Microsatellites grant more stable flanking genes
Directory of Open Access Journals (Sweden)
Joukhadar Reem
2012-10-01
Full Text Available Abstract Background Microsatellites, or simple sequence repeats (SSRs, are DNA sequences that include tandem copies of specific sequences no longer than six bases. SSRs are ubiquitous in all genomes and highly mutable. Presentation of the hypothesis Results from previous studies suggest that flanking regions of SSR are exhibit high stability in a wide range of organisms. We hypothesized that the SSRs ability to discard weak DNA polymerases could be responsible for this unusual stability. . When the weak polymerases are being decayed over SSRs, the flanking sequences would have higher opportunity to be replicated by more stable DNA polymerases. We present evidence of the molecular basis of our hypothesis. Testing the hypothesis The hypothesis could be tested by examining the activity of DNA polymerase during and after a number of PCRs. The PCR reactions should be run with the same SSR locus possessing differences in the SSR length. The hypothesis could also be tested by comparing the mutational rate of a transferred gene between two transformations. The first one has a naked T-DNA (transferred DNA, while the second one has the same T-DNA flanked with two SSRs. Implications of the hypothesis In any transformation experiment, flanking the T-DNA fragment with SSR sequences would result in more stably transferred genes. This process would decrease the unpredictable risks that may occur because of the mutational pressure on this foreign segment.
Cloning and characterization of the 5'-flanking region of the Ehox gene
International Nuclear Information System (INIS)
Lee, Woon Kyu; Kim, Yong-Man; Malik, Nasir; Ma Chang; Westphal, Heiner
2006-01-01
The paired-like homeobox-containing gene Ehox plays a role in embryonic stem cell differentiation and is highly expressed in the developing placenta and thymus. To understand the mechanisms of regulation of Ehox gene expression, the 5'-flanking region of the Ehox gene was isolated from a mouse BAC library. 5'-RACE analysis revealed a single transcriptional start site 130 nucleotides upstream of the translation initiation codon. Transient transfection with a luciferase reporter gene under the control of serially deleted 5'-flanking sequences revealed that the nt -84 to -68 region contained a positive cis-acting element for efficient expression of the Ehox gene. Mutational analysis of this region and oligonucleotide competition in the electrophoretic mobility shift assay revealed the presence of a CCAAT box, which is a target for transcription nuclear factor Y (NFY). NFY is essential for positive gene regulation. No tissue-specific enhancer was identified in the 1.9-kb 5'-flanking region of the Ehox gene. Ehox is expressed during the early stages of embryo development, specifically in Brain at 9.5 dpc, as well as during the late stages of embryo development. These results suggest that NFY is an essential regulatory factor for Ehox transcriptional activity, which is important for the post-implantation stage of the developing embryo
Directory of Open Access Journals (Sweden)
Liang Rubing
2010-08-01
Full Text Available Abstract Background The lambda Red recombination system has been used to inactivate chromosomal genes in various bacteria and fungi. The procedure consists of electroporating a polymerase chain reaction (PCR fragment containing antibiotic cassette flanked by homology regions to the target locus into a strain that can express the lambda Red proteins (Gam, Bet, Exo. Results Here a scarless gene modification strategy based on the Red recombination system has been developed to modify Pseudomonas genome DNA via sequential deletion of multiple targets. This process was mediated by plasmid pRKaraRed encoding the Red proteins regulated by PBAD promoter, which was functional in P. aeruginosa as well as in other bacteria. First the target gene was substituted for the sacB-bla cassette flanked by short homology regions (50 bp, and then this marker gene cassette could be replaced by the PCR fragment flanking itself, generating target-deleted genome without any remnants and no change happened to the surrounding region. Twenty genes involved in the synthesis and regulation pathways of the phenazine derivate, pyocyanin, were modified, including one single-point mutation and deletion of two large operons. The recombination efficiencies ranged from 88% to 98%. Multiple-gene modification was also achieved, generating a triple-gene deletion strain PCA (PAO1, ΔphzHΔphzMΔphzS, which could produce another phenazine derivate, phenazine-1-carboxylic acid (PCA, efficiently and exclusively. Conclusions This lambda Red-based technique can be used to generate scarless and sequential gene modification mutants of P. aeruginosa efficiently, using one-step PCR product flanked by short homology regions. Single-point mutation, scarless deletion of genes can be achieved easily in less than three days. This method may give a new way to construct genetically modified P. aeruginosa strains more efficiently and advance the regulatory network study of this organism.
DEFF Research Database (Denmark)
Jensen, E O; Marcker, K A; Villadsen, IS
1986-01-01
The TM1 yeast mutant was transformed with a 2 micron-derived plasmid (YEp24) which carries a chimaeric gene containing the Escherichia coli chloramphenicol acetyl transferase (CAT) gene fused to the 5'- and 3'-flanking regions of the soybean leghemoglobin (Lb) c3 gene. Expression of the chimaeric...
Identification of functional SNPs in the 5-prime flanking sequences of human genes
Directory of Open Access Journals (Sweden)
Lenhard Boris
2005-02-01
Full Text Available Abstract Background Over 4 million single nucleotide polymorphisms (SNPs are currently reported to exist within the human genome. Only a small fraction of these SNPs alter gene function or expression, and therefore might be associated with a cell phenotype. These functional SNPs are consequently important in understanding human health. Information related to functional SNPs in candidate disease genes is critical for cost effective genetic association studies, which attempt to understand the genetics of complex diseases like diabetes, Alzheimer's, etc. Robust methods for the identification of functional SNPs are therefore crucial. We report one such experimental approach. Results Sequence conserved between mouse and human genomes, within 5 kilobases of the 5-prime end of 176 GPCR genes, were screened for SNPs. Sequences flanking these SNPs were scored for transcription factor binding sites. Allelic pairs resulting in a significant score difference were predicted to influence the binding of transcription factors (TFs. Ten such SNPs were selected for mobility shift assays (EMSA, resulting in 7 of them exhibiting a reproducible shift. The full-length promoter regions with 4 of the 7 SNPs were cloned in a Luciferase based plasmid reporter system. Two out of the 4 SNPs exhibited differential promoter activity in several human cell lines. Conclusions We propose a method for effective selection of functional, regulatory SNPs that are located in evolutionary conserved 5-prime flanking regions (5'-FR regions of human genes and influence the activity of the transcriptional regulatory region. Some SNPs behave differently in different cell types.
Holland, M J; Holland, J P; Thill, G P; Jackson, K A
1981-02-10
Segments of yeast genomic DNA containing two enolase structural genes have been isolated by subculture cloning procedures using a cDNA hybridization probe synthesized from purified yeast enolase mRNA. Based on restriction endonuclease and transcriptional maps of these two segments of yeast DNA, each hybrid plasmid contains a region of extensive nucleotide sequence homology which forms hybrids with the cDNA probe. The DNA sequences which flank this homologous region in the two hybrid plasmids are nonhomologous indicating that these sequences are nontandemly repeated in the yeast genome. The complete nucleotide sequence of the coding as well as the flanking noncoding regions of these genes has been determined. The amino acid sequence predicted from one reading frame of both structural genes is extremely similar to that determined for yeast enolase (Chin, C. C. Q., Brewer, J. M., Eckard, E., and Wold, F. (1981) J. Biol. Chem. 256, 1370-1376), confirming that these isolated structural genes encode yeast enolase. The nucleotide sequences of the coding regions of the genes are approximately 95% homologous, and neither gene contains an intervening sequence. Codon utilization in the enolase genes follows the same biased pattern previously described for two yeast glyceraldehyde-3-phosphate dehydrogenase structural genes (Holland, J. P., and Holland, M. J. (1980) J. Biol. Chem. 255, 2596-2605). DNA blotting analysis confirmed that the isolated segments of yeast DNA are colinear with yeast genomic DNA and that there are two nontandemly repeated enolase genes per haploid yeast genome. The noncoding portions of the two enolase genes adjacent to the initiation and termination codons are approximately 70% homologous and contain sequences thought to be involved in the synthesis and processing messenger RNA. Finally there are regions of extensive homology between the two enolase structural genes and two yeast glyceraldehyde-3-phosphate dehydrogenase structural genes within the 5
Insulin increases transcription of rat gene 33 through cis-acting elements in 5[prime]-flanking DNA
Energy Technology Data Exchange (ETDEWEB)
Cadilla, C.; Isham, K.R.; Lee, K.L.; Ch' ang, L.Y.; Kenney, F.T. (Oak Ridge National Lab., TN (United States)); Johnson, A.C. (National Cancer Institute, Bethesda, MD (United States). Lab. of Molecular Biology)
1992-01-01
Gene 33 is a multihormonally-regulated rat gene whose transcription is rapidly and markedly enhanced by insulin in liver and cultured hepatoma cells. To examine the mechanism by which insulin regulates transcription, the authors have constructed chimeric plasmids in which expression of the bacterial cat gene, encoding chloramphenicol acetyltransferase (CAT), is governed by gene 33 promoter elements and contiguous sequence in DNA flanking the transcription start point (tsp). When transfected into H4IIE hepatoma cells, these constructs gave rise to stably transformed cell lines producing the bacterial CAT enzyme. This expression was increased by insulin treatment in a fashion resembling the effect of this hormone on transcription of the native gene. In vitro transcription assays in nuclear extracts also revealed increased transcription of the chimeric plasmids when the extracts were prepared from insulin-treated rat hepatoma cells. The results demonstrate that induction by insulin is mediated by cis-acting nucleotide sequences located between bp [minus]480 to +27 relative to the tsp.
Nomura, M; Tsujimura, A; Begum, N A; Matsumoto, M; Wabiko, H; Toyoshima, K; Seya, T
2000-01-01
The murine membrane cofactor protein (CD46) gene is expressed exclusively in testis, in contrast to human CD46, which is expressed ubiquitously. To elucidate the mechanism of differential CD46 gene expression among species, we cloned entire murine CD46 genomic DNA and possible regulatory regions were placed in the flanking region of the luciferase reporter gene. The reporter gene assay revealed a silencing activity not in the promoter, but in the 3'-flanking region of the gene and the silencer-like element was identified within a 0.2-kb region between 0.6 and 0.8 kb downstream of the stop codon. This silencer-like element was highly similar to that of the pig MHC class-I gene. The introduction of a mutation into this putative silencer element of murine CD46 resulted in an abrogation of the silencing effect. Electrophoretic mobility-shift assay indicated the presence of the binding molecule(s) for this silencer sequence in murine cell lines and tissues. A size difference of the protein-silencer-element complex was observed depending upon the solubilizers used for preparation of the nuclear extracts. A mutated silencer sequence failed to interact with the binding molecules. The level of the binding factor was lower in the testicular germ cells compared with other organs. Thus the silencer element and its binding factor may play a role in transcriptional regulation of murine CD46 gene expression. These results imply that the effects of the CD46 silencer element encompass the innate immune and reproductive systems, and in mice may determine the testicular germ-cell-dominant expression of CD46. PMID:11023821
Human renin 5'-flanking DNA to nucleotide-2750.
Smith, D L; Jeyapalan, S; Lang, J A; Guo, X H; Sigmund, C D; Morris, B J
1995-01-01
Renin is one of the most important factors in blood pressure and electrolyte regulation in mammals and the renin locus has been implicated in hypertension. To assist studies of promoter control we therefore determined the 5'-flanking sequence of the human gene (REN) to residue -2750 relative to the transcription start site (+1). Sites of homology to consensus sequences for binding of trans-acting factors involved in transcriptional control of other genes were identified, and functionality for two of these (a CRE and Pit-1 site) have so far been demonstrated.
Association of the polymorphism in the 5' flanking region of the ovine ...
African Journals Online (AJOL)
The insulin-like growth factor 1 (IGF-I) gene has been described in several studies as a candidate gene for growth traits in farm animals. The present preliminary study attempts to establish associations between growth traits and genetic polymorphisms at the 5' flanking region s IGF-I in the Baluchi sheep. The DNA of 102 ...
DDC and COBL, flanking the imprinted GRB10 gene on 7p12, are biallelically expressed.
Hitchins, Megan P; Bentley, Louise; Monk, David; Beechey, Colin; Peters, Jo; Kelsey, Gavin; Ishino, Fumitoshi; Preece, Michael A; Stanier, Philip; Moore, Gudrun E
2002-12-01
Maternal duplication of human 7p11.2-p13 has been associated with Silver-Russell syndrome (SRS) in two familial cases. GRB10 is the only imprinted gene identified within this region to date. GRB10 demonstrates an intricate tissue- and isoform-specific imprinting profile in humans, with paternal expression in fetal brain and maternal expression of one isoform in skeletal muscle. The mouse homolog is maternally transcribed. The GRB10 protein is a potent growth inhibitor and represents a candidate for SRS, which is characterized by pre- and postnatal growth retardation and a spectrum of additional dysmorphic features. Since imprinted genes tend to be grouped in clusters, we investigated the imprinting status of the dopa-decarboxylase gene (DDC) and the Cordon-bleu gene (COBL) which flank GRB10 within the 7p11.2-p13 SRS duplicated region. Although both genes were found to replicate asynchronously, suggestive of imprinting, SNP expression analyses showed that neither gene was imprinted in multiple human fetal tissues. The mouse homologues, Ddc and Cobl, which map to the homologous imprinted region on proximal Chr 11, were also biallelically expressed in mice with uniparental maternal or paternal inheritance of this region. With the intent of using mouse Grb10 as an imprinted control, biallelic expression was consistently observed in fetal, postnatal, and adult brain of these mice, in contrast to the maternal-specific transcription previously demonstrated in brain in inter-specific F1 progeny. This may be a further example of over-expression of maternally derived transcripts in inter-specific mouse crosses. GRB10 remains the only imprinted gene identified within 7p11.2-p13.
Bakhtiar, R; Abdolmohammadi, A; Hajarian, H; Nikousefat, Z; Kalantar-Neyestanaki, D
2017-12-01
In this study, semen samples were collected from 96 Sanjabi rams in order to investigate the IGF-1 gene polymorphisms and their relationship with the characteristics of semen quality and testicular size. The dimensions of scrotal length, width and circumference were measured during autumn and spring over two years. Blood samples were simultaneously collected from jugular vein to extract DNA. PCR was performed using specific primers to amplify 294 and 272bp fragments including 5' regulatory region and exon 3 of IGF-1 gene, respectively. PCR products were digested by BFOI and Eco88l restriction enzymes, respectively. Two genotypes including AA (194 and 100bp), AB (294, 194 and 100bp) and all possible genotypes including CC (182 and 90bp), CT (272, 182, and 90bp) and TT (272bp) were observed for 5' flanking region and exon 3 of IGF-1 gene, respectively. The significant differences among IGF-1 genotypes for testicular dimensions were not observed. However, the polymorphism of 5' flanking region in the studied population had significant effect on individual motility and percent morphology traits. Animals with AB genotype had significantly higher individual motility compared with AA genotype (P IGF-1 gene had significant effect on individual motility, concentration, morphology and water test traits. Animals with CT genotype had the highest sperm concentration (P IGF-1 genotypes. It might be concluded that polymorphisms in IGF-1gene can be considered to develop male fertility in future and for using in selection process of better animals under masker assisted selection programs. Copyright © 2017 Elsevier Inc. All rights reserved.
Flanking sequence determination and event-specific detection of genetically modified wheat B73-6-1.
Xu, Junyi; Cao, Jijuan; Cao, Dongmei; Zhao, Tongtong; Huang, Xin; Zhang, Piqiao; Luan, Fengxia
2013-05-01
In order to establish a specific identification method for genetically modified (GM) wheat, exogenous insert DNA and flanking sequence between exogenous fragment and recombinant chromosome of GM wheat B73-6-1 were successfully acquired by means of conventional polymerase chain reaction (PCR) and thermal asymmetric interlaced (TAIL)-PCR strategies. Newly acquired exogenous fragment covered the full-length sequence of transformed genes such as transformed plasmid and corresponding functional genes including marker uidA, herbicide-resistant bar, ubiquitin promoter, and high-molecular-weight gluten subunit. The flanking sequence between insert DNA revealed high similarity with Triticum turgidum A gene (GenBank: AY494981.1). A specific PCR detection method for GM wheat B73-6-1 was established on the basis of primers designed according to the flanking sequence. This specific PCR method was validated by GM wheat, GM corn, GM soybean, GM rice, and non-GM wheat. The specifically amplified target band was observed only in GM wheat B73-6-1. This method is of high specificity, high reproducibility, rapid identification, and excellent accuracy for the identification of GM wheat B73-6-1.
Vaandrager, J W; Schuuring, E; Raap, T; Philippo, K; Kleiverda, K; Kluin, P
Rearrangement of the BCL2 gene is an important parameter for the differential diagnosis of non-Hodgkin lymphomas. Although a relatively large proportion of breakpoints is clustered, many are missed by standard PCR. A FISH assay is therefore desired. Up to now, a lack of probes flanking the BCL2 gene
... how to do these exercises at home. Nonsteroidal anti-inflammatory drugs (NSAIDs) and physical therapy may be prescribed for flank pain caused by spinal arthritis. Antibiotics are used to treat most kidney infections. You ...
Chen, Zhuo-Yu; Gan, Jian-Kang; Xiao, Xiong; Jiang, Li-Yan; Zhang, Xi-Quan; Luo, Qing-Bin
2013-09-01
Thermo stress induces heat shock proteins (HSPs) expression and HSP90 family is one of them that has been reported to involve in cellular protection against heat stress. But whether there is any association of genetic variation in the Hsp90β gene in chicken with thermo tolerance is still unknown. Direct sequencing was used to detect possible SNPs in Hsp90β gene 5' flanking region in 3 chicken breeds (n = 663). Six mutations, among which 2 SNPs were chosen and genotypes were analyzed with PCR-RFLP method, were found in Hsp90β gene in these 3 chicken breeds. Association analysis indicated that SNP of C.-141G>A in the 5' flanking region of the Hsp90β gene in chicken had some effect on thermo tolerance traits, which may be a potential molecular marker of thermo tolerance, and the genotype GG was the thermo tolerance genotype. Hsp90β gene mRNA expression in different tissues detected by quantitative real-time PCR assay were demonstrated to be tissue dependent, implying that different tissues have distinct sensibilities to thermo stress. Besides, it was shown time specific and varieties differences. The expression of Hsp90β mRNA in Lingshan chickens in some tissues including heart, liver, brain and spleen were significantly higher or lower than that of White Recessive Rock (WRR). In this study, we presume that these mutations could be used in marker assisted selection for anti-heat stress chickens in our breeding program, and WRR were vulnerable to tropical thermo stress whereas Lingshan chickens were well adapted.
Understanding Etna flank instability through numerical models
Apuani, Tiziana; Corazzato, Claudia; Merri, Andrea; Tibaldi, Alessandro
2013-02-01
As many active volcanoes, Mount Etna shows clear evidence of flank instability, and different mechanisms were suggested to explain this flank dynamics, based on the recorded deformation pattern and character. Shallow and deep deformations, mainly associated with both eruptive and seismic events, are concentrated along recognised fracture and fault systems, mobilising the eastern and south-eastern flank of the volcano. Several interacting causes were postulated to control the phenomenon, including gravity force, magma ascent along the feeding system, and a very complex local and/or regional tectonic activity. Nevertheless, the complexity of such dynamics is still an open subject of research and being the volcano flanks heavily urbanised, the comprehension of the gravitative dynamics is a major issue for public safety and civil protection. The present research explores the effects of the main geological features (in particular the role of the subetnean clays, interposed between the Apennine-Maghrebian flysch and the volcanic products) and the role of weakness zones, identified by fracture and fault systems, on the slope instability process. The effects of magma intrusions are also investigated. The problem is addressed by integrating field data, laboratory tests and numerical modelling. A bi- and tri-dimensional stress-strain analysis was performed by a finite difference numerical code (FLAC and FLAC3D), mainly aimed at evaluating the relationship among geological features, volcano-tectonic structures and magmatic activity in controlling the deformation processes. The analyses are well supported by dedicated structural-mechanical field surveys, which allowed to estimate the rock mass strength and deformability parameters. To take into account the uncertainties which inevitably occur in a so complicated model, many efforts were done in performing a sensitivity analysis along a WNW-ESE section crossing the volcano summit and the Valle del Bove depression. This was
Khalil, Mohamed I; Sommer, Marvin H; Hay, John; Ruyechan, William T; Arvin, Ann M
2015-07-01
The VZV genome has two origins of DNA replication (oriS), each of which consists of an AT-rich sequence and three origin binding protein (OBP) sites called Box A, C and B. In these experiments, the mutation in the core sequence CGC of the Box A and C not only inhibited DNA replication but also inhibited both ORF62 and ORF63 expression in reporter gene assays. In contrast the Box B mutation did not influence DNA replication or flanking gene transcription. These results suggest that efficient DNA replication enhances ORF62 and ORF63 transcription. Recombinant viruses carrying these mutations in both sites and one with a deletion of the whole oriS were constructed. Surprisingly, the recombinant virus lacking both copies of oriS retained the capacity to replicate in melanoma and HELF cells suggesting that VZV has another origin of DNA replication. Copyright © 2015 Elsevier Inc. All rights reserved.
Energy Technology Data Exchange (ETDEWEB)
McGinnis, R.E.; Spielman, R.S. [Univ. of Pennsylvania School of Medicine, Philadelphia, PA (United States)
1994-09-01
The 5{prime} flanking polymorphism (5{prime}FP), a hypervariable region at the 5{prime} end of the insulin gene, has {open_quotes}class 1{close_quotes} alleles (650-900 bp long) that are in positive linkage disequilibrium with insulin-dependent diabetes mellitus (IDDM). The authors report that precise sizing of the 5{prime}FP yields a bimodal frequency distribution of class 1 allele lengths. Class 1 alleles belonging to the lower component (650-750 bp) of the bimodal distribution were somewhat more highly associated with IDDM than were alleles from the upper component (760-900 bp), but the difference was not statistically significant. They also examined 5{prime}FP length variation in relation to allelic variation at nearby polymorphisms. At biallelic RFLPs on both sides of the 5{prime}FP, they found that one allele exhibits near-total association with the upper component of the 5FP class 1 distribution. Such associations represent a little-known but potentially wide-spread form of linkage disequilibrium. In this type of disequilibrium, a flanking allele has near-complete association with a single mode of VNTR alleles whose lengths represent consecutive numbers of tandem repeats (CNTR). Such extreme disequilibrium between a CNTR mode and flanking alleles may originate and persist because length mutations at some VNTR loci usually add or delete only one or two repeat units. 22 refs., 5 figs., 6 tabs.
Flanking sequence determination and specific PCR identification of transgenic wheat B102-1-2.
Cao, Jijuan; Xu, Junyi; Zhao, Tongtong; Cao, Dongmei; Huang, Xin; Zhang, Piqiao; Luan, Fengxia
2014-01-01
The exogenous fragment sequence and flanking sequence between the exogenous fragment and recombinant chromosome of transgenic wheat B102-1-2 were successfully acquired using genome walking technology. The newly acquired exogenous fragment encoded the full-length sequence of transformed genes with transformed plasmid and corresponding functional genes including ubi, vector pBANF-bar, vector pUbiGUSPlus, vector HSP, reporter vector pUbiGUSPlus, promoter ubiquitin, and coli DH1. A specific polymerase chain reaction (PCR) identification method for transgenic wheat B102-1-2 was established on the basis of designed primers according to flanking sequence. This established specific PCR strategy was validated by using transgenic wheat, transgenic corn, transgenic soybean, transgenic rice, and non-transgenic wheat. A specifically amplified target band was observed only in transgenic wheat B102-1-2. Therefore, this method is characterized by high specificity, high reproducibility, rapid identification, and excellent accuracy for the identification of transgenic wheat B102-1-2.
Tran, Diem Hong; Shishido, Yuji; Chung, Seong Pil; Trinh, Huong Thi Thanh; Yorita, Kazuko; Sakai, Takashi; Fukui, Kiyoshi
2015-12-10
D-Amino acid oxidase (DAO) is a flavoenzyme that metabolizes D-amino acids and is expected to be a promising therapeutic target of schizophrenia and glioblastoma. The study of DNA-binding proteins has yielded much information in the regulation of transcription and other biological processes. However, proteins interacting with DAO gene have not been elucidated. Our assessment of human DAO promoter activity using luciferase reporter system indicated the 5'-flanking region of this gene (-4289 bp from transcription initiation site) has a regulatory sequence for gene expression, which is regulated by multi-protein complexes interacting with this region. By using pull-down assay coupled with two-dimensional gel electrophoresis and mass spectrometry, we identified six proteins binding to the 5'-flanking region of the human DAO gene (zinc finger C2HC domain-containing protein 1A; histidine-tRNA ligase, cytoplasmic; molybdenum cofactor biosynthesis protein; 60S ribosomal protein L37; calponin-1; calmodulin binding protein and heterogeneous nuclear ribonucleoprotein A2/B1). These preliminary results will contribute to the advance in the understanding of the potential factors associated with the regulatory mechanism of DAO expression. Copyright © 2015 Elsevier B.V. All rights reserved.
International Nuclear Information System (INIS)
Riley, L.K.; Morrow, J.K.; Danton, M.J.; Coleman, M.S.
1988-01-01
Human terminal deoxyribonucleotidyltransferase cDNA contains an open reading frame of 1530 base pairs (bp) corresponding to a protein containing 510 amino acids. The encoded protein is a template-independent DNA polymerase found only in a restricted population of normal and malignant prelymphocytes. To begin to investigate the genetic elements responsible for the tissue-specific expression of terminal deoxyribonucleotidyltransferase, genomic clones, containing the entire human gene were isolated and characterized. Initially, cDNA clones were isolated from a library generated from the human lymphoblastoid cell line, MOLT-4R. A cDNA clone containing the entire coding region of the protein was used to isolate a series of overlapping clones from two human genomic libraries. The gene comprises 11 exons and 10 introns and spans 49.4 kilobases. The 5' flanking region (709 bp) including exon 1 was sequenced. Several putative transcription initiation sites were mapped. Within 500 nucleotides of the translation start site, a series of promoter elements was detected. TATA and CAAT sequences, respectively, were found to start at nucleotides -185 and -204, -328 and -370, and -465 and -505. Start sites were found for a cyclic AMP-dependent promoter analog at nucleotide -121, an eight-base sequence corresponding to the IgG promoter enhancer (cd) at nucleotide -455, and an analog of the IgG promoter (pd) at nucleotide -159. These findings suggest that transcripts coding for terminal deoxyribonucleotidyltransferase may be variable in length and that transcription may be influenced by a variety of genetic elements
DEFF Research Database (Denmark)
Rasmussen, Henrik Berg; Werge, Thomas
2005-01-01
The 19-bp insertion/deletion polymorphism in the 5' flank of the dopamine beta-hydroxylase (DBH) gene has been associated with psychiatric disorders. We have developed a simple, reliable and inexpensive closed-tube assay for genotyping of this polymorphism based upon T(m) determination of amplified...... and a conventional approach based upon agarose gel electrophoresis of amplified fragments revealed complete concordance between the two procedures. The insights obtained in this study may be utilized to develop assays based upon dissociation analysis of PCR products for genotyping of other insertion...
Vartiainen, Johanna; Kesäniemi, Y Antero; Ukkola, Olavi
2006-10-01
Ghrelin is a 28-amino-acid peptide with several functions linked to energy metabolism. Low ghrelin plasma concentrations are associated with obesity, hypertension, and type 2 diabetes mellitus, whereas high concentrations reflect states of negative energy balance. Several studies addressing the hormonal and neural regulation of ghrelin gene expression have been carried out, but the role of genetic factors in the regulation of ghrelin plasma levels remains unclear. To elucidate the role of genetic factors in the regulation of ghrelin expression, we screened 1657 nucleotides of the ghrelin gene 5' flanking region (promoter and possible regulatory sites) for new sequential variations from patient samples with low (n = 50) and high (n = 50) fasting plasma total ghrelin concentrations (low- and high-ghrelin groups). Eleven single nucleotide polymorphisms (SNPs), 3 of which were rare variants (allelic frequency less than 1%) were found in our population. The genotype distribution patterns of the SNPs did not differ between the study groups, except for SNP-501A>C (P = .039). In addition, the SNP-01A>C was associated with body mass index (BMI) (P = .018). This variant was studied further in our large and well-defined Oulu Project Elucidating Risk for Atherosclerosis (OPERA) cohort (n = 1045) by the restriction fragment length polymorphism (RFLP) technique. No significant association of SNP-501A>C genotypes with fasting ghrelin plasma concentrations was found in the whole OPERA population. However, the association of this SNP with BMI and with waist circumference reached statistical significance in OPERA (P = .047 and .049, respectively), remaining of borderline significance for BMI after adjustments (P = .055). The results indicate that factors other than the 11 SNPs found in this study in the 5' flanking region of ghrelin gene are the main determinants of ghrelin plasma levels. However, SNP-501 A>C genotype distribution seems to be different in subjects having the highest
DEFF Research Database (Denmark)
Tsangaras, Kyriakos; Wales, Nathan; Sicheritz-Pontén, Thomas
2014-01-01
, a non-negligible fraction of the resulting sequence reads are not homologous to the bait. We demonstrate that during capture, the bait-hybridized library molecules add additional flanking library sequences iteratively, such that baits limited to targeting relatively short regions (e.g. few hundred...... nucleotides) can result in enrichment across entire mitochondrial and bacterial genomes. Our findings suggest that some of the off-target sequences derived in capture experiments are non-randomly enriched, and that CapFlank will facilitate targeted enrichment of large contiguous sequences with minimal prior...
Optimization of turning process through the analytic flank wear modelling
Del Prete, A.; Franchi, R.; De Lorenzis, D.
2018-05-01
In the present work, the approach used for the optimization of the process capabilities for Oil&Gas components machining will be described. These components are machined by turning of stainless steel castings workpieces. For this purpose, a proper Design Of Experiments (DOE) plan has been designed and executed: as output of the experimentation, data about tool wear have been collected. The DOE has been designed starting from the cutting speed and feed values recommended by the tools manufacturer; the depth of cut parameter has been maintained as a constant. Wear data has been obtained by means the observation of the tool flank wear under an optical microscope: the data acquisition has been carried out at regular intervals of working times. Through a statistical data and regression analysis, analytical models of the flank wear and the tool life have been obtained. The optimization approach used is a multi-objective optimization, which minimizes the production time and the number of cutting tools used, under the constraint on a defined flank wear level. The technique used to solve the optimization problem is a Multi Objective Particle Swarm Optimization (MOPS). The optimization results, validated by the execution of a further experimental campaign, highlighted the reliability of the work and confirmed the usability of the optimized process parameters and the potential benefit for the company.
Kass, David H; Janoušek, Václav; Wang, Liuyang; Tucker, Priscilla K
2014-06-01
Reproductive barriers exist between the house mouse subspecies, Mus musculus musculus and M. m. domesticus, members of the Mus musculus species complex, primarily as a result of hybrid male infertility, and a hybrid zone exists where their ranges intersect in Europe. Using single nucleotide polymorphisms (SNPs) diagnostic for the two taxa, the extent of introgression across the genome was previously compared in these hybrid populations. Sixty-nine of 1316 autosomal SNPs exhibited reduced introgression in two hybrid zone transects suggesting maladaptive interactions among certain loci. One of these markers is within a region on chromosome 11 that, in other studies, has been associated with hybrid male sterility of these subspecies. We assessed sequence variation in a 20 Mb region on chromosome 11 flanking this marker, and observed its inclusion within a roughly 150 kb stretch of DNA showing elevated sequence differentiation between the two subspecies. Four genes are associated with this genomic subregion, with two entirely encompassed. One of the two genes, the uncharacterized 1700093K21Rik gene, displays distinguishing features consistent with a potential role in reproductive isolation between these subspecies. Along with its expression specifically within spermatogenic cells, we present various sequence analyses that demonstrate a high rate of molecular evolution of this gene, as well as identify a subspecies amino acid variant resulting in a structural difference. Taken together, the data suggest a role for this gene in reproductive isolation.
Characterization of Bovine 5′-flanking Region during Differentiation of Mouse Embryonic Stem Cells
Directory of Open Access Journals (Sweden)
Hye-Jeong Jang
2015-12-01
Full Text Available Embryonic stem cells (ESCs have been used as a powerful tool for research including gene manipulated animal models and the study of developmental gene regulation. Among the critical regulatory factors that maintain the pluripotency and self-renewal of undifferentiated ESCs, NANOG plays a very important role. Nevertheless, because pluripotency maintaining factors and specific markers for livestock ESCs have not yet been probed, few studies of the NANOG gene from domestic animals including bovine have been reported. Therefore, we chose mouse ESCs in order to understand and compare NANOG expression between bovine, human, and mouse during ESCs differentiation. We cloned a 600 bp (−420/+181 bovine NANOG 5′-flanking region, and tagged it with humanized recombinant green fluorescent protein (hrGFP as a tracing reporter. Very high GFP expression for bovine NANOG promoter was observed in the mouse ESC line. GFP expression was monitored upon ESC differentiation and was gradually reduced along with differentiation toward neurons and adipocyte cells. Activity of bovine NANOG (−420/+181 promoter was compared with already known mouse and human NANOG promoters in mouse ESC and they were likely to show a similar pattern of regulation. In conclusion, bovine NANOG 5-flanking region functions in mouse ES cells and has characteristics similar to those of mouse and human. These results suggest that bovine gene function studied in mouse ES cells should be evaluated and extrapolated for application to characterization of bovine ES cells.
Directory of Open Access Journals (Sweden)
Wang Zhen
2011-11-01
Full Text Available Abstract Background The advent of genomics-based technologies has revolutionized many fields of biological enquiry. However, chromosome walking or flanking sequence cloning is still a necessary and important procedure to determining gene structure. Such methods are used to identify T-DNA insertion sites and so are especially relevant for organisms where large T-DNA insertion libraries have been created, such as rice and Arabidopsis. The currently available methods for flanking sequence cloning, including the popular TAIL-PCR technique, are relatively laborious and slow. Results Here, we report a simple and effective fusion primer and nested integrated PCR method (FPNI-PCR for the identification and cloning of unknown genomic regions flanked known sequences. In brief, a set of universal primers was designed that consisted of various 15-16 base arbitrary degenerate oligonucleotides. These arbitrary degenerate primers were fused to the 3' end of an adaptor oligonucleotide which provided a known sequence without degenerate nucleotides, thereby forming the fusion primers (FPs. These fusion primers are employed in the first step of an integrated nested PCR strategy which defines the overall FPNI-PCR protocol. In order to demonstrate the efficacy of this novel strategy, we have successfully used it to isolate multiple genomic sequences namely, 21 orthologs of genes in various species of Rosaceace, 4 MYB genes of Rosa rugosa, 3 promoters of transcription factors of Petunia hybrida, and 4 flanking sequences of T-DNA insertion sites in transgenic tobacco lines and 6 specific genes from sequenced genome of rice and Arabidopsis. Conclusions The successful amplification of target products through FPNI-PCR verified that this novel strategy is an effective, low cost and simple procedure. Furthermore, FPNI-PCR represents a more sensitive, rapid and accurate technique than the established TAIL-PCR and hiTAIL-PCR procedures.
Sang, Helen; Whitehouse, Harold L K
1983-01-01
Aberrant asci containing one or more wild-type spores were selected from crosses between pairs of alleles of the buff locus in the presence of closely linked flanking markers. Data were obtained relating to the site of aberrant segregation and the position of any associated crossover giving recombination of flanking markers. Aberrant segregation at a proximal site within the buff gene may be associated with a crossover proximal to the site of aberrant segregation or, with equal frequency, wit...
Right psoas abscess following right flank trauma: a case report ...
African Journals Online (AJOL)
This is a case of 15 year old boy who presented with three weeks history of right flank pain, two weeks history of fever and five days history of inability to walk well. There was history of right flank trauma a week before the onset of right flank pain. He had earlier presented in two different hospitals before he was brought to our ...
DEFF Research Database (Denmark)
Larsen, Jesper; Kuhnert, Peter; Frey, Joachim
2007-01-01
subclades, thus reaffirming the hypothesis of vertical inheritance of the leukotoxin operon. The presence of individual 5' flanking regions in M. haemolytica + M. glucosida and M. granulomatis reflects later genome rearrangements within each subclade. The evolution of the novel 5' flanking region in M...
DEFF Research Database (Denmark)
Tsangaras, Kyriakos; Wales, Nathan; Sicheritz-Pontén, Thomas
2014-01-01
nucleotides) can result in enrichment across entire mitochondrial and bacterial genomes. Our findings suggest that some of the off-target sequences derived in capture experiments are non-randomly enriched, and that CapFlank will facilitate targeted enrichment of large contiguous sequences with minimal prior...
Unilateral flank ovariohysterectomy in guinea pigs (Cavia porcellus).
Rozanska, D; Rozanski, P; Orzelski, M; Chlebicka, N; Putowska, K
2016-11-01
To describe a simple, minimally invasive method of ovariohysterectomy via a unilateral flank approach in guinea pigs, for use in routine desexing of healthy female guinea pigs or treatment of ovarian cysts. The subjects of this retrospective study were 41 client-owned guinea pigs submitted for routine desexing or treatment of ovarian cysts. They included 16 healthy female guinea pigs aged 8-12 months (Group 1), and 15 females aged from 9 months to 3 years (Group 2), and 10 females aged from 3 to 7 years (Group 3) with different-sized ovarian cysts. Prior to surgery, the animals received clinical examination, blood testing (complete blood count and serum biochemistry profile) and examination of the abdomen using ultrasonography, to assess the condition of the reproductive tract and ensure the guinea pigs were fit for surgery. Ovariohysterectomy was performed via a unilateral flank incision made close to the erector spinae muscle starting approximately 1 cm caudal to the last rib. Both ovaries, uterine horns, and the uterine cervix were localised, ligated, and dissected through this unilateral retroperitoneal incision. Ovariohysterectomy was successfully completed via a single flank incision in 38/41 (93%) guinea pigs. Three guinea pigs with ovarian cysts from Group 3, which were >6 years old died during surgery due to circulatory and respiratory failure under anaesthesia. In the remaining 38 cases, surgery proceeded without complications. A further two guinea pigs from Group 3 were reluctant to move or eat for the first 3 days after surgery but recovered after provision of supportive care. All 38 animals fully recovered and wound healing was normal. This is the first report of ovariohysterectomy via a unilateral flank incision in guinea pigs. This approach is a simple, minimally invasive and safe alternative to the midline or bilateral flank approaches currently used for surgery of the reproductive tract in guinea pigs.
File list: InP.Emb.50.AllAg.Embryonic_flank [Chip-atlas[Archive
Lifescience Database Archive (English)
Full Text Available InP.Emb.50.AllAg.Embryonic_flank mm9 Input control Embryo Embryonic flank SRX804059... http://dbarchive.biosciencedbc.jp/kyushu-u/mm9/assembled/InP.Emb.50.AllAg.Embryonic_flank.bed ...
The gene identification problem: An overview for developers
Energy Technology Data Exchange (ETDEWEB)
Fickett, J.W.
1995-03-27
The gene identification problem is the problem of interpreting nucleotide sequences by computer, in order to provide tentative annotation on the location, structure, and functional class of protein-coding genes. This problem is of self-evident importance, and is far from being fully solved, particularly for higher eukaryotes, Thus it is not surprising that the number of algorithm and software developers working in this area is rapidly increasing. The present paper is an overview of the field, with an emphasis on eukaryotes, for such developers.
Oosumi, Teruko; Ruiz-Rojas, Juan Jairo; Veilleux, Richard E; Dickerman, Allan; Shulaev, Vladimir
2010-09-01
Reverse genetics is used for functional genomics research in model plants. To establish a model system for the systematic reverse genetics research in the Rosaceae family, we analyzed genomic DNA flanking the T-DNA insertions in 191 transgenic plants of the diploid strawberry, Fragaria vesca. One hundred and seventy-six T-DNA flanking sequences were amplified from the right border (RB) and 37 from the left border (LB) by thermal asymmetric interlaced PCR. Analysis of the T-DNA nick positions revealed that T-DNA was most frequently nicked at the cleavage sites. Analysis of 11 T-DNA integration sites indicated that T-DNA was integrated into the F. vesca genome by illegitimate recombination, as reported in other model plants: Arabidopsis, rice and tobacco. First, deletion of DNA was found at T-DNA integration target sites in all transgenic plants tested. Second, microsimilarities of a few base pairs between the left and/or right ends of the T-DNA and genomic sites were found in all transgenic plants tested. Finally, filler DNA was identified in four break-points. Out of 191 transgenic plants, T-DNA flanking sequences of 79 plants (41%) showed significant similarity to genes, elements or proteins of other plant species and 67 (35%) of the sequences are still unknown strawberry gene fragments. T-DNA flanking sequences of 126 plants (66%) showed homology to plant ESTs. This is the first report of T-DNA integration in a sizeable population of a rosaceous species. We have shown in this paper that T-DNA integration in strawberry is not random but directed by sequence microsimilarities in the host genome.
International Nuclear Information System (INIS)
Andrade, S.M. de; Camarco, P.E.N.
1984-01-01
The Carboniferous sequences of the northeast flank of the Parana Basin and those of the southwest flank of the Parnaiba Basin have been the subject of discussion and polemics for quite a long time, especially in terms of their stratigraphic relations and depositional environments. Thus, we reinforce our main objective, which is to furnish data for the definition of the uranium potential in these Carboniferous sediments, by adding recently acquired information that should aid in the clarification of the existing controversies. The Carboniferous along the northeast flank of the Parana Basin is represented by the Aquidauana Formation which has been informally divided into three members: lower, middle and upper members. The middle member, of marine origin, constitutes a prospective target for uranium and phosphate associations, in which sandstones interbedded with shales constitute the host rocks. On the other hand, the Carboniferous of the southwest margin of the Parnaiba Basin, which encompasses the Longa, Poti and Piaui Formations has shown very remote possibilities of uranium occurrences. The regional structural framework, as reflected by the Carboniferous rocks along both basin flanks, is characterized by homoclines cut by gravity faults. The faults along these weakness zones were occasionally intruded by basic rocks of Cretaceous age. Superimposed on the regional structure, open folds appear in the form of anticlines and domes. These folds are discontinuous structures resulting from uplift due to vertical stresses or result from differential subsidence along the limbs of the folds. (Author) [pt
Flanking Variation Influences Rates of Stutter in Simple Repeats
Directory of Open Access Journals (Sweden)
August E. Woerner
2017-11-01
Full Text Available It has been posited that the longest uninterrupted stretch (LUS of tandem repeats, as defined by the number of exactly matching repeating motif units, is a better predictor of rates of stutter than the parental allele length (PAL. While there are cases where this hypothesis is likely correct, such as the 9.3 allele in the TH01 locus, there can be situations where it may not apply as well. For example, the PAL may capture flanking indel variations while remaining insensitive to polymorphisms in the repeat, and these haplotypic changes may impact the stutter rate. To address this, rates of stutter were contrasted against the LUS as well as the PAL on different flanking haplotypic backgrounds. This study shows that rates of stutter can vary substantially depending on the flanking haplotype, and while there are cases where the LUS is a better predictor of stutter than the PAL, examples to the contrary are apparent in commonly assayed forensic markers. Further, flanking variation that is 7 bp from the repeat region can impact rates of stutter. These findings suggest that non-proximal effects, such as DNA secondary structure, may be impacting the rates of stutter in common forensic short tandem repeat markers.
Casein genes of Bos taurus. II. Isolation and characterization of the β-casein gene
International Nuclear Information System (INIS)
Gorodetskii, S.I.; Tkach, T.M.; Kapelinskaya, T.V.
1988-01-01
The expression of the casein genes in the cells of the mammary gland is regulated by peptide and steroid hormones. In order to study the controlling mechanisms we have isolated and characterized the β-casein gene. The gene is 8.6 kb long and exceeds by a factor of 7.8 the length of the corresponding mRNA which is encoded by nine exons. The genomic clones incorporate in addition 8.5 kb and 4.5 kb of the 5'- and 3'-flanking regions. We have determined the sequence of the 5- and 3-terminals of the gene and have performed a comparative analysis of the corresponding regions of the rat β-casein gene. Furthermore we have identified the conversed sequences identical or homologous to the potential sections of binding to the nuclear factor CTF/NF-1 by glucocorticoid and progesterone receptors. The regulatory region of the bovine casein gene contains two variants of the TATA signal, flanking the duplication section in the promoter region
Multi-stage volcanic island flank collapses with coeval explosive caldera-forming eruptions
Hunt, James E.; Cassidy, Michael; Talling, Peter J.
2018-01-01
Volcanic flank collapses and explosive eruptions are among the largest and most destructive processes on Earth. Events at Mount St. Helens in May 1980 demonstrated how a relatively small (<5 km3) flank collapse on a terrestrial volcano could immediately precede a devastating eruption. The lateral collapse of volcanic island flanks, such as in the Canary Islands, can be far larger (>300 km3), but can also occur in complex multiple stages. Here, we show that multistage retrogressive lands...
International Nuclear Information System (INIS)
Kudo, Shinichi; Fukuda, Minoru
1989-01-01
Glycophorins A (GPA) and B (GPB) are two major sialoglycoproteins of the human erythrocyte membrane. Here the authors present a comparison of the genomic structures of GPA and GPB developed by analyzing DNA clones isolated from a K562 genomic library. Nucleotide sequences of exon-intron junctions and 5' and 3' flanking sequences revealed that the GPA and GPB genes consist of 7 and 5 exons, respectively, and both genes have >95% identical sequence from the 5' flanking region to the region ∼ 1 kilobase downstream from the exon encoding the transmembrane regions. In this homologous part of the genes, GPB lacks one exon due to a point mutation at the 5' splicing site of the third intron, which inactivates the 5' cleavage event of splicing and leads to ligation of the second to the fourth exon. Following these very homologous sequences, the genomic sequences for GPA and GPB diverge significantly and no homology can be detected in their 3' end sequences. The analysis of the Alu sequences and their flanking direct repeat sequences suggest that an ancestral genomic structure has been maintained in the GPA gene, whereas the GPB gene has arisen from the acquisition of 3' sequences different from those of the GPA gene by homologous recombination at the Alu repeats during or after gene duplication
Gene study within the 5' flanking regions of growth hormone gene of ...
African Journals Online (AJOL)
user
2011-01-17
Jan 17, 2011 ... Expression of more than one gene for GH has been reported, indicating ..... hormone levels of palsmáticos IGF-1 and carcass traits in beef cattle. Dissertation ... Structure-function relation of somatotropin with reference to ...
Nucleotide sequence of the triosephosphate isomerase gene from Macaca mulatta
Energy Technology Data Exchange (ETDEWEB)
Old, S.E.; Mohrenweiser, H.W. (Univ. of Michigan, Ann Arbor (USA))
1988-09-26
The triosephosphate isomerase gene from a rhesus monkey, Macaca mulatta, charon 34 library was sequenced. The human and chimpanzee enzymes differ from the rhesus enzyme at ASN 20 and GLU 198. The nucleotide sequence identity between rhesus and human is 97% in the coding region and >94% in the flanking regions. Comparison of the rhesus and chimp genes, including the intron and flanking sequences, does not suggest a mechanism for generating the two TPI peptides of proliferating cells from hominoids and a single peptide from the rhesus gene.
Mitigation of Flanking Noise Transmission in Periodic Structures of Lightweight Elements
DEFF Research Database (Denmark)
Domadiya, Parthkumar Gandalal
through structural junctions and radiates into neighbouring rooms. To diminish the flanking transmission of sound, frames are usually designed with single or double studs or constructed with layers of foam or another viscoelastic material. This thesis is investigating the behaviour of flanking noise...... transmission in periodic structures of lightweight elements by employing various numerical, analytical and experimental methods. At first, three dimensional finite-element (FE) models of a Z-shaped lightweight panel structure based on various frame designs, inclusion of air and structural coupling between...... elements are considered for describing flanking noise transmission through panels. It is assumed that the ribs are fully fixed to the plates in case of various frame designs, and a parametric study is carried out on the centre panel with regard to various spacing between the ribs. Solid finite elements...
Flank tectonics of Martian volcanoes
International Nuclear Information System (INIS)
Thomas, P.J.; Squyres, S.W.; Carr, M.H.
1990-01-01
On the flanks of Olympus Mons is a series of terraces, concentrically distributed around the caldera. Their morphology and location suggest that they could be thrust faults caused by compressional failure of the cone. In an attempt to understand the mechanism of faulting and the possible influences of the interior structure of Olympus Mons, the authors have constructed a numerical model for elastic stresses within a Martian volcano. In the absence of internal pressurization, the middle slopes of the cone are subjected to compressional stress, appropriate to the formation of thrust faults. These stresses for Olympus Mons are ∼250 MPa. If a vacant magma chamber is contained within the cone, the region of maximum compressional stress is extended toward the base of the cone. If the magma chamber is pressurized, extensional stresses occur at the summit and on the upper slopes of the cone. For a filled but unpressurized magma chamber, the observed positions of the faults agree well with the calculated region of high compressional stress. Three other volcanoes on Mars, Ascraeus Mons, Arsia Mons, and Pavonis Mons, possess similar terraces. Extending the analysis to other Martian volcanoes, they find that only these three and Olympus Mons have flank stresses that exceed the compressional failure strength of basalt, lending support to the view that the terraces on all four are thrust faults
The GP problem: quantifying gene-to-phenotype relationships.
Cooper, Mark; Chapman, Scott C; Podlich, Dean W; Hammer, Graeme L
2002-01-01
In this paper we refer to the gene-to-phenotype modeling challenge as the GP problem. Integrating information across levels of organization within a genotype-environment system is a major challenge in computational biology. However, resolving the GP problem is a fundamental requirement if we are to understand and predict phenotypes given knowledge of the genome and model dynamic properties of biological systems. Organisms are consequences of this integration, and it is a major property of biological systems that underlies the responses we observe. We discuss the E(NK) model as a framework for investigation of the GP problem and the prediction of system properties at different levels of organization. We apply this quantitative framework to an investigation of the processes involved in genetic improvement of plants for agriculture. In our analysis, N genes determine the genetic variation for a set of traits that are responsible for plant adaptation to E environment-types within a target population of environments. The N genes can interact in epistatic NK gene-networks through the way that they influence plant growth and development processes within a dynamic crop growth model. We use a sorghum crop growth model, available within the APSIM agricultural production systems simulation model, to integrate the gene-environment interactions that occur during growth and development and to predict genotype-to-phenotype relationships for a given E(NK) model. Directional selection is then applied to the population of genotypes, based on their predicted phenotypes, to simulate the dynamic aspects of genetic improvement by a plant-breeding program. The outcomes of the simulated breeding are evaluated across cycles of selection in terms of the changes in allele frequencies for the N genes and the genotypic and phenotypic values of the populations of genotypes.
Yeh, Hsin-Chih; Jan, Hau-Chern; Wu, Wen-Jeng; Li, Ching-Chia; Li, Wei-Ming; Ke, Hung-Lung; Huang, Shu-Pin; Liu, Chia-Chu; Lee, Yung-Chin; Yang, Sheau-Fang; Liang, Peir-In; Huang, Chun-Nung
2015-01-01
To investigate the impact of preoperative hydronephrosis and flank pain on prognosis of patients with upper tract urothelial carcinoma. In total, 472 patients with upper tract urothelial carcinoma managed by radical nephroureterectomy were included from Kaohsiung Medical University Hospital Healthcare System. Clinicopathological data were collected retrospectively for analysis. The significance of hydronephrosis, especially when combined with flank pain, and other relevant factors on overall and cancer-specific survival were evaluated. Of the 472 patients, 292 (62%) had preoperative hydronephrosis and 121 (26%) presented with flank pain. Preoperative hydronephrosis was significantly associated with age, hematuria, flank pain, tumor location, and pathological tumor stage. Concurrent presence of hydronephrosis and flank pain was a significant predictor of non-organ-confined disease (multivariate-adjusted hazard ratio = 2.10, P = 0.025). Kaplan-Meier analysis showed significantly poorer overall and cancer-specific survival in patients with preoperative hydronephrosis (P = 0.005 and P = 0.026, respectively) and in patients with flank pain (P hydronephrosis and flank pain independently predicted adverse outcome (hazard ratio = 1.98, P = 0.016 for overall survival and hazard ratio = 1.87, P = 0.036 for and cancer-specific survival, respectively) in multivariate Cox proportional hazards models. In addition, concurrent presence of hydronephrosis and flank pain was also significantly predictive of worse survival in patient with high grade or muscle-invasive disease. Notably, there was no difference in survival between patients with hydronephrosis but devoid of flank pain and those without hydronephrosis. Concurrent preoperative presence of hydronephrosis and flank pain predicted non-organ-confined status of upper tract urothelial carcinoma. When accompanied with flank pain, hydronephrosis represented an independent predictor for worse outcome in patients with upper tract
Structure and regulated expression of bovine prolactin and bovine growth hormone genes
International Nuclear Information System (INIS)
Rottman, F.; Camper, S.; Goodwin, E.; Hampson, R.; Lyons, R.
1986-01-01
This paper presents a description of several studies which utilize the transfection of cloned chimeric genes in an attempt to analyze the regulatory signals found in the bPRL and bGH genes. Examination of 5' flanking region of PRL genes reveals a high degree of sequence homology between the bovine, human, and rat species. In order to assess the existence of possible regulatory sequences in a more direct manner, the authors transfected homologous and heterologous cells with chimeric gene constructs containing possible regulatory sequences derived from both the bPRL and bGH genes. An analysis is presented of the polyadenylation signal contained in the bGH 3' flanking sequence
Donaldson, Zoe R; Kondrashov, Fyodor A; Putnam, Andrea; Bai, Yaohui; Stoinski, Tara L; Hammock, Elizabeth A D; Young, Larry J
2008-06-23
The arginine vasopressin V1a receptor (V1aR) modulates social cognition and behavior in a wide variety of species. Variation in a repetitive microsatellite element in the 5' flanking region of the V1aR gene (AVPR1A) in rodents has been associated with variation in brain V1aR expression and in social behavior. In humans, the 5' flanking region of AVPR1A contains a tandem duplication of two approximately 350 bp, microsatellite-containing elements located approximately 3.5 kb upstream of the transcription start site. The first block, referred to as DupA, contains a polymorphic (GT)25 microsatellite; the second block, DupB, has a complex (CT)4-(TT)-(CT)8-(GT)24 polymorphic motif, known as RS3. Polymorphisms in RS3 have been associated with variation in sociobehavioral traits in humans, including autism spectrum disorders. Thus, evolution of these regions may have contributed to variation in social behavior in primates. We examined the structure of these regions in six ape, six monkey, and one prosimian species. Both tandem repeat blocks are present upstream of the AVPR1A coding region in five of the ape species we investigated, while monkeys have only one copy of this region. As in humans, the microsatellites within DupA and DupB are polymorphic in many primate species. Furthermore, both single (lacking DupB) and duplicated alleles (containing both DupA and DupB) are present in chimpanzee (Pan troglodytes) populations with allele frequencies of 0.795 and 0.205 for the single and duplicated alleles, respectively, based on the analysis of 47 wild-caught individuals. Finally, a phylogenetic reconstruction suggests two alternate evolutionary histories for this locus. There is no obvious relationship between the presence of the RS3 duplication and social organization in primates. However, polymorphisms identified in some species may be useful in future genetic association studies. In particular, the presence of both single and duplicated alleles in chimpanzees provides a
Directory of Open Access Journals (Sweden)
Bai Yaohui
2008-06-01
Full Text Available Abstract Background The arginine vasopressin V1a receptor (V1aR modulates social cognition and behavior in a wide variety of species. Variation in a repetitive microsatellite element in the 5' flanking region of the V1aR gene (AVPR1A in rodents has been associated with variation in brain V1aR expression and in social behavior. In humans, the 5' flanking region of AVPR1A contains a tandem duplication of two ~350 bp, microsatellite-containing elements located approximately 3.5 kb upstream of the transcription start site. The first block, referred to as DupA, contains a polymorphic (GT25 microsatellite; the second block, DupB, has a complex (CT4-(TT-(CT8-(GT24 polymorphic motif, known as RS3. Polymorphisms in RS3 have been associated with variation in sociobehavioral traits in humans, including autism spectrum disorders. Thus, evolution of these regions may have contributed to variation in social behavior in primates. We examined the structure of these regions in six ape, six monkey, and one prosimian species. Results Both tandem repeat blocks are present upstream of the AVPR1A coding region in five of the ape species we investigated, while monkeys have only one copy of this region. As in humans, the microsatellites within DupA and DupB are polymorphic in many primate species. Furthermore, both single (lacking DupB and duplicated alleles (containing both DupA and DupB are present in chimpanzee (Pan troglodytes populations with allele frequencies of 0.795 and 0.205 for the single and duplicated alleles, respectively, based on the analysis of 47 wild-caught individuals. Finally, a phylogenetic reconstruction suggests two alternate evolutionary histories for this locus. Conclusion There is no obvious relationship between the presence of the RS3 duplication and social organization in primates. However, polymorphisms identified in some species may be useful in future genetic association studies. In particular, the presence of both single and duplicated
DISQUIETUDE ON THE EASTERN FLANK: AWAITING ALLIANCE RESPONSE
Directory of Open Access Journals (Sweden)
Octavian Manea
2010-03-01
Full Text Available The absence of significant and tangible military defensive infrastructure on the Eastern flank generated over time a breach of credibility in the security guarantee provided by NATO under its Article 5 commitment. The main argument of the countries in the New Europe now is that, in order to be credible enough, and not just a paper guarantee, a collective defence commitment must be backed by “boots on the ground” and by military tangible logistics.While assuming this perspective, the present article looks at some of the alarm signals coming from the countries on NATO’s Eastern flank, trying to explain the feeling of insecurity perceived by the states in the region as well as the options available to the Euro-Atlantic community in order to engage in a much-needed process of strategic reassurance.
Economic method for helical gear flank surface characterisation
Koulin, G.; Reavie, T.; Frazer, R. C.; Shaw, B. A.
2018-03-01
Typically the quality of a gear pair is assessed based on simplified geometric tolerances which do not always correlate with functional performance. In order to identify and quantify functional performance based parameters, further development of the gear measurement approach is required. Methodology for interpolation of the full active helical gear flank surface, from sparse line measurements, is presented. The method seeks to identify the minimum number of line measurements required to sufficiently characterise an active gear flank. In the form ground gear example presented, a single helix and three profile line measurements was considered to be acceptable. The resulting surfaces can be used to simulate the meshing engagement of a gear pair and therefore provide insight into functional performance based parameters. Therefore the assessment of the quality can be based on the predicted performance in the context of an application.
The role of retrotransposons in gene family expansions: insights from the mouse Abp gene family.
Janoušek, Václav; Karn, Robert C; Laukaitis, Christina M
2013-05-29
Retrotransposons have been suggested to provide a substrate for non-allelic homologous recombination (NAHR) and thereby promote gene family expansion. Their precise role, however, is controversial. Here we ask whether retrotransposons contributed to the recent expansions of the Androgen-binding protein (Abp) gene families that occurred independently in the mouse and rat genomes. Using dot plot analysis, we found that the most recent duplication in the Abp region of the mouse genome is flanked by L1Md_T elements. Analysis of the sequence of these elements revealed breakpoints that are the relicts of the recombination that caused the duplication, confirming that the duplication arose as a result of NAHR using L1 elements as substrates. L1 and ERVII retrotransposons are considerably denser in the Abp regions than in one Mb flanking regions, while other repeat types are depleted in the Abp regions compared to flanking regions. L1 retrotransposons preferentially accumulated in the Abp gene regions after lineage separation and roughly followed the pattern of Abp gene expansion. By contrast, the proportion of shared vs. lineage-specific ERVII repeats in the Abp region resembles the rest of the genome. We confirmed the role of L1 repeats in Abp gene duplication with the identification of recombinant L1Md_T elements at the edges of the most recent mouse Abp gene duplication. High densities of L1 and ERVII repeats were found in the Abp gene region with abrupt transitions at the region boundaries, suggesting that their higher densities are tightly associated with Abp gene duplication. We observed that the major accumulation of L1 elements occurred after the split of the mouse and rat lineages and that there is a striking overlap between the timing of L1 accumulation and expansion of the Abp gene family in the mouse genome. Establishing a link between the accumulation of L1 elements and the expansion of the Abp gene family and identification of an NAHR-related breakpoint in
Jiang, Weili; Shang, Siyuan; Su, Yanjie
2015-01-01
People may experience an "aha" moment, when suddenly realizing a solution of a puzzling problem. This experience is called insight problem solving. Several findings suggest that catecholamine-related genes may contribute to insight problem solving, among which the catechol-O-methyltransferase (COMT) gene is the most promising candidate. The current study examined 753 healthy individuals to determine the associations between 7 candidate single nucleotide polymorphisms on the COMT gene and insight problem-solving performance, while considering gender differences. The results showed that individuals carrying A allele of rs4680 or T allele of rs4633 scored significantly higher on insight problem-solving tasks, and the COMT gene rs5993883 combined with gender interacted with correct solutions of insight problems, specifically showing that this gene only influenced insight problem-solving performance in males. This study presents the first investigation of the genetic impact on insight problem solving and provides evidence that highlights the role that the COMT gene plays in insight problem solving.
Relaxation of the south flank after the 7.2-magnitude Kalapana earthquake, Kilauea Volcano, Hawaii
Dvorak, John J.; Klein, Fred W.; Swanson, Donald A.
1994-01-01
An M = 7.2 earthquake on 29 November 1975 caused the south flank of Kilauea Volcano, Hawaii, to move seaward several meters: a catastrophic release of compression of the south flank caused by earlier injections of magma into the adjacent segment of a rift zone. The focal mechanisms of the mainshock, the largest foreshock, and the largest aftershock suggest seaward movement of the upper block. The rate of aftershocks decreased in a familiar hyperbolic decay, reaching the pre-1975 rate of seismicity by the mid-1980s. Repeated rift-zone intrusions and eruptions after 1975, which occurred within 25 km of the summit area, compressed the adjacent portion of the south flank, apparently masking continued seaward displacement of the south flank. This is evident along a trilateration line that continued to extend, suggesting seaward displacement, immediately after the M = 7.2 earthquake, but then was compressed during a series of intrusions and eruptions that began in September 1977. Farther to the east, trilateration measurements show that the portion of the south flank above the aftershock zone, but beyond the area of compression caused by the rift-zone intrusions and eruptions, continued to move seaward at a decreasing rate until the mid-1980s, mimicking the decay in aftershock rate. Along the same portion of the south flank, the pattern of vertical surface displacements can be explained by continued seaward movement of the south flank and development of two eruptive fissures along the east rift zone, each of which extended from a depth of ∼3 km to the surface. The aftershock rate and continued seaward movement of the south flank are reminiscent of crustal response to other large earthquakes, such as the 1966 M = 6 Parkfield earthquake and the 1983 M = 6.5 Coalinga earthquake.
Kardinal, C; Selmayr, M; Mocikat, R
1996-11-01
Gene targeting at the immunoglobulin loci of B cells is an efficient tool for studying immunoglobulin expression or generating chimeric antibodies. We have shown that vector integration induced by human immunoglobulin G1 (IgG1) insertion vectors results in subsequent vector excision mediated by the duplicated target sequence, whereas replacement events which could be induced by the same constructs remain stable. We could demonstrate that the distribution of the vector homology strongly influences the genetic stability obtained. To this end we developed a novel type of a heavy chain replacement vector making use of the heavy chain class switch recombination sequence. Despite the presence of a two-sided homology this construct is universally applicable irrespective of the constant gene region utilized by the B cell. In comparison to an integration vector the frequency of stable incorporation was strongly increased, but we still observed vector excision, although at a markedly reduced rate. The latter events even occurred with circular constructs. Linearization of the construct at various sites and the comparison with an integration vector that carries the identical homology sequence, but differs in the distribution of homology, revealed the following features of homologous recombination of immunoglobulin genes: (i) the integration frequency is only determined by the length of the homology flank where the cross-over takes place; (ii) a 5' flank that does not meet the minimum requirement of homology length cannot be complemented by a sufficient 3' flank; (iii) free vector ends play a role for integration as well as for replacement targeting; (iv) truncating recombination events are suppressed in the presence of two flanks. Furthermore, we show that the switch region that was used as 3' flank is non-functional in an inverted orientation.
The primary structures of two leghemoglobin genes from soybean
DEFF Research Database (Denmark)
Hyldig-Nielsen, J J; Jensen, E O; Paludan, K
1982-01-01
We present the complete nucleotide sequences of two leghemoglobin genes isolated from soybean DNA. Both genes contain three intervening sequences which interrupt the two coding sequences in identical positions. The 5' and 3' flanking sequences in both genes contain conserved sequences similar...
Effect of the bases flanking an abasic site on the recognition of nucleobase by amiloride.
Rajendran, Arivazhagan; Zhao, Chunxia; Rajendar, Burki; Thiagarajan, Viruthachalam; Sato, Yusuke; Nishizawa, Seiichi; Teramae, Norio
2010-06-01
We explain here the various non-covalent interactions which are responsible for the different binding modes of a small ligand with DNA. The combination of experimental and theoretical methods was used. The interaction of amiloride with thymine was found to depend on the bases flanking the AP site and different binding modes were observed for different flanking bases. Molecular modeling, absorption studies and binding constant measurements support for the different binding patterns. The flanking base dependent recognition of AP site phosphates was investigated by (31)P NMR experiments. The thermodynamics of the ligand-nucleotide interaction was demonstrated by isothermal titration calorimetry. The emission behavior of amiloride was found to depend on the bases flanking the AP site. Amiloride photophysics in the context of AP-site containing DNA is investigated by time-dependent density functional theory. Flanking bases affect the ground and excited electronic states of amiloride when binding to AP site, which causes flanking base-dependent fluorescence signaling. The various noncovalent interactions have been well characterized for the determination of nucleic acid structure and dynamics, and protein-DNA interactions. However, these are not clear for the DNA-small molecule interactions and we believe that our studies will bring a new insight into such phenomena. Copyright 2010 Elsevier B.V. All rights reserved.
Sea urchin neural alpha2 tubulin gene: isolation and promoter analysis.
Costa, S; Ragusa, M A; Drago, G; Casano, C; Alaimo, G; Guida, N; Gianguzza, F
2004-04-02
Expression of Talpha2 gene, during sea urchin Paracentrotus lividus development, is spatially and temporally regulated. In order to characterize this gene, we isolated the relevant genomic sequences and scanned the isolated 5'-flanking region in searching for cis-regulatory elements required for proper expression. Gel mobility shift and footprinting assays, as well as reporter gene (CAT and beta-gal) expression assays, were used to address cis-regulatory elements involved in regulation. Here we report that an upstream 5'-flanking fragment of PlTalpha2 gene drives temporal expression of reporter genes congruent with that of endogenous Talpha2 gene. The fragment contains cis-elements able to bind nuclear proteins from the gastrula stage (at which the Talpha2 gene is expressed) whose sequences could be consistent with the consensus sequences for transcription factors present in data bank.
Flank solar wind interaction. Annual report, June 1991-July 1992
International Nuclear Information System (INIS)
Moses, S.L.; Greenstadt, E.W.
1992-08-01
This report summarizes the results of the first 12 months of our program to study the interaction of the Earth's magnetosphere with the solar wind on the far flanks of the bow shock. This study employs data from the ISEE-3 spacecraft during its traversals of the Earth's magnetotail and correlative data from spacecraft monitoring the solar wind upstream. Our main effort to date has involved assembling data sets and developing new plotting programs. Two talks were given at the Spring Meeting of the American Geophysical Union describing our initial results from analyzing data from the far flank foreshock and magnetosheath. The following sections summarize our results
Wear evaluation of flank in burins of high speed steel modified with titanium ions
E Caballero, J.; V-Niño, E. D.
