High-resolution genomic fingerprinting of Campylobacter jejuni and Campylobacter coli by analysis of amplified fragment length polymorphisms

DEFF Research Database (Denmark)

Kokotovic, Branko; On, Stephen L.W.

1999-01-01

A method for high-resolution genomic fingerprinting of the enteric pathogens Campylobacter jejuni and Campylobacter coli, based on the determination of amplified fragment length polymorphism, is described. The potential of this method for molecular epidemiological studies of these species...... is evaluated with 50 type, reference, and well-characterised field strains. Amplified fragment length polymorphism fingerprints comprised over 60 bands detected in the size range 35-500 bp. Groups of outbreak strains, replicate subcultures, and 'genetically identical' strains from humans, poultry and cattle......, proved indistinguishable by amplified fragment length polymorphism fingerprinting, but were differentiated fi-om unrelated isolates. Previously unknown relationships between three hippurate-negative C. jejuni strains, and two C. coil var, hyoilei strains, were identified. These relationships corresponded...

Isoschizomers and amplified fragment length polymorphism for the detection of specific cytosine methylation changes.

Science.gov (United States)

Ruiz-García, Leonor; Cabezas, Jose Antonio; de María, Nuria; Cervera, María-Teresa

2010-01-01

Different molecular techniques have been developed to study either the global level of methylated cytosines or methylation at specific gene sequences. One of them is a modification of the Amplified Fragment Length Polymorphism (AFLP) technique that has been used to study methylation of anonymous CCGG sequences in different fungi, plant and animal species. The main variation of this technique is based on the use of isoschizomers with different methylation sensitivity (such as HpaII and MspI) as a frequent cutter restriction enzyme. For each sample, AFLP analysis is performed using both EcoRI/HpaII and EcoRI/MspI digested samples. Comparative analysis between EcoRI/HpaII and EcoRI/MspI fragment patterns allows the identification of two types of polymorphisms: (1) "Methylation-insensitive polymorphisms" that show common EcoRI/HpaII and EcoRI/MspI patterns but are detected as polymorphic amplified fragments among samples; and (2) "Methylation-sensitive polymorphisms" that are associated with amplified fragments differing in their presence or absence or in their intensity between EcoRI/HpaII and EcoRI/MspI patterns. This chapter describes a detailed protocol of this technique and discusses modifications that can be applied to adjust the technology to different species of interest.

Human cDNA mapping using fluorescence in situ hybridization. Progress report, April 1--December 31, 1992

Energy Technology Data Exchange (ETDEWEB)

Korenberg, J.R.

1993-12-31

The ultimate goal of this proposal is to create a cDNA map of the human genome. Mapping is approached using the techniques of high resolution fluorescence in situ hybridization (FISH). This technology and the results of its application are designed to rapidly generate whole genome as tool box of expressed sequence to speed the identification of human disease genes. The results of this study are intended to dovetail with and to link the results of existing technologies for creating backbone YAC and genetic maps. In the first eight months, this approach will generate 60--80% of the expressed sequence map, the remainder expected to be derived through more long-term, labor-intensive, regional chromosomal gene searches or sequencing. The laboratory has made significant progress in the set-up phase, in mapping fetal and adult brain and other cDNAs, in testing a model system for directly linking genetic and physical maps using FISH with small fragments, in setting up a database, and in establishing the validity and throughput of the system.

Genetic diversity of Actinobacillus pleuropneumoniae assessed by amplified fragment length polymorphism analysis

DEFF Research Database (Denmark)

Kokotovic, Branko; Angen, Øystein

2007-01-01

Amplified fragment length polymorphism (AFLP) was evaluated as a method for genotypic characterization and subtyping within the bacterial species Actinobacillus pleuropneumoniae. A total of 155 isolates of A. pleuropneumoniae, representing the serotypic variation described to occur within...

Normalized cDNA libraries

Science.gov (United States)

Soares, Marcelo B.; Efstratiadis, Argiris

1997-01-01

This invention provides a method to normalize a directional cDNA library constructed in a vector that allows propagation in single-stranded circle form comprising: (a) propagating the directional cDNA library in single-stranded circles; (b) generating fragments complementary to the 3' noncoding sequence of the single-stranded circles in the library to produce partial duplexes; (c) purifying the partial duplexes; (d) melting and reassociating the purified partial duplexes to moderate Cot; and (e) purifying the unassociated single-stranded circles, thereby generating a normalized cDNA library.

Differential Gene Expression in Response to Papaya ringspot virus Infection in Cucumis metuliferus Using cDNA- Amplified Fragment Length Polymorphism Analysis

Science.gov (United States)

Lin, Chia-Wei; Chung, Chien-Hung; Chen, Jo-Chu; Yeh, Shy-Dong; Ku, Hsin-Mei

2013-01-01

A better understanding of virus resistance mechanisms can offer more effective strategies to control virus diseases. Papaya ringspot virus (PRSV), Potyviridae, causes severe economical losses in papaya and cucurbit production worldwide. However, no resistance gene against PRSV has been identified to date. This study aimed to identify candidate PRSV resistance genes using cDNA-AFLP analysis and offered an open architecture and transcriptomic method to study those transcripts differentially expressed after virus inoculation. The whole genome expression profile of Cucumis metuliferus inoculated with PRSV was generated using cDNA-amplified fragment length polymorphism (cDNA-AFLP) method. Transcript derived fragments (TDFs) identified from the resistant line PI 292190 may represent genes involved in the mechanism of PRSV resistance. C. metuliferus susceptible Acc. 2459 and resistant PI 292190 lines were inoculated with PRSV and subsequently total RNA was isolated for cDNA-AFLP analysis. More than 400 TDFs were expressed specifically in resistant line PI 292190. A total of 116 TDFs were cloned and their expression patterns and putative functions in the PRSV-resistance mechanism were further characterized. Subsequently, 28 out of 116 candidates which showed two-fold higher expression levels in resistant PI 292190 than those in susceptible Acc. 2459 after virus inoculation were selected from the reverse northern blot and bioinformatic analysis. Furthermore, the time point expression profiles of these candidates by northern blot analysis suggested that they might play roles in resistance against PRSV and could potentially provide valuable information for controlling PRSV disease in the future. PMID:23874746

Cloning and characterization of transferrin cDNA and rapid detection of transferrin gene polymorphism in rainbow trout (Oncorhynchus mykiss).

Science.gov (United States)

Tange, N; Jong-Young, L; Mikawa, N; Hirono, I; Aoki, T

1997-12-01

A cDNA clone of rainbow trout (Oncorhynchus mykiss) transferrin was obtained from a liver cDNA library. The 2537-bp cDNA sequence contained an open reading frame encoding 691 amino acids and the 5' and 3' noncoding regions. The amino acid sequences at the iron-binding sites and the two N-linked glycosylation sites, and the cysteine residues were consistent with known, conserved vertebrate transferrin cDNA sequences. Single N-linked glycosylation sites existed on the N- and C-lobe. The deduced amino acid sequence of the rainbow trout transferrin cDNA had 92.9% identities with transferrin of coho salmon (Oncorhynchus kisutch); 85%, Atlantic salmon (Salmo salar); 67.3%, medaka (Oryzias latipes); 61.3% Atlantic cod (Gadus morhua); and 59.7%, Japanese flounder (Paralichthys olivaceus). The long and accurate polymerase chain reaction (LA-PCR) was used to amplify approximately 6.5 kb of the transferrin gene from rainbow trout genomic DNA. Restriction fragment length polymorphisms (RFLPs) of the LA-PCR products revealed three digestion patterns in 22 samples.

AMPLIFIED FRAGMENT LENGTH POLYMORPHISM ANALYSIS OF MYCOBACTERIUM AVIUM COMPLEX ISOLATES RECOVERED FROM SOUTHERN CALIFORNIA

Science.gov (United States)

Fine-scale genotyping methods are necessary in order to identify possible sources of human exposure to opportunistic pathogens belonging to the Mycobacterium avium complex (MAC). In this study, amplified fragment length polymorphism (AFLP) analysis was evaluated for fingerprintin...

Fluorescent amplified fragment length polymorphism (FAFLP genotyping demonstrates the role of biofilm-producing methicillin-resistant periocular Staphylococcus epidermidis strains in postoperative endophthalmitis

Directory of Open Access Journals (Sweden)

Hasnain Seyed E

2006-01-01

Full Text Available Abstract Background An observational case series was used to study the virulence characteristics and genotypes of paired Staphylococcus epidermidis isolates cultured from intraocular samples and from periocular environment of patients with postcataract surgery endophthalmitis. Methods Eight S. epidermidis isolates were obtained from three patients (2 from patients #1 and 2 and 4 from patient #3 whose vitreous and/or anterior chamber (AC specimens and preoperative lid/conjunctiva samples were culture positive. Cultures were identified by API-Staph phenotypic identification system and genotypically characterized by Fluorescent Amplified Fragment Length Polymorphism (FAFLP and checked for their antimicrobial susceptibility. The isolates were tested for biofilm-production and methicillin-resistance (MR by PCR amplification of icaAB and mecA gene respectively. Results Four out of eight S. epidermidis strains showed multiple drug resistance (MDR. All the eight strains were PCR positive for mecA gene whereas seven out of eight strains were positive for icaAB genes. In all three patients FAFLP typing established vitreous isolates of S. epidermidis strains to be indistinguishable from the strains isolated from the patient's conjunctival swabs. However, from patient number three there was one isolate (1030b from lid swab, which appeared to be nonpathogenic and ancestral having minor but significant differences from other three strains from the same patient. This strain also lacked icaAB gene. In silico analysis indicated possible evolution of other strains from this strain in the patient. Conclusion Methicillin-resistant biofilm positive S. epidermidis strains colonizing the conjunctiva and eyelid were responsible for postoperative endophthalmitis (POE.

Cloning and characterization of a cDNA encoding topoisomerase II in pea and analysis of its expression in relation to cell proliferation.

Science.gov (United States)

Reddy, M K; Nair, S; Tewari, K K; Mudgil, Y; Yadav, B S; Sopory, S K

1999-09-01

We have isolated and sequenced four overlapping cDNA clones to identify the full-length cDNA for topoisomerase II (PsTopII) from pea. Using degenerate primers, based on the conserved amino acid sequences of other eukaryotic type II topoisomerases, a 680 bp fragment was PCR-amplified with pea cDNA as template. This fragment was used as a probe to screen an oligo-dT-primed pea cDNA library. A partial cDNA clone was isolated that was truncated at the 3' end. RACE-PCR was employed to isolate the remaining portion of the gene. The total size of PsTopII is 4639 bp with an open reading frame of 4392 bp. The deduced amino acid sequence shows a strong homology to other eukaryotic topoisomerase II (topo II) at the N-terminus end. The topo II transcript was abundant in proliferative tissues. We also show that the level of topo II transcripts could be stimulated by exogenous application of growth factors that induced proliferation in vitro cultures. Light irradiation to etiolated tissue strongly stimulated the expression of topo II. These results suggest that topo II gene expression is up-regulated in response to light and hormones and correlates with cell proliferation. Besides, we have also isolated and analysed the 5'-flanking region of the pea TopII gene. This is first report on the isolation of a putative promoter for topoisomerase II from plants.

Comparative Analysis of Human and Canine Campylobacter upsaliensis Isolates by Amplified Fragment Length Polymorphism

DEFF Research Database (Denmark)

Damborg, Peter; Guardabassi, Luca; Pedersen, Karl

2008-01-01

Human (n = 33) and canine (n = 53) Campylobacter upsaliensis isolates from seven countries were genotyped by a new amplified fragment length polymorphism method. We observed 100% typeability and high overall diversity. The majority of human strains (23/33) clustered separately from canine strains...

Genotyping and genetic diversity of Arcobacter butzleri by amplified fragment length polymorphism (AFLP) analysis

DEFF Research Database (Denmark)

On, Stephen L.W.; Atabay, H.I.; Amisu, K.O.

2004-01-01

Aims: To investigate the potential of amplified fragment length polymorphism (AFLP) profiling for genotyping Arcobacter butzleri and to obtain further data on the genetic diversity of this organism. Methods and Results: Seventy-three isolates of Danish, British, Turkish, Swedish, Nigerian and Nor...

Amplified fragment length polymorphism and pulsed field gel electrophoresis for subspecies differentiation of Serpulina pilosicoli

DEFF Research Database (Denmark)

Møller, Kristian; Jensen, Tim Kåre; Boye, Mette

1999-01-01

Pulsed field gel electrophoresis (PFGE) and amplified fragment length polymorphism (AFLP) were compared for their ability to differentiate between 50 porcine Serpulina pilosicoli isolates. Both techniques were highly sensitive, dividing the isolates into 36 and 38 groups, respectively. Due...

Application of Fluorescent Amplified Fragment Length Polymorphism for Comparison of Human and Animal Isolates of Yersinia enterocolitica

Science.gov (United States)

Fearnley, Catherine; On, Stephen L. W.; Kokotovic, Branko; Manning, Georgina; Cheasty, Tom; Newell, Diane G.

2005-01-01

An amplified fragment length polymorphism (AFLP) method, developed to genotype Yersinia enterocolitica, has been used to investigate 70 representative strains isolated from humans, pigs, sheep, and cattle in the United Kingdom. AFLP primarily distinguished Y. enterocolitica strains according to their biotype, with strains dividing into two distinct clusters: cluster A, comprising largely the putatively pathogenic biotypes (BT2 to -4), and cluster B, comprising the putatively nonpathogenic biotype 1A strains and a single BT1B isolate. Within these two clusters, subclusters formed largely on the basis of serotype. However, AFLP profiles also allowed differentiation of strains within these serotype-related subclusters, indicating the high discriminatory power of the technique for Y. enterocolitica. Investigation of the relationship between strain AFLP profile and host confirmed that pigs are, and provides further proof that sheep may be, potential sources of human infection with putatively pathogenic strains. However, the results suggest that some strains causing human disease do not come from veterinary sources identifiable at this time. The distribution of some BT1A isolates within cluster A raises questions about the relationship between virulence potential and biotype. PMID:16151073

Avoiding cross hybridization by choosing nonredundant targets on cDNA arrays

DEFF Research Database (Denmark)

Nielsen, Henrik Bjørn; Knudsen, Steen

2002-01-01

PROBEWIZ designs PCR primers for amplifying probes for cDNA arrays. The probes are designed to have minimal homology to other expressed sequences from a given organism. The primer selection is based on user-defined penalties for homology, primer quality, and proximity to the 3' end.......PROBEWIZ designs PCR primers for amplifying probes for cDNA arrays. The probes are designed to have minimal homology to other expressed sequences from a given organism. The primer selection is based on user-defined penalties for homology, primer quality, and proximity to the 3' end....

DNA methylation levels analysis in four tissues of sea cucumber Apostichopus japonicus based on fluorescence-labeled methylation-sensitive amplified polymorphism (F-MSAP) during aestivation.

Science.gov (United States)

Zhao, Ye; Chen, Muyan; Storey, Kenneth B; Sun, Lina; Yang, Hongsheng

2015-03-01

DNA methylation plays an important role in regulating transcriptional change in response to environmental stimuli. In the present study, DNA methylation levels of tissues of the sea cucumber Apostichopus japonicus were analyzed by the fluorescence-labeled methylation-sensitive amplified polymorphism (F-MSAP) technique over three stages of the aestivation cycle. Overall, a total of 26,963 fragments were amplified including 9112 methylated fragments among four sea cucumber tissues using 18 pairs of selective primers. Results indicated an average DNA methylation level of 33.79% for A. japonicus. The incidence of DNA methylation was different across tissue types in the non-aestivation stage: intestine (30.16%), respiratory tree (27.61%), muscle (27.94%) and body wall (56.25%). Our results show that hypermethylation accompanied deep-aestivation in A. japonicus, which suggests that DNA methylation may have an important role in regulating global transcriptional suppression during aestivation. Further analysis indicated that the main DNA modification sites were focused on intestine and respiratory tree tissues and that full-methylation but not hemi-methylation levels exhibited significant increases in the deep-aestivation stage. Copyright © 2014 Elsevier Inc. All rights reserved.

The function analysis of full-length cDNA sequence from IRM-2 mouse cDNA library

International Nuclear Information System (INIS)

Wang Qin; Liu Xiaoqiu; Xu Chang; Du Liqing; Sun Zhijuan; Wang Yan; Liu Qiang; Song Li; Li Jin; Fan Feiyue

2013-01-01

Objective: To identify the function of full-length cDNA sequence from IRM-2 mouse cDNA library. Methods: Full-length cDNA products were amplified by PCR from IRM-2 mouse cDNA library according to twenty-one pieces of expressed sequence tag. The expression of full-length cDNAs were detected after mouse embryonic fibroblasts were exposed to 6.5 Gy γ-ray radiation. And the effect on the growth of radiosensitivity cells AT5B1VA transfected with full-length cDNAs was investigated. Results: The expression of No.4, 5 and 2 full-length cDNAs from IRM-2 mouse were higher than that of parental ICR and 615 mouse after mouse embryonic fibroblasts irradiated with γ-ray radiation. And the survival rate of AT5B1VA cells transfected with No.4, 5 and 2 full-length cDNAs was high. Conclusion: No.4, 5 and 2 full-length cDNAs of IRM-2 mouse are of high radioresistance. (authors)

Reverse transcription using random pentadecamer primers increases yield and quality of resulting cDNA

DEFF Research Database (Denmark)

Stangegaard, Michael; Dufva, I.H.; Dufva, Hans Martin

2006-01-01

oligonucleotides (pentadecamers) consistently, yielded at least 2 fold as much cDNA as did random hexamers using either-poly(A) RNA or an amplified version of messenger RNA (aRNA) as a template. The cDNA generated using pentadecamers did not differ in size distribution or the amount of incorporated label compared...... with cDNA generated with random hexamers. The increased efficiency of priming using random pentadecamers resulted in reverse transcription of > 80% of the template aRNA, while random hexamers induced reverse transcription of only 40% of the template aRNA. This suggests a better coverage...... that random pentadecamers can replace random hexamers in reverse transcription reactions on both poly(A) RNA and amplified RNA, resulting in higher cDNA yields and quality....

Genomic variations of Mycoplasma capricolum subsp capripneumoniae detected by amplified fragment length polymorphism (AFLP) analysis

DEFF Research Database (Denmark)

Kokotovic, Branko; Bolske, G.; Ahrens, Peter

2000-01-01

The genetic diversity of Mycoplasma capricolum subsp. capripneumoniae strains based on determination of amplified fragment length polymorphisms (AFLP) is described. AFLP fingerprints of 38 strains derived from different countries in Africa and the Middle East consisted of over 100 bands in the size...

Use of Non-Normalized, Non-Amplified cDNA for 454-Based RNA Sequencing of Fleshy Melon Fruit

Directory of Open Access Journals (Sweden)

Vitaly Portnoy

2011-03-01

Full Text Available The melon ( L. fruit is an important crop and model system for the genomic study of both fleshy fruit development and the Cucurbitaceae family. To obtain an accurate representation of the melon fruit transcriptome based on expressed sequence tag (EST abundance in 454-pyrosequencing data, we prepared double-stranded complementary DNA (cDNA of melon without the usual amplification and normalization steps. A purification step was also included to eliminate small fragments. Complementary DNAs were obtained from 14 individual fruit libraries derived from two genotypes, separated into flesh and peel tissues, and sampled throughout fruit development. Pyrosequencing was performed using Genome Sequencer FLX (GS FLX technology, resulting in 1,215,359 reads, with mean length of >200 nucleotides. The global digital expression data was validated by comparative reverse transcription quantitative real-time polymerase chain reaction (RT-qPCR of 40 selected genes and expression patterns were similar for the two methods. The results indicate that high-quality, nonbiased cDNA for next-generation sequencing can be prepared from mature, fleshy fruit, which are notorious for difficulties in ribonucleic acid (RNA preparation.

Genomic Relatedness of Chlamydia Isolates Determined by Amplified Fragment Length Polymorphism Analysis

OpenAIRE

Meijer, Adam; Morré, Servaas A.; Van Den Brule, Adriaan J. C.; Savelkoul, Paul H. M.; Ossewaarde, Jacobus M.

1999-01-01

The genomic relatedness of 19 Chlamydia pneumoniae isolates (17 from respiratory origin and 2 from atherosclerotic origin), 21 Chlamydia trachomatis isolates (all serovars from the human biovar, an isolate from the mouse biovar, and a porcine isolate), 6 Chlamydia psittaci isolates (5 avian isolates and 1 feline isolate), and 1 Chlamydia pecorum isolate was studied by analyzing genomic amplified fragment length polymorphism (AFLP) fingerprints. The AFLP procedure was adapted from a previously...

Mass spectrometry-based cDNA profiling as a potential tool for human body fluid identification.

Science.gov (United States)

Donfack, Joseph; Wiley, Anissa

2015-05-01

Several mRNA markers have been exhaustively evaluated for the identification of human venous blood, saliva, and semen in forensic genetics. As new candidate human body fluid specific markers are discovered, evaluated, and reported in the scientific literature, there is an increasing trend toward determining the ideal markers for cDNA profiling of body fluids of forensic interest. However, it has not been determined which molecular genetics-based technique(s) should be utilized to assess the performance of these markers. In recent years, only a few confirmatory, mRNA/cDNA-based methods have been evaluated for applications in body fluid identification. The most frequently described methods tested to date include quantitative polymerase chain reaction (qPCR) and capillary electrophoresis (CE). However these methods, in particular qPCR, often favor narrow multiplex PCR due to the availability of a limited number of fluorescent dyes/tags. In an attempt to address this technological constraint, this study explored matrix-assisted laser desorption/ionization-time of flight mass spectrometry (MALDI-TOF MS) for human body fluid identification via cDNA profiling of venous blood, saliva, and semen. Using cDNA samples at 20pg input phosphoglycerate kinase 1 (PGK1) amounts, body fluid specific markers for the candidate genes were amplified in their corresponding body fluid (i.e., venous blood, saliva, or semen) and absent in the remaining two (100% specificity). The results of this study provide an initial indication that MALDI-TOF MS is a potential fluorescent dye-free alternative method for body fluid identification in forensic casework. However, the inherent issues of low amounts of mRNA, and the damage caused to mRNA by environmental exposures, extraction processes, and storage conditions are important factors that significantly hinder the implementation of cDNA profiling into forensic casework. Published by Elsevier Ireland Ltd.

Method for construction of normalized cDNA libraries

Science.gov (United States)

Soares, Marcelo B.; Efstratiadis, Argiris

1998-01-01

This invention provides a method to normalize a directional cDNA library constructed in a vector that allows propagation in single-stranded circle form comprising: (a) propagating the directional cDNA library in single-stranded circles; (b) generating fragments complementary to the 3' noncoding sequence of the single-stranded circles in the library to produce partial duplexes; (c) purifying the partial duplexes; (d) melting and reassociating the purified partial duplexes to appropriate Cot; and (e) purifying the unassociated single-stranded circles, thereby generating a normalized cDNA library. This invention also provides normalized cDNA libraries generated by the above-described method and uses of the generated libraries.

A putative peroxidase cDNA from turnip and analysis of the encoded protein sequence.

Science.gov (United States)

Romero-Gómez, S; Duarte-Vázquez, M A; García-Almendárez, B E; Mayorga-Martínez, L; Cervantes-Avilés, O; Regalado, C

2008-12-01

A putative peroxidase cDNA was isolated from turnip roots (Brassica napus L. var. purple top white globe) by reverse transcriptase-polymerase chain reaction (RT-PCR) and rapid amplification of cDNA ends (RACE). Total RNA extracted from mature turnip roots was used as a template for RT-PCR, using a degenerated primer designed to amplify the highly conserved distal motif of plant peroxidases. The resulting partial sequence was used to design the rest of the specific primers for 5' and 3' RACE. Two cDNA fragments were purified, sequenced, and aligned with the partial sequence from RT-PCR, and a complete overlapping sequence was obtained and labeled as BbPA (Genbank Accession No. AY423440, named as podC). The full length cDNA is 1167bp long and contains a 1077bp open reading frame (ORF) encoding a 358 deduced amino acid peroxidase polypeptide. The putative peroxidase (BnPA) showed a calculated Mr of 34kDa, and isoelectric point (pI) of 4.5, with no significant identity with other reported turnip peroxidases. Sequence alignment showed that only three peroxidases have a significant identity with BnPA namely AtP29a (84%), and AtPA2 (81%) from Arabidopsis thaliana, and HRPA2 (82%) from horseradish (Armoracia rusticana). Work is in progress to clone this gene into an adequate host to study the specific role and possible biotechnological applications of this alternative peroxidase source.

Effects of fluorescence excitation geometry on the accuracy of DNA fragment sizing by flow cytometry

Energy Technology Data Exchange (ETDEWEB)

Werner, James H. [Division of Bioscience, Los Alamos National Laboratory, Mail Stop M888, Los Alamos, New Mexico 87545-0001 (United States); Larson, Erica J. [Division of Bioscience, Los Alamos National Laboratory, Mail Stop M888, Los Alamos, New Mexico 87545-0001 (United States); Goodwin, Peter M. [Division of Bioscience, Los Alamos National Laboratory, Mail Stop M888, Los Alamos, New Mexico 87545-0001 (United States); Ambrose, W. Patrick [Division of Bioscience, Los Alamos National Laboratory, Mail Stop M888, Los Alamos, New Mexico 87545-0001 (United States); Keller, Richard A. [Division of Bioscience, Los Alamos National Laboratory, Mail Stop M888, Los Alamos, New Mexico 87545-0001 (United States)

2000-06-01

We report on various excitation geometries used in ultrasensitive flow cytometry that yield a linear relation between the fluorescence intensity measured from individual strained DNA fragments and the lengths of the fragments (in base pairs). This linearity holds for DNA samples that exhibit a wide range of conformations. The variety of DNA conformations leads to a distribution of dipole moment orientations for the dye molecules intercalated into the DNA. It is consequently important to use an excitation geometry such that all dye molecules are detected with similar efficiency. To estimate the conformation and the extent of elongation of the strained fragments in the flow, fluorescence polarization anisotropy and autocorrelation measurements were performed. Significant extension was observed for DNA fragments under the flow conditions frequently used for DNA fragment sizing. Classical calculations of the fluorescence emission collected over a finite solid angle are in agreement with the experimental measurements and have confirmed the relative insensitivity to DNA conformation of an orthogonal excitation geometry. Furthermore, the calculations suggested a modified excitation geometry that has increased our sizing resolution. (c) 2000 Optical Society of America.

Effects of fluorescence excitation geometry on the accuracy of DNA fragment sizing by flow cytometry

International Nuclear Information System (INIS)

Werner, James H.; Larson, Erica J.; Goodwin, Peter M.; Ambrose, W. Patrick; Keller, Richard A.

2000-01-01

We report on various excitation geometries used in ultrasensitive flow cytometry that yield a linear relation between the fluorescence intensity measured from individual strained DNA fragments and the lengths of the fragments (in base pairs). This linearity holds for DNA samples that exhibit a wide range of conformations. The variety of DNA conformations leads to a distribution of dipole moment orientations for the dye molecules intercalated into the DNA. It is consequently important to use an excitation geometry such that all dye molecules are detected with similar efficiency. To estimate the conformation and the extent of elongation of the strained fragments in the flow, fluorescence polarization anisotropy and autocorrelation measurements were performed. Significant extension was observed for DNA fragments under the flow conditions frequently used for DNA fragment sizing. Classical calculations of the fluorescence emission collected over a finite solid angle are in agreement with the experimental measurements and have confirmed the relative insensitivity to DNA conformation of an orthogonal excitation geometry. Furthermore, the calculations suggested a modified excitation geometry that has increased our sizing resolution. (c) 2000 Optical Society of America

Mass amplifying probe for sensitive fluorescence anisotropy detection of small molecules in complex biological samples.

Science.gov (United States)

Cui, Liang; Zou, Yuan; Lin, Ninghang; Zhu, Zhi; Jenkins, Gareth; Yang, Chaoyong James

2012-07-03

Fluorescence anisotropy (FA) is a reliable and excellent choice for fluorescence sensing. One of the key factors influencing the FA value for any molecule is the molar mass of the molecule being measured. As a result, the FA method with functional nucleic acid aptamers has been limited to macromolecules such as proteins and is generally not applicable for the analysis of small molecules because their molecular masses are relatively too small to produce observable FA value changes. We report here a molecular mass amplifying strategy to construct anisotropy aptamer probes for small molecules. The probe is designed in such a way that only when a target molecule binds to the probe does it activate its binding ability to an anisotropy amplifier (a high molecular mass molecule such as protein), thus significantly increasing the molecular mass and FA value of the probe/target complex. Specifically, a mass amplifying probe (MAP) consists of a targeting aptamer domain against a target molecule and molecular mass amplifying aptamer domain for the amplifier protein. The probe is initially rendered inactive by a small blocking strand partially complementary to both target aptamer and amplifier protein aptamer so that the mass amplifying aptamer domain would not bind to the amplifier protein unless the probe has been activated by the target. In this way, we prepared two probes that constitute a target (ATP and cocaine respectively) aptamer, a thrombin (as the mass amplifier) aptamer, and a fluorophore. Both probes worked well against their corresponding small molecule targets, and the detection limits for ATP and cocaine were 0.5 μM and 0.8 μM, respectively. More importantly, because FA is less affected by environmental interferences, ATP in cell media and cocaine in urine were directly detected without any tedious sample pretreatment. Our results established that our molecular mass amplifying strategy can be used to design aptamer probes for rapid, sensitive, and selective

Evaluation of genetic diversity in jackfruit (Artocarpus heterophyllus Lam.) based on amplified fragment length polymorphism markers.

Science.gov (United States)

Shyamalamma, S; Chandra, S B C; Hegde, M; Naryanswamy, P

2008-07-22

Artocarpus heterophyllus Lam., commonly called jackfruit, is a medium-sized evergreen tree that bears high yields of the largest known edible fruit. Yet, it has been little explored commercially due to wide variation in fruit quality. The genetic diversity and genetic relatedness of 50 jackfruit accessions were studied using amplified fragment length polymorphism markers. Of 16 primer pairs evaluated, eight were selected for screening of genotypes based on the number and quality of polymorphic fragments produced. These primer combinations produced 5976 bands, 1267 (22%) of which were polymorphic. Among the jackfruit accessions, the similarity coefficient ranged from 0.137 to 0.978; the accessions also shared a large number of monomorphic fragments (78%). Cluster analysis and principal component analysis grouped all jackfruit genotypes into three major clusters. Cluster I included the genotypes grown in a jackfruit region of Karnataka, called Tamaka, with very dry conditions; cluster II contained the genotypes collected from locations having medium to heavy rainfall in Karnataka; cluster III grouped the genotypes in distant locations with different environmental conditions. Strong coincidence of these amplified fragment length polymorphism-based groupings with geographical localities as well as morphological characters was observed. We found moderate genetic diversity in these jackfruit accessions. This information should be useful for tree breeding programs, as part of our effort to popularize jackfruit as a commercial crop.

Participation of ATM in cellular response to DNA damage induced by ionizing radiation

International Nuclear Information System (INIS)

Meng Xiangbing; Song Yi; Mao Jianping; Gong Bo; Dong Yan; Liu Bin; Sun Zhixian

2000-01-01

Objective: To clone ATM full length cDNA and cDNA fragments containing some functional domains and to identify proteins that interact with ATM and mediate DNA damage signal transduction in cellular response to DNA damage. Methods: ATM cDNA was amplified from MarthomTM-Ready cDNA kit of human leukocytes by LD-PCR. ATM-interacting proteins were screened by yeast two hybrid system. Results: ATM full-length cDNA and cDNA fragments containing PI3K kinase domain, leucine zipper and proline rich region were amplified from human cDNAs. Several candidate clones that interacted with ATM PI3K domain were identified. Conclusion: ATM mediates DNA damage signal transduction by interacting with many proteins

Construction and identification of subtracted cDNA library in bone marrow cells of radon-exposed mice

International Nuclear Information System (INIS)

Li Jianxiang; Nie Jihua; Tong Jian; Fu Chunling; Zhou Jianwei

2008-01-01

Objective: To construct and identify subtracted cDNA library in bone marrow cells of mice exposed to radon inhalation. Methods: Adult male BALB/c mice, weighing 18-22 g, were placed in a multi- functional radon chamber. One group of mice was exposed to radon up to the accumulative dose of 105 work level month (WLM). The control group of mice was housed in a room with an accumulative dose of 1 WLM. To construct a subtracted cDNA library enriched with differentially expressed genes, the SMART technique and the suppression subtractive hybridization were performed. The obtained forward and reverse cDNA fragments were directly inserted into pMD18-T vector and transformed into E. coli JM109. The inserting cDNA fragments were screened by the blue-and-white blot screening and nested PCR of bacterium liquid. Results: The 244 of 285 white bacteria clones obtained randomly were positive clones contained 100-1100 bp inserted cDNA fragments. Conclusions: The forward and reverse subtracted cDNA library in bone marrow cells of mice exposed to radon inhalation is successfully constructed. (authors)

Inheritance of restriction fragment length polymorphisms, random amplified polymorphic DNAs and isozymes in coastal Douglas-fir

Science.gov (United States)

K.D. Jermstad; A.M. Reem; J.R. Henifin; N.C. Wheeler; D.B Neale

1994-01-01

A total of 225 new genetic loci [151 restriction fragment length polymorphisms (RFLP) and 74 random amplified polymorphic DNAs (RAPD)] in coastal Douglas- fir [Pseudotsuga menziesii (Mirb.) Franco var. menziesii] have been identified using a three-generation outbred pedigree. The Mendelian inheritance of 16 RFLP loci and 29...

A secreted aspartic proteinase from Glomerella cingulata: purification of the enzyme and molecular cloning of the cDNA.

Science.gov (United States)

Clark, S J; Templeton, M D; Sullivan, P A

1997-04-01

A secreted aspartic proteinase from Glomerella cingulata (GcSAP) was purified to homogeneity by ion exchange chromatography. The enzyme has an M, of 36000 as estimated by SDS-PAGE, optimal activity from pH 3.5 to pH 4.0 and is inhibited by pepstatin. The N-terminal sequence, 23 residues long, was used to design a gene-specific primer. This was used in 3' RACE (rapid amplification of cDNA ends) PCR to amplify a 1.2 kb fragment of the gcsap cDNA. A second gene-specific primer was designed and used in 5' RACE PCR to clone the 5' region. This yielded a 600 bp DNA fragment and completed the open reading frame. The gcsap open reading frame encodes a protein with a 78 residue prepro-sequence typical of other fungal secreted aspartic proteinases. Based on the deduced sequence, the mature enzyme contains 329 amino acids and shows approximately 40% identity to other fungal aspartic proteinases. Subsequent cloning and sequencing of gcsap fragments obtained from PCR with genomic DNA revealed a 73 bp intron beginning at nt 728. Southern analyses at medium and high stringency indicated that G. cingulata possesses one gene for the secreted aspartic proteinase, and Northern blots indicated that gene expression was induced by exogenous protein and repressed by ammonium salts. GcSAP is a putative pathogenicity factor of G. cingulata, and it will now be possible to create SAP-mutants and assess the role GcSAP plays in pathogenicity.

利用 DDRT-PCR 鉴定芸芥自交不亲和系与自交亲和系的差异表达 cDNA%Identification of cDNA Fragments in Self-incompatible and Self-compatible Lines of Eruca sativa Mill.by DDRT-PCR

Institute of Scientific and Technical Information of China (English)

范惠玲; 白生文; 李华清; 孙万仓

2016-01-01

Yunjie is closely related to important vegetables an d oil seed crops,and can be considered a genetic resource for all Brassiceae crops.Self compatibility is an important variant traits to Yunjie.This study aimed to probe the expression organ of self-compatible gene and isolate cDNA fragments related to self-compatibility of Yunjie. Leaf,anther and stigma from self-incompatible (SI)and self-compatible (SC)lines of Yunjie were examined by DDRT-PCR.The results showed that the amplification pattern of leaves and anthers were the same in SI and SC lines.However,different bands were obtained in stigmas of SI and SC lines before and after flowering.SC gene of E. sativa was not showing constitutive expression but showed tissue-specific expression in stigma.Only two fragments were amplified in SC lines before flowering,the one was less than 100 bp,the other was 750 -1 000 bp.A 300 bp fragment was found unique to self-compatible line after flowering.These three cDNA fragments might be closely re-lated to the self-compatibility in Yunjie.In addition,two cDNA fragments were generated in SI line before flowering, one was 500 bp,the other was 750 bp.One band of 500 -600 bp was identified in SI line after flowering.These cDNA fragments could efficiently distinguish self-compatible and self-incompatible lines,and could also be useful for cloning self-compatible gene of Yunjie.%芸芥与芸薹属植物具有亲缘关系，也是芸薹属植物的重要育种资源。自交亲和性是芸芥的一种重要变异性状。为了探明芸芥自交亲和基因的表达器官，并分离与自交亲和性有关的 cDNA 片段，以芸芥的一对近等基因系，自交亲和系（SC）与自交不亲和系（SI）为试材，利用差异显示 RT-PCR �

Genotypic characterization of Salmonella by multilocus sequence typing, pulsed-field gel electrophoresis and amplified fragment length polymorphism

DEFF Research Database (Denmark)

Torpdahl, Mia; Skov, Marianne N.; Sandvang, Dorthe

2005-01-01

subspecies enterica isolates. A total of 25 serotypes were investigated that had been isolated from humans or veterinary sources in Denmark between 1995 and 2001. All isolates were genotyped by multilocus sequence typing (MLST), pulsed-field gel electrophoresis (PFGE) and amplified fragment length...

[cDNA library construction from panicle meristem of finger millet].

Science.gov (United States)

Radchuk, V; Pirko, Ia V; Isaenkov, S V; Emets, A I; Blium, Ia B

2014-01-01

The protocol for production of full-size cDNA using SuperScript Full-Length cDNA Library Construction Kit II (Invitrogen) was tested and high quality cDNA library from meristematic tissue of finger millet panicle (Eleusine coracana (L.) Gaertn) was created. The titer of obtained cDNA library comprised 3.01 x 10(5) CFU/ml in avarage. In average the length of cDNA insertion consisted about 1070 base pairs, the effectivity of cDNA fragment insertions--99.5%. The selective sequencing of cDNA clones from created library was performed. The sequences of cDNA clones were identified with usage of BLAST-search. The results of cDNA library analysis and selective sequencing represents prove good functionality and full length character of inserted cDNA clones. Obtained cDNA library from meristematic tissue of finger millet panicle represents good and valuable source for isolation and identification of key genes regulating metabolism and meristematic development and for mining of new molecular markers to conduct out high quality genetic investigations and molecular breeding as well.

Construction and application of a bovine immune-endocrine cDNA microarray.

Science.gov (United States)

Tao, Wenjing; Mallard, Bonnie; Karrow, Niel; Bridle, Byram

2004-09-01

A variety of commercial DNA arrays specific for humans and rodents are widely available; however, microarrays containing well-characterized genes to study pathway-specific gene expression are not as accessible for domestic animals, such as cattle, sheep and pigs. Therefore, a small-scale application-targeted bovine immune-endocrine cDNA array was developed to evaluate genetic pathways involved in the immune-endocrine axis of cattle during periods of altered homeostasis provoked by physiological or environmental stressors, such as infection, vaccination or disease. For this purpose, 167 cDNA sequences corresponding to immune, endocrine and inflammatory response genes were collected and categorized. Positive controls included 5 housekeeping genes (glyceraldehydes-3-phosphate dehydrogenase, hypoxanthine phosphoribosyltransferase, ribosomal protein L19, beta-actin, beta2-microglobulin) and bovine genomic DNA. Negative controls were a bacterial gene (Rhodococcus equi 17-kDa virulence-associated protein) and a partial sequence of the plasmid pACYC177. In addition, RNA extracted from un-stimulated, as well as superantigen (Staphylococcus aureus enterotoxin-A, S. aureus Cowan Pansorbin Cells) and mitogen-stimulated (LPS, ConA) bovine blood leukocytes was mixed, reverse transcribed and PCR amplified using gene-specific primers. The endocrine-associated genes were amplified from cDNA derived from un-stimulated bovine hypothalamus, pituitary, adrenal and thyroid gland tissues. The array was constructed in 4 repeating grids of 180 duplicated spots by coupling the PCR amplified 213-630 bp gene fragments onto poly-l-lysine coated glass slides. The bovine immune-endocrine arrays were standardized and preliminary gene expression profiles generated using Cy3 and Cy5 labelled cDNA from un-stimulated and ConA (5 microg/ml) stimulated PBMC of 4 healthy Holstein cows (2-4 replicate arrays/cow) in a time course study. Mononuclear cell-derived cytokine and chemokine (IL-2, IL-1alpha

[Recent advances of amplified fragment length polymorphism and its applications in forensic botany].

Science.gov (United States)

Li, Cheng-Tao; Li, Li

2008-10-01

Amplified fragment length polymorphism (AFLP) is a new molecular marker to detect genomic polymorphism. This new technology has advantages of high resolution, good stability, and reproducibility. Great achievements have been derived in recent years in AFLP related technologies with several AFLP expanded methodologies available. AFLP technology has been widely used in the fields of plant, animal, and microbes. It has become one of the hotspots in Forensic Botany. This review focuses on the recent advances of AFLP and its applications in forensic biology.

Genetic alterations of hepatocellular carcinoma by random amplified polymorphic DNA analysis and cloning sequencing of tumor differential DNA fragment

Science.gov (United States)

Xian, Zhi-Hong; Cong, Wen-Ming; Zhang, Shu-Hui; Wu, Meng-Chao

2005-01-01

AIM: To study the genetic alterations and their association with clinicopathological characteristics of hepatocellular carcinoma (HCC), and to find the tumor related DNA fragments. METHODS: DNA isolated from tumors and corresponding noncancerous liver tissues of 56 HCC patients was amplified by random amplified polymorphic DNA (RAPD) with 10 random 10-mer arbitrary primers. The RAPD bands showing obvious differences in tumor tissue DNA corresponding to that of normal tissue were separated, purified, cloned and sequenced. DNA sequences were analyzed and compared with GenBank data. RESULTS: A total of 56 cases of HCC were demonstrated to have genetic alterations, which were detected by at least one primer. The detestability of genetic alterations ranged from 20% to 70% in each case, and 17.9% to 50% in each primer. Serum HBV infection, tumor size, histological grade, tumor capsule, as well as tumor intrahepatic metastasis, might be correlated with genetic alterations on certain primers. A band with a higher intensity of 480 bp or so amplified fragments in tumor DNA relative to normal DNA could be seen in 27 of 56 tumor samples using primer 4. Sequence analysis of these fragments showed 91% homology with Homo sapiens double homeobox protein DUX10 gene. CONCLUSION: Genetic alterations are a frequent event in HCC, and tumor related DNA fragments have been found in this study, which may be associated with hepatocarcin-ogenesis. RAPD is an effective method for the identification and analysis of genetic alterations in HCC, and may provide new information for further evaluating the molecular mechanism of hepatocarcinogenesis. PMID:15996039

Technique for Increasing the Selectivity of the Method of Laser Fragmentation/Laser-Induced Fluorescence

Science.gov (United States)

Bobrovnikov, S. M.; Gorlov, E. V.; Zharkov, V. I.

2018-05-01

A technique for increasing the selectivity of the method of detecting high-energy materials (HEMs) based on laser fragmentation of HEM molecules with subsequent laser excitation of fluorescence of the characteristic NO fragments from the first vibrational level of the ground state is suggested.

Fluorescent hydroxylamine derived from the fragmentation of PAMAM dendrimers for intracellular hypochlorite recognition.

Science.gov (United States)

Wu, Te-Haw; Liu, Ching-Ping; Chien, Chih-Te; Lin, Shu-Yi

2013-08-26

Herein, a promising sensing approach based on the structure fragmentation of poly(amidoamine) (PAMAM) dendrimers for the selective detection of intracellular hypochlorite (OCl(-)) is reported. PAMAM dendrimers were easily disrupted by a cascade of oxidations in the tertiary amines of the dendritic core to produce an unsaturated hydroxylamine with blue fluorescence. Specially, the novel fluorophore was only sensitive to OCl(-), one of reactive oxygen species (ROS), resulting in an irreversible fluorescence turn-off. The fluorescent hydroxylamine was selectively oxidised by OCl(-) to form a labile oxoammonium cation that underwent further degradation. Without using any troublesomely synthetic steps, the novel sensing platform based on the fragmentation of PAMAM dendrimers, can be applied to detect OCl(-) in macrophage cells. The results suggest that the sensing approach may be useful for the detection of intracellular OCl(-) with minimal interference from biological matrixes. Copyright © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Second-strand cDNA synthesis: classical method

International Nuclear Information System (INIS)

Gubler, U.

1987-01-01

The classical scheme for the synthesis of double-stranded cDNA as it was reported in 1976 is described. Reverse transcription of mRNA with oligo(dT) as the primer generates first strands with a small loop at the 3' end of the cDNA (the end that corresponds to the 5' end of the mRNA). Subsequent removal of the mRNA by alkaline hydrolysis leaves single-stranded cDNA molecules again with a small 3' loop. This loop can be used by either reverse transcriptase or Klenow fragment of DNA polymerase I as a primer for second-strand synthesis. The resulting products are double-stranded cDNA molecules that are covalently closed at the end corresponding to the 5' end of the original mRNA. Subsequent cleavage of the short piece of single-stranded cDNA within the loop with the single-strand-specific S 1 nuclease generate open double-stranded molecules that can be used for molecular cloning in plasmids or in phage. Useful variations of this scheme have been described

Enhanced 1.32 μm fluorescence and broadband amplifying for O-band optical amplifier in Nd3+-doped tellurite glass

Science.gov (United States)

Zhou, Zi-zhong; Zhou, Ming-han; Su, Xiu-e.; Cheng, Pan; Zhou, Ya-xun

2017-01-01

WO3 oxides with relatively high phonon energy and different concentrations were introduced into the Nd3+-doped tellurite-based glasses of TeO2-ZnO-Na2O to improve the 1.32 μm band fluorescence emission. The absorption spectra, Raman spectra, 1.32 μm band fluorescence spectra and differential scanning calorimeter (DSC) curves were measured, together with the Judd-Ofelt intensity parameters, stimulated emission and gain parameters were calculated to evaluate the effects of WO3 amount on the glass structure and spectroscopic properties of 1.32 μm band fluorescence. It is shown that the introduction of an appropriate amount of WO3 oxide can effectively improve the 1.32 μm band fluorescence intensity through the enhanced multi-phonon relaxation (MPR) processes between the excited levels of Nd3+. The results indicate that the prepared Nd3+-doped tellurite glass with an appropriate amount of WO3 oxide is a potential gain medium applied for the O-band broad and high-gain fiber amplifier.

A rapid method for screening arrayed plasmid cDNA library by PCR

International Nuclear Information System (INIS)

Hu Yingchun; Zhang Kaitai; Wu Dechang; Li Gang; Xiang Xiaoqiong

1999-01-01

Objective: To develop a PCR-based method for rapid and effective screening of arrayed plasmid cDNA library. Methods: The plasmid cDNA library was arrayed and screened by PCR with a particular set of primers. Results: Four positive clones were obtained through about one week. Conclusion: This method can be applied to screening not only normal cDNA clones, but also cDNA clones-containing small size fragments. This method offers significant advantages over traditional screening method in terms of sensitivity, specificity and efficiency

Molecular cloning and characterization of a cDNA encoding the gibberellin biosynthetic enzyme ent-kaurene synthase B from pumpkin (Cucurbita maxima L.).

Science.gov (United States)

Yamaguchi, S; Saito, T; Abe, H; Yamane, H; Murofushi, N; Kamiya, Y

1996-08-01

The first committed step in the formation of diterpenoids leading to gibberellin (GA) biosynthesis is the conversion of geranylgeranyl diphosphate (GGDP) to ent-kaurene. ent-Kaurene synthase A (KSA) catalyzes the conversion of GGDP to copalyl diphosphate (CDP), which is subsequently converted to ent-kaurene by ent-kaurene synthase B (KSB). A full-length KSB cDNA was isolated from developing cotyledons in immature seeds of pumpkin (Cucurbita maxima L.). Degenerate oligonucleotide primers were designed from the amino acid sequences obtained from the purified protein to amplify a cDNA fragment, which was used for library screening. The isolated full-length cDNA was expressed in Escherichia coli as a fusion protein, which demonstrated the KSB activity to cyclize [3H]CDP to [3H]ent-kaurene. The KSB transcript was most abundant in growing tissues, but was detected in every organ in pumpkin seedlings. The deduced amino acid sequence shares significant homology with other terpene cyclases, including the conserved DDXXD motif, a putative divalent metal ion-diphosphate complex binding site. A putative transit peptide sequence that may target the translated product into the plastids is present in the N-terminal region.

Human cDNA mapping using fluorescence in situ hybridization

Energy Technology Data Exchange (ETDEWEB)

Korenberg, J.R.

1993-03-04

Genetic mapping is approached using the techniques of high resolution fluorescence in situ hybridization (FISH). This technology and the results of its application are designed to rapidly generate whole genome as tool box of expressed sequence to speed the identification of human disease genes. The results of this study are intended to dovetail with and to link the results of existing technologies for creating backbone YAC and genetic maps. In the first eight months, this approach generated 60--80% of the expressed sequence map, the remainder expected to be derived through more long-term, labor-intensive, regional chromosomal gene searches or sequencing. The laboratory has made significant progress in the set-up phase, in mapping fetal and adult brain and other cDNAs, in testing a model system for directly linking genetic and physical maps using FISH with small fragments, in setting up a database, and in establishing the validity and throughput of the system.

Combining random gene fission and rational gene fusion to discover near-infrared fluorescent protein fragments that report on protein-protein interactions.

Science.gov (United States)

Pandey, Naresh; Nobles, Christopher L; Zechiedrich, Lynn; Maresso, Anthony W; Silberg, Jonathan J

2015-05-15

Gene fission can convert monomeric proteins into two-piece catalysts, reporters, and transcription factors for systems and synthetic biology. However, some proteins can be challenging to fragment without disrupting function, such as near-infrared fluorescent protein (IFP). We describe a directed evolution strategy that can overcome this challenge by randomly fragmenting proteins and concomitantly fusing the protein fragments to pairs of proteins or peptides that associate. We used this method to create libraries that express fragmented IFP as fusions to a pair of associating peptides (IAAL-E3 and IAAL-K3) and proteins (CheA and CheY) and screened for fragmented IFP with detectable near-infrared fluorescence. Thirteen novel fragmented IFPs were identified, all of which arose from backbone fission proximal to the interdomain linker. Either the IAAL-E3 and IAAL-K3 peptides or CheA and CheY proteins could assist with IFP fragment complementation, although the IAAL-E3 and IAAL-K3 peptides consistently yielded higher fluorescence. These results demonstrate how random gene fission can be coupled to rational gene fusion to create libraries enriched in fragmented proteins with AND gate logic that is dependent upon a protein-protein interaction, and they suggest that these near-infrared fluorescent protein fragments will be suitable as reporters for pairs of promoters and protein-protein interactions within whole animals.

Characterization of a human MSX-2 cDNA and its fragment isolated as a transformation suppressor gene against v-Ki-ras oncogene.

Science.gov (United States)

Takahashi, C; Akiyama, N; Matsuzaki, T; Takai, S; Kitayama, H; Noda, M

1996-05-16

A cDNA (termed CT124) encoding a carboxyl-terminal fragment of the human homeobox protein MSX-2 was found to induce flat reversion when expressed in v-Ki-ras-transformed NIH3T3 cells. Although the expression of endogenous MSX-2 gene is low in most of the normal adult tissues examined, it is frequently activated in carcinoma-derived cell lines. Likewise, the gene is inactive in NIH3T3 cells but is transcriptionally activated after transformation by v-Ki-ras oncogene, suggesting that the intact MSX-2 may play a positive, rather than suppressive, role in cell transformation. To test this possibility, we isolated a near full-length human MSX-2 cDNA and tested its activities in two cell systems, i.e. fibroblast and myoblast. In NIH3T3 fibroblasts, although the gene by itself failed to confer a transformed phenotype, antisense MSX-2 cDNA as well as truncated CT124 cDNA interfered with the transforming activities of v-Ki-ras oncogene. In C2C12 myoblasts, MSX-2 was found to suppress MyoD gene expression, as do activated ras oncogenes, under certain culture conditions, and CT124 was found to inhibit the activities of both MSX-2 and ras in this system as well. Our findings not only suggest that CT124 may act as a dominant suppressor of MSX-2 but also raise the possibility that MSX-2 gene may be an important downstream target for the Ras signaling pathways.

[Preparation of the cDNA microarray on the differential expressed cDNA of senescence-accelerated mouse's hippocampus].

Science.gov (United States)

Cheng, Xiao-Rui; Zhou, Wen-Xia; Zhang, Yong-Xiang

2006-05-01

Alzheimer' s disease (AD) is the most common form of dementia in the elderly. AD is an invariably fatal neurodegenerative disorder with no effective treatment. Senescence-accelerated mouse prone 8 (SAMP8) is a model for studying age-related cognitive impairments and also is a good model to study brain aging and one of mouse model of AD. The technique of cDNA microarray can monitor the expression levels of thousands of genes simultaneously and can be used to study AD with the character of multi-mechanism, multi-targets and multi-pathway. In order to disclose the mechanism of AD and find the drug targets of AD, cDNA microarray containing 3136 cDNAs amplified from the suppression subtracted cDNA library of hippocampus of SAMP8 and SAMR1 was prepared with 16 blocks and 14 x 14 pins, the housekeeping gene beta-actin and G3PDH as inner conference. The background of this microarray was low and unanimous, and dots divided evenly. The conditions of hybridization and washing were optimized during the hybridization of probe and target molecule. After the data of hybridization analysis, the differential expressed cDNAs were sequenced and analyzed by the bioinformatics, and some of genes were quantified by the real time RT-PCR and the reliability of this cDNA microarray were validated. This cDNA microarray may be the good means to select the differential expressed genes and disclose the molecular mechanism of SAMP8's brain aging and AD.

FragIdent--automatic identification and characterisation of cDNA-fragments.

Science.gov (United States)

Seelow, Dominik; Goehler, Heike; Hoffmann, Katrin

2009-03-02

Many genetic studies and functional assays are based on cDNA fragments. After the generation of cDNA fragments from an mRNA sample, their content is at first unknown and must be assigned by sequencing reactions or hybridisation experiments. Even in characterised libraries, a considerable number of clones are wrongly annotated. Furthermore, mix-ups can happen in the laboratory. It is therefore essential to the relevance of experimental results to confirm or determine the identity of the employed cDNA fragments. However, the manual approach for the characterisation of these fragments using BLAST web interfaces is not suited for larger number of sequences and so far, no user-friendly software is publicly available. Here we present the development of FragIdent, an application for the automatic identification of open reading frames (ORFs) within cDNA-fragments. The software performs BLAST analyses to identify the genes represented by the sequences and suggests primers to complete the sequencing of the whole insert. Gene-specific information as well as the protein domains encoded by the cDNA fragment are retrieved from Internet-based databases and included in the output. The application features an intuitive graphical interface and is designed for researchers without any bioinformatics skills. It is suited for projects comprising up to several hundred different clones. We used FragIdent to identify 84 cDNA clones from a yeast two-hybrid experiment. Furthermore, we identified 131 protein domains within our analysed clones. The source code is freely available from our homepage at http://compbio.charite.de/genetik/FragIdent/.

Recognition of Y Fragment Deletion by Genotyping Graphs after Amplified by PowerPlex® 21 Detection Kit.

Science.gov (United States)

Wang, S C; Ding, M M; Wei, X L; Zhang, T; Yao, F

2016-06-01

To recognize the possibility of Y fragment deletion of Amelogenin gene intuitively and simply according to the genotyping graphs. By calculating the ratio of total peak height of genotyping graphs, the statistics of equilibrium distribution between Amelogenin and D3S1358 loci, Amelogenin X-gene and Amelogenin Y-gene, and different alleles of D3S1358 loci from 1 968 individuals was analyzed after amplified by PowerPlex ® 21 detection kit. Sum of peak height of Amelogenin X allele was not less than 60% that of D3S1358 loci alleles in 90.8% female samples, and sum of peak height of Amelogenin X allele was not higher than 70% that of D3S1358 loci alleles in 94.9% male samples. The result of genotyping after amplified by PowerPlex ® 21 detection kit shows that the possibility of Y fragment deletion should be considered when only Amelogenin X-gene of Amelogenin is detected and the peak height of Amelogenin X-gene is not higher than 70% of the total peak height of D3S1358 loci. Copyright© by the Editorial Department of Journal of Forensic Medicine

Genetic variation among isolates of Sarcocystis neurona, the agent of protozoal myeloencephalitis, as revealed by amplified fragment length polymorphism markers.

Science.gov (United States)

Elsheikha, H M; Schott, H C; Mansfield, L S

2006-06-01

Sarcocystis neurona causes serious neurological disease in horses and other vertebrates in the Americas. Based on epidemiological data, this parasite has recently emerged. Here, the genetic diversity of Sarcocystis neurona was evaluated using the amplified fragment length polymorphism (AFLP) method. Fifteen S. neurona taxa from different regions collected over the last 10 years were used; six isolates were from clinically diseased horses, eight isolates were from wild-caught opossums (Didelphis virginiana), and one isolate was from a cowbird (Molothrus ater). Additionally, four outgroup taxa were also fingerprinted. Nine primer pairs were used to generate AFLP patterns, with a total number of amplified fragments ranging from 30 to 60, depending on the isolate and primers tested. Based on the presence/absence of amplified AFLP fragments and pairwise similarity values, all the S. neurona isolates tested were clustered in one monophyletic group. No significant correlation could be found between genomic similarity and host origin of the S. neurona isolates. AFLP revealed significant intraspecific genetic variations, and S. neurona appeared as a highly variable species. Furthermore, linkage disequilibrium analysis suggested that S. neurona populations within Michigan have an intermediate type of population structure that includes characteristics of both clonal and panamictic population structures. AFLP is a reliable molecular technique that has provided one of the most informative approaches to ascertain phylogenetic relationships in S. neurona and its closest relatives, allowing them to be clustered by relative similarity using band matching and unweighted pair group method with arithmetic mean analysis, which may be applicable to other related protozoal species.

Sequence of a cloned cDNA encoding human ribosomal protein S11

Energy Technology Data Exchange (ETDEWEB)

Lott, J B; Mackie, G A

1988-02-11

The authors have isolated a cloned cDNA that encodes human ribosomal protein (rp) S11 by screening a human fibroblast cDNA library with a labelled 204 bp DNA fragment encompassing residues 212-416 of pRS11, a rat rp Sll cDNA clone. The human rp S11 cloned cDNA consists of 15 residues of the 5' leader, the entire coding sequence and all 51 residues of the 3' untranslated region. The predicted amino acid sequence of 158 residues is identical to rat rpS11. The nucleotide sequence in the coding region differs, however, from that in rat in the first position in two codons and in the third position in 44 codons.

Genetic and epigenetic diversity and structure of Phragmites australis from local habitats of the Songnen Prairie using amplified fragment length polymorphism markers.

Science.gov (United States)

Qiu, T; Jiang, L L; Yang, Y F

2016-08-19

The genetic and epigenetic diversity and structure of naturally occurring Phragmites australis populations occupying two different habitats on a small spatial scale in the Songnen Prairie in northeastern China were investigated by assessing amplified fragment length polymorphisms (AFLPs) and methylation-sensitive amplified polymorphisms (MSAPs) through fluorescent capillary detection. The two groups of P. australis were located in a seasonal waterlogged low-lying and alkalized meadow with a pH of 8-8.5 and in an alkaline patch without accumulated rainwater and with a pH greater than 10. These groups showed high levels of genetic diversity at the habitat level based on the percentage of polymorphic bands (90.32, 82.56%), Nei's gene diversity index (0.262, 0.248), and the Shannon diversity index (0.407, 0.383). Although little is known about the between-habitat genetic differentiation of P. australis on a small spatial scale, our results implied significant genetic differentiation between habitats. Extensive epigenetic diversity within habitats, along with clear differentiation, was found. Specifically, the former habitat (Habitat 1, designated H1) harbored higher levels of genetic and epigenetic diversity than the latter (Habitat 2, designated H2), and population-level diversity was also high. This study represents one of few attempts to predict habitat-based genetic differentiation of reeds on a small scale. These assessments of genetic and epigenetic variation are integral aspects of molecular ecological studies on P. australis. Possible causes for within- and between-habitat genetic and epigenetic variations are discussed.

Construction of C35 gene bait recombinants and T47D cell cDNA library.

Science.gov (United States)

Yin, Kun; Xu, Chao; Zhao, Gui-Hua; Liu, Ye; Xiao, Ting; Zhu, Song; Yan, Ge

2017-11-20

C35 is a novel tumor biomarker associated with metastasis progression. To investigate the interaction factors of C35 in its high expressed breast cancer cell lines, we constructed bait recombinant plasmids of C35 gene and T47D cell cDNA library for yeast two-hybrid screening. Full length C35 sequences were subcloned using RT-PCR from cDNA template extracted from T47D cells. Based on functional domain analysis, the full-length C35 1-348bp was also truncated into two fragments C351-153bp and C35154-348bp to avoid auto-activation. The three kinds of C35 genes were successfully amplified and inserted into pGBKT7 to construct bait recombinant plasmids pGBKT7-C351-348bp, pGBKT7-C351-153bp and pGBKT7-C35154-348bp, then transformed into Y187 yeast cells by the lithium acetate method. Auto-activation and toxicity of C35 baits were detected using nutritional deficient medium and X-α-Gal assays. The T47D cell ds cDNA was generated by SMART TM technology and the library was constructed using in vivo recombination-mediated cloning in the AH109 yeast strain using a pGADT7-Rec plasmid. The transformed Y187/pGBKT7-C351-348bp line was intensively inhibited while the truncated Y187/pGBKT7-C35 lines had no auto-activation and toxicity in yeast cells. The titer of established cDNA library was 2 × 10 7 pfu/mL with high transformation efficiency of 1.4 × 10 6 , and the insert size of ds cDNA was distributed homogeneously between 0.5-2.0 kb. Our research generated a T47D cell cDNA library with high titer, and the constructed two C35 "baits" contained a respective functional immunoreceptor tyrosine based activation motif (ITAM) and the conserved last four amino acids Cys-Ile-Leu-Val (CILV) motif, and therefore laid a foundation for screening the C35 interaction factors in a BC cell line.

Genotyping of human and porcine Yersinia enterocolitica, Yersinia intertmedia, and Yersinia bercovieri strains from Switzerland by amplified fragment length polymorphism analysis

DEFF Research Database (Denmark)

Kuehni-Boghenbor, Kathrin; On, Stephen L.W.; Kokotovic, Branko

2006-01-01

In this study, 231 strains of Yersinia enterocolitica, 25 strains of Y. intermedia, and 10 strains of Y. bercovieri from human and porcine sources (including reference strains) were analyzed using amplified fragment length polymorphism (AFLP), a whole-genome fingerprinting method for subtyping...

Cloning of low dose radiation induced gene RIG1 by RACE based on non-cloned cDNA library

International Nuclear Information System (INIS)

Luo Ying; Sui Jianli; Tie Yi; Zhang Yuanping; Zhou Pingkun; Sun Zhixian

2001-01-01

Objective: To obtain full-length cDNA of radiation induced new gene RIG1 based on its EST fragment. Methods: Based on non-cloned cDNA library, enhanced nested RACE PCR and biotin-avidin labelled probe for magnetic bead purification was used to obtain full-length cDNA of RIG1. Results: About 1 kb of 3' end of RIG1 gene was successfully cloned by this set of methods and cloning of RIG1 5' end is proceeding well. Conclusion: The result is consistent with the design of experiment. This set of protocol is useful for cloning of full-length gene based on EST fragment

Sequence of a cDNA encoding turtle high mobility group 1 protein.

Science.gov (United States)

Zheng, Jifang; Hu, Bi; Wu, Duansheng

2005-07-01

In order to understand sequence information about turtle HMG1 gene, a cDNA encoding HMG1 protein of the Chinese soft-shell turtle (Pelodiscus sinensis) was amplified by RT-PCR from kidney total RNA, and was cloned, sequenced and analyzed. The results revealed that the open reading frame (ORF) of turtle HMG1 cDNA is 606 bp long. The ORF codifies 202 amino acid residues, from which two DNA-binding domains and one polyacidic region are derived. The DNA-binding domains share higher amino acid identity with homologues sequences of chicken (96.5%) and mammalian (74%) than homologues sequence of rainbow trout (67%). The polyacidic region shows 84.6% amino acid homology with the equivalent region of chicken HMG1 cDNA. Turtle HMG1 protein contains 3 Cys residues located at completely conserved positions. Conservation in sequence and structure suggests that the functions of turtle HMG1 cDNA may be highly conserved during evolution. To our knowledge, this is the first report of HMG1 cDNA sequence in any reptilian.

FragIdent – Automatic identification and characterisation of cDNA-fragments

Directory of Open Access Journals (Sweden)

Goehler Heike

2009-03-01

Full Text Available Abstract Background Many genetic studies and functional assays are based on cDNA fragments. After the generation of cDNA fragments from an mRNA sample, their content is at first unknown and must be assigned by sequencing reactions or hybridisation experiments. Even in characterised libraries, a considerable number of clones are wrongly annotated. Furthermore, mix-ups can happen in the laboratory. It is therefore essential to the relevance of experimental results to confirm or determine the identity of the employed cDNA fragments. However, the manual approach for the characterisation of these fragments using BLAST web interfaces is not suited for larger number of sequences and so far, no user-friendly software is publicly available. Results Here we present the development of FragIdent, an application for the automatic identification of open reading frames (ORFs within cDNA-fragments. The software performs BLAST analyses to identify the genes represented by the sequences and suggests primers to complete the sequencing of the whole insert. Gene-specific information as well as the protein domains encoded by the cDNA fragment are retrieved from Internet-based databases and included in the output. The application features an intuitive graphical interface and is designed for researchers without any bioinformatics skills. It is suited for projects comprising up to several hundred different clones. Conclusion We used FragIdent to identify 84 cDNA clones from a yeast two-hybrid experiment. Furthermore, we identified 131 protein domains within our analysed clones. The source code is freely available from our homepage at http://compbio.charite.de/genetik/FragIdent/.

