 children. We found serum uric acid to be significantly heritable [h(2) ± SD = 0.45 ± 0.08, P = 5.8 × 10(-11)] and associated with SLC2A9 variants (P values between 10(-16) and 10(-7)). Several of the significantly associated polymorphisms were previously identified in studies in adults. We also found positive genetic correlations between serum uric acid and BMI z score (ρG = 0.45, P = 0.002), percentage of body fat (ρG = 0.28, P = 0.04), fat mass (ρG = 0.34, P = 0.02), waist circumference (ρG = 0.42, P = 0.003), and waist-to-height ratio (ρG = 0.46, P = 0.001). Our results show that variation in serum uric acid in Hispanic children is under considerable genetic influence and is associated with obesity-related phenotypes. As in adults, genetic variation in SLC2A9 is associated with serum uric acid concentrations, an important biomarker of renal and cardiovascular disease risk, in Hispanic children. © 2015 American Society for Nutrition.
International Nuclear Information System (INIS)
Fani, Melpomeni; Maecke, Helmut R.; Wang, Xuejuan; Nicolas, Guillaume; Medina, Christelle; Raynal, Isabelle; Port, Marc
2011-01-01
A number of 111 In- and 99m Tc-folate-based tracers have been evaluated as diagnostic agents for imaging folate receptor (FR)-positive tumours. A 68 Ga-folate-based radiopharmaceutical would be of great interest, combining the advantages of PET technology and the availability of 68 Ga from a generator. The aim of the study was to develop a new 68 Ga-folate-based PET radiotracer. Two new DOTA-folate conjugates, named P3026 and P1254, were synthesized using the 1,2-diaminoethane and 3-{2-[2-(3-amino-propoxy)-ethoxy]-ethoxy}-propylamine as a spacer, respectively. Both conjugates were labelled with 67/68 Ga. Binding affinity, internalization and externalization studies were performed using the FR-positive KB cell line. Biodistribution and PET/CT imaging studies were performed in nude mice, on a folate-deficient diet, bearing KB and HT1080 (FR-negative) tumours, concurrently. The new radiotracers were evaluated comparatively to the reference molecule 111 In-DTPA-folate ( 111 In-P3139). The K d values of 67/68 Ga-P3026 (4.65 ± 0.82 nM) and 67/68 Ga-P1254 (4.27 ± 0.42 nM) showed high affinity for the FR. The internalization rate followed the order 67/68 Ga-P3026 > 67/68 Ga-P1254 > 111 In-P3139, while almost double cellular retention was found for 67/68 Ga-P3026 and 67/68 Ga-P1254, compared to 111 In-P3139. The biodistribution data of 67/68 Ga-DOTA-folates showed high and receptor-mediated uptake on the FR-positive tumours and kidneys, with no significant differences compared to 111 In-P3139. PET/CT images, performed with 68 Ga-P3026, showed high uptake in the kidneys and clear visualization of the FR-positive tumours. The DOTA-folate conjugates can be efficiently labelled with 68 Ga in labelling yields and specific activities which allow clinical application. The characteristics of the 67/68 Ga-DOTA-folates are comparable to 111 In-DTPA-folate, which has already been used in clinical trials, showing that the new conjugates are promising candidates as PET radiotracers
Extremely high concentration of folates in premature newborns.
Zikavska, T; Brucknerova, I
2014-01-01
Extremely high concentration of folates in premature newborns: case reports. Folates are a group of water soluble compounds, which are important for metabolic processes in human body. These are important during periods of rapid cell growth. The most accurate indicator of long-term folate level status in the body is the determination of red blood cell (RBC) folate concentrations. The optimal level of RBC folate is not known in neonatal period. Authors discuss the reasons for extremely high level of RBC folate concentrations. In our work we present the cases of two premature newborns with extremely high level of RBC folate concentrations, which were analyzed immunochemically on the first day of life and after six weeks of life. In both cases we measured RBC folate concentrations on the 1st day of life. After 6 weeks we found extremely high RBC folate concentration level (5516.67 ng/ml) in the first case after RBC transfusions. In second case after two months of life the RBC folate concentration level was doubled (2335.1 ng/ml) until 24 hours after RBC transfusion compared to levels after birth. The normal range of RBC folate values vary in newborns. The upper limit of daily dose of folic acid in pregnancy and neonatal period is not known. On the other hand it is an easily excreted water-soluble vitamin but in premature newborn it can lead to the disruption of metabolic balance and slow its degradation. Some factors can have an impact on RBC folate concentration. Blood transfusion can be one of the main influences on RBC folate concentration. To clarify these mechanisms further studies are required (Ref. 29).
Prevalence of iron, folate, and vitamin B12 deficiencies in 20 to 49 years old women: Ensanut 2012.
Shamah-Levy, Teresa; Villalpando, Salvador; Mejía-Rodríguez, Fabiola; Cuevas-Nasu, Lucía; Gaona-Pineda, Elsa Berenice; Rangel-Baltazar, Eduardo; Zambrano-Mujica, Norma
2015-01-01
To describe the prevalence of iron, folate, and B12 deficiencies in Mexican women of reproductive age from the National Health and Nutrition Survey (Ensanut) 2012. Data came from a national probabilistic survey, representative from rural and urban areas, and different age groups. Blood samples were obtained from 4 263, 20 to 49 years old women for serum ferritin, vitamin B12 and serum folate concentrations. The prevalence of deficiencies, was assessed using adjusted logistic regression models. The deficiency of folate was 1.9% (95%CI 1.3-2.8), B12 deficiency was 8.5% (95%CI 6.7-10.1) and iron deficiency was 29.4% (95%CI 26.5-32.2). No differences were found when compared with 2006, 24.8% (95%CI 22.3-27.2). The vitamin B12 deficiency is still a problem for women of reproductive age and their offspring in Mexico, while folate deficiency disappeared as a problem. Iron deficiency needs prevention and fortification strategies.
Pfeiffer, Christine M.; Sternberg, Maya R.; Fazili, Zia; Lacher, David A.; Zhang, Mindy; Johnson, Clifford L.; Hamner, Heather C.; Bailey, Regan L.; Rader, Jeanne I.; Yamini, Sedigheh; Berry, R. J.; Yetley, Elizabeth A.
2015-01-01
Serum and red blood cell (RBC) total folate are indicators of folate status. No nationally representative population data exist for folate forms. We measured serum folate forms [5-methyltetrahydrofolate (5-methylTHF), unmetabolized folic acid (UMFA), non-methyl folate (sum of THF, 5-formylTHF, 5,10-methenylTHF), and MeFox (5-methylTHF oxidation product)] by HPLC-MS/MS and RBC total folate by microbiologic assay in US persons ≥1 year (n ~7500) participating in the National Health and Nutrition...
Zhong, Xi Zoë; Cao, Qi; Sun, Xue
2016-01-01
Key points SLC17A9 proteins function as a lysosomal ATP transporter responsible for lysosomal ATP accumulation.P2X4 receptors act as lysosomal ion channels activated by luminal ATP.SLC17A9‐mediated ATP transport across the lysosomal membrane is suppressed by Bafilomycin A1, the V‐ATPase inhibitor.SLC17A9 mainly uses voltage gradient but not pH gradient generated by the V‐ATPase as the driving force to transport ATP into the lysosome to activate P2X4. Abstract The lysosome contains abundant ATP which plays important roles in lysosome functions and in cell signalling. Recently, solute carrier family 17 member 9 (SLC17A9, also known as VNUT for vesicular nucleotide transporter) proteins were suggested to function as a lysosomal ATP transporter responsible for lysosomal ATP accumulation, and P2X4 receptors were suggested to be lysosomal ion channels that are activated by luminal ATP. However, the molecular mechanism of SLC17A9 transporting ATP and the regulatory mechanism of lysosomal P2X4 are largely unknown. In this study, we report that SLC17A9‐mediated ATP transport across lysosomal membranes is suppressed by Bafilomycin A1, the V‐ATPase inhibitor. By measuring P2X4 activity, which is indicative of ATP transport across lysosomal membranes, we further demonstrated that SLC17A9 mainly uses voltage gradient but not pH gradient as the driving force to transport ATP into lysosomes. This study provides a molecular mechanism for lysosomal ATP transport mediated by SLC17A9. It also suggests a regulatory mechanism of lysosomal P2X4 by SLC17A9. PMID:27477609
Folate and Colorectal Cancer in Rodents: A Model of DNA Repair Deficiency
Directory of Open Access Journals (Sweden)
Rita Rosati
2012-01-01
Full Text Available Fortification of grains has resulted in a positive public health outcome vis-a-vis reduced incidence of neural tube defects. Whether folate has a correspondingly beneficial effect on other disease outcomes is less clear. A role for dietary folate in the prevention of colorectal cancer has been established through epidemiological data. Experimental data aiming to further elucidate this relationship has been somewhat equivocal. Studies report that folate depletion increases DNA damage, mutagenesis, and chromosomal instability, all suggesting inhibited DNA repair. While these data connecting folate depletion and inhibition of DNA repair are convincing, we also present data demonstrating that genetic inhibition of DNA repair is protective in the development of preneoplastic colon lesions, both when folate is depleted and when it is not. The purpose of this paper is to (1 give an overview of the data demonstrating a DNA repair defect in response to folate depletion, and (2 critically compare and contrast the experimental designs utilized in folate/colorectal cancer research and the corresponding impact on tissue folate status and critical colorectal cancer endpoints. Our analysis suggests that there is still an important need for a comprehensive evaluation of the impact of differential dietary prescriptions on blood and tissue folate status.
De Steur, Hans; Feng, Shuyi; Xiaoping, Shi; Gellynck, Xavier
2014-06-01
Despite public health efforts, folate deficiency is still largely prevalent in poor, rural populations and continues to cause a large burden of disease. The present paper determines and compares consumer preferences for two folate strategies: folic acid supplementation v. folate biofortification, i.e. the enhancement of the folate content in staple crops. Experimental auctions with non-repeated information rounds are applied to rice in order to obtain willingness-to-pay for folate products. Thereby, GM or non-GM folate-biofortified rice (FBR) is auctioned together with rice that is supplemented with free folic acid pills (FAR). Shanxi Province (China) as a high-risk region of folate deficiency. One hundred and twenty-six women of childbearing age, divided into a school (n 60) and market sample (n 66). Despite differences according to the targeted sample, a general preference for folate biofortification is observed, regardless of the applied breeding technology. Premiums vary between 33·9 % (GM FBR), 36·5 % (non-GM FBR) and 19·0 % (FAR). Zero bidding behaviour as well as the product choice question, respectively, support and validate these findings. The targeted sample, the timing of the auction, the intention to consume GM food and the responsibility for rice purchases are considered key determinants of product choice. A novel ex-post negative valuation procedure shows low consistency in zero bidding. While the low attractiveness of FAR provides an additional argument for the limited effectiveness of past folic acid supplementation programmes, the positive reactions towards GM FBR further support its potential as a possible complementary micronutrient intervention.
Šerý, Omar; Paclt, Ivo; Drtílková, Ivana; Theiner, Pavel; Kopečková, Marta; Zvolský, Petr; Balcar, Vladimir J
2015-06-11
ADHD and alcoholism are psychiatric diseases with pathophysiology related to dopamine system. DAT1 belongs to the SLC6 family of transporters and is involved in the regulation of extracellular dopamine levels. A 40 bp variable number tandem repeat (VNTR) polymorphism in the 3'-untranslated region of DAT1/SLC6A3 gene was previously reported to be associated with various phenotypes involving disturbed regulation of dopaminergic neurotransmission. A total of 1312 subjects were included and genotyped for 40 bp VNTR polymorphism of DAT1/SLC6A3 gene in this study (441 alcoholics, 400 non-alcoholic controls, 218 ADHD children and 253 non ADHD children). Using miRBase software, we have performed a computer analysis of VNTR part of DAT1 gene for presence of miRNA binding sites. We have found significant relationships between ADHD and the 40 bp VNTR polymorphisms of DAT1/SLC6A3 gene (P VNTR polymorphism of DAT1/SLC6A3 gene has been detected. We have found an association between 40 bp VNTR polymorphism of DAT1/SLC6A3 gene and ADHD in the Czech population; in a broad agreement with studies in other population samples. Furthermore, we detected rare genotypes 8/10, 7/10 and 10/11 present in ADHD boys only and identified miRNAs that should be looked at as potential novel targets in the research on ADHD.
International Nuclear Information System (INIS)
Mathias, Carla J.; Wang, Susan; Low, Philip S.; Waters, David J.; Green, Mark A.
1999-01-01
The radiochemical synthesis and stability of 67 Ga-deferoxamine-folate ([ 67 Ga]Ga-DF-Folate) were examined as a function of DF-Folate concentration. Optimal labeling occurred at DF-Folate concentrations ≥2.5 μg/mL. To define the possible biological significance of variations in product formulation, the biodistribution of [ 67 Ga]Ga-DF-Folate was examined as a function of administered deferoxamine-folate dose in an athymic mouse KB tumor model. The folate-receptor-positive KB tumors were found to concentrate the 67 Ga radiolabel in a dose-dependent fashion, consistent with saturable involvement of the folate receptor in mediating tumor accumulation of the radiopharmaceutical
Association of SLC11A1 gene polymorphism with caprine ...
Indian Academy of Sciences (India)
Navya
2017-01-16
Jan 16, 2017 ... RESEARCH ARTICLE. Evaluation of the ..... Nramp2 (Slc11a2) expressed at the plasma membrane. Blood, 102 ... Received 21 November 2016, in final revised form 11 January 2017; accepted 12 January 2017. Unedited ...
Elevated concentrations of serum uric acid are associated with increased risk of gout and renal and cardiovascular diseases. Genetic studies in adults have consistently identified associations of solute carrier family 2, member 9 (SLC2A9), polymorphisms with variation in serum uric acid. However, it...
Directory of Open Access Journals (Sweden)
Mark W Neff
Full Text Available A crippling dwarfism was first described in the Miniature Poodle in Great Britain in 1956. Here, we resolve the genetic basis of this recessively inherited disorder. A case-control analysis (8:8 of genotype data from 173 k SNPs revealed a single associated locus on CFA14 (P(raw <10(-8. All affected dogs were homozygous for an ancestral haplotype consistent with a founder effect and an identical-by-descent mutation. Systematic failure of nine, nearly contiguous SNPs, was observed solely in affected dogs, suggesting a deletion was the causal mutation. A 130-kb deletion was confirmed both by fluorescence in situ hybridization (FISH analysis and by cloning the physical breakpoints. The mutation was perfectly associated in all cases and obligate heterozygotes. The deletion ablated all but the first exon of SLC13A1, a sodium/sulfate symporter responsible for regulating serum levels of inorganic sulfate. Our results corroborate earlier findings from an Slc13a1 mouse knockout, which resulted in hyposulfatemia and syndromic defects. Interestingly, the metabolic disorder in Miniature Poodles appears to share more clinical signs with a spectrum of human disorders caused by SLC26A2 than with the mouse Slc13a1 model. SLC26A2 is the primary sodium-independent sulfate transporter in cartilage and bone and is important for the sulfation of proteoglycans such as aggregan. We propose that disruption of SLC13A1 in the dog similarly causes undersulfation of proteoglycans in the extracellular matrix (ECM, which impacts the conversion of cartilage to bone. A co-dominant DNA test of the deletion was developed to enable breeders to avoid producing affected dogs and to selectively eliminate the mutation from the gene pool.
DEFF Research Database (Denmark)
Oskari Kilpeläinen, Tuomas; Lakka, T A; Laaksonen, D E
2007-01-01
. The interaction of the SNPs with the change in PA on the conversion to T2D was assessed using Cox regression with adjustments for the other components of the intervention (dietary changes, weight reduction). The carriers of the common homozygous genotype of rs5393, rs5394, or rs5404 of SLC2A2 and rs3758947...
Synthesis and biological assessment of folate-accepted developer (99m)Tc-DTPA-folate-polymer.
Chen, Fei; Shao, Kejing; Zhu, Bao; Jiang, Mengjun
2016-05-15
A novel cancer-targetable folate-poly(2-hydroxyethyl methacrylate) (PFDH) copolymer containing DTPA segment was prepared by conventional chemical synthesis and labeled with (99m)Tc subsequently. The (99m)Tc-labled PFDH could be produced easily with high radiochemical yield of 91% and radiochemical purity of 95%. The LogP octanol-water value for the (99m)Tc-labled PFDH was -2.19 and the radiotracer was stable in phosphate-buffered saline and human serum for 2h (>95% in PBS or ∼90% in human serum). To investigate (99m)Tc-labled PFDH tumor targeting, the in vitro and in vivo stability, cell uptake, in vivo biodistribution, and SPECT imaging were evaluated, respectively. These preliminary results strongly suggest that the novel folate conjugated dendrimer maybe developed to be potential for delivery of therapeutic radionuclides. Copyright © 2016 Elsevier Ltd. All rights reserved.
International Nuclear Information System (INIS)
Thompson, K.A.; Jobe, R.K.; Johnson, R.; Phinney, N.
1987-02-01
Two classes of computer-controlled feedback have been implemented to stabilize parameters in subsystems of the SLC: (1) ''slow'' (time scales ∼ minutes) feedback, and (2) ''fast'', i.e., pulse-to-pulse, feedback. The slow loops run in a single FEEDBACK process in the SLC host VAX, which acquires signals and sets control parameters via communication with the database and the network of normal SLC microprocessors. Slow loops exist to stabilize beam energy and energy spread, beam position and angle, and timing of kicker magnets, and to compensate for changes in the phase length of the rf drive line. The fast loops run in dedicated microprocessors, and may sample and/or feedback on particular parameters as often as every pulse of the SLC beam. The first implementations of fast feedback are to control transverse beam blow-up and to stabilize the energy and energy spread of bunches going into the SLC arcs. The overall architecture of the feedback software and the operator interface for controlling loops are discussed
SLC2A9 is a high-capacity urate transporter in humans.
Directory of Open Access Journals (Sweden)
Mark J Caulfield
2008-10-01
] 0.9 to 1.05, p > 0.33 by meta-analysis of an SLC2A9 variant in six case-control studies including 11,897 participants. In a separate meta-analysis of four population studies including 11,629 participants we found no association of SLC2A9 with systolic (effect size -0.12 mm Hg, 95% CI -0.68 to 0.43, p = 0.664 or diastolic blood pressure (effect size -0.03 mm Hg, 95% CI -0.39 to 0.31, p = 0.82.This study provides evidence that SLC2A9 splice variants act as high-capacity urate transporters and is one of the first functional characterisations of findings from genome-wide association scans. We did not find an association of the SLC2A9 gene with blood pressure in this study. Our findings suggest potential pathogenic mechanisms that could offer a new drug target for gout.
Two novel mutations in the SLC40A1 and HFE genes implicated in iron overload in a Spanish man.
Del-Castillo-Rueda, Alejandro; Moreno-Carralero, María-Isabel; Alvarez-Sala-Walther, Luis-Antonio; Cuadrado-Grande, Nuria; Enríquez-de-Salamanca, Rafael; Méndez, Manuel; Morán-Jiménez, María-Josefa
2011-03-01
The most common form of hemochromatosis is caused by mutations in the HFE gene. Rare forms of the disease are caused by mutations in other genes. We present a patient with hyperferritinemia and iron overload, and facial flushing. Magnetic resonance imaging was performed to measure hepatic iron overload, and a molecular study of the genes involved in iron metabolism was undertaken. The iron overload was similar to that observed in HFE hemochromatosis, and the patient was double heterozygous for two novel mutations, c.-20G>A and c.718A>G (p.K240E), in the HFE and ferroportin (FPN1 or SLC40A1) genes, respectively. Hyperferritinemia and facial flushing improved after phlebotomy. Two of the patient's children were also studied, and the daughter was heterozygous for the mutation in the SLC40A1 gene, although she did not have hyperferritinemia. The patient presented a mild iron overload phenotype probably because of the two novel mutations in the HFE and SLC40A1 genes. © 2011 John Wiley & Sons A/S.
Voruganti, V Saroja; Laston, Sandra; Haack, Karin; Mehta, Nitesh R; Cole, Shelley A; Butte, Nancy F; Comuzzie, Anthony G
2015-01-01
Background: Elevated concentrations of serum uric acid are associated with increased risk of gout and renal and cardiovascular diseases. Genetic studies in adults have consistently identified associations of solute carrier family 2, member 9 (SLC2A9), polymorphisms with variation in serum uric acid. However, it is not known whether the association of serum uric acid with SLC2A9 polymorphisms manifests in children. Objective: The aim was to investigate whether variation in serum uric acid is under genetic influence and whether the association with SLC2A9 polymorphisms generalizes to Hispanic children of the Viva La Familia Study. Design: We conducted a genomewide association study with 1.1 million genetic markers in 815 children. Results: We found serum uric acid to be significantly heritable [h2 ± SD = 0.45 ± 0.08, P = 5.8 × 10−11] and associated with SLC2A9 variants (P values between 10−16 and 10−7). Several of the significantly associated polymorphisms were previously identified in studies in adults. We also found positive genetic correlations between serum uric acid and BMI z score (ρG = 0.45, P = 0.002), percentage of body fat (ρG = 0.28, P = 0.04), fat mass (ρG = 0.34, P = 0.02), waist circumference (ρG = 0.42, P = 0.003), and waist-to-height ratio (ρG = 0.46, P = 0.001). Conclusions: Our results show that variation in serum uric acid in Hispanic children is under considerable genetic influence and is associated with obesity-related phenotypes. As in adults, genetic variation in SLC2A9 is associated with serum uric acid concentrations, an important biomarker of renal and cardiovascular disease risk, in Hispanic children. PMID:25833971
Folate Production by Probiotic Bacteria
Directory of Open Access Journals (Sweden)
Stefano Raimondi
2011-01-01
Full Text Available Probiotic bacteria, mostly belonging to the genera Lactobacillus and Bifidobacterium, confer a number of health benefits to the host, including vitamin production. With the aim to produce folate-enriched fermented products and/or develop probiotic supplements that accomplish folate biosynthesis in vivo within the colon, bifidobacteria and lactobacilli have been extensively studied for their capability to produce this vitamin. On the basis of physiological studies and genome analysis, wild-type lactobacilli cannot synthesize folate, generally require it for growth, and provide a negative contribution to folate levels in fermented dairy products. Lactobacillus plantarum constitutes an exception among lactobacilli, since it is capable of folate production in presence of para-aminobenzoic acid (pABA and deserves to be used in animal trials to validate its ability to produce the vitamin in vivo. On the other hand, several folate-producing strains have been selected within the genus Bifidobacterium, with a great variability in the extent of vitamin released in the medium. Most of them belong to the species B. adolescentis and B. pseudocatenulatum, but few folate producing strains are found in the other species as well. Rats fed a probiotic formulation of folate-producing bifidobacteria exhibited increased plasma folate level, confirming that the vitamin is produced in vivo and absorbed. In a human trial, the same supplement raised folate concentration in feces. The use of folate-producing probiotic strains can be regarded as a new perspective in the specific use of probiotics. They could more efficiently confer protection against inflammation and cancer, both exerting the beneficial effects of probiotics and preventing the folate deficiency that is associated with premalignant changes in the colonic epithelia.
Directory of Open Access Journals (Sweden)
Maura Mack
2017-08-01
Full Text Available A unique eye color, called tiger-eye, segregates in the Puerto Rican Paso Fino (PRPF horse breed and is characterized by a bright yellow, amber, or orange iris. Pedigree analysis identified a simple autosomal recessive mode of inheritance for this trait. A genome-wide association study (GWAS with 24 individuals identified a locus on ECA 1 reaching genome-wide significance (Pcorrected = 1.32 × 10−5. This ECA1 locus harbors the candidate gene, Solute Carrier Family 24 (Sodium/Potassium/Calcium Exchanger, Member 5 (SLC24A5, with known roles in pigmentation in humans, mice, and zebrafish. Humans with compound heterozygous mutations in SLC24A5 have oculocutaneous albinism (OCA type 6 (OCA6, which is characterized by dilute skin, hair, and eye pigmentation, as well as ocular anomalies. Twenty tiger-eye horses were homozygous for a nonsynonymous mutation in exon 2 (p.Phe91Tyr of SLC24A5 (called here Tiger-eye 1, which is predicted to be deleterious to protein function. Additionally, eight of the remaining 12 tiger-eye horses heterozygous for the p.Phe91Tyr variant were also heterozygous for a 628 bp deletion encompassing all of exon 7 of SLC24A5 (c.875-340_1081+82del, which we will call here the Tiger-eye 2 allele. None of the 122 brown-eyed horses were homozygous for either tiger-eye-associated allele or were compound heterozygotes. Further, neither variant was detected in 196 horses from four related breeds not known to have the tiger-eye phenotype. Here, we propose that two mutations in SLC24A5 affect iris pigmentation in tiger-eye PRPF horses. Further, unlike OCA6 in humans, the Tiger-eye 1 mutation in its homozygous state or as a compound heterozygote (Tiger-eye 1/Tiger-eye 2 does not appear to cause ocular anomalies or a change in coat color in the PRPF horse.
The solute carrier 6 family of transporters
DEFF Research Database (Denmark)
Bröer, Stefan; Gether, Ulrik
2012-01-01
of these transporters is associated with a variety of diseases. Pharmacological inhibition of the neurotransmitter transporters in this family is an important strategy in the management of neurological and psychiatric disorders. This review provides an overview of the biochemical and pharmacological properties......The solute carrier 6 (SLC6) family of the human genome comprises transporters for neurotransmitters, amino acids, osmolytes and energy metabolites. Members of this family play critical roles in neurotransmission, cellular and whole body homeostasis. Malfunction or altered expression...... of the SLC6 family transporters....
Salinas-Delgado, Yvain; Galaviz-Hernández, Carlos; Toral, René García; Ávila Rejón, Carmen A; Reyes-Lopez, Miguel A; Martínez, Antonio Rojas; Martínez-Aguilar, Gerardo; Sosa-Macías, Martha
2015-09-01
Polymorphisms in SLC11A1/NRAMP1 have shown an important association with susceptibility to tuberculosis and progression to active disease. However, whether there is an association of these polymorphisms with treatment failure is unknown. The aim of this study was to determine the association of SLC11A1 polymorphisms with treatment failure in Mexican subjects with pulmonary tuberculosis. Thirty-three subjects with treatment failure were paired by age and body mass index with 33 patients who successfully completed treatment and were considered cured. We assessed the polymorphisms of SLC11A1 in the regions of D543N and INT4 via polymerase chain reaction real-time TaqMan® single nucleotide polymorphism (SNP) genotyping. We found that D543N (G/A genotype) was associated with treatment failure in patients with pulmonary tuberculosis [odds ratio (OR) 11.61, 95% confidence interval (CI) 3.66-36.78]. When adjusted by gender, this association remained significant in males (OR 11.09, 95% CI 3.46-35.51). In our male population, the presence of the D543N polymorphism of SLC11A1 is a risk factor for treatment failure. This finding should be confirmed in other populations.
Directory of Open Access Journals (Sweden)
Kheradpour Albert
2008-05-01
Full Text Available Abstract Background Methotrexate (MTX uptake is mediated by the reduced folate carrier (RFC. Defective drug uptake in association with decreased RFC expression is a common mechanism of MTX resistance in many tumor types. Heavy promoter methylation was previously identified as a basis for the complete silencing of RFC in MDA-MB-231 breast cancer cells, its role and prevalence in RFC transcription regulation are, however, not widely studied. Methods In the current study, RFC promoter methylation was assessed using methylation specific PCR in a panel of malignant cell lines (n = 8, including MDA-MB-231, and M805, a MTX resistant cell line directly established from the specimen of a patient with malignant fibrohistocytoma, whom received multiple doses of MTX. A quantitative approach of real-time PCR for measuring the extent of RFC promoter methylation was developed, and was validated by direct bisulfite genomic sequencing. RFC mRNA levels were determined by quantitative real-time RT-PCR and were related to the extent of promoter methylation in these cell lines. Results A partial promoter methylation and RFC mRNA down-regulation were observed in M805. Using the quantitative approach, a reverse correlation (correlation coefficient = -0.59, p Conclusion This study further suggests that promoter methylation is a potential basis for MTX resistance. The quantitative correlation identified in this study implies that promoter methylation is possibly a mechanism involved in the fine regulation of RFC transcription.
Ehmke, Nadja; Graul-Neumann, Luitgard; Smorag, Lukasz; Koenig, Rainer; Segebrecht, Lara; Magoulas, Pilar; Scaglia, Fernando; Kilic, Esra; Hennig, Anna F; Adolphs, Nicolai; Saha, Namrata; Fauler, Beatrix; Kalscheuer, Vera M; Hennig, Friederike; Altmüller, Janine; Netzer, Christian; Thiele, Holger; Nürnberg, Peter; Yigit, Gökhan; Jäger, Marten; Hecht, Jochen; Krüger, Ulrike; Mielke, Thorsten; Krawitz, Peter M; Horn, Denise; Schuelke, Markus; Mundlos, Stefan; Bacino, Carlos A; Bonnen, Penelope E; Wollnik, Bernd; Fischer-Zirnsak, Björn; Kornak, Uwe
2017-11-02
Gorlin-Chaudhry-Moss syndrome (GCMS) is a dysmorphic syndrome characterized by coronal craniosynostosis and severe midface hypoplasia, body and facial hypertrichosis, microphthalmia, short stature, and short distal phalanges. Variable lipoatrophy and cutis laxa are the basis for a progeroid appearance. Using exome and genome sequencing, we identified the recurrent de novo mutations c.650G>A (p.Arg217His) and c.649C>T (p.Arg217Cys) in SLC25A24 in five unrelated girls diagnosed with GCMS. Two of the girls had pronounced neonatal progeroid features and were initially diagnosed with Wiedemann-Rautenstrauch syndrome. SLC25A24 encodes a mitochondrial inner membrane ATP-Mg/P i carrier. In fibroblasts from affected individuals, the mutated SLC25A24 showed normal stability. In contrast to control cells, the probands' cells showed mitochondrial swelling, which was exacerbated upon treatment with hydrogen peroxide (H 2 O 2 ). The same effect was observed after overexpression of the mutant cDNA. Under normal culture conditions, the mitochondrial membrane potential of the probands' fibroblasts was intact, whereas ATP content in the mitochondrial matrix was lower than that in control cells. However, upon H 2 O 2 exposure, the membrane potential was significantly elevated in cells harboring the mutated SLC25A24. No reduction of mitochondrial DNA copy number was observed. These findings demonstrate that mitochondrial dysfunction with increased sensitivity to oxidative stress is due to the SLC25A24 mutations. Our results suggest that the SLC25A24 mutations induce a gain of pathological function and link mitochondrial ATP-Mg/P i transport to the development of skeletal and connective tissue. Copyright © 2017 American Society of Human Genetics. All rights reserved.
International Nuclear Information System (INIS)
Ding Jianhui; Zeng Mengsu; Zhou Kangrong; Shen Jizhang; Chen Caizhong; Zhong Gaoren; Xue Qiong; Gu Haiyan
2005-01-01
Objective: To evaluate the tumor targeting characteristic by observing signal varying of human gastric cancer transplanted nude mice (SGC-7901 ) using Folate-Receptor MR contrast agent. Methods: As a Folate-Receptor MR contrast agent, Gd-DTPA-Folate was obtained by conjugation of DTPA-Folate and GdCl 3 under specific conditions. Nude mice of subcutaneously transplanted human gastric cancer (SGC-7901) were used as animal models, 12 mice were divided into experimental group (n=6) and control group (n=6) randomly. Both were injected with Gd-DTPA-Folate and Gd-DTPA (contained same gadolinium) via abdominal cavity respectively. Tumor signal varying was observed by T 1 WI after injection of contrast agent immediately, 1, 2, 3, 4, 6, 12 and 24 h, and tumor signal changing of experimental group was compared with that of control group. CNR (contrast noise ratio) was regarded as evaluating mark. Results: Tumor signal intensity of experimental group was increased evidently between 1-2 hours after injecting Gd-DTPA-Folate. Comparison with pre-injection, there was a significant difference (evaluating mark is CNR: q 1 =5.80, q 2 =4.64; P 1 =0.64, q 2 =1.19, P>0.05). Conclusion: Gd-DTPA-Folate shows definite characteristic of tumor targeting effect to nude mice of subcutaneously transplanted human gastric cancer (SGC-7901). (authors)
Directory of Open Access Journals (Sweden)
Padmanabhan Srinivasan
Full Text Available Thiamin (vitamin B1, a member of the water-soluble family of vitamins, is essential for normal cellular functions; its deficiency results in oxidative stress and mitochondrial dysfunction. Pancreatic acinar cells (PAC obtain thiamin from the circulation using a specific carrier-mediated process mediated by both thiamin transporters -1 and -2 (THTR-1 and THTR-2; encoded by the SLC19A2 and SLC19A3 genes, respectively. The aim of the current study was to examine the effect of chronic exposure of mouse PAC in vivo and human PAC in vitro to nicotine (a major component of cigarette smoke that has been implicated in pancreatic diseases on thiamin uptake and to delineate the mechanism involved. The results showed that chronic exposure of mice to nicotine significantly inhibits thiamin uptake in murine PAC, and that this inhibition is associated with a marked decrease in expression of THTR-1 and THTR-2 at the protein, mRNA and hnRNAs level. Furthermore, expression of the important thiamin-metabolizing enzyme, thiamin pyrophosphokinase (TPKase, was significantly reduced in PAC of mice exposed to nicotine. Similarly, chronic exposure of cultured human PAC to nicotine (0.5 μM, 48 h significantly inhibited thiamin uptake, which was also associated with a decrease in expression of THTR-1 and THTR-2 proteins and mRNAs. This study demonstrates that chronic exposure of PAC to nicotine impairs the physiology and the molecular biology of the thiamin uptake process. Furthermore, the study suggests that the effect is, in part, mediated through transcriptional mechanism(s affecting the SLC19A2 and SLC19A3 genes.
Prevalence of iron, folate, and vitamin B12 deficiencies in 20 to 49 years old women: Ensanut 2012
Directory of Open Access Journals (Sweden)
Teresa Shamah-Levy
2015-09-01
Full Text Available Objective. To describe the prevalence of iron, folate, and B12 deficiencies in Mexican women of reproductive age from the National Health and Nutrition Survey (Ensanut 2012.Materials and methods. Data came from a ationalprobabilistic survey, representative from rural and urban areas,and different age groups. Blood samples were obtained from 4 263, 20 to 49 years old women for serum ferritin, vitamin B12 and serum folate oncentrations. The prevalence of deficiencies, was assessed using adjusted logistic regression models. Results. The deficiency of folate was 1.9% (95%CI1.3-2.8, B12 deficiency was 8.5% (95%CI 6.7-10.1 and iron deficiency was 29.4% (95%CI 26.5-32.2. No differences were found when compared with 2006, 24.8% (95%CI 22.3-27.2.Conclusions. The vitamin B12 deficiency is still a problem for women of reproductive age and their offspring in Mexico,while folate deficiency disappeared as a problem. Iron deficiency needs prevention and fortification strategies.
Jalali, Rozita; Lodder, Johannes C.; Zandieh-Doulabi, Behrouz; Micha, Dimitra; Melvin, James E.; Catalan, Marcelo A.; Mansvelder, Huibert D.; DenBesten, Pamela; Bronckers, Antonius
2017-01-01
Na+:K+:2Cl− cotransporters (NKCCs) belong to the SLC12A family of cation-coupled Cl− transporters. We investigated whether enamel-producing mouse ameloblasts express NKCCs. Transcripts for Nkcc1 were identified in the mouse dental epithelium by RT-qPCR and NKCC1 protein was immunolocalized in outer enamel epithelium and in the papillary layer but not the ameloblast layer. In incisors of Nkcc1-null mice late maturation ameloblasts were disorganized, shorter and the mineral density of the enamel was reduced by 10% compared to wild-type controls. Protein levels of gap junction protein connexin 43, Na+-dependent bicarbonate cotransporter e1 (NBCe1), and the Cl−-dependent bicarbonate exchangers SLC26A3 and SLC26A6 were upregulated in Nkcc1-null enamel organs while the level of NCKX4/SLC24A4, the major K+, Na+ dependent Ca2+ transporter in maturation ameloblasts, was slightly downregulated. Whole-cell voltage clamp studies on rat ameloblast-like HAT-7 cells indicated that bumetanide increased ion-channel activity conducting outward currents. Bumetanide also reduced cell volume of HAT-7 cells. We concluded that non-ameloblast dental epithelium expresses NKCC1 to regulate cell volume in enamel organ and provide ameloblasts with Na+, K+ and Cl− ions required for the transport of mineral- and bicarbonate-ions into enamel. Absence of functional Nkcc1 likely is compensated by other types of ion channels and ion transporters. The increased amount of Cx43 in enamel organ cells in Nkcc1-null mice suggests that these cells display a higher number of gap junctions to increase intercellular communication. PMID:29209227
Subcellular distribution of folate and folate binding protein in renal proximal tubules
International Nuclear Information System (INIS)
Sharkey, C.; Hjelle, J.T.; Selhub, J.
1986-01-01
High affinity folate binding protein (FBP) found in brush border membranes derived from renal cortices is thought to be involved in the renal conservation of folate. To examine the mechanisms of folate recovery, the subcellular distribution of FBP and 3 H-folate in rabbit renal proximal tubules (PT) was examined using analytical cell fractionation techniques. Tubules contain 3.41 +/- 0.32 picomoles FBP/mg protein (X +/- S.D.; n = 5). Postnuclear supernates (PNS) of PT were layered atop Percoll-sucrose gradients, centrifuged, fractions collected and assayed for various marker enzymes and FBP. Pooled fractions from such gradients were subsequently treated with digitonin and centrifuged in a stoichiometric manner with the activity of the microvillar enzyme, alanylaminopeptidase (AAP); excess FBP distributed with more buoyant particles. Infusion of 3 H-folate into rabbit kidneys followed by tubule isolation and fractionation revealed a time dependent shift in distribution of radiolabel from the AAP-rich gradient fractions to a region containing more buoyant particles; radiolevel was not associated with lysosomal markers. EM-radioautography revealed grains over intracellular vesicles. These results are consistent with the hypothesis that folate is recovered by a process involving receptor-mediated endocytosis or transcytosis
Kim, Woo Hyoung; Kim, Chang Guhn; Kim, Myoung Hyoun; Kim, Dae-Weung; Park, Cho Rong; Park, Ji Yong; Lee, Yun-Sang; Youn, Hyewon; Kang, Keon Wook; Jeong, Jae Min; Chung, June-Key
2016-06-01
The purpose of the present study was to prepare isostructural Tc-99m- and Re-188-folate-Gly-Gly-Cys-Glu (folate-GGCE), and to evaluate the feasibility of their use for folate receptor (FR)-targeted molecular imaging and as theranostic agents in a mouse tumor model. Folate-GGCE was synthesized using solid-phase peptide synthesis and radiolabeled with Tc-99m or Re-188. Radiochemical characterization was performed by radio-high-performance liquid chromatography. The biodistribution of Tc-99m-folate-GGCE was studied, with or without co-injection of excess free folate, in mice bearing both FR-positive (KB cell) and FR-negative (HT1080 cell) tumors. Biodistribution of Re-188-folate-GGCE was studied in mice bearing KB tumors. Serial planar scintigraphy was performed in the dual tumor mouse model after intravenous injection of Tc-99m-folate-GGCE. Serial micro-single photon emission computed tomography/computed tomography (SPECT/CT) studies were performed, with or without co-injection of excess free folate, in the mouse tumor model after injection of Tc-99m-folate-GGCE or Re-188-folate-GGCE. The radiolabeling efficiency and radiochemical stability of Tc-99m- and Re-188-folate-GGCE were more than 95 % for up to 4 h after radiolabeling. Uptake of Tc-99m-folate-GGCE at 1, 2, and 4 h after injection in KB tumor was 16.4, 23.2, and 17.6 % injected dose per gram (%ID/g), respectively. This uptake was suppressed by 97.4 % when excess free folate was co-administered. Tumor:normal organ ratios at 4 h for blood, liver, lung, muscle, and kidney were 54.3, 25.2, 38.3, 97.8, and 0.3, respectively. Tumor uptake of Re-188-folate-GGCE at 2, 4, 8, and 16 h after injection was 17.4, 21.7, 24.1, and 15.6 %ID/g, respectively. Tumor:normal organ ratios at 8 h for blood, liver, lung, muscle, and kidney were 126.8, 21.9, 54.8, 80.3, and 0.4, respectively. KB tumors were clearly visualized at a high intensity using serial scintigraphy and micro-SPECT/CT in mice injected with Tc-99m- or Re
Effect of germination and thermal treatments on folates in rye.
Kariluoto, Susanna; Liukkonen, Kirsi-Helena; Myllymäki, Olavi; Vahteristo, Liisa; Kaukovirta-Norja, Anu; Piironen, Vieno
2006-12-13
Effects of germination conditions and thermal processes on folate contents of rye were investigated. Total folate contents were determined microbiologically with Lactobacillus rhamnosus (ATCC 7469) as the growth indicator organism, and individual folates were determined by high-performance liquid chromatography after affinity chromatographic purification. Germination increased the folate content by 1.7-3.8-fold, depending on germination temperature, with a maximum content of 250 micro g/100 g dry matter. Hypocotylar roots with their notably high folate concentrations (600-1180 micro g/100 g dry matter) contributed 30-50% of the folate contents of germinated grains. Germination altered the proportions of folates, increasing the proportion of 5-methyltetrahydrofolate and decreasing the proportion of formylated folate compounds. Thermal treatments (extrusion, autoclaving and puffing, and IR and toasting) resulted in significant folate losses. However, folate levels in grains that were germinated and then were heat processed were higher than for native (nongerminated) grains. Opportunities to optimize rye processing to enhance folate levels in rye-based foods are discussed.