2017-12-01
This report shows the results obtained researching the flank wearing resistance performed by the high-speed steel (HSS) burins without any surface treatment (reference substrate) and others with surface treatment based on Titanium ions. The flank wearing was carried out by means of an industrial process by chip removal with repetitive tests of dry finished turning of AISI/SAE 1045 steel bars. The useful service life of the burins was evaluated according to ISO 3685:1993, and it was found that the burins treated with Titanium ions showed an increase in the flank wearing resistance with respect to the ones used as reference.
Lyubetsky, Vassily; Gershgorin, Roman; Gorbunov, Konstantin
2017-12-06
Chromosome structure is a very limited model of the genome including the information about its chromosomes such as their linear or circular organization, the order of genes on them, and the DNA strand encoding a gene. Gene lengths, nucleotide composition, and intergenic regions are ignored. Although highly incomplete, such structure can be used in many cases, e.g., to reconstruct phylogeny and evolutionary events, to identify gene synteny, regulatory elements and promoters (considering highly conserved elements), etc. Three problems are considered; all assume unequal gene content and the presence of gene paralogs. The distance problem is to determine the minimum number of operations required to transform one chromosome structure into another and the corresponding transformation itself including the identification of paralogs in two structures. We use the DCJ model which is one of the most studied combinatorial rearrangement models. Double-, sesqui-, and single-operations as well as deletion and insertion of a chromosome region are considered in the model; the single ones comprise cut and join. In the reconstruction problem, a phylogenetic tree with chromosome structures in the leaves is given. It is necessary to assign the structures to inner nodes of the tree to minimize the sum of distances between terminal structures of each edge and to identify the mutual paralogs in a fairly large set of structures. A linear algorithm is known for the distance problem without paralogs, while the presence of paralogs makes it NP-hard. If paralogs are allowed but the insertion and deletion operations are missing (and special constraints are imposed), the reduction of the distance problem to integer linear programming is known. Apparently, the reconstruction problem is NP-hard even in the absence of paralogs. The problem of contigs is to find the optimal arrangements for each given set of contigs, which also includes the mutual identification of paralogs. We proved that these
Construction of Escherichia coli K-12 in-frame, single-gene knockout mutants: the Keio collection.
Baba, Tomoya; Ara, Takeshi; Hasegawa, Miki; Takai, Yuki; Okumura, Yoshiko; Baba, Miki; Datsenko, Kirill A; Tomita, Masaru; Wanner, Barry L; Mori, Hirotada
2006-01-01
We have systematically made a set of precisely defined, single-gene deletions of all nonessential genes in Escherichia coli K-12. Open-reading frame coding regions were replaced with a kanamycin cassette flanked by FLP recognition target sites by using a one-step method for inactivation of chromosomal genes and primers designed to create in-frame deletions upon excision of the resistance cassette. Of 4288 genes targeted, mutants were obtained for 3985. To alleviate problems encountered in high-throughput studies, two independent mutants were saved for every deleted gene. These mutants-the 'Keio collection'-provide a new resource not only for systematic analyses of unknown gene functions and gene regulatory networks but also for genome-wide testing of mutational effects in a common strain background, E. coli K-12 BW25113. We were unable to disrupt 303 genes, including 37 of unknown function, which are candidates for essential genes. Distribution is being handled via GenoBase (http://ecoli.aist-nara.ac.jp/).
Hashimoto, H; Toide, K; Kitamura, R; Fujita, M; Tagawa, S; Itoh, S; Kamataki, T
1993-12-01
CYP3 A4 is the adult-specific form of cytochrome P450 in human livers [Komori, M., Nishio, K., Kitada, M., Shiramatsu, K., Muroya, K., Soma, M., Nagashima, K. & Kamataki, T. (1990) Biochemistry 29, 4430-4433]. The sequences of three genomic clones for CYP3A4 were analyzed for all exons, exon-intron junctions and the 5'-flanking region from the major transcription site to nucleotide position -1105, and compared with those of the CYP3A7 gene, a fetal-specific form of cytochrome P450 in humans. The results showed that the identity of 5'-flanking sequences between CYP3A4 and CYP3A7 genes was 91%, and that each 5'-flanking region had characteristic sequences termed as NFSE (P450NF-specific element) and HFLaSE (P450HFLa specific element), respectively. A basic transcription element (BTE) also lay in the 5'-flanking region of the CYP3A4 gene as seen in many CYP genes [Yanagida, A., Sogawa, K., Yasumoto, K. & Fujii-Kuriyama, Y. (1990) Mol. Cell. Biol. 10, 1470-1475]. The BTE binding factor (BTEB) was present in both adult and fetal human livers. To examine the transcriptional activity of the CYP3A4 gene, DNA fragments in the 5'-flanking region of the gene were inserted in front of the simian virus 40 promoter and the chloramphenicol acetyltransferase structural gene, and the constructs were transfected in HepG2 cells. The analysis of the chloramphenicol acetyltransferase activity indicated that (a) specific element(s) which could bind with a factor(s) in livers was present in the 5'-flanking region of the CYP3A4 gene to show the transcriptional activity.
International Nuclear Information System (INIS)
Hickey, M.J.; Williams, S.A.; Roth, G.J.
1989-01-01
The glycoprotein (GP) Ib-IX complex on the surface of human platelets functions as the von Willebrand factor receptor and mediates von Willebrand factor-dependent platelet adhesion to blood vessels. GPIX is a relatively small (M r , 17,000) protein that may provide for membrane insertion and orientation of the larger component of the complex. GPIb (M r , 165,000). Using antibody screening, the authors cloned a cDNA encoding GPIX from a human erythroleukemia cell cDNA library constructed in phage λgt11. Lacking a 5' untranslated region and start codon, the cDNA sequence includes 604 nucleotides, beginning with 495 bases at the 5' end coding for 165 amino acids, followed by a stop codon and 106 noncoding bases at the 3' end. By Northern blot analysis, the GPIX cDNA hybridizes with a single 1.0-kilobase species of platelet poly(A) + RNA. Translation of the cDNA sequence gives a predicted protein sequence beginning with a truncated putative signal sequence of 5 amino acids followed by a sequence of 17 amino acids matching that determined directly by Edman degradation of intact GPIX. GPIX contains a leucine-rich glycoprotein (LRG) sequence of 24 amino acids similar to conserved LRG sequences in GPIb and other proteins from humans, Drosophila, and yeast. The role of the flank-LRG center-flank structure in the evolution and function of the LRG proteins remains to be defined
Method for Friction Force Estimation on the Flank of Cutting Tools
Directory of Open Access Journals (Sweden)
Luis Huerta
2017-01-01
Full Text Available Friction forces are present in any machining process. These forces could play an important role in the dynamics of the system. In the cutting process, friction is mainly present in the rake face and the flank of the tool. Although the one that acts on the rake face has a major influence, the other one can become also important and could take part in the stability of the system. In this work, experimental identification of the friction on the flank is presented. The experimental determination was carried out by machining aluminum samples in a CNC lathe. As a result, two friction functions were obtained as a function of the cutting speed and the relative motion of the contact elements. Experiments using a worn and a new insert were carried out. Force and acceleration were recorded simultaneously and, from these results, different friction levels were observed depending on the cutting parameters, such as cutting speed, feed rate, and tool condition. Finally, a friction model for the flank friction is presented.
The hamster flank organ model: Is it relevant to man
International Nuclear Information System (INIS)
Franz, T.J.; Lehman, P.A.; Pochi, P.; Odland, G.F.; Olerud, J.
1989-01-01
The critical role that androgens play in the etiology of acne has led to a search for topically active antiandrogens and the frequent use of the flank organ of the golden Syrian hamster as an animal model. 17-alpha-propyltestosterone (17-PT) has been identified as having potent antiandrogenic activity in the hamster model, and this report describes its clinical evaluation. Two double-blind placebo controlled studies comparing 4% 17-PT in 80% alcohol versus vehicle alone were conducted. One study examined 17-PT sebosuppressive activity in 20 subjects. The second study examined its efficacy in 44 subjects having mild to moderate acne. A third study measured in vitro percutaneous absorption of 17-PT through hamster flank and monkey skin, and human face skin in-vivo, using radioactive drug. 17-PT was found to be ineffective in reducing either the sebum excretion rate or the number of inflammatory acne lesions. Failure of 17-PT to show clinical activity was not a result of poor percutaneous absorption. Total absorption in man was 7.7% of the dose and only 1.0% in the hamster. The sebaceous gland of hamster flank organ is apparently more sensitive to antiandrogens than the human sebaceous gland
International Nuclear Information System (INIS)
Chebloune, Y.; Pagnier, J.; Trabuchet, G.; Faure, C.; Verdier, G.; Labie, D.; Nigon, V.
1988-01-01
Haplotype analysis of the β-globin gene cluster shows two regions of DNA characterized by nonrandom association of restriction site polymorphisms. These regions are separated by a variable segment containing the repeated sequences (ATTTT) n and (AT) x T y , which might be involved in recombinational events. Studies of haplotypes linked to the sickle cell gene in Africa provide strong argument for three origins of the mutation: Benin, Senegal, and the Central African Republic. The structure of the variable segment in the three African populations was studied by S1 nuclease mapping of genomic DNA, which allows a comparison of several samples. A 1080-base-pair DNA segment was sequenced for one sample from each population. S1 nuclease mapping confirmed the homogeneity of each population with regard to both (ATTTT) n and (AT) x T y repeats. The authors found three additional structures for (AT) x T y correlating with the geographic origin of the patients. Ten other nucleotide positions, 5' and 3' to the (AT) x T y copies, were found to be variable when compared to homologous sequences from human and monkey DNAs. These results allow us to propose an evolutionary scheme for the polymorphisms in the 5' flanking region of the β-globin gene. The results strongly support the hypothesis of three origins for the sickle mutation in Africa
Calvari, S.; Branca, S.; Corsaro, R.A.; De Beni, E.; Miraglia, L.; Norini, G.; Wijbrans, J.R.; Boschi, E.
2011-01-01
A multidisciplinary geological and compositional investigation allowed us to reconstruct the occurrence of flank eruptions on the lower NE flank of Stromboli volcano since 15 ka. The oldest flank eruption recognised is Roisa, which occurred at ~15 ka during the Vancori period, and has transitional
Sang, H; Whitehouse, H L
1983-02-01
Aberrant asci containing one or more wild-type spores were selected from crosses between pairs of alleles of the buff locus in the presence of closely linked flanking markers. Data were obtained relating to the site of aberrant segregation and the position of any associated crossover giving recombination of flanking markers. Aberrant segregation at a proximal site within the buff gene may be associated with a crossover proximal to the site of aberrant segregation or, with equal frequency, with a crossover distal to the site of the second mutant present in the cross. Similarly, segregation at a distal site may be associated with a crossover distal to the site or, with lower frequency, with a crossover proximal to the site of the proximal mutant present in the cross. Crossovers between the alleles were rare. This evidence for the relationship between hybrid DNA and crossing over is discussed in terms of current models for the mechanism of recombination.
Hazza, Muataz Hazza F. Al; Adesta, Erry Y. T.; Riza, Muhammad
2013-12-01
High speed milling has many advantages such as higher removal rate and high productivity. However, higher cutting speed increase the flank wear rate and thus reducing the cutting tool life. Therefore estimating and predicting the flank wear length in early stages reduces the risk of unaccepted tooling cost. This research presents a neural network model for predicting and simulating the flank wear in the CNC end milling process. A set of sparse experimental data for finish end milling on AISI H13 at hardness of 48 HRC have been conducted to measure the flank wear length. Then the measured data have been used to train the developed neural network model. Artificial neural network (ANN) was applied to predict the flank wear length. The neural network contains twenty hidden layer with feed forward back propagation hierarchical. The neural network has been designed with MATLAB Neural Network Toolbox. The results show a high correlation between the predicted and the observed flank wear which indicates the validity of the models.
International Nuclear Information System (INIS)
Al Hazza, Muataz Hazza F; Adesta, Erry Y T; Riza, Muhammad
2013-01-01
High speed milling has many advantages such as higher removal rate and high productivity. However, higher cutting speed increase the flank wear rate and thus reducing the cutting tool life. Therefore estimating and predicting the flank wear length in early stages reduces the risk of unaccepted tooling cost. This research presents a neural network model for predicting and simulating the flank wear in the CNC end milling process. A set of sparse experimental data for finish end milling on AISI H13 at hardness of 48 HRC have been conducted to measure the flank wear length. Then the measured data have been used to train the developed neural network model. Artificial neural network (ANN) was applied to predict the flank wear length. The neural network contains twenty hidden layer with feed forward back propagation hierarchical. The neural network has been designed with MATLAB Neural Network Toolbox. The results show a high correlation between the predicted and the observed flank wear which indicates the validity of the models
Plasma Transport at the Magnetospheric Flank Boundary. Final report
International Nuclear Information System (INIS)
Otto, Antonius
2012-01-01
Progress is highlighted in these areas: 1. Model of magnetic reconnection induced by three-dimensional Kelvin Helmholtz (KH) modes at the magnetospheric flank boundary; 2. Quantitative evaluation of mass transport from the magnetosheath onto closed geomagnetic field for northward IMF; 3. Comparison of mass transfer by cusp reconnection and Flank Kelvin Helmholtz modes; 4. Entropy constraint and plasma transport in the magnetotail - a new mechanism for current sheet thinning; 5. Test particle model for mass transport onto closed geomagnetic field for northward IMF; 6. Influence of density asymmetry and magnetic shear on (a) the linear and nonlinear growth of 3D Kelvin Helmholtz (KH) modes, and (b) three-dimensional KH mediated mass transport; 7. Examination of entropy and plasma transport in the magnetotail; 8. Entropy change and plasma transport by KH mediated reconnection - mixing and heating of plasma; 9. Entropy and plasma transport in the magnetotail - tail reconnection; and, 10. Wave coupling at the magnetospheric boundary and generation of kinetic Alfven waves
Force Modelling in Orthogonal Cutting Considering Flank Wear Effect
Rathod, Kanti Bhikhubhai; Lalwani, Devdas I.
2017-05-01
In the present work, an attempt has been made to provide a predictive cutting force model during orthogonal cutting by combining two different force models, that is, a force model for a perfectly sharp tool plus considering the effect of edge radius and a force model for a worn tool. The first force model is for a perfectly sharp tool that is based on Oxley's predictive machining theory for orthogonal cutting as the Oxley's model is for perfectly sharp tool, the effect of cutting edge radius (hone radius) is added and improve model is presented. The second force model is based on worn tool (flank wear) that was proposed by Waldorf. Further, the developed combined force model is also used to predict flank wear width using inverse approach. The performance of the developed combined total force model is compared with the previously published results for AISI 1045 and AISI 4142 materials and found reasonably good agreement.
Farr, Alex; Ott, Johannes; Kueronya, Verena; Margreiter, Markus; Javadli, Elchin; Einig, Sabrina; Husslein, Peter W; Bancher-Todesca, Dagmar
2017-10-01
Maternal hydronephrosis may cause flank pain during pregnancy. We aimed to investigate the association between maternal hydronephrosis and flank pain intensity. From 2014 to 2015, all consecutive women with singleton pregnancies, who presented at our tertiary center due to acute flank pain, were prospectively evaluated by renal ultrasonography and pain questionnaires. A visual analogue scale was used to assess pain intensity. The study had 90% power to detect a significant correlation between hydronephrosis and flank pain (Spearman's test). A total of 51 consecutive women with left-sided (13.7%), right-sided (64.7%) or bilateral (21.6%) pain were enrolled. The mean gestational age of these women, who presented due to their pain, was 27.5 ± 6.8 weeks at the time of consultation. The mean VAS score was 7.6 ± 2.2. In 43/51 (84.3%) women, hydronephrosis was found on renal sonograms. No correlation was found between the grade of hydronephrosis and pain intensity (p = 0.466; r= -0.28). Women delivered at a mean gestational age of 38.1 ± 2.4 weeks and their infants had a mean birthweight of 3138 ± 677 g. Hydronephrosis is a common finding among pregnant women with acute flank pain. The grade of hydronephrosis does not affect pain intensity. This study suggests normal pregnancy outcomes in these women.
Prevalence of pfhrp2 and pfhrp3 gene deletions in Puerto Lempira, Honduras.
Abdallah, Joseph F; Okoth, Sheila Akinyi; Fontecha, Gustavo A; Torres, Rosa Elena Mejia; Banegas, Engels I; Matute, María Luisa; Bucheli, Sandra Tamara Mancero; Goldman, Ira F; de Oliveira, Alexandre Macedo; Barnwell, John W; Udhayakumar, Venkatachalam
2015-01-21
Recent studies have demonstrated the deletion of the histidine-rich protein 2 (PfHRP2) gene (pfhrp2) in field isolates of Plasmodium falciparum, which could result in false negative test results when PfHRP2-based rapid diagnostic tests (RDTs) are used for malaria diagnosis. Although primary diagnosis of malaria in Honduras is determined based on microscopy, RDTs may be useful in remote areas. In this study, it was investigated whether there are deletions of the pfhrp2, pfhrp3 and their respective flanking genes in 68 P. falciparum parasite isolates collected from the city of Puerto Lempira, Honduras. In addition, further investigation considered the possible correlation between parasite population structure and the distribution of these gene deletions by genotyping seven neutral microsatellites. Sixty-eight samples used in this study, which were obtained from a previous chloroquine efficacy study, were utilized in the analysis. All samples were genotyped for pfhrp2, pfhrp3 and flanking genes by PCR. The samples were then genotyped for seven neutral microsatellites in order to determine the parasite population structure in Puerto Lempira at the time of sample collection. It was found that all samples were positive for pfhrp2 and its flanking genes on chromosome 8. However, only 50% of the samples were positive for pfhrp3 and its neighboring genes while the rest were either pfhrp3-negative only or had deleted a combination of pfhrp3 and its neighbouring genes on chromosome 13. Population structure analysis predicted that there are at least two distinct parasite population clusters in this sample population. It was also determined that a greater proportion of parasites with pfhrp3-(and flanking gene) deletions belonged to one cluster compared to the other. The findings indicate that the P. falciparum parasite population in the municipality of Puerto Lempira maintains the pfhrp2 gene and that PfHRP2-based RDTs could be considered for use in this region; however
Hazard Potential of Volcanic Flank Collapses Raised by New Megatsunami Evidence
Ramalho, R. S.; Winckler, G.; Madeira, J.; Helffrich, G. R.; Hipólito, A.; Quartau, R.; Adena, K.; Schaefer, J. M.
2015-12-01
Large-scale gravitational flank collapses of steep volcanic islands are hypothetically capable of triggering megatsunamis with highly catastrophic effects. Yet evidence for the existence and impact of collapsed-triggered megatsunamis and their run-up heights remains scarce and/or is highly contentious. Therefore a considerable debate still exists over the potential magnitude of collapse-triggered tsunamis and their inherent hazard. In particular, doubts still remain whether or not large-scale flank failures typically generate enough volume flux to result in megatsunamis, or alternatively operate by slow-moving or multiple smaller episodic failures with much lower tsunamigenic potential. Here we show that one of the tallest and most active oceanic volcanoes on Earth - Fogo, in the Cape Verde Islands - collapsed catastrophically and triggered a megatsunami with devastating near-field effects ~73,000 years ago. Our deductions are based on the recent discovery and cosmogenic 3He dating of tsunamigenic deposits - comprising fields of stranded megaclasts, chaotic conglomerates, and sand sheets - found on the adjacent Santiago Island, which attest to the impact of this megatsunami and document wave run-up heights exceeding 270 m. The evidence reported here implies that Fogo's flank failure involved at least one sudden and voluminous event that resulted in a megatsunami, in contrast to what has been suggested before. Our work thus provides another line of evidence that large-scale flank failures at steep volcanic islands may indeed happen catastrophically and are capable of triggering tsunamis of enormous height and energy. This new line of evidence therefore reinforces the hazard potential of volcanic island collapses and stands as a warning that such hazard should not be underestimated, particularly in areas where volcanic island edifices are close to other islands or to highly populated continental margins.
International Nuclear Information System (INIS)
Lucky, A.W.; Eisenfeld, A.J.; Visintin, I.
1985-01-01
In the hamster flank organ, the growth of hair and growth of sebaceous glands are androgen-dependent functions. Although dihydrotestosterone (DHT) is known to be a potent stimulator of flank organ growth, there is no information about localization of DHT receptor sites in this organ. The purpose of this study was to use steroid autoradiography to localize DHT receptors in the hamster flank organ. Because steroid hormones are functional when translocated to nuclear receptors, nuclear localization by autoradiography defines receptor sites. In order to be able to visualize autoradiographic grains from radiolabeled androgens around hair follicles, albino hamsters were studied to avoid confusion between the grains and pigment granules which are abundant in the more common Golden Syrian hamster. Mature male hamsters castrated 24 hours earlier were given tritium-labeled dihydrotestosterone ( [ 3 H]DHT). Using the technique of thaw-mount steroid autoradiography, 4-micron unfixed frozen sections were mounted in the dark onto emulsion-coated glass slides and allowed to develop for 4-6 months. [ 3 H]DHT was found to be concentrated over sebocyte nuclei. The label was present peripherally as well as in differentiating sebocytes. There was no nuclear localization of [ 3 H]DHT in animals pretreated with excessive quantities of unlabeled DHT. Steroid metabolites of [ 3 H] DHT were assessed by thin-layer chromatography in paired tissue samples. Most of the label remained with DHT. Uptake was inhibited in the flank organ of hamsters pretreated with unlabeled DHT
Radon measurements in the SE and NE flank of Mt. Etna (Italy)
International Nuclear Information System (INIS)
La Delfa, S.; Imme, G.; Lo Nigro, S.; Morelli, D.; Patane, G.; Vizzini, F.
2007-01-01
Soil Radon has been monitored at two fixed sites located in the northeastern and southeastern flank of Mt. Etna. In this study we report the comparison between in-soil Radon concentration trend recorded in the SE flank and that one recorded in the NE one, where an in-soil Radon detection system is operating since 2001. The aim of this work was to implement the investigation area finding a suitable radon detection site, in the south-east flank of Mt. Etna, in order to better understand possible links between Radon anomalies and volcano dynamic. Radon data collected in NE and SE sites were compared with the volcanic tremor, frequency of occurrence of earthquakes and seismic strain-release recorded at a fixed 3D digital seismic station placed in the NE site. Same general in-soil Radon trends and anomalies were found in both sites. These results have confirmed the suitability of the chosen southeastern site for the in-soil Radon monitoring at Mt. Etna. The comparison of the recorded Radon concentration anomalies with seismicity and volcanic tremor trends, has also verified a possible link with the volcanic activity, as observed in our previous published studies
Multi-stage volcanic island flank collapses with coeval explosive caldera-forming eruptions.
Hunt, James E; Cassidy, Michael; Talling, Peter J
2018-01-18
Volcanic flank collapses and explosive eruptions are among the largest and most destructive processes on Earth. Events at Mount St. Helens in May 1980 demonstrated how a relatively small (300 km 3 ), but can also occur in complex multiple stages. Here, we show that multistage retrogressive landslides on Tenerife triggered explosive caldera-forming eruptions, including the Diego Hernandez, Guajara and Ucanca caldera eruptions. Geochemical analyses were performed on volcanic glasses recovered from marine sedimentary deposits, called turbidites, associated with each individual stage of each multistage landslide. These analyses indicate only the lattermost stages of subaerial flank failure contain materials originating from respective coeval explosive eruption, suggesting that initial more voluminous submarine stages of multi-stage flank collapse induce these aforementioned explosive eruption. Furthermore, there are extended time lags identified between the individual stages of multi-stage collapse, and thus an extended time lag between the initial submarine stages of failure and the onset of subsequent explosive eruption. This time lag succeeding landslide-generated static decompression has implications for the response of magmatic systems to un-roofing and poses a significant implication for ocean island volcanism and civil emergency planning.
Połowniak, Piotr; Sobolak, Mariusz
2017-12-01
In this article, a mathematical description of tooth flank surface of the globoidal worm and worm wheel generated by the hourglass worm hob with straight tooth axial profile is presented. The kinematic system of globoidal worm gear is shown. The equation of globoid helix and tooth axial profile of worm is derived to determine worm tooth surface. Based on the equation of meshing the contact lines are obtained. The mathematical description of globoidal worm wheel tooth flank is performed on the basis of contact lines and generating the tooth side by the extreme cutting edge of worm hob. The presented mathematical model of tooth flank of TA worm and worm wheel can be used e.g. to analyse the contact pattern of the gear.
A Boy with an LCR3/4-Flanked 10q22.3q23.2 Microdeletion and Uncommon Phenotypic Features
Petrova, E.; Neuner, C.; Haaf, T.; Schmid, M.; Wirbelauer, J.; Jurkutat, A.; Wermke, K.; Nanda, I.; Kunstmann, E.
2014-01-01
The recurrent 10q22.3q23.2 deletion with breakpoints within low copy repeats 3 and 4 is a rare genomic disorder, reported in only 13 patients to date. The phenotype is rather uncharacteristic, which makes a clinical diagnosis difficult. A phenotypic feature described in almost all patients is a delay in speech development, albeit systematic studies are still pending. In this study, we report on a boy with an LCR3/4-flanked 10q22.3q23.2 deletion exhibiting an age-appropriate language development evaluated by a standardized test at an age of 2 years and 3 months. The boy was born with a cleft palate – a feature not present in any of the patients described before. Previously reported cases are reviewed, and the role of the BMPR1A gene is discussed. The phenotype of patients with an LCR3/4-flanked 10q22.3q23.2 deletion can be rather variable, so counseling the families regarding the prognosis of an affected child should be done with caution. Long-term studies of affected children are needed to delineate the natural history of this rare disorder. PMID:24550761
Single nucleotide polymorphisms in the 5'-flanking region of the ...
African Journals Online (AJOL)
Prolactin (PRL), a polypeptide hormone synthesized and secreted by the animal's anterior pituitary gland, plays an important role in the regulation of mammalian lactation and avian reproduction. Considering the significant association between single nucleotide polymorphisms (SNPs) in the 5'-flanking region of PRL and ...
Le Corvec, Nicolas
2014-07-01
Mount Etna volcano is subject to transient magmatic intrusions and flank movement. The east flank of the edifice, in particular, is moving eastward and is dissected by the Timpe Fault System. The relationship of this eastward motion with intrusions and tectonic fault motion, however, remains poorly constrained. Here we explore this relationship by using analogue experiments that are designed to simulate magmatic rift intrusion, flank movement, and fault activity before, during, and after a magmatic intrusion episode. Using particle image velocimetry allows for a precise temporal and spatial analysis of the development and activity of fault systems. The results show that the occurrence of rift intrusion episodes has a direct effect on fault activity. In such a situation, fault activity may occur or may be hindered, depending on the interplay of fault displacement and flank acceleration in response to dike intrusion. Our results demonstrate that a complex interplay may exist between an active tectonic fault system and magmatically induced flank instability. Episodes of magmatic intrusion change the intensity pattern of horizontal flank displacements and may hinder or activate associated faults. We further compare our results with the GPS data of the Mount Etna 2001 eruption and intrusion. We find that syneruptive displacement rates at the Timpe Fault System have differed from the preeruptive or posteruptive periods, which shows a good agreement of both the experimental and the GPS data. Therefore, understanding the flank instability and flank stability at Mount Etna requires consideration of both tectonic and magmatic forcing. Key Points Analyzing Mount Etna east flank dynamics during the 2001 eruption Good correlation between analogue models and GPS data Understanding the different behavior of faulting before/during/after an eruption © 2014. American Geophysical Union. All Rights Reserved.
Le Corvec, Nicolas; Walter, Thomas R.; Ruch, Joel; Bonforte, Alessandro; Puglisi, Giuseppe
2014-01-01
Mount Etna volcano is subject to transient magmatic intrusions and flank movement. The east flank of the edifice, in particular, is moving eastward and is dissected by the Timpe Fault System. The relationship of this eastward motion with intrusions and tectonic fault motion, however, remains poorly constrained. Here we explore this relationship by using analogue experiments that are designed to simulate magmatic rift intrusion, flank movement, and fault activity before, during, and after a magmatic intrusion episode. Using particle image velocimetry allows for a precise temporal and spatial analysis of the development and activity of fault systems. The results show that the occurrence of rift intrusion episodes has a direct effect on fault activity. In such a situation, fault activity may occur or may be hindered, depending on the interplay of fault displacement and flank acceleration in response to dike intrusion. Our results demonstrate that a complex interplay may exist between an active tectonic fault system and magmatically induced flank instability. Episodes of magmatic intrusion change the intensity pattern of horizontal flank displacements and may hinder or activate associated faults. We further compare our results with the GPS data of the Mount Etna 2001 eruption and intrusion. We find that syneruptive displacement rates at the Timpe Fault System have differed from the preeruptive or posteruptive periods, which shows a good agreement of both the experimental and the GPS data. Therefore, understanding the flank instability and flank stability at Mount Etna requires consideration of both tectonic and magmatic forcing. Key Points Analyzing Mount Etna east flank dynamics during the 2001 eruption Good correlation between analogue models and GPS data Understanding the different behavior of faulting before/during/after an eruption © 2014. American Geophysical Union. All Rights Reserved.
Sabin, Andrew; Blake, Kelly; Lazaro, Mike; Blankenship, Douglas; Kennedy, Mack; McCullough, Jess; DeOreo, S.B.; Hickman, Stephen H.; Glen, Jonathan; Kaven, Joern; Williams, Colin F.; Phelps, Geoffrey; Faulds, James E.; Hinz, Nicholas H.; Calvin, Wendy M.; Siler, Drew; Robertson-Tait, Ann
2017-01-01
The proposed West Flank FORGE site is within the China Lake Naval Air Weapons Station (NAWS), China Lake, CA. The West Flank is west of the Coso geothermal field, an area of China Lake NAWS dominated by the Quaternary Coso volcanic field largely comprised of rhyolite domes and their volcaniclastic and epiclastic horizons. The largest dome flow complex, Sugarloaf Mountain, marks the northwestern margin of the geothermal field. The West Flank is situated due west of Sugarloaf. The geologic setting of the West Flank was determined from one deep well (83-11) drilled as a potential production hole in 2009. The bottom-hole temperature (BHT) of well 83-11 approaches 600 oF (315˚C), but flow tests demonstrate very low, non-commercial permeabilities. With the exception of the upper 600 feet of volcaniclastic alluvium, well 83-11 is completed in granitic basement. The West Flank possesses the primary attributes of a FORGE site: non-commercial permeability (geothermal fieldThe Coso Mountains host the Coso volcanic field and are within a right-releasing stepover between the dextral Airport Lake (ALF) and Little Lake fault zones (LLFZ) and the Wild Horse Mesa and Owens Valley faults. Two distinct fault populations have been identified at Coso: WNW-trending and antithetical, NE-trending strike-slip faults and N- to NNE-trending normal faults. These faults are both high permeability drilling targets at depth within the main (productive) geothermal field and they locally segment the field into distinct hydrothermal regimes. The West Flank may be segmented from the rest of the field by one such northerly trending fault. The overall minimum principal stress orientation in the main geothermal field varies from 103˚ to 108˚; however, the minimum horizontal principal stress in 83-11 is rotated to 081˚.
Xi, Zhenxiang; Liu, Liang; Davis, Charles C
2015-11-01
The development and application of coalescent methods are undergoing rapid changes. One little explored area that bears on the application of gene-tree-based coalescent methods to species tree estimation is gene informativeness. Here, we investigate the accuracy of these coalescent methods when genes have minimal phylogenetic information, including the implementation of the multilocus bootstrap approach. Using simulated DNA sequences, we demonstrate that genes with minimal phylogenetic information can produce unreliable gene trees (i.e., high error in gene tree estimation), which may in turn reduce the accuracy of species tree estimation using gene-tree-based coalescent methods. We demonstrate that this problem can be alleviated by sampling more genes, as is commonly done in large-scale phylogenomic analyses. This applies even when these genes are minimally informative. If gene tree estimation is biased, however, gene-tree-based coalescent analyses will produce inconsistent results, which cannot be remedied by increasing the number of genes. In this case, it is not the gene-tree-based coalescent methods that are flawed, but rather the input data (i.e., estimated gene trees). Along these lines, the commonly used program PhyML has a tendency to infer one particular bifurcating topology even though it is best represented as a polytomy. We additionally corroborate these findings by analyzing the 183-locus mammal data set assembled by McCormack et al. (2012) using ultra-conserved elements (UCEs) and flanking DNA. Lastly, we demonstrate that when employing the multilocus bootstrap approach on this 183-locus data set, there is no strong conflict between species trees estimated from concatenation and gene-tree-based coalescent analyses, as has been previously suggested by Gatesy and Springer (2014). Copyright © 2015 Elsevier Inc. All rights reserved.
DNA sequence responsible for the amplification of adjacent genes.
Pasion, S G; Hartigan, J A; Kumar, V; Biswas, D K
1987-10-01
A 10.3-kb DNA fragment in the 5'-flanking region of the rat prolactin (rPRL) gene was isolated from F1BGH(1)2C1, a strain of rat pituitary tumor cells (GH cells) that produces prolactin in response to 5-bromodeoxyuridine (BrdU). Following transfection and integration into genomic DNA of recipient mouse L cells, this DNA induced amplification of the adjacent thymidine kinase gene from Herpes simplex virus type 1 (HSV1TK). We confirmed the ability of this "Amplicon" sequence to induce amplification of other linked or unlinked genes in DNA-mediated gene transfer studies. When transferred into the mouse L cells with the 10.3-5'rPRL gene sequence of BrdU-responsive cells, both the human growth hormone and the HSV1TK genes are amplified in response to 5-bromodeoxyuridine. This observation is substantiated by BrdU-induced amplification of the cotransferred bacterial Neo gene. Cotransfection studies reveal that the BrdU-induced amplification capability is associated with a 4-kb DNA sequence in the 5'-flanking region of the rPRL gene of BrdU-responsive cells. These results demonstrate that genes of heterologous origin, linked or unlinked, and selected or unselected, can be coamplified when located within the amplification boundary of the Amplicon sequence.
Directory of Open Access Journals (Sweden)
Ying-Juan LIU, Da-Wei WANG, Lixing SUN, Jin-Hua ZHANG, Jian-Xu ZHANG
2010-12-01
Full Text Available Behavioral studies have shown that flank glands are involved in chemical communication in golden hamsters Mesocricetus auratus but little chemical analysis has been conducted on volatiles arising from these glands. Using gas chromatography-mass spectrometry, we detected compounds from the flank glands of males, only eight of which were also produced in females. Based on these chemical data we performed a number of further experiments. By manipulating light we found that males exposed to short-photoperiods developed smaller flank glands than those exposed to long-photoperiods. Six flank gland volatiles reduced in relative abundance, which possibly coded for reproductive status of males of this seasonally breeding hamster species. Through dyadic encounters, we were able to induce the formation of dominant-subordinate relationships and show that two glandular compounds became high in relative abundance and may function as dominance pheromones. Castration eliminated all male-specific compounds resulting from flank glands, but bilateral ovariectomies only affected one compound in females. Once these ovariectomized females were treated with testosterone, their glandular compounds resembled those of males, suggesting these compounds are under the main control of androgen. Two female putative pheromones, tetradecanoic acid and hexadecanoic acid, were used in binary choice tests and were both found to attract males over females. Applying a solution of these pheromone compounds to adult males also suppressed their agonistic behavior [Current Zoology 56 (6: 800–812, 2010].
The role of viscous magma mush spreading in volcanic flank motion at Kīlauea Volcano, Hawai'i
Plattner, C.; Amelung, F.; Baker, S.; Govers, R.; Poland, M.
2013-01-01
Multiple mechanisms have been suggested to explain seaward motion of the south flank of Kīlauea Volcano, Hawai'i. The consistency of flank motion during both waxing and waning magmatic activity at Kīlauea suggests that a continuously acting force, like gravity body force, plays a substantial role.
Directory of Open Access Journals (Sweden)
Nicholas Delihas
Full Text Available BACKGROUND: Plasmids of Borrelia species are dynamic structures that contain a large number of repetitive genes, gene fragments, and gene fusions. In addition, the transposable element IS605/200 family, as well as degenerate forms of this IS element, are prevalent. In Helicobacter pylori, flanking regions of the IS605 transposase gene contain sequences that fold into identical small stem loops. These function in transposition at the single-stranded DNA level. METHODOLOGY/PRINCIPAL FINDINGS: In work reported here, bioinformatics techniques were used to scan Borrelia plasmid genomes for IS605 transposable element specific stem loop sequences. Two variant stem loop motifs are found in the left and right flanking regions of the transposase gene. Both motifs appear to have dispersed in plasmid genomes and are found "free-standing" and phylogenetically conserved without the associated IS605 transposase gene or the adjacent flanking sequence. Importantly, IS605 specific stem loop sequences are also found at the 3' ends of lipoprotein genes (PFam12 and PFam60, however the left and right sequences appear to develop their own evolutionary patterns. The lipoprotein gene-linked left stem loop sequences maintain the IS605 stem loop motif in orthologs but only at the RNA level. These show mutations whereby variants fold into phylogenetically conserved RNA-type stem loops that contain the wobble non-Watson-Crick G-U base-pairing. The right flanking sequence is associated with the family lipoprotein-1 genes. A comparison of homologs shows that the IS605 stem loop motif rapidly dissipates, but a more elaborate secondary structure appears to develop in its place. CONCLUSIONS/SIGNIFICANCE: Stem loop sequences specific to the transposable element IS605 are present in plasmid regions devoid of a transposase gene and significantly, are found linked to lipoprotein genes in Borrelia plasmids. These sequences are evolutionarily conserved and/or structurally developed in
Successful flank appraisal with a horizontal well: a Niger Delta example
Energy Technology Data Exchange (ETDEWEB)
Ohanele, C.; Emelumadu, U.
1998-12-31
Case study of a horizontal well successfully drilled in 1994 by Shell Oil in the Niger Delta is described. The well was drilled with the objectives of improving drainage of the major D3.1 reservoir and appraising the poorly defined eastern flank for structure and fluid content of the overlying D3.0 sand. The well was optimized by 3D reservoir and hydrocarbon modeling of these reservoirs. Combining the development and appraisal objectives in one horizontal well proved to be the optimal solution, both from a cost as well as a production consideration. The well proved up over 50 MMstb of additional reserves. The structural flank proved to be significantly shallower than previously mapped and had a positive effect not only on the D3.0 reserves, but also on the the D3.1. 6 figs.
Evidence for magnocellular involvement in the identification of flanked letters
Omtzigt, D.; Hendriks, A.W.C.J.; Kolk, H.H.J.
2002-01-01
Little is known about the role of the magno system in reading. One important hypothesis is that this system is involved in the allocation of attention. We reasoned that the presentation of a single letter automatically draws attention to this letter, whereas in the case of a flanked letter, an
Directory of Open Access Journals (Sweden)
Messenger Tara
2001-08-01
Full Text Available Abstract Background Alterations in arginine vasopressin regulation and secretion have been proposed as one possible biochemical abnormality in patients with obsessive-compulsive disorder. In golden hamsters, arginine vasopressin microinjections into the anterior hypothalamus trigger robust grooming and flank marking, a stereotyped scent marking behaviors. The intensity and repetition of the behaviors induced by arginine vasopressin is somewhat reminiscent of Obsessive Compulsive Disorder in humans. The present experiments were carried out to test whether pharmacological agents used to alleviate obsessive compulsive disorder could inhibit arginine vasopressin-induced flank marking and grooming. Results Male golden hamsters were treated daily for two weeks with either vehicle, fluoxetine, clomipramine, or desipramine (an ineffective drug, before being tested for arginine vasopressin-induced flank marking and grooming. Flank marking was significantly inhibited in animals treated with fluoxetine or clomipramine but unaffected by treatment with desipramine. Grooming behavior was not affected by any treatment. Conclusion These data suggest that arginine vasopressin-induced flank marking may serve as an animal model for screening drugs used in the control of Obsessive Compulsive Disorder.
Imaging modalities and therapy options in patients with acute flank pain
International Nuclear Information System (INIS)
Grosse, A.; Grosse, C.
2014-01-01
The objective of this article is the description of imaging techniques for the evaluation of patients with acute flank pain and suspicion of urolithiasis and the impact of these techniques in the therapy management of patients with calculi. (orig.) [de
Stability analysis of Western flank of Cumbre Vieja volcano (La Palma) using numerical modelling
Bru, Guadalupe; Gonzalez, Pablo J.; Fernandez-Merodo, Jose A.; Fernandez, Jose
2016-04-01
La Palma volcanic island is one of the youngest of the Canary archipelago, being a composite volcano formed by three overlapping volcanic centers. There are clear onshore and offshore evidences of past giant landslides that have occurred during its evolution. Currently, the active Cumbre Vieja volcano is in an early development state (Carracedo et al., 2001). The study of flank instability processes aim to assess, among other hazards, catastrophic collapse and potential tsunami generation. Early studies of the potential instability of Cumbre Vieja volcano western flank have focused on the use of sparse geodetic networks (Moss et al. 1999), surface geological mapping techniques (Day et al. 1999) and offshore bathymetry (Urgeles et al. 1999). Recently, a dense GNSS network and satellite radar interferometry results indicate ground motion consistent with deep-seated creeping processes (Prieto et al. 2009, Gonzalez et al. 2010). In this work, we present a geomechanical advanced numerical model that captures the ongoing deformation processes at Cumbre Vieja. We choose the Finite Elements Method (FEM) which is based in continuum mechanics and is the most used for geotechnical applications. FEM has the ability of using arbitrary geometry, heterogeneities, irregular boundaries and different constitutive models representative of the geotechnical units involved. Our main contribution is the introduction of an inverse approach to constrain the geomechanical parameters using satellite radar interferometry displacements. This is the first application of such approach on a large volcano flank study. We suggest that the use of surface displacements and inverse methods to rigorously constrain the geomechanical model parameter space is a powerful tool to understand volcano flank instability. A particular important result of the studied case is the estimation of displaced rock volume, which is a parameter of critical importance for simulations of Cumbre Vieja tsunamigenic hazard
DNA Characterization and Polymorphism of KISS1 Gene in Egyptian ...
African Journals Online (AJOL)
The objective of this study was the detection of the restriction fragment length polymorphism (RFLP) and single nucleotide polymorphisms (SNPs) of KISS1 gene in six major Egyptian small ruminant breeds. The primers used in this study flanked a 377 bp fragment from intron 1 of KISS1 gene in sheep and goat. These PCR ...
Reverse time migration of prism waves for salt flank delineation
Dai, Wei; Schuster, Gerard T.
2013-01-01
In this paper, we present a new reverse time migration method for imaging salt flanks with prism wave reflections. It consists of four steps: (1) migrating the seismic data with conventional RTM to give the RTM image; (2) using the RTM image as a reflectivity model to simulate source-side reflections with the Born approximation; (3) zero-lag correlation of the source-side reflection wavefields and receiver-side wavefields to produce the prism wave migration image; and (4) repeating steps 2 and 3 for the receiver-side reflections. An advantage of this method is that there is no need to pick the horizontal reflectors prior to migration of the prism waves. It also separately images the vertical structures at a different step to reduce crosstalk interference. The disadvantage of prism wave migration algorithm is that its computational cost is twice that of conventional RTM. The empirical results with a salt model suggest that prism wave migration can be an effective method for salt flank delineation in the absence of diving waves.
Reverse time migration of prism waves for salt flank delineation
Dai, Wei
2013-09-22
In this paper, we present a new reverse time migration method for imaging salt flanks with prism wave reflections. It consists of four steps: (1) migrating the seismic data with conventional RTM to give the RTM image; (2) using the RTM image as a reflectivity model to simulate source-side reflections with the Born approximation; (3) zero-lag correlation of the source-side reflection wavefields and receiver-side wavefields to produce the prism wave migration image; and (4) repeating steps 2 and 3 for the receiver-side reflections. An advantage of this method is that there is no need to pick the horizontal reflectors prior to migration of the prism waves. It also separately images the vertical structures at a different step to reduce crosstalk interference. The disadvantage of prism wave migration algorithm is that its computational cost is twice that of conventional RTM. The empirical results with a salt model suggest that prism wave migration can be an effective method for salt flank delineation in the absence of diving waves.
Cloning and sequencing of phenol oxidase 1 (pox1) gene from ...
African Journals Online (AJOL)
The gene (pox1) encoding a phenol oxidase 1 from Pleurotus ostreatus was sequenced and the corresponding pox1-cDNA was also synthesized, cloned and sequenced. The isolated gene is flanked by an upstream region called the promoter (399 bp) prior to the start codon (ATG). The putative metalresponsive elements ...
Forests of the tropical eastern Andean flank during the middle Pleistocene
Cárdenas, M.L.; Gosling, W.D.; Pennington, R.T.; Poole, I.; Sherlock, S.C.; Mothes, P.
2014-01-01
Inter-bedded volcanic and organic sediments from Erazo (Ecuador) indicate the presence of four different forest assemblages on the eastern Andean flank during the middle Pleistocene. Radiometric dates (40Ar-39Ar) obtained from the volcanic ash indicate that deposition occurred between 620,000 and
Genetics and mapping of a new leaf rust resistance gene in Triticum ...
Indian Academy of Sciences (India)
Genetic analysis in F1, F2 and F2.3 families at the seedling stage revealed that leaf rust resistance in Selection G12 is conditioned by a single incompletely dominant gene. The leaf rust resistance gene was mapped to chromosome 3BL with SSR markers Xgwm114 and Xgwm547 flanking the gene at a distance of 28.3 cM ...
Polycythemia in transgenic mice expressing the human erythropoietin gene
International Nuclear Information System (INIS)
Semenza, G.L.; Traystman, M.D.; Gearhart, J.D.; Antonarakis, S.E.
1989-01-01
Erythropoietin is a glycoprotein hormone that regulates mammalian erythropoiesis. To study the expression of the human erythropoietin gene, EPO, 4 kilobases of DNA encompassing the gene with 0.4 kilobase of 5' flanking sequence and 0.7 kilobase of 3' flanking sequence was microinjected into fertilized mouse eggs. Transgenic mice were generated that are polycythemic, with increased erythrocytic indices in peripheral blood, increased numbers of erythroid precursors in hematopoietic tissue, and increased serum erythropoietin levels. Transgenic homozygotes show a greater degree of polycythemia than do heterozygotes as well as striking extramedullary erythropoiesis. Human erythropoietin RNA was found not only in fetal liver, adult liver, and kidney but also in all other transgenic tissues analyzed. Anemia induced increased human erythropoietin RNA levels in liver but not kidney. These transgenic mice represent a unique model of polycythemia due to increased erythropoietin levels
Transcriptional regulation of the tyrosine hydroxylase gene by glucocorticoid and cyclic AMP
International Nuclear Information System (INIS)
Lewis, E.J.; Harrington, C.A.; Chikaraishi, D.M.
1987-01-01
Glucocorticoid and cyclic AMP increase tyrosine hydroxylase (TH) activity and mRNA levels in pheochromocytoma cultures. The transcriptional activity of the TH gene, as measured by nuclear run-on assay, is also increased when cultures are treated with the synthetic glucocorticoid dexamethasone or agents that increase intracellular cyclic AMP, such as forskolin and 8-BrcAMP. Both inducers effect transcriptional changes within 10 min after treatment and are maximal after 30 min for forskolin and after 60 min for dexamethasone. The 5' flanking sequences of the TH gene were fused to the bacterial gene chloramphenicol acetyltransferase (CAT), and the hybrid gene was transfected into pheochromocytoma cultures and GH 4 pituitary cells. In both cell lines, a region of the TH gene containing bases -272 to +27 conferred induction of CAT by cyclic AMP, but not by glucocorticoid. The same results were found when a region of the TH gene containing -773 to + 27 was used. Thus, the sequences required for induction of TH by cyclic AMP are contained within 272 bases of 5' flanking sequence, but sequences sufficient for glucocorticoid regulation are not contained with 773 bases
NATO’s Northeastern Flank: Emerging Opportunities for Engagement
2017-01-01
escalation concerns. Engagement should also stress the importance of Polish support for and capabilities toward addressing NATO’s southern flank...in their response to the Ukraine crisis.8 Some countries are either cowed by the Russian threat or genuinely less concerned about it than might be...no small part due to Hungary’s dependence on Russian gas exports, which heat the homes of most Hungarians. It is also, however, due to political
Focused seismicity triggered by flank instability on Kīlauea's Southwest Rift Zone
Judson, Josiah; Thelen, Weston A.; Greenfield, Tim; White, Robert S.
2018-03-01
Swarms of earthquakes at the head of the Southwest Rift Zone on Kīlauea Volcano, Hawai´i, reveal an interaction of normal and strike-slip faulting associated with movement of Kīlauea's south flank. A relocated subset of earthquakes between January 2012 and August 2014 are highly focused in space and time at depths that are coincident with the south caldera magma reservoir beneath the southern margin of Kīlauea Caldera. Newly calculated focal mechanisms are dominantly dextral shear with a north-south preferred fault orientation. Two earthquakes within this focused area of seismicity have normal faulting mechanisms, indicating two mechanisms of failure in very close proximity (10's of meters to 100 m). We suggest a model where opening along the Southwest Rift Zone caused by seaward motion of the south flank permits injection of magma and subsequent freezing of a plug, which then fails in a right-lateral strike-slip sense, consistent with the direction of movement of the south flank. The seismicity is concentrated in an area where a constriction occurs between a normal fault and the deeper magma transport system into the Southwest Rift Zone. Although in many ways the Southwest Rift Zone appears analogous to the more active East Rift Zone, the localization of the largest seismicity (>M2.5) within the swarms to a small volume necessitates a different model than has been proposed to explain the lineament outlined by earthquakes along the East Rift Zone.
Magnocellular involvement in flanked-letter identification relates to the allocation of attention
Omtzigt, D.; Hendriks, A.W.C.J.
2004-01-01
To verify the hypothesis that the magnocellular system is important to flanked-letter identification [Neuropsychologia 40 (2002) 1881] because it subserves attention allocation, we conducted three letter-naming experiments in which we manipulated magnocellular involvement (colour vs. luminance
Biophysical properties of regions flanking the bHLH-Zip motif in the p22 Max protein
International Nuclear Information System (INIS)
Pursglove, Sharon E.; Fladvad, Malin; Bellanda, Massimo; Moshref, Ahmad; Henriksson, Marie; Carey, Jannette; Sunnerhagen, Maria
2004-01-01
The Max protein is the central dimerization partner in the Myc-Max-Mad network of transcriptional regulators, and a founding structural member of the family of basic-helix-loop-helix (bHLH)-leucine zipper (Zip) proteins. Biologically important regions flanking its bHLH-Zip motif have been disordered or absent in crystal structures. The present study shows that these regions are resistant to proteolysis in both the presence and absence of DNA, and that Max dimers containing both flanking regions have significantly higher helix content as measured by circular dichroism than that predicted from the crystal structures. Nuclear magnetic resonance measurements in the absence of DNA also support the inferred structural order. Deletion of both flanking regions is required to achieve maximal DNA affinity as measured by EMSA. Thus, the previously observed functionalities of these Max regions in DNA binding, phosphorylation, and apoptosis are suggested to be linked to structural properties
Yang, Jing-Hua; Zhang, Ming-Fang; Yu, Jing-Quan
2009-02-01
The transcriptional patterns of mitochondrial respiratory related genes were investigated in cytoplasmic male-sterile and fertile maintainer lines of stem mustard, Brassica juncea. There were numerous differences in nad2 (subunit 2 of NADH dehydrogenase) between stem mustard CMS and its maintainer line. One novel open reading frame, hereafter named orfB gene, was located at the downstream of mitochondrial nad2 gene in the CMS. The novel orfB gene had high similarity with YMF19 family protein, orfB in Raphanus sativus, Helianthus annuus, Nicotiana tabacum and Beta vulgaris, orfB-CMS in Daucus carota, atp8 gene in Arabidopsis thaliana, 5' flanking of orf224 in B. napus (nap CMS) and 5' flanking of orf220 gene in CMS Brassica juncea. Three copies probed by specific fragment (amplified by primers of nad2F and nad2R from CMS) were found in the CMS line following Southern blotting digested with HindIII, but only a single copy in its maintainer line. Meanwhile, two transcripts were shown in the CMS line following Northern blotting while only one transcript was detected in the maintainer line, which were probed by specific fragment (amplified by primers of nad2F and nad2R from CMS). Meanwhile, the expression of nad2 gene was reduced in CMS bud compared to that in its maintainer line. We thus suggested that nad2 gene may be co-transcripted with CMS-associated orfB gene in the CMS. In addition, the specific fragment that was amplified by primers of nad2F and nad2R just spanned partial sequences of nad2 gene and orfB gene. Such alterations in the nad2 gene would impact the activity of NADH dehydrogenase, and subsequently signaling, inducing the expression of nuclear genes involved in male sterility in this type of cytoplasmic male sterility.
A novel BDNF gene promoter directs expression to skeletal muscle
Directory of Open Access Journals (Sweden)
Heinrich Gerhard
2003-06-01
Full Text Available Abstract Background Cell-specific expression of the gene that encodes brain-derived neurotrophic factor (BDNF is required for the normal development of peripheral sensory neurons and efficient synaptic transmission in the mature central and peripheral nervous system. The control of BDNF gene expression involves multiple tissue and cell-specific promoters that are differentially regulated. The molecular mechanisms that are responsible for tissue and cell-specific expression of these promoters are still incompletely understood. Results The cloning and analysis of three additional zebrafish (Danio rerio BDNF gene exons and two associated promoters, is reported. Among them are two exons that generate a novel tripartite mature transcript. The exons were located on the transcription unit, whose overall organization was determined by cloning, Southern blot hybridization and sequence analysis, and compared with the pufferfish (Fugu rubripes and mammalian BDNF loci, revealing a conserved but more compact organization. Structural and functional analysis of the exons, their adjacent promoters and 5' flanks, showed that they are expressed cell-specifically. The promoter associated with the 5' exon of the tripartite transcript is GC-rich, TATA-less and the 5' flank adjacent to it contains multiple Sp1, Mef2, and AP1 elements. A fusion gene containing the promoter and 1.5 KB of 5' flank is directed exclusively to skeletal muscle of transiently transfected embryos. The second promoter, whose associated 5' exon contains a 25-nucleotide segment of identity with a mammalian BDNF gene exon, was transiently expressed in yolk of the early embryo. RT-PCR analysis of total RNA from whole juvenile fish and adult female skeletal muscle revealed tissue-specific expression of the 5' exons but the novel exon could not be detected even after two rounds of nested PCR. Conclusion The zebrafish BDNF gene is as complex as the mammalian gene yet much more compact. Its exons are
Stevens, Servi J C; Blom, Eveline W; Siegelaer, Ingrid T J; Smeets, Eric E J G L
2015-04-01
We identified an identical and recurrent 9.4-Mbp deletion at chromosome bands 2p11.2-2p12, which occurred de novo in two unrelated patients. It is flanked at the distal and proximal breakpoints by two homologous segmental duplications consisting of low copy repeat (LCR) blocks in direct orientation, which have >99% sequence identity. Despite the fact that the deletion was almost 10 Mbp in size, the patients showed a relatively mild clinical phenotype, that is, mild-to-moderate intellectual disability, a happy disposition, speech delay and delayed motor development. Their phenotype matches with that of previously described patients. The 2p11.2-2p12 deletion includes the REEP1 gene that is associated with spastic paraplegia and phenotypic features related to this are apparent in most 2p11.2-2p12 deletion patients, but not in all. Other hemizygous genes that may contribute to the clinical phenotype include LRRTM1 and CTNNA2. We propose a recurrent but rare 2p11.2-2p12 deletion syndrome based on (1) the identical, non-random localisation of the de novo deletion breakpoints in two unrelated patients and a patient from literature, (2) the patients' phenotypic similarity and their phenotypic overlap with other 2p deletions and (3) the presence of highly identical LCR blocks flanking both breakpoints, consistent with a non-allelic homologous recombination (NAHR)-mediated rearrangement.
Samek, Diana R.; Hicks, Brian M.; Keyes, Margaret A.; Bailey, Jennifer; McGue, Matt; Iacono, William G.
2014-01-01
Background Previous studies have shown that genetic risk for externalizing (EXT) disorders is greater in the context of adverse family environments during adolescence, but it is unclear whether these effects are long-lasting. The current study evaluated developmental changes in gene-environment interplay in the concurrent and prospective associations between parent-child relationship problems and EXT at ages 18 and 25. Method The sample included 1,382 twin pairs (48% male) from the Minnesota Twin Family Study, participating in assessments at ages 18 (M = 17.8 years, SD = 0.69) and 25 (M = 25.0 years, SD = 0.90). Perceptions of parent-child relationship problems were assessed using questionnaires. Structured interviews were used to assess symptoms of adult antisocial behavior and nicotine, alcohol, and illicit drug dependence. Results We detected a gene-environment interaction at age 18, such that the genetic influence on EXT was greater in the context of more parent-child relationship problems. This moderation effect was not present at age 25, nor did parent-relationship problems at age 18 moderate genetic influence on EXT at age 25. Rather, common genetic influences accounted for this longitudinal association. Conclusions Gene-environment interaction evident in the relationship between adolescent parent-child relationship problems and EXT is both proximal and developmentally limited. Common genetic influence, rather than a gene-environment interaction, accounts for the long-term association between parent-child relationship problems at age 18 and EXT at age 25. These results are consistent with a relatively pervasive importance of gene-environmental correlation in the transition from late adolescence to young adulthood. PMID:25066478
Flank wear analysing of high speed end milling for hardened steel D2 using Taguchi Method
Hazza Faizi Al-Hazza, Muataz; Ibrahim, Nur Asmawiyah bt; Adesta, Erry T. Y.; Khan, Ahsan Ali; Abdullah Sidek, Atiah Bt.
2017-03-01
One of the main challenges for any manufacturer is how to decrease the machining cost without affecting the final quality of the product. One of the new advanced machining processes in industry is the high speed hard end milling process that merges three advanced machining processes: high speed milling, hard milling and dry milling. However, one of the most important challenges in this process is to control the flank wear rate. Therefore a analyzing the flank wear rate during machining should be investigated in order to determine the best cutting levels that will not affect the final quality of the product. In this research Taguchi method has been used to investigate the effect of cutting speed, feed rate and depth of cut and determine the best level s to minimize the flank wear rate up to total length of 0.3mm based on the ISO standard to maintain the finishing requirements.
Wong, S W; Schaffer, P A
1991-05-01
Like other DNA-containing viruses, the three origins of herpes simplex virus type 1 (HSV-1) DNA replication are flanked by sequences containing transcriptional regulatory elements. In a transient plasmid replication assay, deletion of sequences comprising the transcriptional regulatory elements of ICP4 and ICP22/47, which flank oriS, resulted in a greater than 80-fold decrease in origin function compared with a plasmid, pOS-822, which retains these sequences. In an effort to identify specific cis-acting elements responsible for this effect, we conducted systematic deletion analysis of the flanking region with plasmid pOS-822 and tested the resulting mutant plasmids for origin function. Stimulation by cis-acting elements was shown to be both distance and orientation dependent, as changes in either parameter resulted in a decrease in oriS function. Additional evidence for the stimulatory effect of flanking sequences on origin function was demonstrated by replacement of these sequences with the cytomegalovirus immediate-early promoter, resulting in nearly wild-type levels of oriS function. In competition experiments, cotransfection of cells with the test plasmid, pOS-822, and increasing molar concentrations of a competitor plasmid which contained the ICP4 and ICP22/47 transcriptional regulatory regions but lacked core origin sequences resulted in a significant reduction in the replication efficiency of pOS-822, demonstrating that factors which bind specifically to the oriS-flanking sequences are likely involved as auxiliary proteins in oriS function. Together, these studies demonstrate that trans-acting factors and the sites to which they bind play a critical role in the efficiency of HSV-1 DNA replication from oriS in transient-replication assays.
Molecular cytogenetics of radiation-induced gene mutations in Drosophila melanogaster
International Nuclear Information System (INIS)
Aleksandrov, I.D.; Aleksandrova, M.V.; Lapidus, I.L.; Karpovskij, A.L.
1996-01-01
The classical paradigm of spatially unrelated lesions for gene mutations and chromosomal exchange breakpoints induced by ionizing radiations in eukaryotic cells was re-examined in the experiments on the mapping of gamma-ray- or neutron-induced breakpoints in and outside of white (w) and vestigial (vg) genes of Drosophila melanogaster using the in situ hybridization of the large fragments of the genes under study with the polythene chromosomes of the relevant mutants. The results for the random sample of 60 inversion and translocation breakpoints analysed to date have shown that (i) 50% of them are mapped as the hot spots within big introns of both the genes, and (ii) 21 of 60 breaks (35%) are located outside of genes. It is important to note that 26% (16/60) of the breakpoints analysed are flanked by the deletions, the sizes of which vary from the quarter to a whole of the gene. It was found that the deletions flank both the inversion and translocation breakpoints and arise more often after action of neutrons than photons. An unexpectedly high frequency of the multiple-damaged w and vg mutants that have the gene/point mutation and additional, but separate, chromosome exchange (the so-called double- or triple-site mutants) has shown that the genetic danger of ionizing radiation is higher than usually accepted on the base of single gene/point mutation assessments. 11 refs., 3 figs
Physical and genetic map of the major nif gene cluster from Azotobacter vinelandii.
Jacobson, M R; Brigle, K E; Bennett, L T; Setterquist, R A; Wilson, M S; Cash, V L; Beynon, J; Newton, W E; Dean, D R
1989-01-01
Determination of a 28,793-base-pair DNA sequence of a region from the Azotobacter vinelandii genome that includes and flanks the nitrogenase structural gene region was completed. This information was used to revise the previously proposed organization of the major nif cluster. The major nif cluster from A. vinelandii encodes 15 nif-specific genes whose products bear significant structural identity to the corresponding nif-specific gene products from Klebsiella pneumoniae. These genes include ...
Pancreatic Tail Cancer with Sole Manifestation of Left Flank Pain: A Very Rare Presentation
Directory of Open Access Journals (Sweden)
Hsing-Lin Lin
2008-06-01
Full Text Available Pancreatic cancer is sometimes called a “silent disease” because it often causes no symptoms in the early stage. The symptoms can be quite vague and various depending on the location of cancer in the pancreas. The anatomic site distribution is 78% in the head of the pancreas, 11% in the body, and 11% in the tail. Pancreatic cancer is rarely detected in the early stage, and it is very uncommon to diagnose pancreatic tail cancer during an emergency department visit. The manifestation of pancreatic tail cancer as left flank pain is very rare and has seldom been identified in the literature. We present a case of pancreatic tail cancer with the sole manifestation of dull left flank pain. Having negative findings on an ultrasound study initially, this female patient was misdiagnosed as having possible acute gastritis, urolithiasis or muscle strain after she received gastroendoscopy and colonofiberscopy. Her symptoms persisted for several months and she visited our emergency department due to an acute exacerbation of a persistent dull pain in the left flank area. Radiographic evaluation with computed tomography was performed, and pancreatic tail tumor with multiple metastases was found unexpectedly. We review the literature and discuss this rare presentation of pancreatic tail cancer.
An unusual manifestation of acute appendicitis with left flank pain
Directory of Open Access Journals (Sweden)
Roland Talanow, MD, PhD
2008-08-01
Full Text Available The author presents a case with an unusual presentation of early appendicitis. The patient presented initially with left sided flank pain. Workup for nephrolithiasis, including non-contrast CT of the abdomen and pelvis was negative for renal stones or hydronephrosis. After discharge, the patient presented one week later in the ED with right lower quadrant pain. Contrast enhanced CT of the abdomen revealed perforated appendicitis.
International Nuclear Information System (INIS)
Agrawal, Vikash; Shahjad; Bhardwaj, Dinesh; Bhargav, Ranoo; Sharma, Gauri Datt; Bhardwaj, Ramil Kumar; Patra, Asit; Chand, Suresh
2016-01-01
Highlights: • Biselenophene-flanked 3,4-ethylenedioxythiophene polymer films were obtained by electrochemical polymerization. • Supporting electrolyte has significant effect on the doping level, whereas electropolymerized solvent has a major effect on morphology of the polymer films. • Optoelectronic properties and morphology of the electropolymerized films were studied. • Density functional theory (DFT) calculation has been made for optoelectronic properties. - Abstract: Biselenophene-flanked 3,4-ethylenedioxythiophene (EDOT) based polymer films were obtained by electrochemical polymerization. The effects of polymerization conditions such as supporting electrolytes and solvents on doping level, optical property and morphology of the polymer films were systematically studied. Interestingly, we found that polymer prepared by using different supporting electrolytes (TBAPF 6 , TBABF 4 and TBAClO 4 ) has significant effects on the doping level of the polymer films, whereas electropolymerized solvents (acetonitrile and dichloromethane) has no such effects on doping level. The polymer films show reversible dedoping and doping behavior upon treatment with hydrazine hydrate and iodine respectively. Biselenophene-flanked EDOT polymer shows a band gap of about 1.6 eV which is comparable to poly(3,4- ethylenedioxythiophene) (PEDOT) and parent polyselenophene, whereas fine-tuning of HOMO and LUMO energy levels has been found. In contrast, we observed that electropolymerized solvent has a major effect on morphology of the polymer films, while supporting electrolyte has very minor effects on the morphology. The surface morphologies of the polymer films were characterized by scanning electron microscope (SEM) and atomic force microscope (AFM) techniques. We also present an efficient synthesis of bisthiophene-flanked bridged EDOT (ETTE), and biselenophene-flanked bridged EDOT (ESeSeE), and their electrochemical polymerization, characterizations and throughout comparison
Mia, Mozammel; Al Bashir, Mahmood; Dhar, Nikhil Ranjan
2016-10-01
Hard turning is increasingly employed in machining, lately, to replace time-consuming conventional turning followed by grinding process. An excessive amount of tool wear in hard turning is one of the main hurdles to be overcome. Many researchers have developed tool wear model, but most of them developed it for a particular work-tool-environment combination. No aggregate model is developed that can be used to predict the amount of principal flank wear for specific machining time. An empirical model of principal flank wear (VB) has been developed for the different hardness of workpiece (HRC40, HRC48 and HRC56) while turning by coated carbide insert with different configurations (SNMM and SNMG) under both dry and high pressure coolant conditions. Unlike other developed model, this model includes the use of dummy variables along with the base empirical equation to entail the effect of any changes in the input conditions on the response. The base empirical equation for principal flank wear is formulated adopting the Exponential Associate Function using the experimental results. The coefficient of dummy variable reflects the shifting of the response from one set of machining condition to another set of machining condition which is determined by simple linear regression. The independent cutting parameters (speed, rate, depth of cut) are kept constant while formulating and analyzing this model. The developed model is validated with different sets of machining responses in turning hardened medium carbon steel by coated carbide inserts. For any particular set, the model can be used to predict the amount of principal flank wear for specific machining time. Since the predicted results exhibit good resemblance with experimental data and the average percentage error is <10 %, this model can be used to predict the principal flank wear for stated conditions.