Cloning and sequencing of Indian Water buffalo (Bubalus bubalis) interleukin-3 cDNA

KAUST Repository

Sugumar, Thennarasu; Harishankar, M.; Dhinakar Raj, G.

2011-01-01

Full-length cDNA (435 bp) of the interleukin-3(IL-3) gene of the Indian water buffalo was amplified by reverse transcriptase-polymerase chain reaction and sequenced. This sequence had 96% nucleotide identity and 92% amino acid identity with bovine

Characterization of Mycoplasma hyosynoviae strains by amplified fragment length polymorphism analysis, pulsed-field gel electrophoresis and 16S ribosomal DNA sequencing

DEFF Research Database (Denmark)

Kokotovic, Branko; Friis, N.F.; Ahrens, Peter

2002-01-01

, were investigated by analysis of amplified fragment length polymorphisms of the Bgl II and Mfe I restriction sites and by pulsed-field gel electrophoresis of a Bss HII digest of chromosomal DNA. Both methods allowed unambiguous differentiation of the analysed strains and showed similar discriminatory...

Constructing and detecting a cDNA library for mites.

Science.gov (United States)

Hu, Li; Zhao, YaE; Cheng, Juan; Yang, YuanJun; Li, Chen; Lu, ZhaoHui

2015-10-01

RNA extraction and construction of complementary DNA (cDNA) library for mites have been quite challenging due to difficulties in acquiring tiny living mites and breaking their hard chitin. The present study is to explore a better method to construct cDNA library for mites that will lay the foundation on transcriptome and molecular pathogenesis research. We selected Psoroptes cuniculi as an experimental subject and took the following steps to construct and verify cDNA library. First, we combined liquid nitrogen grinding with TRIzol for total RNA extraction. Then, switching mechanism at 5' end of the RNA transcript (SMART) technique was used to construct full-length cDNA library. To evaluate the quality of cDNA library, the library titer and recombination rate were calculated. The reliability of cDNA library was detected by sequencing and analyzing positive clones and genes amplified by specific primers. The results showed that the RNA concentration was 836 ng/μl and the absorbance ratio at 260/280 nm was 1.82. The library titer was 5.31 × 10(5) plaque-forming unit (PFU)/ml and the recombination rate was 98.21%, indicating that the library was of good quality. In the 33 expressed sequence tags (ESTs) of P. cuniculi, two clones of 1656 and 1658 bp were almost identical with only three variable sites detected, which had an identity of 99.63% with that of Psoroptes ovis, indicating that the cDNA library was reliable. Further detection by specific primers demonstrated that the 553-bp Pso c II gene sequences of P. cuniculi had an identity of 98.56% with those of P. ovis, confirming that the cDNA library was not only reliable but also feasible.

Construction of high-quality Caco-2 three-frame cDNA library and its application to yeast two-hybrid for the human astrovirus protein-protein interaction.

Science.gov (United States)

Zhao, Wei; Li, Xin; Liu, Wen-Hui; Zhao, Jian; Jin, Yi-Ming; Sui, Ting-Ting

2014-09-01

Human epithelial colorectal adenocarcinoma (Caco-2) cells are widely used as an in vitro model of the human small intestinal mucosa. Caco-2 cells are host cells of the human astrovirus (HAstV) and other enteroviruses. High quality cDNA libraries are pertinent resources and critical tools for protein-protein interaction research, but are currently unavailable for Caco-2 cells. To construct a three-open reading frame, full length-expression cDNA library from the Caco-2 cell line for application to HAstV protein-protein interaction screening, total RNA was extracted from Caco-2 cells. The switching mechanism at the 5' end of the RNA transcript technique was used for cDNA synthesis. Double-stranded cDNA was digested by Sfi I and ligated to reconstruct a pGADT7-Sfi I three-frame vector. The ligation mixture was transformed into Escherichia coli HST08 premium electro cells by electroporation to construct the primary cDNA library. The library capacity was 1.0×10(6)clones. Gel electrophoresis results indicated that the fragments ranged from 0.5kb to 4.2kb. Randomly picked clones show that the recombination rate was 100%. The three-frame primary cDNA library plasmid mixture (5×10(5)cfu) was also transformed into E. coli HST08 premium electro cells, and all clones were harvested to amplify the cDNA library. To detect the sufficiency of the cDNA library, HAstV capsid protein as bait was screened and tested against the Caco-2 cDNA library by a yeast two-hybrid (Y2H) system. A total of 20 proteins were found to interact with the capsid protein. These results showed that a high-quality three-frame cDNA library from Caco-2 cells was successfully constructed. This library was efficient for the application to the Y2H system, and could be used for future research. Copyright © 2014 Elsevier B.V. All rights reserved.

Isolation of CYP3A5P cDNA from human liver: a reflection of a novel cytochrome P-450 pseudogene.

Science.gov (United States)

Schuetz, J D; Guzelian, P S

1995-03-14

We have isolated, from a human liver cDNA library, a 1627 bp CYP3A5 cDNA variant (CYP3A5P) that contains several large insertions, deletions, and in-frame termination codons. By comparison with the genomic structure of other CYP3A genes, the major insertions in CYP3A5P cDNA demarcate the inferred sites of several CYP3A5 exons. The segments inserted in CYP3A5P have no homology with splice donor acceptor sites. It is unlikely that CYP3A5P cDNA represents an artifact of the cloning procedures since Southern blot analysis of human genomic DNA disclosed that CYP3A5P cDNA hybridized with a DNA fragment distinct from fragments that hybridized with either CYP3A5, CYP3A3 or CYP3A4. Moreover, analysis of adult human liver RNA on Northern blots hybridized with a CYP3A5P cDNA fragment revealed the presence of an mRNA with the predicted size of CYP3A5P. We conclude that CYP3A5P cDNA was derived from a separate gene, CYP3A5P, most likely a pseudogene evolved from CYP3A5.

Cloning and Sequencing of Protein Kinase cDNA from Harbor Seal (Phoca vitulina Lymphocytes

Directory of Open Access Journals (Sweden)

Jennifer C. C. Neale

2004-01-01

Full Text Available Protein kinases (PKs play critical roles in signal transduction and activation of lymphocytes. The identification of PK genes provides a tool for understanding mechanisms of immunotoxic xenobiotics. As part of a larger study investigating persistent organic pollutants in the harbor seal and their possible immunomodulatory actions, we sequenced harbor seal cDNA fragments encoding PKs. The procedure, using degenerate primers based on conserved motifs of human protein tyrosine kinases (PTKs, successfully amplified nine phocid PK gene fragments with high homology to human and rodent orthologs. We identified eight PTKs and one dual (serine/threonine and tyrosine kinase. Among these were several PKs important in early signaling events through the B- and T-cell receptors (FYN, LYN, ITK and SYK and a MAP kinase involved in downstream signal transduction. V-FGR, RET and DDR2 were also expressed. Sequential activation of protein kinases ultimately induces gene transcription leading to the proliferation and differentiation of lymphocytes critical to adaptive immunity. PKs are potential targets of bioactive xenobiotics, including persistent organic pollutants of the marine environment; characterization of these molecules in the harbor seal provides a foundation for further research illuminating mechanisms of action of contaminants speculated to contribute to large-scale die-offs of marine mammals via immunosuppression.

A recombinant estrogen receptor fragment-based homogeneous fluorescent assay for rapid detection of estrogens.

Science.gov (United States)

Wang, Dan; Xie, Jiangbi; Zhu, Xiaocui; Li, Jinqiu; Zhao, Dongqin; Zhao, Meiping

2014-05-15

In this work, we demonstrate a novel estrogenic receptor fragment-based homogeneous fluorescent assay which enables rapid and sensitive detection of 17β-estradiol (E2) and other highly potent estrogens. A modified human estrogenic receptor fragment (N-His × 6-hER270-595-C-Strep tag II) has been constructed that contains amino acids 270-595 of wild-type human estrogenic receptor α (hER270-595) and two specific tags (6 × His and Strep tag II) fused to the N and C terminus, respectively. The designed receptor protein fragment could be easily produced by prokaryotic expression with high yield and high purity. The obtained protein exhibits high binding affinity to E2 and the two tags greatly facilitate the application of the recombinant protein. Taking advantage of the unique spectroscopic properties of coumestrol (CS), a fluorescent phytoestrogen, a CS/hER270-595-based fluorescent assay has been developed which can sensitively respond to E2 within 1.0 min with a linear working range from 0.1 to 20 ng/mL and a limit of detection of 0.1 ng/mL. The assay was successfully applied for rapid detection of E2 in the culture medium of rat hippocampal neurons. The method also holds great potential for high-throughput monitoring the variation of estrogen levels in complex biological fluids, which is crucial for investigation of the molecular basis of various estrogen-involved processes. Copyright © 2013 Elsevier B.V. All rights reserved.

Multicolor-based discrimination of 21 short tandem repeats and amelogenin using four fluorescent universal primers.

Science.gov (United States)

Asari, Masaru; Okuda, Katsuhiro; Hoshina, Chisato; Omura, Tomohiro; Tasaki, Yoshikazu; Shiono, Hiroshi; Matsubara, Kazuo; Shimizu, Keiko

2016-02-01

The aim of this study was to develop a cost-effective genotyping method using high-quality DNA for human identification. A total of 21 short tandem repeats (STRs) and amelogenin were selected, and fluorescent fragments at 22 loci were simultaneously amplified in a single-tube reaction using locus-specific primers with 24-base universal tails and four fluorescent universal primers. Several nucleotide substitutions in universal tails and fluorescent universal primers enabled the detection of specific fluorescent fragments from the 22 loci. Multiplex polymerase chain reaction (PCR) produced intense FAM-, VIC-, NED-, and PET-labeled fragments ranging from 90 to 400 bp, and these fragments were discriminated using standard capillary electrophoretic analysis. The selected 22 loci were also analyzed using two commercial kits (the AmpFLSTR Identifiler Kit and the PowerPlex ESX 17 System), and results for two loci (D19S433 and D16S539) were discordant between these kits due to mutations at the primer binding sites. All genotypes from the 100 samples were determined using 2.5 ng of DNA by our method, and the expected alleles were completely recovered. Multiplex 22-locus genotyping using four fluorescent universal primers effectively reduces the costs to less than 20% of genotyping using commercial kits, and our method would be useful to detect silent alleles from commercial kit analysis. Copyright © 2015 Elsevier Inc. All rights reserved.

A simple strategy for subcloning and amplifying random multimegabase subchromosomal acentric DNA fragments as double minute chromosomes

International Nuclear Information System (INIS)

Hahn, P.J.; Giddings, L.; Lane, M.J.

1989-01-01

Restriction mapping of relatively large genomes (e.g. human) utilizing randomly generated DNA segments requires high mapping redundancy to successfully organize 'contigs' to represent the entire genome. The number of independent DNA segment maps required is dependent on the average size of a mapping segment; the larger the segment, the fewer required. The authors have developed a strategy for subcloning intact multimegabase subchromosomal fragments as double minute chromosomes. Such fragments could serve as primary mapping elements or as adjunct (linking) fragments to rapidly connect already existent contigs generated using yeast artificial chromosomes or cosmids. They present several lines of evidence supporting the viability of this approach. (1) X-ray treated EMT-6 mouse cells (7.5 Gr.) which are selected over several months with increasing levels of methotrexate (MTX) contain highly amplified circular DNA molecules (double minutes) which include the dihydrofolate reductase (DHFR) gene in a size range between 1,000 and 3,500 kilobases as determined by pulsed-field gel electrophoresis and these acentric chromosomal fragments have been stably maintained in culture for at least a year. (2) Preliminary data based on experiments involving fusion of X-irradiated Chinese Hamster Ovary (CH0 DG44) cells containing randomly inserted cotransfected Neomycin resistance and DHFR genes to mouse EMT-6 cells shows that the linked genes can be readily cotransferred as acentric subchromosomal fragment(s) suitable for gene amplification. (3) The studies of CHO cells with cell fusion transferred X-ray induced chromosomal fragments containing the natural CHO DHFR gene suggest that transferred chromosome fragments undergo gene amplification much more readily than nonfragmented endogenous DHFR genes

Expression of a humanized SZ-63 McAb functional recombinant Fab fragment in E. Coli

International Nuclear Information System (INIS)

Xia Lijun; Gu Jianming; Zhang Xiaoming; Liu Yue; Wan Haiying; Li Peixia; Ruan Changgeng

1995-06-01

MRNA was selected on oligo(dT)-cellulose from total RNA isolated from SZ-63 hybridoma cells by CsCl ultracentrifugation. cDNA coding for heavy and light variable regions were amplified by reverse transcriptase-polymerase chain reaction (RT-PCR). The amplified fragments were then cloned and sequenced by the 32 P labelled sanger dideoxy-mediated chain-termination method. The nucleotides of VH and Vκ are 354 and 321 respectively, the amino acid sequence of heavy and light chain of SZ-63 were also deduced. Then, linking the variable genes of SZ-63 with human immunoglobulin γ 1 CH and κ VL genes, constructing pHEN1-63 Fab/Hu chimera for expression and transforming E. coli HB2151. The expressed chimeric SZ-63 Fab was soluble. Both ELISA and Western blot results showed the expression products could specifically bind with cross-linked fibrin and the content in expression culture was about 225 μg/L. (5 figs.)

Scanning force microscopy and fluorescence microscopy of microcontact printed antibodies and antibody fragments.

Science.gov (United States)

LaGraff, John R; Chu-LaGraff, Quynh

2006-05-09

Unlabeled primary immunoglobulin G (IgG) antibodies and its F(ab')2 and Fc fragments were attached to oxygen-plasma-cleaned glass substrates using either microcontact printing (MCP) or physical adsorption during bath application from dilute solutions. Fluorescently labeled secondary IgGs were then bound to surface-immobilized IgG, and the relative surface coverage was determined by measuring the fluorescence intensity. Results indicated that the surface coverage of IgG increased with increasing protein solution concentration for both MCP and bath-applied IgG and that a greater concentration of IgG was transferred to a glass substrate using MCP than during physisorption during bath applications. Scanning force microscopy (SFM) showed that patterned MCP IgG monolayers were 5 nm in height, indicating that IgG molecules lie flat on the substrate. After incubation with a secondary IgG, the overall line thickness increased to around 15 nm, indicating that the secondary IgG was in a more vertical orientation with respect to the substrate. The surface roughness of these MCP patterned IgG bilayers as measured by SFM was observed to increase with increasing surface coverage. Physisorption of IgG to both unmodified patterned polydimethylsiloxane (PDMS) stamps and plasma-cleaned glass substrates was modeled by Langmuir adsorption kinetics yielding IgG binding constants of K(MCP) = 1.7(2) x 10(7) M(-1) and K(bath) = 7.8(7) x 10(5) M(-1), respectively. MCP experiments involving primary F(ab')2 and Fc fragments incubated in fluorescently labeled fragment-specific secondary IgGs were carried out to test for the function and orientation of IgG. Finally, possible origins of MCP stamping defects such as pits, pull outs, droplets, and reverse protein transfer are discussed.

[Primary culture of cat intestinal epithelial cell and construction of its cDNA library].

Science.gov (United States)

Ye, L; Gui-Hua, Z; Kun, Y; Hong-Fa, W; Ting, X; Gong-Zhen, L; Wei-Xia, Z; Yong, C

2017-04-12

Objective To establish the primary cat intestinal epithelial cells (IECs) culture methods and construct the cDNA library for the following yeast two-hybrid experiment, so as to screen the virulence interaction factors among the final host. Methods The primary cat IECs were cultured by the tissue cultivation and combined digestion with collagenase XI and dispase I separately. Then the cat IECs cultured was identified with the morphological observation and cyto-keratin detection, by using goat anti-cyto-keratin monoclonal antibodies. The mRNA of cat IECs was isolated and used as the template to synthesize the first strand cDNA by SMART™ technology, and then the double-strand cDNAs were acquired by LD-PCR, which were subsequently cloned into the plasmid PGADT7-Rec to construct yeast two-hybrid cDNA library in the yeast strain Y187 by homologous recombination. Matchmaker™ Insert Check PCR was used to detect the size distribution of cDNA fragments after the capacity calculation of the cDNA library. Results The comparison of the two cultivation methods indicated that the combined digestion of collagenase XI and dispase I was more effective than the tissue cultivation. The cat IECs system of continuous culture was established and the cat IECs with high purity were harvested for constructing the yeast two-hybrid cDNA library. The library contained 1.1×10 6 independent clones. The titer was 2.8×10 9 cfu/ml. The size of inserted fragments was among 0.5-2.0 kb. Conclusion The yeast two-hybrid cDNA library of cat IECs meets the requirements of further screen research, and this study lays the foundation of screening the Toxoplasma gondii virulence interaction factors among the cDNA libraries of its final hosts.

Genomic diversity among Danish field strains of Mycoplasma hyosynoviae assessed by amplified fragment length polymorphism analysis

DEFF Research Database (Denmark)

Kokotovic, Branko; Friis, Niels F.; Nielsen, Elisabeth O.

2002-01-01

Genomic diversity among strains of Mycoplasma hyosynoviae isolated in Denmark was assessed by using amplified fragment length polymorphism (AFLP) analysis. Ninety-six strains, obtained from different specimens and geographical locations during 30 years and the type strain of M. hyosynoviae S16(T......) were concurrently examined for variance in BglII-MfeI and EcoRI-Csp6I-A AFLP markers. A total of 56 different genomic fingerprints having an overall similarity between 77 and 96% were detected. No correlation between AFLP variability and period of isolation or anatomical site of isolation could...

Amplified Fragment Length Polymorphism Diversity in Cephalosporium maydis from Egypt.

Science.gov (United States)

Saleh, Amgad A; Zeller, Kurt A; Ismael, Abou-Serie M; Fahmy, Zeinab M; El-Assiuty, Elhamy M; Leslie, John F

2003-07-01

ABSTRACT Cephalosporium maydis, the causal agent of late wilt of maize, was first described in Egypt in the 1960s, where it can cause yield losses of up to 40% in susceptible plantings. We characterized 866 isolates of C. maydis collected from 14 governates in Egypt, 7 in the Nile River Delta and 7 in southern (Middle and Upper) Egypt, with amplified fragment length polymorphism (AFLP) markers. The four AFLP primer-pair combinations generated 68 bands, 25 of which were polymorphic, resulting in 52 clonal haplotypes that clustered the 866 isolates into four phylogenetic lineages. Three lineages were found in both the Nile River Delta and southern Egypt. Lineage IV, the most diverse group (20 haplotypes), was recovered only from governates in the Nile River Delta. In some locations, one lineage dominated (up to 98% of the isolates recovered) and, from some fields, only a single haplotype was recovered. Under field conditions in Egypt, there is no evidence that C. maydis reproduces sexually. The nonuniform geographic distribution of the pathogen lineages within the country could be due to differences in climate or in the farming system, because host material differs in susceptibility and C. maydis lineages differ in pathogenicity.

Characterization and immunological identification of cDNA clones encoding two human DNA topoisomerase II isozymes

International Nuclear Information System (INIS)

Chung, T.D.Y.; Drake, F.H.; Tan, K.B.; Per, S.R.; Crooke, S.T.; Mirabelli, C.K.

1989-01-01

Several DNA topoisomerase II partial cDNA clones obtained from a human Raji-HN2 cDNA library were sequenced and two classes of nucleotide sequences were found. One member of the first class, SP1, was identical to an internal fragment of human HeLa cell Topo II cDNA described earlier. A member of the second class, SP11, shared extensive nucleotide (75%) and predicted peptide (92%) sequence similarities with the first two-thirds of HeLa Topo II. Each class of cDNAs hybridized to unique, nonoverlapping restriction enzyme fragments of genomic DNA from several human cell lines. Synthetic 24-mer oligonucleotide probes specific for each cDNA class hybridized to 6.5-kilobase mRNAs; furthermore, hybridization of probe specific for one class was not blocked by probe specific for the other. Antibodies raised against a synthetic SP1-encoded dodecapeptide specifically recognized the 170-kDa form of Topo II, while antibodies raised against the corresponding SP11-encoded dodecapeptide, or a second unique SP11-encoded tridecapeptide, selectively recognized the 180-kDa form of Topo II. These data provide genetic and immunochemical evidence for two Topo II isozymes

Molecular characterization of MHC-DRB cDNA in water buffalo (Bubalus bubalis

Directory of Open Access Journals (Sweden)

Soumen Naskar

2012-01-01

Full Text Available In the present study, water buffalo MHC (Bubu-DRB cDNA was cloned and characterized. The 1022 base long-amplified cDNA product encompassed a single open reading frame of 801 bases that coded for 266 amino acids. The Bubu-DRB sequence showed maximum homology with the BoLA-DRB3*0101 allele of cattle. A total of seven amino acid residues were found to be unique for the Bubu-DRB sequence. The majority of amino acid substitutions was observed in the β1 domain. Residues associated with important functions were mostly conserved. Water buffalo DRB was phylogenetically closer to goat DRB*A.

Construction of a T7 Human Lung Cancer cDNA Library

Directory of Open Access Journals (Sweden)

Wentao YUE

2008-10-01

Full Text Available Background and objective Currently, only a limited numbers of tumor markers for non small lung cancer (NSCLC diagnosis, new biomarker, such as serum autoantibody may improve the early detection of lung cancer. Our objective is construction human lung squamous carcinoma and adenocarcinoma T7 phage display cDNA library from the tissues of NSCLC patients. Methods mRNA was isolated from a pool of total RNA extract from NSCLC tissues obtained from 5 adenocarcinomas and 5 squamous carcinomas, and then mRNA was reverse transcribed into double stranded cDNA. After digestion, the cDNA was inserted into T7Select 10-3 vector. The phage display cDNA library was constructed by package reaction in vitro and plate proliferation. Plaque assay and PCR were used to evaluate the library.Results Two T7 phage display cDNA library were established. Plaque assay show the titer of lung squamas carcinoma library was 1.8×106 pfu, and the adenocarcinoma library was 5×106 pfu. The phage titer of the amplified library were 3.2×1010 pfu/mL and 2.5×1010 pfu/mL. PCR amplification of random plaque show insert ratio were 100% (24/24 in adenocarcinoma library and 95.8% in human lung squamas carcinoma library (23/24. Insert range from 300 bp to 1 500 bp. Conclusion Two phage display cDNA library from NSCLC were constructed.

Human pro. cap alpha. 1)(I) collagen: cDNA sequence for the C-propeptide domain

Energy Technology Data Exchange (ETDEWEB)

Maekelae, J K; Raassina, M; Virta, A; Vuorio, E

1988-01-11

The authors have previously constructed a cDNA clone pHCAL1, covering most of the C-terminal propeptide domain of human pro..cap alpha..1(I) collagen mRNA,by inserting a 678 bp EcoRI-XhoI fragment of cDNA into pBR322. Since the XhoI/SalI ligation prevented removal of the insert, they used the same strategy to obtain a similar clone in pUC8. RNA was isolated from fetal calvarial bones. The cDNA was digested with EcoRI and XhoI and fractionated on a 1 % agarose gel. Fragments of 650-700 bp were cloned in pUC8 at the polylinker site, which now permits easy removal of the insert. The new clone was named pHCAL1U since the RNA was isolated from another individual. The approach outlined is useful for studies on individual variation which is important to recognize when searching for disease-related mutations in type I collagen.

Differentiation in a geographical mosaic of plants coevolving with ants: phylogeny of the Leonardoxa africana complex (Fabaceae: Caesalpinioideae) using amplified fragment length polymorphism markers.

Science.gov (United States)

Brouat, C; McKey, D; Douzery, E J P

2004-05-01

Comprising four allopatric subspecies that exhibit various grades of ant-plant interactions, from diffuse to obligate and symbiotic associations, the Leonardoxa africana complex (Fabaceae, Caesalpinioideae) provides a good opportunity to investigate the evolutionary history of ant-plant mutualisms. A previous study of the L. africana complex based on chloroplast DNA noncoding sequences revealed a lack of congruence between clades suggested by morphological and plastid characters. In this study, we analysed phylogenetic relationships within the L. africana complex using a Bayesian probability approach on amplified fragment length polymorphism markers. The results reported permit partial validation of the four subspecies of L. africana previously defined by morphological and ecological markers. Incongruences between phylogenies based on chloroplast DNA and amplified fragment length polymorphism markers are discussed in the light of morphological and ecological data, and confronted with hypotheses of convergence, lineage sorting and introgression.

Amplified fluorescent aptasensor through catalytic recycling for highly sensitive detection of ochratoxin A.

Science.gov (United States)

Wei, Yin; Zhang, Ji; Wang, Xu; Duan, Yixiang

2015-03-15

This paper describes a novel approach utilizing nano-graphite-aptamer hybrid and DNase I for the amplified detection of ochratoxin A (OTA) for the first time. Nano-graphite can effectively quench the fluorescence of carboxyfluorescein (FAM) labeled OTA specific aptamer due to their strong π-π; stacking interactions; while upon OTA addition, it will bind with aptamer to fold into an OTA-aptamerG-quadruplex structure, which does not adsorb on the surface of nano-graphite and thus retains the dye fluorescence. Meanwhile, the G-quadruplex structure can be cleaved by DNase I, and in such case OTA is delivered from the complex. The released OTA then binds other FAM-labeled aptamers on the nano-graphite surface, and touches off another target recycling, resulting in the successive release of dye-labeled aptamers from the nano-graphite, which leads to significant amplification of the signal. Under the optimized conditions, the present amplified sensing system exhibits high sensitivity toward OTA with a limit of detection of 20nM (practical measurement), which is about 100-fold higher than that of traditional unamplified homogeneous assay. Our developed method also showed high selectivity against other interference molecules and can be applied for the detection of OTA in real red wine samples. The proposed assay is simple, cost-effective, and might open a door for the development of new assays for other biomolecules. This aptasensor is of great practical importance in food safety and could be widely extended to the detection of other toxins by replacing the sequence of the recognition aptamer. Copyright © 2014 Elsevier B.V. All rights reserved.

RFLP for Duchenne muscular dystrophy cDNA clone 44-1

Energy Technology Data Exchange (ETDEWEB)

Laing, N G; Siddique, T; Bartlett, R J; Yamaoka, L H; Chen, J C; Walker, A P; Hung, W Y; Roses, A D [Duke Univ. Medical Center, Durham, NC (USA)

1988-07-25

Clone 44-1 is one of six cDNA clones which comprise the cDNA for the Duchenne muscular dystrophy gene. It is a 0.9kb fragment in the EcoR1 site of Bluescript. Taq1 (TlCGA) identifies two alleles with bands at 6.8 and 5.7kb, as well as four constant bands at 4.8, 3.9, 3.5 and 2.5kb. Its frequency was studied in 62 unrelated individuals. Mendelian inheritance was demonstrated in one three generation and three two generation informative families, 26 individuals. There were no problems on RFLP analysis under normal stringency conditions.

Tip-enhanced fluorescence with radially polarized illumination for monitoring loop-mediated isothermal amplification on Hepatitis C virus cDNA

Science.gov (United States)

Wei, Shih-Chung; Chuang, Tsung-Liang; Wang, Da-Shin; Lu, Hui-Hsin; Gu, Frank X.; Sung, Kung-Bin; Lin, Chii-Wann

2015-02-01

A tip nanobiosensor for monitoring DNA replication was presented. The effects of excitation power and polarization on tip-enhanced fluorescence (TEF) were assessed with the tip immersed in fluorescein isothiocyanate solution first. The photon count rose on average fivefold with radially polarized illumination at 50 mW. We then used polymerase-functionalized tips for monitoring loop-mediated isothermal amplification on Hepatitis C virus cDNA. The amplicon-SYBR Green I complex was detected and compared to real-time loop-mediated isothermal amplification. The signals of the reaction using 4 and 0.004 ng/μl templates were detected 10 and 30 min earlier, respectively. The results showed the potential of TEF in developing a nanobiosensor for real-time DNA amplification.

Fibered confocal fluorescence microscopy for imaging apoptotic DNA fragmentation at the single-cell level in vivo

International Nuclear Information System (INIS)

Al-Gubory, Kais H.

2005-01-01

The major characteristic of cell death by apoptosis is the loss of nuclear DNA integrity by endonucleases, resulting in the formation of small DNA fragments. The application of confocal imaging to in vivo monitoring of dynamic cellular events, like apoptosis, within internal organs and tissues has been limited by the accessibility to these sites. Therefore, the aim of the present study was to test the feasibility of fibered confocal fluorescence microscopy (FCFM) to image in situ apoptotic DNA fragmentation in surgically exteriorized sheep corpus luteum in the living animal. Following intra-luteal administration of a fluorescent DNA-staining dye, YO-PRO-1, DNA cleavage within nuclei of apoptotic cells was serially imaged at the single-cell level by FCFM. This imaging technology is sufficiently simple and rapid to allow time series in situ detection and visualization of cells undergoing apoptosis in the intact animal. Combined with endoscope, this approach can be used for minimally invasive detection of fluorescent signals and visualization of cellular events within internal organs and tissues and thereby provides the opportunity to study biological processes in the natural physiological environment of the cell in living animals

Genetic Variation among Isolates of Sarcocystis neurona, the Agent of Protozoal Myeloencephalitis, as Revealed by Amplified Fragment Length Polymorphism Markers

OpenAIRE

Elsheikha, H. M.; Schott, H. C.; Mansfield, L. S.

2006-01-01

Sarcocystis neurona causes serious neurological disease in horses and other vertebrates in the Americas. Based on epidemiological data, this parasite has recently emerged. Here, the genetic diversity of Sarcocystis neurona was evaluated using the amplified fragment length polymorphism (AFLP) method. Fifteen S. neurona taxa from different regions collected over the last 10 years were used; six isolates were from clinically diseased horses, eight isolates were from wild-caught opossums (Didelph...

cDNA cloning, sequence analysis, and chromosomal localization of the gene for human carnitine palmitoyltransferase

International Nuclear Information System (INIS)

Finocchiaro, G.; Taroni, F.; Martin, A.L.; Colombo, I.; Tarelli, G.T.; DiDonato, S.; Rocchi, M.

1991-01-01

The authors have cloned and sequenced a cDNA encoding human liver carnitine palmitoyltransferase an inner mitochondrial membrane enzyme that plays a major role in the fatty acid oxidation pathway. Mixed oligonucleotide primers whose sequences were deduced from one tryptic peptide obtained from purified CPTase were used in a polymerase chain reaction, allowing the amplification of a 0.12-kilobase fragment of human genomic DNA encoding such a peptide. A 60-base-pair (bp) oligonucleotide synthesized on the basis of the sequence from this fragment was used for the screening of a cDNA library from human liver and hybridized to a cDNA insert of 2255 bp. This cDNA contains an open reading frame of 1974 bp that encodes a protein of 658 amino acid residues including 25 residues of an NH 2 -terminal leader peptide. The assignment of this open reading frame to human liver CPTase is confirmed by matches to seven different amino acid sequences of tryptic peptides derived from pure human CPTase and by the 82.2% homology with the amino acid sequence of rat CPTase. The NH 2 -terminal region of CPTase contains a leucine-proline motif that is shared by carnitine acetyl- and octanoyltransferases and by choline acetyltransferase. The gene encoding CPTase was assigned to human chromosome 1, region 1q12-1pter, by hybridization of CPTase cDNA with a DNA panel of 19 human-hanster somatic cell hybrids

[Cloning and sequencing of KIR2DL1 framework gene cDNA and identification of a novel allele].

Science.gov (United States)

Sun, Ge; Wang, Chang; Zhen, Jianxin; Zhang, Guobin; Xu, Yunping; Deng, Zhihui

2016-10-01

To develop an assay for cDNA cloning and haplotype sequencing of KIR2DL1 framework gene and determine the genotype of an ethnic Han from southern China. Total RNA was isolated from peripheral blood sample, and complementary DNA (cDNA) transcript was synthesized by RT-PCR. The entire coding sequence of the KIR2DL1 framework gene was amplified with a pair of KIR2DL1-specific PCR primers. The PCR products with a length of approximately 1.2 kb were then subjected to cloning and haplotype sequencing. A specific target fragment of the KIR2DL1 framework gene was obtained. Following allele separation, a wild-type KIR2DL1*00302 allele and a novel variant allele, KIR2DL1*031, were identified. Sequence alignment with KIR2DL1 alleles from the IPD-KIR Database showed that the novel allele KIR2DL1*031 has differed from the closest allele KIR2DL1*00302 by a non-synonymous mutation at CDS nt 188A>G (codon 42 GAG>GGG) in exon 4, which has caused an amino acid change Glu42Gly. The sequence of the novel allele KIR2DL1*031 was submitted to GenBank under the accession number KP025960 and to the IPD-KIR Database under the submission number IWS40001982. A name KIR2DL1*031 has been officially assigned by the World Health Organization (WHO) Nomenclature Committee. An assay for cDNA cloning and haplotype sequencing of KIR2DL1 has been established, which has a broad applications in KIR studies at allelic level.

Restriction fragment polymorphism (RFLP) of a "new" HLA-DP specificity, CDP-HEI

DEFF Research Database (Denmark)

Hyldig-Nielsen, J J; Ødum, Niels; Morling, Niels

1988-01-01

Southern blotting with a DP beta cDNA probe of MspI digested DNA from 83 healthy unrelated individuals revealed a 1.8 kb fragment present in all four individuals (and no others) possessing the newly determined DP specificity, CDP-HEI.......Southern blotting with a DP beta cDNA probe of MspI digested DNA from 83 healthy unrelated individuals revealed a 1.8 kb fragment present in all four individuals (and no others) possessing the newly determined DP specificity, CDP-HEI....

O-GlcNAcase Fragment Discovery with Fluorescence Polarimetry.

Science.gov (United States)

Borodkin, Vladimir S; Rafie, Karim; Selvan, Nithya; Aristotelous, Tonia; Navratilova, Iva; Ferenbach, Andrew T; van Aalten, Daan M F

2018-05-18

The attachment of the sugar N-acetyl-D-glucosamine (GlcNAc) to specific serine and threonine residues on proteins is referred to as protein O-GlcNAcylation. O-GlcNAc transferase (OGT) is the enzyme responsible for carrying out the modification, while O-GlcNAcase (OGA) reverses it. Protein O-GlcNAcylation has been implicated in a wide range of cellular processes including transcription, proteostasis, and stress response. Dysregulation of O-GlcNAc has been linked to diabetes, cancer, and neurodegenerative and cardiovascular disease. OGA has been proposed to be a drug target for the treatment of Alzheimer's and cardiovascular disease given that increased O-GlcNAc levels appear to exert a protective effect. The search for specific, potent, and drug-like OGA inhibitors with bioavailability in the brain is therefore a field of active research, requiring orthogonal high-throughput assay platforms. Here, we describe the synthesis of a novel probe for use in a fluorescence polarization based assay for the discovery of inhibitors of OGA. We show that the probe is suitable for use with both human OGA, as well as the orthologous bacterial counterpart from Clostridium perfringens, CpOGA, and the lysosomal hexosaminidases HexA/B. We structurally characterize CpOGA in complex with a ligand identified from a fragment library screen using this assay. The versatile synthesis procedure could be adapted for making fluorescent probes for the assay of other glycoside hydrolases.

Chalcone synthase genes from milk thistle (Silybum marianum ...

Indian Academy of Sciences (India)

In the current research, fragments of CHS genes were amplified ... transcript level in petals in the early flowering stage and in the stem of five upper leaves, followed by five upper leaves in the ..... First strand cDNA was amplified by 1 μg of.

TARC: Carlo Rubbia's Energy Amplifier

CERN Multimedia

Laurent Guiraud

1997-01-01

Transmutation by Adiabatic Resonance Crossing (TARC) is Carlo Rubbia's energy amplifier. This CERN experiment demonstrated that long-lived fission fragments, such as 99-TC, can be efficiently destroyed.

Radioactive cDNA microarray in neurospsychiatry

International Nuclear Information System (INIS)

Choe, Jae Gol; Shin, Kyung Ho; Lee, Min Soo; Kim, Meyoung Kon

2003-01-01

Microarray technology allows the simultaneous analysis of gene expression patterns of thousands of genes, in a systematic fashion, under a similar set of experimental conditions, thus making the data highly comparable. In some cases arrays are used simply as a primary screen leading to downstream molecular characterization of individual gene candidates. In other cases, the goal of expression profiling is to begin to identify complex regulatory networks underlying developmental processes and disease states. Microarrays were originally used with cell lines or other simple model systems. More recently, microarrays have been used in the analysis of more complex biological tissues including neural systems and the brain. The application of cDNA arrays in neuropsychiatry has lagged behind other fields for a number of reasons. These include a requirement for a large amount of input probe RNA in fluorescent-glass based array systems and the cellular complexity introduced by multicellular brain and neural tissues. An additional factor that impacts the general use of microarrays in neuropsychiatry is the lack of availability of sequenced clone sets from model systems. While human cDNA clones have been widely available, high quality rat, mouse, and drosophilae, among others are just becoming widely available. A final factor in the application of cDNA microarrays in neuropsychiatry is cost of commercial arrays. As academic microarray facilitates become more commonplace custom made arrays will become more widely available at a lower cost allowing more widespread applications. In summary, microarray technology is rapidly having an impact on many areas of biomedical research. Radioisotope-nylon based microarrays offer alternatives that may in some cases be more sensitive, flexible, inexpensive, and universal as compared to other array formats, such as fluorescent-glass arrays. In some situations of limited RNA or exotic species, radioactive membrane microarrays may be the most

Radioactive cDNA microarray in neurospsychiatry

Energy Technology Data Exchange (ETDEWEB)

Choe, Jae Gol; Shin, Kyung Ho; Lee, Min Soo; Kim, Meyoung Kon [Korea University Medical School, Seoul (Korea, Republic of)

2003-02-01

Microarray technology allows the simultaneous analysis of gene expression patterns of thousands of genes, in a systematic fashion, under a similar set of experimental conditions, thus making the data highly comparable. In some cases arrays are used simply as a primary screen leading to downstream molecular characterization of individual gene candidates. In other cases, the goal of expression profiling is to begin to identify complex regulatory networks underlying developmental processes and disease states. Microarrays were originally used with cell lines or other simple model systems. More recently, microarrays have been used in the analysis of more complex biological tissues including neural systems and the brain. The application of cDNA arrays in neuropsychiatry has lagged behind other fields for a number of reasons. These include a requirement for a large amount of input probe RNA in fluorescent-glass based array systems and the cellular complexity introduced by multicellular brain and neural tissues. An additional factor that impacts the general use of microarrays in neuropsychiatry is the lack of availability of sequenced clone sets from model systems. While human cDNA clones have been widely available, high quality rat, mouse, and drosophilae, among others are just becoming widely available. A final factor in the application of cDNA microarrays in neuropsychiatry is cost of commercial arrays. As academic microarray facilitates become more commonplace custom made arrays will become more widely available at a lower cost allowing more widespread applications. In summary, microarray technology is rapidly having an impact on many areas of biomedical research. Radioisotope-nylon based microarrays offer alternatives that may in some cases be more sensitive, flexible, inexpensive, and universal as compared to other array formats, such as fluorescent-glass arrays. In some situations of limited RNA or exotic species, radioactive membrane microarrays may be the most

Application of Amplified Fragment Length Polymorphism Fingerprinting for Taxonomy and Identification of the Soft Rot Bacteria Erwinia carotovora and Erwinia chrysanthemi

OpenAIRE

Avrova, Anna O.; Hyman, Lizbeth J.; Toth, Rachel L.; Toth, Ian K.

2002-01-01

The soft rot bacteria Erwinia carotovora and Erwinia chrysanthemi are important pathogens of potato and other crops. However, the taxonomy of these pathogens, particularly at subspecies level, is unclear. An investigation using amplified fragment length polymorphism (AFLP) fingerprinting was undertaken to determine the taxonomic relationships within this group based on their genetic relatedness. Following cluster analysis on the similarity matrices derived from the AFLP gels, four clusters (c...

Genotyping of Campylobacter jejuni from broiler carcasses and slaughterhouse environment by amplified fragment length polymorphism.

Science.gov (United States)

Johnsen, G; Kruse, H; Hofshagen, M

2006-12-01

We examined the occurrence and diversity of Campylobacter jejuni on broiler carcasses during slaughter of an infected flock and in the slaughterhouse environment during slaughter and postdisinfection before a new production run. During the slaughter of a known C. jejuni infected broiler flock, samples were taken from broiler carcasses at 7 different stages during the process. Thirty-seven sites in the slaughterhouse environment were sampled both during process and postdisinfection. The samples were analyzed for C. jejuni, and genetic fingerprinting was performed using amplified fragment length polymorphism. All carcass samples were positive. Of the environmental samples collected during slaughter, 89% were positive; 100% of those from the arrival, stunning, scalding, defeathering, and evisceration facilities and 67% of those from the cooling and sorting facilities. Postdisinfection, 41% of the samples were positive; 71% of those from the arrival and stunning area, 60% of those from the scalding and defeathering area, and 20% of those from the evisceration, cooling, and sorting area. The C. jejuni isolates (n = 60) recovered were grouped into 4 different amplified fragment length polymorphism clones with a similarity index of 95% or greater. All isolates obtained from the flock and 94% of the isolates obtained from the environment during slaughtering belonged to clone A, whereas 1 environmental isolate belonged to each of the clones B and C. Isolates from clones A, B, and D were present postdisinfection. Only clone B was detected on flocks slaughtered during the previous week. The high level and continuous presence of Campylobacter in the environment constitutes a risk for transmission to negative carcasses. In Norway, where above 96% of the broiler flocks are Campylobacter-negative, this aspect is of special importance. The ability of Campylobacter to remain in the slaughterhouse environment through washing and disinfection is associated with constructional

Identification and characterization of some aromatic rice mutants using amplified fragment length polymorphism (AFLP) technique

International Nuclear Information System (INIS)

Fahmy, E.M.; Sobieh, S. E. S.; Ayaad, M. H.; El-Gohary, A. A.; Rownak, A.

2012-12-01

Accurate identifying of the genotypes is considered one of the most important mechanisms used in the recording or the protection of plant varieties. The investigation was conducted at the experimental form belonging to the egyptian Atomic Energy Authority, Inshas. The aim was to evaluate grain quality characteristics and molecular genetic variation using Amplified Fragment Length Polymorphism (AFLP) technique among six rice genotypes, Egyptian Jasmine aromatic rice cultivar and five aromatic rice mutants in (M3 mutagenic generation). Two mutation (Egy22 and Egy24) were selected from irradiated Sakha 102 population with 200 and 400Gy of gamma rays in the M2 generation, respectively, and three mutations ( Egy32, Egy33, and Egy34) were selected from irradiated Sakha 103 population with 200, 300, 400Gy of gamma rays in the M2 generation, respectively. The obtained results showed that the strong aroma was obtained for mutant Egy22 as compared with Egyptian Jasmine rice cultivar (moderate aroma). Seven primer combinations were used through six rice genotypes on the molecular level using AFLP marker. The size of AFLP Fragments Were Ranged from 51- 494bp. The total number of amplified bands was 997 band among them 919 polymorphic bans representing 92.2%. The highest similarity index (89%) was observed between Egyptian Jasmine and Egy32 followed by (82%) observed between Egyptian Jasmine and Egy34. On the other hand, the lowest similarity index was (48%) between Egyptian Jasmine and Egy24. In six rice genotypes, Egy24 produced the highest number of the AFLP makers giving 49 unique markers (23 positive and 26 negative), then Egy22 showed 23 unique markers (27 positive and 6 negative) while Egy33 was characterized by 17 unique markers (12 positive and 5 negative). At last Egyptian Jasmine was discriminated by the lowest number of markets, 10 (6 positive and 4 negative). The study further confirmed that AFLP technique was able to differentiate rice genotypes by a higher number

Recovery of avian metapneumovirus subgroup C from cDNA: cross-recognition of avian and human metapneumovirus support proteins.

Science.gov (United States)

Govindarajan, Dhanasekaran; Buchholz, Ursula J; Samal, Siba K

2006-06-01

Avian metapneumovirus (AMPV) causes an acute respiratory disease in turkeys and is associated with "swollen head syndrome" in chickens, contributing to significant economic losses for the U.S. poultry industry. With a long-term goal of developing a better vaccine for controlling AMPV in the United States, we established a reverse genetics system to produce infectious AMPV of subgroup C entirely from cDNA. A cDNA clone encoding the entire 14,150-nucleotide genome of AMPV subgroup C strain Colorado (AMPV/CO) was generated by assembling five cDNA fragments between the T7 RNA polymerase promoter and the autocatalytic hepatitis delta virus ribozyme of a transcription plasmid, pBR 322. Transfection of this plasmid, along with the expression plasmids encoding the N, P, M2-1, and L proteins of AMPV/CO, into cells stably expressing T7 RNA polymerase resulted in the recovery of infectious AMPV/CO. Characterization of the recombinant AMPV/CO showed that its growth properties in tissue culture were similar to those of the parental virus. The potential of AMPV/CO to serve as a viral vector was also assessed by generating another recombinant virus, rAMPV/CO-GFP, that expressed the enhanced green fluorescent protein (GFP) as a foreign protein. Interestingly, GFP-expressing AMPV and GFP-expressing human metapneumovirus (HMPV) could be recovered using the support plasmids of either virus, denoting that the genome promoters are conserved between the two metapneumoviruses and can be cross-recognized by the polymerase complex proteins of either virus. These results indicate a close functional relationship between AMPV/CO and HMPV.

ESTs, cDNA microarrays, and gene expression profiling: tools for dissecting plant physiology and development.

Science.gov (United States)

Alba, Rob; Fei, Zhangjun; Payton, Paxton; Liu, Yang; Moore, Shanna L; Debbie, Paul; Cohn, Jonathan; D'Ascenzo, Mark; Gordon, Jeffrey S; Rose, Jocelyn K C; Martin, Gregory; Tanksley, Steven D; Bouzayen, Mondher; Jahn, Molly M; Giovannoni, Jim

2004-09-01

Gene expression profiling holds tremendous promise for dissecting the regulatory mechanisms and transcriptional networks that underlie biological processes. Here we provide details of approaches used by others and ourselves for gene expression profiling in plants with emphasis on cDNA microarrays and discussion of both experimental design and downstream analysis. We focus on methods and techniques emphasizing fabrication of cDNA microarrays, fluorescent labeling, cDNA hybridization, experimental design, and data processing. We include specific examples that demonstrate how this technology can be used to further our understanding of plant physiology and development (specifically fruit development and ripening) and for comparative genomics by comparing transcriptome activity in tomato and pepper fruit.

PCR-identification of a Nicotiana plumbaginifolia cDNA homologous to the high-affinity nitrate transporters of the crnA family.

Science.gov (United States)

Quesada, A; Krapp, A; Trueman, L J; Daniel-Vedele, F; Fernández, E; Forde, B G; Caboche, M

1997-05-01

A family of high-affinity nitrate transporters has been identified in Aspergillus nidulans and Chlamydomonas reinhardtii, and recently homologues of this family have been cloned from a higher plant (barley). Based on six of the peptide sequences most strongly conserved between the barley and C. reinhardtii polypeptides, a set of degenerate primers was designed to permit amplification of the corresponding genes from other plant species. The utility of these primers was demonstrated by RT-PCR with cDNA made from poly(A)+ RNA from barley, C. reinhardtii and Nicotiana plumbaginifolia. A PCR fragment amplified from N. plumbaginifolia was used as probe to isolate a full-length cDNA clone which encodes a protein, NRT2;1Np, that is closely related to the previously isolated crnA homologue from barley. Genomic Southern blots indicated that there are only 1 or 2 members of the Nrt2 gene family in N. plumbaginifolia. Northern blotting showed that the Nrt2 transcripts are most strongly expressed in roots. The effects of external treatments with different N sources showed that the regulation of the Nrt2 gene(s) is very similar to that reported for nitrate reductase and nitrite reductase genes: their expression was strongly induced by nitrate but was repressed when reduced forms of N were supplied to the roots.

Directly Transforming PCR-Amplified DNA Fragments into Plant Cells Is a Versatile System That Facilitates the Transient Expression Assay

Science.gov (United States)

Lu, Yuming; Chen, Xi; Wu, Yuxuan; Wang, Yanping; He, Yuqing; Wu, Yan

2013-01-01

A circular plasmid containing a gene coding sequence has been broadly used for studying gene regulation in cells. However, to accommodate a quick screen plasmid construction and preparation can be time consuming. Here we report a PCR amplified dsDNA fragments (PCR-fragments) based transient expression system (PCR-TES) for suiting in the study of gene regulation in plant cells. Instead of transforming plasmids into plant cells, transient expression of PCR-fragments can be applicable. The transformation efficiency and expression property of PCR-fragments are comparable to transformation using plasmids. We analyzed the transformation efficiency in PCR-TES at transcription and protein levels. Our results indicate that the PCR-TES is as versatile as the conventional transformation system using plasmid DNA. Through reconstituting PYR1-mediated ABA signaling pathway in Arabidopsis mesophyll protoplasts, we were not only validating the practicality of PCR-TES but also screening potential candidates of CDPK family members which might be involved in the ABA signaling. Moreover, we determined that phosphorylation of ABF2 by CPK4 could be mediated by ABA-induced PYR1 and ABI1, demonstrating a crucial role of CDPKs in the ABA signaling. In summary, PCR-TES can be applicable to facilitate analyzing gene regulation and for the screen of putative regulatory molecules at the high throughput level in plant cells. PMID:23468926

Directly transforming PCR-amplified DNA fragments into plant cells is a versatile system that facilitates the transient expression assay.

Directory of Open Access Journals (Sweden)

Yuming Lu

Full Text Available A circular plasmid containing a gene coding sequence has been broadly used for studying gene regulation in cells. However, to accommodate a quick screen plasmid construction and preparation can be time consuming. Here we report a PCR amplified dsDNA fragments (PCR-fragments based transient expression system (PCR-TES for suiting in the study of gene regulation in plant cells. Instead of transforming plasmids into plant cells, transient expression of PCR-fragments can be applicable. The transformation efficiency and expression property of PCR-fragments are comparable to transformation using plasmids. We analyzed the transformation efficiency in PCR-TES at transcription and protein levels. Our results indicate that the PCR-TES is as versatile as the conventional transformation system using plasmid DNA. Through reconstituting PYR1-mediated ABA signaling pathway in Arabidopsis mesophyll protoplasts, we were not only validating the practicality of PCR-TES but also screening potential candidates of CDPK family members which might be involved in the ABA signaling. Moreover, we determined that phosphorylation of ABF2 by CPK4 could be mediated by ABA-induced PYR1 and ABI1, demonstrating a crucial role of CDPKs in the ABA signaling. In summary, PCR-TES can be applicable to facilitate analyzing gene regulation and for the screen of putative regulatory molecules at the high throughput level in plant cells.

A new approach for cloning hLIF cDNA from genomic DNA isolated from the oral mucous membrane.

Science.gov (United States)

Cui, Y H; Zhu, G Q; Chen, Q J; Wang, Y F; Yang, M M; Song, Y X; Wang, J G; Cao, B Y

2011-11-25

Complementary DNA (cDNA) is valuable for investigating protein structure and function in the study of life science, but it is difficult to obtain by traditional reverse transcription. We employed a novel strategy to clone human leukemia inhibitory factor (hLIF) gene cDNA from genomic DNA, which was directly isolated from the mucous membrane of mouth. The hLIF sequence, which is 609 bp long and is composed of three exons, can be acquired within a few hours by amplifying each exon and splicing all of them using overlap-PCR. This new approach developed is simple, time- and cost-effective, without RNA preparation or cDNA synthesis, and is not limited to the specific tissues for a particular gene and the expression level of the gene.

RFLP for Duchenne muscular dystrophy cDNA clone 30-2

Energy Technology Data Exchange (ETDEWEB)

Walker, A P; Bartlett, R J; Laing, N G; Siddique, T; Yamaoka, L H; Chen, J C; Hung, W Y; Roses, A D [Duke Univ. Medical Center, Durham, NC (USA)

1988-09-26

30-2 is one of 6 cDNA clones which comprise the cDNA for the Duchenne muscular dystrophy gene. It is a 1.15 kb fragment in the EcoRI site of Bluescribe. TaqI (T{down arrow}CGA) identifies two bands with alleles at 3.7 and 3.5 kb, as well as eight constant bands at 9.0, 7.5, 4.6, 3.6, 3.4, 2.5, 1.7 and 1.4 kb. The allele frequency was studied in 47 unrelated DMD males: 3.7 kb allele 0.45; and 3.5 kb allele 0.55. Co-dominant X-linked segregation was demonstrated in two 2-generation families. 1.1% agarose gels required to resolve the bands. The polymorphism is also recognized by PERT 87-15.

High-efficiency electroluminescence and amplified spontaneous emission from a thermally activated delayed fluorescent near-infrared emitter

Science.gov (United States)

Kim, Dae-Hyeon; D'Aléo, Anthony; Chen, Xian-Kai; Sandanayaka, Atula D. S.; Yao, Dandan; Zhao, Li; Komino, Takeshi; Zaborova, Elena; Canard, Gabriel; Tsuchiya, Youichi; Choi, Eunyoung; Wu, Jeong Weon; Fages, Frédéric; Brédas, Jean-Luc; Ribierre, Jean-Charles; Adachi, Chihaya

2018-02-01

Near-infrared organic light-emitting diodes and semiconductor lasers could benefit a variety of applications including night-vision displays, sensors and information-secured displays. Organic dyes can generate electroluminescence efficiently at visible wavelengths, but organic light-emitting diodes are still underperforming in the near-infrared region. Here, we report thermally activated delayed fluorescent organic light-emitting diodes that operate at near-infrared wavelengths with a maximum external quantum efficiency of nearly 10% using a boron difluoride curcuminoid derivative. As well as an effective upconversion from triplet to singlet excited states due to the non-adiabatic coupling effect, this donor-acceptor-donor compound also exhibits efficient amplified spontaneous emission. By controlling the polarity of the active medium, the maximum emission wavelength of the electroluminescence spectrum can be tuned from 700 to 780 nm. This study represents an important advance in near-infrared organic light-emitting diodes and the design of alternative molecular architectures for photonic applications based on thermally activated delayed fluorescence.

Single-Cell-Based Platform for Copy Number Variation Profiling through Digital Counting of Amplified Genomic DNA Fragments.

Science.gov (United States)

Li, Chunmei; Yu, Zhilong; Fu, Yusi; Pang, Yuhong; Huang, Yanyi

2017-04-26

We develop a novel single-cell-based platform through digital counting of amplified genomic DNA fragments, named multifraction amplification (mfA), to detect the copy number variations (CNVs) in a single cell. Amplification is required to acquire genomic information from a single cell, while introducing unavoidable bias. Unlike prevalent methods that directly infer CNV profiles from the pattern of sequencing depth, our mfA platform denatures and separates the DNA molecules from a single cell into multiple fractions of a reaction mix before amplification. By examining the sequencing result of each fraction for a specific fragment and applying a segment-merge maximum likelihood algorithm to the calculation of copy number, we digitize the sequencing-depth-based CNV identification and thus provide a method that is less sensitive to the amplification bias. In this paper, we demonstrate a mfA platform through multiple displacement amplification (MDA) chemistry. When performing the mfA platform, the noise of MDA is reduced; therefore, the resolution of single-cell CNV identification can be improved to 100 kb. We can also determine the genomic region free of allelic drop-out with mfA platform, which is impossible for conventional single-cell amplification methods.

Application of amplified fragment length polymorphism (AFLPs) for ...

African Journals Online (AJOL)

Uapaca kirkiana Muell. Årg is a dioecious fruit tree species for priority domestication in Southern Africa. It reaches reproductive maturity in eight to ten years with male plants making up 50% of breeding populations. Early identification of sex of seedlings is a prerequisite for selection and tree improvement. The amplified ...

Efficiency of random amplified polymorphic DNA (RAPD) and inter ...

African Journals Online (AJOL)

Efficiency of random amplified polymorphic DNA (RAPD) and inter-simple sequence repeats (ISSR) markers for genotype fingerprinting and genetic diversity studies in canola ( ) ... The number of amplified fragments with RAPD primers ranged from 8 to 21, with the size of amplicons ranging from 162 to 3154 bp.

Certain amplified genomic-DNA fragments (AGFs) may be involved in cell cycle progression and chloroquine is found to induce the production of cell-cycle-associated AGFs (CAGFs) in Plasmodium falciparum

OpenAIRE

Li, Gao-De

2015-01-01

It is well known that cyclins are a family of proteins that control cell-cycle progression by activating cyclin-dependent kinase. Based on our experimental results, we propose here a novel hypothesis that certain amplified genomic-DNA fragments (AGFs) may also be required for the cell cycle progression of eukaryotic cells and thus can be named as cell-cycle-associated AGFs (CAGFs). Like fluctuation in cyclin levels during cell cycle progression, these CAGFs are amplified and degraded at diffe...

An integrated PCR colony hybridization approach to screen cDNA libraries for full-length coding sequences.

Science.gov (United States)

Pollier, Jacob; González-Guzmán, Miguel; Ardiles-Diaz, Wilson; Geelen, Danny; Goossens, Alain

2011-01-01

cDNA-Amplified Fragment Length Polymorphism (cDNA-AFLP) is a commonly used technique for genome-wide expression analysis that does not require prior sequence knowledge. Typically, quantitative expression data and sequence information are obtained for a large number of differentially expressed gene tags. However, most of the gene tags do not correspond to full-length (FL) coding sequences, which is a prerequisite for subsequent functional analysis. A medium-throughput screening strategy, based on integration of polymerase chain reaction (PCR) and colony hybridization, was developed that allows in parallel screening of a cDNA library for FL clones corresponding to incomplete cDNAs. The method was applied to screen for the FL open reading frames of a selection of 163 cDNA-AFLP tags from three different medicinal plants, leading to the identification of 109 (67%) FL clones. Furthermore, the protocol allows for the use of multiple probes in a single hybridization event, thus significantly increasing the throughput when screening for rare transcripts. The presented strategy offers an efficient method for the conversion of incomplete expressed sequence tags (ESTs), such as cDNA-AFLP tags, to FL-coding sequences.

Identification of a cryptic prokaryotic promoter within the cDNA encoding the 5' end of dengue virus RNA genome.

Directory of Open Access Journals (Sweden)

Dongsheng Li

Full Text Available Infectious cDNA clones of RNA viruses are important research tools, but flavivirus cDNA clones have proven difficult to assemble and propagate in bacteria. This has been attributed to genetic instability and/or host cell toxicity, however the mechanism leading to these difficulties has not been fully elucidated. Here we identify and characterize an efficient cryptic bacterial promoter in the cDNA encoding the dengue virus (DENV 5' UTR. Following cryptic transcription in E. coli, protein expression initiated at a conserved in-frame AUG that is downstream from the authentic DENV initiation codon, yielding a DENV polyprotein fragment that was truncated at the N-terminus. A more complete understanding of constitutive viral protein expression in E. coli might help explain the cloning and propagation difficulties generally observed with flavivirus cDNA.

Generation and characterization of a stable red fluorescent ...

African Journals Online (AJOL)

An approximately 1.0 kb fragment amplified from 5'-flanking sequence of transgenes was identified in wild-type T. albonubes genome, and bears no homologous sequence in the GenBank database. In the 3'-flanking region, an approximately 1.2 kb fragment with unidentified source was amplified which has 99% homology ...

TRANSGENIC STRATEGY FOR IDENTIFYING SYNAPTIC CONNECTIONS IN MICE BY FLUORESCENCE COMPLEMENTATION (GRASP

Directory of Open Access Journals (Sweden)

Masahito eYamagata

2012-02-01

Full Text Available In the "GFP reconstitution across synaptic partners" (GRASP method, non-fluorescent fragments of GFP are expressed in two different neurons; the fragments self-assemble at synapses between the two to form a fluorophore. GRASP has proven useful for light microscopic identification of synapses in two invertebrate species, Caenorhabditis elegans and Drosophila melanogaster, but has not yet been applied to vertebrates. Here, we describe GRASP constructs that function in mammalian cells and implement a transgenic strategy in which a Cre-dependent gene switch leads to expression of the two fragments in mutually exclusive neuronal subsets in mice. Using a transgenic line that expresses Cre selectively in rod photoreceptors, we demonstrate labeling of synapses in the outer plexiform layer of the retina. Labeling is specific, in that synapses made by rods remain labeled for at least 6 months whereas nearby synapses made by intercalated cone photoreceptors on many of the same interneurons remain unlabeled. We also generated antisera that label reconstituted GFP but neither fragment in order to amplify the GRASP signal and thereby increase the sensitivity of the method.

Isolation and characterization of cDNA clones for human erythrocyte β-spectrin

International Nuclear Information System (INIS)

Prchal, J.T.; Morley, B.J.; Yoon, S.H.; Coetzer, T.L.; Palek, J.; Conboy, J.G.; Kan, Y.W.

1987-01-01

Spectrin is an important structural component of the membrane skeleton that underlies and supports the erythrocyte plasma membrane. It is composed of nonidentical α (M/sub r/ 240,000) and β (M/sub r/ 220,000) subunits, each of which contains multiple homologous 106-amino acid segments. The authors report here the isolation and characterization of a human erythroid-specific β-spectrin cDNA clone that encodes parts of the β-9 through β-12 repeat segments. This cDNA was used as a hybridization probe to assign the β-spectrin gene to human chromosome 14 and to begin molecular analysis of the gene and its mRNA transcripts. RNA transfer blot analysis showed that the reticulocyte β-spectrin mRNA is 7.8 kilobases in length. Southern blot analysis of genomic DNA revealed the presence of restriction fragment length polymorphisms (RFLPs) within the β-spectrin gene locus. The isolation of human spectrin cDNA probes and the identification of closely linked RFLPs will facilitate analysis of mutant spectrin genes causing congenital hemolytic anemias associated with quantitative and qualitative spectrin abnormalities

Genetic differentiation of Octopus minor (Mollusca, Cephalopoda) off the northern coast of China as revealed by amplified fragment length polymorphisms.

Science.gov (United States)

Yang, J M; Sun, G H; Zheng, X D; Ren, L H; Wang, W J; Li, G R; Sun, B C

2015-12-02

Octopus minor (Sasaki, 1920) is an economically important cephalopod that is found in the northern coastal waters of China. In this study, we investigated genetic differentiation in fishery populations using amplified fragment length polymorphisms (AFLPs). A total of 150 individuals were collected from five locations: Dalian (DL), Yan-tai (YT), Qingdao (QD), Lianyungang (LY), and Zhoushan (ZS), and 243 reproducible bands were amplified using five AFLP primer combinations. The percentage of polymorphic bands ranged from 53.33 to 76.08%. Nei's genetic identity ranged from 0.9139 to 0.9713, and the genetic distance ranged from 0.0291 to 0.0900. A phylogenetic tree was constructed using the unweighted pair group method with arithmetic mean, based on the genetic distance. The DL and YT populations originated from one clade, while the QD, LY, and ZS populations originated from another. The results indicate that the O. minor stock consisted of two genetic populations with an overall significantly analogous FST value (0.1088, P octopus fisheries, so that this marine resource can be conserved for its long-term utilization.

Plasmonically amplified fluorescence bioassay with microarray format

Science.gov (United States)

Gogalic, S.; Hageneder, S.; Ctortecka, C.; Bauch, M.; Khan, I.; Preininger, Claudia; Sauer, U.; Dostalek, J.

2015-05-01

Plasmonic amplification of fluorescence signal in bioassays with microarray detection format is reported. A crossed relief diffraction grating was designed to couple an excitation laser beam to surface plasmons at the wavelength overlapping with the absorption and emission bands of fluorophore Dy647 that was used as a label. The surface of periodically corrugated sensor chip was coated with surface plasmon-supporting gold layer and a thin SU8 polymer film carrying epoxy groups. These groups were employed for the covalent immobilization of capture antibodies at arrays of spots. The plasmonic amplification of fluorescence signal on the developed microarray chip was tested by using interleukin 8 sandwich immunoassay. The readout was performed ex situ after drying the chip by using a commercial scanner with high numerical aperture collecting lens. Obtained results reveal the enhancement of fluorescence signal by a factor of 5 when compared to a regular glass chip.

Amplified Fragment Length Polymorphism Fingerprinting for Identification of a Core Group of Neisseria gonorrhoeae Transmitters in the Population Attending a Clinic for Treatment of Sexually Transmitted Diseases in Amsterdam, The Netherlands

OpenAIRE

Spaargaren, Joke; Stoof, Jeroen; Fennema, Han; Coutinho, Roel; Savelkoul, Paul

2001-01-01

Amplified fragment length polymorphism analysis seems well suited for studying the epidemiology of isolates of Neisseria gonorrhoeae obtained from patients attending the Sexually Transmitted Disease Outpatient Clinic in Amsterdam, The Netherlands. It shows potential to identify the core group of transmitters.

[Cloning of human CD45 gene and its expression in Hela cells].

Science.gov (United States)

Li, Jie; Xu, Tianyu; Wu, Lulin; Zhang, Liyun; Lu, Xiao; Zuo, Daming; Chen, Zhengliang

2015-11-01

To clone human CD45 gene PTPRC and establish Hela cells overexpressing recombinant human CD45 protein. The intact cDNA encoding human CD45 amplified using RT-PCR from the total RNA extracted from peripheral blood mononuclear cells (PBMCs) of a healthy donor was cloned into pMD-18T vector. The CD45 cDNA fragment amplified from the pMD-18T-CD45 by PCR was inserted to the coding region of the PcDNA3.1-3xflag vector, and the resultant recombinant expression vector PcDNA3.1-3xflag-CD45 was transfected into Hela cells. The expression of CD45 in Hela cells was detected by flow cytometry and Western blotting, and the phosphastase activity of CD45 was quantified using an alkaline phosphatase assay kit. The cDNA fragment of about 3 900 bp was amplified from human PBMCs and cloned into pMD-18T vector. The recombinant expression vector PcDNA3.1-3xflag-CD45 was constructed, whose restriction maps and sequence were consistent with those expected. The expression of CD45 in transfected Hela cells was detected by flow cytometry and Western blotting, and the expressed recombinant CD45 protein in Hela cells showed a phosphastase activity. The cDNA of human CD45 was successfully cloned and effectively expressed in Hela cells, which provides a basis for further exploration of the functions of CD45.