Directory of Open Access Journals (Sweden)
Wu Bailin
2008-11-01
Full Text Available Abstract Background The molecular etiology of hearing impairment in Chinese has not been thoroughly investigated. Study of GJB2 gene revealed that 30.4% of the patients with hearing loss in Inner Mongolia carried GJB2 mutations. The SLC26A4 gene mutations and relevant phenotype are analyzed in this study. Methods One hundred and thirty-five deaf patients were included. The coding exons of SLC26A4 gene were sequence analyzed in 111 patients, not including 22 patients carrying bi-allelic GJB2 mutations or one patient carrying a known GJB2 dominant mutation as well as one patient with mtDNA 1555A>G mutation. All patients with SLC26A4 mutations or variants were subjected to high resolution temporal bone CT scan and those with confirmed enlarged vestibular aqueduct and/or other inner ear malformation were then given further ultrasound scan of thyroid and thyroid hormone assays. Results Twenty-six patients (19.26%, 26/135 were found carrying SLC26A4 mutation. Among them, 17 patients with bi-allelic SLC26A4 mutations were all confirmed to have EVA or other inner ear malformation by CT scan. Nine patients were heterozygous for one SLC26A4 mutation, including 3 confirmed to be EVA or EVA and Mondini dysplasia by CT scan. The most common mutation, IVS7-2A>G, accounted for 58.14% (25/43 of all SLC26A4 mutant alleles. The shape and function of thyroid were confirmed to be normal by thyroid ultrasound scan and thyroid hormone assays in 19 of the 20 patients with EVA or other inner ear malformation except one who had cystoid change in the right side of thyroid. No Pendred syndrome was diagnosed. Conclusion In Inner Mongolia, China, mutations in SLC26A4 gene account for about 12.6% (17/135 of the patients with hearing loss. Together with GJB2 (23/135, SLC26A4 are the two most commonly mutated genes causing deafness in this region. Pendred syndrome is not detected in this deaf population. We established a new strategy that detects SLC26A4 mutations prior to the
Dai, Pu; Yuan, Yongyi; Huang, Deliang; Zhu, Xiuhui; Yu, Fei; Kang, Dongyang; Yuan, Huijun; Wu, Bailin; Han, Dongyi; Wong, Lee-Jun C
2008-01-01
Background The molecular etiology of hearing impairment in Chinese has not been thoroughly investigated. Study of GJB2 gene revealed that 30.4% of the patients with hearing loss in Inner Mongolia carried GJB2 mutations. The SLC26A4 gene mutations and relevant phenotype are analyzed in this study. Methods One hundred and thirty-five deaf patients were included. The coding exons of SLC26A4 gene were sequence analyzed in 111 patients, not including 22 patients carrying bi-allelic GJB2 mutations or one patient carrying a known GJB2 dominant mutation as well as one patient with mtDNA 1555A>G mutation. All patients with SLC26A4 mutations or variants were subjected to high resolution temporal bone CT scan and those with confirmed enlarged vestibular aqueduct and/or other inner ear malformation were then given further ultrasound scan of thyroid and thyroid hormone assays. Results Twenty-six patients (19.26%, 26/135) were found carrying SLC26A4 mutation. Among them, 17 patients with bi-allelic SLC26A4 mutations were all confirmed to have EVA or other inner ear malformation by CT scan. Nine patients were heterozygous for one SLC26A4 mutation, including 3 confirmed to be EVA or EVA and Mondini dysplasia by CT scan. The most common mutation, IVS7-2A>G, accounted for 58.14% (25/43) of all SLC26A4 mutant alleles. The shape and function of thyroid were confirmed to be normal by thyroid ultrasound scan and thyroid hormone assays in 19 of the 20 patients with EVA or other inner ear malformation except one who had cystoid change in the right side of thyroid. No Pendred syndrome was diagnosed. Conclusion In Inner Mongolia, China, mutations in SLC26A4 gene account for about 12.6% (17/135) of the patients with hearing loss. Together with GJB2 (23/135), SLC26A4 are the two most commonly mutated genes causing deafness in this region. Pendred syndrome is not detected in this deaf population. We established a new strategy that detects SLC26A4 mutations prior to the temporal bone CT scan to
Energy Technology Data Exchange (ETDEWEB)
Aranda L, L.; Ferro F, G.; Azorin V, E.; Ramirez, F. M.; Ocampo G, B.; Santos C, C.; Jimenez M, N. [ININ, Carretera Mexico-Toluca s/n, 52750 Ocoyoacac, Estado de Mexico (Mexico); Issac O, K. [Universidad Autonoma del Estado de Mexico, Facultad de Medicina, 50180 Toluca, Estado de Mexico (Mexico)
2015-10-15
Full text: Lutetium-177 labeled hetero bivalent molecules that interact with different targets on tumor cells have been proposed as a new class of theranostic radiopharmaceuticals. The aim of this work was to synthesize Lys{sup 1} (α,γ-Folate)-Lys{sup 3}({sup 177}Lu-DOTA)-Bombesin (1-14) ({sup 177}LuFolate-Bn), as well as to assess its in vitro and in vivo potential for molecular imaging and targeted radiotherapy of breast tumors expressing folate receptors (Fr) and gastrin releasing peptide receptors (GRPR). Lys{sup 1} Lys{sup 3} (DOTA)-Bombesin (1-14) was conjugated to the terminal carboxylic group of the folic acid and the product purified by size-exclusion HPLC. Chemical characterization was carried out by UV-vis, Ft-IR spectroscopies and MALDI-TOF mass spectrometry. {sup 177}Lu labeling was performed by reaction of {sup 177}LuCl{sub 3} with the Lys{sup 1} (α,γ-Folate)-Lys{sup 3} (DOTA)-Bombesin (Folate-Bn) conjugate. In vitro binding studies were carried out in T47D breast cancer cells (positive to Fr and GRPR). Biokinetic studies and micro-SPECT/CT images were obtained using athymic mice with T47D induced tumors. Spectroscopic studies and HPLC analyses indicated that the conjugate was obtained with high chemical and radiochemical purity (98 ± 1.3%). T47D-tumors were clearly visible with high contrast at 2 h after radiopharmaceutical administration. The {sup 177}Lu-absorbed dose delivered to tumors was 23.9 ± 2.1 Gy (74 MBq, intravenously administered) {sup 177}Lu-Folate-Bn demonstrated properties suitable as a theranostic radiopharmaceutical for breast tumors expressing Fr s and GRPR s. (Author)
Fritz, Sébastien; Capitan, Aurelien; Djari, Anis; Rodriguez, Sabrina C; Barbat, Anne; Baur, Aurélia; Grohs, Cécile; Weiss, Bernard; Boussaha, Mekki; Esquerré, Diane; Klopp, Christophe; Rocha, Dominique; Boichard, Didier
2013-01-01
The regular decrease of female fertility over time is a major concern in modern dairy cattle industry. Only half of this decrease is explained by indirect response to selection on milk production, suggesting the existence of other factors such as embryonic lethal genetic defects. Genomic regions harboring recessive deleterious mutations were detected in three dairy cattle breeds by identifying frequent haplotypes (>1%) showing a deficit in homozygotes among Illumina Bovine 50k Beadchip haplotyping data from the French genomic selection database (47,878 Holstein, 16,833 Montbéliarde, and 11,466 Normande animals). Thirty-four candidate haplotypes (pHH3 in Holstein breed were identified. Haplotype length varied from 1 to 4.8 Mb and frequencies from 1.7 up to 9%. A significant negative effect on calving rate, consistent in heifers and in lactating cows, was observed for 9 of these haplotypes in matings between carrier bulls and daughters of carrier sires, confirming their association with embryonic lethal mutations. Eight regions were further investigated using whole genome sequencing data from heterozygous bull carriers and control animals (45 animals in total). Six strong candidate causative mutations including polymorphisms previously reported in FANCI (Brachyspina), SLC35A3 (CVM), APAF1 (HH1) and three novel mutations with very damaging effect on the protein structure, according to SIFT and Polyphen-2, were detected in GART, SHBG and SLC37A2 genes. In conclusion, this study reveals a yet hidden consequence of the important inbreeding rate observed in intensively selected and specialized cattle breeds. Counter-selection of these mutations and management of matings will have positive consequences on female fertility in dairy cattle.
Effects of yeasts and bacteria on the levels of folates in rye sourdoughs.
Kariluoto, Susanna; Aittamaa, Marja; Korhola, Matti; Salovaara, Hannu; Vahteristo, Liisa; Piironen, Vieno
2006-02-01
Fermentation of rye dough is often accompanied with an increase in folate content. In this study, three sourdough yeasts, Candida milleri CBS 8195, Saccharomyces cerevisiae TS 146, and Torulaspora delbrueckii TS 207; a control, baker's yeast S. cerevisiae ALKO 743; and four Lactobacillus spp., L. acidophilus TSB 262, L. brevis TSB 307, L. plantarum TSB 304, and L. sanfranciscensis TSB 299 originally isolated from rye sourdough were examined for their abilities to produce or consume folates. The microorganisms were grown in yeast extract-peptone-d-glucose medium as well as in small-scale fermentations that modelled the sourdough fermentation step used in rye baking. Total folate contents were determined using Lactobacillus rhamnosus (ATCC 7469) as the growth indicator organism. The microorganisms studied did not excrete folates into the media in significant amounts. Yeasts increased the folate contents of sterilised rye flour-water mixtures from 6.5 microg/100 g to between 15 and 23 microg/100 g after 19-h fermentation, whereas lactic acid bacteria decreased it to between 2.9 and 4.2 microg/100 g. Strains of Lactobacillus bulgaricus, L. casei, L. curvatus, L. fermentum, L. helveticus, Pediococcus spp., and Streptococcus thermophilus that were also tested gave folate contents after fermentation that varied between 2 and 10.4 microg/100 g. Although the four Lactobacillus spp. from sourdough consumed folates their effect on folate contents in co-cultivations was minimal. It was concluded that the increase of folate content during fermentation was mainly due to folate synthesis by yeasts. Fermentation of non-sterilised flour-water mixtures as such resulted in three-fold increases in the folate contents. Two folate producing bacteria were isolated from the non-sterilised flour and identified as Enterobacter cowanii and Pantoea agglomerans.
Hartman, Brenda A.; Fazili, Zia; Pfeiffer, Christine M.; O’Connor, Deborah L.
2016-01-01
It is not known whether folate metabolism is altered during pregnancy to support increased DNA and RNA biosynthesis. By using a state-of-the-art LC tandem mass spectrometry technique, the aim of this study was to investigate differences in RBC folate forms between pregnant and nonpregnant women and between nonpregnant women consuming different concentrations of supplemental folic acid. Forms of folate in RBCs were used to explore potential shifts in folate metabolism during early erythropoiesis. Total RBC folate and folate forms [tetrahydrofolate; 5-methyltetrahydrofolate (5-methyl-THF); 4α-hydroxy-5-methyl-tetrahydrofolate (an oxidation product of 5-methyl-THF); 5-formyl-tetrahydrofolate; and 5,10-methenyl-tetrahydrofolate] were measured in 4 groups of women (n = 26): pregnant women (PW) (30–36 wk of gestation) consuming 1 mg/d of folic acid, and nonpregnant women consuming 0 mg/d (NPW-0), 1 mg/d (NPW-1), and 5 mg/d (NPW-5) folic acid. The mean ± SD RBC folate concentration of the NPW-0 group (890 ± 530 nmol/L) was lower than the NPW-1 (1660 ± 350 nmol/L) and NPW-5 (1980 ± 570 nmol/L) groups as assessed by microbiologic assay (n = 26, P methyl-THF [limit of detection (LOD) = 0.06 nmol/L] in all groups and tetrahydrofolate (LOD = 0.2 nmol/L) in most women regardless of methylenetetrahydrofolate reductase genotype. Most women consuming folic acid supplements had detectable concentrations of 5,10-methenyl-tetrahydrofolate (LOD = 0.31 nmol/L). However, there was no difference in the relative distribution of 5-methyl-THF (83–84%), sum of non-methyl folates (0.6–3%), or individual non-methyl folate forms in RBCs across groups. We conclude that although folic acid supplementation in nonpregnant women increases RBC total folate and the concentration of individual folate forms, it does not alter the relative distribution of folate forms. Similarly, distribution of RBC folate forms did not differ between pregnant and nonpregnant women. This trial was registered
Synthesis and evaluation of boronated folates for BNCT
International Nuclear Information System (INIS)
Shukla, S.; Sekido, M.; Guo, W.; Mueller, R.; Sudimack, J.; Lee, R.J.; Tjarks, W.; Adams, D.M.; Barth, R.F.
2000-01-01
To study the possible utilization of folic acid as the 10 B carrier for BNCT, folic acid conjugated boron containing liposomes and starburst dendrimers were prepared. In both systems folic acid was used as the recognition part and polyethylene glycol (PEG) as the spacer. In vitro studies were carried out using folate receptor overexpressing 24JK-FBP and KB cells. The results indicated that these boronated folic acid conjugates were incorporated into the tumor cells via receptor-mediated endocytosis. (author)
Critical evaluation of lowering the recommended dietary intake of folate.
Obeid, Rima; Koletzko, Berthold; Pietrzik, Klaus
2014-04-01
We evaluated the recommendation of the Austrian, German, and Swiss Societies for Nutrition of lowering dietary folate intake from 400 to 300 μg dietary folate equivalents/d. A dose-response relation exists between folate intake or plasma level and disease risk within the normal range. Improving folate status can prevent between 30% and 75% of neural tube defects. A prepregnancy plasma folate of >18.0 nmol/L (mean 26.1 nmol/L) is associated with low total homocysteine (tHcy) (folate intake cannot achieve maximal risk reduction. The Austrian, German, and Swiss Societies for Nutrition recommend that young women should additionally supplement with 400 μg folic acid at least 4 weeks before conception. This short time window is not sufficient to achieve optimal plasma folate and tHcy levels in the majority of women. Factors affecting the relation between folate intake and blood biomarkers are total folate intake, baseline plasma folate, time available for supplement use, dose and form (folic acid or methyl folate), genetic polymorphisms, physiological and lifestyle factors. Lowering the recommended dietary folate intake may have important public health consequences. Elderly people and young women are at risk for diseases related to folate shortage. Reducing birth defects through supplementation of folic acid remains a poor option, as folate intake is crucial for reaching the target protective plasma folate levels in the population. Copyright © 2014 Elsevier Ltd and European Society for Clinical Nutrition and Metabolism. All rights reserved.
Enhancement of the folate content in Egyptian pita bread.
Hefni, Mohammed; Witthöft, Cornelia M
2012-01-01
Egypt has a high incidence of neural tube defects related to folate deficiency. One major food source for folate is pita (baladi) bread, which is consumed daily. Bioprocessing (e.g. germination) has been reported to increase the folate content in cereals. The aim was to produce pita bread with increased folate content using germinated wheat flour (GWF). Prior to milling the effects of germination and drying conditions on folate content in wheat grains were studied. Pita bread was baked from wheat flour substituted with different levels of GWF. The folate content in dough and bread and rheological properties of dough were determined. Germination of wheat grains resulted in, depending on temperature, 3- to 4-fold higher folate content with a maximum of 61 µg/100 g DM (dry matter). The folate content in both flour and bread increased 1.5 to 4-fold depending on the level of flour replacement with GWF. Pita bread baked with 50% sieved GWF was acceptable with respect to colour and layer separation, and had a folate content of 50 µg/100 g DM compared with 30 µg/100 g DM in conventional pita bread (0% GWF). Using 50% GWF, pita bread with increased folate content, acceptable for the Egyptian consumer, was produced. Consumption of this bread would increase the average daily folate intake by 75 µg.
Enhancement of the folate content in Egyptian pita bread
Directory of Open Access Journals (Sweden)
Cornelia M. Witthöft
2012-04-01
Full Text Available Introduction: Egypt has a high incidence of neural tube defects related to folate deficiency. One major food source for folate is pita (baladi bread, which is consumed daily. Bioprocessing (e.g. germination has been reported to increase the folate content in cereals. The aim was to produce pita bread with increased folate content using germinated wheat flour (GWF.Methods: Prior to milling the effects of germination and drying conditions on folate content in wheat grains were studied. Pita bread was baked from wheat flour substituted with different levels of GWF. The folate content in dough and bread and rheological properties of dough were determined.Results: Germination of wheat grains resulted in, depending on temperature, 3- to 4-fold higher folate content with a maximum of 61 µg/100 g DM (dry matter. The folate content in both flour and bread increased 1.5 to 4-fold depending on the level of flour replacement with GWF. Pita bread baked with 50% sieved GWF was acceptable with respect to colour and layer separation, and had a folate content of 50 µg/100 g DM compared with 30 µg/100 g DM in conventional pita bread (0% GWF.Conclusion: Using 50% GWF, pita bread with increased folate content, acceptable for the Egyptian consumer, was produced. Consumption of this bread would increase the average daily folate intake by 75 µg.
AVPR1a and SLC6A4 Gene Polymorphisms Are Associated with Creative Dance Performance.
Directory of Open Access Journals (Sweden)
2005-09-01
Full Text Available Dancing, which is integrally related to music, likely has its origins close to the birth of Homo sapiens, and throughout our history, dancing has been universally practiced in all societies. We hypothesized that there are differences among individuals in aptitude, propensity, and need for dancing that may partially be based on differences in common genetic polymorphisms. Identifying such differences may lead to an understanding of the neurobiological basis of one of mankind's most universal and appealing behavioral traits-dancing. In the current study, 85 current performing dancers and their parents were genotyped for the serotonin transporter (SLC6A4: promoter region HTTLPR and intron 2 VNTR and the arginine vasopressin receptor 1a (AVPR1a: promoter microsatellites RS1 and RS3. We also genotyped 91 competitive athletes and a group of nondancers/nonathletes (n = 872 subjects from 414 families. Dancers scored higher on the Tellegen Absorption Scale, a questionnaire that correlates positively with spirituality and altered states of consciousness, as well as the Reward Dependence factor in Cloninger's Tridimensional Personality Questionnaire, a measure of need for social contact and openness to communication. Highly significant differences in AVPR1a haplotype frequencies (RS1 and RS3, especially when conditional on both SLC6A4 polymorphisms (HTTLPR and VNTR, were observed between dancers and athletes using the UNPHASED program package (Cocaphase: likelihood ratio test [LRS] = 89.23, p = 0.000044. Similar results were obtained when dancers were compared to nondancers/nonathletes (Cocaphase: LRS = 92.76, p = 0.000024. These results were confirmed using a robust family-based test (Tdtphase: LRS = 46.64, p = 0.010. Association was also observed between Tellegen Absorption Scale scores and AVPR1a (Qtdtphase: global chi-square = 26.53, p = 0.047, SLC6A4 haplotypes (Qtdtphase: chi-square = 2.363, p = 0.018, and AVPR1a conditional on SCL6A4 (Tdtphase: LRS
AVPR1a and SLC6A4 gene polymorphisms are associated with creative dance performance.
Directory of Open Access Journals (Sweden)
Rachel Bachner-Melman
2005-09-01
Full Text Available Dancing, which is integrally related to music, likely has its origins close to the birth of Homo sapiens, and throughout our history, dancing has been universally practiced in all societies. We hypothesized that there are differences among individuals in aptitude, propensity, and need for dancing that may partially be based on differences in common genetic polymorphisms. Identifying such differences may lead to an understanding of the neurobiological basis of one of mankind's most universal and appealing behavioral traits--dancing. In the current study, 85 current performing dancers and their parents were genotyped for the serotonin transporter (SLC6A4: promoter region HTTLPR and intron 2 VNTR and the arginine vasopressin receptor 1a (AVPR1a: promoter microsatellites RS1 and RS3. We also genotyped 91 competitive athletes and a group of nondancers/nonathletes (n = 872 subjects from 414 families. Dancers scored higher on the Tellegen Absorption Scale, a questionnaire that correlates positively with spirituality and altered states of consciousness, as well as the Reward Dependence factor in Cloninger's Tridimensional Personality Questionnaire, a measure of need for social contact and openness to communication. Highly significant differences in AVPR1a haplotype frequencies (RS1 and RS3, especially when conditional on both SLC6A4 polymorphisms (HTTLPR and VNTR, were observed between dancers and athletes using the UNPHASED program package (Cocaphase: likelihood ratio test [LRS] = 89.23, p = 0.000044. Similar results were obtained when dancers were compared to nondancers/nonathletes (Cocaphase: LRS = 92.76, p = 0.000024. These results were confirmed using a robust family-based test (Tdtphase: LRS = 46.64, p = 0.010. Association was also observed between Tellegen Absorption Scale scores and AVPR1a (Qtdtphase: global chi-square = 26.53, p = 0.047, SLC6A4 haplotypes (Qtdtphase: chi-square = 2.363, p = 0.018, and AVPR1a conditional on SCL6A4 (Tdtphase: LRS
DEFF Research Database (Denmark)
Baslund, B.; Gregers, J.; Nielsen, Claus Henrik
2008-01-01
OBJECTIVE: To examine if polymorphism 80G --> A in the Reduced Folate Carrier (RFC) affects uptake of MTX in B- and CD4+ T-cells. METHODS: Mononuclear cells were isolated from peripheral blood of healthy persons. Real-time PCR was used to detect the RFC80 variants. FITC-labelled MTX was added to ...
Archer, N S; Nassif, N T; O'Brien, B A
2015-06-01
A systematic review and meta-analyses were undertaken to investigate the association of SLC11A1 genetic variants with disease occurrence. Literature searching indentified 109 publications to include in the meta-analyses assessing the association of 11 SLC11A1 variants with autoimmune and infectious disease. The (GT)n promoter alleles 2 and 3 (rs534448891), which alter SLC11A1 expression, were significantly associated with tuberculosis (OR=1.47 (1.30-1.66), OR=0.76 (0.65-0.89), respectively) and infectious disease (OR=1.25 (1.10-1.42), OR=0.83 (0.74-0.93), respectively). However, although no association was observed with autoimmune disease, a modest significant association was observed with type 1 diabetes (allele 2 OR=0.94 (0.89-0.98)). On the basis of a stronger association of (GT)n allele 2 with tuberculosis, compared with the protective effect of allele 3, we hypothesise that allele 2 is likely the disease-causing variant influencing disease susceptibility. Significant associations were observed between the 469+14G/C polymorphism (rs3731865) and autoimmune disease (OR=1.30 (1.04-1.64)) and rheumatoid arthritis (OR=1.60 (1.20-2.13)) and between the -237C/T polymorphism (rs7573065) and inflammatory bowel disease (OR=0.60 (0.43-0.84)). Further, significant associations were identified between the 469+14G/C, 1730G/A and 1729+55del4 polymorphisms (rs3731865, rs17235409 and rs17235416, respectively) and both infectious disease per se and tuberculosis. These findings show a clear association between variants in the SLC11A1 locus and autoimmune and infectious disease susceptibility.
The Physiopathological Role of the Exchangers Belonging to the SLC37 Family
Directory of Open Access Journals (Sweden)
Anna Rita Cappello
2018-04-01
Full Text Available The human SLC37 gene family includes four proteins SLC37A1-4, localized in the endoplasmic reticulum (ER membrane. They have been grouped into the SLC37 family due to their sequence homology to the bacterial organophosphate/phosphate (Pi antiporter. SLC37A1-3 are the less characterized isoforms. SLC37A1 and SLC37A2 are Pi-linked glucose-6-phosphate (G6P antiporters, catalyzing both homologous (Pi/Pi and heterologous (G6P/Pi exchanges, whereas SLC37A3 transport properties remain to be clarified. Furthermore, SLC37A1 is highly homologous to the bacterial glycerol 3-phosphate permeases, so it is supposed to transport also glycerol-3-phosphate. The physiological role of SLC37A1-3 is yet to be further investigated. SLC37A1 seems to be required for lipid biosynthesis in cancer cell lines, SLC37A2 has been proposed as a vitamin D and a phospho-progesterone receptor target gene, while mutations in the SLC37A3 gene appear to be associated with congenital hyperinsulinism of infancy. SLC37A4, also known as glucose-6-phosphate translocase (G6PT, transports G6P from the cytoplasm into the ER lumen, working in complex with either glucose-6-phosphatase-α (G6Pase-α or G6Pase-β to hydrolyze intraluminal G6P to Pi and glucose. G6PT and G6Pase-β are ubiquitously expressed, whereas G6Pase-α is specifically expressed in the liver, kidney and intestine. G6PT/G6Pase-α complex activity regulates fasting blood glucose levels, whereas G6PT/G6Pase-β is required for neutrophil functions. G6PT deficiency is responsible for glycogen storage disease type Ib (GSD-Ib, an autosomal recessive disorder associated with both defective metabolic and myeloid phenotypes. Several kinds of mutations have been identified in the SLC37A4 gene, affecting G6PT function. An increased autoimmunity risk for GSD-Ib patients has also been reported, moreover, SLC37A4 seems to be involved in autophagy.
The Physiopathological Role of the Exchangers Belonging to the SLC37 Family
Cappello, Anna Rita; Curcio, Rosita; Lappano, Rosamaria; Maggiolini, Marcello; Dolce, Vincenza
2018-04-01
The human SLC37 gene family includes four proteins SLC37A1-4, localized in the endoplasmic reticulum (ER) membrane. They have been grouped into the SLC37 family due to their sequence homology to the bacterial organophosphate/phosphate (Pi) antiporter. SLC37A1-3 are the less characterized isoforms. SLC37A1 and SLC37A2 are Pi-linked glucose-6-phosphate (G6P) antiporters, catalyzing both homologous (Pi/Pi) and heterologous (G6P/Pi) exchanges, whereas SLC37A3 transport properties remain to be clarified. Furthermore, SLC37A1 is highly homologous to the bacterial glycerol 3-phosphate permeases, so it is supposed to transport also glycerol-3-phosphate. The physiological role of SLC37A1-3 is yet to be further investigated. SLC37A1 seems to be required for lipid biosynthesis in cancer cell lines, SLC37A2 has been proposed as a vitamin D and a phospho-progesterone receptor target gene, while mutations in the SLC37A3 gene appear to be associated with congenital hyperinsulinism of infancy. SLC37A4, also known as glucose-6-phosphate translocase (G6PT), transports G6P from the cytoplasm into the ER lumen, working in complex with either glucose-6-phosphatase-α (G6Pase-α) or G6Pase-β to hydrolyze intraluminal G6P to Pi and glucose. G6PT and G6Pase-β are ubiquitously expressed, whereas G6Pase-α is specifically expressed in the liver, kidney and intestine. G6PT/G6Pase-α complex activity regulates fasting blood glucose levels, whereas G6PT/G6Pase-β is required for neutrophil functions. G6PT deficiency is responsible for glycogen storage disease type Ib (GSD-Ib), an autosomal recessive disorder associated with both defective metabolic and myeloid phenotypes. Several kinds of mutations have been identified in the SLC37A4 gene, affecting G6PT function. An increased autoimmunity risk for GSD-Ib patients has also been reported, moreover, SLC37A4 seems to be involved in autophagy.
International Nuclear Information System (INIS)
Lynch, E.P.J.; Tovey, K.C.; Guilford, H.
1977-01-01
A Competitive Protein Binding assay for the determination of folate in serum and red cells has been developed. The assay has been fully validated in hospital trials and comparisons have been made with the microbiological assay. We have based the standardization of the radioassay on N 5 -methyltetrahydrofolate (N 5 -MTHF) as this is the predominant folate derivative in serum samples. At about pH 9.5 pteroylglutamic acid (PGA) and N 5 -MTHF demonstrate the same affinity for folate binding proteins. Therefore, many folate assays have adopted PGA largely because of the popular belief that N 5 -MTHF is highly unstable. However, we have demonstrated that N 5 -MTHF in serum standards is surprisingly stable at -20 0 C. All the reagents for the assay (including the N 5 -MTHF standards) have shown perfectly acceptable stability, permitting their storage for at least three weeks at -20 0 C and one week at 4 0 C. Evidence will be presented to support the use of N 5 -MTHF as being the more appropriate standard. Folate in human serum samples is stable even at room temperature in the presence of 0.1% sodium azide. (orig./AJ) [de
Directory of Open Access Journals (Sweden)
Lorenza Mistura
2013-05-01
Full Text Available To compare the efficacy of a diet rich in natural folate and of two different folic acid supplementation protocols in subjects with “moderate” hyperhomocysteinemia, also taking into account C677T polymorphism of 5,10-methylenetetrahydrofolate reductase (MTHFR gene. Subjects/Methods: We performed a 13 week open, randomized, double blind clinical trial on 149 free living persons with mild hyperhomocyteinemia, with daily 200 μg from a natural folate-rich diet, 200 μg [6S]5-methyltetrahydrofolate (5-MTHF, 200 μg folic acid or placebo. Participants were stratified according to their MTHFR genotype. Results: Homocysteine (Hcy levels were reduced after folate enriched diet, 5-MTHF or folic acid supplementation respectively by 20.1% (p < 0.002, 19.4% (p < 0.001 and 21.9% (p < 0.001, as compared to baseline levels and significantly as compared to placebo (p < 0.001, p < 0.002 and p < 0.001, respectively for enriched diet, 5-MTHF and folic acid. After this enriched diet and the folic acid supplementation, Hcy in both genotype groups decreased approximately to the same level, with higher percentage decreases observed for the TT group because of their higher pre-treatment value. Similar results were not seen by genotype for 5-MTHF. A significant increase in RBC folate concentration was observed after folic acid and natural folate-rich food supplementations, as compared to placebo. Conclusions: Supplementation with natural folate-rich foods, folic acid and 5-MTHF reached a similar reduction in Hcy concentrations.
International Nuclear Information System (INIS)
Piyasena, R.D.; Weerasekera, D.A.; Hettiaratchi, N.; Wikramanayake, T.W.; Sri Lanka Univ., Peradeniya Campus. Nuclear Medicine Unit)
1977-01-01
Preparations of cow, goat, buffalo, and human milk in addition to pig plasma were tested for folate binding properties. Of these, only pig plasma and goat milk showed sufficient binding to enable use as binding agents in a radioassay for serum and whole blood folate. The binding of folate by cow mild preparations in particular was found to be very poor. (orig.) [de
Folic acid derivatives for PET imaging and therapy addressing folate receptor positive tumors
Energy Technology Data Exchange (ETDEWEB)
Schieferstein, Hanno
2013-07-01
Folic acid, also known as vitamin B9, is the oxidized form of 5,6,7,8-tetrahydrofolate, which serves as methyl- or methylene donor (C1-building blocks) during DNA synthesis. Under physiological conditions the required amount of 5,6,7,8-tetrahydrofolate for survival of the cell is accomplished through the reduced folate carrier (RFC). In contrast, the supply of 5,6,7,8-tetrahydrofolate is insufficient under pathophysiological conditions of tumors due to an increased proliferation rate. Consequently, many tumor cells exhibit an (over)expression of the folate receptor. This phenomenon has been applied to diagnostics (PET, SPECT, MR) to image FR-positive tumors and on the other hand to treat malignancies related to a FR (over)expression. Based on this concept, a new {sup 18}F-labeled folate for PET imaging has been developed and was evaluated in vivo using tumor-bearing mice. The incorporation of oligoethylene spacers into the molecular structure led to a significant enhancement of the pharmacokinetics in comparison to previously developed {sup 18}F-folates. The liver uptake could be reduced by one sixth by remaining a tumor uptake of 3%ID/g leading to better contrast ratios. Encouraged by these results, a clickable {sup 18}F-labeled serine-based prosthetic group has been synthesized, again with the idea to improve the metabolic and pharmacokinetic profile of hydrophilic radiotracers. Therefore, an alkyne-carrying azido-functionalized serine derivative for coupling to biomolecules was synthesized and a chlorine leaving group for {sup 18}F-labeling, which could be accomplished using a microwave-assisted synthesis, a [K is contained in 2.2.2]{sup +}/carbonate system in DMSO. Radiochemical yields of 77±6% could be achieved. The promising results obtained from the FR-targeting concept in the diagnostic field have been transferred to the boron neutron capture therapy. Therefore, a folate derivative was coupled to different boron clusters and cell uptake studies were
Folic acid derivatives for PET imaging and therapy addressing folate receptor positive tumors
International Nuclear Information System (INIS)
Schieferstein, Hanno
2013-01-01
Folic acid, also known as vitamin B9, is the oxidized form of 5,6,7,8-tetrahydrofolate, which serves as methyl- or methylene donor (C1-building blocks) during DNA synthesis. Under physiological conditions the required amount of 5,6,7,8-tetrahydrofolate for survival of the cell is accomplished through the reduced folate carrier (RFC). In contrast, the supply of 5,6,7,8-tetrahydrofolate is insufficient under pathophysiological conditions of tumors due to an increased proliferation rate. Consequently, many tumor cells exhibit an (over)expression of the folate receptor. This phenomenon has been applied to diagnostics (PET, SPECT, MR) to image FR-positive tumors and on the other hand to treat malignancies related to a FR (over)expression. Based on this concept, a new 18 F-labeled folate for PET imaging has been developed and was evaluated in vivo using tumor-bearing mice. The incorporation of oligoethylene spacers into the molecular structure led to a significant enhancement of the pharmacokinetics in comparison to previously developed 18 F-folates. The liver uptake could be reduced by one sixth by remaining a tumor uptake of 3%ID/g leading to better contrast ratios. Encouraged by these results, a clickable 18 F-labeled serine-based prosthetic group has been synthesized, again with the idea to improve the metabolic and pharmacokinetic profile of hydrophilic radiotracers. Therefore, an alkyne-carrying azido-functionalized serine derivative for coupling to biomolecules was synthesized and a chlorine leaving group for 18 F-labeling, which could be accomplished using a microwave-assisted synthesis, a [K is contained in 2.2.2] + /carbonate system in DMSO. Radiochemical yields of 77±6% could be achieved. The promising results obtained from the FR-targeting concept in the diagnostic field have been transferred to the boron neutron capture therapy. Therefore, a folate derivative was coupled to different boron clusters and cell uptake studies were conducted. The synthesis of
Thangaraju, Muthusamy; Karunakaran, Senthil K; Itagaki, Shiro; Gopal, Elangovan; Elangovan, Selvakumar; Prasad, Puttur D; Ganapathy, Vadivel
2009-10-15
3-bromopyruvate is an alkylating agent with antitumor activity. It is currently believed that blockade of adenosine triphosphate production from glycolysis and mitochondria is the primary mechanism responsible for this antitumor effect. The current studies uncovered a new and novel mechanism for the antitumor activity of 3-bromopyruvate. The transport of 3-bromopyruvate by sodium-coupled monocarboxylate transporter SMCT1 (SLC5A8), a tumor suppressor and a sodium (Na+)-coupled, electrogenic transporter for short-chain monocarboxylates, was studied using a mammalian cell expression and the Xenopus laevis oocyte expression systems. The effect of 3-bromopyruvate on histone deacetylases (HDACs) was monitored using the lysate of the human breast cancer cell line MCF7 and human recombinant HDAC isoforms as the enzyme sources. Cell viability was monitored by fluorescence-activated cell-sorting analysis and colony-formation assay. The acetylation status of histone H4 was evaluated by Western blot analysis. 3-Bromopyruvate is a transportable substrate for SLC5A8, and that transport process is Na+-coupled and electrogenic. MCF7 cells did not express SLC5A8 and were not affected by 3-bromopyruvate. However, when transfected with SLC5A8 or treated with inhibitors of DNA methylation, these cells underwent apoptosis in the presence of 3-bromopyruvate. This cell death was associated with the inhibition of HDAC1/HDAC3. Studies with different isoforms of human recombinant HDACs identified HDAC1 and HDAC3 as the targets for 3-bromopyruvate. 3-Bromopyruvate was transported into cells actively through the tumor suppressor SLC5A8, and the process was energized by an electrochemical Na+ gradient. Ectopic expression of the transporter in MCF7 cells led to apoptosis, and the mechanism involved the inhibition of HDAC1/HDAC3. Copyright (c) 2009 American Cancer Society.
Folate, colorectal cancer and the involvement of DNA methylation.
Williams, Elizabeth A
2012-11-01
Diet is a major factor in the aetiology of colorectal cancer (CRC). Epidemiological evidence suggests that folate confers a modest protection against CRC risk. However, the relationship is complex, and evidence from human intervention trials and animal studies suggests that a high-dose of folic acid supplementation may enhance the risk of colorectal carcinogenesis in certain circumstances. The molecular mechanisms underlying the apparent dual modulatory effect of folate on colorectal carcinogenesis are not fully understood. Folate is central to C1 metabolism and is needed for both DNA synthesis and DNA methylation, providing plausible biological mechanisms through which folate could modulate cancer risk. Aberrant DNA methylation is an early event in colorectal carcinogenesis and is typically associated with the transcriptional silencing of tumour suppressor genes. Folate is required for the production of S-adenosyl methionine, which serves as a methyl donor for DNA methylation events; thereby folate availability is proposed to modulate DNA methylation status. The evidence for an effect of folate on DNA methylation in the human colon is limited, but a modulation of DNA methylation in response to folate has been demonstrated. More research is required to clarify the optimum intake of folate for CRC prevention and to elucidate the effect of folate availability on DNA methylation and the associated impact on CRC biology.
Solute carrier transporters: potential targets for digestive system neoplasms
Xie, Jing; Zhu, Xiao Yan; Liu, Lu Ming; Meng, Zhi Qiang
2018-01-01
Jing Xie,1,2 Xiao Yan Zhu,1,2 Lu Ming Liu,1,2 Zhi Qiang Meng1,2 1Department of Integrative Oncology, Fudan University Shanghai Cancer Center, 2Department of Oncology, Shanghai Medical College, Fudan University, Shanghai 200032, People’s Republic of China Abstract: Digestive system neoplasms are the leading causes of cancer-related death all over the world. Solute carrier (SLC) superfamily is composed of a series of transporters that are ubiquitously expressed in organs and tissues o...
Directory of Open Access Journals (Sweden)
Sébastien Fritz
Full Text Available The regular decrease of female fertility over time is a major concern in modern dairy cattle industry. Only half of this decrease is explained by indirect response to selection on milk production, suggesting the existence of other factors such as embryonic lethal genetic defects. Genomic regions harboring recessive deleterious mutations were detected in three dairy cattle breeds by identifying frequent haplotypes (>1% showing a deficit in homozygotes among Illumina Bovine 50k Beadchip haplotyping data from the French genomic selection database (47,878 Holstein, 16,833 Montbéliarde, and 11,466 Normande animals. Thirty-four candidate haplotypes (p<10(-4 including previously reported regions associated with Brachyspina, CVM, HH1, and HH3 in Holstein breed were identified. Haplotype length varied from 1 to 4.8 Mb and frequencies from 1.7 up to 9%. A significant negative effect on calving rate, consistent in heifers and in lactating cows, was observed for 9 of these haplotypes in matings between carrier bulls and daughters of carrier sires, confirming their association with embryonic lethal mutations. Eight regions were further investigated using whole genome sequencing data from heterozygous bull carriers and control animals (45 animals in total. Six strong candidate causative mutations including polymorphisms previously reported in FANCI (Brachyspina, SLC35A3 (CVM, APAF1 (HH1 and three novel mutations with very damaging effect on the protein structure, according to SIFT and Polyphen-2, were detected in GART, SHBG and SLC37A2 genes. In conclusion, this study reveals a yet hidden consequence of the important inbreeding rate observed in intensively selected and specialized cattle breeds. Counter-selection of these mutations and management of matings will have positive consequences on female fertility in dairy cattle.
Fritz, Sébastien; Capitan, Aurelien; Djari, Anis; Rodriguez, Sabrina C.; Barbat, Anne; Baur, Aurélia; Grohs, Cécile; Weiss, Bernard; Boussaha, Mekki; Esquerré, Diane; Klopp, Christophe; Rocha, Dominique; Boichard, Didier
2013-01-01
The regular decrease of female fertility over time is a major concern in modern dairy cattle industry. Only half of this decrease is explained by indirect response to selection on milk production, suggesting the existence of other factors such as embryonic lethal genetic defects. Genomic regions harboring recessive deleterious mutations were detected in three dairy cattle breeds by identifying frequent haplotypes (>1%) showing a deficit in homozygotes among Illumina Bovine 50k Beadchip haplotyping data from the French genomic selection database (47,878 Holstein, 16,833 Montbéliarde, and 11,466 Normande animals). Thirty-four candidate haplotypes (p<10−4) including previously reported regions associated with Brachyspina, CVM, HH1, and HH3 in Holstein breed were identified. Haplotype length varied from 1 to 4.8 Mb and frequencies from 1.7 up to 9%. A significant negative effect on calving rate, consistent in heifers and in lactating cows, was observed for 9 of these haplotypes in matings between carrier bulls and daughters of carrier sires, confirming their association with embryonic lethal mutations. Eight regions were further investigated using whole genome sequencing data from heterozygous bull carriers and control animals (45 animals in total). Six strong candidate causative mutations including polymorphisms previously reported in FANCI (Brachyspina), SLC35A3 (CVM), APAF1 (HH1) and three novel mutations with very damaging effect on the protein structure, according to SIFT and Polyphen-2, were detected in GART, SHBG and SLC37A2 genes. In conclusion, this study reveals a yet hidden consequence of the important inbreeding rate observed in intensively selected and specialized cattle breeds. Counter-selection of these mutations and management of matings will have positive consequences on female fertility in dairy cattle. PMID:23762392
The orphan transporter v7-3 (slc6a15) is a Na+-dependent neutral amino acid transporter (B0AT2)
DEFF Research Database (Denmark)
Bröer, Angelika; Tietze, Nadine; Kowalczuk, Sonja
2006-01-01
. The transporter is functionally and sequence related to B(0)AT1 (slc6a19) and was hence named B(0)AT2. Leucine, isoleucine, valine, proline and methionine were recognized by the transporter, with values of K(0.5) (half-saturation constant) ranging from 40 to 200 microM. Alanine, glutamine and phenylalanine were...
Suazo, José; Castillo, Silvia; Martin, Luz Maria; Rojas, Francisca; Santos, José Luis; Rotter, Karin; Solar, Margarita; Tapia, Eva
2013-01-01
Obese/diabetic mothers present a higher risk to develop offspring with myelomeningocele (MM), evidence supporting the role of energy homeostasis-related genes in neural tube defects. Using polymerase chain reaction–restriction fragment length polymorphism, we have genotyped SLC2A1, HK1, and LEPR single-nucleotide polymorphisms in 105 Chilean patients with MM and their parents in order to evaluate allele–phenotype associations by means of allele/haplotype transmission test (TDT) and parent-of-origin effects. We detected an undertransmission for the SLC2A1 haplotype T-A (rs710218-rs2229682; P = .040), which was not significant when only lower MM (90% of the cases) was analyzed. In addition, the leptin receptor rs1137100 G allele showed a significant increase in the risk of MM for maternal-derived alleles in the whole sample (2.43-fold; P = .038) and in lower MM (3.20-fold; P = .014). Our results support the role of genes involved in energy homeostasis in the risk of developing MM, thus sustaining the hypothesis of diverse pathways and genetic mechanisms acting in the expression of such birth defect. PMID:23427181
Association of polymorphisms in folate metabolic genes and ...
Indian Academy of Sciences (India)
cancer risk: a case–control study in a Chinese population. DAWEI CAI1, LIN ... 1Department of Urology, Shengjing Hospital of China Medical University, Sanhao Street 36, ... low folate intake and an increased cancer risk. Folate ... labile protein (Weisberg et al. 2001). ..... control study, systematic review, and meta-analysis.
Gurav, Ashish; Sivaprakasam, Sathish; Bhutia, Yangzom D; Boettger, Thomas; Singh, Nagendra; Ganapathy, Vadivel
2015-07-15
Mammalian colon harbours trillions of bacteria under physiological conditions; this symbiosis is made possible because of a tolerized response from the mucosal immune system. The mechanisms underlying this tolerogenic phenomenon remain poorly understood. In the present study we show that Slc5a8 (solute carrier gene family 5a, member 8), a Na(+)-coupled high-affinity transporter in colon for the bacterial fermentation product butyrate, plays a critical role in this process. Among various immune cells in colon, dendritic cells (DCs) are unique not only in their accessibility to luminal contents but also in their ability to induce tolerogenic phenotype in T-cells. We found that DCs exposed to butyrate express the immunosuppressive enzymes indoleamine 2,3-dioxygenase 1 (IDO1) and aldehyde dehydrogenase 1A2 (Aldh1A2), promote conversion of naive T-cells into immunosuppressive forkhead box P3(+) (FoxP3(+)) Tregs (regulatory T-cells) and suppress conversion of naive T-cells into pro-inflammatory interferon (IFN)-γ-producing cells. Slc5a8-null DCs do not induce IDO1 and Aldh1A2 and do not generate Tregs or suppress IFN-γ-producing T-cells in response to butyrate. We also provide in vivo evidence for an obligatory role for Slc5a8 in suppression of IFN-γ-producing T-cells. Furthermore, Slc5a8 protects against colitis and colon cancer under conditions of low-fibre intake but not when dietary fibre intake is optimal. This agrees with the high-affinity nature of the transporter to mediate butyrate entry into cells. We conclude that Slc5a8 is an obligatory link between dietary fibre and mucosal immune system via the bacterial metabolite butyrate and that this transporter is a conditional tumour suppressor in colon linked to dietary fibre content. © 2015 Authors; published by Portland Press Limited.
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC460 (Link to dictyBase) - - - - SLC460Z (Link to Original site) - - SLC4...60Z 333 - - - - Show SLC460 Library SL (Link to library) Clone ID SLC460 (Link to dictyBase) At...las ID - NBRP ID - dictyBase ID - Link to Contig - Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-C/SLC4...60Q.Seq.d/ Representative seq. ID SLC460Z (Link to Original site) R...epresentative DNA sequence >SLC460 (SLC460Q) /CSM/SL/SLC4-C/SLC460Q.Seq.d/ XXXXXXXXXXAATTATTATTGTGTAATTCCTGT
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC496 (Link to dictyBase) - - - - SLC496E (Link to Original site) - - - - - - SLC4...96E 443 Show SLC496 Library SL (Link to library) Clone ID SLC496 (Link to dictyBase) At...las ID - NBRP ID - dictyBase ID - Link to Contig - Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-D/SLC4...96Q.Seq.d/ Representative seq. ID SLC496E (Link to Original site) R...epresentative DNA sequence >SLC496 (SLC496Q) /CSM/SL/SLC4-D/SLC496Q.Seq.d/ AAGAAATTTGAATCACTCCAAATCATTATCCCA
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC449 (Link to dictyBase) - - - - SLC449Z (Link to Original site) - - SLC4...49Z 384 - - - - Show SLC449 Library SL (Link to library) Clone ID SLC449 (Link to dictyBase) At...las ID - NBRP ID - dictyBase ID - Link to Contig - Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-C/SLC4...49Q.Seq.d/ Representative seq. ID SLC449Z (Link to Original site) R...epresentative DNA sequence >SLC449 (SLC449Q) /CSM/SL/SLC4-C/SLC449Q.Seq.d/ XXXXXXXXXXGTAAAAAGGAACACCAAGCCACT
Hozumi, Isao; Kurita, Hisaka; Ozawa, Kazuhiro; Furuta, Nobuyuki; Inden, Masatoshi; Sekine, Shin-Ichiro; Yamada, Megumi; Hayashi, Yuichi; Kimura, Akio; Inuzuka, Takashi; Seishima, Mitsuru
2018-05-15
Idiopathic basal ganglia calcification (IBGC), also called Fahr's disease or recently primary familial brain calcification (PFBC), is characterized by abnormal deposits of minerals including calcium mainly and phosphate in the brain. Mutations in SLC20A2 (IBGC1 (merged with former IBGC2 and IBGC3)), which encodes PiT-2, a phosphate transporter, is the major cause of IBGC. Recently, Slc20a2-KO mice have been showed to have elevated levels of inorganic phosphorus (Pi) in cerebrospinal fluid (CSF); however, CSF Pi levels in patients with IBGC have not been fully examined. We investigated the cases of 29 patients with IBGC including six patients with SLC20A2 mutation and three patients with PDGFB mutation, and 13 controls. The levels of sodium (Na), potassium (K), chloride (Cl), calcium (Ca), and Pi in sera and CSF were determined by potentiometry and colorimetry. Moreover, clinical manifestations were investigated in the IBGC patients with high Pi levels in CSF. The study revealed that the average level of Pi in the CSF of the total group of patients with IBGC is significantly higher than that of the control group, and the levels of Pi in CSF of the IBGC patients with SLC20A2 mutations are significantly higher than those of the IBGC patients with PDGFB mutations, the other IBGC patients and controls. Results of this study suggest that the levels of CSF Pi will be a good biomarker for IBGC1. Copyright © 2018 Elsevier B.V. All rights reserved.