Directory of Open Access Journals (Sweden)
Alexander B. Opoku-Acheampong
2016-01-01
Full Text Available Saw palmetto supplements (SPS are commonly consumed by men with prostate cancer. We investigated whether SPS fatty acids and phytosterols concentrations determine their growth-inhibitory action in androgen-sensitive LNCaP cells and hamster flank organs. High long-chain fatty acids-low phytosterols (HLLP SPS ≥ 750 nM with testosterone significantly increased and ≥500 nM with dihydrotestosterone significantly decreased LNCaP cell number. High long-chain fatty acids-high phytosterols (HLHP SPS ≥ 500 nM with dihydrotestosterone and high medium-chain fatty acids-low phytosterols (HMLP SPS ≥ 750 nM or with androgens significantly decreased LNCaP cell number (n=3; p<0.05. Five- to six-week-old, castrated male Syrian hamsters were randomized to control (n=4, HLLP, HLHP, and HMLP SPS (n=6 groups. Testosterone or dihydrotestosterone was applied topically daily for 21 days to the right flank organ; the left flank organ was treated with ethanol and served as the control. Thirty minutes later, SPS or ethanol was applied to each flank organ in treatment and control groups, respectively. SPS treatments caused a notable but nonsignificant reduction in the difference between left and right flank organ growth in testosterone-treated SPS groups compared to the control. The same level of inhibition was not seen in dihydrotestosterone-treated SPS groups (p<0.05. Results may suggest that SPS inhibit 5α-reductase thereby preventing hamster flank organ growth.
Opoku-Acheampong, Alexander B; Penugonda, Kavitha; Lindshield, Brian L
2016-01-01
Saw palmetto supplements (SPS) are commonly consumed by men with prostate cancer. We investigated whether SPS fatty acids and phytosterols concentrations determine their growth-inhibitory action in androgen-sensitive LNCaP cells and hamster flank organs. High long-chain fatty acids-low phytosterols (HLLP) SPS ≥ 750 nM with testosterone significantly increased and ≥500 nM with dihydrotestosterone significantly decreased LNCaP cell number. High long-chain fatty acids-high phytosterols (HLHP) SPS ≥ 500 nM with dihydrotestosterone and high medium-chain fatty acids-low phytosterols (HMLP) SPS ≥ 750 nM or with androgens significantly decreased LNCaP cell number (n = 3; p < 0.05). Five- to six-week-old, castrated male Syrian hamsters were randomized to control (n = 4), HLLP, HLHP, and HMLP SPS (n = 6) groups. Testosterone or dihydrotestosterone was applied topically daily for 21 days to the right flank organ; the left flank organ was treated with ethanol and served as the control. Thirty minutes later, SPS or ethanol was applied to each flank organ in treatment and control groups, respectively. SPS treatments caused a notable but nonsignificant reduction in the difference between left and right flank organ growth in testosterone-treated SPS groups compared to the control. The same level of inhibition was not seen in dihydrotestosterone-treated SPS groups (p < 0.05). Results may suggest that SPS inhibit 5α-reductase thereby preventing hamster flank organ growth.
Lawal, S. A.; Choudhury, I. A.; Nukman, Y.
2015-01-01
The understanding of cutting fluids performance in turning process is very important in order to improve the efficiency of the process. This efficiency can be determined based on certain process parameters such as flank wear, cutting forces developed, temperature developed at the tool chip interface, surface roughness on the work piece, etc. In this study, the objective is to determine the influence of cutting fluids on flank wear during turning of AISI 4340 with coated carbide inserts. The performances of three types of cutting fluids were compared using Taguchi experimental method. The results show that palm kernel oil based cutting fluids performed better than the other two cutting fluids in reducing flank wear. Mathematical models for cutting parameters such as cutting speed, feed rate, depth of cut and cutting fluids were obtained from regression analysis using MINITAB 14 software to predict flank wear. Experiments were conducted based on the optimized values to validate the regression equations for flank wear and 5.82 % error was obtained. The optimal cutting parameters for the flank wear using S/N ratio were 160 m/min of cutting speed (level 1), 0.18 mm/rev of feed (level 1), 1.75 mm of depth of cut (level 2) and 2.97 mm2/s palm kernel oil based cutting fluid (level 3). ANOVA shows cutting speed of 85.36 %; and feed rate 4.81 %) as significant factors.
Characterization of carotenoid hydroxylase gene promoter in Haematococcus pluvialis.
Meng, C X; Wei, W; Su, Z- L; Qin, S
2006-10-01
Astaxanthin, a high-value ketocarotenoid is mainly used in fish aquaculture. It also has potential in human health due to its higher antioxidant capacity than beta-carotene and vitamin E. The unicellular green alga Haematococcus pluvialis is known to accumulate astaxanthin in response to environmental stresses, such as high light intensity and salt stress. Carotenoid hydroxylase plays a key role in astaxanthin biosynthesis in H. pluvialis. In this paper, we report the characterization of a promoter-like region (-378 to -22 bp) of carotenoid hydroxylase gene by cloning, sequence analysis and functional verification of its 919 bp 5'-flanking region in H. pluvialis. The 5'-flanking region was characterized using micro-particle bombardment method and transient expression of LacZ reporter gene. Results of sequence analysis showed that the 5'-flanking region might have putative cis-acting elements, such as ABA (abscisic acid)-responsive element (ABRE), C-repeat/dehydration responsive element (C-repeat/DRE), ethylene-responsive element (ERE), heat-shock element (HSE), wound-responsive element (WUN-motif), gibberellin-responsive element (P-box), MYB-binding site (MBS) etc., except for typical TATA and CCAAT boxes. Results of 5' deletions construct and beta-galactosidase assays revealed that a highest promoter-like region might exist from -378 to -22 bp and some negative regulatory elements might lie in the region from -919 to -378 bp. Results of site-directed mutagenesis of a putative C-repeat/DRE and an ABRE-like motif in the promoter-like region (-378 to -22 bp) indicated that the putative C-repeat/DRE and ABRE-like motif might be important for expression of carotenoid hydroxylase gene.
Energy Technology Data Exchange (ETDEWEB)
Das, Sudhansu Ranjan; Kuma, Amaresh [National Institute of Technology, Jamshedpur (India); Dhupal, Debabrata [Veer Surendra Sai University of Technology, Burla (India)
2015-10-15
This experimental investigation deals with dry hard turning of AISI 4140 steel using PVD-TiN coated Al{sub 2}O{sub 3}+TiCN mixed ceramic inserts. The combined effect of cutting parameters (cutting speed, feed and depth of cut) on performance characteristics such as surface roughness and flank wear is explored by Full factorial design (FFD) and analysis of variance (ANOVA). The results show that feed is the principal cutting parameter influencing surface roughness, followed by cutting speed. However, flank wear is affected by the cutting speed and interaction of feed-depth of cut, although depth of cut has not been found statistically significant, but flank wear is an increasing function of depth of cut. Observations are made on the machined surface, and worn tool by Scanning electron microscope (SEM) to establish the process. Abrasion was the major wear mechanism found during hard turning within the studied range. The effect of tool wear on surface roughness was also studied. The experimental data were analyzed to predict the optimal range of surface roughness and flank wear. Based on Response surface methodology (RSM), mathematical models were developed for surface roughness (Ra) and flank wear (VB) with 95% confidence level. Finally, under optimum cutting conditions (obtained by response optimization technique), tool life was evaluated to perform cost analysis for justifying the economic viability of coated ceramic inserts in hard turning. The estimated machining cost per part for TiN coated ceramic was found to be lower (Rs. 12.31) because of higher tool life (51 min), which results in the reduction of downtime and increase in savings.
International Nuclear Information System (INIS)
Das, Sudhansu Ranjan; Kuma, Amaresh; Dhupal, Debabrata
2015-01-01
This experimental investigation deals with dry hard turning of AISI 4140 steel using PVD-TiN coated Al_2O_3+TiCN mixed ceramic inserts. The combined effect of cutting parameters (cutting speed, feed and depth of cut) on performance characteristics such as surface roughness and flank wear is explored by Full factorial design (FFD) and analysis of variance (ANOVA). The results show that feed is the principal cutting parameter influencing surface roughness, followed by cutting speed. However, flank wear is affected by the cutting speed and interaction of feed-depth of cut, although depth of cut has not been found statistically significant, but flank wear is an increasing function of depth of cut. Observations are made on the machined surface, and worn tool by Scanning electron microscope (SEM) to establish the process. Abrasion was the major wear mechanism found during hard turning within the studied range. The effect of tool wear on surface roughness was also studied. The experimental data were analyzed to predict the optimal range of surface roughness and flank wear. Based on Response surface methodology (RSM), mathematical models were developed for surface roughness (Ra) and flank wear (VB) with 95% confidence level. Finally, under optimum cutting conditions (obtained by response optimization technique), tool life was evaluated to perform cost analysis for justifying the economic viability of coated ceramic inserts in hard turning. The estimated machining cost per part for TiN coated ceramic was found to be lower (Rs. 12.31) because of higher tool life (51 min), which results in the reduction of downtime and increase in savings.
Directory of Open Access Journals (Sweden)
Nagib eAhsan
2012-07-01
Full Text Available The mitochondrial pyruvate dehydrogenase complex is regulated by reversible seryl-phosphorylation of the E1α subunit by a dedicated, intrinsic kinase. The phospho-complex is reactivated when dephosphorylated by an intrinsic PP2C-type protein phosphatase. Both the position of the phosphorylated Ser-residue and the sequences of the flanking amino acids are highly conserved. We have used the synthetic peptide-based kinase client assay plus recombinant pyruvate dehydrogenase E1α and E1α-kinase to perform scanning mutagenesis of the residues flanking the site of phosphorylation. Consistent with the results from phylogenetic analysis of the flanking sequences, the direct peptide-based kinase assays tolerated very few changes. Even conservative changes such as Leu, Ile, or Val for Met, or Glu for Asp, gave very marked reductions in phosphorylation. Overall the results indicate that regulation of the mitochondrial pyruvate dehydrogenase complex by reversible phosphorylation is an extreme example of multiple, interdependent instances of co-evolution.
Directory of Open Access Journals (Sweden)
Madajewski Marek
2017-01-01
Full Text Available This paper presents analysis of flank wear influence on forces in orthogonal turning of 42CrMo4 steel and evaluates capacity of finite element model to provide such force values. Data about magnitude of feed and cutting force were obtained from measurements with force tensiometer in experimental test as well as from finite element analysis of chip formation process in ABAQUS/Explicit software. For studies an insert with complex rake face was selected and flank wear was simulated by grinding operation on its flank face. The aim of grinding inset surface was to obtain even flat wear along cutting edge, which after the measurement could be modeled with CAD program and applied in FE analysis for selected range of wear width. By comparing both sets of force values as function of flank wear in given cutting conditions FEA model was validated and it was established that it can be applied to analyze other physical aspects of machining. Force analysis found that progression of wear causes increase in cutting force magnitude and steep boost to feed force magnitude. Analysis of Fc/Ff force ratio revealed that flank wear has significant impact on resultant force in orthogonal cutting and magnitude of this force components in cutting and feed direction. Surge in force values can result in transfer of substantial loads to machine-tool interface.
Madajewski, Marek; Nowakowski, Zbigniew
2017-01-01
This paper presents analysis of flank wear influence on forces in orthogonal turning of 42CrMo4 steel and evaluates capacity of finite element model to provide such force values. Data about magnitude of feed and cutting force were obtained from measurements with force tensiometer in experimental test as well as from finite element analysis of chip formation process in ABAQUS/Explicit software. For studies an insert with complex rake face was selected and flank wear was simulated by grinding operation on its flank face. The aim of grinding inset surface was to obtain even flat wear along cutting edge, which after the measurement could be modeled with CAD program and applied in FE analysis for selected range of wear width. By comparing both sets of force values as function of flank wear in given cutting conditions FEA model was validated and it was established that it can be applied to analyze other physical aspects of machining. Force analysis found that progression of wear causes increase in cutting force magnitude and steep boost to feed force magnitude. Analysis of Fc/Ff force ratio revealed that flank wear has significant impact on resultant force in orthogonal cutting and magnitude of this force components in cutting and feed direction. Surge in force values can result in transfer of substantial loads to machine-tool interface.
Directory of Open Access Journals (Sweden)
Bingfu Guo
2016-07-01
Full Text Available Molecular characterization of sequences flanking exogenous fragment insertions is essential for safety assessment and labeling of genetically modified organisms (GMO. In this study, the T-DNA insertion sites and flanking sequences were identified in two newly developed transgenic glyphosate-tolerant soybeans GE-J16 and ZH10-6 based on whole genome sequencing (WGS method. About 21 Gb sequence data (~21× coverage for each line was generated on Illumina HiSeq 2500 platform. The junction reads mapped to boundary of T-DNA and flanking sequences in these two events were identified by comparing all sequencing reads with soybean reference genome and sequence of transgenic vector. The putative insertion loci and flanking sequences were further confirmed by PCR amplification, Sanger sequencing, and co-segregation analysis. All these analyses supported that exogenous T-DNA fragments were integrated in positions of Chr19: 50543767-50543792 and Chr17: 7980527-7980541 in these two transgenic lines. Identification of the genomic insertion site of the G2-EPSPS and GAT transgenes will facilitate the use of their glyphosate-tolerant traits in soybean breeding program. These results also demonstrated that WGS is a cost-effective and rapid method of identifying sites of T-DNA insertions and flanking sequences in soybean.
Kunrat, S. L.; Schwandner, F. M.
2013-12-01
Gede Volcano (West Java) is part of an andesitic stratovolcano complex consisting of Pangrango in the north-west and Gede in the south-east. The last recorded eruptive activity was a phreatic subvolcanian ash eruption in 1957. Current activity is characterized by episodic swarms at 2-4 km depth, and low-temperature (~160°C) crater degassing in two distinct summit crater fumarolic areas. Hot springs occur in the saddle between the Gede and Pangrango edifice, as well as on the NE flank base. The most recent eruptive events produced pyroclastic material, their flow deposits concentrate toward the NE. A collaborative effort between the Center for Volcanology and Geological Hazard Mitigation (CVGHM), Geological Agency and the Earth Observatory of Singapore (EOS) is since 2010 aimed at upgrading the geophysical and geochemical monitoring network at Gede Volcano. To support the monitoring instrumentation upgrades under way, surveys of soil CO2 degassing have been performed on the flanks of Gede, in circular and radial traverses.The goal was to establish a spatial distribution of flank CO2 fluxes, and to allow smart siting for continuous gas monitoring stations. Crater fluxes were not surveyed, as its low-temperature hydrothermal system is likely prone to large hydraulic changes in this tropical environment, resulting in variable permeability effects that might mask signals from deeper reservoir or conduit degassing. The high precipitation intensity in the mountains of tropical Java pose challenges to this method, since soil gas permeability is largely controlled by soil moisture content. Simultaneous soil moisture measurements were undertaken. The soil CO2 surveys were carried out using a LI-8100A campaign flux chamber instrument (LICOR Biosciences, Lincoln, Nebraska). This instrument has a very precise and highly stable sensor and an atmospheric pressure equilibrator, making it highly sensitive to low fluxes. It is the far superior choice for higher precision low
International Nuclear Information System (INIS)
Silver, B.J.; Bokar, J.A.; Virgin, J.B.; Vallen, E.A.; Milsted, A.; Nilson, J.H.
1987-01-01
cAMP regulates transcription of the gene encoding the α-subunit of human chorionic gonadotropin (hCG) in the choriocarcinoma cells (BeWo). To define the sequences required for regulation by cAMP, the authors inserted fragments from the 5' flanking region of the α-subunit gene into a test vector containing the simian virus 40 early promoter (devoid of its enhancer) linked to the bacterial chloramphenicol acetyltransferase (CAT) gene. Results from transient expression assays in BeWo cells indicated that a 1500-base-pair (bp) fragment conferred cAMP responsiveness on the CAT gene regardless of position or orientation of the insert relative to the viral promoter. A subfragment extending from position -169 to position -100 had the same effect on cAMP-induced expression. Furthermore, the entire stimulatory effect could be achieved with an 18-bp synthetic oligodeoxynucleotide corresponding to a direct repeat between position -146 and -111. In the absence of cAMP, the α-subunit 5' flanking sequence also enhanced transcription from the simian virus 40 early promoter. They localized this enhancer activity to the same -169/-100 fragment containing the cAMP response element. The 18-bp element alone, however, had no effect on basal expression. Thus, this short DNA sequence serves as a cAMP response element and also functions independently of other promoter-regulatory elements located in the 5' flanking sequence of the α-subunit gene
Compartmentalization of the Coso East Flank geothermal field imaged by 3-D full-tensor MT inversion
Lindsey, Nathaniel J.; Kaven, Joern; Davatzes, Nicholas C.; Newman, Gregory A.
2017-01-01
Previous magnetotelluric (MT) studies of the high-temperature Coso geothermal system in California identified a subvertical feature of low resistivity (2–5 Ohm m) and appreciable lateral extent (>1 km) in the producing zone of the East Flank field. However, these models could not reproduce gross 3-D effects in the recorded data. We perform 3-D full-tensor inversion and retrieve a resistivity model that out-performs previous 2-D and 3-D off-diagonal models in terms of its fit to the complete 3-D MT data set as well as the degree of modelling bias. Inclusion of secondary Zxx and Zyy data components leads to a robust east-dip (60†) to the previously identified conductive East Flank reservoir feature, which correlates strongly with recently mapped surface faults, downhole well temperatures, 3-D seismic reflection data, and local microseismicity. We perform synthetic forward modelling to test the best-fit dip of this conductor using the response at a nearby MT station. We interpret the dipping conductor as a fractured and fluidized compartment, which is structurally controlled by an unmapped blind East Flank fault zone.
International Nuclear Information System (INIS)
Shibata, Toru; Akiyama, Nobutake; Noda, Makoto; Sasai, Keisuke; Hiraoka, Masahiro
1998-01-01
Purpose: Selective gene expression in response to tumor hypoxia may provide new avenues, not only for radiotherapy and chemotherapy, but also for gene therapy. In this study, we have assessed the extent of hypoxia responsiveness of various DNA constructs by the luciferase assay to help design vectors suitable for cancer therapy. Materials and Methods: Reporter plasmids were constructed with fragments of the human vascular endothelial growth factor (VEGF) and the erythropoietin (Epo) genes encompassing the putative hypoxia-responsive elements (HRE) and the pGL3 promoter vector. Test plasmids and the control pRL-CMV plasmid were cotransfected into tumor cells by the calcium phosphate method. After 6 h hypoxic treatment, the reporter assay was performed. Results: The construct pGL3/VEGF containing the 385 bp fragment of the 5' flanking region in human VEGF gene showed significant increases in luciferase activity in response to hypoxia. The hypoxic/aerobic ratios were about 3-4, and 8-12 for murine and human tumor cells, respectively. Despite the very high degree of conservation among the HREs of mammalian VEGF genes, murine cells showed lower responsiveness than human cells. We next tested the construct pGL3/Epo containing the 150 bp fragment of the 3' flanking region in the Epo gene. Luciferase activity of pGL3/Epo was increased with hypoxia only in human cell lines. The insertion of 5 copies of the 35-bp fragments derived from the VEGF HREs and 32 bp of the E1b minimal promoter resulted in maximal enhancement of hypoxia responsiveness. Conclusions: The constructs with VEGF or Epo fragments containing HRE may be useful for inducing specific gene expression in hypoxic cells. Especially, the application of multiple copies of the HREs and an E1b minimal promoter appears to have the advantage of great improvement in hypoxia responsiveness
Amyloidosis of the renal pelvis presenting as flank pain
Directory of Open Access Journals (Sweden)
Rachel Shikhman, D.O.
2018-02-01
Full Text Available Amyloidosis is a rare disease defined by accumulation of extracellular amyloid systemically or within a specific organ. Localized amyloidosis of the genitourinary system is extremely rare, with the predominate location being the bladder. The imaging findings are often nonspecific and mimic urothelial carcinoma. We present a 49-year-old woman with a chief complaint of flank pain. A filling defect was discovered on radiological imaging. The defect was subsequently biopsied and proven to be a primary amyloidosis of the renal pelvis. We then review the radiological findings of amyloidosis of the genitourinary system.
Vertebrate gene predictions and the problem of large genes
DEFF Research Database (Denmark)
Wang, Jun; Li, ShengTing; Zhang, Yong
2003-01-01
To find unknown protein-coding genes, annotation pipelines use a combination of ab initio gene prediction and similarity to experimentally confirmed genes or proteins. Here, we show that although the ab initio predictions have an intrinsically high false-positive rate, they also have a consistent...
Directory of Open Access Journals (Sweden)
Ashok Kumar Sahoo
2013-10-01
Full Text Available The paper presents the development of flank wear model in turning hardened EN 24 steel with PVD TiN coated mixed ceramic insert under dry environment. The paper also investigates the effect of process parameter on flank wear (VBc. The experiments have been conducted using three level full factorial design techniques. The machinability model has been developed in terms of cutting speed (v, feed (f and machining time (t as input variable using response surface methodology. The adequacy of model has been checked using correlation coefficients. As the determination coefficient, R2 (98% is higher for the model developed; the better is the response model fits the actual data. In addition, residuals of the normal probability plot lie reasonably close to a straight line showing that the terms mentioned in the model are statistically significant. The predicted flank wear has been found to lie close to the experimental value. This indicates that the developed model can be effectively used to predict the flank wear in the hard turning. Abrasion and diffusion has been found to be the dominant wear mechanism in machining hardened steel from SEM micrographs at highest parametric range. Machining time has been found to be the most significant parameter on flank wear followed by cutting speed and feed as observed from main effect plot and ANOVA study.
Kempter, K.A.; Rowe, G.L.
2000-01-01
The Active Crater at Rincon de la Vieja volcano, Costa Rica, reaches an elevation of 1750 m and contains a warm, hyper-acidic crater lake that probably formed soon after the eruption of the Rio Blanco tephra deposit approximately 3500 years before present. The Active Crater is buttressed by volcanic ridges and older craters on all sides except the north, which dips steeply toward the Caribbean coastal plains. Acidic, above-ambient-temperature streams are found along the Active Crater's north flank at elevations between 800 and 1000 m. A geochemical survey of thermal and non-thermal waters at Rincon de la Vieja was done in 1989 to determine whether hyper-acidic fluids are leaking from the Active Crater through the north flank, affecting the composition of north-flank streams. Results of the water-chemistry survey reveal that three distinct thermal waters are found on the flanks of Rincon de la Vieja volcano: acid chloride-sulfate (ACS), acid sulfate (AS), and neutral chloride (NC) waters. The most extreme ACS water was collected from the crater lake that fills the Active Crater. Chemical analyses of the lake water reveal a hyper-acidic (pH ~ 0) chloride-sulfate brine with elevated concentrations of calcium, magnesium, aluminum, iron, manganese, copper, zinc, fluorine, and boron. The composition of the brine reflects the combined effects of magmatic degassing from a shallow magma body beneath the Active Crater, dissolution of andesitic volcanic rock, and evaporative concentration of dissolved constituents at above-ambient temperatures. Similar cation and anion enrichments are found in the above-ambient-temperature streams draining the north flank of the Active Crater. The pH of north-flank thermal waters range from 3.6 to 4.1 and chloride:sulfate ratios (1.2-1.4) that are a factor of two greater than that of the lake brine (0.60). The waters have an ACS composition that is quite different from the AS and NC thermal waters that occur along the southern flank of Rincon
Southward flow on the western flank of the Florida Current
Soloviev, Alexander V.; Hirons, Amy; Maingot, Christopher; Dean, Cayla W.; Dodge, Richard E.; Yankovsky, Alexander E.; Wood, Jon; Weisberg, Robert H.; Luther, Mark E.; McCreary, Julian P.
2017-07-01
A suite of long-term in situ measurements in the Straits of Florida, including the ADCP bottom moorings at an 11-m isobath and 244-m isobath (Miami Terrace) and several ADCP ship transects, have revealed a remarkable feature of the ocean circulation - southward flow on the western, coastal flank of the Florida Current. We have observed three forms of the southward flow - a seasonally varying coastal countercurrent, an undercurrent jet attached to the Florida shelf, and an intermittent undercurrent on the Miami Terrace. According to a 13-year monthly climatology obtained from the near-shore mooring, the coastal countercurrent is a persistent feature from October through January. The southward flow in the form of an undercurrent jet attached to the continental slope was observed during five ship transects from April through September but was not observed during three transects in February, March, and November. This undercurrent jet is well mixed due to strong shear at its top associated with the northward direction of the surface flow (Florida Current) and friction at the bottom. At the same time, no statistically significant seasonal cycle has been observed in the undercurrent flow on the Miami Terrace. Theoretical considerations suggest that several processes could drive the southward current, including interaction between the Florida Current and the shelf, as well as forcing that is independent of the Florida Current. The exact nature of the southward flow on the western flank of the Florida Current is, however, unknown.
Bacillus caldolyticus prs gene encoding phosphoribosyldiphosphate synthase
DEFF Research Database (Denmark)
Krath, Britta N.; Hove-Jensen, Bjarne
1996-01-01
The prs gene, encoding phosphoribosyl-diphosphate (PRPP) synthase, as well as the flanking DNA sequences were cloned and sequenced from the Gram-positive thermophile, Bacillus caldolyticus. Comparison with the homologous sequences from the mesophile, Bacillus subtilis, revealed a gene (gca......D) encoding N-acetylglucosamine-l-phosphate uridyltransferase upstream of prs, and a gene homologous to ctc downstream of prs. cDNA synthesis with a B. caldolyticus gcaD-prs-ctc-specified mRNA as template, followed by amplification utilising the polymerase chain reaction indicated that the three genes are co......-transcribed. Comparison of amino acid sequences revealed a high similarity among PRPP synthases across a wide phylogenetic range. An E. coli strain harbouring the B. caldolyticus prs gene in a multicopy plasmid produced PRPP synthase activity 33-fold over the activity of a haploid B. caldolyticus strain. B. caldolyticus...
Structure of the gene for human β2-adrenergic receptor: expression and promoter characterization
International Nuclear Information System (INIS)
Emorine, L.J.; Marullo, S.; Delavier-Klutchko, C.; Kaveri, S.V.; Durieu-Trautmann, O.; Strosberg, A.D.
1987-01-01
The genomic gene coding for the human β 2 -adrenergic receptor (β 2 AR) from A431 epidermoid cells has been isolated. Transfection of the gene into eukaryotic cells restores a fully active receptor/GTP-binding protein/adenylate cyclase complex with β 2 AR properties. Southern blot analyses with β 2 AR-specific probes show that a single β 2 AR gene is common to various human tissues and that its flanking sequences are highly conserved among humans and between man and rabbit, mouse, and hamster. Functional significance of these regions is supported by the presence of a promoter region (including mRNA cap sites, two TATA boxes, a CAAT box, and three G + C-rich regions that resemble binding sites for transcription factor Sp1) 200-300 base pairs 5' to the translation initiation codon. In the 3' flanking region, sequences homologous to glucocorticoid-response elements might be responsible for the increased expression of the β 2 AR gene observed after treatment of the transfected cells with hydrocortisone. In addition, 5' to the promoter region, an open reading frame encodes a 251-residue polypeptide that displays striking homologies with protein kinases and other nucleotide-binding proteins
Modulation of hepatocyte growth factor gene expression by estrogen in mouse ovary.
Liu, Y; Lin, L; Zarnegar, R
1994-09-01
Hepatocyte growth factor (HGF) is expressed in a variety of tissues and cell types under normal conditions and in response to various stimuli such as tissue injury. In the present study, we demonstrate that the transcription of the HGF gene is stimulated by estrogen in mouse ovary. A single injection of 17 beta-estradiol results in a dramatic and transient elevation of the levels of mouse HGF mRNA. Sequence analysis has found that two putative estrogen responsive elements (ERE) reside at -872 in the 5'-flanking region and at +511 in the first intron, respectively, of the mouse HGF gene. To test whether these ERE elements are responsible for estrogen induction of HGF gene expression, chimeric plasmids containing variable regions of the 5'-flanking sequence of HGF gene and the coding region for chloramphenicol acetyltransferase (CAT) gene were transiently transfected into both human endometrial carcinoma RL 95-2 cells and mouse fibroblast NIH 3T3 cells to assess hormone responsiveness. Transfection results indicate that the ERE elements of the mouse HGF gene can confer estrogen action to either homologous or heterologous promoters. Nuclear protein extracts either from RL95-2 cells transfected with the estrogen receptor expression vector or from mouse liver bound in vitro to ERE elements specifically, as shown by band shift assay. Therefore, our results demonstrate that the HGF gene is transcriptionally regulated by estrogen in mouse ovary; and such regulation is mediated via a direct interaction of the estrogen receptor complex with cis-acting ERE elements identified in the mouse HGF gene.
Unenhanced helical CT in the investigation of acute flank pain
International Nuclear Information System (INIS)
Colistro, Robert; Torreggiani, William C.; Lyburn, Iain D.; Harris, Alison C.; Al-Nakshabandi, Nizar A.; Nicolaou, Savvas; Munk, Peter L.
2002-01-01
Unenhanced helical CT has emerged as the imaging technique of choice for the investigation of patients presenting with acute flank pain and suspected nephroureteric stone disease. There are several signs identifiable on unenhanced CT that support a diagnosis of stone disease. However, there are many pitfalls, that may confound a correct diagnosis. Some of the common pitfalls, together with methods to avoid such occurrences, will be discussed. A review of some of the common alternative diagnoses that may mimic the symptoms of nephroureteric stone disease is illustrated. Colistro, R. et al (2002)
Naparstek, Sharon; Safadi, Ziad; Lichtenstein-Vidne, Limor; Henik, Avishai
2015-01-01
The current research examined whether peripherally presented numerical information can affect the speed of number processing. In 2 experiments, participants were presented with a target matrix flanked by a distractor matrix and were asked to perform a comparative judgment (i.e., decide whether the target was larger or smaller than the reference…
Directory of Open Access Journals (Sweden)
Joergen B. Kjaer
2016-10-01
Full Text Available The serotonergic system has been shown to be implicated in the regulation of mood and feeding behavior. Previous studies have identified a polymorphism in the 5′-flanking region of the serotonin transporter ( 5 - HTT gene of Lohmann Brown (LB laying hens. The deleted variant D was found to be associated with increased body weight. The objective of this study was to address whether the increased body weight may be due to an increased feed intake. After hatching, hens were kept under ad libitum feeding conditions, and their body weight and feed intake were weekly determined. From 5 weeks of age, the body weight of hens with the D/D and W/D genotypes was significantly greater than that of W/W carrying hens. Interestingly, we found that the feed intake of D/D carrying hens, relative to body weight, was transiently increased only between 4 and 7 weeks of age ( p < 0.05, leading to a higher growth rate ( p < 0.05, compared with that of W/W carrying hens. These results suggest that the presence of variant D may be correlated with a transiently increased appetite of D/D carrying hens.
Directory of Open Access Journals (Sweden)
Jumpei Saito
Full Text Available MicroRNA (miRNA are non-coding small RNA that regulate gene expression. MiR-328 is reported to influence breast cancer resistance protein (BCRP expression in cancer cells. As a large inter-individual difference in BCRP levels is observed in various human tissues, the contribution of miR-328 to these differences is of interest. We hypothesized that DNA methylation in the miR-328 promoter region is responsible for the difference in miR-328 levels, leading to inter-individual variability in BCRP levels in human placenta. The association between placental miR-328 and BCRP levels was analyzed, and then DNA methylation in the miR-328 5'-flanking region and regulatory mechanisms causing inter-individual differences in miR-328 and BCRP levels were examined. MiR-328 expression was significantly correlated with BCRP mRNA (Rs = -0.560, P < 0.01 and protein (Rs = -0.730, P < 0.01 levels. It was also up-regulated by the demethylating agent 5-aza-2'-deoxycytidine in BCRP-expressing cells. Luciferase assays with differentially methylated reporter constructs indicated that methylation in the miR-328 5'-flanking region including a predicted CpG island remarkably decreased transcriptional activity compared to that in unmethylated constructs. We selected CCAAT/enhancer binding protein α (C/EBPα, located within the predicted CpG island, by in silico analysis. To elucidate the role of C/EBPα in miR-328 expression, a chromatin immunoprecipitation assay, promoter deletion analysis, and electrophoretic mobility shift assay (EMSA were performed. C/EBPα-binding site-truncated constructs showed significantly decreased promoter activity, and EMSA indicated that the C/EBPα-binding sites were located in the CpG island. Finally, the methylation patterns of several CpG dinucleotides proximal to two C/EBPα-binding sites in the miR-328 5'-flanking region were correlated negatively with miR-328 levels, and positively with BCRP levels in human placental samples. These
Odedeyi, P. B.; Abou-El-Hossein, K.; Liman, M.
2017-05-01
Stainless steel 316 is a difficult-to-machine iron-based alloys that contain minimum of about 12% of chromium commonly used in marine and aerospace industry. This paper presents an experimental study of the tool wear propagation variations in the end milling of stainless steel 316 with coated carbide inserts. The milling tests were conducted at three different cutting speeds while feed rate and depth of cut were at (0.02, 0.06 and 01) mm/rev and (1, 2 and 3) mm, respectively. The cutting tool used was TiAlN-PVD-multi-layered coated carbides. The effects of cutting speed, cutting tool coating top layer and workpiece material were investigated on the tool life. The results showed that cutting speed significantly affected the machined flank wears values. With increasing cutting speed, the flank wear values decreased. The experimental results showed that significant flank wear was the major and predominant failure mode affecting the tool life.
Effect of 5'-flanking sequence deletions on expression of the human insulin gene in transgenic mice
DEFF Research Database (Denmark)
Fromont-Racine, M; Bucchini, D; Madsen, O
1990-01-01
Expression of the human insulin gene was examined in transgenic mouse lines carrying the gene with various lengths of DNA sequences 5' to the transcription start site (+1). Expression of the transgene was demonstrated by 1) the presence of human C-peptide in urine, 2) the presence of specific...... of the transgene was observed in cell types other than beta-islet cells....
Sediment transport along the Cap de Creus Canyon flank during a mild, wet winter
Directory of Open Access Journals (Sweden)
J. Martín
2013-05-01
Full Text Available Cap de Creus Canyon (CCC is known as a preferential conduit for particulate matter leaving the Gulf of Lion continental shelf towards the slope and the basin, particularly in winter when storms and dense shelf water cascading coalesce to enhance the seaward export of shelf waters. During the CASCADE (CAscading, Storm, Convection, Advection and Downwelling Events cruise in March 2011, deployments of recording instruments within the canyon and vertical profiling of the water column properties were conducted to study with high spatial-temporal resolution the impact of such processes on particulate matter fluxes. In the context of the mild and wet 2010–2011 winter, no remarkable dense shelf water formation was observed. On the other hand, the experimental setup allowed for the study of the impact of E-SE storms on the hydrographical structure and the particulate matter fluxes in the CCC. The most remarkable feature in terms of sediment transport was a period of dominant E-SE winds from 12 to 16 March, including two moderate storms (maximum significant wave heights = 4.1–4.6 m. During this period, a plume of freshened, relatively cold and turbid water flowed at high speeds along the southern flank of the CCC in an approximate depth range of 150–350 m. The density of this water mass was lighter than the ambient water in the canyon, indicating that it did not cascade off-shelf and that it merely downwelled into the canyon forced by the strong cyclonic circulation induced over the shelf during the storms and by the subsequent accumulation of seawater along the coast. Suspended sediment load in this turbid intrusion recorded along the southern canyon flank oscillated between 10 and 50 mg L−1, and maximum currents speeds reached values up to 90 cm s−1. A rough estimation of 105 tons of sediment was transported through the canyon along its southern wall during a 3-day-long period of storm-induced downwelling. Following the veering of the wind
A murC gene from coryneform bacteria.
Wachi, M; Wijayarathna, C D; Teraoka, H; Nagai, K
1999-02-01
The upstream flanking region of the ftsQ and ftsZ genes of Brevibacterium flavum MJ233, which belongs to the coryneform bacteria, was amplified by the inverse polymerase chain reaction method and cloned in Escherichia coli. Complementation analysis of E. coli mutant with a defective cell-wall synthesis mechanism with the cloned fragment and its DNA sequencing indicated the presence of the murC gene, encoding UDP-N-acetylmuramate:L-alanine ligase involved in peptidoglycan synthesis, just upstream from the ftsQ gene. The B. flavum murC gene could encode a protein of 486 amino acid residues with a calculated molecular mass of 51 198 Da. A 50-kDa protein was synthesized by the B. flavum murC gene in an in vitro transcription/translation system using E. coli S30 lysate. These results indicate that the genes responsible for cell-wall synthesis and cell division are located as a cluster in B. flavum similar to the E. coli mra region.
Flanking signal and mature peptide residues influence signal peptide cleavage
Directory of Open Access Journals (Sweden)
Ranganathan Shoba
2008-12-01
Full Text Available Abstract Background Signal peptides (SPs mediate the targeting of secretory precursor proteins to the correct subcellular compartments in prokaryotes and eukaryotes. Identifying these transient peptides is crucial to the medical, food and beverage and biotechnology industries yet our understanding of these peptides remains limited. This paper examines the most common type of signal peptides cleavable by the endoprotease signal peptidase I (SPase I, and the residues flanking the cleavage sites of three groups of signal peptide sequences, namely (i eukaryotes (Euk (ii Gram-positive (Gram+ bacteria, and (iii Gram-negative (Gram- bacteria. Results In this study, 2352 secretory peptide sequences from a variety of organisms with amino-terminal SPs are extracted from the manually curated SPdb database for analysis based on physicochemical properties such as pI, aliphatic index, GRAVY score, hydrophobicity, net charge and position-specific residue preferences. Our findings show that the three groups share several similarities in general, but they display distinctive features upon examination in terms of their amino acid compositions and frequencies, and various physico-chemical properties. Thus, analysis or prediction of their sequences should be separated and treated as distinct groups. Conclusion We conclude that the peptide segment recognized by SPase I extends to the start of the mature protein to a limited extent, upon our survey of the amino acid residues surrounding the cleavage processing site. These flanking residues possibly influence the cleavage processing and contribute to non-canonical cleavage sites. Our findings are applicable in defining more accurate prediction tools for recognition and identification of cleavage site of SPs.
International Nuclear Information System (INIS)
Breslow, Norman E.; Beckwith, J. Bruce; Haase, Gerald M.; Kalapurakal, John A.; Ritchey, Michael L.; Shamberger, Robert C.; Thomas, Patrick; D'Angio, Giulio J.; Green, Daniel M.
2006-01-01
Purpose: To determine whether radiation therapy (RT) of patients with Wilms tumor of favorable histology prevented flank recurrence and thereby improved the survival outcomes. Methods and Materials: Recurrence and mortality risks were compared among groups of patients with Stage I-IV/favorable histology Wilms tumor enrolled in the third (n = 1,640) and fourth (n = 2,066) National Wilms Tumor Study Group studies. Results: Proportions of patients with flank recurrence were 0 of 513 = 0.0% for 20 Gy, 12 of 805 = 1.5% for 10 Gy, and 44 of 2,388 = 1.8% for no flank RT (p trend 0.001 adjusted for stage and doxorubicin); for intra-abdominal (including flank) recurrence they were 5 of 513 = 1.0%, 30 of 805 = 3.7%, and 58 of 2,388 = 2.4%, respectively (p trend = 0.02 adjusted). Survival percentages at 8 years after intra-abdominal recurrence were 0 of 5 = 0% for 20 Gy, 10 of 30 = 33% for 10 Gy, and 34 of 58 = 56% for no RT (p trend = 0.0001). NWTS-4 discontinued use of 20 Gy RT, and the 8-year flank recurrence risk increased to 2.1% from 1.0% on NWTS-3 (p = 0.013). However, event-free survival was unaltered (88% vs. 86%, p = 0.39), and overall survival was better (93.8% vs. 90.8%, p = 0.036) on NWTS-4. Conclusions: Partly because of lower postrecurrence mortality among nonirradiated patients, prevention of flank recurrence by RT did not improve survival. It is important to evaluate entire treatment policies with regard to long-term outcomes
Childhood problem behavior and parental divorce: evidence for gene-environment interaction.
Robbers, Sylvana; van Oort, Floor; Huizink, Anja; Verhulst, Frank; van Beijsterveldt, Catharina; Boomsma, Dorret; Bartels, Meike
2012-10-01
The importance of genetic and environmental influences on children's behavioral and emotional problems may vary as a function of environmental exposure. We previously reported that 12-year-olds with divorced parents showed more internalizing and externalizing problems than children with married parents, and that externalizing problems in girls precede and predict later parental divorce. The aim of the current study was to investigate as to whether genetic and environmental influences on internalizing and externalizing problems were different for children from divorced versus non-divorced families. Maternal ratings on internalizing and externalizing problems were collected with the Child Behavior Checklist in 4,592 twin pairs at ages 3 and 12 years, of whom 367 pairs had experienced a parental divorce between these ages. Variance in internalizing and externalizing problems at ages 3 and 12 was analyzed with biometric models in which additive genetic and environmental effects were allowed to depend on parental divorce and sex. A difference in the contribution of genetic and environmental influences between divorced and non-divorced groups would constitute evidence for gene-environment interaction. For both pre- and post-divorce internalizing and externalizing problems, the total variances were larger for children from divorced families, which was mainly due to higher environmental variances. As a consequence, heritabilities were lower for children from divorced families, and the relative contributions of environmental influences were higher. Environmental influences become more important in explaining variation in children's problem behaviors in the context of parental divorce.
Spradling, A C; Stern, D M; Kiss, I; Roote, J; Laverty, T; Rubin, G M
1995-01-01
Biologists require genetic as well as molecular tools to decipher genomic information and ultimately to understand gene function. The Berkeley Drosophila Genome Project is addressing these needs with a massive gene disruption project that uses individual, genetically engineered P transposable elements to target open reading frames throughout the Drosophila genome. DNA flanking the insertions is sequenced, thereby placing an extensive series of genetic markers on the physical genomic map and a...
Cloning and sequence of the human adrenodoxin reductase gene
International Nuclear Information System (INIS)
Lin, Dong; Shi, Y.; Miller, W.L.
1990-01-01
Adrenodoxin reductase is a flavoprotein mediating electron transport to all mitochondrial forms of cytochrome P450. The authors cloned the human adrenodoxin reductase gene and characterized it by restriction endonuclease mapping and DNA sequencing. The entire gene is approximately 12 kilobases long and consists of 12 exons. The first exon encodes the first 26 of the 32 amino acids of the signal peptide, and the second exon encodes the remainder of signal peptide and the apparent FAD binding site. The remaining 10 exons are clustered in a region of only 4.3 kilobases, separated from the first two exons by a large intron of about 5.6 kilobases. Two forms of human adrenodoxin reductase mRNA, differing by the presence or absence of 18 bases in the middle of the sequence, arise from alternate splicing at the 5' end of exon 7. This alternately spliced region is directly adjacent to the NADPH binding site, which is entirely contained in exon 6. The immediate 5' flanking region lacks TATA and CAAT boxes; however, this region is rich in G+C and contains six copies of the sequence GGGCGGG, resembling promoter sequences of housekeeping genes. RNase protection experiments show that transcription is initiated from multiple sites in the 5' flanking region, located about 21-91 base pairs upstream from the AUG translational initiation codon
Ndika, Joseph D T; Lusink, Vera; Beaubrun, Claudine; Kanhai, Warsha; Martinez-Munoz, Cristina; Jakobs, Cornelis; Salomons, Gajja S
2014-01-10
Interconversion between phosphocreatine and creatine, catalyzed by creatine kinase is crucial in the supply of ATP to tissues with high energy demand. Creatine's importance has been established by its use as an ergogenic aid in sport, as well as the development of intellectual disability in patients with congenital creatine deficiency. Creatine biosynthesis is complemented by dietary creatine uptake. Intracellular transport of creatine is carried out by a creatine transporter protein (CT1/CRT/CRTR) encoded by the SLC6A8 gene. Most tissues express this gene, with highest levels detected in skeletal muscle and kidney. There are lower levels of the gene detected in colon, brain, heart, testis and prostate. The mechanism(s) by which this regulation occurs is still poorly understood. A duplicated unprocessed pseudogene of SLC6A8-SLC6A10P has been mapped to chromosome 16p11.2 (contains the entire SLC6A8 gene, plus 2293 bp of 5'flanking sequence and its entire 3'UTR). Expression of SLC6A10P has so far only been shown in human testis and brain. It is still unclear as to what is the function of SLC6A10P. In a patient with autism, a chromosomal breakpoint that intersects the 5'flanking region of SLC6A10P was identified; suggesting that SLC6A10P is a non-coding RNA involved in autism. Our aim was to investigate the presence of cis-acting factor(s) that regulate expression of the creatine transporter, as well as to determine if these factors are functionally conserved upstream of the creatine transporter pseudogene. Via gene-specific PCR, cloning and functional luciferase assays we identified a 1104 bp sequence proximal to the mRNA start site of the SLC6A8 gene with promoter activity in five cell types. The corresponding 5'flanking sequence (1050 bp) on the pseudogene also had promoter activity in all 5 cell lines. Surprisingly the pseudogene promoter was stronger than that of its parent gene in 4 of the cell lines tested. To the best of our knowledge, this is the first
Directory of Open Access Journals (Sweden)
Syahrul Azwan Sundi
2017-01-01
Full Text Available This paper is a study on full flute (extra-long tool and ground shank end mill wear analysis by utilizing five-axis CNC to implement flank milling strategy on curved shape part. Five-axis machining eases the user to implement variations of strategy such as flank milling. Flank milling is different from point milling. Point milling cuts materials by using the tip of the tool whereas the flank milling uses the cutting tool body to cut material. The type of cutting tool used was end mill 10 mm diameter with High Speed Steel (HSS material. One factor at a time was utilized to analyze the overall data. Feed rate and spindle speed were the two main factors that been set up equally for both full flute and ground shank end mill. At the end of this research, the qualitative analysis based on tool wear between full flute and ground shank end mill is observed. Generally, both types of cutting tools showed almost the same failure indication such as broken edge or chipped off edge, formation of pinned hole on the surface and serration formation or built-up edge (BUE on the primary flute. However, the results obtained from the enlarged images which were captured by Optical Microscope indicated that, the ground shank end mill is better than the full flute end mill.
National Research Council Canada - National Science Library
Werner, Sandra
1999-01-01
The thesis investigates the circulation at a 75-meter deep study site on the southern flank of Georges Bank, a shallow submarine bank located between the deeper Gulf of Maine and the continental slope...
Le Gal, V.; Lucazeau, F.; Cannat, M.; Poort, J.; Monnin, C.; Battani, A.; Fontaine, F.; Goutorbe, B.; Rolandone, F.; Poitou, C.; Blanc-Valleron, M.-M.; Piedade, A.; Hipólito, A.
2018-01-01
Hydrothermal circulation affects heat and mass transfers in the oceanic lithosphere, not only at the ridge axis but also on their flanks, where the magnitude of this process has been related to sediment blanket and seamounts density. This was documented in several areas of the Pacific Ocean by heat flow measurements and pore water analysis. However, as the morphology of Atlantic and Indian ridge flanks is generally rougher than in the Pacific, these regions of slow and ultra-slow accretion may be affected by hydrothermal processes of different regimes. We carried out a survey of two regions on the eastern and western flanks of the Mid-Atlantic Ridge between Oceanographer and Hayes fracture zones. Two hundred and eight new heat flow measurements were obtained along six seismic profiles, on 5 to 14 Ma old seafloor. Thirty sediment cores (from which porewaters have been extracted) have been collected with a Kullenberg corer equipped with thermistors thus allowing simultaneous heat flow measurement. Most heat flow values are lower than those predicted by purely conductive cooling models, with some local variations and exceptions: heat flow values on the eastern flank of the study area are more variable than on the western flank, where they tend to increase westward as the sedimentary cover in the basins becomes thicker and more continuous. Heat flow is also higher, on average, on the northern sides of both the western and eastern field regions and includes values close to conductive predictions near the Oceanographer Fracture Zone. All the sediment porewaters have a chemical composition similar to that of bottom seawater (no anomaly linked to fluid circulation has been detected). Heat flow values and pore fluid compositions are consistent with fluid circulation in volcanic rocks below the sediment. The short distances between seamounts and short fluid pathways explain that fluids flowing in the basaltic aquifer below the sediment have remained cool and unaltered
Sequencing analysis reveals a unique gene organization in the gyrB region of Mycoplasma hominis
DEFF Research Database (Denmark)
Ladefoged, Søren; Christiansen, Gunna
1994-01-01
of which showed similarity to that which encodes the LicA protein of Haemophilus influenzae. The organization of the genes in the region showed no resemblance to that in the corresponding regions of other bacteria sequenced so far. The gyrA gene was mapped 35 kb downstream from the gyrB gene.......The homolog of the gyrB gene, which has been reported to be present in the vicinity of the initiation site of replication in bacteria, was mapped on the Mycoplasma hominis genome, and the region was subsequently sequenced. Five open reading frames were identified flanking the gyrB gene, one...
Lava-flow hazard on the SE flank of Mt. Etna (Southern Italy)
Crisci, G. M.; Iovine, G.; Di Gregorio, S.; Lupiano, V.
2008-11-01
A method for mapping lava-flow hazard on the SE flank of Mt. Etna (Sicily, Southern Italy) by applying the Cellular Automata model SCIARA -fv is described, together with employed techniques of calibration and validation through a parallel Genetic Algorithm. The study area is partly urbanised; it has repeatedly been affected by lava flows from flank eruptions in historical time, and shows evidence of a dominant SSE-trending fracture system. Moreover, a dormant deep-seated gravitational deformation, associated with a larger volcano-tectonic phenomenon, affects the whole south-eastern flank of the volcano. The Etnean 2001 Mt. Calcarazzi lava-flow event has been selected for model calibration, while validation has been performed by considering the 2002 Linguaglossa and the 1991-93 Valle del Bove events — suitable data for back analysis being available for these recent eruptions. Quantitative evaluation of the simulations, with respect to the real events, has been performed by means of a couple of fitness functions, which consider either the areas affected by the lava flows, or areas and eruption duration. Sensitivity analyses are in progress for thoroughly evaluating the role of parameters, topographic input data, and mesh geometry on model performance; though, preliminary results have already given encouraging responses on model robustness. In order to evaluate lava-flow hazard in the study area, a regular grid of n.340 possible vents, uniformly covering the study area and located at 500 m intervals, has been hypothesised. For each vent, a statistically-significant number of simulations has been planned, by adopting combinations of durations, lava volumes, and effusion-rate functions, selected by considering available volcanological data. Performed simulations have been stored in a GIS environment for successive analyses and map elaboration. Probabilities of activation, empirically based on past behaviour of the volcano, can be assigned to each vent of the grid, by
Cluster Observations of reconnection along the dusk flank of the magnetosphere
Escoubet, C.-Philippe; Grison, Benjamin; Berchem, Jean; Trattner, Karlheinz; Lavraud, Benoit; Pitout, Frederic; Soucek, Jan; Richard, Robert; Laakso, Harri; Masson, Arnaud; Dunlop, Malcolm; Dandouras, Iannis; Reme, Henri; Fazakerley, Andrew; Daly, Patrick
2015-04-01
Magnetic reconnection is generally accepted to be the main process that transfers particles and energy from the solar wind to the magnetosphere. The location of the reconnection site depends on the orientation of the interplanetary magnetic field (IMF) in the solar wind: on the dayside magnetosphere for an IMF southward, on the lobes for an IMF northward and on the flanks for an IMF in the East-West direction. Since most of observations of reconnection events have sampled a limited region of space simultaneously it is still not yet know if the reconnection line is extended over large regions of the magnetosphere or if is patchy and made of many reconnection lines. We report a Cluster crossing on 5 January 2002 near the exterior cusp on the southern dusk side where we observe multiple sources of reconnection/injections. The IMF was mainly azimuthal (IMF-By around -5 nT), the solar wind speed lower than usual around 280 km/s with the density of order 5 cm-3. The four Cluster spacecraft had an elongated configuration near the magnetopause. C4 was the first spacecraft to enter the cusp around 19:52:04 UT, followed by C2 at 19:52:35 UT, C1 at 19:54:24 UT and C3 at 20:13:15 UT. C4 and C1 observed two ion energy dispersions at 20:10 UT and 20:40 UT and C3 at 20:35 UT and 21:15 UT. Using the time of flight technique on the upgoing and downgoing ions, which leads to energy dispersions, we obtain distances of the ion sources between 14 and 20 RE from the spacecraft. The slope of the ion energy dispersions confirmed these distances. Using Tsyganenko model, we find that these sources are located on the dusk flank, past the terminator. The first injection by C3 is seen at approximately the same time as the 2nd injection on C1 but their sources at the magnetopause were separated by more than 7 RE. This would imply that two distinct sources were active at the same time on the dusk flank of the magnetosphere. In addition, a flow reversal was observed at the magnetopause on C4
Problem-Solving Test: Targeted Gene Disruption
Szeberenyi, Jozsef
2008-01-01
Mutational inactivation of a specific gene is the most powerful technique to analyze the biological function of the gene. This approach has been used for a long time in viruses, bacteria, yeast, and fruit fly, but looked quite hopeless in more complex organisms. Targeted inactivation of specific genes (also known as knock-out mutation) in mice is…
Gene expression profiling of the green seed problem in Soybean.
Teixeira, Renake N; Ligterink, Wilco; França-Neto, José de B; Hilhorst, Henk W M; da Silva, Edvaldo A A
2016-02-01
Due to the climate change of the past few decades, some agricultural areas in the world are now experiencing new climatic extremes. For soybean, high temperatures and drought stress can potentially lead to the "green seed problem", which is characterized by chlorophyll retention in mature seeds and is associated with lower oil and seed quality, thus negatively impacting the production of soybean seeds. Here we show that heat and drought stress result in a "mild" stay-green phenotype and impaired expression of the STAY-GREEN 1 and STAY-GREEN 2 (D1, D2), PHEOPHORBIDASE 2 (PPH2) and NON-YELLOW COLORING 1 (NYC1_1) genes in soybean seeds of a susceptible soybean cultivar. We suggest that the higher expression of these genes in fully mature seeds of a tolerant cultivar allows these seeds to cope with stressful conditions and complete chlorophyll degradation. The gene expression results obtained in this study represent a significant advance in understanding chlorophyll retention in mature soybean seeds produced under stressful conditions. This will open new research possibilities towards finding molecular markers for breeding programs to produce cultivars which are less susceptible to chlorophyll retention under the hot and dry climate conditions which are increasingly common in the largest soybean production areas of the world.
Grove, J R; Deutsch, P J; Price, D J; Habener, J F; Avruch, J
1989-11-25
Plasmids that encode a bioactive amino-terminal fragment of the heat-stable inhibitor of the cAMP-dependent protein kinase, PKI(1-31), were employed to characterize the role of this protein kinase in the control of transcriptional activity mediated by three DNA regulatory elements in the JEG-3 human placental cell line. The 5'-flanking sequence of the human collagenase gene contains the heptameric sequence, 5'-TGAGTCA-3', previously identified as a "phorbol ester" response element. Reporter genes containing either the intact 1.2-kilobase 5'-flanking sequence from the human collagenase gene or just the 7-base pair (bp) response element, when coupled to an enhancerless promoter, each exhibit both cAMP and phorbol ester-stimulated expression in JEG-3 cells. Cotransfection of either construct with plasmids encoding PKI(1-31) inhibits cAMP-stimulated but not basal- or phorbol ester-stimulated expression. Pretreatment of cells with phorbol ester for 1 or 2 days abrogates completely the response to rechallenge with phorbol ester but does not alter the basal expression of either construct; cAMP-stimulated expression, while modestly inhibited, remains vigorous. The 5'-flanking sequence of the human chorionic gonadotropin-alpha subunit (HCG alpha) gene has two copies of the sequence, 5'-TGACGTCA-3', contained in directly adjacent identical 18-bp segments, previously identified as a cAMP-response element. Reporter genes containing either the intact 1.5 kilobase of 5'-flanking sequence from the HCG alpha gene, or just the 36-bp tandem repeat cAMP response element, when coupled to an enhancerless promoter, both exhibit a vigorous cAMP stimulation of expression but no response to phorbol ester in JEG-3 cells. Cotransfection with plasmids encoding PKI(1-31) inhibits both basal and cAMP-stimulated expression in a parallel fashion. The 5'-flanking sequence of the human enkephalin gene mediates cAMP-stimulated expression of reporter genes in both JEG-3 and CV-1 cells. Plasmids
International Nuclear Information System (INIS)
Van Zonneveld, A.J.; Curriden, S.A.; Loskutoff, D.J.
1988-01-01
Plasminogen activator inhibitor type 1 is an important component of the fibrinolytic system and its biosynthesis is subject to complex regulation. To study this regulation at the level of transcription, the authors have identified and sequenced the promoter of the human plasminogen activator inhibitor type 1 gene. Nuclease protection experiments were performed by using endothelial cell mRNA and the transcription initiation (cap) site was established. Sequence analysis of the 5' flanking region of the gene revealed a perfect TATA box at position -28 to position -23, the conserved distance from the cap site. Comparative functional studies with the firefly luciferase gene as a reporter gene showed that fragments derived from this 5' flanking region exhibited high promoter activity when transfected into bovine aortic endothelial cells and mouse Ltk - fibroblasts but were inactive when introduced into HeLa cells. These studies indicate that the fragments contain the plasminogen activator inhibitor type 1 promoter and that it is expressed in a tissue-specific manner. Although the fragments were also silent in rat FTO2B hepatoma cells, their promoter activity could be induced up to 40-fold with the synthetic glucocorticoid dexamethasone. Promoter deletion mapping experiments and studies involving the fusion of promoter fragments to a heterologous gene indicated that dexamethasone induction is mediated by a glucocorticoid responsive element with enhancer-like properties located within the region between nucleotides -305 and +75 of the plasminogen activator inhibitor type 1 gene
Divergence of gene body DNA methylation and evolution of plant duplicate genes.
Directory of Open Access Journals (Sweden)
Jun Wang
Full Text Available It has been shown that gene body DNA methylation is associated with gene expression. However, whether and how deviation of gene body DNA methylation between duplicate genes can influence their divergence remains largely unexplored. Here, we aim to elucidate the potential role of gene body DNA methylation in the fate of duplicate genes. We identified paralogous gene pairs from Arabidopsis and rice (Oryza sativa ssp. japonica genomes and reprocessed their single-base resolution methylome data. We show that methylation in paralogous genes nonlinearly correlates with several gene properties including exon number/gene length, expression level and mutation rate. Further, we demonstrated that divergence of methylation level and pattern in paralogs indeed positively correlate with their sequence and expression divergences. This result held even after controlling for other confounding factors known to influence the divergence of paralogs. We observed that methylation level divergence might be more relevant to the expression divergence of paralogs than methylation pattern divergence. Finally, we explored the mechanisms that might give rise to the divergence of gene body methylation in paralogs. We found that exonic methylation divergence more closely correlates with expression divergence than intronic methylation divergence. We show that genomic environments (e.g., flanked by transposable elements and repetitive sequences of paralogs generated by various duplication mechanisms are associated with the methylation divergence of paralogs. Overall, our results suggest that the changes in gene body DNA methylation could provide another avenue for duplicate genes to develop differential expression patterns and undergo different evolutionary fates in plant genomes.
Soil radon monitoring in the NE flank of Mt. Etna (Sicily)
International Nuclear Information System (INIS)
Imme, G.; La Delfa, S.; Lo Nigro, S.; Morelli, D.; Patane, G.
2006-01-01
Soil radon has been monitored at a fixed location on the northeastern flank of Mt. Etna, a high-risk volcano in Sicily. The aim of this study was to evaluate the effects of the recent volcanic activity on soil radon concentration. Continuous radon measurements have been performed since July 2001. While comparison between the trend in in-soil radon concentration and the acquired meteorological series (temperature, humidity and pressure) appear to confirm a general seasonal correlation, nevertheless particular anomalies suggest a possible dependence of the radon concentration on volcanic dynamics
Directory of Open Access Journals (Sweden)
M. F. Ulum
2014-12-01
Full Text Available The aim of this study was to describe the sonographic appearance of abdominal wall at the left flank of laparotomy incision site in 11 mated Ettawah grade does. Brightness-mode ultrasound examination by using transducer with frequency of 5.0-6.0 MHz was conducted to grouping the does based on their pregnancy statuses. The incision site of the abdominal wall at left flank laparotomy was transcutaneous-scanned as long as 8 cm vertically. The sonographic appearance of the laparotomy wall thickness showed that in all groups of does were similar and not different statistically. The thickness of oblique external and oblique internal abdominal muscles increased in the pregnant does as compared to non-pregnant does (P<0.05.
Mutations of the Norrie gene in Korean ROP infants.
Kim, Jeong Hun; Yu, Young Suk; Kim, Jiyeon; Park, Seong Sup
2002-12-01
The present study was conducted to evaluate if there is a Norrie disease gene (ND gene) mutation involved in the retinopathy of prematurity (ROP), and to identify the possibility of a genetic abnormality that may be linked to the presence of ROP. Nineteen premature Korean infants, with a low birth weight (1500 g or less) or low gestational age (32 weeks or less), were included in the study. Eighteen infants had ROP, and the other did not. Genomic DNA was isolated from the peripheral blood leukocytes of these patients, and all three exons and their flanking areas, all known ND gene mutations regions, were evaluated following amplification by a polymerase chain reaction, but no ND gene mutations were detected. Any disagreement between the relationship of ROP to the ND gene mutation will need to be clarified by further investigation.
A multicolor panel of novel lentiviral "gene ontology" (LeGO) vectors for functional gene analysis.
Weber, Kristoffer; Bartsch, Udo; Stocking, Carol; Fehse, Boris
2008-04-01
Functional gene analysis requires the possibility of overexpression, as well as downregulation of one, or ideally several, potentially interacting genes. Lentiviral vectors are well suited for this purpose as they ensure stable expression of complementary DNAs (cDNAs), as well as short-hairpin RNAs (shRNAs), and can efficiently transduce a wide spectrum of cell targets when packaged within the coat proteins of other viruses. Here we introduce a multicolor panel of novel lentiviral "gene ontology" (LeGO) vectors designed according to the "building blocks" principle. Using a wide spectrum of different fluorescent markers, including drug-selectable enhanced green fluorescent protein (eGFP)- and dTomato-blasticidin-S resistance fusion proteins, LeGO vectors allow simultaneous analysis of multiple genes and shRNAs of interest within single, easily identifiable cells. Furthermore, each functional module is flanked by unique cloning sites, ensuring flexibility and individual optimization. The efficacy of these vectors for analyzing multiple genes in a single cell was demonstrated in several different cell types, including hematopoietic, endothelial, and neural stem and progenitor cells, as well as hepatocytes. LeGO vectors thus represent a valuable tool for investigating gene networks using conditional ectopic expression and knock-down approaches simultaneously.
Population SAMC vs SAMC: Convergence and Applications to Gene Selection Problems
Faming Liang, Mingqi Wu
2013-01-01
The Bayesian model selection approach has been adopted by more and more people when analyzing a large data. However, it is known that the reversible jump MCMC (RJMCMC) algorithm, which is perhaps the most popular MCMC algorithm for Bayesian model selection, is prone to get trapped into local modes when the model space is complex. The stochastic approximation Monte Carlo (SAMC) algorithm essentially overcomes the local trap problem suffered by conventional MCMC algorithms by introducing a self-adjusting mechanism based on the past samples. In this paper, we propose a population SAMC (Pop-SAMC) algorithm, which works on a population of SAMC chains and can make use of crossover operators from genetic algorithms to further improve its efficiency. Under mild conditions, we show the convergence of this algorithm. Comparing to the single chain SAMC algorithm, Pop-SAMC provides a more efficient self-adjusting mechanism and thus can converge faster. The effectiveness of Pop-SAMC for Bayesian model selection problems is examined through a change-point identification problem and a gene selection problem. The numerical results indicate that Pop-SAMC significantly outperforms both the single chain SAMC and RJMCMC.
Position-independent high level expression of the human β-globin gene in transgenic mice.
F.G. Grosveld (Frank); G. Blom van Assendelft (Greet); D.R. Greaves (David); G. Kollias (George)
1987-01-01
textabstractWe have constructed a "minilocus" that contains the 5' and 3' flanking regions of the human beta-globin locus and the beta-globin gene. These regions are characterized by erythroid-specific DNAase I-superhypersensitive sites and are normally located approximately 50 kb 5' and 20 kb 3' of
The Norrie disease gene maps to a 150 kb region on chromosome Xp11.3.
Sims, K B; Lebo, R V; Benson, G; Shalish, C; Schuback, D; Chen, Z Y; Bruns, G; Craig, I W; Golbus, M S; Breakefield, X O
1992-05-01
Norrie disease is a human X-linked recessive disorder of unknown etiology characterized by congenital blindness, sensory neural deafness and mental retardation. This disease gene was previously linked to the DXS7 (L1.28) locus and the MAO genes in band Xp11.3. We report here fine physical mapping of the obligate region containing the Norrie disease gene (NDP) defined by a recombination and by the smallest submicroscopic chromosomal deletion associated with Norrie disease identified to date. Analysis, using in addition two overlapping YAC clones from this region, allowed orientation of the MAOA and MAOB genes in a 5'-3'-3'-5' configuration. A recombination event between a (GT)n polymorphism in intron 2 of the MAOB gene and the NDP locus, in a family previously reported to have a recombination between DXS7 and NDP, delineates a flanking marker telomeric to this disease gene. An anonymous DNA probe, dc12, present in one of the YACs and in a patient with a submicroscopic deletion which includes MAOA and MAOB but not L1.28, serves as a flanking marker centromeric to the disease gene. An Alu-PCR fragment from the right arm of the MAO YAC (YMAO.AluR) is not deleted in this patient and also delineates the centromeric extent of the obligate disease region. The apparent order of these loci is telomere ... DXS7-MAOA-MAOB-NDP-dc12-YMAO.AluR ... centromere. Together these data define the obligate region containing the NDP gene to a chromosomal segment less than 150 kb.
Weathers, T. S.; Fisher, A. T.; Winslow, D. M.; Stauffer, P. H.; Gable, C. W.
2017-12-01
The flanks of mid-ocean ridges experience coupled flows of fluid, heat, and solutes that are critical for a wide range of global processes, including the cycling of carbon and nutrients, which supports a vast crustal biosphere. Only a few ridge-flank sites have been studied in detail; hydrogeologic conditions and processes in the volcanic crust are best understood on the eastern flank of the Juan de Fuca Ridge. This area has been extensively explored with decades of drilling, submersible, observatory, and survey expeditions and experiments, including the first hole-to-hole tracer injection experiment in the ocean crust. This study describes the development of reactive transport simulations for this ridge-flank setting using three-dimensional coupled (thermal-hydrological) models of crustal-scale circulation, beginning with the exploration of tracer transport. The prevailing flow direction is roughly south to north as a result of outcrop-to-outcrop flow, with a bulk flow rate in the range of meters/year. However, tracer was detected 500 m south ("upstream") from the injection borehole during the first year following injection. This may be explained by local mixing and/or formation fluid discharge from the southern borehole during and after injection. The constraints and parameters required to fit the observed tracer behavior can be used as a basis for modeling reactive transport processes such as nutrient delivery or microbial community evolution as a function of fluid flow. For example, the sulfate concentration in fluid samples from Baby Bare outcrop ( 8 km south of the tracer transport experiment) was 17.8 mmol/kg, whereas at Mama Bare outcrop ( 8 km to north of the tracer transport experiment) the sulfate concentration was 16.3 mmol/mg. By integrating laboratory-derived sulfate reduction rates from microbial samples originating from Juan de Fuca borehole observatories into reactive transport models, we can explore the range of microbial activity that supports
Directory of Open Access Journals (Sweden)
Wu Yu-Ren
2016-01-01
Full Text Available In this paper, a novel longitudinal tooth flank crowning method is proposed by setting the crossed angle between the hob cutter and work gear as a linear function of hob’s traverse feed movement in the gear hobbing process. However, this method makes twisted tooth flanks on the hobbed work gear. Therefore, a variable pressure angle hob cutter is applied to obtain an anti-twist tooth flank of hobbed work gear. A computer simulation example is performed to verify the superiority of the proposed novel hobbing method by comparing topographies of the crowned work gear surfaces hobbed by a standard hob cutter and a variable pressure angle hob cutter.