ISOLASI cDNA SUCROSE TRANSPORTER (SUT DARI BATANG TANAMAN TEBU (Saccharum officinarum L.

Directory of Open Access Journals (Sweden)

- Slameto

2010-09-01

Full Text Available Sucrose Transporter (SUT is kind of protein transporter that control in sucrose translocation. Sucrose Transporter is intermediate in translocation of sucrose from apoplasmic to simplasmic. SUT facilitates sucrose transportation from vascular tissues to parenchyma cells toward in node sugarcane stem. This research was purposed to isolate cDNA SUT from sugarcane stem, and cloned in Escherichia coli strain DH5α. Total RNA of sugarcane stem was isolated by single step method, then add with oligo dT in order to obtain the first strand of SUT cDNA then used as template for PCR. The primer used for PCR is 5’ –ggg ctg att gtg gcc atg tc- ‘3 (SUT-F and 5’ –tgc cct ttg tct ccg gaa cc- ‘3 (SUT-R. PCR was programmed as follow denaturation at 94°C for 2 minutes and 30 second, annealing at 54°C for 30 s, extension at 72°C 2 min and 7 min, and storage at 4°C for unlimited, It was for 30 cycles. Complementary DNA SUT from PCR ligalized to pTOPO bunt-end, then it cloned in to E. coli strain DH5α. The cloning resulted then be sequenced in order to observe the homologues with other nucleotides sequences of some plant using BLASTn program in GENE BANK NCBI and the level of homology determined by Genetyx program. The concentrated of total RNA isolated was 5,024 μg/μl, with purity of 1,85. Complementary DNA SUT fragment from PCR with size 2037 bp appropriated to the both of primer was used. Complementary DNA SUT fragment showed by analyzed some of restriction enzyme e.g. EcoRI, PstI and BamHI. Homologues of this cDNA SUT fragment was 100% to SoSUT 2A of sugarcane stem and 84% to OsSUT of rice plant (Casu et al ., 2003.

High-Resolution Amplified Fragment Length Polymorphism Typing of Lactococcus lactis Strains Enables Identification of Genetic Markers for Subspecies-Related Phenotypes▿

Science.gov (United States)

Kütahya, Oylum Erkus; Starrenburg, Marjo J. C.; Rademaker, Jan L. W.; Klaassen, Corné H. W.; van Hylckama Vlieg, Johan E. T.; Smid, Eddy J.; Kleerebezem, Michiel

2011-01-01

A high-resolution amplified fragment length polymorphism (AFLP) methodology was developed to achieve the delineation of closely related Lactococcus lactis strains. The differentiation depth of 24 enzyme-primer-nucleotide combinations was experimentally evaluated to maximize the number of polymorphisms. The resolution depth was confirmed by performing diversity analysis on 82 L. lactis strains, including both closely and distantly related strains with dairy and nondairy origins. Strains clustered into two main genomic lineages of L. lactis subsp. lactis and L. lactis subsp. cremoris type-strain-like genotypes and a third novel genomic lineage rooted from the L. lactis subsp. lactis genomic lineage. Cluster differentiation was highly correlated with small-subunit rRNA homology and multilocus sequence analysis (MLSA) studies. Additionally, the selected enzyme-primer combination generated L. lactis subsp. cremoris phenotype-specific fragments irrespective of the genotype. These phenotype-specific markers allowed the differentiation of L. lactis subsp. lactis phenotype from L. lactis subsp. cremoris phenotype strains within the same L. lactis subsp. cremoris type-strain-like genomic lineage, illustrating the potential of AFLP for the generation of phenotype-linked genetic markers. PMID:21666014

An amplified graphene oxide-based fluorescence aptasensor based on target-triggered aptamer hairpin switch and strand-displacement polymerization recycling for bioassays.

Science.gov (United States)

Hu, Kun; Liu, Jinwen; Chen, Jia; Huang, Yong; Zhao, Shulin; Tian, Jianniao; Zhang, Guohai

2013-04-15

An amplified graphene oxide (GO) based fluorescence aptasensor based on target-triggered aptamer hairpin switch and strand-displacement polymerization recycling is developed for bioassays. The dye-labeled single-strand DNA (aptamer hairpin) was adsorbed on the surface of GO, which result in the fluorescence quenching of dye, and exhibiting minimal background fluorescence. Upon the target, primer and polymerase, the stem of the aptamer hairpin was opened, and binds with the primer to triggers the circular target strand-displacement polymerization reaction, which produces huge amounts of duplex helixes DNA and lead to strong fluorescence emission due to shielding of nucelobases within its double-helix structure. During the polymerization reaction, the primer was extended, and target was displaced. And the displaced target recognizes and hybridizes with another hairpin probe, triggering the next round of polymerization reaction, and the circle process induces fluorescence signal amplification for the detection of analyte. To test the feasibility of the aptasensor systems, interferon-gamma (IFN-γ) was employed as a model analyte. A detection limit as low as 1.5 fM is obtained based on the GO aptasensor with a linear range of three orders of magnitude. The present method was successfully applied for the detection of IFN-γ in human plasma. Copyright © 2012 Elsevier B.V. All rights reserved.

Construction and expression of a functional monoclonal antibody SZ-51 specific for GMP-140 chimeric fab fragment in Escherichia coli

International Nuclear Information System (INIS)

Gu Jianming; Zhang Xiaomin; Xia Lijun; Wan Haiying; Liu Yue; Li Peixia; Ruan Changgeng

1996-04-01

The variable region cDNAs of a monoclonal antibody SZ-51 specific for α-granule membrane protein (GMP-140) on the surface of activated human platelets were spliced with the constant region cDNA of the heavy chain CH1 and light chain k of human Ig G by means of the gene recombination techniques. The above recombinant gene was amplified by the polymerase chain reaction (PCR). The expression vector of phage plasmid pHEN1 SZ-51 Fab/Hu was constructed. The pHEN1-51 Fab/Hu was introduced into non-suppressor E. coli HB2151. The amount of expression of SZ-51 chimeric Fab/Hu measured by quantitative ELISA was about 500 μg/L. Western blot demonstrated that the SZ-51 chimeric Fab fragment could specifically bind to GMP-140. (2 figs.)

Methods to determine the transcriptomes of trypanosomes in mixtures with mammalian cells: the effects of parasite purification and selective cDNA amplification.

Directory of Open Access Journals (Sweden)

Julius Mulindwa

2014-04-01

Full Text Available Patterns of gene expression in cultured Trypanosoma brucei bloodstream and procyclic forms have been extensively characterized, and some comparisons have been made with trypanosomes grown to high parasitaemias in laboratory rodents. We do not know, however, to what extent these transcriptomes resemble those in infected Tsetse flies - or in humans or cattle, where parasitaemias are substantially lower. For clinical and field samples it is difficult to characterize parasite gene expression because of the large excess of host cell RNA. We have here examined two potential solutions to this problem for bloodstream form trypanosomes, assaying transcriptomes by high throughput cDNA sequencing (RNASeq. We first purified the parasites from blood of infected rats. We found that a red blood cell lysis procedure affected the transcriptome substantially more than purification using a DEAE cellulose column, but that too introduced significant distortions and variability. As an alternative, we specifically amplified parasite sequences from a mixture containing a 1000-fold excess of human RNA. We first purified polyadenylated RNA, then made trypanosome-specific cDNA by priming with a spliced leader primer. Finally, the cDNA was amplified using nested primers. The amplification procedure was able to produce samples in which 20% of sequence reads mapped to the trypanosome genome. Synthesis of the second cDNA strand with a spliced leader primer, followed by amplification, is sufficiently reproducible to allow comparison of different samples so long as they are all treated in the same way. However, SL priming distorted the abundances of the cDNA products and definitely cannot be used, by itself, to measure absolute mRNA levels. The amplification method might be suitable for clinical samples with low parasitaemias, and could also be adapted for other Kinetoplastids and to samples from infected vectors.

Characterization of cDNA encoding human placental anticoagulant protein (PP4): Homology with the lipocortin family

International Nuclear Information System (INIS)

Grundmann, U.; Abel, K.J.; Bohn, H.; Loebermann, H.; Lottspeich, F.; Kuepper, H.

1988-01-01

A cDNA library prepared from human placenta was screened for sequences encoding the placental protein 4 (PP4). PP4 is an anticoagulant protein that acts as an indirect inhibitor of the thromboplastin-specific complex, which is involved in the blood coagulation cascade. Partial amino acid sequence information from PP4-derived cyanogen bromide fragments was used to design three oligonucleotide probes for screening the library. From 10 6 independent recombinants, 18 clones were identified that hybridized to all three probes. These 18 recombinants contained cDNA inserts encoding a protein of 320 amino acid residues. In addition to the PP4 cDNA the authors identified 9 other recombinants encoding a protein with considerable similarity (74%) to PP4, which was termed PP4-X. PP4 and PP4-X belong to the lipocortin family, as judged by their homology to lipocortin I and calpactin I

D22S15 - a fetal brain cDNA with BanII and SacI RFLP

Energy Technology Data Exchange (ETDEWEB)

Rouleau, G A; Kurnit, D M; Neve, R L; Bazanowsky, A; Patterson, D; Gusella, J F

1988-02-25

A .58 kb single copy EcoRI fragment was isolated from a human fetal brain cDNA library and cloned into pBR322. This fragment recognizes a two allele polymorphism when used to probe human genomic DNA digested with SacI. There are no constant bands. Additional polymorphisms recognized by BanII and Bsp1286 are in disequilibrium with the BanII polymorphism. It has been localized to chromosome 22 by somatic cell hybrid analysis and linkage analysis. Co-dominant segregation has been observed in 15 informative families.

Construction of a cDNA library and preliminary analysis of expressed sequence tags in Piper hainanense.

Science.gov (United States)

Fan, R; Ling, P; Hao, C Y; Li, F P; Huang, L F; Wu, B D; Wu, H S

2015-10-19

Black pepper is a perennial climbing vine. It is widely cultivated because its berries can be utilized not only as a spice in food but also for medicinal use. This study aimed to construct a standardized, high-quality cDNA library to facilitated identification of new Piper hainanense transcripts. For this, 262 unigenes were used to generate raw reads. The average length of these 262 unigenes was 774.8 bp. Of these, 94 genes (35.9%) were newly identified, according to the NCBI protein database. Thus, identification of new genes may broaden the molecular knowledge of P. hainanense on the basis of Clusters of Orthologous Groups and Gene Ontology categories. In addition, certain basic genes linked to physiological processes, which can contribute to disease resistance and thereby to the breeding of black pepper. A total of 26 unigenes were found to be SSR markers. Dinucleotide SSR was the main repeat motif, accounting for 61.54%, followed by trinucleotide SSR (23.07%). Eight primer pairs successfully amplified DNA fragments and detected significant amounts of polymorphism among twenty-one piper germplasm. These results present a novel sequence information of P. hainanense, which can serve as the foundation for further genetic research on this species.

Genome-wide macrosynteny among Fusarium species in the Gibberella fujikuroi complex revealed by amplified fragment length polymorphisms.

Directory of Open Access Journals (Sweden)

Lieschen De Vos

Full Text Available The Gibberella fujikuroi complex includes many Fusarium species that cause significant losses in yield and quality of agricultural and forestry crops. Due to their economic importance, whole-genome sequence information has rapidly become available for species including Fusarium circinatum, Fusarium fujikuroi and Fusarium verticillioides, each of which represent one of the three main clades known in this complex. However, no previous studies have explored the genomic commonalities and differences among these fungi. In this study, a previously completed genetic linkage map for an interspecific cross between Fusarium temperatum and F. circinatum, together with genomic sequence data, was utilized to consider the level of synteny between the three Fusarium genomes. Regions that are homologous amongst the Fusarium genomes examined were identified using in silico and pyrosequenced amplified fragment length polymorphism (AFLP fragment analyses. Homology was determined using BLAST analysis of the sequences, with 777 homologous regions aligned to F. fujikuroi and F. verticillioides. This also made it possible to assign the linkage groups from the interspecific cross to their corresponding chromosomes in F. verticillioides and F. fujikuroi, as well as to assign two previously unmapped supercontigs of F. verticillioides to probable chromosomal locations. We further found evidence of a reciprocal translocation between the distal ends of chromosome 8 and 11, which apparently originated before the divergence of F. circinatum and F. temperatum. Overall, a remarkable level of macrosynteny was observed among the three Fusarium genomes, when comparing AFLP fragments. This study not only demonstrates how in silico AFLPs can aid in the integration of a genetic linkage map to the physical genome, but it also highlights the benefits of using this tool to study genomic synteny and architecture.

Eukaryotic transcriptomics in silico: Optimizing cDNA-AFLP efficiency

NARCIS (Netherlands)

Stölting, K.N.; Gort, G.; Wüst, C.; Wilson, A.B.

2009-01-01

Background - Complementary-DNA based amplified fragment length polymorphism (cDNA-AFLP) is a commonly used tool for assessing the genetic regulation of traits through the correlation of trait expression with cDNA expression profiles. In spite of the frequent application of this method, studies on

Characterization of cDNA for PMT: a Partial Nicotine Biosynthesis-Related Gene Isolated from Indonesian Local Tobacco (Nicotiana tabacum cv. Sindoro1

Directory of Open Access Journals (Sweden)

SESANTI BASUKI

2013-12-01

Full Text Available Nicotine is the major alkaloid compound in cultivated tobacco (Nicotiana tabacum that could potentially be converted into carcinogenic compound (nor-nicotine. The PMT gene encoding putrescine N-methyltransferase (PMT is one of the two key genes that play a prominent role in nicotine biosynthesis. The aimed of this study was to isolate and characterize the cDNA sequence originated from Indonesian local tobacco cv. Sindoro1 (Ntpmt_Sindoro1. The results showed that the Ntpmt_Sindoro1 was 1124 bp in length. This cDNA fragment encodes for 374 amino acid residues. The predicted polypeptide from the cDNA is a hidrophilic protein, and has a predicted molecular weight of 40.95 kDa. The predicted amino acids sequence also showed high similarity to the PMT gene product Nicotiana sp. available in the GenBank data base. The amino acid sequences also exert conserved residues specifically exhibited only by PMT gene originated from N. tabacum. Clustering analysis revealed that Ntpmt_Sindoro1 belongs to the same clade as the PMT3 gene, a member of the N. tabacum PMT gene family. The Ntpmt_Sindoro1 cDNA sequence covering exon1-exon8 of the PMT gene fragment has been registered in the GenBank data base, under the accession number JX978277.

Sex Determination from Fragmented and Degenerated DNA by Amplified Product-Length Polymorphism Bidirectional SNP Analysis of Amelogenin and SRY Genes.

Directory of Open Access Journals (Sweden)

Kotoka Masuyama

Full Text Available Sex determination is important in archeology and anthropology for the study of past societies, cultures, and human activities. Sex determination is also one of the most important components of individual identification in criminal investigations. We developed a new method of sex determination by detecting a single-nucleotide polymorphism in the amelogenin gene using amplified product-length polymorphisms in combination with sex-determining region Y analysis. We particularly focused on the most common types of postmortem DNA damage in ancient and forensic samples: fragmentation and nucleotide modification resulting from deamination. Amplicon size was designed to be less than 60 bp to make the method more useful for analyzing degraded DNA samples. All DNA samples collected from eight Japanese individuals (four male, four female were evaluated correctly using our method. The detection limit for accurate sex determination was determined to be 20 pg of DNA. We compared our new method with commercial short tandem repeat analysis kits using DNA samples artificially fragmented by ultraviolet irradiation. Our novel method was the most robust for highly fragmented DNA samples. To deal with allelic dropout resulting from deamination, we adopted "bidirectional analysis," which analyzed samples from both sense and antisense strands. This new method was applied to 14 Jomon individuals (3500-year-old bone samples whose sex had been identified morphologically. We could correctly identify the sex of 11 out of 14 individuals. These results show that our method is reliable for the sex determination of highly degenerated samples.

Cloning of a novel transcription factor-like gene amplified in human glioma including astrocytoma grade I

NARCIS (Netherlands)

Fischer, U.; Heckel, D.; Michel, A.; Janka, M.; Hulsebos, T.; Meese, E.

1997-01-01

Gene amplification, which is generally considered to occur late in tumor development, is a common feature of high grade glioma. Up until now, there have been no reports on amplification in astrocytoma grade I. In this study, we report cloning and sequencing of a cDNA termed glioma-amplified sequence

Construction and sequencing analysis of scFv antibody fragment derived from monoclonal antibody against norfloxacin (Nor155

Directory of Open Access Journals (Sweden)

J. Mala

2017-06-01

Full Text Available Norfloxacin belongs to the group of fluoroquinolone antibiotics which has been approved for treatment in animals. However, its residues in animal products can pose adverse side effects to consumer. Therefore, detection of the residue in different food matrices must be concerned. In this study, a single chain variable fragment (scFv that recognizes norfloxacin antibiotic was constructed. The cDNA was synthesized from total RNA of hybridoma cells against norfloxacin. Genes encoding VH and VL regions of monoclonal antibody against norfloxacin (Nor155 were amplified and size of VH and VL fragments was 402 bp and 363 bp, respectively. The scFv of Nor155 was constructed by an addition of (Gly4Ser3 as a linker between VH and VL regions and subcloned into pPICZαA, an expression vector of Pichia pastoris. The sequence of scFv Nor155 (GenBank No. AJG06891.1 was confirmed by sequencing analysis. The complementarity determining regions (CDR I, II, and III of VH and VL were specified by Kabat method. The obtained recombinant plasmid will be useful for production of scFv antibody against norfloxacin in P. pastoris and further engineer scFv antibody against fluoroquinolone antibiotics.

Genetic relationship among nine Rhododendron species in Qinling mountains, China using amplified fragment length polymorphism markers

International Nuclear Information System (INIS)

Zhao, B.; Zheng, X.Z.

2015-01-01

Genetic relationships of nine species of Rhododendron in the Qinling Mountains were evaluated using amplified fragment length polymorphism (AFLP) markers. A total of 440 amplification products were obtained using nine selected AFLP markers, of which 421 (95.40%) showed polymorphism. With these polymorphic products, a dendrogram was constructed using the unweighted pair-group method with arithmetic mean (UPGMA). R. calophytum, R. hypoglaucum and R. clementinae, belonging to Subgen Hymenanthes, gathered together, and the species derived from Subgen Rhododendron and Subgen Tsutsusi formed another two groups. R. tsinlingense, R. purdomii, R. Taibaiense and R. capitatum (Subsect. Lapponica), and R. concinnum (Subsect. Triflora) were clustered as one group, but they belong to difference subsect. and R. purdomii and R. Taibaiense showed the closest genetic distance, but both species differed greatly in morphological characteristics.These results showed that the genetic relationships among nine Rhododendron species, determined by AFLP markers, were partially related to their taxonomic position, geography distribution and morphological classification. The present study will benefit the identification and conservation of Rhododendron, and the development of new Rhododendron cultivar. (author)

cDNA sequence quality data - Budding yeast cDNA sequencing project | LSDB Archive [Life Science Database Archive metadata

Lifescience Database Archive (English)

Full Text Available List Contact us Budding yeast cDNA sequencing project cDNA sequence quality data Data detail Data name cDNA sequence quality... data DOI 10.18908/lsdba.nbdc00838-003 Description of data contents Phred's quality score. P...tion Download License Update History of This Database Site Policy | Contact Us cDNA sequence quality

Consistent errors in first strand cDNA due to random hexamer mispriming.

Directory of Open Access Journals (Sweden)

Thomas P van Gurp

Full Text Available Priming of random hexamers in cDNA synthesis is known to show sequence bias, but in addition it has been suggested recently that mismatches in random hexamer priming could be a cause of mismatches between the original RNA fragment and observed sequence reads. To explore random hexamer mispriming as a potential source of these errors, we analyzed two independently generated RNA-seq datasets of synthetic ERCC spikes for which the reference is known. First strand cDNA synthesized by random hexamer priming on RNA showed consistent position and nucleotide-specific mismatch errors in the first seven nucleotides. The mismatch errors found in both datasets are consistent in distribution and thermodynamically stable mismatches are more common. This strongly indicates that RNA-DNA mispriming of specific random hexamers causes these errors. Due to their consistency and specificity, mispriming errors can have profound implications for downstream applications if not dealt with properly.

Restriction fragment polymorphism (RFLP) of a "new" HLA-DP specificity, CDP-HEI

DEFF Research Database (Denmark)

Hyldig-Nielsen, J J; Ødum, Niels; Morling, Niels

1988-01-01

Southern blotting with a DP beta cDNA probe of MspI digested DNA from 83 healthy unrelated individuals revealed a 1.8 kb fragment present in all four individuals (and no others) possessing the newly determined DP specificity, CDP-HEI....

Cloning of the cDNA for a human homologue of the Drosophila white gene and mapping to chromosome 21q22.3.

OpenAIRE

Chen, H.; Rossier, C.; Lalioti, M. D.; Lynn, A.; Chakravarti, A.; Perrin, G.; Antonarakis, S. E.

1996-01-01

In an effort to contribute to the transcript map of human chromosome 21 and the understanding of the pathophysiology of trisomy 21, we have used exon trapping to identify fragments of chromosome 21 genes. Two trapped exons, from pools of chromosome 21-specific cosmids, showed homology to the Drosophila white (w) gene. We subsequently cloned the corresponding cDNA for a human homologue of the Drosophila w gene (hW) from human retina and fetal brain cDNA libraries. The gene belongs to the ATP-b...

Frame-Insensitive Expression Cloning of Fluorescent Protein from Scolionema suvaense

Directory of Open Access Journals (Sweden)

Yuki Horiuchi

2018-01-01

Full Text Available Expression cloning from cDNA is an important technique for acquiring genes encoding novel fluorescent proteins. However, the probability of in-frame cDNA insertion following the first start codon of the vector is normally only 1/3, which is a cause of low cloning efficiency. To overcome this issue, we developed a new expression plasmid vector, pRSET-TriEX, in which transcriptional slippage was induced by introducing a DNA sequence of (dT14 next to the first start codon of pRSET. The effectiveness of frame-insensitive cloning was validated by inserting the gene encoding eGFP with all three possible frames to the vector. After transformation with one of these plasmids, E. coli cells expressed eGFP with no significant difference in the expression level. The pRSET-TriEX vector was then used for expression cloning of a novel fluorescent protein from Scolionema suvaense. We screened 3658 E. coli colonies transformed with pRSET-TriEX containing Scolionema suvaense cDNA, and found one colony expressing a novel green fluorescent protein, ScSuFP. The highest score in protein sequence similarity was 42% with the chain c of multi-domain green fluorescent protein like protein “ember” from Anthoathecata sp. Variations in the N- and/or C-terminal sequence of ScSuFP compared to other fluorescent proteins indicate that the expression cloning, rather than the sequence similarity-based methods, was crucial for acquiring the gene encoding ScSuFP. The absorption maximum was at 498 nm, with an extinction efficiency of 1.17 × 105 M−1·cm−1. The emission maximum was at 511 nm and the fluorescence quantum yield was determined to be 0.6. Pseudo-native gel electrophoresis showed that the protein forms obligatory homodimers.

Cloning and sequencing of Indian Water buffalo (Bubalus bubalis) interleukin-3 cDNA

KAUST Repository

Sugumar, Thennarasu

2011-12-12

Full-length cDNA (435 bp) of the interleukin-3(IL-3) gene of the Indian water buffalo was amplified by reverse transcriptase-polymerase chain reaction and sequenced. This sequence had 96% nucleotide identity and 92% amino acid identity with bovine IL-3. There are 10 amino acid substitutions in buffalo compared with that of bovine. The amino acid sequence of buffalo IL-3 also showed very high identity with that of other ruminants, indicating functional cross-reactivity. Structural homology modelling of buffalo IL-3 protein with human IL-3 showed the presence of five helical structures.

[Expression and purification of a novel thermophilic bacterial single-stranded DNA-binding protein and enhancement the synthesis of DNA and cDNA].

Science.gov (United States)

Jia, Xiao-Wei; Zhang, Guo-Hui; Shi, Hai-Yan

2012-12-01

Express a novel species of single-stranded DNA-binding protein (SSB) derived from Thermococcus kodakarensis KOD1, abbreviated kod-ssb. And evaluate the effect of kod-ssb on PCR-based DNA amplification and reverse transcription. We express kod-ssb with the Transrtta (DE3), and kod-ssb was purified by affinity chromatography on a Ni2+ Sepharose column, detected by SDS-PAGE. To evaluate the effect of kod-ssb on PCR-based DNA amplification, the human beta globin gene was used as template to amplify a 5-kb, 9-kb and 13-kb. And to detect the effect of kod-ssb on reverse transcription, we used RNA from flu cell culture supernatant extraction as templates to implement qRT-PCR reaction. The plasmid pET11a-kod was transformed into Transetta (DE3) and the recombinant strain Transetta (pET11 a-kod) was obtained. The kod-ssb was highly expressed when the recombinant strain Transetta(pET11a-kod) was induced by IPTG. The specific protein was detected by SDS-PAGE. To confirm that kod-ssb can enhance target DNA synthesis and reduce PCR by-products, 5-, 9-, and 13-kb human beta globin gene fragments were used as templates for PCR. When PCR reactions did not include SSB proteins, the specific PCR product was contaminated with non-specific products. When kod -ssb was added, kod-ssb significantly enhanced amplification of the 5-, 9-and 13-kb target product and minimised the non-specific PCR products. To confirm that kod-ssb can enhance target cDNA synthesis, RNA from flu cell culture supernatant extraction was used as templates for qRT-PCR reaction. The results was that when kod-ssb was added, kod-ssb significantly enhanced the synthesis of cDNA, average Ct value is 19.42, and the average Ct value without kod-ssb is 22.15. kod-ssb may in future be used to enhance DNA and cDNA amplification.

Yeast two-hybrid screening of proteins interacting with plasmin receptor subunit: C-terminal fragment of annexin A2.

Science.gov (United States)

Li, Qun; Laumonnier, Yves; Syrovets, Tatiana; Simmet, Thomas

2011-11-01

To identify proteins that interact with the C-terminal fragment of annexin A2 (A2IC), generated by plasmin cleavage of the plasmin receptor, a heterotetramer (AA2t) containing annexin A2. The gene that encodes the A2IC fragment was obtained from PCR-amplified cDNA isolated from human monocytes, and was ligated into the pBTM116 vector using a DNA ligation kit. The resultant plasmid (pBTM116-A2IC) was sequenced with an ABI PRISM 310 Genetic Analyzer. The expression of an A2IC bait protein fused with a LexA-DNA binding domain (BD) was determined using Western blot analysis. The identification of proteins that interact with A2IC and are encoded in a human monocyte cDNA library was performed using yeast two-hybrid screening. The DNA sequences of the relevant cDNAs were determined using an ABI PRISM BigDye terminator cycle sequencing ready reaction kit. Nucleotide sequence databases were searched for homologous sequences using BLAST search analysis (http://www.ncbi.nlm.nih.gov). Confirmation of the interaction between the protein LexA-A2IC and each of cathepsin S and SNX17 was conducted using a small-scale yeast transformation and X-gal assay. The yeast transformed with plasmids encoding the bait proteins were screened with a human monocyte cDNA library by reconstituting full-length transcription factors containing the GAL4-active domain (GAL4-AD) as the prey in a yeast two-hybrid approach. After screening 1×10(7) clones, 23 independent β-Gal-positive clones were identified. Sequence analysis and a database search revealed that 15 of these positive clones matched eight different proteins (SNX17, ProCathepsin S, RPS2, ZBTB4, OGDH, CCDC32, PAPD4, and actin which was already known to interact with annexin A2). A2IC A2IC interacts with various proteins to form protein complexes, which may contribute to the molecular mechanism of monocyte activation induced by plasmin. The yeast two-hybrid system is an efficient approach for investigating protein interactions.

Construction of Agrobacterium tumefaciens-mediated tomato black ring virus infectious cDNA clones.

Science.gov (United States)

Zarzyńska-Nowak, Aleksandra; Ferriol, Inmaculada; Falk, Bryce W; Borodynko-Filas, Natasza; Hasiów-Jaroszewska, Beata

2017-02-15

Tomato black ring virus (TBRV, genus Nepovirus) infects a wide range of economically important plants such as tomato, potato, tobacco and cucumber. Here, a successful construction of infectious full-length cDNA clones of the TBRV genomic RNAs (RNA1 and RNA2) is reported for the first time. The engineered constructs consisting of PCR-amplified DNAs were cloned into binary vector pJL89 immediately downstream of a double cauliflower mosaic virus (CaMV) 35S promoter, and upstream of the hepatitis delta virus (HDV) ribozyme and nopaline synthase terminator (NOS). The symptoms induced on plants agroinoculated with both constructs were indistinguishable from those caused by the wild-type virus. The infectivity of obtained clones was verified by reinoculation to Nicotiana tabacum cv. Xanthi, Chenopodium quinoa and Cucumis sativus. The presence of viral particles and RNA was confirmed by electron microscopy and reverse transcription polymerase chain reaction, respectively. Constructed full-length infectious cDNA clones will serve as an excellent tool to study virus-host-vector interactions. Copyright © 2017 Elsevier B.V. All rights reserved.

Protein subcellular localization assays using split fluorescent proteins

Science.gov (United States)

Waldo, Geoffrey S [Santa Fe, NM; Cabantous, Stephanie [Los Alamos, NM

2009-09-08

The invention provides protein subcellular localization assays using split fluorescent protein systems. The assays are conducted in living cells, do not require fixation and washing steps inherent in existing immunostaining and related techniques, and permit rapid, non-invasive, direct visualization of protein localization in living cells. The split fluorescent protein systems used in the practice of the invention generally comprise two or more self-complementing fragments of a fluorescent protein, such as GFP, wherein one or more of the fragments correspond to one or more beta-strand microdomains and are used to "tag" proteins of interest, and a complementary "assay" fragment of the fluorescent protein. Either or both of the fragments may be functionalized with a subcellular targeting sequence enabling it to be expressed in or directed to a particular subcellular compartment (i.e., the nucleus).

Assessment of intercentre reproducibility and epidemiological concordance of Legionella pneumophila serogroup 1 genotyping by amplified fragment length polymorphism analysis

DEFF Research Database (Denmark)

Fry, N K; Bangsborg, Jette Marie; Bernander, S

2000-01-01

The aims of this work were to assess (i) the intercentre reproducibility and epidemiological concordance of amplified fragment length polymorphism analysis for epidemiological typing of Legionella pneumophila serogroup 1, and (ii) the suitability of the method for standardisation and implementation...... by members of the European Working Group on Legionella Infections. Fifty coded isolates comprising two panels of well-characterised strains, a "reproducibility" panel (n=20) and an "epidemiologically related" panel (n=30), were sent to 13 centres in 12 European countries. Analysis was undertaken in each...... using gel analysis software yielded R=1.00 and E=1.00, with 12, 13 or 14 types. This method can be used as a simple, rapid screening tool for epidemiological typing of isolates of Legionella pneumophila serogroup 1. Results demonstrate that the method can be highly reproducible (R=1...

Sex Determination from Fragmented and Degenerated DNA by Amplified Product-Length Polymorphism Bidirectional SNP Analysis of Amelogenin and SRY Genes

Science.gov (United States)

Masuyama, Kotoka; Shojo, Hideki; Nakanishi, Hiroaki; Inokuchi, Shota; Adachi, Noboru

2017-01-01

Sex determination is important in archeology and anthropology for the study of past societies, cultures, and human activities. Sex determination is also one of the most important components of individual identification in criminal investigations. We developed a new method of sex determination by detecting a single-nucleotide polymorphism in the amelogenin gene using amplified product-length polymorphisms in combination with sex-determining region Y analysis. We particularly focused on the most common types of postmortem DNA damage in ancient and forensic samples: fragmentation and nucleotide modification resulting from deamination. Amplicon size was designed to be less than 60 bp to make the method more useful for analyzing degraded DNA samples. All DNA samples collected from eight Japanese individuals (four male, four female) were evaluated correctly using our method. The detection limit for accurate sex determination was determined to be 20 pg of DNA. We compared our new method with commercial short tandem repeat analysis kits using DNA samples artificially fragmented by ultraviolet irradiation. Our novel method was the most robust for highly fragmented DNA samples. To deal with allelic dropout resulting from deamination, we adopted “bidirectional analysis,” which analyzed samples from both sense and antisense strands. This new method was applied to 14 Jomon individuals (3500-year-old bone samples) whose sex had been identified morphologically. We could correctly identify the sex of 11 out of 14 individuals. These results show that our method is reliable for the sex determination of highly degenerated samples. PMID:28052096

Isolation and characterization of reverse transcriptase fragments of LTR retrotransposons from the genome of Chenopodium quinoa (Amaranthaceae).

Science.gov (United States)

Kolano, Bozena; Bednara, Edyta; Weiss-Schneeweiss, Hanna

2013-10-01

High heterogeneity was observed among conserved domains of reverse transcriptase ( rt ) isolated from quinoa. Only one Ty1- copia rt was highly amplified. Reverse transcriptase sequences were located predominantly in pericentromeric region of quinoa chromosomes. The heterogeneity, genomic abundance, and chromosomal distribution of reverse transcriptase (rt)-coding fragments of Ty1-copia and Ty3-gypsy long terminal repeat retrotransposons were analyzed in the Chenopodium quinoa genome. Conserved domains of the rt gene were amplified and characterized using degenerate oligonucleotide primer pairs. Sequence analyses indicated that half of Ty1-copia rt (51 %) and 39 % of Ty3-gypsy rt fragments contained intact reading frames. High heterogeneity among rt sequences was observed for both Ty1-copia and Ty3-gypsy rt amplicons, with Ty1-copia more heterogeneous than Ty3-gypsy. Most of the isolated rt fragments were present in quinoa genome in low copy numbers, with only one highly amplified Ty1-copia rt sequence family. The gypsy-like RNase H fragments co-amplified with Ty1-copia-degenerate primers were shown to be highly amplified in the quinoa genome indicating either higher abundance of some gypsy families of which rt domains could not be amplified, or independent evolution of this gypsy-region in quinoa. Both Ty1-copia and Ty3-gypsy retrotransposons were preferentially located in pericentromeric heterochromatin of quinoa chromosomes. Phylogenetic analyses of newly amplified rt fragments together with well-characterized retrotransposon families from other organisms allowed identification of major lineages of retroelements in the genome of quinoa and provided preliminary insight into their evolutionary dynamics.

Identification of cultured isolates of clinically important yeast species using fluorescent fragment length analysis of the amplified internally transcribed rRNA spacer 2 region

Directory of Open Access Journals (Sweden)

Muylaert An

2002-07-01

Full Text Available Abstract Background The number of patients with yeast infection has increased during the last years. Also the variety of species of clinical importance has increased. Correct species identification is often important for efficient therapy, but is currently mostly based on phenotypic features and is sometimes time-consuming and depends largely on the expertise of technicians. Therefore, we evaluated the feasibility of PCR-based amplification of the internally transcribed spacer region 2 (ITS2, followed by fragment size analysis on the ABI Prism 310 for the identification of clinically important yeasts. Results A rapid DNA-extraction method, based on simple boiling-freezing was introduced. Of the 26 species tested, 22 could be identified unambiguously by scoring the length of the ITS2-region. No distinction could be made between the species Trichosporon asteroides and T. inkin or between T. mucoides and T. ovoides. The two varieties of Cryptococcus neoformans (var. neoformans and var. gattii could be differentiated from each other due to a one bp length difference of the ITS2 fragment. The three Cryptococcus laurentii isolates were split into two groups according to their ITS2-fragment lengths, in correspondence with the phylogenetic groups described previously. Since the obtained fragment lengths compare well to those described previously and could be exchanged between two laboratories, an internationally usable library of ITS2 fragment lengths can be constructed. Conclusions The existing ITS2 size based library enables identification of most of the clinically important yeast species within 6 hours starting from a single colony and can be easily updated when new species are described. Data can be exchanged between laboratories.

RAPD analysis of alfalfa DNA mutation via N+ implantation

International Nuclear Information System (INIS)

Li Yufeng; Huang Qunce; Yu Zengliang; Liang Yunzhang

2003-01-01

Germination capacity of alfalfa seeds under low energy N + implantation manifests oscillations going down with dose strength. From analyzing alfalfa genome DNA under low energy N + implantation by RAPD (Random Amplified Polymorphous DNA), it is recommended that 30 polymorphic DNA fragments be amplified with 8 primers in total 100 primers, and fluorescence intensity of the identical DNA fragment amplified by RAPD is different between CK and treatments. Number of different polymorphic DNA fragments between treatment and CK via N + implantation manifests going up with dose strength

Efficacy Testing of H56 cDNA Tattoo Immunization against Tuberculosis in a Mouse Model.

Science.gov (United States)

Platteel, Anouk C M; Nieuwenhuizen, Natalie E; Domaszewska, Teresa; Schürer, Stefanie; Zedler, Ulrike; Brinkmann, Volker; Sijts, Alice J A M; Kaufmann, Stefan H E

2017-01-01

Tuberculosis (TB), caused by Mycobacterium tuberculosis ( Mtb ), remains a global threat. The only approved vaccine against TB, Mycobacterium bovis bacillus Calmette-Guérin (BCG), provides insufficient protection and, being a live vaccine, can cause disseminated disease in immunocompromised individuals. Previously, we found that intradermal cDNA tattoo immunization with cDNA of tetanus toxoid fragment C domain 1 fused to cDNA of the fusion protein H56, comprising the Mtb antigens Ag85B, ESAT-6, and Rv2660c, induced antigen-specific CD8 + T cell responses in vivo . As cDNA tattoo immunization would be safer than a live vaccine in immunocompromised patients, we tested the protective efficacy of intradermal tattoo immunization against TB with H56 cDNA, as well as with H56_E, a construct optimized for epitope processing in a mouse model. As Mtb antigens can be used in combination with BCG to boost immune responses, we also tested the protective efficacy of heterologous prime-boost, using dermal tattoo immunization with H56_E cDNA to boost BCG immunization in mice. Dermal H56 and H56_E cDNA immunization induced H56-specific CD4 + and CD8 + T cell responses and Ag85B-specific IgG antibodies, but did not reduce bacterial loads, although immunization with H56_E ameliorated lung pathology. Both subcutaneous and intradermal immunization with BCG resulted in broad cellular immune responses, with increased frequencies of CD4 + T effector memory cells, T follicular helper cells, and germinal center B cells, and resulted in reduced bacterial loads and lung pathology. Heterologous vaccination with BCG/H56_E cDNA induced increased H56-specific CD4 + and CD8 + T cell cytokine responses compared to vaccination with BCG alone, and lung pathology was significantly decreased in BCG/H56_E cDNA immunized mice compared to unvaccinated controls. However, bacterial loads were not decreased after heterologous vaccination compared to BCG alone. CD4 + T cells responding to Ag85B- and ESAT-6

Human cDNA mapping using fluorescence in situ hybridization. Progress report, April 1, 1992--December 31, 1992

Energy Technology Data Exchange (ETDEWEB)

Korenberg, J.R.

1993-03-04

Genetic mapping is approached using the techniques of high resolution fluorescence in situ hybridization (FISH). This technology and the results of its application are designed to rapidly generate whole genome as tool box of expressed sequence to speed the identification of human disease genes. The results of this study are intended to dovetail with and to link the results of existing technologies for creating backbone YAC and genetic maps. In the first eight months, this approach generated 60--80% of the expressed sequence map, the remainder expected to be derived through more long-term, labor-intensive, regional chromosomal gene searches or sequencing. The laboratory has made significant progress in the set-up phase, in mapping fetal and adult brain and other cDNAs, in testing a model system for directly linking genetic and physical maps using FISH with small fragments, in setting up a database, and in establishing the validity and throughput of the system.

Evaluation of the use of amplified 16S rRNA gene-restriction fragment length polymorphism analysis to detect enterobacter cloacae and bacillus licheniformis for microbial enhanced oil recovery field pilot

Energy Technology Data Exchange (ETDEWEB)

Fujiwara, Kazuhiro; Tanaka, Shinji; Otsuka, Makiko; Ichimura, Naoya [Lansai Research Institute, Kyoto (Japan); Yonebayashi, Hideharu [Japan National Oil Corp., Chiba (Japan); Hong, Chengxie; Enomoto, Heiji [Tohoku University, Miyagi (Japan)

1999-09-01

Evaluation of effectiveness of restriction fragment length polymorphism (RFLP) analysis of the 16S rRNA gene of microorganisms injected into an oil reservoir, for monitoring their levels over time, was conducted. Two microorganisms, enterobacter cloacae TRC-322 and Bacillus licheniformis TRC-18-2-a, were focused in this paper among the microorganisms selected for injection, and gene fragments of the 16S rRNA gene of these microorganisms were amplified by polymerase chain reaction (PCP), using one set of universal primers. Samples of the reservoir brine and reservoir rock were obtained; the microorganisms inhabiting in the reservoir were isolated from these samples, and the 16S rRNA gene of these microorganisms was amplified, condition remaining the same. RFLP analysis was performed on the 16S rRNA gene of each of these microorganisms, using restriction endonucleases HhaI, MspI, AluI and TaqI as necessary. Comparison of the resultant rRNA gene fragments, demonstrated that closely-related species displaying RFLP profile similar to that of E. cloacae TRC-322 or B. licheniformis TRC-18-2-a were not among the microorganisms isolated from the reservoir. PCR-RFLP analysis of the 16S rRNA gene, using the protocol; presented in this paper, is effective to detect the presence appropriate injecting microorganisms. This method was also effective for studying microorganisms isolated from the reservoir, which have the ability to grow on a molasses. (author)

X-ray image amplifying tube

International Nuclear Information System (INIS)

1977-01-01

The photo electrons from the picture on the fluorescent input screen are amplified by an electron optical system and produce an intensified image on the output screen. This can be photographed and shown on a TV screen. The effects of stray magnetic fields are reduced by covering the input screen with a grating made of strips of ferromagnetic material such as μ metal. (T.S.E.T.)

Identification of immune protective genes of Eimeria maxima through cDNA expression library screening.

Science.gov (United States)

Yang, XinChao; Li, MengHui; Liu, JianHua; Ji, YiHong; Li, XiangRui; Xu, LiXin; Yan, RuoFeng; Song, XiaoKai

2017-02-16

Eimeria maxima is one of the most prevalent Eimeria species causing avian coccidiosis, and results in huge economic loss to the global poultry industry. Current control strategies, such as anti-coccidial medication and live vaccines have been limited because of their drawbacks. The third generation anticoccidial vaccines including the recombinant vaccines as well as DNA vaccines have been suggested as a promising alternative strategy. To date, only a few protective antigens of E. maxima have been reported. Hence, there is an urgent need to identify novel protective antigens of E. maxima for the development of neotype anticoccidial vaccines. With the aim of identifying novel protective genes of E. maxima, a cDNA expression library of E. maxima sporozoites was constructed using Gateway technology. Subsequently, the cDNA expression library was divided into 15 sub-libraries for cDNA expression library immunization (cDELI) using parasite challenged model in chickens. Protective sub-libraries were selected for the next round of screening until individual protective clones were obtained, which were further sequenced and analyzed. Adopting the Gateway technology, a high-quality entry library was constructed, containing 9.2 × 10 6 clones with an average inserted fragments length of 1.63 kb. The expression library capacity was 2.32 × 10 7 colony-forming units (cfu) with an average inserted fragments length of 1.64 Kb. The expression library was screened using parasite challenged model in chickens. The screening yielded 6 immune protective genes including four novel protective genes of EmJS-1, EmRP, EmHP-1 and EmHP-2, and two known protective genes of EmSAG and EmCKRS. EmJS-1 is the selR domain-containing protein of E. maxima whose function is unknown. EmHP-1 and EmHP-2 are the hypothetical proteins of E. maxima. EmRP and EmSAG are rhomboid-like protein and surface antigen glycoproteins of E. maxima respectively, and involved in invasion of the parasite. Our

Amplified fragment length polymorphism fingerprinting of Pseudomonas strains from a poultry processing plant.

Science.gov (United States)

Geornaras, I; Kunene, N F; von Holy, A; Hastings, J W

1999-09-01

Molecular typing has been used previously to identify and trace dissemination of pathogenic and spoilage bacteria associated with food processing. Amplified fragment length polymorphism (AFLP) is a novel DNA fingerprinting technique which is considered highly reproducible and has high discriminatory power. This technique was used to fingerprint 88 Pseudomonas fluorescens and Pseudomonas putida strains that were previously isolated from plate counts of carcasses at six processing stages and various equipment surfaces and environmental sources of a poultry abattoir. Clustering of the AFLP patterns revealed a high level of diversity among the strains. Six clusters (clusters I through VI) were delineated at an arbitrary Dice coefficient level of 0.65; clusters III (31 strains) and IV (28 strains) were the largest clusters. More than one-half (52.3%) of the strains obtained from carcass samples, which may have represented the resident carcass population, grouped together in cluster III. By contrast, 43.2% of the strains from most of the equipment surfaces and environmental sources grouped together in cluster IV. In most cases, the clusters in which carcass strains from processing stages grouped corresponded to the clusters in which strains from the associated equipment surfaces and/or environmental sources were found. This provided evidence that there was cross-contamination between carcasses and the abattoir environment at the DNA level. The AFLP data also showed that strains were being disseminated from the beginning to the end of the poultry processing operation, since many strains associated with carcasses at the packaging stage were members of the same clusters as strains obtained from carcasses after the defeathering stage.

Yoctomole electrochemical genosensing of Ebola virus cDNA by rolling circle and circle to circle amplification.

Science.gov (United States)

Carinelli, S; Kühnemund, M; Nilsson, M; Pividori, M I

2017-07-15

This work addresses the design of an Ebola diagnostic test involving a simple, rapid, specific and highly sensitive procedure based on isothermal amplification on magnetic particles with electrochemical readout. Ebola padlock probes were designed to detect a specific L-gene sequence present in the five most common Ebola species. Ebola cDNA was amplified by rolling circle amplification (RCA) on magnetic particles. Further re-amplification was performed by circle-to-circle amplification (C2CA) and the products were detected in a double-tagging approach using a biotinylated capture probe for immobilization on magnetic particles and a readout probe for electrochemical detection by square-wave voltammetry on commercial screen-printed electrodes. The electrochemical genosensor was able to detect as low as 200 ymol, corresponding to 120 cDNA molecules of L-gene Ebola virus with a limit of detection of 33 cDNA molecules. The isothermal double-amplification procedure by C2CA combined with the electrochemical readout and the magnetic actuation enables the high sensitivity, resulting in a rapid, inexpensive, robust and user-friendly sensing strategy that offers a promising approach for the primary care in low resource settings, especially in less developed countries. Copyright © 2016 Elsevier B.V. All rights reserved.

Gene expression analysis by cDNA-AFLP highlights a set of new signaling networks and translational control during seed dormancy breaking in Nicotiana plumbaginifolia.

Science.gov (United States)

Bove, Jérôme; Lucas, Philippe; Godin, Béatrice; Ogé, Laurent; Jullien, Marc; Grappin, Philippe

2005-03-01

Seed dormancy in Nicotiana plumbaginifolia is characterized by an abscisic acid accumulation linked to a pronounced germination delay. Dormancy can be released by 1 year after-ripening treatment. Using a cDNA-amplified fragment length polymorphism (cDNA-AFLP) approach we compared the gene expression patterns of dormant and after-ripened seeds, air-dry or during one day imbibition and analyzed 15,000 cDNA fragments. Among them 1020 were found to be differentially regulated by dormancy. Of 412 sequenced cDNA fragments, 83 were assigned to a known function by search similarities to public databases. The functional categories of the identified dormancy maintenance and breaking responsive genes, give evidence that after-ripening turns in the air-dry seed to a new developmental program that modulates, at the RNA level, components of translational control, signaling networks, transcriptional control and regulated proteolysis.

Construction of cDNA library and preliminary analysis of expressed sequence tags from Siberian tiger

Science.gov (United States)

Liu, Chang-Qing; Lu, Tao-Feng; Feng, Bao-Gang; Liu, Dan; Guan, Wei-Jun; Ma, Yue-Hui

2010-01-01

In this study we successfully constructed a full-length cDNA library from Siberian tiger, Panthera tigris altaica, the most well-known wild Animal. Total RNA was extracted from cultured Siberian tiger fibroblasts in vitro. The titers of primary and amplified libraries were 1.30×106 pfu/ml and 1.62×109 pfu/ml respectively. The proportion of recombinants from unamplified library was 90.5% and average length of exogenous inserts was 1.13 kb. A total of 282 individual ESTs with sizes ranging from 328 to 1,142bps were then analyzed the BLASTX score revealed that 53.9% of the sequences were classified as strong match, 38.6% as nominal and 7.4% as weak match. 28.0% of them were found to be related to enzyme/catalytic protein, 20.9% ESTs to metabolism, 13.1% ESTs to transport, 12.1% ESTs to signal transducer/cell communication, 9.9% ESTs to structure protein, 3.9% ESTs to immunity protein/defense metabolism, 3.2% ESTs to cell cycle, and 8.9 ESTs classified as novel genes. These results demonstrated that the reliability and representativeness of the cDNA library attained to the requirements of a standard cDNA library. This library provided a useful platform for the functional genomic research of Siberian tigers. PMID:20941376

An improved method for RNA isolation and cDNA library construction from immature seeds of Jatropha curcas L

Directory of Open Access Journals (Sweden)

Kaur Jatinder

2010-05-01

Full Text Available Abstract Background RNA quality and quantity is sometimes unsuitable for cDNA library construction, from plant seeds rich in oil, polysaccharides and other secondary metabolites. Seeds of jatropha (Jatropha curcas L. are rich in fatty acids/lipids, storage proteins, polysaccharides, and a number of other secondary metabolites that could either bind and/or co-precipitate with RNA, making it unsuitable for downstream applications. Existing RNA isolation methods and commercial kits often fail to deliver high-quality total RNA from immature jatropha seeds for poly(A+ RNA purification and cDNA synthesis. Findings A protocol has been developed for isolating good quality total RNA from immature jatropha seeds, whereby a combination of the CTAB based RNA extraction method and a silica column of a commercial plant RNA extraction kit is used. The extraction time was reduced from two days to about 3 hours and the RNA was suitable for poly(A+ RNA purification, cDNA synthesis, cDNA library construction, RT-PCR, and Northern hybridization. Based on sequence information from selected clones and amplified PCR product, the cDNA library seems to be a good source of full-length jatropha genes. The method was equally effective for isolating RNA from mustard and rice seeds. Conclusions This is a simple CTAB + silica column method to extract high quality RNA from oil rich immature jatropha seeds that is suitable for several downstream applications. This method takes less time for RNA extraction and is equally effective for other tissues where the quality and quantity of RNA is highly interfered by the presence of fatty acids, polysaccharides and polyphenols.

Baculovirus display of functional antibody Fab fragments.

Science.gov (United States)

Takada, Shinya; Ogawa, Takafumi; Matsui, Kazusa; Suzuki, Tasuku; Katsuda, Tomohisa; Yamaji, Hideki

2015-08-01

The generation of a recombinant baculovirus that displays antibody Fab fragments on the surface was investigated. A recombinant baculovirus was engineered so that the heavy chain (Hc; Fd fragment) of a mouse Fab fragment was expressed as a fusion to the N-terminus of baculovirus gp64, while the light chain of the Fab fragment was simultaneously expressed as a secretory protein. Following infection of Sf9 insect cells with the recombinant baculovirus, the culture supernatant was analyzed by enzyme-linked immunosorbent assay using antigen-coated microplates and either an anti-mouse IgG or an anti-gp64 antibody. A relatively strong signal was obtained in each case, showing antigen-binding activity in the culture supernatant. In western blot analysis of the culture supernatant using the anti-gp64 antibody, specific protein bands were detected at an electrophoretic mobility that coincided with the molecular weight of the Hc-gp64 fusion protein as well as that of gp64. Flow cytometry using a fluorescein isothiocyanate-conjugated antibody specific to mouse IgG successfully detected the Fab fragments on the surface of the Sf9 cells. These results suggest that immunologically functional antibody Fab fragments can be displayed on the surface of baculovirus particles, and that a fluorescence-activated cell sorter with a fluorescence-labeled antigen can isolate baculoviruses displaying specific Fab fragments. This successful baculovirus display of antibody Fab fragments may offer a novel approach for the efficient selection of specific antibodies.

Amplification of a transcriptionally active DNA sequence in the human brain

International Nuclear Information System (INIS)

Yakovlev, A.G.; Sazonov, A.E.; Spunde, A.Ya.; Gindilis, V.M.

1986-01-01

The authors present their findings of tissue-specific amplification of a DNA fragment actively transcribed in the human brain. This genome fragment was found in the library complement of cDNA of the human brain and evidently belongs to a new class of moderate repetitions of DNA with an unstable copying capacity in the human genome. The authors isolated total cell RNA from various human tissues (brain, placenta), and rat tissues (brain, liver), by the method of hot phenol extraction with guanidine thiocynate. The poly(A + ) RNA fraction was isolated by chromatography. Synthesis of cDNA was done on a matrix of poly(A + ) RNA of human brain. The cDNA obtained was cloned in plasmid pBR322 for the PstI site using (dC/dG) sequences synthesized on the 3' ends of the vector molecule and cDNA respectively. In cloning 75 ng cDNA, the authors obtained approximately 10 5 recombinant. This library was analyzed by the hybridization method on columns with two radioactive ( 32 P) probes: the total cDNA preparation and the total nuclear DNA from the human brain. The number of copies of the cloned DNA fragment in the genome was determined by dot hybridization. Restricting fragments of human and rat DNA genomes homologous to the cloned cDNA were identified on radio-autographs. In each case, 10 micrograms of EcoRI DNA hydrolyzate was fractionated in 1% agarose gel. The probe was also readied with RNA samples fractionated in agarose gel with formaldehyde and transferred to a nitrocellulose filter under weak vacuum. The filter was hybridized with 0.1 micrograms DNA pAG 02, labeled with ( 32 P) to a specific activity of 0.5-1 x 10 9 counts/min x microgram. The autograph was exposed with amplifying screens at -70 0 C for 2 days

Characterization of cDNA for human tripeptidyl peptidase II: The N-terminal part of the enzyme is similar to subtilisin

International Nuclear Information System (INIS)

Tomkinson, B.; Jonsson, A-K

1991-01-01

Tripeptidyl peptidase II is a high molecular weight serine exopeptidase, which has been purified from rat liver and human erythrocytes. Four clones, representing 4453 bp, or 90% of the mRNA of the human enzyme, have been isolated from two different cDNA libraries. One clone, designated A2, was obtained after screening a human B-lymphocyte cDNA library with a degenerated oligonucleotide mixture. The B-lymphocyte cDNA library, obtained from human fibroblasts, were rescreened with a 147 bp fragment from the 5' part of the A2 clone, whereby three different overlapping cDNA clones could be isolated. The deduced amino acid sequence, 1196 amino acid residues, corresponding to the longest open rading frame of the assembled nucleotide sequence, was compared to sequences of current databases. This revealed a 56% similarity between the bacterial enzyme subtilisin and the N-terminal part of tripeptidyl peptidase II. The enzyme was found to be represented by two different mRNAs of 4.2 and 5.0 kilobases, respectively, which probably result from the utilziation of two different polyadenylation sites. Futhermore, cDNA corresponding to both the N-terminal and C-terminal part of tripeptidyl peptidase II hybridized with genomic DNA from mouse, horse, calf, and hen, even under fairly high stringency conditions, indicating that tripeptidyl peptidase II is highly conserved

Ligand-receptor assay for evaluation of functional activity of human recombinant VEGF and VEGFR-1 extracellular fragment.

Science.gov (United States)

Leopol'd, A V; Baklaushev, V P; Korchagina, A A; Shein, S A; Grinenko, N F; Pavlov, K A; Ryabukhin, I A; Chekhonin, V P

2012-04-01

cDNA encoding VEGF and Ig-like extracellular domains 2-4 of VEGFR-1 (sFlt-1(2-4)) were cloned into prokaryotic expression vectors pET32a and pQE60. Recombinant proteins were purified (metal affinity chromatography) and renatured. Chemiluminescent study for the interaction of recombinant VEGF and sFlt-1(2-4) showed that biotinylated VEGF specifically binds to the polystyrene-immobilized receptor extracellular fragment. Biotinylated recombinant sFlt-1 interacts with immobilized VEGF. Analysis of the interaction of immobilized recombinant VEGFR-1 and VEGF with C6 glioma cells labeled with CFDA-SE (vital fluorescent dye) showed that recombinant VEGFR-1 also binds to native membrane-associated VEGF. Recombinant VEGF was shown to bind to specific receptors expressed on the surface of C6 glioma cells. Functional activity of these proteins was confirmed by ligand-receptor assay for VEGF and VEGFR-1 (sFlt-1) and quantitative chemiluminescent detection.

RNA signal amplifier circuit with integrated fluorescence output.

Science.gov (United States)

Akter, Farhima; Yokobayashi, Yohei

2015-05-15

We designed an in vitro signal amplification circuit that takes a short RNA input that catalytically activates the Spinach RNA aptamer to produce a fluorescent output. The circuit consists of three RNA strands: an internally blocked Spinach aptamer, a fuel strand, and an input strand (catalyst), as well as the Spinach aptamer ligand 3,5-difluoro-4-hydroxylbenzylidene imidazolinone (DFHBI). The input strand initially displaces the internal inhibitory strand to activate the fluorescent aptamer while exposing a toehold to which the fuel strand can bind to further displace and recycle the input strand. Under a favorable condition, one input strand was able to activate up to five molecules of the internally blocked Spinach aptamer in 185 min at 30 °C. The simple RNA circuit reported here serves as a model for catalytic activation of arbitrary RNA effectors by chemical triggers.

Effects of heat stress on gene expression in eggplant ( Solanum ...

African Journals Online (AJOL)

In order to identify differentially expressed genes involved in heat shock response, cDNA amplified fragment length polymorphism (cDNA-AFLP) and quantitative real-time polymerase chain reaction (QPCR) were used to study gene expression of eggplant seedlings subjected to 0, 6 and 12 h at 43°C. A total of 53 of over ...

Norrie disease: linkage analysis using a 4.2-kb RFLP detected by a human ornithine aminotransferase cDNA probe.

Science.gov (United States)

Ngo, J T; Bateman, J B; Cortessis, V; Sparkes, R S; Mohandas, T; Inana, G; Spence, M A

1989-05-01

Previous study has shown that the usual DNA marker for Norrie disease, the L1.28 probe which identifies the DXS7 locus, can recombine with the disease locus. In this study, we used a human ornithine aminotransferase (OAT) cDNA which detects OAT-related DNA sequences mapped to the same region on the X chromosome as that of the L1.28 probe to investigate the family with Norrie disease who exhibited the recombinational event. When genomic DNA from this family was digested with the PvuII restriction endonuclease, we found a restriction fragment length polymorphism (RFLP) of 4.2 kb in size. This fragment was absent in the affected males and cosegregated with the disease locus; we calculated a lod score of 0.602, at theta = 0.00. No deletion could be detected by chromosomal analysis or on Southern blots with other enzymes. These results suggest that one of the OAT-related sequences on the X chromosome may be in close proximity to the Norrie disease locus and represent the first report which indicates that the OAT cDNA may be useful for the identification of carrier status and/or prenatal diagnosis.

[Study on sequence characterized amplified region (SCAR) markers of Cornus officinalis].

Science.gov (United States)

Chen, Suiqing; Lu, Xiaolei; Wang, Lili

2011-05-01

To establish sequence characterized amplified region markers of Cornus officinalis and provide a scientific basis for molecular identification of C. officinalis. The random primer was screened through RAPD to obtain specific RAPD marker bands. The RAPD marker bands were separated, extracted, cloned and sequenced. Both ends of the sequence of RAPD marker bands were determined. A pair of specific primers was designed for conventional PCR reaction, and SCAR marker was acquired. Four pairs of primers were designed based on the sequence of RAPD marker bands. The DNA of the seven varieties of C. officinalis was amplified by using YST38 and YST43 primer. The results showed that seven varieties of C. officinalis were able to produce a single PCR product. It was an effective way to identify C. officinalis. The varieties with cylindrical and long-pear shape fruits amplified by YST38 showed a specific band, which could be used as the evidence of variety identification. Seven varieties of C. oficinalis were amplified by using primer YST39. But the size of band of the variety with spindly shape fruit (35,0400 bp) was about 300 bp, which was shorter than those of the variety with the other shape fruits of C. officinalis (650-700 bp). The variety with the spindly shape fruit could be identified through this difference. The primer YST92 could produce a fragment from 600-700 bp in the varieties with cylindrical and long-pear shape fruits, a fragment from 200-300 bp in the varieties with oval and short-cylindrical shape fruits and had no fragment in the varieties with long cylindrical, elliptic and short-pear shape fruits, which could be used to select the different shapes of C. officinalis. SCAR mark is established and can be used as the basis for breeding and distinguishing the verieties of C. officinalis.

Structure and characterization of a cDNA clone for phenylalanine ammonia-lyase from cut-injured roots of sweet potato

International Nuclear Information System (INIS)

Tanaka, Yoshiyuki; Matsuoka, Makoto; Yamanoto, Naoki; Ohashi, Yuko; Kano-Murakami, Yuriko; Ozeki, Yoshihiro

1989-01-01

A cDNA clone for phenylalanine ammonia-lyase (PAL) induced in wounded sweet potato (Ipomoea batatas Lam.) root was obtained by immunoscreening a cDNA library. The protein produced in Escherichia coli cells containing the plasmid pPAL02 was indistinguishable from sweet potato PAL as judged by Ouchterlony double diffusion assays. The M r of its subunit was 77,000. The cells converted [ 14 C]-L-phenylalanine into [ 14 C]-t-cinnamic acid and PAL activity was detected in the homogenate of the cells. The activity was dependent on the presence of the pPAL02 plasmid DNA. The nucleotide sequence of the cDNA contained a 2,121-base pair (bp) open-reading frame capable of coding for a polypeptide with 707 amino acids (M r 77,137), a 22-bp 5'-noncoding region and a 207-bp 3'-noncoding region. The results suggest that the insert DNA fully encoded the amino acid sequence for sweet potato PAL that is induced by wounding. Comparison of the deduced amino acid sequence with that of a PAL cDNA fragment from Phaseolus vulgaris revealed 78.9% homology. The sequence from amino acid residues 258 to 494 was highly conserved, showing 90.7% homology

Molecular cloning of lupin leghemoglobin cDNA

DEFF Research Database (Denmark)

Konieczny, A; Jensen, E O; Marcker, K A

1987-01-01

Poly(A)+ RNA isolated from root nodules of yellow lupin (Lupinus luteus, var. Ventus) has been used as a template for the construction of a cDNA library. The ds cDNA was synthesized and inserted into the Hind III site of plasmid pBR 322 using synthetic Hind III linkers. Clones containing sequences...... specific for nodules were selected by differential colony hybridization using 32P-labeled cDNA synthesized either from nodule poly(A)+ RNA or from poly(A)+ RNA of uninfected root as probes. Among the recombinant plasmids, the cDNA gene for leghemoglobin was identified. The protein structure derived from...... its nucleotide sequence was consistent with known amino acid sequence of lupin Lb II. The cloned lupin Lb cDNA hybridized to poly(A)+ RNA from nodules only, which is in accordance with the general concept, that leghemoglobin is expressed exclusively in nodules. Udgivelsesdato: 1987-null...

Cloning of the human androgen receptor cDNA

International Nuclear Information System (INIS)

Govindan, M.V.; Burelle, M.; Cantin, C.; Kabrie, C.; Labrie, F.; Lachance, Y.; Leblanc, G.; Lefebvre, C.; Patel, P.; Simard, J.

1988-01-01

The authors discuss how in order to define the functional domains of the human androgen receptor, complementary DNA (cDNA) clones encoding the human androgen receptor (hAR) have been isolated from a human testis λgtll cDNA library using synthetic oligonnucleotide probes, homologous to segments of the human glucocorticoid, estradiol and progesterone receptors. The cDNA clones corresponding to the human glucocorticoid, estradiol and progesterone receptors were eliminated after cross-hybridization with their respective cDNA probes and/or after restriction mapping of the cDNA clones. The remaining cDNA clones were classified into different groups after analysis by restriction digestion and cross-hybridization. Two of the largest cDNA clones from each group were inserted into an expression vector in both orientations. The linearized plasmids were used as templates in in vitro transcription with T7 RNA polymerase. Subsequent in vitro translation of the purified transcripts in rabbit reticulocyte lysate followed by sodium dodecylsulfate polyacrylamide gel electrophoresis (SDS-PAGE) permitted the characterization of the encoded polyeptides. The expressed proteins larger than 30,000 Da were analyzed for their ability to bind tritium-labelled dihydrotestosterone ([ 3 H] DHT) with high affinity and specificity

Evaluation of chemical fluorescent dyes as a protein conjugation partner for live cell imaging.

Directory of Open Access Journals (Sweden)

Yoko Hayashi-Takanaka

Full Text Available To optimize live cell fluorescence imaging, the choice of fluorescent substrate is a critical factor. Although genetically encoded fluorescent proteins have been used widely, chemical fluorescent dyes are still useful when conjugated to proteins or ligands. However, little information is available for the suitability of different fluorescent dyes for live imaging. We here systematically analyzed the property of a number of commercial fluorescent dyes when conjugated with antigen-binding (Fab fragments directed against specific histone modifications, in particular, phosphorylated H3S28 (H3S28ph and acetylated H3K9 (H3K9ac. These Fab fragments were conjugated with a fluorescent dye and loaded into living HeLa cells. H3S28ph-specific Fab fragments were expected to be enriched in condensed chromosomes, as H3S28 is phosphorylated during mitosis. However, the degree of Fab fragment enrichment on mitotic chromosomes varied depending on the conjugated dye. In general, green fluorescent dyes showed higher enrichment, compared to red and far-red fluorescent dyes, even when dye:protein conjugation ratios were similar. These differences are partly explained by an altered affinity of Fab fragment after dye-conjugation; some dyes have less effect on the affinity, while others can affect it more. Moreover, red and far-red fluorescent dyes tended to form aggregates in the cytoplasm. Similar results were observed when H3K9ac-specific Fab fragments were used, suggesting that the properties of each dye affect different Fab fragments similarly. According to our analysis, conjugation with green fluorescent dyes, like Alexa Fluor 488 and Dylight 488, has the least effect on Fab affinity and is the best for live cell imaging, although these dyes are less photostable than red fluorescent dyes. When multicolor imaging is required, we recommend the following dye combinations for optimal results: Alexa Fluor 488 (green, Cy3 (red, and Cy5 or CF640 (far-red.