Aromatase expression is increased in BRCA1 mutation carriers
International Nuclear Information System (INIS)
Chand, Ashwini L; KConFab; Simpson, Evan R; Clyne, Colin D
2009-01-01
Until recently, the molecular mechanisms explaining increased incidence of ovarian and breast cancers in carriers of BRCA1 gene mutations had not been clearly understood. Of significance is the finding that BRCA1 negatively regulates aromatase expression in vitro. Our objective was to characterise aromatase gene (CYP19A1) and its promoter expression in breast adipose and ovarian tissue in BRCA1 mutation carriers and unaffected controls. We measured aromatase transcripts, total and promoter-specific (PII, PI.3, PI.4) in prophylactic oophorectomy or mastectomy, therapeutic mastectomy, ovarian and breast tissue from unaffected women. We demonstrate that the lack of functional BRCA1 protein correlates to higher aromatase levels in 85% of BRCA1 mutation carriers. This increase is mediated by aberrant transcriptional regulation of aromatase; in breast adipose by increases in promoter II/I.3 and I.4-specific transcripts; and in the ovary with elevation in promoter I.3 and II-specific transcripts. Understanding the link between BRCA1 and aromatase is significant in terms of understanding why carcinogenesis is restricted to estrogen-producing tissues in BRCA1 mutation carriers
Folate content and availability in Malaysian cooked foods.
Chew, S C; Khor, G L; Loh, S P
2012-12-01
Data on folate availability of Malaysian cooked foods would be useful for estimation of dietary folate intake; however such information is scarce. A total of 53 samples of frequently consumed foods in Malaysia were selected from the Nutrient Composition of Malaysian Foods. Folate content was determined using HPLC method hyphenated with a stainless steel C18 column and ultraviolet detector (lambda = 280 nm). The index of folate availability was defined as the proportion of folate identified as monoglutamyl derivatives from the total folate content. Total folate content of different food samples varied from 30-95 microg/100g fresh weight. Among rice-based dishes, the highest and the lowest total folate was in coconut milk rice (nasi lemak) and ghee rice (nasi minyak), respectively. In noodle dishes, fried rice noodle (kuey teow goreng) and curry noodle (mee kari) had the highest folate contents. The highest index of folate availability was in a flat rice noodle dish (kuey teow bandung) (12.13%), while the lowest was in a festival cake (kuih bakul) (0.13%). Folate content was found to be negatively related to its availability. This study determined folate content and folate availability in commonly consumed cooked foods in Malaysia. The uptake of folate from foods with high folate content may not be necessarily high as folate absorption also depends on the capacity of intestinal deconjugation and the presence of high fibre in the foods.
Energy Technology Data Exchange (ETDEWEB)
Kim, Myoung Hyoun; Kim, Chang Guhn; Kim, Dae Weung [Dept. of Nuclear Medicine, Wonkwang University School of Medicine, Iksan (Korea, Republic of); Kim, Woo Hyoung [Dept. of Nuclear Medicine, Seoul National University Hospital, Seoul (Korea, Republic of)
2015-09-15
The folate receptor (FR) is an attractive molecular target since it is overexpressed in a variety of human tumors. The purpose of the present study was to synthesize and evaluate the feasibility of a novel {sup 99m}Tc-ECG-EDA (Glu-Cys-Gly-ethylenediamine)-folate as an FR-positive tumor imaging agent in a mouse tumor model. ECG-EDA-folate was synthesized using solid phase peptide synthesis (SPPS) and radiolabeled with {sup 99m}Tc using tripeptide ECG as a chelator. FR-positive KB cells were inoculated in athymic nude mice. Following injection of {sup 99m}Tc-ECG-EDA-folate, serial scintigraphy and micro-SPECT/CT imaging were performed at various time points with and without pre-administration of excess free folate. Mean count densities (MCD) for regions of interest drawn on KB tumors and major normal organs at each time point were measured, and uptake ratios of tumor to normal organs were calculated. ECG-EDA-folate was labeled with {sup 99m}Tc with high radiolabeling efficiency and stability (>96 %). FR-positive tumors were clearly visualized on both scintigraphy and micro-SPECT/CT images and the tumor uptake of {sup 99m}Tc-ECG-EDA-folate was markedly suppressed with faint visualization of tumors by pre-administration of excess free folate on serial planar scintigraphy, indicating FR-specific binding of the agent. Furthermore, semiquantitative analysis of MCD data showed again that both tumor MCD and tumor-to-normal organ ratios decreased considerably by pre-administration of excess free folate, supporting FR-specific tumor uptake. Tumor-to-normal organ ratios approximately increased with time after injection until 4 h. The present study demonstrated that 9{sup 99m}Tc-ECG-EDA-folate can bind specifically to FR with clear visualization of FR-positive tumors in a mouse tumor model.
SLC and SLD: Experimental experience with a linear collider
International Nuclear Information System (INIS)
Breidenbach, M.
1993-08-01
The SLAC Linear Collider (SLC) is the prototype e + e - linear collider. This talk will consist of an introduction to SLC, a description of the strategy for luminosity, a description of the systems for the transport and measurement of the polarized electrons, and a description of the present performance of the SLC and planned upgrades. The detector, SLD, and the status of the polarization asymmetry measurement A LR will be described
Folates in plants: research advances and progress in crop biofortification
Gorelova, Vera; Ambach, Lars; Rébeillé, Fabrice; Stove, Christophe; Van Der Straeten, Dominique
2017-03-01
Folates, also known as B9 vitamins, serve as donors and acceptors in one-carbon (C1) transfer reactions. The latter are involved in synthesis of many important biomolecules, such as amino acids, nucleic acids and vitamin B5. Folates also play a central role in the methyl cycle that provides one-carbon groups for methylation reactions. The important functions fulfilled by folates make them essential in all living organisms. Plants, being able to synthesize folates de novo, serve as an excellent dietary source of folates for animals that lack the respective biosynthetic pathway. Unfortunately, the most important staple crops such as rice, potato and maize are rather poor sources of folates. Insufficient folate consumption is known to cause severe developmental disorders in humans. Two approaches are employed to fight folate deficiency: pharmacological supplementation in the form of folate pills and biofortification of staple crops. As the former approach is considered rather costly for the major part of the world population, biofortification of staple crops is viewed as a decent alternative in the struggle against folate deficiency. Therefore strategies, challenges and recent progress of folate enhancement in plants will be addressed in this review. Apart from the ever-growing need for the enhancement of nutritional quality of crops, the world population faces climate change catastrophes or environmental stresses, such as elevated temperatures, drought, salinity that severely affect growth and productivity of crops. Due to immense diversity of their biochemical functions, folates take part in virtually every aspect of plant physiology. Any disturbance to the plant folate metabolism leads to severe growth inhibition and, as a consequence, to a lower productivity. Whereas today’s knowledge of folate biochemistry can be considered very profound, evidence on the physiological roles of folates in plants only starts to emerge. In the current review we will discuss the
International Nuclear Information System (INIS)
AlJammaz, I.; Al-Otaibi, B.; Al-Rumayan, F.; Al-Yanbawi, S.; Amer, S.; Okarvi, S.M.
2014-01-01
In an attempt to develop new folate radiotracers with favorable biochemical properties for detecting folate receptor-positive cancers, we have synthesized [ 124 I]-SIB- and [ 124 I]-SIP-folate conjugates using a straightforward and two-step simple reactions. Radiochemical yields for [ 124 I]-SIB- and [ 124 I]-SIP-folate conjugates were greater than 90 and 60% respectively, with total synthesis time of 30–40 min. Radiochemical purities were always greater than 98% without HPLC purification. These synthetic approaches hold considerable promise as rapid and simple method for 124 I-folate conjugate preparation with high radiochemical yield in short synthesis time. In vitro tests on KB cell line showed that the significant amounts of the radioconjugates were associated with cell fractions. In vivo characterization in normal Balb/c mice revealed rapid blood clearance of these radioconjugates and favorable biodistribution profile for [ 124 I]-SIP-folate conjugate over [ 124 I]-SIB-folate conjugate. Biodistribution studies of [ 124 I]-SIP-folate conjugate in nude mice bearing human KB cell line xenografts, demonstrated significant tumor uptake. The uptake in the tumors was blocked by excess injection of folic acid, suggesting a receptor-mediated process. These results demonstrate that [ 124 I]-SIP-folate conjugate may be useful as a molecular probe for detecting and staging of folate receptor-positive cancers, such as ovarian cancer and their metastasis as well as monitoring tumor response to treatment
Directory of Open Access Journals (Sweden)
André Bordinassi Medina
2017-04-01
Full Text Available Solute carrier (SLC transporters are a diverse group of membrane transporter proteins that regulate the cellular flux and distribution of endogenous and xenobiotic compounds. Post-translational modifications (PTMs, such as ubiquitination, have recently emerged as one of the major regulatory mechanisms in protein function and localization. Previously, we showed that SLC amino acid transporters were on average 6-fold de-ubiquitinated and increased amino acid levels were detected in ρ0 cells (lacking mitochondrial DNA, mtDNA compared to parental cells. Here, we elucidated the altered functionality of SLC transporters and their dynamic ubiquitination status by measuring the uptake of several isotopically labeled amino acids in both human osteosarcoma 143B.TK- and ρ0 cells. Our pulse chase analysis indicated that de-ubiquitinated amino acid transporters in ρ0 cells were accompanied by an increased transport rate, which leads to higher levels of amino acids in the cell. Finding SLC transport enhancers is an aim of the pharmaceutical industry in order to compensate for loss of function mutations in these genes. Thus, the ubiquitination status of SLC transporters could be an indicator for their functionality, but evidence for a direct connection between de-ubiquitination and transporter activity has to be further elucidated.
Human folate metabolism using 14C-accelerator mass spectrometry
International Nuclear Information System (INIS)
Arjomand, A; Bucholz, B A; Clifford, A J; Duecker, S R; Johnson, H; Schneider, P D; Zulim, R A.
1999-01-01
Folate is a water soluble vitamin required for optimal health, growth and development. It occurs naturally in various states of oxidation of the pteridine ring and with varying lengths to its glutamate chain. Folates function as one-carbon donors through methyl transferase catalyzed reactions. Low-folate diets, especially by those with suboptimal methyltransferase activity, are associated with increased risk of neural tube birth defects in children, hyperhomocysteinemic heart disease, and cancer in adults. Rapidly dividing (neoplastic) cells have a high folate need for DNA synthesis. Chemical analogs of folate (antifolates) that interfere with folate metabolism are used as therapeutic agents in cancer treatment. Although much is known about folate chemistry, metabolism of this vitamin in vivo in humans is not well understood. Since folate levels in blood and tissues are very low and methods to measure them are inadequate, the few previous studies that have examined folate metabolism used large doses of radiolabeled folic acid in patients with Hodgkins disease and cancer (Butterworth et al. 1969, Krumdieck et al. 1978). A subsequent protocol using deuterated folic acid was also insufficiently sensitive to trace a physiologic folate dose (Stites et al. 1997). Accelerator mass spectrometry (AMS) is an emerging bioanalytical tool that overcomes the limitations of traditional mass spectrometry and of decay counting of long lived radioisotopes (Vogel et al. 1995). AMS can detect attomolar concentrations of 14 C in milligram-sized samples enabling in vivo radiotracer studies in healthy humans. We used AMS to study the metabolism of a physiologic 80 nmol oral dose of 14 C-folic acid (1/6 US RDA) by measuring the 14 C-folate levels in serial plasma, urine and feces samples taken over a 150-day period after dosing a healthy adult volunteer
Drosophila SLC5A11 Mediates Hunger by Regulating K(+) Channel Activity.
Park, Jin-Yong; Dus, Monica; Kim, Seonil; Abu, Farhan; Kanai, Makoto I; Rudy, Bernardo; Suh, Greg S B
2016-08-08
Hunger is a powerful drive that stimulates food intake. Yet, the mechanism that determines how the energy deficits that result in hunger are represented in the brain and promote feeding is not well understood. We previously described SLC5A11-a sodium/solute co-transporter-like-(or cupcake) in Drosophila melanogaster, which is required for the fly to select a nutritive sugar over a sweeter nonnutritive sugar after periods of food deprivation. SLC5A11 acts on approximately 12 pairs of ellipsoid body (EB) R4 neurons to trigger the selection of nutritive sugars, but the underlying mechanism is not understood. Here, we report that the excitability of SLC5A11-expressing EB R4 neurons increases dramatically during starvation and that this increase is abolished in the SLC5A11 mutation. Artificial activation of SLC5A11-expresssing neurons is sufficient to promote feeding and hunger-driven behaviors; silencing these neurons has the opposite effect. Notably, SLC5A11 transcript levels in the brain increase significantly when flies are starved and decrease shortly after starved flies are refed. Furthermore, expression of SLC5A11 is sufficient for promoting hunger-driven behaviors and enhancing the excitability of SLC5A11-expressing neurons. SLC5A11 inhibits the function of the Drosophila KCNQ potassium channel in a heterologous expression system. Accordingly, a knockdown of dKCNQ expression in SLC5A11-expressing neurons produces hunger-driven behaviors even in fed flies, mimicking the overexpression of SLC5A11. We propose that starvation increases SLC5A11 expression, which enhances the excitability of SLC5A11-expressing neurons by suppressing dKCNQ channels, thereby conferring the hunger state. Copyright © 2016 Elsevier Ltd. All rights reserved.
Tóth, Lola; Fábos, Beáta; Farkas, Katalin; Sulák, Adrienn; Tripolszki, Kornélia; Széll, Márta; Nagy, Nikoletta
2017-03-15
Oculocutaneous albinism (OCA) is a clinically and genetically heterogenic group of pigmentation abnormalities. OCA type IV (OCA4, OMIM 606574) develops due to homozygous or compound heterozygous mutations in the solute carrier family 45, member 2 (SLC45A2) gene. This gene encodes a membrane-associated transport protein, which regulates tyrosinase activity and, thus, melanin content by changing melanosomal pH and disrupting the incorporation of copper into tyrosinase. Here we report two Hungarian siblings affected by an unusual OCA4 phenotype. After genomic DNA was isolated from peripheral blood of the patients, the coding regions of the SLC45A2 gene were sequenced. In silico tools were applied to identify the functional impact of the newly detected mutations. Direct sequencing of the SLC45A2 gene revealed two novel, heterozygous mutations, one missense (c.1226G > A, p.Gly409Asp) and one nonsense (c.1459C > T, p.Gln437*), which were present in both patients, suggesting the mutations were compound heterozygous. In silico tools suggest that these variations are disease causing mutations. The newly identified mutations may affect the transmembrane domains of the protein, and could impair transport function, resulting in decreases in both melanosomal pH and tyrosinase activity. Our study provides expands on the mutation spectrum of the SLC45A2 gene and the genetic background of OCA4.
Patriquin, Michelle A; Hamon, Sara C; Harding, Mark J; Nielsen, Ellen M; Newton, Thomas F; De La Garza, Richard; Nielsen, David A
2017-10-01
This study investigated variants of tryptophan hydroxylase (TPH)1, TPH2, and SLC6A4 in the moderation of the subjective effects of cocaine. Non-treatment-seeking cocaine-dependent individuals (N=66) were intravenously administered saline and cocaine (40 mg) in a randomized order. Participants self-reported subjective effects of cocaine using a visual analog scale starting before administration of saline or cocaine (-15 min) to up to 20 min after infusion. Self-report ratings on the visual analog scale ranged from 0 (no effect) to 100 (greatest effect). Participants were genotyped for the TPH1 rs1799913, TPH2 rs4290270, and SLC6A4 5-HTTLPR variants. Repeated-measures analysis of covariance was used to examine changes in subjective effect scores over time while controlling for population structure. Participants carrying the TPH1 rs1799913 A allele reported greater subjective response to cocaine for 'stimulated' and 'access' relative to the CC genotype group. Those carrying the TPH2 rs4290270 A allele reported higher 'good effect' and lower 'depressed' effect relative to the TT genotype group. Those carrying the SLC6A4 5-HTTLPR S' allele reported greater 'desire' and 'access' compared with the L'L' genotype group. These findings indicate that TPH1, TPH2, and SLC6A4 variants moderate the subjective effects of cocaine in non-treatment-seeking cocaine-dependent participants.
Yuan, Fang-Fen; Gu, Xue; Huang, Xin; Zhong, Yan; Wu, Jing
2017-07-03
Attention-deficit/hyperactivity disorder (ADHD) is an early onset childhood neurodevelopmental disorder with an estimated heritability of approximately 76%. We conducted a case-control study to explore the role of the SLC6A1 gene in ADHD. The genotypes of eight variants were determined using Sequenom MassARRAY technology. The participants in the study were 302 children with ADHD and 411 controls. ADHD symptoms were assessed using the Conners Parent Symptom Questionnaire. In our study, rs2944366 was consistently shown to be associated with the ADHD risk in the dominant model (odds ratio [OR]=0.554, 95% confidence interval [CI]=0.404-0.760), and nominally associated with Hyperactive index score (P=0.027). In addition, rs1170695 has been found to be associated with the ADHD risk in the addictive model (OR=1.457, 95%CI=1.173-1.809), while rs9990174 was associated with the Hyperactive index score (P=0.010). Intriguingly, gene-environmental interactions analysis consistently revealed the potential interactions of rs1170695 with blood lead (P mul =0.044) to modify the ADHD risk. Expression quantitative trait loci analysis suggested that these positive single nucleotide polymorphisms (SNPs) may mediate SLC6A1 gene expression. Therefore, our results suggest that selected SLC6A1 gene variants may have a significant effect on the ADHD risk. Copyright © 2017 Elsevier Inc. All rights reserved.
International Nuclear Information System (INIS)
Adolphsen, C.; Barklow, T.; Burke, D.; Decker, F.J.; Emma, P.; Hildreth, M.; Himel, T.; Krejcik, P.; Limberg, T.; Minty, M.
1993-01-01
The Stanford Linear Collider was designed to operate with round beams; horizontal and vertical emittance made equal in the damping rings. The main motivation was to facilitate the optical matching through beam lines with strong coupling elements like the solenoid spin rotator magnets and the SLC arcs. Tests in 1992 showed that open-quote flat close-quote beams with a vertical to horizontal emittance ratio of around 1/10 can be successfully delivered to the end of the linac. Techniques developed to measure and control the coupling of the SLC arcs allow These beams to be transported to the Interaction Point (IP). Before flat beams could be used for collisions with polarized electrons, a new method of rotating the electron spin orientation with vertical arc orbit bumps had to be developed. Early in the 1993 run, the SLC was switched to open-quote flat close-quote beam operation. Within a short time the peak luminosity of the previous running cycle was reached and then surpassed. The average daily luminosity is now a factor of about two higher than the best achieved last year. In the following the authors present an overview of the problems encountered and their solutions for different parts of the SLC
Total folate and unmetabolized folic acid in the breast milk of a cross-section of Canadian women.
Page, Rachael; Robichaud, André; Arbuckle, Tye E; Fraser, William D; MacFarlane, Amanda J
2017-05-01
Background: Folate requirements increase during pregnancy and lactation. It is recommended that women who could become pregnant, are pregnant, or are lactating consume a folic acid (FA)-containing supplement. Objectives: We sought to determine breast-milk total folate and unmetabolized folic acid (UMFA) contents and their relation with FA-supplement use and doses in a cohort of Canadian mothers who were enrolled in the MIREC (Maternal-Infant Research on Environmental Chemicals) study. Design: Breast-milk tetrahydrofolate (THF), 5-methyl-THF, 5-formyl-THF, 5,10-methenyl-THF, and UMFA were measured with the use of liquid chromatography-tandem mass spectrometry ( n = 561). Total daily supplemental FA intake was based on self-reported FA-supplement use. Results: UMFA was detectable in the milk of 96.1% of the women. Total daily FA intake from supplements was associated with breast folate concentration and species. Breast-milk total folate was 18% higher ( P 400 μg FA/d ( P ≤ 0.004). 5-Methyl-THF was 19% lower ( P 400 μg FA/d had proportionally lower 5-methyl-THF and higher UMFA than did women who consumed ≤400 μg FA/d. Conclusions: FA-supplement use was associated with modestly higher breast-milk total folate. Detectable breast-milk UMFA was nearly ubiquitous, including in women who did not consume an FA supplement. Breast-milk UMFA was proportionally higher than 5-methyl-THF in women who consumed >400 μg FA/d, thereby suggesting that higher doses exceed the physiologic capacity to metabolize FA and result in the preferential uptake of FA in breast milk. Therefore, FA-supplement doses >400 μg may not be warranted, especially in populations for whom FA fortification is mandatory. © 2017 American Society for Nutrition.
Cystinuria Associated with Different SLC7A9 Gene Variants in the Cat.
Directory of Open Access Journals (Sweden)
Keijiro Mizukami
Full Text Available Cystinuria is a classical inborn error of metabolism characterized by a selective proximal renal tubular defect affecting cystine, ornithine, lysine, and arginine (COLA reabsorption, which can lead to uroliths and urinary obstruction. In humans, dogs and mice, cystinuria is caused by variants in one of two genes, SLC3A1 and SLC7A9, which encode the rBAT and bo,+AT subunits of the bo,+ basic amino acid transporter system, respectively. In this study, exons and flanking regions of the SLC3A1 and SLC7A9 genes were sequenced from genomic DNA of cats (Felis catus with COLAuria and cystine calculi. Relative to the Felis catus-6.2 reference genome sequence, DNA sequences from these affected cats revealed 3 unique homozygous SLC7A9 missense variants: one in exon 5 (p.Asp236Asn from a non-purpose-bred medium-haired cat, one in exon 7 (p.Val294Glu in a Maine Coon and a Sphinx cat, and one in exon 10 (p.Thr392Met from a non-purpose-bred long-haired cat. A genotyping assay subsequently identified another cystinuric domestic medium-haired cat that was homozygous for the variant originally identified in the purebred cats. These missense variants result in deleterious amino acid substitutions of highly conserved residues in the bo,+AT protein. A limited population survey supported that the variants found were likely causative. The remaining 2 sequenced domestic short-haired cats had a heterozygous variant at a splice donor site in intron 10 and a homozygous single nucleotide variant at a branchpoint in intron 11 of SLC7A9, respectively. This study identifies the first SLC7A9 variants causing feline cystinuria and reveals that, as in humans and dogs, this disease is genetically heterogeneous in cats.
Energy Technology Data Exchange (ETDEWEB)
Mueller, Cristina [Paul Scherrer Institute, Center for Radiopharmaceutical Science ETH-PSI-USZ, Villigen PSI (Switzerland); Erasmus MC, Department of Nuclear Medicine, Rotterdam (Netherlands); Mindt, Thomas L. [ETH Zurich, Department of Chemistry and Applied Biosciences, Zurich (Switzerland); Jong, Marion de [Erasmus MC, Department of Nuclear Medicine, Rotterdam (Netherlands); Schibli, Roger [Paul Scherrer Institute, Center for Radiopharmaceutical Science ETH-PSI-USZ, Villigen PSI (Switzerland); ETH Zurich, Department of Chemistry and Applied Biosciences, Zurich (Switzerland)
2009-06-15
Folate-based radiopharmaceuticals have the potential to be used for imaging and therapy of tumours positive for the folate receptor (FR). We describe the in vitro and in vivo evaluation of a DOTA-folate conjugate. Radiolabelling of the DOTA-folate was carried out via standard procedures using {sup 111}InCl{sub 3} and {sup 177}LuCl{sub 3}, respectively. The distribution coefficient (log D) was determined in octanol/PBS (pH 7.4). Tissue distribution was investigated in nude mice bearing KB tumour xenografts at different time points after administration of {sup 111}In-DOTA-folate (radiofolate 1) or {sup 177}Lu-DOTA-folate (radiofolate 2) (1 MBq, 1 nmol per mouse). Pemetrexed (PMX, 400 {mu}g) was injected 1 h prior to the radiofolate in order to reduce renal uptake. Images were acquired with a SPECT/CT camera 24 h after injection of the radiofolate (40-50 MBq, 3 nmol per mouse). The hydrophilic character of the DOTA-folate was represented by a low log D value (radiofolate 1 -4.21{+-}0.11). In vivo, maximal tumour uptake was found 4 h after injection (radiofolate 1 5.80{+-}0.55% ID/g; radiofolate 2 7.51{+-}1.25% ID/g). In FR-positive kidneys there was considerable accumulation of the radiofolates (radiofolate 1 55.88{+-}3.91% ID/g; radiofolate 2 57.22{+-}11.05% ID/g; 4 h after injection). However, renal uptake was reduced by preinjection of PMX (radiofolate 1 9.52{+-}1.07% ID/g; radiofolate 2 13.43{+-}0.54% ID/g; 4 h after injection) whereas the tumour uptake was retained (radiofolate 1 6.32{+-}0.41% ID/g; radiofolate 2 8.99{+-}0.43% ID/g; 4 h after injection). SPECT/CT images clearly confirmed favourable tissue distribution of the novel radiofolates and the positive effect of PMX. The preliminary requirements for the therapeutic use of the novel DOTA-folate are met by its favourable tissue distribution that can be ascribed to its hydrophilic properties and combined administration with PMX. (orig.)
Folate inadequacy in the diet of pregnant women
Directory of Open Access Journals (Sweden)
Lívia de Castro Crivellenti
2014-06-01
Full Text Available OBJECTIVE: To estimate food and dietary folate inadequacies in the diets of adult pregnant women. METHODS: A prospective study was conducted with 103 healthy pregnant adult users of the Public Health Care System of Ribeirão Preto, São Paulo, Brazil. The present study included the 82 women with complete food intake data during pregnancy, which were collected by three 24-hour dietary recalls. Food folate (folate naturally present in foods and dietary folate (food folate plus folate from fortified wheat flour and cornmeal inadequacies were determined, using the Estimated Average Requirement as cutoff. RESULTS: The diets of 100% and 94% of the pregnant women were inadequate in food folate and dietary folate, respectively. However, fortified foods increased the medium availability of the nutrient by 87%. CONCLUSION: The large number of pregnant women consuming low-folate diets was alarming. Nationwide population studies are needed to confirm the hypothesized high prevalence of low-folate diets among pregnant women.
Saini, R. K.; Manoj, P.; Shetty, N. P.; Srinivasan, K.; Giridhar, P.
2015-01-01
Moringa oleifera is an affordable and rich source of dietary folate. Quantification of folate by HPLC showed that 5-formyl-5,6,7,8-tetrahydrofolic acid (502.1 μg/100 g DW) and 5,6,7,8-tetrahydrofolic acid (223.9 μg/100 g DW) as the most dominant forms of folate in M. oleifera leaves. The bioavailability of folate and the effects of folate depletion and repletion on biochemical and molecular markers of folate status were investigated in Wistar rats. Folate deficiency was induced by keeping the...
Hepatic folate metabolism in the chronic alcoholic monkey
International Nuclear Information System (INIS)
Tamura, T.; Romero, J.J.; Watson, J.E.; Gong, E.J.; Halsted, C.H.
1981-01-01
To assess the role of altered hepatic folate metabolism in the pathogenesis of the folate deficiency of chronic alcoholism, the hepatic metabolism of a tracer dose of 3 H-PteGlu was compared in monkeys given 50% of energy as ethanol for 2 years and in control monkeys. Long-term ethanol feeding resulted in mild hepatic injury, with a significant decrease in hepatic folate levels. Chromatographic studies of liver biopsies obtained after the tracer dose indicated that the processes of reduction, methylation, and formylation of reduced folate and the synthesis of polyglutamyl folates were not affected by long-term ethanol feeding. Hepatic tritium levels were significantly decreased in the ethanol-fed group. These studies suggest that the decrease in hepatic folate levels observed after long-term ethanol ingestion is due to a decrease in hepatic folate levels observed after long-term ethanol ingestion is due to a decreased ability to retain folates in the liver, whereas reduction and further metabolism of folates is not affected
Circulating folate levels and colorectal adenoma: a case-control study and a meta-analysis.
Park, Yeong Mi; Youn, Jiyoung; Cho, Chang Ho; Kim, Sung Hi; Lee, Jung Eun
2017-10-01
The relationship between folate and colorectal neoplasia remains controversial. We examined the association between serum folate concentrations and colorectal adenomas in a case-control study of Korean adults and conducted a meta-analysis. Our case-control study included 113 pairs of case and control who underwent colonoscopy and provided blood samples. We used multivariable conditional logistic regression models to obtain the odds ratios and 95% confidence interval (CIs). For meta-analysis, we identified the relevant studies by searching the PubMed database up to February 2017, included our case-control study and combined the study-specific relative risks (RRs) using a random-effects model. In this case-control study, we included 58 men and 55 women with colorectal adenomas and sex and fasting status matched the controls. We did not find any significant association between the serum folate levels and colorectal adenomas in either men or women. For meta-analysis, a total of eleven studies were included in our analysis and classified into two groups; polyp clearance group (PC) for the studies that included participants who underwent endoscopies and had their polyps removed at baseline; and no polyp clearance group (NPC) for the studies that included participants whose histories of endoscopies were unknown or who underwent their first endoscopies. Four PC (1,311 cases and 1,672 non-cases) and eight NPC studies (3,501 cases and 11,347 non-cases) were included. The combined RRs (95% CIs) comparing the bottom with the top categories of circulating folate levels were 1.07 (0.97-1.18) for the NPC group but 1.45 (1.16-1.74) for the PC group. Low circulating folate levels were associated with new adenoma formation.
The folate receptor as a molecular target for tumor-selective radionuclide delivery
International Nuclear Information System (INIS)
Ke, C.-Y.; Mathias, Carla J.; Green, Mark A.
2003-01-01
The cell-membrane folate receptor is a potential molecular target for tumor-selective drug delivery, including radiolabeled folate-chelate conjugates for diagnostic imaging. We review here some background on the folate receptor as tumor-associated molecular target for drug delivery, and briefly survey the literature on tumor-targeting with radiolabeled folate-chelate conjugates
Folate and human reproduction.
Tamura, Tsunenobu; Picciano, Mary Frances
2006-05-01
The influence of folate nutritional status on various pregnancy outcomes has long been recognized. Studies conducted in the 1950s and 1960s led to the recognition of prenatal folic acid supplementation as a means to prevent pregnancy-induced megaloblastic anemia. In the 1990s, the utility of periconceptional folic acid supplementation and folic acid food fortification emerged when they were proven to prevent the occurrence of neural tube defects. These distinctively different uses of folic acid may well be ranked among the most significant public health measures for the prevention of pregnancy-related disorders. Folate is now viewed not only as a nutrient needed to prevent megaloblastic anemia in pregnancy but also as a vitamin essential for reproductive health. This review focuses on the relation between various outcomes of human reproduction (ie, pregnancy, lactation, and male reproduction) and folate nutrition and metabolism, homocysteine metabolism, and polymorphisms of genes that encode folate-related enzymes or proteins, and we identify issues for future research.
Ganz, Ariel B; Shields, Kelsey; Fomin, Vlad G; Lopez, Yusnier S; Mohan, Sanjay; Lovesky, Jessica; Chuang, Jasmine C; Ganti, Anita; Carrier, Bradley; Yan, Jian; Taeswuan, Siraphat; Cohen, Vanessa V; Swersky, Camille C; Stover, Julie A; Vitiello, Gerardo A; Malysheva, Olga V; Mudrak, Erika; Caudill, Marie A
2016-10-01
Although single nucleotide polymorphisms (SNPs) in folate-mediated pathways predict susceptibility to choline deficiency during severe choline deprivation, it is unknown if effects persist at recommended intakes. Thus, we used stable isotope liquid chromatography-mass spectrometry (LC-MS) methodology to examine the impact of candidate SNPs on choline metabolism in a long-term, randomized, controlled feeding trial among pregnant, lactating, and nonpregnant (NP) women consuming 480 or 930 mg/d choline (22% as choline-d 9 , with d 9 indicating a deuterated trimethyl amine group) and meeting folate-intake recommendations. Variants impairing folate metabolism, methylenetetrahydrofolate reductase (MTHFR) rs1801133, methionine synthase (MTR) rs1805087 [wild-type (WT)], MTR reductase (MTRR) rs1801394, and methylenetetrahydrofolate dehydrogenase-methenyltetrahydrofolate cyclohydrolase-formyltetrahydrofolate synthetase (MTHFD1) rs2236225, influenced choline dynamics, frequently through interactions with reproductive state and choline intake, with fewer genotypic alterations observed among pregnant women. Women with these variants partitioned more dietary choline toward phosphatidylcholine (PC) biosynthesis via the cytidine diphosphate (CDP)-choline pathway at the expense of betaine synthesis even when use of betaine as a methyl donor was increased. Choline intakes of 930 mg/d restored partitioning of dietary choline between betaine and CDP-PC among NP (MTHFR rs1801133 and MTR rs1805087 WT) and lactating (MTHFD1 rs2236225) women with risk genotypes. Overall, our findings indicate that loss-of-function variants in folate-metabolizing enzymes strain cellular PC production, possibly via impaired folate-dependent phosphatidylethanolamine-N-methyltransferase (PEMT)-PC synthesis, and suggest that women with these risk genotypes may benefit from choline intakes exceeding current recommendations.-Ganz, A. B., Shields, K., Fomin, V. G., Lopez, Y. S., Mohan, S., Lovesky, J., Chuang, J
Ohrvik, Veronica E.; Witthoft, Cornelia M.
2011-01-01
The vitamin folate is recognized as beneficial health-wise in the prevention of neural tube defects, anemia, cardiovascular diseases, poor cognitive performance, and some forms of cancer. However, suboptimal dietary folate intake has been reported in a number of countries. Several national health authorities have therefore introduced mandatory food fortification with synthetic folic acid, which is considered a convenient fortificant, being cost-efficient in production, more stable than natura...
Lever, E G; Elwes, R D; Williams, A; Reynolds, E H
1986-01-01
Subacute combined degeneration of the cord is a rare complication of folate deficiency. Disturbance of methylation reactions in nervous tissue probably underlie subacute combined degeneration of the cord arising from folate as well as vitamin B12 deficiency. Methyl tetrahydrofolate is the form in which folic acid is transported into the CNS. Therefore methyl tetrahydrofolate treatment of the neurological and psychiatric manifestations of folate deficiency would seem to be theoretically advant...
International Nuclear Information System (INIS)
Ross, M.
1993-04-01
The SLAC Linear Collider (SLC) is the forerunner of a new generation of high energy accelerators. As such, it incorporates many novel features that must be fully exploited to achieve optimum performance. In this paper we present an overview of the frontiers of collider performance at SLC. Recent developments have centered on polarization, intensity and emittance preservation issues. A polarized source and spin transport system were successfully commissioned in 1992 and operated with high reliability. Practical intensity limits associated with rapid growth ( S ) bunch length instabilities have been observed in the damping rings. Ring RF voltage manipulations are used to suppress the instabilities. Emittance preservation technique development has focused on controlling system-wide instabilities and improving feedback and tuning procedures. Control of instabilities of all time scales, pulse to pulse, fast and slow, is one of the most challenging aspects of the collider. The challenge is met with (1) very high level of control and automation required for general tuning and optimization, (2) real-time transport line optical correction and monitoring, (3) coupled, high level, trajectory and energy feedback, (4) high order multipole optical correction and monitoring, (5) feedback-based linac beam emittance preservation, and (6) interaction region luminosity optimization. The common thread beneath all of these is the SLC control system which must provide a level of control, diagnosis and feedback not required for simpler machines
F.J. Couch (Fergus); M.M. Gaudet (Mia); A.C. Antoniou (Antonis); S.J. Ramus (Susan); K.B. Kuchenbaecker (Karoline); P. Soucy (Penny); J. Beesley (Jonathan); X. Chen (Xiaoqing); X. Wang (Xing); T. Kircchoff (Tomas); L. McGuffog (Lesley); D. Barrowdale (Daniel); A. Lee (Andrew); S. Healey (Sue); O. Sinilnikova (Olga); I.L. Andrulis (Irene); H. Ozcelik (Hilmi); A.M. Mulligan (Anna Marie); M. Thomassen (Mads); A-M. Gerdes (Anne-Marie); U.B. Jensen; A.-B. Skytte (Anne-Bine); T.A. Kruse (Torben); M.A. Caligo (Maria); A. von Wachenfeldt (Anna); G. Barbany-Bustinza (Gisela); N. Loman (Niklas); M. Soller (Maria); H. Ehrencrona (Hans); P. Karlsson (Per); K.L. Nathanson (Katherine); R. Rebbeck (Timothy); S.M. Domchek (Susan); A. Jakubowska (Anna); J. Lubinski (Jan); K. Jaworska (Katarzyna); K. Durda (Katarzyna); E. Zołwocka (Elzbieta); T. Huzarski (Tomasz); T. Byrski (Tomasz); J. Gronwald (Jacek); C. Cybulski (Cezary); B. Górski (Bohdan); A. Osorio (Ana); M. Durán (Mercedes); M.I. Tejada; J. Benítez (Javier); U. Hamann (Ute); F.B.L. Hogervorst (Frans); T.A.M. van Os (Theo); F.E. van Leeuwen (Flora); E.J. Meijers-Heijboer (Hanne); J.T. Wijnen (Juul); M.J. Blok (Marinus); C.M. Kets; M.J. Hooning (Maartje); R.A. Oldenburg (Rogier); M.G.E.M. Ausems (Margreet); S. Peock (Susan); D. Frost (Debra); S.D. Ellis (Steve); R. Platte (Radka); E. Fineberg (Elena); D.G. Evans (Gareth); C. Jacobs (Chris); R. Eeles (Rosalind); J.W. Adlard (Julian); R. Davidson (Rosemarie); D. Eccles (Diana); T.J. Cole (Trevor); J. Cook (Jackie); J. Paterson (Joan); C. Brewer (Carole); F. Douglas (Fiona); S.V. Hodgson (Shirley); P.J. Morrison (Patrick); L.J. Walker (Lisa); M.E. Porteous (Mary); M.J. Kennedy (John); L. Side (Lucy); B. Bove (B.); A.K. Godwin (Andrew); D. Stoppa-Lyonnet (Dominique); M. Fassy-Colcombet (Marion); L. Castera (Laurent); F. Cornelis (Franco̧is); S. Mazoyer (Sylvie); M. Léone (Mélanie); N. Boutry-Kryza (N.); B. Bressac-de Paillerets (Brigitte); O. Caron (Olivier); P. Pujol (Pascal); I. Coupier (Isabelle); C.D. Delnatte (Capucine); L. Akloul (Linda); H. Lynch (Henry); C.L. Snyder (Carrie); S.S. Buys (Saundra); M.B. Daly (Mary); M.-B. Terry (Mary-Beth); W. Chung (Wendy); E.M. John (Esther); A. Miron (Alexander); M.C. Southey (Melissa); J.L. Hopper (John); D. Goldgar (David); C.F. Singer (Christian); C. Rappaport (Christine); M.-K. Tea; A. Fink-Retter (Anneliese); T.V.O. Hansen (Thomas); F.C. Nielsen (Finn); A. Arason (Adalgeir); J. Vijai (Joseph); S. Shah (Sonia); K. Sarrel (Kara); M. Robson (Mark); M. Piedmonte (Marion); K. Phillips (Kelly); J. Basil (Jack); W.S. Rubinstein (Wendy); J.F. Boggess (John); K. Wakeley (Katie); A. Ewart-Toland (Amanda); M. Montagna (Marco); S. Agata (Simona); E.N. Imyanitov (Evgeny); C. Isaacs (Claudine); R. Janavicius (Ramunas); C. Lazaro (Conxi); I. Blanco (Ignacio); L. Feliubadaló (L.); J. Brunet (Joan); S.A. Gayther (Simon); P.D.P. Pharoah (Paul); K. Odunsi (Kunle); B.Y. Karlan (Beth); C.S. Walsh (Christine); E. Olah; S.-H. Teo (Soo-Hwang); P.A. Ganz (Patricia); M.S. Beattie (Mary); E.J. van Rensburg (Elizabeth); C.M. Dorfling (Cecelia); O. Diez (Orland); A. Kwong (Ava); R.K. Schmutzler (Rita); B. Wapenschmidt (Barbara); C.W. Engel (Christoph); A. Meindl (Alfons); N. Ditsch (Nina); N. Arnold (Norbert); S. Heidemann (Simone); D. Niederacher (Dieter); S. Preisler-Adams (Sabine); D. Gadzicki (Dorothea); R. Varon-Mateeva (Raymonda); H. Deissler (Helmut); P.A. Gehrig (Paola A.); C. Sutter (Christian); K. Kast (Karin); B. Fiebig (Britta); W. Heinritz (Wolfram); T. Caldes (Trinidad); M. de La Hoya (Miguel); T.A. Muranen (Taru); H. Nevanlinna (Heli); M. Tischkowitz (Marc); A.B. Spurdle (Amanda); S.L. Neuhausen (Susan); Y.C. Ding (Yuan); N.M. Lindor (Noralane); Z. Fredericksen (Zachary); V.S. Pankratz (Shane); P. Peterlongo (Paolo); S. Manoukian (Siranoush); B. Peissel (Bernard); D. Zaffaroni (D.); M. Barile (Monica); L. Bernard (Loris); A. Viel (Alessandra); G. Giannini (Giuseppe); L. Varesco (Liliana); P. Radice (Paolo); M.H. Greene (Mark); P.L. Mai (Phuong); D.F. Easton (Douglas); G. Chenevix-Trench (Georgia); K. Offit (Kenneth); J. Simard (Jacques)
2012-01-01
textabstractBackground: Genome-wide association studies (GWAS) identified variants at 19p13.1 and ZNF365 (10q21.2) as risk factors for breast cancer among BRCA1 and BRCA2 mutation carriers, respectively. We explored associations with ovarian cancer and with breast cancer by tumor histopathology for
Couch, Fergus J.; Gaudet, Mia M.; Antoniou, Antonis C.; Ramus, Susan J.; Kuchenbaecker, Karoline B.; Soucy, Penny; Beesley, Jonathan; Chen, Xiaoqing; Wang, Xianshu; Kirchhoff, Tomas; McGuffog, Lesley; Barrowdale, Daniel; Lee, Andrew; Healey, Sue; Sinilnikova, Olga M.; Andrulis, Irene L.; Ozcelik, Hilmi; Mulligan, Anna Marie; Thomassen, Mads; Gerdes, Anne-Marie; Jensen, Uffe Birk; Skytte, Anne-Bine; Kruse, Torben A.; Caligo, Maria A.; von Wachenfeldt, Anna; Barbany-Bustinza, Gisela; Loman, Niklas; Soller, Maria; Ehrencrona, Hans; Karlsson, Per; Nathanson, Katherine L.; Rebbeck, Timothy R.; Domchek, Susan M.; Jakubowska, Ania; Lubinski, Jan; Jaworska, Katarzyna; Durda, Katarzyna; Zlowocka, Elzbieta; Huzarski, Tomasz; Byrski, Tomasz; Gronwald, Jacek; Cybulski, Cezary; Górski, Bohdan; Osorio, Ana; Durán, Mercedes; Tejada, María Isabel; Benitez, Javier; Hamann, Ute; Hogervorst, Frans B. L.; van Os, Theo A.; van Leeuwen, Flora E.; Meijers-Heijboer, Hanne E. J.; Wijnen, Juul; Blok, Marinus J.; Kets, Marleen; Hooning, Maartje J.; Oldenburg, Rogier A.; Ausems, Margreet G. E. M.; Peock, Susan; Frost, Debra; Ellis, Steve D.; Platte, Radka; Fineberg, Elena; Evans, D. Gareth; Jacobs, Chris; Eeles, Rosalind A.; Adlard, Julian; Davidson, Rosemarie; Eccles, Diana M.; Cole, Trevor; Cook, Jackie; Paterson, Joan; Brewer, Carole; Douglas, Fiona; Hodgson, Shirley V.; Morrison, Patrick J.; Walker, Lisa; Porteous, Mary E.; Kennedy, M. John; Side, Lucy E.; Bove, Betsy; Godwin, Andrew K.; Stoppa-Lyonnet, Dominique; Fassy-Colcombet, Marion; Castera, Laurent; Cornelis, François; Mazoyer, Sylvie; Léoné, Mélanie; Boutry-Kryza, Nadia; Bressac-de Paillerets, Brigitte; Caron, Olivier; Pujol, Pascal; Coupier, Isabelle; Delnatte, Capucine; Akloul, Linda; Lynch, Henry T.; Snyder, Carrie L.; Buys, Saundra S.; Daly, Mary B.; Terry, Marybeth; Chung, Wendy K.; John, Esther M.; Miron, Alexander; Southey, Melissa C.; Hopper, John L.; Goldgar, David E.; Singer, Christian F.; Rappaport, Christine; tea, Muy-Kheng M.; Fink-Retter, Anneliese; Hansen, Thomas V. O.; Nielsen, Finn C.; Arason, Aðalgeir; Vijai, Joseph; Shah, Sohela; Sarrel, Kara; Robson, Mark E.; Piedmonte, Marion; Phillips, Kelly; Basil, Jack; Rubinstein, Wendy S.; Boggess, John; Wakeley, Katie; Ewart-Toland, Amanda; Montagna, Marco; Agata, Simona; Imyanitov, Evgeny N.; Isaacs, Claudine; Janavicius, Ramunas; Lazaro, Conxi; Blanco, Ignacio; Feliubadalo, Lidia; Brunet, Joan; Gayther, Simon A.; Pharoah, Paul P. D.; Odunsi, Kunle O.; Karlan, Beth Y.; Walsh, Christine S.; Olah, Edith; teo, Soo Hwang; Ganz, Patricia A.; Beattie, Mary S.; van Rensburg, Elizabeth J.; Dorfling, Cecelia M.; Diez, Orland; Kwong, Ava; Schmutzler, Rita K.; Wappenschmidt, Barbara; Engel, Christoph; Meindl, Alfons; Ditsch, Nina; Arnold, Norbert; Heidemann, Simone; Niederacher, Dieter; Preisler-Adams, Sabine; Gadzicki, Dorothea; Varon-Mateeva, Raymonda; Deissler, Helmut; Gehrig, Andrea; Sutter, Christian; Kast, Karin; Fiebig, Britta; Heinritz, Wolfram; Caldes, Trinidad; de la Hoya, Miguel; Muranen, Taru A.; Nevanlinna, Heli; Tischkowitz, Marc D.; Spurdle, Amanda B.; Neuhausen, Susan L.; Ding, Yuan Chun; Lindor, Noralane M.; Fredericksen, Zachary; Pankratz, V. Shane; Peterlongo, Paolo; Manoukian, Siranoush; Peissel, Bernard; Zaffaroni, Daniela; Barile, Monica; Bernard, Loris; Viel, Alessandra; Giannini, Giuseppe; Varesco, Liliana; Radice, Paolo; Greene, Mark H.; Mai, Phuong L.; Easton, Douglas F.; Chenevix-Trench, Georgia; Offit, Kenneth; Simard, Jacques
2012-01-01
Background: Genome-wide association studies (GWAS) identified variants at 19p13.1 and ZNF365 (10q21.2) as risk factors for breast cancer among BRCA1 and BRCA2 mutation carriers, respectively. We explored associations with ovarian cancer and with breast cancer by tumor histopathology for these
Directory of Open Access Journals (Sweden)
Jose M. Colomina
2016-10-01
Full Text Available The effect of the betaine: homocysteine methyltransferase BHMT c.716G>A (G: guanosine; A: adenosine single nucleotide polymorphism (SNP on the BHMT pathway is unknown during pregnancy. We hypothesised that it impairs betaine to dimethylglycine conversion and that folate status modifies its effect. We studied 612 women from the Reus Tarragona Birth Cohort from ≤12 gestational weeks (GW throughout pregnancy. The frequency of the variant BHMT c.716A allele was 30.8% (95% confidence interval (CI: 28.3, 33.5. In participants with normal-high plasma folate status (>13.4 nmol/L, least square geometric mean [95% CI] plasma dimethylglycine (pDMG, µmol/L was lower in the GA (2.35 [2.23, 2.47] versus GG (2.58 [2.46, 2.70] genotype at ≤12 GW (p < 0.05 and in the GA (2.08 [1.97, 2.19] and AA (1.94 [1.75, 2.16] versus GG (2.29 [2.18, 2.40] genotypes at 15 GW (p < 0.05. No differences in pDMG between genotypes were observed in participants with possible folate deficiency (≤13.4 nmol/L (p for interactions at ≤12 GW: 0.023 and 15 GW: 0.038. PDMG was lower in participants with the AA versus GG genotype at 34 GW (2.01 [1.79, 2.25] versus 2.44 [2.16, 2.76] and at labour, 2.51 [2.39, 2.64] versus 3.00 [2.84, 3.18], (p < 0.01. Possible deficiency compared to normal-high folate status was associated with higher pDMG in multiple linear regression analysis (β coefficients [SEM] ranging from 0.07 [0.04], p < 0.05 to 0.20 [0.04], p < 0.001 in models from early and mid-late pregnancy and the AA compared to GG genotype was associated with lower pDMG (β coefficients [SEM] ranging from −0.11 [0.06], p = 0.055 to −0.23 [0.06], p < 0.001. Conclusion: During pregnancy, the BHMT pathway is affected by folate status and by the variant BHMT c.716A allele.