HOXA genes cluster: clinical implications of the smallest deletion
Pezzani, Lidia; Milani, Donatella; Manzoni, Francesca; Baccarin, Marco; Silipigni, Rosamaria; Guerneri, Silvana; Esposito, Susanna
2015-01-01
Background HOXA genes cluster plays a fundamental role in embryologic development. Deletion of the entire cluster is known to cause a clinically recognizable syndrome with mild developmental delay, characteristic facies, small feet with unusually short and big halluces, abnormal thumbs, and urogenital malformations. The clinical manifestations may vary with different ranges of deletions of HOXA cluster and flanking regions. Case presentation We report a girl with the smallest deletion reporte...
Pore Pressure Distribution and Flank Instability in Hydrothermally Altered Stratovolcanoes
Ball, J. L.; Taron, J.; Hurwitz, S.; Reid, M. E.
2015-12-01
Field and geophysical investigations of stratovolcanoes with long-lived hydrothermal systems commonly reveal that initially permeable regions (such as brecciated layers of pyroclastic material) can become both altered and water-bearing. Hydrothermal alteration in these regions, including clay formation, can turn them into low-permeability barriers to fluid flow, which could increase pore fluid pressures resulting in flank slope instability. We examined elevated pore pressure conditions using numerical models of hydrothermal flow in stratovolcanoes, informed by geophysical data about internal structures and deposits. Idealized radially symmetric meshes were developed based on cross-sectional profiles and alteration/permeability structures of Cascade Range stratovolcanoes. We used the OpenGeoSys model to simulate variably saturated conditions in volcanoes heated only by regional heat fluxes, as well as 650°C intrusions at two km depth below the surface. Meteoric recharge was estimated from precipitation rates in the Cascade Range. Preliminary results indicate zones of elevated pore pressures form: 1) where slopes are underlain by continuous low-permeability altered layers, or 2) when the edifice has an altered core with saturated, less permeable limbs. The first scenario might control shallow collapses on the slopes above the altered layers. The second could promote deeper flank collapses that are initially limited to the summit and upper slopes, but could progress to the core of an edifice. In both scenarios, pore pressures can be further elevated by shallow intrusions, or evolve over longer time scales under forcing from regional heat flux. Geometries without confining low-permeability layers do not show these pressure effects. Our initial scenarios use radially symmetric models, but we are also simulating hydrothermal flow under real 3D geometries with asymmetric subsurface structures (Mount Adams). Simulation results will be used to inform 3D slope
Cluster observations of surface waves on the dawn flank magnetopause
Directory of Open Access Journals (Sweden)
C. J. Owen
2004-03-01
Full Text Available On 14 June 2001 the four Cluster spacecraft recorded multiple encounters of the dawn-side flank magnetopause. The characteristics of the observed electron populations varied between a cold, dense magnetosheath population and warmer, more rarified boundary layer population on a quasi-periodic basis. The demarcation between these two populations can be readily identified by gradients in the scalar temperature of the electrons. An analysis of the differences in the observed timings of the boundary at each spacecraft indicates that these magnetopause crossings are consistent with a surface wave moving across the flank magnetopause. When compared to the orientation of the magnetopause expected from models, we find that the leading edges of these waves are approximately 45° steeper than the trailing edges, consistent with the Kelvin-Helmholtz (KH driving mechanism. A stability analysis of this interval suggests that the magnetopause is marginally stable to this mechanism during this event. Periods in which the analysis predicts that the magnetopause is unstable correspond to observations of greater wave steepening. Analysis of the pulses suggests that the waves have an average wavelength of approximately 3.4 RE and move at an average speed of ~65km s-1 in an anti-sunward and northward direction, despite the spacecraft location somewhat south of the GSE Z=0 plane. This wave propagation direction lies close to perpendicular to the average magnetic field direction in the external magnetosheath, suggesting that these waves may preferentially propagate in the direction that requires no bending of these external field lines
Key words. Magnetospheric physics (magnetospheric configuration and dynamics; MHD waves and unstabilities; solar wind-magnetosphere interactions
DEFF Research Database (Denmark)
Wadskov-Hansen, Steen Lüders; Martinussen, Jan; Hammer, Karin
2000-01-01
establishing the ability of the encoded protein to synthesize UDP. The pyrH gene in L. lactis is flanked downstream by frr1 encoding ribosomal recycling factor 1 and upstream by an open reading frame, orfA, of unknown function. The three genes were shown to constitute an operon transcribed in the direction orf......A-pyrH-frr1 from a promoter immediately in front of orfA. This operon belongs to an evolutionary highly conserved gene cluster, since the organization of pyrH on the chromosomal level in L. lactis shows a high resemblance to that found in Bacillus subtilis as well as in Escherichia coli and several other...
Beauparlant, Marc A; Drouin, Guy
2014-02-01
Analyses of the 5S rRNA genes found in the spliced-leader (SL) gene repeat units of numerous trypanosome species suggest that such linkages were not inherited from a common ancestor, but were the result of independent 5S rRNA gene insertions. In trypanosomes, 5S rRNA genes are found either in the tandemly repeated units coding for SL genes or in independent tandemly repeated units. Given that trypanosome species where 5S rRNA genes are within the tandemly repeated units coding for SL genes are phylogenetically related, one might hypothesize that this arrangement is the result of an ancestral insertion of 5S rRNA genes into the tandemly repeated SL gene family of trypanosomes. Here, we use the types of 5S rRNA genes found associated with SL genes, the flanking regions of the inserted 5S rRNA genes and the position of these insertions to show that most of the 5S rRNA genes found within SL gene repeat units of trypanosome species were not acquired from a common ancestor but are the results of independent insertions. These multiple 5S rRNA genes insertion events in trypanosomes are likely the result of frequent founder events in different hosts and/or geographical locations in species having short generation times.
Qi, L L; Long, Y M; Jan, C C; Ma, G J; Gulya, T J
2015-04-01
Pl 17, a novel downy mildew resistance gene independent of known downy mildew resistance genes in sunflowers, was genetically mapped to linkage group 4 of the sunflower genome. Downy mildew (DM), caused by Plasmopara halstedii (Farl.). Berl. et de Toni, is one of the serious sunflower diseases in the world due to its high virulence and the variability of the pathogen. DM resistance in the USDA inbred line, HA 458, has been shown to be effective against all virulent races of P. halstedii currently identified in the USA. To determine the chromosomal location of this resistance, 186 F 2:3 families derived from a cross of HA 458 with HA 234 were phenotyped for their resistance to race 734 of P. halstedii. The segregation ratio of the population supported that the resistance was controlled by a single dominant gene, Pl 17. Simple sequence repeat (SSR) and single nucleotide polymorphism (SNP) primers were used to identify molecular markers linked to Pl 17. Bulked segregant analysis using 849 SSR markers located Pl 17 to linkage group (LG) 4, which is the first DM gene discovered in this linkage group. An F2 population of 186 individuals was screened with polymorphic SSR and SNP primers from LG4. Two flanking markers, SNP SFW04052 and SSR ORS963, delineated Pl 17 in an interval of 3.0 cM. The markers linked to Pl 17 were validated in a BC3 population. A search for the physical location of flanking markers in sunflower genome sequences revealed that the Pl 17 region had a recombination frequency of 0.59 Mb/cM, which was a fourfold higher recombination rate relative to the genomic average. This region can be considered amenable to molecular manipulation for further map-based cloning of Pl 17.
Simulation of flanking transmission in super-light structures for airborne and impact sound
DEFF Research Database (Denmark)
Christensen, Jacob Ellehauge; Hertz, Kristian Dahl; Brunskog, Jonas
2012-01-01
. Previously the airborne and impact sound insulation has been measured for a super-light deck element in a laboratory. This paper presents a flanking transmission analysis based on the measured results and are carried out for the Super-light deck elements by means of the acoustical software Bastian...... to design buildings with super-light deck elements while achieving a good acoustical environment in the building, fulfilling various acoustical requirements from the building regulations....
Directory of Open Access Journals (Sweden)
S. Yu. Sokolov
2017-01-01
Full Text Available This article presents the first map showing the vertical amplitudes of modern disjunctive dislocations inNorthern Atlantic, based on the estimated phase shifts of reflected waves recorded by high-frequency seismic acoustic surveys. The amplitude distribution pattern is mosaic with alternating areas of compression and extension in the flanks of the Knipovich rift system. The modern structure of the Knipovich Ridge, including two strike-slip faults, represents a local rift in the pull-apart setting. The asymmetry of stresses and the presence of compression in the ridge flanks is evidenced by the distribution of the focal mechanisms of strong earthquakes related to reverse faults. In the southeastern Knipovich Ridge, tectonic activity is marked by the asymmetric pattern of the epicenters of small earthquakes.
Maltreatment, the Oxytocin Receptor Gene, and Conduct Problems Among Male and Female Teenagers
Directory of Open Access Journals (Sweden)
Dimitrios Andreou
2018-03-01
Full Text Available The oxytocin receptor gene (OXTR influences human behavior. The G allele of OXTR rs53576 has been associated with both prosocial and maladaptive behaviors but few studies have taken account of environmental factors. The present study determined whether the association of childhood maltreatment with conduct problems was modified by OXTR rs53576 genotypes. In a general population sample of 1591 teenagers, conduct problems as well as maltreatment were measured by self-report. DNA was extracted from saliva samples. In males, there was a significant positive association between maltreatment and conduct problems independent of the genotype. In females, among G allele carriers, the level of conduct problems was significantly higher among those who had been maltreated as compared to those not maltreated. By contrast, among female AA carriers, conduct problems did not vary between those who were, and who were not, maltreated. The results indicate that OXTR rs53576 plays a role in antisocial behavior in females such that the G allele confers vulnerability for antisocial behavior if they experience maltreatment, whereas the A allele has a protective effect.
Perreten, Vincent; Boerlin, Patrick
2003-03-01
A new gene, sul3, which specifies a 263-amino-acid protein similar to a dihydropteroate synthase encoded by the 54-kb conjugative plasmid pVP440 from Escherichia coli was characterized. Expression of the cloned sul3 gene conferred resistance to sulfamethoxazole on E. coli. Two copies of the insertion element IS15Delta/26 flanked the region containing sul3. The sul3 gene was detected in one-third of the sulfonamide-resistant pathogenic E. coli isolates from pigs in Switzerland.
Perreten, Vincent; Boerlin, Patrick
2003-01-01
A new gene, sul3, which specifies a 263-amino-acid protein similar to a dihydropteroate synthase encoded by the 54-kb conjugative plasmid pVP440 from Escherichia coli was characterized. Expression of the cloned sul3 gene conferred resistance to sulfamethoxazole on E. coli. Two copies of the insertion element IS15Δ/26 flanked the region containing sul3. The sul3 gene was detected in one-third of the sulfonamide-resistant pathogenic E. coli isolates from pigs in Switzerland.
PRIMARY STRUCTURE OF THE CYTOCHROME P450 LANOSTEROL 14A-DEMETHYLASE GENE FROM CANDIDA TROPICALIS
We report the nucleotide sequence of the gene and flanking DNA for the cytochrome P450 lanosterol 14 alpha-demethylase (14DM) from the yeast Candida tropicalis ATCC750. An open reading frame (ORF) of 528 codons encoding a 60.9-kD protein is identified. This ORF includes a charact...
Determining injuries from posterior and flank stab wounds using computed tomography tractography.
Bansal, Vishal; Reid, Chris M; Fortlage, Dale; Lee, Jeanne; Kobayashi, Leslie; Doucet, Jay; Coimbra, Raul
2014-04-01
Unlike anterior stab wounds (SW), in which local exploration may direct management, posterior SW can be challenging to evaluate. Traditional triple contrast computed tomography (CT) imaging is cumbersome and technician-dependent. The present study examines the role of CT tractography as a strategy to manage select patients with back and flank SW. Hemodynamically stable patients with back and flank SW were studied. After resuscitation, Betadine- or Visipaque®-soaked sterile sponges were inserted into each SW for the estimated depth of the wound. Patients underwent abdominal helical CT scanning, including intravenous contrast, as the sole abdominal imaging study. Images were reviewed by an attending radiologist and trauma surgeon. The tractogram was evaluated to determine SW trajectory and injury to intra- or retroperitoneal organs, vascular structures, the diaphragm, and the urinary tract. Complete patient demographics including operative management and injuries were collected. Forty-one patients underwent CT tractography. In 11 patients, tractography detected violation of the intra- or retroperitoneal cavity leading to operative exploration. Injuries detected included: the spleen (two), colon (one), colonic mesentery (one), kidney (kidney), diaphragm (kidney), pneumothorax (seven), hemothorax (two), iliac artery (one), and traumatic abdominal wall hernia (two). In all patients, none had negative CT findings that failed observation. In this series, CT tractography is a safe and effective imaging strategy to evaluate posterior torso SW. It is unknown whether CT tractography is superior to traditional imaging modalities. Other uses for CT tractography may include determining trajectory from missile wounds and tangential penetrating injuries.
Automatic fitting of conical envelopes to free-form surfaces for flank CNC machining
Bo P.; Bartoň M.; Pottmann H.
2017-01-01
We propose a new algorithm to detect patches of free-form surfaces that can be well approximated by envelopes of a rotational cone under a rigid body motion. These conical envelopes are a preferable choice from the manufacturing point of view as they are, by-definition, manufacturable by computer numerically controlled (CNC) machining using the efficient flank (peripheral) method with standard conical tools. Our geometric approach exploits multi-valued vector fields that consist of vectors in...
Airborne sound insulation evaluation and flanking path prediction of coupled room
Tassia, R. D.; Asmoro, W. A.; Arifianto, D.
2016-11-01
One of the parameters to review the acoustic comfort is based on the value of the insulation partition in the classroom. The insulation value can be expressed by the sound transmission loss which converted into a single value as weighted sound reduction index (Rw, DnTw) and also have an additional sound correction factor in low frequency (C, Ctr) .In this study, the measurements were performed in two positions at each point using BSWA microphone and dodecahedron speaker as the sound source. The results of field measurements indicate the acoustic insulation values (DnT w + C) is 19.6 dB. It is noted that the partition wall not according to the standard which the DnTw + C> 51 dB. Hence the partition wall need to be redesign to improve acoustic insulation in the classroom. The design used gypsum board, plasterboard, cement board, and PVC as the replacement material. Based on the results, all the material is simulated in accordance with established standards. Best insulation is cement board with the insulation value is 69dB, the thickness of 12.5 mm on each side and the absorber material is 50 mm. Many factors lead to increase the value of acoustic insulation, such as the thickness of the panel, the addition of absorber material, density, and Poisson's ratio of a material. The prediction of flanking path can be estimated from noise reduction values at each measurement point in the class room. Based on data obtained, there is no significant change in noise reduction from each point so that the pathway of flanking is not affect the sound transmission in the classroom.
The chromosomal organization of horizontal gene transfer in bacteria.
Oliveira, Pedro H; Touchon, Marie; Cury, Jean; Rocha, Eduardo P C
2017-10-10
Bacterial adaptation is accelerated by the acquisition of novel traits through horizontal gene transfer, but the integration of these genes affects genome organization. We found that transferred genes are concentrated in only ~1% of the chromosomal regions (hotspots) in 80 bacterial species. This concentration increases with genome size and with the rate of transfer. Hotspots diversify by rapid gene turnover; their chromosomal distribution depends on local contexts (neighboring core genes), and content in mobile genetic elements. Hotspots concentrate most changes in gene repertoires, reduce the trade-off between genome diversification and organization, and should be treasure troves of strain-specific adaptive genes. Most mobile genetic elements and antibiotic resistance genes are in hotspots, but many hotspots lack recognizable mobile genetic elements and exhibit frequent homologous recombination at flanking core genes. Overrepresentation of hotspots with fewer mobile genetic elements in naturally transformable bacteria suggests that homologous recombination and horizontal gene transfer are tightly linked in genome evolution.Horizontal gene transfer (HGT) is an important mechanism for genome evolution and adaptation in bacteria. Here, Oliveira and colleagues find HGT hotspots comprising ~ 1% of the chromosomal regions in 80 bacterial species.
Exclusion of RAI2 as the causative gene for Nance-Horan syndrome.
Walpole, S M; Ronce, N; Grayson, C; Dessay, B; Yates, J R; Trump, D; Toutain, A
1999-05-01
Nance-Horan syndrome (NHS) is an X-linked condition characterised by congenital cataracts, microphthalmia and/or microcornea, unusual dental morphology, dysmorphic facial features, and developmental delay in some cases. Recent linkage studies have mapped the NHS disease gene to a 3.5-cM interval on Xp22.2 between DXS1053 and DXS443. We previously identified a human homologue of a mouse retinoic-acid-induced gene (RAI2) within the NHS critical flanking interval and have tested the gene as a candidate for Nance-Horan syndrome in nine NHS-affected families. Direct sequencing of the RAI2 gene and predicted promoter region has revealed no mutations in the families screened; RAI2 is therefore unlikely to be associated with NHS.
Surface waves on the tailward flanks of the Earth's magnetopause
Seon, J.; Frank, L. A.; Lazarus, A. J.; Lepping, R. P.
1995-01-01
Forty-three examples of ISEE 1 tailward flank side magnetopause crossings are examined and directly compared with upstream solar wind parameters. The crossings are classified into two groups. In the first group, a few sudden magnetopause crossings are observed, whereas repeated magnetopause crossings and oscillatory motions, often with boundary layer signatures, are observed in the second group. These distinctive characteristics of the two groups are interpreted in terms of the surface waves due to the Kelvin-Helmholtz instability. It is found that low solar wind speed tends to favor characteristics of the first group, whereas high solar wind speed yields those of the second group. However, no evident correlations between the groups and the interplanetary magnetic field directions are found.
Lipman, P.W.; Coombs, M.L.
2006-01-01
The North Kona slump is an elliptical region, about 20 by 60 km (1000-km2 area), of multiple, geometrically intricate benches and scarps, mostly at water depths of 2000–4500 m, on the west flank of Hualalai Volcano. Two dives up steep scarps in the slump area were made in September 2001, using the ROV Kaiko of the Japan Marine Science and Technology Center (JAMSTEC), as part of a collaborative Japan–USA project to improve understanding of the submarine flanks of Hawaiian volcanoes. Both dives, at water depths of 2700–4000 m, encountered pillow lavas draping the scarp-and-bench slopes. Intact to only slightly broken pillow lobes and cylinders that are downward elongate dominate on the steepest mid-sections of scarps, while more equant and spherical pillow shapes are common near the tops and bases of scarps and locally protrude through cover of muddy sediment on bench flats. Notably absent are subaerially erupted Hualalai lava flows, interbedded hyaloclastite pillow breccia, and/or coastal sandy sediment that might have accumulated downslope from an active coastline. The general structure of the North Kona flank is interpreted as an intricate assemblage of downdropped lenticular blocks, bounded by steeply dipping normal faults. The undisturbed pillow-lava drape indicates that slumping occurred during shield-stage tholeiitic volcanism. All analyzed samples of the pillow-lava drape are tholeiite, similar to published analyses from the submarine northwest rift zone of Hualālai. Relatively low sulfur (330–600 ppm) and water (0.18–0.47 wt.%) contents of glass rinds suggest that the eruptive sources were in shallow water, perhaps 500–1000-m depth. In contrast, saturation pressures calculated from carbon dioxide concentrations (100–190 ppm) indicate deeper equilibration, at or near sample sites at water depths of − 3900 to − 2800 m. Either vents close to the sample sites erupted mixtures of undegassed and degassed magmas, or volatiles were resorbed from
International Nuclear Information System (INIS)
Andrade, S.M. de; Camarco, P.E.N.
1982-01-01
The analyses of the already existent geological data of the northeastern flank of the Parana Basin and the Southwestern flank of the Parnaiba Basin, added to new data from drilling and geological mapping allowed a better knowledge of the stratigraphy of the pre-carboniferous sedimentary sequences (silurian and devonian ages) as well as provided subsidies for the definition of its uranium possibilites. Besides the already known uranium deposits of the Ponta Grossa Formation, is should be considered as worth while of prospecting the Pimenteiras Formation. (Author) [pt
Gene screening in a Chinese family with Marfan syndrome
Directory of Open Access Journals (Sweden)
Wen-Jiao Xia
2016-05-01
Full Text Available AIM:To analyze the causative gene mutation for Marfan syndrome(MFSwith autosomal dominant hereditary in a Chinese family in Liaoning Province,China. METHODS: Venous blood was collected and candidate gene was selected to design primers according to the clinical phenotype. With genomic polymerase chain reaction(PCRperformed, the coding exons and their flanking intron in sequences of candidate gene were sequenced,DNA fragments separated by agarose gel electrophoresis and direct sequencing method was used to determine the pathogenic gene.RESULTS:Phenotype of the proband was presented as ectopic lentis. Sequencing of the coding regions of FBN1 gene showed the presence of a heterozygous A→G transversion at nucleotide 640 in the 7 exon of FBN1 and the missense mutation made for Glycine into Serine(G214S. CONCLUSION:A heterozygous mutation of FBN1 c.A640G(p.G214Sis responsible for the Marfan syndrome in the four generation Chinese pedigree.
Loughlin, N.J.D.; Gosling, W.D.; Coe, A.L.; Gulliver, P.; Mothes, P.; Montoya, E.
2018-01-01
Understanding the impact of landscape-scale disturbance events during the last glacial period is vital in accurately reconstructing the ecosystem dynamics of montane environments. Here, a sedimentary succession from the tropical montane cloud forest of the eastern Andean flank of Ecuador provides
Energy Technology Data Exchange (ETDEWEB)
Owerbach, D.; Gabbay, K.H. (Baylor College of Medicine, Houston, TX (United States))
1994-05-01
Ninety-six multiplex type I diabetic families were typed at the 5' flanking region of the insulin gene by using a PCR assay that better resolves the VNTR into multiple alleles. Affected sibling pairs shared 2, 1, and 0 VNTR alleles - identical by descent - at a frequency of .47, .45, and .08, respectively, a ratio that deviated from the expected 1:2:1 ratio (P<.001). These results confirm linkage of the chromosome 11p15.5 region with type I diabetes mellitus susceptibility. 20 refs., 2 tabs.
Epidermal growth factor gene is a newly identified candidate gene for gout.
Han, Lin; Cao, Chunwei; Jia, Zhaotong; Liu, Shiguo; Liu, Zhen; Xin, Ruosai; Wang, Can; Li, Xinde; Ren, Wei; Wang, Xuefeng; Li, Changgui
2016-08-10
Chromosome 4q25 has been identified as a genomic region associated with gout. However, the associations of gout with the genes in this region have not yet been confirmed. Here, we performed two-stage analysis to determine whether variations in candidate genes in the 4q25 region are associated with gout in a male Chinese Han population. We first evaluated 96 tag single nucleotide polymorphisms (SNPs) in eight inflammatory/immune pathway- or glucose/lipid metabolism-related genes in the 4q25 region in 480 male gout patients and 480 controls. The SNP rs12504538, located in the elongation of very-long-chain-fatty-acid-like family member 6 gene (Elovl6), was found to be associated with gout susceptibility (Padjusted = 0.00595). In the second stage of analysis, we performed fine mapping analysis of 93 tag SNPs in Elovl6 and in the epidermal growth factor gene (EGF) and its flanking regions in 1017 male patients gout and 1897 healthy male controls. We observed a significant association between the T allele of EGF rs2298999 and gout (odds ratio = 0.77, 95% confidence interval = 0.67-0.88, Padjusted = 6.42 × 10(-3)). These results provide the first evidence for an association between the EGF rs2298999 C/T polymorphism and gout. Our findings should be validated in additional populations.
Liu, Shuang; Wang, Feng; Gao, Li Jun; Li, Jin Hua; Li, Rong Bai; Gao, Han Liang; Deng, Guo Fu; Yang, Jin Shui; Luo, Xiao Jin
2012-12-01
Heading date in rice (Oryza sativa L.) is a critical agronomic trait with a complex inheritance. To investigate the genetic basis and mechanism of gene interaction in heading date, we conducted genetic analysis on segregation populations derived from crosses among the indica cultivars Bo B, Yuefeng B and Baoxuan 2. A set of dominant complementary genes controlling late heading, designated LH1 and LH2, were detected by molecular marker mapping. Genetic analysis revealed that Baoxuan 2 contains both dominant genes, while Bo B and Yuefeng B each possess either LH1 or LH2. Using larger populations with segregant ratios of 3 : 1, we fine-mapped LH1 to a 63-kb region near the centromere of chromosome 7 flanked by markers RM5436 and RM8034, and LH2 to a 177-kb region on the short arm of chromosome 8 between flanking markers Indel22468-3 and RM25. Some candidate genes were identified through sequencing of Bo B and Yuefeng B in these target regions. Our work provides a solid foundation for further study on gene interaction in heading date and has application in marker-assisted breeding of photosensitive hybrid rice in China.
Itzhaki, H; Maxson, J M; Woodson, W R
1994-01-01
The increased production of ethylene during carnation petal senescence regulates the transcription of the GST1 gene encoding a subunit of glutathione-S-transferase. We have investigated the molecular basis for this ethylene-responsive transcription by examining the cis elements and trans-acting factors involved in the expression of the GST1 gene. Transient expression assays following delivery of GST1 5' flanking DNA fused to a beta-glucuronidase receptor gene were used to functionally define ...
Hyder, S M; Stancel, G M; Nawaz, Z; McDonnell, D P; Loose-Mitchell, D S
1992-09-05
We have used transient transfection assays with reporter plasmids expressing chloramphenicol acetyltransferase, linked to regions of mouse c-fos, to identify a specific estrogen response element (ERE) in this protooncogene. This element is located in the untranslated 3'-flanking region of the c-fos gene, 5 kilobases (kb) downstream from the c-fos promoter and 1.5 kb downstream of the poly(A) signal. This element confers estrogen responsiveness to chloramphenicol acetyltransferase reporters linked to both the herpes simplex virus thymidine kinase promoter and the homologous c-fos promoter. Deletion analysis localized the response element to a 200-base pair fragment which contains the element GGTCACCACAGCC that resembles the consensus ERE sequence GGTCACAGTGACC originally identified in Xenopus vitellogenin A2 gene. A synthetic 36-base pair oligodeoxynucleotide containing this c-fos sequence conferred estrogen inducibility to the thymidine kinase promoter. The corresponding sequence also induced reporter activity when present in the c-fos gene fragment 3 kb from the thymidine kinase promoter. Gel-shift experiments demonstrated that synthetic oligonucleotides containing either the consensus ERE or the c-fos element bind human estrogen receptor obtained from a yeast expression system. However, the mobility of the shifted band is faster for the fos-ERE-complex than the consensus ERE complex suggesting that the three-dimensional structure of the protein-DNA complexes is different or that other factors are differentially involved in the two reactions. When the 5'-GGTCA sequence present in the c-fos ERE is mutated to 5'-TTTCA, transcriptional activation and receptor binding activities are both lost. Mutation of the CAGCC-3' element corresponding to the second half-site of the c-fos sequence also led to the loss of receptor binding activity, suggesting that both half-sites of this element are involved in this function. The estrogen induction mediated by either the c-fos or
Anatomy of the blood supply [by the circumflexa ilium profunda artery] to the flank of the sheep
International Nuclear Information System (INIS)
Zoltie, N.; Hynd, P.I.; Kuchel, T.
1988-01-01
The anatomy of the circumflexa ilium profunda artery supplying the flank of the sheep was investigated in 25 sheep. Two constant branches were identified by dissection and angiography, and the cutaneous areas they supply identified. The arterial system was used successfully in 2 separate experiments
Suzuki, Masaharu; Ketterling, Matthew G; McCarty, Donald R
2005-09-01
We have developed a simple quantitative computational approach for objective analysis of cis-regulatory sequences in promoters of coregulated genes. The program, designated MotifFinder, identifies oligo sequences that are overrepresented in promoters of coregulated genes. We used this approach to analyze promoter sequences of Viviparous1 (VP1)/abscisic acid (ABA)-regulated genes and cold-regulated genes, respectively, of Arabidopsis (Arabidopsis thaliana). We detected significantly enriched sequences in up-regulated genes but not in down-regulated genes. This result suggests that gene activation but not repression is mediated by specific and common sequence elements in promoters. The enriched motifs include several known cis-regulatory sequences as well as previously unidentified motifs. With respect to known cis-elements, we dissected the flanking nucleotides of the core sequences of Sph element, ABA response elements (ABREs), and the C repeat/dehydration-responsive element. This analysis identified the motif variants that may correlate with qualitative and quantitative differences in gene expression. While both VP1 and cold responses are mediated in part by ABA signaling via ABREs, these responses correlate with unique ABRE variants distinguished by nucleotides flanking the ACGT core. ABRE and Sph motifs are tightly associated uniquely in the coregulated set of genes showing a strict dependence on VP1 and ABA signaling. Finally, analysis of distribution of the enriched sequences revealed a striking concentration of enriched motifs in a proximal 200-base region of VP1/ABA and cold-regulated promoters. Overall, each class of coregulated genes possesses a discrete set of the enriched motifs with unique distributions in their promoters that may account for the specificity of gene regulation.
Nucleotide sequence, transcript mapping, and regulation of the RAD2 gene of Saccharomyces cerevisiae
International Nuclear Information System (INIS)
Madura, K.; Prakash, S.
1986-01-01
The authors determined the nucleotide sequence, mapped the 5' and 3' nRNA termini, and examined the regulation of the RAD2 gene of Saccharomyces cerevisiae. A long open reading frame within the RAD2 transcribed region encodes a protein of 1031 amino acids with a calculated molecular weight of 117,847. A disruption of the RAD2 gene that deletes the 78 carboxyl terminal codons results in loss of RAD2 function. The 5' ends of RAD2 mRNA show considerable heterogeneity, mapping 5 to 62 nucleotides upstream of the first ATG codon of the long RAD2 open reading frame. The longest RAD2 transcripts also contain a short open reading frame of 37 codons that precedes and overlaps the 5' end of the long RAD2 open reading frame. The RAD2 3' nRNA end maps 171 nucleotides downstream of the TAA termination codon and 20 nucleotides downstream from a 12-base-pair inverted repeat that might function in transcript termination. Northern blot analysis showed a ninefold increase in steady-state levels of RAD2 mRNA after treatment of yeast cells with UV light. The 5' flanking region of the RAD2 gene contains several direct and inverted repeats and a 44-nuclotide-long purine-rich tract. The sequence T G G A G G C A T T A A found at position - 167 to -156 in the RAD2 gene is similar to at sequence present in the 5' flanking regions of the RAD7 and RAD10 genes
Reinforcing Deterrence on NATO’s Eastern Flank: Wargaming the Defense of the Baltics
2016-01-01
SUMMARY ■ C O R P O R A T I O N Reinforcing Deterrence on NATO’s Eastern Flank Wargaming the Defense of the Baltics David A. Shlapak and Michael...and stability between Moscow and its Western neighbors and raised concerns about its larger intentions. From the perspective of the North Atlantic...After eastern Ukraine, the next most likely targets for an attempted Russian coercion are the Baltic Republics of Estonia, Latvia, and Lithuania
Yong, Dongeun; Toleman, Mark A; Bell, Jan; Ritchie, Brett; Pratt, Rachael; Ryley, Henry; Walsh, Timothy R
2012-12-01
Three clinical Pseudomonas aeruginosa isolates (WCH2677, WCH2813, and WCH2837) isolated from the Women's and Children's Hospital, Adelaide, Australia, produced a metallo-β-lactamase (MBL)-positive Etest result. All isolates were PCR negative for known MBL genes. A gene bank was created, and an MBL gene, designated bla(AIM-1), was cloned and fully characterized. The encoded enzyme, AIM-1, is a group B3 MBL that has the highest level of identity to THIN-B and L1. It is chromosomal and flanked by two copies (one intact and one truncated) of an ISCR element, ISCR15. Southern hybridization studies indicated the movement of both ISCR15 and bla(AIM-1) within the three different clinical isolates. AIM-1 hydrolyzes most β-lactams, with the exception of aztreonam and, to a lesser extent, ceftazidime; however, it possesses significantly higher k(cat) values for cefepime and carbapenems than most other MBLs. AIM-1 was the first mobile group B3 enzyme detected and signals further problems for already beleaguered antimicrobial regimes to treat serious P. aeruginosa and other Gram-negative infections.
Geomorphology of the north flank of the Uinta Mountains
Bradley, W.H.
1936-01-01
The Uinta Mountains, whose northern margin is almost coincident with the southern boundary of Wyoming, extend from the Wasatch Range eastward across the northern part of Utah into northwestern Colorado. They were carved out of a large, simple anticlinal fold of sedimentary rocks arched up into essentially their present attitude at the end of the Cretaceous period. The Uinta Mountain group (Uinta quartzite of previous reports) a series of brick-red to purplish-red quartzite and sandstone beds of pre-Cambrian age, aggregating more than 12,000 feet in thickness, makes up the central mass of the range. Flanking the quartzite core and sharing its anticlinal structure are beds of limestone, sandstone, and shale ranging in age from Upper or Middle Cambrian to Upper Cretaceous. These rocks, which have a total thickness of about 15,000 feet, have been eroded from the higher part of the range, so the upturned edges of the harder
Gálvez, José Héctor; Tai, Helen H; Lagüe, Martin; Zebarth, Bernie J; Strömvik, Martina V
2016-05-19
Nitrogen (N) is the most important nutrient for the growth of potato (Solanum tuberosum L.). Foliar gene expression in potato plants with and without N supplementation at 180 kg N ha(-1) was compared at mid-season. Genes with consistent differences in foliar expression due to N supplementation over three cultivars and two developmental time points were examined. In total, thirty genes were found to be over-expressed and nine genes were found to be under-expressed with supplemented N. Functional relationships between over-expressed genes were found. The main metabolic pathway represented among differentially expressed genes was amino acid metabolism. The 1000 bp upstream flanking regions of the differentially expressed genes were analysed and nine overrepresented motifs were found using three motif discovery algorithms (Seeder, Weeder and MEME). These results point to coordinated gene regulation at the transcriptional level controlling steady state potato responses to N sufficiency.
Liu, P N; Miao, H; Lu, H W; Cui, J Y; Tian, G L; Wehner, T C; Gu, X F; Zhang, S P
2017-08-31
Powdery mildew (PM) of cucumber (Cucumis sativus), caused by Podosphaera xanthii, is a major foliar disease worldwide and resistance is one of the main objectives in cucumber breeding programs. The resistance to PM in cucumber stem is important to the resistance for the whole plant. In this study, genetic analysis and gene mapping were implemented with cucumber inbred lines NCG-122 (with resistance to PM in the stem) and NCG-121 (with susceptibility in the stem). Genetic analysis showed that resistance to PM in the stem of NCG-122 was qualitative and controlled by a single-recessive nuclear gene (pm-s). Susceptibility was dominant to resistance. In the initial genetic mapping of the pm-s gene, 10 SSR markers were discovered to be linked to pm-s, which was mapped to chromosome 5 (Chr.5) of cucumber. The pm-s gene's closest flanking markers were SSR20486 and SSR06184/SSR13237 with genetic distances of 0.9 and 1.8 cM, respectively. One hundred and fifty-seven pairs of new SSR primers were exploited by the sequence information in the initial mapping region of pm-s. The analysis on the F 2 mapping population using the new molecular markers showed that 17 SSR markers were confirmed to be linked to the pm-s gene. The two closest flanking markers, pmSSR27and pmSSR17, were 0.1 and 0.7 cM from pm-s, respectively, confirming the location of this gene on Chr.5. The physical length of the genomic region containing pm-s was 135.7 kb harboring 21 predicted genes. Among these genes, the gene Csa5G623470 annotated as encoding Mlo-related protein was defined as the most probable candidate gene for the pm-s. The results of this study will provide a basis for marker-assisted selection, and make the benefit for the cloning of the resistance gene.
Energy Technology Data Exchange (ETDEWEB)
Lace, M. J.; Kambesis, P. N.; Mylroie, J. E.
2016-07-01
Isla de Mona, a small, uplifted carbonate plateau jutting out of the waters of the Mona Passage, is an incredibly fragile and densely karstic environment. Expedition work was conducted by the Isla de Mona Project in cooperation with the Departamento Recursos Naturales y Ambientales de Puerto Rico (DRNA), including contributions from many researchers and cavers volunteering from across the U.S and Puerto Rico in the course of 12 separate expeditions, spanning a 14 year period (1998 to 2013). Over 200 caves have been documented on the island to date, the majority of this inventory is composed of flank margin caves but also includes sea caves, pit caves and talus caves. The most extensive example of cave development on the island is Sistema Faro - a sprawling maze-like series of chambers formed within the eastern point of the island with over 40 cliffside entrances overlooking the Caribbean Sea. Detailed cartography and analysis of the geomorphology and development of the Sistema Faro has helped form a complex model of carbonate island cave development as a function of tectonic uplift, lithology, sea level changes, karst hydrogeology and cliff retreat. This communication examines the roles these controls have played in the genesis of the world's largest flank margin cave. (Author)
Genetic analysis and gene fine mapping of aroma in rice (Oryza sativa L. Cyperales, Poaceae
Directory of Open Access Journals (Sweden)
Shu Xia Sun
2008-01-01
Full Text Available We investigated inheritance and carried out gene fine mapping of aroma in crosses between the aromatic elite hybrid rice Oryza sativa indica variety Chuanxiang-29B (Ch-29B and the non-aromatic rice O. sativa indica variety R2 and O. sativa japonica Lemont (Le. The F1 grains and leaves were non-aromatic while the F2 non-aroma to aroma segregation pattern was 3:1. The F3 segregation ratio was consistent with the expected 1:2:1 for a single recessive aroma gene in Ch-29B. Linkage analysis between simple sequence repeat (SSR markers and the aroma locus for the aromatic F2 plants mapped the Ch-29B aroma gene to a chromosome 8 region flanked by SSR markers RM23120 at 0.52 cM and RM3459 at 1.23 cM, a replicate F2 population confirming these results. Three bacterial artificial chromosome (BAC clones cover chromosome 8 markers RM23120 and RM3459. Our molecular mapping data from the two populations indicated that the aroma locus occurs in a 142.85 kb interval on BAC clones AP005301 or AP005537, implying that it might be the same gene reported by Bradbury et al (2005a; Plant Biotec J. 3:363-370. The flanking markers Aro7, RM23120 and RM3459 identified by us could greatly accelerate the efficiency and precision of aromatic rice breeding programs.
Epidermal growth factor gene is a newly identified candidate gene for gout
Han, Lin; Cao, Chunwei; Jia, Zhaotong; Liu, Shiguo; Liu, Zhen; Xin, Ruosai; Wang, Can; Li, Xinde; Ren, Wei; Wang, Xuefeng; Li, Changgui
2016-01-01
Chromosome 4q25 has been identified as a genomic region associated with gout. However, the associations of gout with the genes in this region have not yet been confirmed. Here, we performed two-stage analysis to determine whether variations in candidate genes in the 4q25 region are associated with gout in a male Chinese Han population. We first evaluated 96 tag single nucleotide polymorphisms (SNPs) in eight inflammatory/immune pathway- or glucose/lipid metabolism-related genes in the 4q25 region in 480 male gout patients and 480 controls. The SNP rs12504538, located in the elongation of very-long-chain-fatty-acid-like family member 6 gene (Elovl6), was found to be associated with gout susceptibility (Padjusted = 0.00595). In the second stage of analysis, we performed fine mapping analysis of 93 tag SNPs in Elovl6 and in the epidermal growth factor gene (EGF) and its flanking regions in 1017 male patients gout and 1897 healthy male controls. We observed a significant association between the T allele of EGF rs2298999 and gout (odds ratio = 0.77, 95% confidence interval = 0.67–0.88, Padjusted = 6.42 × 10−3). These results provide the first evidence for an association between the EGF rs2298999 C/T polymorphism and gout. Our findings should be validated in additional populations. PMID:27506295
The nucleotide sequence and organization of nuclear 5S rRNA genes in yellow lupine
International Nuclear Information System (INIS)
Nuc, K.; Nuc, P.; Pawelkiewicz, J.
1993-01-01
We have isolated a genomic clone containing 'Lupinus luteus' 5S ribosomal RNA genes by screening with 5S rDNA probe clones that were hybridized previously with the initiator methionine tRNA preparation (contaminated) with traces of rRNA or its degradation products). The clone isolated contains ten repeat units of 342 bp with 119 bp fragment showing 100% homology to the 5S rRNA from yellow lupine. Sequence analysis indicates only point heterogeneities among the flanking regions of the genes. (author). 6 refs, 3 figs
The value of HASTE MR urography in the diagnosis of the chronic nephrogenic flank pain
International Nuclear Information System (INIS)
Werel, D.; Tarasow, E.; Dzienis, W.; Ustymowicz, A.; Orzechowska-Bobkiewicz, A.; Walecki, J.; Darewicz, B.
2004-01-01
To asses the usefulness of the projectional HASTE sequence in the diagnosis of chronic flank pain caused by obstructive uropathy in comparison with conventional urography. 28 patients with chronic flank pain and hydronephrosis on ultrasound underwent conventional urography and HASTE sequence of static MR urography. The methods were evaluated for image quality, presence, agree, level and cause of urinary tract dilatation. The image quality of the urinary tract on HASTE was good in 57.1% and satisfactory in 42.9%; in conventional urography - good in 28.6%, satisfactory in 42.8% and poor in 28.6%. HASTE demonstrated hydronephrosis and degree of hydronephrosis in all the cases and conventional urography in 25 (83.3%). HASTE identified correctly the site of obstruction in 29 cases (96.7%), and conventional urography in 21 cases (70%). The sensitivity of HASTE in diagnosis of the intrinsic and extrinsic causes of obstruction was 73.7% and 80%, accuracy 73.3% and that of conventional urography 68.4%, 40% and 56.7%, respectively. HASTE is a valuable method in the diagnostics of chronic obstructive uropathy. It allows to evaluate the degree of hydronephrosis, the level and in many cases the cause of obstruction. When the urinary tract is not visualized in conventional urography, static MR urography is especially useful. (author)
Sistema Faro, Isla de Mona, Puerto Rico: speleogenesis of the worlds largest flank margin cave
International Nuclear Information System (INIS)
Lace, M. J.; Kambesis, P. N.; Mylroie, J. E.
2016-01-01
Isla de Mona, a small, uplifted carbonate plateau jutting out of the waters of the Mona Passage, is an incredibly fragile and densely karstic environment. Expedition work was conducted by the Isla de Mona Project in cooperation with the Departamento Recursos Naturales y Ambientales de Puerto Rico (DRNA), including contributions from many researchers and cavers volunteering from across the U.S and Puerto Rico in the course of 12 separate expeditions, spanning a 14 year period (1998 to 2013). Over 200 caves have been documented on the island to date, the majority of this inventory is composed of flank margin caves but also includes sea caves, pit caves and talus caves. The most extensive example of cave development on the island is Sistema Faro - a sprawling maze-like series of chambers formed within the eastern point of the island with over 40 cliffside entrances overlooking the Caribbean Sea. Detailed cartography and analysis of the geomorphology and development of the Sistema Faro has helped form a complex model of carbonate island cave development as a function of tectonic uplift, lithology, sea level changes, karst hydrogeology and cliff retreat. This communication examines the roles these controls have played in the genesis of the world's largest flank margin cave. (Author)
Guo, Xiaolu; Zhang, Hongli; Zheng, Xiuping; Zhou, Qianjin; Yang, Yi; Chen, Xueqiu; Du, Aifang
2016-07-29
The strongylid nematode Haemonchus contortus is a parasite of major concern for modern livestock husbandry because hostile environmental conditions may induce diapause in the early fourth-stage larvae. A new gene Hc-daf-22 was identified which is the homologue of Ce-daf-22 and human SCPx. Genome walking and RACE were performed to obtain the whole cDNA and genomic sequence of this gene. Using qRT-PCR with all developmental stages as templates to explore the transcription level and micro-injection was applied to confirm the promoter activity of the 5'-flanking region. Overexpression, rescue and RNA interference experiments were performed in N2, daf-22 mutant (ok 693) strains of C. elegans to study the gene function of Hc-daf-22. The full length gene of Hc-daf-22 (6,939 bp) contained 16 exons separated by 15 introns, and encoded a cDNA of 1,602 bp (533 amino acids, estimated at about 59.3 kDa) with a peak in L3 and L4 in transcriptional level. The Hc-DAF-22 protein was consisted of a 3-oxoacyl-CoA thiolase domain and a SCP2 domain and evolutionarily conserved. The 1,548 bp fragment upstream of the 5'-flanking region was confirmed to have promoter activity compared with 5'-flanking region of Ce-daf-22. The rescue experiment by micro-injection of daf-22 (ok693) mutant strain showed significant increase in body size and brood size in the rescued worms with significantly reduced or completely absent fat granules confirmed by Oil red O staining, indicating that Hc-daf-22 could partially rescue the function of Ce-daf-22. Furthermore, RNAi with Hc-daf-22 could partially silence the endogenous Ce-daf-22 in N2 worms and mimic the phenotype of daf-22 (ok693) mutants. The gene Hc-daf-22 was isolated and its function identified using C. elegans as a model organism. Our results indicate that Hc-daf-22 shared similar characteristics and function with Ce-daf-22 and may play an important role in peroxisomal β-oxidation and the development in H. contortus.
[Analysis of SOX10 gene mutation in a family affected with Waardenburg syndrome type II].
Zheng, Lei; Yan, Yousheng; Chen, Xue; Zhang, Chuan; Zhang, Qinghua; Feng, Xuan; Hao, Shen
2018-02-10
OBJECTIVE To detect potential mutation of SOX10 gene in a pedigree affected with Warrdenburg syndrome type II. METHODS Genomic DNA was extracted from peripheral blood samples of the proband and his family members. Exons and flanking sequences of MITF, PAX3, SOX10, SNAI2, END3 and ENDRB genes were analyzed by chip capturing and high throughput sequencing. Suspected mutations were verified with Sanger sequencing. RESULTS A c.127C>T (p.R43X) mutation of the SOX10 gene was detected in the proband, for which both parents showed a wild-type genotype. CONCLUSION The c.127C>T (p.R43X) mutation of SOX10 gene probably underlies the ocular symptoms and hearing loss of the proband.
DEFF Research Database (Denmark)
Giese, H.; Holm-Jensen, A.G.; Jensen, H.P.
1993-01-01
The powdery mildew disease resistance gene Ml(La) was found to belong to a locus on barely chromosome 2. We suggest that this locus be designated MlLa. Linkage analysis was carried out on 72 chromosome-doubled, spring-type progeny lines from a cross between the winter var 'Vogelsanger Gold' and t......' and the spring var 'Alf'. A map of chromosome 2 spanning 119 cM and flanked by two peroxidase gene loci was constructed. In addition to the Laevigatum resistance locus the map includes nine RFLP markers, the two peroxidase gene loci and the six-row locus in barley....
Wateren, F.M. van der; Dunai, T.J.; Balen, R.T. van; Klas, W.; Verbers, A.L.L.M.; Passchier, S.; Herpers, U.
1999-01-01
Separate regions within the Transantarctic Mountains, the uplifted flank of the West Antarctic rift system, appear to have distinct Neogene histories of glaciation and valley downcutting. Incision of deep glacial outlet valleys occurred at different times throughout central and northern Victoria
Influence of the cutting parameters on flank wear of coated inserts during turning of AISI 316L
Directory of Open Access Journals (Sweden)
Yusimit Zamora Hernández
2015-03-01
Full Text Available (Received: 2015/01/20 - Accepted: 2015/03/25The continuous improvement of manufacturing processes is critical to achieve optimum levels of productivity, quality and cut production of components and products. This research aims to determine the cutting tool flank wearing progression, during a high speed dry turning, for AISI 316L steel parts. Experimental data were acquired using two cutting feed levels, two material levels, three cutting speeds, and four principal cutting times. A scanning electron microscope (SEM was used to measure and analyze the wear of the cutting tools. Results were compared using analysis of variance and multiple regression for describing the relation between the variables used in the study. The analysis showed that the three layers coating insert did not exceed the end of life wearing criterion, while the one layer insert suffered a catastrophic wearing at the highest cutting speed. It was found that a relation exists between the experimental data and the predicted values for flank wear with a general average error of 4.1182%.
Harp, A. G.; Valentine, G. A.
2018-02-01
Mafic flank eruptions are common events that pose a serious hazard to the communities and infrastructure often encroaching on the slopes of stratovolcanoes. Flank vent locations are dictated by the propagation path of their feeder dikes. The dikes are commonly thought to propagate either laterally from the central conduit or vertically from a deeper source. However, these interpretations are often based on indirect measurements, such as surface deformation and seismicity at active systems, and several studies at eroded volcanoes indicate the propagation paths may be more complex. We investigated the Oligocene age Summer Coon volcano (Colorado, USA), where erosion has exposed over 700 basaltic-andesitic radial dikes, to constrain the propagation directions, geometries, and spatial distributions of mafic dikes within a stratovolcano. The mean fabric angle of aligned plagioclase crystals was measured in oriented samples from the margins of 77 dikes. Of the 41 dikes with statistically significant flow fabrics, 85% had fabric angles that were inclined—plunging both inward and outward relative to the center of the volcano. After comparing fabric angles to those reported in other studies, we infer that, while most of the dikes with outward-plunging fabrics descended toward the flanks from a source within the edifice and near its axis, dikes with inward-plunging fabrics ascended through the edifice and toward the flanks from a deeper source. A possible control for the inclination of ascending dikes was the ratio between magma overpressure and the normal stress in the host rock. While higher ratios led to high-angle propagation, lower ratios resulted in inclined emplacement. Dikes crop out in higher frequencies within a zone surrounding the volcano axis at 2500 m radial distance from the center and may be the result of ascending dikes, emplaced at similar propagation angles, intersecting the current level of exposure at common distances from the volcano axis. The process
Sodium Ion Dynamics in the Magnetospheric Flanks of Mercury
Aizawa, Sae; Delcourt, Dominique; Terada, Naoki
2018-01-01
We investigate the transport of planetary ions in the magnetospheric flanks of Mercury. In situ measurements from the MErcury Surface, Space ENvironment, GEochemistry, and Ranging spacecraft show evidences of Kelvin-Helmholtz instability development in this region of space, due to the velocity shear between the downtail streaming flow of solar wind originating protons in the magnetosheath and the magnetospheric populations. Ions that originate from the planet exosphere and that gain access to this region of space may be transported across the magnetopause along meandering orbits. We examine this transport using single-particle trajectory calculations in model Magnetohydrodynamics simulations of the Kelvin-Helmholtz instability. We show that heavy ions of planetary origin such as Na+ may experience prominent nonadiabatic energization as they E × B drift across large-scale rolled up vortices. This energization is controlled by the characteristics of the electric field burst encountered along the particle path, the net energy change realized corresponding to the maximum E × B drift energy. This nonadiabatic energization also is responsible for prominent scattering of the particles toward the direction perpendicular to the magnetic field.
Distinct sources of particles near the cusp and the dusk flank of the magnetosphere
Escoubet, C. P.; Grison, B.; Berchem, J.; Trattner, K. J.; Lavraud, B.; Pitout, F.; Soucek, J.; Richard, R. L.; Laakso, H. E.; Masson, A.; Dunlop, M.; Dandouras, I. S.; Rème, H.; Fazakerley, A. N.; Daly, P. W.
2015-12-01
At the magnetopause, the location of the magnetic reconnection sites depends on the orientation of the interplanetary magnetic field (IMF) in the solar wind: on the dayside magnetosphere for an IMF southward, on the lobes for an IMF northward and on the flanks for an IMF in the East-West direction. Since most of observations of reconnection events have sampled a limited region of space simultaneously it is still not yet know if the reconnection line is extended over large regions of the magnetosphere or if is patchy and made of many reconnection lines. We report a Cluster crossing on 5 January 2002 near the exterior cusp on the southern dusk side where we observe multiple sources of reconnection/injections. The IMF was mainly azimuthal (IMF-By around -5 nT), the solar wind speed lower than usual around 280 km/s with the density of order 5 cm-3. The four Cluster spacecraft had an elongated configuration near the magnetopause. C4 was the first spacecraft to enter the cusp around 19:52:04 UT, followed by C2 at 19:52:35 UT, C1 at 19:54:24 UT and C3 at 20:13:15 UT. C4 and C1 observed two ion energy dispersions at 20:10 UT and 20:40 UT and C3 at 20:35 UT and 21:15 UT. Using the time of flight technique on the upgoing and downgoing ions, which leads to energy dispersions, we obtain distances of the ion sources between 14 and 20 RE from the spacecraft. The slope of the ion energy dispersions confirmed these distances. Using Tsyganenko model, we find that these sources are located on the dusk flank, past the terminator. The first injection by C3 is seen at approximately the same time as the 2nd injection on C1 but their sources at the magnetopause were separated by more than 7 RE. This would imply that two distinct sources were active at the same time on the dusk flank of the magnetosphere. In addition, a flow reversal was observed at the magnetopause on C4 which would be an indication that reconnection is also taking place near the exterior cusp quasi-simultaneously. A
Evolution of trappin genes in mammals
Directory of Open Access Journals (Sweden)
Furutani Yutaka
2010-01-01
Full Text Available Abstract Background Trappin is a multifunctional host-defense peptide that has antiproteolytic, antiinflammatory, and antimicrobial activities. The numbers and compositions of trappin paralogs vary among mammalian species: human and sheep have a single trappin-2 gene; mouse and rat have no trappin gene; pig and cow have multiple trappin genes; and guinea pig has a trappin gene and two other derivativegenes. Independent duplications of trappin genes in pig and cow were observed recently after the species were separated. To determine whether these trappin gene duplications are restricted only to certain mammalian lineages, we analyzed recently-developed genome databases for the presence of duplicate trappin genes. Results The database analyses revealed that: 1 duplicated trappin multigenes were found recently in the nine-banded armadillo; 2 duplicated two trappin genes had been found in the Afrotherian species (elephant, tenrec, and hyrax since ancient days; 3 a single trappin-2 gene was found in various eutherians species; and 4 no typical trappin gene has been found in chicken, zebra finch, and opossum. Bayesian analysis estimated the date of the duplication of trappin genes in the Afrotheria, guinea pig, armadillo, cow, and pig to be 244, 35, 11, 13, and 3 million-years ago, respectively. The coding regions of trappin multigenes of almadillo, bovine, and pig evolved much faster than the noncoding exons, introns, and the flanking regions, showing that these genes have undergone accelerated evolution, and positive Darwinian selection was observed in pig-specific trappin paralogs. Conclusion These results suggest that trappin is an eutherian-specific molecule and eutherian genomes have the potential to form trappin multigenes.
DEFF Research Database (Denmark)
Regenberg, Birgitte; Hansen, J.
2000-01-01
the GAP1 gene. This is caused by recombination between two Salmonella typuimurium hisG direct repeats embracing GAP1, and will result in a sub-population of gap1 cells. Such cells are selected on a medium containing D-histidine, and may subsequently be used for a second gene disruption. Hence, multiple...... flanked by short (60 bp) stretches of the gene in question. Through homologous recombination, the cassette will integrate into the target gene, which is thus replaced by GAP1, and mutants are selected for on minimal L-citrulline medium. When propagated under non-selective conditions, some cells will lose...... gene disruptions can be made fast, cheaply and easily in a gap1 strain, with two positive selection steps for each disruption. Copyright (C) 2000 John Wiley & Sons, Ltd....
Genome-wide screening of Saccharomyces cerevisiae genes regulated by vanillin.
Park, Eun-Hee; Kim, Myoung-Dong
2015-01-01
During pretreatment of lignocellulosic biomass, a variety of fermentation inhibitors, including acetic acid and vanillin, are released. Using DNA microarray analysis, this study explored genes of the budding yeast Saccharomyces cerevisiae that respond to vanillin-induced stress. The expression of 273 genes was upregulated and that of 205 genes was downregulated under vanillin stress. Significantly induced genes included MCH2, SNG1, GPH1, and TMA10, whereas NOP2, UTP18, FUR1, and SPR1 were down regulated. Sequence analysis of the 5'-flanking region of upregulated genes suggested that vanillin might regulate gene expression in a stress response element (STRE)-dependent manner, in addition to a pathway that involved the transcription factor Yap1p. Retardation in the cell growth of mutant strains indicated that MCH2, SNG1, and GPH1 are intimately involved in vanillin stress response. Deletion of the genes whose expression levels were decreased under vanillin stress did not result in a notable change in S. cerevisiae growth under vanillin stress. This study will provide the basis for a better understanding of the stress response of the yeast S. cerevisiae to fermentation inhibitors.
Cloning and sequencing of Staphylococcus aureus murC, a gene essential for cell wall biosynthesis.
Lowe, A M; Deresiewicz, R L
1999-01-01
Staphylococcus aureus is a major human pathogen that is increasingly resistant to clinically useful antimicrobial agents. While screening for S. aureus genes expressed during mammalian infection, we isolated murC. This gene encodes UDP-N-acetylmuramoyl-L-alanine synthetase, an enzyme essential for cell wall biosynthesis in a number of bacteria. S. aureus MurC has a predicted mass 49,182 Da and complements the temperature-sensitive murC mutation of E. coli ST222. Sequence data on the DNA flanking staphylococcal murC suggests that the local gene organization there parallels that found in B. subtilis, but differs from that found in gram-negative bacterial pathogens. MurC proteins represent promising targets for broad spectrum antimicrobial drug development.
Directory of Open Access Journals (Sweden)
Mi Zhao
Full Text Available We reported pearl oyster Pinctada fucata cDNA and genomic characterization of a new homeobox-containing protein, PfMSX. The PfMSX gene encodes a transcription factor that was localized to the nucleus. Analyses of PfMSX mRNA in tissues and developmental stages showed high expressions in mantle or D-shaped larvae. In electrophoretic mobility shift assays (EMSAs PfMSX binded to MSX consensus binding sites in the 5' flanking region of the Pif promoter. In co-transfection experiment PfMSX transactivated reporter constructs containing Pif promoter sequences, and mutation of the MSX-binding sites attenuated transactivation. A knockdown experiment using PfMSX dsRNA showed decreased Pif mRNA and unregular crystallization of the nacreous layer using scanning electron microscopy. Our results suggested that PfMSX was a conserved homeodomain transcription factor gene, which can activate Pif gene expression through MSX binding site, and was then involved in the mineralization process in pearl oyster Pinctada fucata. Our data provided important clues about mechanisms regulating biomineralization in pearl oyster.
Zhao, Mi; He, Maoxian; Huang, Xiande; Wang, Qi
2014-01-01
We reported pearl oyster Pinctada fucata cDNA and genomic characterization of a new homeobox-containing protein, PfMSX. The PfMSX gene encodes a transcription factor that was localized to the nucleus. Analyses of PfMSX mRNA in tissues and developmental stages showed high expressions in mantle or D-shaped larvae. In electrophoretic mobility shift assays (EMSAs) PfMSX binded to MSX consensus binding sites in the 5′ flanking region of the Pif promoter. In co-transfection experiment PfMSX transactivated reporter constructs containing Pif promoter sequences, and mutation of the MSX-binding sites attenuated transactivation. A knockdown experiment using PfMSX dsRNA showed decreased Pif mRNA and unregular crystallization of the nacreous layer using scanning electron microscopy. Our results suggested that PfMSX was a conserved homeodomain transcription factor gene, which can activate Pif gene expression through MSX binding site, and was then involved in the mineralization process in pearl oyster Pinctada fucata. Our data provided important clues about mechanisms regulating biomineralization in pearl oyster. PMID:25099698
Zhao, Mi; He, Maoxian; Huang, Xiande; Wang, Qi
2014-01-01
We reported pearl oyster Pinctada fucata cDNA and genomic characterization of a new homeobox-containing protein, PfMSX. The PfMSX gene encodes a transcription factor that was localized to the nucleus. Analyses of PfMSX mRNA in tissues and developmental stages showed high expressions in mantle or D-shaped larvae. In electrophoretic mobility shift assays (EMSAs) PfMSX binded to MSX consensus binding sites in the 5' flanking region of the Pif promoter. In co-transfection experiment PfMSX transactivated reporter constructs containing Pif promoter sequences, and mutation of the MSX-binding sites attenuated transactivation. A knockdown experiment using PfMSX dsRNA showed decreased Pif mRNA and unregular crystallization of the nacreous layer using scanning electron microscopy. Our results suggested that PfMSX was a conserved homeodomain transcription factor gene, which can activate Pif gene expression through MSX binding site, and was then involved in the mineralization process in pearl oyster Pinctada fucata. Our data provided important clues about mechanisms regulating biomineralization in pearl oyster.
Cloning and analysis of the promoter region of the human fibronectin gene
International Nuclear Information System (INIS)
Dean, D.C.; Bowlus, C.L.; Bourgeois, S.
1987-01-01
Human fibronectin (FN) genomic clones were isolated by screening a human genomic library with a 75-base oligonucleotide. The sequence of the oligonucleotide corresponds to a region near the 5' end of the human FN cDNA clone pFH6 that contains the amino-terminal coding sequences but does not extend to the 5' end of the mRNA. The 5' end of the FN gene is found on a 3.7-kilobase-pair EcoRI fragment that contains about 2.7 kilobase pairs of flanking sequence. The first exon is 414 base pairs long, with a 5' untranslated region of 267 base pairs. As deduced on the basis of the position of the initiation codon, FN is synthesized with a 31-residue amino acid extension on the amion terminus that is not present in the mature polypeptide. This amino-terminal extension appears to contain both a signal peptide and a propeptide. The first 200 base pairs of 5'-flanking sequence is very G+C rich. Upstream of this the sequence becomes relatively A+T rich. The sequence ATATAA is found at -25 and the sequence CAAT is present at -150. The sequence GGGGCGGGGC at -102 exhibits homology to the binding site for the transcription factor SP1, and the sequence TGACGTCA at -173 exhibits homology to 5'-flanking sequences important for induction by cAMP
Energy Technology Data Exchange (ETDEWEB)
Itadera, K. (Kanagawa Hot Springs Research Institute, Kanagawa (Japan)); Shimano, Y. (Utsunomiya Bunsei Junior College, Tochigi (Japan))
1993-06-30
This paper describes the following matters on the springs at the mountain flank of Iwate volcano in Iwate Prefecture, with the Kanazawa spring as the main subject: The new and old Iwate volcanos have rock-bed flow deposits which resulted from mountain disintegration, distributed over their south, east and north flanks, and most of the spring water wells up in these areas; the south, east and north flanks have about 80 springs, about 30 springs, and about 10 springs, respectively; the number of springs and the water well-up scale show a trend of inverse proportion; the Kanazawa spring is a generic name of the several springs located on the north flank in the Kanazawa area; its main spring forms a spring pond with an area of about 100 m[sup 2] with a spring water temperature of about 11.5[degree]C, electric conductivity of 200 [mu] S/cm or higher, and a flow-out rate of 500 l/s or more; the Kanazawa spring is characterized by having as large total dissolved component amount as 170 mg/l or more and abundant amount of SO4[sup 2-] and Cl[sup -]; and the spring presents properties different from those in other springs. 10 refs., 5 figs., 1 tab.
Gene therapy, early promises, subsequent problems, and recent breakthroughs.
Razi Soofiyani, Saeideh; Baradaran, Behzad; Lotfipour, Farzaneh; Kazemi, Tohid; Mohammadnejad, Leila
2013-01-01
Gene therapy is one of the most attractive fields in medicine. The concept of gene delivery to tissues for clinical applications has been discussed around half a century, but scientist's ability to manipulate genetic material via recombinant DNA technology made this purpose to reality. Various approaches, such as viral and non-viral vectors and physical methods, have been developed to make gene delivery safer and more efficient. While gene therapy initially conceived as a way to treat life-threatening disorders (inborn errors, cancers) refractory to conventional treatment, to date gene therapy is considered for many non-life-threatening conditions including those adversely influence on a patient's quality of life. Gene therapy has made significant progress, including tangible success, although much slower than was initially predicted. Although, gene therapies still at a fairly primitive stage, it is firmly science based. There is justifiable hope that with enhanced pathobiological understanding and biotechnological improvements, gene therapy will be a standard part of clinical practice within 20 years.
Gene expression patterns specific to the regenerating limb of the Mexican axolotl
Directory of Open Access Journals (Sweden)
James R. Monaghan
2012-07-01
Salamander limb regeneration is dependent upon tissue interactions that are local to the amputation site. Communication among limb epidermis, peripheral nerves, and mesenchyme coordinate cell migration, cell proliferation, and tissue patterning to generate a blastema, which will form missing limb structures. An outstanding question is how cross-talk between these tissues gives rise to the regeneration blastema. To identify genes associated with epidermis-nerve-mesenchymal interactions during limb regeneration, we examined histological and transcriptional changes during the first week following injury in the wound epidermis and subjacent cells between three injury types; 1 a flank wound on the side of the animal that will not regenerate a limb, 2 a denervated limb that will not regenerate a limb, and 3 an innervated limb that will regenerate a limb. Early, histological and transcriptional changes were similar between the injury types, presumably because a common wound-healing program is employed across anatomical locations. However, some transcripts were enriched in limbs compared to the flank and are associated with vertebrate limb development. Many of these genes were activated before blastema outgrowth and expressed in specific tissue types including the epidermis, peripheral nerve, and mesenchyme. We also identified a relatively small group of transcripts that were more highly expressed in innervated limbs versus denervated limbs. These transcripts encode for proteins involved in myelination of peripheral nerves, epidermal cell function, and proliferation of mesenchymal cells. Overall, our study identifies limb-specific and nerve-dependent genes that are upstream of regenerative growth, and thus promising candidates for the regulation of blastema formation.