Production of a full-length infectious GFP-tagged cDNA clone of Beet mild yellowing virus for the study of plant-polerovirus interactions.

Science.gov (United States)

Stevens, Mark; Viganó, Felicita

2007-04-01

The full-length cDNA of Beet mild yellowing virus (Broom's Barn isolate) was sequenced and cloned into the vector pLitmus 29 (pBMYV-BBfl). The sequence of BMYV-BBfl (5721 bases) shared 96% and 98% nucleotide identity with the other complete sequences of BMYV (BMYV-2ITB, France and BMYV-IPP, Germany respectively). Full-length capped RNA transcripts of pBMYV-BBfl were synthesised and found to be biologically active in Arabidopsis thaliana protoplasts following electroporation or PEG inoculation when the protoplasts were subsequently analysed using serological and molecular methods. The BMYV sequence was modified by inserting DNA that encoded the jellyfish green fluorescent protein (GFP) into the P5 gene close to its 3' end. A. thaliana protoplasts electroporated with these RNA transcripts were biologically active and up to 2% of transfected protoplasts showed GFP-specific fluorescence. The exploitation of these cDNA clones for the study of the biology of beet poleroviruses is discussed.

AFLP fragment isolation technique as a method to produce random sequences for single nucleotide polymorphism discovery in the green turtle, Chelonia mydas.

Science.gov (United States)

Roden, Suzanne E; Dutton, Peter H; Morin, Phillip A

2009-01-01

The green sea turtle, Chelonia mydas, was used as a case study for single nucleotide polymorphism (SNP) discovery in a species that has little genetic sequence information available. As green turtles have a complex population structure, additional nuclear markers other than microsatellites could add to our understanding of their complex life history. Amplified fragment length polymorphism technique was used to generate sets of random fragments of genomic DNA, which were then electrophoretically separated with precast gels, stained with SYBR green, excised, and directly sequenced. It was possible to perform this method without the use of polyacrylamide gels, radioactive or fluorescent labeled primers, or hybridization methods, reducing the time, expense, and safety hazards of SNP discovery. Within 13 loci, 2547 base pairs were screened, resulting in the discovery of 35 SNPs. Using this method, it was possible to yield a sufficient number of loci to screen for SNP markers without the availability of prior sequence information.

Complementation of radiation-sensitive Ataxia telangiectasia cells after transfection of cDNA expression libraries and cosmid clones from wildtype cells

International Nuclear Information System (INIS)

Fritz, E.

1994-06-01

In this Ph.D.-thesis, phenotypic complementation of AT-cells (AT5BIVA) by transfection of cDNA-expression-libraries was adressed: After stable transfection of cDNA-expression-libraries G418 resistant clones were selected for enhanced radioresistance by a fractionated X-ray selection. One surviving transfectant clone (clone 514) exhibited enhanced radiation resistance in dose-response experiments and further X-ray selections. Cell cycle analysis revealed complementation of untreated and irradiated 514-cells in cell cycle progression. The rate of DNA synthesis, however, is not diminished after irradiation but shows the reverse effect. A transfected cDNA-fragment (AT500-cDNA) was isolated from the genomic DNA of 514-cells and proved to be an unknown DNA sequence. A homologous sequence could be detected in genomic DNA from human cell lines, but not in DNA from other species. The cDNA-sequence could be localized to human chromosome 11. In human cells the cDNA sequence is part of two large mRNAs. 4 different cosmid clones containing high molecular genomic DNA from normal human cells could be isolated from a library, each hybridizing to the AT500-cDNA. After stable transfection into AT-cells, one cosmid-clone was able to confer enhanced radiation resistance both in X-ray selections and dose-response experiments. The results indicate that the cloned cDNA-fragment is based on an unknown gene from human chromosome 11 which partially complements the radiosensitivity and the defective cell cycle progression in AT5BIVA cells. (orig.) [de

Restriction fragment length polymorphism (RFLP) analysis of PCR products amplified from 18S ribosomal RNA gene of Trypanosoma congolense

International Nuclear Information System (INIS)

Osanyo, A.; Majiwa, P.W.

2006-01-01

Oligonucleotide primers were designed from the conserved nucleotide sequences of 18S ribosomal RNA (18S rRNA) gene of protozoans: Trypanosoma brucei, Leishmania donovani, Triponema aequale and Lagenidium gigantum. The primers were used in polymerace chain reaction (PCR) to generate PCR products of approximately 1 Kb using genomic DNA from T. brucei and the four genotypic groups of T. congolense as template. The five PCR products so produced were digested with several restriction enzymes and hybridized to a DNA probe made from T. brucei PCR product of the same 18S rRNA gene region. Most restriction enzyme digests revealed polymorphism with respect to the location of their recognition sites on the five PCR products. The restriction fragment length polymorphism (RFLP) pattern observed indicate that the 18S rRNA gene sequences of trypanosomes: T. brucei and the four genotypes of T.congolence group are heterogeneous. The results further demonstrate that the region that was amplified can be used in specific identification of trypanosomes species and subspecies.(author)

NcoI restriction fragment length polymorphism (RFLP) of the tumour necrosis factor (TNF alpha) region in primary biliary cirrhosis and in healthy Danes

DEFF Research Database (Denmark)

Fugger, L; Morling, N; Ryder, L P

1989-01-01

The restriction fragment length polymorphism of the human tumour necrosis factor (TNF alpha) region was investigated by means of 20 different restriction enzymes and a human TNF alpha cDNA probe. Only one of the enzymes, NcoI, revealed a polymorphic pattern consisting of fragments of 10.5 and 5.5...

Designation of the European Working Group on Legionella Infection (EWGLI) amplified fragment length polymorphism types of Legionella pneumophila serogroup 1 and results of intercentre proficiency testing Using a standard protocol

DEFF Research Database (Denmark)

Fry, N K; Bangsborg, Jette Marie; Bergmans, A

2002-01-01

The utility of amplified fragment length polymorphism (AFLP) analysis as a genotyping method for the epidemiological typing of Legionella pneumophila serogroup 1 has been previously demonstrated. This study (i). reports recommendations for the designation of the European Working Group on Legionella...... centres), and 92% (7 centres) to 100% (7 centres). The AFLP method as described is robust and rapid and allows the genotypic comparison of isolates of Legionella pneumophila between different testing centres without the need for exchange of the strains studied....

Identification of expressed genes in cDNA library of hemocytes from the RLO-challenged oyster, Crassostrea ariakensis Gould with special functional implication of three complement-related fragments (CaC1q1, CaC1q2 and CaC3).

Science.gov (United States)

Xu, Ting; Xie, Jiasong; Li, Jianming; Luo, Ming; Ye, Shigen; Wu, Xinzhong

2012-06-01

A SMARTer™ cDNA library of hemocyte from Rickettsia-like organism (RLO) challenged oyster, Crassostrea ariakensis Gould was constructed. Random clones (400) were selected and single-pass sequenced, resulted in 200 unique sequences containing 96 known genes and 104 unknown genes. The 96 known genes were categorized into 11 groups based on their biological process. Furthermore, we identified and characterized three complement-related fragments (CaC1q1, CaC1q2 and CaC3). Tissue distribution analysis revealed that all of three fragments were ubiquitously expressed in all tissues studied including hemocyte, gills, mantle, digestive glands, gonads and adductor muscle, while the highest level was seen in the hemocyte. Temporal expression profile in the hemocyte monolayers reveled that the mRNA expression levels of three fragments presented huge increase after the RLO incubation at 3 h and 6 h in post-challenge, respectively. And the maximal expression levels at 3 h in post-challenge are about 256, 104 and 64 times higher than the values detected in the control of CaC1q1, CaC1q2 and CaC3, respectively. Copyright © 2012 Elsevier Ltd. All rights reserved.

Identification and Molecular Characterization of the cDNA Encoding Cucumis melo Allergen, Cuc m 3, a Plant Pathogenesis-Related Protein

Directory of Open Access Journals (Sweden)

Mojtaba Sankian

2014-05-01

Full Text Available Background: Melon (Cucumis melo allergy is one of the most common food allergies, characterized by oral allergy syndrome. To date, two allergen molecules, Cuc m 1 and Cuc m 2, have been fully characterized in melon pulp, but there are few reports about the molecular characteristics of Cuc m 3. Methods:The Cuc m 3 cDNA has been characterized by rapid amplification of cDNA ends (RACE, which revealed a 456 base-pair (bp fragment encoding a 151-amino acid polypeptide with a predicted molecular mass of 16.97 kDa, and identified 79 and 178 bp untranslated sequences at the 5′ and 3´ ends, respectively. Results: In silico analysis showed strong similarities between Cuc m 3 and other plant pathogen-related protein 1s from cucumber, grape, bell pepper, and tomato. Conclusion: Here we report the identification and characterization of the Cuc m 3 cDNA, which will be utilized for further analyses of structural and allergenic features of this allergen

[Preparation of monoclonal antibody against 4-amylphenol and homology modeling of its Fv fragment].

Science.gov (United States)

Cheng, Lei; Wu, Haizhen; Fei, Jing; Zhang, Lujia; Ye, Jiang; Zhang, Huizhan

2017-03-01

Objective To prepare and characterize a monoclonal antibody (mAb) against 4-amylphenol (4-AP), clone its cDNA sequence and make homology modeling for its Fv fragment. Methods A high-affinity anti-4-AP mAb was generated from a hybridoma cell line F10 using electrofusion between splenocytes from APA-BSA-immunized mouse and Sp2/0 myeloma cells. Then we extracted the mRNA of F10 cells and cloned the cDNA of mAb. The homology modeling and molecular docking of its Fv fragment was conducted with biological software. Results Under the optimum conditions, the ic-ELISA equation was y=A 2 +(A 1 -A 2 )/(1+(x/x 0 ) p ) (A 1 =1.28; A 2 =-0.066; x 0 =12560.75; p=0.74) with a correlation coefficient (R 2 ) of 0.997. The lowest detectable limit was 0.65 μg/mL. The heavy and light chains of mAb respectively belonged to IgG1 and Kappa. The homology modeling and molecular docking studies revealed that the binding of 4-Ap and mAb was attributed to the hydrogen bond and hydrophobic interactions. Conclusion The study successfully established a stable 4-AP mAb-secreting hybridoma cell line. The study on spatial structure of Fv fragment using homology modeling provided a reference for the development and design of single chain variable fragments.

Sequence of human protamine 2 cDNA

Energy Technology Data Exchange (ETDEWEB)

Domenjoud, L; Fronia, C; Uhde, F; Engel, W [Universitaet Goettingen (West Germany)

1988-08-11

The authors report the cloning and sequencing of a cDNA clone for human protamine 2 (hp2), isolated from a human testis cDNA library cloned in the vector {lambda}-gt11. A 66mer oligonucleotide, that corresponds to an amino acid sequence which is highly conserved between hp2 and mouse protamine 2 (mp2) served as hybridization probe. The homology between the amino acid sequence deduced from our cDNA and the published amino acid sequence for hp2 is 100%.

Amplification of deoxyribonucleic acid (DNA) fragment using two ...

African Journals Online (AJOL)

user

2011-04-11

Apr 11, 2011 ... polymerases on this method, whether different lengths of. DNA fragments could be amplified by two-step PCR and the difference of DNA product quality produced by the two methods. MATERIALS AND METHODS. PCR template and reagents. Enterobacteria phage lambda DNA (GenBank no: V00636) ...

Hibiscus latent Fort Pierce virus in Brazil and synthesis of its biologically active full-length cDNA clone.

Science.gov (United States)

Gao, Ruimin; Niu, Shengniao; Dai, Weifang; Kitajima, Elliot; Wong, Sek-Man

2016-10-01

A Brazilian isolate of Hibiscus latent Fort Pierce virus (HLFPV-BR) was firstly found in a hibiscus plant in Limeira, SP, Brazil. RACE PCR was carried out to obtain the full-length sequences of HLFPV-BR which is 6453 nucleotides and has more than 99.15 % of complete genomic RNA nucleotide sequence identity with that of HLFPV Japanese isolate. The genomic structure of HLFPV-BR is similar to other tobamoviruses. It includes a 5' untranslated region (UTR), followed by open reading frames encoding for a 128-kDa protein and a 188-kDa readthrough protein, a 38-kDa movement protein, 18-kDa coat protein, and a 3' UTR. Interestingly, the unique feature of poly(A) tract is also found within its 3'-UTR. Furthermore, from the total RNA extracted from the local lesions of HLFPV-BR-infected Chenopodium quinoa leaves, a biologically active, full-length cDNA clone encompassing the genome of HLFPV-BR was amplified and placed adjacent to a T7 RNA polymerase promoter. The capped in vitro transcripts from the cloned cDNA were infectious when mechanically inoculated into C. quinoa and Nicotiana benthamiana plants. This is the first report of the presence of an isolate of HLFPV in Brazil and the successful synthesis of a biologically active HLFPV-BR full-length cDNA clone.

Experimental study of gene expression in lung and bronchus of radon-exposed mice

International Nuclear Information System (INIS)

Guo Zhiying; Tian Mei; Liu Jianxiang; Ruan Jianlei; Piao Chunnan; Su Xu

2008-01-01

Objective: To construct and identify differentially expressed cDNA library in lung and bronchus of mice exposed to radon. Methods: 2 week old, weighing (18-22)g, male BALB/c mice were placed in a SR-NIM02 radon chamber. One group of mice was exposed to radon, which was equivalent to the accumulative dose of 30 WLM. The control group was about 0.02 WLM. To construct a subtracted cDNA library enriched with differentially expressed genes, the Super SMART technique and the suppression subtractive hybridization (SSH) were performed. The obtained forward and reverse cDNA fragments were directly inserted into pGEM-T-easy vector and transformed into E. coli DH5α. The inserts in plasmid were amplified by nested polymerase chain reaction (PCR), and some of which were sequenced. In the end these sequences were BLASTed with GeneBank. Results: 146 of 460 clones obtained randomly were positive clones contained (1000-1500)bp inserted cDNA fragments. The forward and reverse subtracted cDNA library in lung and bronchus of mice exposed to radon was constructed, and 48 up-regulation and 61 down-regulation cDNA sequences selected were homologous with GeneBank in different extent. Conclusions: The subtracted cDNA library in lung and bronchus of mice exposed to radon is successfully constructed, and genes that differentially expressed are identified. Some genes might have relation with the immunity, cell cycle and apoptosis. (authors)

Differential tissue expression of enhanced green fluorescent protein in ‘Green mice’

OpenAIRE

Ma, De-Fu; Tezuka, Hideo; Kondo, Tetsuo; Sudo, Katsuko; Niu, Dong-Feng; Nakazawa, Tadao; Kawasaki, Tomonori; Yamane, Tetsu; Nakamura, Nobuki; Katoh, Ryohei

2010-01-01

In order to clarify tissue expression of enhanced green fluorescent protein (EGFP) in ‘green mice’ from a transgenic line having an EGFP cDNA under the control of a chicken beta-actin promoter and cytomegalovirus enhancer, we studied the expression of EGFP in various organs and tissues from these ‘green mice’ by immunohistochemistry with anti- EGFP antibody in conjunction with direct observation for EGFP fluorescence using confocal laser scanning microscopy. On i...

Opsin cDNA sequences of a UV and green rhodopsin of the satyrine butterfly Bicyclus anynana.

Science.gov (United States)

Vanhoutte, K J A; Eggen, B J L; Janssen, J J M; Stavenga, D G

2002-11-01

The cDNAs of an ultraviolet (UV) and long-wavelength (LW) (green) absorbing rhodopsin of the bush brown Bicyclus anynana were partially identified. The UV sequence, encoding 377 amino acids, is 76-79% identical to the UV sequences of the papilionids Papilio glaucus and Papilio xuthus and the moth Manduca sexta. A dendrogram derived from aligning the amino acid sequences reveals an equidistant position of Bicyclus between Papilio and Manduca. The sequence of the green opsin cDNA fragment, which encodes 242 amino acids, represents six of the seven transmembrane regions. At the amino acid level, this fragment is more than 80% identical to the corresponding LW opsin sequences of Dryas, Heliconius, Papilio (rhodopsin 2) and Manduca. Whereas three LW absorbing rhodopsins were identified in the papilionid butterflies, only one green opsin was found in B. anynana.

Nuclear targeting by fragmentation of the Potato spindle tuber viroid genome

International Nuclear Information System (INIS)

Abraitiene, Asta; Zhao Yan; Hammond, Rosemarie

2008-01-01

Transient expression of engineered reporter RNAs encoding an intron-containing green fluorescent protein (GFP) from a Potato virus X-based expression vector previously demonstrated the nuclear targeting capability of the 359 nucleotide Potato spindle tuber viroid (PSTVd) RNA genome. To further delimit the putative nuclear-targeting signal, PSTVd subgenomic fragments were embedded within the intron, and recombinant reporter RNAs were inoculated onto Nicotiana benthamiana plants. Appearance of green fluorescence in leaf tissue inoculated with PSTVd-fragment-containing constructs indicated shuttling of the RNA into the nucleus by fragments as short as 80 nucleotides in length. Plant-to-plant variation in the timing of intron removal and subsequent GFP fluorescence was observed; however, earliest and most abundant GFP expression was obtained with constructs containing the conserved hairpin I palindrome structure and embedded upper central conserved region. Our results suggest that this conserved sequence and/or the stem-loop structure it forms is sufficient for import of PSTVd into the nucleus

Amplification of the Signal Intensity of Fluorescence-Based Fiber-Optic Biosensors Using a Fabry-Perot Resonator Structure

Directory of Open Access Journals (Sweden)

Meng-Chang Hsieh

2015-02-01

Full Text Available Fluorescent biosensors have been widely used in biomedical applications. To amplify the intensity of fluorescence signals, this study developed a novel structure for an evanescent wave fiber-optic biosensor by using a Fabry-Perot resonator structure. An excitation light was coupled into the optical fiber through a laser-drilled hole on the proximal end of the resonator. After entering the resonator, the excitation light was reflected back and forth inside the resonator, thereby amplifying the intensity of the light in the fiber. Subsequently, the light was used to excite the fluorescent molecules in the reactive region of the sensor. The experimental results showed that the biosensor signal was amplified eight-fold when the resonator reflector was formed using a 92% reflective coating. Furthermore, in a simulation, the biosensor signal could be amplified 20-fold by using a 99% reflector.

Isolation and characterization of full-length cDNA clones coding for cholinesterase from fetal human tissues

International Nuclear Information System (INIS)

Prody, C.A.; Zevin-Sonkin, D.; Gnatt, A.; Goldberg, O.; Soreq, H.

1987-01-01

To study the primary structure and regulation of human cholinesterases, oligodeoxynucleotide probes were prepared according to a consensus peptide sequence present in the active site of both human serum pseudocholinesterase and Torpedo electric organ true acetylcholinesterase. Using these probes, the authors isolated several cDNA clones from λgt10 libraries of fetal brain and liver origins. These include 2.4-kilobase cDNA clones that code for a polypeptide containing a putative signal peptide and the N-terminal, active site, and C-terminal peptides of human BtChoEase, suggesting that they code either for BtChoEase itself or for a very similar but distinct fetal form of cholinesterase. In RNA blots of poly(A) + RNA from the cholinesterase-producing fetal brain and liver, these cDNAs hybridized with a single 2.5-kilobase band. Blot hybridization to human genomic DNA revealed that these fetal BtChoEase cDNA clones hybridize with DNA fragments of the total length of 17.5 kilobases, and signal intensities indicated that these sequences are not present in many copies. Both the cDNA-encoded protein and its nucleotide sequence display striking homology to parallel sequences published for Torpedo AcChoEase. These finding demonstrate extensive homologies between the fetal BtChoEase encoded by these clones and other cholinesterases of various forms and species

Gold and silver nanoparticles based superquenching of fluorescence: A review

Energy Technology Data Exchange (ETDEWEB)

Ghosh, Debanjana; Chattopadhyay, Nitin, E-mail: nitin.chattopadhyay@yahoo.com

2015-04-15

The short review highlights the recent advances on the gold and silver nanoparticles induced efficient quenching of fluorescence from various fluorophores looking at their promising use as optical rulers and chemo-/bio- sensors. The fluorescence quenching often leads to the increase in the Stern–Volmer constant (K{sub SV}~10{sup 7}–10{sup 10} mol{sup −1} dm{sup 3}) several orders of magnitude higher than the values observed for the normal photochemical quenching processes (~10{sup 2} mol{sup −1} dm{sup 3}). This amplified quenching has been termed as “super-quenching” or “hyper-quenching”. Energy transfer (ET) is established from the donor to the metal nanoparticles rationalizing these fast quenching processes. Considering the distance dependence of the ET process, Förster resonance energy transfer (FRET) and nanometal surface energy transfer (NSET) are ascribed to take place. These sensitive distance dependent phenomena serve as the spectroscopic ruler to measure the intra- or intermolecular distances between the interacting partners. In this account focus has been laid on the size dependent energy transfer and super- and hyper- quenching of the fluorescence of the donor moieties by the nanometals and their probable applications in sensing. Rationalization has been made for the nanoparticle induced huge enhancement in the quenching efficiency. The impact of this review lies in the possible application of these amplified quenching processes in designing high sensitive chemical and biological sensors. - Highlights: • Super efficient quenching of fluorescence of probes by gold and silver nanoparticles is highlighted. • The amplified fluorescence quenching of dyes and polymers is rationalized. • Energy transfer is assigned to be responsible for the efficient quenching process. • Amplified quenching has its potential use in designing sensitive chemical/biological sensors.

Gold and silver nanoparticles based superquenching of fluorescence: A review

International Nuclear Information System (INIS)

Ghosh, Debanjana; Chattopadhyay, Nitin

2015-01-01

The short review highlights the recent advances on the gold and silver nanoparticles induced efficient quenching of fluorescence from various fluorophores looking at their promising use as optical rulers and chemo-/bio- sensors. The fluorescence quenching often leads to the increase in the Stern–Volmer constant (K SV ~10 7 –10 10 mol −1 dm 3 ) several orders of magnitude higher than the values observed for the normal photochemical quenching processes (~10 2 mol −1 dm 3 ). This amplified quenching has been termed as “super-quenching” or “hyper-quenching”. Energy transfer (ET) is established from the donor to the metal nanoparticles rationalizing these fast quenching processes. Considering the distance dependence of the ET process, Förster resonance energy transfer (FRET) and nanometal surface energy transfer (NSET) are ascribed to take place. These sensitive distance dependent phenomena serve as the spectroscopic ruler to measure the intra- or intermolecular distances between the interacting partners. In this account focus has been laid on the size dependent energy transfer and super- and hyper- quenching of the fluorescence of the donor moieties by the nanometals and their probable applications in sensing. Rationalization has been made for the nanoparticle induced huge enhancement in the quenching efficiency. The impact of this review lies in the possible application of these amplified quenching processes in designing high sensitive chemical and biological sensors. - Highlights: • Super efficient quenching of fluorescence of probes by gold and silver nanoparticles is highlighted. • The amplified fluorescence quenching of dyes and polymers is rationalized. • Energy transfer is assigned to be responsible for the efficient quenching process. • Amplified quenching has its potential use in designing sensitive chemical/biological sensors

Cloning and sequence analysis of serine proteinase of Gloydius ussuriensis venom gland

International Nuclear Information System (INIS)

Sun Dejun; Liu Shanshan; Yang Chunwei; Zhao Yizhuo; Chang Shufang; Yan Weiqun

2005-01-01

Objective: To construct a cDNA library by using mRNA from Gloydius ussuriensis (G. Ussuriensis) venom gland, to clone and analyze serine proteinase gene from the cDNA library. Methods: Total RNA was isolated from venom gland of G. ussuriensis, mRNA was purified by using mRNA isolation Kit. The whole length cDNA was synthesized by means of smart cDNA synthesis strategy, and amplified by long distance PCR procedure, lately cDAN was cloned into vector pBluescrip-sk. The recombinant cDNA was transformed into E. coli DH5α. The cDNA of serine proteinase gene in the venom gland of G. ussuriensis was detected and amplified using the in situ hybridization. The cDNA fragment was inserted into pGEMT vector, cloned and its nucleotide sequence was determined. Results: The capacity of cDNA library of venom gland was above 2.3 x 10 6 . Its open reading frame was composed of 702 nucleotides and coded a protein pre-zymogen of 234 amino acids. It contained 12 cysteine residues. The sequence analysis indicated that the deduced amino acid sequence of the cDNA fragment shared high identity with the thrombin-like enzyme genes of other snakes in the GenBank. the query sequence exhibited strong amino acid sequence homology of 85% to the serine proteas of T. gramineus, thrombin-like serine proteinase I of D. acutus and serine protease catroxase II of C. atrox respectively. Based on the amino acid sequences of other thrombin-like enzymes, the catalytic residues and disulfide bridges of this thrombin-like enzyme were deduced as follows: catalytic residues, His 41 , Asp 86 , Ser 180 ; and six disulfide bridges Cys 7 -Cys 139 , Cys 26 -Cys 42 , Cys 74 -Cys 232 , Cys 118 -Cys 186 , Cys 150 -Cys 165 , Cys 176 -Cys 201 . Conclusion: The capacity of cDNA library of venom gland is above 2.3 x 10 6 , overtop the level of 10 5 capicity. The constructed cDNA library of G. ussuriensis venom gland would be helpful platform to detect new target genes and further gene manipulate. The cloned serine

cDNA - ASTRA | LSDB Archive [Life Science Database Archive metadata

Lifescience Database Archive (English)

Full Text Available ontents List of cDNA in locus Data file File name: astra_cdna.zip File URL: ftp://ftp.biosciencedbc.jp/archive/astra/LATEST/astra_cdn...a.zip File size: 3.3 MB Simple search URL http://togodb.biosciencedbc.jp/togodb/view/astra_cdna...n, Department of Molecular Genetics, National Institute of Agrobiological Sciences (Kikuchi et al., 2003; ftp://cdna

Scanning fluorescence detector for high-throughput DNA genotyping

Science.gov (United States)

Rusch, Terry L.; Petsinger, Jeremy; Christensen, Carl; Vaske, David A.; Brumley, Robert L., Jr.; Luckey, John A.; Weber, James L.

1996-04-01

A new scanning fluorescence detector (SCAFUD) was developed for high-throughput genotyping of short tandem repeat polymorphisms (STRPs). Fluorescent dyes are incorporated into relatively short DNA fragments via polymerase chain reaction (PCR) and are separated by electrophoresis in short, wide polyacrylamide gels (144 lanes with well to read distances of 14 cm). Excitation light from an argon laser with primary lines at 488 and 514 nm is introduced into the gel through a fiber optic cable, dichroic mirror, and 40X microscope objective. Emitted fluorescent light is collected confocally through a second fiber. The confocal head is translated across the bottom of the gel at 0.5 Hz. The detection unit utilizes dichroic mirrors and band pass filters to direct light with 10 - 20 nm bandwidths to four photomultiplier tubes (PMTs). PMT signals are independently amplified with variable gain and then sampled at a rate of 2500 points per scan using a computer based A/D board. LabView software (National Instruments) is used for instrument operation. Currently, three fluorescent dyes (Fam, Hex and Rox) are simultaneously detected with peak detection wavelengths of 543, 567, and 613 nm, respectively. The detection limit for fluorescein-labeled primers is about 100 attomoles. Planned SCAFUD upgrades include rearrangement of laser head geometry, use of additional excitation lasers for simultaneous detection of more dyes, and the use of detector arrays instead of individual PMTs. Extensive software has been written for automatic analysis of SCAFUD images. The software enables background subtraction, band identification, multiple- dye signal resolution, lane finding, band sizing and allele calling. Whole genome screens are currently underway to search for loci influencing such complex diseases as diabetes, asthma, and hypertension. Seven production SCAFUDs are currently in operation. Genotyping output for the coming year is projected to be about one million total genotypes (DNA

Amplified fragment length polymorphism analysis to assess crossover interference and homozygosity in gynogenetic diploid Pacific abalone (Haliotis discus hannai).

Science.gov (United States)

Nie, H-T; Li, Q; Kong, L-F

2014-06-01

Recombination analysis in gynogenetic diploids is a powerful tool for assessing the degree of inbreeding, investigating crossover events and understanding chiasma interference during meiosis. To estimate the marker-centromere recombination rate, the inheritance pattern of 654 amplified fragment length polymorphism (AFLP) markers was examined in the 72-h veliger larvae of two meiogynogenetic diploid families in the Pacific abalone (Haliotis discus hannai). The second-division segregation frequency (y) of the AFLP loci ranged from 0.00 to 0.96, with 23.9% of loci showing y-values higher than 0.67, evidencing the existence of interference. The average recombination frequency across the 654 AFLP loci was 0.45, allowing estimation of the fixation index of 0.55, indicating that meiotic gynogenesis could provide an effective means of rapid inbreeding in the Pacific abalone. The AFLP loci have a small proportion (4.4%) of y-values greater than 0.90, suggesting that a relatively low or intermediate degree of chiasma interference occurred in the abalone chromosomes. The information obtained in this study will enhance our understanding of the abalone genome and will be useful for genetic studies in the species. © 2014 Stichting International Foundation for Animal Genetics.

Isolation of full-length putative rat lysophospholipase cDNA using improved methods for mRNA isolation and cDNA cloning

International Nuclear Information System (INIS)

Han, J.H.; Stratowa, C.; Rutter, W.J.

1987-01-01

The authors have cloned a full-length putative rat pancreatic lysophospholipase cDNA by an improved mRNA isolation method and cDNA cloning strategy using [ 32 P]-labelled nucleotides. These new methods allow the construction of a cDNA library from the adult rat pancreas in which the majority of recombinant clones contained complete sequences for the corresponding mRNAs. A previously recognized but unidentified long and relatively rare cDNA clone containing the entire sequence from the cap site at the 5' end to the poly(A) tail at the 3' end of the mRNA was isolated by single-step screening of the library. The size, amino acid composition, and the activity of the protein expressed in heterologous cells strongly suggest this mRNA codes for lysophospholipase

NONINVASIVE OPTICAL IMAGING OF STAPHYLOCOCCUS AUREUS INFECTION IN VIVO USING AN ANTIMICROBIAL PEPTIDE FRAGMENT BASED NEAR-INFRARED FLUORESCENT PROBES

Directory of Open Access Journals (Sweden)

CUICUI LIU

2013-07-01

Full Text Available The diagnosis of bacterial infections remains a major challenge in medicine. Optical imaging of bacterial infection in living animals is usually conducted with genetic reporters such as light-emitting enzymes or fluorescent proteins. However, there are many circumstances where genetic reporters are not applicable, and there is an urgent need for exogenous synthetic probes that can selectively target bacteria. Optical imaging of bacteria in vivo is much less developed than methods such as radioimaging and MRI. Furthermore near-infrared (NIR dyes with emission wavelengths in the region of 650–900 nm can propagate through two or more centimeters of tissue and may enable deeper tissue imaging if sensitive detection techniques are employed. Here we constructed an antimicrobial peptide fragment UBI29-41-based near-infrared fluorescent imaging probe. The probe is composed of UBI29-41 conjugated to a near infrared dye ICG-Der-02. UBI29-41 is a cationic antimicrobial peptide that targets the anionic surfaces of bacterial cells. The probe allows detection of Staphylococcus aureus infection (5 × 107 cells in a mouse local infection model using whole animal near-infrared fluorescence imaging. Furthermore, we demonstrate that the UBI29-41-based imaging probe can selectively accumulate within bacteria. The significantly higher accumulation in bacterial infection suggests that UBI29-41-based imaging probe may be a promising imaging agent to detect bacterial infections.

Resonantly enhanced production of excited fragments of gaseous molecules following core-level excitation

International Nuclear Information System (INIS)

Chen, J.M.; Lu, K.T.; Lee, J.M.; Ho, S.C.; Chang, H.W.; Lee, Y.Y.

2005-01-01

State-selective dissociation dynamics for the excited fragments of gaseous Si(CH 3 ) 2 Cl 2 following Cl 2p and Si 2p core-level excitations have been investigated by resonant photoemission spectroscopy and dispersed UV/optical fluorescence spectroscopy. The main features in the gaseous Si(CH 3 ) 2 Cl 2 fluorescence spectrum are identified as the emission from excited Si*, Si + *, CH* and H*. The core-to-Rydberg excitations at both Si 2p and Cl 2p edges lead to a noteworthy production of not only the excited atomic fragments, neutral and ionic (Si*, Si + *) but also the excited diatomic fragments (CH*). In particular, the excited neutral atomic fragments Si* are significantly reinforced. The experimental results provide deeper insight into the state-selective dissociation dynamics for the excited fragments of molecules via core-level excitation

Interactions between colloidal silver and photosynthetic pigments located in cyanobacteria fragments and in solution.

Science.gov (United States)

Siejak, Przemysław; Frackowiak, Danuta

2007-09-25

Changes in the yield of the fluorescence emitted by pigments of photosynthetic organisms could be used for the establishment of the presence of some toxic substances. The presence of colloidal metals can be indicated by enhancement of pigments' emission as a result of plasmons generation. The spectra of the pigments of cyanobacterium Synechocystis located in the bacterium fragments and in solutions with and without colloidal silver additions have been measured. The quantum yield of the pigments' fluorescence in solution has been observed to increase at some wavelength of excitation, while the fluorescence of the pigments in the bacteria fragments has been only quenched as a consequence of interactions with colloidal silver particles. Close contact between pigment molecules located in bacteria fragments and silver particles is probably not possible. We plan in future to investigate the influence of other, more typical metal pollutants of water, using similar spectral methods and several other photosynthetic bacteria pigments, in solution, in cell fragments and in the whole bacteria organisms.

Cloning and characterization of stress responsive Glp genes and their promotor regions from rice (abstract)

International Nuclear Information System (INIS)

Naqvi, S.M.S.; Mahmood, T.

2005-01-01

Plants respond to a number of environmental stimuli by modulating expression of genes. One such family of genes is now known as germin/germin-like protein genes (Glps). In order to detect any Glp gene response in rice, a pair of degenerate primers was designed based on consensus region from Glp sequences in Genbank. Using these primers a DNA fragment of about 550 bp was obtained by PCR amplification from genomic template. This 550 bp DNA was used as probe in Northern analysis. These studies provided evidence pointing to differential response of Glp expression to salt stress. RNA obtained from the roots was used for synthesis of cDNA. This cDNA was amplifiable with sense primer (RGLP1) from above mentioned pair and oligo-(dt) yielding a fragment of approx. 800 bp. Restriction analysis revealed that the PCR product was heterogeneous. After establishing that 800 bp fragment was the desired product, it was cloned in pCRII-TOPO. Five clones were picked up and analyzed by restriction analysis and sequencing. Two different Glp cDNAs were represented by these partial clones. Remaining sequence of the 5' end for clone 4 and 16 was obtained by Rapid Amplification of cDNA ends (RACE). The resultant sequences have been submitted to Genbank as Oryza sativa Rice Germin-like Protein 1 and 2 (osRGLP1 and 2). When full length genes corresponding to these sequences were amplified from genomic templates, resulting fragments were nearly 150 by larger than cDNAs. Cloning of structural genes for osRGLP1 revealed presence of a 162 bp intron in the coding region near 3' end. Preliminary evidence shows that expression of both osRGLP1 and 2 is severely reduced during salt stress. Another approach to establish both osRGLP1 and 2 genes involvement in stress tolerance is to study the ability of their promotor regions to drive expression of some reporter gene during stress. Promotor regions of about 1100 bp has been amplified and cloned and has been confirmed by restriction analysis and nested

Construction and biological activities of the first infectious cDNA clones of the genus Foveavirus

Energy Technology Data Exchange (ETDEWEB)

Meng, Baozhong, E-mail: bmeng@uoguelph.ca [Department of Molecular and Cellular Biology, University of Guelph, 50 Stone Road, Guelph, Ontario, Canada N1G2W1 (Canada); Venkataraman, Srividhya; Li, Caihong; Wang, Weizhou [Department of Molecular and Cellular Biology, University of Guelph, 50 Stone Road, Guelph, Ontario, Canada N1G2W1 (Canada); Dayan-Glick, Cathy; Mawassi, Munir [The Plant Pathology Department-The Virology Unit, Plant Protection Institute, Agricultural Research Organization, The Volcani Center, Bet-Dagan 50250 (Israel)

2013-01-20

Grapevine rupestris stem pitting-associated virus (GRSPaV, genus Foveavirus, family Betaflexiviridae) is one of the most prevalent viruses in grapevines and is associated with three distinct diseases: rupestris stem pitting, vein necrosis and Syrah decline. Little is known about the biology and pathological properties of GRSPaV. In this work, we engineered a full-length infectious cDNA clone for GRSPaV and a GFP-tagged variant, both under the transcriptional control of Cauliflower mosaic virus 35 S promoter. We demonstrated that these cDNA clones were infectious in grapevines and Nicotiana benthamiana through fluorescence microscopy, RT-PCR, Western blotting and immuno electron microscopy. Interestingly, GRSPaV does not cause systemic infection in four of the most commonly used herbaceous plants, even in the presence of the movement proteins of two other viruses which are known to complement numerous movement-defective viruses. These infectious clones are the first of members of Foveavirus which would allow further investigations into mechanisms governing different aspects of replication for GRSPaV and perhaps related viruses.

Molecular Identification of Date Palm Cultivars Using Random Amplified Polymorphic DNA (RAPD) Markers.

Science.gov (United States)

Al-Khalifah, Nasser S; Shanavaskhan, A E

2017-01-01

Ambiguity in the total number of date palm cultivars across the world is pointing toward the necessity for an enumerative study using standard morphological and molecular markers. Among molecular markers, DNA markers are more suitable and ubiquitous to most applications. They are highly polymorphic in nature, frequently occurring in genomes, easy to access, and highly reproducible. Various molecular markers such as restriction fragment length polymorphism (RFLP), amplified fragment length polymorphism (AFLP), simple sequence repeats (SSR), inter-simple sequence repeats (ISSR), and random amplified polymorphic DNA (RAPD) markers have been successfully used as efficient tools for analysis of genetic variation in date palm. This chapter explains a stepwise protocol for extracting total genomic DNA from date palm leaves. A user-friendly protocol for RAPD analysis and a table showing the primers used in different molecular techniques that produce polymorphisms in date palm are also provided.

Procedure for normalization of cDNA libraries

Science.gov (United States)

Bonaldo, Maria DeFatima; Soares, Marcelo Bento

1997-01-01

This invention provides a method to normalize a cDNA library constructed in a vector capable of being converted to single-stranded circles and capable of producing complementary nucleic acid molecules to the single-stranded circles comprising: (a) converting the cDNA library in single-stranded circles; (b) generating complementary nucleic acid molecules to the single-stranded circles; (c) hybridizing the single-stranded circles converted in step (a) with complementary nucleic acid molecules of step (b) to produce partial duplexes to an appropriate Cot; (e) separating the unhybridized single-stranded circles from the hybridized single-stranded circles, thereby generating a normalized cDNA library.

Papain cleavage of the 38,000-dalton fragment inhibits the binding of 4, 4'-diisothiocyanostilbene-2, 2'-disulfonate to lys-539 on the 60,000-dalton fragment in human band 3.

Science.gov (United States)

Yamaguchi, Takeo; Kojima, Hideaki; Kawaguchi, Shiori; Shimada, Maiko; Aso, Haruka

2017-08-01

Human band 3 is a 98-kDa transmembrane (TM) protein comprising 14 TM segments. Papain cleavages band 3 into 38- and 60-kDa fragments. Under vigorous conditions, the cleavage of the loop region between the TM 7 of gate domain and the TM 8 of core domain in the 38-kDa fragment produces 7- and 31-kDa fragments. Conformational changes of the TM 5 segment containing Lys-539 by cleavage of the 38-kDa fragment remain unclear. Pressure-induced haemolysis of erythrocytes was suppressed by binding of 4, 4'-diisothiocyanostilbene-2, 2'-disulfonate (DIDS) to Lys-539. Such effect of DIDS was not observed upon cleavage of the 38-kDa fragment, because of inhibition of DIDS binding to Lys-539. Using fluorescence of DIDS labelled to Lys-539, conformational changes of band 3 were examined. Fluorescence spectra demonstrated that the molecular motion of DIDS is more restricted upon digestion of the 38-kDa fragment. Interestingly, the quenching of DIDS fluorescence showed that Hg2+ is less accessible to DIDS upon digestion of the 38-kDa fragment. Taken together, we propose that the conformational changes of the TM 5 segment characterized by the sequestration and restricted motion of Lys-539 are induced by the cleavage of the loop region between the TM 7 and the TM 8. © The Authors 2017. Published by Oxford University Press on behalf of the Japanese Biochemical Society. All rights reserved.

Improving RNA-Seq expression estimates by correcting for fragment bias

Science.gov (United States)

2011-01-01

The biochemistry of RNA-Seq library preparation results in cDNA fragments that are not uniformly distributed within the transcripts they represent. This non-uniformity must be accounted for when estimating expression levels, and we show how to perform the needed corrections using a likelihood based approach. We find improvements in expression estimates as measured by correlation with independently performed qRT-PCR and show that correction of bias leads to improved replicability of results across libraries and sequencing technologies. PMID:21410973

Use of spontaneously mutated human DNA as competitive internal standard for nucleic acid quantification by reverse transcription-polymerase chain reaction (RT-PCR)

International Nuclear Information System (INIS)

Rudnicka, L.; Diaz, A.; Varga, J.; Jimenez, S.A.; Christiano, A.; Uitto, J.

1995-01-01

Quantification of gene expression is of increasing interest in many medical sciences. Methods based on reverse transcription-polymerase chain reactions (RT-PCRs) are timesaving and require only very small amounts of RNA. A limiting factor, however, is the significant fluctuation in the efficacy of reverse transcription as well in the polymerase chain reactions. Various external and internal standards have been suggested for correcting these fluctuations. We describe a novel way of creating an internal standard for assessing the expression of type VII collagen in human cells. The total RNA of a patient with hereditary 'epidermilysis bulosa dystrophica' associated with a homozygous T to A point mutation in type VII collagen gene was reverse transcribed and a 382bp fragment of type VII collagen cDNA containing the mutation was amplified. The mutated cDNA, unlike normal type VII collagen cDNA could be cleaved by 'Ear I' endonuclease into 244bp and 138bp fragments. Semiquantitative PCR was performed with the mutated cDNA as internal standard and the studied cDNA sample in the same tube in the presence of α 32 P-labelled dCTP. The reaction was followed by 'Ear I' digestion, electrophoresis on a polyacrylamide gel and exposure to a X-ray film. In conclusion, we describe a timesaving method for creating internal standards for semiquantitative RT-PCR. (author). 12 refs, 3 figs

c-DNA of HIV-1 detection on spot of Buffy-Coat of leukocytes (DBCS

Directory of Open Access Journals (Sweden)

Marco Rossi de Gasperis

2010-03-01

Full Text Available Introduction:The elective way for the diagnosis of HIV-1-infection in the window period and in children under the age of 16-18 months is to search virus integrated in leukocytes. Aim of the study was to assess the sensitivity and specificity of extraction from Buffy-Dried Coat Spot (DBCS in leukocyte to detect c-DNA with nested-PCR in HIV-1-infected individuals compared to Dried Blood Spot (DBS both extracted by automated instrument EZ1 (QIAGEN, Hilden, Germany. Both DBCS and both DBS were compared with those tests from whole blood by conventional DNA-extraction Methods: Five ml of whole blood from 50 HIV-infected individuals were collected. 40 μl of each sample were spotted on “FTA ELUTE Micro Card” (Whatman, Inc., Clifton, NJ, 200 μl were extracted according to the manual procedure (QIAGEN “QIAamp DNA minikit and the remaining sample was incubated at 37 °C for 120 minutes. Plasma was centrifuged at 1000 rcf/1g for 10 minutes at room temperature. Forty μl of the obtained buffy-coat was spotted. Both DBCS and both DBS were dried at room temperature for 24 hours.Two of 5 punch from each spot were extracted with TISSUE DNA kit (Biorobot EZ1 DSP “Qiagen” and eluted in 50 μl of buffer.The recovery of genomic DNA was measured amplifying the ß-globin gene by Real-Time “SybrGreen I”.The DNA was amplified for the “pol” gene of HIV-1 by nested PCR and revealed in “SYBR-green I”. Eight HIV-antibody-negative samples were used as internal control. Results:The experimental protocol adopted for the DBCS showed high sensitivity and specificity.The extracted DNA from DBS and DBCS was characterized by excellent quality and without any inhibitory agents. The amount of proviral DNA extracted from DBCS is similar to that obtained by conventional extraction, while the DBS test was significantly less sensitive. Conclusion:These preliminary data suggest that the amount of c-DNA obtained with DBS technique is often not enough for the

Significant population genetic structure detected in the rock bream Oplegnathus fasciatus (Temminck & Schlegel, 1844) inferred from fluorescent-AFLP analysis

Science.gov (United States)

Xiao, Yongshuang; Ma, Daoyuan; Xu, Shihong; Liu, Qinghua; Wang, Yanfeng; Xiao, Zhizhong; Li, Jun

2016-05-01

Oplegnathus fasciatus (rock bream) is a commercial rocky reef fish species in East Asia that has been considered for aquaculture. We estimated the population genetic diversity and population structure of the species along the coastal waters of China using fluorescent-amplified fragment length polymorphisms technology. Using 53 individuals from three populations and four pairs of selective primers, we amplified 1 264 bands, 98.73% of which were polymorphic. The Zhoushan population showed the highest Nei's genetic diversity and Shannon genetic diversity. The results of analysis of molecular variance (AMOVA) showed that 59.55% of genetic variation existed among populations and 40.45% occurred within populations, which indicated that a significant population genetic structure existed in the species. The pairwise fixation index F st ranged from 0.20 to 0.63 and were significant after sequential Bonferroni correction. The topology of an unweighted pair group method with arithmetic mean tree showed two significant genealogical branches corresponding to the sampling locations of North and South China. The AMOVA and STRUCTURE analyses suggested that the O. fasciatus populations examined should comprise two stocks.

Lectin cDNA and transgenic plants derived therefrom

Science.gov (United States)

Raikhel, Natasha V.

2000-10-03

Transgenic plants containing cDNA encoding Gramineae lectin are described. The plants preferably contain cDNA coding for barley lectin and store the lectin in the leaves. The transgenic plants, particularly the leaves exhibit insecticidal and fungicidal properties.

cDNA table - RPD | LSDB Archive [Life Science Database Archive metadata

Lifescience Database Archive (English)

Full Text Available of data contents Results of homology search to cDNA clones in the KOME. Data file File name: rpd_cdna.zip F...ile URL: ftp://ftp.biosciencedbc.jp/archive/rpd/LATEST/rpd_cdna.zip File size: 15 KB Simple search URL http:...//togodb.biosciencedbc.jp/togodb/view/rpd_cdna#en Data acquisition method - Data

Fiber Amplifiers

DEFF Research Database (Denmark)

Rottwitt, Karsten

2017-01-01

The chapter provides a discussion of optical fiber amplifiers and through three sections provides a detailed treatment of three types of optical fiber amplifiers, erbium doped fiber amplifiers (EDFA), Raman amplifiers, and parametric amplifiers. Each section comprises the fundamentals including...... the basic physics and relevant in-depth theoretical modeling, amplifiers characteristics and performance data as a function of specific operation parameters. Typical applications in fiber optic communication systems and the improvement achievable through the use of fiber amplifiers are illustrated....

Molecular cloning of growth hormone encoding cDNA of Indian

Indian Academy of Sciences (India)

A modified rapid amplification of cDNA ends (RACE) strategy has been developed for cloning highly conserved cDNA sequences. Using this modified method, the growth hormone (GH) encoding cDNA sequences of Labeo rohita, Cirrhina mrigala and Catla catla have been cloned, characterized and overexpressed in ...

KARAKTERISTIK GENETIK Kappaphycus alvarezii SEHAT DAN TERINFEKSI PENYAKIT ICE-ICE DENGAN METODE Amplified Fragment Length Polymorphism (AFLP

Directory of Open Access Journals (Sweden)

Emma Suryati

2013-03-01

Full Text Available Infeksi penyakit ice-ice pada Kappaphycus alvarezii seringkali menyebabkan penurunan produksi yang sangat signifikan. K. alvarezii merupakan alga merah penghasil karaginan yang memiliki nilai ekonomi tinggi dan banyak dimanfaatkan dalam berbagai industri, seperti farmasi, makanan, stabilizer, dan kosmetik. Perbaikan genetik sangat diperlukan untuk meningkatkan produksi. Penelitian ini bertujuan untuk mengetahui karakteristik kemiripan genetik K. alvarezii sehat dan terinfeksi penyakit dari Balai Penelitian dan Pengembangan Budidaya Air Payau (BPPBAP, Maros dengan metode Amplified Fragment Length Polymorphism (AFLP. Pada penelitian ini juga dianalisis K. alvarezii asal Bone (BNE, Gorontalo (GRL, Tambalang (TMB, dan Kendari (KND sebagai kontrol rumput laut sehat. Metode AFLP menggunakan enzim restriksi Psti dan Mset, preamplifikasi dan amplifikasi selektif diawali dengan isolsi DNA, uji genimoc DNA, restriksi dan ligasi. Hasil yang diperoleh menunjukkan penggunaan marker AFLP dengan primer forward P11 dan primer reverse M48, M49 dan M50 terhadap K. alvarezii yang berasal dari Takalar (TKL, dan Mataram (MTR, tanpa infeksi (sehat dan terinfeksi penyakit Takalar ice (TKL+, Mataram ice (MTR+, serta K. alvarezii kontrol (BNE, (GRL, (TMB, dan (KND menghasilkan 519 fragmen dalam 122 lokus dengan ukuran 50 - ~370 pb. Kemiripan genetik K. alvarezii yang terinfeksi penyakit ice-ice lebih rendah jika dibandingkan dengan yang sehat. Kemiripan genetik K. alvarezii dari Takalar sehat (TKL dan terinfeksi ice-ice (TKL+ adalah 0,8176 dan MTR-MTR+ adalah 0,8033.

AFLPMax: a user-friendly application for computing the optimal number of amplified fragment length polymorphism markers needed in phylogenetic reconstruction.

Science.gov (United States)

García-Pereira, M J; Quesada, H; Caballero, A; Carvajal-Rodríguez, A

2012-05-01

Amplified fragment length polymorphisms (AFLPs) are widely used for phylogenetic inference especially in non-model species. Frequently, trees obtained with other nuclear or mitochondrial markers or with morphological information need additional resolution, increased branch support, or independent data sources (i.e. unlinked loci). In such cases, the use of AFLPs is a quick and cheap option. Computer simulation has shown that dominant AFLP markers lead to less accurate tree topologies than bi-allelic codominant markers such as SNPs, but this difference becomes negligible for shallow trees when using AFLP data sets that include a sufficiently large number of characters. Thus, determining how many AFLP characters are required to recover a given phylogeny is a key issue regarding the appropriateness of AFLPs for phylogenetic reconstruction. Here, we present a user-friendly, java-based graphical interface, AFLPMax, which executes an automatic pipeline of different programs providing the user with the optimal number of AFLP characters needed to recover a given phylogeny with high accuracy and support. Executables for Windows, linux and MacOS X operating systems, source code and user manual are available from: http://webs.uvigo.es/acraaj/AFLPMax.htm. © 2012 Blackwell Publishing Ltd.

Transcriptomic identification of candidate genes involved in sunflower responses to chilling and salt stresses based on cDNA microarray analysis

Directory of Open Access Journals (Sweden)

Paniego Norma

2008-01-01

Full Text Available Abstract Background Considering that sunflower production is expanding to arid regions, tolerance to abiotic stresses as drought, low temperatures and salinity arises as one of the main constrains nowadays. Differential organ-specific sunflower ESTs (expressed sequence tags were previously generated by a subtractive hybridization method that included a considerable number of putative abiotic stress associated sequences. The objective of this work is to analyze concerted gene expression profiles of organ-specific ESTs by fluorescence microarray assay, in response to high sodium chloride concentration and chilling treatments with the aim to identify and follow up candidate genes for early responses to abiotic stress in sunflower. Results Abiotic-related expressed genes were the target of this characterization through a gene expression analysis using an organ-specific cDNA fluorescence microarray approach in response to high salinity and low temperatures. The experiment included three independent replicates from leaf samples. We analyzed 317 unigenes previously isolated from differential organ-specific cDNA libraries from leaf, stem and flower at R1 and R4 developmental stage. A statistical analysis based on mean comparison by ANOVA and ordination by Principal Component Analysis allowed the detection of 80 candidate genes for either salinity and/or chilling stresses. Out of them, 50 genes were up or down regulated under both stresses, supporting common regulatory mechanisms and general responses to chilling and salinity. Interestingly 15 and 12 sequences were up regulated or down regulated specifically in one stress but not in the other, respectively. These genes are potentially involved in different regulatory mechanisms including transcription/translation/protein degradation/protein folding/ROS production or ROS-scavenging. Differential gene expression patterns were confirmed by qRT-PCR for 12.5% of the microarray candidate sequences. Conclusion

Cloning of the cDNA for human 12-lipoxygenase

International Nuclear Information System (INIS)

Izumi, T.; Hoshiko, S.; Radmark, O.; Samuelsson, B.

1990-01-01

A full-length cDNA clone encoding 12-lipoxygenase was isolated from a human platelet cDNA library by using a cDNA for human reticulocyte 15-lipoxygenase as probe for the initial screening. The cDNA had an open reading frame encoding 662 amino acid residues with a calculated molecular weight of 75,590. Three independent clones revealed minor heterogeneities in their DNA sequences. Thus, in three positions of the deduced amino acid sequence, there is a choice between two different amino acids. The deduced sequence from the clone plT3 showed 65% identity with human reticulocyte 15-lipoxygenase and 42% identity with human leukocyte 5-lipoxygenase. The 12-lipoxygenase cDNA recognized a 3.0-kilobase mRNA species in platelets and human erythroleukemia cells (HEL cells). Phorbol 12-tetradecanoyl 13-acetate induced megakaryocytic differentiation of HEL cells and 12-lipoxygenase activity and increased mRNA for 12-lipoxygenase. The identity of the cloned 12-lipoxygenase was assured by expression in a mammalian cell line (COS cells). Human platelet 12-lipoxygenase has been difficult to purify to homogeneity. The cloning of this cDNA will increase the possibilities to elucidate the structure and function of this enzyme

HindIII RFLP on chromosome 8 detected with a calbindin 27 kDa cDNA probe, HBSC21

Energy Technology Data Exchange (ETDEWEB)

Parmentier, M; Vassart, G

1988-10-11

A 1.8 kb for EcoRI fragment of the human calbindin cDNA clone HBSC21 was subcloned into M13mp18 and used as a probe. HindIII identifies a 2 allele polymorphism with a band at 4.7 kb (A1) and a band at 4.3 kb (A2). A constant band is located at 5.3 kb. The calbindin 27 kDa gene was assigned to chromosome 8 using chinese hamster-human and mouse-human cell hybrids. Co-dominant segregation was demonstrated in 3 families (total of 20 individuals).

Functional cloning using pFB retroviral cDNA expression libraries.

Science.gov (United States)

Felts, Katherine A; Chen, Keith; Zaharee, Kim; Sundar, Latha; Limjoco, Jamie; Miller, Anna; Vaillancourt, Peter

2002-09-01

Retroviral cDNA expression libraries allow the efficient introduction of complex cDNA libraries into virtually any mitotic cell type for screening based on gene function. The cDNA copy number per cell can be easily controlled by adjusting the multiplicity of infection, thus cell populations may be generated in which >90% of infected cells contain one to three cDNAs. We describe the isolation of two known oncogenes and one cell-surface receptor from a human Burkitt's lymphoma (Daudi) cDNA library inserted into the high-titer retroviral vector pFB.

Cloning and analysis of the mouse Fanconi anemia group a cDNA and an overlapping penta zinc finger cDNA

NARCIS (Netherlands)

Wong, JCY; Alon, N; Norga, K; Kruyt, FAE; Youssoufian, H; Buchwald, M

2000-01-01

Despite the cloning of four disease-associated genes for Fanconi anemia (FA), the molecular pathogenesis of FA remains largely unknown. To study FA complementation group A using the mouse as a mode I system, we cloned and characterized the mouse homolog of the human FANCA cDNA, The mouse cDNA

Nucleotide sequence of a cDNA for branched chain acyltransferase with analysis of the deduced protein structure

International Nuclear Information System (INIS)

Hummel, K.B.; Litwer, S.; Bradford, A.P.; Aitken, A.; Danner, D.J.; Yeaman, S.J.

1988-01-01

Nucleotide sequence was determined for a 1.6-kilobase human cDNA putative for the branched chain acyltransferase protein of the branched chain α-ketoacid dehydrogenase complex. Translation of the sequence reveals an open reading frame encoding a 315-amino acid protein of molecular weight 35,759 followed by 560 bases of 3'-untranslated sequence. Three repeats of the polyadenylation signal hexamer ATTAAA are present prior to the polyadenylate tail. Within the open reading frame is a 10-amino acid fragment which matches exactly the amino acid sequence around the lipoate-lysine residue in bovine kidney branched chain acyltransferase, thus confirming the identity of the cDNA. Analysis of the deduced protein structure for the human branched chain acyltransferase revealed an organization into domains similar to that reported for the acyltransferase proteins of the pyruvate and α-ketoglutarate dehydrogenase complexes. This similarity in organization suggests that a more detailed analysis of the proteins will be required to explain the individual substrate and multienzyme complex specificity shown by these acyltransferases

cDNA library construction of two human Demodexspecies.

Science.gov (United States)

Niu, DongLing; Wang, RuiLing; Zhao, YaE; Yang, Rui; Hu, Li; Lei, YuYang; Dan, WeiChao

2017-06-01

The research of Demodex, a type of pathogen causing various dermatoses in animals and human beings, is lacking at RNA level. This study aims at extracting RNA and constructing cDNA library for Demodex. First, P. cuniculiand D. farinaewere mixed to establish homogenization method for RNA extraction. Second, D. folliculorumand D. breviswere collected and preserved in Trizol, which were mixed with D. farinaerespectively to extract RNA. Finally, cDNA library was constructed and its quality was assessed. The results indicated that for D. folliculorum& D. farinae, the recombination rate of cDNA library was 90.67% and the library titer was 7.50 × 104 pfu/ml. 17 of the 59 positive clones were predicted to be of D. folliculorum; For D. brevis& D. farinae, the recombination rate was 90.96% and the library titer was 7.85 x104 pfu/ml. 40 of the 59 positive clones were predicted to be of D. brevis. Further detection by specific primers demonstrated that mtDNA cox1, cox3and ATP6 detected from cDNA libraries had 96.52%-99.73% identities with the corresponding sequences in GenBank. In conclusion, the cDNA libraries constructed for Demodexmixed with D. farinaewere successful and could satisfy the requirements for functional genes detection.

PCR-free detection of genetically modified organisms using magnetic capture technology and fluorescence cross-correlation spectroscopy.

Directory of Open Access Journals (Sweden)

Xiaoming Zhou

2009-11-01

Full Text Available The safety of genetically modified organisms (GMOs has attracted much attention recently. Polymerase chain reaction (PCR amplification is a common method used in the identification of GMOs. However, a major disadvantage of PCR is the potential amplification of non-target DNA, causing false-positive identification. Thus, there remains a need for a simple, reliable and ultrasensitive method to identify and quantify GMO in crops. This report is to introduce a magnetic bead-based PCR-free method for rapid detection of GMOs using dual-color fluorescence cross-correlation spectroscopy (FCCS. The cauliflower mosaic virus 35S (CaMV35S promoter commonly used in transgenic products was targeted. CaMV35S target was captured by a biotin-labeled nucleic acid probe and then purified using streptavidin-coated magnetic beads through biotin-streptavidin linkage. The purified target DNA fragment was hybridized with two nucleic acid probes labeled respectively by Rhodamine Green and Cy5 dyes. Finally, FCCS was used to detect and quantify the target DNA fragment through simultaneously detecting the fluorescence emissions from the two dyes. In our study, GMOs in genetically engineered soybeans and tomatoes were detected, using the magnetic bead-based PCR-free FCCS method. A detection limit of 50 pM GMOs target was achieved and PCR-free detection of GMOs from 5 microg genomic DNA with magnetic capture technology was accomplished. Also, the accuracy of GMO determination by the FCCS method is verified by spectrophotometry at 260 nm using PCR amplified target DNA fragment from GM tomato. The new method is rapid and effective as demonstrated in our experiments and can be easily extended to high-throughput and automatic screening format. We believe that the new magnetic bead-assisted FCCS detection technique will be a useful tool for PCR-free GMOs identification and other specific nucleic acids.

System for Gamma an X rays fluorescence spectrometric

International Nuclear Information System (INIS)

Alonso Abad, D.; Arista Romeu, E.; Bolanos Perez, L. and others

1997-01-01

A system for spectrometry of gamma or fluorescence X rays is presented. It sis composed by a Si(Li) semiconductors detector, a charge sensitive preamplifier, a high voltage power supply, a spectrometric amplifier and a monolithic 1024 channels multichannel analyzers or an IBM compatible 4096 channels add - on- card multichannel analyzer. The system can be configured as a 1024 or 4096 channels gamma or fluorescent X rays spectrometer

Cloning of the cDNA for murine von Willebrand factor and identification of orthologous genes reveals the extent of conservation among diverse species.

Science.gov (United States)

Chitta, Mohan S; Duhé, Roy J; Kermode, John C

2007-05-01

Interaction of von Willebrand factor (VWF) with circulating platelets promotes hemostasis when a blood vessel is injured. The A1 domain of VWF is responsible for the initial interaction with platelets and is well conserved among species. Knowledge of the cDNA and genomic DNA sequences for human VWF allowed us to predict the cDNA sequence for murine VWF in silico and amplify its entire coding region by RT-PCR. The murine VWF cDNA has an open reading frame of 8,442 bp, encoding a protein of 2,813 amino acid residues with 83% identity to human pre-pro-VWF. The same strategy was used to predict in silico the cDNA sequence for the ortholog of VWF in a further six species. Many of these predictions diverged substantially from the putative Reference Sequences derived by ab initio methods. Our predicted sequences indicated that the VWF gene has a conserved structure of 52 exons in all seven mammalian species examined, as well as in the chicken. There is a minor structural variation in the pufferfish Takifugu rubripes insofar as the VWF gene in this species has 53 exons. Comparison of the translated amino acid sequences also revealed a high degree of conservation. In particular, the cysteine residues are conserved precisely throughout both the pro-peptide and the mature VWF sequence in all species, with a minor exception in the pufferfish VWF ortholog where two adjacent cysteine residues are omitted. The marked conservation of cysteine residues emphasizes the importance of the intricate pattern of disulfide bonds in governing the structure of pro-VWF and regulating the function of the mature VWF protein. It should also be emphasized that many of the conserved features of the VWF gene and protein were obscured when the comparison among species was based on the putative Reference Sequences instead of our predicted cDNA sequences.

cDNA library information - Dicty_cDB | LSDB Archive [Life Science Database Archive metadata

Lifescience Database Archive (English)

Full Text Available List Contact us Dicty_cDB cDNA library information Data detail Data name cDNA library information DOI 10.189...s Data item Description cDNA library name Names of cDNA libraries (AF, AH, CF, CH, FC, FC-IC, FCL, SF, SH, S...(C) 5) sexually fusion-competent KAX3 cells (Gamete phase) (F) cDNA library construction method How to construct cDNA library...dir) 2) Full-length cDNA libraries (oligocapped method)(fl) 3) Gamete-specific subtraction library (sub) cDNA library... construction protocol Link to the webpage describing the protocol for generating cDNA library Size

cDNA library Table - KAIKOcDNA | LSDB Archive [Life Science Database Archive metadata

Lifescience Database Archive (English)

Full Text Available c00951-005 Description of data contents List of Bombyx mori cDNA libraries. Data file File name: kaiko_cdna_...library.zip File URL: ftp://ftp.biosciencedbc.jp/archive/kaiko-cdna/LATEST/kaiko_cdna_library.zip File size:... 4.8 KB Simple search URL http://togodb.biosciencedbc.jp/togodb/view/kaiko_cdna_l

α/sub i/-3 cDNA encodes the α subunit of G/sub k/, the stimulatory G protein of receptor-regulated K+ channels

International Nuclear Information System (INIS)

Codina, J.; Olate, J.; Abramowitz, J.; Mattera, R.; Cook, R.G.; Birnbaumer, L.

1988-01-01

cDNA cloning has identified the presence in the human genome of three genes encoding α subunits of pertussis toxin substrates, generically called G/sub i/. They are named α/sub i/-1, α/sub i/-2 and α/sub i/-3. However, none of these genes has been functionally identified with any of the α subunits of several possible G proteins, including pertussis toxin-sensitive G/sub p/'s, stimulatory to phospholipase C or A 2 , G/sub i/, inhibitory to adenylyl cyclase, or G/sub k/, stimulatory to a type of K + channels. The authors now report the nucleotide sequence and the complete predicted amino acid sequence of human liver α/sub i/-3 and the partial amino acid sequence of proteolytic fragments of the α subunit of human erythrocyte G/sub k/. The amino acid sequence of the proteolytic fragment is uniquely encoded by the cDNA of α/sub i/-3, thus identifying it as α/sub k/. The probable identity of α/sub i/-1 with α/sub p/ and possible roles for α/sub i/-2, as well as additional roles for α/sub i/-1 and α/sub i/-3 (α/sub k/) are discussed

Genetic analysis of 430 Chinese Cynodon dactylon accessions using sequence-related amplified polymorphism markers.