Making electron beams for the SLC linac
International Nuclear Information System (INIS)
Clendenin, J.E.; Ecklund, S.D.; James, M.B.; Miller, R.H.; Sheppard, J.C.; Sodja, J.; Truher, J.B.; Minten, A.
1984-01-01
A source of high-intensity, single-bunch electron beams has been developed at SLAC for the SLC. The properties of these beams have been studied extensively utilizing the first 100-m of the SLAC linac and the computer-based control system being developed for the SLC. The source is described and the properties of the beams are summarized. 9 references, 2 figures, 1 table
Boas, Wendell Vilas; Gonçalves, Rozana Oliveira; Costa, Olívia Lúcia Nunes; Goncalves, Marilda Souza
2015-02-01
To investigate the association between polymorphisms in genes that encode enzymes involved in folate- and vitamin B12-dependent homocysteine metabolism and recurrent spontaneous abortion (RSA). We investigated the C677T and A1298C polymorphisms of the methylenetetrahydrofalate reductase gene (MTHFR), the A2756G polymorphism of the methionine synthase gene (MS) and the 844ins68 insertion of the cystathionine beta synthetase gene (CBS). The PCR technique followed by RFLP was used to assess the polymorphisms; the serum levels of homocysteine, vitamin B12 and folate were investigated by chemiluminescence. The EPI Info Software version 6.04 was used for statistical analysis. Parametric variables were compared by Student's t-test and nonparametric variables by the Wilcoxon rank sum test. The frequencies of gene polymorphisms in 89 women with a history of idiopathic recurrent miscarriage and 150 controls were 19.1 and 19.6% for the C677T, insertion, 20.8 and 26% for the A1298C insertion, 14.2 and 21.9% for the A2756G insertion, and 16.4 and 18% for the 844ins68 insertion, respectively. There were no significant differences between case and control groups in any of the gene polymorphisms investigated. However, the frequency of the 844ins68 insertion in the CBS gene was higher among women with a history of loss during the third trimester of pregnancy (p=0.003). Serum homocysteine, vitamin B12 and folate levels id not differ between the polymorphisms studied in the case and control groups. However, linear regression analysis showed a dependence of serum folate levels on the maintenance of tHcy levels. The investigated gene polymorphisms and serum homocysteine, vitamin B12 and folate levels were not associated with idiopathic recurrent miscarriage in the present study. Further investigations are needed in order to confirm the role of the CBS 844ins68 insertion in recurrent miscarriage.
Regulators of Slc4 bicarbonate transporter activity
Directory of Open Access Journals (Sweden)
Ian M. Thornell
2015-06-01
Full Text Available The Slc4 family of transporters is comprised of anion exchangers (AE1-4, Na-coupled bicarbonate transporters (NCBTs including electrogenic Na/bicarbonate cotransporters (NBCe1 and NBCe2, electroneutral Na/bicarbonate cotransporters (NBCn1 and NBCn2, and the electroneutral Na-driven Cl-bicarbonate exchanger (NDCBE, as well as a borate transporter (BTR1. These transporters regulate intracellular pH (pHi and contribute to steady-state pHi, but are also involved in other physiological processes including CO2 carriage by red blood cells and solute secretion/reabsorption across epithelia. Acid-base transporters function as either acid extruders or acid loaders, with the Slc4 proteins moving HCO3– either into or out of cells. According to results from both molecular and functional studies, multiple Slc4 proteins and/or associated splice variants with similar expected effects on pHi are often found in the same tissue or cell. Such apparent redundancy is likely to be physiologically important. In addition to regulating pHi, a HCO3– transporter contributes to a cell’s ability to fine tune the intracellular regulation of the cotransported/exchanged ion(s (e.g., Na+ or Cl–. In addition, functionally similar transporters or splice variants with different regulatory profiles will optimize pH physiology and solute transport under various conditions or within subcellular domains. Such optimization will depend on activated signaling pathways and transporter expression profiles. In this review, we will summarize and discuss both classical and more recently identified regulators of the Slc4 proteins. Some of these regulators include traditional second messengers, lipids, binding proteins, autoregulatory domains, and less conventional regulators. The material presented will provide insight into the diversity and physiological significance of multiple members within the Slc4 gene family.
DEFF Research Database (Denmark)
Couch, Fergus J; Gaudet, Mia M; Antoniou, Antonis C
2012-01-01
Genome-wide association studies (GWAS) identified variants at 19p13.1 and ZNF365 (10q21.2) as risk factors for breast cancer among BRCA1 and BRCA2 mutation carriers, respectively. We explored associations with ovarian cancer and with breast cancer by tumor histopathology for these variants in mut...
Measurement of electron beam polarization at the SLC
International Nuclear Information System (INIS)
Steiner, H.; California Univ., Berkeley
1988-01-01
One of the unique features of the SLC is its capability to accelerate longitudinally polarized electrons. The SLC polarization group has been performed to implement the polarization program at the SLC. Technically the polarization project consists of three main parts: (1) a polarized source, (2) spin-rotating superconducting solenoid magnets to be used to manipulate the direction of the electron spin, and (3) the polarimeters needed to monitor and measure the electron beam polarization. It is this last topic that will concern us here. Two types of polarimeters will be used - Compton and Moeller. (orig./HSI)
Association study of serotonin transporter SLC6A4 gene with Chinese Han irritable bowel syndrome.
Directory of Open Access Journals (Sweden)
Jing Yuan
Full Text Available OBJECTIVE: Irritable bowel syndrome (IBS is a common clinical gastrointestinal dysfunction disorders. 5-sertonon (5-hydroxytryptamine, 5-HT is a very important neurotransmitter, which is involved in gastrointestinal motion and sensation. Solute carrier family 6 member 4 (SLC6A4 gene encode serotonin transporter (SERT which function is to rapidly reuptake the most of 5-HT. Therefore, it is needed to explore the association between SLC6A4 gene polymorphisms and IBS. METHODS: 119 patients and 238 healthy controls were administrated to detect the SLC6A4 gene polymorphisms including 5-HT-transporter-gene-linked polymorphic region (5-HTTLPR, variable number of tandem repeats (VNTRs and three selected tag Single Nucleotide Polymorphisms (SNPs rs1042173, rs3794808, rs2020936 by using polymerase chain reaction (PCR and TaqMan® SNP Genotyping. RESULTS: There were significant difference for 5-HTTLPR between IBS and control groups (X2 = 106.168, P<0.0001. In control group, genotypes were mainly L/L (58.4%, however, the genotypes in IBS were S/S (37.8%. The significant difference was shown in D-IBS subjects when compared to the controls (X(2 = 50.850, P<0.0001 for 5-HTTLPR. For STin2 VNTR, rs1042173, rs3794808, and rs2020936 polymorphisms, there were no any significant differences between IBS and control groups. There were no statistical significantly haplotypes for 5-HTTLPR, VNTRs and the three SNPs between IBS and controls. CONCLUSION: The S allele in 5-HTTLPR was a susceptible allele with Chinese Han IBS, but other associations of VNTRs, three selected Tag SNPs and positive haplotype with IBS were not found. It is indicated that much research are needed to study the relationship between other polymorphisms in SLC6A4 gene and IBS.
Transcellular movement of hydroxyurea is mediated by specific solute carrier transporters
Walker, Aisha L.; Franke, Ryan M.; Sparreboom, Alex; Ware, Russell E.
2015-01-01
Objective Hydroxyurea has proven laboratory and clinical therapeutic benefits for sickle cell anemia (SCA) and other diseases, yet many questions remain regarding its in vivo pharmacokinetic and pharmacodynamic profiles. Previous reports suggest that hydroxyurea passively diffuses across cells, but its observed rapid absorption and distribution are more consistent with facilitated or active transport. We investigated the potential role of solute carrier (SLC) transporters in cellular uptake and accumulation of hydroxyurea. Materials and Methods Passive diffusion of hydroxyurea across cell membranes was determined using the parallel artificial membrane permeability assay. SLC transporter screens were conducted using in vitro intracellular drug accumulation and transcellular transport assays in cell lines and oocytes overexpressing SLC transporters. Gene expression of SLC transporters was measured by real-time PCR in human tissues and cell lines. Results Hydroxyurea had minimal diffusion across a lipid bilayer but was a substrate for 5 different SLC transporters belonging to the OCTN and OATP families of transporters and urea transporters A and B. Further characterization of hydroxyurea transport revealed that cellular uptake by OATP1B3 is time and temperature dependent and inhibited by known substrates of OATP1B3. Urea transporters A and B are expressed differentially in human tissues and erythroid cells, and transport hydroxyurea bidirectionally via facilitated diffusion. Conclusions These studies provide new insight into drug transport proteins that may be involved in the in vivo absorption, cellular distribution, and elimination of hydroxyurea. Elucidation of hydroxyurea transcellular movement should improve our understanding of its pharmacokinetics and pharmacodynamics, and may help explain some of the inter-patient drug variability observed in patients with SCA. PMID:21256917
Detection of Dysplastic Intestinal Adenomas Using a Fluorescent Folate Imaging Probe
Directory of Open Access Journals (Sweden)
Wei-Tsung Chen
2005-01-01
Full Text Available Macrophages have long been recognized as a prominent component of tumors. Activated macrophages overexpress folate receptors and we used this phenomenon to image inflammatory reactions in colon dysplasia using a fluorescent folate probe (FFP. APCΔ468 mice injected with FFP showed fluorescent adenomas (target-to-background ratio, adenoma vs. adjacent normal mucosa, of 2.46 ± 0.41, significantly higher (p < .001 than adenomas in animals injected with a non-folate-containing control probe. Fluorescence-activated cell-sorting analysis revealed a 3-fold higher content of Mac1-positive cells in colonic adenomas compared with normal adjacent mucosa (6.8% vs. 2.2%, and confirmed the source of FFP-positive cells to be primarily an F4/80-positive macrophage subpopulation. Taken together, these results indicate that FFP potentially can be used to image dysplastic intestinal adenomas in vivo.
Tanegashima, Kosuke; Sato-Miyata, Yukiko; Funakoshi, Masabumi; Nishito, Yasumasa; Aigaki, Toshiro; Hara, Takahiko
2017-01-01
We carried out liquid chromatography-tandem mass spectrometry analysis of metabolites in mice. Those metabolome data showed that hepatic glucose content is reduced, but that brain glucose content is unaffected, during fasting, consistent with the priority given to brain glucose consumption during fasting. The molecular mechanisms for this preferential glucose supply to the brain are not fully understood. We also showed that the fasting-induced production of the ketone body β-hydroxybutyrate (β-OHB) enhances expression of the glucose transporter gene Slc2a1 (Glut1) via histone modification. Upon β-OHB treatment, Slc2a1 expression was up-regulated, with a concomitant increase in H3K9 acetylation at the critical cis-regulatory region of the Slc2a1 gene in brain microvascular endothelial cells and NB2a neuronal cells, shown by quantitative PCR analysis and chromatin immunoprecipitation assay. CRISPR/Cas9-mediated disruption of the Hdac2 gene increased Slc2a1 expression, suggesting that it is one of the responsible histone deacetylases (HDACs). These results confirm that β-OHB is a HDAC inhibitor and show that β-OHB plays an important role in fasting-induced epigenetic activation of a glucose transporter gene in the brain. © 2016 Molecular Biology Society of Japan and John Wiley & Sons Australia, Ltd.
Plasma Membrane Na+-Coupled Citrate Transporter (SLC13A5 and Neonatal Epileptic Encephalopathy
Directory of Open Access Journals (Sweden)
Yangzom D. Bhutia
2017-02-01
Full Text Available SLC13A5 is a Na+-coupled transporter for citrate that is expressed in the plasma membrane of specific cell types in the liver, testis, and brain. It is an electrogenic transporter with a Na+:citrate3− stoichiometry of 4:1. In humans, the Michaelis constant for SLC13A5 to transport citrate is ~600 μM, which is physiologically relevant given that the normal concentration of citrate in plasma is in the range of 150–200 μM. Li+ stimulates the transport function of human SLC13A5 at concentrations that are in the therapeutic range in patients on lithium therapy. Human SLC13A5 differs from rodent Slc13a5 in two important aspects: the affinity of the human transporter for citrate is ~30-fold less than that of the rodent transporter, thus making human SLC13A5 a low-affinity/high-capacity transporter and the rodent Slc13a5 a high-affinity/low-capacity transporter. In the liver, SLC13A5 is expressed exclusively in the sinusoidal membrane of the hepatocytes, where it plays a role in the uptake of circulating citrate from the sinusoidal blood for metabolic use. In the testis, the transporter is expressed only in spermatozoa, which is also only in the mid piece where mitochondria are located; the likely function of the transporter in spermatozoa is to mediate the uptake of citrate present at high levels in the seminal fluid for subsequent metabolism in the sperm mitochondria to generate biological energy, thereby supporting sperm motility. In the brain, the transporter is expressed mostly in neurons. As astrocytes secrete citrate into extracellular medium, the potential function of SLC13A5 in neurons is to mediate the uptake of circulating citrate and astrocyte-released citrate for subsequent metabolism. Slc13a5-knockout mice have been generated; these mice do not have any overt phenotype but are resistant to experimentally induced metabolic syndrome. Recently however, loss-of-function mutations in human SLC13A5 have been found to cause severe epilepsy
Tang, Xin; Liu, Huawei; Chen, Quanmei; Wang, Xin; Xiong, Ying; Zhao, Ping
2016-10-03
The solute carrier 6 (SLC6) gene family, initially known as the neurotransmitter transporters, plays vital roles in the regulation of neurotransmitter signaling, nutrient absorption and motor behavior. In this study, a total of 16 candidate genes were identified as SLC6 family gene homologs in the silkworm (Bombyx mori) genome. Spatio-temporal expression patterns of silkworm SLC6 gene transcripts indicated that these genes were highly and specifically expressed in midgut, brain and gonads; moreover, these genes were expressed primarily at the feeding stage or adult stage. Levels of expression for most midgut-specific and midgut-enriched gene transcripts were down-regulated after starvation but up-regulated after re-feeding. In addition, we observed that expression levels of these genes except for BmSLC6-15 and BmGT1 were markedly up-regulated by a juvenile hormone analog. Moreover, brain-enriched genes showed differential expression patterns during wandering and mating processes, suggesting that these genes may be involved in modulating wandering and mating behaviors. Our results improve our understanding of the expression patterns and potential physiological functions of the SLC6 gene family, and provide valuable information for the comprehensive functional analysis of the SLC6 gene family.
Reduced Slc6a15 in Nucleus Accumbens D2-Neurons Underlies Stress Susceptibility.
Chandra, Ramesh; Francis, T Chase; Nam, Hyungwoo; Riggs, Lace M; Engeln, Michel; Rudzinskas, Sarah; Konkalmatt, Prasad; Russo, Scott J; Turecki, Gustavo; Iniguez, Sergio D; Lobo, Mary Kay
2017-07-05
Previous research demonstrates that Slc6a15, a neutral amino acid transporter, is associated with depression susceptibility. However, no study examined Slc6a15 in the ventral striatum [nucleus accumbens (NAc)] in depression. Given our previous characterization of Slc6a15 as a striatal dopamine receptor 2 (D2)-neuron-enriched gene, we examined the role of Slc6a15 in NAc D2-neurons in mediating susceptibility to stress in male mice. First, we showed that Slc6a15 mRNA was reduced in NAc of mice susceptible to chronic social defeat stress (CSDS), a paradigm that produces behavioral and molecular adaptations that resemble clinical depression. Consistent with our preclinical data, we observed Slc6a15 mRNA reduction in NAc of individuals with major depressive disorder (MDD). The Slc6a15 reduction in NAc occurred selectively in D2-neurons. Next, we used Cre-inducible viruses combined with D2-Cre mice to reduce or overexpress Slc6a15 in NAc D2-neurons. Slc6a15 reduction in D2-neurons caused enhanced susceptibility to a subthreshold social defeat stress (SSDS) as observed by reduced social interaction, while a reduction in social interaction following CSDS was not observed when Slc6a15 expression in D2-neurons was restored. Finally, since both D2-medium spiny neurons (MSNs) and D2-expressing choline acetyltransferase (ChAT) interneurons express Slc6a15, we examined Slc6a15 protein in these interneurons after CSDS. Slc6a15 protein was unaltered in ChAT interneurons. Consistent with this, reducing Slc5a15 selectively in NAc D2-MSNs, using A2A-Cre mice that express Cre selectively in D2-MSNs, caused enhanced susceptibility to SSDS. Collectively, our data demonstrate that reduced Slc6a15 in NAc occurs in MDD individuals and that Slc6a15 reduction in NAc D2-neurons underlies stress susceptibility. SIGNIFICANCE STATEMENT Our study demonstrates a role for reduced Slc6a15, a neutral amino acid transporter, in nucleus accumbens (NAc) in depression and stress susceptibility. The
Bui, Lan T T; Small, Darryl M
2007-06-01
Asian noodles, a widely consumed staple food, were evaluated as potential vehicles for fortification with folic acid. Samples of white salted, yellow alkaline, and instant noodles, prepared under controlled laboratory conditions, were fortified and folates were measured at each stage of processing using a microbiological assay. Although the 3 styles showed differing patterns of retention, overall losses were slightly more than 40% and were similar for all styles. White salted and yellow alkaline noodles showed no significant decrease in total folate content during production. In contrast, significant losses occurred for instant noodles during steaming and deep-frying of the noodle strands. In all cases, substantial losses occurred during subsequent cooking of the dried noodles. Fortification at a rate of 50% of the reference value per serving resulted in retention of folate at levels corresponding to 30% following cooking, whereas unfortified noodles contributed less than 4% per serving. It is concluded that fortifying Asian noodles provides an effective means for enhancing folate intake.
A Missense Mutation in SLC45A2 Is Associated with Albinism in Several Small Long Haired Dog Breeds.
Wijesena, Hiruni R; Schmutz, Sheila M
2015-01-01
Homozygosity for a large deletion in the solute carrier family 45, member 2 (SLC45A2) gene causes oculocutaneous albinism (OCA) in the Doberman Pinscher breed. An albino Lhasa Apso did not have this g.27141_31223del (CanFam2) deletion in her SLC45A2 sequence. Therefore, SLC45A2 was investigated in this female Lhasa Apso to search for other possible variants that caused her albinism. The albino Lhasa Apso was homozygous for a nonsynonymous substitution in the seventh exon, a c.1478G>A base change that resulted in a glycine to aspartic acid substitution (p.G493D). This mutation was not found in a wolf, a coyote, or any of the 15 other Lhasa Apso dogs or 32 other dogs of breeds related to the Lhasa Apso. However, an albino Pekingese, 2 albino Pomeranians, and an albino mixed breed dog that was small and long haired were also homozygous for the 493D allele. The colored puppies of the albino Lhasa Apso and the colored dam of the 2 albino Pomeranians were heterozygous for this allele. However, an albino Pug was homozygous for the 493G allele and therefore although we suggest the 493D allele causes albinism when homozygous in several small, long haired dog breeds, it does not explain all albinism in dogs. A variant effect prediction for the albino Lhasa Apso confirms that p.G493D is a deleterious substitution, and a topology prediction for SLC45A2 suggests that the 11th transmembrane domain where the 493rd amino acid was located, has an altered structure. © The American Genetic Association 2015. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.
Erdoğar, Nazlı; Esendağlı, Güneş; Nielsen, Thorbjorn T; Şen, Murat; Öner, Levent; Bilensoy, Erem
2016-07-25
As nanomedicines are gaining momentum in the therapy of cancer, new biomaterials emerge as alternative platforms for the delivery of anticancer drugs with bioavailability problems. In this study, two novel amphiphilic cyclodextrins (FCD-1 and FCD-2) conjugated with folate group to enable active targeting to folate positive breast tumors were introduced. The objective of this study was to develop and characterize new folated-CD nanoparticles via 3(2) factorial design for optimal final parameters. Full physicochemical characterization studies were performed. Blank and paclitaxel loaded FCD-1 and FCD-2 nanoparticles remained within the range of 70-275nm and 125-185nm, respectively. Zeta potential values were neutral and -20mV for FCD-1 and FCD-2 nanoparticles, respectively. Drug release studies showed initial burst release followed by a longer sustained release. Blank nanoparticles had no cytotoxicity against L929 cells. T-47D and ZR-75-1 human breast cancer cells with different levels of folate receptor expression were used to assess anti-cancer efficacy. Through targeting the folate receptor, these nanoparticles were efficiently engulfed by the breast cancer cells. Additionally, breast cancer cells became more sensitive to cytotoxic and/or cytostatic effects of PCX delivered by FCD-1 and FCD-2. In conclusion, these novel folate-conjugated cyclodextrin nanoparticles can therefore be considered as promising alternative systems for safe and effective delivery of paclitaxel with a folate-dependent mechanism. Copyright © 2016 Elsevier B.V. All rights reserved.
International Nuclear Information System (INIS)
Taniguchi, Yukimi; Kawano, Kumi; Minowa, Takuya; Shimojo, Yuki; Maitani, Yoshie; Sugino, Takashi
2010-01-01
Tumor cell targeting of drug carriers is a promising strategy and uses the attachment of various ligands to enhance the therapeutic potential of chemotherapy agents. Folic acid is a high-affinity ligand for folate receptor, which is a functional tumor-specific receptor. The transforming growth factor (TGF)-β type I receptor (TβR-I) inhibitor A-83-01 was expected to enhance the accumulation of nanocarriers in tumors by changing the microvascular environment. To enhance the therapeutic effect of folate-linked liposomal doxorubicin (F-SL), we co-administrated F-SL with A-83-01. Intraperitoneally injected A-83-01-induced alterations in the cancer-associated neovasculature were examined by magnetic resonance imaging (MRI) and histological analysis. The targeting efficacy of single intravenous injections of F-SL combined with A-83-01 was evaluated by measurement of the biodistribution and the antitumor effect in mice bearing murine lung carcinoma M109. A-83-01 temporarily changed the tumor vasculature around 3 h post injection. A-83-01 induced 1.7-fold higher drug accumulation of F-SL in the tumor than liposome alone at 24 h post injection. Moreover F-SL co-administrated with A-83-01 showed significantly greater antitumor activity than F-SL alone. This study shows that co-administration of TβR-I inhibitor will open a new strategy for the use of folate receptor (FR)-targeting nanocarriers for cancer treatment. (author)
Early Infantile Leigh-like Gene Defects Have a Poor Prognosis: Report and Review
Directory of Open Access Journals (Sweden)
Majid Alfadhel
2017-10-01
Full Text Available Solute carrier family 19 (thiamine transporter, member 3 ( SCL19A3 gene defect produces an autosomal recessive neurodegenerative disorder associated with different phenotypes and acronyms. One of the common presentations is early infantile lethal Leigh-like syndrome. We report a case of early infantile Leigh-like SLC19A3 gene defects of patients who died at 4 months of age with no response to a high dose of biotin and thiamine. In addition, we report a novel mutation that was not reported previously. Finally, we review the literature regarding early infantile Leigh-like SLC19A3 gene defects and compare the literature with our patient.
Gagnon, Kenneth B; Delpire, Eric
2013-04-15
Among the over 300 members of the solute carrier (SLC) group of integral plasma membrane transport proteins are the nine electroneutral cation-chloride cotransporters belonging to the SLC12 gene family. Seven of these transporters have been functionally described as coupling the electrically silent movement of chloride with sodium and/or potassium. Although in silico analysis has identified two additional SLC12 family members, no physiological role has been ascribed to the proteins encoded by either the SLC12A8 or the SLC12A9 genes. Evolutionary conservation of this gene family from protists to humans confirms their importance. A wealth of physiological, immunohistochemical, and biochemical studies have revealed a great deal of information regarding the importance of this gene family to human health and disease. The sequencing of the human genome has provided investigators with the capability to link several human diseases with mutations in the genes encoding these plasma membrane proteins. The availability of bacterial artificial chromosomes, recombination engineering techniques, and the mouse genome sequence has simplified the creation of targeting constructs to manipulate the expression/function of these cation-chloride cotransporters in the mouse in an attempt to recapitulate some of these human pathologies. This review will summarize the three human disorders that have been linked to the mutation/dysfunction of the Na-Cl, Na-K-2Cl, and K-Cl cotransporters (i.e., Bartter's, Gitleman's, and Andermann's syndromes), examine some additional pathologies arising from genetically modified mouse models of these cotransporters including deafness, blood pressure, hyperexcitability, and epithelial transport deficit phenotypes.
Association of Folate Level in Blood with the Risk of Schizophrenia.
Ding, Yujie; Ju, Mingliang; He, Lin; Chen, Wenzhong
2017-01-01
The aim of this study was to evaluate the association between folate level and the risk of schizophrenia and to identify possible biomarker for schizophrenia. Data about folate were extracted from 16 high quality studies. The association of folate level in blood and schizophrenia was evaluated using standardized mean difference (SMD) and 95% confidence interval (CI). Totally 1183 (52.1%) cases and 1089 (47.9%) controls were included in the current metaanalysis. Folate level in schizophrenia patients was significantly lower than that in healthy controls (SMD= -0.65; 95% CI: [-0.86, -0.45]; P 0.05). Sensitivity analysis confirmed that these results were stable and reliable, no publication bias existed in our meta-analysis based on Egger's and Begg's tests (P=0.48 and 0.30, respectively). These results suggest that decreased folate may be a risk factor for schizophrenia. More epidemiological and biochemistry studies are required to describe how folate or folate supplementation play roles in the progress of schizophrenia. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.
Radioassay for serum and red cell folate
International Nuclear Information System (INIS)
Longo, D.L.; Herbert, V.
1976-01-01
A simple, reliable assay for serum and red cell folate is described. It uses plain untreated liquid or powdered milk, requiring no special handling or purification, as binder. Such milk makes it possible to ignore endogenous serum folate binder, since crude (but not purified) milk contains a factor which releases folate from serum binder. It simplifies counting radioactivity by employing a gamma emitting isotope of pteroylglutamic acid (PGA), namely the 125 I-tyramide of PGA. Like the 3 H-PGA assay of Givas and Gutcho, it permits the use of stable PGA rather than unstable methyltetrahydrofolic acid (MeTHFA) standards, because it is carried out at pH 9.3, a pH at which milk folate binder is unable to distinguish PGA from MeTHFA, which is the predominant folate in human tissues. The equipment required to do the radioassay is present in most diagnostic chemistry laboratories. Results are essentially identical to the generally accepted Lactobacillus casei microbiologic method of folate assay, except that false low results are not produced in the radioassay by antibiotics, tranquilizers, and chemotherapeutic agents. Three caveats in its use are the relative instability of 125 I-PGA as compared to 3 H-PGA, the fact that various powdered milks differ widely in folate-binding capacity, and that only about 60 percent of commercially obtained skim or powdered milk preparations appear to contain the substance which splits folate from serum binder
NBCe1 (SLC4A4) a potential pH regulator in enamel organ cells during enamel development in the mouse
Jalali, R.; Guo, J.; Zandieh-Doulabi, B.; Bervoets, T.J.M.; Paine, M.L.; Boron, W.F.; Parker, M.D.; Bijvelds, M.J.C.; Medina, J.F.; DenBesten, P.K.; Bronckers, A.L.J.J.
2014-01-01
During the formation of dental enamel, maturation-stage ameloblasts express ion-transporting transmembrane proteins. The SLC4 family of ion-transporters regulates intra- and extracellular pH in eukaryotic cells by cotransporting HCO3 − with Na+. Mutation in SLC4A4 (coding for the sodium-bicarbonate
DEFF Research Database (Denmark)
Antoniou, Antonis C; Wang, Xianshu; Fredericksen, Zachary S
2010-01-01
diagnosis over age 35. We took forward 96 SNPs for replication in another 5,986 BRCA1 carriers (2,974 individuals with breast cancer and 3,012 unaffected individuals). Five SNPs on 19p13 were associated with breast cancer risk (P(trend) = 2.3 × 10¿¿ to P(trend) = 3.9 × 10¿7), two of which showed independent......Germline BRCA1 mutations predispose to breast cancer. To identify genetic modifiers of this risk, we performed a genome-wide association study in 1,193 individuals with BRCA1 mutations who were diagnosed with invasive breast cancer under age 40 and 1,190 BRCA1 carriers without breast cancer...... associations (rs8170, hazard ratio (HR) = 1.26, 95% CI 1.17-1.35; rs2363956 HR = 0.84, 95% CI 0.80-0.89). Genotyping these SNPs in 6,800 population-based breast cancer cases and 6,613 controls identified a similar association with estrogen receptor-negative breast cancer (rs2363956 per-allele odds ratio (OR...
Folate Biofortification of Potato by Tuber-Specific Expression of Four Folate Biosynthesis Genes
Lepeleire, De Jolien; Strobbe, Simon; Verstraete, Jana; Blancquaert, Dieter; Ambach, Lars; Visser, Richard G.F.; Stove, Christophe; Straeten, Van Der Dominique
2018-01-01
Insufficient dietary intake of micronutrients, known as "hidden hunger", is a devastating global burden, affecting two billion people. Deficiency of folates (vitamin B9), which are known to play a central role in C1 metabolism, causes birth defects in at least a quarter million people annually.
Slc3a2 Mediates Branched-Chain Amino-Acid-Dependent Maintenance of Regulatory T Cells
Directory of Open Access Journals (Sweden)
Kayo Ikeda
2017-11-01
Full Text Available Summary: Foxp3+ regulatory T (Treg cells, which suppress immune responses, are highly proliferative in vivo. However, it remains unclear how the active replication of Treg cells is maintained in vivo. Here, we show that branched-chain amino acids (BCAAs, including isoleucine, are required for maintenance of the proliferative state of Treg cells via the amino acid transporter Slc3a2-dependent metabolic reprogramming. Mice fed BCAA-reduced diets showed decreased numbers of Foxp3+ Treg cells with defective in vivo proliferative capacity. Mice lacking Slc3a2 specifically in Foxp3+ Treg cells showed impaired in vivo replication and decreased numbers of Treg cells. Slc3a2-deficient Treg cells showed impaired isoleucine-induced activation of the mTORC1 pathway and an altered metabolic state. Slc3a2 mutant mice did not show an isoleucine-induced increase of Treg cells in vivo and exhibited multi-organ inflammation. Taken together, these findings demonstrate that BCAA controls Treg cell maintenance via Slc3a2-dependent metabolic regulation. : Treg cells regulate excess immune responses and are highly proliferative in vivo. Ikeda et al. find that branched-chain amino acids (BCAAs are essentially required to maintain expansion and the suppressive capacity of Treg cells via Slc3a2 and mTORC1. Keywords: Treg cells, amino acids, immunometabolism, immune regulation, transporter
Dufay, J Noelia; Fernández-Murray, J Pedro; McMaster, Christopher R
2017-06-07
The SLC25 family member SLC25A38 (Hem25 in yeast) was recently identified as a mitochondrial glycine transporter that provides substrate to initiate heme/hemoglobin synthesis. Mutations in the human SLC25A38 gene cause congenital sideroblastic anemia. The full extent to which SLC25 family members coregulate heme synthesis with other mitochondrial functions is not clear. In this study, we surveyed 29 nonessential SLC25 family members in Saccharomyces cerevisiae for their ability to support growth in the presence and absence of HEM25 Six SLC25 family members were identified that were required for growth or for heme synthesis in cells lacking Hem25 function. Importantly, we determined that loss of function of the SLC25 family member Flx1, which imports FAD into mitochondria, together with loss of function of Hem25, resulted in inability to grow on media that required yeast cells to supply energy using mitochondrial respiration. We report that specific components of complexes of the electron transport chain are decreased in the absence of Flx1 and Hem25 function. In addition, we show that mitochondria from flx1 Δ hem25 Δ cells contain uncharacterized Cox2-containing high molecular weight aggregates. The functions of Flx1 and Hem25 provide a facile explanation for the decrease in heme level, and in specific electron transport chain complex components. Copyright © 2017 Dufay et al.
Directory of Open Access Journals (Sweden)
J. Noelia Dufay
2017-06-01
Full Text Available The SLC25 family member SLC25A38 (Hem25 in yeast was recently identified as a mitochondrial glycine transporter that provides substrate to initiate heme/hemoglobin synthesis. Mutations in the human SLC25A38 gene cause congenital sideroblastic anemia. The full extent to which SLC25 family members coregulate heme synthesis with other mitochondrial functions is not clear. In this study, we surveyed 29 nonessential SLC25 family members in Saccharomyces cerevisiae for their ability to support growth in the presence and absence of HEM25. Six SLC25 family members were identified that were required for growth or for heme synthesis in cells lacking Hem25 function. Importantly, we determined that loss of function of the SLC25 family member Flx1, which imports FAD into mitochondria, together with loss of function of Hem25, resulted in inability to grow on media that required yeast cells to supply energy using mitochondrial respiration. We report that specific components of complexes of the electron transport chain are decreased in the absence of Flx1 and Hem25 function. In addition, we show that mitochondria from flx1Δ hem25Δ cells contain uncharacterized Cox2-containing high molecular weight aggregates. The functions of Flx1 and Hem25 provide a facile explanation for the decrease in heme level, and in specific electron transport chain complex components.
Piyathilake, Chandrika J; Badiga, Suguna; Alvarez, Ronald D; Partridge, Edward E; Johanning, Gary L
2013-01-01
Identification of associations between global DNA methylation and excess body weight (EBW) and related diseases and their modifying factors are an unmet research need that may lead to decreasing DNA methylation-associated disease risks in humans. The purpose of the current study was to evaluate the following; 1) Association between the degree of peripheral blood mononuclear cell (PBMC) L1 methylation and folate, and indicators of EBW, 2) Association between the degree of PBMC L1 methylation and folate, and insulin resistance (IR) as indicated by a higher homeostasis model assessment (HOMA-IR). The study population consisted of 470 child-bearing age women diagnosed with abnormal pap. The degree of PBMC L1 methylation was assessed by pyrosequencing. Logistic regression models specified indicators of EBW (body mass index-BMI, body fat-BF and waist circumference-WC) or HOMA-IR as dependent variables and the degree of PBMC L1 methylation and circulating concentrations of folate as the independent predictor of primary interest. Women with a lower degree of PBMC L1 methylation and lower plasma folate concentrations were significantly more likely to have higher BMI, % BF or WC (OR = 2.49, 95% CI:1.41-4.47, P = 0.002; OR = 2.49, 95% CI:1.40-4.51, P = 0.002 and OR = 1.98, 95% = 1.14-3.48 P = 0.0145, respectively) and higher HOMA-IR (OR = 1.78, 95% CI:1.02-3.13, P = 0.041). Our results demonstrated that a lower degree of PBMC L1 methylation is associated with excess body weight and higher HOMA-IR, especially in the presence of lower concentrations of plasma folate.
Mönch, Sabine; Netzel, Michael; Netzel, Gabriele; Ott, Undine; Frank, Thomas; Rychlik, Michael
2015-01-01
Different sources of folate may have different bioavailability and hence may impact the standard definition of folate equivalents. In order to examine this, a short term human study was undertaken to evaluate the relative native folate bioavailabilities from spinach, Camembert cheese and wheat germs compared to pteroylmonoglutamic acid as the reference dose. The study had a single-centre, randomised, four-treatment, four-period, four-sequence, cross-over design, i.e. the four (food) items to be tested (referred to as treatments) were administered in sequences according to the Latin square, so that each experimental treatment occurred only once within each sequence and once within each study period. Each of the 24 subjects received the four experimental items separated by a 14-day equilibrium phase and received a pteroylmonoglutamic acid supplement for 14 days before the first testing and between the testings for saturation of body pools. Folates in test foods, plasma and urine samples were determined by stable isotope dilution assays, and in urine and plasma, the concentrations of 5-methyltetrahydrofolate were evaluated. Standard non-compartmental methods were applied to determine the biokinetic parameters C(max), t(max) and AUC from baseline corrected 5-methyltetrahydrofolate concentrations within the interval from 0 to 12 hours. The variability of AUC and C(max) was moderate for spinach and oral solution of pteroylmonoglutamic acid but high for Camembert cheese and very high for wheat germs. The median t(max) was lowest for spinach, though t(max) showed a high variability among all treatments. When comparing the ratio estimates of AUC and C(max) for the different test foods, highest bioavailability was found for spinach followed by that for wheat germs and Camembert cheese. The results underline the dependence of folate bioavailability on the type of food ingested. Therefore, the general assumption of 50% bioavailability as the rationale behind the definition of
2010-07-01
... 29 Labor 4 2010-07-01 2010-07-01 false Carrier. 1201.1 Section 1201.1 Labor Regulations Relating to Labor (Continued) NATIONAL MEDIATION BOARD DEFINITIONS § 1201.1 Carrier. The term carrier includes any express company, sleeping car company, carrier by railroad, subject to the Interstate Commerce Act...
Wolf, Marlene; Clark-Lewis, Ian; Buri, Caroline; Langen, Hanno; Lis, Maddalena; Mazzucchelli, Luca
2003-01-01
Cathepsin D (Cath-D) expression in human primary breast cancer has been associated with a poor prognosis. In search of a better understanding of the Cath-D substrates possibly involved in cancer invasiveness and metastasis, we investigated the potential interactions between this protease and chemokines. Here we report that purified Cath-D, as well as culture supernatants from the human breast carcinoma cell lines MCF-7 and T47D, selectively degrade macrophage inflammatory protein (MIP)-1α (CCL3), MIP-1β (CCL4), and SLC (CCL21). Proteolysis was totally blocked by the protease inhibitor pepstatin A, and specificity of Cath-D cleavage was demonstrated using a large chemokine panel. Whereas MIP-1α and MIP-1β degradation was rapid and complete, cleavage of SLC was slow and not complete. Mass spectrometry analysis showed that Cath-D cleaves the Leu58 to Trp59 bond of SLC producing two functionally inactive fragments. Analysis of Cath-D proteolysis of a series of monocyte chemoattractant protein-3/MIP-1β hybrids indicated that processing of MIP-1β might start by cleaving off amino acids located in the C-terminal domain. In situ hybridization studies revealed MIP-1α, MIP-1β, and Cath-D gene expression mainly in the stromal compartment of breast cancers whereas SLC transcripts were found in endothelial cells of capillaries and venules within the neoplastic tissues. Cath-D production in the breast carcinoma cell lines MCF-7 and T47D, as assessed by enzyme-linked immunosorbent assay of culture supernatants and cell lysates, was not affected by stimulation with chemokines such as interleukin-8 (CXCL8), SDF-1 (CXCL12), and SLC. These data suggest that inactivation of chemokines by Cath-D possibly influences regulatory mechanisms in the tumoral extracellular microenvironment that in turn may affect the generation of the antitumoral immune response, the migration of cancer cells, or both processes. PMID:12651610
Paul, Ligi; Jacques, Paul F; Aviv, Abraham; Vasan, Ramachandran S; D'Agostino, Ralph B; Levy, Daniel; Selhub, Jacob
2015-03-01
Shortening of telomeres, the protective structures at the ends of eukaryotic chromosomes, is associated with age-related pathologies. Telomere length is influenced by DNA integrity and DNA and histone methylation. Folate plays a role in providing precursors for nucleotides and methyl groups for methylation reactions and has the potential to influence telomere length. We determined the association between leukocyte telomere length and long-term plasma folate status (mean of 4 years) in Framingham Offspring Study (n = 1,044, females = 52.1 %, mean age 59 years) using data from samples collected before and after folic acid fortification. Leukocyte telomere length was determined by Southern analysis and fasting plasma folate concentration using microbiological assay. There was no significant positive association between long-term plasma folate and leukocyte telomere length among the Framingham Offspring Study participants perhaps due to their adequate folate status. While the leukocyte telomere length in the second quintile of plasma folate was longer than that in the first quintile, the difference was not statistically significant. The leukocyte telomere length of the individuals in the fifth quintile of plasma folate was shorter than that of those in the second quintile by 180 bp (P folate concentrations in the upper four quintiles of plasma folate (P for trend = 0.001). Multivitamin use was associated with shorter telomeres in this cohort (P = 0.015). High plasma folate status possibly resulting from high folic acid intake may interfere with the role of folate in maintaining telomere integrity.