Identification of novel androgen receptor target genes in prostate cancer
Directory of Open Access Journals (Sweden)
Gerald William L
2007-06-01
Full Text Available Abstract Background The androgen receptor (AR plays critical roles in both androgen-dependent and castrate-resistant prostate cancer (PCa. However, little is known about AR target genes that mediate the receptor's roles in disease progression. Results Using Chromatin Immunoprecipitation (ChIP Display, we discovered 19 novel loci occupied by the AR in castrate resistant C4-2B PCa cells. Only four of the 19 AR-occupied regions were within 10-kb 5'-flanking regulatory sequences. Three were located up to 4-kb 3' of the nearest gene, eight were intragenic and four were in gene deserts. Whereas the AR occupied the same loci in C4-2B (castrate resistant and LNCaP (androgen-dependent PCa cells, differences between the two cell lines were observed in the response of nearby genes to androgens. Among the genes strongly stimulated by DHT in C4-2B cells – D-dopachrome tautomerase (DDT, Protein kinase C delta (PRKCD, Glutathione S- transferase theta 2 (GSTT2, Transient receptor potential cation channel subfamily V member 3 (TRPV3, and Pyrroline-5-carboxylate reductase 1 (PYCR1 – most were less strongly or hardly stimulated in LNCaP cells. Another AR target gene, ornithine aminotransferase (OAT, was AR-stimulated in a ligand-independent manner, since it was repressed by AR siRNA knockdown, but not stimulated by DHT. We also present evidence for in vivo AR-mediated regulation of several genes identified by ChIP Display. For example, PRKCD and PYCR1, which may contribute to PCa cell growth and survival, are expressed in PCa biopsies from primary tumors before and after ablation and in metastatic lesions in a manner consistent with AR-mediated stimulation. Conclusion AR genomic occupancy is similar between LNCaP and C4-2B cells and is not biased towards 5' gene flanking sequences. The AR transcriptionally regulates less than half the genes nearby AR-occupied regions, usually but not always, in a ligand-dependent manner. Most are stimulated and a few are
International Nuclear Information System (INIS)
Nakayama, Kohzo; Nagase, Kazuko; Tokutake, Yuriko; Koh, Chang-Sung; Hiratochi, Masahiro; Ohkawara, Takeshi; Nakayama, Noriko
2004-01-01
We cloned the 5'-flanking region of the mouse homolog of the Delta gene (Dll1) and demonstrated that the sequence between nucleotide position -514 and -484 in the 5'-flanking region of Dll1 played a critical role in the regulation of its tissue-specific expression in neural stem cells (NSCs). Further, we showed that multiple POU-binding motifs, located within this short sequence of 30 bp, were essential for transcriptional activation of Dll1 and also that multiple tissue-specific nuclear factors recognized these POU-binding motifs in various combinations through differentiation of NSCs. Thus, POU-binding factors may play an important role in Dll1 expression in developing NSCs
Nakamura, Masayuki; Kuwahara, Hideto; Onoyama, Keisuke; Iwai, Hisashi
2012-08-01
Agrobacterium tumefaciens-mediated transformation (AtMT) has become a common technique for DNA transformation of yeast and filamentous fungi. In this study, we first established a protocol of AtMT for the phytopathogenic fungus Colletotrichum sansevieriae. Binary T-DNA vector containing the hygromycin B phosphotransferase gene controlled by the Aspergillus nidulans gpdA promoter and the trpC terminator was constructed with pCAMBIA0380 and used with three different strains LBA4404, GV3101, and GV2260 of A. tumefaciens. Transformants were most effectively obtained when GV2260 and C. sansevieriae Sa-1-2 were co-cultivated; there were about 320 transformants per 10(6) spores. When 1,048 transformants were inoculated on Sansevieria trifasciata, three transformants were found to have completely lost their pathogenicity and two transformants displayed reduced pathogenicity. All of the five transformants had a single copy of T-DNA in their genomes. The three pathogenicity-deficient transformants were subjected to thermal asymmetric interlaced polymerase chain reaction and the reaction allowed us to amplify the sequences flanking the left and/or right borders. The flanking sequences of the two transformants, M154 and M875, showed no homology to any sequences in databases, but the sequences of M678 contained motifs of alpha-1,3-glucan synthase, suggesting that the gene might contribute to the pathogenicity of C. sansevieriae. This study describes a useful method for investigating pathogenicity genes in C. sansevieriae.
Selective sweep on human amylase genes postdates the split with Neanderthals
Inchley, Charlotte E.; Larbey, Cynthia D. A.; Shwan, Nzar A. A.; Pagani, Luca; Saag, Lauri; Antão, Tiago; Jacobs, Guy; Hudjashov, Georgi; Metspalu, Ene; Mitt, Mario; Eichstaedt, Christina A.; Malyarchuk, Boris; Derenko, Miroslava; Wee, Joseph; Abdullah, Syafiq
2016-01-01
Humans have more copies of amylase genes than other primates. It is still poorly understood, however, when the copy number expansion occurred and whether its spread was enhanced by selection. Here we assess amylase copy numbers in a global sample of 480 high coverage genomes and find that regions flanking the amylase locus show notable depression of genetic diversity both in African and non-African populations. Analysis of genetic variation in these regions supports the model of an early sele...
Tagging of four Rf genes with selective genotyping analysis in rice (Oryza sativa L.
Directory of Open Access Journals (Sweden)
Yarahmadi Saeid
2017-01-01
Full Text Available Wild abortive type of cytoplasmic male sterility (WA-CMS is commercially used for hybrid rice seed production. The linked markers can be used for selection of plants with desirable traits. Tagging of Rf genes was carried out using recessive and dominant class analysis in a large F2 population from the cross IR58025A×IR42686R. Pollen fertility and seed setting were evaluated at the flowering and maturity stages, respectively. Forty-seven highly sterile and 23 fertile homozygous plants were selected from F2 population for molecular marker assay. Four Rf genes identified in a good restorer line with high-quality derived from a random mating composite population at the International Rice Research Institute (IRRI. The genetic distance from Rf3 locus with flanking markers RM443 and RM315 on chromosome 1 was 3.7 and 21.2 cM, respectively. RM258, RM591, RM271 and RM6737 on the long arm of chromosome 10 were linked with the Rf6 gene with distance of 7.4, 22.6, 6 and 2.9 cM, respectively. Rf6 was flanked by RM6737 and RM591. The Rf4 gene located on chromosome 7 was linked with RM6344 at a genetic distance of 10.6 cM. RM519 and RM7003 were linked with other Rf gene on chromosome 12 at a genetic distance of 8.5 and 20.8 cM, respectively. Closely linked markers identified in this study could be used for marker assisted selection in a hybrid rice breeding program. A new Rf locus on chromosome 12 that designated Rf7 was linked with RM7003 and RM519.
Gene Therapy, Early Promises, Subsequent Problems, and Recent Breakthroughs
Directory of Open Access Journals (Sweden)
Saeideh Razi Soofiyani
2013-08-01
Full Text Available Gene therapy is one of the most attractive fields in medicine. The concept of gene delivery to tissues for clinical applications has been discussed around half a century, but scientist’s ability to manipulate genetic material via recombinant DNA technology made this purpose to reality. Various approaches, such as viral and non-viral vectors and physical methods, have been developed to make gene delivery safer and more efficient. While gene therapy initially conceived as a way to treat life-threatening disorders (inborn errors, cancers refractory to conventional treatment, to date gene therapy is considered for many non–life-threatening conditions including those adversely influence on a patient’s quality of life. Gene therapy has made significant progress, including tangible success, although much slower than was initially predicted. Although, gene therapies still at a fairly primitive stage, it is firmly science based. There is justifiable hope that with enhanced pathobiological understanding and biotechnological improvements, gene therapy will be a standard part of clinical practice within 20 years.
Characterization of human cardiac myosin heavy chain genes
International Nuclear Information System (INIS)
Yamauchi-Takihara, K.; Sole, M.J.; Liew, J.; Ing, D.; Liew, C.C.
1989-01-01
The authors have isolated and analyzed the structure of the genes coding for the α and β forms of the human cardiac myosin heavy chain (MYHC). Detailed analysis of four overlapping MYHC genomic clones shows that the α-MYHC and β-MYHC genes constitute a total length of 51 kilobases and are tandemly linked. The β-MYHC-encoding gene, predominantly expressed in the normal human ventricle and also in slow-twitch skeletal muscle, is located 4.5 kilobases upstream of the α-MYHC-encoding gene, which is predominantly expressed in normal human atrium. The authors have determined the nucleotide sequences of the β form of the MYHC gene, which is 100% homologous to the cardiac MYHC cDNA clone (pHMC3). It is unlikely that the divergence of a few nucleotide sequences from the cardiac β-MYHC cDNA clone (pHMC3) reported in a MYHC cDNA clone (PSMHCZ) from skeletal muscle is due to a splicing mechanism. This finding suggests that the same β form of the cardiac MYHC gene is expressed in both ventricular and slow-twitch skeletal muscle. The promoter regions of both α- and β-MYHC genes, as well as the first four coding regions in the respective genes, have also been sequenced. The sequences in the 5'-flanking region of the α- and β-MYHC-encoding genes diverge extensively from one another, suggesting that expression of the α- and β-MYHC genes is independently regulated
GENE TRANSFER IN TOBACCO MITOCHONDRIA IN VITRO AND IN VIVO
Directory of Open Access Journals (Sweden)
Katyshev A.I.
2012-08-01
Full Text Available Earlier, we had showed that isolated mitochondria from different organisms can import DNA. Exploiting this mechanism, we assessed the possibility of genes transfer in tobacco mitochondria in vitro and in vivo. Whereas homologous recombination is a rare occasion in higher plant nuclei, recombination between the large direct repeats in plant mitochondrial genome generates its multipartite structure. Following transfection of isolated organelles with constructs composed of a partial gfp gene flanked by mitochondrial DNA fragments, we showed the homologous recombination of imported DNA with the resident DNA and the integration of the reporter gene. The recombination yielded an insertion of a continuous exogenous DNA fragment including the gfp sequence and at least the 0.5 kb of the flanking sequence on each side. Using of transfection constructs carrying multiple sequences homologous to mitochondrial DNA could be suitable for insertion of a target gene into any region of the mitochondrial genome, which turns this approach to be of a general and methodical importance. Usually mitochondrial reactive oxygen species (ROS level is under strict control of the antioxidant system including the Mn-containing superoxide dismutase (MnSOD. MnSOD is presented in multiple forms encoded by several genes in plants. Possibly, this enzyme, beside its catalytic function, fulfills as well some unknown biochemical functions. Thus, one of maize SOD enzymes (SOD3.4 could bind with mitochondrial DNA. Another SOD form (SOD3.1 is located in close proximity to mitochondrial respiratory complexes, where ROS are generated. To study possible physiological functions of this enzyme, we cloned the maize SOD3.1 gene. Compared to the SOD3.4, this enzyme didn't demonstrate DNA-binding activity. At the same time, SOD3.1 didn't show non-specific DNA-hydrolyzing activity as Cu/ZnSOD does. It means that this enzyme might have some DNA protective function. We made NtPcob-sod3.1-IGR
Burnside, Rachel D; Pasion, Romela; Mikhail, Fady M; Carroll, Andrew J; Robin, Nathaniel H; Youngs, Erin L; Gadi, Inder K; Keitges, Elizabeth; Jaswaney, Vikram L; Papenhausen, Peter R; Potluri, Venkateswara R; Risheg, Hiba; Rush, Brooke; Smith, Janice L; Schwartz, Stuart; Tepperberg, James H; Butler, Merlin G
2011-10-01
The proximal long arm of chromosome 15 has segmental duplications located at breakpoints BP1-BP5 that mediate the generation of NAHR-related microdeletions and microduplications. The classical Prader-Willi/Angelman syndrome deletion is flanked by either of the proximal BP1 or BP2 breakpoints and the distal BP3 breakpoint. The larger Type I deletions are flanked by BP1 and BP3 in both Prader-Willi and Angelman syndrome subjects. Those with this deletion are reported to have a more severe phenotype than individuals with either Type II deletions (BP2-BP3) or uniparental disomy 15. The BP1-BP2 region spans approximately 500 kb and contains four evolutionarily conserved genes that are not imprinted. Reports of mutations or disturbed expression of these genes appear to impact behavioral and neurological function in affected individuals. Recently, reports of deletions and duplications flanked by BP1 and BP2 suggest an association with speech and motor delays, behavioral problems, seizures, and autism. We present a large cohort of subjects with copy number alteration of BP1 to BP2 with common phenotypic features. These include autism, developmental delay, motor and language delays, and behavioral problems, which were present in both cytogenetic groups. Parental studies demonstrated phenotypically normal carriers in several instances, and mildly affected carriers in others, complicating phenotypic association and/or causality. Possible explanations for these results include reduced penetrance, altered gene dosage on a particular genetic background, or a susceptibility region as reported for other areas of the genome implicated in autism and behavior disturbances.
Deep Sequencing of 71 Candidate Genes to Characterize Variation Associated with Alcohol Dependence.
Clark, Shaunna L; McClay, Joseph L; Adkins, Daniel E; Kumar, Gaurav; Aberg, Karolina A; Nerella, Srilaxmi; Xie, Linying; Collins, Ann L; Crowley, James J; Quackenbush, Corey R; Hilliard, Christopher E; Shabalin, Andrey A; Vrieze, Scott I; Peterson, Roseann E; Copeland, William E; Silberg, Judy L; McGue, Matt; Maes, Hermine; Iacono, William G; Sullivan, Patrick F; Costello, Elizabeth J; van den Oord, Edwin J
2017-04-01
Previous genomewide association studies (GWASs) have identified a number of putative risk loci for alcohol dependence (AD). However, only a few loci have replicated and these replicated variants only explain a small proportion of AD risk. Using an innovative approach, the goal of this study was to generate hypotheses about potentially causal variants for AD that can be explored further through functional studies. We employed targeted capture of 71 candidate loci and flanking regions followed by next-generation deep sequencing (mean coverage 78X) in 806 European Americans. Regions included in our targeted capture library were genes identified through published GWAS of alcohol, all human alcohol and aldehyde dehydrogenases, reward system genes including dopaminergic and opioid receptors, prioritized candidate genes based on previous associations, and genes involved in the absorption, distribution, metabolism, and excretion of drugs. We performed single-locus tests to determine if any single variant was associated with AD symptom count. Sets of variants that overlapped with biologically meaningful annotations were tested for association in aggregate. No single, common variant was significantly associated with AD in our study. We did, however, find evidence for association with several variant sets. Two variant sets were significant at the q-value <0.10 level: a genic enhancer for ADHFE1 (p = 1.47 × 10 -5 ; q = 0.019), an alcohol dehydrogenase, and ADORA1 (p = 5.29 × 10 -5 ; q = 0.035), an adenosine receptor that belongs to a G-protein-coupled receptor gene family. To our knowledge, this is the first sequencing study of AD to examine variants in entire genes, including flanking and regulatory regions. We found that in addition to protein coding variant sets, regulatory variant sets may play a role in AD. From these findings, we have generated initial functional hypotheses about how these sets may influence AD. Copyright © 2017 by the Research Society on
Hitchen, Trevor; Metcalfe, Judith
1987-01-01
Describes a simulation of the results of real experiments which use different strains of Escherichia coli. Provides an inexpensive practical problem-solving exercise to aid the teaching and understanding of the Jacob and Monod model of gene regulation. (Author/CW)
Fast and efficient Drosophila melanogaster gene knock-ins using MiMIC transposons.
Vilain, Sven; Vanhauwaert, Roeland; Maes, Ine; Schoovaerts, Nils; Zhou, Lujia; Soukup, Sandra; da Cunha, Raquel; Lauwers, Elsa; Fiers, Mark; Verstreken, Patrik
2014-10-08
Modern molecular genetics studies necessitate the manipulation of genes in their endogenous locus, but most of the current methodologies require an inefficient donor-dependent homologous recombination step to locally modify the genome. Here we describe a methodology to efficiently generate Drosophila knock-in alleles by capitalizing on the availability of numerous genomic MiMIC transposon insertions carrying recombinogenic attP sites. Our methodology entails the efficient PhiC31-mediated integration of a recombination cassette flanked by unique I-SceI and/or I-CreI restriction enzyme sites into an attP-site. These restriction enzyme sites allow for double-strand break-mediated removal of unwanted flanking transposon sequences, while leaving the desired genomic modifications or recombination cassettes. As a proof-of-principle, we mutated LRRK, tau, and sky by using different MiMIC elements. We replaced 6 kb of genomic DNA encompassing the tau locus and 35 kb encompassing the sky locus with a recombination cassette that permits easy integration of DNA at these loci and we also generated a functional LRRK(HA) knock in allele. Given that ~92% of the Drosophila genes are located within the vicinity (MiMIC element, our methodology enables the efficient manipulation of nearly every locus in the fruit fly genome without the need for inefficient donor-dependent homologous recombination events. Copyright © 2014 Vilain et al.
How many 5S rRNA genes and pseudogenes are there in ''Aspergillus nidulans''?
International Nuclear Information System (INIS)
Pelczar, P.; Fiett, J.; Bartnik, E.
1994-01-01
We have estimated the number of 5S rRNA genes in ''Aspergillus nidulans'' using two-dimensional agarose gel electrophoresis and hybridization to appropriate probes, representing the 5'-halves, the 3'-halves of the 5S rRNA sequence and a sequence found at the 3'-end of all known. ''A. nidulans'' pseudogenes (block C). We have found 23 5S rRNA genes, 15 pseudogenes consisting of the 5'-half of the 5S rRNA sequence (of which 3 are flanked by block C) and 12 copies of block C which do not seem to be in the vicinity of 5S rRNA sequences. This number of genes is much lower than our earlier estimates, and makes our previously analyzed sample of 9 sequenced genes and 3 pseudogenes much more representative. (author). 7 refs, 1 fig
DEFF Research Database (Denmark)
Nilsson, Dan; Hove-Jensen, Bjarne
1987-01-01
The gene (prs) encoding phosphoribosylpyrophosphate (PRPP) synthetase has been cloned from a library of Bacillus subtilis DNA by complementation of an Escherichia coli prs mutation. Flanking DNA sequences were pruned away by restriction endonuclease and exonuclease BAL 31 digestions, resulting...... in a DNA fragment of approx. 1.8 kb complementing the E. coli prs mutation. Minicell experiments revealed that this DNA fragment coded for a polypeptide, shown to be the PRPP synthetase subunit, with an Mr of approx. 40,000. B. subtilis strains harbouring the prs gene in a multicopy plasmid contained up...... to nine-fold increased PRPP synthetase activity. The prs gene was cloned in an integration vector and the resulting hybrid plasmid inserted into the B. subtilis chromosome by homologous recombination. The integration site was mapped by transduction and the gene order established as purA-guaA-prs-cysA....
Transcriptional activation of the mouse obese (ob) gene by CCAAT/enhancer binding protein alpha
DEFF Research Database (Denmark)
Hwang, C S; Mandrup, S; MacDougald, O A
1996-01-01
Like other adipocyte genes that are transcriptionally activated by CCAAT/enhancer binding protein alpha (C/EBP alpha) during preadipocyte differentiation, expression of the mouse obese (ob) gene is immediately preceded by the expression of C/EBP alpha. While the 5' flanking region of the mouse ob...... gene contains several consensus C/EBP binding sites, only one of these sites appears to be functional. DNase I cleavage inhibition patterns (footprinting) of the ob gene promoter revealed that recombinant C/EBP alpha, as well as a nuclear factor present in fully differentiated 3T3-L1 adipocytes...... to a consensus C/EBP binding site at nucleotides -55 to -47 generated a specific protein-oligonucleotide complex that was supershifted by antibody against C/EBP alpha. Probes corresponding to two upstream consensus C/EBP binding sites failed to generate protein-oligonucleotide complexes. Cotransfection of a C...
Directory of Open Access Journals (Sweden)
R. Paris
2014-05-01
Full Text Available Tsunamis related to volcano flank collapse are typically a high-magnitude, low frequency hazard for which evaluation and mitigation are difficult to address. In this short communication, we present field evidences of a large tsunami along the southern coast of Mauritius Island ca. 4400 years ago. Tsunami deposits described include both marine conglomerates and coral boulders up to 90 m3 (> 100 tons. The most probable origin of the tsunami is a flank collapse of Piton de la Fournaise volcano, Réunion Island.
Lee, M O; Liu, Y; Zhang, X K
1995-01-01
The lactoferrin gene is highly expressed in many different tissues, and its expression is controlled by different regulators. In this report, we have defined a retinoic acid response element (RARE) in the 5'-flanking region of the lactoferrin gene promoter. The lactoferrin-RARE is composed of two AGGTCA-like motifs arranged as a direct repeat with 1-bp spacing (DR-1). A gel retardation assay demonstrated that it bound strongly with retinoid X receptor (RXR) homodimers and RXR-retinoic acid re...
Norrie disease and MAO genes: nearest neighbors.
Chen, Z Y; Denney, R M; Breakefield, X O
1995-01-01
The Norrie disease and MAO genes are tandemly arranged in the p11.4-p11.3 region of the human X chromosome in the order tel-MAOA-MAOB-NDP-cent. This relationship is conserved in the mouse in the order tel-MAOB-MAOA-NDP-cent. The MAO genes appear to have arisen by tandem duplication of an ancestral MAO gene, but their positional relationship to NDP appears to be random. Distinctive X-linked syndromes have been described for mutations in the MAOA and NDP genes, and in addition, individuals have been identified with contiguous gene syndromes due to chromosomal deletions which encompass two or three of these genes. Loss of function of the NDP gene causes a syndrome of congenital blindness and progressive hearing loss, sometimes accompanied by signs of CNS dysfunction, including variable mental retardation and psychiatric symptoms. Other mutations in the NDP gene have been found to underlie another X-linked eye disease, exudative vitreo-retinopathy. An MAOA deficiency state has been described in one family to date, with features of altered amine and amine metabolite levels, low normal intelligence, apparent difficulty in impulse control and cardiovascular difficulty in affected males. A contiguous gene syndrome in which all three genes are lacking, as well as other as yet unidentified flanking genes, results in severe mental retardation, small stature, seizures and congenital blindness, as well as altered amine and amine metabolites. Issues that remain to be resolved are the function of the NDP gene product, the frequency and phenotype of the MAOA deficiency state, and the possible occurrence and phenotype of an MAOB deficiency state.
Energy Technology Data Exchange (ETDEWEB)
Werner, C.; Goff, F. [Los Alamos National Lab., NM (United States); Janik, C.J. [Geological Survey, Menlo Park, CA (United States)] [and others
1997-06-01
Popocatepetl Volcano is potentially devastating to populations living in the greater Mexico City area. Systematic monitoring of fumarole gases and flanking thermal/mineral springs began in early 1994 after increased fumarolic and seismic activity were noticed in 1991. These investigations had two major objectives: (1) to determine if changes in magmatic conditions beneath Popocatepetl might be reflected by chemical changes in fumarolic discharges and (2) to determine if thermal/mineral spring waters in the vicinity of Popocatepetl are geochemically related to or influences by the magmatic system. This report summarizes results from these two discrete studies.
Zhang, Xiaobing; Tang, Qiaoling; Wang, Xujing; Wang, Zhixing
2016-01-01
In this study, the flanking sequence of an inserted fragment conferring glyphosate tolerance on transgenic cotton line BG2-7 was analyzed by thermal asymmetric interlaced polymerase chain reaction (TAIL-PCR) and standard PCR. The results showed apparent insertion of the exogenous gene into chromosome D10 of the Gossypium hirsutum L. genome, as the left and right borders of the inserted fragment are nucleotides 61,962,952 and 61,962,921 of chromosome D10, respectively. In addition, a 31-bp cotton microsatellite sequence was noted between the genome sequence and the 5' end of the exogenous gene. In total, 84 and 298 bp were deleted from the left and right borders of the exogenous gene, respectively, with 30 bp deleted from the cotton chromosome at the insertion site. According to the flanking sequence obtained, several pairs of event-specific detection primers were designed to amplify sequence between the 5' end of the exogenous gene and the cotton genome junction region as well as between the 3' end and the cotton genome junction region. Based on screening tests, the 5'-end primers GTCATAACGTGACTCCCTTAATTCTCC/CCTATTACACGGCTATGC and 3'-end primers TCCTTTCGCTTTCTTCCCTT/ACACTTACATGGCGTCTTCT were used to detect the respective BG2-7 event-specific primers. The limit of detection of the former primers reached 44 copies, and that of the latter primers reached 88 copies. The results of this study provide useful data for assessment of BG2-7 safety and for accelerating its industrialization.
Directory of Open Access Journals (Sweden)
Trudy M. Wassenaar
2016-09-01
Full Text Available Resistance of Staphylococcus species to quaternary ammonium compounds, frequently used as disinfectants and biocides, can be attributed to qac genes. These qac gene products belong to the Small Multidrug Resistant (SMR protein family, and are often encoded by rolling-circle (RC replicating plasmids. Four classes of SMR-type qac gene families have been described in Staphylococcus species: qacC, qacG, qacJ and qacH. Within their class, these genes are highly conserved, but qacC genes are extremely conserved, although they are found in variable plasmid backgrounds. The lower degree of sequence identity of these plasmids compared to the strict nucleotide conservation of their qacC means that this gene has recently spread. In the absence of insertion sequences or other genetic elements explaining the mobility, we sought for an explanation of mobilization by sequence comparison. Publically available sequences of qac genes, their flanking genes and the replication gene that is invariably present in RC-plasmids were compared to reconstruct the evolutionary history of these plasmids and to explain the recent spread of qacC. Here we propose a new model that explains how qacC is mobilized and transferred to acceptor RC-plasmids without assistance of other genes, by means of its location in between the Double Strand replication Origin (DSO and the Single-Strand replication Origin (SSO. The proposed mobilization model of this DSO-qacC-SSO element represents a novel mechanism of gene mobilization in RC-plasmids, which has also been employed by other genes, such as lnuA (conferring lincomycin resistance. The proposed gene mobility has aided to the wide spread of clinically relevant resistance genes in Staphylococcus populations.
Nucleotide sequence of a human tRNA gene heterocluster
International Nuclear Information System (INIS)
Chang, Y.N.; Pirtle, I.L.; Pirtle, R.M.
1986-01-01
Leucine tRNA from bovine liver was used as a hybridization probe to screen a human gene library harbored in Charon-4A of bacteriophage lambda. The human DNA inserts from plaque-pure clones were characterized by restriction endonuclease mapping and Southern hybridization techniques, using both [3'- 32 P]-labeled bovine liver leucine tRNA and total tRNA as hybridization probes. An 8-kb Hind III fragment of one of these γ-clones was subcloned into the Hind III site of pBR322. Subsequent fine restriction mapping and DNA sequence analysis of this plasmid DNA indicated the presence of four tRNA genes within the 8-kb DNA fragment. A leucine tRNA gene with an anticodon of AAG and a proline tRNA gene with an anticodon of AGG are in a 1.6-kb subfragment. A threonine tRNA gene with an anticodon of UGU and an as yet unidentified tRNA gene are located in a 1.1-kb subfragment. These two different subfragments are separated by 2.8 kb. The coding regions of the three sequenced genes contain characteristic internal split promoter sequences and do not have intervening sequences. The 3'-flanking region of these three genes have typical RNA polymerase III termination sites of at least four consecutive T residues
Characterization of an ancient lepidopteran lateral gene transfer.
Directory of Open Access Journals (Sweden)
David Wheeler
Full Text Available Bacteria to eukaryote lateral gene transfers (LGT are an important potential source of material for the evolution of novel genetic traits. The explosion in the number of newly sequenced genomes provides opportunities to identify and characterize examples of these lateral gene transfer events, and to assess their role in the evolution of new genes. In this paper, we describe an ancient lepidopteran LGT of a glycosyl hydrolase family 31 gene (GH31 from an Enterococcus bacteria. PCR amplification between the LGT and a flanking insect gene confirmed that the GH31 was integrated into the Bombyx mori genome and was not a result of an assembly error. Database searches in combination with degenerate PCR on a panel of 7 lepidopteran families confirmed that the GH31 LGT event occurred deep within the Order approximately 65-145 million years ago. The most basal species in which the LGT was found is Plutella xylostella (superfamily: Yponomeutoidea. Array data from Bombyx mori shows that GH31 is expressed, and low dN/dS ratios indicates the LGT coding sequence is under strong stabilizing selection. These findings provide further support for the proposition that bacterial LGTs are relatively common in insects and likely to be an underappreciated source of adaptive genetic material.
National Oceanic and Atmospheric Administration, Department of Commerce — The project restored both structural and habitat functions of Bayou Dupont and flanking marshes. The project created and nourished marsh and restored a ridge on the...
Directory of Open Access Journals (Sweden)
Li Xianchun
2007-03-01
Full Text Available Abstract Background Transposons, i.e. transposable elements (TEs, are the major internal spontaneous mutation agents for the variability of eukaryotic genomes. To address the general issue of whether transposons mediate genomic changes in environment-adaptation genes, we scanned two alleles per each of the six xenobiotic-metabolizing Helicoverpa zea cytochrome P450 loci, including CYP6B8, CYP6B27, CYP321A1, CYP321A2, CYP9A12v3 and CYP9A14, for the presence of transposon insertions by genome walking and sequence analysis. We also scanned thirteen Drosophila melanogaster P450s genes for TE insertions by in silico mapping and literature search. Results Twelve novel transposons, including LINEs (long interspersed nuclear elements, SINEs (short interspersed nuclear elements, MITEs (miniature inverted-repeat transposable elements, one full-length transib-like transposon, and one full-length Tcl-like DNA transpson, are identified from the alleles of the six H. zea P450 genes. The twelve transposons are inserted into the 5'flanking region, 3'flanking region, exon, or intron of the six environment-adaptation P450 genes. In D. melanogaster, seven out of the eight Drosophila P450s (CYP4E2, CYP6A2, CYP6A8, CYP6A9, CYP6G1, CYP6W1, CYP12A4, CYP12D1 implicated in insecticide resistance are associated with a variety of transposons. By contrast, all the five Drosophila P450s (CYP302A1, CYP306A1, CYP307A1, CYP314A1 and CYP315A1 involved in ecdysone biosynthesis and developmental regulation are free of TE insertions. Conclusion These results indicate that TEs are selectively retained within or in close proximity to xenobiotic-metabolizing P450 genes.
Directory of Open Access Journals (Sweden)
Strassmann Joan E
2004-03-01
Full Text Available Abstract Background Social wasps in the subfamily Polistinae (Hymenoptera: Vespidae have been important in studies of the evolution of sociality, kin selection, and within colony conflicts of interest. These studies have generally been conducted within species, because a resolved phylogeny among species is lacking. We used nuclear DNA microsatellite flanking sequences, mitochondrial COI sequence, and morphological characters to generate a phylogeny for the Polistinae (Hymenoptera using 69 species. Results Our phylogeny is largely concordant with previous phylogenies at higher levels, and is more resolved at the species level. Our results support the monophyly of the New World subgenera of Polistini, while the Old World subgenera are a paraphyletic group. All genera for which we had more than one exemplar were supported as monophyletic except Polybia which is not resolved, and may be paraphyletic. Conclusion The combination of DNA sequences from flanks of microsatellite repeats with mtCOI sequences and morphological characters proved to be useful characters establishing relationships among the different subgenera and species of the Polistini. This is the first detailed hypothesis for the species of this important group.
Plasma wave profiles of Earth's bow shock at low Mach number: ISEE 3 observations on the far flank
International Nuclear Information System (INIS)
Greenstadt, E.W.; Coroniti, F.V.; Moses, S.L.; Smith, E.J.
1992-01-01
The Earth's bow shock is weak along its distant flanks where the projected component of solar wind velocity normal to the hyperboloidal surface is only a fraction of the total free stream velocity, severely reducing the local Mach number. The authors present a survey of selected crossings far downstream from the subsolar shock, delineating the overall plasma wave (pw) behavior of a selected set of nearly perpendicular crossings and another set of limited Mach number but broad geometry; they include their immediate upstream regions. The result is a generalizable pw signature, or signatures, of low Mach number shocks and some likely implications of those signatures for the weak shock's plasma physical processes on the flank. They find the data consistent with the presence of ion beam interactions producing noise ahead of the shock in the ion acoustic frequency range. One subcritical case was found whose pw noise was presumably related to a reflected ion population just as in stronger events. The presence or absence, and the amplitudes, of pw activity are explainable by the presence or absence of a population of upstream ions controlled by the component of interplanetary magnetic field normal to the solar wind flow
Directory of Open Access Journals (Sweden)
Mette L Schousboe
2015-11-01
Full Text Available Chloroquine combined with primaquine has been the recommended antimalarial treatment of Plasmodium vivax malaria infections for six decades but the efficacy of this treatment regimen is threatened by chloroquine resistance (CQR. Single nucleotide polymorphisms (SNPs in the multidrug resistance gene, Pvmdr1 are putative determinants of CQR but the extent of their emergence at population level remains to be explored.In this study we describe the prevalence of SNPs in the Pvmdr1 among samples collected in seven P. vivax endemic countries and we looked for molecular evidence of drug selection by characterising polymorphism at microsatellite (MS loci flanking the Pvmdr1 gene.We examined the prevalence of SNPs in the Pvmdr1 gene among 267 samples collected from Pakistan, Afghanistan, Sri Lanka, Nepal, Sudan, São Tomé and Ecuador. We measured and diversity in four microsatellite (MS markers flanking the Pvmdr1 gene to look evidence of selection on mutant alleles.SNP polymorphism in the Pvmdr1 gene was largely confined to codons T958M, Y976F and F1076L. Only 2.4% of samples were wildtype at all three codons (TYF, n = 5, 13.3% (n = 28 of the samples were single mutant MYF, 63.0% of samples (n = 133 were double mutant MYL, and 21.3% (n = 45 were triple mutant MFL. Clear geographic differences in the prevalence of these Pvmdr mutation combinations were observed. Significant linkage disequilibrium (LD between Pvmdr1 and MS alleles was found in populations sampled in Ecuador, Nepal and Sri Lanka, while significant LD between Pvmdr1 and the combined 4 MS locus haplotype was only seen in Ecuador and Sri Lanka. When combining the 5 loci, high level diversity, measured as expected heterozygosity (He, was seen in the complete sample set (He = 0.99, while He estimates for individual loci ranged from 0.00-0.93. Although Pvmdr1 haplotypes were not consistently associated with specific flanking MS alleles, there was significant differentiation between geographic
He, Huagang; Zhu, Shanying; Jiang, Zhengning; Ji, Yaoyong; Wang, Feng; Zhao, Renhui; Bie, Tongde
2016-04-01
The powdery mildew resistance gene Pm21 was physically and comparatively mapped by newly developed markers. Seven candidate genes were verified to be required for Pm21 -mediated resistance to wheat powdery mildew. Pm21, a gene derived from wheat wild relative Dasypyrum villosum, has been transferred into common wheat and widely utilized in wheat resistance breeding for powdery mildew. Previously, Pm21 has been located to the bin FL0.45-0.58 of 6VS by using deletion stocks. However, its fine mapping is still a hard work. In the present study, 30 gene-derived 6VS-specific markers were obtained based on the collinearity among genomes of Brachypodium distachyon, Oryza and Triticeae, and then physically and comparatively mapped in the bin FL0.45-0.58 and its nearby chromosome region. According to the maps, the bin FL0.45-0.58 carrying Pm21 was closely flanked by the markers 6VS-03 and 6VS-23, which further narrowed the orthologous regions to 1.06 Mb in Brachypodium and 1.38 Mb in rice, respectively. Among the conserved genes shared by Brachypodium and rice, four serine/threonine protein kinase genes (DvMPK1, DvMLPK, DvUPK and DvPSYR1), one protein phosphatase gene (DvPP2C) and two transcription factor genes (DvGATA and DvWHY) were confirmed to be required for Pm21-mediated resistance to wheat powdery mildew by barley stripe mosaic virus-induced gene silencing (BSMV-VIGS) and transcriptional pattern analyses. In summary, this study gives new insights into the genetic basis of the Pm21 locus and the disease resistance pathways mediated by Pm21.
Kitani, Y
1978-07-01
From the analysis of large samples of gene conversion asci in the g locus of Sordaria fimicola, it was found that neither the conversion event itself nor conversion-associated recombination of flanking markers cause either chiasma or chromatid interference with crossing over in a neighboring interval. The presence of more than one kind of crossover event, one causing interference the other not, is considered. The existence of two kinds of gene loci, one of single-cistron composition and the other of multiple-cistron composition, is discussed in relation to reciprocal recombination within a locus.
5' Region of the human interleukin 4 gene: structure and potential regulatory elements
Energy Technology Data Exchange (ETDEWEB)
Eder, A; Krafft-Czepa, H; Krammer, P H
1988-01-25
The lymphokine Interleukin 4 (IL-4) is secreted by antigen or mitogen activated T lymphocytes. IL-4 stimulates activation and differentiation of B lymphocytes and growth of T lymphocytes and mast cells. The authors isolated the human IL-4 gene from a lambda EMBL3 genomic library. As a probe they used a synthetic oligonucleotide spanning position 40 to 79 of the published IL-4 cDNA sequence. The 5' promoter region contains several sequence elements which may have a cis-acting regulatory function for IL-4 gene expression. These elements include a TATA-box, three CCAAT-elements (two are on the non-coding strand) and an octamer motif. A comparison of the 5' flanking region of the human murine IL-4 gene (4) shows that the region between position -306 and +44 is highly conserved (83% homology).
Pennings, R J E; Kremer, H; Deutman, A F; Kimberling, W J; Cremers, C W R J
2002-12-07
Usher syndrome is an autosomal recessively inherited disease, characterised by sensorineural hearing loss, tapetoretinal degeneration and in some cases vestibular problems. Based on the clinical heterogeneity, the disease can be classified into three clinical types (I, II and III), which have their own genetic subtypes (Usher 1A-Usher IG, Usher 2A-Usher 2C and Usher 3). The majority of the Usher type I cases are caused by mutations in the MYO7A gene (Usher 1B) while mutations in the USH2A gene (Usher 2A) are the cause of most cases of type II. Usher syndrome type III, caused by mutations in the USH3 gene, is frequently seen only in Finland.
Zang, Wen; Eckstein, Peter E; Colin, Mark; Voth, Doug; Himmelbach, Axel; Beier, Sebastian; Stein, Nils; Scoles, Graham J; Beattie, Aaron D
2015-07-01
The candidate gene for the barley Un8 true loose smut resistance gene encodes a deduced protein containing two tandem protein kinase domains. In North America, durable resistance against all known isolates of barley true loose smut, caused by the basidiomycete pathogen Ustilago nuda (Jens.) Rostr. (U. nuda), is under the control of the Un8 resistance gene. Previous genetic studies mapped Un8 to the long arm of chromosome 5 (1HL). Here, a population of 4625 lines segregating for Un8 was used to delimit the Un8 gene to a 0.108 cM interval on chromosome arm 1HL, and assign it to fingerprinted contig 546 of the barley physical map. The minimal tilling path was identified for the Un8 locus using two flanking markers and consisted of two overlapping bacterial artificial chromosomes. One gene located close to a marker co-segregating with Un8 showed high sequence identity to a disease resistance gene containing two kinase domains. Sequence of the candidate gene from the parents of the segregating population, and in an additional 19 barley lines representing a broader spectrum of diversity, showed there was no intron in alleles present in either resistant or susceptible lines, and fifteen amino acid variations unique to the deduced protein sequence in resistant lines differentiated it from the deduced protein sequences in susceptible lines. Some of these variations were present within putative functional domains which may cause a loss of function in the deduced protein sequences within susceptible lines.
International Nuclear Information System (INIS)
Gentile, R.; Fucks, E.; De Francesco, F.
2004-01-01
Pleistocene and Holocene superficial deposits, which have been recognized in an area of 1500 km2 in the northeast flank of Sierras Australes, are characterized. In divide they are underlain by silts and siltstone which are called Sediments Pampeanas. There, a lower sequence, consisting mainly of aeolian sediments (loess) with scarce fluvial deposits and diamictons, was recognized. In some places an upper sequence that is product of aeolian and anthropogenic activity, was also recognized. In the valley sequences, the loess deposits can not only be underlain by fluvial sediments but can also overlain them. The more recent fluvial deposits which have eroded loess sequences are of the post conquest age [es
Flank pseudohernia following posterior rib fracture: a case report.
Butensky, Adam M; Gruss, Leah P; Gleit, Zachary L
2016-10-01
A pseudohernia is an abdominal wall bulge that may be mistaken for a hernia but that lacks the disruption of the abdominal wall that characterizes a hernia. Thus, the natural history and treatment of this condition differ from those of a hernia. This is the first report of a pseudohernia due to cough-associated rib fracture. A case of pseudohernia due to fractures of the 10 th and 11 th ribs in a 68-year-old white woman is presented. The patient suffered from a major coughing episode 1 year prior to her presentation, after which she noted a progressively enlarging bulge in her left flank. Computed tomography demonstrated a bulge in the abdominal wall containing bowel and spleen but with all muscle and fascial layers intact; in addition, lateral 10 th rib and posterior 11 th rib fractures were noted. As there was no defect in muscle or fascia, we diagnosed a pseudohernia, likely due to a denervation injury from the fractured ribs. Symptomatic treatment was recommended, including wearing a corset and referral to a pain management clinic. Symptomatic treatment is thought to be the mainstay of therapy for pseudohernias, as surgical intervention is unlikely to be of benefit.
Directory of Open Access Journals (Sweden)
Chung I-Fang
2008-10-01
Full Text Available Abstract Background The Signal-to-Noise-Ratio (SNR is often used for identification of biomarkers for two-class problems and no formal and useful generalization of SNR is available for multiclass problems. We propose innovative generalizations of SNR for multiclass cancer discrimination through introduction of two indices, Gene Dominant Index and Gene Dormant Index (GDIs. These two indices lead to the concepts of dominant and dormant genes with biological significance. We use these indices to develop methodologies for discovery of dominant and dormant biomarkers with interesting biological significance. The dominancy and dormancy of the identified biomarkers and their excellent discriminating power are also demonstrated pictorially using the scatterplot of individual gene and 2-D Sammon's projection of the selected set of genes. Using information from the literature we have shown that the GDI based method can identify dominant and dormant genes that play significant roles in cancer biology. These biomarkers are also used to design diagnostic prediction systems. Results and discussion To evaluate the effectiveness of the GDIs, we have used four multiclass cancer data sets (Small Round Blue Cell Tumors, Leukemia, Central Nervous System Tumors, and Lung Cancer. For each data set we demonstrate that the new indices can find biologically meaningful genes that can act as biomarkers. We then use six machine learning tools, Nearest Neighbor Classifier (NNC, Nearest Mean Classifier (NMC, Support Vector Machine (SVM classifier with linear kernel, and SVM classifier with Gaussian kernel, where both SVMs are used in conjunction with one-vs-all (OVA and one-vs-one (OVO strategies. We found GDIs to be very effective in identifying biomarkers with strong class specific signatures. With all six tools and for all data sets we could achieve better or comparable prediction accuracies usually with fewer marker genes than results reported in the literature using the
[Norrie syndrome: identification of carriers by segregation analysis with flanking DNA markers].
Körner, J; Uhlhaas, S; Neugebauer, M; Gal, A
1989-01-01
Norrie disease is an X-linked recessive disorder. Affected males present with congenital blindness. Additionally, hearing loss and psychotic behavior may occur at any time. Since carriers are clinically healthy, they can only be identified by genetic means. Daughters of carriers or sisters of affected males have an à priori 50% risk of being carriers themselves. Close linkage has been found between the Norrie disease locus (NDP) and the DNA locus DXS7 mapped to Xp11.3. For genetic counselling, this linkage relationship allows carriers of the disease to be identified in informative families. We describe a large pedigree with Norrie disease. Segregation analysis was carried out with DXS7 and a second flanking marker, DXS255, both linked to NDP. In this way, three females at risk were identified who had a high probability of being carriers for Norrie disease.
Epigenetic interplay between mouse endogenous retroviruses and host genes.
Rebollo, Rita; Miceli-Royer, Katharine; Zhang, Ying; Farivar, Sharareh; Gagnier, Liane; Mager, Dixie L
2012-10-03
Transposable elements are often the targets of repressive epigenetic modifications such as DNA methylation that, in theory, have the potential to spread toward nearby genes and induce epigenetic silencing. To better understand the role of DNA methylation in the relationship between transposable elements and genes, we assessed the methylation state of mouse endogenous retroviruses (ERVs) located near genes. We found that ERVs of the ETn/MusD family show decreased DNA methylation when near transcription start sites in tissues where the nearby gene is expressed. ERVs belonging to the IAP family, however, are generally heavily methylated, regardless of the genomic environment and the tissue studied. Furthermore, we found full-length ETn and IAP copies that display differential DNA methylation between their two long terminal repeats (LTRs), suggesting that the environment surrounding gene promoters can prevent methylation of the nearby LTR. Spreading from methylated ERV copies to nearby genes was rarely observed, with the regions between the ERVs and genes apparently acting as a boundary, enriched in H3K4me3 and CTCF, which possibly protects the unmethylated gene promoter. Furthermore, the flanking regions of unmethylated ERV copies harbor H3K4me3, consistent with spreading of euchromatin from the host gene toward ERV insertions. We have shown that spreading of DNA methylation from ERV copies toward active gene promoters is rare. We provide evidence that genes can be protected from ERV-induced heterochromatin spreading by either blocking the invasion of repressive marks or by spreading euchromatin toward the ERV copy.
Meireles, C M; Schneider, M P; Sampaio, M I; Schneider, H; Slightom, J L; Chiu, C H; Neiswanger, K; Gumucio, D L; Czelusniak, J; Goodman, M
1995-01-01
Conclusive evidence was provided that gamma 1, the upstream of the two linked simian gamma-globin loci (5'-gamma 1-gamma 2-3'), is a pseudogene in a major group of New World monkeys. Sequence analysis of PCR-amplified genomic fragments of predicted sizes revealed that all extant genera of the platyrrhine family Atelidae [Lagothrix (woolly monkeys), Brachyteles (woolly spider monkeys), Ateles (spider monkeys), and Alouatta (howler monkeys)] share a large deletion that removed most of exon 2, all of intron 2 and exon 3, and much of the 3' flanking sequence of gamma 1. The fact that two functional gamma-globin genes were not present in early ancestors of the Atelidae (and that gamma 1 was the dispensible gene) suggests that for much or even all of their evolution, platyrrhines have had gamma 2 as the primary fetally expressed gamma-globin gene, in contrast to catarrhines (e.g., humans and chimpanzees) that have gamma 1 as the primary fetally expressed gamma-globin gene. Results from promoter sequences further suggest that all three platyrrhine families (Atelidae, Cebidae, and Pitheciidae) have gamma 2 rather than gamma 1 as their primary fetally expressed gamma-globin gene. The implications of this suggestion were explored in terms of how gene redundancy, regulatory mutations, and distance of each gamma-globin gene from the locus control region were possibly involved in the acquisition and maintenance of fetal, rather than embryonic, expression. Images Fig. 2 PMID:7535927
Analysis of the reptile CD1 genes: evolutionary implications.
Yang, Zhi; Wang, Chunyan; Wang, Tao; Bai, Jianhui; Zhao, Yu; Liu, Xuhan; Ma, Qingwei; Wu, Xiaobing; Guo, Ying; Zhao, Yaofeng; Ren, Liming
2015-06-01
CD1, as the third family of antigen-presenting molecules, is previously only found in mammals and chickens, which suggests that the chicken and mammalian CD1 shared a common ancestral gene emerging at least 310 million years ago. Here, we describe CD1 genes in the green anole lizard and Crocodylia, demonstrating that CD1 is ubiquitous in mammals, birds, and reptiles. Although the reptilian CD1 protein structures are predicted to be similar to human CD1d and chicken CD1.1, CD1 isotypes are not found to be orthologous between mammals, birds, and reptiles according to phylogenetic analyses, suggesting an independent diversification of CD1 isotypes during the speciation of mammals, birds, and reptiles. In the green anole lizard, although the single CD1 locus and MHC I gene are located on the same chromosome, there is an approximately 10-Mb-long sequence in between, and interestingly, several genes flanking the CD1 locus belong to the MHC paralogous region on human chromosome 19. The CD1 genes in Crocodylia are located in two loci, respectively linked to the MHC region and MHC paralogous region (corresponding to the MHC paralogous region on chromosome 19). These results provide new insights for studying the origin and evolution of CD1.
Harp, A. G.; Valentine, G. A.
2018-06-01
In the article "Emplacement controls for the basaltic-andesitic radial dikes of Summer Coon volcano and implications for flank vents at stratovolcanoes", the vertical axis for Fig. 8 a was incorrectly labeled (i.e., the value for dikes per km2).
A new mathematical model of the surface degradation causing wear on the cutting tool`s flank land
Pаlmai, Z.
2011-01-01
Having reviewed the extensive literature on the wear of the cutting tool, we chose the theoretical description of flank wear as the subject matter of this paper. Based on the optical electron-optical and morphological studies of the physical characteristics of wear processes we came to the conclusion that the cutting distance need not only be taken into consideration in abrasive, adhesive processes but also in thermally activated diffusion, oxidation processes. Consequently, we propose the ap...
National Oceanic and Atmospheric Administration, Department of Commerce — The project restored both structural and habitat functions of Grand Liard Bayou and flanking marshes. The project created and nourished marsh and restored a ridge on...
Kumar, Kamal; Srivastava, Vikas; Purayannur, Savithri; Kaladhar, V Chandra; Cheruvu, Purnima Jaiswal; Verma, Praveen Kumar
2016-06-01
The WRKY genes have been identified as important transcriptional modulators predominantly during the environmental stresses, but they also play critical role at various stages of plant life cycle. We report the identification of WRKY domain (WD)-encoding genes from galegoid clade legumes chickpea (Cicer arietinum L.) and barrel medic (Medicago truncatula). In total, 78 and 98 WD-encoding genes were found in chickpea and barrel medic, respectively. Comparative analysis suggests the presence of both conserved and unique WRKYs, and expansion of WRKY family in M. truncatula primarily by tandem duplication. Exclusively found in galegoid legumes, CaWRKY16 and its orthologues encode for a novel protein having a transmembrane and partial Exo70 domains flanking a group-III WD. Genomic region of galegoids, having CaWRKY16, is more dynamic when compared with millettioids. In onion cells, fused CaWRKY16-EYFP showed punctate fluorescent signals in cytoplasm. The chickpea WRKY group-III genes were further characterized for their transcript level modulation during pathogenic stress and treatments of abscisic acid, jasmonic acid, and salicylic acid (SA) by real-time PCR. Differential regulation of genes was observed during Ascochyta rabiei infection and SA treatment. Characterization of A. rabiei and SA inducible gene CaWRKY50 showed that it localizes to plant nucleus, binds to W-box, and have a C-terminal transactivation domain. Overexpression of CaWRKY50 in tobacco plants resulted in early flowering and senescence. The in-depth comparative account presented here for two legume WRKY genes will be of great utility in hastening functional characterization of crop legume WRKYs and will also help in characterization of Exo70Js. © The Author 2016. Published by Oxford University Press on behalf of Kazusa DNA Research Institute.
Liu, Xiao-Ping; Gao, Bao-Zhen; Han, Feng-Qing; Fang, Zhi-Yuan; Yang, Li-Mei; Zhuang, Mu; Lv, Hong-Hao; Liu, Yu-Mei; Li, Zhan-Sheng; Cai, Cheng-Cheng; Yu, Hai-Long; Li, Zhi-Yuan; Zhang, Yang-Yong
2017-03-14
Due to its variegated and colorful leaves, ornamental kale (Brassica oleracea L. var. acephala) has become a popular ornamental plant. In this study, we report the fine mapping and analysis of a candidate purple leaf gene using a backcross population and an F 2 population derived from two parental lines: W1827 (with white leaves) and P1835 (with purple leaves). Genetic analysis indicated that the purple leaf trait is controlled by a single dominant gene, which we named BoPr. Using markers developed based on the reference genome '02-12', the BoPr gene was preliminarily mapped to a 280-kb interval of chromosome C09, with flanking markers M17 and BoID4714 at genetic distances of 4.3 cM and 1.5 cM, respectively. The recombination rate within this interval is almost 12 times higher than the usual level, which could be caused by assembly error for reference genome '02-12' at this interval. Primers were designed based on 'TO1000', another B. oleracea reference genome. Among the newly designed InDel markers, BRID485 and BRID490 were found to be the closest to BoPr, flanking the gene at genetic distances of 0.1 cM and 0.2 cM, respectively; the interval between the two markers is 44.8 kb (reference genome 'TO1000'). Seven annotated genes are located within the 44.8 kb genomic region, of which only Bo9g058630 shows high homology to AT5G42800 (dihydroflavonol reductase), which was identified as a candidate gene for BoPr. Blast analysis revealed that this 44.8 kb interval is located on an unanchored scaffold (Scaffold000035_P2) of '02-12', confirming the existence of assembly error at the interval between M17 and BoID4714 for reference genome '02-12'. This study identified a candidate gene for BoPr and lays a foundation for the cloning and functional analysis of this gene.
Egervärn, M; Roos, S; Lindmark, H
2009-11-01
The study aimed to identify the resistance genes mediating atypical minimum inhibitory concentrations (MICs) for tetracycline, erythromycin, clindamycin and chloramphenicol within two sets of representative strains of the species Lactobacillus reuteri and Lactobacillus plantarum and to characterize identified genes by means of gene location and sequencing of flanking regions. A tet(W) gene was found in 24 of the 28 Lact. reuteri strains with atypical MIC for tetracycline, whereas four of the six strains with atypical MIC for erythromycin were positive for erm(B) and one strain each was positive for erm(C) and erm(T). The two Lact. plantarum strains with atypical MIC for tetracycline harboured a plasmid-encoded tet(M) gene. The majority of the tet(W)-positive Lact. reuteri strains and all erm-positive Lact. reuteri strains carried the genes on plasmids, as determined by Southern blot and a real-time PCR method developed in this study. Most of the antibiotic-resistant strains of Lact. reuteri and Lact. plantarum harboured known plasmid-encoded resistance genes. Examples of putative transfer machineries adjacent to both plasmid- and chromosome-located resistance genes were also demonstrated. These data provide some of the knowledge required for assessing the possible risk of using Lact. reuteri and Lact. plantarum strains carrying antibiotic resistance genes as starter cultures and probiotics.
Directory of Open Access Journals (Sweden)
Whittle Carrie A
2010-07-01
Full Text Available Abstract Background The self-fertile filamentous ascomycete Neurospora tetrasperma contains a large (~7 Mbp and young (mat chromosomes. The objective of the present study is to reveal the evolutionary history, including key genomic events, associated with the various regions of the mat chromosomes among ten strains representing all the nine known species (lineages contained within the N. tetrasperma species complex. Results Comparative analysis of sequence divergence among alleles of 24 mat-linked genes (mat A and mat a indicates that a large region of suppressed recombination exists within the mat chromosome for each of nine lineages of N. tetrasperma sensu latu. The recombinationally suppressed region varies in size and gene composition among lineages, and is flanked on both ends by normally recombining regions. Genealogical analyses among lineages reveals that eight gene conversion events have occurred between homologous mat A and mat a-linked alleles of genes located within the region of restricted recombination during the evolutionary history of N. tetrasperma. Conclusions We conclude that the region of suppressed recombination in the mat chromosomes has likely been subjected to independent contraction and/or expansion during the evolutionary history of the N. tetrasperma species complex. Furthermore, we infer that gene conversion events are likely a common phenomenon within this recombinationally suppressed genomic region. We argue that gene conversions might provide an efficient mechanism of adaptive editing of functional genes, including the removal of deleterious mutations, within the young recombinationally suppressed region of the mat chromosomes.
International Nuclear Information System (INIS)
Wang, Li-Jen; Wong, Yon-Cheong; Ng, Chip-Jin; Chen, Jih-Chang; Chiu, Te-Fa
2004-01-01
The aim of this study was to assess the usefulness of combined direct and indirect signs on intravenous urography (IVU) and unenhanced helical computed tomography (UHCT) for the diagnosis of ureteral stones in emergency patients with acute flank pain. During an 8-month period, 82 emergency patients with acute flank pain undergoing IVU and UHCT with sufficient clinical follow-up formed the study group. The presence or absence of direct sign (visualization of ureteral stones) and indirect signs on IVU and UHCT was recorded. The diagnostic accuracy of each direct/indirect sign and their combination for the diagnosis of ureteral stones on IVU and UHCT were analyzed and compared. Of the 82 patients, 66 had ureteral stones, four had passed urinary stones prior to imaging and 12 had other diseases. The diagnostic accuracies of direct signs on IVU and UHCT for the diagnosis of ureteral stones were 79.3 and 98.8%, respectively, which was more accurate than that of any single indirect sign on IVU and UHCT. However, the diagnostic accuracy of ureteral stones by IVU increased to 90.2% when using diagnostic criteria requiring the presence of a direct sign or at least three indirect signs, and by UHCT, it increased to 100% when using diagnostic criteria requiring the presence of a direct sign with at least one indirect sign. Therefore, for emergency patients with acute flank pain, the use of the above combinations of direct/indirect signs is useful as the diagnostic criterion for ureteral stones. (orig.)
Norini, Gianluca; de Beni, Emanuela; Andronico, Daniele; Polacci, Margherita; Burton, Mike; Zucca, Francesco
2009-02-01
On 16 November 2006 a flank collapse affected the unstable eastern slope of the South-East Crater (SEC) of Mount Etna. The collapse occurred during one of the paroxysmal events with sustained strombolian activity that characterized the August-December 2006 eruption and was triggered by erosion of loose, hydrothermally altered material of the steep south-east sector of SEC from the outpour of lava. The collapse produced a debris avalanche that involved both lithic and juvenile material and resulted in a deposit emplaced on the eastern flank of the volcano up to 1.2 km away from the source. The total volume of the deposit was estimated to be in the order of 330,000-413,000 m3. The reconstruction of the collapse event was simulated using TITAN2D software designed to model granular avalanches and landslides. This approach can be used to estimate areas that may be affected by similar collapse events in the future. The area affected by the 16 November 2006 lateral collapse of SEC was a small portion of the Mount Etna summit area, but the fact that no one was killed or injured should be considered fortuitous. The summit and adjacent areas of the volcano, in fact, are usually visited by many tourists who are not prepared to face this type of danger. The 16 November 2006 collapse points to the need to be prepared for similar events through scientific investigation (analysis of flank instability, numerical simulation of flows) and development of specific civil protection plans.
Tornow, J; Santangelo, G M
1994-06-01
A duplicate copy of the RPL37A gene (encoding ribosomal protein L37) was cloned and sequenced. The coding region of RPL37B is very similar to that of RPL37A, with only one conservative amino-acid difference. However, the intron and flanking sequences of the two genes are extremely dissimilar. Disruption experiments indicate that the two loci are not functionally equivalent: disruption of RPL37B was insignificant, but disruption of RPL37A severely impaired the growth rate of the cell. When both RPL37 loci are disrupted, the cell is unable to grow at all, indicating that rpL37 is an essential protein. The functional disparity between the two RPL37 loci could be explained by differential gene expression. The results of two experiments support this idea: gene fusion of RPL37A to a reporter gene resulted in six-fold higher mRNA levels than was generated by the same reporter gene fused to RPL37B, and a modest increase in gene dosage of RPL37B overcame the lack of a functional RPL37A gene.
Directory of Open Access Journals (Sweden)
Patricio Jeria Soto
2010-01-01
Full Text Available En este artículo se intenta mostrar la problematización del lenguaje y la práctica filosófica a propósito de las anécdotas de Diógenes de Sínope. Además, se plantea el problema de la relación entre lenguaje y realidad, sobre todo desde la óptica de la filosofía y su pretensión de sistematización de lo real. Finalmente, se señala la posibilidad de rastrear en Diógenes atisbos de una manera de hacer filosofía en la cual el mostrar, el ver y la interacción anteceden y encaminan al decir, a fin de evitar la reproducción de los vicios del lenguaje abstracto y universalista de la filosofía tradicional.In this article an attempt is made to show the problem of language and the philosophical practice related to the anecdotes of Diógenes of Sinope. The problem of the relation between language and reality is also studied, specially from a philosophical point of view and its intention of systematizing the real. Finally, the possibility of looking for traces of a way of philosophizing is pursued in Diógenes. In it, showing, seeing and interaction precede and open the way to saying, in order to reproduce the vices of the abstract and universal language of traditional philosophy.
A genome-wide characterization of microRNA genes in maize.
Directory of Open Access Journals (Sweden)
Lifang Zhang
2009-11-01
Full Text Available MicroRNAs (miRNAs are small, non-coding RNAs that play essential roles in plant growth, development, and stress response. We conducted a genome-wide survey of maize miRNA genes, characterizing their structure, expression, and evolution. Computational approaches based on homology and secondary structure modeling identified 150 high-confidence genes within 26 miRNA families. For 25 families, expression was verified by deep-sequencing of small RNA libraries that were prepared from an assortment of maize tissues. PCR-RACE amplification of 68 miRNA transcript precursors, representing 18 families conserved across several plant species, showed that splice variation and the use of alternative transcriptional start and stop sites is common within this class of genes. Comparison of sequence variation data from diverse maize inbred lines versus teosinte accessions suggest that the mature miRNAs are under strong purifying selection while the flanking sequences evolve equivalently to other genes. Since maize is derived from an ancient tetraploid, the effect of whole-genome duplication on miRNA evolution was examined. We found that, like protein-coding genes, duplicated miRNA genes underwent extensive gene-loss, with approximately 35% of ancestral sites retained as duplicate homoeologous miRNA genes. This number is higher than that observed with protein-coding genes. A search for putative miRNA targets indicated bias towards genes in regulatory and metabolic pathways. As maize is one of the principal models for plant growth and development, this study will serve as a foundation for future research into the functional roles of miRNA genes.
Huang, Jinqiang; Li, Yongjuan; Shao, Changwei; Wang, Na; Chen, Songlin
2017-06-20
The nanos gene encodes an RNA-binding zinc finger protein, which is required in the development and maintenance of germ cells. However, there is very limited information about nanos in flatfish, which impedes its application in fish breeding. In this study, we report the molecular cloning, characterization and functional analysis of the 3'-untranslated region of the nanos gene (Csnanos) from half-smooth tongue sole (Cynoglossus semilaevis), which is an economically important flatfish in China. The 1233-bp cDNA sequence, 1709-bp genomic sequence and flanking sequences (2.8-kb 5'- and 1.6-kb 3'-flanking regions) of Csnanos were cloned and characterized. Sequence analysis revealed that CsNanos shares low homology with Nanos in other species, but the zinc finger domain of CsNanos is highly similar. Phylogenetic analysis indicated that CsNanos belongs to the Nanos2 subfamily. Csnanos expression was widely detected in various tissues, but the expression level was higher in testis and ovary. During early development and sex differentiation, Csnanos expression exhibited a clear sexually dimorphic pattern, suggesting its different roles in the migration and differentiation of primordial germ cells (PGCs). Higher expression levels of Csnanos mRNA in normal females and males than in neomales indicated that the nanos gene may play key roles in maintaining the differentiation of gonad. Moreover, medaka PGCs were successfully labeled by the microinjection of synthesized mRNA consisting of green fluorescence protein and the 3'-untranslated region of Csnanos. These findings provide new insights into nanos gene expression and function, and lay the foundation for further study of PGC development and applications in tongue sole breeding. Copyright © 2017 Elsevier B.V. All rights reserved.
Polymorphism of BMP4 gene in Indian goat breeds differing in prolificacy.
Sharma, Rekha; Ahlawat, Sonika; Maitra, A; Roy, Manoranjan; Mandakmale, S; Tantia, M S
2013-12-10
Bone morphogenetic proteins (BMPs) are members of the TGF-β (transforming growth factor-beta) superfamily, of which BMP4 is the most important due to its crucial role in follicular growth and differentiation, cumulus expansion and ovulation. Reproduction is a crucial trait in goat breeding and based on the important role of BMP4 gene in reproduction it was considered as a possible candidate gene for the prolificacy of goats. The objective of the present study was to detect polymorphism in intronic, exonic and 3' un-translated regions of BMP4 gene in Indian goats. Nine different goat breeds (Barbari, Beetal, Black Bengal, Malabari, Jakhrana (Twinning>40%), Osmanabadi, Sangamneri (Twinning 20-30%), Sirohi and Ganjam (Twinning<10%)) differing in prolificacy and geographic distribution were employed for polymorphism scanning. Cattle sequence (AC_000167.1) was used to design primers for the amplification of a targeted region followed by direct DNA sequencing to identify the genetic variations. Single nucleotide polymorphisms (SNPs) were not detected in exon 3, the intronic region and the 3' flanking region. A SNP (G1534A) was identified in exon 2. It was a non-synonymous mutation resulting in an arginine to lysine change in a corresponding protein sequence. G to A transition at the 1534 locus revealed two genotypes GG and GA in the nine investigated goat breeds. The GG genotype was predominant with a genotype frequency of 0.98. The GA genotype was present in the Black Bengal as well as Jakhrana breed with a genotype frequency of 0.02. A microsatellite was identified in the 3' flanking region, only 20 nucleotides downstream from the termination site of the coding region, as a short sequence with more than nineteen continuous and repeated CA dinucleotides. Since the gene is highly evolutionarily conserved, identification of a non-synonymous SNP (G1534A) in the coding region gains further importance. To our knowledge, this is the first report of a mutation in the coding
Unenhanced helical computed tomography in the evaluation of acute flank pain
International Nuclear Information System (INIS)
Ahmad, N.A.; Ather, M.H.; Rees, J.
2003-01-01
The purpose of this study was to determine the value of unenhanced helical computed tomography (UHCT) in the diagnosis of acute flank pain at our institution. Two hundred and thirty-three consecutive UHCT examinations, performed for suspected renal/ureteral colic between July 2000 and August 2001 were reviewed, along with pertinent medical records. Ureteral calculi were identified in 148 (64%) examinations, evidence of recent passage of calculi was found in 10 (4%) and no calculi were found in 75 (32%). Thirty-two of the conservatively managed patients were excluded for inadequate follow-up. In the remaining 201 patients, sensitivity of UHCT in diagnosing calculi was 99% and specificity was 98%, while the positive predictive value was 99% and negative positive predictive value was 98%. Overall, an alternative or additional diagnosis was established in 28 (12%) patients. Upon diagnosis of ureterolithiasis on UHCT, none of the patients required additional imaging studies for confirmation. UHCT is a highly sensitive imaging modality for the detection of urinary tract calculi and obstruction. (author)
Itzhaki, H; Maxson, J M; Woodson, W R
1994-09-13
The increased production of ethylene during carnation petal senescence regulates the transcription of the GST1 gene encoding a subunit of glutathione-S-transferase. We have investigated the molecular basis for this ethylene-responsive transcription by examining the cis elements and trans-acting factors involved in the expression of the GST1 gene. Transient expression assays following delivery of GST1 5' flanking DNA fused to a beta-glucuronidase receptor gene were used to functionally define sequences responsible for ethylene-responsive expression. Deletion analysis of the 5' flanking sequences of GST1 identified a single positive regulatory element of 197 bp between -667 and -470 necessary for ethylene-responsive expression. The sequences within this ethylene-responsive region were further localized to 126 bp between -596 and -470. The ethylene-responsive element (ERE) within this region conferred ethylene-regulated expression upon a minimal cauliflower mosaic virus-35S TATA-box promoter in an orientation-independent manner. Gel electrophoresis mobility-shift assays and DNase I footprinting were used to identify proteins that bind to sequences within the ERE. Nuclear proteins from carnation petals were shown to specifically interact with the 126-bp ERE and the presence and binding of these proteins were independent of ethylene or petal senescence. DNase I footprinting defined DNA sequences between -510 and -488 within the ERE specifically protected by bound protein. An 8-bp sequence (ATTTCAAA) within the protected region shares significant homology with promoter sequences required for ethylene responsiveness from the tomato fruit-ripening E4 gene.
Mechanisms of radiation-induced gene responses
International Nuclear Information System (INIS)
Woloschak, G.E.; Paunesku, T.
1996-01-01
In the process of identifying genes differentially expressed in cells exposed ultraviolet radiation, we have identified a transcript having a 26-bp region that is highly conserved in a variety of species including Bacillus circulans, yeast, pumpkin, Drosophila, mouse, and man. When the 5' region (flanking region or UTR) of a gene, the sequence is predominantly in +/+ orientation with respect to the coding DNA strand; while in the coding region and the 3' region (UTR), the sequence is most frequently in the +/-orientation with respect to the coding DNA strand. In two genes, the element is split into two parts; however, in most cases, it is found only once but with a minimum of 11 consecutive nucleotides precisely depicting the original sequence. The element is found in a large number of different genes with diverse functions (from human ras p21 to B. circulans chitonase). Gel shift assays demonstrated the presence of a protein in HeLa cell extracts that binds to the sense and antisense single-stranded consensus oligomers, as well as to the double- stranded oligonucleotide. When double-stranded oligomer was used, the size shift demonstrated as additional protein-oligomer complex larger than the one bound to either sense or antisense single-stranded consensus oligomers alone. It is speculated either that this element binds to protein(s) important in maintaining DNA is a single-stranded orientation for transcription or, alternatively that this element is important in the transcription-coupled DNA repair process
Geologic map of the northeast flank of Mauna Loa volcano, Island of Hawai'i, Hawaii
Trusdell, Frank A.; Lockwood, John P.