Science.gov (United States)

Huang, Chunqiong; Liu, Guodao; Bai, Changjun; Wang, Wenqiang

2014-10-21

Although Cynodon dactylon (C. dactylon) is widely distributed in China, information on its genetic diversity within the germplasm pool is limited. The objective of this study was to reveal the genetic variation and relationships of 430 C. dactylon accessions collected from 22 Chinese provinces using sequence-related amplified polymorphism (SRAP) markers. Fifteen primer pairs were used to amplify specific C. dactylon genomic sequences. A total of 481 SRAP fragments were generated, with fragment sizes ranging from 260-1800 base pairs (bp). Genetic similarity coefficients (GSC) among the 430 accessions averaged 0.72 and ranged from 0.53-0.96. Cluster analysis conducted by two methods, namely the unweighted pair-group method with arithmetic averages (UPGMA) and principle coordinate analysis (PCoA), separated the accessions into eight distinct groups. Our findings verify that Chinese C. dactylon germplasms have rich genetic diversity, which is an excellent basis for C. dactylon breeding for new cultivars.

Assignment of Alzheimer's presenilin-2 (PS-2) gene to 1q42.1 by fluorescence in situ hybridization.

Science.gov (United States)

Takano, T; Sahara, N; Yamanouchi, Y; Mori, H

1997-01-17

Presenilin-2 (PS-2) was suggested to be localized on 1q31-42 based on linkage analysis and cDNA cloning. The final identification of PS-2 as the causal gene for early-onset familial Alzheimer's disease in Voga-German pedigrees was concluded based on the point mutation found in the candidate cDNA isolated from this familial AD. We present evidence of its physical genome mapping of PS-2 on chromosome 1q42.1 by fluorescence in situ hybridization method.

Signal recognition particle assembly in relation to the function of amplified nucleoli of Xenopus oocytes.

Science.gov (United States)

Sommerville, John; Brumwell, Craig L; Politz, Joan C Ritland; Pederson, Thoru

2005-03-15

The signal recognition particle (SRP) is a ribonucleoprotein machine that controls the translation and intracellular sorting of membrane and secreted proteins. The SRP contains a core RNA subunit with which six proteins are assembled. Recent work in both yeast and mammalian cells has identified the nucleolus as a possible initial site of SRP assembly. In the present study, SRP RNA and protein components were identified in the extrachromosomal, amplified nucleoli of Xenopus laevis oocytes. Fluorescent SRP RNA microinjected into the oocyte nucleus became specifically localized in the nucleoli, and endogenous SRP RNA was also detected in oocyte nucleoli by RNA in situ hybridization. An initial step in the assembly of SRP involves the binding of the SRP19 protein to SRP RNA. When green fluorescent protein (GFP)-tagged SRP19 protein was injected into the oocyte cytoplasm it was imported into the nucleus and became concentrated in the amplified nucleoli. After visiting the amplified nucleoli, GFP-tagged SRP19 protein was detected in the cytoplasm in a ribonucleoprotein complex, having a sedimentation coefficient characteristic of the SRP. These results suggest that the amplified nucleoli of Xenopus oocytes produce maternal stores not only of ribosomes, the classical product of nucleoli, but also of SRP, presumably as a global developmental strategy for stockpiling translational machinery for early embryogenesis.

Protein- protein interaction detection system using fluorescent protein microdomains

Science.gov (United States)

Waldo, Geoffrey S.; Cabantous, Stephanie

2010-02-23

The invention provides a protein labeling and interaction detection system based on engineered fragments of fluorescent and chromophoric proteins that require fused interacting polypeptides to drive the association of the fragments, and further are soluble and stable, and do not change the solubility of polypeptides to which they are fused. In one embodiment, a test protein X is fused to a sixteen amino acid fragment of GFP (.beta.-strand 10, amino acids 198-214), engineered to not perturb fusion protein solubility. A second test protein Y is fused to a sixteen amino acid fragment of GFP (.beta.-strand 11, amino acids 215-230), engineered to not perturb fusion protein solubility. When X and Y interact, they bring the GFP strands into proximity, and are detected by complementation with a third GFP fragment consisting of GFP amino acids 1-198 (strands 1-9). When GFP strands 10 and 11 are held together by interaction of protein X and Y, they spontaneous association with GFP strands 1-9, resulting in structural complementation, folding, and concomitant GFP fluorescence.

Characterization of Urtica dioica agglutinin isolectins and the encoding gene family.

Science.gov (United States)

Does, M P; Ng, D K; Dekker, H L; Peumans, W J; Houterman, P M; Van Damme, E J; Cornelissen, B J

1999-01-01

Urtica dioica agglutinin (UDA) has previously been found in roots and rhizomes of stinging nettles as a mixture of UDA-isolectins. Protein and cDNA sequencing have shown that mature UDA is composed of two hevein domains and is processed from a precursor protein. The precursor contains a signal peptide, two in-tandem hevein domains, a hinge region and a carboxyl-terminal chitinase domain. Genomic fragments encoding precursors for UDA-isolectins have been amplified by five independent polymerase chain reactions on genomic DNA from stinging nettle ecotype Weerselo. One amplified gene was completely sequenced. As compared to the published cDNA sequence, the genomic sequence contains, besides two basepair substitutions, two introns located at the same positions as in other plant chitinases. By partial sequence analysis of 40 amplified genes, 16 different genes were identified which encode seven putative UDA-isolectins. The deduced amino acid sequences share 78.9-98.9% identity. In extracts of roots and rhizomes of stinging nettle ecotype Weerselo six out of these seven isolectins were detected by mass spectrometry. One of them is an acidic form, which has not been identified before. Our results demonstrate that UDA is encoded by a large gene family.

Cloning and sequencing of cDNA encoding human DNA topoisomerase II and localization of the gene to chromosome region 17q21-22

International Nuclear Information System (INIS)

Tsai-Pflugfelder, M.; Liu, L.F.; Liu, A.A.; Tewey, K.M.; Whang-Peng, J.; Knutsen, T.; Huebner, K.; Croce, C.M.; Wang, J.C.

1988-01-01

Two overlapping cDNA clones encoding human DNA topoisomerase II were identified by two independent methods. In one, a human cDNA library in phage λ was screened by hybridization with a mixed oligonucleotide probe encoding a stretch of seven amino acids found in yeast and Drosophila DNA topoisomerase II; in the other, a different human cDNA library in a λgt11 expression vector was screened for the expression of antigenic determinants that are recognized by rabbit antibodies specific to human DNA topoisomerase II. The entire coding sequences of the human DNA topoisomerase II gene were determined from these and several additional clones, identified through the use of the cloned human TOP2 gene sequences as probes. Hybridization between the cloned sequences and mRNA and genomic DNA indicates that the human enzyme is encoded by a single-copy gene. The location of the gene was mapped to chromosome 17q21-22 by in situ hybridization of a cloned fragment to metaphase chromosomes and by hybridization analysis with a panel of mouse-human hybrid cell lines, each retaining a subset of human chromosomes

Characterization of the porcine carboxypeptidase E cDNA

DEFF Research Database (Denmark)

Hreidarsdôttir, G.E.; Cirera, Susanna; Fredholm, Merete

2007-01-01

the sequence of the cDNA for the porcine CPE gene including all the coding region and the 3'-UTR region was generated. Comparisons with bovine, human, mouse, and rat CPE cDNA sequences showed that the coding regions of the gene are highly conserved both at the nucleotide and at the amino acid level. A very low...

Fiscal 2000 report on result of the full-length cDNA structure analysis; 2000 nendo kanzen cho cDNA kozo kaiseki seika hokokusho

Energy Technology Data Exchange (ETDEWEB)

NONE

2001-03-01

This paper explains the results of research on full-length cDNA structure analysis for the period from April, 2000 to March, 2001. The outline of human genome sequence was published in June, 2000. In Japan, human gene analysis was such that, as the basic technology of the bio industry, a millennium project was decided in the budget of fiscal 2000. The full-length cDNA structure analysis is the core of the project. The libraries of cDNA were prepared using full-length and more than 4-5kbp-long cDNAs by oligo-capping method. It began from determining partial sequence data at end cDNA, and then, with new clones selected therefrom, full-length human cDNA sequence data were determined. The partial sequence data determined by fiscal 2000 were 1,035,000 clones while the full-length sequence data were 12,144 clones. The sequence data obtained were analyzed by homology search and translated into amino acid coding sequences, with predictions conducted on protein functions. A clustering method was examined that selects new clones from partial sequences. Database was constructed on gene expression profiles and disease-related gene sequence data. (NEDO)

Protocol for chromosome-specific probe construction using PRINS, micromanipulation and DOP-PCR techniques

Directory of Open Access Journals (Sweden)

PAULO Z. PASSAMANI

2017-12-01

Full Text Available ABSTRACT Chromosome-specific probes have been widely used in molecular cytogenetics, being obtained with different methods. In this study, a reproducible protocol for construction of chromosome-specific probes is proposed which associates in situ amplification (PRINS, micromanipulation and degenerate oligonucleotide-primed PCR (DOP-PCR. Human lymphocyte cultures were used to obtain metaphases from male and female individuals. The chromosomes were amplified via PRINS, and subcentromeric fragments of the X chromosome were microdissected using microneedles coupled to a phase contrast microscope. The fragments were amplified by DOP-PCR and labeled with tetramethyl-rhodamine-5-dUTP. The probes were used in fluorescent in situ hybridization (FISH procedure to highlight these specific regions in the metaphases. The results show one fluorescent red spot in male and two in female X chromosomes and interphase nuclei.

In vivo fluorescent detection of Fe-S clusters coordinated by human GRX2.

Science.gov (United States)

Hoff, Kevin G; Culler, Stephanie J; Nguyen, Peter Q; McGuire, Ryan M; Silberg, Jonathan J; Smolke, Christina D

2009-12-24

A major challenge to studying Fe-S cluster biosynthesis in higher eukaryotes is the lack of simple tools for imaging metallocluster binding to proteins. We describe the first fluorescent approach for in vivo detection of 2Fe2S clusters that is based upon the complementation of Venus fluorescent protein fragments via human glutaredoxin 2 (GRX2) coordination of a 2Fe2S cluster. We show that Escherichia coli and mammalian cells expressing Venus fragments fused to GRX2 exhibit greater fluorescence than cells expressing fragments fused to a C37A mutant that cannot coordinate a metallocluster. In addition, we find that maximal fluorescence in the cytosol of mammalian cells requires the iron-sulfur cluster assembly proteins ISCU and NFS1. These findings provide evidence that glutaredoxins can dimerize within mammalian cells through coordination of a 2Fe2S cluster as observed with purified recombinant proteins. Copyright 2009 Elsevier Ltd. All rights reserved.

THE HUMAN FUMARYLACETOACETATE GENE : CHARACTERIZATION OF RESTRICTION-FRAGMENT-LENGTH-POLYMORPHISMS AND IDENTIFICATION OF HAPLOTYPES IN TYROSINEMIA TYPE-1 AND PSEUDODEFICIENCY

NARCIS (Netherlands)

ROOTWELT, H; KVITTINGEN, EA; HOIE, K; AGSTERIBBE, E; HARTOG, M; BERGER, R

Deficiency of human fumarylacetoacetase (FAH) activity results in hereditary tyrosinemia type I. Using the restriction enzymes BglII, KpnI and StuI and a 1.3-kb cDNA probe for the FAH gene, we have found 6 restriction fragment length polymorphisms (RFLPs). These RFLPs were utilised in 3 tyrosinemia

Gain measurement in a CW medium-power diode pumped Nd:YAG laser amplifier by ASE analysis

International Nuclear Information System (INIS)

Razzaghi, D; Hajiesmaeilbaigi, F; Ruzbehani, M

2014-01-01

Using the relation between amplified spontaneous emission intensity and gain, a set of formulas is derived for gain evaluation by comparing fluorescence yield in two different lengths of the active medium. Experimental measurements are carried out and gain is calculated by solving the derived formula. For comparison, measurements are also carried out using the probe beam method, which shows good agreement between the two methods in a typical CW medium-power diode pumped Nd:YAG amplifier. (paper)

PCR detection of a Maell polymorphism in the human major breakpoint cluster region (BCR)

Energy Technology Data Exchange (ETDEWEB)

McClure, J.S.; Litz, C.E. (Medical School, Minneapolis, MN (United States))

1991-09-25

Nested primer pairs flanking the second intron of the breakpoint cluster region were constructed from the published cDNA sequence. The outer primer pair 5{prime}BCR Exon 2 (5{prime}-GTT TCA GAA GCT TCT CCC TG-3{prime}) and 3{prime}BCR Exon 3 (5{prime}-ACT CTG CTT AAA TCC AGT GG-3{prime}), amplified a fragment of genomic DNA approximately 810 bp in length. The inner primer pair, 3{prime}BCR Exon 2(5{prime}-CGC TGA CCA TCA ATA AGG AA-3{prime}) and 5{prime}BCR Exon 3 (5{prime}-AGA AAC CCA TAG AGC CCC GG-3{prime}), amplified a fragment approximately 730 bp in length. Double stranded DNA amplified with the outer primer pair was subjected to asymmetric PCR using the inner primer pair. Sequencing reactions were performed using the Sequenase dideoxy sequencing kit with S{sup 35}-dATP. Sequences in homozygotes revealed either an A or a G 85 bp 5{prime} of the BCR BamHI site. Heterozygotes demonstrated both bands at the corresponding position.

DNA fingerprinting of Mycobacterium leprae strains using variable number tandem repeat (VNTR) - fragment length analysis (FLA).

Science.gov (United States)

Jensen, Ronald W; Rivest, Jason; Li, Wei; Vissa, Varalakshmi

2011-07-15

The study of the transmission of leprosy is particularly difficult since the causative agent, Mycobacterium leprae, cannot be cultured in the laboratory. The only sources of the bacteria are leprosy patients, and experimentally infected armadillos and nude mice. Thus, many of the methods used in modern epidemiology are not available for the study of leprosy. Despite an extensive global drug treatment program for leprosy implemented by the WHO, leprosy remains endemic in many countries with approximately 250,000 new cases each year. The entire M. leprae genome has been mapped and many loci have been identified that have repeated segments of 2 or more base pairs (called micro- and minisatellites). Clinical strains of M. leprae may vary in the number of tandem repeated segments (short tandem repeats, STR) at many of these loci. Variable number tandem repeat (VNTR) analysis has been used to distinguish different strains of the leprosy bacilli. Some of the loci appear to be more stable than others, showing less variation in repeat numbers, while others seem to change more rapidly, sometimes in the same patient. While the variability of certain VNTRs has brought up questions regarding their suitability for strain typing, the emerging data suggest that analyzing multiple loci, which are diverse in their stability, can be used as a valuable epidemiological tool. Multiple locus VNTR analysis (MLVA) has been used to study leprosy evolution and transmission in several countries including China, Malawi, the Philippines, and Brazil. MLVA involves multiple steps. First, bacterial DNA is extracted along with host tissue DNA from clinical biopsies or slit skin smears (SSS). The desired loci are then amplified from the extracted DNA via polymerase chain reaction (PCR). Fluorescently-labeled primers for 4-5 different loci are used per reaction, with 18 loci being amplified in a total of four reactions. The PCR products may be subjected to agarose gel electrophoresis to verify the

Observation of high seasonal variation in community structure of denitrifying bacteria in arable soil receiving artificial fertilizer and cattle manure by determining T-RFLP of nir gene fragments

DEFF Research Database (Denmark)

Priemé, Anders; Wolsing, Martin

2004-01-01

Temporal and spatial variation of communities of soil denitrifying bacteria at sites receiving mineral fertilizer (60 and 120 kg N ha-1 year-1) and cattle manure (75 and 150 kg N ha-1 year-1) were explored using terminal restriction fragment length polymorphism (T-RFLP) analyses of PCR amplified...... nitrite reductase (nirK and nirS) gene fragments. The analyses were done three times during the year: in March, July and October. nirK gene fragments could be amplified in all three months, whereas nirS gene fragments could be amplified only in March. Analysis of similarities in T-RFLP patterns revealed...... a significant seasonal shift in the community structure of nirK-containing bacteria. Also, sites treated with mineral fertilizer or cattle manure showed different communities of nirK-containing denitrifying bacteria, since the T-RFLP patterns of soils treated with these fertilizers were significantly different...

Molecular characterization of the amplified carboxylesterase gene associated with organophosphorus insecticide resistance in the brown planthopper, Nilaparvata lugens.

Science.gov (United States)

Small, G J; Hemingway, J

2000-12-01

Widespread resistance to organophosphorus insecticides (OPs) in Nilaparvata lugens is associated with elevation of carboxylesterase activity. A cDNA encoding a carboxylesterase, Nl-EST1, has been isolated from an OP-resistant Sri Lankan strain of N. lugens. The full-length cDNA codes for a 547-amino acid protein with high homology to other esterases/lipases. Nl-EST1 has an N-terminal hydrophobic signal peptide sequence of 24 amino acids which suggests that the mature protein is secreted from cells expressing it. The nucleotide sequence of the homologue of Nl-EST1 in an OP-susceptible, low esterase Sri Lankan strain of N. lugens is identical to Nl-EST1. Southern analysis of genomic DNA from the Sri Lankan OP-resistant and susceptible strains suggests that Nl-EST1 is amplified in the resistant strain. Therefore, resistance to OPs in the Sri Lankan strain is through amplification of a gene identical to that found in the susceptible strain.

A mechanism of gene amplification driven by small DNA fragments.

Directory of Open Access Journals (Sweden)

Kuntal Mukherjee

Full Text Available DNA amplification is a molecular process that increases the copy number of a chromosomal tract and often causes elevated expression of the amplified gene(s. Although gene amplification is frequently observed in cancer and other degenerative disorders, the molecular mechanisms involved in the process of DNA copy number increase remain largely unknown. We hypothesized that small DNA fragments could be the trigger of DNA amplification events. Following our findings that small fragments of DNA in the form of DNA oligonucleotides can be highly recombinogenic, we have developed a system in the yeast Saccharomyces cerevisiae to capture events of chromosomal DNA amplification initiated by small DNA fragments. Here we demonstrate that small DNAs can amplify a chromosomal region, generating either tandem duplications or acentric extrachromosomal DNA circles. Small fragment-driven DNA amplification (SFDA occurs with a frequency that increases with the length of homology between the small DNAs and the target chromosomal regions. SFDA events are triggered even by small single-stranded molecules with as little as 20-nt homology with the genomic target. A double-strand break (DSB external to the chromosomal amplicon region stimulates the amplification event up to a factor of 20 and favors formation of extrachromosomal circles. SFDA is dependent on Rad52 and Rad59, partially dependent on Rad1, Rad10, and Pol32, and independent of Rad51, suggesting a single-strand annealing mechanism. Our results reveal a novel molecular model for gene amplification, in which small DNA fragments drive DNA amplification and define the boundaries of the amplicon region. As DNA fragments are frequently found both inside cells and in the extracellular environment, such as the serum of patients with cancer or other degenerative disorders, we propose that SFDA may be a common mechanism for DNA amplification in cancer cells, as well as a more general cause of DNA copy number variation

Isolation, cDNA cloning and gene expression of an antibacterial protein from larvae of the coconut rhinoceros beetle, Oryctes rhinoceros.

Science.gov (United States)

Yang, J; Yamamoto, M; Ishibashi, J; Taniai, K; Yamakawa, M

1998-08-01

An antibacterial protein, designated rhinocerosin, was purified to homogeneity from larvae of the coconut rhinoceros beetle, Oryctes rhinoceros immunized with Escherichia coli. Based on the amino acid sequence of the N-terminal region, a degenerate primer was synthesized and reverse-transcriptase PCR was performed to clone rhinocerosin cDNA. As a result, a 279-bp fragment was obtained. The complete nucleotide sequence was determined by sequencing the extended rhinocerosin cDNA clone by 5' rapid amplification of cDNA ends. The deduced amino acid sequence of the mature portion of rhinocerosin was composed of 72 amino acids without cystein residues and was shown to be rich in glycine (11.1%) and proline (11.1%) residues. Comparison of the deduced amino acid sequence of rhinocerosin with those of other antibacterial proteins indicated that it has 77.8% and 44.6% identity with holotricin 2 and coleoptrecin, respectively. Rhinocerosin had strong antibacterial activity against E. coli, Streptococcus pyogenes, Staphylococcus aureus but not against Pseudomonas aeruginosa. Results of reverse-transcriptase PCR analysis of gene expression in different tissues indicated that the rhinocerosin gene is strongly expressed in the fat body and the Malpighian tubule, and weakly expressed in hemocytes and midgut. In addition, gene expression was inducible by bacteria in the fat body, the Malpighian tubule and hemocyte but constitutive expression was observed in the midgut.

cDNA microarray screening in food safety

International Nuclear Information System (INIS)

Roy, Sashwati; Sen, Chandan K.

2006-01-01

The cDNA microarray technology and related bioinformatics tools presents a wide range of novel application opportunities. The technology may be productively applied to address food safety. In this mini-review article, we present an update highlighting the late breaking discoveries that demonstrate the vitality of cDNA microarray technology as a tool to analyze food safety with reference to microbial pathogens and genetically modified foods. In order to bring the microarray technology to mainstream food safety, it is important to develop robust user-friendly tools that may be applied in a field setting. In addition, there needs to be a standardized process for regulatory agencies to interpret and act upon microarray-based data. The cDNA microarray approach is an emergent technology in diagnostics. Its values lie in being able to provide complimentary molecular insight when employed in addition to traditional tests for food safety, as part of a more comprehensive battery of tests

Selective disulfide reduction for labeling and enhancement of Fab antibody fragments.

Science.gov (United States)

Kirley, Terence L; Greis, Kenneth D; Norman, Andrew B

2016-11-25

Many methods have been developed for chemical labeling and enhancement of the properties of antibodies and their common fragments, including the Fab and F(ab') 2 fragments. Somewhat selective reduction of some antibody disulfide bonds has been previously achieved, yielding antibodies and antibody fragments that can be labeled at defined sites, enhancing their utility and properties. Selective reduction of the two hinge disulfide bonds present in F(ab') 2 fragments using mild reduction has been useful. However, such reduction is often not quantitative and results in the reduction of multiple disulfide bonds, and therefore subsequent multiple labeling or conjugation sites are neither homogenous nor stoichiometric. Here, a simple and efficient selective reduction of the single disulfide bond linking the partial heavy chain and the intact light chain which compose the Fab fragment is accomplished utilizing tris(2-carboxyethyl)phosphine (TCEP) immobilized on agarose beads. The resultant reduced cysteine residues were labeled with several cysteine-selective fluorescent reagents, as well as by cysteine-directed PEGylation. These two cysteine residues can also be re-ligated by means of a bifunctional cysteine cross-linking agent, dibromobimane, thereby both restoring a covalent linkage between the heavy and light chains at this site, far removed from the antigen binding site, and also introducing a fluorescent probe. There are many other research and clinical uses for these selectively partially reduced Fab fragments, including biotinylation, toxin and drug conjugation, and incorporation of radioisotopes, and this technique enables simple generation of very useful Fab fragment derivatives with many potential applications. Copyright © 2016 Elsevier Inc. All rights reserved.

cDNA structure, genomic organization and expression patterns of ...

African Journals Online (AJOL)

Visfatin was a newly identified adipocytokine, which was involved in various physiologic and pathologic processes of organisms. The cDNA structure, genomic organization and expression patterns of silver Prussian carp visfatin were described in this report. The silver Prussian carp visfatin cDNA cloned from the liver was ...

Detection of chromosomal aberrations by fluorescence in situ hybridization in the first three postirradiation divisions of human lymphocytes

International Nuclear Information System (INIS)

Boei, J.J.W.A.; Vermeulen, S.; Natarajan, A.T.

1996-01-01

Chromosomal aberrations in human lymphocytes were analyzed by fluorescence in situ hybridization (FISH) in the first 3 postirradiation (0 and 2 Gy) divisions. Cells were grown in the presence of BrdU, collected at different sampling times (47, 70 and 91 h) and analyzed using an alphoid centromeric probe and PCR amplified DNA libraries for chromosomes 2 and 8. Following differential staining of sister chromatids, the analyzed cells were identified to be either in the first, second or third mitosis after irradiation. The frequencies of both dicentrics and fragments showed a reduction of about 50% after each cell generation, whereas translocations were more persistent. Cells within the same postirradiation division showed higher aberration frequencies when derived from later sampling times, indicating a delay in progression of aberrant cells. As a result, the frequencies for dicentrics and fragments remained rather constant at different sampling times if the cell cycle parameter was not taken into account. Thus, the average generation time of the lymphocytes had a clear effect on the obtained aberration frequencies. The described method allows the study of the persistence of chromosome damage using the FISH technique during 3 subsequent cell divisions in vitro

CHARACTERIZATION OF 0.58 kb DNA STILBENE SYNTHASE ENCODING GENE FRAGMENT FROM MELINJO PLANT (Gnetum gnemon

Directory of Open Access Journals (Sweden)

Tri Joko Raharjo

2011-12-01

Full Text Available Resveratrol is a potent anticancer agent resulted as the main product of enzymatic reaction between common precursor in plants and Stilbene Synthase enzyme, which is expressed by sts gene. Characterization of internal fragment of Stilbene Synthase (STS encoding gene from melinjo plant (Gnetum gnemon L. has been carried out as part of a larger work to obtain a full length of Stilbene Synthase encoding gene of the plant. RT-PCR (Reverse Transcriptase Polymerase Chain Reaction was performed using two degenerated primers to amplify the gene fragment. Ten published STS conserved amino acid sequences from various plant species from genebank were utilized to construct a pair of GGF2 (5' GTTCCACCTGCGAAGCAGCC 3' and GGR2 (5' CTGGATCGCACATCC TGGTG 3' primers. Both designed primers were predicted to be in the position of 334-354 and 897-916 kb of the gene respectively. Total RNA isolated from melinjo leaves was used as template for the RT-PCR amplification process using two-step technique. A collection of 0.58 DNA fragments was generated from RT-PCR amplification and met the expected results. The obtained DNA fragments were subsequently isolated, refined and sequenced. A nucleotide sequence analysis was accomplished by comparing it to the existed sts genes available in genebank. Homology analysis of the DNA fragments with Arachis hypogaea L00952 sts gene showed high similarity level. Taken together, the results are evidence that the amplified fragment obtained in this study is part of melinjo sts gene

Infectious Maize rayado fino virus from cloned cDNA

Science.gov (United States)

Maize rayado fino virus (MRFV) is the type member of the marafiviruses within the family Tymoviridae. A cDNA clone from which infectious RNA can be transcribed was produced from a US isolate of MRFV (MRFV-US). Infectivity of transcripts derived from cDNA clones was demonstrated by infection of mai...

Mouse tetranectin: cDNA sequence, tissue-specific expression, and chromosomal mapping

DEFF Research Database (Denmark)

Ibaraki, K; Kozak, C A; Wewer, U M

1995-01-01

regulation, mouse tetranectin cDNA was cloned from a 16-day-old mouse embryo library. Sequence analysis revealed a 992-bp cDNA with an open reading frame of 606 bp, which is identical in length to the human tetranectin cDNA. The deduced amino acid sequence showed high homology to the human cDNA with 76......(s) of tetranectin. The sequence analysis revealed a difference in both sequence and size of the noncoding regions between mouse and human cDNAs. Northern analysis of the various tissues from mouse, rat, and cow showed the major transcript(s) to be approximately 1 kb, which is similar in size to that observed...

Self-Assembly of Colloidal Photonic Crystals of PS@PNIPAM Nanoparticles and Temperature-Responsive Tunable Fluorescence.

Science.gov (United States)

Yuan, Shuai; Ge, Fengyan; Yang, Xue; Guang, Shanyi

2016-11-01

A strategy for significantly enhancing fluorescence is developed based on the coupling of optical properties of colloidal photonic crystals (CPCs) with responsive microgel. In this paper, thermoresponsive microgel PNIPAM was employed for the fabrication of core-shell structure. The core-shell PS@PNIPAM nanoparticles (NPs) are then assembled to CPCs by a vertical deposition method. Subsequently, the novel functional material (RhB/CPCs) can be prepared by depositing fluorescent dye molecules (RhB) on the top of PS@PNIPAM CPCs. We obtained an increase in the fluorescent intensity up to 15-fold and 22-fold compared with RhB on the glass slid and the uneven film. Due to the unique responsive shrinking properties of PNIPAM shell, the amplifying fluorescence behavior of CPCs can be well tuned by varying the temperature. In contrast to RhB on the glass slid, a 15-fold and 12-fold fluorescence enhancement can be observed when the temperature of RhB/CPCs was 20 °C and 50 °C, respectively. The mechanism on enhancement fluorescence of tunable CPCs can be achieved by measurements of thermoresponsive properties. The results indicate that the responsive fluorescence-amplifying method based on CPCs made with responsive core-shell NPs has a potential application for the development of efficient fluorescence sensors.

Operation amplifier

NARCIS (Netherlands)

Tetsuya, Saito; Nauta, Bram

2008-01-01

To provide an operation amplifier which improves power source voltage removal ratios while assuring phase compensation characteristics, and therefore can be realized with a small-scale circuit and low power consumption. SOLUTION: The operation amplifier comprises: a differential amplifier circuit 1;

Cloning and functional expression of a human pancreatic islet glucose-transporter cDNA

International Nuclear Information System (INIS)

Permutt, M.A.; Koranyi, L.; Keller, K.; Lacy, P.E.; Scharp, D.W.; Mueckler, M.

1989-01-01

Previous studies have suggested that pancreatic islet glucose transport is mediated by a high-K m , low-affinity facilitated transporter similar to that expressed in liver. To determine the relationship between islet and liver glucose transporters, liver-type glucose-transporter cDNA clones were isolated from a human liver cDNA library. The liver-type glucose-transporter cDNA clone hybridized to mRNA transcripts of the same size in human liver and pancreatic islet RNA. A cDNA library was prepared from purified human pancreatic islet tissue and screened with human liver-type glucose-transporter cDNA. The authors isolated two overlapping cDNA clones encompassing 2600 base pairs, which encode a pancreatic islet protein identical in sequence to that of the putative liver-type glucose-transporter protein. Xenopus oocytes injected with synthetic mRNA transcribed from a full-length cDNA construct exhibited increased uptake of 2-deoxyglucose, confirming the functional identity of the clone. These cDNA clones can now be used to study regulation of expression of the gene and to assess the role of inherited defects in this gene as a candidate for inherited susceptibility to non-insulin-dependent diabetes mellitus

Analysis of DNA methylation of maize in response to osmotic and salt stress based on methylation-sensitive amplified polymorphism.

Science.gov (United States)

Tan, Ming-pu

2010-01-01

Water stress is known to alter cytosine methylation, which generally represses transcription. However, little is known about the role of methylation alteration in maize under osmotic stress. Here, methylation-sensitive amplified polymorphism (MSAP) was used to screen PEG- or NaCl-induced methylation alteration in maize seedlings. The sequences of 25 differentially amplified fragments relevant to stress were successfully obtained. Two stress-specific fragments from leaves, LP166 and LPS911, shown to be homologous to retrotransposon Gag-Pol protein genes, suggested that osmotic stress-induced methylation of retrotransposons. Three MSAP fragments, representing drought-induced or salt-induced methylation in leaves, were homologous to a maize aluminum-induced transporter. Besides these, heat shock protein HSP82, Poly [ADP-ribose] polymerase 2, Lipoxygenase, casein kinase (CK2), and dehydration-responsive element-binding (DREB) factor were also homologs of MSAP sequences from salt-treated roots. One MSAP fragment amplified from salt-treated roots, designated RS39, was homologous to the first intron of maize protein phosphatase 2C (zmPP2C), whereas - LS103, absent from salt-treated leaves, was homologous to maize glutathione S-transferases (zmGST). Expression analysis showed that salt-induced intron methylation of root zmPP2C significantly downregulated its expression, while salt-induced demethylation of leaf zmGST weakly upregulated its expression. The results suggested that salinity-induced methylation downregulated zmPP2C expression, a negative regulator of the stress response, while salinity-induced demethylation upregulated zmGST expression, a positive effecter of the stress response. Altered methylation, in response to stress, might also be involved in stress acclimation. Copyright 2009 Elsevier Masson SAS. All rights reserved.

Characterization of a recombinant humanized anti-cocaine monoclonal antibody and its Fab fragment.

Science.gov (United States)

Kirley, Terence L; Norman, Andrew B

2015-01-01

Variations of post-translational modifications are important for stability and in vivo behavior of therapeutic antibodies. A recombinant humanized anti-cocaine monoclonal antibody (h2E2) was characterized for heterogeneity of N-linked glycosylation and disulfide bonds. In addition, charge heterogeneity, which is partially due to the presence or absence of C-terminal lysine on the heavy chains, was examined. For cocaine overdose therapy, Fab fragments may be therapeutic, and thus, a simplified method of generation, purification, and characterization of the Fab fragment generated by Endoproteinase Lys-C digestion was devised. Both the intact h2E2 antibody and purified Fab fragments were analyzed for their affinities for cocaine and 2 of its metabolites, benzoylecgonine and cocaethylene, by fluorescence quenching of intrinsic antibody tyrosine and tryptophan fluorescence resulting from binding of these drugs. Binding constants obtained from fluorescence quenching measurements are in agreement with recently published radioligand and ELISA binding assays. The dissociation constants determined for the h2E2 monoclonal and its Fab fragment are approximately 1, 5, and 20 nM for cocaethylene, cocaine, and benzoylecgonine, respectively. Tryptophan fluorescence quenching (emission at 330 nm) was measured after either excitation of tyrosine and tryptophan (280 nm) or selective excitation of tryptophan alone (295 nm). More accurate binding constants are obtained using tryptophan selective excitation at 295 nm, likely due to interfering absorption of cocaine and metabolites at 280 nm. These quenching results are consistent with multiple tryptophan and tyrosine residues in or near the predicted binding location of cocaine in a previously published 3-D model of this antibody's variable region.

Resonance Fluorescence from an Artificial Atom in Squeezed Vacuum

Directory of Open Access Journals (Sweden)

D. M. Toyli

2016-07-01

Full Text Available We present an experimental realization of resonance fluorescence in squeezed vacuum. We strongly couple microwave-frequency squeezed light to a superconducting artificial atom and detect the resulting fluorescence with high resolution enabled by a broadband traveling-wave parametric amplifier. We investigate the fluorescence spectra in the weak and strong driving regimes, observing up to 3.1 dB of reduction of the fluorescence linewidth below the ordinary vacuum level and a dramatic dependence of the Mollow triplet spectrum on the relative phase of the driving and squeezed vacuum fields. Our results are in excellent agreement with predictions for spectra produced by a two-level atom in squeezed vacuum [Phys. Rev. Lett. 58, 2539 (1987], demonstrating that resonance fluorescence offers a resource-efficient means to characterize squeezing in cryogenic environments.

Fluorescent Random Amplified Microsatellites (F-RAMS) analysis of mushrooms as a forensic investigative tool

Czech Academy of Sciences Publication Activity Database

Kallifatidis, B.; Borovička, Jan; Stránská, J.; Drábek, J.; Mills, D. K.

2014-01-01

Roč. 9, MAR (2014), s. 25-32 ISSN 1872-4973 Institutional support: RVO:61389005 Keywords : random amplified microsatellites * hallucinogenic mashrooms * DNA profiling Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 4.604, year: 2014

cDNA encoding a polypeptide including a hevein sequence

Energy Technology Data Exchange (ETDEWEB)

Raikhel, N.V.; Broekaert, W.F.; Namhai Chua; Kush, A.

1993-02-16

A cDNA clone (HEV1) encoding hevein was isolated via polymerase chain reaction (PCR) using mixed oligonucleotides corresponding to two regions of hevein as primers and a Hevea brasiliensis latex cDNA library as a template. HEV1 is 1,018 nucleotides long and includes an open reading frame of 204 amino acids.

Cloning and analysis of the mouse Fanconi anemia group A cDNA and an overlapping penta zinc finger cDNA.

Science.gov (United States)

Wong, J C; Alon, N; Norga, K; Kruyt, F A; Youssoufian, H; Buchwald, M

2000-08-01

Despite the cloning of four disease-associated genes for Fanconi anemia (FA), the molecular pathogenesis of FA remains largely unknown. To study FA complementation group A using the mouse as a model system, we cloned and characterized the mouse homolog of the human FANCA cDNA. The mouse cDNA (Fanca) encodes a 161-kDa protein that shares 65% amino acid sequence identity with human FANCA. Fanca is located at the distal region of mouse chromosome 8 and has a ubiquitous pattern of expression in embryonic and adult tissues. Expression of the mouse cDNA in human FA-A cells restores the cellular drug sensitivity to normal levels. Thus, the expression pattern, protein structure, chromosomal location, and function of FANCA are conserved in the mouse. We also isolated a novel zinc finger protein, Zfp276, which has five C(2)H(2) domains. Interestingly, Zfp276 is situated in the Fanca locus, and the 3'UTR of its cDNA overlaps with the last four exons of Fanca in a tail-to-tail manner. Zfp276 is expressed in the same tissues as Fanca, but does not complement the mitomycin C (MMC)-sensitive phenotype of FA-A cells. The overlapping genomic organization between Zfp276 and Fanca may have relevance to the disease phenotype of FA. Copyright 2000 Academic Press.

Universal primers that amplify RNA from all three flavivirus subgroups

Directory of Open Access Journals (Sweden)

Barnard Ross T

2008-01-01

Full Text Available Abstract Background Species within the Flavivirus genus pose public health problems around the world. Increasing cases of Dengue and Japanese encephalitis virus in Asia, frequent outbreaks of Yellow fever virus in Africa and South America, and the ongoing spread of West Nile virus throughout the Americas, show the geographical burden of flavivirus diseases. Flavivirus infections are often indistinct from and confused with other febrile illnesses. Here we review the specificity of published primers, and describe a new universal primer pair that can detect a wide range of flaviviruses, including viruses from each of the recognised subgroups. Results Bioinformatic analysis of 257 published full-length Flavivirus genomes revealed conserved regions not previously targeted by primers. Two degenerate primers, Flav100F and Flav200R were designed from these regions and used to generate an 800 base pair cDNA product. The region amplified encoded part of the methyltransferase and most of the RNA-dependent-RNA-polymerase (NS5 coding sequence. One-step RT-PCR testing was successful using standard conditions with RNA from over 60 different flavivirus strains representing about 50 species. The cDNA from each virus isolate was sequenced then used in phylogenetic analyses and database searches to confirm the identity of the template RNA. Conclusion Comprehensive testing has revealed the broad specificity of these primers. We briefly discuss the advantages and uses of these universal primers.

Electron detachment dissociation of fluorescently labeled sialylated oligosaccharides.

Science.gov (United States)

Zhou, Wen; Håkansson, Kristina

2011-12-01

We explored the application of electron detachment dissociation (EDD) and infrared multiphoton dissociation (IRMPD) tandem mass spectrometry to fluorescently labeled sialylated oligosaccharides. Standard sialylated oligosaccharides and a sialylated N-linked glycan released from human transferrin were investigated. EDD yielded extensive glycosidic cleavages and cross-ring cleavages in all cases studied, consistently providing complementary structural information compared with infrared multiphoton dissociation. Neutral losses and satellite ions such as C-2H ions were also observed following EDD. In addition, we examined the influence of different fluorescent labels. The acidic label 2-aminobenzoic acid (2-AA) enhanced signal abundance in negative-ion mode. However, few cross-ring fragments were observed for 2-AA-labeled oligosaccharides. The neutral label 2-aminobenzamide (2-AB) resulted in more cross-ring cleavages compared with 2-AA-labeled species, but not as extensive fragmentation as for native oligosaccharides, likely resulting from altered negative charge locations from introduction of the fluorescent tag. Copyright © 2011 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Brain cDNA clone for human cholinesterase

International Nuclear Information System (INIS)

McTiernan, C.; Adkins, S.; Chatonnet, A.; Vaughan, T.A.; Bartels, C.F.; Kott, M.; Rosenberry, T.L.; La Du, B.N.; Lockridge, O.

1987-01-01

A cDNA library from human basal ganglia was screened with oligonucleotide probes corresponding to portions of the amino acid sequence of human serum cholinesterase. Five overlapping clones, representing 2.4 kilobases, were isolated. The sequenced cDNA contained 207 base pairs of coding sequence 5' to the amino terminus of the mature protein in which there were four ATG translation start sites in the same reading frame as the protein. Only the ATG coding for Met-(-28) lay within a favorable consensus sequence for functional initiators. There were 1722 base pairs of coding sequence corresponding to the protein found circulating in human serum. The amino acid sequence deduced from the cDNA exactly matched the 574 amino acid sequence of human serum cholinesterase, as previously determined by Edman degradation. Therefore, our clones represented cholinesterase rather than acetylcholinesterase. It was concluded that the amino acid sequences of cholinesterase from two different tissues, human brain and human serum, were identical. Hybridization of genomic DNA blots suggested that a single gene, or very few genes coded for cholinesterase

3' RNA ligase mediated rapid amplification of cDNA ends for validating viroid induced cleavage at the 3' extremity of the host mRNA.

Science.gov (United States)

Adkar-Purushothama, Charith Raj; Bru, Pierrick; Perreault, Jean-Pierre

2017-12-01

5' RNA ligase-mediated rapid amplification of cDNA ends (5' RLM-RACE) is a widely-accepted method for the validation of direct cleavage of a target gene by a microRNA (miRNA) and viroid-derived small RNA (vd-sRNA). However, this method cannot be used if cleavage takes place in the 3' extremity of the target RNA, as this gives insufficient sequence length to design nested PCR primers for 5' RLM RACE. To overcome this hurdle, we have developed 3' RNA ligase-mediated rapid amplification of cDNA ends (3' RLM RACE). In this method, an oligonucleotide adapter having 5' adenylated and 3' blocked is ligated to the 3' end of the cleaved RNA followed by PCR amplification using gene specific primers. In other words, in 3' RLM RACE, 3' end is mapped using 5' fragment instead of small 3' fragment. The method developed here was verified by examining the bioinformatics predicted and parallel analysis of RNA ends (PARE) proved cleavage sites of chloride channel protein CLC-b-like mRNA in Potato spindle tuber viroid infected tomato plants. The 3' RLM RACE developed in this study has the potential to validate the miRNA and vd-sRNA mediated cleavage of mRNAs at its 3' untranslated region (3' UTR). Copyright © 2017 Elsevier B.V. All rights reserved.

Amplifier Distortion

Science.gov (United States)

Keeports, David

2006-12-01

By definition, a high fidelity amplifier's instantaneous output voltage is directly proportional to its instantaneous input voltage. While high fidelity is generally valued in the amplification of recorded music, nonlinearity, also known as distortion, is desirable in the amplification of some musical instruments. In particular, guitar amplifiers exploit nonlinearity to increase both the harmonic content and sustain of a guitar's sound. I will discuss how both modifications in sound result from saturation of triode tubes and transistors. Additionally, I will describe the difference in the symmetry of saturation curves for transistors and tubes and the reason why tube guitar amplifiers are generally considered to be superior to solid-state amplifiers. Finally, I will discuss attempts to use solid-state electronics to replicate the sound of tube amplifiers.

Cloning and characterization of the human colipase cDNA

International Nuclear Information System (INIS)

Lowe, M.E.; Rosenblum, J.L.; McEwen, P.; Strauss, A.W.

1990-01-01

Pancreatic lipase hydrolyzes dietary triglycerides to monoglycerides and fatty acids. In the presence of bile salts, the activity of pancreatic lipase is markedly decreased. The activity can be restored by the addition of colipase, a low molecular weight protein secreted by the pancreas. The action of pancreatic lipase in the gut lumen is dependent upon its interaction with colipase. As a first step in elucidating the molecular events governing the interaction of lipase and colipase with each other and with fatty acids, a cDNA encoding human colipase was isolated from a λgt11 cDNA library with a rabbit polyclonal anti-human colipase antibody. The full-length 525 bp cDNA contained an open reading frame encoding 112 amino acids, including a 17 amino acid signal peptide. The predicted sequence contains 100% of the published protein sequence for human colipase determined by chemical methods, but predicts the presence of five additional NH 2 -terminal amino acids and four additional COOH-terminal amino acids. Comparison of the predicted protein sequence with the known sequences of colipase from other species reveals regions of extensive identity. The authors report, for the first time, a cDNA for colipase. The cDNA predicts a human procolipase an suggests that there may also be processing at the COOH-terminus. The regions of identity with colipase from other species will aid in defining the interaction with lipase and lipids through site-specific mutagenesis

Quantification of DNA fragmentation in processed foods using real-time PCR.

Science.gov (United States)

Mano, Junichi; Nishitsuji, Yasuyuki; Kikuchi, Yosuke; Fukudome, Shin-Ichi; Hayashida, Takuya; Kawakami, Hiroyuki; Kurimoto, Youichi; Noguchi, Akio; Kondo, Kazunari; Teshima, Reiko; Takabatake, Reona; Kitta, Kazumi

2017-07-01

DNA analysis of processed foods is performed widely to detect various targets, such as genetically modified organisms (GMOs). Food processing often causes DNA fragmentation, which consequently affects the results of PCR analysis. In order to assess the effects of DNA fragmentation on the reliability of PCR analysis, we investigated a novel methodology to quantify the degree of DNA fragmentation. We designed four real-time PCR assays that amplified 18S ribosomal RNA gene sequences common to various plants at lengths of approximately 100, 200, 400, and 800 base pairs (bp). Then, we created an indicator value, "DNA fragmentation index (DFI)", which is calculated from the Cq values derived from the real-time PCR assays. Finally, we demonstrated the efficacy of this method for the quality control of GMO detection in processed foods by evaluating the relationship between the DFI and the limit of detection. Copyright © 2017 Elsevier Ltd. All rights reserved.

RICD: A rice indica cDNA database resource for rice functional genomics

Directory of Open Access Journals (Sweden)

Zhang Qifa

2008-11-01

Full Text Available Abstract Background The Oryza sativa L. indica subspecies is the most widely cultivated rice. During the last few years, we have collected over 20,000 putative full-length cDNAs and over 40,000 ESTs isolated from various cDNA libraries of two indica varieties Guangluai 4 and Minghui 63. A database of the rice indica cDNAs was therefore built to provide a comprehensive web data source for searching and retrieving the indica cDNA clones. Results Rice Indica cDNA Database (RICD is an online MySQL-PHP driven database with a user-friendly web interface. It allows investigators to query the cDNA clones by keyword, genome position, nucleotide or protein sequence, and putative function. It also provides a series of information, including sequences, protein domain annotations, similarity search results, SNPs and InDels information, and hyperlinks to gene annotation in both The Rice Annotation Project Database (RAP-DB and The TIGR Rice Genome Annotation Resource, expression atlas in RiceGE and variation report in Gramene of each cDNA. Conclusion The online rice indica cDNA database provides cDNA resource with comprehensive information to researchers for functional analysis of indica subspecies and for comparative genomics. The RICD database is available through our website http://www.ncgr.ac.cn/ricd.

CtGEM typing: Discrimination of Chlamydia trachomatis ocular and urogenital strains and major evolutionary lineages by high resolution melting analysis of two amplified DNA fragments.

Science.gov (United States)

Giffard, Philip M; Andersson, Patiyan; Wilson, Judith; Buckley, Cameron; Lilliebridge, Rachael; Harris, Tegan M; Kleinecke, Mariana; O'Grady, Kerry-Ann F; Huston, Wilhelmina M; Lambert, Stephen B; Whiley, David M; Holt, Deborah C

2018-01-01

Chlamydia trachomatis infects the urogenital tract (UGT) and eyes. Anatomical tropism is correlated with variation in the major outer membrane protein encoded by ompA. Strains possessing the ocular ompA variants A, B, Ba and C are typically found within the phylogenetically coherent "classical ocular lineage". However, variants B, Ba and C have also been found within three distinct strains in Australia, all associated with ocular disease in children and outside the classical ocular lineage. CtGEM genotyping is a method for detecting and discriminating ocular strains and also the major phylogenetic lineages. The rationale was facilitation of surveillance to inform responses to C. trachomatis detection in UGT specimens from young children. CtGEM typing is based on high resolution melting analysis (HRMA) of two PCR amplified fragments with high combinatorial resolving power, as defined by computerised comparison of 65 whole genomes. One fragment is from the hypothetical gene defined by Jali-1891 in the C. trachomatis B_Jali20 genome, while the other is from ompA. Twenty combinatorial CtGEM types have been shown to exist, and these encompass unique genotypes for all known ocular strains, and also delineate the TI and T2 major phylogenetic lineages, identify LGV strains and provide additional resolution beyond this. CtGEM typing and Sanger sequencing were compared with 42 C. trachomatis positive clinical specimens, and there were no disjunctions. CtGEM typing is a highly efficient method designed and tested using large scale comparative genomics. It divides C. trachomatis into clinically and biologically meaningful groups, and may have broad application in surveillance.

Cloning and expression of human deoxycytidine kinase cDNA

International Nuclear Information System (INIS)

Chottiner, E.G.; Shewach, D.S.; Datta, N.S.; Ashcraft, E.; Gribbin, D.; Ginsburg, D.; Fox, I.H.; Mitchell, B.S.

1991-01-01

Deoxycytidine (dCyd) kinase is required for the phosphorylation of several deoxyribonucleosides and certain nucleoside analogs widely employed as antiviral and chemotherapeutic agents. Detailed analysis of this enzyme has been limited, however, by its low abundance and instability. Using oligonucleotides based on primary amino acid sequence derived from purified dCyd kinase, the authors have screened T-lymphoblast cDNA libraries and identified a cDNA sequence that encodes a 30.5-kDa protein corresponding to the subunit molecular mass of the purified protein. Expression of the cDNA in Escherichia coli results in a 40-fold increase in dCyd kinase activity over control levels. Northern blot analysis reveals a single 2.8-kilobase mRNA expressed in T lymphoblasts at 5- to 10-fold higher levels than in B lymphoblasts, and decreased dCyd kinase mRNA levels are present in T-lymphoblast cell lines resistant to arabinofuranosylcytosine and dideoxycytidine. These findings document that this cDNA encodes the T-lymphoblast dCyd kinase responsible for the phosphorylation of dAdo and dGuo as well as dCyd and arabinofuranosylcytosine

Mapping of the antigenic and allergenic epitopes of Lol p VB using gene fragmentation.

Science.gov (United States)

Ong, E K; Knox, R B; Singh, M B

1995-03-01

The recombinant proteins of Lol p VA and Lol p VB expressed in E. coli reacted with IgE antibodies from sera of allergic patients and mAbs FMC A7 and PpV1. Cross-absorption analyses using these recombinant proteins showed that Lol p VA and Lol p VB possess both similar and unique IgE binding determinants. Gene fragmentation was utilized to localize the antigenic and allergenic determinants of Lol p VB. When full-length cDNA of Lol p VB was digested into three fragments and expressed as the fusions from the glutathione transferase of pGEX vectors, fragments Met1-Val196 and Asp197-Val339 bound IgE while fragment Met1-Pro96 did not. The data suggest that there are at least two IgE binding determinants in Lol p VB. In addition, only fragment Met1-Val196 reacted with mAb PpV1. The localization of these determinants was further resolved using random fragment expression libraries. The mAb PpV1 determinant was near the N-terminal region of Lol p VB molecule. The IgE binding determinants were distributed in the central region: region I (amino acids 111-195) and II (199-254). These IgE binding determinants are conserved in Lol p VA.

Triphenylamine based benzimidazole and benzothiazole: Synthesis and applications in fluorescent chemosensors and laser dyes

Energy Technology Data Exchange (ETDEWEB)

Yang, Yang [State Key Laboratory of Luminescence and Applications, Changchun Institute of Optics Fine Mechanics and Physics, Chinese Academy of Sciences, Changchun 130033 (China); University of Chinese Academy of Sciences, Beijing 100039 (China); Li, Bin, E-mail: libinteacher@163.com [State Key Laboratory of Luminescence and Applications, Changchun Institute of Optics Fine Mechanics and Physics, Chinese Academy of Sciences, Changchun 130033 (China); Zhang, Liming; Guan, Yunlong [State Key Laboratory of Luminescence and Applications, Changchun Institute of Optics Fine Mechanics and Physics, Chinese Academy of Sciences, Changchun 130033 (China)

2014-01-15

Triphenylamine based fluorescent dyes TPA-benzimidazole and TPA-benzothiazole have been designed and synthesized. The TPA-benzimidazole chemosensor was tested for a number of metal ions and found to exhibit binding affinity for Fe{sup 3+} and Hg{sup 2+} in acetonitrile, and the fluorescence quenching was achieved through a PET process. The appearance of an isosbestic point in absorption titrations and Job's plot analysis supported 1:1 stoichiometries for Fe{sup 3+} and Hg{sup 2+} ions. Laser experiments showed that under transversal pumping with a Q-switched Nd:YAG (355 nm) laser in toluene, TPA-benzothiazole exhibits efficient and stable amplified spontaneous emissions (ASE) at 436 nm. -- Highlights: • Triphenylamine based fluorescent dyes TPA-benzimidazole and TPA-benzothiazole have been designed and synthesized. • The TPA-benzimidazole exhibits binding affinity for Fe{sup 3+} and Hg{sup 2+} in acetonitrile and the fluorescence quenching was achieved through a PET process. • Under transversal pumping at 355 nm in toluene, TPA-benzothiazole exhibits efficient and stable amplified spontaneous emissions (ASE) in 436 nm.

Triphenylamine based benzimidazole and benzothiazole: Synthesis and applications in fluorescent chemosensors and laser dyes

International Nuclear Information System (INIS)

Yang, Yang; Li, Bin; Zhang, Liming; Guan, Yunlong

2014-01-01

Triphenylamine based fluorescent dyes TPA-benzimidazole and TPA-benzothiazole have been designed and synthesized. The TPA-benzimidazole chemosensor was tested for a number of metal ions and found to exhibit binding affinity for Fe 3+ and Hg 2+ in acetonitrile, and the fluorescence quenching was achieved through a PET process. The appearance of an isosbestic point in absorption titrations and Job's plot analysis supported 1:1 stoichiometries for Fe 3+ and Hg 2+ ions. Laser experiments showed that under transversal pumping with a Q-switched Nd:YAG (355 nm) laser in toluene, TPA-benzothiazole exhibits efficient and stable amplified spontaneous emissions (ASE) at 436 nm. -- Highlights: • Triphenylamine based fluorescent dyes TPA-benzimidazole and TPA-benzothiazole have been designed and synthesized. • The TPA-benzimidazole exhibits binding affinity for Fe 3+ and Hg 2+ in acetonitrile and the fluorescence quenching was achieved through a PET process. • Under transversal pumping at 355 nm in toluene, TPA-benzothiazole exhibits efficient and stable amplified spontaneous emissions (ASE) in 436 nm

Molecular cloning and mammalian expression of human beta 2-glycoprotein I cDNA

DEFF Research Database (Denmark)

Kristensen, Torsten; Schousboe, Inger; Boel, Espen

1991-01-01

Human β2-glycoprotein (β2gpI) cDNA was isolated from a liver cDNA library and sequenced. The cDNA encoded a 19-residue hydrophobic signal peptide followed by the mature β2gpI of 326 amino acid residues. In liver and in the hepatoma cell line HepG2 there are two mRNA species of about 1.4 and 4.3 kb......, respectively, hybridizing specifically with the β2gpI cDNA. Upon isoelectric focusing, recombinant β2gpI obtained from expression of β2gpI cDNA in baby hamster kidney cells showed the same pattern of bands as β2gpI isolated from plasma, and at least 5 polypeptides were visible...

Use of inter-simple sequence repeats and amplified fragment length polymorphisms to analyze genetic relationships among small grain-infecting species of ustilago.

Science.gov (United States)

Menzies, J G; Bakkeren, G; Matheson, F; Procunier, J D; Woods, S

2003-02-01

ABSTRACT In the smut fungi, few features are available for use as taxonomic criteria (spore size, shape, morphology, germination type, and host range). DNA-based molecular techniques are useful in expanding the traits considered in determining relationships among these fungi. We examined the phylogenetic relationships among seven species of Ustilago (U. avenae, U. bullata, U. hordei, U. kolleri, U. nigra, U. nuda, and U. tritici) using inter-simple sequence repeats (ISSRs) and amplified fragment length polymorphisms (AFLPs) to compare their DNA profiles. Fifty-four isolates of different Ustilago spp. were analyzed using ISSR primers, and 16 isolates of Ustilago were studied using AFLP primers. The variability among isolates within species was low for all species except U. bullata. The isolates of U. bullata, U. nuda, and U. tritici were well separated and our data supports their speciation. U. avenae and U. kolleri isolates did not separate from each other and there was little variability between these species. U. hordei and U. nigra isolates also showed little variability between species, but the isolates from each species grouped together. Our data suggest that U. avenae and U. kolleri are monophyletic and should be considered one species, as should U. hordei and U. nigra.

cDNA and deduced primary structure of basic phospholipase A2 with neurotoxic activity from the venom secretion of the Crotalus durissus collilineatus rattlesnake

Directory of Open Access Journals (Sweden)

F.H.R. Fagundes

2010-03-01

Full Text Available To illustrate the construction of precursor complementary DNAs, we isolated mRNAs from whole venom samples. After reverse transcription polymerase chain reaction (RT-PCR, we amplified the cDNA coding for a neurotoxic protein, phospholipase A2 D49 (PLA2 D49, from the venom of Crotalus durissus collilineatus (Cdc PLA2. The cDNA encoding Cdc PLA2 from whole venom was sequenced. The deduced amino acid sequence of this cDNA has high overall sequence identity with the group II PLA2 protein family. Cdc PLA2 has 14 cysteine residues capable of forming seven disulfide bonds that characterize this group of PLA2 enzymes. Cdc PLA2 was isolated using conventional Sephadex G75 column chromatography and reverse-phase high performance liquid chromatography (RP-HPLC. The molecular mass was estimated using matrix-assisted laser desorption ionization-time-of-flight (MALDI-TOF mass spectrometry. We tested the neuromuscular blocking activities on chick biventer cervicis neuromuscular tissue. Phylogenetic analysis of Cdc PLA2 showed the existence of two lines of N6-PLA2, denominated F24 and S24. Apparently, the sequences of the New World’s N6-F24-PLA2 are similar to those of the agkistrodotoxin from the Asian genus Gloydius. The sequences of N6-S24-PLA2 are similar to the sequence of trimucrotoxin from the genus Protobothrops, found in the Old World.

The effects of radiation on p53-mutated glioma cells using cDNA microarray technique

International Nuclear Information System (INIS)

Ngo, F.Q.H.; Hsiao, Y.-Y.H.

2003-01-01

Full text: In this study, we investigated the effects of 10-Gy irradiation on cell-cycle arrest, apoptosis and clonogenic death in the p53-mutated human U138MG (malignant glioblastoma) cell line. In order to evaluate time-dependent events in cellular responses to radiation, we did a time course study by incubating cells ranging from 0.5 to 48 hours after irradiation. Cell-cycle distribution and apoptosis were evaluated by flow cytometry using propidium iodide (PI) and annexin-V plus PI staining. Cell viability and proliferative capacity were studied by colony formation assay. Dual fluorescence cDNA microarray technique was used to examine the differential expression patterns of the irradiated cells. The cDNA microarray chips used contained DNA sequences corresponding to 12,814 human genes. From the flow cytometry data, it can be observed that radiation induced G2/M phase arrest and that late apoptosis was more evident following G2/M arrest. After 36 hours, some cells underwent senescence and the remains continued on with the cell cycle. Microarray analyses revealed changes in the expression of a small number of cell-cycle-related genes (p21, cyclin B1, etc.) and cell-death genes (tumor necrosis factors, DDB2, etc.) suggesting their involvement in radiation-induced cell-cycle arrest and apoptosis. In silico interpretations of the molecular mechanisms responsible for these radiation effects are in progress

Clone and expression of human transferrin receptor gene: a marker gene for magnetic resonance imaging

International Nuclear Information System (INIS)

Li Li; Liu Lizhi; Lv Yanchun; Liu Xuewen; Cui Chunyan; Wu Peihong; Liu Qicai; Ou Shanxing

2007-01-01

Objective: To clone human transferrin receptor (hTfR) gene and construct expression vector producing recombination protein. Methods: Human transferrin receptor gene cDNA was amplified by RT-PCR from human embryonic liver and lung tissue. Recombinant pcDNA3-hTfR and pEGFP-Cl-hTfR plasmids were constructed and confirmed by DNA sequencing. These plasmids were stably transfected into the HEK293 cells. The protein expression in vitro was confirmed by Western Blot. The efficiency of expression and the location of hTfR were also investigated by fluorescence microscopy and confocal fluorescence microscopy. Results: The full length cDNA of hTfR gene (2332 bp) was cloned and sequenced. The hTfR (190 000) was overexpressed in transfected HEK293 cells by Western blot analysis. Fluorescence micrographs displayed that the hTfR was expressed at high level and located predominantly in the cell surface. Conclusions: Human transferrin receptor (hTfR) gene has been successfully cloned and obtained high-level expression in HEK293 cells, and the recombination protein of hTfR distributed predominantly in the cell membrane. (authors)

Electron Detachment Dissociation (EDD) of Fluorescently Labeled Sialylated Oligosaccharides

Science.gov (United States)

Zhou, Wen; Håkansson, Kristina

2012-01-01

We explored the application of electron detachment dissociation (EDD) and infrared multiphoton dissociation (IRMPD) tandem mass spectrometry to fluorescently labeled sialylated oligosaccharides. Standard sialylated oligosaccharides and a sialylated N-linked glycan released from human transferrin were investigated. EDD yielded extensive glycosidic cleavages and cross-ring cleavages in all cases studied, consistently providing complementary structural information compared to IRMPD. Neutral losses and satellite ions such as C – 2H ions were also observed following EDD. In addition, we examined the influence of different fluorescent labels. The acidic label 2-aminobenzoic acid (2-AA) enhanced signal abundance in negative-ion mode. However, few cross-ring fragments were observed for 2-AA labeled oligosaccharides. The neutral label 2-aminobenzamide (2-AB) resulted in more cross-ring cleavages compared to 2-AA labeled species, but not as extensive fragmentation as for native oligosaccharides, likely resulting from altered negative charge locations from introduction of the fluorescent tag. PMID:22120881

Recombinogenic engineering of conjugative plasmids with fluorescent marker cassettes

DEFF Research Database (Denmark)

Reisner, A.; Molin, Søren; Zechner, E.L.

2002-01-01

An efficient approach for the insertion of fluorescent marker genes with sequence specificity into conjugative plasmids in Escherichia coli is described. For this purpose, homologous recombination of linear double-stranded targeting DNA was mediated by the bacteriophage lambda recombination...... resistance genes and fluorescent markers. The choice of 5' non-homologous extensions in primer pairs used for amplifying the marker cassettes determines the site specificity of the targeting DNA. This methodology is applicable to the modification of all plasmids that replicate in E coli and is not restricted...

Cloning, sequencing, and expression of cDNA for human β-glucuronidase

International Nuclear Information System (INIS)

Oshima, A.; Kyle, J.W.; Miller, R.D.

1987-01-01

The authors report here the cDNA sequence for human placental β-glucuronidase (β-D-glucuronoside glucuronosohydrolase, EC 3.2.1.31) and demonstrate expression of the human enzyme in transfected COS cells. They also sequenced a partial cDNA clone from human fibroblasts that contained a 153-base-pair deletion within the coding sequence and found a second type of cDNA clone from placenta that contained the same deletion. Nuclease S1 mapping studies demonstrated two types of mRNAs in human placenta that corresponded to the two types of cDNA clones isolated. The NH 2 -terminal amino acid sequence determined for human spleen β-glucuronidase agreed with that inferred from the DNA sequence of the two placental clones, beginning at amino acid 23, suggesting a cleaved signal sequence of 22 amino acids. When transfected into COS cells, plasmids containing either placental clone expressed an immunoprecipitable protein that contained N-linked oligosaccharides as evidenced by sensitivity to endoglycosidase F. However, only transfection with the clone containing the 153-base-pair segment led to expression of human β-glucuronidase activity. These studies provide the sequence for the full-length cDNA for human β-glucuronidase, demonstrate the existence of two populations of mRNA for β-glucuronidase in human placenta, only one of which specifies a catalytically active enzyme, and illustrate the importance of expression studies in verifying that a cDNA is functionally full-length

Restriction fragment length polymorphism of the major histocompatibility complex of the dog.

Science.gov (United States)

Sarmiento, U M; Storb, R F

1988-01-01

Human major histocompatibility complex (HLA) cDNA probes were used to analyze the restriction fragment length polymorphism (RFLP) of the DLA-D region in dogs. Genomic DNA from peripheral blood leucocytes of 23 unrelated DLA-D-homozygous dogs representing nine DLA-D types (defined by mixed leucocyte reaction) was digested with restriction enzymes (Bam HI, Eco RI, Hind III, Pvu II, Taq I, Rsa I, Msp I, Pst I, and Bgl II), separated by agarose gel electrophoresis, and transferred onto Biotrace membrane. The Southern blots were successively hybridized with radiolabeled HLA cDNA probes corresponding to DR, DQ, DP, and DO beta genes. The autoradiograms for all nine enzyme digests displayed multiple bands with the DRb, DQb, and DPb probes while the DOb probe hybridized with one to two bands. The RFLP patterns were highly polymorphic but consistent within each DLA-D type. Standard RFLP patterns were established for nine DLA-D types which could be discriminated from each other by using two enzymes (Rsa I and Pst I) and the HLA-DPb probe. Cluster analysis of the polymorphic restriction fragments detected by the DRb probe revealed four closely related supertypic groups or DLA-DR families: Dw3 + Dw4 + D1, Dw8 + D10, D7 + D16 + D9, and Dw1. This study provides the basis for DLA-D genotyping at a population level by RFLP analysis. These results also suggest that the genetic organization of the DLA-D region may closely resemble that of the HLA complex.