Simultaneous radioassay of folate and vitamin B12
International Nuclear Information System (INIS)
1981-01-01
An improved simultaneous radioassay for folate and vitamin B 12 in biological specimens is described. A sample containing folate and vitamin B 12 is contacted with 125 I-folate and 57 Co-vitamin B 12 and their respective specific binders. After separation of the bound and free portions, the radioactivity in the portions is counted and the amounts of folate and vitamin B 12 then determined from standard curves. (U.K.)
SLC39A8 Deficiency: A Disorder of Manganese Transport and Glycosylation.
Park, Julien H; Hogrebe, Max; Grüneberg, Marianne; DuChesne, Ingrid; von der Heiden, Ava L; Reunert, Janine; Schlingmann, Karl P; Boycott, Kym M; Beaulieu, Chandree L; Mhanni, Aziz A; Innes, A Micheil; Hörtnagel, Konstanze; Biskup, Saskia; Gleixner, Eva M; Kurlemann, Gerhard; Fiedler, Barbara; Omran, Heymut; Rutsch, Frank; Wada, Yoshinao; Tsiakas, Konstantinos; Santer, René; Nebert, Daniel W; Rust, Stephan; Marquardt, Thorsten
2015-12-03
SLC39A8 is a membrane transporter responsible for manganese uptake into the cell. Via whole-exome sequencing, we studied a child that presented with cranial asymmetry, severe infantile spasms with hypsarrhythmia, and dysproportionate dwarfism. Analysis of transferrin glycosylation revealed severe dysglycosylation corresponding to a type II congenital disorder of glycosylation (CDG) and the blood manganese levels were below the detection limit. The variants c.112G>C (p.Gly38Arg) and c.1019T>A (p.Ile340Asn) were identified in SLC39A8. A second individual with the variants c.97G>A (p.Val33Met) and c.1004G>C (p.Ser335Thr) on the paternal allele and c.610G>T (p.Gly204Cys) on the maternal allele was identified among a group of unresolved case subjects with CDG. These data demonstrate that variants in SLC39A8 impair the function of manganese-dependent enzymes, most notably β-1,4-galactosyltransferase, a Golgi enzyme essential for biosynthesis of the carbohydrate part of glycoproteins. Impaired galactosylation leads to a severe disorder with deformed skull, severe seizures, short limbs, profound psychomotor retardation, and hearing loss. Oral galactose supplementation is a treatment option and results in complete normalization of glycosylation. SLC39A8 deficiency links a trace element deficiency with inherited glycosylation disorders. Copyright © 2015 The American Society of Human Genetics. Published by Elsevier Inc. All rights reserved.
Wibowo, Ardian S; Singh, Mirage; Reeder, Kristen M; Carter, Joshua J; Kovach, Alexander R; Meng, Wuyi; Ratnam, Manohar; Zhang, Faming; Dann, Charles E
2013-09-17
Antifolates, folate analogs that inhibit vitamin B9 (folic acid)-using cellular enzymes, have been used over several decades for the treatment of cancer and inflammatory diseases. Cellular uptake of the antifolates in clinical use occurs primarily via widely expressed facilitative membrane transporters. More recently, human folate receptors (FRs), high affinity receptors that transport folate via endocytosis, have been proposed as targets for the specific delivery of new classes of antifolates or folate conjugates to tumors or sites of inflammation. The development of specific, FR-targeted antifolates would be accelerated if additional biophysical data, particularly structural models of the receptors, were available. Here we describe six distinct crystallographic models that provide insight into biological trafficking of FRs and distinct binding modes of folate and antifolates to these receptors. From comparison of the structures, we delineate discrete structural conformations representative of key stages in the endocytic trafficking of FRs and propose models for pH-dependent conformational changes. Additionally, we describe the molecular details of human FR in complex with three clinically prevalent antifolates, pemetrexed (also Alimta), aminopterin, and methotrexate. On the whole, our data form the basis for rapid design and implementation of unique, FR-targeted, folate-based drugs for the treatment of cancer and inflammatory diseases.
Thangaraju, Muthusamy; Karunakaran, Senthil K.; Itagaki, Shiro; Gopal, Elangovan; Elangovan, Selvakumar; Prasad, Puttur D.; Ganapathy, Vadivel
2009-01-01
Background 3-Bromopyruvate is an alkylating agent with antitumor activity. It is currently believed that blockade of ATP production from glycolysis and mitochondria is the primary mechanism responsible for this antitumor effect. The present studies have uncovered a new and novel mechanism for the antitumor activity of 3-bromopyruvate. Methods Transport of 3-bromopyruvate via SLC5A8, a tumor suppressor and a Na+-coupled electrogenic transporter for short-chain monocarboxylates, was studied using a mammalian cell expression and the Xenopus laevis oocyte expression systems. The effect of 3-bromopyruvate on histone deacetylases (HDACs) was monitored using the lysate of the human breast cancer cell line MCF7 and human recombinant HDAC isoforms as the enzyme sources. Cell viability was monitored by FACS analysis and colony formation assay. Acetylation status of histone H4 was evaluated by Western blot. Results 3-Bromopyruvate is a transportable substrate for SLC5A8, with the transport process being Na+-coupled and electrogenic. MCF7 cells do not express SLC5A8 and are not affected by 3-bromopyruvate. However, when transfected with SLC5A8 or treated with inhibitors of DNA methylation, these cells undergo apoptosis in the presence of 3-bromopyruvate. This cell death is associated with inhibition of HDAC1/HDAC3. Studies with different isoforms of human recombinant HDACs identify HDAC1 and HDAC3 as the targets for 3-bromopyruvate. Conclusions 3-Bromopyruvate is transported into cells actively via the tumor suppressor SLC5A8 and the process is energized by an electrochemical Na+ gradient. Ectopic expression of the transporter in MCF7 cells leads to apoptosis, and the mechanism involves inhibition of HDAC1/HDAC3. PMID:19637353
Adding PCs to SLC Control System
International Nuclear Information System (INIS)
Lahey, T.; Levitt, S.; MacKenzie, R.; Spencer, N.; Underwood, K.
1993-05-01
The SLAC Controls Department has interfaced IBM-Compatible PCs to the SLC Control System, for use by the Final Focus Test Beam (FFTB) experimenters, who are building new accelerator equipment and developing and testing it at their home institutions. They will bring the equipment to SLAC and integrate it into the control system using a new software package. The machine physicists and operators will use the existing SLC control system applications and database device types to control and monitor the equipment. The PCs support a limited control environment: they run DOS and exchange messages with the existing control system via TCP/IP over ethernet, using the new SLC Area Message Service. This mechanism will also allow SLC to implement other commercial device controllers that can communicate over ethernet and run the same software interface code
International Nuclear Information System (INIS)
Tan, Hua-Zhen; Wu, Zhi-Yong; Wu, Jian-Yi; Long, Lin; Jiao, Ji-Wei; Peng, Yu-Hui; Xu, Yi-Wei; Li, Shan-Shan; Wang, Wei; Zhang, Jian-Jun; Li, En-Min; Xu, Li-Yan
2016-01-01
SLC52A3 was recently identified as a susceptibility gene for esophageal squamous cell carcinoma (ESCC). However, associations between the single nucleotide polymorphisms (SNPs) rs13042395 (C > T) and rs3746803 (G > A) in SLC52A3 and risk, tumor characteristics and survival of ESCC patients remain inconclusive and of unknown prognostic significance. Analyses of the association between SNPs in SLC52A3 and ESCC risk were performed on 479 ESCC cases, together with 479 controls, in a case-control study. Blood samples for cases and controls were collected and genotyped by real-time polymerase chain reaction (PCR) using TaqMan assays. Among the 479 ESCC cases, 343 cases with complete clinical data were used to investigate the association between SNPs and ESCC clinical characteristics; 288 cases with complete clinical data and 5-year follow-up data were used to analyze the association between SNPs and prognosis. Dual luciferase reporter assays and electrophoretic mobility shift assays (EMSAs) were used to investigate the biological function of rs13042395. No association was found between SLC52A3 rs3746803 and susceptibility, tumor characteristics or survival of ESCC patients. For rs13042395, TT genotype carriers were likely to have reduced lymph node metastasis (odds ratio (OR) = 0.55, 95 % confidence interval (CI), 0.31–0.98) and longer relapse-free survival time (P = 0.03) . Also, both rs13042395 (hazard ratio (HR) = 0.62, 95 % CI, 0.38–0.99) and regional lymph node metastasis (HR = 2.06, 95 % CI, 1.36–3.13 for N1 vs. N0; HR = 2.88, 95 % CI, 1.70–4.86 for N2 vs. N0; HR = 2.08, 95 % CI, 1.01–4.30 for N3 vs. N0) were independent factors affecting relapse-free survival for ESCC patients who underwent surgery. Dual luciferase reporter assays and EMSAs suggested that the CC genotype of rs13042395 enhanced SLC52A3 expression, probably via binding with specific transcription factors. The rs13042395 polymorphism in SLC52A3 is associated with regional lymph node
Naz, Naila; Jimenez, Alicia Requena; Sanjuan-Vilaplana, Anna; Gurney, Megan; Miyan, Jaleel
2016-08-01
Folate is vital in a range of biological processes and folate deficiency is associated with neurodevelopmental disorders such as neural tube defects and hydrocephalus (HC). 10-formyl-tetrahydrofolate-dehydrogenase (FDH) is a key regulator for folate availability and metabolic interconversion for the supply of 1-carbon groups. In previous studies, we found a deficiency of FDH in CSF associated with the developmental deficit in congenital and neonatal HC. In this study, we therefore aimed to investigate the role of FDH in folate transport and metabolism during the brain development of the congenital hydrocephalic Texas (H-Tx) rat and normal (Sprague-Dawley) rats. We show that at embryonic (E) stage E18 and E20, FDH-positive cells and/or vesicles derived from the cortex can bind methyl-folate similarly to folate receptor alpha, the main folate transporter. Hydrocephalic rats expressed diminished nuclear FDH in both liver and brain at all postnatal (P) ages tested (P5, P15, and P20) together with a parallel increase in hepatic nuclear methyl-folate at P5 and cerebral methylfolate at P15 and P20. A similar relationship was found between FDH and 5-methyl cytosine, the main marker for DNA methylation. The data indicated that FDH binds and transports methylfolate in the brain and that decreased liver and brain nuclear expression of FDH is linked with decreased DNA methylation which could be a key factor in the developmental deficits associated with congenital and neonatal HC. Folate deficiency is associated with neurodevelopmental disorders such as neural tube defects and hydrocephalus. 10-formyl-tetrahydrofolate-dehydrogenase (FDH) is a key regulator for folate availability and metabolic interconversion. We show that FDH binds and transports methylfolate in the brain. Moreover, we found that a deficiency of FDH in the nucleus of brain and liver is linked with decreased DNA methylation which could be a key factor in the developmental deficits associated with congenital and
Price, R Jordan; Lillycrop, Karen A; Burdge, Graham C
2016-01-01
The effect of folic acid (FA) on breast cancer (BC) risk is uncertain. We hypothesised that this uncertainty may be due, in part, to differential effects of FA between BC cells with different phenotypes. To test this we investigated the effect of treatment with FA concentrations within the range of unmetabolised FA reported in humans on the expression of the transcriptome of non-transformed (MCF10A) and cancerous (MCF7 and Hs578T) BC cells. The total number of transcripts altered was: MCF10A, seventy-five (seventy up-regulated); MCF7, twenty-four (fourteen up-regulated); and Hs578T, 328 (156 up-regulated). Only the cancer-associated gene TAGLN was altered by FA in all three cell lines. In MCF10A and Hs578T cells, FA treatment decreased pathways associated with apoptosis, cell death and senescence, but increased those associated with cell proliferation. The folate transporters SLC19A1, SLC46A1 and FOLR1 were differentially expressed between cell lines tested. However, the level of expression was not altered by FA treatment. These findings suggest that physiological concentrations of FA can induce cell type-specific changes in gene regulation in a manner that is consistent with proliferative phenotype. This has implications for understanding the role of FA in BC risk. In addition, these findings support the suggestion that differences in gene expression induced by FA may involve differential activities of folate transporters. Together these findings indicate the need for further studies of the effect of FA on BC.
A comparison of folate status in women of child-bearing age in Korea and in the United States
Directory of Open Access Journals (Sweden)
Hyun T
2012-07-01
Full Text Available Taisun Hyun,1 Suguna Badiga,2 Han Byul Jang,1 Young-Hee Han,1 Chandrika J Piyathilake21Department of Food and Nutrition, Chungbuk National University, Cheongju, Korea; 2Department of Nutrition Sciences, University of Alabama at Birmingham, Birmingham, AL, USABackground: Even though several studies have demonstrated that periconceptional supplementation with folic acid (FA reduces the occurrence of neural tube defects, FA fortification has been a topic of intense debate due to the possible adverse effects of higher folate status on several health conditions. Several countries, including Korea, have been indecisive as to whether fortification is warranted or not. It is therefore helpful for these countries to compare folate concentrations in their populations with populations exposed to mandatory FA fortification.Purpose: To evaluate the differences in the distribution of circulating concentrations of folate in Korea and the United States (US at different time points.Methods: The Korean study populations consisted of women of child-bearing age recruited in 1999 and in 2009. The US study populations consisted of women of child-bearing age recruited in the post FA fortification era (2005 and 2009. Plasma and red blood cell (RBC folate concentrations were measured using the Lactobacillus casei microbiological assay.Results: The percentage of US women with neural tube defect-protective levels of RBC folate was significantly higher compared to Korean women in 1999 and 2009. However, in 2009, when FA supplements became readily available for Koreans, 50% of Korean women in the study achieved the neural tube defect-protective level of RBC folate; 11% of them demonstrating supraphysiologic concentrations of plasma folate. Even though FA fortification in the US resulted in more than 80of women achieving >400 ng/mL of RBC folate by 2009, nearly 50% also demonstrated having supraphysiologic concentrations of plasma folate, which prompted some researchers to
Folate content and retention in commonly consumed vegetables in the South Pacific.
Maharaj, Prayna P P; Prasad, Surendra; Devi, Riteshma; Gopalan, Romila
2015-09-01
This paper reports the effect of boiling and frying on the retention of folate in commonly consumed Fijian vegetables (drumstick leaves, taro leaves, bele leaves, amaranth leaves, fern/ota, okra and French bean). The folate content was determined by microbiological assay (Lactobacillus casei rhamnosus) and tri-enzyme (protease, α-amylase and chicken pancreas conjugase) extraction treatment. The folate loss varied among the vegetables from 10-64% on boiling while 1-36% on frying. The higher folate loss was observed during boiling. The folate content in the water derived after boiling different vegetables ranged from 11.9 ± 0.5 to 61.6 ± 2.5 μg/100mL. The folate loss on boiling was accounted for in the cooking water. The predominant way of folate loss on boiling was leaching rather than thermal degradation which makes boiling the better choice of cooking the studied vegetables for folate intake, provided the cooking water is consumed together with the vegetables. Copyright © 2015 Elsevier Ltd. All rights reserved.
Role of folate in nonalcoholic fatty liver disease.
Sid, Victoria; Siow, Yaw L; O, Karmin
2017-10-01
Nonalcoholic fatty liver disease (NAFLD) is a spectrum of chronic liver conditions that are characterized by steatosis, inflammation, fibrosis, and liver injury. The global prevalence of NAFLD is rapidly increasing in proportion to the rising incidence of obesity and type 2 diabetes. Because NAFLD is a multifaceted disorder with many underlying metabolic abnormalities, currently, there is no pharmacological agent that is therapeutically approved for the treatment of this disease. Folate is a water-soluble B vitamin that plays an essential role in one-carbon transfer reactions involved in nucleic acid biosynthesis, methylation reactions, and sulfur-containing amino acid metabolism. The liver is the primary organ responsible for storage and metabolism of folates. Low serum folate levels have been observed in patients with obesity and diabetes. It has been reported that a low level of endogenous folates in rodents perturbs folate-dependent one-carbon metabolism, and may be associated with development of metabolic diseases such as NAFLD. This review highlights the biological role of folate in the progression of NAFLD and its associated metabolic complications including obesity and type 2 diabetes. Understanding the role of folate in metabolic disease may position this vitamin as a potential therapeutic for NAFLD.
Schneebauer, Gabriel; Mauracher, David; Fiechtner, Birgit; Pelster, Bernd
2018-04-01
The rate of glucose metabolism has been shown to be correlated to glucose uptake in swimbladder gas gland cells. Therefore, it is assumed that in the European eel silvering, i.e., the preparation of the eel for the spawning migration to the Sargasso Sea, coincides with an enhanced capacity for glucose uptake. To test this hypothesis expression of all known glucose transport proteins has been assessed at the transcript level in yellow and in silver eels, and we also included Anguillicola crassus infected swimbladders. Glucose uptake by rete mirabile endothelial cells could be crucial for the countercurrent exchange capacity of the rete. Therefore, this tissue was also included in our analysis. The results revealed expression of ten different members of the slc2 family of glucose transporters, of four slc5 family members, and of kiaa1919 in gas gland tissue. Glucose transporters of the slc2 family were expressed at very high level, and slc2a1b made up about 80% of all slc2 family members, irrespective of the developmental state or the infection status of the eel. Overall, the slc5 family contributed to only about 8% of all detected glucose transport transcripts in gas gland tissue, and the slc2 family to more than 85%. In rete capillaries, the contribution of sodium-dependent glucose transporters was significantly higher, leaving only 66% for the slc2 family of glucose transporters. Neither silvering nor the infection status had a significant effect on the expression of glucose transporters in swimbladder gas gland tissue, suggesting that glucose metabolism of eel gas gland cells may not be related to transcriptional changes of glucose transport proteins.
Lucock, Mark; Beckett, Emma; Martin, Charlotte; Jones, Patrice; Furst, John; Yates, Zoe; Jablonski, Nina G; Chaplin, George; Veysey, Martin
2017-03-01
The purpose of this study was to examine whether UV exposure alters folate status according to C677T-MTHFR genotype, and to consider the relevance of this to human health and the evolutionary model of skin pigmentation. Total Ozone Mapping Spectrometer (TOMS) satellite data were used to examine surface UV-irradiance, as a marker of UV exposure, in a large (n = 649) Australian cross-sectional study population. PCR/RFLP analysis was used to genotype C677T-MTHFR. Overall, cumulative UV-irradiance (42 and 120 days pre-clinic) was significantly negatively related to red cell folate (RCF) levels. When the cohort was stratified by MTHFR-C677T genotype, the relationship between UV-irradiance (42 days pre-clinic) and RCF remained significant only in the cohorts containing carriers of the T allele. Statistically significant z-score statistics and interaction terms from genotype and UV-irradiance (p-interaction) demonstrated that genotype did modify the effect of UV-irradiance on RCF, with the largest effect of UV being demonstrated in the 677TT-MTHFR subjects. Data provide strong evidence that surface UV-irradiance reduces long-term systemic folate levels, and that this is influenced by the C677T-MTHFR gene variant. We speculate this effect may be due to 677TT-MTHFR individuals containing more 5,10CH 2 -H 4 PteGlu, and that this folate form may be particularly UV labile. Since UV-irradiance lowers RCF in an MTHFR genotype-specific way, there are likely implications for human health and the evolution of skin pigmentation. © 2016 Wiley Periodicals, Inc.
Directory of Open Access Journals (Sweden)
Bianca Maria Rotoli
2018-03-01
Full Text Available Lysinuric protein intolerance (LPI is a recessively inherited aminoaciduria caused by mutations of SLC7A7, the gene encoding y+LAT1 light chain of system y+L for cationic amino acid transport. The pathogenesis of LPI is still unknown. In this study, we have utilized a gene silencing approach in macrophages and airway epithelial cells to investigate whether complications affecting lung and immune system are directly ascribable to the lack of SLC7A7 or, rather, mediated by an abnormal accumulation of arginine in mutated cells. When SLC7A7/y+LAT1 was silenced in human THP-1 macrophages and A549 airway epithelial cells by means of short interference RNA (siRNA, a significant induction of the expression and release of the inflammatory mediators IL1β and TNFα was observed, no matter the intracellular arginine availability. This effect was mainly regulated at transcriptional level through the activation of NFκB signaling pathway. Moreover, since respiratory epithelial cells are the important sources of chemokines in response to pro-inflammatory stimuli, the effect of IL1β has been addressed on SLC7A7 silenced A549 cells. Results obtained indicated that the downregulation of SLC7A7/y+LAT1 markedly strengthened the stimulatory effect of the cytokine on CCL5/RANTES expression and release without affecting the levels of CXCL8/IL8. Consistently, also the conditioned medium of silenced THP-1 macrophages activated airway epithelial cells in terms of CCL5/RANTES expression due to the presence of elevated amount of proinflammatory cytokines. In conclusion, our results point to a novel thus far unknown function of SLC7A7/y+LAT1, that, under physiological conditions, besides transporting arginine, may act as a brake to restrain inflammation.
Bonnette, R E; Caudill, M A; Boddie, A M; Hutson, A D; Kauwell, G P; Bailey, L B
1998-08-01
To assess the effects of folate intake and pregnancy on plasma total homocyst(e)ine concentrations in women during the second trimester of pregnancy compared with young, healthy nonpregnant women. The diet provided either 450 or 850 microg of folate per day. These levels are approximately the current (400 microg/day) and previous (800 microg/day) Recommended Dietary Allowances for folate in pregnant women. Folate was provided as both food folate (120 microg/day) and supplemental folic acid (either 330 or 730 microg/day) for a period of 12 weeks. Plasma homocyst(e)ine (sum of free and protein-bound homocysteine), serum folate, and erythrocyte folate concentrations were determined weekly. Homocyst(e)ine concentrations were lower in pregnant women during the second trimester of normal pregnancy than in nonpregnant controls, independent of dietary folate intake. The overall mean (+/- standard deviation) homocyst(e)ine concentration of the pregnant subjects (5.4 +/- 1.4 micromol/L) was significantly lower than that observed in the nonpregnant control group (8.7 +/- 1.7 micromol/L) (P ine concentrations remained constant throughout the 12 weeks of the investigation. The folate intakes in this investigation were adequate to maintain constant homocyst(e)ine concentrations in pregnant and nonpregnant women. The lower homocyst(e)ine concentrations observed in pregnant subjects compared with nonpregnant controls may be a physiologic response to pregnancy.
DEFF Research Database (Denmark)
Huppke, Peter; Brendel, Cornelia; Kalscheuer, Vera
2012-01-01
or compound heterozygous mutations for all affected subjects in SLC33A1 encoding a highly conserved acetylCoA transporter (AT-1) required for acetylation of multiple gangliosides and glycoproteins. The mutations were found to cause reduced or absent AT-1 expression and abnormal intracellular localization...
Maxwell, Susannah J; Brameld, Kate J; Bower, Caroline; D'Antoine, Heather; Hickling, Siobhan; Marley, Julia; O'Leary, Peter
2013-02-01
In September 2009, Australia implemented mandatory folic acid fortification of wheat flour for bread-making to reduce the incidence of neural tube defects. Our study aimed to establish baseline folate status data in Aboriginal and non-Aboriginal Western Australians. Patients who presented at a health service or collection centre for blood tests were invited to participate. One hundred and ninety-one Aboriginals and 159 non-Aboriginals were recruited between April 2008 and September 2009. Participants completed a five-minute questionnaire and had blood taken for red blood cell (RBC) folate and serum vitamin B12. Data were analysed using SPSS (version 17.0.2, SPSS Inc., Chicago, IL, USA). Ten per cent (95% confidence intervals (CI): 5, 19) of the Aboriginal women participants and 26% (95% CI: 16, 40) of men had RBC folate concentrations below 250 ng/mL, the cut-off associated with folate deficiency. None of the non-Aboriginal women (95% CI: 0, 4) and 4% of the non-Aboriginal men (95% CI: 2, 12) had RBC folate concentrations below 250 ng/mL. All participants were vitamin B12 replete. None of the 96 Aboriginal and 8% of non-Aboriginal women aged 16-44 reported consumption of supplements with a daily intake of >400 μg folic acid during the previous week. This study established a baseline of RBC folate, folate consumption and supplement use in Aboriginal and non-Aboriginal groups. We identified 10% of Aboriginal women and none of non-Aboriginal women participants with low folate concentrations. The higher prevalence of folate deficiency in Aboriginal participants suggests they are more likely to benefit from a universal program of folate fortification. © 2012 The Authors ANZJOG © 2012 The Royal Australian and New Zealand College of Obstetricians and Gynaecologists.
Directory of Open Access Journals (Sweden)
Dale W Hailey
Full Text Available Mechanosensory hair cell death is a leading cause of hearing and balance disorders in the human population. Hair cells are remarkably sensitive to environmental insults such as excessive noise and exposure to some otherwise therapeutic drugs. However, individual responses to damaging agents can vary, in part due to genetic differences. We previously carried out a forward genetic screen using the zebrafish lateral line system to identify mutations that alter the response of larval hair cells to the antibiotic neomycin, one of a class of aminoglycoside compounds that cause hair cell death in humans. The persephone mutation confers resistance to aminoglycosides. 5 dpf homozygous persephone mutants are indistinguishable from wild-type siblings, but differ in their retention of lateral line hair cells upon exposure to neomycin. The mutation in persephone maps to the chloride/bicarbonate exchanger slc4a1b and introduces a single Ser-to-Phe substitution in zSlc4a1b. This mutation prevents delivery of the exchanger to the cell surface and abolishes the ability of the protein to import chloride across the plasma membrane. Loss of function of zSlc4a1b reduces hair cell death caused by exposure to the aminoglycosides neomycin, kanamycin, and gentamicin, and the chemotherapeutic drug cisplatin. Pharmacological block of anion transport with the disulfonic stilbene derivatives DIDS and SITS, or exposure to exogenous bicarbonate, also protects hair cells against damage. Both persephone mutant and DIDS-treated wild-type larvae show reduced uptake of labeled aminoglycosides. persephone mutants also show reduced FM1-43 uptake, indicating a potential impact on mechanotransduction-coupled activity in the mutant. We propose that tight regulation of the ionic environment of sensory hair cells, mediated by zSlc4a1b activity, is critical for their sensitivity to aminoglycoside antibiotics.
Liu, Ying; Liu, Yi-qun; Morita, Tatsuya; Sugiyama, Kimio
2012-01-01
The effect of betaine status on folate deficiency-induced hyperhomocysteinemia was investigated to determine whether folate deficiency impairs homocysteine removal not only by the methionine synthase (MS) pathway but also by the betaine-homocysteine S-methyltransferase (BHMT) pathway. For this purpose, we investigated the effect of dietary supplementation with betaine at a high level (1%) in rats fed a folate-deprived 10% casein diet (10C) and 20% casein diet (20C). We also investigated the effect of choline deprivation on folate deficiency-induced hyperhomocysteinemia in rats fed 20C. Supplementation of folate-deprived 10C and 20C with 1% betaine significantly suppressed folate deprivation-induced hyperhomocysteinemia, but the extent of suppression was partial or limited, especially in rats fed 10C, the suppression of plasma homocysteine increment being 48.5% in rats fed 10C and 69.7% in rats fed 20C. Although betaine supplementation greatly increased hepatic betaine concentration and BHMT activity, these increases did not fully explain why the effect of betaine supplementation was partial or limited. Folate deprivation markedly increased the hepatic concentration of N,N-dimethylglycine (DMG), a known inhibitor of BHMT, and there was a significant positive correlation between hepatic DMG concentration and plasma homocysteine concentration, suggesting that folate deficiency increases hepatic DMG concentration and thereby depresses BHMT reaction, leading to interference with the effect of betaine supplementation. Choline deprivation did not increase plasma homocysteine concentration in rats fed 20C, but it markedly enhanced plasma homocysteine concentration when rats were fed folate-deprived 20C. This indicates that choline deprivation reinforced folate deprivation-induced hyperhomocysteinemia. Increased hepatic DMG concentration was also associated with such an effect. These results support the concept that folate deficiency impairs homocysteine metabolism not only
Lessons from the SLC for future LC control systems
International Nuclear Information System (INIS)
Humphrey, R.
1992-01-01
The SLC control system is the dynamic result of a number of forces. The most obvious force is the functional requirements of the SLC itself, but other forces are history, budget, people, available technology, etc. The plan of this paper is to describe the critical functional requirements of the SLC which caused significant development of the control system. I have tried to focus on functional requirements as a driver, and I will describe some solutions which we have implemented to satisfy those requirements. The important functional requirements drivers for the control system discussed in this paper are: (1) Repetition rate, (2) Sensitivity to orbit distortion, (3) Stability/Automation, (4) Accelerator Development. (author)
Directory of Open Access Journals (Sweden)
Minxue Shen
Full Text Available It has been reported that higher folate intake from food and supplementation is associated with decreased blood pressure (BP. The association between serum folate concentration and BP has been examined in few studies. We aim to examine the association between serum folate and BP levels in a cohort of young Chinese women.We used the baseline data from a pre-conception cohort of women of childbearing age in Liuyang, China, for this study. Demographic data were collected by structured interview. Serum folate concentration was measured by immunoassay, and homocysteine, blood glucose, triglyceride and total cholesterol were measured through standardized clinical procedures. Multiple linear regression and principal component regression model were applied in the analysis.A total of 1,532 healthy normotensive non-pregnant women were included in the final analysis. The mean concentration of serum folate was 7.5 ± 5.4 nmol/L and 55% of the women presented with folate deficiency (< 6.8 nmol/L. Multiple linear regression and principal component regression showed that serum folate levels were inversely associated with systolic and diastolic BP, after adjusting for demographic, anthropometric, and biochemical factors.Serum folate is inversely associated with BP in non-pregnant women of childbearing age with high prevalence of folate deficiency.
Wang, Yi-Cheng; Chen, Yi-Ming; Lin, Yan-Jun; Liu, Shih-Ping; Chiang, En-Pei Isabel
2011-01-01
Glycine N-methyltransferase (GNMT) is a major hepatic enzyme that converts S-adenosylmethionine to S-adenosylhomocysteine while generating sarcosine from glycine, hence it can regulate mediating methyl group availability in mammalian cells. GNMT is also a major hepatic folate binding protein that binds to, and, subsequently, may be inhibited by 5-methyltetrafolate. GNMT is commonly diminished in human hepatoma; yet its role in cellular folate metabolism, in tumorigenesis and antifolate therap...
Kongsfelt, Iben Boutrup; Byskov, Kristina; Pedersen, Lasse Ebdrup; Pedersen, Lene
2014-01-01
The inorganic phosphate transporter PiT1 (SLC20A1) is ubiquitously expressed in mammalian cells. We recently showed that overexpression of human PiT1 was sufficient to increase proliferation of two strict density-inhibited cell lines, murine fibroblastic NIH3T3 and pre-osteoblastic MC3T3-E1 cells, and allowed the cultures to grow to higher cell densities. In addition, upon transformation NIH3T3 cells showed increased ability to form colonies in soft agar. The cellular regulation of PiT1 expre...
Lucock, Mark; Glanville, Tracey; Yates, Zoë; Walker, James; Furst, John; Simpson, Nigel
2012-08-01
Folate, a key periconceptional nutrient, is ultraviolet light (UV-R) sensitive. We therefore hypothesise that a relationship exists between sunspot activity, a proxy for total solar irradiance (particularly UV-R) reaching Earth, and the occurrence of folate-sensitive, epigenomic-related neonatal genotypes during the first trimester of pregnancy. Limited data is provided to support the hypothesis that the solar cycle predicts folate-related human embryo loss: 379 neonates born at latitude 54°N between 1998 and 2000 were examined for three folate-sensitive, epigenome-related polymorphisms, with solar activity for trimester one accessed via the Royal Greenwich Observatory-US Air force/National Oceanic and Atmospheric Administration Sunspot Database (34,110 total observation days). Logistic regression showed solar activity predicts C677T-methylenetetrahydrofolate reductase (C677T-MTHFR) and A66G-methionine synthase reductase (A66G-MSR) genotype at discrete phases of trimester one. Total and maximal sunspot activity predicts C677T-MTHFR genotype for days 31-60 of trimester one (p=0.0181 and 0.0366, respectively) and A66G-MSR genotype for days 61-90 of trimester one (p=0.0072 and 0.0105, respectively). Loss of UV-R sensitive folate associated with the sunspot cycle might therefore interact with variant folate genes to perturb DNA methylation and/or elaboration of the primary base sequence (thymidylate synthesis), as well as increase embryo-toxic homocysteine. We hypothesise that this may influence embryo viability leading to 677CC-MTHFR and 66GG-MSR embryo loss at times of increased solar activity. This provides an interesting and plausible link between well recognised 'folate gene originated developmental disorders' and 'solar activity/seasonality modulated developmental disorders'. Copyright © 2012 Elsevier Ltd. All rights reserved.
Hefni, Mohammed E; Shalaby, Mohamed T; Witthöft, Cornelia M
2015-01-01
Faba beans are an important source of folate and commonly consumed in Egypt. This study examined the effects of Egyptian industrial food processing (e.g., canning and freezing), germination, cultivar, and maturity stages on folate content, with the aim to develop a candidate functional canned faba bean food with increased folate content. The folate content in four cultivars of green faba beans ranged from 110 to 130 μg 100 g(-1) fresh weight (535-620 μg 100 g(-1) dry matter [DM]), which was four- to sixfold higher than in dried seeds. Industrial canning of dried seeds resulted in significant folate losses of ∼20% (P = 0.004), while industrial freezing had no effect. Germination of faba beans increased the folate content by >40% (P beans resulted in a net folate content of 194 μg 100 g(-1) DM, which is 52% more than in conventional canned beans. The consumption of green faba beans should be recommended, providing ∼120 μg dietary folate equivalents per 100 g/portion.
Gene-diet-interactions in folate-mediated one-carbon metabolism modify colon cancer risk.
Liu, Amy Y; Scherer, Dominique; Poole, Elizabeth; Potter, John D; Curtin, Karen; Makar, Karen; Slattery, Martha L; Caan, Bette J; Ulrich, Cornelia M
2013-04-01
The importance of folate-mediated one-carbon metabolism (FOCM) in colorectal carcinogenesis is emphasized by observations that high dietary folate intake is associated with decreased risk of colon cancer (CC) and its precursors. Additionally, polymorphisms in FOCM-related genes have been repeatedly associated with risk, supporting a causal relationship between folate and colorectal carcinogenesis. We investigated ten candidate polymorphisms with defined or probable functional impact in eight FOCM-related genes (SHMT1, DHFR, DNMT1, MTHFD1, MTHFR, MTRR, TCN2, and TDG) in 1609 CC cases and 1974 controls for association with CC risk and for interaction with dietary factors. No polymorphism was statistically significantly associated with overall risk of CC. However, statistically significant interactions modifying CC risk were observed for DNMT1 I311V with dietary folate, methionine, vitamin B2 , and vitamin B12 intake and for MTRR I22M with dietary folate, a predefined one-carbon dietary pattern, and vitamin B6 intake. We observed statistically significant gene-diet interactions with five additional polymorphisms. Our results provide evidence that FOCM-related dietary intakes modify the association between CC risk and FOCM allelic variants. These findings add to observations showing that folate-related gene-nutrient interactions play an important role in modifying the risk of CC. © 2012 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Vitamin-responsive disorders: cobalamin, folate, biotin, vitamins B1 and E.
Baumgartner, Matthias R
2013-01-01
The catalytic properties of many enzymes depend on the participation of vitamins as obligatory cofactors. Vitamin B12 (cobalamin) and folic acid (folate) deficiencies in infants and children classically present with megaloblastic anemia and are often accompanied by neurological signs. A number of rare inborn errors of cobalamin and folate absorption, transport, cellular uptake, and intracellular metabolism have been delineated and identification of disease-causing mutations has improved our ability to diagnose and treat many of these conditions. Two inherited defects in biotin metabolism are known, holocarboxylase synthetase and biotinidase deficiency. Both lead to multiple carboxylase deficiency manifesting with metabolic acidosis, neurological abnormalities, and skin rash. Thiamine-responsive megaloblastic anemia is characterized by megaloblastic anemia, non-type I diabetes, and sensorineural deafness that responds to pharmacological doses of thiamine (vitamin B1). Individuals affected with inherited vitamin E deficiencies including ataxia with isolated vitamin E deficiency and abetalipoproteinemia present with a spinocerebellar syndrome similar to patients with Friedreich's ataxia. If started early, treatment of these defects by oral or parenteral administration of the relevant vitamin often results in correction of the metabolic defect and reversal of the signs of disease, stressing the importance of early and correct diagnosis in these treatable conditions. Copyright © 2013 Elsevier B.V. All rights reserved.
Folate Deficiency Could Restrain Decidual Angiogenesis in Pregnant Mice
Directory of Open Access Journals (Sweden)
Yanli Li
2015-08-01
Full Text Available The mechanism of birth defects induced by folate deficiency was focused on mainly in fetal development. Little is known about the effect of folate deficiency on the maternal uterus, especially on decidual angiogenesis after implantation which establishes vessel networks to support embryo development. The aim of this study was to investigate the effects of folate deficiency on decidual angiogenesis. Serum folate levels were measured by electrochemiluminescence. The status of decidual angiogenesis was examined by cluster designation 34 (CD34 immunohistochemistry and the expression of angiogenic factors, including vascular endothelial growth factor A (VEGFA, placental growth factor (PLGF, and VEGF receptor 2 (VEGFR2 were also tested. Serum levels of homocysteine (Hcy, follicle stimulating hormone (FSH, luteinizing hormone (LH, prolactin (PRL, progesterone (P4, and estradiol (E2 were detected by Enzyme-linked immunosorbent assay. The folate-deficient mice had a lower folate level and a higher Hcy level. Folate deficiency restrained decidual angiogenesis with significant abnormalities in vascular density and the enlargement and elongation of the vascular sinus. It also showed a reduction in the expressions of VEGFA, VEGFR2, and PLGF. In addition, the serum levels of P4, E2, LH, and PRL were reduced in folate-deficient mice, and the expression of progesterone receptor (PR and estrogen receptor α (ERα were abnormal. These results indicated that folate deficiency could impaire decidual angiogenesis and it may be related to the vasculotoxic properties of Hcy and the imbalance of the reproductive hormone.
International Nuclear Information System (INIS)
Cassel, R.; Donaldson, A.; Mattison, T.; Bowden, G.; Weaver, J.; Bulos, F.; Fiander, D.
1991-01-01
The SLC Damping Ring kicker magnets requires a fast magnetic field rise time of 58 nsec, a peak field of 800 gauss, a pulse amplitude stability of 0.01%, and a reasonable operational lifetime. The original kicker magnets designed by SLAC and at Fermi were not able to fulfill the SLC kicker requirements. Extensive studies were conducted to determine the limitation in the magnets, response of the ferrite in kicker magnet, and the modifications needed to improve the kicker magnet performance. The paper details the SLAC and Fermi kicker magnets limitation of performance
Directory of Open Access Journals (Sweden)
Agné Kulyté
Full Text Available Although the mechanisms linking obesity to insulin resistance (IR and type 2 diabetes (T2D are not entirely understood, it is likely that alterations of adipose tissue function are involved. The aim of this study was to identify new genes controlling insulin sensitivity in adipocytes from obese women with either insulin resistant (OIR or sensitive (OIS adipocytes. Insulin sensitivity was first determined by measuring lipogenesis in isolated adipocytes from abdominal subcutaneous white adipose tissue (WAT in a large observational study. Lipogenesis was measured under conditions where glucose transport was the rate limiting step and reflects in vivo insulin sensitivity. We then performed microarray-based transcriptome profiling on subcutaneous WAT specimen from a subgroup of 9 lean, 21 OIS and 18 obese OIR women. We could identify 432 genes that were differentially expressed between the OIR and OIS group (FDR ≤5%. These genes are enriched in pathways related to glucose and amino acid metabolism, cellular respiration, and insulin signaling, and include genes such as SLC2A4, AKT2, as well as genes coding for enzymes in the mitochondria respiratory chain. Two IR-associated genes, KLF15 encoding a transcription factor and SLC25A10 encoding a dicarboxylate carrier, were selected for functional evaluation in adipocytes differentiated in vitro. Knockdown of KLF15 and SLC25A10 using siRNA inhibited insulin-stimulated lipogenesis in adipocytes. Transcriptome profiling of siRNA-treated cells suggested that KLF15 might control insulin sensitivity by influencing expression of PPARG, PXMP2, AQP7, LPL and genes in the mitochondrial respiratory chain. Knockdown of SLC25A10 had only modest impact on the transcriptome, suggesting that it might directly influence insulin sensitivity in adipocytes independently of transcription due to its important role in fatty acid synthesis. In summary, this study identifies novel genes associated with insulin sensitivity in
Temperature effects on separation of Gd3+ from Gd-DTPA-folate using nanofiltration method
Rahayu, I.; Indraneli, R. P.; Yuliyati, Y. B.; Anggraeni, A.; Soedjanaatmadja, U. M. S.; Bahti, H. H.
2018-05-01
MRI is one of the best techniques in medical diagnostics. Contrast agents are used to improve the visual of organs that are difficult to distinguish through MRI. Gd-DTPA-folate is one of the specific contrast agents against cancer diagnosis, because it has a high affinity to folate receptors. In the complexing Gd-DTPA-folate, does not rule out the complexity step runs imperfectly, so there is still Gd3+ in the Gd-DTPA-folate complex. The separation of Gd3+ from the Gd-DTPA-folate complex is important to eliminate toxic effects on the contrast agent. This study aims to determine the effect of temperature on the separation of Gd-DTPA-folate from Gd3+ with nanofiltration. The method are preparation Gd-DTPA-folate from GdCl3.6H2O and DTPA-folate by reflux method, then separated Gd-DTPA-folate complex from Gd3+ with nanofiltration at variation temperature (40, 41, 42, 43, 44oC ). Then, the values of flux and rejection coefficients were analyzed. The results showed that the optimum temperature for the separation of Gd3+ from Gd-DTPA-folate was achieved at 42.6°C with the rejection coefficient of 24% and the permeate flux of 403 L.m-2.h-1.
19p13.1 is a triple-negative-specific breast cancer susceptibility locus
DEFF Research Database (Denmark)
Stevens, Kristen N; Fredericksen, Zachary; Vachon, Celine M
2012-01-01
(PR), and human epidermal growth factor receptor-2 (HER2) status, using 48,869 breast cancer cases and 49,787 controls from the Breast Cancer Association Consortium (BCAC). Variants from 19p13.1 were not associated with breast cancer overall or with ER-positive breast cancer but were significantly......The 19p13.1 breast cancer susceptibility locus is a modifier of breast cancer risk in BRCA1 mutation carriers and is also associated with the risk of ovarian cancer. Here, we investigated 19p13.1 variation and risk of breast cancer subtypes, defined by estrogen receptor (ER), progesterone receptor...... associated with ER-negative breast cancer risk [rs8170 OR, 1.10; 95% confidence interval (CI), 1.05-1.15; P = 3.49 × 10(-5)] and triple-negative (ER-, PR-, and HER2-negative) breast cancer (rs8170: OR, 1.22; 95% CI, 1.13-1.31; P = 2.22 × 10(-7)). However, rs8170 was no longer associated with ER...
Filling Landsat ETM+ SLC-off gaps using a segmentation model approach
Maxwell, Susan
2004-01-01
The purpose of this article is to present a methodology for filling Landsat Scan Line Corrector (SLC)-off gaps with same-scene spectral data guided by a segmentation model. Failure of the SLC on the Landsat 7 Enhanced Thematic Mapper Plus (ETM+) instrument resulted in a loss of approximately 25 percent of the spectral data. The missing data span across most of the image with scan gaps varying in size from two pixels near the center of the image to 14 pixels along the east and west edges. Even with the scan gaps, the radiometric and geometric qualities of the remaining portions of the image still meet design specifications and therefore contain useful information (see http:// landsat7.usgs.gov for additional information). The U.S. Geological Survey EROS Data Center (EDC) is evaluating several techniques to fill the gaps in SLC-off data to enhance the usability of the imagery (Howard and Lacasse 2004) (PE&RS, August 2004). The method presented here uses a segmentation model approach that allows for same-scene spectral data to be used to fill the gaps. The segment model is generated from a complete satellite image with no missing spectral data (e.g., Landsat 5, Landsat 7 SLCon, SPOT). The model is overlaid on the Landsat SLC-off image, and the missing data within the gaps are then estimated using SLC-off spectral data that intersect the segment boundary. A major advantage of this approach is that the gaps are filled using spectral data derived from the same SLC-off satellite image.