2017-05-01
SummaryMauna Loa, the largest volcano on Earth, has erupted 33 times since written descriptions became available in 1832. Some eruptions were preceded by only brief seismic unrest, while others followed several months to a year of increased seismicity.The majority of the eruptions of Mauna Loa began in the summit area (>12,000-ft elevation; Lockwood and Lipman, 1987); yet the Northeast Rift Zone (NERZ) was the source of eight flank eruptions since 1843 (table 1). This zone extends from the 13,680-ft-high summit towards Hilo (population ~60,000), the second largest city in the State of Hawaii. Although most of the source vents are farther than 30 km away, the 1880 flow from one of the vents extends into Hilo, nearly reaching Hilo Bay. The city is built entirely on flows erupted from the NERZ, most older than that erupted in 1843.Once underway, Mauna Loa's eruptions can produce lava flows that reach the sea in less than 24 hours, severing roads and utilities in their path. For example, lava flows erupted from the Southwest Rift Zone (SWRZ) in 1950 advanced at an average rate of 9.3 km per hour, and all three lobes reached the ocean within approximately 24 hours (Finch and Macdonald, 1953). The flows near the eruptive vents must have traveled even faster.In terms of eruption frequency, pre-eruption warning, and rapid flow emplacement, Mauna Loa poses an enormous volcanic-hazard threat to the Island of Hawai‘i. By documenting past activity and by alerting the public and local government officials of our findings, we can anticipate the volcanic hazards and substantially mitigate the risks associated with an eruption of this massive edifice.From the geologic record, we can deduce several generalized facts about the geologic history of the NERZ. The middle to the uppermost section of the rift zone were more active in the past 4,000 years than the lower part, perhaps due to buttressing of the lower east rift zone by Mauna Kea and Kīlauea volcanoes. The historical flows
Puerma, Eva; Acosta, Manuel J; Barragán, Maria José L; Martínez, Sergio; Marchal, Juan Alberto; Bullejos, Mónica; Sánchez, Antonio
2008-11-01
The karyotype of individuals of the species Rhinolophus hipposideros from Spain present a chromosome number of 2n = 54 (NFa = 62). The described karyotype for these specimens is very similar to another previously described in individual from Bulgaria. However, the presence of one additional pair of autosomal acrocentric chromosomes in the Bulgarian karyotype and the differences in X chromosome morphology indicated that we have described a new karyotype variant in this species. In addition, we have analyzed several clones of 1.4 and 1 kb of a PstI repeated DNA sequence from the genome of R. hipposideros. The repeated sequence included a region with high identity with the 5S rDNA genes and flanking regions, with no homology with GenBank sequences. Search for polymerase III regulatory elements demonstrated the presence of type I promoter elements (A-box, Intermediate Element and C-box) in the 5S rDNA region. In addition, upstream regulatory elements, as a D-box and Sp1 binding sequences, were present in flanking regions. All data indicated that the cloned repeated sequences are the functional rDNA genes from this species. Finally, FISH demonstrated the presence of rDNA in nine chromosome pairs, which is surprising as most mammals have only one carrier chromosome pair.
Energy Technology Data Exchange (ETDEWEB)
Grosse, A.; Grosse, C. [Universitaet Bern, Bern (Switzerland)
2014-07-15
The objective of this article is the description of imaging techniques for the evaluation of patients with acute flank pain and suspicion of urolithiasis and the impact of these techniques in the therapy management of patients with calculi. (orig.) [German] Ziel der Arbeit ist die Eroerterung der bildgebenden Verfahren zur Abklaerung von Patienten mit akutem Flankenschmerz und Verdacht auf Urolithiasis und die Rolle dieser Verfahren im Therapiemanagement von Steinpatienten. (orig.)
Ni, Zhenjie; Dong, Huanli; Wang, Hanlin; Ding, Shang; Zou, Ye; Zhao, Qiang; Zhen, Yonggang; Liu, Feng; Jiang, Lang; Hu, Wenping
2018-03-01
Herein, the design and synthesis of novel π-extended quinoline-flanked diketopyrrolopyrrole (DPP) [abbreviated as QDPP] motifs and corresponding copolymers named PQDPP-T and PQDPP-2FT for high performing n-type organic field-effect transistors (OFETs) in flexible organic thin film devices are reported. Serving as DPP-flankers in backbones, quinoline is found to effectively tune copolymer optoelectric properties. Compared with TDPP and pyridine-flanked DPP (PyDPP) analogs, widened bandgaps and strengthened electron deficiency are achieved. Moreover, both hole and electron mobility are improved two orders of magnitude compared to those of PyDPP analogs (PPyDPP-T and PPyDPP-2FT). Notably, featuring an all-acceptor-incorporated backbone, PQDPP-2FT exhibits electron mobility of 6.04 cm 2 V -1 s -1 , among the highest value in OFETs fabricated on flexible substrates to date. Moreover, due to the widened bandgap and strengthened electron deficiency of PQDPP, n-channel on/off ratio over 10 5 with suppressed hole transport is first realized in the ambipolar DPP-based copolymers. © 2018 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Cis-acting elements in the promoter region of the human aldolase C gene.
Buono, P; de Conciliis, L; Olivetta, E; Izzo, P; Salvatore, F
1993-08-16
We investigated the cis-acting sequences involved in the expression of the human aldolase C gene by transient transfections into human neuroblastoma cells (SKNBE). We demonstrate that 420 bp of the 5'-flanking DNA direct at high efficiency the transcription of the CAT reporter gene. A deletion between -420 bp and -164 bp causes a 60% decrease of CAT activity. Gel shift and DNase I footprinting analyses revealed four protected elements: A, B, C and D. Competition analyses indicate that Sp1 or factors sharing a similar sequence specificity bind to elements A and B, but not to elements C and D. Sequence analysis shows a half palindromic ERE motif (GGTCA), in elements B and D. Region D binds a transactivating factor which appears also essential to stabilize the initiation complex.
Identification of a p53-response element in the promoter of the proline oxidase gene
International Nuclear Information System (INIS)
Maxwell, Steve A.; Kochevar, Gerald J.
2008-01-01
Proline oxidase (POX) is a p53-induced proapoptotic gene. We investigated whether p53 could bind directly to the POX gene promoter. Chromatin immunoprecipitation (ChIP) assays detected p53 bound to POX upstream gene sequences. In support of the ChIP results, sequence analysis of the POX gene and its 5' flanking sequences revealed a potential p53-binding site, GGGCTTGTCTTCGTGTGACTTCTGTCT, located at 1161 base pairs (bp) upstream of the transcriptional start site. A 711-bp DNA fragment containing the candidate p53-binding site exhibited reporter gene activity that was induced by p53. In contrast, the same DNA region lacking the candidate p53-binding site did not show significant p53-response activity. Electrophoretic mobility shift assay (EMSA) in ACHN renal carcinoma cell nuclear lysates confirmed that p53 could bind to the 711-bp POX DNA fragment. We concluded from these experiments that a p53-binding site is positioned at -1161 to -1188 bp upstream of the POX transcriptional start site
Mapping the transcription termination region of the mouse immunoglobulin kappa gene
International Nuclear Information System (INIS)
Xu, M.; Garrard, W.T.
1986-01-01
To define the transcription termination region of the mouse immunoglobulin kappa gene, they have subcloned single copy DNA sequences corresponding to both the template and the non-template strands of this locus. In vitro nuclear transcription with isolated MPC-11 nuclei was performed and the resulting 32 P-labeled RNA was hybridized to slot-blotted, single-stranded M13 probes covering regions within and flanking the kappa gene. The hybridization pattern for the template-strand reveals that transcription terminates within the region between 1.1 to 2.3 kb downstream from the poly(A) site. Ten different short sequences (8-13 bp) reside within 460 bp of this region that exhibit homology with sequences found in the termination regions of mouse β-globin and chicken ovalbumin genes. Transcription of the non-template strand occurs on either side of this termination region. They note that no transcription is detectable on the non-template strand downstream of the enhancer, indicating that if RNA polymerase II enters at this site, it does not initiate transcription during transit to the promoter region. They conclude that transcription of the kappa gene passes the poly(A) addition site and terminates within 2.3 Kb downstream
Sun, Ting; Renner, Susanne S.; Xu, Yuxing; Qin, Yan; Wu, Jianqiang; Sun, Guiling
2016-01-01
A growing body of evidence is pointing to an important role of horizontal gene transfer (HGT) in the evolution of higher plants. However, reports of HGTs of transposable elements (TEs) in plants are still scarce, and only one case is known of a class II transposon horizontally transferred between grasses. To investigate possible TE transfers in dicots, we performed transcriptome screening in the obligate root parasite Phelipanche aegyptiaca (Orobanchaceae), data-mining in the draft genome assemblies of four other Orobanchaceae, gene cloning, gene annotation in species with genomic information, and a molecular phylogenetic analysis. We discovered that the broomrape genera Phelipanche and Orobanche acquired two related nuclear genes (christened BO transposase genes), a new group of the hAT superfamily of class II transposons, from Asian Sisymbrieae or a closely related tribe of Brassicaceae, by HGT. The collinearity of the flanking genes, lack of a classic border structure, and low expression levels suggest that BO transposase genes cannot transpose in Brassicaceae, whereas they are highly expressed in P. aegyptiaca. PMID:27452947
Spermatogenesis-related ring finger gene ZNF230 promoter: identification and functional analysis
DEFF Research Database (Denmark)
Xu, Wenming; Zhang, Sizhong; Qiu, Weimin
2009-01-01
reporter Plasmids. Overexpression and site-directed mutation test were used to characterize the cis-element. The results showed ZNF230 gene promoter to be GC rich and not contain a TATA box. Deletion analysis of the 5'-flanking region of ZNF230 in HEK293 cells indicated that the sequence encompassing from...... nt -131 to +152 has a basal transcriptional activity. Site-directed mutation test and mithramycin A treatment demonstrated that the ZNF230 promoter contained a functional Sp1 site. Overexpression of the Sox5 protein activated the promoter activity. A 312-bp fragment surrounding the transcription...
Hu, Zhan; Ding, Xuezhi; Hu, Shengbiao; Sun, Yunjun; Xia, Liqiu
2013-12-01
Marker-free, genetically-modified rice was created by the tissue-specifically regulated Cre/loxP system, in which the Cre recombinase gene and hygromycin phosphotransferase gene (hpt) were flanked by two directly oriented loxP sites. Cre expression was activated by the tissue-specific promoter OsMADS45 in flower or napin in seed, resulting in simultaneous excision of the recombinase and marker genes. Segregation of T1 progeny was performed to select recombined plants. The excision was confirmed by PCR, Southern blot and sequence analyses indicating that efficiency varied from 10 to 53 % for OsMADS45 and from 12 to 36 % for napin. The expression of cry1Ac and vip3A was detected by RT-PCR analysis in marker-free transgenic rice. These results suggested that our tissue-specifically regulated Cre/loxP system could auto-excise marker genes from transgenic rice and alleviate public concerns about the security of GM crops.
Chen, Zhuo; Xu, Shixia; Zhou, Kaiya; Yang, Guang
2011-10-27
A diversity of hypotheses have been proposed based on both morphological and molecular data to reveal phylogenetic relationships within the order Cetacea (dolphins, porpoises, and whales), and great progress has been made in the past two decades. However, there is still some controversy concerning relationships among certain cetacean taxa such as river dolphins and delphinoid species, which needs to be further addressed with more markers in an effort to address unresolved portions of the phylogeny. An analysis of additional SINE insertions and SINE-flanking sequences supported the monophyly of the order Cetacea as well as Odontocete, Delphinoidea (Delphinidae + Phocoenidae + Mondontidae), and Delphinidae. A sister relationship between Delphinidae and Phocoenidae + Mondontidae was supported, and members of classical river dolphins and the genera Tursiops and Stenella were found to be paraphyletic. Estimates of divergence times revealed rapid divergences of basal Odontocete lineages in the Oligocene and Early Miocene, and a recent rapid diversification of Delphinidae in the Middle-Late Miocene and Pliocene within a narrow time frame. Several novel SINEs were found to differentiate Delphinidae from the other two families (Monodontidae and Phocoenidae), whereas the sister grouping of the latter two families with exclusion of Delphinidae was further revealed using the SINE-flanking sequences. Interestingly, some anomalous PCR amplification patterns of SINE insertions were detected, which can be explained as the result of potential ancestral SINE polymorphisms and incomplete lineage sorting. Although a few loci were potentially anomalous, this study demonstrated that the SINE-based approach is a powerful tool in phylogenetic studies. Identifying additional SINE elements that resolve the relationships in the superfamily Delphinoidea and family Delphinidae will be important steps forward in completely resolving cetacean phylogenetic relationships in the future.
Directory of Open Access Journals (Sweden)
Zhou Kaiya
2011-10-01
Full Text Available Abstract Background A diversity of hypotheses have been proposed based on both morphological and molecular data to reveal phylogenetic relationships within the order Cetacea (dolphins, porpoises, and whales, and great progress has been made in the past two decades. However, there is still some controversy concerning relationships among certain cetacean taxa such as river dolphins and delphinoid species, which needs to be further addressed with more markers in an effort to address unresolved portions of the phylogeny. Results An analysis of additional SINE insertions and SINE-flanking sequences supported the monophyly of the order Cetacea as well as Odontocete, Delphinoidea (Delphinidae + Phocoenidae + Mondontidae, and Delphinidae. A sister relationship between Delphinidae and Phocoenidae + Mondontidae was supported, and members of classical river dolphins and the genera Tursiops and Stenella were found to be paraphyletic. Estimates of divergence times revealed rapid divergences of basal Odontocete lineages in the Oligocene and Early Miocene, and a recent rapid diversification of Delphinidae in the Middle-Late Miocene and Pliocene within a narrow time frame. Conclusions Several novel SINEs were found to differentiate Delphinidae from the other two families (Monodontidae and Phocoenidae, whereas the sister grouping of the latter two families with exclusion of Delphinidae was further revealed using the SINE-flanking sequences. Interestingly, some anomalous PCR amplification patterns of SINE insertions were detected, which can be explained as the result of potential ancestral SINE polymorphisms and incomplete lineage sorting. Although a few loci were potentially anomalous, this study demonstrated that the SINE-based approach is a powerful tool in phylogenetic studies. Identifying additional SINE elements that resolve the relationships in the superfamily Delphinoidea and family Delphinidae will be important steps forward in completely resolving
Wheat, C. Geoffrey; Jannasch, Hans W.; Fisher, Andrew T.; Becker, Keir; Sharkey, Jessica; Hulme, Samuel
2010-07-01
Integrated Ocean Drilling Program (IODP) Hole 1301A was drilled, cased, and instrumented with a long-term, subseafloor observatory (CORK) on the eastern flank of the Juan de Fuca Ridge in summer 2004. This borehole is located 1 km south of ODP Hole 1026B and 5 km north of Baby Bare outcrop. Hole 1301A penetrates 262 m of sediment and 108 m of the uppermost 3.5 Ma basaltic basement in an area of warm (64°C) hydrothermal circulation. The borehole was instrumented, and those instruments were recovered 4 years later. Here we report chemical data from two continuous fluid samplers (OsmoSamplers) and temperature recording tools that monitored changes in the state of borehole (formation) fluids. These changes document the effects of drilling, fluid overpressure and flow, seawater-basalt interactions, and microbial metababolic activity. Initially, bottom seawater flowed into the borehole through a leak between concentric CORK casing strings. Eventually, the direction of flow reversed, and warm, altered formation fluid flowed into the borehole and discharged at the seafloor. This reversal occurred during 1 week in September 2007, 3 years after drilling operations ceased. The composition of the formation fluid around Hole 1301A generally lies within bounds defined by springs on Baby Bare outcrop (to the south) and fluids that discharged from Hole 1026B (to the north); deviations likely result from reactions with drilling products. Simple conservative mixing of two end-member fluids reveals reactions occurring within the crust, including nitrate reduction presumably by denitrifying microbes. The observed changes in borehole fluid composition provide the foundation for a conceptual model of chemical and microbial change during recharge of a warm ridge-flank hydrothermal system. This model can be tested through future scientific ocean drilling experiments.
Arce, José Luis; Macías, Rodolfo; García Palomo, Armando; Capra, Lucia; Macías, José Luis; Layer, Paul; Rueda, Hernando
2008-11-01
Zempoala is an extinct Pleistocene (˜ 0.7-0.8 Ma) stratovolcano that together with La Corona volcano (˜ 0.9 Ma) forms the southern end of the Sierra de las Cruces volcanic range, Central Mexico. The volcano consists of andesitic and dacitic lava flows and domes, as well as pyroclastic and epiclastic sequences, and has had a complex history with several flank collapses. One of these collapses occurred during the late Pleistocene on the S-SE flank of the volcano and produced the Zempoala debris avalanche deposit. This collapse could have been triggered by the reactivation of two normal fault systems (E-W and NE-SW), although magmatic activity cannot be absolutely excluded. The debris avalanche traveled 60 km to the south, covers an area of 600 km 2 and has a total volume of 6 km 3, with a calculated Heim coefficient (H/L) of 0.03. Based on the textural characteristics of the deposit we recognized three zones: proximal, axial, and lateral distal zone. The proximal zone consists of debris avalanche blocks that develop a hummocky topography; the axial zone corresponds with the main debris avalanche deposit made of large clasts set in a sandy matrix, which transformed to a debris flow in the lateral distal portion. The deposit is heterolithologic in composition, with dacitic and andesitic fragments from the old edifice that decrease in volume as bulking of exotic clasts from the substratum increase. Several cities (Cuernavaca, Jojutla de Juárez, Alpuyeca) with associated industrial, agricultural, and tourism activities have been built on the deposit, which pose in evidence the possible impact in case of a new event with such characteristics, since the area is still tectonically active.
A rhodanine flanked nonfullerene acceptor for solution-processed organic photovoltaics
Holliday, Sarah
2015-01-21
A novel small molecule, FBR, bearing 3-ethylrhodanine flanking groups was synthesized as a nonfullerene electron acceptor for solution-processed bulk heterojunction organic photovoltaics (OPV). A straightforward synthesis route was employed, offering the potential for large scale preparation of this material. Inverted OPV devices employing poly(3-hexylthiophene) (P3HT) as the donor polymer and FBR as the acceptor gave power conversion efficiencies (PCE) up to 4.1%. Transient and steady state optical spectroscopies indicated efficient, ultrafast charge generation and efficient photocurrent generation from both donor and acceptor. Ultrafast transient absorption spectroscopy was used to investigate polaron generation efficiency as well as recombination dynamics. It was determined that the P3HT:FBR blend is highly intermixed, leading to increased charge generation relative to comparative devices with P3HT:PC60BM, but also faster recombination due to a nonideal morphology in which, in contrast to P3HT:PC60BM devices, the acceptor does not aggregate enough to create appropriate percolation pathways that prevent fast nongeminate recombination. Despite this nonoptimal morphology the P3HT:FBR devices exhibit better performance than P3HT:PC60BM devices, used as control, demonstrating that this acceptor shows great promise for further optimization.
Gene disruption in Salmonella typhimurim by modified λ Red disruption system.
Ahani Azari, A; Zahraei Salehi, T; Nayeri Fasaei, B; Alebouyeh, M
2015-01-01
There are many techniques to knock out directed genes in bacteria, some of which have been described in Salmonella species. In this study, a combination of SOEing PCR method and the λ Red disruption system were used to disrupt phoP gene in wild type and standard strains of Salmonella typhimurium. Three standards PCR and one fusion PCR reactions were performed to construct a linear DNA including upstream and downstream of phoP gene and Kanamycin cassette. As a template plasmid, we used pKD4 which carries kanamycin gene flanked by FRT (FLP recognition target) sites. The resulting construct was electroporated into prepared competent cells of S. typhimurium. The transformants colonies related to the standard strain appeared on the LB-Km-agar plates after incubation, but there was no colony on LB-Km-agar plates corresponding to the wild type strain. The failure in transformation of the wild type strain may be because of inflexibility of the λ Red disruption system in this strain or its unique restriction-modification system. However, by this construct we are able to generate phoP mutant in many of the Salmonella species due to high homology of the phoP gene which exists in different species.
Thomas, N Simon; Harvey, John F; Bunyan, David J; Rankin, Julia; Grigelioniene, Giedre; Bruno, Damien L; Tan, Tiong Y; Tomkins, Susan; Hastings, Robert
2009-07-01
Deletions of the SHOX gene are well documented and cause disproportionate short stature and variable skeletal abnormalities. In contrast interstitial SHOX duplications limited to PAR1 appear to be very rare and the clinical significance of the only case report in the literature is unclear. Mapping of this duplication has now shown that it includes the entire SHOX gene but little flanking sequence and so will not encompass any of the long-range enhancers required for SHOX transcription. We now describe the clinical and molecular characterization of three additional cases. The duplications all included the SHOX coding sequence but varied in the amount of flanking sequence involved. The probands were ascertained for a variety of reasons: hypotonia and features of Asperger syndrome, Leri-Weill dyschondrosteosis (LWD), and a family history of cleft palate. However, the presence of a duplication did not correlate with any of these features or with evidence of skeletal abnormality. Remarkably, the proband with LWD had inherited both a SHOX deletion and a duplication. The effect of the duplications on stature was variable: height appeared to be elevated in some carriers, particularly in those with the largest duplications, but was still within the normal range. SHOX duplications are likely to be under ascertained and more cases need to be identified and characterized in detail in order to accurately determine their phenotypic consequences.
3D FEM Simulation of Flank Wear in Turning
Attanasio, Aldo; Ceretti, Elisabetta; Giardini, Claudio
2011-05-01
This work deals with tool wear simulation. Studying the influence of tool wear on tool life, tool substitution policy and influence on final part quality, surface integrity, cutting forces and power consumption it is important to reduce the global process costs. Adhesion, abrasion, erosion, diffusion, corrosion and fracture are some of the phenomena responsible of the tool wear depending on the selected cutting parameters: cutting velocity, feed rate, depth of cut, …. In some cases these wear mechanisms are described by analytical models as a function of process variables (temperature, pressure and sliding velocity along the cutting surface). These analytical models are suitable to be implemented in FEM codes and they can be utilized to simulate the tool wear. In the present paper a commercial 3D FEM software has been customized to simulate the tool wear during turning operations when cutting AISI 1045 carbon steel with uncoated tungsten carbide tip. The FEM software was improved by means of a suitable subroutine able to modify the tool geometry on the basis of the estimated tool wear as the simulation goes on. Since for the considered couple of tool-workpiece material the main phenomena generating wear are the abrasive and the diffusive ones, the tool wear model implemented into the subroutine was obtained as combination between the Usui's and the Takeyama and Murata's models. A comparison between experimental and simulated flank tool wear curves is reported demonstrating that it is possible to simulate the tool wear development.
Fortescue field, Gippsland basin: Flank potential realized
Energy Technology Data Exchange (ETDEWEB)
Hendrich, J.H.; Schwebel, D.A.; Palmer, I.D. (Esso Asustralia Ltd., Sydney, New South Wales (Australia))
1990-09-01
Fortescue field was the last major oil field to be discovered in the offshore Gippsland basin, southeastern Australia. The discovery well, 1 West Halibut, was drilled in 1978 on the basis of a 1-km seismic grid as a follow up to the dry 1 Fortescue wildcat. Data from this well were interpreted to indicate that there was a high probability of a stratigraphic trap occurring on the western flank of the giant Halibut-Cobia structure. The 2, 3, and 4 Fortescue wells were drilled by early 1979 to determine the limits of the field, delineate the stratigraphy, and define the hydrocarbon contacts. Cobia A had the dual purpose of developing the Cobia field and the southern extent of the Fortescue reservoirs that were inaccessible to the Fortescue A plat-form. At the conclusion of development drilling in early 1986, eight Cobia A wells and 20 Fortescue A wells were capable of producing from Fortescue reservoirs. The Fortescue reservoirs are Eocene sandstones that were deposited in coastal plain, upper shoreface, and lower shoreface environments. Integration of well log correlations, stratigraphic interpretations, reservoir pressure data, and seismic data indicates that these Fortescue reservoirs are stratigraphically younger than, and are hydraulically separated from, the underlying Halibut-Cobia fields. Pressure data acquired during development drilling and while monitoring subsequent production performance have conclusively demonstrated that there are at least three separate hydraulic systems active within the Fortescue field. Fortescue field dimensions are approximately 11 km x 4 km with a maximum relief of 100 m above the original oil-water contact. Reserves are estimated at 280,000 STB, based on original oil in place estimates of 415,000 STB and recovery factors in the 65-70% range. Production rate peaked in 1984 at 100 K BOPD from the combined development facilities and was sustained until late 1986. More than two-thirds of the reserves have been produced to date.
Sequencing genes in silico using single nucleotide polymorphisms
Directory of Open Access Journals (Sweden)
Zhang Xinyi
2012-01-01
Full Text Available Abstract Background The advent of high throughput sequencing technology has enabled the 1000 Genomes Project Pilot 3 to generate complete sequence data for more than 906 genes and 8,140 exons representing 697 subjects. The 1000 Genomes database provides a critical opportunity for further interpreting disease associations with single nucleotide polymorphisms (SNPs discovered from genetic association studies. Currently, direct sequencing of candidate genes or regions on a large number of subjects remains both cost- and time-prohibitive. Results To accelerate the translation from discovery to functional studies, we propose an in silico gene sequencing method (ISS, which predicts phased sequences of intragenic regions, using SNPs. The key underlying idea of our method is to infer diploid sequences (a pair of phased sequences/alleles at every functional locus utilizing the deep sequencing data from the 1000 Genomes Project and SNP data from the HapMap Project, and to build prediction models using flanking SNPs. Using this method, we have developed a database of prediction models for 611 known genes. Sequence prediction accuracy for these genes is 96.26% on average (ranges 79%-100%. This database of prediction models can be enhanced and scaled up to include new genes as the 1000 Genomes Project sequences additional genes on additional individuals. Applying our predictive model for the KCNJ11 gene to the Wellcome Trust Case Control Consortium (WTCCC Type 2 diabetes cohort, we demonstrate how the prediction of phased sequences inferred from GWAS SNP genotype data can be used to facilitate interpretation and identify a probable functional mechanism such as protein changes. Conclusions Prior to the general availability of routine sequencing of all subjects, the ISS method proposed here provides a time- and cost-effective approach to broadening the characterization of disease associated SNPs and regions, and facilitating the prioritization of candidate
Directory of Open Access Journals (Sweden)
Robin Charles
2011-03-01
Full Text Available Abstract Background Polyploidy is important from a phylogenetic perspective because of its immense past impact on evolution and its potential future impact on diversification, survival and adaptation, especially in plants. Molecular population genetics studies of polyploid organisms have been difficult because of problems in sequencing multiple-copy nuclear genes using Sanger sequencing. This paper describes a method for sequencing a barcoded mixture of targeted gene regions using next-generation sequencing methods to overcome these problems. Results Using 64 3-bp barcodes, we successfully sequenced three chloroplast and two nuclear gene regions (each of which contained two gene copies with up to two alleles per individual in a total of 60 individuals across 11 species of Australian Poa grasses. This method had high replicability, a low sequencing error rate (after appropriate quality control and a low rate of missing data. Eighty-eight percent of the 320 gene/individual combinations produced sequence reads, and >80% of individuals produced sufficient reads to detect all four possible nuclear alleles of the homeologous nuclear loci with 95% probability. We applied this method to a group of sympatric Australian alpine Poa species, which we discovered to share an allopolyploid ancestor with a group of American Poa species. All markers revealed extensive allele sharing among the Australian species and so we recommend that the current taxonomy be re-examined. We also detected hypermutation in the trnH-psbA marker, suggesting it should not be used as a land plant barcode region. Some markers indicated differentiation between Tasmanian and mainland samples. Significant positive spatial genetic structure was detected at Conclusions Our results demonstrate that 454 sequencing of barcoded amplicon mixtures can be used to reliably sample all alleles of homeologous loci in polyploid species and successfully investigate phylogenetic relationships among
Directory of Open Access Journals (Sweden)
Jean-Paul eBaquiran
2016-03-01
Full Text Available To examine microbe-mineral interactions in subsurface oceanic crust, we evaluated microbial colonization on crustal minerals that were incubated in borehole fluids for one year at the seafloor wellhead of a crustal borehole observatory (IODP Hole U1301A, Juan de Fuca Ridge flank as compared to an experiment that was not exposed to subsurface crustal fluids (at nearby IODP Hole U1301B. In comparison to previous studies at these same sites, this approach allowed assessment of the effects of temperature, fluid chemistry, and/or mineralogy on colonization patterns of different mineral substrates, and an opportunity to verify the approach of deploying colonization experiments at an observatory wellhead at the seafloor instead of within the borehole. The Hole U1301B deployment did not have biofilm growth, based on microscopy and DNA extraction, thereby confirming the integrity of the colonization design against bottom seawater intrusion. In contrast, the Hole U1301A deployment supported biofilms dominated by Epsilonproteobacteria (43.5% of 370 16S rRNA gene clone sequences and Gammaproteobacteria (29.3%. Sequence analysis revealed overlap in microbial communities between different minerals incubated at the Hole U1301A wellhead, indicating that mineralogy did not separate biofilm structure within the one-year colonization experiment. Differences in the Hole U1301A wellhead biofilm community composition relative to previous studies from within the borehole using similar mineral substrates suggest that temperature and the diffusion of dissolved oxygen through plastic components influenced the mineral colonization experiments positioned at the wellhead. This highlights the capacity of low abundance crustal fluid taxa to rapidly establish communities on diverse mineral substrates under changing environmental conditions such as from temperature and oxygen.
Skorczyk, A; Flisikowski, K; Szydlowski, M; Cieslak, J; Fries, R; Switonski, M
2011-02-01
There are five genes encoding melanocortin receptors. Among canids, the genes have mainly been studied in the dog (MC1R, MC2R and MC4R). The MC4R gene has also been analysed in the red fox. In this report, we present a study of chromosome localization, comparative sequence analysis and polymorphism of the MC3R gene in the dog, red fox, arctic fox and Chinese raccoon dog. The gene was localized by FISH to the following chromosome: 24q24-25 in the dog, 14p16 in the red fox, 18q13 in the arctic fox and NPP4p15 in the Chinese raccoon dog. A high identity level of the MC3R gene sequences was observed among the species, ranging from 96.0% (red fox--Chinese raccoon dog) to 99.5% (red fox--arctic fox). Altogether, eight polymorphic sites were found in the red fox, six in the Chinese raccoon dog and two in the dog, while the arctic fox appeared to be monomorphic. In addition, association of several polymorphisms with body weight was analysed in red foxes (the number of genotyped animals ranged from 319 to 379). Two polymorphisms in the red fox, i.e. a silent substitution c.957A>C and c.*185C>T in the 3'-flanking sequence, showed a significant association (P < 0.01) with body weight. © 2010 The Authors, Animal Genetics © 2010 Stichting International Foundation for Animal Genetics.
Salleh, Faridah Hani Mohamed; Zainudin, Suhaila; Arif, Shereena M
2017-01-01
Gene regulatory network (GRN) reconstruction is the process of identifying regulatory gene interactions from experimental data through computational analysis. One of the main reasons for the reduced performance of previous GRN methods had been inaccurate prediction of cascade motifs. Cascade error is defined as the wrong prediction of cascade motifs, where an indirect interaction is misinterpreted as a direct interaction. Despite the active research on various GRN prediction methods, the discussion on specific methods to solve problems related to cascade errors is still lacking. In fact, the experiments conducted by the past studies were not specifically geared towards proving the ability of GRN prediction methods in avoiding the occurrences of cascade errors. Hence, this research aims to propose Multiple Linear Regression (MLR) to infer GRN from gene expression data and to avoid wrongly inferring of an indirect interaction (A → B → C) as a direct interaction (A → C). Since the number of observations of the real experiment datasets was far less than the number of predictors, some predictors were eliminated by extracting the random subnetworks from global interaction networks via an established extraction method. In addition, the experiment was extended to assess the effectiveness of MLR in dealing with cascade error by using a novel experimental procedure that had been proposed in this work. The experiment revealed that the number of cascade errors had been very minimal. Apart from that, the Belsley collinearity test proved that multicollinearity did affect the datasets used in this experiment greatly. All the tested subnetworks obtained satisfactory results, with AUROC values above 0.5.
Genetic and Functional Evidence Supports LPAR1 as a Susceptibility Gene for Hypertension.
Xu, Ke; Ma, Lu; Li, Yang; Wang, Fang; Zheng, Gu-Yan; Sun, Zhijun; Jiang, Feng; Chen, Yundai; Liu, Huirong; Dang, Aimin; Chen, Xi; Chun, Jerold; Tian, Xiao-Li
2015-09-01
Essential hypertension is a complex disease affected by genetic and environmental factors and serves as a major risk factor for cardiovascular diseases. Serum lysophosphatidic acid correlates with an elevated blood pressure in rats, and lysophosphatidic acid interacts with 6 subtypes of receptors. In this study, we assessed the genetic association of lysophosphatidic acid receptors with essential hypertension by genotyping 28 single-nucleotide polymorphisms from genes encoding for lysophosphatidic acid receptors, LPAR1, LPAR2, LPAR3, LPAR4, LPAR5, and LPAR6 and their flanking sequences, in 3 Han Chinese cohorts consisting of 2630 patients and 3171 controls in total. We identified a single-nucleotide polymorphism, rs531003 in the 3'-flanking genomic region of LPAR1, associated with hypertension (the Bonferroni corrected P=1.09×10(-5), odds ratio [95% confidence interval]=1.23 [1.13-1.33]). The risk allele C of rs531003 is associated with the increased expression of LPAR1 and the susceptibility of hypertension, particularly in those with a shortage of sleep (P=4.73×10(-5), odds ratio [95% confidence interval]=1.75 [1.34-2.28]). We further demonstrated that blood pressure elevation caused by sleep deprivation and phenylephrine-induced vasoconstriction was both diminished in LPAR1-deficient mice. Together, we show that LPAR1 is a novel susceptibility gene for human essential hypertension and that stress, such as shortage of sleep, increases the susceptibility of patients with risk allele to essential hypertension. © 2015 American Heart Association, Inc.
Apuani, Tiziana; Corazzato, Claudia
2015-04-01
Ground deformations in the northeastern flank of Etna are well known. Despite only a few landslide events have been documented, these have significantly involved and damaged lifelines and buildings. These events are mainly related to the activity of the volcano-tectonic structures and associated seismicity, as in the case of the 2002 reactivation of the Presa landslide during an increased activity of the Pernicana fault system. In order to highlight the areal distribution of potentially unstable slopes based on a detailed, site-specific study of the factors responsible for landslide, and to ultimately contribute to risk management, a landslide susceptibility analysis of the northeastern flank of Etna in the Pernicana area was carried out, and a susceptibility map at 1:10.000 scale was produced, extending over an area of 168 km2. Different methods are proposed in the literature to obtain the regional distribution of potentially unstable slopes, depending on the problem scale, the slope dynamic evolution in the geological context, and the availability of data. Among semi-quantitative approaches, the present research combines the Rock Engineering System (RES) methodology with parameter zonation mapping in a GIS environment. The RES method represents a structured approach to manage a high number of interacting factors involved in the instability problem. A numerically coded, site-specific interaction matrix (IM) analyzes the cause-effect relationship in these factors, and calculates the degree of interactivity of each parameter, normalized by the overall interactivity of the system (weight factor). In the specific Etna case, the considered parameters are: slope attitude, lithotechnical properties (lithology, structural complexity, soil and rock mass quality), land use, tectonic structures, seismic activity (horizontal acceleration) and hydrogeological conditions (groundwater and drainage). Thematic maps are prepared at 1:10.000 scale for each of these parameters, and
A novel mutation of WFS1 gene in a Chinese patient with Wolfram syndrome: a case report.
Li, Min; Liu, Jia; Yi, Huan; Xu, Li; Zhong, Xiufeng; Peng, Fuhua
2018-03-17
Wolfram syndrome (WS), caused by mutations of the Wolfram syndrome 1 (WFS1) gene on chromosome 4p16.1, is an autosomal recessive disorder characterized by diabetes insipidus (DI), neuro-psychiatric disorders, hearing deficit, and urinary tract anomalies. Here we report a 11-year-old Chinese boy who presented with visual loss, was suspected with optic neuritis (ON) or neuromyelitis optica (NMO) and referred to our department for further diagnosis. Finally he was diagnosed with WS because of diabetes mellitus (DM) and optic atrophy (OA). Eight exons and flanking introns of WFS1 gene were analyzed by sequencing. A novel mutation c.1760G > A in WFS1 gene of exon 8 was identified. This report reviews a case of WS associated with a novel mutation, c.1760G > A in WFS1 gene of exon 8, and emphasizes that WS should be taken into account for juveniles with visual loss and diabetes mellitus.
Zhang, J R; Norris, S J
1998-08-01
The Lyme disease spirochete Borrelia burgdorferi possesses 15 silent vls cassettes and a vls expression site (vlsE) encoding a surface-exposed lipoprotein. Segments of the silent vls cassettes have been shown to recombine with the vlsE cassette region in the mammalian host, resulting in combinatorial antigenic variation. Despite promiscuous recombination within the vlsE cassette region, the 5' and 3' coding sequences of vlsE that flank the cassette region are not subject to sequence variation during these recombination events. The segments of the silent vls cassettes recombine in the vlsE cassette region through a unidirectional process such that the sequence and organization of the silent vls loci are not affected. As a result of recombination, the previously expressed segments are replaced by incoming segments and apparently degraded. These results provide evidence for a gene conversion mechanism in VlsE antigenic variation.
Bracke, M.B.M.; Ettema, K.
2014-01-01
Injurious behaviours in pigs may involve persistent or forceful biting in specific body parts and may result in wounds of the pigs’ tails, ears, flanks and legs. Such behaviours, which may lead to progressive tissue damage, are difficult to counteract. On a commercial farm 22 groups of pigs with
International Nuclear Information System (INIS)
Liu Bing; Chinese Academy of Sciences, Beijing; Zhang Hong
2005-01-01
Radiotherapy has some disadvantages due to the severe side-effect on the normal tissues at a curative dose of ionizing radiation (IR). Similarly, as a new developing approach, gene therapy also has some disadvantages, such as lack of specificity for tumors, limited expression of therapeutic gene, potential biological risk. To certain extent, above problems would be solved by the suicide genes or p53 gene and its target genes therapies targeted by ionizing radiation. This strategy not only makes up the disadvantage from radiotherapy or gene therapy alone, but also promotes success rate on the base of lower dose. By present, there have been several vectors measuring up to be reaching clinical trials. This review focused on the development of the cancer gene therapy through suicide genes or p53 and its target genes mediated by IR. (authors)
Bo P.; Bartoň M.; Plakhotnik D.; Pottmann H.
2016-01-01
We introduce a new method that approximates free-form surfaces by envelopes of one-parameter motions of surfaces of revolution. In the context of 5-axis computer numerically controlled (CNC) machining, we propose a flank machining methodology which is a preferable scallop-free scenario when the milling tool and the machined free-form surface meet tangentially along a smooth curve. We seek both an optimal shape of the milling tool as well as its optimal path in 3D space and propose an optimiza...
Opposite replication polarities of transcribed and nontranscribed histone H5 genes
International Nuclear Information System (INIS)
Trempe, J.P.; Lindstrom, Y.I.; Leffak, M.
1988-01-01
The authors used an in vitro nuclear runoff replication assay to analyze the direction of replication of the active and inactive histone H5 genes in avian cells. In embryonic erythrocytes the transcribed histone H5 gene displayed sensitivity to endogenous nuclease cleavage. In contrast, this gene was insensitive to endogenous nuclease digestion under the same conditions in nuclei of the lymphoblastoid cell line MSB-1, and histone H5 gene transcripts were not detectable by dot-blot analysis of MSB-1 cell RNA. When nuclei were isolated from embryonic erythrocyctes and incubated with bromodeoxyuridine triphosphate, runoff replication from endogenous nuclease cleavage sites led to a relative enrichment for fragments near the 3' end of the histone H5 gene in the density-labeled DNA. In nuclei of MSB-1 cells or chicken embryo fibroblasts, however, runoff replication from restriction enzyme-cut sites (or induced endogenous nuclease-cut sites in MSB-1 nuclei) led to a relative enrichment for fragments near the 5' end of the H5 gene in dense DNA. Based on the enhanced incorporation of bromodeoxyuridine into origin-distal regions of DNA during the in vitro runoff replication assay, the authors conclude that the active histone H5 gene in embryonic erythrocytes is preferentially replicated in the transcriptional direction from an origin in the 5'-flanking DNA, whereas its inactive counterparts in MSB-1 cells and chicken embryo fibroblasts are preferentially replicated in the opposite direction
Energy Technology Data Exchange (ETDEWEB)
Korfhagen, T.R.; Glasser, S.W.; Wert, S.E.; Bruno, M.D.; Daugherty, C.C.; McNeish, J.D.; Stock, J.L.; Potter, S.S.; Whitsett, J.A. (Cincinnati College of Medicine, OH (USA))
1990-08-01
Pulmonary surfactant is produced in late gestation by developing type II epithelial cells lining the alveolar epithelium of the lung. Lack of surfactant at birth is associated with respiratory distress syndrome in premature infants. Surfactant protein C (SP-C) is a highly hydrophobic peptide isolated from pulmonary tissue that enhances the biophysical activity of surfactant phospholipids. Like surfactant phospholipid, SP-C is produced by epithelial cells in the distal respiratory epithelium, and its expression increases during the latter part of gestation. A chimeric gene containing 3.6 kilobases of the promoter and 5{prime}-flanking sequences of the human SP-C gene was used to express diphtheria toxin A. The SP-C-diphtheria toxin A fusion gene was injected into fertilized mouse eggs to produce transgenic mice. Affected mice developed respiratory failure in the immediate postnatal period. Morphologic analysis of lungs from affected pups showed variable but severe cellular injury confined to pulmonary tissues. Ultrastructural changes consistent with cell death and injury were prominent in the distal respiratory epithelium. Proximal components of the tracheobronchial tree were not severely affected. Transgenic animals were of normal size at birth, and structural abnormalities were not detected in nonpulmonary tissues. Lung-specific diphtheria toxin A expression controlled by the human SP-C gene injured type II epithelial cells and caused extensive necrosis of the distal respiratory epithelium. The absence of type I epithelial cells in the most severely affected transgenic animals supports the concept that developing type II cells serve as precursors to type I epithelial cells.
International Nuclear Information System (INIS)
Choi, I.S.; Kim, J.B.; Lee, K.N.; Park, S.D.
1990-01-01
The previously isolated RAD4 gene designated as pPC1 from the genomic library of Saccharomyces cerevisiae appeared to propagate in Escherichia coli and yet retained its complementing activity of rad4 mutants without inactivation. The subcloned RAD4 gene was found to be localized within a 2.5 kb DNA fragment flanking Bg/II and BamHI sites in the insert DNA, and was shown to have the same restriction map as a yeast chromosomal DNA, as determined by Southern hybridization. Tetrad analysis and pulse-field chromosome mapping have revealed that the cloned RAD4 gene can be mapped and integrated into the yeast chromosome V, the actual site of this gene. DNA-tRNA hybridization has shown that the isolated RAD4 gene did not contain a suppressor tRNA gene. These results have indicated that the pPC1 is a functional RAD4 gene playing a unique role involved in the nucleotide excision repair of yeast without any genetic change during amplification in E. coli. (author)
Murillo Solano, Claribel; Akinyi Okoth, Sheila; Abdallah, Joseph F; Pava, Zuleima; Dorado, Erika; Incardona, Sandra; Huber, Curtis S; Macedo de Oliveira, Alexandre; Bell, David; Udhayakumar, Venkatachalam; Barnwell, John W
2015-01-01
A number of studies have analyzed the performance of malaria rapid diagnostic tests (RDTs) in Colombia with discrepancies in performance being attributed to a combination of factors such as parasite levels, interpretation of RDT results and/or the handling and storage of RDT kits. However, some of the inconsistencies observed with results from Plasmodium falciparum histidine-rich protein 2 (PfHRP2)-based RDTs could also be explained by the deletion of the gene that encodes the protein, pfhrp2, and its structural homolog, pfhrp3, in some parasite isolates. Given that pfhrp2- and pfhrp3-negative P. falciparum isolates have been detected in the neighboring Peruvian and Brazilian Amazon regions, we hypothesized that parasites with deletions of pfhrp2 and pfhrp3 may also be present in Colombia. In this study we tested 100 historical samples collected between 1999 and 2009 from six Departments in Colombia for the presence of pfhrp2, pfhrp3 and their flanking genes. Seven neutral microsatellites were also used to determine the genetic background of these parasites. In total 18 of 100 parasite isolates were found to have deleted pfhrp2, a majority of which (14 of 18) were collected from Amazonas Department, which borders Peru and Brazil. pfhrp3 deletions were found in 52 of the 100 samples collected from all regions of the country. pfhrp2 flanking genes PF3D7_0831900 and PF3D7_0831700 were deleted in 22 of 100 and in 1 of 100 samples, respectively. pfhrp3 flanking genes PF3D7_1372100 and PF3D7_1372400 were missing in 55 of 100 and in 57 of 100 samples. Structure analysis of microsatellite data indicated that Colombian samples tested in this study belonged to four clusters and they segregated mostly based on their geographic region. Most of the pfhrp2-deleted parasites were assigned to a single cluster and originated from Amazonas Department although a few pfhrp2-negative parasites originated from the other three clusters. The presence of a high proportion of pfhrp2
Hess, A.D.; Thoburn, C.; Chen, W.; Miura, Y.; Wall, E. van der
2001-01-01
The N-terminal flanking region of the invariant chain peptide termed CLIP appears to have superagonistic properties interacting with the T cell receptor and the MHC class II molecule at or near the binding site for the bacterial superantigen Staphylococcal enterotoxin B (SEB). The present studies
Gillard, D.; Wyss, M.; Okubo, P.
1996-01-01
Earthquake focal mechanisms of events occurring between 1972 and 1992 in the south flank of Kilauea volcano, Hawaii, are used to infer the state of stress and strain as a function of time and space. We have determined 870 fault plane solutions from P wave first motion polarities for events with magnitudes ML ??? 2.5 and depth ranging between 6 and 12 km. Faulting is characterized by a mixture of decollement, reverse, and normal faults. Most large earthquakes with magnitude M 7 rupture the decollement plane, since it is the only surface large enough to generate magnitude 7 or larger earthquakes. The percentage of reverse faulting events is high compared to the decollement and normal faulting mechanisms for the period 1972-1983. The percentage of decollement type focal mechanisms becomes dominant after 1983. This pattern of faulting activity suggests that pressure was building up within Kilauea's rift zone prior to the 1983 Puu'Oo eruption. Overall, a single stress orientation with the maximum compressive stress oriented SE perpendicular to the rift and dipping at 45?? is compatible with the coeval existence of decollement, reverse, and normal faults. However, in a crustal volume east of longitude 155??10'W, we find a change of the orientation of ??1 from nearly horizontal to plunging 45?? SE occurring in 1979. This stress rotation suggests magma movements within the aseismic part of Kilauea's east rift zone. The strain and stress orientations are coaxial in the south flank except within the volume where the stress rotation is observed. We observe a change in the relationship between stress and strain directions caused either by the shifting of seismic activity from reverse faults to decollements, while stress stays constant, or by a rotation of stress, while strain remains constant. Assuming that the model of a noncohesive Coulomb wedge is appropriate for Kilauea's south flank, we find that high pore pressures are prevalent along the decollement and within the wedge
Dettori, Maria Luisa; Pazzola, Michele; Paschino, Pietro; Pira, Maria Giovanna; Vacca, Giuseppe Massimo
2015-11-01
The 5' flanking region and 3' UTR of the caprine LALBA gene were analysed by SSCP and sequencing. A total of nine SNPs were detected: three in the promoter region, two were synonymous coding SNPs at exon-1, and four SNPs were in exon-4, within the 3'UTR. The nucleotide changes located in the promoter region (c.-358T>C, c.-163G>A, c.-121T>G) were genotyped by SSCP in 263 Sarda goats to evaluate their possible effect on milk yield, composition and renneting properties. We observed an effect of the three SNPs on milk yield and lactose content. Genotypes TT and CT at c.-358T>C (P A (P C and c.-121T>G were part of transcription factors binding sites, potentially involved in modulating the LALBA gene expression. The LALBA genotype affected renneting properties (P < 0.001), as heterozygotes c.-358CT and c.-163GA were characterised by delayed rennet coagulation time and curd firming time and the lowest value of curd firmness. The present investigation increases the panel of SNPs and adds new information about the effects of the caprine LALBA gene polymorphism.
Khang, Chang Hyun; Park, Sook-Young; Lee, Yong-Hwan; Kang, Seogchan
2005-06-01
Rapid progress in fungal genome sequencing presents many new opportunities for functional genomic analysis of fungal biology through the systematic mutagenesis of the genes identified through sequencing. However, the lack of efficient tools for targeted gene replacement is a limiting factor for fungal functional genomics, as it often necessitates the screening of a large number of transformants to identify the desired mutant. We developed an efficient method of gene replacement and evaluated factors affecting the efficiency of this method using two plant pathogenic fungi, Magnaporthe grisea and Fusarium oxysporum. This method is based on Agrobacterium tumefaciens-mediated transformation with a mutant allele of the target gene flanked by the herpes simplex virus thymidine kinase (HSVtk) gene as a conditional negative selection marker against ectopic transformants. The HSVtk gene product converts 5-fluoro-2'-deoxyuridine to a compound toxic to diverse fungi. Because ectopic transformants express HSVtk, while gene replacement mutants lack HSVtk, growing transformants on a medium amended with 5-fluoro-2'-deoxyuridine facilitates the identification of targeted mutants by counter-selecting against ectopic transformants. In addition to M. grisea and F. oxysporum, the method and associated vectors are likely to be applicable to manipulating genes in a broad spectrum of fungi, thus potentially serving as an efficient, universal functional genomic tool for harnessing the growing body of fungal genome sequence data to study fungal biology.
Feasibility of sodium/iodide symporter gene as a new imaging reporter gene: comparison with HSV1-tk
International Nuclear Information System (INIS)
Shin, Jae Hoon; Chung, June-Key; Lee, Yong Jin; Kim, Kwang Il; Kang, Joo Hyun; Jeong, Jae Min; Lee, Dong Soo; Kim, Chul Woo; Lee, Myung Chul
2004-01-01
Positron emission tomography (PET) imaging reporter genes, such as HSV1-tk and D 2 receptor genes, make it possible to visualise gene expression non-invasively and repetitively in vivo. However, these systems require the synthesis of complicated substrates and the availability of expensive PET equipment. Expression of the sodium/iodide symporter (NIS) gene can be easily monitored with radioiodines and technetium-99m using a gamma camera. To evaluate the possibility of using NIS as an imaging reporter gene, we compared its characteristics with those of the conventional HSV1-tk gene. The CM cell line was made by transfecting the HSV1-tk gene into CT-26 (mouse colon carcinoma cell line). The CTN and CMN cell lines were then made by transfecting the NIS gene into CT-26 and CM. We measured the uptake of iodine-125 iodovinyldeoxyuridine ([ 125 I]IVDU) and 125 I to evaluate the expression of the HSV1-tk and NIS genes, respectively. Each cell line was injected into four flank sites in Balb/c mice. The biodistribution study was performed after intravenously injecting [ 125 I]IVDU and 131 I, and 131 I scintigraphy was performed for the evaluation of NIS expression. In vitro studies indicated that CTN and CMN had 40- to 79-fold and 150- to 256-fold higher uptake of 125 I than CT-26 and CM, respectively. Furthermore, CM and CMN showed 57- to 69-fold higher uptake of [ 125 I]IVDU than CT-26 and CTN. NIS gene expression and 125 I accumulation were found to be directly correlated (R 2 =0.923), as were HSV1-tk gene expression and [ 125 I]IVDU accumulation (R 2 =0.956). Calculated signal per unit NIS and HSV1-tk mRNA expression was 23,240±3,755 cpm and 34,039±5,346 cpm, respectively. In vivo study indicated that CTN and CMN had 2.3- and 5.8-fold higher uptake of 131 I than CT-26 and CM, and 1.8- and 3.5-fold higher uptake of [ 125 I]IVDU than CT-26 and CTN. Scintigraphy using 131 I easily visualised CTN and CMN tumours. In conclusion, the NIS gene may be viewed as an imaging
Molecular mechanisms of extensive mitochondrial gene rearrangementin plethodontid salamanders
Energy Technology Data Exchange (ETDEWEB)
Mueller, Rachel Lockridge; Boore, Jeffrey L.
2005-06-01
Extensive gene rearrangement is reported in the mitochondrial genomes of lungless salamanders (Plethodontidae). In each genome with a novel gene order, there is evidence that the rearrangement was mediated by duplication of part of the mitochondrial genome, including the presence of both pseudogenes and additional, presumably functional, copies of duplicated genes. All rearrangement-mediating duplications include either the origin of light strand replication and the nearby tRNA genes or the regions flanking the origin of heavy strand replication. The latter regions comprise nad6, trnE, cob, trnT, an intergenic spacer between trnT and trnP and, in some genomes, trnP, the control region, trnF, rrnS, trnV, rrnL, trnL1, and nad1. In some cases, two copies of duplicated genes, presumptive regulatory regions, and/or sequences with no assignable function have been retained in the genome following the initial duplication; in other genomes, only one of the duplicated copies has been retained. Both tandem and non-tandem duplications are present in these genomes, suggesting different duplication mechanisms. In some of these mtDNAs, up to 25 percent of the total length is composed of tandem duplications of non-coding sequence that includes putative regulatory regions and/or pseudogenes of tRNAs and protein-coding genes along with otherwise unassignable sequences. These data indicate that imprecise initiation and termination of replication, slipped-strand mispairing, and intra-molecular recombination may all have played a role in generating repeats during the evolutionary history of plethodontid mitochondrial genomes.
Directory of Open Access Journals (Sweden)
Faridah Hani Mohamed Salleh
2017-01-01
Full Text Available Gene regulatory network (GRN reconstruction is the process of identifying regulatory gene interactions from experimental data through computational analysis. One of the main reasons for the reduced performance of previous GRN methods had been inaccurate prediction of cascade motifs. Cascade error is defined as the wrong prediction of cascade motifs, where an indirect interaction is misinterpreted as a direct interaction. Despite the active research on various GRN prediction methods, the discussion on specific methods to solve problems related to cascade errors is still lacking. In fact, the experiments conducted by the past studies were not specifically geared towards proving the ability of GRN prediction methods in avoiding the occurrences of cascade errors. Hence, this research aims to propose Multiple Linear Regression (MLR to infer GRN from gene expression data and to avoid wrongly inferring of an indirect interaction (A → B → C as a direct interaction (A → C. Since the number of observations of the real experiment datasets was far less than the number of predictors, some predictors were eliminated by extracting the random subnetworks from global interaction networks via an established extraction method. In addition, the experiment was extended to assess the effectiveness of MLR in dealing with cascade error by using a novel experimental procedure that had been proposed in this work. The experiment revealed that the number of cascade errors had been very minimal. Apart from that, the Belsley collinearity test proved that multicollinearity did affect the datasets used in this experiment greatly. All the tested subnetworks obtained satisfactory results, with AUROC values above 0.5.
Mongini, Patricia K. A.; Kramer, Jill M.; Ishikawa, Tomo-o; Herschman, Harvey; Esposito, Donna
2014-01-01
Sjogren’s syndrome (SS) is characterized by salivary gland leukocytic infiltrates and impaired salivation (xerostomia). Cox-2 (Ptgs2) is located on chromosome 1 within the span of the Aec2 region. In an attempt to demonstrate that COX-2 drives antibody-dependent hyposalivation, NOD.B10 congenic mice bearing a Cox-2flox gene were generated. A congenic line with non-NOD alleles in Cox-2-flanking genes failed manifest xerostomia. Further backcrossing yielded disease-susceptible NOD.B10 Cox-2flox lines; fine genetic mapping determined that critical Aec2 genes lie within a 1.56 to 2.17 Mb span of DNA downstream of Cox-2. Bioinformatics analysis revealed that susceptible and non-susceptible lines exhibit non-synonymous coding SNPs in 8 protein-encoding genes of this region, thereby better delineating candidate Aec2 alleles needed for SS xerostomia. PMID:24685748
The human oxytocin gene promoter is regulated by estrogens.
Richard, S; Zingg, H H
1990-04-15
Gonadal steroids affect brain function primarily by altering the expression of specific genes, yet the specific mechanisms by which neuronal target genes undergo such regulation are unknown. Recent evidence suggests that the expression of the neuropeptide gene for oxytocin (OT) is modulated by estrogens. We therefore examined the possibility that this regulation occurred via a direct interaction of the estrogen-receptor complex with cis-acting elements flanking the OT gene. DNA-mediated gene transfer experiments were performed using Neuro-2a neuroblastoma cells and chimeric plasmids containing portions of the human OT gene 5'-glanking region linked to the chloramphenicol acetyltransferase gene. We identified a 19-base pair region located at -164 to -146 upstream of the transcription start site which is capable of conferring estrogen responsiveness to the homologous as well as to a heterologous promoter. The hormonal response is strictly dependent on the presence of intracellular estrogen receptors, since estrogen induced stimulation occurred only in Neuro-2a cells co-transfected with an expression vector for the human estrogen receptor. The identified region contains a novel imperfect palindrome (GGTGACCTTGACC) with sequence similarity to other estrogen response elements (EREs). To define cis-acting elements that function in synergism with the ERE, sequences 3' to the ERE were deleted, including the CCAAT box, two additional motifs corresponding to the right half of the ERE palindrome (TGACC), as well as a CTGCTAA heptamer similar to the "elegans box" found in Caenorhabditis elegans. Interestingly, optimal function of the identified ERE was fully independent of these elements and only required a short promoter region (-49 to +36). Our studies define a molecular mechanism by which estrogens can directly modulate OT gene expression. However, only a subset of OT neurons are capable of binding estrogens, therefore, direct action of estrogens on the OT gene may be
Soil gases and SAR measurements reveal hidden faults on the sliding flank of Mt. Etna (Italy)
Bonforte, Alessandro; Federico, Cinzia; Giammanco, Salvatore; Guglielmino, Francesco; Liuzzo, Marco; Neri, Marco
2013-02-01
From October 2008 to November 2009, soil CO2, radon and structural field surveys were performed on Mt. Etna, in order to acquire insights into active tectonic structures in a densely populated sector of the south-eastern flank of the volcano, which is involved in the flank dynamics, as highlighted by satellite data (InSAR). The studied area extends about 150 km2, in a sector of the volcano where InSAR results detected several lineaments that were not well-defined from previous geological surveys. In order to validate and better constrain these features with ground data evidences, soil CO2 and soil radon measurements were performed along transects roughly orthogonal to the newly detected faults, with measurement points spaced about 100 m. In each transect, the highest CO2 values were found very close to the lineaments evidenced by InSAR observations. Anomalous soil CO2 and radon values were also measured at old eruptive fractures. In some portions of the investigated area soil gas anomalies were rather broad over transects, probably suggesting a complex structural framework consisting of several parallel volcano-tectonic structures, instead of a single one. Soil gas measurements proved particularly useful in areas at higher altitude on Mt. Etna (i.e. above 900 m asl), where InSAR results are not very informative/are fairly limited, and allowed recognizing the prolongation of some tectonic lineaments towards the summit of the volcano. At a lower altitude on the volcanic edifice, soil gas anomalies define the active structures indicated by InSAR results prominently, down to almost the coastline and through the northern periphery of the city of Catania. Coupling InSAR with soil gas prospecting methods has thus proved to be a powerful tool in detecting hidden active structures that do not show significant field evidences.
Ancient Origin of the U2 Small Nuclear RNA Gene-Targeting Non-LTR Retrotransposons Utopia.
Kojima, Kenji K; Jurka, Jerzy
2015-01-01
Most non-long terminal repeat (non-LTR) retrotransposons encoding a restriction-like endonuclease show target-specific integration into repetitive sequences such as ribosomal RNA genes and microsatellites. However, only a few target-specific lineages of non-LTR retrotransposons are distributed widely and no lineage is found across the eukaryotic kingdoms. Here we report the most widely distributed lineage of target sequence-specific non-LTR retrotransposons, designated Utopia. Utopia is found in three supergroups of eukaryotes: Amoebozoa, SAR, and Opisthokonta. Utopia is inserted into a specific site of U2 small nuclear RNA genes with different strength of specificity for each family. Utopia families from oomycetes and wasps show strong target specificity while only a small number of Utopia copies from reptiles are flanked with U2 snRNA genes. Oomycete Utopia families contain an "archaeal" RNase H domain upstream of reverse transcriptase (RT), which likely originated from a plant RNase H gene. Analysis of Utopia from oomycetes indicates that multiple lineages of Utopia have been maintained inside of U2 genes with few copy numbers. Phylogenetic analysis of RT suggests the monophyly of Utopia, and it likely dates back to the early evolution of eukaryotes.
Sequence and transcription analysis of the human cytomegalovirus DNA polymerase gene
International Nuclear Information System (INIS)
Kouzarides, T.; Bankier, A.T.; Satchwell, S.C.; Weston, K.; Tomlinson, P.; Barrell, B.G.
1987-01-01
DNA sequence analysis has revealed that the gene coding for the human cytomegalovirus (HCMV) DNA polymerase is present within the long unique region of the virus genome. Identification is based on extensive amino acid homology between the predicted HCMV open reading frame HFLF2 and the DNA polymerase of herpes simplex virus type 1. The authors present here a 5280 base-pair DNA sequence containing the HCMV pol gene, along with the analysis of transcripts encoded within this region. Since HCMV pol also shows homology to the predicted Epstein-Barr virus pol, they were able to analyze the extent of homology between the DNA polymerases of three distantly related herpes viruses, HCMV, Epstein-Barr virus, and herpes simplex virus. The comparison shows that these DNA polymerases exhibit considerable amino acid homology and highlights a number of highly conserved regions; two such regions show homology to sequences within the adenovirus type 2 DNA polymerase. The HCMV pol gene is flanked by open reading frames with homology to those of other herpes viruses; upstream, there is a reading frame homologous to the glycoprotein B gene of herpes simplex virus type I and Epstein-Barr virus, and downstream there is a reading frame homologous to BFLF2 of Epstein-Barr virus
Energy Technology Data Exchange (ETDEWEB)
Miranda, S.R.P.; Gwon, S.; DeGasperi, R. [New York Univ. Medical Center, NY (United States)] [and others
1994-09-01
Tay-Sachs disease (TSD) is an autosomal recessive storage disorder caused by a deficiency of the lysosomal enzyme, {beta}-N-acetylhexosaminidase A (Hex A), a heteropolymer composed of two polypeptides, {alpha} and {beta}. Mutations in the {alpha}-chain gene render the enzyme defective, resulting in the accumulation of g{sub m2} ganglioside in the nervous system. Deficiency of Hex A was detected in a non-Ashkenazic girl of Mexican origin indicating infantile onset of TSD. Molecular investigation of the {alpha}-chain gene excluded the typical Ashkenazic 4 bp insertion in the exon 11 and the intron 12 splice-junction mutations by Hae III and Dde I restriction analysis, respectively. Single strand conformation polymorphism (SSCP) analysis showed a different pattern in the sample where exon 11 and flanking regions were amplified in the patient DNA as compared to the migration of control DNA. Sequencing of PCR amplified genomic DNA containing exon 11 and flanking intronic regions showed a single base substitution (G {r_arrow} A) at position IVS-11 +1. This mutation creates a recognition site for the restriction enzyme Mbo II. Digestion of exon 11 and flanking regions with Mbo II demonstrated homozygosity of the patient for this mutation and heterozygosity in the mother. mRNA from cultured fibroblasts obtained from a normal control and from the propositus was reverse transcribed. The cDNAs coding for Hex A {alpha}-chain were amplified in four overlapping fragments. In the patient sample it was not possible to amplify the fragment containing the exon 11/intron 11 junction, indicating that this mutation alters normal RNA processing of the Hex A pre-mRNA resulting in the deficiency of Hex A activity.
International Nuclear Information System (INIS)
Shiga, Kiyoto; Yamamoto, Hiroshi; Okamoto, Hiroshi
1990-01-01
Rig (rat insulinoma gene) was first isolated from a cDNA library of rat insulinomas and has been found to be activated in various human tumors such as insulinomas, esophageal cancers, and colon cancers. Here the authors isolated the human homologue of rig from a genomic DNA library constructed from a human esophageal carcinoma and determined its complete nucleotide sequence. The gene is composed of about 3,000 nucleotides and divided into four exons separated by three introns: exon 3 encodes the nuclear location signal and the DNA-binding domain of the RIG protein. The transcription initiation site was located at -46 base pairs upstream from the first ATG codon. The 5'-flanking region of the gene has no apparent TATA-box or CAAT-box sequence. However, two GC boxes are found at -189 and -30 base pairs upstream from the transcription initiation site and five GC boxes are also found in introns 1 and 2. The gene is bounded in the 5' region by CpG islands, regions of DNA with a high GC content and a high frequency of CpG dinucleotides relative to the bulk genome. Furthermore, the human genome contains at least six copies of RIG pseudogenes, and four of them have the characteristics of processed pseudogenes. From these results together with the finding that RIG is expressed in a wide variety of tissues and cells, they speculate that RIG belongs to the class of housekeeping genes, whose products are necessary for the growth of all cell types
Krause, E Tobias; Kjaer, Joergen B; Lüders, Carolin; van, Loc Phi
2017-07-14
The neural serotonin (5-HT)/serotonin transporter (5-HTT) system is involved in the regulation of physiological processes and emotional states. In humans, the short (S) allele in the 5-HTT gene-linked polymorphic region, which decreases 5-HTT expression, has been shown to be associated with behavioral changes including an increased level of anxiety. Also in birds a polymorphism in the 5-HTT gene is described, a deletion (D) has been found to have functional consequences on growth and locomotion. Furthermore, the D-allele leads to an increased 5-HTT expression compared to the wild type (W), a feature which is linked to lower levels of fear in mammalian species. Thus, we aimed here to test whether the polymorphism in the chicken 5-HTT gene also leads to respective alternations of fear-related behaviors. We tested 268 hens of three genotypes (W/W, W/D, D/D) in two behavioral paradigms (open field, light-dark test) to assess fear-related behavior. Both tests revealed that hens possessing the D-allele showed lower levels of fear than those having the W-allele. These similar outcomes in fear-related behaviors in an avian and a mammalian species are associated with an increased 5-HTT expression. In the human 5-HTT gene, the long (L) allele is linked to such increased expression, whereas in chickens it is the D-allele. Thus, increased 5-HTT expression causing decreased fear may be a general mechanism in vertebrates. Copyright © 2017 Elsevier B.V. All rights reserved.
MitoRes: a resource of nuclear-encoded mitochondrial genes and their products in Metazoa.