Quantification of apoptotic DNA fragmentation in a transformed uterine epithelial cell line, HRE-H9, using capillary electrophoresis with laser-induced fluorescence detector (CE-LIF).

Science.gov (United States)

Fiscus, R R; Leung, C P; Yuen, J P; Chan, H C

2001-01-01

Apoptotic cell death of uterine epithelial cells is thought to play an important role in the onset of menstruation and the successful implantation of an embryo during early pregnancy. Abnormal apoptosis in these cells can result in dysmenorrhoea and infertility. In addition, decreased rate of epithelial apoptosis likely contributes to endometriosis. A key step in the onset of apoptosis in these cells is cleavage of the genomic DNA between nucleosomes, resulting in polynucleosomal-sized fragments of DNA. The conventional technique for assessing apoptotic DNA fragmentation uses agarose (slab) gel electrophoresis (i.e. DNA laddering). However, recent technological advances in the use of capillary electrophoresis (CE), particularly the introduction of the laser-induced fluorescence detector (LIF), has made it possible to perform DNA laddering with improved automation and much greater sensitivity. In the present study, we have further developed the CE-LIF technique by using a DNA standard curve to quantify accurately the amount of DNA in the apoptotic DNA fragments and have applied this new quantitative technique to study apoptosis in a transformed uterine epithelial cell line, the HRE-H9 cells. Apoptosis was induced in the HRE-H9 cells by serum deprivation for 5, 7 and 24 h, resulting in increased DNA fragmentation of 2.2-, 3.1- and 6.2-fold, respectively, above the 0 h or plus-serum controls. This ultrasensitive CE-LIF technique provides a novel method for accurately measuring the actions of pro- or anti-apoptotic agents or conditions on uterine epithelial cell lines. Copyright 2001 Academic Press.

Genome-Wide Single-Nucleotide Polymorphisms Discovery and High-Density Genetic Map Construction in Cauliflower Using Specific-Locus Amplified Fragment Sequencing

Science.gov (United States)

Zhao, Zhenqing; Gu, Honghui; Sheng, Xiaoguang; Yu, Huifang; Wang, Jiansheng; Huang, Long; Wang, Dan

2016-01-01

Molecular markers and genetic maps play an important role in plant genomics and breeding studies. Cauliflower is an important and distinctive vegetable; however, very few molecular resources have been reported for this species. In this study, a novel, specific-locus amplified fragment (SLAF) sequencing strategy was employed for large-scale single nucleotide polymorphism (SNP) discovery and high-density genetic map construction in a double-haploid, segregating population of cauliflower. A total of 12.47 Gb raw data containing 77.92 M pair-end reads were obtained after processing and 6815 polymorphic SLAFs between the two parents were detected. The average sequencing depths reached 52.66-fold for the female parent and 49.35-fold for the male parent. Subsequently, these polymorphic SLAFs were used to genotype the population and further filtered based on several criteria to construct a genetic linkage map of cauliflower. Finally, 1776 high-quality SLAF markers, including 2741 SNPs, constituted the linkage map with average data integrity of 95.68%. The final map spanned a total genetic length of 890.01 cM with an average marker interval of 0.50 cM, and covered 364.9 Mb of the reference genome. The markers and genetic map developed in this study could provide an important foundation not only for comparative genomics studies within Brassica oleracea species but also for quantitative trait loci identification and molecular breeding of cauliflower. PMID:27047515

5'-end sequences of budding yeast full-length cDNA clones and quality scores - Budding yeast cDNA sequencing project | LSDB Archive [Life Science Database Archive metadata

Lifescience Database Archive (English)

Full Text Available east_seq_qual.zip File URL: ftp://ftp.biosciencedbc.jp/archive/yeast_cdna/LATEST/...yeast_seq_qual.zip File size: 59.9MB Simple search URL http://togodb.biosciencedbc.jp/togodb/view/budding_yeast_cdna

Cloning of cDNA encoding steroid 11β-hydroxylase (P450c11)

International Nuclear Information System (INIS)

Chua, S.C.; Szabo, P.; Vitek, A.; Grzeschik, K.H.; John, M.; White, P.C.

1987-01-01

The authors have isolated bovine and human adrenal cDNA clones encoding the adrenal cytochrome P-450 specific for 11β-hydroxylation (P450c11). A bovine adrenal cDNA library constructed in the bacteriophage λ vector gt10 was probed with a previously isolated cDNA clone corresponding to part of the 3' untranslated region of the 4.2-kilobase (kb) mRNA encoding P450c11. Several clones with 3.2-kb cDNA inserts were isolated. Sequence analysis showed that they overlapped the original probe by 300 base pairs (bp). Combined cDNA and RNA sequence data demonstrated a continuous open reading frame of 1509 bases. P450c11 is predicted to contain 479 amino acid residues in the mature protein in addition to a 24-residue amino-terminal mitochondrial signal sequence. A bovine clone was used to isolate a homologous clone with a 3.5-kb insert from a human adrenal cDNA library. A region of 1100 bp was 81% homologous to 769 bp of the coding sequence of the bovine cDNA except for a 400-bp segment presumed to be an unprocessed intron. Hybridization of the human cDNA to DNA from a panel of human-rodent somatic cell hybrid lines and in situ hybridization to metaphase spreads of human chromosomes localized the gene to the middle of the long arm of chromosome 8. These data should be useful in developing reagents for heterozygote detection and prenatal diagnosis of 11β-hydroxylase deficiency, the second most frequent cause of congenital adrenal hyperplasia

Isolation and characterization of cDNA encoding the 80-kDa subunit protein of the human autoantigen Ku (p70/p80) recognized by autoantibodies from patients with scleroderma-polymyositis overlap syndrome

International Nuclear Information System (INIS)

Mimori, Tsuneyo; Ohosone, Yasuo; Hama, Nobuaki; Suwa, Akira; Akizuki, Masashi; Homma, Mitsuo; Griffith, A.J.; Hardin, J.A.

1990-01-01

Anti-Ku (p70/p80) autoantibodies in patients with scleroderma-polymyositis overlap syndrome recognize a 70-kDa/80-kDa protein heterodimer which binds to terminal regions of double-stranded DNA. In the present study, the authors isolated full-length cDNAs that encode the 80-kDa Ku subunit. Initial screening of a human spleen cDNA library with anti-Ku antibodies yielded a cDNA of 1.0 kilobase (kb) (termed K71) encoding a portion of the 80-kDa Ku polypeptide (identification based on immunological criteria). In RNA blots, this cDNA hybridized with two mRNAs of 3.4 and 2.6 kb. In vitro transcription and translation experiments produced an immunoprecipitable polypeptide which comigrated with the 80-kDa Ku subunit. The Ku80-6 cDNA proved to be 3304 nucleotides in length, with an additional poly(A) tail, closely approximating the size of the larger mRNA. It contains a single long open reading frame encoding 732 amino acids. The putative polypeptide has a high content of acidic amino acids and a region with periodic repeat of leucine in every seventh position which may form the leucine zipper structure. In genomic DNA blots, probes derived from the opposite ends of cDNA Ku80-6 hybridized with several nonoverlapping restriction fragments from human leukocyte DNA, indicating that the gene encoding the 80-kDa Ku polypeptide is divided into several exons by intervening sequences

Auto-Zero Differential Amplifier

Science.gov (United States)

Quilligan, Gerard T. (Inventor); Aslam, Shahid (Inventor)

2017-01-01

An autozero amplifier may include a window comparator network to monitor an output offset of a differential amplifier. The autozero amplifier may also include an integrator to receive a signal from a latched window comparator network, and send an adjustment signal back to the differential amplifier to reduce an offset of the differential amplifier.

Cloning and expression of cDNA coding for bouganin.

Science.gov (United States)

den Hartog, Marcel T; Lubelli, Chiara; Boon, Louis; Heerkens, Sijmie; Ortiz Buijsse, Antonio P; de Boer, Mark; Stirpe, Fiorenzo

2002-03-01

Bouganin is a ribosome-inactivating protein that recently was isolated from Bougainvillea spectabilis Willd. In this work, the cloning and expression of the cDNA encoding for bouganin is described. From the cDNA, the amino-acid sequence was deduced, which correlated with the primary sequence data obtained by amino-acid sequencing on the native protein. Bouganin is synthesized as a pro-peptide consisting of 305 amino acids, the first 26 of which act as a leader signal while the 29 C-terminal amino acids are cleaved during processing of the molecule. The mature protein consists of 250 amino acids. Using the cDNA sequence encoding the mature protein of 250 amino acids, a recombinant protein was expressed, purified and characterized. The recombinant molecule had similar activity in a cell-free protein synthesis assay and had comparable toxicity on living cells as compared to the isolated native bouganin.

LEDGF/p75 Deficiency Increases Deletions at the HIV-1 cDNA Ends.

Science.gov (United States)

Bueno, Murilo T D; Reyes, Daniel; Llano, Manuel

2017-09-15

Processing of unintegrated linear HIV-1 cDNA by the host DNA repair system results in its degradation and/or circularization. As a consequence, deficient viral cDNA integration generally leads to an increase in the levels of HIV-1 cDNA circles containing one or two long terminal repeats (LTRs). Intriguingly, impaired HIV-1 integration in LEDGF/p75-deficient cells does not result in a correspondent increase in viral cDNA circles. We postulate that increased degradation of unintegrated linear viral cDNA in cells lacking the lens epithelium-derived growth factor (LEDGF/p75) account for this inconsistency. To evaluate this hypothesis, we characterized the nucleotide sequence spanning 2-LTR junctions isolated from LEDGF/p75-deficient and control cells. LEDGF/p75 deficiency resulted in a significant increase in the frequency of 2-LTRs harboring large deletions. Of note, these deletions were dependent on the 3' processing activity of integrase and were not originated by aberrant reverse transcription. Our findings suggest a novel role of LEDGF/p75 in protecting the unintegrated 3' processed linear HIV-1 cDNA from exonucleolytic degradation.

Construction of Infectious cDNA Clone of a Chrysanthemum stunt viroid Korean Isolate

Directory of Open Access Journals (Sweden)

Ju-Yeon Yoon

2014-03-01

Full Text Available Chrysanthemum stunt viroid (CSVd, a noncoding infectious RNA molecule, causes seriously economic losses of chrysanthemum for 3 or 4 years after its first infection. Monomeric cDNA clones of CSVd isolate SK1 (CSVd-SK1 were constructed in the plasmids pGEM-T easy vector and pUC19 vector. Linear positive-sense transcripts synthesized in vitro from the full-length monomeric cDNA clones of CSVd-SK1 could infect systemically tomato seedlings and chrysanthemum plants, suggesting that the linear CSVd RNA transcribed from the cDNA clones could be replicated as efficiently as circular CSVd in host species. However, direct inoculation of plasmid cDNA clones containing full-length monomeric cDNA of CSVd-SK1 failed to infect tomato and chrysanthemum and linear negative-sense transcripts from the plasmid DNAs were not infectious in the two plant species. The cDNA sequences of progeny viroid in systemically infected tomato and chrysanthemum showed a few substitutions at a specific nucleotide position, but there were no deletions and insertions in the sequences of the CSVd progeny from tomato and chrysanthemum plants.

Theoretical Investigation of Oxazine 170 Perchlorate Doped Polymeric Optical Fiber Amplifier

Directory of Open Access Journals (Sweden)

Piotr Miluski

2017-01-01

Full Text Available Optical signal amplification in the waveguiding structure of optical fibers can be used for optical telecommunication systems and new light sources constructions. Organic dyes doped materials are interesting for new applications in polymeric optical fibers technology due to their benefits (efficient fluorescence, high absorption cross section, and easy processing. This article presents a numerical simulation of gain in poly(methyl methacrylate optical fiber doped by Oxazine 170 Perchlorate. The calculated gain characteristic for the used dye molar concentration (0.2·10-6–1.4·10-6 and pump power (1–10 kW is presented. The fabricated fluorescent polymeric optical fiber is also shown. The presented analysis can be used for optical amplifier construction based on dye-doped polymeric optical fiber (POF.

Portable musical instrument amplifier

Science.gov (United States)

Christian, David E.

1990-07-24

The present invention relates to a musical instrument amplifier which is particularly useful for electric guitars. The amplifier has a rigid body for housing both the electronic system for amplifying and processing signals from the guitar and the system's power supply. An input plug connected to and projecting from the body is electrically coupled to the signal amplifying and processing system. When the plug is inserted into an output jack for an electric guitar, the body is rigidly carried by the guitar, and the guitar is operatively connected to the electrical amplifying and signal processing system without use of a loose interconnection cable. The amplifier is provided with an output jack, into which headphones are plugged to receive amplified signals from the guitar. By eliminating the conventional interconnection cable, the amplifier of the present invention can be used by musicians with increased flexibility and greater freedom of movement.

Construction of an SNP-based high-density linkage map for flax (Linum usitatissimum L.) using specific length amplified fragment sequencing (SLAF-seq) technology.

Science.gov (United States)

Yi, Liuxi; Gao, Fengyun; Siqin, Bateer; Zhou, Yu; Li, Qiang; Zhao, Xiaoqing; Jia, Xiaoyun; Zhang, Hui

2017-01-01

Flax is an important crop for oil and fiber, however, no high-density genetic maps have been reported for this species. Specific length amplified fragment sequencing (SLAF-seq) is a high-resolution strategy for large scale de novo discovery and genotyping of single nucleotide polymorphisms. In this study, SLAF-seq was employed to develop SNP markers in an F2 population to construct a high-density genetic map for flax. In total, 196.29 million paired-end reads were obtained. The average sequencing depth was 25.08 in male parent, 32.17 in the female parent, and 9.64 in each F2 progeny. In total, 389,288 polymorphic SLAFs were detected, from which 260,380 polymorphic SNPs were developed. After filtering, 4,638 SNPs were found suitable for genetic map construction. The final genetic map included 4,145 SNP markers on 15 linkage groups and was 2,632.94 cM in length, with an average distance of 0.64 cM between adjacent markers. To our knowledge, this map is the densest SNP-based genetic map for flax. The SNP markers and genetic map reported in here will serve as a foundation for the fine mapping of quantitative trait loci (QTLs), map-based gene cloning and marker assisted selection (MAS) for flax.

Nucleotide sequence of cloned cDNA for human sphingolipid activator protein 1 precursor

International Nuclear Information System (INIS)

Dewji, N.N.; Wenger, D.A.; O'Brien, J.S.

1987-01-01

Two cDNA clones encoding prepro-sphingolipid activator protein 1 (SAP-1) were isolated from a λ gt11 human hepatoma expression library using polyclonal antibodies. These had inserts of ≅ 2 kilobases (λ-S-1.2 and λ-S-1.3) and both were both homologous with a previously isolated clone (λ-S-1.1) for mature SAP-1. The authors report here the nucleotide sequence of the longer two EcoRI fragments of S-1.2 and S-1.3 that were not the same and the derived amino acid sequences of mature SAP-1 and its prepro form. The open reading frame encodes 19 amino acids, which are colinear with the amino-terminal sequence of mature SAP-1, and extends far beyond the predicted carboxyl terminus of mature SAP-1, indicating extensive carboxyl-terminal processing. The nucleotide sequence of cDNA encoding prepro-SAP-1 includes 1449 bases from the assigned initiation codon ATG at base-pair 472 to the stop codon TGA at base-pair 1921. The first 23 amino acids coded after the initiation ATG are characteristic of a signal peptide. The calculated molecular mass for a polypeptide encoded by 1449 bases is ≅ 53 kDa, in keeping with the reported value for pro-SAP-1. The data indicate that after removal of the signal peptide mature SAP-1 is generated by removing an additional 7 amino acids from the amino terminus and ≅ 373 amino acids from the carboxyl terminus. One potential glycosylation site was previously found in mature SAP-1. Three additional potential glycosylation sites are present in the processed carboxyl-terminal polypeptide, which they designate as P-2

3G vector-primer plasmid for constructing full-length-enriched cDNA libraries.

Science.gov (United States)

Zheng, Dong; Zhou, Yanna; Zhang, Zidong; Li, Zaiyu; Liu, Xuedong

2008-09-01

We designed a 3G vector-primer plasmid for the generation of full-length-enriched complementary DNA (cDNA) libraries. By employing the terminal transferase activity of reverse transcriptase and the modified strand replacement method, this plasmid (assembled with a polydT end and a deoxyguanosine [dG] end) combines priming full-length cDNA strand synthesis and directional cDNA cloning. As a result, the number of steps involved in cDNA library preparation is decreased while simplifying downstream gene manipulation, sequencing, and subcloning. The 3G vector-primer plasmid method yields fully represented plasmid primed libraries that are equivalent to those made by the SMART (switching mechanism at 5' end of RNA transcript) approach.

Purification of Single-Stranded cDNA Based on RNA Degradation Treatment and Adsorption Chromatography.

Science.gov (United States)

Trujillo-Esquivel, Elías; Franco, Bernardo; Flores-Martínez, Alberto; Ponce-Noyola, Patricia; Mora-Montes, Héctor M

2016-08-02

Analysis of gene expression is a common research tool to study networks controlling gene expression, the role of genes with unknown function, and environmentally induced responses of organisms. Most of the analytical tools used to analyze gene expression rely on accurate cDNA synthesis and quantification to obtain reproducible and quantifiable results. Thus far, most commercial kits for isolation and purification of cDNA target double-stranded molecules, which do not accurately represent the abundance of transcripts. In the present report, we provide a simple and fast method to purify single-stranded cDNA, exhibiting high purity and yield. This method is based on the treatment with RNase H and RNase A after cDNA synthesis, followed by separation in silica spin-columns and ethanol precipitation. In addition, our method avoids the use of DNase I to eliminate genomic DNA from RNA preparations, which improves cDNA yield. As a case report, our method proved to be useful in the purification of single-stranded cDNA from the pathogenic fungus Sporothrix schenckii.

Application of amplified fragment length polymorphism fingerprinting for taxonomy and identification of the soft rot bacteria Erwinia carotovora and Erwinia chrysanthemi.

Science.gov (United States)

Avrova, Anna O; Hyman, Lizbeth J; Toth, Rachel L; Toth, Ian K

2002-04-01

The soft rot bacteria Erwinia carotovora and Erwinia chrysanthemi are important pathogens of potato and other crops. However, the taxonomy of these pathogens, particularly at subspecies level, is unclear. An investigation using amplified fragment length polymorphism (AFLP) fingerprinting was undertaken to determine the taxonomic relationships within this group based on their genetic relatedness. Following cluster analysis on the similarity matrices derived from the AFLP gels, four clusters (clusters 1 to 4) resulted. Cluster 1 contained Erwinia carotovora subsp. carotovora (subclusters 1a and 1b) and Erwinia carotovora subsp. odorifera (subcluster 1c) strains, while cluster 2 contained Erwinia carotovora subsp. atroseptica (subcluster 2a) and Erwinia carotovora subsp. betavasculorum (subcluster 2b) strains. Clusters 3 and 4 contained Erwinia carotovora subsp. wasabiae and E. chrysanthemi strains, respectively. While E. carotovora subsp. carotovora and E. chrysanthemi showed a high level of molecular diversity (23 to 38% mean similarity), E. carotovora subsp. odorifera, E. carotovora subsp. betavasculorum, E. carotovora subsp. atroseptica, and E. carotovora subsp. wasabiae showed considerably less (56 to 76% mean similarity), which may reflect their limited geographical distributions and/or host ranges. The species- and subspecies-specific banding profiles generated from the AFLPs allowed rapid identification of unknown isolates and the potential for future development of diagnostics. AFLP fingerprinting was also found to be more differentiating than other techniques for typing the soft rot erwinias and was applicable to all strain types, including different serogroups.

Operation Amplifier

NARCIS (Netherlands)

Tetsuya, Saito; Nauta, Bram

2011-01-01

PROBLEM TO BE SOLVED: To provide an operation amplifier which improves power source voltage removal ratios while assuring phase compensation characteristics, and therefore can be realized with a small-scale circuit and low power consumption. SOLUTION: The operation amplifier comprises: a

Operation Amplifier

NARCIS (Netherlands)

Tetsuya, S.; Nauta, Bram

2007-01-01

PROBLEM TO BE SOLVED: To provide an operation amplifier which improves power source voltage removal ratios while assuring phase compensation characteristics, and therefore can be realized with a small-scale circuit and low power consumption. ; SOLUTION: The operation amplifier comprises: a

CDNA encoding a polypeptide including a hevein sequence

Science.gov (United States)

Raikhel, Natasha V.; Broekaert, Willem F.; Chua, Nam-Hai; Kush, Anil

1995-03-21

A cDNA clone (HEV1) encoding hevein was isolated via polymerase chain reaction (PCR) using mixed oligonucleotides corresponding to two regions of hevein as primers and a Hevea brasiliensis latex cDNA library as a template. HEV1 is 1018 nucleotides long and includes an open reading frame of 204 amino acids. The deduced amino acid sequence contains a putative signal sequence of 17 amino acid residues followed by a 187 amino acid polypeptide. The amino-terminal region (43 amino acids) is identical to hevein and shows homology to several chitin-binding proteins and to the amino-termini of wound-induced genes in potato and poplar. The carboxyl-terminal portion of the polypeptide (144 amino acids) is 74-79% homologous to the carboxyl-terminal region of wound-inducible genes of potato. Wounding, as well as application of the plant hormones abscisic acid and ethylene, resulted in accumulation of hevein transcripts in leaves, stems and latex, but not in roots, as shown by using the cDNA as a probe. A fusion protein was produced in E. coli from the protein of the present invention and maltose binding protein produced by the E. coli.

GFP expression by intracellular gene delivery of GFP-coding fragments using nanocrystal quantum dots

International Nuclear Information System (INIS)

Hoshino, Akiyoshi; Manabe, Noriyoshi; Fujioka, Kouki; Hanada, Sanshiro; Yamamoto, Kenji; Yasuhara, Masato; Kondo, Akihiko

2008-01-01

Gene therapy is an attractive approach to supplement a deficient gene function. Although there has been some success with specific gene delivery using various methods including viral vectors and liposomes, most of these methods have a limited efficiency or also carry a risk for oncogenesis. We herein report that quantum dots (QDs) conjugated with nuclear localizing signal peptides (NLSP) successfully introduced gene-fragments with promoter elements, which promoted the expression of the enhanced green fluorescent protein (eGFP) gene in mammalian cells. The expression of eGFP protein was observed when the QD/gene-construct was added to the culture media. The gene-expression efficiency varied depending on multiple factors around QDs, such as (1) the reading direction of the gene-fragments, (2) the quantity of gene-fragments attached on the surface of the QD-constructs, (3) the surface electronic charges varied according to the structure of the QD/gene-constructs, and (4) the particle size of QD/gene complex varied according to the structure and amounts of gene-fragments. Using this QD/gene-construct system, eGFP protein could be detected 28 days after the gene-introduction whereas the fluorescence of QDs had disappeared. This system therefore provides another method for the intracellular delivery of gene-fragments without using either viral vectors or specific liposomes.

A High-Performance Fluorescence Immunoassay Based on the Relaxation of Quenching, Exemplified by Detection of Cardiac Troponin I

Directory of Open Access Journals (Sweden)

Seung-Wan Kim

2016-05-01

Full Text Available The intramolecular fluorescence self-quenching phenomenon is a major drawback in developing high-performance fluorometric biosensors which use common fluorophores as signal generators. We propose two strategies involving liberation of the fluorescent molecules by means of enzymatic fragmentation of protein or dehybridization of double-stranded DNA. In the former, bovine serum albumin (BSA was coupled with the fluorescent BODIPY dye (Red BSA, and then immobilized on a solid surface. When the insolubilized Red BSA was treated with proteinase K (10 units/mL for 30 min, the fluorescent signal was significantly increased (3.5-fold compared to the untreated control. In the second case, fluorophore-tagged DNA probes were linked to gold nanoparticles by hybridization with capture DNA strands densely immobilized on the surface. The quenched fluorescence signal was recovered (3.7-fold by thermal dehybridization, which was induced with light of a specific wavelength (e.g., 530 nm for less than 1 min. We next applied the Red BSA self-quenching relaxation technique employing enzymatic fragmentation to a high-performance immunoassay of cardiac troponin I (cTnI in a microtiter plate format. The detection limit was 0.19 ng/mL cTnI, and the fluorescent signal was enhanced approximately 4.1-fold compared with the conventional method of direct measurement of the fluorescent signal from a non-fragmented fluorophore-labeled antibody.

Selective disulfide reduction for labeling and enhancement of Fab antibody fragments

International Nuclear Information System (INIS)

Kirley, Terence L.; Greis, Kenneth D.; Norman, Andrew B.

2016-01-01

Many methods have been developed for chemical labeling and enhancement of the properties of antibodies and their common fragments, including the Fab and F(ab’) 2 fragments. Somewhat selective reduction of some antibody disulfide bonds has been previously achieved, yielding antibodies and antibody fragments that can be labeled at defined sites, enhancing their utility and properties. Selective reduction of the two hinge disulfide bonds present in F(ab’) 2 fragments using mild reduction has been useful. However, such reduction is often not quantitative and results in the reduction of multiple disulfide bonds, and therefore subsequent multiple labeling or conjugation sites are neither homogenous nor stoichiometric. Here, a simple and efficient selective reduction of the single disulfide bond linking the partial heavy chain and the intact light chain which compose the Fab fragment is accomplished utilizing tris(2-carboxyethyl)phosphine (TCEP) immobilized on agarose beads. The resultant reduced cysteine residues were labeled with several cysteine-selective fluorescent reagents, as well as by cysteine-directed PEGylation. These two cysteine residues can also be re-ligated by means of a bifunctional cysteine cross-linking agent, dibromobimane, thereby both restoring a covalent linkage between the heavy and light chains at this site, far removed from the antigen binding site, and also introducing a fluorescent probe. There are many other research and clinical uses for these selectively partially reduced Fab fragments, including biotinylation, toxin and drug conjugation, and incorporation of radioisotopes, and this technique enables simple generation of very useful Fab fragment derivatives with many potential applications. - Highlights: • TCEP agarose is effective for selective reduction of a single Fab disulfide bond. • This disulfide is solvent accessible and distant from the antigen binding site. • A variety of buffers of varying pHs can be used, simplifying

Construction of full-length cDNA library of white flower Salvia ...

African Journals Online (AJOL)

In order to screen and isolate secondary metabolite biosynthesis related gene, we construct a cDNA library of white flower Salvia miltiorrhiza bge. f.alba. High quality of total RNA was successfully isolated from roots of white flower S. miltiorrhiza using modified CTAB method. Double strand cDNA was cloned into pDNR-LIB ...

Molecular cloning of a cDNA and chromosomal localization of a human theta-class glutathione S-transferase gene (GSTT2) to chromosome 22

Energy Technology Data Exchange (ETDEWEB)

Tan, K.L.; Baker, R.T.; Board, P.G. [Australian National Univ., Canberra (Australia)] [and others

1995-01-20

Until recently the Theta-class glutathione S-transferases (GSTs) were largely overlooked due to their low activity with the model substrate 1-chloro-2,4-dinitrobenzene (CDNB) and their failure to bind to immobilized glutathione affinity matrices. Little is known about the number of genes in this class. Recently, Pemble et al. reported the cDNA cloning of a human Theta-class GST, termed GSTT1. In this study, we describe the molecular cloning of a cDNA encoding a second human Theta-class GST (GSTT2) from a {lambda}gt11 human liver 5{prime}-stretch cDNA library. The encoded protein contains 244 amino acids and has 78.3% sequence identity with the rat subunit 12 and only 55.0% identity with human GSTT1. GSTT2 has been mapped to chromosome 22 by somatic cell hybrid analysis. The precise position of the gene was localized to subband 22q11.2 by in situ hybridization. The absence of other regions of hybridization suggests that there are no closely related sequences (e.g., reverse transcribed pseudogenes) scattered throughout the genome and that if there are closely related genes, they must be clustered near GSTT2. Southern blot analysis of human DNA digested with BamHI shows that the size of the GSTT2 gene is relatively small, as the coding sequence falls within a 3.6-kb BamHI fragment. 35 refs., 6 figs.

A study on a portable fluorescence imaging system

Science.gov (United States)

Chang, Han-Chao; Wu, Wen-Hong; Chang, Chun-Li; Huang, Kuo-Cheng; Chang, Chung-Hsing; Chiu, Shang-Chen

2011-09-01

The fluorescent reaction is that an organism or dye, excited by UV light (200-405 nm), emits a specific frequency of light; the light is usually a visible or near infrared light (405-900 nm). During the UV light irradiation, the photosensitive agent will be induced to start the photochemical reaction. In addition, the fluorescence image can be used for fluorescence diagnosis and then photodynamic therapy can be given to dental diseases and skin cancer, which has become a useful tool to provide scientific evidence in many biomedical researches. However, most of the methods on acquiring fluorescence biology traces are still stay in primitive stage, catching by naked eyes and researcher's subjective judgment. This article presents a portable camera to obtain the fluorescence image and to make up a deficit from observer competence and subjective judgment. Furthermore, the portable camera offers the 375nm UV-LED exciting light source for user to record fluorescence image and makes the recorded image become persuasive scientific evidence. In addition, when the raising the rate between signal and noise, the signal processing module will not only amplify the fluorescence signal up to 70 %, but also decrease the noise significantly from environmental light on bill and nude mouse testing.

cDNA encoding a polypeptide including a hevein sequence

Energy Technology Data Exchange (ETDEWEB)

Raikhel, Natasha V. (Okemos, MI); Broekaert, Willem F. (Dilbeek, BE); Chua, Nam-Hai (Scarsdale, NY); Kush, Anil (New York, NY)

1993-02-16

A cDNA clone (HEV1) encoding hevein was isolated via polymerase chain reaction (PCR) using mixed oligonucleotides corresponding to two regions of hevein as primers and a Hevea brasiliensis latex cDNA library as a template. HEV1 is 1018 nucleotides long and includes an open reading frame of 204 amino acids. The deduced amino acid sequence contains a pu GOVERNMENT RIGHTS This application was funded under Department of Energy Contract DE-AC02-76ER01338. The U.S. Government has certain rights under this application and any patent issuing thereon.

Distributed feedback laser amplifiers combining the functions of amplifiers and channel filters

DEFF Research Database (Denmark)

Wang, Z.; Durhuus, T.; Mikkelsen, Benny

1994-01-01

A dynamic model for distributed feedback amplifiers, including the mode coupled equations and the carrier rate equation, is established. The presented mode coupled equations have taken into account the interaction between fast changing optical signal and the waveguide with corrugations. By showin...... the possibility of amplifying 100 ps pulses without pulse broadening, we anticipate that a distributed feedback amplifier can be used as a combined amplifier and channel filter in high bit rate transmission systems....

Fluorescence in situ hybridization on human metaphase chromosomes detected by near-field scanning optical microscopy

NARCIS (Netherlands)

Moers, M.H.P.; Moers, M.H.P.; Kalle, W.H.J.; Kalle, W.H.J.; Ruiter, A.G.T.; Wiegant, J.C.A.G.; Raap, A.K.; Greve, Jan; de Grooth, B.G.; van Hulst, N.F.

1996-01-01

Fluorescence in situ hybridization o­n human metaphase chromosomes is detected by near-field scanning optical microscopy. This combination of cytochemical and scanning probe techniques enables the localization and identification of several fluorescently labelled genomic DNA fragments o­n a single

Laser-induced fluorescence detection strategies for sodium atoms and compounds in high-pressure combustors

Science.gov (United States)

Weiland, Karen J. R.; Wise, Michael L.; Smith, Gregory P.

1993-01-01

A variety of laser-induced fluorescence schemes were examined experimentally in atmospheric pressure flames to determine their use for sodium atom and salt detection in high-pressure, optically thick environments. Collisional energy transfer plays a large role in fluorescence detection. Optimum sensitivity, at the parts in 10 exp 9 level for a single laser pulse, was obtained with the excitation of the 4p-3s transition at 330 nm and the detection of the 3d-3p fluorescence at 818 nm. Fluorescence loss processes, such as ionization and amplified spontaneous emission, were examined. A new laser-induced atomization/laser-induced fluorescence detection technique was demonstrated for NaOH and NaCl. A 248-nm excimer laser photodissociates the salt molecules present in the seeded flames prior to atom detection by laser-induced fluorescence.

CDNA cloning, characterization and expression of an endosperm-specific barley peroxidase

DEFF Research Database (Denmark)

Rasmussen, Søren Kjærsgård; Welinder, K.G.; Hejgaard, J.

1991-01-01

A barley peroxidase (BP 1) of pI ca. 8.5 and M(r) 37000 has been purified from mature barley grains. Using antibodies towards peroxidase BP 1, a cDNA clone (pcR7) was isolated from cDNA expression library. The nucleotide sequence of pcR7 gave a derived amino acid sequence identical to the 158 C...

Ultra-sensitive DNA assay based on single-molecule detection coupled with fluorescent quantum dot-labeling and its application to determination of messenger RNA

International Nuclear Information System (INIS)

Li Li; Li Xincang; Li Lu; Wang Jinxing; Jin Wenrui

2011-01-01

An ultra-sensitive single-molecule detection (SMD) method for quantification of DNA using total internal reflection fluorescence microscopy (TIRFM) coupled with fluorescent quantum dot (QD)-labeling was developed. In this method, the target DNA (tDNA) was captured by the capture DNA immobilized on the silanized coverslip blocked with ethanolamine and bovine serum albumin. Then, the QD-labeled probe DNA was hybridized to the tDNA. Ten fluorescent images of the QD-labeled sandwich DNA hybrids on the coverslip were taken by a high-sensitive CCD. The tDNA was quantified by counting the bright spots on the images using a calibration curve. The LOD of the method was 1 x 10 -14 mol L -1 . Several key factors, including image acquirement, fluorescence probe, substrate preparation, noise elimination from solutions and glass coverslips, and nonspecific adsorption and binding of solution-phase detection probes were discussed in detail. The method could be applied to quantify messenger RNA (mRNA) in cells. In order to determine mRNA, double-stranded RNA-DNA hybrids consisting of mRNA and corresponding cDNA were synthesized from the cellular mRNA template using reverse transcription in the presence of reverse transcriptase. After removing the mRNA in the double-stranded hybrids using ribonuclease, cDNA was quantified using the SMD-based TIRFM. Osteopontin mRNA in decidual stromal cells was chosen as the model analyte.

Heterogeneity of rat tropoelastin mRNA revealed by cDNA cloning

International Nuclear Information System (INIS)

Pierce, R.A.; Deak, S.B.; Stolle, C.A.; Boyd, C.D.

1990-01-01

A λgt11 library constructed from poly(A+) RNA isolated from aortic tissue of neonatal rats was screened for rat tropoelastin cDNAs. The first, screen, utilizing a human tropoelastin cDNA clone, provided rat tropoelastin cDNAs spanning 2.3 kb of carboxy-terminal coding sequence and extended into the 3'-untranslated region. A subsequent screen using a 5' rat tropoelastin cDNA clone yielded clones extending into the amino-terminal signal sequence coding region. Sequence analysis of these clones has provided the complete derived amino acid sequence of rat tropoelastin and allowed alignment and comparison with published bovine cDNA sequence. While the overall structure of rat tropoelastin is similar to bovine sequence, numerous substitutions, deletions, and insertions demonstrated considerable heterogeneity between species. In particular, the pentapeptide repeat VPGVG, characteristic of all tropoelastins analyzed to date, is replaced in rat tropoelastin by a repeating pentapeptide, IPGVG. The hexapeptide repeat VGVAPG, the bovine elastin receptor binding peptide, is not encoded by rat tropoelastin cDNAs. Variations in coding sequence between rat tropoelastin CDNA clones were also found which may represent mRNA heterogeneity produced by alternative splicing of the rat tropoelastin pre-mRNA

Quantification and micron-scale imaging of spatial distribution of trace beryllium in shrapnel fragments and metallurgic samples with correlative fluorescence detection method and secondary ion mass spectrometry (SIMS)

Science.gov (United States)

Abraham, Jerrold L.; Chandra, Subhash; Agrawal, Anoop

2014-01-01

Recently, a report raised the possibility of shrapnel-induced chronic beryllium disease (CBD) from long-term exposure to the surface of retained aluminum shrapnel fragments in the body. Since the shrapnel fragments contained trace beryllium, methodological developments were needed for beryllium quantification and to study its spatial distribution in relation to other matrix elements, such as aluminum and iron, in metallurgic samples. In this work, we developed methodology for quantification of trace beryllium in samples of shrapnel fragments and other metallurgic sample-types with main matrix of aluminum (aluminum cans from soda, beer, carbonated water, and aluminum foil). Sample preparation procedures were developed for dissolving beryllium for its quantification with the fluorescence detection method for homogenized measurements. The spatial distribution of trace beryllium on the sample surface and in 3D was imaged with a dynamic secondary ion mass spectrometry (SIMS) instrument, CAMECA IMS 3f SIMS ion microscope. The beryllium content of shrapnel (~100 ppb) was the same as the trace quantities of beryllium found in aluminum cans. The beryllium content of aluminum foil (~25 ppb) was significantly lower than cans. SIMS imaging analysis revealed beryllium to be distributed in the form of low micron-sized particles and clusters distributed randomly in X-Y-and Z dimensions, and often in association with iron, in the main aluminum matrix of cans. These observations indicate a plausible formation of Be-Fe or Al-Be alloy in the matrix of cans. Further observations were made on fluids (carbonated water) for understanding if trace beryllium in cans leached out and contaminated the food product. A direct comparison of carbonated water in aluminum cans and plastic bottles revealed that beryllium was below the detection limits of the fluorescence detection method (~0.01 ppb). These observations indicate that beryllium present in aluminum matrix was either present in an

Quantification and micron-scale imaging of spatial distribution of trace beryllium in shrapnel fragments and metallurgic samples with correlative fluorescence detection method and secondary ion mass spectrometry (SIMS).

Science.gov (United States)

Abraham, J L; Chandra, S; Agrawal, A

2014-11-01

Recently, a report raised the possibility of shrapnel-induced chronic beryllium disease from long-term exposure to the surface of retained aluminum shrapnel fragments in the body. Since the shrapnel fragments contained trace beryllium, methodological developments were needed for beryllium quantification and to study its spatial distribution in relation to other matrix elements, such as aluminum and iron, in metallurgic samples. In this work, we developed methodology for quantification of trace beryllium in samples of shrapnel fragments and other metallurgic sample-types with main matrix of aluminum (aluminum cans from soda, beer, carbonated water and aluminum foil). Sample preparation procedures were developed for dissolving beryllium for its quantification with the fluorescence detection method for homogenized measurements. The spatial distribution of trace beryllium on the sample surface and in 3D was imaged with a dynamic secondary ion mass spectrometry instrument, CAMECA IMS 3f secondary ion mass spectrometry ion microscope. The beryllium content of shrapnel (∼100 ppb) was the same as the trace quantities of beryllium found in aluminum cans. The beryllium content of aluminum foil (∼25 ppb) was significantly lower than cans. SIMS imaging analysis revealed beryllium to be distributed in the form of low micron-sized particles and clusters distributed randomly in X-Y- and Z dimensions, and often in association with iron, in the main aluminum matrix of cans. These observations indicate a plausible formation of Be-Fe or Al-Be alloy in the matrix of cans. Further observations were made on fluids (carbonated water) for understanding if trace beryllium in cans leached out and contaminated the food product. A direct comparison of carbonated water in aluminum cans and plastic bottles revealed that beryllium was below the detection limits of the fluorescence detection method (∼0.01 ppb). These observations indicate that beryllium present in aluminum matrix was either

X-ray fluorescence in geology

International Nuclear Information System (INIS)

Dutra, C.V.; Gomes, C.B.

1990-01-01

This work is about the X-ray fluorescence aplication in geology. It's showing the X-ray origin and excitation. About the instrumentation this work shows the following: X-ray tubes, colimators, analysers crystals, detectors, amplifiers, pulse height selector, and others electronic components. By X-ray fluorescente are done quantitative and qualitative geological analysis and this work shows this analysis and its detection limits. The problems determination is the example. In this work was done yet the comparative analysis of the various instrumental methods in geochemistry. (C.G.) [pt

Antares laser power amplifier

International Nuclear Information System (INIS)

Stine, R.D.; Ross, G.F.; Silvernail, C.

1979-01-01

The overall design of the Antares laser power amplifier is discussed. The power amplifier is the last stage of amplification in the 100-kJ Antares laser. In the power amplifier a single, cylindrical, grid-controlle, cold-cathode electron gun is surrounded by 12 large-aperture CO 2 electron-beam sustained laser discharge sectors. Each power amplifier will deliver 18 kJ and the six modules used in Antares will produce the required 100 kJ for delivery to the target. A large-scale interaction between optical, mechanical, and electrical disciplines is required to meet the design objectives. Significant component advances required by the power amplifier design are discussed

Peptidomics combined with cDNA library unravel the diversity of centipede venom

DEFF Research Database (Denmark)

Rong, Mingqiang; Yang, Shilong; Wen, Bo

2015-01-01

of centipede venom. In the present study, we use peptidomics combined with cDNA library to uncover the diversity of centipede Scolopendra subspinipes mutilans L. Koch. 192 peptides were identified by LC-MS/MS and 79 precursors were deduced by cDNA library. Surprisingly, the signal peptides of centipede toxins...

Construction of a Full-Length Enriched cDNA Library and Preliminary Analysis of Expressed Sequence Tags from Bengal Tiger Panthera tigris tigris

Science.gov (United States)

Liu, Changqing; Liu, Dan; Guo, Yu; Lu, Taofeng; Li, Xiangchen; Zhang, Minghai; Ma, Jianzhang; Ma, Yuehui; Guan, Weijun

2013-01-01

In this study, a full-length enriched cDNA library was successfully constructed from Bengal tiger, Panthera tigris tigris, the most well-known wild Animal. Total RNA was extracted from cultured Bengal tiger fibroblasts in vitro. The titers of primary and amplified libraries were 1.28 × 106 pfu/mL and 1.56 × 109 pfu/mL respectively. The percentage of recombinants from unamplified library was 90.2% and average length of exogenous inserts was 0.98 kb. A total of 212 individual ESTs with sizes ranging from 356 to 1108 bps were then analyzed. The BLASTX score revealed that 48.1% of the sequences were classified as a strong match, 45.3% as nominal and 6.6% as a weak match. Among the ESTs with known putative function, 26.4% ESTs were found to be related to all kinds of metabolisms, 19.3% ESTs to information storage and processing, 11.3% ESTs to posttranslational modification, protein turnover, chaperones, 11.3% ESTs to transport, 9.9% ESTs to signal transducer/cell communication, 9.0% ESTs to structure protein, 3.8% ESTs to cell cycle, and only 6.6% ESTs classified as novel genes. By EST sequencing, a full-length gene coding ferritin was identified and characterized. The recombinant plasmid pET32a-TAT-Ferritin was constructed, coded for the TAT-Ferritin fusion protein with two 6× His-tags in N and C-terminal. After BCA assay, the concentration of soluble Trx-TAT-Ferritin recombinant protein was 2.32 ± 0.12 mg/mL. These results demonstrated that the reliability and representativeness of the cDNA library attained to the requirements of a standard cDNA library. This library provided a useful platform for the functional genome and transcriptome research of Bengal tigers. PMID:23708105

Construction of a Full-Length Enriched cDNA Library and Preliminary Analysis of Expressed Sequence Tags from Bengal Tiger Panthera tigris tigris

Directory of Open Access Journals (Sweden)

Changqing Liu

2013-05-01

Full Text Available In this study, a full-length enriched cDNA library was successfully constructed from Bengal tiger, Panthera tigris tigris, the most well-known wild Animal. Total RNA was extracted from cultured Bengal tiger fibroblasts in vitro. The titers of primary and amplified libraries were 1.28 × 106 pfu/mL and 1.56 × 109 pfu/mL respectively. The percentage of recombinants from unamplified library was 90.2% and average length of exogenous inserts was 0.98 kb. A total of 212 individual ESTs with sizes ranging from 356 to 1108 bps were then analyzed. The BLASTX score revealed that 48.1% of the sequences were classified as a strong match, 45.3% as nominal and 6.6% as a weak match. Among the ESTs with known putative function, 26.4% ESTs were found to be related to all kinds of metabolisms, 19.3% ESTs to information storage and processing, 11.3% ESTs to posttranslational modification, protein turnover, chaperones, 11.3% ESTs to transport, 9.9% ESTs to signal transducer/cell communication, 9.0% ESTs to structure protein, 3.8% ESTs to cell cycle, and only 6.6% ESTs classified as novel genes. By EST sequencing, a full-length gene coding ferritin was identified and characterized. The recombinant plasmid pET32a-TAT-Ferritin was constructed, coded for the TAT-Ferritin fusion protein with two 6× His-tags in N and C-terminal. After BCA assay, the concentration of soluble Trx-TAT-Ferritin recombinant protein was 2.32 ± 0.12 mg/mL. These results demonstrated that the reliability and representativeness of the cDNA library attained to the requirements of a standard cDNA library. This library provided a useful platform for the functional genome and transcriptome research of Bengal tigers.

Full-Length Venom Protein cDNA Sequences from Venom-Derived mRNA: Exploring Compositional Variation and Adaptive Multigene Evolution.

Science.gov (United States)

Modahl, Cassandra M; Mackessy, Stephen P

2016-06-01

Envenomation of humans by snakes is a complex and continuously evolving medical emergency, and treatment is made that much more difficult by the diverse biochemical composition of many venoms. Venomous snakes and their venoms also provide models for the study of molecular evolutionary processes leading to adaptation and genotype-phenotype relationships. To compare venom complexity and protein sequences, venom gland transcriptomes are assembled, which usually requires the sacrifice of snakes for tissue. However, toxin transcripts are also present in venoms, offering the possibility of obtaining cDNA sequences directly from venom. This study provides evidence that unknown full-length venom protein transcripts can be obtained from the venoms of multiple species from all major venomous snake families. These unknown venom protein cDNAs are obtained by the use of primers designed from conserved signal peptide sequences within each venom protein superfamily. This technique was used to assemble a partial venom gland transcriptome for the Middle American Rattlesnake (Crotalus simus tzabcan) by amplifying sequences for phospholipases A2, serine proteases, C-lectins, and metalloproteinases from within venom. Phospholipase A2 sequences were also recovered from the venoms of several rattlesnakes and an elapid snake (Pseudechis porphyriacus), and three-finger toxin sequences were recovered from multiple rear-fanged snake species, demonstrating that the three major clades of advanced snakes (Elapidae, Viperidae, Colubridae) have stable mRNA present in their venoms. These cDNA sequences from venom were then used to explore potential activities derived from protein sequence similarities and evolutionary histories within these large multigene superfamilies. Venom-derived sequences can also be used to aid in characterizing venoms that lack proteomic profiles and identify sequence characteristics indicating specific envenomation profiles. This approach, requiring only venom, provides

Amplified fragment length polymorphism mapping of quantitative trait loci for malaria parasite susceptibility in the yellow fever mosquito Aedes aegypti.

Science.gov (United States)

Zhong, Daibin; Menge, David M; Temu, Emmanuel A; Chen, Hong; Yan, Guiyun

2006-07-01

The yellow fever mosquito Aedes aegypti has been the subject of extensive genetic research due to its medical importance and the ease with which it can be manipulated in the laboratory. A molecular genetic linkage map was constructed using 148 amplified fragment length polymorphism (AFLP) and six single-strand conformation polymorphism (SSCP) markers. Eighteen AFLP primer combinations were used to genotype two reciprocal F2 segregating populations. Each primer combination generated an average of 8.2 AFLP markers eligible for linkage mapping. The length of the integrated map was 180.9 cM, giving an average marker resolution of 1.2 cM. Composite interval mapping revealed a total of six QTL significantly affecting Plasmodium susceptibility in the two reciprocal crosses of Ae. aegypti. Two common QTL on linkage group 2 were identified in both crosses that had similar effects on the phenotype, and four QTL were unique to each cross. In one cross, the four main QTL accounted for 64% of the total phenotypic variance, and digenic epistasis explained 11.8% of the variance. In the second cross, the four main QTL explained 66% of the variance, and digenic epistasis accounted for 16% of the variance. The actions of these QTL were either dominance or underdominance. Our results indicated that at least three new QTL were mapped on chromosomes 1 and 3. The polygenic nature of susceptibility to P. gallinaceum and epistasis are important factors for significant variation within or among mosquito strains. The new map provides additional information useful for further genetic investigation, such as identification of new genes and positional cloning.

Amplification factor variable amplifier

NARCIS (Netherlands)

Akitsugu, Oshita; Nauta, Bram

2007-01-01

PROBLEM TO BE SOLVED: To provide an amplification factor variable amplifier capable of achieving temperature compensation of an amplification factor over a wide variable amplification factor range. ; SOLUTION: A Gilbert type amplification factor variable amplifier 11 amplifies an input signal and

Molecular cloning and nucleotide sequence of cDNA for human liver arginase

International Nuclear Information System (INIS)

Haraguchi, Y.; Takiguchi, M.; Amaya, Y.; Kawamoto, S.; Matsuda, I.; Mori, M.

1987-01-01

Arginase (EC3.5.3.1) catalyzes the last step of the urea cycle in the liver of ureotelic animals. Inherited deficiency of the enzyme results in argininemia, an autosomal recessive disorder characterized by hyperammonemia. To facilitate investigation of the enzyme and gene structures and to elucidate the nature of the mutation in argininemia, the authors isolated cDNA clones for human liver arginase. Oligo(dT)-primed and random primer human liver cDNA libraries in λ gt11 were screened using isolated rat arginase cDNA as a probe. Two of the positive clones, designated λ hARG6 and λ hARG109, contained an overlapping cDNA sequence with an open reading frame encoding a polypeptide of 322 amino acid residues (predicted M/sub r/, 34,732), a 5'-untranslated sequence of 56 base pairs, a 3'-untranslated sequence of 423 base pairs, and a poly(A) segment. Arginase activity was detected in Escherichia coli cells transformed with the plasmid carrying λ hARG6 cDNA insert. RNA gel blot analysis of human liver RNA showed a single mRNA of 1.6 kilobases. The predicted amino acid sequence of human liver arginase is 87% and 41% identical with those of the rat liver and yeast enzymes, respectively. There are several highly conserved segments among the human, rat, and yeast enzymes

Amplification factor variable amplifier

NARCIS (Netherlands)

Akitsugu, Oshita; Nauta, Bram

2010-01-01

PROBLEM TO BE SOLVED: To provide an amplification factor variable amplifier capable of achieving temperature compensation of an amplification factor over a wide variable amplification factor range. ;SOLUTION: A Gilbert type amplification factor variable amplifier 11 amplifies an input signal and can

Author template for journal articles

African Journals Online (AJOL)

china

2011-11-09

Nov 9, 2011 ... In this study, ent-kaurene oxidase cDNA sequence was successfully amplified from the total cDNA of ... especially abundant in root and stem apexes. .... The cDNA was synthesized using the first-strand cDNA synthesis.

Probing the binding of Cu(2+) ions to a fragment of the Aβ(1-42) polypeptide using fluorescence spectroscopy, isothermal titration calorimetry and molecular dynamics simulations.

Science.gov (United States)

Makowska, Joanna; Żamojć, Krzysztof; Wyrzykowski, Dariusz; Żmudzińska, Wioletta; Uber, Dorota; Wierzbicka, Małgorzata; Wiczk, Wiesław; Chmurzyński, Lech

2016-09-01

Steady-state and time-resolved fluorescence quenching measurements supported by isothermal titration calorimetry (ITC) and molecular dynamics simulations (MD), with the NMR-derived restraints, were used to investigate the interactions of Cu(2+) ions with a fragment of the Aβ(1-42) polypeptide, Aβ(5-16) with the following sequence: Ac-Arg-His-Asp-Ser-Gly-Tyr-Glu-Val-His-His-Gln-Lys-NH2, denoted as HZ1. The studies presented in this paper, when compared with our previous results (Makowska et al., Spectrochim. Acta A 153: 451-456), show that the affinity of the peptide to metal ions is conformation-dependent. All the measurements were carried out in 20mM 2-(N-morpholino)ethanesulfonic acid (MES) buffer solution, pH6.0. The Stern-Volmer equations, along with spectroscopic observations, were used to determine the quenching and binding parameters. The obtained results unequivocally suggest that Cu(2+) ions quench the fluorescence of HZ1 only through a static quenching mechanism, in contrast to the fragment from the N-terminal part of the FPB28 protein, with sequence Ac-Tyr-Lys-Thr-Ala-Asp-Gly-Lys-Thr-Tyr- NH2 (D9) and its derivative with a single point mutation: Ac-Tyr-Lys-Thr-Ala-Asn-Gly-Lys-Thr-Tyr- NH2 (D9_M), where dynamic quenching occurred. The thermodynamic parameters (ΔITCH, ΔITCS) for the interactions between Cu(2+) ions and the HZ1 peptide were determined from the calorimetric data. The conditional thermodynamic parameters suggest that, under the experimental conditions, the formation of the Cu(2+)-HZ1 complex is both an enthalpy and entropy driven process. Copyright © 2016 Elsevier B.V. All rights reserved.

Explosion-evaporation model for fragment production in intermediate-energy nuclear collisions

International Nuclear Information System (INIS)

Fai, G.; Randrup, J.

1981-01-01

Nuclear collisions at intermediate energies may create transient systems of hot nuclear matter that decay into many nuclear fragments. The disassembly of such a nuclear fireball is described as a two-stage process. In the primary explosion stage the system quickly fragments into nucleons and composite nuclei according to the available phase space. The explosion produces excited nuclei with half-lives longer than the time associated with the breakup. In the secondary evaporation stage, these nuclei decay, first by sequential emission of light particles (neutrons, protons, alphas), later by electromagnetic radiation. The secondary stage in general changes the relative abundancies of the various fragment species. This general feature makes it essential to take account of the composite fragments before using d/p as a measure of the entropy of the initial source. The formation of unbound nuclei at the explosion stage also has the desirable effect of enhancing the final abundancies of particularly stable nuclei, e.g., 4 He. For neutron-excessive sources the presence of composite nuclei amplifies the ratio of observed neutrons and protons; this effect persists for heavier mirror systems. Predictions of the model are qualitatively compared to available experimental data. The model offers a convenient way to augment existing dynamical models, such as intra-nuclear cascade and nuclear fluid dynamics, to yield actual nuclear fragments rather than merely matter distributions

Display of a Maize cDNA library on baculovirus infected insect cells

Directory of Open Access Journals (Sweden)

Jones Ian M

2008-08-01

Full Text Available Abstract Background Maize is a good model system for cereal crop genetics and development because of its rich genetic heritage and well-characterized morphology. The sequencing of its genome is well advanced, and new technologies for efficient proteomic analysis are needed. Baculovirus expression systems have been used for the last twenty years to express in insect cells a wide variety of eukaryotic proteins that require complex folding or extensive posttranslational modification. More recently, baculovirus display technologies based on the expression of foreign sequences on the surface of Autographa californica (AcMNPV have been developed. We investigated the potential of a display methodology for a cDNA library of maize young seedlings. Results We constructed a full-length cDNA library of young maize etiolated seedlings in the transfer vector pAcTMVSVG. The library contained a total of 2.5 × 105 independent clones. Expression of two known maize proteins, calreticulin and auxin binding protein (ABP1, was shown by western blot analysis of protein extracts from insect cells infected with the cDNA library. Display of the two proteins in infected insect cells was shown by selective biopanning using magnetic cell sorting and demonstrated proof of concept that the baculovirus maize cDNA display library could be used to identify and isolate proteins. Conclusion The maize cDNA library constructed in this study relies on the novel technology of baculovirus display and is unique in currently published cDNA libraries. Produced to demonstrate proof of principle, it opens the way for the development of a eukaryotic in vivo display tool which would be ideally suited for rapid screening of the maize proteome for binding partners, such as proteins involved in hormone regulation or defence.

Construction of recombinant adenovirus with Egr-1 promoter and Smad7 cDNA and study of the Egr-1 promoter's biological activity

International Nuclear Information System (INIS)

Cai Xuwei; Fu Xiaolong; Yang Jian; Song Houyan

2005-01-01

Objective: To construct a recombinant replication-defective adenovirus containing Egr-1 promoter and Smad7 cDNA, then to evaluate the biological activity of Egr-1 promoter. Methods: Based on Adeno- X TM expression system, CMV promoter of the pShuttle vector was replaced by Egr-1 promoter, and the Smad7 cDNA was subcloned into the MCS(multiple cloning site) of pShuttle. The recombinant pShuttle was then sub-cloned into the Adeno-X TM genome, which was transformed into E. coli to get recombinant Adeno-X TM plasmid DNA. The recombinant adenovirus was packaged and amplified in the transfected HEK293 cells before it was purified and tested for viral titer. The fibroblasts (3T6 cells) infected by the recombinant adenovirus were irradiated , and the activity of Egr-1 promoter was quantitively determined by the amount of Smad7 protein expressed in the 3T6 cells using Western blot. Results: Identified by restriction endonuclease analysis and PCR, the recombinant adenovirus containing Egr-1 promoter and Smad7 cDNA was constructed successfully, with a viral titer of 1.0 x 10 11 TCID 50 /ml. The expressed amount of Smad7 protein varied at different dose levels and different time points post-irradiation in the 3T6 cells infected with the recombinant adenovirus. The amount of Smad7 protein increased along with the rising of the irradiation dose, and remained at a high expression level from 8 Gy to 15 Gy. The amount of Smad7 protein started to increase at 2 hours post-irradiation, and maintained a relatively high level for the next 5 hours before it descended, which was not observed in the control 3T6 cells. Conclusions: With the aid of Adeno-X TM expression system and molecular cloning techniques, construction of recombinant adenovirus could be quick and efficient. The recombined Egr-1 promoter has the activity of regulating the expression of downstream Smad7 cDNA. The increase in Smad7 expression under control of Egr-1 promoter induced by ionizing radiation is time- and dose

A new assay based on terminal restriction fragment length polymorphism of homocitrate synthase gene fragments for Candida species identification.

Science.gov (United States)

Szemiako, Kasjan; Śledzińska, Anna; Krawczyk, Beata

2017-08-01

Candida sp. have been responsible for an increasing number of infections, especially in patients with immunodeficiency. Species-specific differentiation of Candida sp. is difficult in routine diagnosis. This identification can have a highly significant association in therapy and prophylaxis. This work has shown a new application of the terminal restriction fragment length polymorphism (t-RFLP) method in the molecular identification of six species of Candida, which are the most common causes of fungal infections. Specific for fungi homocitrate synthase gene was chosen as a molecular target for amplification. The use of three restriction enzymes, DraI, RsaI, and BglII, for amplicon digestion can generate species-specific fluorescence labeled DNA fragment profiles, which can be used to determine the diagnostic algorithm. The designed method can be a cost-efficient high-throughput molecular technique for the identification of six clinically important Candida species.

Time-synchronized continuous wave laser-induced fluorescence on an oscillatory xenon discharge.

Science.gov (United States)

MacDonald, N A; Cappelli, M A; Hargus, W A

2012-11-01

A novel approach to time-synchronizing laser-induced fluorescence measurements to an oscillating current in a 60 Hz xenon discharge lamp using a continuous wave laser is presented. A sample-hold circuit is implemented to separate out signals at different phases along a current cycle, and is followed by a lock-in amplifier to pull out the resulting time-synchronized fluorescence trace from the large background signal. The time evolution of lower state population is derived from the changes in intensity of the fluorescence excitation line shape resulting from laser-induced fluorescence measurements of the 6s(')[1/2](1)(0)-6p(')[3/2](2) xenon atomic transition at λ = 834.68 nm. Results show that the lower state population oscillates at twice the frequency of the discharge current, 120 Hz.

CMOS Current-mode Operational Amplifier

DEFF Research Database (Denmark)

Kaulberg, Thomas

1992-01-01

current-mode feedback amplifier or a constant bandwidth in a transimpedance feedback amplifier. The amplifier is found to have a gain bandwidth product of 8 MHz, an offset current of 0.8 ¿A (signal-range ±700¿A) and a (theoretically) unlimited slew-rate. The amplifier is realized in a standard CMOS 2......A fully differential-input differential-output current-mode operational amplifier (COA) is described. The amplifier utilizes three second generation current-conveyors (CCII) as the basic building blocks. It can be configured to provide either a constant gain-bandwidth product in a fully balanced...

cDNA encoding a polypeptide including a hevein sequence

Energy Technology Data Exchange (ETDEWEB)

Raikhel, N.V.; Broekaert, W.F.; Chua, N.H.; Kush, A.

2000-07-04

A cDNA clone (HEV1) encoding hevein was isolated via polymerase chain reaction (PCR) using mixed oligonucleotides corresponding to two regions of hevein as primers and a Hevea brasiliensis latex cDNA library as a template. HEV1 is 1018 nucleotides long and includes an open reading frame of 204 amino acids. The deduced amino acid sequence contains a putative signal sequence of 17 amino acid residues followed by a 187 amino acid polypeptide. The amino-terminal region (43 amino acids) is identical to hevein and shows homology to several chitin-binding proteins and to the amino-termini of wound-induced genes in potato and poplar. The carboxyl-terminal portion of the polypeptide (144 amino acids) is 74--79% homologous to the carboxyl-terminal region of wound-inducible genes of potato. Wounding, as well as application of the plant hormones abscisic acid and ethylene, resulted in accumulation of hevein transcripts in leaves, stems and latex, but not in roots, as shown by using the cDNA as a probe. A fusion protein was produced in E. coli from the protein of the present invention and maltose binding protein produced by the E. coli.

cDNA encoding a polypeptide including a hevein sequence

Energy Technology Data Exchange (ETDEWEB)

Raikhel, N.V.; Broekaert, W.F.; Chua, N.H.; Kush, A.

1999-05-04

A cDNA clone (HEV1) encoding hevein was isolated via polymerase chain reaction (PCR) using mixed oligonucleotides corresponding to two regions of hevein as primers and a Hevea brasiliensis latex cDNA library as a template. HEV1 is 1018 nucleotides long and includes an open reading frame of 204 amino acids. The deduced amino acid sequence contains a putative signal sequence of 17 amino acid residues followed by a 187 amino acid polypeptide. The amino-terminal region (43 amino acids) is identical to hevein and shows homology to several chitin-binding proteins and to the amino-termini of wound-induced genes in potato and poplar. The carboxyl-terminal portion of the polypeptide (144 amino acids) is 74--79% homologous to the carboxyl-terminal region of wound-inducible genes of potato. Wounding, as well as application of the plant hormones abscisic acid and ethylene, resulted in accumulation of hevein transcripts in leaves, stems and latex, but not in roots, as shown by using the cDNA as a probe. A fusion protein was produced in E. coli from the protein of the present invention and maltose binding protein produced by the E. coli. 12 figs.

cDNA encoding a polypeptide including a hevein sequence

Energy Technology Data Exchange (ETDEWEB)

Raikhel, Natasha V. (Okemos, MI); Broekaert, Willem F. (Dilbeek, BE); Chua, Nam-Hai (Scarsdale, NY); Kush, Anil (New York, NY)

1999-05-04

A cDNA clone (HEV1) encoding hevein was isolated via polymerase chain reaction (PCR) using mixed oligonucleotides corresponding to two regions of hevein as primers and a Hevea brasiliensis latex cDNA library as a template. HEV1 is 1018 nucleotides long and includes an open reading frame of 204 amino acids. The deduced amino acid sequence contains a putative signal sequence of 17 amino acid residues followed by a 187 amino acid polypeptide. The amino-terminal region (43 amino acids) is identical to hevein and shows homology to several chitin-binding proteins and to the amino-termini of wound-induced genes in potato and poplar. The carboxyl-terminal portion of the polypeptide (144 amino acids) is 74-79% homologous to the carboxyl-terminal region of wound-inducible genes of potato. Wounding, as well as application of the plant hormones abscisic acid and ethylene, resulted in accumulation of hevein transcripts in leaves, stems and latex, but not in roots, as shown by using the cDNA as a probe. A fusion protein was produced in E. coli from the protein of the present invention and maltose binding protein produced by the E. coli.

cDNA encoding a polypeptide including a hevein sequence

Energy Technology Data Exchange (ETDEWEB)

Raikhel, N.V.; Broekaert, W.F.; Chua, N.H.; Kush, A.

1995-03-21

A cDNA clone (HEV1) encoding hevein was isolated via polymerase chain reaction (PCR) using mixed oligonucleotides corresponding to two regions of hevein as primers and a Hevea brasiliensis latex cDNA library as a template. HEV1 is 1,018 nucleotides long and includes an open reading frame of 204 amino acids. The deduced amino acid sequence contains a putative signal sequence of 17 amino acid residues followed by a 187 amino acid polypeptide. The amino-terminal region (43 amino acids) is identical to hevein and shows homology to several chitin-binding proteins and to the amino-termini of wound-induced genes in potato and poplar. The carboxyl-terminal portion of the polypeptide (144 amino acids) is 74--79% homologous to the carboxyl-terminal region of wound-inducible genes of potato. Wounding, as well as application of the plant hormones abscisic acid and ethylene, resulted in accumulation of hevein transcripts in leaves, stems and latex, but not in roots, as shown by using the cDNA as a probe. A fusion protein was produced in E. coli from the protein of the present invention and maltose binding protein produced by the E. coli. 11 figures.

Operational amplifiers

CERN Document Server

Dostal, Jiri

1993-01-01

This book provides the reader with the practical knowledge necessary to select and use operational amplifier devices. It presents an extensive treatment of applications and a practically oriented, unified theory of operational circuits.Provides the reader with practical knowledge necessary to select and use operational amplifier devices. Presents an extensive treatment of applications and a practically oriented, unified theory of operational circuits

Allelic sequence variations in the hypervariable region of a T-cell receptor β chain: Correlation with restriction fragment length polymorphism in human families and populations

International Nuclear Information System (INIS)

Robinson, M.A.