Simultaneous radioassay of folate and vitamin B12
International Nuclear Information System (INIS)
Gutcho, S.; Mansbach, L.
1979-01-01
A serum sample is heated at an alkaline pH to release folate and vitamin B 12 from endogenous binders. A simultaneous radioassay for folate and vitamin B 12 is effected by contacting the sample with binder for folate, binder for vitamin B 12 , folote labeled with one radioactive isotope and vitamin B 12 labeled with another radioacitve isotope, followed by separation of bound and free portions, and determination of the radioactivity of at least one of the portions. The amounts of folate and vitamin B 12 present in the sample may be determined from standard curves
Boycott, Kym M.; Beaulieu, Chandree L.; Kernohan, Kristin D.; Gebril, Ola H.; Mhanni, Aziz; Chudley, Albert E.; Redl, David; Qin, Wen; Hampson, Sarah; Küry, Sébastien; Tetreault, Martine; Puffenberger, Erik G.; Scott, James N.; Bezieau, Stéphane; Reis, André; Uebe, Steffen; Schumacher, Johannes; Hegele, Robert A.; McLeod, D. Ross; Gálvez-Peralta, Marina; Majewski, Jacek; Ramaekers, Vincent T.; Nebert, Daniel W.; Innes, A. Micheil; Parboosingh, Jillian S.; Abou Jamra, Rami
2015-01-01
Manganese (Mn) and zinc (Zn) are essential divalent cations used by cells as protein cofactors; various human studies and animal models have demonstrated the importance of Mn and Zn for development. Here we describe an autosomal-recessive disorder in six individuals from the Hutterite community and in an unrelated Egyptian sibpair; the disorder is characterized by intellectual disability, developmental delay, hypotonia, strabismus, cerebellar atrophy, and variable short stature. Exome sequencing in one affected Hutterite individual and the Egyptian family identified the same homozygous variant, c.112G>C (p.Gly38Arg), affecting a conserved residue of SLC39A8. The affected Hutterite and Egyptian individuals did not share an extended common haplotype, suggesting that the mutation arose independently. SLC39A8 is a member of the solute carrier gene family known to import Mn, Zn, and other divalent cations across the plasma membrane. Evaluation of these two metal ions in the affected individuals revealed variably low levels of Mn and Zn in blood and elevated levels in urine, indicating renal wasting. Our findings identify a human Mn and Zn transporter deficiency syndrome linked to SLC39A8, providing insight into the roles of Mn and Zn homeostasis in human health and development. PMID:26637978
Folates in Asian noodles: II. A comparison of commercial samples and the impact of cooking.
Bui, Lan T T; Small, Darryl M
2007-06-01
The folate contents of 26 commercial noodle samples were investigated. The impact of ingredients, pH, and cooking on folate content was studied for the 3 predominant styles of noodles: white salted, yellow alkaline, and instant. Some variability was found in the proportion of folate present in the free form and the noodles generally had low total folate contents. The pH values of the samples covered a wide range, varying from 3.7 to 10.3; however, the results did not provide strong evidence for a relationship between pH and folate content for any of the noodle styles studied. Higher folate levels were typically found in yellow alkaline samples compared to white salted and instant noodles. The storage of noodles in dry or moist forms did not appear to influence total folate contents, and subsequent losses during cooking depended upon the time of exposure to elevated temperatures. The enzymatic treatment of samples was particularly important for cooked noodles, indicating that folates were bound or entrapped during this process.
Directory of Open Access Journals (Sweden)
Sofia Blazevic
Full Text Available We tested the hypothesis that gestational diabetes mellitus (GDM alters the DNA methylation pattern of the fetal serotonin transporter gene (SLC6A4, and examined the functional relevance of DNA methylation for regulation of the SLC6A4 expression in the human placenta. The study included 50 mother-infant pairs. Eighteen mothers were diagnosed with GDM and 32 had normal glucose tolerance (NGT. All neonates were of normal birth weight and born at term by planned Cesarean section. DNA and RNA were isolated from samples of tissue collected from the fetal side of the placenta immediately after delivery. DNA methylation was quantified at 7 CpG sites within the SLC6A4 distal promoter region using PCR amplification of bisulfite treated DNA and subsequent DNA sequencing. SLC6A4 mRNA levels were measured by reverse transcription-quantitative PCR (RT-qPCR. Functional SLC6A4 polymorphisms (5HTTLPR, STin2, rs25531 were genotyped using standard PCR-based procedures. Average DNA methylation across the 7 analyzed loci was decreased in the GDM as compared to the NGT group (by 27.1%, p = 0.037 and negatively correlated, before and after adjustment for potential confounder/s, with maternal plasma glucose levels at the 24th to 28th week of gestation (p0.05. The results suggest that DNA methylation of the fetal SLC6A4 gene is sensitive to the maternal metabolic state in pregnancy. They also indicate a predominant role of epigenetic over genetic mechanisms in the regulation of SLC6A4 expression in the human placenta. Longitudinal studies in larger cohorts are needed to verify these results and determine to which degree placental SLC6A4 changes may contribute to long-term outcomes of infants exposed to GDM.
Directory of Open Access Journals (Sweden)
Thomas Lundåsen
Full Text Available Interruption of the enterohepatic circulation of bile acids increases cholesterol catabolism, thereby stimulating hepatic cholesterol synthesis from acetate. We hypothesized that such treatment should lower the hepatic acetate pool which may alter triglyceride and glucose metabolism. We explored this using mice deficient of the ileal sodium-dependent BA transporter (Slc10a2 and ob/ob mice treated with a specific inhibitor of Slc10a2. Plasma TG levels were reduced in Slc10a2-deficient mice, and when challenged with a sucrose-rich diet, they displayed a reduced response in hepatic TG production as observed from the mRNA levels of several key enzymes in fatty acid synthesis. This effect was paralleled by a diminished induction of mature sterol regulatory element-binding protein 1c (Srebp1c. Unexpectedly, the SR-diet induced intestinal fibroblast growth factor (FGF 15 mRNA and normalized bile acid synthesis in Slc10a2-/- mice. Pharmacologic inhibition of Slc10a2 in diabetic ob/ob mice reduced serum glucose, insulin and TGs, as well as hepatic mRNA levels of Srebp1c and its target genes. These responses are contrary to those reported following treatment of mice with a bile acid binding resin. Moreover, when key metabolic signal transduction pathways in the liver were investigated, those of Mek1/2-Erk1/2 and Akt were blunted after treatment of ob/ob mice with the Slc10a2 inhibitor. It is concluded that abrogation of Slc10a2 reduces hepatic Srebp1c activity and serum TGs, and in the diabetic ob/ob model it also reduces glucose and insulin levels. Hence, targeting of Slc10a2 may be a promising strategy to treat hypertriglyceridemia and diabetes.
Folate and neural tube defects - Recommendations from a Danish working group
DEFF Research Database (Denmark)
Rasmussen, Lone Banke; Andersen, Niels Lyhne; Andersson, G.
1998-01-01
acid daily from a multivitamin/folic acid tablet. Women who have had a child with NTD and women who themselves have NTDs are recommended a supplement of 5 mg folic acid daily. Dietary changes and supplements should be initiated when pregnancy is planned........ Folate is a B-vitamin found in most food groups. In case-control studies and randomised studies, a protective effect of folic acid supplements on NTDs has been found. The studies show that a periconceptional folic acid supplement df 360 mu g to 4 mg daily decreases the recurrence rate of NTDs. Likewise......, in the few studies which calculate folate intake from the diet, a lower risk of NTD with higher intake of folate from the diet has been found. The folate intake can be increased by the diet, by folic acid supplements or by fortification of food a with folic acid. It is concluded that the incidence of NTDs...
Wang, Sheng; Wang, Hanjie; Liu, Zhongyun; Wang, Liangliang; Wang, Xiaomin; Su, Lin; Chang, Jin
2014-06-01
To improve their therapeutic index, designed nanocarriers should preferentially accumulate in tumor tissues and then rapidly enter tumor cells to release the encapsulated drugs in a triggered manner. In this article, a new kind of a smart pH- and reduction-dual-responsive drug delivery system based on folate-PEG-coated polymeric lipid vesicles (FPPLVs) formed from amphiphilic dextran derivatives was designed and prepared successfully. PEG chains with pH-sensitive hydrazone bonds, stearyl alcohol (SA) chains with reduction-sensitive disulfide bonds and folate were connected to a dextran main chain. The newly developed FPPLVs had a nano-sized structure (~50 nm) with a PEG coating. The in vitro DOX release profiles showed that the FPPLVs achieved a triggered drug release in response to acidic pH and reducing environments due to the cleavage of hydrazone bonds and disulfide bonds. It has also been demonstrated by an in vitro cellular uptake study that the FPPLVs lose their PEG coating as well as expose the folate in acidic conditions, which allows them to efficiently enter tumor cells through ligand-receptor interactions. In vitro cytotoxicity measurements also confirmed that FPPLVs exhibited pronounced antitumor activity against HeLa cells. These results suggest that FPPLVs are promising carriers for smart antitumor drug delivery applications.To improve their therapeutic index, designed nanocarriers should preferentially accumulate in tumor tissues and then rapidly enter tumor cells to release the encapsulated drugs in a triggered manner. In this article, a new kind of a smart pH- and reduction-dual-responsive drug delivery system based on folate-PEG-coated polymeric lipid vesicles (FPPLVs) formed from amphiphilic dextran derivatives was designed and prepared successfully. PEG chains with pH-sensitive hydrazone bonds, stearyl alcohol (SA) chains with reduction-sensitive disulfide bonds and folate were connected to a dextran main chain. The newly developed FPPLVs had a
Increased uracil misincorporation in lymphocytes from folate-deficient rats
Duthie, S J; Grant, G; Narayanan, S
2000-01-01
The development of certain human cancers has been linked with inadequate intake of folates. The effects of folate deficiency in vivo on DNA stability (strand breakage, misincorporated uracil and oxidative base damage) in lymphocytes isolated from rats fed a diet deficient in folic acid was determined. Because the metabolic pathways of folate and other methyl donors are closely coupled, the effects of methionine and choline deficiency alone or in combination with folate deficiency were determi...
Boczonadi, Veronika; King, Martin S; Smith, Anthony C; Olahova, Monika; Bansagi, Boglarka; Roos, Andreas; Eyassu, Filmon; Borchers, Christoph; Ramesh, Venkateswaran; Lochmüller, Hanns; Polvikoski, Tuomo; Whittaker, Roger G; Pyle, Angela; Griffin, Helen; Taylor, Robert W; Chinnery, Patrick F; Robinson, Alan J; Kunji, Edmund R S; Horvath, Rita
2018-03-08
PurposeTo understand the role of the mitochondrial oxodicarboxylate carrier (SLC25A21) in the development of spinal muscular atrophy-like disease.MethodsWe identified a novel pathogenic variant in a patient by whole-exome sequencing. The pathogenicity of the mutation was studied by transport assays, computer modeling, followed by targeted metabolic testing and in vitro studies in human fibroblasts and neurons.ResultsThe patient carries a homozygous pathogenic variant c.695A>G; p.(Lys232Arg) in the SLC25A21 gene, encoding the mitochondrial oxodicarboxylate carrier, and developed spinal muscular atrophy and mitochondrial myopathy. Transport assays show that the mutation renders SLC25A21 dysfunctional and 2-oxoadipate cannot be imported into the mitochondrial matrix. Computer models of central metabolism predicted that impaired transport of oxodicarboxylate disrupts the pathways of lysine and tryptophan degradation, and causes accumulation of 2-oxoadipate, pipecolic acid, and quinolinic acid, which was confirmed in the patient's urine by targeted metabolomics. Exposure to 2-oxoadipate and quinolinic acid decreased the level of mitochondrial complexes in neuronal cells (SH-SY5Y) and induced apoptosis.ConclusionMitochondrial oxodicarboxylate carrier deficiency leads to mitochondrial dysfunction and the accumulation of oxoadipate and quinolinic acid, which in turn cause toxicity in spinal motor neurons leading to spinal muscular atrophy-like disease.GENETICS in MEDICINE advance online publication, 8 March 2018; doi:10.1038/gim.2017.251.
SLC26A4 mutations are associated with a specific inner ear malformation.
Fitoz, Suat; Sennaroğlu, Levent; Incesulu, Armağan; Cengiz, Filiz Başak; Koç, Yasemin; Tekin, Mustafa
2007-03-01
Inner ear anomalies have been reported in approximately 30% of children with early onset deafness. Identification of causative genetic factors in a large proportion of these patients was not successful. Mutations in the SLC26A4 gene have been detected in individuals with enlarged vestibular aqueduct (EVA) or Mondini dysplasia. We aimed to characterize the inner ear anomalies associated with SLC26A4 mutations. The SLC26A4 gene has been screened for mutations in 16 subjects from 14 unrelated Turkish families with a variety of inner ear anomalies ranging from Michel aplasia to incomplete partition-II and EVA. None of the patients was diagnosed to have a recognizable genetic syndrome. Additional four patients with Pendred syndrome from three families were included. Only one patient with EVA was found to have a heterozygous mutation (c.1586delT) in SLC26A4. All patients with Pendred syndrome had homozygous mutations and were noted to have either EVA or EVA associated with incomplete partition-II on the computed tomography of the temporal bone. SLC26A4 mutations are not associated with a large spectrum of inner ear anomalies. They, instead, result in a specific morphological appearance consistent with EVA or incomplete partition-II.
Directory of Open Access Journals (Sweden)
Sychev DA
2017-03-01
Full Text Available Dmitrij Alekseevitch Sychev,1 Grigorij Nikolaevich Shuev,1 Salavat Shejhovich Suleymanov,2 Kristina Anatol’evna Ryzhikova,3 Karin Badavievich Mirzaev,3 Elena Anatol’evna Grishina,3 Natalia Evgenievna Snalina,3 Zhannet Alimovna Sozaeva,3 Anton Mikhailovich Grabuzdov,4 Irina Andreevna Matsneva4 1Department of Internal Medicine and Clinical Pharmacology, Russian Medical Academy of Continuing Professional Education, Ministry of Healthcare, Moscow, 2Saiko Russian–Japanese Medical Center, Khabarovsk, 3Research Centre, Russian Medical Academy of Continuous Professional Education, Ministry of Healthcare, 4Department of General Medicine, Sechenov First Moscow State Medical University, Moscow, Russian Federation Background: The efficiency and safety of drug therapy depends on the peculiarities of functioning of the P450 cytochrome group and transporting proteins. There are significant differences for single-nucleotide polymorphism (SNP frequency. Materials and methods: We studied the peculiarities of P450 cytochrome polymorphisms, SLCO1B1 transporting protein, and P-glycoprotein carriage in healthy volunteers in the Nanai ethnic group living in Russia, and compared them to the carriage of SNPs in the Russian population according to literature data. Results: After performing the real-time polymerase chain reactions on the samples from 70 healthy volunteers from the Nanai group, for the CYP2C9*2C430T polymorphism we determined 70 CC-genotype carriers. As for the CYP2C9*3A1075C polymorphism, we found 62 AA-genotype carriers and eight AC-genotype carriers. For the CYP2C19*2G681A polymorphism, we determined 39 GG-genotype carriers and 28 GA-genotype carriers, for the CYP2C19*3G636A polymorphism 58 GG-genotype carriers and 12 GA-genotype carriers, and for the CYP2C19*17C806T polymorphism 67 CC-genotype carriers and three CT-genotype carriers. For the CYP2D6*4G1846A polymorphism, the GG genotype had 68 carriers, and the GA genotype two carriers. For the
International Nuclear Information System (INIS)
Kennedy, D. A.; Stern, S. J.; Matok, I.; Moretti, M. E.; Sarkar, M.; Webber, T. A.; Koren, G.; Kennedy, D. A.; Koren, G.; Stern, S. J.; Koren, G.
2012-01-01
Background. The objective was to determine whether relationships exist between the methylene-tetrahydrofolate reductase (Mthf) polymorphisms and risk of colorectal cancer (CRC) and examine whether the risk is modified by level of folate intake. Methods. MEDLINE, Embase, and SCOPUS were searched to May 2012 using the terms “folic acid,” “folate,” “colorectal cancer,” “methylenetetrahydrofolate reductase,” “MTHFR.” Observational studies were included which (1) assessed the risk of CRC for each polymorphism and/or (2) had defined levels of folate intake for each polymorphism and assessed the risk of CRC. Results. From 910 references, 67 studies met our criteria; hand searching yielded 10 studies. The summary risk estimate comparing the 677CT versus CC genotype was 1.02 (95% CI 0.95-1.10) and for 677TT versus CC was 0.88 (95% CI 0.80-0.96) both with heterogeneity. The summary risk estimates for A1298C polymorphisms suggested no reduced risk. The summary risk estimate for high versus low total folate for the 677CC genotype was 0.70 (95% CI 0.56-0.89) and the 677TT genotype 0.63 (95% CI 0.41-0.97). Conclusion. These results suggest that the 677TT genotype is associated with a reduced risk of developing CRC, under conditions of high total folate intake, and this associated risk remains reduced for both MTHFR 677 CC and TT genotypes.
SLC energy spectrum monitor using synchrotron radiation
International Nuclear Information System (INIS)
Seeman, J.; Brunk, W.; Early, R.; Ross, M.; Tillmann, E.; Walz, D.
1986-01-01
The SLAC linac is being upgraded for the use in the SLAC Linear Collider (SLC). The improved linac must accelerate electron and positron bunches from 1.2 GeV to 50 GeV while producing output energy spectra of about 0.2%. The energy spectra must be maintained during operation to provide for good beam transmission and to minimize chromatic effects in the SLC ARCs and Final Focus. The energy spectra of these beams are determined by the bunch length and intensity, the RF phase and waveform and the intra-bunch longitudinal wakefields. A non-destructive energy spectrum monitor has been designed using a vertical wiggler magnet located downstream of the horizontal beam splitter at the end of the SLC linac. It produces synchrotron radiation which is viewed in an off-axis x-ray position sensitive detector. The expected resolution is 0.08 %. The design considerations of this monitor are presented. A pair of these monitors is under construction with an installation data set for late summer 1986
SLC energy spectrum monitor using synchrotron radiation
International Nuclear Information System (INIS)
Seeman, J.; Brunk, W.; Early, R.; Ross, M.; Tillmann, E.; Walz, D.
1986-04-01
The SLAC Linac is being upgraded for the use in the SLAC Linear Collider (SLC). The improved Linac must accelerate electron and positron bunches from 1.2 GeV to 50 GeV while producing output energy spectra of about 0.2%. The energy spectra must be maintained during operation to provide for good beam transmission and to minimize chromatic effects in the SLC ARCs and Final Focus. the energy spectra of these beams are determined by the bunch length and intensity, the RF phase and waveform and the intra-bunch longitudinal wakefields. A non-destructive energy spectrum monitor has been designed using a vertical wiggler magnet located downstream of the horizontal beam splitter at the end of the SLC Linac. It produces synchrotron radiation which is viewed in an off-axis x-ray position sensitive detector. The expected resolution is 0.08%. The design considerations of this monitor are presented in this paper. A pair of these monitors is under construction with an installation date set for late summer 1986. 5 refs., 6 figs
Epigenetic Mechanisms of Folate Nutrition in Breast Cancer
2012-04-01
MDAMB231 clones that express non-leaky TetR systems. Test effects of folate deficiency on global and gene specific DNA methylation and gene...cellular differentiation and function. Aberrant DNA methylation is a characteristic of cancer cells, including mammary tumors. The B vitamin folate ...relationships between folate , one-carbon metabolism, DNA methylation , and gene expression within the context of breast cancer. We hypothesize that
[Determination of folate content in ready-to-eat food products].
Fajardo Martín, Violeta; Alonso-Aperte, Elena; Varela-Moreiras, Gregorio
2013-01-01
In the last years, the consumption of ready-to-eat foods has become an increasing part of the current Spanish diet. Accordingly, the nutritional composition of these food categories should be investigated in order to estimate its contribution to vitamin and nutrient intakes, in particular its folate content. The broad lack of folate data in food composition tables and databases justifies this approach. The aim of this work was to screen the current availability and to supply new folate data in ready-to-eat commercial products in the Spanish market. Seventeen ready-to-eat foods, including mainly vegetable ingredients, were analysed for total folate content using a validated method that relies on Lactobacillus casei ssp. rhamnosus chloramphenicol-resistant folate dependent growth. The accuracy of the analytical procedure was checked using a certified reference material and by a recovery test. Mean TF content ranged from 13.6 to 103.8 μg/100 g in different food matrices on a fresh weight basis. Higher TF quantity was found for vegetable hamburguers, recipes including chickpeas, peas or artichockes. Selected precooked products were also analysed after a soft heat treatment as recommended by the manufacter before its consumption. No significant differences were found in the folate content after processing. The coefficient of variation for the duplicates of the same product was less than 15%. Folate content in ready-to-eat products indicates the potential to considerably increase folate intake by choosing folate-rich foods. There have been no previous reports on folate data in chilled ready-to-eat meals. The present data will assist dietary studies to estimate and evaluate the adequacy of population folate intakes. Copyright © AULA MEDICA EDICIONES 2013. Published by AULA MEDICA. All rights reserved.
Chuang, Shu-Chun; Rota, Matteo; Gunter, Marc J; Zeleniuch-Jacquotte, Anne; Eussen, Simone J P M; Vollset, Stein Emil; Ueland, Per Magne; Norat, Teresa; Ziegler, Regina G; Vineis, Paolo
2013-10-01
Most epidemiologic studies on folate intake suggest that folate may be protective against colorectal cancer, but the results on circulating (plasma or serum) folate are mostly inconclusive. We conducted a meta-analysis of case-control studies nested within prospective studies on circulating folate and colorectal cancer risk by using flexible meta-regression models to test the linear and nonlinear dose-response relationships. A total of 8 publications (10 cohorts, representing 3,477 cases and 7,039 controls) were included in the meta-analysis. The linear and nonlinear models corresponded to relative risks of 0.96 (95% confidence interval (CI): 0.91, 1.02) and 0.99 (95% CI: 0.96, 1.02), respectively, per 10 nmol/L of circulating folate in contrast to the reference value. The pooled relative risks when comparing the highest with the lowest category were 0.80 (95% CI: 0.61, 0.99) for radioimmunoassay and 1.03 (95% CI: 0.83, 1.22) for microbiological assay. Overall, our analyses suggest a null association between circulating folate and colorectal cancer risk. The stronger association for the radioimmunoassay-based studies could reflect differences in cohorts and study designs rather than assay performance. Further investigations need to integrate more accurate measurements and flexible modeling to explore the effects of folate in the presence of genetic, lifestyle, dietary, and hormone-related factors.
Mistry, Divya; Wise, Roger P; Dickerson, Julie A
2017-01-01
Identification of central genes and proteins in biomolecular networks provides credible candidates for pathway analysis, functional analysis, and essentiality prediction. The DiffSLC centrality measure predicts central and essential genes and proteins using a protein-protein interaction network. Network centrality measures prioritize nodes and edges based on their importance to the network topology. These measures helped identify critical genes and proteins in biomolecular networks. The proposed centrality measure, DiffSLC, combines the number of interactions of a protein and the gene coexpression values of genes from which those proteins were translated, as a weighting factor to bias the identification of essential proteins in a protein interaction network. Potentially essential proteins with low node degree are promoted through eigenvector centrality. Thus, the gene coexpression values are used in conjunction with the eigenvector of the network's adjacency matrix and edge clustering coefficient to improve essentiality prediction. The outcome of this prediction is shown using three variations: (1) inclusion or exclusion of gene co-expression data, (2) impact of different coexpression measures, and (3) impact of different gene expression data sets. For a total of seven networks, DiffSLC is compared to other centrality measures using Saccharomyces cerevisiae protein interaction networks and gene expression data. Comparisons are also performed for the top ranked proteins against the known essential genes from the Saccharomyces Gene Deletion Project, which show that DiffSLC detects more essential proteins and has a higher area under the ROC curve than other compared methods. This makes DiffSLC a stronger alternative to other centrality methods for detecting essential genes using a protein-protein interaction network that obeys centrality-lethality principle. DiffSLC is implemented using the igraph package in R, and networkx package in Python. The python package can be
Directory of Open Access Journals (Sweden)
Mayor-Olea Alvaro
2011-05-01
Full Text Available Abstract Background Temporomandibular disorder (TMD is a multifactorial syndrome related to a critical period of human life. TMD has been associated with psychological dysfunctions, oxidative state and sexual dimorphism with coincidental occurrence along the pubertal development. In this work we study the association between TMD and genetic polymorphisms of folate metabolism, neurotransmission, oxidative and hormonal metabolism. Folate metabolism, which depends on genes variations and diet, is directly involved in genetic and epigenetic variations that can influence the changes of last growing period of development in human and the appearance of the TMD. Methods A case-control study was designed to evaluate the impact of genetic polymorphisms above described on TMD. A total of 229 individuals (69% women were included at the study; 86 were patients with TMD and 143 were healthy control subjects. Subjects underwent to a clinical examination following the guidelines by the Research Diagnostic Criteria for Temporomandibular Disorders (RDC/TMD. Genotyping of 20 Single Nucleotide Polymorphisms (SNPs, divided in two groups, was performed by multiplex minisequencing preceded by multiplex PCR. Other seven genetic polymorphisms different from SNPs (deletions, insertions, tandem repeat, null genotype were achieved by a multiplex-PCR. A chi-square test was performed to determine the differences in genotype and allelic frequencies between TMD patients and healthy subjects. To estimate TMD risk, in those polymorphisms that shown significant differences, odds ratio (OR with a 95% of confidence interval were calculated. Results Six of the polymorphisms showed statistical associations with TMD. Four of them are related to enzymes of folates metabolism: Allele G of Serine Hydoxymethyltransferase 1 (SHMT1 rs1979277 (OR = 3.99; 95%CI 1.72, 9.25; p = 0.002, allele G of SHMT1 rs638416 (OR = 2.80; 95%CI 1.51, 5.21; p = 0.013, allele T of Methylentetrahydrofolate
Roffman, Joshua L; Brohawn, David G; Nitenson, Adam Z; Macklin, Eric A; Smoller, Jordan W; Goff, Donald C
2013-03-01
Low serum folate levels previously have been associated with negative symptom risk in schizophrenia, as has the hypofunctional 677C>T variant of the MTHFR gene. This study examined whether other missense polymorphisms in folate-regulating enzymes, in concert with MTHFR, influence negative symptoms in schizophrenia, and whether total risk allele load interacts with serum folate status to further stratify negative symptom risk. Medicated outpatients with schizophrenia (n = 219), all of European origin and some included in a previous report, were rated with the Positive and Negative Syndrome Scale. A subset of 82 patients also underwent nonfasting serum folate testing. Patients were genotyped for the MTHFR 677C>T (rs1801133), MTHFR 1298A>C (rs1801131), MTR 2756A>G (rs1805087), MTRR 203A>G (rs1801394), FOLH1 484T>C (rs202676), RFC 80A>G (rs1051266), and COMT 675G>A (rs4680) polymorphisms. All genotypes were entered into a linear regression model to determine significant predictors of negative symptoms, and risk scores were calculated based on total risk allele dose. Four variants, MTHFR 677T, MTR 2756A, FOLH1 484C, and COMT 675A, emerged as significant independent predictors of negative symptom severity, accounting for significantly greater variance in negative symptoms than MTHFR 677C>T alone. Total allele dose across the 4 variants predicted negative symptom severity only among patients with low folate levels. These findings indicate that multiple genetic variants within the folate metabolic pathway contribute to negative symptoms of schizophrenia. A relationship between folate level and negative symptom severity among patients with greater genetic vulnerability is biologically plausible and suggests the utility of folate supplementation in these patients.
Folate Metabolism and the Risk of Down Syndrome
Patterson, David
2008-01-01
Folate is an important vitamin that contributes to cell division and growth and is therefore of particular importance during infancy and pregnancy. Folate deficiency has been associated with slowed growth, anaemia, weight loss, digestive disorders and some behavioural issues. Adequate folate intake around the time of conception and early pregnancy…
Folate Biofortification in Hydroponically Cultivated Spinach by the Addition of Phenylalanine.
Watanabe, Sho; Ohtani, Yuta; Tatsukami, Yohei; Aoki, Wataru; Amemiya, Takashi; Sukekiyo, Yasunori; Kubokawa, Seiichi; Ueda, Mitsuyoshi
2017-06-14
Folate is an important vitamin mainly ingested from vegetables, and folate deficiency causes various health problems. Recently, several studies demonstrated folate biofortification in plants or food crops by metabolic engineering through genetic modifications. However, the production and sales of genetically modified foods are under strict regulation. Here, we developed a new approach to achieve folate biofortification in spinach (Spinacia oleracea) without genetic modification. We hydroponically cultivated spinach with the addition of three candidate compounds expected to fortify folate. As a result of liquid chromatography tandem mass spectrometry analysis, we found that the addition of phenylalanine increased the folate content up to 2.0-fold (306 μg in 100 g of fresh spinach), representing 76.5% of the recommended daily allowance for adults. By measuring the intermediates of folate biosynthesis, we revealed that phenylalanine activated folate biosynthesis in spinach by increasing the levels of pteridine and p-aminobenzoic acid. Our approach is a promising and practical approach to cultivate nutrient-enriched vegetables.
Chandrasekar, Durairaj; Sistla, Ramakrishna; Ahmad, Farhan J; Khar, Roop K; Diwan, Prakash V
2007-07-01
Folate receptor is overexpressed on the activated (but not quiescent) macrophages in both animal models and human patients with naturally occurring rheumatoid arthritis. The aim of this study was to prepare folate targeted poly(ethylene glycol) (PEG) conjugates of anionic dendrimer (G3.5 PAMAM) as targeted drug delivery systems to inflammation and to investigate its biodistribution pattern in arthritic rats. Folate-PEG-PAMAM conjugates, with different degrees of substitution were synthesized by a two-step reaction through a carbodiimide-mediated coupling reaction and loaded with indomethacin. Folate-PEG conjugation increased the drug loading efficiency by 10- to 20-fold and the in vitro release profile indicated controlled release of drug. The plasma pharmacokinetic parameters indicated an increased AUC, circulatory half-life and mean residence time for the folate-PEG conjugates. The tissue distribution studies revealed significantly lesser uptake by stomach for the folate-PEG conjugates, thereby limiting gastric-related side effect. The time-averaged relative drug exposure (r(e)) of the drug in paw for the folate-PEG conjugates ranged from 1.81 to 2.37. The overall drug targeting efficiency (T(e)) was highest for folate-PEG conjugate (3.44) when compared to native dendrimer (1.72). The folate-PEG-PAMAM conjugates are the ideal choice for targeted delivery of antiarthritic drugs to inflammation with reduced side-effects and higher targeting efficiency. Copyright 2007 Wiley Periodicals, Inc.
Impact of Maternal Folate Deficiencies on Early Neurological Development: A Narrative Review
Directory of Open Access Journals (Sweden)
Joshua T Emmerson
2016-07-01
Full Text Available Context Folates are B-vitamins that cannot be generated de novo and are therefore obtained from the diet. In the brain, these vitamins are involved in nucleotide synthesis, DNA repair, lipid metabolism, methylation and neurotransmitter synthesis. It is well established that adequate levels of maternal folates are required for closure of the neural tube within the first month of pregnancy, however, it is not clear whether maternal folates are needed throughout pregnancy for brain development and whether they influence offspring neurological function after birth. The aim of this review is to outline current literature from epidemiological and animal model studies that shows maternal supplementation of folates throughout pregnancy does indeed affect offspring neurological function after birth. Evidence Acquisition A Medline search was performed using the following mesh terms, maternal-fetal exchange, folic acid, offspring neurologic manifestations, methylenetetrahydrofolate reductase (MTHFR, embryology, and behavior. Results The studies described in the present review have reported that maternal deficiencies in folates during pregnancy result in changes in behavior as well as in blood and brain tissue in offspring, including altered methylation, including reduced levels of the global methyl donor S-adenosylmethionine (SAM, and increased levels of oxidative stress. Conclusions The data summarized here outlines the importance of adequate levels of folates throughout pregnancy to facilitate appropriate neurological development of offspring after birth.
Homocyst(e)ine metabolism in hemodialysis patients treated with vitamins B6, B12 and folate.
Henning, B F; Zidek, W; Riezler, R; Graefe, U; Tepel, M
2001-03-01
Hyperhomocyst(e)inemia is commonly accepted as an independent atherosclerotic risk factor. In most hemodialysis patients, serum homocyst(e)ine is markedly elevated and may contribute to premature atherosclerosis in these patients. Whereas the beneficial effect of folate supplementation on serum homocyst(e)ine has been extensively studied, there are less detailed studies on the effects of cobalamin and pyridoxal phosphate alone, or in combination with folate. We examined the effect of a four-week course of intravenous treatment with folate (1.1 mg), cobalamin (1.0 mg), and pyridoxal phosphate (5.0 mg), administered once (group 1), twice (group 2) or thrice (group 3) weekly in 33 hemodialysis patients divided in three groups of 11 patients. All patients were followed for a further four weeks after treatment was stopped. Serum homocyst(e)ine, cobalamin, folate and pyridoxal phosphate, as well as the metabolites of homocyst(e)ine, methylmalonate, 2-methylcitrate and cystathionine, were determined before, during and after treatment. Baseline serum homocyst(e)ine correlated significantly with serum folate (P=0.0149), cobalamin (P=0.0047) and pyridoxal phosphate (P=0.0408). Correlations independent from the other metabolites or vitamins were found for methylmalonate (P=0.003) and folate (P=0.029). All regimens increased serum cobalamin significantly (in group 1 from 444 +/- 215 to 17,303 +/- 11,989 pg/ml, Pine was lowered significantly by 39.8% +/- 31.9% (Pine levels. Increasing cobalamin levels and additional treatment with folate and pyridoxal phosphate 156 may decrease serum homocyst(e)ine in the same way as high doses of folate alone.
Hurba, Olha; Mancikova, Andrea; Krylov, Vladimir; Pavlikova, Marketa; Pavelka, Karel; Stibůrková, Blanka
2014-01-01
Using European descent Czech populations, we performed a study of SLC2A9 and SLC22A12 genes previously identified as being associated with serum uric acid concentrations and gout. This is the first study of the impact of non-synonymous allelic variants on the function of GLUT9 except for patients suffering from renal hypouricemia type 2. The cohort consisted of 250 individuals (150 controls, 54 nonspecific hyperuricemics and 46 primary gout and/or hyperuricemia subjects). We analyzed 13 exons of SLC2A9 (GLUT9 variant 1 and GLUT9 variant 2) and 10 exons of SLC22A12 by PCR amplification and sequenced directly. Allelic variants were prepared and their urate uptake and subcellular localization were studied by Xenopus oocytes expression system. The functional studies were analyzed using the non-parametric Wilcoxon and Kruskall-Wallis tests; the association study used the Fisher exact test and linear regression approach. We identified a total of 52 sequence variants (12 unpublished). Eight non-synonymous allelic variants were found only in SLC2A9: rs6820230, rs2276961, rs144196049, rs112404957, rs73225891, rs16890979, rs3733591 and rs2280205. None of these variants showed any significant difference in the expression of GLUT9 and in urate transport. In the association study, eight variants showed a possible association with hyperuricemia. However, seven of these were in introns and the one exon located variant, rs7932775, did not show a statistically significant association with serum uric acid concentration. Our results did not confirm any effect of SLC22A12 and SLC2A9 variants on serum uric acid concentration. Our complex approach using association analysis together with functional and immunohistochemical characterization of non-synonymous allelic variants did not show any influence on expression, subcellular localization and urate uptake of GLUT9.
Physics at the SLC [SLAC Linear Collider
International Nuclear Information System (INIS)
Swartz, M.L.
1990-11-01
The SLAC Linear Collider (SLC) was constructed in the years 1983--1987 for two principal reasons: to develop the accelerator physics and technology that are necessary for the construction of future linear electron-positron colliders; and to produce electron-positron collisions at the Z 0 pole and to study the physics of the weak neutral current. To date, the SLC program has been quite successful at achieving the first goal. The machine has produced and collided high energy electron and positron beams of three-micron transverse size. The problems of operating an open geometry detector in an environment that is more akin to those found in fixed-target experiments than in storage rings have largely been solved. As a physics producing venture, the SLC has been less successful than was originally hoped but more successful than is commonly believed. Some of the results that have been produced by the Mark II experiment with a very modest data sample are competitive with those that have been produced with much larger samples by the four LEP collaborations. At the current, time, SLAC is engaged in an ambitious program to upgrade the SLC luminosity and to exploit one of its unique features, a spin polarized electron beam. These lectures are therefore organized into three sections: a brief description of the SLC; a review of the physics results that have been achieved with the Mark II detector; a description of the SLC's future: the realization and use of a polarized electron beam
Phan, Quoc Thong; Le, Mai Huong; Le, Thi Thu Huong; Tran, Thi Hong Ha; Xuan, Phuc Nguyen; Ha, Phuong Thu
2016-06-30
Targeting delivery system use natural drugs for tumor cells is an appealing platform help to reduce the side effects and enhance the therapeutic effects of the drug. In this study, we synthesized curcumin (Cur) loaded (D, L Poly lactic - Poly ethylenglycol) micelle (Cur/PLA-PEG) with the ratio of PLA/PEG of 3:1 2:1 1:1 1:2 and 1:3 (w/w) and another micelle modified by folate (Cur/PLA-PEG-Fol) for targeting cancer therapy. The PLA-PEG copolymer was synthesized by ring opening polymerization method. After loading onto the micelle, solubility of Cur increased from 0.38 to 0.73mgml(-1). The average size of prepared Cur/PLA-PEG micelles was from 60 to 69nm (corresponding to the ratio difference of PLA/PEG) and the drug encapsulating efficiency was from 48.8 to 91.3%. Compared with the Cur/PLA-PEG micelles, the size of Cur/PLA-PEG-Fol micelles were from 80 to 86nm and showed better in vitro cellular uptake and cytotoxicity towards HepG2 cells. The cytotoxicity of the NPs however depends much on the PEG component. The results demonstrated that Folate-modified micelles could serve as a potential nano carrier to improve solubility, anti-cancer activity of Cur and targeting ability of the system. Copyright © 2016 Elsevier B.V. All rights reserved.
Polarized source performance in 1992 for SLC--SLD
International Nuclear Information System (INIS)
Schultz, D.; Alley, R.; Clendenin, J.; Frisch, J.; Garden, C.; Hoyt, E.; Klaisner, L.; Kulikov, A.; Prescott, C.; Saez, P.; Tang, H.; Turner, J.; Wicks, M.; Woods, M.; Yeremian, D.; Zolotorev, M.
1993-02-01
In its initial operation, the SLC Polarized Electron Source successfully met the SLC goals for 1992 for intensity and efficiency. However, the stability of the beam at the source was marginal, and the polarization was only ∼28%. The SLC goal to provide > 10,000 Z events for the SLD from polarized electrons was met
Kirsch, Susanne H; Herrmann, Wolfgang; Kruse, Vera; Eckert, Rudolf; Gräber, Stefan; Geisel, Jürgen; Obeid, Rima
2015-02-01
We aimed to study the effect of long-term supplementation of B-vitamins on folate forms in serum and whole blood (WB) in elderly German subjects. 59 participants (mean age 67 years) were randomized to daily receive either vitamin D3 (1200 IU), folic acid (500 μg), vitamin B12 (500 μg), vitamin B6 (50 mg), and calcium carbonate (456 mg) or vitamin D3 plus calcium carbonate. Serum and WB folate forms were measured before and after 6 and 12 months. B-vitamins supplementation for 6 months led to higher concentrations of 5-methyltetrahydrofolate (5-methylTHF) in serum (mean 49.1 vs. 19.6 nmol/L) and WB (1332 vs. 616 nmol/L). Also non-methyl-folate concentrations in serum and WB were higher after 6 months with B-vitamins supplementation. Unmetabolized folic acid (UFA) increased after supplementation. tHcy concentration was lowered after 1 year of B-vitamin supplementation (mean 13.1 vs. 9.6 μmol/L). A stronger reduction of tHcy after 1 year was found in participants who had baseline level >12.5 μmol/L (mean 17.0 vs. 11.9 μmol/L) compared to those with baseline tHcy lower than this limit (mean 9.1 vs. 7.4 μmol/L). In contrast, the increases in serum and WB 5-methylTHF were comparable between the two groups. One year B-vitamins supplementation increased the levels of 5-methylTHF and non-methyl-folate in serum and WB, normalized tHcy, but caused an increase in the number of cases with detectable UFA in serum. Lowering of tHcy was predicted by baseline tHcy, but not by baseline serum or WB 5-methylTHF.
Kicker thyratron experience from SLC
International Nuclear Information System (INIS)
Donaldson, A.R.; Cassel, R.L.; Mattison, T.S.; Reginato, L.L.
1991-05-01
The SLAC Linear Collider has five fast kickers for the damping ring injectors, extractors, and the electron extractor for the positron target that use multi-gap Deuterium-filled thyratrons. The thyratrons operate with 30 to 70 kV anode voltages and 1 to 5 kA currents, to deliver pulses to kicker magnets with ∼ 30 ns rise times, up to ∼ 150 ns pulse widths, at 120 Hz. Operating and lifetime experience with several types of thyratrons and support electronics are discussed. Floating driver and power supply electronics were replaced by a ferrite choke isolator to allow grounding of the cathode support electronics with a commensurate increase in operating reliability. The construction of a 100 ns Blumlein enabled detailed measurements of the switching times for all SLC thyratrons under similar conditions. In the final focus area, the kickers dump the SLC beams after the e + e - collisions. These thyratrons function with 15 kV anode voltages and up to 2 kA currents to produce 1/2 sine pulses with ∼ 300 ns rise times, ∼ 550 ns FWHM, at 120 Hz. Operating experience with these thyratrons will also be presented. 7 refs., 1 fig., 3 tabs
Hefni, Mohammed E; Shalaby, Mohamed T; Witthöft, Cornelia M
2015-01-01
Faba beans are an important source of folate and commonly consumed in Egypt. This study examined the effects of Egyptian industrial food processing (e.g., canning and freezing), germination, cultivar, and maturity stages on folate content, with the aim to develop a candidate functional canned faba bean food with increased folate content. The folate content in four cultivars of green faba beans ranged from 110 to 130 μg 100 g−1 fresh weight (535–620 μg 100 g−1 dry matter [DM]), which was four- to sixfold higher than in dried seeds. Industrial canning of dried seeds resulted in significant folate losses of ∼20% (P = 0.004), while industrial freezing had no effect. Germination of faba beans increased the folate content by >40% (P beans resulted in a net folate content of 194 μg 100 g−1 DM, which is 52% more than in conventional canned beans. The consumption of green faba beans should be recommended, providing ∼120 μg dietary folate equivalents per 100 g/portion. PMID:25650294
SLC26A4 Variations Among Graves’ Hyper-Functioning Thyroid Gland
Directory of Open Access Journals (Sweden)
Hassen Hadj-Kacem
2010-01-01
Full Text Available Deleterious mutations of SLC26A4 cause Pendred syndrome (PS, an autosomal recessive disorder comprising goitre and deafness with enlarged vestibular aqueducts (EVA, and nonsyndromic hearing loss (NSHL. However, the SLC26A4 hyperactivity was recently associated with the emergence of autoimmune thyroid diseases (AITD and asthma among human and mouse model. Here, by direct sequencing, we investigate the sequences of the 20 coding exons (2 to 21 of SLC26A4 and their flanking intron-exon junctions among patients affected with Graves' disease (GD hyperthyroidism. Ten mono-allelic variants were identified, seven of which are intronic and previously unreported. Two, c.898A>C (p.I300L and c.1061T>C (p.F354S, of the three exonic variants are non synonymous. The p.F354S variant is already described to be involved in PS or NSHL inheritances. The exploration by PCR-RFLP of p.I300L and p.F354S variants among 132 GD patients, 105 Hashimoto thyroiditis (HT, 206 Healthy subjects and 102 families with NSHL have shown the presence of both variants. The p.F354S variation was identified both among patients (1~HT and 3 GD and healthy subjects (n=5. Whereas, the p.I300L variant was identified only in GD patients (n=3. Our studies provide evidence of the importance of systematic analysis of SLC26A4 gene sequences on models other than deafness. This approach allows the identification of new variants and the review of the pathogenic effects of certain mono-allelic variants reported responsible for PS and NSHL development.