Catalano, Domenico; Licciulli, Flavio; Turi, Antonio; Grillo, Giorgio; Saccone, Cecilia; D'Elia, Domenica
2006-01-24
Mitochondria are sub-cellular organelles that have a central role in energy production and in other metabolic pathways of all eukaryotic respiring cells. In the last few years, with more and more genomes being sequenced, a huge amount of data has been generated providing an unprecedented opportunity to use the comparative analysis approach in studies of evolution and functional genomics with the aim of shedding light on molecular mechanisms regulating mitochondrial biogenesis and metabolism. In this context, the problem of the optimal extraction of representative datasets of genomic and proteomic data assumes a crucial importance. Specialised resources for nuclear-encoded mitochondria-related proteins already exist; however, no mitochondrial database is currently available with the same features of MitoRes, which is an update of the MitoNuc database extensively modified in its structure, data sources and graphical interface. It contains data on nuclear-encoded mitochondria-related products for any metazoan species for which this type of data is available and also provides comprehensive sequence datasets (gene, transcript and protein) as well as useful tools for their extraction and export. MitoRes http://www2.ba.itb.cnr.it/MitoRes/ consolidates information from publicly external sources and automatically annotates them into a relational database. Additionally, it also clusters proteins on the basis of their sequence similarity and interconnects them with genomic data. The search engine and sequence management tools allow the query/retrieval of the database content and the extraction and export of sequences (gene, transcript, protein) and related sub-sequences (intron, exon, UTR, CDS, signal peptide and gene flanking regions) ready to be used for in silico analysis. The tool we describe here has been developed to support lab scientists and bioinformaticians alike in the characterization of molecular features and evolution of mitochondrial targeting sequences. The
Matsumoto, M; Imagawa, M; Aoki, Y
1999-01-01
3,3',4,4',5-Pentachlorobiphenyl (PenCB), one of the most toxic co-planar polychlorinated biphenyl congeners, specifically induces class Pi glutathione S-transferase (GSTP1) as well as cytochrome P-450 1A1 in primary cultured rat liver parenchymal cells [Aoki, Matsumoto and Suzuki (1993) FEBS Lett. 333, 114-118]. However, the 5'-flanking sequence of the GSTP1 gene does not contain a xenobiotic responsive element, to which arylhydrocarbon receptor binds. Using a chloramphenicol acetyltransferas...
International Nuclear Information System (INIS)
Madu, Ikenna G.; Belouzard, Sandrine; Whittaker, Gary R.
2009-01-01
The S2 domain of the coronavirus spike (S) protein is known to be responsible for mediating membrane fusion. In addition to a well-recognized cleavage site at the S1-S2 boundary, a second proteolytic cleavage site has been identified in the severe acute respiratory syndrome coronavirus (SARS-CoV) S2 domain (R797). C-terminal to this S2 cleavage site is a conserved region flanked by cysteine residues C822 and C833. Here, we investigated the importance of this well conserved region for SARS-CoV S-mediated fusion activation. We show that the residues between C822-C833 are well conserved across all coronaviruses. Mutagenic analysis of SARS-CoV S, combined with cell-cell fusion and pseudotyped virion infectivity assays, showed a critical role for the core-conserved residues C822, D830, L831, and C833. Based on available predictive models, we propose that the conserved domain flanked by cysteines 822 and 833 forms a loop structure that interacts with components of the SARS-CoV S trimer to control the activation of membrane fusion.
Regulation of the Apolipoprotein Gene Cluster by a Long Noncoding RNA
Directory of Open Access Journals (Sweden)
Paul Halley
2014-01-01
Full Text Available Apolipoprotein A1 (APOA1 is the major protein component of high-density lipoprotein (HDL in plasma. We have identified an endogenously expressed long noncoding natural antisense transcript, APOA1-AS, which acts as a negative transcriptional regulator of APOA1 both in vitro and in vivo. Inhibition of APOA1-AS in cultured cells resulted in the increased expression of APOA1 and two neighboring genes in the APO cluster. Chromatin immunoprecipitation (ChIP analyses of a ∼50 kb chromatin region flanking the APOA1 gene demonstrated that APOA1-AS can modulate distinct histone methylation patterns that mark active and/or inactive gene expression through the recruitment of histone-modifying enzymes. Targeting APOA1-AS with short antisense oligonucleotides also enhanced APOA1 expression in both human and monkey liver cells and induced an increase in hepatic RNA and protein expression in African green monkeys. Furthermore, the results presented here highlight the significant local modulatory effects of long noncoding antisense RNAs and demonstrate the therapeutic potential of manipulating the expression of these transcripts both in vitro and in vivo.
A genetic ensemble approach for gene-gene interaction identification
Directory of Open Access Journals (Sweden)
Ho Joshua WK
2010-10-01
Full Text Available Abstract Background It has now become clear that gene-gene interactions and gene-environment interactions are ubiquitous and fundamental mechanisms for the development of complex diseases. Though a considerable effort has been put into developing statistical models and algorithmic strategies for identifying such interactions, the accurate identification of those genetic interactions has been proven to be very challenging. Methods In this paper, we propose a new approach for identifying such gene-gene and gene-environment interactions underlying complex diseases. This is a hybrid algorithm and it combines genetic algorithm (GA and an ensemble of classifiers (called genetic ensemble. Using this approach, the original problem of SNP interaction identification is converted into a data mining problem of combinatorial feature selection. By collecting various single nucleotide polymorphisms (SNP subsets as well as environmental factors generated in multiple GA runs, patterns of gene-gene and gene-environment interactions can be extracted using a simple combinatorial ranking method. Also considered in this study is the idea of combining identification results obtained from multiple algorithms. A novel formula based on pairwise double fault is designed to quantify the degree of complementarity. Conclusions Our simulation study demonstrates that the proposed genetic ensemble algorithm has comparable identification power to Multifactor Dimensionality Reduction (MDR and is slightly better than Polymorphism Interaction Analysis (PIA, which are the two most popular methods for gene-gene interaction identification. More importantly, the identification results generated by using our genetic ensemble algorithm are highly complementary to those obtained by PIA and MDR. Experimental results from our simulation studies and real world data application also confirm the effectiveness of the proposed genetic ensemble algorithm, as well as the potential benefits of
Energy Technology Data Exchange (ETDEWEB)
Hernandez-Gonzalez, L. W.; Perez-Rodriguez, R.; Zambrano-Robledo, P.; Guerrero-Mata, M.; Dumitrescu, L.
2011-07-01
This work deals with the experimental study of the flank wear evolution of two coating carbide inserts and a cermet insert during the dry finishing turning of AISI 1045 steel with 400, 500 and 600 m/min cutting speeds. The results were analyzed using the variance analysis and lineal regression analysis in order to describe the relationship between the flank wear and machining time, obtaining the adjusted model equation. The investigation demonstrated a significant effect of cutting speed and machining time on the flank wear at high speed machining. The three coating layers insert showed the best performance while the two layers insert had the worst behaviour of the cutting tool wear at high cutting speeds. (Author) 19 refs.
Drabova, Jana; Trkova, Marie; Hancarova, Miroslava; Novotna, Drahuse; Hejtmankova, Michaela; Havlovicova, Marketa; Sedlacek, Zdenek
2014-01-01
Inversions are balanced structural chromosome rearrangements, which can influence gene expression and the risk of unbalanced chromosome constitution in offspring. Many examples of inversion polymorphisms exist in human, affecting both heterochromatic regions and euchromatin. We describe a novel, 15 Mb long paracentric inversion, inv(21)(q21.1q22.11), affecting more than a third of human 21q. Despite of its length, the inversion cannot be detected using karyotyping due to similar band patterns on the normal and inverted chromosomes, and is therefore likely to escape attention. Its identification was aided by the repeated observation of the same pair of 150 kb long duplications present in cis on chromosome 21 in three Czech families subjected to microarray analysis. The finding prompted us to hypothesise that this co-occurrence of two remote duplications could be associated with an inversion of the intervening segment, and this speculation turned out to be right. The inversion was confirmed in a series of FISH experiments which also showed that the second copy of each of the duplications was always located at the opposite end of the inversion. The presence of the same pair of duplications in additional individuals reported in public databases indicates that the inversion may also be present in other populations. Three out of the total of about 4000 chromosomes 21 examined in our sample carried the duplications and were inverted, corresponding to carrier frequency of about 1/660. Although the breakpoints affect protein-coding genes, the occurrence of the inversion in normal parents and siblings of our patients and the occurrence of the duplications in unaffected controls in databases indicate that this rare variant is rather non-pathogenic. The inverted segment carried an identical shared haplotype in the three families studied. The haplotypes, however, diverged very rapidly in the flanking regions, possibly pointing to an ancient founder event at the origin of the
Energy Technology Data Exchange (ETDEWEB)
Tran, Thi Kim Anh [School of Environmental and Life Sciences, The University of Newcastle, Callaghan, NSW 2308 (Australia); Department of Agriculture, Forestry and Fisheries, Vinh University, 182 Le Duan St., Vinh City, Nghe An (Viet Nam); MacFarlane, Geoff R. [School of Environmental and Life Sciences, The University of Newcastle, Callaghan, NSW 2308 (Australia); Kong, Richard Yuen Chong [Department of Biology and Chemistry, City University of Hong Kong, Tat Chee Avenue, Kowloon, Hong Kong Special Administrative Region (China); O’Connor, Wayne A. [New South Wales Department of Primary Industries, Port Stephens Fisheries Institute, Taylors Beach, NSW 2316 (Australia); Yu, Richard Man Kit, E-mail: Richard.Yu@newcastle.edu.au [School of Environmental and Life Sciences, The University of Newcastle, Callaghan, NSW 2308 (Australia)
2016-10-15
Highlights: • This is the first report on the putative promoter sequence of a molluscan ER gene. • The gene promoter contains putative binding sites for direct and indirect interaction with ER. • E2 upregulates ER gene expression in the ovary in vitro and in vivo. • E2-induced gene expression may require a novel ligand-dependent receptor. • The ER proximal promoter is hypomethylated regardless of gene expression levels. - Abstract: In vertebrates, estrogens and estrogen mimicking chemicals modulate gene expression mainly through a genomic pathway mediated by the estrogen receptors (ERs). Although the existence of an ER orthologue in the mollusc genome has been known for some time, its role in estrogen signalling has yet to be deciphered. This is largely due to its constitutive (ligand-independent) activation and a limited mechanistic understanding of its regulation. To fill this knowledge gap, we cloned and characterised an ER cDNA (sgER) and the 5′-flanking region of the gene from the Sydney rock oyster Saccostrea glomerata. The sgER cDNA is predicted to encode a 477-amino acid protein that contains a DNA-binding domain (DBD) and a ligand-binding domain (LBD) typically conserved among both vertebrate and invertebrate ERs. A comparison of the sgER LBD sequence with those of other ligand-dependent ERs revealed that the sgER LBD is variable at several conserved residues known to be critical for ligand binding and receptor activation. Ligand binding assays using fluorescent-labelled E2 and purified sgER protein confirmed that sgER is devoid of estrogen binding. In silico analysis of the sgER 5′-flanking sequence indicated the presence of three putative estrogen responsive element (ERE) half-sites and several putative sites for ER-interacting transcription factors, suggesting that the sgER promoter may be autoregulated by its own gene product. sgER mRNA is ubiquitously expressed in adult oyster tissues, with the highest expression found in the ovary
International Nuclear Information System (INIS)
Reue, K.; Leff, T.; Breslow, J.L.
1988-01-01
Apolipoprotein CIII (apoCIII) is a major protein constituent of triglyceride-rich lipoproteins and is synthesized primarily in the liver. Cis-acting DNA elements required for liver-specific apoCIII gene transcription were identified with transient expression assays in the human hepatoma (HepG2) and epithelial carcinoma (HeLa) cell lines. In liver cells, 821 nucleotides of the human apoCIII gene 5'-flanking sequence were required for maximum levels of gene expression, while the proximal 110 nucleotides alone were sufficient. No expression was observed in similar studies with HeLa cells. The level of expression was modulated by a combination of positive and negative cis-acting sequences, which interact with distinct sets of proteins from liver and HeLa cell nuclear extracts. The proximal positive regulatory region shares homology with similarly located sequences of other genes strongly expressed in the liver, including α 1 -antitrypsin and other apolipoprotein genes. The negative regulatory region is striking homologous to the human β-interferon gene regulatory element. The distal positive region shares homology with some viral enhancers and has properties of a tissue-specific enhancer. The regulation of the apoCIII gene is complex but shares features with other genes, suggesting shuffling of regulatory elements as a common mechanism for cell type-specific gene expression
Structure of the human hepatic triglyceride lipase gene
International Nuclear Information System (INIS)
Cai, Shengjian; Wong, D.M.; Chen, Sanhwan; Chan, L.
1989-01-01
The structure of the human hepatic triglyceride lipase gene was determined from multiple cosmid clones. All the exons, exon-intron junctions, and 845 bp of the 5' and 254 bp of the 3' flanking DNA were sequenced. Comparison of the exon sequences to three previously published cDNA sequences revealed differences in the sequence of the codons for residue 133, 193, 202, and 234 that may represent sequence polymorphisms. By primer extension, hepatic lipase mRNA initiates at an adenine 77 bases upstream of the translation initiation site. The hepatic lipase gene spans over 60 kb containing 9 exons and 8 introns, the latter being all located within the region encoding the mature protein. The exons are all of average size (118-234 bp). Exon 1 encodes the signal peptide, exon 4, a region that binds to the lipoprotein substrate, and exon 5, an evolutionarily highly conserved region of potential catalytic function, and exons 6 and 9 encode sequences rich in basic amino acids thought to be important in anchoring the enzyme to the endothelial surface by interacting with acidic domains of the surface glycosaminoglycans. The human lipoprotein lipase gene has been recently reported to have an identical exon-intron organization containing the analogous structural domains. The observations strongly support the common evolutionary origin of these two lipolytic enzymes
Complete exon sequencing of all known Usher syndrome genes greatly improves molecular diagnosis.
Bonnet, Crystel; Grati, M'hamed; Marlin, Sandrine; Levilliers, Jacqueline; Hardelin, Jean-Pierre; Parodi, Marine; Niasme-Grare, Magali; Zelenika, Diana; Délépine, Marc; Feldmann, Delphine; Jonard, Laurence; El-Amraoui, Aziz; Weil, Dominique; Delobel, Bruno; Vincent, Christophe; Dollfus, Hélène; Eliot, Marie-Madeleine; David, Albert; Calais, Catherine; Vigneron, Jacqueline; Montaut-Verient, Bettina; Bonneau, Dominique; Dubin, Jacques; Thauvin, Christel; Duvillard, Alain; Francannet, Christine; Mom, Thierry; Lacombe, Didier; Duriez, Françoise; Drouin-Garraud, Valérie; Thuillier-Obstoy, Marie-Françoise; Sigaudy, Sabine; Frances, Anne-Marie; Collignon, Patrick; Challe, Georges; Couderc, Rémy; Lathrop, Mark; Sahel, José-Alain; Weissenbach, Jean; Petit, Christine; Denoyelle, Françoise
2011-05-11
Usher syndrome (USH) combines sensorineural deafness with blindness. It is inherited in an autosomal recessive mode. Early diagnosis is critical for adapted educational and patient management choices, and for genetic counseling. To date, nine causative genes have been identified for the three clinical subtypes (USH1, USH2 and USH3). Current diagnostic strategies make use of a genotyping microarray that is based on the previously reported mutations. The purpose of this study was to design a more accurate molecular diagnosis tool. We sequenced the 366 coding exons and flanking regions of the nine known USH genes, in 54 USH patients (27 USH1, 21 USH2 and 6 USH3). Biallelic mutations were detected in 39 patients (72%) and monoallelic mutations in an additional 10 patients (18.5%). In addition to biallelic mutations in one of the USH genes, presumably pathogenic mutations in another USH gene were detected in seven patients (13%), and another patient carried monoallelic mutations in three different USH genes. Notably, none of the USH3 patients carried detectable mutations in the only known USH3 gene, whereas they all carried mutations in USH2 genes. Most importantly, the currently used microarray would have detected only 30 of the 81 different mutations that we found, of which 39 (48%) were novel. Based on these results, complete exon sequencing of the currently known USH genes stands as a definite improvement for molecular diagnosis of this disease, which is of utmost importance in the perspective of gene therapy.
Complete exon sequencing of all known Usher syndrome genes greatly improves molecular diagnosis
Directory of Open Access Journals (Sweden)
Lacombe Didier
2011-05-01
Full Text Available Abstract Background Usher syndrome (USH combines sensorineural deafness with blindness. It is inherited in an autosomal recessive mode. Early diagnosis is critical for adapted educational and patient management choices, and for genetic counseling. To date, nine causative genes have been identified for the three clinical subtypes (USH1, USH2 and USH3. Current diagnostic strategies make use of a genotyping microarray that is based on the previously reported mutations. The purpose of this study was to design a more accurate molecular diagnosis tool. Methods We sequenced the 366 coding exons and flanking regions of the nine known USH genes, in 54 USH patients (27 USH1, 21 USH2 and 6 USH3. Results Biallelic mutations were detected in 39 patients (72% and monoallelic mutations in an additional 10 patients (18.5%. In addition to biallelic mutations in one of the USH genes, presumably pathogenic mutations in another USH gene were detected in seven patients (13%, and another patient carried monoallelic mutations in three different USH genes. Notably, none of the USH3 patients carried detectable mutations in the only known USH3 gene, whereas they all carried mutations in USH2 genes. Most importantly, the currently used microarray would have detected only 30 of the 81 different mutations that we found, of which 39 (48% were novel. Conclusions Based on these results, complete exon sequencing of the currently known USH genes stands as a definite improvement for molecular diagnosis of this disease, which is of utmost importance in the perspective of gene therapy.
Directory of Open Access Journals (Sweden)
Maarten de Wit
2018-05-01
Full Text Available The Makhonjwa Mountains, traditionally referred to as the Barberton Greenstone Belt, retain an iconic Paleoarchean archive against which numerical models of early earth geodynamics can be tested. We present new geologic and structural maps, geochemical plots, geo- and thermo-chronology, and geophysical data from seven silicic, mafic to ultramafic complexes separated by major shear systems across the southern Makhonjwa Mountains. All reveal signs of modern oceanic back-arc crust and subduction-related processes. We compare the rates of processes determined from this data and balance these against plate tectonic and plume related models. Robust rates of both horizontal and vertical tectonic processes derived from the Makhonjwa Mountain complexes are similar, well within an order of magnitude, to those encountered across modern oceanic and orogenic terrains flanking Western Pacific-like subduction zones. We conclude that plate tectonics and linked plate-boundary processes were well established by 3.2–3.6 Ga. Our work provides new constraints for modellers with rates of a ‘basket’ of processes against which to test Paleoarchean geodynamic models over a time period close to the length of the Phanerozoic. Keywords: Paleoarchean, Barberton Greenstone Belt, Onverwacht Suite, Geologic bedrock and structural maps, Geochemistry and geophysics, Plate tectonics
Abe, Kimihiro; Shimizu, Shin-Ya; Tsuda, Shuhei; Sato, Tsutomu
2017-09-12
Gene rearrangement is a widely-shared phenomenon in spore forming bacteria, in which prophage(-like) elements interrupting sporulation-specific genes are excised from the host genome to reconstitute the intact gene. Here, we report a novel class of gene-intervening elements, named gin, inserted in the 225 bp gerE-coding region of the B. cereus ATCC10987 genome, which generates a sporulation-specific rearrangement. gin has no phage-related genes and possesses three site-specific recombinase genes; girA, girB, and girC. We demonstrated that the gerE rearrangement occurs at the middle stage of sporulation, in which site-specific DNA recombination took place within the 9 bp consensus sequence flanking the disrupted gerE segments. Deletion analysis of gin uncovered that GirC and an additional factor, GirX, are responsible for gerE reconstitution. Involvement of GirC and GirX in DNA recombination was confirmed by an in vitro recombination assay. These results broaden the definition of the sporulation-specific gene rearrangement phenomenon: gene-intervening elements are not limited to phage DNA but may include non-viral genetic elements that carry a developmentally-regulated site-specific recombination system.
LCGbase: A Comprehensive Database for Lineage-Based Co-regulated Genes.
Wang, Dapeng; Zhang, Yubin; Fan, Zhonghua; Liu, Guiming; Yu, Jun
2012-01-01
Animal genes of different lineages, such as vertebrates and arthropods, are well-organized and blended into dynamic chromosomal structures that represent a primary regulatory mechanism for body development and cellular differentiation. The majority of genes in a genome are actually clustered, which are evolutionarily stable to different extents and biologically meaningful when evaluated among genomes within and across lineages. Until now, many questions concerning gene organization, such as what is the minimal number of genes in a cluster and what is the driving force leading to gene co-regulation, remain to be addressed. Here, we provide a user-friendly database-LCGbase (a comprehensive database for lineage-based co-regulated genes)-hosting information on evolutionary dynamics of gene clustering and ordering within animal kingdoms in two different lineages: vertebrates and arthropods. The database is constructed on a web-based Linux-Apache-MySQL-PHP framework and effective interactive user-inquiry service. Compared to other gene annotation databases with similar purposes, our database has three comprehensible advantages. First, our database is inclusive, including all high-quality genome assemblies of vertebrates and representative arthropod species. Second, it is human-centric since we map all gene clusters from other genomes in an order of lineage-ranks (such as primates, mammals, warm-blooded, and reptiles) onto human genome and start the database from well-defined gene pairs (a minimal cluster where the two adjacent genes are oriented as co-directional, convergent, and divergent pairs) to large gene clusters. Furthermore, users can search for any adjacent genes and their detailed annotations. Third, the database provides flexible parameter definitions, such as the distance of transcription start sites between two adjacent genes, which is extendable to genes that flanking the cluster across species. We also provide useful tools for sequence alignment, gene
Kannan, Lavanya; Li, Hua; Rubinstein, Boris; Mushegian, Arcady
2013-01-01
Background The problem of probabilistic inference of gene content in the last common ancestor of several extant species with completely sequenced genomes is: for each gene that is conserved in all or some of the genomes, assign the probability that its ancestral gene was present in the genome of their last common ancestor. Results We have developed a family of models of gene gain and gene loss in evolution, and applied the maximum-likelihood approach that uses phylogenetic tree of prokaryotes...
Brauburger, Kristina; Boehmann, Yannik; Krähling, Verena; Mühlberger, Elke
2016-02-15
The highly pathogenic Ebola virus (EBOV) has a nonsegmented negative-strand (NNS) RNA genome containing seven genes. The viral genes either are separated by intergenic regions (IRs) of variable length or overlap. The structure of the EBOV gene overlaps is conserved throughout all filovirus genomes and is distinct from that of the overlaps found in other NNS RNA viruses. Here, we analyzed how diverse gene borders and noncoding regions surrounding the gene borders influence transcript levels and govern polymerase behavior during viral transcription. Transcription of overlapping genes in EBOV bicistronic minigenomes followed the stop-start mechanism, similar to that followed by IR-containing gene borders. When the gene overlaps were extended, the EBOV polymerase was able to scan the template in an upstream direction. This polymerase feature seems to be generally conserved among NNS RNA virus polymerases. Analysis of IR-containing gene borders showed that the IR sequence plays only a minor role in transcription regulation. Changes in IR length were generally well tolerated, but specific IR lengths led to a strong decrease in downstream gene expression. Correlation analysis revealed that these effects were largely independent of the surrounding gene borders. Each EBOV gene contains exceptionally long untranslated regions (UTRs) flanking the open reading frame. Our data suggest that the UTRs adjacent to the gene borders are the main regulators of transcript levels. A highly complex interplay between the different cis-acting elements to modulate transcription was revealed for specific combinations of IRs and UTRs, emphasizing the importance of the noncoding regions in EBOV gene expression control. Our data extend those from previous analyses investigating the implication of noncoding regions at the EBOV gene borders for gene expression control. We show that EBOV transcription is regulated in a highly complex yet not easily predictable manner by a set of interacting cis
Genetic Basis for Geosmin Production by the Water Bloom-Forming Cyanobacterium, Anabaena ucrainica
Directory of Open Access Journals (Sweden)
Zhongjie Wang
2014-12-01
Full Text Available Geosmin is a common, musty-smelling sesquiterpene, principally produced by cyanobacteria. Anabaena ucrainica (Schhorb. Watanabe, a water bloom-forming cyanobacterium, is the geosmin producer responsible for odor problems in Dianchi and Erhai lakes in China. In this study, the geosmin synthase gene (geo of A. ucrainica and its flanking regions were identified and cloned by polymerase chain reaction (PCR and genome walking. The geo gene was found to be located in a transcription unit with two cyclic nucleotide-binding protein genes (cnb. The two cnb genes were highly similar and were predicted members of the cyclic adenosine monophosphate (cAMP receptor protein/fumarate nitrate reductase regulator (Crp–Fnr family. Phylogenetic and evolutionary analyses implied that the evolution of the geosmin genes involved a horizontal gene transfer process in cyanobacteria. These genes showed a close relationship to 2-methylisoborneol genes in origin and evolution.
Sharma, Prem N; Torii, Akihide; Takumi, Shigeo; Mori, Naoki; Nakamura, Chiharu
2004-01-01
Brown planthopper (BPH) (Nilaparvata lugens Stål) is a significant insect pest of rice (Oryza sativa L.). We constructed a gene-pyramided japonica line, in which two BPH resistance genes Bph1 and Bph2 on the long arm of chromosome 12 independently derived from two indica resistance lines were combined through the recombinant selection. The gene-pyramiding was achieved based on the previously constructed high-resolution linkage maps of the two genes. Two co-dominant and four dominant PCR-based markers flanking the loci were used to select for a homozygous recombinant line in a segregating population that was derived from a cross between the parental homozygous single-gene introgression lines. BPH bioassay showed that the resistance level of the pyramided line was equivalent to that of the Bph1-single introgression line, which showed a higher level of resistance than the Bph2-single introgression line. The pyramid line should provide a useful experimental means for studying the fine structure of the chromosomal region covering these two major BPH resistance genes.
Generalized Artificial Life Structure for Time-dependent Problems
Institute of Scientific and Technical Information of China (English)
TSAU Minhe; KAO Weiwen; CHANG Albert
2009-01-01
In recent years, more attention has been paid on artificial life researches. Artificial life(AL) is a research on regulating gene parameters of digital organisms under complicated problematic environments through natural selections and evolutions to achieve the final emergence of intelligence. Most recent studies focused on solving certain real problems by artificial life methods, yet without much address on the AL life basic mechanism. The real problems are often very complicated, and the proposed methods sometimes seem too simple to handle those problems. This study proposed a new approach in AL research, named "generalized artificial life structure(GALS)", in which the traditional "gene bits" in genetic algorithms is first replaced by "gene parameters", which could appear anywhere in GALS. A modeling procedure is taken to normalize the input data, and AL "tissue" is innovated to make AL more complex. GALS is anticipated to contribute significantly to the fitness of AL evolution. The formation of"tissue" begins with some different AL basic cells, and then tissue is produced by the casual selections of one or several of these cells. As a result, the gene parameters, represented by "tissues", could become highly diversified. This diversification should have obvious effects on improving gene fitness. This study took the innovative method of GALS in a stock forecasting problem under a carefully designed manipulating platform. And the researching results verify that the GALS is successful in improving the gene evolution fitness.
PGMA-Based Cationic Nanoparticles with Polyhydric Iodine Units for Advanced Gene Vectors.
Sun, Yue; Hu, Hao; Yu, Bingran; Xu, Fu-Jian
2016-11-16
It is crucial for successful gene delivery to develop safe, effective, and multifunctional polycations. Iodine-based small molecules are widely used as contrast agents for CT imaging. Herein, a series of star-like poly(glycidyl methacrylate) (PGMA)-based cationic vectors (II-PGEA/II) with abundant flanking polyhydric iodine units are prepared for multifunctional gene delivery systems. The proposed II-PGEA/II star vector is composed of one iohexol intermediate (II) core and five ethanolamine (EA) and II-difunctionalized PGMA arms. The amphipathic II-PGEA/II vectors readily self-assemble into well-defined cationic nanoparticles, where massive hydroxyl groups can establish a hydration shell to stabilize the nanoparticles. The II introduction improves cell viabilities of polycations. Moreover, by controlling the suitable amount of introduced II units, the resultant II-PGEA/II nanoparticles can produce fairly good transfection performances in different cell lines. Particularly, the II-PGEA/II nanoparticles induce much better in vitro CT imaging abilities in tumor cells than iohexol (one commonly used commercial CT contrast agent). The present design of amphipathic PGMA-based nanoparticles with CT contrast agents would provide useful information for the development of new multifunctional gene delivery systems.
Hepatocyte specific expression of human cloned genes
Energy Technology Data Exchange (ETDEWEB)
Cortese, R
1986-01-01
A large number of proteins are specifically synthesized in the hepatocyte. Only the adult liver expresses the complete repertoire of functions which are required at various stages during development. There is therefore a complex series of regulatory mechanisms responsible for the maintenance of the differentiated state and for the developmental and physiological variations in the pattern of gene expression. Human hepatoma cell lines HepG2 and Hep3B display a pattern of gene expression similar to adult and fetal liver, respectively; in contrast, cultured fibroblasts or HeLa cells do not express most of the liver specific genes. They have used these cell lines for transfection experiments with cloned human liver specific genes. DNA segments coding for alpha1-antitrypsin and retinol binding protein (two proteins synthesized both in fetal and adult liver) are expressed in the hepatoma cell lines HepG2 and Hep3B, but not in HeLa cells or fibroblasts. A DNA segment coding for haptoglobin (a protein synthesized only after birth) is only expressed in the hepatoma cell line HepG2 but not in Hep3B nor in non hepatic cell lines. The information for tissue specific expression is located in the 5' flanking region of all three genes. In vivo competition experiments show that these DNA segments bind to a common, apparently limiting, transacting factor. Conventional techniques (Bal deletions, site directed mutagenesis, etc.) have been used to precisely identify the DNA sequences responsible for these effects. The emerging picture is complex: they have identified multiple, separate transcriptional signals, essential for maximal promoter activation and tissue specific expression. Some of these signals show a negative effect on transcription in fibroblast cell lines.
Directory of Open Access Journals (Sweden)
Angeline S Andrew
Full Text Available Bladder cancer is the 4(th most common cancer among men in the U.S. We analyzed variant genotypes hypothesized to modify major biological processes involved in bladder carcinogenesis, including hormone regulation, apoptosis, DNA repair, immune surveillance, metabolism, proliferation, and telomere maintenance. Logistic regression was used to assess the relationship between genetic variation affecting these processes and susceptibility in 563 genotyped urothelial cell carcinoma cases and 863 controls enrolled in a case-control study of incident bladder cancer conducted in New Hampshire, U.S. We evaluated gene-gene interactions using Multifactor Dimensionality Reduction (MDR and Statistical Epistasis Network analysis. The 3'UTR flanking variant form of the hormone regulation gene HSD3B2 was associated with increased bladder cancer risk in the New Hampshire population (adjusted OR 1.85 95%CI 1.31-2.62. This finding was successfully replicated in the Texas Bladder Cancer Study with 957 controls, 497 cases (adjusted OR 3.66 95%CI 1.06-12.63. The effect of this prevalent SNP was stronger among males (OR 2.13 95%CI 1.40-3.25 than females (OR 1.56 95%CI 0.83-2.95, (SNP-gender interaction P = 0.048. We also identified a SNP-SNP interaction between T-cell activation related genes GATA3 and CD81 (interaction P = 0.0003. The fact that bladder cancer incidence is 3-4 times higher in males suggests the involvement of hormone levels. This biologic process-based analysis suggests candidate susceptibility markers and supports the theory that disrupted hormone regulation plays a role in bladder carcinogenesis.
Structure and function of the human metallothionein gene family: Final technical report
International Nuclear Information System (INIS)
Karin, M.
1986-01-01
The full nucleotide sequence of two additional human metallothionein (hMT) genes has been determined. These genes, hMT-I/sub B/ and hMT-I/sub F/, are located within the MT-I gene cluster we have described originally. The hMT-I/sub F/ gene is the first hMT-I gene whose amino acid sequence is in complete agreement with the published sequence of the human MT-I proteins. Therefore it is likely to be an active gene encoding a functional protein. However, since we have just completed the sequence analysis, we have not characterized this gene further yet. The hMT-I/sub B/ gene is closely linked to the hMT-I/sub A/ gene, and two pseudogenes, hMT-I/sub C/ and hMT-I/sub D/ separate the two. From its nucleotide sequence hMT-I/sub B/ seems to be an active gene, encoding a functional protein even though it differs in four positions from the published sequence of human MT-I proteins. This gene is expressed in a human hepatoma cell line, HepG2, and its expression is stimulated by Cd ++ . Using gene fusions to the viral thymidine-kinase gene we find that hMT-I/sub B/, like the hMT-I/sub A/ and hMT-II/sub A/ genes, contains a heavy metal responsive promoterregulatory element within its 5' flanking region. We analyzed the level of hMT-I/sub B/ mRNA in a variety of human cell lines by the S1 nuclease technique, and compared it to the expression of the hMT-II/sub A/ gene. While the hMT-II/sub A/ gene was expressed in all of the cell lines analyzed, the hMT-I/sub B/ gene was expressed in liver and kidney derived cell lines cells. This suggest that the expression of the hMT-I/sub B/ gene is controlled in a tissue specific manner. 13 refs
Venken, Koen J. T.; Schulze, Karen L.; Haelterman, Nele A.; Pan, Hongling; He, Yuchun; Evans-Holm, Martha; Carlson, Joseph W.; Levis, Robert W.; Spradling, Allan C.; Hoskins, Roger A.; Bellen, Hugo J.
2011-01-01
We demonstrate the versatility of a collection of insertions of the transposon Minos mediated integration cassette (MiMIC), in Drosophila melanogaster. MiMIC contains a gene-trap cassette and the yellow+ marker flanked by two inverted bacteriophage ΦC31 attP sites. MiMIC integrates almost at random in the genome to create sites for DNA manipulation. The attP sites allow the replacement of the intervening sequence of the transposon with any other sequence through recombinase mediated cassette exchange (RMCE). We can revert insertions that function as gene traps and cause mutant phenotypes to wild type by RMCE and modify insertions to control GAL4 or QF overexpression systems or perform lineage analysis using the Flp system. Insertions within coding introns can be exchanged with protein-tag cassettes to create fusion proteins to follow protein expression and perform biochemical experiments. The applications of MiMIC vastly extend the Drosophila melanogaster toolkit. PMID:21985007
Wen, Y; Sachs, G; Athmann, C
2000-02-01
The development of the lens is dependent on the proliferation of lens epithelial cells and their differentiation into fiber cells near the lens bow/equator. Identification of genes specifically expressed in the lens epithelial cells and their functions may provide insight into molecular events that regulate the processes of lens epithelial cell differentiation. In this study, a novel lens epithelium gene product, LEP503, identified from rat by a subtractive cDNA cloning strategy was investigated in the genome organization, mRNA expression and protein localization. The genomic sequences for LEP503 isolated from rat, mouse and human span 1754 bp, 1694 bp and 1895 bp regions encompassing the 5'-flanking region, two exons, one intron and 3'-flanking region. All exon-intron junction sequences conform to the GT/AG rule. Both mouse and human LEP503 genes show very high identity (93% for mouse and 79% for human) to rat LEP503 gene in the exon 1 that contains an open reading frame coding for a protein of 61 amino acid residues with a leucine-rich domain. The deduced protein sequences also show high identity (91% between mouse and rat and 77% between human and rat). Western blot shows that LEP503 is present as a specific approximately 6.9 kDa band in the water-insoluble-urea-soluble fraction of lens cortex where lens epithelium is included. Immuno-staining shows that LEP503 is localized in the epithelial cells along the entire anterior surface of rat lens. Developmentally, LEP503 is expressed at a low level at newborn, and then the expression level increases by about ten-fold around postnatal day 14 and remains at this high level for about 25 days before it drops back to the low level by postnatal day 84. These data suggest that the LEP503 may be an important lens epithelial cell gene involving the processes of epithelial cell differentiation. Copyright 2000 Academic Press.
Tchoudakova, A; Kishida, M; Wood, E; Callard, G V
2001-11-01
Teleost fish are characterized by exceptionally high levels of neural estrogen biosynthesis when compared with the brains of other vertebrates or to the ovaries of the same fish. Two P450arom mRNAs which derive from separate gene loci (cyp19a and cyp19b) are differentially expressed in brain (b>a) and ovary (a>b) and have a different developmental program (b>a) and estrogen upregulation (b only). A polymerase chain reaction (PCR)-based genomic walking strategy was used to isolate the 5'-flanking regions of the goldfish (Carassius auratus) cyp19 genes. Sequence analysis of the cyp19b gene approximately 1.8 kb upstream of the transcription start site revealed a TATA box at nucleotide (nt) -30, two estrogen responsive elements (EREs; nt -351 and -211) and a consensus binding site (NBRE) for nerve growth factor inducible-B protein (NGFI-B/Nur77) at -286, which includes another ERE half-site. Also present were a sequence at nt -399 (CCCTCCT) required for neural specificity of the zebrafish GATA-2 gene, and 16 copies of an SRY/SOX binding motif. The 5'-flanking region ( approximately 1.0 kb) of the cyp19a gene had TATA (nt -48) and CAAT (nt -71) boxes, a steroidogenic factor-1 (SF-1) binding site (nt -265), eight copies of the SRY/SOX motif, and two copies of a recognition site for binding the arylhydrocarbon receptor (AhR)/AhR nuclear translocator factor (ARNT) heterodimer. Both genes had elements previously identified in the brain specific exon I promoter of the mouse aromatase gene. Cyp19a- and -b/luciferase constructs showed basal promoter activity in aromatase-expressing rodent pituitary (GH3) cells, but differences (a>b) did not reflect expression in fish pituitary in vivo (b>a), implying a lack of appropriate cell factors. Consistent with the onset of cyp19b expression in zebrafish embryos, microinjection of a green fluorescent protein (GFP) reporter plasmid into fertilized eggs revealed labeling in neural tissues at 30-48 h post-fertilization (hpf), most
Directory of Open Access Journals (Sweden)
Palmer Jeffrey D
2006-09-01
Full Text Available Abstract Background Horizontal gene transfer (HGT to the plant mitochondrial genome has recently been shown to occur at a surprisingly high rate; however, little evidence has been found for HGT to the plastid genome, despite extensive sequencing. In this study, we analyzed all genes from sequenced plastid genomes to unearth any neglected cases of HGT and to obtain a measure of the overall extent of HGT to the plastid. Results Although several genes gave strongly supported conflicting trees under certain conditions, we are confident of HGT in only a single case beyond the rubisco HGT already reported. Most of the conflicts involved near neighbors connected by long branches (e.g. red algae and their secondary hosts, where phylogenetic methods are prone to mislead. However, three genes – clpP, ycf2, and rpl36 – provided strong support for taxa moving far from their organismal position. Further taxon sampling of clpP and ycf2 resulted in rejection of HGT due to long-branch attraction and a serious error in the published plastid genome sequence of Oenothera elata, respectively. A single new case, a bacterial rpl36 gene transferred into the ancestor of the cryptophyte and haptophyte plastids, appears to be a true HGT event. Interestingly, this rpl36 gene is a distantly related paralog of the rpl36 type found in other plastids and most eubacteria. Moreover, the transferred gene has physically replaced the native rpl36 gene, yet flanking genes and intergenic regions show no sign of HGT. This suggests that gene replacement somehow occurred by recombination at the very ends of rpl36, without the level and length of similarity normally expected to support recombination. Conclusion The rpl36 HGT discovered in this study is of considerable interest in terms of both molecular mechanism and phylogeny. The plastid acquisition of a bacterial rpl36 gene via HGT provides the first strong evidence for a sister-group relationship between haptophyte and
Rice, Danny W; Palmer, Jeffrey D
2006-01-01
Background Horizontal gene transfer (HGT) to the plant mitochondrial genome has recently been shown to occur at a surprisingly high rate; however, little evidence has been found for HGT to the plastid genome, despite extensive sequencing. In this study, we analyzed all genes from sequenced plastid genomes to unearth any neglected cases of HGT and to obtain a measure of the overall extent of HGT to the plastid. Results Although several genes gave strongly supported conflicting trees under certain conditions, we are confident of HGT in only a single case beyond the rubisco HGT already reported. Most of the conflicts involved near neighbors connected by long branches (e.g. red algae and their secondary hosts), where phylogenetic methods are prone to mislead. However, three genes – clpP, ycf2, and rpl36 – provided strong support for taxa moving far from their organismal position. Further taxon sampling of clpP and ycf2 resulted in rejection of HGT due to long-branch attraction and a serious error in the published plastid genome sequence of Oenothera elata, respectively. A single new case, a bacterial rpl36 gene transferred into the ancestor of the cryptophyte and haptophyte plastids, appears to be a true HGT event. Interestingly, this rpl36 gene is a distantly related paralog of the rpl36 type found in other plastids and most eubacteria. Moreover, the transferred gene has physically replaced the native rpl36 gene, yet flanking genes and intergenic regions show no sign of HGT. This suggests that gene replacement somehow occurred by recombination at the very ends of rpl36, without the level and length of similarity normally expected to support recombination. Conclusion The rpl36 HGT discovered in this study is of considerable interest in terms of both molecular mechanism and phylogeny. The plastid acquisition of a bacterial rpl36 gene via HGT provides the first strong evidence for a sister-group relationship between haptophyte and cryptophyte plastids to the
Zhang, Xin; Huang, Danping; Jia, Xiwei; Zou, Zhihua; Wang, Yilei; Zhang, Ziping
2018-04-01
In this study, the 5'-flanking region of molt-inhibiting hormone (MIH) gene was cloned by Tail-PCR. It is 2024 bp starting from the translation initiation site, and 1818 bp starting from the predicted transcription start site. Forecast analysis results by the bioinformatics software showed that the transcription start site is located at 207 bp upstream of the start codon ATG, and TATA box is located at 240 bp upstream of the start codon ATG. Potential transcription factor binding sites include Sp1, NF-1, Oct-1, Sox-2, RAP1, and so on. There are two CpG islands, located at -25- +183 bp and -1451- -1316 bp respectively. The transfection results of luciferase reporter constructs showed that the core promoter region was located in the fragment -308 bp to -26 bp. NF-kappaB and RAP1 were essential for mih basal transcriptional activity. There are three kinds of polymorphism CA in the 5'-flanking sequence, and they can influence mih promoter activity. These findings provide a genetic foundation of the further research of mih transcription regulation. Copyright © 2017 Elsevier Inc. All rights reserved.
Directory of Open Access Journals (Sweden)
Seong-Bin Kim
Full Text Available Paenibacillus polymyxa is a bacterium widely used in agriculture, industry, and environmental remediation because it has multiple functions including nitrogen fixation and produces various biologically active compounds. Among these compounds are the antibiotics polymyxins, and the bacterium is currently being reassessed for medical application. However, a lack of genetic tools for manipulation of P. polymyxa has limited our understanding of the biosynthesis of these compounds.To facilitate an understanding of the genetic determinants of the bacterium, we have developed a system for marker exchange mutagenesis directly on competent cells of P. polymyxa under conditions where homologous recombination is enhanced by denaturation of the suicide plasmid DNA. To test this system, we targeted P. polymyxa α-and β-amylase genes for disruption. Chloramphenicol or erythromycin resistance genes were inserted into the suicide plasmid pGEM7Z-f+ (Promega. To mediate homologous recombination and replacement of the targeted genes with the antibiotic resistance genes nucleotide sequences of the α-and β-amylase genes were cloned into the plasmid flanking the antibiotic resistance genes.We have created a simple system for targeted gene deletion in P. polymyxa E681. We propose that P. polymyxa isogenic mutants could be developed using this system of marker exchange mutagenesis. α-and β-amylase genes provide a useful tool for direct recombinant screening in P. polymyxa.
Basics on Genes and Genetic Disorders
... for Educators Search English Español The Basics on Genes and Genetic Disorders KidsHealth / For Teens / The Basics ... such as treating health problems. What Is a Gene? To understand how genes work, let's review some ...
Conservation of gene linkage in dispersed vertebrate NK homeobox clusters.
Wotton, Karl R; Weierud, Frida K; Juárez-Morales, José L; Alvares, Lúcia E; Dietrich, Susanne; Lewis, Katharine E
2009-10-01
Nk homeobox genes are important regulators of many different developmental processes including muscle, heart, central nervous system and sensory organ development. They are thought to have arisen as part of the ANTP megacluster, which also gave rise to Hox and ParaHox genes, and at least some NK genes remain tightly linked in all animals examined so far. The protostome-deuterostome ancestor probably contained a cluster of nine Nk genes: (Msx)-(Nk4/tinman)-(Nk3/bagpipe)-(Lbx/ladybird)-(Tlx/c15)-(Nk7)-(Nk6/hgtx)-(Nk1/slouch)-(Nk5/Hmx). Of these genes, only NKX2.6-NKX3.1, LBX1-TLX1 and LBX2-TLX2 remain tightly linked in humans. However, it is currently unclear whether this is unique to the human genome as we do not know which of these Nk genes are clustered in other vertebrates. This makes it difficult to assess whether the remaining linkages are due to selective pressures or because chance rearrangements have "missed" certain genes. In this paper, we identify all of the paralogs of these ancestrally clustered NK genes in several distinct vertebrates. We demonstrate that tight linkages of Lbx1-Tlx1, Lbx2-Tlx2 and Nkx3.1-Nkx2.6 have been widely maintained in both the ray-finned and lobe-finned fish lineages. Moreover, the recently duplicated Hmx2-Hmx3 genes are also tightly linked. Finally, we show that Lbx1-Tlx1 and Hmx2-Hmx3 are flanked by highly conserved noncoding elements, suggesting that shared regulatory regions may have resulted in evolutionary pressure to maintain these linkages. Consistent with this, these pairs of genes have overlapping expression domains. In contrast, Lbx2-Tlx2 and Nkx3.1-Nkx2.6, which do not seem to be coexpressed, are also not associated with conserved noncoding sequences, suggesting that an alternative mechanism may be responsible for the continued clustering of these genes.
Li, Lili; Wang, Zhan; Zhou, Yubai; Zhang, Fang; Shen, Sisi; Li, Zelin; Zeng, Yi
2015-09-01
For rapid and accurate screening of recombinant modified vaccinia virus Ankara (rMVA) that satisfied the quality standards of clinical trials, a novel shuttle vector that can delete the marker gene automatically during virus propagation was construted: pZL-EGFP. To construct the pZL-EGFP, the original shuttle vector pSC11 was modified by replacing the LacZ marker gene with enhanced green fluorescent protein (EGFP) and then inserting homologous sequences of TKL into the flank regions of EGFP. Baby hamster kidney (BHK)-21 cells were cotransfected with pZL-EGFP and MVA, and underwent ten passages and one plaque screening to obtain the EGFP-free rMVA carrying the exogenous gene. Resulting rMVA was tested by polymerase chain reaction and western blotting to verify pZL-EGFP function. A novel shuttle vector pZL-EGFP containing an EGFP marker gene which could be deleted automatically was constructed. This gene deletion had no effect on the activities of rMVA, and the exogenous gene could be expressed stably. These results suggest that rMVA can be packaged efficiently by homologous recombination between pZL-EGFP and MVA in BHK-21 cells, and that the carried EGFP gene can be removed automatically by intramolecular homologous recombination during virus passage. Meanwhile, the gene deletion had no influence on the activities of rMVA and the expression of exogenous target gene. This study lays a solid foundation for the future research.
Chen, Hung-Yang
2017-12-28
A novel fused heterocycle-flanked diketopyrrolopyrrole (DPP) monomer, thieno[2,3-b]pyridine diketopyrrolopyrrole (TPDPP), was designed and synthesized. When copolymerized with 3,4-difluorothiophene using Stille coupling polymerization, the new polymer pTPDPP-TF possesses a highly planar conjugated polymer backbone due to the fused thieno[2,3-b]pyridine flanking unit that effectively alleviates the steric hindrance with both the central DPP core and the 3,4-difluorothiophene repeat unit. This new polymer exhibits a high electron affinity (EA) of −4.1 eV and was successfully utilized as an n-type polymer semiconductor for applications in organic field-effect transistors (OFETs) and all polymer solar cells. A promising n-type charge carrier mobility of 0.1 cm2 V–1 s–1 was obtained in bottom-contact, top-gate OFETs, and a power conversion efficiency (PCE) of 2.72% with a high open-circuit voltage (VOC) of 1.04 V was achieved for all polymer solar cells using PTB7-Th as the polymer donor.
Chen, Hung-Yang; Nikolka, Mark; Wadsworth, Andrew; Yue, Wan; Onwubiko, Ada; Xiao, Mingfei; White, Andrew J. P.; Baran, Derya; Sirringhaus, Henning; McCulloch, Iain
2017-01-01
A novel fused heterocycle-flanked diketopyrrolopyrrole (DPP) monomer, thieno[2,3-b]pyridine diketopyrrolopyrrole (TPDPP), was designed and synthesized. When copolymerized with 3,4-difluorothiophene using Stille coupling polymerization, the new polymer pTPDPP-TF possesses a highly planar conjugated polymer backbone due to the fused thieno[2,3-b]pyridine flanking unit that effectively alleviates the steric hindrance with both the central DPP core and the 3,4-difluorothiophene repeat unit. This new polymer exhibits a high electron affinity (EA) of −4.1 eV and was successfully utilized as an n-type polymer semiconductor for applications in organic field-effect transistors (OFETs) and all polymer solar cells. A promising n-type charge carrier mobility of 0.1 cm2 V–1 s–1 was obtained in bottom-contact, top-gate OFETs, and a power conversion efficiency (PCE) of 2.72% with a high open-circuit voltage (VOC) of 1.04 V was achieved for all polymer solar cells using PTB7-Th as the polymer donor.
Directory of Open Access Journals (Sweden)
K. Nykyri
2006-10-01
Full Text Available On 3 July 2001, the four Cluster satellites traversed along the dawnside magnetospheric flank and observed large variations in all plasma parameters. The estimated magnetopause boundary normals were oscillating in the z-direction and the normal component of the magnetic field showed systematic 2–3 min bipolar variations for 1 h when the IMF had a small positive bz-component and a Parker-spiral orientation in the x,y-plane. Brief 33 s intervals with excellent deHoffman Teller frames were observed satisfying the Walén relation. Detailed comparisons with 2-D MHD simulations indicate that Cluster encountered rotational discontinuities generated by Kelvin-Helmholtz instability. We estimate a wave length of 6 RE and a wave vector with a significant z-component.
Detection of mutations in the COL4A5 gene by SSCP in X-linked Alport syndrome
DEFF Research Database (Denmark)
Hertz, Jens Michael; Juncker, I; Persson, U
2001-01-01
, three in-frame deletions, four nonsense mutations, and six splice site mutations. Twenty-two of the mutations have not previously been reported. Furthermore, we found one non-pathogenic amino acid substitution, one rare variant in a non-coding region, and one polymorphism with a heterozygosity of 28...... of type IV-collagen. We performed mutation analysis of the COL4A5 gene by PCR-SSCP analysis of each of the 51 exons with flanking intronic sequences in 81 patients suspected of X-linked Alport syndrome including 29 clear X-linked cases, 37 cases from families with a pedigree compatible with X...
Directory of Open Access Journals (Sweden)
Charmaine Ng
2017-11-01
Full Text Available The dissemination of antimicrobial resistance (AMR is an escalating problem and a threat to public health. Comparative metagenomics was used to investigate the occurrence of antibiotic resistant genes (ARGs in wastewater and urban surface water environments in Singapore. Hospital and municipal wastewater (n = 6 were found to have higher diversity and average abundance of ARGs (303 ARG subtypes, 197,816 x/Gb compared to treated wastewater effluent (n = 2, 58 ARG subtypes, 2,692 x/Gb and surface water (n = 5, 35 subtypes, 7,985 x/Gb. A cluster analysis showed that the taxonomic composition of wastewaters was highly similar and had a bacterial community composition enriched in gut bacteria (Bacteroides, Faecalibacterium, Bifidobacterium, Blautia, Roseburia, Ruminococcus, the Enterobacteriaceae group (Klebsiella, Aeromonas, Enterobacter and opportunistic pathogens (Prevotella, Comamonas, Neisseria. Wastewater, treated effluents and surface waters had a shared resistome of 21 ARGs encoding multidrug resistant efflux pumps or resistance to aminoglycoside, macrolide-lincosamide-streptogramins (MLS, quinolones, sulfonamide, and tetracycline resistance which suggests that these genes are wide spread across different environments. Wastewater had a distinctively higher average abundance of clinically relevant, class A beta-lactamase resistant genes (i.e., blaKPC, blaCTX-M, blaSHV, blaTEM. The wastewaters from clinical isolation wards, in particular, had a exceedingly high levels of blaKPC-2 genes (142,200 x/Gb, encoding for carbapenem resistance. Assembled scaffolds (16 and 30 kbp from isolation ward wastewater samples indicated this gene was located on a Tn3-based transposon (Tn4401, a mobilization element found in Klebsiella pneumonia plasmids. In the longer scaffold, transposable elements were flanked by a toxin–antitoxin (TA system and other metal resistant genes that likely increase the persistence, fitness and propagation of the plasmid in the
Distribution of mutations in the PEX gene in families with X-linked hypophosphataemic rickets (HYP).
Rowe, P S; Oudet, C L; Francis, F; Sinding, C; Pannetier, S; Econs, M J; Strom, T M; Meitinger, T; Garabedian, M; David, A; Macher, M A; Questiaux, E; Popowska, E; Pronicka, E; Read, A P; Mokrzycki, A; Glorieux, F H; Drezner, M K; Hanauer, A; Lehrach, H; Goulding, J N; O'Riordan, J L
1997-04-01
Mutations in the PEX gene at Xp22.1 (phosphate-regulating gene with homologies to endopeptidases, on the X-chromosome), are responsible for X-linked hypophosphataemic rickets (HYP). Homology of PEX to the M13 family of Zn2+ metallopeptidases which include neprilysin (NEP) as prototype, has raised important questions regarding PEX function at the molecular level. The aim of this study was to analyse 99 HYP families for PEX gene mutations, and to correlate predicted changes in the protein structure with Zn2+ metallopeptidase gene function. Primers flanking 22 characterised exons were used to amplify DNA by PCR, and SSCP was then used to screen for mutations. Deletions, insertions, nonsense mutations, stop codons and splice mutations occurred in 83% of families screened for in all 22 exons, and 51% of a separate set of families screened in 17 PEX gene exons. Missense mutations in four regions of the gene were informative regarding function, with one mutation in the Zn2+-binding site predicted to alter substrate enzyme interaction and catalysis. Computer analysis of the remaining mutations predicted changes in secondary structure, N-glycosylation, protein phosphorylation and catalytic site molecular structure. The wide range of mutations that align with regions required for protease activity in NEP suggests that PEX also functions as a protease, and may act by processing factor(s) involved in bone mineral metabolism.
Chen, Jiang; Du, Yinan; He, Xueyan; Huang, Xingxu; Shi, Yun S
2017-03-31
The most powerful way to probe protein function is to characterize the consequence of its deletion. Compared to conventional gene knockout (KO), conditional knockout (cKO) provides an advanced gene targeting strategy with which gene deletion can be performed in a spatially and temporally restricted manner. However, for most species that are amphiploid, the widely used Cre-flox conditional KO (cKO) system would need targeting loci in both alleles to be loxP flanked, which in practice, requires time and labor consuming breeding. This is considerably significant when one is dealing with multiple genes. CRISPR/Cas9 genome modulation system is advantaged in its capability in targeting multiple sites simultaneously. Here we propose a strategy that could achieve conditional KO of multiple genes in mouse with Cre recombinase dependent Cas9 expression. By transgenic construction of loxP-stop-loxP (LSL) controlled Cas9 (LSL-Cas9) together with sgRNAs targeting EGFP, we showed that the fluorescence molecule could be eliminated in a Cre-dependent manner. We further verified the efficacy of this novel strategy to target multiple sites by deleting c-Maf and MafB simultaneously in macrophages specifically. Compared to the traditional Cre-flox cKO strategy, this sgRNAs-LSL-Cas9 cKO system is simpler and faster, and would make conditional manipulation of multiple genes feasible.
[Analysis of the NDP gene in a Chinese family with X-linked recessive Norrie disease].
Mei, Libin; Huang, Yanru; Pan, Qian; Liang, Desheng; Wu, Lingqian
2015-05-01
The purpose of the current research was to investigate the NDP (Norrie disease protein) gene in one Chinese family with Norrie disease (ND) and to characterize the related clinical features. Clinical data of the proband and his family members were collected. Complete ophthalmic examinations were carried out on the proband. Genomic DNA was extracted from peripheral blood leukocytes of 35 family members. Molecular analysis of the NDP gene was performed by polymerase chain reaction and direct sequencing of all exons and flanking regions. A hemizygous NDP missense mutation c.362G > A (p.Arg121Gln) in exon 3 was identified in the affected members, but not in any of the unaffected family individuals. The missense mutation c.362G > A in NDP is responsible for the Norrie disease in this family. This discovery will help provide the family members with accurate and reliable genetic counseling and prenatal diagnosis.
Integrones: los coleccionistas de genes Integrons: gene collectors
Directory of Open Access Journals (Sweden)
J. A. Di Conza
2010-02-01
which they may incorporate gene cassettes (encoding resistance mechanisms. A promoter (Pc embedded within the integrase gene controls the transcription of integrated resistance markers, as these genes do not have their own promoters. When in cassettes, resistance genes are flanked by specific sequences (attC, which are recognized by the integrase that, by site specific recombination, incorporates them after attI in proper orientation for their expression. In the past, integrons were classified according to their sequence homology; currently they are classified according to their location. In general, they are divided into "mobile" integrons (those associated with insertion sequences, transposons and/or plasmids, being most of them associated with resistance mechanisms, and chromosomally-located "super" integrons with large arrangements of cassette genes. "Mobile" class 1 integrons are the most abundant in clinical isolates and are generally associated with Tn21 subgroup transposons, followed by class 2, derived primarily from Tn7. These elements are not mobile themselves, but their association with mobile platforms that facilitate horizontal transfer, explains their wide distribution among bacteria. This review also attempts to describe the mobile integrons described so far in Argentina.
On the Complexity of Duplication-Transfer-Loss Reconciliation with Non-Binary Gene Trees.
Kordi, Misagh; Bansal, Mukul S
2017-01-01
Duplication-Transfer-Loss (DTL) reconciliation has emerged as a powerful technique for studying gene family evolution in the presence of horizontal gene transfer. DTL reconciliation takes as input a gene family phylogeny and the corresponding species phylogeny, and reconciles the two by postulating speciation, gene duplication, horizontal gene transfer, and gene loss events. Efficient algorithms exist for finding optimal DTL reconciliations when the gene tree is binary. However, gene trees are frequently non-binary. With such non-binary gene trees, the reconciliation problem seeks to find a binary resolution of the gene tree that minimizes the reconciliation cost. Given the prevalence of non-binary gene trees, many efficient algorithms have been developed for this problem in the context of the simpler Duplication-Loss (DL) reconciliation model. Yet, no efficient algorithms exist for DTL reconciliation with non-binary gene trees and the complexity of the problem remains unknown. In this work, we resolve this open question by showing that the problem is, in fact, NP-hard. Our reduction applies to both the dated and undated formulations of DTL reconciliation. By resolving this long-standing open problem, this work will spur the development of both exact and heuristic algorithms for this important problem.
Li, Huafeng; Li, Yongli; Zhang, Li
2017-06-10
To explore the characteristics of (PAH) gene mutations among patients with phenylketonuria (PKU) from Linyi area of Shandong Province. For 51 children affected with PKU and their parents, the 13 exons and their flanking intronic sequences of the PAH gene were directly sequenced with Sanger method. PAH gene mutations were detected in all of the 102 alleles of the patients, which included 31 types of mutations. Common mutations included R243Q (17/102, 16.67%), IVS4-1G to A (9/102, 8.82%), R241C (8/102, 7.84%), R111X (8/102, 7.84%), and V399V (8/102, 7.84%). In addition, two novel mutations, D101N, 345-347del, have been detected. The 31 types of mutations included missense, nonsense, deletion, and splicing mutations, which were mainly located in exons 7 (29, 28.43%), 11 (18, 17.65%), 3 (16, 15.69%) and 12 (13, 12.75%). Mutations of the PAH gene in Linyi region mainly distributed in exons 7, 11, and 3, and the most common mutation were R243Q. Two novel mutations, D101N and 345-347del, have been detected.
Le Dréan, Y; Lazennec, G; Kern, L; Saligaut, D; Pakdel, F; Valotaire, Y
1995-08-01
We previously reported that the expression of the rainbow trout estrogen receptor (rtER) gene is markedly increased by estradiol (E2). In this paper, we have used transient transfection assays with reporter plasmids expressing chloramphenicol acetyl transferase (CAT), linked to 5' flanking regions of the rtER gene promoter, to identify cis-elements responsible for E2 inducibility. Deletion analysis localized an estrogen-responsive element (ERE), at position +242, with one mutation on the first base compared with the consensus sequence. This element confers estrogen responsiveness to CAT reporter linked to both the herpes simplex virus thymidine kinase promoter and the homologous rtER promoter. Moreover, using a 0.2 kb fragment of the rtER promoter encompassing the ERE and the rtER DNA binding domain obtained from a bacterial expression system, DNase I footprinting experiments demonstrated a specific protection covering 20 bp (+240/+260) containing the ERE sequence. Based on these studies, we believe that this ERE sequence, identified in the rtER gene promoter, may be a major cis-acting element involved in the regulation of the gene by estrogen.
Directory of Open Access Journals (Sweden)
Mikhail Doubrovin
2003-04-01
Full Text Available We report the development of a novel dual-modality fusion reporter gene system consisting of Escherichia coli xanthine phosphoribosyltransferase (XPRT for nuclear imaging with radiolabeled xanthine and Discosoma red fluorescent protein for optical fluorescent imaging applications. The dsRed/XPRT fusion gene was successfully created and stably transduced into RG2 glioma cells, and both reporters were shown to be functional. The level of dsRed fluorescence directly correlated with XPRT enzymatic activity as measured by ribophosphorylation of [14C]-xanthine was in vitro (Ki = 0.124 ± 0.008 vs. 0.00031 ± 0.00005 mL/min/g in parental cell line, and [*]-xanthine octanol/water partition coefficient was 0.20 at pH = 7.4 (logP = 0.69, meeting requirements for the blood-brain barrier (BBB penetrating tracer. In the in vivo experiment, the concentration of [* C]-xanthine in the normal brain varied from 0.20 to 0.16 + 0.05% dose/g under 0.87 + 0.24% dose/g plasma radiotracer concentration. The accumulation in vivo in the transfected flank tumor was to 2.4 ± 0.3% dose/g, compared to 0.78 ± 0.02% dose/g and 0.64 ± 0.05% dose/g in the control flank tumors and intact muscle, respectively. [14C]-Xanthine appeared to be capable of specific accumulation in the transfected infiltrative brain tumor (RG2-dsRed/XPRT, which corresponded to the 585 nm fluorescent signal obtained from the adjacent cryosections. The images of endogenous gene expression with the “sensory system” have to be normalized for the transfection efficiency based on the “beacon system” image data. Such an approach requires two different “reporter genes” and two different “reporter substrates.” Therefore, the novel dsRed/XPRT fusion gene can be used as a multimodality reporter system in the biological applications requiring two independent reporter genes, including the cells located behind the BBB.
Deletion of an X-inactivation boundary disrupts adjacent gene silencing.
Directory of Open Access Journals (Sweden)
Lindsay M Horvath
2013-11-01
Full Text Available In mammalian females, genes on one X are largely silenced by X-chromosome inactivation (XCI, although some "escape" XCI and are expressed from both Xs. Escapees can closely juxtapose X-inactivated genes and provide a tractable model for assessing boundary function at epigenetically regulated loci. To delimit sequences at an XCI boundary, we examined female mouse embryonic stem cells carrying X-linked BAC transgenes derived from an endogenous escape locus. Previously we determined that large BACs carrying escapee Kdm5c and flanking X-inactivated transcripts are properly regulated. Here we identify two lines with truncated BACs that partially and completely delete the distal Kdm5c XCI boundary. This boundary is not required for escape, since despite integrating into regions that are normally X inactivated, transgenic Kdm5c escapes XCI, as determined by RNA FISH and by structurally adopting an active conformation that facilitates long-range preferential association with other escapees. Yet, XCI regulation is disrupted in the transgene fully lacking the distal boundary; integration site genes up to 350 kb downstream of the transgene now inappropriately escape XCI. Altogether, these results reveal two genetically separable XCI regulatory activities at Kdm5c. XCI escape is driven by a dominant element(s retained in the shortest transgene that therefore lies within or upstream of the Kdm5c locus. Additionally, the distal XCI boundary normally plays an essential role in preventing nearby genes from escaping XCI.
Energy Technology Data Exchange (ETDEWEB)
Graff, C.; Ahlbom, B.E.; Anneren, G. [University Hospital, Uppsala (Sweden)] [and others
1994-09-01
Best`s macular dystrophy (BMD) is an autosomal dominant disease characterized by accumulation of lipofuscin beneath the pigment epithelium of the macula, leading to early-onset impairment of central vision. The gene has previously been mapped to 11q13. Based on DNA from 191 people from a large 12-generation family, the gene now has been mapped to a 1.5 cM interval between the markers Fc{epsilon}RI and D11S480/ROM1. By disequilibrium analysis the gene was estimated to be 0.321 cM centromeric to the marker D11S480. Since this on average corresponds to 300 kb, the gene may be at a distance contained in YAC molecules. To physically characterize this region, YAC clones positive for markers flanking BMD have been identified. Sequence analysis of the candidate gene ROM1 did not reveal any mutation. However, one recombination between intragenic ROM1 polymorphisms and BMD was detected, which make it highly unlikely that mutations in ROM1 are causing BMD.
The sheep growth hormone gene polymorphism and its effects on milk traits.
Dettori, Maria Luisa; Pazzola, Michele; Pira, Emanuela; Paschino, Pietro; Vacca, Giuseppe Massimo
2015-05-01
Growth hormone (GH) is encoded by the GH gene, which may be single copy or duplicate in sheep. The two copies of the sheep GH gene (GH1/GH2-N and GH2-Z) were entirely sequenced in one 106 ewes of Sarda breed, in order to highlight sequence polymorphisms and investigate possible association between genetic variants and milk traits. Milk traits included milk yield, fat, protein, casein and lactose percentage. We evidenced 75 nucleotide changes. Transcription factor binding site prediction revealed two sequences potentially recognised by the pituitary-specific transcription factor POU1FI at the GH1/GH2-N gene, which were lost at the promoter of GH2-Z, which might explain the different tissues of expression of GH1/GH2-N (pituitary) and GH2-Z (placenta). Significant differences in milk traits were observed among genotypes at polymorphic loci only for the GH2-Z gene. Sheep with homozygote genotype ss748770547 CC had higher fat percentage (P < 0.01) than TT. SNP ss748770547 was part of a potential transcription factor binding site for C/EBP alpha (CCAAT/Enhancer Binding Protein), which is involved in the regulation of adipogenesis and adipoblast differentiation. SNP ss748770547, located in the GH2-Z gene 5' flanking region, may be a causal mutation affecting milk fat content. These findings might contribute to the knowledge of the sheep GH locus and might be useful in selection processes in sheep.
Reconciliation of Gene and Species Trees
Directory of Open Access Journals (Sweden)
L. Y. Rusin
2014-01-01
Full Text Available The first part of the paper briefly overviews the problem of gene and species trees reconciliation with the focus on defining and algorithmic construction of the evolutionary scenario. Basic ideas are discussed for the aspects of mapping definitions, costs of the mapping and evolutionary scenario, imposing time scales on a scenario, incorporating horizontal gene transfers, binarization and reconciliation of polytomous trees, and construction of species trees and scenarios. The review does not intend to cover the vast diversity of literature published on these subjects. Instead, the authors strived to overview the problem of the evolutionary scenario as a central concept in many areas of evolutionary research. The second part provides detailed mathematical proofs for the solutions of two problems: (i inferring a gene evolution along a species tree accounting for various types of evolutionary events and (ii trees reconciliation into a single species tree when only gene duplications and losses are allowed. All proposed algorithms have a cubic time complexity and are mathematically proved to find exact solutions. Solving algorithms for problem (ii can be naturally extended to incorporate horizontal transfers, other evolutionary events, and time scales on the species tree.
Generation of mice with a conditional Foxp2 null allele
French, C.; Groszer, M.; Preece, C.; Coupe, A.; Rajewsky, K.; Fisher, S.