1989-01-01

Direct sequence analysis of the human T-cell antigen receptor (TCR) V β1 variable gene identified a single base-pair allelic variation (C/G) located within the coding region. This change results in substitution of a histidine (CAC) for a glutamine (CAG) at position 48 of the TCR β chain, a position predicted to be in the TCR antigen binding site. The V β1 polymorphism was found by DNA sequence analysis of V β1 genes from seven unrelated individuals; V β1 genes were amplified by the polymerase chain reaction, the amplified fragments were cloned into M13 phage vectors, and sequences were determined. To determined the inheritance patterns of the V β1 substitution and to test correlation with V β1 restriction fragment length polymorphism detected with Pvu II and Taq I, allele-specific oligonucleotides were constructed and used to characterize amplified DNA samples. Seventy unrelated individuals and six families were tested for both restriction fragment length polymorphism and for the V β1 substitution. The correlation was also tested using amplified, size-selected, Pvu II- and Taq I-digested DNA samples from heterozygotes. Pvu II allele 1 (61/70) and Taq I allele 1 (66/70) were found to be correlated with the substitution giving rise to a histidine at position 48. Because there are exceptions to the correlation, the use of specific probes to characterize allelic forms of TCR variable genes will provide important tools for studies of basic TCR genetics and disease associations

Distributed Sensor Particles for Remote Fluorescence Detection of Trace Analytes: UXO/CW; TOPICAL

International Nuclear Information System (INIS)

SINGH, ANUP K.; GUPTA, ALOK; MULCHANDANI, ASHOK; CHEN, WILFRED; BHATIA, RIMPLE B.; SCHOENIGER, JOSEPH S.; ASHLEY, CAROL S.; BRINKER, C. JEFFREY; HANCE, BRADLEY G.; SCHMITT, RANDAL L.; JOHNSON, MARK S.; HARGIS JR. PHILIP J.; SIMONSON, ROBERT J.

2001-01-01

This report summarizes the development of sensor particles for remote detection of trace chemical analytes over broad areas, e.g residual trinitrotoluene from buried landmines or other unexploded ordnance (UXO). We also describe the potential of the sensor particle approach for the detection of chemical warfare (CW) agents. The primary goal of this work has been the development of sensor particles that incorporate sample preconcentration, analyte molecular recognition, chemical signal amplification, and fluorescence signal transduction within a ''grain of sand''. Two approaches for particle-based chemical-to-fluorescence signal transduction are described: (1) enzyme-amplified immunoassays using biocompatible inorganic encapsulants, and (2) oxidative quenching of a unique fluorescent polymer by TNT

Identification and functional analysis of a new glyphosate resistance gene from a fungus cDNA library.

Science.gov (United States)

Tao, Bo; Shao, Bai-Hui; Qiao, Yu-Xin; Wang, Xiao-Qin; Chang, Shu-Jun; Qiu, Li-Juan

2017-08-01

Glyphosate is a widely used broad spectrum herbicide; however, this limits its use once crops are planted. If glyphosate-resistant crops are grown, glyphosate can be used for weed control in crops. While several glyphosate resistance genes are used in commercial glyphosate tolerant crops, there is interest in identifying additional genes for glyphosate tolerance. This research constructed a high-quality cDNA library form the glyphosate-resistant fungus Aspergillus oryzae RIB40 to identify genes that may confer resistance to glyphosate. Using a medium containing glyphosate (120mM), we screened several clones from the library. Based on a nucleotide sequence analysis, we identified a gene of unknown function (GenBank accession number: XM_001826835.2) that encoded a hypothetical 344-amino acid protein. The gene was named MFS40. Its ORF was amplified to construct an expression vector, pGEX-4T-1-MFS40, to express the protein in Escherichia coli BL21. The gene conferred glyphosate tolerance to E. coli ER2799 cells. Copyright © 2017 Elsevier B.V. All rights reserved.

The nucleotide sequence of human transition protein 1 cDNA

Energy Technology Data Exchange (ETDEWEB)

Luerssen, H; Hoyer-Fender, S; Engel, W [Universitaet Goettingen (West Germany)

1988-08-11

The authors have screened a human testis cDNA library with an oligonucleotide of 81 mer prepared according to a part of the published nucleotide sequence of the rat transition protein TP 1. They have isolated a cDNA clone with the length of 441 bp containing the coding region of 162 bp for human transition protein 1. There is about 84% homology in the coding region of the sequence compared to rat. The human cDNA-clone encodes a polypeptide of 54 amino acids of which 7 are different to that of rat.

CMOS Current-mode Operational Amplifier

OpenAIRE

Kaulberg, Thomas

1992-01-01

A fully differential-input differential-output current-mode operational amplifier (COA) is described. The amplifier utilizes three second generation current-conveyors (CCII) as the basic building blocks. It can be configured to provide either a constant gain-bandwidth product in a fully balanced current-mode feedback amplifier or a constant bandwidth in a transimpedance feedback amplifier. The amplifier is found to have a gain bandwidth product of 8 MHz, an offset current of 0.8 ¿A (signal-r...

High-throughput screening of suppression subtractive hybridization cDNA libraries using DNA microarray analysis

CSIR Research Space (South Africa)

Van den Berg, N

2004-11-01

Full Text Available Efficient construction of cDNA libraries enriched for differentially expressed transcripts is an important first step in many biological investigations. We present a quantitative procedure for screening cDNA libraries constructed by suppression...

Preparation of Proper Immunogen by Cloning and Stable Expression of cDNA coding for Human Hematopoietic Stem Cell Marker CD34 in NIH-3T3 Mouse Fibroblast Cell Line

Science.gov (United States)

Shafaghat, Farzaneh; Abbasi-Kenarsari, Hajar; Majidi, Jafar; Movassaghpour, Ali Akbar; Shanehbandi, Dariush; Kazemi, Tohid

2015-01-01

Purpose: Transmembrane CD34 glycoprotein is the most important marker for identification, isolation and enumeration of hematopoietic stem cells (HSCs). We aimed in this study to clone the cDNA coding for human CD34 from KG1a cell line and stably express in mouse fibroblast cell line NIH-3T3. Such artificial cell line could be useful as proper immunogen for production of mouse monoclonal antibodies. Methods: CD34 cDNA was cloned from KG1a cell line after total RNA extraction and cDNA synthesis. Pfu DNA polymerase-amplified specific band was ligated to pGEMT-easy TA-cloning vector and sub-cloned in pCMV6-Neo expression vector. After transfection of NIH-3T3 cells using 3 μg of recombinant construct and 6 μl of JetPEI transfection reagent, stable expression was obtained by selection of cells by G418 antibiotic and confirmed by surface flow cytometry. Results: 1158 bp specific band was aligned completely to reference sequence in NCBI database corresponding to long isoform of human CD34. Transient and stable expression of human CD34 on transfected NIH-3T3 mouse fibroblast cells was achieved (25% and 95%, respectively) as shown by flow cytometry. Conclusion: Cloning and stable expression of human CD34 cDNA was successfully performed and validated by standard flow cytometric analysis. Due to murine origin of NIH-3T3 cell line, CD34-expressing NIH-3T3 cells could be useful as immunogen in production of diagnostic monoclonal antibodies against human CD34. This approach could bypass the need for purification of recombinant proteins produced in eukaryotic expression systems. PMID:25789221

Simplified design of IC amplifiers

CERN Document Server

Lenk, John

1996-01-01

Simplified Design of IC Amplifiers has something for everyone involved in electronics. No matter what skill level, this book shows how to design and experiment with IC amplifiers. For experimenters, students, and serious hobbyists, this book provides sufficient information to design and build IC amplifier circuits from 'scratch'. For working engineers who design amplifier circuits or select IC amplifiers, the book provides a variety of circuit configurations to make designing easier.Provides basics for all phases of practical design.Covers the most popular forms for amplif

Enhanced 3D fluorescence live cell imaging on nanoplasmonic substrate

International Nuclear Information System (INIS)

Gartia, Manas Ranjan; Hsiao, Austin; Logan Liu, G; Sivaguru, Mayandi; Chen Yi

2011-01-01

We have created a randomly distributed nanocone substrate on silicon coated with silver for surface-plasmon-enhanced fluorescence detection and 3D cell imaging. Optical characterization of the nanocone substrate showed it can support several plasmonic modes (in the 300-800 nm wavelength range) that can be coupled to a fluorophore on the surface of the substrate, which gives rise to the enhanced fluorescence. Spectral analysis suggests that a nanocone substrate can create more excitons and shorter lifetime in the model fluorophore Rhodamine 6G (R6G) due to plasmon resonance energy transfer from the nanocone substrate to the nearby fluorophore. We observed three-dimensional fluorescence enhancement on our substrate shown from the confocal fluorescence imaging of chinese hamster ovary (CHO) cells grown on the substrate. The fluorescence intensity from the fluorophores bound on the cell membrane was amplified more than 100-fold as compared to that on a glass substrate. We believe that strong scattering within the nanostructured area coupled with random scattering inside the cell resulted in the observed three-dimensional enhancement in fluorescence with higher photostability on the substrate surface.

Enhanced 3D fluorescence live cell imaging on nanoplasmonic substrate

Energy Technology Data Exchange (ETDEWEB)

Gartia, Manas Ranjan [Department of Nuclear, Plasma and Radiological Engineering, University of Illinois, Urbana, IL 61801 (United States); Hsiao, Austin; Logan Liu, G [Department of Bioengineering, University of Illinois, Urbana, IL 61801 (United States); Sivaguru, Mayandi [Institute for Genomic Biology, University of Illinois, Urbana, IL 61801 (United States); Chen Yi, E-mail: loganliu@illinois.edu [Department of Electrical and Computer Engineering, University of Illinois, Urbana, IL 61801 (United States)

2011-09-07

We have created a randomly distributed nanocone substrate on silicon coated with silver for surface-plasmon-enhanced fluorescence detection and 3D cell imaging. Optical characterization of the nanocone substrate showed it can support several plasmonic modes (in the 300-800 nm wavelength range) that can be coupled to a fluorophore on the surface of the substrate, which gives rise to the enhanced fluorescence. Spectral analysis suggests that a nanocone substrate can create more excitons and shorter lifetime in the model fluorophore Rhodamine 6G (R6G) due to plasmon resonance energy transfer from the nanocone substrate to the nearby fluorophore. We observed three-dimensional fluorescence enhancement on our substrate shown from the confocal fluorescence imaging of chinese hamster ovary (CHO) cells grown on the substrate. The fluorescence intensity from the fluorophores bound on the cell membrane was amplified more than 100-fold as compared to that on a glass substrate. We believe that strong scattering within the nanostructured area coupled with random scattering inside the cell resulted in the observed three-dimensional enhancement in fluorescence with higher photostability on the substrate surface.

Partial nucleotide sequences, and routine typing by polymerase chain reaction-restriction fragment length polymorphism, of the brown trout (Salmo trutta) lactate dehydrogenase, LDH-C1*90 and *100 alleles.

Science.gov (United States)

McMeel, O M; Hoey, E M; Ferguson, A

2001-01-01

The cDNA nucleotide sequences of the lactate dehydrogenase alleles LDH-C1*90 and *100 of brown trout (Salmo trutta) were found to differ at position 308 where an A is present in the *100 allele but a G is present in the *90 allele. This base substitution results in an amino acid change from aspartic acid at position 82 in the LDH-C1 100 allozyme to a glycine in the 90 allozyme. Since aspartic acid has a net negative charge whilst glycine is uncharged, this is consistent with the electrophoretic observation that the LDH-C1 100 allozyme has a more anodal mobility relative to the LDH-C1 90 allozyme. Based on alignment of the cDNA sequence with the mouse genomic sequence, a local primer set was designed, incorporating the variable position, and was found to give very good amplification with brown trout genomic DNA. Sequencing of this fragment confirmed the difference in both homozygous and heterozygous individuals. Digestion of the polymerase chain reaction products with BslI, a restriction enzyme specific for the site difference, gave one, two and three fragments for the two homozygotes and the heterozygote, respectively, following electrophoretic separation. This provides a DNA-based means of routine screening of the highly informative LDH-C1* polymorphism in brown trout population genetic studies. Primer sets presented could be used to sequence cDNA of other LDH* genes of brown trout and other species.

The cDNA sequence of a neutral horseradish peroxidase.

Science.gov (United States)

Bartonek-Roxå, E; Eriksson, H; Mattiasson, B

1991-02-16

A cDNA clone encoding a horseradish (Armoracia rusticana) peroxidase has been isolated and characterized. The cDNA contains 1378 nucleotides excluding the poly(A) tail and the deduced protein contains 327 amino acids which includes a 28 amino acid leader sequence. The predicted amino acid sequence is nine amino acids shorter than the major isoenzyme belonging to the horseradish peroxidase C group (HRP-C) and the sequence shows 53.7% identity with this isoenzyme. The described clone encodes nine cysteines of which eight correspond well with the cysteines found in HRP-C. Five potential N-glycosylation sites with the general sequence Asn-X-Thr/Ser are present in the deduced sequence. Compared to the earlier described HRP-C this is three glycosylation sites less. The shorter sequence and fewer N-glycosylation sites give the native isoenzyme a molecular weight of several thousands less than the horseradish peroxidase C isoenzymes. Comparison with the net charge value of HRP-C indicates that the described cDNA clone encodes a peroxidase which has either the same or a slightly less basic pI value, depending on whether the encoded protein is N-terminally blocked or not. This excludes the possibility that HRP-n could belong to either the HRP-A, -D or -E groups. The low sequence identity (53.7%) with HRP-C indicates that the described clone does not belong to the HRP-C isoenzyme group and comparison of the total amino acid composition with the HRP-B group does not place the described clone within this isoenzyme group. Our conclusion is that the described cDNA clone encodes a neutral horseradish peroxidase which belongs to a new, not earlier described, horseradish peroxidase group.

cDNA sequencing improves the detection of P53 missense mutations in colorectal cancer

International Nuclear Information System (INIS)

Szybka, Malgorzata; Kordek, Radzislaw; Zakrzewska, Magdalena; Rieske, Piotr; Pasz-Walczak, Grazyna; Kulczycka-Wojdala, Dominika; Zawlik, Izabela; Stawski, Robert; Jesionek-Kupnicka, Dorota; Liberski, Pawel P

2009-01-01

Recently published data showed discrepancies beteween P53 cDNA and DNA sequencing in glioblastomas. We hypothesised that similar discrepancies may be observed in other human cancers. To this end, we analyzed 23 colorectal cancers for P53 mutations and gene expression using both DNA and cDNA sequencing, real-time PCR and immunohistochemistry. We found P53 gene mutations in 16 cases (15 missense and 1 nonsense). Two of the 15 cases with missense mutations showed alterations based only on cDNA, and not DNA sequencing. Moreover, in 6 of the 15 cases with a cDNA mutation those mutations were difficult to detect in the DNA sequencing, so the results of DNA analysis alone could be misinterpreted if the cDNA sequencing results had not also been available. In all those 15 cases, we observed a higher ratio of the mutated to the wild type template by cDNA analysis, but not by the DNA analysis. Interestingly, a similar overexpression of P53 mRNA was present in samples with and without P53 mutations. In terms of colorectal cancer, those discrepancies might be explained under three conditions: 1, overexpression of mutated P53 mRNA in cancer cells as compared with normal cells; 2, a higher content of cells without P53 mutation (normal cells and cells showing K-RAS and/or APC but not P53 mutation) in samples presenting P53 mutation; 3, heterozygous or hemizygous mutations of P53 gene. Additionally, for heterozygous mutations unknown mechanism(s) causing selective overproduction of mutated allele should also be considered. Our data offer new clues for studying discrepancy in P53 cDNA and DNA sequencing analysis

cDNA cloning of rat and human medium chain acyl-CoA dehydrogenase (MCAD)

International Nuclear Information System (INIS)

Matsubara, Y.; Kraus, J.P.; Rosenberg, L.E.; Tanaka, K.

1986-01-01

MCAD is one of three mitochondrial flavoenzymes which catalyze the first step in the β-oxidation of straight chain fatty acids. It is a tetramer with a subunit Mr of 45 kDa. MCAD is synthesized in the cytosol as a 49 kDa precursor polypeptide (pMCAD), imported into mitochondria, and cleaved to the mature form. Genetic deficiency of MCAD causes recurrent episodes of hypoglycemic coma accompanied by medium chain dicarboxylic aciduria. Employing a novel approach, the authors now report isolation of partial rat and human cDNA clones encoding pMCAD. mRNA encoding pMCAD was purified to near homogeneity by polysome immunoadsorption using polyclonal monospecific antibody. Single-stranded [ 32 P]labeled cDNA probe was synthesized using the enriched mRNA as template, and was used to screen directly 16,000 colonies from a total rat liver cDNA library constructed in pBR322. One clone (600 bp) was detected by in situ hybridization. Hybrid-selected translation with this cDNA yielded a 49 kDa polypeptide indistinguishable in size from rat pMCAD and immunoprecipitable with anti-MCAD antibody. Using the rat cDNA as probe, 43,000 colonies from a human liver cDNA library were screened. Four identical positive clones (400 bp) were isolated and positively identified by hybrid-selected translation and immunoprecipitation. The sizes of rat and human mRNAs encoding pMCAD were 2.2 kb and 2.4 kb, respectively, as determined by Northern blotting

Styl RFLP recognized by a human IRBP cDNA localized to chromosome 10

Energy Technology Data Exchange (ETDEWEB)

Chin, K S; Mathew, C G.P.; Fong, S L; Bridges, C D; Ponder, B A.J.

1988-02-25

A 2184 bp cDNA (H.4 IRBP) encoding human interstitial retinol-biding protein isolated from a human retina cDNA library in lambdagt10 by screening with a bovine IRBP cDNA probe. Styl identifies a 2-allele polymorphism with bands at 2.3 kb (Cl) and 1.95 kb (C2) and invariant bands at 1.1, 1.0 and 0.8kb. Codominant segregation was observed in two informative families. The RFLP was mapped to chromosome 10 using somatic cell hybrids. In situ hybridization suggests regional assignments near p11.2 -q11.2 with a secondary site of hybridization at q24-25.

Ultra-sensitive DNA assay based on single-molecule detection coupled with fluorescent quantum dot-labeling and its application to determination of messenger RNA

Energy Technology Data Exchange (ETDEWEB)

Li Li [School of Chemistry and Chemical Engineering, Shandong University, Jinan 250100 (China); Li Xincang [School of Life Sciences, Shandong University, Jinan 250100 (China); Li Lu [School of Chemistry and Chemical Engineering, Shandong University, Jinan 250100 (China); Wang Jinxing [School of Life Sciences, Shandong University, Jinan 250100 (China); Jin Wenrui, E-mail: jwr@sdu.edu.cn [School of Chemistry and Chemical Engineering, Shandong University, Jinan 250100 (China)

2011-01-24

An ultra-sensitive single-molecule detection (SMD) method for quantification of DNA using total internal reflection fluorescence microscopy (TIRFM) coupled with fluorescent quantum dot (QD)-labeling was developed. In this method, the target DNA (tDNA) was captured by the capture DNA immobilized on the silanized coverslip blocked with ethanolamine and bovine serum albumin. Then, the QD-labeled probe DNA was hybridized to the tDNA. Ten fluorescent images of the QD-labeled sandwich DNA hybrids on the coverslip were taken by a high-sensitive CCD. The tDNA was quantified by counting the bright spots on the images using a calibration curve. The LOD of the method was 1 x 10{sup -14} mol L{sup -1}. Several key factors, including image acquirement, fluorescence probe, substrate preparation, noise elimination from solutions and glass coverslips, and nonspecific adsorption and binding of solution-phase detection probes were discussed in detail. The method could be applied to quantify messenger RNA (mRNA) in cells. In order to determine mRNA, double-stranded RNA-DNA hybrids consisting of mRNA and corresponding cDNA were synthesized from the cellular mRNA template using reverse transcription in the presence of reverse transcriptase. After removing the mRNA in the double-stranded hybrids using ribonuclease, cDNA was quantified using the SMD-based TIRFM. Osteopontin mRNA in decidual stromal cells was chosen as the model analyte.

Study on construction of pEgr-hPTEN expression vector induced by irradiation and its anti-tumor effect in vitro

International Nuclear Information System (INIS)

Tian Mei; Jin Guanghui; Piao Chunji; Li Xiuyi; Liu Linlin

2003-01-01

Objective: To clone the cDNA of human tumor suppressor gene-PTEN, construct pEgr-hPTEN expression vector induced by irradiation and study its inhibitory effect on proliferation of malignant glioma cell line SHG-44 transfected steadily with pEgr-hPTEN after different doses of X-ray irradiation. Methods: A DNA fragment about 1200 bp, PTEN, was amplified from human placenta tissues by using RT-nested PCR and was cloned into pUCm-T vector after automatic sequencing, then the fragment was inserted into a vector pcD-NA3.1-Egr to construct an expression vector pEgr-hPTEN. pEgr-hPTEN was transfected into SHG-44 cells in vitro. Stably transfected cell line SHG-44-sPTEN was selected through G418. The inhibitor effect on SHG-44-sPTEN was observed after different doses of X-ray irradiation in vitro. Results: The PTEN cDNA has been cloned correctly and its expression vector pEgr-hPTEN was also constructed. Growth of SHG-44 cells was inhibited significantly by stable pEgr-hPTEN transfection combined with X-ray irradiation. With the increase of dose, the inhibitory effect was enhanced within 5 Gy. Conclusion: Human tumor suppressor gene-PTEN cDNA has been cloned and its expression vector has been constructed. The tumor was inhibited significantly by gene-radiotherapy in vitro. The result provides the theoretical and experimental basis for improvement of clinical radiotherapeutic effect on tumors

MultiLocus Sequence Analysis- and Amplified Fragment Length Polymorphism-based characterization of xanthomonads associated with bacterial spot of tomato and pepper and their relatedness to Xanthomonas species.

Science.gov (United States)

Hamza, A A; Robene-Soustrade, I; Jouen, E; Lefeuvre, P; Chiroleu, F; Fisher-Le Saux, M; Gagnevin, L; Pruvost, O

2012-05-01

MultiLocus Sequence Analysis (MLSA) and Amplified Fragment Length Polymorphism (AFLP) were used to measure the genetic relatedness of a comprehensive collection of xanthomonads pathogenic to solaneous hosts to Xanthomonas species. The MLSA scheme was based on partial sequences of four housekeeping genes (atpD, dnaK, efp and gyrB). Globally, MLSA data unambiguously identified strains causing bacterial spot of tomato and pepper at the species level and was consistent with AFLP data. Genetic distances derived from both techniques showed a close relatedness of (i) X. euvesicatoria, X. perforans and X. alfalfae and (ii) X. gardneri and X. cynarae. Maximum likelihood tree topologies derived from each gene portion and the concatenated data set for species in the X. campestris 16S rRNA core (i.e. the species cluster comprising all strains causing bacterial spot of tomato and pepper) were not congruent, consistent with the detection of several putative recombination events in our data sets by several recombination search algorithms. One recombinant region in atpD was identified in most strains of X. euvesicatoria including the type strain. Copyright © 2012 Elsevier GmbH. All rights reserved.

Novel fluorescent sequence-related amplified polymorphism(FSRAP markers for the construction of a genetic linkage map of wheat(Triticum aestivum L.

Directory of Open Access Journals (Sweden)

Zhao Lingbo

2017-01-01

Full Text Available Novel fluorescent sequence-related amplified polymorphism (FSRAP markers were developed based on the SRAP molecular marker. Then, the FSRAP markers were used to construct the genetic map of a wheat (Triticum aestivumL. recombinant inbred line population derived from a Chuanmai 42×Chuannong 16 cross. Reproducibility and polymorphism tests indicated that the FSRAP markers have repeatability and better reflect the polymorphism of wheat varieties compared with SRAP markers. A total of 430 polymorphic loci between Chuanmai 42 and Chuannong 16 were detected with 189 FSRAP primer combinations. A total of 281 FSARP markers and 39 SSR markers re classified into 20 linkage groups. The maps spanned a total length of 2499.3cM with an average distance of 7.81cM between markers. A total of 201 markers were mapped on the B genome and covered a distance of 1013cM. On the A genome, 84 markers were mapped and covered a distance of 849.6cM. On the D genome, however, only 35 markers were mapped and covered a distance of 636.7cM. No FSRAP markers were distributed on the 7D chromosome. The results of the present study revealed that the novel FSRAP markers can be used to generate dense, uniform genetic maps of wheat.

Picosecond-resolved FRET on non-amplified DNA for identifying individuals genetically susceptible to type-1 diabetes

Science.gov (United States)

Nardo, Luca; Tosi, Giovanna; Bondani, Maria; Accolla, Roberto; Andreoni, Alessandra

2012-06-01

By tens-of-picosecond resolved fluorescence detection we study Förster resonance energy transfer between a donor and a black-hole-quencher bound at the 5'- and 3'-positions of an oligonucleotide probe matching the highly polymorphic region between codons 51 and 58 of the human leukocyte antigen DQB1 0201 allele, conferring susceptibility to type-1 diabetes. The probe is annealed with non-amplified genomic DNAs carrying either the 0201 sequence or other DQB1 allelic variants. We detect the longest-lived donor fluorescence in the case of hybridization with the 0201 allele and definitely faster and distinct decays for the other allelic variants, some of which are single-nucleotide polymorphic.

Time-synchronized continuous wave laser-induced fluorescence on an oscillatory xenon discharge

Energy Technology Data Exchange (ETDEWEB)

MacDonald, N. A.; Cappelli, M. A. [Stanford Plasma Physics Laboratory, Stanford University, Stanford, California 94305 (United States); Hargus, W. A. Jr. [Air Force Research Laboratory, Edwards AFB, California 93524 (United States)

2012-11-15

A novel approach to time-synchronizing laser-induced fluorescence measurements to an oscillating current in a 60 Hz xenon discharge lamp using a continuous wave laser is presented. A sample-hold circuit is implemented to separate out signals at different phases along a current cycle, and is followed by a lock-in amplifier to pull out the resulting time-synchronized fluorescence trace from the large background signal. The time evolution of lower state population is derived from the changes in intensity of the fluorescence excitation line shape resulting from laser-induced fluorescence measurements of the 6s{sup Prime }[1/2]{sub 1}{sup 0}-6p{sup Prime }[3/2]{sub 2} xenon atomic transition at {lambda}= 834.68 nm. Results show that the lower state population oscillates at twice the frequency of the discharge current, 120 Hz.

Sequence-Related Amplified Polymorphism (SRAP Markers: A Potential Resource for Studies in Plant Molecular Biology

Directory of Open Access Journals (Sweden)

Daniel W. H. Robarts

2014-07-01

Full Text Available In the past few decades, many investigations in the field of plant biology have employed selectively neutral, multilocus, dominant markers such as inter-simple sequence repeat (ISSR, random-amplified polymorphic DNA (RAPD, and amplified fragment length polymorphism (AFLP to address hypotheses at lower taxonomic levels. More recently, sequence-related amplified polymorphism (SRAP markers have been developed, which are used to amplify coding regions of DNA with primers targeting open reading frames. These markers have proven to be robust and highly variable, on par with AFLP, and are attained through a significantly less technically demanding process. SRAP markers have been used primarily for agronomic and horticultural purposes, developing quantitative trait loci in advanced hybrids and assessing genetic diversity of large germplasm collections. Here, we suggest that SRAP markers should be employed for research addressing hypotheses in plant systematics, biogeography, conservation, ecology, and beyond. We provide an overview of the SRAP literature to date, review descriptive statistics of SRAP markers in a subset of 171 publications, and present relevant case studies to demonstrate the applicability of SRAP markers to the diverse field of plant biology. Results of these selected works indicate that SRAP markers have the potential to enhance the current suite of molecular tools in a diversity of fields by providing an easy-to-use. highly variable marker with inherent biological significance.

Improved-Bandwidth Transimpedance Amplifier

Science.gov (United States)

Chapsky, Jacob

2009-01-01

The widest available operational amplifier, with the best voltage and current noise characteristics, is considered for transimpedance amplifier (TIA) applications where wide bandwidth is required to handle fast rising input signals (as for time-of-flight measurement cases). The added amplifier inside the TIA feedback loop can be configured to have slightly lower voltage gain than the bandwidth reduction factor.

Selection of cDNAs differential fragments related to water stress in Ullucus tuberosus Loz. (Bassellaceae) «olluco»

OpenAIRE

Romero-Carpio, Mariela; Estrada-Jiménez, Rolando

2013-01-01

A partir de la expresión diferencial de ARNm de plántulas in vitro de dos accesiones de Ullucus tuberosus Loz. «olluco» altamente tolerantes a estrés osmótico, fueron seleccionados 31 fragmentos diferenciales de ADNc relacionados con tolerancia a sequía. Thirty-one differential fragments of cDNA related to drought tolerance have been selected from the mRNA differential expression of in vitro plantelets belonging to two accessions of Ullucus tuberosus Loz. «olluco» highly tolerant to osmoti...

Human tissue factor: cDNA sequence and chromosome localization of the gene

International Nuclear Information System (INIS)

Scarpati, E.M.; Wen, D.; Broze, G.J. Jr.; Miletich, J.P.; Flandermeyer, R.R.; Siegel, N.R.; Sadler, J.E.

1987-01-01

A human placenta cDNA library in λgt11 was screened for the expression of tissue factor antigens with rabbit polyclonal anti-human tissue factor immunoglobulin G. Among 4 million recombinant clones screened, one positive, λHTF8, expressed a protein that shared epitopes with authentic human brain tissue factor. The 1.1-kilobase cDNA insert of λHTF8 encoded a peptide that contained the amino-terminal protein sequence of human brain tissue factor. Northern blotting identified a major mRNA species of 2.2 kilobases and a minor species of ∼ 3.2 kilobases in poly(A) + RNA of placenta. Only 2.2-kilobase mRNA was detected in human brain and in the human monocytic U937 cell line. In U937 cells, the quantity of tissue factor mRNA was increased several fold by exposure of the cells to phorbol 12-myristate 13-acetate. Additional cDNA clones were selected by hybridization with the cDNA insert of λHTF8. These overlapping isolates span 2177 base pairs of the tissue factor cDNA sequence that includes a 5'-noncoding region of 75 base pairs, an open reading frame of 885 base pairs, a stop codon, a 3'-noncoding region of 1141 base pairs, and a poly(a) tail. The open reading frame encodes a 33-kilodalton protein of 295 amino acids. The predicted sequence includes a signal peptide of 32 or 34 amino acids, a probable extracellular factor VII binding domain of 217 or 219 amino acids, a transmembrane segment of 23 acids, and a cytoplasmic tail of 21 amino acids. There are three potential glycosylation sites with the sequence Asn-X-Thr/Ser. The 3'-noncoding region contains an inverted Alu family repetitive sequence. The tissue factor gene was localized to chromosome 1 by hybridization of the cDNA insert of λHTF8 to flow-sorted human chromosomes

Introducing inducible fluorescent split cholesterol oxidase to mammalian cells.

Science.gov (United States)

Chernov, Konstantin G; Neuvonen, Maarit; Brock, Ivonne; Ikonen, Elina; Verkhusha, Vladislav V

2017-05-26

Cholesterol oxidase (COase) is a bacterial enzyme catalyzing the first step in the biodegradation of cholesterol. COase is an important biotechnological tool for clinical diagnostics and production of steroid drugs and insecticides. It is also used for tracking intracellular cholesterol; however, its utility is limited by the lack of an efficient temporal control of its activity. To overcome this we have developed a regulatable fragment complementation system for COase cloned from Chromobacterium sp. The enzyme was split into two moieties that were fused to FKBP (FK506-binding protein) and FRB (rapamycin-binding domain) pair and split GFP fragments. The addition of rapamycin reconstituted a fluorescent enzyme, termed split GFP-COase, the fluorescence level of which correlated with its oxidation activity. A rapid decrease of cellular cholesterol induced by intracellular expression of the split GFP-COase promoted the dissociation of a cholesterol biosensor D4H from the plasma membrane. The process was reversible as upon rapamycin removal, the split GFP-COase fluorescence was lost, and cellular cholesterol levels returned to normal. These data demonstrate that the split GFP-COase provides a novel tool to manipulate cholesterol in mammalian cells. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

Millimeter-wave power amplifiers

CERN Document Server

du Preez, Jaco

2017-01-01

This book provides a detailed review of millimeter-wave power amplifiers, discussing design issues and performance limitations commonly encountered in light of the latest research. Power amplifiers, which are able to provide high levels of output power and linearity while being easily integrated with surrounding circuitry, are a crucial component in wireless microwave systems. The book is divided into three parts, the first of which introduces readers to mm-wave wireless systems and power amplifiers. In turn, the second focuses on design principles and EDA concepts, while the third discusses future trends in power amplifier research. The book provides essential information on mm-wave power amplifier theory, as well as the implementation options and technologies involved in their effective design, equipping researchers, circuit designers and practicing engineers to design, model, analyze, test and implement high-performance, spectrally clean and energy-efficient mm-wave systems.

Preparation and characterization of the polyclonal antibody against ...

African Journals Online (AJOL)

To prepare the polyclonal antibody against GAR domain, cDNA encoding 466 amino acids protein of GAR domain was amplified from MG-63 cell by RT-PCR. The amplified cDNA, that exhibited 99% identity to the published sequence, was cloned into prokaryotic expression vector pQE-80L for the expression of GAR ...

Oscillators and operational amplifiers

OpenAIRE

Lindberg, Erik

2005-01-01

A generalized approach to the design of oscillators using operational amplifiers as active elements is presented. A piecewise-linear model of the amplifier is used so that it make sense to investigate the eigenvalues of the Jacobian of the differential equations. The characteristic equation of the general circuit is derived. The dynamic nonlinear transfer characteristic of the amplifier is investigated. Examples of negative resistance oscillators are discussed.

Characterization and phylogenetic analysis of lectin gene cDNA isolated from sea cucumber ( Apostichopus japonicus) body wall

Science.gov (United States)

Xue, Zhuang; Li, Hui; Liu, Yang; Zhou, Wei; Sun, Jing; Wang, Xiuli

2017-12-01

As a `living fossil' of species origin and `rich treasure' of food and nutrition development, sea cucumber has received a lot of attentions from researchers. The cDNA library construction and EST sequencing of blood had been conducted previously in our lab. The bioinformatic analysis provided a gene fragment which is highly homologous with the genes of lectin family, named AjL ( Apostichopus japonicus lectin). To characterize and determine the phylogeny of AjL genes in early evolution, we isolated a full-length cDNA of lectin gene from the body wall of A. japonicus. The open reading frame of this gene contained 489 bp and encoded a 163 amino acids secretory protein being homologous to lectins of mammals and aquatic organisms. The deduced protein included a lectin-like domain. SDS-PAGE analysis showed that AjL migrated as a specific band (about 36.09 kDa under reducing), and agglutinated against rabbit red blood cells. AjL was similar to chain A of CEL-IV in space structure. We predicted that AjL may play the same role of CEL-IV. Our results suggested that more than one lectin gene functioned in sea cucumber and most of other species, which was fused by uncertain sequences during the evolution and encoded different proteins with diverse functions. Our findings provided the insights into the function and characteristics of lectin genes invertebrates. The results will also be helpful for the identification and structural, functional, and evolutionary analyses of lectin genes.

FLUIDIC AC AMPLIFIERS.

Science.gov (United States)

Several fluidic tuned AC Amplifiers were designed and tested. Interstage tuning and feedback designs are considered. Good results were obtained...corresponding Q’s as high as 12. Element designs and test results of one, two, and three stage amplifiers are presented. AC Modulated Carrier Systems

A BIOINFORMATIC STRATEGY TO RAPIDLY CHARACTERIZE CDNA LIBRARIES

Science.gov (United States)

A Bioinformatic Strategy to Rapidly Characterize cDNA LibrariesG. Charles Ostermeier1, David J. Dix2 and Stephen A. Krawetz1.1Departments of Obstetrics and Gynecology, Center for Molecular Medicine and Genetics, & Institute for Scientific Computing, Wayne State Univer...

Cloning and functional expression of a cDNA encoding stearoyl-ACP Δ9-desaturase from the endosperm of coconut (Cocos nucifera L.).

Science.gov (United States)

Gao, Lingchao; Sun, Ruhao; Liang, Yuanxue; Zhang, Mengdan; Zheng, Yusheng; Li, Dongdong

2014-10-01

Coconut (Cocos nucifera L.) is an economically tropical fruit tree with special fatty acid compositions. The stearoyl-acyl carrier protein (ACP) desaturase (SAD) plays a key role in the properties of the majority of cellular glycerolipids. In this paper, a full-length cDNA of a stearoyl-acyl carrier protein desaturase, designated CocoFAD, was isolated from cDNA library prepared from the endosperm of coconut (C. nucifera L.). An 1176 bp cDNA from overlapped PCR products containing ORF encoding a 391-amino acid (aa) protein was obtained. The coded protein was virtually identical and shared the homology to other Δ9-desaturase plant sequences (greater than 80% as similarity to that of Elaeis guineensis Jacq). The real-time fluorescent quantitative PCR result indicated that the yield of CocoFAD was the highest in the endosperm of 8-month-old coconut and leaf, and the yield was reduced to 50% of the highest level in the endosperm of 15-month-old coconut. The coding region showed heterologous expression in strain INVSc1 of yeast (Saccharomyces cerevisiae). GC-MS analysis showed that the levels of palmitoleic acid (16:1) and oleic acid (18:1) were improved significantly; meanwhile stearic acid (18:0) was reduced. These results indicated that the plastidial Δ9 desaturase from the endosperm of coconut was involved in the biosynthesis of hexadecenoic acid and octadecenoic acid, which was similar with other plants. These results may be valuable for understanding the mechanism of fatty acid metabolism and the genetic improvement of CocoFAD gene in palm plants in the future. Copyright © 2014 Elsevier B.V. All rights reserved.

AN IMAGE-ANALYSIS TECHNIQUE FOR DETECTION OF RADIATION-INDUCED DNA FRAGMENTATION AFTER CHEF ELECTROPHORESIS

NARCIS (Netherlands)

ROSEMANN, M; KANON, B; KONINGS, AWT; KAMPINGA, HH

CHEF-electrophoresis was used as a technique to detect radiation-induced DNA breakage with special emphasis to biological relevant X-ray doses (0-10 Gy). Fluorescence detection of DNA-fragments using a sensitive image analysis system was directly compared with conventional scintillation counting of

Nucleic Acid Sandwich Hybridization Assay with Quantum Dot-Induced Fluorescence Resonance Energy Transfer for Pathogen Detection

Science.gov (United States)

Chou, Cheng-Chung; Huang, Yi-Han

2012-01-01

This paper reports a nucleic acid sandwich hybridization assay with a quantum dot (QD)-induced fluorescence resonance energy transfer (FRET) reporter system. Two label-free hemagglutinin H5 sequences (60-mer DNA and 630-nt cDNA fragment) of avian influenza viruses were used as the targets in this work. Two oligonucleotides (16 mers and 18 mers) that specifically recognize two separate but neighboring regions of the H5 sequences were served as the capturing and reporter probes, respectively. The capturing probe was conjugated to QD655 (donor) in a molar ratio of 10:1 (probe-to-QD), and the reporter probe was labeled with Alexa Fluor 660 dye (acceptor) during synthesis. The sandwich hybridization assay was done in a 20 μL transparent, adhesive frame-confined microchamber on a disposable, temperature-adjustable indium tin oxide (ITO) glass slide. The FRET signal in response to the sandwich hybridization was monitored by a homemade optical sensor comprising a single 400 nm UV light-emitting diode (LED), optical fibers, and a miniature 16-bit spectrophotometer. The target with a concentration ranging from 0.5 nM to 1 μM was successfully correlated with both QD emission decrease at 653 nm and dye emission increase at 690 nm. To sum up, this work is beneficial for developing a portable QD-based nucleic acid sensor for on-site pathogen detection. PMID:23211753

New cell line development for antibody-producing Chinese hamster ovary cells using split green fluorescent protein

Directory of Open Access Journals (Sweden)

Kim Yeon-Gu

2012-05-01

Full Text Available Abstract Background The establishment of high producer is an important issue in Chinese hamster ovary (CHO cell culture considering increased heterogeneity by the random integration of a transfected foreign gene and the altered position of the integrated gene. Fluorescence-activated cell sorting (FACS-based cell line development is an efficient strategy for the selection of CHO cells in high therapeutic protein production. Results An internal ribosome entry site (IRES was introduced for using two green fluorescence protein (GFP fragments as a reporter to both antibody chains, the heavy chain and the light chain. The cells co-transfected with two GFP fragments showed the emission of green fluorescence by the reconstitution of split GFP. The FACS-sorted pool with GFP expression had a higher specific antibody productivity (qAb than that of the unsorted pool. The qAb was highly correlated with the fluorescence intensity with a high correlation coefficient, evidenced from the analysis of median GFP and qAb in individual selected clones. Conclusions This study proved that the fragment complementation for split GFP could be an efficient indication for antibody production on the basis of high correlation of qAb with reconstitution of GFP. Taken together, we developed an efficient FACS-based screening method for high antibody-producing CHO cells with the benefits of the split GFP system.

Cloning and expression of a cDNA encoding human sterol carrier protein 2

International Nuclear Information System (INIS)

Yamamoto, Ritsu; Kallen, C.B.; Babalola, G.O.; Rennert, H.; Strauss, J.F. III; Billheimer, J.T.

1991-01-01

The authors report the cloning and expression of a cDNA encoding human sterol carrier protein 2 (SCP 2 ). The 1.3-kilobase (kb) cDNA contains an open reading frame which encompasses a 143-amino acid sequence which is 89% identical to the rat SCP 2 amino acid sequence. The deduced amino acid sequence of the polypeptide reveals a 20-residue amino-terminal leader sequence in front of the mature polypeptide, which contains a carboxyl-terminal tripeptide (Ala-Lys-Leu) related to the peroxisome targeting sequence. The expressed cDNA in COS-7 cells yields a 15.3-kDa polypeptide and increased amounts of a 13.2-kDa polypeptide, both reacting with a specific rabbit antiserum to rat liver SCP 2 . The cDNA insert hybridizes with 3.2- and 1.8-kb mRNA species in human liver poly(A) + RNA. In human fibroblasts and placenta the 1.8-kb mRNA was most abundant. Southern blot analysis suggests either that there are multiple copies of the SCP 2 gene in the human genome or that the SCP 2 gene is very large. Coexpression of the SCP 2 cDNA with expression vectors for cholesterol side-chain cleavage enzyme and adrenodoxin resulted in a 2.5-fold enhancement of progestin synthesis over that obtained with expression of the steroidogenic enzyme system alone. These findings are concordant with the notion that SCP 2 plays a role in regulating steroidogenesis, among other possible functions

Construction of a cDNA microarray derived from the ascidian Ciona intestinalis.

Science.gov (United States)

Azumi, Kaoru; Takahashi, Hiroki; Miki, Yasufumi; Fujie, Manabu; Usami, Takeshi; Ishikawa, Hisayoshi; Kitayama, Atsusi; Satou, Yutaka; Ueno, Naoto; Satoh, Nori

2003-10-01

A cDNA microarray was constructed from a basal chordate, the ascidian Ciona intestinalis. The draft genome of Ciona has been read and inferred to contain approximately 16,000 protein-coding genes, and cDNAs for transcripts of 13,464 genes have been characterized and compiled as the "Ciona intestinalis Gene Collection Release I". In the present study, we constructed a cDNA microarray of these 13,464 Ciona genes. A preliminary experiment with Cy3- and Cy5-labeled probes showed extensive differential gene expression between fertilized eggs and larvae. In addition, there was a good correlation between results obtained by the present microarray analysis and those from previous EST analyses. This first microarray of a large collection of Ciona intestinalis cDNA clones should facilitate the analysis of global gene expression and gene networks during the embryogenesis of basal chordates.

An alternative method for cDNA cloning from surrogate eukaryotic cells transfected with the corresponding genomic DNA.

Science.gov (United States)

Hu, Lin-Yong; Cui, Chen-Chen; Song, Yu-Jie; Wang, Xiang-Guo; Jin, Ya-Ping; Wang, Ai-Hua; Zhang, Yong

2012-07-01

cDNA is widely used in gene function elucidation and/or transgenics research but often suitable tissues or cells from which to isolate mRNA for reverse transcription are unavailable. Here, an alternative method for cDNA cloning is described and tested by cloning the cDNA of human LALBA (human alpha-lactalbumin) from genomic DNA. First, genomic DNA containing all of the coding exons was cloned from human peripheral blood and inserted into a eukaryotic expression vector. Next, by delivering the plasmids into either 293T or fibroblast cells, surrogate cells were constructed. Finally, the total RNA was extracted from the surrogate cells and cDNA was obtained by RT-PCR. The human LALBA cDNA that was obtained was compared with the corresponding mRNA published in GenBank. The comparison showed that the two sequences were identical. The novel method for cDNA cloning from surrogate eukaryotic cells described here uses well-established techniques that are feasible and simple to use. We anticipate that this alternative method will have widespread applications.

[Construction of forward and reverse subtracted cDNA libraries between muscle tissue of Meishan and Landrace pigs].

Science.gov (United States)

Xu, De-Quan; Zhang, Yi-Bing; Xiong, Yuan-Zhu; Gui, Jian-Fang; Jiang, Si-Wen; Su, Yu-Hong

2003-07-01

Using suppression subtractive hybridization (SSH) technique, forward and reverse subtracted cDNA libraries were constructed between Longissimus muscles from Meishan and Landrace pigs. A housekeeping gene, G3PDH, was used to estimate the efficiency of subtractive cDNA. In two cDNA libraries, G3PDH was subtracted very efficiently at appropriate 2(10) and 2(5) folds, respectively, indicating that some differentially expressed genes were also enriched at the same folds and the two subtractive cDNA libraries were very successful. A total of 709 and 673 positive clones were isolated from forward and reverse subtracted cDNA libraries, respectively. Analysis of PCR showed that most of all plasmids in the clones contained 150-750 bp inserts. The construction of subtractive cDNA libraries between muscle tissue from different pig breeds laid solid foundations for isolating and identifying the genes determining muscle growth and meat quality, which will be important to understand the mechanism of muscle growth, determination of meat quality and practice of molecular breeding.

cDNA encoding a polypeptide including a hev ein sequence

Energy Technology Data Exchange (ETDEWEB)

Raikhel, Natasha V. (Okemos, MI); Broekaert, Willem F. (Dilbeek, BE); Chua, Nam-Hai (Scarsdale, NY); Kush, Anil (New York, NY)

2000-07-04

A cDNA clone (HEV1) encoding hevein was isolated via polymerase chain reaction (PCR) using mixed oligonucleotides corresponding to two regions of hevein as primers and a Hevea brasiliensis latex cDNA library as a template. HEV1 is 1018 nucleotides long and includes an open reading frame of 204 amino acids. The deduced amino acid sequence contains a putative signal sequence of 17 amino acid residues followed by a 187 amino acid polypeptide. The amino-terminal region (43 amino acids) is identical to hevein and shows homology to several chitin-binding proteins and to the amino-termini of wound-induced genes in potato and poplar. The carboxyl-terminal portion of the polypeptide (144 amino acids) is 74-79% homologous to the carboxyl-terminal region of wound-inducible genes of potato. Wounding, as well as application of the plant hormones abscisic acid and ethylene, resulted in accumulation of hevein transcripts in leaves, stems and latex, but not in roots, as shown by using the cDNA as a probe. A fusion protein was produced in E. coli from the protein of the present invention and maltose binding protein produced by the E. coli.

Assessment of genetic diversity in Chinese eared pheasant using fluorescent-AFLP markers

DEFF Research Database (Denmark)

Li, Xiujuan; Zhu, Yaohong; Liu, Panqi

2010-01-01

on the list of the world’s threatened species. In this paper, 74 individuals from the four eared pheasant species were assessed for population genetic diversity by means of fluorescent-AFLP markers. A total of 429 AFLP peaks were amplified by 11 pairs of fluorescent EcoRI/TaqI primer combinations. Out of all...... using Jaccard’s similarity coefficients (SC) and the corresponding dendrogram. It was found that there was a moderate genetic distance between the four species (SC = 0.674–0.832). Brown eared pheasant was genetically closely related to blue eared pheasant (SC = 0.832), while white eared pheasant...

FastCloning: a highly simplified, purification-free, sequence- and ligation-independent PCR cloning method

Directory of Open Access Journals (Sweden)

Lu Jia

2011-10-01

Full Text Available Abstract Background Although a variety of methods and expensive kits are available, molecular cloning can be a time-consuming and frustrating process. Results Here we report a highly simplified, reliable, and efficient PCR-based cloning technique to insert any DNA fragment into a plasmid vector or into a gene (cDNA in a vector at any desired position. With this method, the vector and insert are PCR amplified separately, with only 18 cycles, using a high fidelity DNA polymerase. The amplified insert has the ends with ~16-base overlapping with the ends of the amplified vector. After DpnI digestion of the mixture of the amplified vector and insert to eliminate the DNA templates used in PCR reactions, the mixture is directly transformed into competent E. coli cells to obtain the desired clones. This technique has many advantages over other cloning methods. First, it does not need gel purification of the PCR product or linearized vector. Second, there is no need of any cloning kit or specialized enzyme for cloning. Furthermore, with reduced number of PCR cycles, it also decreases the chance of random mutations. In addition, this method is highly effective and reproducible. Finally, since this cloning method is also sequence independent, we demonstrated that it can be used for chimera construction, insertion, and multiple mutations spanning a stretch of DNA up to 120 bp. Conclusion Our FastCloning technique provides a very simple, effective, reliable, and versatile tool for molecular cloning, chimera construction, insertion of any DNA sequences of interest and also for multiple mutations in a short stretch of a cDNA.

Fragment virtual screening based on Bayesian categorization for discovering novel VEGFR-2 scaffolds.

Science.gov (United States)

Zhang, Yanmin; Jiao, Yu; Xiong, Xiao; Liu, Haichun; Ran, Ting; Xu, Jinxing; Lu, Shuai; Xu, Anyang; Pan, Jing; Qiao, Xin; Shi, Zhihao; Lu, Tao; Chen, Yadong

2015-11-01

The discovery of novel scaffolds against a specific target has long been one of the most significant but challengeable goals in discovering lead compounds. A scaffold that binds in important regions of the active pocket is more favorable as a starting point because scaffolds generally possess greater optimization possibilities. However, due to the lack of sufficient chemical space diversity of the databases and the ineffectiveness of the screening methods, it still remains a great challenge to discover novel active scaffolds. Since the strengths and weaknesses of both fragment-based drug design and traditional virtual screening (VS), we proposed a fragment VS concept based on Bayesian categorization for the discovery of novel scaffolds. This work investigated the proposal through an application on VEGFR-2 target. Firstly, scaffold and structural diversity of chemical space for 10 compound databases were explicitly evaluated. Simultaneously, a robust Bayesian classification model was constructed for screening not only compound databases but also their corresponding fragment databases. Although analysis of the scaffold diversity demonstrated a very unevenly distribution of scaffolds over molecules, results showed that our Bayesian model behaved better in screening fragments than molecules. Through a literature retrospective research, several generated fragments with relatively high Bayesian scores indeed exhibit VEGFR-2 biological activity, which strongly proved the effectiveness of fragment VS based on Bayesian categorization models. This investigation of Bayesian-based fragment VS can further emphasize the necessity for enrichment of compound databases employed in lead discovery by amplifying the diversity of databases with novel structures.

Cloning of the relative genes of endocrine exophthalmos

International Nuclear Information System (INIS)

Zheng, JG

2004-01-01

Aim: In order to clarify the pathogenesis of endocrine exophthalmos, and lay foundations for finding the new functions of its relative genes, the cloning of its relative genes was carried out. Methods: The thyroid tissues of 10 hyperthyroidism patients, 5 of them with endocrine exophthalmos and 5 without that, were obtained. Their mRNA were collected respectively by using Quick Prep Micro mRNA purification kit. Then the same amount of the mRNA from 5 patients with endocrine exophthalmos was added into an eppendorf tube to form a mRNA pool. And that of the 5 patients without endocrine exophthalmos was also prepared as the other pool. As a model, the pool was used to synthesize the single and double chains of cDNA through SMART Tm PCR cDNA Synthesis Kit. The double chains cDNA from the endocrine exophthalmos patients, being used as tester, and that from the patients without endocrine exophthalmos, being used as driver, were digested by restriction endonucleases Hae III to get the fragments which was less than 500 bases. The tester cDNA was ligated with adapt or 1 or 2 respectively. Then the subtractive suppressive hybridization was performed between tester and driver cDNA. And the efficacies of subtraction were measured. The differential genes between the thyroid tissues of endocrine exophthalmos and the thyroid tissues without endocrine exophthalmos were obtained through two cycles of subtractive hybridization and two cycles PCR. The differential genes were cloned into the vector of pT-Adv, and then transformed into E.coliDH5a. 48 white clonies were selected to build the subtractive suppressive library of the relative genes of endocrine exophthalmos. The primer 2 was applied for the colony PCR of the relative genes. The amplified genes were obtained and purified by using Quaqwich Spine PCR Purification Kit. According to the principle of random primer, the double chains cDNA from the thyroid tissues with or without endocrine exophthalmos were digested by Hae III

cDNA fingerprinting of osteoprogenitor cells to isolate differentiation stage-specific genes.

OpenAIRE

Candeliere, G A; Rao, Y; Floh, A; Sandler, S D; Aubin, J E

1999-01-01

A cDNA fingerprinting strategy was developed to identify genes based on their differential expression pattern during osteoblast development. Preliminary biological and molecular staging of cDNA pools prepared by global amplification PCR allowed discrim-inating choices to be made in selection of expressed sequence tags (ESTs) to be isolated. Sequencing of selected ESTs confirmed that both known and novel genes can be isolated from any developmental stage of interest, e.g. from primitive progen...

Construction and identification of eukaryotic expression vector of pcDNA3-UHRF1

International Nuclear Information System (INIS)

Li Xinli; Zhu Ran; Zhu Wei; Fan Saijun; Meng Qinghui

2011-01-01

Objective: To generate eukaryotic expression vector of pcDNA3-UHRF1(ubiquitin-like, containing PHD and RING finger domains 1, UHRF1) and testify its expression in breast cancer cells MDA-MB-231. Methods: A 2.3 kb cDNA fragment was amplified from the total RNA of the human breast cancer cells MCF-7 by the RT-PCR method and was cloned into the plasmid pcDNA3. The vector was identified by the double digestion with restriction enzymes Kpn I and Xho I and was sequenced. The cDNA of UHRF1 was transfected into human breast cancer cells MDA-MB-231 by Lipofactamin2000. The positive clones were selected by G418. The expression of the UHRF1 was detected by RT-PCR and Western blot analysis. Results: The recombinant eukaryotic expression vector pcDNA3-UHRF1 was digested with Kpn I and BamH I, and the electrophoresis of the digested products showed two fragments; 2.3kb fragment of UHRF1 and 5.4 kb fragment of pcDNA3, and the sequence inserted was identical to the published sequence. The MDA-MB-231 cells transfected with the pcDNA3-UHRF1 plasmid expressed a high level of the UHRF1 mRNA and protein. Conclusion: The recombinant eukaryotic cell expression vector of pcDNA3-UHRF1 is constructed successfully. The recombinant plasmid pcDNA3-UHRF1 can provide a very useful tool and lay an important foundation for the research on the function of UHRF1. (authors)

A CMOS current-mode operational amplifier

DEFF Research Database (Denmark)

Kaulberg, Thomas

1993-01-01

current-mode feedback amplifier or a constant bandwidth in a transimpedance feedback amplifier. The amplifier is found to have a gain-bandwidth product of 3 MHz, an offset current of 0.8 μA (signal range ±700 μA), and a (theoretically) unlimited slew rate. The amplifier is realized in a standard CMOS 2......A fully differential-input, differential-output, current-mode operational amplifier (COA) is described. The amplifier utilizes three second-generation current conveyors (CCIIs) as the basic building blocks. It can be configured to provide either a constant gain-bandwidth product in a fully balanced...

Sequence-related amplified polymorphism (SRAP) markers: A potential resource for studies in plant molecular biology1

Science.gov (United States)

Robarts, Daniel W. H.; Wolfe, Andrea D.

2014-01-01

In the past few decades, many investigations in the field of plant biology have employed selectively neutral, multilocus, dominant markers such as inter-simple sequence repeat (ISSR), random-amplified polymorphic DNA (RAPD), and amplified fragment length polymorphism (AFLP) to address hypotheses at lower taxonomic levels. More recently, sequence-related amplified polymorphism (SRAP) markers have been developed, which are used to amplify coding regions of DNA with primers targeting open reading frames. These markers have proven to be robust and highly variable, on par with AFLP, and are attained through a significantly less technically demanding process. SRAP markers have been used primarily for agronomic and horticultural purposes, developing quantitative trait loci in advanced hybrids and assessing genetic diversity of large germplasm collections. Here, we suggest that SRAP markers should be employed for research addressing hypotheses in plant systematics, biogeography, conservation, ecology, and beyond. We provide an overview of the SRAP literature to date, review descriptive statistics of SRAP markers in a subset of 171 publications, and present relevant case studies to demonstrate the applicability of SRAP markers to the diverse field of plant biology. Results of these selected works indicate that SRAP markers have the potential to enhance the current suite of molecular tools in a diversity of fields by providing an easy-to-use, highly variable marker with inherent biological significance. PMID:25202637

Sequence-related amplified polymorphism (SRAP) markers: A potential resource for studies in plant molecular biology(1.).

Science.gov (United States)

Robarts, Daniel W H; Wolfe, Andrea D

2014-07-01

In the past few decades, many investigations in the field of plant biology have employed selectively neutral, multilocus, dominant markers such as inter-simple sequence repeat (ISSR), random-amplified polymorphic DNA (RAPD), and amplified fragment length polymorphism (AFLP) to address hypotheses at lower taxonomic levels. More recently, sequence-related amplified polymorphism (SRAP) markers have been developed, which are used to amplify coding regions of DNA with primers targeting open reading frames. These markers have proven to be robust and highly variable, on par with AFLP, and are attained through a significantly less technically demanding process. SRAP markers have been used primarily for agronomic and horticultural purposes, developing quantitative trait loci in advanced hybrids and assessing genetic diversity of large germplasm collections. Here, we suggest that SRAP markers should be employed for research addressing hypotheses in plant systematics, biogeography, conservation, ecology, and beyond. We provide an overview of the SRAP literature to date, review descriptive statistics of SRAP markers in a subset of 171 publications, and present relevant case studies to demonstrate the applicability of SRAP markers to the diverse field of plant biology. Results of these selected works indicate that SRAP markers have the potential to enhance the current suite of molecular tools in a diversity of fields by providing an easy-to-use, highly variable marker with inherent biological significance.

Genetic relationship and diversity in a sesame (Sesamum indicum L. germplasm collection using amplified fragment length polymorphism (AFLP

Directory of Open Access Journals (Sweden)

Karlovsky Petr

2006-02-01

Full Text Available Abstract Background Sesame is an important oil crop in tropical and subtropical areas. Despite its nutritional value and historic and cultural importance, the research on sesame has been scarce, particularly as far as its genetic diversity is concerned. The aims of the present study were to clarify genetic relationships among 32 sesame accessions from the Venezuelan Germplasm Collection, which represents genotypes from five diversity centres (India, Africa, China-Korea-Japan, Central Asia and Western Asia, and to determine the association between geographical origin and genetic diversity using amplified fragment length polymorphism (AFLP. Results Large genetic variability was found within the germplasm collection. A total of 457 AFLP markers were recorded, 93 % of them being polymorphic. The Jaccard similarity coefficient ranged from 0.38 to 0.85 between pairs of accessions. The UPGMA dendrogram grouped 25 of 32 accessions in two robust clusters, but it has not revealed any association between genotype and geographical origin. Indian, African and Chinese-Korean-Japanese accessions were distributed throughout the dendrogram. A similar pattern was obtained using principal coordinates analysis. Genetic diversity studies considering five groups of accessions according to the geographic origin detected that only 20 % of the total diversity was due to diversity among groups using Nei's coefficient of population differentiation. Similarly, only 5% of the total diversity was attributed to differences among groups by the analysis of molecular variance (AMOVA. This small but significant difference was explained by the fact that the Central Asia group had a lower genetic variation than the other diversity centres studied. Conclusion We found that our sesame collection was genetically very variable and did not show an association between geographical origin and AFLP patterns. This result suggests that there was considerable gene flow among diversity centres

cDNA cloning and mRNA expression of heat shock protein 70 gene ...

African Journals Online (AJOL)

In this study, the full-length heat shock protein 70 of Tegillarca granosa was cloned from cDNA library by rapid amplification of cDNA end (RACE). The open reading frame (ORF) of heat shock protein 70 was 1968 bp, and it encoded a protein of 655 amino acids with a predicted molecular weight of 71.48 kDa and an ...

Modeling of semiconductor optical amplifiers

DEFF Research Database (Denmark)

Mørk, Jesper; Bischoff, Svend; Berg, Tommy Winther

We discuss the modelling of semiconductor optical amplifiers with emphasis on their high-speed properties. Applications in linear amplification as well as ultrafast optical signal processing are reviewed. Finally, the possible role of quantum-dot based optical amplifiers is discussed.......We discuss the modelling of semiconductor optical amplifiers with emphasis on their high-speed properties. Applications in linear amplification as well as ultrafast optical signal processing are reviewed. Finally, the possible role of quantum-dot based optical amplifiers is discussed....

NASA developments in solid state power amplifiers

Science.gov (United States)

Leonard, Regis F.

1990-01-01

Over the last ten years, NASA has undertaken an extensive program aimed at development of solid state power amplifiers for space applications. Historically, the program may be divided into three phases. The first efforts were carried out in support of the advanced communications technology satellite (ACTS) program, which is developing an experimental version of a Ka-band commercial communications system. These first amplifiers attempted to use hybrid technology. The second phase was still targeted at ACTS frequencies, but concentrated on monolithic implementations, while the current, third phase, is a monolithic effort that focusses on frequencies appropriate for other NASA programs and stresses amplifier efficiency. The topics covered include: (1) 20 GHz hybrid amplifiers; (2) 20 GHz monolithic MESFET power amplifiers; (3) Texas Instruments' (TI) 20 GHz variable power amplifier; (4) TI 20 GHz high power amplifier; (5) high efficiency monolithic power amplifiers; (6) GHz high efficiency variable power amplifier; (7) TI 32 GHz monolithic power amplifier performance; (8) design goals for Hughes' 32 GHz variable power amplifier; and (9) performance goals for Hughes' pseudomorphic 60 GHz power amplifier.

HIGH AVERAGE POWER OPTICAL FEL AMPLIFIERS

International Nuclear Information System (INIS)

2005-01-01

Historically, the first demonstration of the optical FEL was in an amplifier configuration at Stanford University [l]. There were other notable instances of amplifying a seed laser, such as the LLNL PALADIN amplifier [2] and the BNL ATF High-Gain Harmonic Generation FEL [3]. However, for the most part FELs are operated as oscillators or self amplified spontaneous emission devices. Yet, in wavelength regimes where a conventional laser seed can be used, the FEL can be used as an amplifier. One promising application is for very high average power generation, for instance FEL's with average power of 100 kW or more. The high electron beam power, high brightness and high efficiency that can be achieved with photoinjectors and superconducting Energy Recovery Linacs (ERL) combine well with the high-gain FEL amplifier to produce unprecedented average power FELs. This combination has a number of advantages. In particular, we show that for a given FEL power, an FEL amplifier can introduce lower energy spread in the beam as compared to a traditional oscillator. This properly gives the ERL based FEL amplifier a great wall-plug to optical power efficiency advantage. The optics for an amplifier is simple and compact. In addition to the general features of the high average power FEL amplifier, we will look at a 100 kW class FEL amplifier is being designed to operate on the 0.5 ampere Energy Recovery Linac which is under construction at Brookhaven National Laboratory's Collider-Accelerator Department

Electrospun amplified fiber optics.

Science.gov (United States)

Morello, Giovanni; Camposeo, Andrea; Moffa, Maria; Pisignano, Dario

2015-03-11

All-optical signal processing is the focus of much research aiming to obtain effective alternatives to existing data transmission platforms. Amplification of light in fiber optics, such as in Erbium-doped fiber amplifiers, is especially important for efficient signal transmission. However, the complex fabrication methods involving high-temperature processes performed in a highly pure environment slow the fabrication process and make amplified components expensive with respect to an ideal, high-throughput, room temperature production. Here, we report on near-infrared polymer fiber amplifiers working over a band of ∼20 nm. The fibers are cheap, spun with a process entirely carried out at room temperature, and shown to have amplified spontaneous emission with good gain coefficients and low levels of optical losses (a few cm(-1)). The amplification process is favored by high fiber quality and low self-absorption. The found performance metrics appear to be suitable for short-distance operations, and the large variety of commercially available doping dyes might allow for effective multiwavelength operations by electrospun amplified fiber optics.

A retinoic acid receptor cDNA probe (RAR2) identifies a moderately frequent RFLP on chromosome 17

Energy Technology Data Exchange (ETDEWEB)

Bale, A E; Weinberger, C; McBride, O W [National Cancer Institute, Bethesda, MD (USA)

1988-08-11

RAR2, a 0.72 kb EcoRI, PvuII fragment from the 5{prime} end of the retinoic acid receptor cDNA probe was isolated. PstI identifies a constant band at 0.87 kb and a simple two allele polymorphism with a band at either 3.3 kb (A1) or 2.9 kb (A2). In 38 random blood donors, the frequency of the 3.3 kb allele (A1) was 0.29 and of the 2.9 kb allele (A2) was 0.71. The polymorphic bands and the 0.87 kb constant band segregated with chromosome 17 in 88 human-rodent somatic cell hybrids. Co-dominant inheritance was shown in 35 individuals from 5 informative families. Weak constant bands at 6.4 kb, 4.0 kb and 1.4 kb did not cosegregate with the polymorphic bands in somatic cell hybrids and could be eliminated by increasing the wash stringency.

[Construction and identification of Nogo extra cellular peptide residues 1-40 gene lentiviral vector].