International Nuclear Information System (INIS)
Tsang, Verne; Fry, Rebecca C.; Niculescu, Mihai D.; Rager, Julia E.; Saunders, Jesse; Paul, David S.; Zeisel, Steven H.; Waalkes, Michael P.; Stýblo, Miroslav; Drobná, Zuzana
2012-01-01
Inorganic arsenic (iAs) is a complete transplacental carcinogen in mice. Previous studies have demonstrated that in utero exposure to iAs promotes cancer in adult mouse offspring, possibly acting through epigenetic mechanisms. Humans and rodents enzymatically convert iAs to its methylated metabolites. This reaction requires S-adenosylmethionine (SAM) as methyl group donor. SAM is also required for DNA methylation. Supplementation with folate, a major dietary source of methyl groups for SAM synthesis, has been shown to modify iAs metabolism and the adverse effects of iAs exposure. However, effects of gestational folate supplementation on iAs metabolism and fetal DNA methylation have never been thoroughly examined. In the present study, pregnant CD1 mice were fed control (i.e. normal folate, or 2.2 mg/kg) or high folate diet (11 mg/kg) from gestational day (GD) 5 to 18 and drank water with 0 or 85 ppm of As (as arsenite) from GD8 to 18. The exposure to iAs significantly decreased body weight of GD18 fetuses and increased both SAM and S-adenosylhomocysteine (SAH) concentrations in fetal livers. High folate intake lowered the burden of total arsenic in maternal livers but did not prevent the effects of iAs exposure on fetal weight or hepatic SAM and SAH concentrations. In fact, combined folate-iAs exposure caused further significant body weight reduction. Notably, iAs exposure alone had little effect on DNA methylation in fetal livers. In contrast, the combined folate-iAs exposure changed the CpG island methylation in 2,931 genes, including genes known to be imprinted. Most of these genes were associated with neurodevelopment, cancer, cell cycle, and signaling networks. The canonical Wnt-signaling pathway, which regulates fetal development, was among the most affected biological pathways. Taken together, our results suggest that a combined in utero exposure to iAs and a high folate intake may adversely influence DNA methylation profiles and weight of fetuses
Energy Technology Data Exchange (ETDEWEB)
Tsang, Verne [Department of Nutrition, University of North Carolina at Chapel Hill, Chapel Hill, NC 27599 (United States); Fry, Rebecca C. [Department of Environmental Sciences and Engineering, University of North Carolina at Chapel Hill, Chapel Hill, NC 27599 (United States); Niculescu, Mihai D. [UNC Nutrition Research Institute, Department of Nutrition, University of North Carolina at Chapel Hill, Chapel Hill, NC 27599 (United States); Rager, Julia E. [Department of Environmental Sciences and Engineering, University of North Carolina at Chapel Hill, Chapel Hill, NC 27599 (United States); Saunders, Jesse; Paul, David S. [Department of Nutrition, University of North Carolina at Chapel Hill, Chapel Hill, NC 27599 (United States); Zeisel, Steven H. [Department of Nutrition, University of North Carolina at Chapel Hill, Chapel Hill, NC 27599 (United States); UNC Nutrition Research Institute, Department of Nutrition, University of North Carolina at Chapel Hill, Chapel Hill, NC 27599 (United States); Waalkes, Michael P. [NIEHS, Research Triangle Park, NC 27709 (United States); Stýblo, Miroslav [Department of Nutrition, University of North Carolina at Chapel Hill, Chapel Hill, NC 27599 (United States); Drobná, Zuzana, E-mail: drobnazu@med.unc.edu [Department of Nutrition, University of North Carolina at Chapel Hill, Chapel Hill, NC 27599 (United States)
2012-11-01
Inorganic arsenic (iAs) is a complete transplacental carcinogen in mice. Previous studies have demonstrated that in utero exposure to iAs promotes cancer in adult mouse offspring, possibly acting through epigenetic mechanisms. Humans and rodents enzymatically convert iAs to its methylated metabolites. This reaction requires S-adenosylmethionine (SAM) as methyl group donor. SAM is also required for DNA methylation. Supplementation with folate, a major dietary source of methyl groups for SAM synthesis, has been shown to modify iAs metabolism and the adverse effects of iAs exposure. However, effects of gestational folate supplementation on iAs metabolism and fetal DNA methylation have never been thoroughly examined. In the present study, pregnant CD1 mice were fed control (i.e. normal folate, or 2.2 mg/kg) or high folate diet (11 mg/kg) from gestational day (GD) 5 to 18 and drank water with 0 or 85 ppm of As (as arsenite) from GD8 to 18. The exposure to iAs significantly decreased body weight of GD18 fetuses and increased both SAM and S-adenosylhomocysteine (SAH) concentrations in fetal livers. High folate intake lowered the burden of total arsenic in maternal livers but did not prevent the effects of iAs exposure on fetal weight or hepatic SAM and SAH concentrations. In fact, combined folate-iAs exposure caused further significant body weight reduction. Notably, iAs exposure alone had little effect on DNA methylation in fetal livers. In contrast, the combined folate-iAs exposure changed the CpG island methylation in 2,931 genes, including genes known to be imprinted. Most of these genes were associated with neurodevelopment, cancer, cell cycle, and signaling networks. The canonical Wnt-signaling pathway, which regulates fetal development, was among the most affected biological pathways. Taken together, our results suggest that a combined in utero exposure to iAs and a high folate intake may adversely influence DNA methylation profiles and weight of fetuses
Directory of Open Access Journals (Sweden)
Sofie V Hellsten
Full Text Available SLC38A9 is characterized as a lysosomal component of the amino acid sensing Ragulator-RAG GTPase complex, controlling the mechanistic target of rapamycin complex 1 (mTORC1. Here, immunohistochemistry was used to map SLC38A9 in mouse brain and staining was detected throughout the brain, in cortex, hypothalamus, thalamus, hippocampus, brainstem and cerebellum. More specifically, immunostaining was found in areas known to be involved in amino acid sensing and signaling pathways e.g. piriform cortex and hypothalamus. SLC38A9 immunoreactivity co-localized with both GABAergic and glutamatergic neurons, but not with astrocytes. SLC38A9 play a key role in the mTORC1 pathway, and therefore we performed in vivo starvation and high-fat diet studies, to measure gene expression alterations in specific brain tissues and in larger brain regions. Following starvation, Slc38a9 was upregulated in brainstem and cortex, and in anterior parts of the brain (Bregma 3.2 to -2.1mm. After high-fat diet, Slc38a9 was specifically upregulated in hypothalamus, while overall downregulation was noticed throughout the brain (Bregma 3.2 to -8.6mm.
A single base deletion in the SLC45A2 gene in a Bullmastiff with oculocutaneous albinism.
Caduff, M; Bauer, A; Jagannathan, V; Leeb, T
2017-10-01
Oculocutaneous albinism type 4 (OCA4) in humans and similar phenotypes in many animal species are caused by variants in the SLC45A2 gene, encoding a putative sugar transporter. In dog, two independent SLC45A2 variants are known that cause oculocutaneous albinism in Doberman Pinschers and several small dog breeds respectively. For the present study, we investigated a Bullmastiff with oculocutaneous albinism. The affected dog was highly inbred and resulted from the mating of a sire to its own grandmother. We obtained whole genome sequence data from the affected dog and searched specifically for variants in candidate genes known to cause albinism. We detected a single base deletion in exon 6 of the SLC45A2 gene (NM_001037947.1:c.1287delC) that has not been reported thus far. This deletion is predicted to result in an early premature stop codon. It was confirmed by Sanger sequencing and perfectly co-segregated with the phenotype in the available family members. We genotyped 174 unrelated dogs from diverse breeds, all of which were homozygous wildtype. We therefore suggest that SLC45A2:c.1287delC causes the observed oculocutaneous albinism in the affected Bullmastiff. © 2017 Stichting International Foundation for Animal Genetics.
The Folate-Vitamin B12 Interaction, Low Hemoglobin, and the Mortality Risk from Alzheimer's Disease.
Min, Jin-Young; Min, Kyoung-Bok
2016-03-21
Abnormal hemoglobin levels are a risk factor for Alzheimer's disease (AD). Although the mechanism underlying these associations is elusive, inadequate micronutrients, particularly folate and vitamin B12, may increase the risk for anemia, cognitive impairment, and AD. In this study, we investigated whether the nutritional status of folate and vitamin B12 is involved in the association between low hemoglobin levels and the risk of AD mortality. Data were obtained from the 1999-2006 National Health and Nutrition Examination Survey (NHANES) and the NHANES (1999-2006) Linked Mortality File. A total of 4,688 participants aged ≥60 years with available baseline data were included in this study. We categorized three groups based on the quartiles of folate and vitamin B12 as follows: Group I (low folate and vitamin B12); Group II (high folate and low vitamin B12 or low folate and high vitamin B12); and Group III (high folate and vitamin B12). Of 4,688 participants, 49 subjects died due to AD. After adjusting for age, sex, ethnicity, education, smoking history, body mass index, the presence of diabetes or hypertension, and dietary intake of iron, significant increases in the AD mortality were observed in Quartile1 for hemoglobin (HR: 8.4, 95% CI: 1.4-50.8), and the overall risk of AD mortality was significantly reduced with increases in the quartile of hemoglobin (p for trend = 0.0200), in subjects with low levels of both folate and vitamin B12 at baseline. This association did not exist in subjects with at least one high level of folate and vitamin B12. Our finding shows the relationship between folate and vitamin B12 levels with respect to the association between hemoglobin levels and AD mortality.
Directory of Open Access Journals (Sweden)
Suguna Badiga
Full Text Available Studies in populations unexposed to folic acid (FA fortification have demonstrated that MTHFR C677T polymorphism is associated with increased risk of higher grades of cervical intraepithelial neoplasia (CIN 2+. However, it is unknown whether exposure to higher folate as a result of the FA fortification program has altered the association between MTHFR C677T and risk of CIN, or the mechanisms involved with such alterations. The current study investigated the following in a FA fortified population: 1 The association between MTHFR C677T polymorphism and risk of CIN 2+; 2 The modifying effects of plasma folate concentrations on this association; and 3 The modifying effects of plasma folate on the association between the polymorphism and degree of methylation of long interspersed nucleotide elements (L1s, in peripheral blood mononuclear cell (PBMC DNA, a documented biomarker of CIN risk.The study included 457 US women diagnosed with either CIN 2+ (cases or ≤ CIN 1 (non-cases. Unconditional logistic regression models were used to test the associations after adjusting for relevant risk factors for CIN.The 677CT/TT MTHFR genotypes were not associated with the risk of CIN 2+. Women with CT/TT genotype with lower folate, however, were more likely to be diagnosed with CIN 2+ compared to women with CT/TT genotype with higher folate (OR = 2.41, P = 0.030. Women with CT/TT genotype with lower folate were less likely to have a higher degree of PBMC L1 methylation compared to women with CT/TT genotype with higher folate (OR = 0.28, P = 0.017.This study provides the first evidence that the MTHFR 677CT/TT genotype-associated lower degree of PBMC L1 methylation increases the risk of CIN 2+ in women in the US post-FA fortification era. Thus, even in the post-FA fortification era, not all women have adequate folate status to overcome MTHFR 677CT/TT genotype-associated lower degree of L1 methylation.
Directory of Open Access Journals (Sweden)
Veerachat Muangsombut
2017-08-01
Full Text Available Bacterial survival in macrophages can be affected by the natural resistance-associated macrophage protein 1 (Nramp1; also known as solute carrier family 11 member a1 or Slc11a1 which localizes to phagosome membranes and transports divalent cations, including iron. Little is known about the role of Nramp1 in Burkholderia infection, in particular whether this differs for pathogenic species like Burkholderia pseudomallei causing melioidosis or non-pathogenic species like Burkholderia thailandensis. Here we show that transfected macrophages stably expressing wild-type Nramp1 (Nramp1+ control the net replication of B. thailandensis, but not B. pseudomallei. Control of B. thailandensis was associated with increased cytokine responses, and could be abrogated by blocking NADPH oxidase-mediated production of reactive oxygen species but not by blocking generation of reactive nitrogen species. The inability of Nramp1+ macrophages to control B. pseudomallei was associated with rapid escape of bacteria from phagosomes, as indicated by decreased co-localization with LAMP1 compared to B. thailandensis. A B. pseudomallei bipB mutant impaired in escape from phagosomes was controlled to a greater extent than the parent strain in Nramp1+ macrophages, but was also attenuated in Nramp1− cells. Consistent with reduced escape from phagosomes, B. thailandensis formed fewer multinucleated giant cells in Nramp1+ macrophages at later time points compared to B. pseudomallei. B. pseudomallei exhibited elevated transcription of virulence-associated genes of Type VI Secretion System cluster 1 (T6SS-1, the Bsa Type III Secretion System (T3SS-3 and the bimA gene required for actin-based motility in Nramp1+ macrophages. Nramp1+ macrophages were found to contain decreased iron levels that may impact on expression of such genes. Our data show that B. pseudomallei is able to evade Nramp1- and NADPH oxidase-mediated killing in macrophages and that expression of virulence
Justifying the "Folate trap" in folic acid fortification programs.
Mahajan, Niraj N; Mahajan, Kshitija N; Soni, Rajani N; Gaikwad, Nilima L
2007-01-01
Many countries have now adopted fortification, where folic acid is added to flour and intended to benefit all with rise in blood folate level. During many transformations of folate from one form to another, a proportion is accidentally converted to N(5)-methyl-THF, an inactive metabolite, the so-called "folate trap". Consideration should be given to including B(12) as well as folic acid in any program of supplementation or food fortification to prevent NTDs. This is especially applicable to developing countries like India where the majority of women are vegetarians and have borderline levels of vitamin B(12). Administration of [6S]-5-MTHF is more effective than is folic acid supplementation at improving folate status. Therefore, we urge to reconsider the "folate trap" in folic acid fortification programs.
SLC4A11 Prevents Osmotic Imbalance Leading to Corneal Endothelial Dystrophy, Deafness, and Polyuria*
Gröger, Nicole; Fröhlich, Henning; Maier, Hannes; Olbrich, Andrea; Kostin, Sawa; Braun, Thomas; Boettger, Thomas
2010-01-01
Maintenance of ion concentration gradients is essential for the function of many organs, including the kidney, the cornea, and the inner ear. Ion concentrations and fluid content in the cornea are regulated by endothelial cells that separate the collagenous avascular corneal stroma from the anterior eye chamber. Failure to maintain correct ion concentrations leads to swelling and destruction of the cornea. In the inner ear, the stria vascularis is responsible for generating proper ion concentrations in the endolymph, which is essential for hearing. Mutations of SLC4A11 in humans lead to syndromes associated with corneal dystrophy and perceptive deafness. The molecular mechanisms underlying these symptoms are poorly understood, impeding therapeutic interventions. The ion transporter SLC4A11 mediates sodium-dependent transport of borate as well as flux of sodium and hydroxyl ions in vitro. Here, we show that SLC4A11 is expressed in the endothelial cells of the cornea where it prevents severe morphological changes of the cornea caused by increased sodium chloride concentrations in the stroma. In the inner ear, SLC4A11 is located in fibrocytes underlying the stria vascularis. Loss of SLC4A11 leads to morphological changes in the fibrocytes and deafness. We demonstrate that SLC4A11 is essential for the generation of the endocochlear potential but not for regulation of potassium concentrations in the endolymph. In the kidney, SLC4A11 is expressed in the thin descending limb of Henle loop. SLC4A11 is essential for urinary concentration, suggesting that SLC4A11 participates in the countercurrent multiplication that concentrates urine in the kidney medulla. PMID:20185830
Disruption of the folate pathway in zebrafish causes developmental defects
Directory of Open Access Journals (Sweden)
Lee Marina S
2012-04-01
Full Text Available Abstract Background Folic acid supplementation reduces the risk of neural tube defects and congenital heart defects. The biological mechanisms through which folate prevents birth defects are not well understood. We explore the use of zebrafish as a model system to investigate the role of folate metabolism during development. Results We first identified zebrafish orthologs of 12 human folate metabolic genes. RT-PCR and in situ analysis indicated maternal transcripts supply the embryo with mRNA so that the embryo has an intact folate pathway. To perturb folate metabolism we exposed zebrafish embryos to methotrexate (MTX, a potent inhibitor of dihydrofolate reductase (Dhfr an essential enzyme in the folate metabolic pathway. Embryos exposed to high doses of MTX exhibited developmental arrest prior to early segmentation. Lower doses of MTX resulted in embryos with a shortened anterior-posterior axis and cardiac defects: linear heart tubes or incomplete cardiac looping. Inhibition of dhfr mRNA with antisense morpholino oligonucleotides resulted in embryonic lethality. One function of the folate pathway is to provide essential one-carbon units for dTMP synthesis, a rate-limiting step of DNA synthesis. After 24 hours of exposure to high levels of MTX, mutant embryos continue to incorporate the thymidine analog BrdU. However, additional experiments indicate that these embryos have fewer mitotic cells, as assayed with phospho-histone H3 antibodies, and that treated embryos have perturbed cell cycles. Conclusions Our studies demonstrate that human and zebrafish utilize similar one-carbon pathways. Our data indicate that folate metabolism is essential for early zebrafish development. Zebrafish studies of the folate pathway and its deficiencies could provide insight into the underlying etiology of human birth defects and the natural role of folate in development.
Directory of Open Access Journals (Sweden)
Fabian R. Reimold
2015-06-01
Full Text Available Congenital chloride diarrhea is an autosomal recessive disease caused by mutations in the intestinal lumenal membrane Cl-/HCO3- exchanger, SLC26A3.We report here the novel SLC26A3 mutation G393W in a Mexican child, the first such report in a patient from Central America. SLC26A3 G393W expression in Xenopus oocytes exhibits a mild hypomorphic phenotype, with normal surface expression and moderately reduced anion transport function. However, expression of HA-SLC26A3 in HEK-293 cells reveals intracellular retention and greatly decreased steady-state levels of the mutant polypeptide, in contrast to peripheral membrane expression of the wildtype protein. Whereas wildtype HA-SLC26A3 is apically localized in polarized monolayers of filter-grown MDCK cells and Caco2 cells, mutant HA-SLC26A3 G393W exhibits decreased total polypeptide abundance, with reduced or absent surface expression and sparse punctate (or absent intracellular distribution. The WT protein is similarly localized in LLCPK1 cells, but the mutant fails to accumulate to detectable levels. We conclude that the chloride-losing diarrhea phenotype associated with homozygous expression of SLC26A3 G393W likely reflects lack of apical surface expression in enterocytes, secondary to combined abnormalities in polypeptide trafficking and stability. Future progress in development of general or target-specific folding chaperonins and correctors may hold promise for pharmacological rescue of this and similar genetic defects in membrane protein targeting.
Inhibitors of GLUT/SLC2A Enhance the Action of BCNU and Temozolomide against High-Grade Gliomas
Directory of Open Access Journals (Sweden)
Alberto Azzalin
2017-04-01
Full Text Available Glucose transport across glioblastoma membranes plays a crucial role in maintaining the enhanced glycolysis typical of high-grade gliomas and glioblastoma. We tested the ability of two inhibitors of the glucose transporters GLUT/SLC2A superfamily, indinavir (IDV and ritonavir (RTV, and of one inhibitor of the Na/glucose antiporter type 2 (SGLT2/SLC5A2 superfamily, phlorizin (PHZ, in decreasing glucose consumption and cell proliferation of human and murine glioblastoma cells. We found in vitro that RTV, active on at least three different GLUT/SLC2A transporters, was more effective than IDV, a specific inhibitor of GLUT4/SLC2A4, both in decreasing glucose consumption and lactate production and in inhibiting growth of U87MG and Hu197 human glioblastoma cell lines and primary cultures of human glioblastoma. PHZ was inactive on the same cells. Similar results were obtained when cells were grown in adherence or as 3D multicellular tumor spheroids. RTV treatment but not IDV treatment induced AMP-activated protein kinase (AMPKα phosphorylation that paralleled the decrease in glycolytic activity and cell growth. IDV, but not RTV, induced an increase in GLUT1/SLC2A1 whose activity could compensate for the inhibition of GLUT4/SLC2A4 by IDV. RTV and IDV pass poorly the blood brain barrier and are unlikely to reach sufficient liquoral concentrations in vivo to inhibit glioblastoma growth as single agents. Isobologram analysis of the association of RTV or IDV and 1,3-bis(2-chloroethyl-1-nitrosourea (BCNU or 4-methyl-5-oxo-2,3,4,6,8-pentazabicyclo[4.3.0]nona-2,7,9-triene-9-carboxamide (TMZ indicated synergy only with RTV on inhibition of glioblastoma cells. Finally, we tested in vivo the combination of RTV and BCNU on established GL261 tumors. This drug combination increased the overall survival and allowed a five-fold reduction in the dose of BCNU.
Disruption of Slc52a3 gene causes neonatal lethality with riboflavin deficiency in mice
Yoshimatsu, Hiroki; Yonezawa, Atsushi; Yamanishi, Kaori; Yao, Yoshiaki; Sugano, Kumiko; Nakagawa, Shunsaku; Imai, Satoshi; Omura, Tomohiro; Nakagawa, Takayuki; Yano, Ikuko; Masuda, Satohiro; Inui, Ken-ichi; Matsubara, Kazuo
2016-01-01
Homeostasis of riboflavin should be maintained by transporters. Previous in vitro studies have elucidated basic information about riboflavin transporter RFVT3 encoded by SLC52A3 gene. However, the contribution of RFVT3 to the maintenance of riboflavin homeostasis and the significance in vivo remain unclear. Here, we investigated the physiological role of RFVT3 using Slc52a3 knockout (Slc52a3−/−) mice. Most Slc52a3−/− mice died with hyperlipidemia and hypoglycemia within 48 hr after birth. The...
Huang, Shasha; Han, Dongyi; Yuan, Yongyi; Wang, Guojian; Kang, Dongyang; Zhang, Xin; Yan, Xiaofei; Meng, Xiaoxiao; Dong, Min; Dai, Pu
2011-09-30
Mutations in SLC26A4 cause Pendred syndrome (hearing loss with goiter) or DFNB4 (non-syndromic hearing loss with inner ear malformation, such as enlarged vestibular aqueduct or Mondini deformity). The relationship between mutations in SLC26A4 and Mondini deformity without enlarged vestibular aqueduct has not been studied in any Chinese deaf population. The purpose of this study was to assess whether mutations in the SLC26A4 gene cause Mondini deformity without an enlarged vestibular aqueduct (isolated Mondini deformity) in a Chinese population. In total, 144 patients with sensorineural hearing loss were included and subjected to high-resolution temporal bone CT. Among them, 28 patients with isolated Mondini dysplasia (MD group), 50 patients with enlarged vestibular aqueduct with Mondini dysplasia (EVA with MD group), 50 patients with enlarged vestibular aqueduct without Mondini dysplasia (EVA group), and 16 patients with other types of inner ear malformations (IEM group) were identified. The coding exons of SLC26A4 were analyzed in all subjects. DNA sequence analysis of SLC26A4 was performed in all 144 patients. In the different groups, the detection rate of the SLC26A4 mutation differed. In the isolated MD group, only one single allelic mutation in SLC26A4 was found in one patient (1/28, 3.6%). In the EVA with MD group, biallelic and monoallelic SLC26A4 mutations were identified in 46 patients (46/50, 92.0%) and three patients (3/50, 6.0%), respectively. Also, in the EVA group, biallelic and monoallelic SLC26A4 mutations were identified in 46 patients (46/50, 92.0%) and three patients (3/50, 6.0%), respectively. These percentages were identical to those in the EVA plus MD group. Only two patients carried monoallelic mutations of the SLC26A4 gene in the IEM group (2/16, 12.5%). There were significant differences in the frequency of SLC26A4 mutation among the groups (P0.5). Although mutations in the SLC26A4 gene were frequently found in Chinese EVA patients with and
Interaction of nitrate and folate on the risk of breast cancer among postmenopausal women.
Inoue-Choi, Maki; Ward, Mary H; Cerhan, James R; Weyer, Peter J; Anderson, Kristin E; Robien, Kim
2012-01-01
Ingested nitrate can be endogenously reduced to nitrite, which may form N-nitroso compounds, known potent carcinogens. However, some studies have reported no or inverse associations between dietary nitrate intake and cancer risk. These associations may be confounded by a protective effect of folate, which plays a vital role in DNA repair. We evaluated the interaction of dietary and water nitrate intake with total folate intake on breast cancer risk in the Iowa Women's Health Study. Dietary intake was assessed at study baseline. Nitrate intake from public water was assessed using a historical database on Iowa municipal water supplies. After baseline exclusions, 34,388 postmenopausal women and 2,875 incident breast cancers were included. Overall, neither dietary nor water nitrate was associated with breast cancer risk. Among those with folate intake ≥400 μg/day, breast cancer risk was significantly increased in public water users with the highest nitrate quintile (HR = 1.40, 95% CI = 1.05-1.87) and private well users (HR = 1.38, 95% CI = 1.05-1.82) compared to public water users with the lowest nitrate quintile; in contrast, there was no association among those with lower folate intake. Our findings do not support a previous report of increased risk of breast cancer among individuals with high dietary nitrate but low folate intake.
Hartman, Brenda A.; Fazili, Zia; Pfeiffer, Christine M.; O’Connor, Deborah L.
2014-01-01
It is not known whether folate metabolism is altered during pregnancy to support increased DNA and RNA biosynthesis. By using a state-of-the-art LC tandem mass spectrometry technique, the aim of this study was to investigate differences in RBC folate forms between pregnant and nonpregnant women and between nonpregnant women consuming different concentrations of supplemental folic acid. Forms of folate in RBCs were used to explore potential shifts in folate metabolism during early erythropoies...
Genotoxicity testing of peptides: Folate deprivation as a marker of exaggerated pharmacology
International Nuclear Information System (INIS)
Guérard, Melanie; Zeller, Andreas; Festag, Matthias; Schubert, Christine; Singer, Thomas; Müller, Lutz
2014-01-01
The incidence of micronucleated-cells is considered to be a marker of a genotoxic event and can be caused by direct- or indirect-DNA reactive mechanisms. In particular, small increases in the incidence of micronuclei, which are not associated with toxicity in the target tissue or any structurally altering properties of the compound, trigger the suspicion that an indirect mechanism could be at play. In a bone marrow micronucleus test of a synthetic peptide (a dual agonist of the GLP-1 and GIP receptors) that had been integrated into a regulatory 13-week repeat-dose toxicity study in the rat, small increases in the incidence of micronuclei had been observed, together with pronounced reductions in food intake and body weight gain. Because it is well established that folate plays a crucial role in maintaining genomic integrity and pronounced reductions in food intake and body weight gain were observed, folate levels were determined from plasma samples initially collected for toxicokinetic analytics. A dose-dependent decrease in plasma folate levels was evident after 4 weeks of treatment at the mid and high dose levels, persisted until the end of the treatment duration of 13-weeks and returned to baseline levels during the recovery period of 4 weeks. Based on these properties, and the fact that the compound tested (peptide) per se is not expected to reach the nucleus and cause DNA damage, the rationale is supported that the elevated incidence of micronucleated polychromatic erythrocytes is directly linked to the exaggerated pharmacology of the compound resulting in a decreased folate level. - Highlights: • A synthetic peptide has been evaluated for potential genotoxicity • Small increases in an integrated (13-weeks) micronucleus test were observed • Further, animals had a pronounced reductions in food intake and body weight gain • A dose-dependent decrease in plasma folate levels was evident from week 4 onwards • Elevated micronuclei-incidence due to the
Detergent activation of the binding protein in the folate radioassay
International Nuclear Information System (INIS)
Hansen, S.I.; Holm, J.; Lyngbye, J.
1982-01-01
A minor cow's whey protein associated with β-lactoglobulin is used as binding protein in the competitive radioassay for serum and erythrocyte folate. Seeking to optimize the assay, we tested the performance of binder solutions of increasing purity. The folate binding protein was isolated from cow's whey by means of CM-Sepharose CL-6B cation-exchange chromatography, and further purified on a methotrexate-AH-Sepharose 4B affinity matrix. In contrast to β-lactoglobulin, the purified protein did not bind folate unless the detergents cetyltrimethylammonium (10 mmol/Ll) or Triton X-100 (1 g/L) were present. Such detergent activation was not needed in the presence of serum. There seems to be a striking analogy between these phenomena and the well-known reactivation of certain purified membrane-derived enzymes by surfactants
Optimization of the trienzyme extraction for the microbiological assay of folate in vegetables.
Chen, Liwen; Eitenmiller, Ronald R
2007-05-16
Response surface methodology was applied to optimize the trienzyme digestion for the extraction of folate from vegetables. Trienzyme extraction is a combined enzymatic digestion by protease, alpha-amylase, and conjugase (gamma-glutamyl hydrolase) to liberate the carbohydrate and protein-bound folates from food matrices for total folate analysis. It is the extraction method used in AOAC Official Method 2004.05 for assay of total folate in cereal grain products. Certified reference material (CRM) 485 mixed vegetables was used to represent the matrix of vegetables. Regression and ridge analysis were performed by statistical analysis software. The predicted second-order polynomial model was adequate (R2 = 0.947), without significant lack of fit (p > 0.1). Both protease and alpha-amylase have significant effects on the extraction. Ridge analysis gave an optimum trienzyme digestion time: Pronase, 1.5 h; alpha-amylase, 1.5 h; and conjugase, 3 h. The experimental value for CRM 485 under this optimum digestion was close to the predicted value from the model, confirming the validity and adequacy of the model. The optimized trienzyme digestion condition was applied to five vegetables and yielded higher folate levels than the trienzyme digestion parameters employed in AOAC Official Method 2004.05.
International Nuclear Information System (INIS)
Moffeit, K.C.
1987-01-01
The status and research possibilities of the Stanford Linear Collider (SLC) are reviewed. The physics program concentrates on production of Z 0 's and their decay. The SLC systems include a new injector and booster, two damping rings to provide the small beam emittance, a new positron source, the existing LINAC structure upgraded for higher energy and better beam control, beam transport arcs, a final focus section, and experimental halls are detectors. Energy spectrometers with an accuracy of ± 50 MeV/c 2 for pulse-to-pulse center of mass energy measurement are to be installed. Longitudinal polarized electrons are expected, and will allow more precise tests of the standard model
International Nuclear Information System (INIS)
Phinney, N.
1992-08-01
The SLAC Linear Collider (SLC) has begun a new era of operation with the SLD detector. During 1991 there was a first engineering run for the SLD in parallel with machine improvements to increase luminosity and reliability. For the 1992 run, a polarized electron source was added and more than 10,000 Zs with an average of 23% polarization have been logged by the SLD. This paper will discuss the performance of the SLC in 1991 and 1992 and the technical advances that have produced higher luminosity. Emphasis will be placed on issues relevant to future linear colliders such as producing and maintaining high-current, low-emittance beams and focusing the beams to the micron scale for collisions
Energy Technology Data Exchange (ETDEWEB)
Phinney, N. [Stanford Univ., CA (United States). Stanford Linear Accelerator Center
1998-07-01
The SLAC Linear Collider (SLC) is the first example of an entirely new type of lepton collider. Many years of effort were required to develop the understanding and techniques needed to approach design luminosity. This paper discusses some of the key issues and problems encountered in producing a working linear collider. These include the polarized source, techniques for emittance preservation, extensive feedback systems, and refinements in beam optimization in the final focus. The SLC experience has been invaluable for testing concepts and developing designs for a future linear collider.
International Nuclear Information System (INIS)
Phinney, N.
1998-01-01
The SLAC Linear Collider (SLC) is the first example of an entirely new type of lepton collider. Many years of effort were required to develop the understanding and techniques needed to approach design luminosity. This paper discusses some of the key issues and problems encountered in producing a working linear collider. These include the polarized source, techniques for emittance preservation, extensive feedback systems, and refinements in beam optimization in the final focus. The SLC experience has been invaluable for testing concepts and developing designs for a future linear collider
Lack of Association between SLC30A8 Variants and Type 2 Diabetes in Mexican American Families
Directory of Open Access Journals (Sweden)
Hemant Kulkarni
2016-01-01
Full Text Available SLC30A8 encodes zinc transporter 8 which is involved in packaging and release of insulin. Evidence for the association of SLC30A8 variants with type 2 diabetes (T2D is inconclusive. We interrogated single nucleotide polymorphisms (SNPs around SLC30A8 for association with T2D in high-risk, pedigreed individuals from extended Mexican American families. This study of 118 SNPs within 50 kb of the SLC30A8 locus tested the association with eight T2D-related traits at four levels: (i each SNP using measured genotype approach (MGA; (ii interaction of SNPs with age and sex; (iii combinations of SNPs using Bayesian Quantitative Trait Nucleotide (BQTN analyses; and (iv entire gene locus using the gene burden test. Only one SNP (rs7817754 was significantly associated with incident T2D but a summary statistic based on all T2D-related traits identified 11 novel SNPs. Three SNPs and one SNP were weakly but interactively associated with age and sex, respectively. BQTN analyses could not demonstrate any informative combination of SNPs over MGA. Lastly, gene burden test results showed that at best the SLC30A8 locus could account for only 1-2% of the variability in T2D-related traits. Our results indicate a lack of association of the SLC30A8 SNPs with T2D in Mexican American families.
DEFF Research Database (Denmark)
Pullen, Timothy J; Sylow, Lykke; Sun, Gao
2012-01-01
Exercise-induced hyperinsulinism (EIHI) is an autosomal dominant disorder characterized by inappropriate insulin secretion in response to vigorous physical exercise or pyruvate injection. Activating mutations in the monocarboxylate transporter-1 (MCT1, SLC16A1) promoter have been linked to EIHI....... Expression of this pyruvate transporter is specifically repressed (disallowed) in pancreatic ß-cells, despite nearly universal expression across other tissues. It has been impossible to determine, however, whether EIHI mutations cause MCT1 expression in patient ß-cells. The hypothesis that MCT1 expression...... in ß-cells is sufficient to cause EIHI by allowing entry of pyruvate and triggering insulin secretion thus remains unproven. Therefore, we generated a transgenic mouse capable of doxycycline-induced, ß-cell-specific overexpression of MCT1 to test this model directly. MCT1 expression caused isolated...
High Prevalence of Vitamin B12 Deficiency and No Folate Deficiency in Young Children in Nepal
Directory of Open Access Journals (Sweden)
Bernadette N. Ng’eno
2017-01-01
Full Text Available Many children in low- and middle-income countries may have inadequate intake of vitamin B12 and folate; data confirming these inadequacies are limited. We used biochemical, demographic, behavioral and anthropometric data to describe the folate and vitamin B12 concentrations among six- to 23-month-old Nepalese children. Vitamin B12 (serum B12 < 150 pmol/L and folate deficiencies (red blood cell (RBC folate < 226.5 nmol/L were assessed. We used logistic regression to identify predictors of vitamin B12 deficiency. The vitamin B12 geometric mean was 186 pmol/L; 30.2% of children were deficient. The mean RBC folate concentration was 13,612 nmol/L; there was no deficiency. Factors associated with vitamin B12 deficiency included: (a age six to 11 months (adjusted odds ratio (aOR 1.51; 95% confidence interval (CI: 1.18, 1.92 or 12–17 months (aOR 1.38; 95% CI: 1.10, 1.72 compared to 18–23 months; (b being stunted (aOR 1.24; 95% CI: 1.03, 1.50 compared to not being stunted; (c and not eating animal-source foods (aOR 1.85; 95% CI: 1.42, 2.41 compared to eating animal-source foods the previous day. There was a high prevalence of vitamin B12 deficiency, but no folate deficiency. Improving early feeding practices, including the consumption of rich sources of vitamin B12, such as animal-source foods and fortified foods, may help decrease deficiency.
Directory of Open Access Journals (Sweden)
Yan Xiaofei
2011-09-01
Full Text Available Abstract Background Mutations in SLC26A4 cause Pendred syndrome (hearing loss with goiter or DFNB4 (non-syndromic hearing loss with inner ear malformation, such as enlarged vestibular aqueduct or Mondini deformity. The relationship between mutations in SLC26A4 and Mondini deformity without enlarged vestibular aqueduct has not been studied in any Chinese deaf population. The purpose of this study was to assess whether mutations in the SLC26A4 gene cause Mondini deformity without an enlarged vestibular aqueduct (isolated Mondini deformity in a Chinese population. Methods In total, 144 patients with sensorineural hearing loss were included and subjected to high-resolution temporal bone CT. Among them, 28 patients with isolated Mondini dysplasia (MD group, 50 patients with enlarged vestibular aqueduct with Mondini dysplasia (EVA with MD group, 50 patients with enlarged vestibular aqueduct without Mondini dysplasia (EVA group, and 16 patients with other types of inner ear malformations (IEM group were identified. The coding exons of SLC26A4 were analyzed in all subjects. Results DNA sequence analysis of SLC26A4 was performed in all 144 patients. In the different groups, the detection rate of the SLC26A4 mutation differed. In the isolated MD group, only one single allelic mutation in SLC26A4 was found in one patient (1/28, 3.6%. In the EVA with MD group, biallelic and monoallelic SLC26A4 mutations were identified in 46 patients (46/50, 92.0% and three patients (3/50, 6.0%, respectively. Also, in the EVA group, biallelic and monoallelic SLC26A4 mutations were identified in 46 patients (46/50, 92.0% and three patients (3/50, 6.0%, respectively. These percentages were identical to those in the EVA plus MD group. Only two patients carried monoallelic mutations of the SLC26A4 gene in the IEM group (2/16, 12.5%. There were significant differences in the frequency of SLC26A4 mutation among the groups (P SLC26A4 mutation in the isolated MD group was
Directory of Open Access Journals (Sweden)
Olha Hurba
Full Text Available OBJECTIVE: Using European descent Czech populations, we performed a study of SLC2A9 and SLC22A12 genes previously identified as being associated with serum uric acid concentrations and gout. This is the first study of the impact of non-synonymous allelic variants on the function of GLUT9 except for patients suffering from renal hypouricemia type 2. METHODS: The cohort consisted of 250 individuals (150 controls, 54 nonspecific hyperuricemics and 46 primary gout and/or hyperuricemia subjects. We analyzed 13 exons of SLC2A9 (GLUT9 variant 1 and GLUT9 variant 2 and 10 exons of SLC22A12 by PCR amplification and sequenced directly. Allelic variants were prepared and their urate uptake and subcellular localization were studied by Xenopus oocytes expression system. The functional studies were analyzed using the non-parametric Wilcoxon and Kruskall-Wallis tests; the association study used the Fisher exact test and linear regression approach. RESULTS: We identified a total of 52 sequence variants (12 unpublished. Eight non-synonymous allelic variants were found only in SLC2A9: rs6820230, rs2276961, rs144196049, rs112404957, rs73225891, rs16890979, rs3733591 and rs2280205. None of these variants showed any significant difference in the expression of GLUT9 and in urate transport. In the association study, eight variants showed a possible association with hyperuricemia. However, seven of these were in introns and the one exon located variant, rs7932775, did not show a statistically significant association with serum uric acid concentration. CONCLUSION: Our results did not confirm any effect of SLC22A12 and SLC2A9 variants on serum uric acid concentration. Our complex approach using association analysis together with functional and immunohistochemical characterization of non-synonymous allelic variants did not show any influence on expression, subcellular localization and urate uptake of GLUT9.
Directory of Open Access Journals (Sweden)
Jennifer eThiaville
2016-03-01
Full Text Available Tetrahydrofolate (THF and its one-carbon derivatives, collectively termed folates, are essential cofact¬ors, but are inherently unstable. While it is clear that chemical oxidation can cleave folates or damage their pterin precursors, very little is known about enzymatic damage to these molec-ules or about whether the folate biosynthesis pathway responds adaptively to damage to its end-pro¬¬ducts. The presence of a duplication of the gene encoding the folate biosynthesis enzyme 6-hydr¬oxymethyl-7,8-dihydropterin pyrophosphokinase (FolK in many sequenced bacterial gen-omes combined with a strong chromosomal clustering of the folK gene with panB, encoding the 5,10-methylene-THF-dependent enzyme ketopantoate hydroxymethyltransferase, led us to infer that PanB has a side activity that cleaves 5,10-methylene-THF, yielding a pterin product that is recycled by FolK. Genetic and metabolic analyses of Escherichia coli strains showed that over-expression of PanB leads to accumulation of the likely folate cleavage product 6-hydroxy¬methyl-pterin and other pterins in cells and medium, and – unexpectedly – to a 46% increase in total fol-ate content. In silico modeling of the folate bio¬syn¬thesis pathway showed that these observations are consistent with the in vivo cleavage of 5,10-methylene-THF by a side-activity of PanB, with FolK-mediated recycling of the pterin cleavage product, and with regulation of folate biosynth-esis by folates or their damage products.
STANFORD: Highly polarized SLC electron beams
International Nuclear Information System (INIS)
Anon.
1993-01-01
Full text: Using specialized photocathodes made with 'strained' gallium arsenide, physicists at the Stanford Linear Accelerator Center (SLAC) have generated electron beams with polarizations in excess of 60 percent a year ahead of schedule. Together with recent luminosity increases, this breakthrough will have a major impact on the physics output of the Stanford Linear Collider (SLC). Beam polarization was almost tripled using photocathodes in which a gallium arsenide layer was grown epitaxially over a substrate of gallium arsenide phosphide. The mismatch between these two layers deforms the crystal structure and removes a degeneracy in the valence band structure, permitting selective optical pumping of one unique spin state. Whereas conventional gallium arsenide photocathodes are limited to 50 percent polarization because of this degeneracy (and realistic cathodes fall substantially below this theoretical limit), such strained crystal lattices have the potential to yield polarizations close to 100 percent. Polarization enhancement with strained lattices was first demonstrated in 1991 by a SLAC/Wisconsin/ Berkeley group (May 1991, page 6) with a 71 percent polarization in a laboratory experiment. More recently this group has achieved polarization in excess of 90 percent, reported last November at the Nagoya Spin Symposium. (In a complementary development, a Japanese KEK/ Nagoya/KEK obtains polarized beams using a 'superlattice' - May 1991, page 4.) The 1993 SLC run, the strained gallium arsenide photocathode technique's debut in an operating particle accelerator, has proved to be a resounding, unqualified success - as have physics experiments on the Z particles produced by the highly polarized beam. A conservative approach was called for, due to concerns about possible charge saturation effects. A relatively thick (0.3 micron) gallium arsenide layer was used for the photocathode in the SLC polarized electron source. With a titanium
Directory of Open Access Journals (Sweden)
Aniruddha Basu
2015-01-01
Full Text Available Background & objectives: Genetic factors have potential of predicting response to antidepressants in patients with major depressive disorder (MDD. In this study, an attempt was made to find an association between response to escitalopram in patients with MDD, and serotonin transporter (SLC6A4 and receptor (5HTR1A, 5HTR2A polymorphisms. Methods: Fifty five patients diagnosed as suffering from MDD, were selected for the study. The patients were treated with escitalopram over a period of 6-8 wk. Severity of depression, response to treatment and side effects were assessed using standardised instruments. Genetic variations from HTR1A (rs6295, HTR2A (rs6311 and rs6313 and SLC6A4 (44 base-pair insertion/deletion at 5-HTTLPR were genotyped. The genetic data of the responders and non-responders were compared to assess the role of genetic variants in therapeutic outcome. Results: Thirty six (65.5% patients responded to treatment, and 19 (34.5% had complete remission. No association was observed for genotype and allelic frequencies of single nucleotide polymorphisms (SNPs among remitter/non-remitter and responder/non-responder groups, and six most common side-effects, except memory loss which was significantly associated with rs6311 ( p0 =0.03. Interpretation & conclusions: No significant association was found between the SNPs analysed and response to escitalopram in patients with MDD though a significant association was seen between the side effect of memory loss and rs6311. Studies with larger sample are required to find out genetic basis of antidepressant response in Indian patients.