Science.gov (United States)

Yuan, Haifeng; Song, Yueming; Liu, Hao; Zhou, Chunguang; Kong, Qingquan; Liu, Liming; Gong, Quan

2012-02-01

To construct a lentiviral expression vector carrying Nogo extra cellular peptide residues 1-40 (NEP1-40) and to obtain NEP1-40 efficient and stable expression in mammalian cells. The DNA fragment of NEP1-40 coding sequence was amplified by PCR with designed primer from the cDNA library including NEP1-40 gene, and then subcloned into pGC-FU vector with in-fusion technique to generate the lentiviral expression vector, pGC-FU-NEP1-40. The positive clones were screened by PCR and the correct NEP1-40 was confirmed by sequencing. Recombinant lentiviruses were produced in 293T cells after the cotransfection of pGC-FU-NEP1-40, and packaging plasmids of pHelper 1.0 and pHelper 2.0. Green fluorescent protein (GFP) expression of infected 293T cells was observed to evaluate gene delivery efficiency. NEP1-40 protein expression in 293T cells was detected by Western blot. The lentiviral expression vector carrying NEP1-40 was successfully constructed by GFP observation, and NEP1-40 protein expression was detected in 293T cells by Western blot. The recombinant lentivirus pGC-FU-NEP1-40 is successfully constructed and it lays a foundation for further molecular function study of NEP 1-40.

Metal Enhanced Fluorescence on Super-Hydrophobic Clusters of Gold Nanoparticles

KAUST Repository

Battista, Edmondo; Coluccio, Maria Laura; Alabastri, Alessandro; Barberio, Marianna; Causa, Filippo; Netti, Paolo Antonio; Di Fabrizio, Enzo M.; Gentile, Francesco

2016-01-01

We used optical lithography, electroless deposition and deep reactive ion etching techniques to realize arrays of super-hydrophobic gold nanoparticles arranged in a hierarchical structure. At the micro-scale, silicon-micro pillars in the chip permit to manipulate and concentrate biological solutions, at the nano-scale, gold nanoparticles enable metal enhanced fluorescence (MEF) effects, whereby fluorescence signal of fluorophores in close proximity to a rough metal surface is amplified by orders of magnitude. Here, we demonstrated the device in the analysis of fluorescein derived gold-binding peptides (GBP-FITC). While super-hydrophobic schemes and MEF effects have been heretofore used in isolation, their integration in a platform may advance the current state of fluorescence-based sensing technology in medical diagnostics and biotechnology. This scheme may be employed in protein microarrays where the increased sensitivity of the device may enable the early detection of cancer biomarkers or other proteins of biomedical interest.

Metal Enhanced Fluorescence on Super-Hydrophobic Clusters of Gold Nanoparticles

KAUST Repository

Battista, Edmondo

2016-12-15

We used optical lithography, electroless deposition and deep reactive ion etching techniques to realize arrays of super-hydrophobic gold nanoparticles arranged in a hierarchical structure. At the micro-scale, silicon-micro pillars in the chip permit to manipulate and concentrate biological solutions, at the nano-scale, gold nanoparticles enable metal enhanced fluorescence (MEF) effects, whereby fluorescence signal of fluorophores in close proximity to a rough metal surface is amplified by orders of magnitude. Here, we demonstrated the device in the analysis of fluorescein derived gold-binding peptides (GBP-FITC). While super-hydrophobic schemes and MEF effects have been heretofore used in isolation, their integration in a platform may advance the current state of fluorescence-based sensing technology in medical diagnostics and biotechnology. This scheme may be employed in protein microarrays where the increased sensitivity of the device may enable the early detection of cancer biomarkers or other proteins of biomedical interest.

Ball-milled nano-colloids of rare-earth compounds as liquid gain media for capillary optical amplifiers and lasers

Science.gov (United States)

Patel, Darayas; Blockmon, Avery; Ochieng, Vanesa; Lewis, Ashley; Wright, Donald M.; Lewis, Danielle; Valentine, Rueben; Valentine, Maucus; Wesley, Dennis; Sarkisov, Sergey S.; Darwish, Abdalla M.; Sarkisov, Avedik S.

2017-02-01

Nano-colloids and nano-crystals doped with ions of rare-earth elements have recently attracted a lot of attention in the scientific community due to their potential applications as biomarkers, fluorescent inks, gain media for lasers and optical amplifiers. Many rare-earth doped materials of different compositions, shapes and size distribution have been prepared by different synthetic methods, such as chemical vapor deposition, sol-gel process, micro-emulsion techniques, gas phase condensation methods, hydrothermal methods and laser ablation. In this paper micro-crystalline powder of the rare-earthdoped compound NaYF4:Yb3+, Er3+ was synthesized using a simple wet process followed by baking in open air. Under 980 nm diode laser excitation strong fluorescence in the 100 nm band around 1531-nm peak was observed from the synthesized micro-powder. The micro-powder was pulverized using a ball mill and prepared in the form of nano-colloids in different liquids. The particle size of the obtained nano-colloids was measured using an atomic force microscope and a dynamic light scatterometer. The size of the nano-particles was close to 100-nm. The nano-colloids were utilized as a filling media in capillary optical amplifiers and lasers. The gain of a 7-cm-long capillary optical amplifier (150-micron inner diameter) was as high as 6 dB at 200 mW pump power. The synthesized nano-colloids and the active optical components using them can be potentially used in optical communication, signal processing, optical computing, and other applications.

Chemical characterization of archaeological ceramics fragments by X-ray (μ-XRF) micro fluorescence

International Nuclear Information System (INIS)

Silva, Richard Maximiliano da Cunha e; Nascimento Filho, Virgilio Franco do; Appoloni, Carlos Roberto; Perez, Carlos Alberto

2002-01-01

The concentrations of the inorganic chemical elements presents in archaeological ceramic samples and clay samples allows the study about the clay sources determination used in the ceramic production. The analyzed samples are fragments of Brazilian indigenous ceramic, found in the area of the city of Londrina, North of Parana, and they belong to the archaeological collection of the 'Padre Carlos Weiss' Historical Museum, of the State University of Londrina. The determination of the chemical elements in these fragments was performed by energy dispersive X-ray microfluorescence (μ-XRF), for being not destructive and multielementar. The analytic technique allowed the identification of the K, Ca, Ti, Mn, Fe minority elements, and the Cr, Ni, Cu, Zn and Rb trace elements. The cluster analysis for the method of the medium grouping was used, and it was obtained two different groups, taking to conclude that indigenous Tupiguaranis used two clay sources in the making of its ceramic. (author)

Genetic barcoding with fluorescent proteins for multiplexed applications.

Science.gov (United States)

Smurthwaite, Cameron A; Williams, Wesley; Fetsko, Alexandra; Abbadessa, Darin; Stolp, Zachary D; Reed, Connor W; Dharmawan, Andre; Wolkowicz, Roland

2015-04-14

Fluorescent proteins, fluorescent dyes and fluorophores in general have revolutionized the field of molecular cell biology. In particular, the discovery of fluorescent proteins and their genes have enabled the engineering of protein fusions for localization, the analysis of transcriptional activation and translation of proteins of interest, or the general tracking of individual cells and cell populations. The use of fluorescent protein genes in combination with retroviral technology has further allowed the expression of these proteins in mammalian cells in a stable and reliable manner. Shown here is how one can utilize these genes to give cells within a population of cells their own biosignature. As the biosignature is achieved with retroviral technology, cells are barcoded 'indefinitely'. As such, they can be individually tracked within a mixture of barcoded cells and utilized in more complex biological applications. The tracking of distinct populations in a mixture of cells is ideal for multiplexed applications such as discovery of drugs against a multitude of targets or the activation profile of different promoters. The protocol describes how to elegantly develop and amplify barcoded mammalian cells with distinct genetic fluorescent markers, and how to use several markers at once or one marker at different intensities. Finally, the protocol describes how the cells can be further utilized in combination with cell-based assays to increase the power of analysis through multiplexing.

Screening and identification of male-specific DNA fragments in common carps Cyprinus carpio using suppression subtractive hybridization.

Science.gov (United States)

Chen, J J; Du, Q Y; Yue, Y Y; Dang, B J; Chang, Z J

2010-08-01

In this study, a sex subtractive genomic DNA library was constructed using suppression subtractive hybridization (SSH) between male and female Cyprinus carpio. Twenty-two clones with distinguishable hybridization signals were selected and sequenced. The specific primers were designed based on the sequence data. Those primers were then used to amplify the sex-specific fragments from the genomic DNA of male and female carp. The amplified fragments from two clones showed specificity to males but not to females, which were named as Ccmf2 [387 base pairs (bp)] and Ccmf3 (183 bp), respectively. The sex-specific pattern was analysed in a total of 40 individuals from three other different C. carpio. stocks and grass carp Ctenopharyngodon idella using Ccmf2 and Ccmf3 as dot-blotting probes. The results revealed that the molecular diversity exists on the Y chromosome of C. carpio. No hybridization signals, however, were detected from individuals of C. idella, suggesting that the two sequences are specific to C. carpio. No significant homologous sequences of Ccmf2 and Ccmf3 were found in GenBank. Therefore, it was interpreted that the results as that Ccmf2 and Ccmf3 are two novel male-specific sequences; and both fragments could be used as markers to rapidly and accurately identify the genetic sex of part of C. carpio. This may provide a very efficient selective tool for practically breeding monosex female populations in aquacultural production.

Indocyanine Green-Loaded Polydopamine-Reduced Graphene Oxide Nanocomposites with Amplifying Photoacoustic and Photothermal Effects for Cancer Theranostics.

Science.gov (United States)

Hu, Dehong; Zhang, Jingnan; Gao, Guanhui; Sheng, Zonghai; Cui, Haodong; Cai, Lintao

2016-01-01

Photoacoustic (PA) imaging and photothermal therapy (PTT) as light-induced theranostic platforms have been attracted much attention in recent years. However, the development of highly efficient and integrated phototheranostic nanoagents for amplifying PA imaging and PTT treatments poses great challenges. Here, we report a novel phototheranostic nanoagent using indocyanine green-loaded polydopamine-reduced graphene oxide nanocomposites (ICG-PDA-rGO) with amplifying PA and PTT effects for cancer theranostics. The results demonstrate that the PDA layer coating on the surface of rGO could effectively absorb a large number of ICG molecules, quench ICG's fluorescence, and enhance the PDA-rGO's optical absorption at 780 nm. The obtained ICG-PDA-rGO exhibits stronger PTT effect and higher PA contrast than that of pure GO and PDA-rGO. After PA imaging-guided PTT treatments, the tumors in 4T1 breast subcutaneous and orthotopic mice models are suppressed completely and no treatment-induced toxicity being observed. It illustrates that the ICG-PDA-rGO nanocomposites constitute a new class of theranostic nanomedicine for amplifying PA imaging and PTT treatments.

Cloning and cDNA sequence of the dihydrolipoamide dehydrogenase component of human α-ketoacid dehydrogenase complexes

International Nuclear Information System (INIS)

Pons, G.; Raefsky-Estrin, C.; Carothers, D.J.; Pepin, R.A.; Javed, A.A.; Jesse, B.W.; Ganapathi, M.K.; Samols, D.; Patel, M.S.

1988-01-01

cDNA clones comprising the entire coding region for human dihydrolipoamide dehydrogenase have been isolated from a human liver cDNA library. The cDNA sequence of the largest clone consisted of 2082 base pairs and contained a 1527-base open reading frame that encodes a precursor dihydrolipoamide dehydrogenase of 509 amino acid residues. The first 35-amino acid residues of the open reading frame probably correspond to a typical mitochondrial import leader sequence. The predicted amino acid sequence of the mature protein, starting at the residue number 36 of the open reading frame, is almost identical (>98% homology) with the known partial amino acid sequence of the pig heart dihydrolipoamide dehydrogenase. The cDNA clone also contains a 3' untranslated region of 505 bases with an unusual polyadenylylation signal (TATAAA) and a short poly(A) track. By blot-hybridization analysis with the cDNA as probe, two mRNAs, 2.2 and 2.4 kilobases in size, have been detected in human tissues and fibroblasts, whereas only one mRNA (2.4 kilobases) was detected in rat tissues

Cloning, sequencing and expression of cDNA encoding growth ...

Indian Academy of Sciences (India)

Unknown

of medicine, animal husbandry, fish farming and animal ..... northern pike (Esox lucius) growth hormone; Mol. Mar. Biol. ... prolactin 1-luciferase fusion gene in African catfish and ... 1988 Cloning and sequencing of cDNA that encodes goat.

Fast pulse amplifier

International Nuclear Information System (INIS)

Lepetit, J.; Poussier, E.

1984-01-01

This amplifier comprises an inverter transformer, the primary circuit of which receives a pulse and the secondary circuit of which is connected to several amplifying elements in parallel. The inverter transformer is made of coaxial cable segments winded around a magnetic torus; the cable cores connected in series constitute the primary circuit and the braiding of cables, connected in parallel, are the secondary circuit. The transformer comprises, besides, delay lines in series with each braiding of the secondary circuit, these ones are such that pulses issued from each braiding arrive together to the secondary circuit connectors. This invention applies, noticeably in the case of a high voltage amplifier, to the control of deflection blocks of particles used in medicine or in particle accelerators [fr

A fluidic/pneumatic interface amplifier

Science.gov (United States)

Limbert, D. E.; Kegel, T. M.

The development of a low cost, reliable, linear pressure amplifier to interface Laminar Proportional Amplifiers (LPA) to pneumatic controllers is presented. The amplifier consists of an LPA input stage and an output stage consisting of a venturi in series with a bellows nozzle valve. The LPA output drives the bellows nozzle valve thereby altering the flowrate through the venturi. The pressure within the venturi throat region, which is the amplifier output, changes with the flowrate. Non-linear characteristics, due to supersonic flow within the venturi, are altered through the use of feedback to the LPA input. A computer based model, to aid in optimizing the amplifier design, is developed. This model incorporates the effects of shock waves and boundary layers within the venturi. Good correspondence between the model and an experimental prototype is shown.

Isolation and characterization of cDNA clones for carrot extensin and a proline-rich 33-kDa protein

International Nuclear Information System (INIS)

Chen, J.; Varner, J.E.

1985-01-01

Extensins are hydroxyproline-rich glycoproteins associated with most dicotyledonous plant cell walls. To isolate cDNA clones encoding extensin, the authors started by isolating poly(A) + RNA from carrot root tissue, and then translating the RNA in vitro, in the presence of tritiated leucine or proline. A 33-kDa peptide was identified in the translation products as a putative extensin precursor. From a cDNA library constructed with poly(A) + RNA from wounded carrots, one cDNA clone (pDC5) was identified that specifically hybridized to poly(A) + RNA encoding this 33-kDa peptide. They isolated three cDNA clones (pDC11, pDC12, and pDC16) from another cDNA library using pCD5 as a probe. DNA sequence data, RNA hybridization analysis, and hybrid released in vitro translation indicate that the cDNA clones pDC11 encodes extensin and that cDNA clones pDC12 and pDC16 encode the 33-kDa peptide, which as yet has an unknown identity and function. The assumption that the 33-kDa peptide was an extensin precursor was invalid. RNA hybridization analysis showed that RNA encoded by both clone types is accumulated upon wounding

cDNA cloning of a snake venom metalloproteinase from the eastern diamondback rattlesnake (Crotalus adamanteus), and the expression of its disintegrin domain with anti-platelet effects

Science.gov (United States)

Suntravat, Montamas; Jia, Ying; Lucena, Sara E.; Sánchez, Elda E.; Pérez, John C.

2013-01-01

A 5′ truncated snake venom metalloproteinase was identified from a cDNA library constructed from venom glands of an eastern diamondback rattlesnake (Crotalus adamanteus). The 5′-rapid amplification of cDNA ends (RACE) was used to obtain the 1865 bp full-length cDNA sequence of a snake venom metalloproteinase (CamVMPII). CamVMPII encodes an open reading frame of 488 amino acids, which includes a signal peptide, a pro-domain, a metalloproteinase domain, a spacer, and an RGD-disintegrin domain. The predicted amino acid sequence of CamVMPII showed a 91%, 90%, 83%, and 82% sequence homology to the P-II class enzymes of C. adamanteus metalloproteinase 2, C. atrox CaVMP-II, Gloydius halys agkistin, and Protobothrops jerdonii jerdonitin, respectively. Disintegrins are potent inhibitors of both platelet aggregation and integrin-dependent cell adhesion. Therefore, the disintegrin domain (Cam-dis) of CamVMPII was amplified by PCR, cloned into a pET-43.1a vector, and expressed in Escherichia coli BL21. Affinity purified recombinantly modified Cam-dis (r-Cam-dis) with a yield of 8.5 mg/L culture medium was cleaved from the fusion tags by enterokinase cleavage. r-Cam-dis was further purified by two-step chromatography consisting of HiTrap™ Benzamidine FF column, followed by Talon Metal affinity column with a final yield of 1 mg/L culture. r-Cam-dis was able to inhibit all three processes of platelet thrombus formation including platelet adhesion with an estimated IC50 of 1 nM, collagen- and ADP-induced platelet aggregation with the estimated IC50s of 18 and 6 nM, respectively, and platelet function on clot retraction. It is a potent anti-platelet inhibitor, which should be further investigated for drug discovery to treat stroke patients or patients with thrombotic disorders. PMID:23313448

Amplifier for nuclear spectrometry

International Nuclear Information System (INIS)

Suarez Canner, E.

1996-01-01

The spectroscopy amplifier model AE-020 is designed to adjust suitable the pulses coming from nuclear radiation detectors. Due to is capacity and specifications, the amplifier can be used together with high and medium resolution spectroscopy system

Modeling FWM and impairments aware amplifiers placement technique for an optical MAN/WAN: Inline amplifiers case

Science.gov (United States)

Singh, Gurpreet; Singh, Maninder Lal

2015-08-01

A new four wave mixing (FWM) model for an optical network with amplifiers and a comparative analysis among three proposed amplifiers placement techniques have been presented in this paper. The FWM model is validated with the experimental measured data. The novelty of this model is its uniqueness that on direct substitutions of network parameters like length, it works even for unequal inter amplifier separations. The novelty of the analysis done among three schemes is that it presents fair choice of amplifiers placement methods for varied total system length. The appropriateness of these three schemes has been analyzed on the basis of critical system length, critical number of amplifiers and critical bit error rate (10-9) in presence of four wave mixing (FWM) and amplified spontaneous emission noise (ASE). The implementation of analysis done has been given with the help of an example of a regenerative metropolitan area network (MAN). The results suggest that the decreasing fiber section scheme should be avoided for placements of amplifiers and schemes IUFS and EFS shows their importance interchangeably for different set of parameters.

Semiconductor quantum-dot lasers and amplifiers

DEFF Research Database (Denmark)

Hvam, Jørn Märcher; Borri, Paola; Ledentsov, N. N.

2002-01-01

-power surface emitting VCSELs. We investigated the ultrafast dynamics of quantum-dot semiconductor optical amplifiers. The dephasing time at room temperature of the ground-state transition in semiconductor quantum dots is around 250 fs in an unbiased amplifier, decreasing to below 50 fs when the amplifier...... is biased to positive net gain. We have further measured gain recovery times in quantum dot amplifiers that are significantly lower than in bulk and quantum-well semiconductor optical amplifiers. This is promising for future demonstration of quantum dot devices with high modulation bandwidth...

NIF/LMJ prototype amplifier mechanical design

International Nuclear Information System (INIS)

Horvath, J.

1996-10-01

Amplifier prototypes for the National Ignition Facility and the Laser Megajoule will be tested at Lawrence Livermore National Laboratory. The prototype amplifier, which is an ensemble of modules from LLNL and Centre d'Etudes de Limeil-Valenton, is cassette-based with bottom access for maintenance. A sealed maintenance transfer vehicle which moves optical cassettes between the amplifier and the assembly cleanroom, and a vacuum gripper which holds laser slabs during cassette assembly will also be tested. The prototype amplifier will be used to verify amplifier optical performance, thermal recovery time, and cleanliness of mechanical operations

An XmnI RFLP detected with a cDNA probe for the CYP2C gene locus on chromosome 10

Energy Technology Data Exchange (ETDEWEB)

Gough, A C; Spurr, N K [Clare Hall Laboratories, Herts (England); Meehan, R R; Miles, J S; Wolf, C R [Univ. Department of Biochemistry, Edinburgh (England)

1989-06-12

A 700 bp fragment of the cDNA clone for the human cytochrome P450 gene cloned in pUC9 at the PstI restriction site. XmnI detects a two allele polymorphism with bands at 10.00 kb (A1), 4.8 kb (A2) and constants bands at 13.0, 8.3, 4.6, 3.1, 2.8, 2.5, 2.3, 2.2, 1.8 and 1.5 kb. A total of 16 unrelated individuals of Caucasian origin were screened for A1 (.625) and A2 (.375). The probe was assigned to chromosome 10q24.1-q24.3 using a panel of human-rodent somatic cell hybrids and in situ hybridization. Co-dominant inheritance was observed in 3 families from CEPH, K1329 2 K1331 and K1333.

Cu2+-labeled dansyl compounds as fluorescent and PET probes for imaging apoptosis.

Science.gov (United States)

Han, Junyan; Wang, Xukui; Yu, MeiXiang

2016-11-15

Compound DNSTT-Cu 2+ , a novel chelate of Cu 2+ with DOTA conjugated to a fluorescent dansyl fragment, is developed for imaging cell apoptosis. Apoptotic U-87MG cells could be selectively visualized by the fluorescence of DNSTT-Cu 2+ from cytoplasm of cells, confirmed by the fluorescence of apoptosis cells co-labeled with Alexa Fluor 568-labeled annexin V, a conventional probe for selectively labeling membranes of apoptosis cells. A radioactive 64 Cu 2 + analog, DNSTT- 64 Cu 2+ , was easily synthesized, providing a potential PET probe for imaging apoptosis in vivo. Copyright © 2016 Elsevier Ltd. All rights reserved.

Isolation and sequencing of a cDNA coding for the human DF3 breast carcinoma-associated antigen

International Nuclear Information System (INIS)

Siddiqui, J.; Abe, M.; Hayes, D.; Shani, E.; Yunis, E.; Kufe, D.

1988-01-01

The murine monoclonal antibody (mAb) DF3 reacts with a high molecular weight glycoprotein detectable in human breast carcinomas. DF3 antigen expression correlates with human breast tumor differentiation, and the detection of a cross-reactive species in human milk has suggested that this antigen might be useful as a marker of differentiated mammary epithelium. To further characterize DF3 antigen expression, the authors have isolated a cDNA clone from a λgt11 library by screening with mAb DF3. The results demonstrate that this 309-base-pair cDNA, designated pDF9.3, codes for the DF3 epitope. Southern blot analyses of EcoRI-digested DNAs from six human tumor cell lines with 32 P-labeled pDF9.3 have revealed a restriction fragment length polymorphism. Variations in size of the alleles detected by pDF9.3 were also identified in Pst I, but not in HindIII, DNA digests. Furthermore, hybridization of 32 P-labeled pDF9.3 with total cellular RNA from each of these cell lines demonstrated either one or two transcripts that varied from 4.1 to 7.1 kilobases in size. The presence of differently sized transcripts detected by pDF9.3 was also found to correspond with the polymorphic expression of DF3 glycoproteins. Nucleotide sequence analysis of pDF9.3 has revealed a highly conserved (G + C)-rich 60-base-pair tandem repeat. These findings suggest that the variation in size of alleles coding for the polymorphic DF3 glycoprotein may represent different numbers of repeats

Phenol emulsion-enhanced DNA-driven subtractive cDNA cloning: isolation of low-abundance monkey cortex-specific mRNAs

International Nuclear Information System (INIS)

Travis, G.H.; Sutcliffe, J.G.

1988-01-01

To isolate cDNA clones of low-abundance mRNAs expressed in monkey cerebral cortex but absent from cerebellum, the authors developed an improved subtractive cDNA cloning procedure that requires only modest quantities of mRNA. Plasmid DNA from a monkey cerebellum cDNA library was hybridized in large excess to radiolabeled monkey cortex cDNA in a phenol emulsion-enhanced reaction. The unhybridized cortex cDNA was isolated by chromatography on hydroxyapatite and used to probe colonies from a monkey cortex cDNA library. Of 60,000 colonies screened, 163 clones were isolated and confirmed by colony hybridization or RNA blotting to represent mRNAs, ranging from 0.001% to 0.1% abundance, specific to or highly enriched in cerebral cortex relative to cerebellum. Clones of one medium-abundance mRNA were recovered almost quantitatively. Two of the lower-abundance mRNAs were expressed at levels reduced by a factor of 10 in Alzheimer disease relative to normal human cortex. One of these was identified as the monkey preprosomatostatin I mRNA

A low-voltage sense amplifier with two-stage operational amplifier clamping for flash memory

Science.gov (United States)

Guo, Jiarong

2017-04-01

A low-voltage sense amplifier with reference current generator utilizing two-stage operational amplifier clamp structure for flash memory is presented in this paper, capable of operating with minimum supply voltage at 1 V. A new reference current generation circuit composed of a reference cell and a two-stage operational amplifier clamping the drain pole of the reference cell is used to generate the reference current, which avoids the threshold limitation caused by current mirror transistor in the traditional sense amplifier. A novel reference voltage generation circuit using dummy bit-line structure without pull-down current is also adopted, which not only improves the sense window enhancing read precision but also saves power consumption. The sense amplifier was implemented in a flash realized in 90 nm flash technology. Experimental results show the access time is 14.7 ns with power supply of 1.2 V and slow corner at 125 °C. Project supported by the National Natural Science Fundation of China (No. 61376028).

Assembly and maintenance of full scale NIF amplifiers in the amplifier module prototype laboratory (AMPLAB)

International Nuclear Information System (INIS)

Horvath, J. A.

1998-01-01

Mechanical assembly and maintenance of the prototype National Ignition Facility amplifiers in the Amplifier Module Prototype Laboratory (AMPLAB) at Lawrence Livermore National Laboratory requires specialized equipment designed to manipulate large and delicate amplifier components in a safe and clean manner. Observations made during the operation of this assembly and maintenance equipment in AMPLAB provide design guidance for similar tools being built for the National Ignition Facility. Fixtures used for amplifier frame installation, laser slab and flashlamp cassette assembly, transport, and installation, and in-situ blastshield exchange are presented. Examples include a vacuum slab gripper, slab handling clean crane, slab cassette assembly fixture, sealed transport vehicle for slab cassette movement between the cleanroom and amplifier, slab cassette transfer fixture between the cleanroom and transport vehicle, and equipment needed for frame assembly unit, blastshield, an d flashlamp cassette installation and removal. The use of these tools for amplifier assembly, system reconfiguration, reflector replacement, and recovery from an abnormal occurrence such as a flashlamp explosion is described. Observations are made on the design and operation of these tools and their contribution to the final design

Fragment-based lead generation: identification of seed fragments by a highly efficient fragment screening technology

Science.gov (United States)

Neumann, Lars; Ritscher, Allegra; Müller, Gerhard; Hafenbradl, Doris

2009-08-01

For the detection of the precise and unambiguous binding of fragments to a specific binding site on the target protein, we have developed a novel reporter displacement binding assay technology. The application of this technology for the fragment screening as well as the fragment evolution process with a specific modelling based design strategy is demonstrated for inhibitors of the protein kinase p38alpha. In a fragment screening approach seed fragments were identified which were then used to build compounds from the deep-pocket towards the hinge binding area of the protein kinase p38alpha based on a modelling approach. BIRB796 was used as a blueprint for the alignment of the fragments. The fragment evolution of these deep-pocket binding fragments towards the fully optimized inhibitor BIRB796 included the modulation of the residence time as well as the affinity. The goal of our study was to evaluate the robustness and efficiency of our novel fragment screening technology at high fragment concentrations, compare the screening data with biochemical activity data and to demonstrate the evolution of the hit fragments with fast kinetics, into slow kinetic inhibitors in an in silico approach.

Amplified emission and modified spectral features in an opal hetero-structure mediated by passive defect mode localization

Science.gov (United States)

Rout, Dipak; Kumar, Govind; Vijaya, R.

2018-01-01

A photonic crystal hetero-structure consisting of a passive planar defect of SiO2 thin film sandwiched between two identical opals grown by inward growing self-assembly method using Rhodamine-B dye-doped polystyrene microspheres is studied for the characteristics of dye emission. The optical properties and the defect mode characteristics of the hetero-structure are studied from the reflection and transmission measurements. Laser-induced fluorescence from the hetero-structure showed amplified and spectrally narrowed emission compared to the photonic crystal emphasizing the role of the defect mode and distributed feedback. The enhanced emission is also complemented by the reduction in fluorescence decay time in the case of the hetero-structure in comparison to the 3D photonic crystals.

Detection of Theileria annulata in blood samples of carrier cattle by PCR.

Science.gov (United States)

d'Oliveira, C; van der Weide, M; Habela, M A; Jacquiet, P; Jongejan, F

1995-01-01

We report the detection of Theileria annulata, the causative agent of tropical theileriosis, by PCR in blood samples obtained from carrier cattle. The assay employs primers specific for the gene encoding the 30-kDa major merozoite surface antigen of T. annulata. A 721-bp fragment was amplified from blood samples taken monthly from calves experimentally infected with one of four different stocks of T. annulata originating in either Mauritania, Portugal, Spain, or Turkey. At the end of the experiment, five animals carried the infection for 12 months and two animals remained infected for 15 months. DNAs from six other Theileria species, T. parva, T. mutans, T. sergenti, T. buffeli, T. velifera, and T. taurotragi, were not amplified. Moreover, DNAs from four other hemoparasites (Anaplasma centrale, Anaplasma marginale, Babesia bovis, and Babesia bigemina) were also not amplified. As a control, primers derived from the small subunit rRNA gene of Theileria spp. amplified a 1.1-kb DNA fragment from all Theileria species examined but not from the other four hemoparasites. As few as two to three parasites per microliter of infected blood in a 50-microliters sample volume were detected by Southern or microplate hybridization with a T. annulata-specific cDNA probe. In addition, 92 field samples obtained from cattle in Spain were tested; 22% were positive in blood smears, 40% were positive by immunofluorescent antibody test, and 75% were positive for T. annulata by PCR. The method provides a useful diagnostic tool for detecting T. annulata carrier cattle. PMID:8567902

Cloning and expression of a cDNA coding for a human monocyte-derived plasminogen activator inhibitor.

OpenAIRE

Antalis, T M; Clark, M A; Barnes, T; Lehrbach, P R; Devine, P L; Schevzov, G; Goss, N H; Stephens, R W; Tolstoshev, P

1988-01-01

Human monocyte-derived plasminogen activator inhibitor (mPAI-2) was purified to homogeneity from the U937 cell line and partially sequenced. Oligonucleotide probes derived from this sequence were used to screen a cDNA library prepared from U937 cells. One positive clone was sequenced and contained most of the coding sequence as well as a long incomplete 3' untranslated region (1112 base pairs). This cDNA sequence was shown to encode mPAI-2 by hybrid-select translation. A cDNA clone encoding t...

Mining candidate genes associated with powdery mildew resistance in cucumber via super-BSA by specific length amplified fragment (SLAF) sequencing.

Science.gov (United States)

Zhang, Peng; Zhu, Yuqiang; Wang, Lili; Chen, Liping; Zhou, Shengjun

2015-12-14

Powdery mildew (PM) is the most common fungal disease of cucumber and other cucurbit crops, while breeding the PM-resistant materials is the effective way to defense this disease, and the recent development of modern genetics and genomics make us aware of that studying the resistance genes is the essential way to breed the PM high-resistance plant. With the ever increasing throughput of next-generation sequencing (NGS), the development of specific length amplified fragment sequencing (SLAF-seq) as a high-resolution strategy for large-scale de novo SNP discovery is gradually applied for functional gene mining. Here we combined the bulked segregant analysis (BSA) with SLAF-seq to identify candidate genes associated with PM resistance in cucumber. A segregating population comprising 251 F2 individuals was developed using H136 (female parent) as susceptible parent and BK2 (male parent) as resistance donor. After PMR test, total genomic DNA was prepared from each plant. Systemic genomic analysis of the GC content, repeat sequence, etc. was carried out by prediction software SLAF_Predict to establish condition to ensure the uniformity and density of the molecular markers. After samples were gel purified, SLAFs were generated at Biomarker Technologies Corporation in Beijing. Based on SLAF tags and the PMR test result, the hot region were annotated. A total of 73,100 high-quality SLAF tags with an average depth of 99.11× were sequenced. Among these, 5,355 polymorphic tags were identified with a polymorphism rate of 7.34 %, including 7.09 % SNPs and other polymorphism types. Finally, 140 associated SLAFs were identified, and two main Hot Regions were detected on chromosome 1 and 6, which contained five genes invovled in defense response, toxin metabolism, cell stress response, and injury response in cucumber. Associated markers identified by super-BSA in this study, could not only speed up the study of the PMR genes, but also provide a feasible solution for breeding the

Molecular cloning of a human glycophorin B cDNA: nucleotide sequence and genomic relationship to glycophorin A

International Nuclear Information System (INIS)

Siebert, P.D.; Fukuda, M.

1987-01-01

The authors describe the isolation and nucleotide sequence of a human glycophorin B cDNA. The cDNA was identified by differential hybridization of synthetic oligonucleotide probes to a human erythroleukemic cell line (K562) cDNA library constructed in phage vector λgt10. The nucleotide sequence of the glycophorin B cDNA was compared with that of a previously cloned glycophorin A cDNA. The nucleotide sequences encoding the NH 2 -terminal leader peptide and first 26 amino acids of the two proteins are nearly identical. This homologous region is followed by areas specific to either glycophorin A or B and a number of small regions of homology, which in turn are followed by a very homologous region encoding the presumed membrane-spanning portion of the proteins. They used RNA blot hybridization with both cDNA and synthetic oligonucleotide probes to prove our previous hypothesis that glycophorin B is encoded by a single 0.5- to 0.6-kb mRNA and to show that glycophorins A and B are negatively and coordinately regulated by a tumor-promoting phorbol ester, phorbol 12-myristate 13-acetate. They established the intron/exon structure of the glycophorin A and B genes by oligonucleotide mapping; the results suggest a complex evolution of the glycophorin genes

[Construction of a low-pH-sensing system in Streptococcus mutans].

Science.gov (United States)

Di, Kang; Yuqing, Li; Xuedong, Zhou

2017-06-01

To construct a low-pH-sensing system in Streptococcus mutans (S. mutans) and to visually detect the pH in situ. Promoter of ureaseⅠ(PureⅠ) and green fluorescence protein (gfp) DNA fragments were amplified by polymerase chain reaction (PCR) from the genome of Streptococcus salivarius 57.I and S. mutans containing the gfp fragment. The two amplified DNA fragments were ligated together and further integrated into pDL278 to construct the recombinant plasmid pDL278-pureⅠ-gfp. This recombinant plasmid was then transformed into S. mutans UA159 cells. Subsequently, the intensity of the optical density per unit area of the low-pH-sensing system was measured and compared under different pH conditions and different processing times. PureⅠ and gfp DNA fragments were amplified successfully with the correct molecule sizes (450 and 717 bp, respectively). The recombinant plasmid pDL278-pureⅠ-gfp was constructed and further verified by PCR and sequencing. The intensity of the optical density per unit area of the low-pH-sensing system increased with decreasing pH and increasing processing time. A low-pH-sensing system was constructed successfully in S. mutans. Our research verified that pureⅠ of Streptococcus salivarius can function well in S. mutans as an acid induced promoter, and provided a new method of detecting the pH of plaque biofilms in situ.

Adipose tissue-derived microvascular fragments from aged donors exhibit an impaired vascularisation capacity

Directory of Open Access Journals (Sweden)

MW Laschke

2014-10-01

Full Text Available Adipose tissue-derived microvascular fragments are promising vascularisation units for applications in the field of tissue engineering. Elderly patients are the major future target population of such applications due to an increasing human life expectancy. Therefore, we herein investigated the effect of aging on the fragments’ vascularisation capacity. Microvascular fragments were isolated from epididymal fat pads of adult (8 months and aged (16 months C57BL/6 donor mice. These fragments were seeded onto porous polyurethane scaffolds, which were implanted into dorsal skinfold chambers to study their vascularisation using intravital fluorescence microscopy, histology and immunohistochemistry. Scaffolds seeded with fragments from aged donors exhibited a significantly lower functional microvessel density and intravascular blood flow velocity. This was associated with an impaired vessel maturation, as indicated by vessel wall irregularities, constantly elevated diameters and a lower fraction of CD31/α-smooth muscle actin double positive microvessels in the implants’ border and centre zones. Additional in vitro analyses revealed that microvascular fragments from adult and aged donors do not differ in their stem cell content as well as in their release of angiogenic growth factors, survival and proliferative activity under hypoxic conditions. However, fragments from aged donors exhibit a significantly lower number of matrix metalloproteinase -9-positive perivascular cells. Taken together, these findings demonstrate that aging is a crucial determinant for the vascularisation capacity of isolated microvascular fragments.

NORMAL NASAL GENE EXPRESSION LEVELS USING CDNA ARRAY TECHNOLOGY

Science.gov (United States)

Normal Nasal Gene Expression Levels Using cDNA Array Technology. The nasal epithelium is a target site for chemically-induced toxicity and carcinogenicity. To detect and analyze genetic events which contribute to nasal tumor development, we first defined the gene expressi...

Optimization of mNeonGreen for Homo sapiens increases its fluorescent intensity in mammalian cells.

Science.gov (United States)

Tanida-Miyake, Emiko; Koike, Masato; Uchiyama, Yasuo; Tanida, Isei

2018-01-01

Green fluorescent protein (GFP) is tremendously useful for investigating many cellular and intracellular events. The monomeric GFP mNeonGreen is about 3- to 5-times brighter than GFP and monomeric enhanced GFP and shows high photostability. The maturation half-time of mNeonGreen is about 3-fold faster than that of monomeric enhanced GFP. However, the cDNA sequence encoding mNeonGreen contains some codons that are rarely used in Homo sapiens. For better expression of mNeonGreen in human cells, we synthesized a human-optimized cDNA encoding mNeonGreen and generated an expression plasmid for humanized mNeonGreen under the control of the cytomegalovirus promoter. The resultant plasmid was introduced into HEK293 cells. The fluorescent intensity of humanized mNeonGreen was about 1.4-fold higher than that of the original mNeonGreen. The humanized mNeonGreen with a mitochondria-targeting signal showed mitochondrial distribution of mNeonGreen. We further generated an expression vector of humanized mNeonGreen with 3xFLAG tags at its carboxyl terminus as these tags are useful for immunological analyses. The 3xFLAG-tagged mNeonGreen was recognized well with an anti-FLAG-M2 antibody. These plasmids for the expression of humanized mNeonGreen and mNeonGreen-3xFLAG are useful tools for biological studies in mammalian cells using mNeonGreen.

Fluorescence properties of Yb3+-Er3+ co-doped phosphate glasses containing silver nanoparticles

Science.gov (United States)

Martínez Gámez, Ma A.; Vallejo H, Miguel A.; Kiryanov, A. V.; Licea-Jiménez, L.; Lucio M, J. L.; Pérez-García, S. A.

2018-04-01

Er3+-Yb3+ co-doped phosphate glasses containing silver nitrate (SN), were fabricated. Transmission electron microscopy (TEM) and x-ray photoelectron spectroscopy (XPS) analyses were used to evidence the nucleation and presence of silver nanoparticles (SNP). The basic parameters of the glasses were inspected by means of absorption and fluorescence spectra, and fluorescence lifetimes under excitation at 916 nm (in-band of Yb3+), and at 406 nm (in-band of surface plasmon resonance given by the presence of SNP). The spectra as well as estimates for the basic parameters defining the lasing/amplifying potential of the glasses were studied as a function of SN concentration. The experimental results indicate that by increasing the SN content an enhancement of Er3+/Yb3+ fluorescence takes place.

Digital quantification of rolling circle amplified single DNA molecules in a resistive pulse sensing nanopore.

Science.gov (United States)

Kühnemund, M; Nilsson, M

2015-05-15

Novel portable, sensitive and selective DNA sensor methods for bio-sensing applications are required that can rival conventionally used non-portable and expensive fluorescence-based sensors. In this paper, rolling circle amplification (RCA) products are detected in solution and on magnetic particles using a resistive pulse sensing (RPS) nanopore. Low amounts of DNA molecules are detected by padlock probes which are circularized in a strictly target dependent ligation reaction. The DNA-padlock probe-complex is captured on magnetic particles by sequence specific capture oligonucleotides and amplified by a short RCA. Subsequent RPS analysis is used to identify individual particles with single attached RCA products from blank particles. This proof of concept opens up for a novel non-fluorescent digital DNA quantification method that can have many applications in bio-sensing and diagnostic approaches. Copyright © 2014 Elsevier B.V. All rights reserved.

European Research on THz Vacuum Amplifiers

DEFF Research Database (Denmark)

Brunetti, F.; Cojocarua, C.-S.; de Rossi, A.

2010-01-01

The OPTHER (OPtically Driven TeraHertz AmplifiERs) project represents a considerable advancement in the field of high frequency amplification. The design and realization of a THz amplifier within this project is a consolidation of efforts at the international level from the main players...... of the European research, academy and industry in vacuum electronics. This paper describes the status of the project and progress towards the THz amplifier realization....

Integrated amplifying circuit with MOS transistors

Energy Technology Data Exchange (ETDEWEB)

Baylac, B; Merckel, G; Meunier, P

1974-01-25

The invention relates to a feedback-pass-band amplifier with MOS-transistors. The differential stage of conventional amplifiers is changed into an adding state, whereas the differential amplification stages are changed into amplifier inverter stages. All MOS transistors used in that amplifier are of similar configuration and are interdigitized, whereby the operating speed dispersion is reduced. This can be applied to obtaining a measurement channel for proportional chambers.

Multisegment one-step RT-PCR fluorescent labeling of influenza A virus genome for use in diagnostic microarray applications

Energy Technology Data Exchange (ETDEWEB)

Vasin, A V; Plotnikova, M A; Klotchenko, S A; Elpaeva, E A; Komissarov, A B; Egorov, V V; Kiselev, O I [Research Institute of Influenza of the Ministry of Health and Social Development of the Russian Federation, 15/17 Prof. Popova St., St. Petersburg (Russian Federation); Sandybaev, N T; Chervyakova, O V; Strochkov, V M; Taylakova, E T; Koshemetov, J K; Mamadaliev, S M, E-mail: vasin@influenza.spb.ru [Research Institute for Biological Safety Problems of the RK NBC/SC ME and S RK, Gvardeiskiy (Kazakhstan)

2011-04-01

Microarray technology is one of the most challenging methods of influenza A virus subtyping, which is based on the antigenic properties of viral surface glycoproteins - hemagglutinin and neuraminidase. On the example of biochip for detection of influenza A/H5N1 virus we showed the possibility of using multisegment RTPCR method for amplification of fluorescently labeled cDNA of all possible influenza A virus subtypes with a single pair of primers in influenza diagnostic microarrays.

Two human cDNA molecules coding for the Duchenne muscular dystrophy (DMD) locus are highly homologous

Energy Technology Data Exchange (ETDEWEB)

Rosenthal, A.; Speer, A.; Billwitz, H. (Zentralinstitut fuer Molekularbiologie, Berlin-Buch (Germany Democratic Republic)); Cross, G.S.; Forrest, S.M.; Davies, K.E. (Univ. of Oxford (England))

1989-07-11

Recently the complete sequence of the human fetal cDNA coding for the Duchenne muscular dystrophy (DMD) locus was reported and a 3,685 amino acid long, rod-shaped cytoskeletal protein (dystrophin) was predicted as the protein product. Independently, the authors have isolated and sequenced different DMD cDNA molecules from human adult and fetal muscle. The complete 12.5 kb long sequence of all their cDNA clones has now been determined and they report here the nucleotide (nt) and amino acid (aa) differences between the sequences of both groups. The cDNA sequence comprises the whole coding region but lacks the first 110 nt from the 5{prime}-untranslated region and the last 1,417 nt of the 3{prime}-untranslated region. They have found 11 nt differences (approximately 99.9% homology) from which 7 occurred at the aa level.

Cloning and sequence analysis of cDNA coding for rat nucleolar protein C23

International Nuclear Information System (INIS)

Ghaffari, S.H.; Olson, M.O.J.

1986-01-01

Using synthetic oligonucleotides as primers and probes, the authors have isolated and sequenced cDNA clones encoding protein C23, a putative nucleolus organizer protein. Poly(A + ) RNA was isolated from rat Novikoff hepatoma cells and enriched in C23 mRNA by sucrose density gradient ultracentrifugation. Two deoxyoligonuleotides, a 48- and a 27-mer, were synthesized on the basis of amino acid sequence from the C-terminal half of protein C23 and cDNA sequence data from CHO cell protein. The 48-mer was used a primer for synthesis of cDNA which was then inserted into plasmid pUC9. Transformed bacterial colonies were screened by hybridization with 32 P labeled 27-mer. Two clones among 5000 gave a strong positive signal. Plasmid DNAs from these clones were purified and characterized by blotting and nucleotide sequence analysis. The length of C23 mRNA was estimated to be 3200 bases in a northern blot analysis. The sequence of a 267 b.p. insert shows high homology with the CHO cDNA with only 9 nucleotide differences and an identical amino acid sequence. These studies indicate that this region of the protein is highly conserved

Power Amplifiers in CMOS Technology: A contribution to power amplifier theory and techniques

NARCIS (Netherlands)

Acar, M.

2011-01-01

In order to meet the demands from the market on cheaper, miniaturized mobile communications devices realization of RF power amplifiers in the mainstream CMOS technology is essential. In general, CMOS Power Amplifiers (PAs) require high voltage to decrease the matching network losses and for high

Enhanced performance CCD output amplifier

Science.gov (United States)

Dunham, Mark E.; Morley, David W.

1996-01-01

A low-noise FET amplifier is connected to amplify output charge from a che coupled device (CCD). The FET has its gate connected to the CCD in common source configuration for receiving the output charge signal from the CCD and output an intermediate signal at a drain of the FET. An intermediate amplifier is connected to the drain of the FET for receiving the intermediate signal and outputting a low-noise signal functionally related to the output charge signal from the CCD. The amplifier is preferably connected as a virtual ground to the FET drain. The inherent shunt capacitance of the FET is selected to be at least equal to the sum of the remaining capacitances.

Genetic diversity of clinical and environmental isolates of Vibrio cholerae determined by amplified fragment length polymorphism fingerprinting.

Science.gov (United States)

Jiang, S C; Matte, M; Matte, G; Huq, A; Colwell, R R

2000-01-01

Vibrio cholerae, the causative agent of major epidemics of diarrheal disease in Bangladesh, South America, Southeastern Asia, and Africa, was isolated from clinical samples and from aquatic environments during and between epidemics over the past 20 years. To determine the evolutionary relationships and molecular diversity of these strains, in order to understand sources, origin, and epidemiology, a novel DNA fingerprinting technique, amplified fragment length polymorphism (AFLP), was employed. Two sets of restriction enzyme-primer combinations were tested for fingerprinting of V. cholerae serogroup O1, O139, and non-O1, O139 isolates. Amplification of HindIII- and TaqI-digested genomic DNA produced 30 to 50 bands for each strain. However, this combination, although capable of separating environmental isolates of O1 and non-O1 strains, was unable to distinguish between O1 and O139 clinical strains. This result confirmed that clinical O1 and O139 strains are genetically closely related. On the other hand, AFLP analyses of restriction enzyme ApaI- and TaqI-digested genomic DNA yielded 20 to 30 bands for each strain, but were able to separate O1 from O139 strains. Of the 74 strains examined with the latter combination, 26 serogroup O1 strains showed identical banding patterns and were represented by the O1 El Tor strain of the seventh pandemic. A second group, represented by O139 Bengal, included 12 strains of O139 clinical isolates, with 7 from Thailand, 3 from Bangladesh, and 2 from India. Interestingly, an O1 clinical isolate from Africa also grouped with the O139 clinical isolates. Eight clinical O1 isolates from Mexico grouped separately from the O1 El Tor of the seventh pandemic, suggesting an independent origin of these isolates. Identical fingerprints were observed between an O1 environmental isolate from a river in Chile and an O1 clinical strain from Kenya, both isolated more than 10 years apart. Both strains were distinct from the O1 seventh pandemic strain

Localizing Proteins in Fixed Giardia lamblia and Live Cultured Mammalian Cells by Confocal Fluorescence Microscopy.

Science.gov (United States)

Nyindodo-Ogari, Lilian; Schwartzbach, Steven D; Skalli, Omar; Estraño, Carlos E

2016-01-01

Confocal fluorescence microscopy and electron microscopy (EM) are complementary methods for studying the intracellular localization of proteins. Confocal fluorescence microscopy provides a rapid and technically simple method to identify the organelle in which a protein localizes but only EM can identify the suborganellular compartment in which that protein is present. Confocal fluorescence microscopy, however, can provide information not obtainable by EM but required to understand the dynamics and interactions of specific proteins. In addition, confocal fluorescence microscopy of cells transfected with a construct encoding a protein of interest fused to a fluorescent protein tag allows live cell studies of the subcellular localization of that protein and the monitoring in real time of its trafficking. Immunostaining methods for confocal fluorescence microscopy are also faster and less involved than those for EM allowing rapid optimization of the antibody dilution needed and a determination of whether protein antigenicity is maintained under fixation conditions used for EM immunogold labeling. This chapter details a method to determine by confocal fluorescence microscopy the intracellular localization of a protein by transfecting the organism of interest, in this case Giardia lamblia, with the cDNA encoding the protein of interest and then processing these organisms for double label immunofluorescence staining after chemical fixation. Also presented is a method to identify the organelle targeting information in the presequence of a precursor protein, in this case the presequence of the precursor to the Euglena light harvesting chlorophyll a/b binding protein of photosystem II precursor (pLHCPII), using live cell imaging of mammalian COS7 cells transiently transfected with a plasmid encoding a pLHCPII presequence fluorescent protein fusion and stained with organelle-specific fluorescent dyes.

Optimizing pulse compressibility in completely all-fibered Ytterbium chirped pulse amplifiers for in vivo two photon laser scanning microscopy.

Science.gov (United States)

Fernández, A; Grüner-Nielsen, L; Andreana, M; Stadler, M; Kirchberger, S; Sturtzel, C; Distel, M; Zhu, L; Kautek, W; Leitgeb, R; Baltuska, A; Jespersen, K; Verhoef, A

2017-08-01

A simple and completely all-fiber Yb chirped pulse amplifier that uses a dispersion matched fiber stretcher and a spliced-on hollow core photonic bandgap fiber compressor is applied in nonlinear optical microscopy. This stretching-compression approach improves compressibility and helps to maximize the fluorescence signal in two-photon laser scanning microscopy as compared with approaches that use standard single mode fibers as stretcher. We also show that in femtosecond all-fiber systems, compensation of higher order dispersion terms is relevant even for pulses with relatively narrow bandwidths for applications relying on nonlinear optical effects. The completely all-fiber system was applied to image green fluorescent beads, a stained lily-of-the-valley root and rat-tail tendon. We also demonstrated in vivo imaging in zebrafish larvae, where we simultaneously measure second harmonic and fluorescence from two-photon excited red-fluorescent protein. Since the pulses are compressed in a fiber, this source is especially suited for upgrading existing laser scanning (confocal) microscopes with multiphoton imaging capabilities in space restricted settings or for incorporation in endoscope-based microscopy.

Archaeological pottery fragments analysis from Sambaqui do Bacanga (MA-Brazil) with a portable EDXRF system

International Nuclear Information System (INIS)

Ikeoka, Renato A.; Appoloni, Carlos R.; Parreira, Paulo S.; Lopes, Fabio; Bandeira, Arkley M.

2009-01-01

Sambaqui do Bacanga archaeological site is located in the Island of Sao Luis - Maranhao - Brazil, in the region bathed by the Bacanga River. A stratigraphic collection of 68 pottery fragments was collected during the years 2005 and 2006 to perform a qualitative analysis of the chemical elements employing a Portable System of Energy Dispersive X-ray Fluorescence (PXRF). The elements K, Ca, Ti, Mn, Fe, Zn, Br, Rb, Sr, Y, Zr and Pb were identified in the different fragments and only Fe, Ca, Sr, Zr, Mn, Ti and Zn were common elements for all of them, indicating that these elements are present in the raw material used in the manufacture of the fragments. Only one fragment presented remains of painting. A larger concentration of Fe was observed in this region compared to other areas. This indicates that a material with iron oxide was used to make the painting. The elements Fe, Sr, Mn, Ti and Zn are present, systematically, with larger intensities on concave and convex sides in relation to the ceramic paste for 43 among the 68 analyzed fragments, indicating a different surface treatment that leads to an enrichment of those elements. Cluster analysis was performed with the pottery fragments at three levels. The fragments were grouped in three different clusters, except for two fragments from the 132 cm level, which grouped with the fragments from 10-20 cm level. This result indicates three different sources of clay for the studied pottery fragments. (author)

Transmission characteristics of acoustic amplifier in thermoacoustic engine

International Nuclear Information System (INIS)

Sun Daming; Qiu Limin; Wang Bo; Xiao Yong

2008-01-01

Thermoacoustic engines are promising in practical applications for the merits of simple configuration, reliable operation and environmentally friendly working gas. An acoustic amplifier can increase the output pressure amplitude of a thermoacoustic engine (TE) and improve the matching between the engine and its load. In order to make full use of an acoustic amplifier, the transmission characteristics are studied based on linear thermoacoustic theory. Computational and experimental results show that the amplifying ability of an acoustic amplifier is mainly determined by its geometry parameters and output resistance impedance. The amplifying ability of an acoustic amplifier with appropriate length and diameter reaches its maximum when the output resistance impedance is infinite. It is also shown that the acoustic amplifier consumes an amount of acoustic power when amplifying pressure amplitude and the acoustic power consumption increases with amplifying ratio. Furthermore, a novel cascade acoustic amplifier is proposed, which has a much stronger amplifying ability with reduced acoustic power consumption. In experiments, a two-stage cascade acoustic amplifier amplifies the pressure ratio from 1.177 to 1.62 and produces a pressure amplitude of 0.547 MPa with nitrogen of 2.20 MPa as working gas. Good agreements are obtained between the theoretical analysis and experimental results. This research is instructive for comprehensively understanding the mechanism and making full use of the acoustic amplifier

Expression of wild-type and mutant medium-chain acyl-CoA dehydrogenase (MCAD) cDNA in eucaryotic cells

DEFF Research Database (Denmark)

Jensen, T G; Andresen, B S; Bross, P

1992-01-01

An effective EBV-based expression system for eucaryotic cells has been developed and used for the study of the mitochondrial enzyme medium-chain acyl-CoA dehydrogenase (MCAD). 1325 bp of PCR-generated MCAD cDNA, containing the entire coding region, was placed between the SV40 early promoter...... and polyadenylation signals in the EBV-based vector. Both wild-type MCAD cDNA and cDNA containing the prevalent disease-causing mutation A to G at position 985 of the MCAD cDNA were tested. In transfected COS-7 cells, the steady state amount of mutant MCAD protein was consistently lower than the amount of wild......-type human enzyme. The enzyme activity in extracts from cells harbouring the wild-type MCAD cDNA was dramatically higher than in the controls (harbouring the vector without the MCAD gene) while only a slightly higher activity was measured with the mutant MCAD. The mutant MCAD present behaves like wild...

Characterisation of Toxoplasma gondii isolates using polymerase chain reaction (PCR) and restriction fragment length polymorphism (RFLP) of the non-coding Toxoplasma gondii (TGR)-gene sequences

DEFF Research Database (Denmark)

Høgdall, Estrid; Vuust, Jens; Lind, Peter

2000-01-01

of using TGR gene variants as markers to distinguish among T. gondii isolates from different animals and different geographical sources. Based on the band patterns obtained by restriction fragment length polymorphism (RFLP) analysis of the polymerase chain reaction (PCR) amplified TGR sequences, the T...

Ligation-mediated PCR with a back-to-back adapter reduces amplification bias resulting from variations in GC content.

Science.gov (United States)

Ishihara, Satoru; Kotomura, Naoe; Yamamoto, Naoki; Ochiai, Hiroshi

2017-08-15

Ligation-mediated polymerase chain reaction (LM-PCR) is a common technique for amplification of a pool of DNA fragments. Here, a double-stranded oligonucleotide consisting of two primer sequences in back-to-back orientation was designed as an adapter for LM-PCR. When DNA fragments were ligated with this adapter, the fragments were sandwiched between two adapters in random orientations. In the ensuing PCR, ligation products linked at each end to an opposite side of the adapter, i.e. to a distinct primer sequence, were preferentially amplified compared with products linked at each end to an identical primer sequence. The use of this adapter in LM-PCR reduced the impairment of PCR by substrate DNA with a high GC content, compared with the use of traditional LM-PCR adapters. This result suggested that our method has the potential to contribute to reduction of the amplification bias that is caused by an intrinsic property of the sequence context in substrate DNA. A DNA preparation obtained from a chromatin immunoprecipitation assay using pulldown of a specific form of histone H3 was successfully amplified using the modified LM-PCR, and the amplified products could be used as probes in a fluorescence in situ hybridization analysis. Copyright © 2017 Elsevier Inc. All rights reserved.

Virtual fragment preparation for computational fragment-based drug design.

Science.gov (United States)

Ludington, Jennifer L

2015-01-01

Fragment-based drug design (FBDD) has become an important component of the drug discovery process. The use of fragments can accelerate both the search for a hit molecule and the development of that hit into a lead molecule for clinical testing. In addition to experimental methodologies for FBDD such as NMR and X-ray Crystallography screens, computational techniques are playing an increasingly important role. The success of the computational simulations is due in large part to how the database of virtual fragments is prepared. In order to prepare the fragments appropriately it is necessary to understand how FBDD differs from other approaches and the issues inherent in building up molecules from smaller fragment pieces. The ultimate goal of these calculations is to link two or more simulated fragments into a molecule that has an experimental binding affinity consistent with the additive predicted binding affinities of the virtual fragments. Computationally predicting binding affinities is a complex process, with many opportunities for introducing error. Therefore, care should be taken with the fragment preparation procedure to avoid introducing additional inaccuracies.This chapter is focused on the preparation process used to create a virtual fragment database. Several key issues of fragment preparation which affect the accuracy of binding affinity predictions are discussed. The first issue is the selection of the two-dimensional atomic structure of the virtual fragment. Although the particular usage of the fragment can affect this choice (i.e., whether the fragment will be used for calibration, binding site characterization, hit identification, or lead optimization), general factors such as synthetic accessibility, size, and flexibility are major considerations in selecting the 2D structure. Other aspects of preparing the virtual fragments for simulation are the generation of three-dimensional conformations and the assignment of the associated atomic point charges.

Cloning a cDNA for the lysosomal alpha-glucosidase

NARCIS (Netherlands)

KONINGS, A.; HUPKES, P.; Versteeg, R.; Grosveld, G.; Reuser, A.; Galjaard, H.

1984-01-01

Messenger RNA was isolated from monkey testes and size-fractionated on sucrose gradients. In vitro translation of these mRNA fractions resulted in nascent, labeled alpha-glucosidase that could be precipitated with anti human alpha-glucosidase antiserum. A cDNA library was constructed from the most

cDNA sequences of two inducible T-cell genes

Energy Technology Data Exchange (ETDEWEB)

Kwon, B.S. (Indiana Univ. School of Medicine, Indianapolis (USA) Guthrie Research Institute, Sayre, PA (USA)); Weissman, S.M. (Yale Univ., New Haven, CT (USA))

1989-03-01

The authors have previously described a set of human T-lymphocyte-specific cDNA clones isolated by a modified differential screening procedure. Apparent full-length cDNAs containing the sequences of 14 of the 16 initial isolates were sequenced and were found to represent five different species of mRNA; three of the five species were identical to previously reported cDNA sequences of preproenkephalin, T-cell-replacing factor, and a serine esterase, respectively. The other two species, 4-1BB and L2G25B, were inducible sequences found in mRNA from both a cytolytic T-lymphocyte and a helper T-lymphocyte clone and were not previously described in T-cell mRNA; these mRNA sequences encode peptides of 256 and 92 amino acids, respectively. Both peptides contain putative leader sequences. The protein encoded by 4-1BB also has a potential membrane anchor segment and other features also seen in known receptor proteins.

Multiplex cDNA quantification method that facilitates the standardization of gene expression data

Science.gov (United States)

Gotoh, Osamu; Murakami, Yasufumi; Suyama, Akira

2011-01-01

Microarray-based gene expression measurement is one of the major methods for transcriptome analysis. However, current microarray data are substantially affected by microarray platforms and RNA references because of the microarray method can provide merely the relative amounts of gene expression levels. Therefore, valid comparisons of the microarray data require standardized platforms, internal and/or external controls and complicated normalizations. These requirements impose limitations on the extensive comparison of gene expression data. Here, we report an effective approach to removing the unfavorable limitations by measuring the absolute amounts of gene expression levels on common DNA microarrays. We have developed a multiplex cDNA quantification method called GEP-DEAN (Gene expression profiling by DCN-encoding-based analysis). The method was validated by using chemically synthesized DNA strands of known quantities and cDNA samples prepared from mouse liver, demonstrating that the absolute amounts of cDNA strands were successfully measured with a sensitivity of 18 zmol in a highly multiplexed manner in 7 h. PMID:21415008

Fluorescence- and capillary electrophoresis (CE)-based SSR DNA fingerprinting and a molecular identity database for the Louisiana sugarcane industry

Science.gov (United States)

A database of Louisiana sugarcane molecular identity has been constructed and is being updated annually using FAM or HEX or NED fluorescence- and capillary electrophoresis (CE)-based microsatellite (SSR) fingerprinting information. The fingerprints are PCR-amplified from leaf DNA samples of current ...

Molecular cloning of the cDNA encoding follicle-stimulating hormone beta subunit of the Chinese soft-shell turtle Pelodiscus sinensis, and its gene expression.

Science.gov (United States)

Chien, Jung-Tsun; Shen, San-Tai; Lin, Yao-Sung; Yu, John Yuh-Lin

2005-04-01

Follicle-stimulating hormone (FSH) is a member of the pituitary glycoprotein hormone family. These hormones are composed of two dissimilar subunits, alpha and beta. Very little information is available regarding the nucleotide and amino acid sequence of FSHbeta in reptilian species. For better understanding of the phylogenetic diversity and evolution of FSH molecule, we have isolated and sequenced the complementary DNA (cDNA) encoding the Chinese soft-shell turtle (Pelodiscus sinensis, Family of Trionychidae) FSHbeta precursor molecule by reverse transcription-polymerase chain reaction (RT-PCR) and rapid amplification of cDNA end (RACE) methods. The cloned Chinese soft-shell turtle FSHbeta cDNA consists of 602-bp nucleotides, including 34-bp nucleotides of the 5'-untranslated region (UTR), 396-bp of the open reading frame, and 3'-UTR of 206-bp nucleotides. It encodes a 131-amino acid precursor molecule of FSHbeta subunit with a signal peptide of 20 amino acids followed by a mature protein of 111 amino acids. Twelve cysteine residues, forming six disulfide bonds within beta-subunit and two putative asparagine-linked glycosylation sites, are also conserved in the Chinese soft-shell turtle FSHbeta subunit. The deduced amino acid sequence of the Chinese soft-shell turtle FSHbeta shares identities of 97% with Reeves's turtle (Family of Bataguridae), 83-89% with birds, 61-70% with mammals, 63-66% with amphibians and 40-58% with fish. By contrast, when comparing the FSHbeta with the beta-subunits of the Chinese soft-shell turtle luteinizing hormone and thyroid stimulating hormone, the homologies are as low as 38 and 39%, respectively. A phylogenetic tree including reptilian species of FSHbeta subunits, is presented for the first time. Out of various tissues examined, FSHbeta mRNA was only expressed in the pituitary gland and can be up-regulated by gonadotropin-releasing hormone in pituitary tissue culture as estimated by fluorescence real-time PCR analysis.

Final amplifier design and mercury

International Nuclear Information System (INIS)

Rose, E.A.; Hanson, D.E.

1991-01-01

The final amplifier for the Mercury KrF excimer facility is being designed. The design exercise involves extensive modeling to predict amplifier performance. Models of the pulsed-power system, including a Child-Langmuir diode with closure, electron-beam energy deposition, KrF laser kinetics, amplified spontaneous emission (ASE), a time-dependent laser extraction in the presence of ASE are presented as a design package. The design exercise indicates that the energy objective of Phase I -- 100 joules -- will be met

Analysis of human blood plasma cell-free DNA fragment size distribution using EvaGreen chemistry based droplet digital PCR assays.

Science.gov (United States)

Fernando, M Rohan; Jiang, Chao; Krzyzanowski, Gary D; Ryan, Wayne L

2018-04-12

Plasma cell-free DNA (cfDNA) fragment size distribution provides important information required for diagnostic assay development. We have developed and optimized droplet digital PCR (ddPCR) assays that quantify short and long DNA fragments. These assays were used to analyze plasma cfDNA fragment size distribution in human blood. Assays were designed to amplify 76,135, 490 and 905 base pair fragments of human β-actin gene. These assays were used for fragment size analysis of plasma cell-free, exosome and apoptotic body DNA obtained from normal and pregnant donors. The relative percentages for 76, 135, 490 and 905 bp fragments from non-pregnant plasma and exosome DNA were 100%, 39%, 18%, 5.6% and 100%, 40%, 18%,3.3%, respectively. The relative percentages for pregnant plasma and exosome DNA were 100%, 34%, 14%, 23%, and 100%, 30%, 12%, 18%, respectively. The relative percentages for non-pregnant plasma pellet (obtained after 2nd centrifugation step) were 100%, 100%, 87% and 83%, respectively. Non-pregnant Plasma cell-free and exosome DNA share a unique fragment distribution pattern which is different from pregnant donor plasma and exosome DNA fragment distribution indicating the effect of physiological status on cfDNA fragment size distribution. Fragment distribution pattern for plasma pellet that includes apoptotic bodies and nuclear DNA was greatly different from plasma cell-free and exosome DNA. Copyright © 2018 The Authors. Published by Elsevier B.V. All rights reserved.