Energy Technology Data Exchange (ETDEWEB)
Gelernter, J.; Kruger, S.D.; Pakstis, A.J. [Yale Univ., New Haven, CT (United States)]|[West Haven Veterans Affairs Medical Center, CT (United States)] [and others
1995-12-10
The dopamine transporter, the molecule responsible for presynaptic reuptake of dopamine and a major site of action of psychostimulant drugs, including cocaine, is encoded by locus SLC6A3 (alias DAT1). The protein`s actions and DAT`s specific localization to dopaminergic neurons make it a candidate gene for several psychiatric illnesses. SLC6A3 has been mapped to distal chromosome 5p, using physical methods. Genetic linkage methods were used to place SLC6A3 in the genetic linkage map. Four extended pedigrees (one of which overlaps with CEPH) were typed. Linkage with Tourette syndrome (TS) was also examined. SLC6A3 showed close linkage with several markers previously mapped to distal chromosome 5p, including D5S11 (Z{sub max} = 16.0, {theta}{sub M} = {theta}{sub F} = 0.03, results from four families) and D5S678 (Z{sub max} = 7.84, {theta}{sub M} = {theta}{sub F} = 0, results from two families). Observed crossovers established that SLC6A3 is a distal marker close to D5S10 and D5S678, but these three distal markers could not be ordered. Linkage between TS and SLC6A3 could be excluded independently in two branches of a large kindred segregating TS; the lod score in a third family was also negative, but not significant. Cumulative results show a lod score of -6.2 at {theta} = 0 and of -3.9 at {theta} = 0.05 (dominant model, narrow disease definition). SLC6A3 thus maps to distal chromosome 5p by linkage analysis, in agreement with previous physical mapping data. A mutation at SLC6A3 is not causative for TS in the two large families that generated significant negative lod scores (if the parameters of our analyses were correct) and is unlikely to be causative in the family that generated a negative lod score that did not reach significance. These results do not exclude a role for the dopamine transporter in influencing risk for TS in combination with other loci. 23 refs., 1 fig., 2 tabs.
Directory of Open Access Journals (Sweden)
Daniel M. Moreira
2013-06-01
Full Text Available Introduction To analyze the association between serum levels of folate and risk of biochemical recurrence after radical prostatectomy among men from the Shared Equal Access Regional Cancer Hospital (SEARCH database. Materials and Methods Retrospective analysis of 135 subjects from the SEARCH database treated between 1991-2009 with available preoperative serum folate levels. Patients' characteristics at the time of the surgery were analyzed with ranksum and linear regression. Uni- and multivariable analyses of folate levels (log-transformed and time to biochemical recurrence were performed with Cox proportional hazards. Results The median preoperative folate level was 11.6ng/mL (reference = 1.5-20.0ng/mL. Folate levels were significantly lower among African-American men than Caucasians (P = 0.003. In univariable analysis, higher folate levels were associated with more recent year of surgery (P < 0.001 and lower preoperative PSA (P = 0.003. In univariable analysis, there was a trend towards lower risk of biochemical recurrence among men with high folate levels (HR = 0.61, 95%CI = 0.37-1.03, P = 0.064. After adjustments for patients characteristics' and pre- and post-operative clinical and pathological findings, higher serum levels of folate were independently associated with lower risk for biochemical recurrence (HR = 0.42, 95%CI = 0.20-0.89, P = 0.023. Conclusion In a cohort of men undergoing radical prostatectomy at several VAs across the country, higher serum folate levels were associated with lower PSA and lower risk for biochemical failure. While the source of the folate in the serum in this study is unknown (i.e. diet vs. supplement, these findings, if confirmed, suggest a potential role of folic acid supplementation or increased consumption of folate rich foods to reduce the risk of recurrence.
Lipid-Polymer Nanoparticles for Folate-Receptor Targeting Delivery of Doxorubicin.
Zheng, Mingbin; Gong, Ping; Zheng, Cuifang; Zhao, Pengfei; Luo, Zhenyu; Ma, Yifan; Cai, Lintao
2015-07-01
A biocompatible PLGA-lipid hybrid nanoparticles (NPs) was developed for targeted delivery of anticancer drugs with doxorubicin (DOX). The hydrodynamic diameter and zeta potential of DOX-loaded PLGA-lipid NPs (DNPs) were affected by the mass ratio of Lipid/PLGA or DSPE-PEG-COOH/Lecithin. At the 1:20 drug/polymer mass ratio, the mean hydrodynamic diameter of DNPs was the lowest (99.2 1.83 nm) and the NPs presented the encapsulation efficiency of DOX with 42.69 1.30%. Due to the folate-receptor mediated endocytosis, the PLGA-lipid NPs with folic acid (FA) targeting ligand showed significant higher uptake by folate-receptor-positive MCF-7 cells as compared to PLGA-lipid NPs without folate. Confocal microscopic observation and flow cytometry analysis also supported the enhanced cellular uptake of the FA-targeted NPs. The results indicated that the FA-targeted DNPs exhibited higher cytotoxicity in MCF-7 cells compared with non-targeted NPs. The lipid-polymer nanoparticles provide a solution of biocompatible nanocarrier for cancer targeting therapy.
Folates in foods: reactivity, stability during processing, and nutritional implications.
Hawkes, J G; Villota, R
1989-01-01
Nutritional deficiencies are eminent at all socioeconomic levels of the world population and have created a critical need for a reevaluation of the nutritional quality of the food supply. A particular group of vitamers, collectively referred to as folates, has received a great deal of attention due to their significance in human metabolism, their prevalent deficiency worldwide, as well as their complexity of analysis. Severe folate deficiency may result in megaloblastic anemia and is generally attributed to low dietary intake, although it may also result from malabsorption. Such concerns have instigated increased interest in food-fortification programs. In order to ensure appropriate levels of nutrient fortification and optimization of food processes for maximum folate retention, it is of great importance to have a basic understanding of the kinetic behavior of individual vitamers with respect to processing parameters and various environmental conditions. This article reviews kinetic stability of folates as affected by processing conditions, discusses problems associated with current methodology for folate analyses, and integrates this information with the nutritional aspects of folates.
Hartman, Brenda A; Fazili, Zia; Pfeiffer, Christine M; O'Connor, Deborah L
2014-09-01
It is not known whether folate metabolism is altered during pregnancy to support increased DNA and RNA biosynthesis. By using a state-of-the-art LC tandem mass spectrometry technique, the aim of this study was to investigate differences in RBC folate forms between pregnant and nonpregnant women and between nonpregnant women consuming different concentrations of supplemental folic acid. Forms of folate in RBCs were used to explore potential shifts in folate metabolism during early erythropoiesis. Total RBC folate and folate forms [tetrahydrofolate; 5-methyltetrahydrofolate (5-methyl-THF); 4α-hydroxy-5-methyl-tetrahydrofolate (an oxidation product of 5-methyl-THF); 5-formyl-tetrahydrofolate; and 5,10-methenyl-tetrahydrofolate] were measured in 4 groups of women (n = 26): pregnant women (PW) (30-36 wk of gestation) consuming 1 mg/d of folic acid, and nonpregnant women consuming 0 mg/d (NPW-0), 1 mg/d (NPW-1), and 5 mg/d (NPW-5) folic acid. The mean ± SD RBC folate concentration of the NPW-0 group (890 ± 530 nmol/L) was lower than the NPW-1 (1660 ± 350 nmol/L) and NPW-5 (1980 ± 570 nmol/L) groups as assessed by microbiologic assay (n = 26, P methyl-THF [limit of detection (LOD) = 0.06 nmol/L] in all groups and tetrahydrofolate (LOD = 0.2 nmol/L) in most women regardless of methylenetetrahydrofolate reductase genotype. Most women consuming folic acid supplements had detectable concentrations of 5,10-methenyl-tetrahydrofolate (LOD = 0.31 nmol/L). However, there was no difference in the relative distribution of 5-methyl-THF (83-84%), sum of non-methyl folates (0.6-3%), or individual non-methyl folate forms in RBCs across groups. We conclude that although folic acid supplementation in nonpregnant women increases RBC total folate and the concentration of individual folate forms, it does not alter the relative distribution of folate forms. Similarly, distribution of RBC folate forms did not differ between pregnant and nonpregnant women. This trial was registered at
Maternal folic acid supplementation and dietary folate intake and congenital heart defects.
Directory of Open Access Journals (Sweden)
Baohong Mao
Full Text Available It has been reported that folic acid supplementation before and/or during pregnancy could reduce the risk of congenital heart defects (CHDs. However, the results from limited epidemiologic studies have been inconclusive. We investigated the associations between maternal folic acid supplementation, dietary folate intake, and the risk of CHDs.A birth cohort study was conducted in 2010-2012 at the Gansu Provincial Maternity & Child Care Hospital in Lanzhou, China. After exclusion of stillbirths and multiple births, a total of 94 births were identified with congenital heart defects, and 9,993 births without any birth defects. Unconditional logistic regression was used to estimate the associations.Compared to non-users, folic acid supplement users before pregnancy had a reduced risk of overall CHDs (OR: 0.42, 95% CI: 0.21-0.86, Ptrend = 0.025 after adjusted for potential confounders. A protective effect was observed for certain subtypes of CHDs (OR: 0.37, 95% CI: 0.16-0.85 for malformation of great arteries; 0.26, 0.10-0.68 for malformation of cardiac septa; 0.34, 0.13-0.93 for Atrial septal defect. A similar protective effect was also seen for multiple CHDs (OR: 0.49, 95% CI: 0.26-0.93, Ptrend = 0.004. Compared with the middle quartiles of dietary folate intake, lower dietary folate intake (<149.88 μg/day during pregnancy were associated with increased risk of overall CHDs (OR: 1.63, 95% CI: 1.01-2.62 and patent ductus arteriosus (OR: 1.85, 95% CI: 1.03-3.32. Women who were non-user folic acid supplement and lower dietary folate intake have almost 2-fold increased CHDs risk in their offspring.Our study suggested that folic acid supplementation before pregnancy was associated with a reduced risk of CHDs, lower dietary folate intake during pregnancy was associated with increased risk. The observed associations varied by CHD subtypes. A synergistic effect of dietary folate intake and folic acid supplementation was also observed.
Recent Findings Concerning PAMAM Dendrimer Conjugates with Cyclodextrins as Carriers of DNA and RNA
Directory of Open Access Journals (Sweden)
Keiichi Motoyama
2009-08-01
Full Text Available We have evaluated the potential use of various polyamidoamine (PAMAM dendrimer [dendrimer, generation (G 2-4] conjugates with cyclodextrins (CyDs as novel DNA and RNA carriers. Among the various dendrimer conjugates with CyDs, the dendrimer (G3 conjugate with α-CyD having an average degree of substitution (DS of 2.4 [α-CDE (G3, DS2] displayed remarkable properties as DNA, shRNA and siRNA delivery carriers through the sensor function of α-CDEs toward nucleic acid drugs, cell surface and endosomal membranes. In an attempt to develop cell-specific gene transfer carriers, we prepared sugar-appended α-CDEs. Of the various sugar-appended α-CDEs prepared, galactose- or mannose-appended α-CDEs provided superior gene transfer activity to α-CDE in various cells, but not cell-specific gene delivery ability. However, lactose-appended α-CDE [Lac-α-CDE (G2] was found to possess asialoglycoprotein receptor (AgpR-mediated hepatocyte-selective gene transfer activity, both in vitro and in vivo. Most recently, we prepared folate-poly(ethylene glycol-appended α-CDE [Fol-PαC (G3] and revealed that Fol-PαC (G3 imparted folate receptor (FR-mediated cancer cell-selective gene transfer activity. Consequently, α-CDEs bearing integrated, multifunctional molecules may possess the potential to be novel carriers for DNA, shRNA and siRNA.
Pang, Xiuhong; Chai, Yongchuan; He, Longxia; Chen, Penghui; Wang, Xiaowen; Li, Lei; Jia, Huan; Wu, Hao; Yang, Tao
2015-12-01
To investigate the genetic cause of the patients with non-syndromic enlarged vestibular aqueduct (EVA) but without bi-allelic SLC26A4 mutations. Presence of a homozygous genomic deletion was detected in a Chinese Han deaf patient (D1467-1) who failed to amplify the first three exons of SLC26A4. The breakpoints of the deletion were fine-mapped and revealed by PCR amplification and sequencing. This deletion was subsequently screened in 22 Chinese Han EVA probands with mono-allelic SLC26A4 mutations. The possible founder effect of the newly identified genomic deletion was evaluated by haplotype analysis. A homozygous c.-2071_307+3801del7666 deletion of SLC26A4 was identified in patient D1467-1. This novel genomic deletion was subsequently identified in 18% (4/22) of the Chinese Han EVA probands with mono-allelic SLC26A4 mutations. Haplotype analysis showed that this genomic deletion is likely a founder mutation in Chinese Hans. Our results suggested that the cryptic c.-2071_307+3801del7666 deletion of SLC26A4 is relatively frequent in Chinese Han non-syndromic EVA patients without bi-allelic SLC26A4 mutations. Screening of this genomic deletion should be incorporated into the routine DNA testing of SLC26A4 in Chinese Hans. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.
Dietary intake and biological measurement of folate: A qualitative review of validation studies
Park, Y.H.; Vollset, S.E.; Boonstra, A.; Chajes, V.; Ueland, P.M.; Slimani, N.
2013-01-01
Folate is a nutrient of major health significance, but its dietary intake assessment is particularly complex to quantify through traditional approaches. Attempts have been made to validate dietary instruments for assessing folate intake against circulating concentration biomarkers. However, this
International Nuclear Information System (INIS)
Erculj, Nina; Kotnik, Barbara Faganel; Debeljak, Marusa; Jazbec, Janez; Dolzan, Vita
2014-01-01
We evaluated the influence of folate pathway polymorphisms on high-dose methotrexate (HD-MTX) related toxicity in paediatric patients with T-cell non-Hodgkin lymphoma (NHL). In total, 30 NHL patients were genotyped for selected folate pathway polymorphisms. Carriers of at least one MTHFR 677T allele had significantly higher MTX area under the time-concentration curve levels at third MTX cycle (P = 0.003). These patients were also at higher odds of leucopoenia (P = 0.006) or thrombocytopenia (P = 0.041) and had higher number of different HD-MTX-related toxicity (P = 0.035) compared to patients with wild-type genotype. Our results suggest an important role of MTHFR 677C>T polymorphism in the development of HD-MTX-related toxicity in children with NHL
Mammen, Cherry; Rupps, Rosemarie; Trnka, Peter; Boerkoel, Cornelius F
2012-02-01
We report a 5-year-old boy with thiazide-resistant Bartter syndrome. This is highly unusual since thiazide hypersensitivity is a common diagnostic finding in Bartter syndrome patients. Subsequent molecular testing identified compound heterozygosity for two novel mutations in KCNJ1, (c.556A > G and c.683G > A) which is associated with Bartter syndrome, and a paternally inherited polymorphism in SLC12A3 (c.791G > C). Mutations in SLC12A3 cause the thiazide-resistant tubulopathy Gitelman syndrome. Based on published studies of this polymorphism in SLC12A3 and the features of the proband's father, we postulate that this polymorphism modifies the phenotype of Bartter syndrome in the proband to thiazide resistance. Copyright © 2011 Elsevier Masson SAS. All rights reserved.
Wani, Nissar Ahmad; Thakur, Shilpa; Najar, Rauf Ahmad; Nada, Ritambhara; Khanduja, Krishan Lal; Kaur, Jyotdeep
2013-03-01
Folate mediated one-carbon metabolism is of fundamental importance for various cellular processes, including DNA synthesis and methylation of biological molecules. Due to the exogenous requirement of folate in mammals, there exists a well developed epithelial folate transport system for regulation of normal folate homeostasis. The intestinal and renal folate uptake is tightly and diversely regulated and disturbances in folate homeostasis like in alcoholism have pathological consequences. The study was sought to delineate the regulatory mechanism of folate uptake in intestine and reabsorption in renal tubular cells that could evaluate insights of malabsorption during alcoholism. The folate transporters PCFT and RFC were found to be associated with lipid rafts of membrane surfaces in intestine and kidney. Importantly, the observed lower intestinal and renal folate uptake was associated with decreased levels of folate transporter viz. PCFT and RFC in lipid rafts of intestinal and renal membrane surfaces. The decreased association of folate transporters in lipid rafts was associated with decreased protein and mRNA levels. In addition, immunohistochemical studies showed that alcoholic conditions deranged that localization of PCFT and RFC. These findings could explain the possible mechanistic insights that may result in folate malabsorption during alcoholism. Copyright © 2013 Elsevier Inc. All rights reserved.
Iniesta, M Dolores; Pérez-Conesa, Darío; García-Alonso, Javier; Ros, Gaspar; Periago, M Jesús
2009-06-10
The effects of cultivar, on-vine ripening, and year of harvest on the folate content of raw tomatoes were studied. Folate content in hot-break tomato puree (HTP) subjected to pasteurization at different temperatures and its evolution during the shelf life of tomato juice were also investigated. 5-Methyltetrahydrofolate (5-CH(3)-H(4)-folate) was the only folate compound identified in raw tomatoes and HTP, but tetrahydrofolate (H(4)-folate) was 10% of the folate detected in tomato juice. The content of folates in raw tomatoes ranged from 4.1 to 35.3 microg/100 g of fresh weight and was highly influenced by all of the factors studied. No clear trend of folate content with ripening stage was observed. The extractability of 5-CH(3)-H(4)-folate from HTP increased significantly after pasteurization at 98 degrees C for 40 s, but higher temperatures decreased its content. Tomato juice showed folate losses during storage independent of the storage temperature. Folate losses were higher when tomato juice was packed in glass bottles than in Tetra Pak.
Effects of industrial processing on folate content in green vegetables.
Delchier, Nicolas; Ringling, Christiane; Le Grandois, Julie; Aoudé-Werner, Dalal; Galland, Rachel; Georgé, Stéphane; Rychlik, Michael; Renard, Catherine M G C
2013-08-15
Folates are described to be sensitive to different physical parameters such as heat, light, pH and leaching. Most studies on folates degradation during processing or cooking treatments were carried out on model solutions or vegetables only with thermal treatments. Our aim was to identify which steps were involved in folates loss in industrial processing chains, and which mechanisms were underlying these losses. For this, the folates contents were monitored along an industrial canning chain of green beans and along an industrial freezing chain of spinach. Folates contents decreased significantly by 25% during the washing step for spinach in the freezing process, and by 30% in the green beans canning process after sterilisation, with 20% of the initial amount being transferred into the covering liquid. The main mechanism involved in folate loss during both canning green beans and freezing spinach was leaching. Limiting the contact between vegetables and water or using steaming seems to be an adequate measure to limit folates losses during processing. Copyright © 2013 Elsevier Ltd. All rights reserved.
Cell-Type Specific Determinants of NRAMP1 Expression in Professional Phagocytes
Directory of Open Access Journals (Sweden)
Mathieu F. M. Cellier
2013-01-01
Full Text Available The Natural resistance-associated macrophage protein 1 (Nramp1 or Solute carrier 11 member 1, Slc11a1 transports divalent metals across the membrane of late endosomes and lysosomes in professional phagocytes. Nramp1 represents an ancient eukaryotic cell-autonomous defense whereas the gene duplication that yielded Nramp1 and Nramp2 predated the origin of Sarcopterygians (lobe-finned fishes and tetrapods. SLC11A1 genetic polymorphisms associated with human resistance to tuberculosis consist of potential regulatory variants. Herein, current knowledge of the regulation of SLC11A1 gene expression is reviewed and comprehensive analysis of ENCODE data available for hematopoietic cell-types suggests a hypothesis for the regulation of SLC11A1 expression during myeloid development and phagocyte functional polarization. SLC11A1 is part of a 34.6 kb CTCF-insulated locus scattered with predicted regulatory elements: a 3' enhancer, a large 5' enhancer domain and four elements spread around the transcription start site (TSS, including several C/EBP and PU.1 sites. SLC11A1 locus ends appear mobilized by ETS-related factors early during myelopoiesis; activation of both 5' and 3' enhancers in myelo-monocytic cells correlate with transcription factor binding at the TSS. Characterizing the corresponding cis/trans determinants functionally will establish the mechanisms involved and possibly reveal genetic variation that impacts susceptibility to infectious or immune diseases.
Folinic acid treatment for schizophrenia associated with folate receptor autoantibodies.
Ramaekers, V T; Thöny, B; Sequeira, J M; Ansseau, M; Philippe, P; Boemer, F; Bours, V; Quadros, E V
2014-12-01
Auto-antibodies against folate receptor alpha (FRα) at the choroid plexus that block N(5)-methyltetrahydrofolate (MTHF) transfer to the brain were identified in catatonic schizophrenia. Acoustic hallucinations disappeared following folinic acid treatment. Folate transport to the CNS prevents homocysteine accumulation and delivers one-carbon units for methyl-transfer reactions and synthesis of purines. The guanosine derivative tetrahydrobiopterin acts as common co-factor for the enzymes producing dopamine, serotonin and nitric oxide. Our study selected patients with schizophrenia unresponsive to conventional treatment. Serum from these patients with normal plasma homocysteine, folate and vitamin B12 was tested for FR autoantibodies of the blocking type on serial samples each week. Spinal fluid was analyzed for MTHF and the metabolites of pterins, dopamine and serotonin. The clinical response to folinic acid treatment was evaluated. Fifteen of 18 patients (83.3%) had positive serum FR auto-antibodies compared to only 1 in 30 controls (3.3%) (χ(2)=21.6; pfolate flux to the CNS, which explained low CSF folate values in 6 and normal values in 7 patients. The mean±SD for CSF MTHF was diminished compared to previously established controls (t-test: 3.90; p=0.0002). A positive linear correlation existed between CSF MTHF and biopterin levels. CSF dopamine and serotonin metabolites were low or in the lower normal range. Administration of folinic acid (0.3-1mg/kg/day) to 7 participating patients during at least six months resulted in clinical improvement. Assessment of FR auto-antibodies in serum is recommended for schizophrenic patients. Clinical negative or positive symptoms are speculated to be influenced by the level and evolution of FRα antibody titers which determine folate flux to the brain with up- or down-regulation of brain folate intermediates linked to metabolic processes affecting homocysteine levels, synthesis of tetrahydrobiopterin and neurotransmitters
Energy Technology Data Exchange (ETDEWEB)
Anon.
1990-05-15
During January, Stanford's SLC Linear Collider began producing Z particles again after the major disruptions in October due to the Loma Prieta earthquake. What's more, the pulse repetition rate climbed smoothly from 60 to 120 Hz as part of the ongoing collider improvement programme. Although the SLC luminosity has not quite returned to its best pre-quake levels, the collider managed to produce enough Z particles to permit Mark II physicists to test their newly installed Vertex Detection System (VDS)
Udhayabanu, Tamilarasan; Subramanian, Veedamali S; Teafatiller, Trevor; Gowda, Vykuntaraju K; Raghavan, Varun S; Varalakshmi, Perumal; Said, Hamid M; Ashokkumar, Balasubramaniem
2016-11-01
Brown-Vialetto-Van Laere Syndrome (BVVLS), a rare neurological disorder characterized by bulbar palsies and sensorineural deafness, is mainly associated with defective riboflavin transporters encoded by the SLC52A2 and SLC52A3 genes. Here we present a 16-year-old BVVLS patient belonging to a five generation consanguineous family from Indian ethnicity with two homozygous missense mutations viz., c.421C>A [p.P141T] in SLC52A2 and c.62A>G [p.N21S] in SLC52A3. Functional characterization based on 3 H-riboflavin uptake assay and live-cell confocal imaging revealed that the effect of mutation c.421C>A [p.P141T] identified in SLC52A2 had a slight reduction in riboflavin uptake; on the other hand, the c.62A>G [p.N21S] identified in SLC52A3 showed a drastic reduction in riboflavin uptake, which appeared to be due to impaired trafficking and membrane targeting of the hRFVT-3 protein. This is the first report presenting mutations in both riboflavin transporters hRFVT-2 and hRFVT-3 in the same BVVLS patient. Also, c.62A>G [p.N21S] in SLC52A3 appears to contribute more to the disease phenotype in this patient than c.421C>A [p.P141T] in SLC52A2. Copyright © 2016 Elsevier B.V. All rights reserved.
Natural variation of folate tuber content in potato
Folates are essential vitamins in the human diet. Folate deficiency is still a common worldwide problem that is linked to various serious disorders, such as birth defects, certain types of cardiovascular diseases and cancers, megaloblastic anemia, impaired cognitive performance and depression. There...
Variants in SLC18A3, vesicular acetylcholine transporter, cause congenital myasthenic syndrome
O'Grady, Gina L.; Verschuuren, Corien; Yuen, Michaela; Webster, Richard; Menezes, Manoj; Fock, Johanna M.; Pride, Natalie; Best, Heather A.; Damm, Tatiana Benavides; Turner, Christian; Lek, Monkol; Engel, Andrew G.; North, Kathryn N.; Clarke, Nigel F.; MacArthur, Daniel G.; Kamsteeg, Erik-Jan; Cooper, Sandra T.
2016-01-01
Objective: To describe the clinical and genetic characteristics of presynaptic congenital myasthenic syndrome secondary to biallelic variants in SLC18A3. Methods: Individuals from 2 families were identified with biallelic variants in SLC18A3, the gene encoding the vesicular acetylcholine transporter
A partial gene deletion of SLC45A2 causes oculocutaneous albinism in Doberman pinscher dogs.
Directory of Open Access Journals (Sweden)
Paige A Winkler
Full Text Available The first white Doberman pinscher (WDP dog was registered by the American Kennel Club in 1976. The novelty of the white coat color resulted in extensive line breeding of this dog and her offspring. The WDP phenotype closely resembles human oculocutaneous albinism (OCA and clinicians noticed a seemingly high prevalence of pigmented masses on these dogs. This study had three specific aims: (1 produce a detailed description of the ocular phenotype of WDPs, (2 objectively determine if an increased prevalence of ocular and cutaneous melanocytic tumors was present in WDPs, and (3 determine if a genetic mutation in any of the genes known to cause human OCA is causal for the WDP phenotype. WDPs have a consistent ocular phenotype of photophobia, hypopigmented adnexal structures, blue irides with a tan periphery and hypopigmented retinal pigment epithelium and choroid. WDPs have a higher prevalence of cutaneous melanocytic neoplasms compared with control standard color Doberman pinschers (SDPs; cutaneous tumors were noted in 12/20 WDP (5 years of age: 8/8 and 1/20 SDPs (p<0.00001. Using exclusion analysis, four OCA causative genes were investigated for their association with WDP phenotype; TYR, OCA2, TYRP1 and SLC45A2. SLC45A2 was found to be linked to the phenotype and gene sequencing revealed a 4,081 base pair deletion resulting in loss of the terminus of exon seven of SLC45A2 (chr4∶77,062,968-77,067,051. This mutation is highly likely to be the cause of the WDP phenotype and is supported by a lack of detectable SLC45A2 transcript levels by reverse transcriptase PCR. The WDP provides a valuable model for studying OCA4 visual disturbances and melanocytic neoplasms in a large animal model.
Directory of Open Access Journals (Sweden)
Bhagavathi Sundaram Sivamaruthi
2012-06-01
Full Text Available Caenorhabditis elegans is an instructive and suitable model for studying pathogenesis of almost all human pathogens. Salmonella Typhi is gram-negative facultative intracellular anaerobe that causes several pathetic infections. Necessary enriched nutrient ingestion during pathological conditions may reduce the harshness of the infection. We investigated the impact of folate and food supplementation during S. Typhi infection on the model system, C. elegans. Our data indicated that folate supplementation (10 µg increases the lifespan of S. Typhi infected C. elegans up to 20%. In combination with laboratory food source E. coli OP50, folate increases the infected the worm’s lifespan to 40%. The wild type C. elegans infected by S. Typhi died with the LT50 of 60 ± 12 h. The LT50 of S. Typhi infected folt-1 mutant strain VC959 was 96 ± 6 h. However, the folate supplemented mutant worms exhibited an extended life with LT50 of 120 ± 6 h. The short time exposure and pharyngeal pumping studies confirmed that folt-1 mutant worm exhibited increased survival rate during pathogenic course at significant level when compared to wild-type. Our data revealed that folt-1 plays a significant role in host defense system against S. Typhi infection and the folate supplementation in combination with food increases the host survival during S. Typhi infection.
Mutations in the HFE, TFR2, and SLC40A1 genes in patients with hemochromatosis.
Del-Castillo-Rueda, Alejandro; Moreno-Carralero, María-Isabel; Cuadrado-Grande, Nuria; Alvarez-Sala-Walther, Luis-Antonio; Enríquez-de-Salamanca, Rafael; Méndez, Manuel; Morán-Jiménez, María-Josefa
2012-10-15
Hereditary hemochromatosis causes iron overload and is associated with a variety of genetic and phenotypic conditions. Early diagnosis is important so that effective treatment can be administered and the risk of tissue damage avoided. Most patients are homozygous for the c.845G>A (p.C282Y) mutation in the HFE gene; however, rare forms of genetic iron overload must be diagnosed using a specific genetic analysis. We studied the genotype of 5 patients who had hyperferritinemia and an iron overload phenotype, but not classic mutations in the HFE gene. Two patients were undergoing phlebotomy and had no iron overload, 1 with metabolic syndrome and no phlebotomy had mild iron overload, and 2 patients had severe iron overload despite phlebotomy. The patients' first-degree relatives also underwent the analysis. We found 5 not previously published mutations: c.-408_-406delCAA in HFE, c.1118G>A (p.G373D), c.1473G>A (p.E491E) and c.2085G>C (p.S695S) in TFR2; and c.-428_-427GG>TT in SLC40A1. Moreover, we found 3 previously published mutations: c.221C>T (p.R71X) in HFE; c.1127C>A (p.A376D) in TFR2; and c.539T>C (p.I180T) in SLC40A1. Four patients were double heterozygous or compound heterozygous for the mutations mentioned above, and the patient with metabolic syndrome was heterozygous for a mutation in the TFR2 gene. Our findings show that hereditary hemochromatosis is clinically and genetically heterogeneous and that acquired factors may modify or determine the phenotype. Copyright © 2012. Published by Elsevier B.V.
Gibson, Todd M; Weinstein, Stephanie J; Pfeiffer, Ruth M; Hollenbeck, Albert R; Subar, Amy F; Schatzkin, Arthur; Mayne, Susan T; Stolzenberg-Solomon, Rachael
2011-10-01
A higher folate intake is associated with a decreased colorectal cancer risk in observational studies, but recent evidence suggests that excessive folate supplementation may increase colorectal cancer risk in some individuals. Therefore, mandatory folic acid fortification of grain products in the United States may have unintended negative consequences. We examined the association between folate intake and colorectal cancer risk, including 8.5 y of postfortification follow-up. We examined the association between folate intake and colorectal cancer in the NIH-AARP Diet and Health Study-a US cohort study of 525,488 individuals aged 50-71 y initiated in 1995-1996. Dietary, supplemental, and total folate intakes were calculated for the pre- and postfortification periods (before and after 1 July 1997) based on a baseline food-frequency questionnaire. HRs and 95% CIs were calculated by using multivariable Cox proportional hazards regression models. During follow-up through 31 December 2006 (mean follow-up: 9.1 y), 7212 incident colorectal cancer cases were identified. In the postfortification analysis (6484 cases), a higher total folate intake was associated with a decreased colorectal cancer risk (HR for ≥900 compared with pattern of associations was similar for the prefortification period, and no significant differences between time periods were observed. In this large prospective cohort study that included 8.5 y of postfortification follow-up, folate intake was associated with a decreased colorectal cancer risk. Given that the adenoma-carcinoma sequence may take ≥10 y, additional follow-up time is needed to fully examine the effect of folic acid fortification.
Soleimani, Robabeh; Salehi, Zivar; Soltanipour, Soheil; Hasandokht, Tolou; Jalali, Mir Mohammad
2018-04-01
Methylphenidate (MPH) is the most commonly used treatment for attention-deficit hyperactivity disorder (ADHD) in children. However, the response to MPH is not similar in all patients. This meta-analysis investigated the potential role of SLC6A3 polymorphisms in response to MPH in children with ADHD. Clinical trials or naturalistic studies were selected from electronic databases. A meta-analysis was conducted using a random-effects model. Cohen's d effect size and 95% confidence intervals (CIs) were determined. Sensitivity analysis and meta-regression were performed. Q-statistic and Egger's tests were conducted to evaluate heterogeneity and publication bias, respectively. The Grading of Recommendations Assessment, Development and Evaluation (GRADE) system was used to assess the quality of evidence. Sixteen studies with follow-up periods of 1-28 weeks were eligible. The mean treatment acceptability of MPH was 97.2%. In contrast to clinical trials, the meta-analysis of naturalistic studies indicated that children without 10/10 repeat carriers had better response to MPH (Cohen's d: -0.09 and 0.44, respectively). The 9/9 repeat polymorphism had no effect on the response rate (Cohen's d: -0.43). In the meta-regression, a significant association was observed between baseline severity of ADHD, MPH dosage, and combined type of ADHD in some genetic models. Sensitivity analysis indicated the robustness of our findings. No publication bias was observed in our meta-analysis. The GRADE evaluations revealed very low levels of confidence for each outcome of response to MPH. The results of clinical trials and naturalistic studies regarding the effect size between different polymorphisms of SLC6A3 were contradictory. Therefore, further research is recommended. © 2017 Wiley Periodicals, Inc.
Directory of Open Access Journals (Sweden)
Gurmukh Singh
2015-04-01
Full Text Available Objective: Assess the need for folate testing, frequency of corrective action, and determine reference level for serum folate. Methods: Serum folate levels in 5313 samples from 4448 patients, and clinical data were reviewed for patient characteristics and for (a evidence of corrective action in patients with serum folate values 25.7 ng/mL. Results: The prevalence of serum folate levels, in patients, 25.7 ng/mL the sample was collected after supplementation with folic acid. Of the 128 patients with serum folate 60% of the patients. Since serum folate levels â¥13.0 ng/mL are needed for optimal prevention of neural tube defects in the embryo/fetus, we propose that normal serum folate level should be designated to be â¥13.0 ng/mL. Keywords: Serum folate, Prevalence of folate deficiency, Neural tube defects, Optimum serum folate level, Utility of folate testing
Folik Asit Takviyesi Turk Toplumunda Gebelerde Serum Folat Duzeyini Nasil Etkilemektedir?
Directory of Open Access Journals (Sweden)
Alev Ozer
2016-07-01
Full Text Available Aim: To determine the effect of the use of folic acid supplementation on serum folate levels in Turkish pregnant women. Material and Method: Clinical records of a total of 397 patients were retrospectively examined. The patients were recruited into 2 groups based on folic acid supplementation. Group 1 included 294 women who did not take any folic acid tablets before or during pregnancy and Group 2 consisted of 103 women who regularly took 400 mcg of folic acid daily, starting from the preconception period. Both groups were compared with respect to demographic and biochemical characteristics. Results: The patients in Group 1 and 2 had statistically similar pre-pregnancy and pregnancy hemoglobin, pre-pregnancy and pregnancy serum calcium, and pre-pregnancy and pregnancy serum folate concentrations (p=0.544, p=0.549, p=0.289, p=0.299, p=0.072, and p=0.061 respectively. No statistically significant difference was determined between pre-pregnancy and pregnancy folate concentrations in Group 1 (p=0.059. Pre-pregnancy and pregnancy folate concentrations were statistically similar in Group 2 (p=0.057. Both study groups were determined as statistically similar with respect to perinatal outcomes, including molar pregnancy, intrauterine demise, neural tube defects, ventricular septal defect, fetal growth restriction, preeclampsia, preterm birth, birth weight, neonatal intensive care unit admission, and 1st minute and 5th minute Apgar scores (p=0.760, p=0.576, p=0.382, p=0.553, p=0.452, p=0.940, p=0.683, p=0.855, p=0.710, p=0.910, and p=0.924 respectively. Discussion: Based on the findings of the present study, it may be considered that serum folate concentrations in pregnant women can be maintained by dietary intake alone of over 4.5 ng/ml.
Wang, Yongwei; Du, Yali; Liu, Gang; Guo, Shanshan; Hou, Bo; Jiang, Xianyong; Han, Bing; Chang, Yanzhong; Nie, Guangjun
2017-04-01
Hereditary hemochromatosis (HH) is a group of inherited iron-overload disorders associated with pathogenic defects in the genes encoding hemochromatosis (HFE), hemojuvelin (HJV/HFE2), hepcidin (HAMP), transferrin receptor 2 (TfR2), and ferroportin (FPN1/SLC40A1) proteins, and the clinical features are well described. However, there have been only a few detailed reports of HH in Chinese populations. Thus, there is insufficient patient information for population-based analyses in Chinese populations or comparative studies among different ethical groups. In the current work, we describe eight Chinese cases of hereditary hemochromatosis. Gene sequencing results revealed eight mutations (five novel mutations) in HFE, HFE2, TfR2, and SLC40A1 genes in these Chinese HH patients. In addition, we used Polymorphism Phenotyping v2 (Polyphen), Sorting Intolerant From Tolerant (SIFT), and a sequence alignment program to predict the molecular consequences of missense mutations.
Folate Decorated Nanomicelles Loaded with a Potent Curcumin Analogue for Targeting Retinoblastoma
Directory of Open Access Journals (Sweden)
Hashem Alsaab
2017-04-01
Full Text Available The aim of this study was to develop a novel folate receptor-targeted drug delivery system for retinoblastoma cells using a promising anticancer agent, curcumin-difluorinated (CDF, loaded in polymeric micelles. Folic acid was used as a targeting moiety to enhance the targeting and bioavailability of CDF. For this purpose, amphiphilic poly(styrene-co-maleic acid-conjugated-folic acid (SMA-FA was synthesized and utilized to improve the aqueous solubility of a highly hydrophobic, but very potent anticancer compound, CDF, and its targeted delivery to folate overexpressing cancers. The SMA-FA conjugate was first synthesized and characterized by 1H NMR, FTIR and DSC. Furthermore, the chromatographic condition (HPLC for estimating CDF was determined and validated. The formulation was optimized to achieve maximum entrapment of CDF. The particle size of the micelles was measured and confirmed by dynamic light scattering (DLS and transmission electron microscopy (TEM. Cytotoxicity studies were conducted on (Y-79 and WERI-RB retinoblastoma cells. Results showed that the solubility of CDF could be increased with the newly-synthesized polymer, and the entrapment efficiency was >85%. The drug-loaded nanomicelles exhibited an appropriate size of <200 nm and a narrow size distribution. The formulation did not show any adverse cytotoxicity on a human retinal pigment epithelial cell (ARPE-19, indicating its safety. However, it showed significant cell killing activity in both Y-79 and WERI-RB retinoblastoma cell lines, indicating its potency in killing cancer cells. In conclusion, the folic acid-conjugated SMA loaded with CDF showed promising potential with high safety and pronounced anticancer activity on the tested retinoblastoma cell lines. The newly-formulated targeted nanomicelles thus could be a viable option as an alternative approach to current retinoblastoma therapies.
Dietary folate deficiency blocks prostate cancer progression in the TRAMP model.
Bistulfi, Gaia; Foster, Barbara A; Karasik, Ellen; Gillard, Bryan; Miecznikowski, Jeff; Dhiman, Vineet K; Smiraglia, Dominic J
2011-11-01
Dietary folate is essential in all tissues to maintain several metabolite pools and cellular proliferation. Prostate cells, due to specific metabolic characteristics, have increased folate demand to support proliferation and prevent genetic and epigenetic damage. Although several studies have found that dietary folate interventions can affect colon cancer biology in rodent models, its impact on prostate is unknown. The purpose of this study was to determine whether dietary folate manipulation, possibly being of primary importance for prostate epithelial cell metabolism, could significantly affect prostate cancer progression. Strikingly, mild dietary folate depletion arrested prostate cancer progression in 25 of 26 transgenic adenoma of the mouse prostate (TRAMP) mice, in which tumorigenesis is prostate-specific and characteristically aggressive. The significant effect on prostate cancer growth was characterized by size, grade, proliferation, and apoptosis analyses. Folate supplementation had a mild, nonsignificant, beneficial effect on grade. In addition, characterization of folate pools (correlated with serum), metabolite pools (polyamines and nucleotides), genetic and epigenetic damage, and expression of key biosynthetic enzymes in prostate tissue revealed interesting correlations with tumor progression. These findings indicate that prostate cancer is highly sensitive to folate manipulation and suggest that antifolates, paired with current therapeutic strategies, might significantly improve treatment of prostate cancer, the most commonly diagnosed cancer in American men.
International Nuclear Information System (INIS)
Anon.
1990-01-01
During January, Stanford's SLC Linear Collider began producing Z particles again after the major disruptions in October due to the Loma Prieta earthquake. What's more, the pulse repetition rate climbed smoothly from 60 to 120 Hz as part of the ongoing collider improvement programme. Although the SLC luminosity has not quite returned to its best pre-quake levels, the collider managed to produce enough Z particles to permit Mark II physicists to test their newly installed Vertex Detection System (VDS)
Performance of the SLC polarized electron source with high polarization
International Nuclear Information System (INIS)
Clendenin, J.E.; Alley, R.K.; Aoyagi, H.
1993-04-01
For the 1992 operating cycle of the SLAC Linear Collider (SLC), the polarized electron source (PES) during its maiden run successfully met the pulse intensity and overall efficiency requirements of the SLC. However, the polarization of the bulk GaAs cathode was low (∼27%) and the pulse-to-pulse stability was marginal. We have shown that adequate charge for the SLC can be extracted from a strained layer cathode having P e ∼80% even though the quantum efficiency (QE) is - beam stability. The performance of the PES during the 1993 SLC operating cycle with these and other improvements is discussed
Hearing loss associated with enlarged vestibular aqueduct and zero or one mutant allele of SLC26A4.
Rose, Jane; Muskett, Julie A; King, Kelly A; Zalewski, Christopher K; Chattaraj, Parna; Butman, John A; Kenna, Margaret A; Chien, Wade W; Brewer, Carmen C; Griffith, Andrew J
2017-07-01
To characterize the severity and natural history of hearing loss, and the prevalence of having a cochlear implant in a maturing cohort of individuals with enlarged vestibular aqueduct (EVA) and zero or one mutant allele of SLC26A4. Prospective cohort study of subjects ascertained between 1998 and 2015 at the National Institutes of Health Clinical Center. Study subjects were 127 individuals (median age, 8 years; range, 0-59 years) with EVA in at least one ear. Ears with EVA and zero or one mutant allele of SLC26A4 had mean 0.5/1/2/4-kHz pure-tone averages of 62.6 and 52.9 dB HL, respectively, in contrast to EVA ears with two mutant alleles of SLC26A4 (88.1 dB HL; P zero, one, and two mutant alleles, respectively (P = .00833). This association was not independent (P = .534) but reflected underlying correlations with age at time of first audiogram (P = .003) or severity of hearing loss (P = .000). Ears with EVA and zero or one mutant allele of SLC26A4 have less severe hearing loss, no difference in prevalence of fluctuation, and a lower prevalence of cochlear implantation in comparison to ears with two mutant alleles of SLC26A4. NA Laryngoscope, 127:E238-E243, 2017. © 2016 The American Laryngological, Rhinological and Otological Society, Inc.
Simultaneous radiodetermination of folate and vitamin B12
International Nuclear Information System (INIS)
Gutcho, S.; Mansbach, L.
1978-01-01
The invention concerns a method to simultaneously investigate or determine folate and vitamin B12. The differentiation between both compounds is based on the use of radioactive tracers; a radio-iodized folic acid is used as folate tracer; vitamin B12 can be labelled with 57 Co. (VJ) [de
De Grandis, Elisa; Stagnaro, Michela; Biancheri, Roberta; Giannotta, Melania; Gobbi, Giuseppe; Traverso, Monica; Veneselli, Edvige; Zara, Federico
2013-07-01
Alternating hemiplegia of childhood is a rare, predominantly sporadic disorder. Diagnosis is clinical, and little is known about genetics. Glucose transporter 1 deficiency syndrome shares with alternating hemiplegia of childhood paroxysmal and nonparoxysmal symptoms. The aim of the study was to investigate glucose transporter 1 mutations in 30 Italian patients. Genetic material was analyzed by DNA amplification and glucose transporter 1 region sequencing. Mutational analysis findings of the SLC2A1 gene were negative in all patients. The pattern of movement disorders was reviewed. Interictal dystonia and multiple paroxysmal events were typical of alternating hemiplegia of childhood. In conclusion, alternating hemiplegia of childhood is a heterogeneous clinical condition, and although glucose transporter 1 deficiency can represent an undiagnosed cause of this disorder, mutational analysis is not routinely recommended. Alternatively, a careful clinical analysis and the 3-O-methyl-D-glucose uptake test can allow prompt identification of a subgroup of patients with alternating hemiplegia of childhood treatable with a ketogenic diet.
SLAC-Linac-Collider (SLC) Project
International Nuclear Information System (INIS)
Wiedemann, H.
1981-02-01
The proposed SLAC Linear Collider Project (SLC) and its features are described in this paper. In times of ever increasing costs for energy the electron storage ring principle is about to reach its practical limit. A new class of colliding beam beam facilities, the Linear Colliders, are getting more and more attractive and affordable at very high center-of-mass energies. The SLC is designed to be a poineer of this new class of colliding beam facilities and at the same time will serve as a valuable tool to explore the high energy physics at the level of 100 GeV in the center-of-mass system