2007-01-01
Disruptions of the human FOXP2 gene cause problems with articulation of complex speech sounds, accompanied by impairment in many aspects of language ability. The FOXP2/Foxp2 transcription factor is highly similar in humans and mice, and shows a complex conserved expression pattern, with high levels in neuronal subpopulations of the cortex, striatum, thalamus, and cerebellum. In the present study we generated mice in which loxP sites flank exons 12?14 of Foxp2; these exons encode the DNA-bindi...
Gene structure and functional characterization of growth hormone in dogfish, Squalus acanthias.
Moriyama, Shunsuke; Oda, Mayumi; Yamazaki, Tomohide; Yamaguchi, Kiyoko; Amiya, Noriko; Takahashi, Akiyoshi; Amano, Masafumi; Goto, Tomoaki; Nozaki, Masumi; Meguro, Hiroshi; Kawauchi, Hiroshi
2008-06-01
Dogfish (Squalus acanthias) growth hormone (GH) was identified by cDNA cloning and protein purification from the pituitary gland. Dogfish GH cDNA encoded a prehormone of 210 amino acids (aa). Sequence analysis of purified GH revealed that the prehormone is composed of a signal peptide of 27 aa and a mature protein of 183 aa. Dogfish GH showed 94% sequence identity with blue shark GH, and also showed 37-66%, 26%, and 48-67% sequence identity with GH from osteichtyes, an agnathan, and tetrapods. The site of production was identified through immunocytochemistry to be cells of the proximal pars distalis of the pituitary gland. Dogfish GH stimulates both insulin-like growth factor-I and II mRNA levels in dogfish liver in vitro. The dogfish GH gene consisted of five exons and four introns, the same as in lamprey, teleosts such as cypriniforms and siluriforms, and tetrapods. The 5'-flanking region within 1082 bp of the transcription start site contained consensus sequences for the TATA box, Pit-1/GHF-1, CRE, TRE, and ERE. These results show that the endocrine mechanism for growth stimulation by the GH-IGF axis was established at an early stage of vertebrate evolution, and that the 5-exon-type gene organization might reflect the structure of the ancestral gene for the GH gene family.
Cai, Zhiying; Li, Guohua; Lin, Chunhua; Shi, Tao; Zhai, Ligang; Chen, Yipeng; Huang, Guixiu
2013-07-19
To gain more insight into the molecular mechanisms of Colletotrichum gloeosporioides pathogenesis, Agrobacterium tumefaciens-mediated transformation (ATMT) was used to identify mutants of C. gloeosporioides impaired in pathogenicity. An ATMT library of 4128 C. gloeosporioides transformants was generated. Transformants were screened for defects in pathogenicity with a detached copper brown leaf assay. 32 mutants showing reproducible pathogenicity defects were obtained. Southern blot analysis showed 60.4% of the transformants had single-site T-DNA integrations. 16 Genomic sequences flanking T-DNA were recovered from mutants by thermal asymmetric interlaced PCR, and were used to isolate the tagged genes from the genome sequence of wild-type C. gloeosporioides by Basic Local Alignment Search Tool searches against the local genome database of the wild-type C. gloeosporioides. One potential pathogenicity genes encoded calcium-translocating P-type ATPase. Six potential pathogenicity genes had no known homologs in filamentous fungi and were likely to be novel fungal virulence factors. Two putative genes encoded Glycosyltransferase family 28 domain-containing protein and Mov34/MPN/PAD-1 family protein, respectively. Five potential pathogenicity genes had putative function matched with putative protein of other Colletotrichum species. Two known C. gloeosporioides pathogenicity genes were also identified, the encoding Glomerella cingulata hard-surface induced protein and C. gloeosporioides regulatory subunit of protein kinase A gene involved in cAMP-dependent PKA signal transduction pathway. Copyright © 2013 Elsevier GmbH. All rights reserved.
Boros, D L; Singh, K P; Gerard, H C; Hudson, A P; White, S L; Cutroneo, K R
2005-08-01
Schistosomiasis mansoni disseminated worm eggs in mice and humans induce granulomatous inflammations and cumulative fibrosis causing morbidity and possibly mortality. In this study, intrahepatic and I.V. injections of a double-stranded oligodeoxynucleotide decoy containing the TGF-beta regulatory element found in the distal promoter of the COL1A1 gene into worm-infected mice suppressed TGF-beta1, COL1A1, tissue inhibitor of metalloproteinase-1, and decreased COL3A1 mRNAs to a lesser extent. Sequence comparisons within the mouse genome found homologous sequences within the COL3A1, TGF-beta1, and TIMP-1 5' flanking regions. Cold competition gel mobility shift assays using these homologous sequences with 5' and 3' flanking regions found in the natural COL1A1 gene showed competition. Competitive gel mobility assays in a separate experiment showed no competition using a 5-base mutated or scrambled sequence. Explanted liver granulomas from saline-injected mice incorporated 10.45 +/- 1.7% (3)H-proline into newly synthesized collagen, whereas decoy-treated mice showed no collagen synthesis. Compared with the saline control schistosomiasis mice phosphorothioate double-stranded oligodeoxynucleotide treatment decreased total liver collagen content (i.e. hydroxy-4-proline) by 34%. This novel molecular approach has the potential to be employed as a novel antifibrotic treatment modality. (c) 2005 Wiley-Liss, Inc.
Morad, Daniel; Nader, Fadi H.; Gasparrini, Marta; Morad, Sadoon; Rossi, Carlos; Marchionda, Elisabetta; Al Darmaki, Fatima; Martines, Marco; Hellevang, Helge
2018-05-01
This petrographic, stable isotopic and fluid inclusion microthermometric study of the Upper Jurassic limestones of an onshore field, Abu Dhabi, United Arab Emirates (UAE) compares diagenesis in flanks and crest of the anticline. The results revealed that the diagenetic and related reservoir quality evolution occurred during three phases, including: (i) eogenesis to mesogenesis 1, during which reservoir quality across the field was either deteriorated or preserved by calcite cementation presumably derived from marine or evolved marine pore waters. Improvement of reservoir quality was due to the formation of micropores by micritization of allochems and creation of moldic/intragranular pores by dissolution of peloids and skeletal fragments. (ii) Obduction of Oman ophiolites and formation of the anticline of the studied field was accompanied by cementation by saddle dolomite and blocky calcite. High homogenization temperatures (125-175 °C) and high salinity (19-26 wt% NaCl eq) of the fluid inclusions, negative δ18OVPDB values (-7.7 to -2.9‰), saddle shape of dolomite, and the presence of exotic cements (i.e. fluorite and sphalerite) suggest that these carbonates were formed by flux of hot basinal brines, probably related to this tectonic compression event. (iii) Mesogenesis 2 during subsidence subsequent to the obduction event, which resulted in extensive stylolitization and cementation by calcite. This calcite cement occluded most of the remaining moldic and inter-/intragranular pores of the flank limestones (water zone) whereas porosity was preserved in the crest. This study contributes to: (1) our understanding of differences in the impact of diagenesis on reservoir quality evolution in flanks and crests of anticlines, i.e. impact of hydrocarbon emplacement on diagenesis, and (2) relating various diagenetic processes to burial history and tectonic events of foreland basins in the Arabian Gulf area and elsewhere.
Directory of Open Access Journals (Sweden)
M. G. G. T. Taylor
2012-06-01
Full Text Available The Kelvin-Helmholtz Instability (KHI can drive waves at the magnetopause. These waves can grow to form rolled-up vortices and facilitate transfer of plasma into the magnetosphere. To investigate the persistence and frequency of such waves at the magnetopause we have carried out a survey of all Double Star 1 magnetopause crossings, using a combination of ion and magnetic field measurements. Using criteria originally used in a Geotail study made by Hasegawa et al. (2006 (forthwith referred to as H2006, 17 candidate events were identified from the entire TC-1 mission (covering ~623 orbits where the magnetopause was sampled, a majority of which were on the dayside of the terminator. The relationship between density and shear velocity was then investigated, to identify the predicted signature of a rolled up vortex from H2006 and all 17 events exhibited some level of rolled up behavior. The location of the events had a clear dawn-dusk asymmetry, with 12 (71% on the post noon, dusk flank suggesting preferential growth in this region.
Energy Technology Data Exchange (ETDEWEB)
Nijbroek, G.; Dietz, H.C. [Johns Hopkins Univ. School of Med., Baltimore, MD (United States); Pereira, L.; Ramirz, F. [Mount Sinai School of Med., New York, NY (United States)
1994-09-01
Defects in fibrillin (FNB1) cause the Marfan syndrome (MFS). Classic Marfan phenotype cosegregates with intragenic and/or flanking marker alleles in all families tested and a significant number of FBN1 mutations have been identified in affected individuals. Using a standard method of mutation detection, SSCP analysis of overlapping RT-PCR amplimers that span the entire coding sequence, the general experience has been a low yield of identifiable mutations, ranging from 10-20%. Possible explanations included low sensitivity of mutation screening procedures, under-representation of mutant transcript in patient samples either due to deletions or mutant alleles containing premature termination codons, clustering of mutations in yet uncharacterized regions of the gene, including regulatory elements, or genetic heterogeneity. In order to compensate for a potential reduced mutant transcript stability, we have devised a method to screen directly from genomic DNA. The intronic boundaries flanking each of the 65 FBN1 exons were characterized and primer pairs were fashioned such that all splice junctions would be included in the resultant amplimers. The entire gene was screened for a panel of 9 probands with classic Marfan syndrome using mutation detection enhancement (MDE) gel heteroduplex analysis. A mutation was identified in 5/9 (55%) of patient samples. All were either missense mutations involving a cysteine residue or small deletions that did not create a frame shift. In addition, 10 novel polymorphisms were found. We conclude that the majority of mutations causing Marfan syndrome reside in the FBN1 gene and that mutations creating premature termination codons are not the predominant cause of inefficient mutation detection using RT-PCR. We are currently modifying screening methods to increase sensitivity and targeting putative FBN1 gene promoter sequences for study.
Thongkum, Monthathip; Burns, Parichart; Bhunchoth, Anjana; Warin, Nuchnard; Chatchawankanphanich, Orawan; van Doorn, Wouter G
2015-03-15
We studied the expression of a gene encoding an ethylene receptor, called Ethylene Response Sensor 1 (Den-ERS1), in the petals of Dendrobium orchid flowers. Transcripts accumulated during the young floral bud stage and declined by the time the flowers had been open for several days. Pollination or exposure to exogenous ethylene resulted in earlier flower senescence, an increase in ethylene production and a lower Den-ERS1 transcript abundance. Treatment with 1-methylcyclopropene (1-MCP), an inhibitor of the ethylene receptor, decreased ethylene production and resulted in high transcript abundance. The literature indicates two kinds of ethylene receptor genes with regard to the effects of ethylene. One group shows ethylene-induced down-regulated transcription, while the other has ethylene-induced up-regulation. The present gene is an example of the first group. The 5' flanking region showed binding sites for Myb and myb-like, homeodomain, MADS domain, NAC, TCP, bHLH and EIN3-like transcription factors. The binding site for the EIN3-like factor might explain the ethylene effect on transcription. A few other transcription factors (RAV1 and NAC) seem also related to ethylene effects. Copyright © 2015 Elsevier GmbH. All rights reserved.
Pu, Jian; Sun, Haina; Wang, Jinda; Wu, Min; Wang, Kangxu; Denholm, Ian; Han, Zhaojun
2016-11-01
As well as arising from single point mutations in binding sites or detoxifying enzymes, it is likely that insecticide resistance mechanisms are frequently controlled by multiple genetic factors, resulting in resistance being inherited as a quantitative trait. However, empirical evidence for this is still rare. Here we analyse the causes of up-regulation of CYP6FU1, a monoxygenase implicated in resistance to deltamethrin in the rice pest Laodelphax striatellus. The 5'-flanking region of this gene was cloned and sequenced from individuals of a susceptible and a resistant strain. A luminescent reporter assay was used to evaluate different 5'-flanking regions and their fragments for promoter activity. Mutations enhancing promoter activity in various fragments were characterized, singly and in combination, by site mutation recovery. Nucleotide diversity in flanking sequences was greatly reduced in deltamethrin-resistant insects compared to susceptible ones. Phylogenetic sequence analysis found that CYP6FU1 had five different types of 5'-flanking region. All five types were present in a susceptible strain but only a single type showing the highest promoter activity was present in a resistant strain. Four cis-acting elements were identified whose influence on up-regulation was much more pronounced in combination than when present singly. Of these, two were new transcription factor (TF) binding sites produced by mutations, another one was also a new TF binding site alternated from an existing one, and the fourth was a unique transcription start site. These results demonstrate that multiple cis-acting elements are involved in up-regulating CYP6FU1 to generate a resistance phenotype. Copyright © 2016 Elsevier Ltd. All rights reserved.
Qi, L L; Ma, G J; Long, Y M; Hulke, B S; Gong, L; Markell, S G
2015-03-01
The rust resistance gene R 2 was reassigned to linkage group 14 of the sunflower genome. DNA markers linked to R 2 were identified and used for marker-assisted gene pyramiding in a confection type genetic background. Due to the frequent evolution of new pathogen races, sunflower rust is a recurring threat to sunflower production worldwide. The inbred line Morden Cross 29 (MC29) carries the rust resistance gene, R 2 , conferring resistance to numerous races of rust fungus in the US, Canada, and Australia, and can be used as a broad-spectrum resistance resource. Based on phenotypic assessments and SSR marker analyses on the 117 F2 individuals derived from a cross of HA 89 with MC29 (USDA), R 2 was mapped to linkage group (LG) 14 of the sunflower, and not to the previously reported location on LG9. The closest SSR marker HT567 was located at 4.3 cM distal to R 2 . Furthermore, 36 selected SNP markers from LG14 were used to saturate the R 2 region. Two SNP markers, NSA_002316 and SFW01272, flanked R 2 at a genetic distance of 2.8 and 1.8 cM, respectively. Of the three closely linked markers, SFW00211 amplified an allele specific for the presence of R 2 in a marker validation set of 46 breeding lines, and SFW01272 was also shown to be diagnostic for R 2 . These newly developed markers, together with the previously identified markers linked to the gene R 13a , were used to screen 524 F2 individuals from a cross of a confection R 2 line and HA-R6 carrying R 13a . Eleven homozygous double-resistant F2 plants with the gene combination of R 2 and R 13a were obtained. This double-resistant line will be extremely useful in confection sunflower, where few rust R genes are available, risking evolution of new virulence phenotypes and further disease epidemics.
Rethinking cell-cycle-dependent gene expression in Schizosaccharomyces pombe.
Cooper, Stephen
2017-11-01
Three studies of gene expression during the division cycle of Schizosaccharomyces pombe led to the proposal that a large number of genes are expressed at particular times during the S. pombe cell cycle. Yet only a small fraction of genes proposed to be expressed in a cell-cycle-dependent manner are reproducible in all three published studies. In addition to reproducibility problems, questions about expression amplitudes, cell-cycle timing of expression, synchronization artifacts, and the problem with methods for synchronizing cells must be considered. These problems and complications prompt the idea that caution should be used before accepting the conclusion that there are a large number of genes expressed in a cell-cycle-dependent manner in S. pombe.
Characterization of the human gene (TBXAS1) encoding thromboxane synthase.
Miyata, A; Yokoyama, C; Ihara, H; Bandoh, S; Takeda, O; Takahashi, E; Tanabe, T
1994-09-01
The gene encoding human thromboxane synthase (TBXAS1) was isolated from a human EMBL3 genomic library using human platelet thromboxane synthase cDNA as a probe. Nucleotide sequencing revealed that the human thromboxane synthase gene spans more than 75 kb and consists of 13 exons and 12 introns, of which the splice donor and acceptor sites conform to the GT/AG rule. The exon-intron boundaries of the thromboxane synthase gene were similar to those of the human cytochrome P450 nifedipine oxidase gene (CYP3A4) except for introns 9 and 10, although the primary sequences of these enzymes exhibited 35.8% identity each other. The 1.2-kb of the 5'-flanking region sequence contained potential binding sites for several transcription factors (AP-1, AP-2, GATA-1, CCAAT box, xenobiotic-response element, PEA-3, LF-A1, myb, basic transcription element and cAMP-response element). Primer-extension analysis indicated the multiple transcription-start sites, and the major start site was identified as an adenine residue located 142 bases upstream of the translation-initiation site. However, neither a typical TATA box nor a typical CAAT box is found within the 100-b upstream of the translation-initiation site. Southern-blot analysis revealed the presence of one copy of the thromboxane synthase gene per haploid genome. Furthermore, a fluorescence in situ hybridization study revealed that the human gene for thromboxane synthase is localized to band q33-q34 of the long arm of chromosome 7. A tissue-distribution study demonstrated that thromboxane synthase mRNA is widely expressed in human tissues and is particularly abundant in peripheral blood leukocyte, spleen, lung and liver. The low but significant levels of mRNA were observed in kidney, placenta and thymus.
Effect of the absolute statistic on gene-sampling gene-set analysis methods.
Nam, Dougu
2017-06-01
Gene-set enrichment analysis and its modified versions have commonly been used for identifying altered functions or pathways in disease from microarray data. In particular, the simple gene-sampling gene-set analysis methods have been heavily used for datasets with only a few sample replicates. The biggest problem with this approach is the highly inflated false-positive rate. In this paper, the effect of absolute gene statistic on gene-sampling gene-set analysis methods is systematically investigated. Thus far, the absolute gene statistic has merely been regarded as a supplementary method for capturing the bidirectional changes in each gene set. Here, it is shown that incorporating the absolute gene statistic in gene-sampling gene-set analysis substantially reduces the false-positive rate and improves the overall discriminatory ability. Its effect was investigated by power, false-positive rate, and receiver operating curve for a number of simulated and real datasets. The performances of gene-set analysis methods in one-tailed (genome-wide association study) and two-tailed (gene expression data) tests were also compared and discussed.
Yang, Xing; Xie, Lu; Li, Yixue; Wei, Chaochun
2009-06-29
Estimating the number of genes in human genome has been long an important problem in computational biology. With the new conception of considering human as a super-organism, it is also interesting to estimate the number of genes in this human super-organism. We presented our estimation of gene numbers in the human gut bacterial community, the largest microbial community inside the human super-organism. We got 552,700 unique genes from 202 complete human gut bacteria genomes. Then, a novel gene counting model was built to check the total number of genes by combining culture-independent sequence data and those complete genomes. 16S rRNAs were used to construct a three-level tree and different counting methods were introduced for the three levels: strain-to-species, species-to-genus, and genus-and-up. The model estimates that the total number of genes is about 9,000,000 after those with identity percentage of 97% or up were merged. By combining completed genomes currently available and culture-independent sequencing data, we built a model to estimate the number of genes in human gut bacterial community. The total number of genes is estimated to be about 9 million. Although this number is huge, we believe it is underestimated. This is an initial step to tackle this gene counting problem for the human super-organism. It will still be an open problem in the near future. The list of genomes used in this paper can be found in the supplementary table.
International Nuclear Information System (INIS)
Heck, J.D. III.
1988-01-01
This work reports the subcloning and characterization of the molecular elements necessary for the expression of the Escherichia coli valS gene encoding valyl-tRNA synthetase. The valS gene was subcloned from plasmid pLC26-22 by genetic complementation of a valS ts strain. The DNA region encoding the valS structural gene was determined by in vitro coupled transcription-translation assays. Cells transformed with a plasmid containing a full length copy of the valS gene enhanced in vivo valyl-tRNA synthetase specific activity twelve-fold. DNA sequences flanking the valS structural gene are presented. The transcription initiation sites of the valS gene were determined, in vivo and in vitro, by S1 nuclease protection studies, primer-extension analysis and both [α- 32 P]labeled and [γ- 32 P]end-labeled in vitro transcription assays. The DNA sequence of the valS gene of Escherichia coli has been determined. Significant similarity at the primary sequence level was detected between valyl-tRNA synthetase of E. coli and other known branched-chain aminoacyl-tRNA synthetases. An extended open reading frame (ORF) encoded on the DNA strand opposite the valS structural gene is described
Lubys, A; Lubienè, J; Kulakauskas, S; Stankevicius, K; Timinskas, A; Janulaitis, A
1996-07-15
The genomic region encoding the type IIS restriction-modification (R-M) system HphI (enzymes recognizing the asymmetric sequence 5'-GGTGA-3'/5'-TCACC-3') from Haemophilus parahaemolyticus were cloned into Escherichia coli and sequenced. Sequence analysis of the R-M HphI system revealed three adjacent genes aligned in the same orientation: a cytosine 5 methyltransferase (gene hphIMC), an adenine N6 methyltransferase (hphIMA) and the HphI restriction endonuclease (gene hphIR). Either methyltransferase is capable of protecting plasmid DNA in vivo against the action of the cognate restriction endonuclease. hphIMA methylation renders plasmid DNA resistant to R.Hindill at overlapping sites, suggesting that the adenine methyltransferase modifies the 3'-terminal A residue on the GGTGA strand. Strong homology was found between the N-terminal part of the m6A methyltransferasease and an unidentified reading frame interrupted by an incomplete gaIE gene of Neisseria meningitidis. The HphI R-M genes are flanked by a copy of a 56 bp direct nucleotide repeat on each side. Similar sequences have also been identified in the non-coding regions of H.influenzae Rd DNA. Possible involvement of the repeat sequences in the mobility of the HphI R-M system is discussed.
Suzuki, K; Yasunami, M; Matsuda, Y; Maeda, T; Kobayashi, H; Terasaki, H; Ohkubo, H
1996-09-01
Embryonic TEA domain-containing factor (ETF) belongs to the family of proteins structurally related to transcriptional enhancer factor-1 (TEF-1) and is implicated in neural development. Isolation and characterization of the cosmid clones encoding the mouse ETF gene (Etdf) revealed that Etdf spans approximately 17.9 kb and consists of 12 exons. The exon-intron structure of Etdf closely resembles that of the Drosophila scalloped gene, indicating that these genes may have evolved from a common ancestor. The multiple transcription initiation sites revealed by S1 protection and primer extension analyses are consistent with the absence of the canonical TATA and CAAT boxes in the 5'-flanking region, which contains many potential regulatory sequences, such as the E-box, N-box, Sp1 element, GATA-1 element, TAATGARAT element, and B2 short interspersed element (SINE) as well as several direct and inverted repeat sequences. The Etdf locus was assigned to the proximal region of mouse chromosome 7 using fluorescence in situ hybridization and linkage mapping analyses. These results provide the molecular basis for studying the regulation, in vivo function, and evolution of Etdf.
Directory of Open Access Journals (Sweden)
Pinto João
2010-06-01
Full Text Available Abstract Background Resistance of the malaria parasite Plasmodium falciparum to sulfadoxine-pyrimethamine (SP has evolved worldwide. In the archipelago of São Tomé and Principe (STP, West Africa, although SP resistance is highly prevalent the drug is still in use in particular circumstances. To address the evolutionary origins of SP resistance in these islands, we genotyped point mutations at P. falciparum dhfr and dhps genes and analysed microsatellites flanking those genes. Methods Blood samples were collected in July and December 2004 in three localities of São Tomé Island and one in Principe Island. Species-specific nested-PCR was used to identify P. falciparum infected samples. Subsequently, SNPs at the dhfr and dhps genes were identified through PCR-RFLP. Isolates were also analysed for three microsatellite loci flanking the dhfr gene, three loci flanking dhps and four loci located at putative neutral genomic regions. Results An increase of resistance-associated mutations at dhfr and dhps was observed, in particular for the dhfr/dhps quintuple mutant, associated with clinical SP failure. Analysis of flanking microsatellites suggests multiple independent introductions for dhfr and dhps mutant haplotypes, possibly from West Africa. A reduced genetic diversity and increased differentiation at flanking microsatellites when compared to neutral loci is consistent with a selective sweep for resistant alleles at both loci. Conclusions This study provides additional evidence for the crucial role of gene flow and drug selective pressures in the rapid spread of SP resistance in P. falciparum populations, from only a few mutation events giving rise to resistance-associated mutants. It also highlights the importance of human migration in the spread of drug resistant malaria parasites, as the distance between the islands and mainland is not consistent with mosquito-mediated parasite dispersal.
Labonne, Jonathan J D; Goultiaeva, Alina; Shore, Joel S
2009-06-01
While the breeding system known as distyly has been used as a model system in genetics, and evolutionary biology for over a century, the genes determining this system remain unknown. To positionally clone genes determining distyly, a high-resolution map of the S-locus region of Turnera has been constructed using segregation data from 2,013 backcross progeny. We discovered three putative genes tightly linked with the S-locus. An N-acetyltransferase (TkNACE) flanks the S-locus at 0.35 cM while a sulfotransferase (TkST1) and a non-LTR retroelement (TsRETRO) show complete linkage to the S-locus. An assay of population samples of six species revealed that TsRETRO, initially discovered in diploid Turnera subulata, is also associated with the S-allele in tetraploid T. subulata and diploid Turnera scabra. The sulfotransferase gene shows some level of differential expression in long versus short styles, indicating it might be involved in some aspect of distyly. The complete linkage of TkST1 and TsRETRO to the S-locus suggests that both genes may reside within, or in the immediate vicinity of the S-locus. Chromosome walking has been initiated using one of the genes discovered in the present study to identify the genes determining distyly.
[Clinical features and COMP gene mutation in a family with a pseudoachondroplasia child].
Lu, Chun-Ting; Guo, Li; Zahng, Zhan-Hui; Lin, Wei-Xia; Song, Yuan-Zong; Feng, Lie
2013-11-01
This study aimed to report the clinical characteristics and COMP gene mutation of a family with pseudoachondroplasia (PSACH), a relatively rare spinal and epiphyseal dysplasia that is inherited as an autosomal dominant trait. Clinical information on a 5-year-2-month-old PSACH child and his parents was collected and analyzed. Diagnosis was confirmed by PCR amplification and direct sequencing of all the 19 exons and their flanking sequences of COMP gene, and the mutation was further ascertained by cloning analysis of exon 10. The child presented with short and stubby fingers, bow leg, short limb dwarfism and metaphysic broadening in long bone as well as lumbar lordosis. A mutation c.1048_1116del (p.Asn350_Asp372del) in exon 10, inherited from his father who did not demonstrate any phenotypic feature of PSACH, was detected in the child. PSACH was diagnosed definitively by means of COMP mutation analysis, on the basis of the child's clinical and imaging features. The non-penetrance phenomenon of COMP mutation was described for the first time in PSACH.
A tetO Toolkit To Alter Expression of Genes in Saccharomyces cerevisiae.
Cuperus, Josh T; Lo, Russell S; Shumaker, Lucia; Proctor, Julia; Fields, Stanley
2015-07-17
Strategies to optimize a metabolic pathway often involve building a large collection of strains, each containing different versions of sequences that regulate the expression of pathway genes. Here, we develop reagents and methods to carry out this process at high efficiency in the yeast Saccharomyces cerevisiae. We identify variants of the Escherichia coli tet operator (tetO) sequence that bind a TetR-VP16 activator with differential affinity and therefore result in different TetR-VP16 activator-driven expression. By recombining these variants upstream of the genes of a pathway, we generate unique combinations of expression levels. Here, we built a tetO toolkit, which includes the I-OnuI homing endonuclease to create double-strand breaks, which increases homologous recombination by 10(5); a plasmid carrying six variant tetO sequences flanked by I-OnuI sites, uncoupling transformation and recombination steps; an S. cerevisiae-optimized TetR-VP16 activator; and a vector to integrate constructs into the yeast genome. We introduce into the S. cerevisiae genome the three crt genes from Erwinia herbicola required for yeast to synthesize lycopene and carry out the recombination process to produce a population of cells with permutations of tetO variants regulating the three genes. We identify 0.7% of this population as making detectable lycopene, of which the vast majority have undergone recombination at all three crt genes. We estimate a rate of ∼20% recombination per targeted site, much higher than that obtained in other studies. Application of this toolkit to medically or industrially important end products could reduce the time and labor required to optimize the expression of a set of metabolic genes.
Directory of Open Access Journals (Sweden)
Lakhdar Bouzid
2018-10-01
Full Text Available The wear of cutting tools remains a major obstacle. The effects of wear are not only antagonistic at the lifespan and productivity, but also harmful with the surface quality. The present work deals with some machinability studies on flank wear, surface roughness, and lifespan in finish turning of AISI 304 stainless steel using multilayer Ti(C,N/Al2O3/TiN coated carbide inserts. The machining experiments are conducted based on the response surface methodology (RSM. Combined effects of three cutting parameters, namely cutting speed, feed rate and cutting time on the two performance outputs (i.e. VB and Ra, and combined effects of two cutting parameters, namely cutting speed and feed rate on lifespan (T, are explored employing the analysis of variance (ANOVA. The relationship between the variables and the technological parameters is determined using a quadratic regression model and optimal cutting conditions for each performance level are established through desirability function approach (DFA optimization. The results show that the flank wear is influenced principally by the cutting time and in the second level by the cutting speed. In addition, it is indicated that the cutting time is the dominant factor affecting workpiece surface roughness followed by feed rate, while lifespan is influenced by cutting speed. The optimum level of input parameters for composite desirability was found Vc1-f1-t1 for VB, Ra and Vc1-f1 for T, with a maximum percentage of error 6.38%.
van Roekel, Eeske; Goossens, Luc; Scholte, Ron H. J.; Engels, Rutger C. M. E.; Verhagen, Maaike
2011-01-01
Background: Loneliness is a common problem in adolescence. Earlier research focused on genes within the serotonin and oxytocin systems, but no studies have examined the role of dopamine-related genes in loneliness. In the present study, we focused on the dopamine D2 receptor gene (DRD2). Methods:
Directory of Open Access Journals (Sweden)
Q. Nie
2009-01-01
Full Text Available Ghrelin (GHRL and its receptor (GHSR are involved in various bioactivities. In this study, the complete cDNA and 5′ flanking region of the duck GHRL (dGHRL gene and a 3717 bp fragment of the duck GHSR (dGHSR gene were obtained. A total of 19, 8, 43, and 48 SNPs identified in 2751, 1358, 3671, and 3567 bp of the chicken GHRL (cGHRL, chicken GHSR (cGHSR, dGHRL, and dGHSR genes, respectively. Both cGHRL and dGHRL were expressed predominantly in the proventriculus, whereas the highest mRNA levels of cGHSR and dGHSR were detected in the breast muscle and pituitary. Association analysis showed that C-2047G, A-2355C, and A-2220C of the cGHRL gene were significantly associated with abdominal fat weight (AFW; P=.01, crude protein content of leg muscle (CPCLM; P=.02, and CPCLM (P=.0009, respectively. C-1459T of the cGHSR gene was also significantly associated with CPCLM (P=.0004. C-729T of dGHRL and A3427T of dGHSR were both significantly associated with subcutaneous fat thickness (SFT; P=.04. It was indicated by this study that the GHRL and GHSR genes were related to fat deposition in both chicken and duck.
Gonzalez, S M; Ferland, L H; Robert, B; Abdelhay, E
1998-06-01
Vertebrate Msx genes are related to one of the most divergent homeobox genes of Drosophila, the muscle segment homeobox (msh) gene, and are expressed in a well-defined pattern at sites of tissue interactions. This pattern of expression is conserved in vertebrates as diverse as quail, zebrafish, and mouse in a range of sites including neural crest, appendages, and craniofacial structures. In the present work, we performed structural and functional analyses in order to identify potential cis-acting elements that may be regulating Msx1 gene expression. To this end, a 4.9-kb segment of the 5'-flanking region was sequenced and analyzed for transcription-factor binding sites. Four regions showing a high concentration of these sites were identified. Transfection assays with fragments of regulatory sequences driving the expression of the bacterial lacZ reporter gene showed that a region of 4 kb upstream of the transcription start site contains positive and negative elements responsible for controlling gene expression. Interestingly, a fragment of 130 bp seems to contain the minimal elements necessary for gene expression, as its removal completely abolishes gene expression in cultured cells. These results are reinforced by comparison of this region with the human Msx1 gene promoter, which shows extensive conservation, including many consensus binding sites, suggesting a regulatory role for them.
Directory of Open Access Journals (Sweden)
Shanying Zhu
2018-02-01
Full Text Available Pm21, derived from wheat wild relative Dasypyrum villosum, is one of the most effective powdery mildew resistance genes and has been widely applied in wheat breeding in China. Mapping and cloning Pm21 are of importance for understanding its resistance mechanism. In the present study, physical mapping was performed using different genetic stocks involving in structural variations of chromosome 6VS carrying Pm21. The data showed that 6VS could be divided into eight distinguishable chromosomal bins, and Pm21 was mapped to the bin FLb4–b5/b6 closely flanked by the markers 6VS-08.6 and 6VS-10.2. Comparative genomic mapping indicated that the orthologous regions of FLb4–b5/b6 carrying Pm21 were narrowed to a 117.7 kb genomic region harboring 19 genes in Brachypodium and a 37.7 kb region harboring 5 genes in rice, respectively. The result was consistent with that given by recent genetic mapping in diploid D. villosum. In conclusion, this study demonstrated that physical mapping based on chromosomal structural variations is an efficient method for locating alien genes in wheat background.
Mögling, Ramona; Richard, Mathilde J; Vliet, Stefan van der; Beek, Ruud van; Schrauwen, Eefje J A; Spronken, Monique I; Rimmelzwaan, Guus F; Fouchier, Ron A M
2017-06-01
Over the last decade, an increasing proportion of circulating human influenza A(H3N2) viruses exhibited haemagglutination activity that was sensitive to neuraminidase inhibitors. This change in haemagglutination as compared to older circulating A(H3N2) viruses prompted an investigation of the underlying molecular basis. Recent human influenza A(H3N2) viruses were found to agglutinate turkey erythrocytes in a manner that could be blocked with either oseltamivir or neuraminidase-specific antisera, indicating that agglutination was driven by neuraminidase, with a low or negligible contribution of haemagglutinin. Using representative virus recombinants it was shown that the haemagglutinin of a recent A(H3N2) virus indeed had decreased activity to agglutinate turkey erythrocytes, while its neuraminidase displayed increased haemagglutinating activity. Viruses with chimeric and mutant neuraminidases were used to identify the amino acid substitution histidine to arginine at position 150 flanking the neuraminidase catalytic site as the determinant of this neuraminidase-mediated haemagglutination. An analysis of publicly available neuraminidase gene sequences showed that viruses with histidine at position 150 were rapidly replaced by viruses with arginine at this position between 2005 and 2008, in agreement with the phenotypic data. As a consequence of neuraminidase-mediated haemagglutination of recent A(H3N2) viruses and poor haemagglutination via haemagglutinin, haemagglutination inhibition assays with A(H3N2) antisera are no longer useful to characterize the antigenic properties of the haemagglutinin of these viruses for vaccine strain selection purposes. Continuous monitoring of the evolution of these viruses and potential consequences for vaccine strain selection remains important.
Lan, Desong; Shi, Xingming; Wang, Yunfeng; Liu, Changjun; Wang, Mei; Cui, Hongyu; Tian, Guobin; Li, Jisong; Tong, Guangzhi
2009-01-01
In recent years,manipulation of large herpesvirus genomes has been facilitated by using bacterial artificial chromosome (BAC) vectors. We have previously reported the construction of the BAC clones (HVT BACs) of herpesvirus of turkey (HVT). With these BAC clones in hand,we manipulated the genome of HVT by utilizing Red/ET recombination system, and developed a biologically safe live vaccine based on the HVT BACs. In this two-step approach, we first transformed the plasmid pRedET into the DH10B competent cells that carried the HVT BACs,and added inducer L-arabinose into the cells. We prepared the cells into competent cells and electroporated the linear rpsL-neo counter-selection/selection cassette flanked by the 50 bp long homology arms into the cells. So the functional cassette was inserted into the U(S)2 locus. Only colonies carrying the modified BAC would survive Kanamycin selection on the agar plates. The successful integration of the rpsL-neo cassette was monitored by PCR and Streptomycin selection, for the insertion of rpsL-neo cassette cells will become Streptomycin sensitive. Secondly, in the same way, we replaced the rpsL-neo cassette with the hemagglutinin (HA) gene of (HPAIV) A/Goose/ Guangdong/1/96(H5N1) flanked by the same homology arms. Only colonies which lost the rpsL-neo cassette will grow on Streptomycin containing plates. Finally, we obtained many colonies of which the HA gene of the AIV was inserted into the U(S)2 locus to be modified of HVT. And we reconstituted one recombinant virus from transfecting one of these BAC clones DNA into chick embryo fibroblasts (CEFs). We achieved one rescued recombinant virus which designated as rHVT-HA3. The H5 subtype HA gene expression in this recombinant virus rHVT-HA3 was confirmed by immunofluorescence assay.
New Clox Systems for rapid and efficient gene disruption in Candida albicans.
Directory of Open Access Journals (Sweden)
Shahida Shahana
Full Text Available Precise genome modification is essential for the molecular dissection of Candida albicans, and is yielding invaluable information about the roles of specific gene functions in this major fungal pathogen of humans. C. albicans is naturally diploid, unable to undergo meiosis, and utilizes a non-canonical genetic code. Hence, specialized tools have had to be developed for gene disruption in C. albicans that permit the deletion of both target alleles, and in some cases, the recycling of the Candida-specific selectable markers. Previously, we developed a tool based on the Cre recombinase, which recycles markers in C. albicans with 90-100% efficiency via site-specific recombination between loxP sites. Ironically, the utility of this system was hampered by the extreme efficiency of Cre, which prevented the construction in Escherichia coli of stable disruption cassettes carrying a methionine-regulatable CaMET3p-cre gene flanked by loxP sites. Therefore, we have significantly enhanced this system by engineering new Clox cassettes that carry a synthetic, intron-containing cre gene. The Clox kit facilitates efficient transformation and marker recycling, thereby simplifying and accelerating the process of gene disruption in C. albicans. Indeed, homozygous mutants can be generated and their markers resolved within two weeks. The Clox kit facilitates strategies involving single marker recycling or multi-marker gene disruption. Furthermore, it includes the dominant NAT1 marker, as well as URA3, HIS1 and ARG4 cassettes, thereby permitting the manipulation of clinical isolates as well as genetically marked strains of C. albicans. The accelerated gene disruption strategies afforded by this new Clox system are likely to have a profound impact on the speed with which C. albicans pathobiology can be dissected.
Editing Transgenic DNA Components by Inducible Gene Replacement in Drosophila melanogaster
Lin, Chun-Chieh; Potter, Christopher J.
2016-01-01
Gene conversions occur when genomic double-strand DNA breaks (DSBs) trigger unidirectional transfer of genetic material from a homologous template sequence. Exogenous or mutated sequence can be introduced through this homology-directed repair (HDR). We leveraged gene conversion to develop a method for genomic editing of existing transgenic insertions in Drosophila melanogaster. The clustered regularly-interspaced palindromic repeats (CRISPR)/Cas9 system is used in the homology assisted CRISPR knock-in (HACK) method to induce DSBs in a GAL4 transgene, which is repaired by a single-genomic transgenic construct containing GAL4 homologous sequences flanking a T2A-QF2 cassette. With two crosses, this technique converts existing GAL4 lines, including enhancer traps, into functional QF2 expressing lines. We used HACK to convert the most commonly-used GAL4 lines (labeling tissues such as neurons, fat, glia, muscle, and hemocytes) to QF2 lines. We also identified regions of the genome that exhibited differential efficiencies of HDR. The HACK technique is robust and readily adaptable for targeting and replacement of other genomic sequences, and could be a useful approach to repurpose existing transgenes as new genetic reagents become available. PMID:27334272
Genetic homogeneity of Clostridium botulinum type A1 strains with unique toxin gene clusters.
Raphael, Brian H; Luquez, Carolina; McCroskey, Loretta M; Joseph, Lavin A; Jacobson, Mark J; Johnson, Eric A; Maslanka, Susan E; Andreadis, Joanne D
2008-07-01
A group of five clonally related Clostridium botulinum type A strains isolated from different sources over a period of nearly 40 years harbored several conserved genetic properties. These strains contained a variant bont/A1 with five nucleotide polymorphisms compared to the gene in C. botulinum strain ATCC 3502. The strains also had a common toxin gene cluster composition (ha-/orfX+) similar to that associated with bont/A in type A strains containing an unexpressed bont/B [termed A(B) strains]. However, bont/B was not identified in the strains examined. Comparative genomic hybridization demonstrated identical genomic content among the strains relative to C. botulinum strain ATCC 3502. In addition, microarray data demonstrated the absence of several genes flanking the toxin gene cluster among the ha-/orfX+ A1 strains, suggesting the presence of genomic rearrangements with respect to this region compared to the C. botulinum ATCC 3502 strain. All five strains were shown to have identical flaA variable region nucleotide sequences. The pulsed-field gel electrophoresis patterns of the strains were indistinguishable when digested with SmaI, and a shift in the size of at least one band was observed in a single strain when digested with XhoI. These results demonstrate surprising genomic homogeneity among a cluster of unique C. botulinum type A strains of diverse origin.
Sharples, G J; Lloyd, R G
1991-12-01
The ruvC gene of Escherichia coli specifies a nuclease that resolves Holliday junction intermediates in genetic recombination (B. Connolly, C.A. Parsons, F.E. Benson, H.J. Dunderdale, G.J. Sharples, R.G. Lloyd, and S.C. West, Proc. Natl. Acad, Sci. USA 88:6063-6067, 1991). The gene was located between aspS and the ruvAB operon by DNA sequencing and deletion analysis of ruvC plasmids and was shown to encode a protein of 18,747 Da. Analysis of the DNA flanking ruvC indicated that the gene is transcribed independently of the LexA-regulated ruvAB operon and is not under direct SOS control. ruvC lies downstream of an open reading frame, orf-33, for a protein which migrates during sodium dodecyl sulfate-polyacrylamide gel electrophoresis as a 33-kDa polypeptide. These two genes probably form an operon. However, expression of ruvC was found to be very poor relative to that of orf-33. A double ribosomal frameshift between these genes is proposed as a possible reason for the low level of RuvC. Two further open reading frames of unknown function were identified, one on either side of the orf-33-ruvC operon.
Wang, Yang; Zhang, Wanjiang; Wang, Juan; Wu, Congming; Shen, Zhangqi; Fu, Xiao; Yan, Yang; Zhang, Qijing; Schwarz, Stefan; Shen, Jianzhong
2012-03-01
A total of 149 porcine Staphylococcus isolates with florfenicol MICs of ≥ 16 μg/ml were screened for the presence of the multiresistance gene cfr, its location on plasmids, and its genetic environment. In total, 125 isolates carried either cfr (16 isolates), fexA (92 isolates), or both genes (17 isolates). The 33 cfr-carrying staphylococci, which included isolates of the species Staphylococcus cohnii, S. arlettae, and S. saprophyticus in which the cfr gene has not been described before, exhibited a wide variety of SmaI pulsed-field gel electrophoresis patterns. In 18 cases, the cfr gene was located on plasmids. Four different types of cfr-carrying plasmids--pSS-01 (n = 2; 40 kb), pSS-02 (n = 3; 35.4 kb), pSS-03 (n = 10; 7.1 kb), and pBS-01 (n = 3; 16.4 kb)--were differentiated on the basis of their sizes, restriction patterns, and additional resistance genes. Sequence analysis revealed that in plasmid pSS-01, the cfr gene was flanked in the upstream part by a complete aacA-aphD-carrying Tn4001-like transposon and in the downstream part by a complete fexA-carrying transposon Tn558. In plasmid pSS-02, an insertion sequence IS21-558 and the cfr gene were integrated into transposon Tn558 and thereby truncated the tnpA and tnpB genes. The smallest cfr-carrying plasmid pSS-03 carried the macrolide-lincosamide-streptogramin B resistance gene erm(C). Plasmid pBS-01, previously described in Bacillus spp., harbored a Tn917-like transposon, including the macrolide-lincosamide-streptogramin B resistance gene erm(B) in the cfr downstream region. Plasmids, which in part carry additional resistance genes, seem to play an important role in the dissemination of the gene cfr among porcine staphylococci.
Futagami, Taiki; Morono, Yuki; Terada, Takeshi; Kaksonen, Anna H.; Inagaki, Fumio
2009-01-01
Halogenated organic compounds serve as terminal electron acceptors for anaerobic respiration in a diverse range of microorganisms. Here, we report on the widespread distribution and diversity of reductive dehalogenase homologous (rdhA) genes in marine subsurface sediments. A total of 32 putative rdhA phylotypes were detected in sediments from the southeast Pacific off Peru, the eastern equatorial Pacific, the Juan de Fuca Ridge flank off Oregon, and the northwest Pacific off Japan, collected at a maximum depth of 358 m below the seafloor. In addition, significant dehalogenation activity involving 2,4,6-tribromophenol and trichloroethene was observed in sediment slurry from the Nankai Trough Forearc Basin. These results suggest that dehalorespiration is an important energy-yielding pathway in the subseafloor microbial ecosystem. PMID:19749069
Directory of Open Access Journals (Sweden)
Pierce Levi CT
2009-01-01
Full Text Available Abstract Background Gene rearrangements such as chromosomal translocations have been shown to contribute to cancer development. Human chromosomal fragile sites are regions of the genome especially prone to breakage, and have been implicated in various chromosome abnormalities found in cancer. However, there has been no comprehensive and quantitative examination of the location of fragile sites in relation to all chromosomal aberrations. Results Using up-to-date databases containing all cancer-specific recurrent translocations, we have examined 444 unique pairs of genes involved in these translocations to determine the correlation of translocation breakpoints and fragile sites in the gene pairs. We found that over half (52% of translocation breakpoints in at least one gene of these gene pairs are mapped to fragile sites. Among these, we examined the DNA sequences within and flanking three randomly selected pairs of translocation-prone genes, and found that they exhibit characteristic features of fragile DNA, with frequent AT-rich flexibility islands and the potential of forming highly stable secondary structures. Conclusion Our study is the first to examine gene pairs involved in all recurrent chromosomal translocations observed in tumor cells, and to correlate the location of more than half of breakpoints to positions of known fragile sites. These results provide strong evidence to support a causative role for fragile sites in the generation of cancer-specific chromosomal rearrangements.
Seok, Junhee; Davis, Ronald W; Xiao, Wenzhong
2015-01-01
Accumulated biological knowledge is often encoded as gene sets, collections of genes associated with similar biological functions or pathways. The use of gene sets in the analyses of high-throughput gene expression data has been intensively studied and applied in clinical research. However, the main interest remains in finding modules of biological knowledge, or corresponding gene sets, significantly associated with disease conditions. Risk prediction from censored survival times using gene sets hasn't been well studied. In this work, we propose a hybrid method that uses both single gene and gene set information together to predict patient survival risks from gene expression profiles. In the proposed method, gene sets provide context-level information that is poorly reflected by single genes. Complementarily, single genes help to supplement incomplete information of gene sets due to our imperfect biomedical knowledge. Through the tests over multiple data sets of cancer and trauma injury, the proposed method showed robust and improved performance compared with the conventional approaches with only single genes or gene sets solely. Additionally, we examined the prediction result in the trauma injury data, and showed that the modules of biological knowledge used in the prediction by the proposed method were highly interpretable in biology. A wide range of survival prediction problems in clinical genomics is expected to benefit from the use of biological knowledge.
Moreno, Maria de Lourdes; Sánchez-Porro, Cristina; Piubeli, Francine; Frias, Luciana; García, María Teresa; Mellado, Encarnación
2011-01-01
Background Extensive use of phenolic compounds in industry has resulted in the generation of saline wastewaters that produce significant environmental contamination; however, little information is available on the degradation of phenolic compounds in saline conditions. Halomonas organivorans G-16.1 (CECT 5995T) is a moderately halophilic bacterium that we isolated in a previous work from saline environments of South Spain by enrichment for growth in different pollutants, including phenolic compounds. PCR amplification with degenerate primers revealed the presence of genes encoding ring-cleaving enzymes of the β-ketoadipate pathway for aromatic catabolism in H. organivorans. Findings The gene cluster catRBCA, involved in catechol degradation, was isolated from H. organivorans. The genes catA, catB, catC and the divergently transcribed catR code for catechol 1,2-dioxygenase (1,2-CTD), cis,cis-muconate cycloisomerase, muconolactone delta-isomerase and a LysR-type transcriptional regulator, respectively. The benzoate catabolic genes (benA and benB) are located flanking the cat genes. The expression of cat and ben genes by phenol and benzoic acid was shown by RT-PCR analysis. The induction of catA gene by phenol and benzoic acid was also probed by the measurement of 1,2-CTD activity in H. organivorans growth in presence of these inducers. 16S rRNA and catA gene-based phylogenies were established among different degrading bacteria showing no phylogenetic correlation between both genes. Conclusions/Significance In this work, we isolated and determined the sequence of a gene cluster from a moderately halophilic bacterium encoding ortho-pathway genes involved in the catabolic metabolism of phenol and analyzed the gene organization, constituting the first report characterizing catabolic genes involved in the degradation of phenol in moderate halophiles, providing an ideal model system to investigate the potential use of this group of extremophiles in the decontamination of
The ‘Pokemon’ (ZBTB7) Gene: No Evidence of Association with Sporadic Breast Cancer
Salas, Antonio; Vega, Ana; Milne, Roger L.; García-Magariños, Manuel; Ruibal, Álvaro; Benítez, Javier; Carracedo, Ángel
2008-01-01
It has been proposed that the excess of familiar risk associated with breast cancer could be explained by the cumulative effect of multiple weakly predisposing alleles. The transcriptional repressor FBI1, also known as Pokemon, has recently been identified as a critical factor in oncogenesis. This protein is encoded by the ZBTB7 gene. Here we aimed to determine whether polymorphisms in ZBTB7 are associated with breast cancer risk in a sample of cases and controls collected in hospitals from North and Central Spanish patients. We genotyped 15 SNPs in ZBTB7, including the flanking regions, with an average coverage of 1 SNP/2.4 Kb, in 360 sporadic breast cancer cases and 402 controls. Comparison of allele, genotype and haplotype frequencies between cases and controls did not reveal associations using Pearson’s chi-square test and a permutation procedure to correct for multiple test. In this, the first study of the ZBTB7 gene in relation to, sporadic breast cancer, we found no evidence of an association. PMID:21892298
Seismic Anisotropy Beneath the Eastern Flank of the Rio Grande Rift
Benton, N. W.; Pulliam, J.
2015-12-01
Shear wave splitting was measured across the eastern flank of the Rio Grande Rift (RGR) to investigate mechanisms of upper mantle anisotropy. Earthquakes recorded at epicentral distances of 90°-130° from EarthScope Transportable Array (TA) and SIEDCAR (SC) broadband seismic stations were examined comprehensively, via the Matlab program "Splitlab", to determine whether SKS and SKKS phases indicated anisotropic properties. Splitlab allows waveforms to be rotated, filtered, and windowed interactively and splitting measurements are made on a user-specified waveform segment via three independent methods simultaneously. To improve signal-to-noise and improve reliability, we stacked the error surfaces that resulted from grid searches in the measurements for each station location. Fast polarization directions near the Rio Grande Rift tend to be sub-parallel to the RGR but then change to angles that are consistent with North America's average plate motion, to the east. The surface erosional depression of the Pecos Valley coincides with fast polarization directions that are aligned in a more northerly direction than their neighbors, whereas the topographic high to the east coincides with an easterly change of the fast axis.The area above a mantle high velocity anomaly discovered separately via seismic tomography which may indicate thickened lithosphere, corresponds to unusually large delay times and fast polarization directions that are more closely aligned to a north-south orientation. The area of southeastern New Mexico that falls between the mantle fast anomaly and the Great Plains craton displays dramatically smaller delay times, as well as changes in fast axis directions toward the northeast. Changes in fast axis directions may indicate flow around the mantle anomaly; small delay times could indicate vertical or attenuated flow.
[Mutation analysis of the PAH gene in children with phenylketonuria from the Qinghai area of China].
He, Jiang; Wang, Hui-Zhen; Xu, Fa-Liang; Yang, Xi; Wang, Rui; Zou, Hong-Yun; Yu, Wu-Zhong
2015-11-01
To study the mutation characteristics of the phenylalanine hydroxylase (PAH) gene in children with phenylketonuria (PKU) from the Qinghai area of China, in order to provide basic information for genetic counseling and prenatal diagnosis. Mutations of the PAH gene were detected in the promoter and exons 1-13 and their flanking intronic sequences of PAH gene by PCR and DNA sequencing in 49 children with PKU and their parents from the Qinghai area of China. A total of 30 different mutations were detected in 80 out of 98 mutant alleles (82%), including 19 missense (63%), 5 nonsense (17%), 3 splice-site (10%) and 3 deletions (10%). Most mutations were detected in exons 3, 6, 7, 11 and intron 4 of PAH gene. The most frequent mutations were p.R243Q (19%), IVS4-1G>A (9%), p.Y356X (7%) and p.EX6-96A>G(5%). Two novel mutations p.N93fsX5 (c.279-282delCATC) and p.G171E (c.512G>A) were found. p.H64fsX9(c.190delC) was documented for the second time in Chinese PAH gene. The mutation spectrum of the gene PAH in the Qinghai population was similar to that in other populations in North China while significantly different from that in the populations from some provinces in southern China, Japan and Europe. The mutations of PAH gene in the Qinghai area of China demonstrate a unique diversity, complexity and specificity.
Raymond, Laure; Diebold, Bertrand; Leroux, Céline; Maurey, Hélène; Drouin-Garraud, Valérie; Delahaye, Andre; Dulac, Olivier; Metreau, Julia; Melikishvili, Gia; Toutain, Annick; Rivier, François; Bahi-Buisson, Nadia; Bienvenu, Thierry
2013-01-01
Mutations in the cyclin-dependent kinase-like 5 gene (CDKL5) have been predominantly described in epileptic encephalopathies of female, including infantile spasms with Rett-like features. Up to now, detection of mutations in this gene was made by laborious, expensive and/or time consuming methods. Here, we decided to validate high-resolution melting analysis (HRMA) for mutation scanning of the CDKL5 gene. Firstly, using a large DNA bank consisting to 34 samples carrying different mutations and polymorphisms, we validated our analytical conditions to analyse the different exons and flanking intronic sequences of the CDKL5 gene by HRMA. Secondly, we screened CDKL5 by both HRMA and denaturing high performance liquid chromatography (dHPLC) in a cohort of 135 patients with early-onset seizures. Our results showed that point mutations and small insertions and deletions can be reliably detected by HRMA. Compared to dHPLC, HRMA profiles are more discriminated, thereby decreasing unnecessary sequencing. In this study, we identified eleven novel sequence variations including four pathogenic mutations (2.96% prevalence). HRMA appears cost-effective, easy to set up, highly sensitive, non-toxic and rapid for mutation screening, ideally suited for large genes with heterogeneous mutations located along the whole coding sequence, such as the CDKL5 gene. Copyright © 2012 Elsevier B.V. All rights reserved.
Mlynarova, L.; Nap, J.P.H.
2003-01-01
To study the impact of different DNA configurations on the stability of transgene expression, a variant of the cre gene was developed. This variant allows for the highly efficient in planta removal of its own loxP-flanked coding sequence as well as other DNAs flanked by ectopic heterospecific lox
Mutational Analysis of the Rhodopsin Gene in Sector Retinitis Pigmentosa.
Napier, Maria L; Durga, Dash; Wolsley, Clive J; Chamney, Sarah; Alexander, Sharon; Brennan, Rosie; Simpson, David A; Silvestri, Giuliana; Willoughby, Colin E
2015-01-01
To determine the role of rhodopsin (RHO) gene mutations in patients with sector retinitis pigmentosa (RP) from Northern Ireland. A case series of sector RP in a tertiary ocular genetics clinic. Four patients with sector RP were recruited from the Royal Victoria Hospital (Belfast, Northern Ireland) and Altnagelvin Hospital (Londonderry, Northern Ireland) following informed consent. The diagnosis of sector RP was based on clinical examination, International Society for Clinical Electrophysiology of Vision (ISCEV) standard electrophysiology, and visual field analysis. DNA was extracted from peripheral blood leucocytes and the coding regions and adjacent flanking intronic sequences of the RHO gene were polymerase chain reaction (PCR) amplified and cycle sequenced. Rhodopsin mutational status. A heterozygous missense mutation in RHO (c.173C > T) resulting in a non-conservative substitution of threonine to methionine (p. Thr58Met) was identified in one patient and was absent from 360 control individuals. This non-conservative substitution (p.Thr58Met) replaces a highly evolutionary conserved polar hydrophilic threonine residue with a non-polar hydrophobic methionine residue at position 58 near the cytoplasmic border of helix A of RHO. The study identified a RHO gene mutation (p.Thr58Met) not previously reported in RP in a patient with sector RP. These findings outline the phenotypic variability associated with RHO mutations. It has been proposed that the regional effects of RHO mutations are likely to result from interplay between mutant alleles and other genetic, epigenetic and environmental factors.
Transcriptional and epigenetic regulation of KIAA1199 gene expression in human breast cancer.
Directory of Open Access Journals (Sweden)
Cem Kuscu
Full Text Available Emerging evidence has demonstrated that upregulated expression of KIAA1199 in human cancer bodes for poor survival. The regulatory mechanism controlling KIAA1199 expression in cancer remains to be characterized. In the present study, we have isolated and characterized the human KIAA1199 promoter in terms of regulation of KIAA1199 gene expression. A 3.3 kb fragment of human genomic DNA containing the 5'-flanking sequence of the KIAA1199 gene possesses both suppressive and activating elements. Employing a deletion mutagenesis approach, a 1.4 kb proximal region was defined as the basic KIAA1199 promoter containing a TATA-box close to the transcription start site. A combination of 5'-primer extension study with 5'RACE DNA sequencing analysis revealed one major transcription start site that is utilized in the human KIAA1199 gene. Bioinformatics analysis suggested that the 1.4 kb KIAA1199 promoter contains putative activating regulatory elements, including activator protein-1(AP-1, Twist-1, and NF-κB sites. Sequential deletion and site-direct mutagenesis analysis demonstrated that the AP-1 and distal NF-κB sites are required for KIAA1199 gene expression. Further analyses using an electrophoretic mobility-shift assay and chromatin immunoprecipitation confirmed the requirement of these cis- and trans-acting elements in controlling KIAA1199 gene expression. Finally, we found that upregulated KIAA1199 expression in human breast cancer specimens correlated with hypomethylation of the regulatory region. Involvement of DNA methylation in regulation of KIAA1199 expression was recapitulated in human breast cancer cell lines. Taken together, our study unraveled the regulatory mechanisms controlling KIAA1199 gene expression in human cancer.
Harris, Roger L; Barbieri, Sonia; Paraskevopoulos, Kostas; Murphy, Loretta M; Eady, Robert R; Hasnain, S Samar; Sawers, R Gary
2010-01-01
The cycP gene encoding a periplasmic cytochrome c' from the denitrifying beta-proteobacterium Achromobacter xylosoxidans was characterized. The genes flanking cycP encode components of a mobile genetic element characteristic of the beta-proteobacteria, suggesting that cycP has inserted within a transposon or insertion element. The gene therefore does not form part of a denitrification operon or gene cluster. The level of expression of the cycP gene and the level of synthesis of its corresponding gene product were found to increase by maximally 3-fold anaerobically. Expression of cycP appears to occur mainly by non-specific read-through transcription from portions of the insertion element. Conditions were developed for high-level overproduction of cytochrome c' in Escherichia coli, which resulted in signal peptide cleavage concomitant with secretion of the protein into the periplasm. Using a single-step purification, 20-30 mg of pure protein were isolated from a 1-litre culture. Based on UV-visible spectrophotometry the dimeric protein was shown to have a full complement of haem and to be indistinguishable from the native protein purified from A. xylosoxidans. This system provides an excellent platform to facilitate biochemical and structural dissection of the mechanism underlying the novel specificity of NO binding to the proximal face of the haem.
Ellestad, Laura E; Porter, Tom E
2013-01-01
Glucocorticoids play a role in functional differentiation of pituitary somatotrophs and lactotrophs during embryogenesis. Ras-dva was identified as a gene regulated by anterior neural fold protein-1/homeobox expressed in embryonic stem cells-1, a transcription factor known to be critical in pituitary development, and has an expression profile in the chicken embryonic pituitary gland that is consistent with in vivo regulation by glucocorticoids. The objective of this study was to characterize expression and regulation of ras-dva mRNA in the developing chicken anterior pituitary. Pituitary ras-dva mRNA levels increased during embryogenesis to a maximum on embryonic day (e) 18 and then decreased and remained low or undetectable after hatch. Ras-dva expression was highly enriched in the pituitary gland on e18 relative to other tissues examined. Glucocorticoid treatment of pituitary cells from mid- and late-stage embryos rapidly increased ras-dva mRNA, suggesting it may be a direct transcriptional target of glucocorticoids. A reporter construct driven by 4 kb of the chicken ras-dva 5'-flanking region, containing six putative pituitary-specific transcription factor-1 (Pit-1) binding sites and two potential glucocorticoid receptor (GR) binding sites, was highly activated in embryonic pituitary cells and up-regulated by corticosterone. Mutagenesis of the most proximal Pit-1 site decreased promoter activity in chicken e11 pituitary cells, indicating regulation of ras-dva by Pit-1. However, mutating putative GR binding sites did not substantially reduce induction of ras-dva promoter activity by corticosterone, suggesting additional DNA elements within the 5'-flanking region are responsible for glucocorticoid regulation. We have identified ras-dva as a glucocorticoid-regulated gene that is likely expressed in cells of the Pit-1 lineage within the developing anterior pituitary gland.
International Nuclear Information System (INIS)
Montazer-Torbati, Mohammad Bagher; Hue-Beauvais, Cathy; Droineau, Stephanie; Ballester, Maria; Coant, Nicolas; Aujean, Etienne; Petitbarat, Marie; Rijnkels, Monique; Devinoy, Eve
2008-01-01
Whey Acidic Protein (WAP) gene expression is specific to the mammary gland and regulated by lactogenic hormones to peak during lactation. It differs markedly from the more constitutive expression of the two flanking genes, Ramp3 and Tbrg4. Our results show that the tight regulation of WAP gene expression parallels variations in the chromatin structure and DNA methylation profile throughout the Ramp3-WAP-Tbrg4 locus. Three Matrix Attachment Regions (MAR) have been predicted in this locus. Two of them are located between regions exhibiting open and closed chromatin structures in the liver. The third, located around the transcription start site of the Tbrg4 gene, interacts with topoisomerase II in HC11 mouse mammary cells, and in these cells anchors the chromatin loop to the nuclear matrix. Furthermore, if lactogenic hormones are present in these cells, the chromatin loop surrounding the WAP gene is more tightly attached to the nuclear structure, as observed after a high salt treatment of the nuclei and the formation of nuclear halos. Taken together, our results point to a combination of several epigenetic events that may explain the differential expression pattern of the WAP locus in relation to tissue and developmental stages
Nuclear factor 1 regulates adipose tissue-specific expression in the mouse GLUT4 gene
International Nuclear Information System (INIS)
Miura, Shinji; Tsunoda, Nobuyo; Ikeda, Shinobu; Kai, Yuko; Cooke, David W.; Lane, M. Daniel; Ezaki, Osamu
2004-01-01
Previous studies demonstrated that an adipose tissue-specific element(s) (ASE) of the murine GLUT4 gene is located between -551 and -506 in the 5'-flanking sequence and that a high-fat responsive element(s) for down-regulation of the GLUT4 gene is located between bases -701 and -552. A binding site for nuclear factor 1 (NF1), that mediates insulin and cAMP-induced repression of GLUT4 in 3T3-L1 adipocytes is located between bases -700 and -688. To examine the role of NF1 in the regulation of GLUT4 gene expression in white adipose tissues (WAT) in vivo, we created two types of transgenic mice harboring mutated either 5' or 3' half-site of NF1-binding sites in GLUT4 minigene constructs. In both cases, the GLUT4 minigene was not expressed in WAT, while expression was maintained in brown adipose tissue, skeletal muscle, and heart. This was an unexpected finding, since a -551 GLUT4 minigene that did not have the NF1-binding site was expressed in WAT. We propose a model that explains the requirement for both the ASE and the NF1-binding site for expression of GLUT4 in WAT
Isolation and characterization of major histocompatibility complex class II B genes in cranes.
Kohyama, Tetsuo I; Akiyama, Takuya; Nishida, Chizuko; Takami, Kazutoshi; Onuma, Manabu; Momose, Kunikazu; Masuda, Ryuichi
2015-11-01
In this study, we isolated and characterized the major histocompatibility complex (MHC) class II B genes in cranes. Genomic sequences spanning exons 1 to 4 were amplified and determined in 13 crane species and three other species closely related to cranes. In all, 55 unique sequences were identified, and at least two polymorphic MHC class II B loci were found in most species. An analysis of sequence polymorphisms showed the signature of positive selection and recombination. A phylogenetic reconstruction based on exon 2 sequences indicated that trans-species polymorphism has persisted for at least 10 million years, whereas phylogenetic analyses of the sequences flanking exon 2 revealed a pattern of concerted evolution. These results suggest that both balancing selection and recombination play important roles in the crane MHC evolution.
Pathgroups, a dynamic data structure for genome reconstruction problems.
Zheng, Chunfang
2010-07-01
Ancestral gene order reconstruction problems, including the median problem, quartet construction, small phylogeny, guided genome halving and genome aliquoting, are NP hard. Available heuristics dedicated to each of these problems are computationally costly for even small instances. We present a data structure enabling rapid heuristic solution to all these ancestral genome reconstruction problems. A generic greedy algorithm with look-ahead based on an automatically generated priority system suffices for all the problems using this data structure. The efficiency of the algorithm is due to fast updating of the structure during run time and to the simplicity of the priority scheme. We illustrate with the first rapid algorithm for quartet construction and apply this to a set of yeast genomes to corroborate a recent gene sequence-based phylogeny. http://albuquerque.bioinformatics.uottawa.ca/pathgroup/Quartet.html chunfang313@gmail.com Supplementary data are available at Bioinformatics online.
Koo, Ching Lee; Liew, Mei Jing; Mohamad, Mohd Saberi; Salleh, Abdul Hakim Mohamed
2013-01-01
Recently, the greatest statistical computational challenge in genetic epidemiology is to identify and characterize the genes that interact with other genes and environment factors that bring the effect on complex multifactorial disease. These gene-gene interactions are also denoted as epitasis in which this phenomenon cannot be solved by traditional statistical method due to the high dimensionality of the data and the occurrence of multiple polymorphism. Hence, there are several machine learning methods to solve such problems by identifying such susceptibility gene which are neural networks (NNs), support vector machine (SVM), and random forests (RFs) in such common and multifactorial disease. This paper gives an overview on machine learning methods, describing the methodology of each machine learning methods and its application in detecting gene-gene and gene-environment interactions. Lastly, this paper discussed each machine learning method and presents the strengths and weaknesses of each machine learning method in detecting gene-gene interactions in complex human disease.
A Review for Detecting Gene-Gene Interactions Using Machine Learning Methods in Genetic Epidemiology
Directory of Open Access Journals (Sweden)
Ching Lee Koo
2013-01-01
Full Text Available Recently, the greatest statistical computational challenge in genetic epidemiology is to identify and characterize the genes that interact with other genes and environment factors that bring the effect on complex multifactorial disease. These gene-gene interactions are also denoted as epitasis in which this phenomenon cannot be solved by traditional statistical method due to the high dimensionality of the data and the occurrence of multiple polymorphism. Hence, there are several machine learning methods to solve such problems by identifying such susceptibility gene which are neural networks (NNs, support vector machine (SVM, and random forests (RFs in such common and multifactorial disease. This paper gives an overview on machine learning methods, describing the methodology of each machine learning methods and its application in detecting gene-gene and gene-environment interactions. Lastly, this paper discussed each machine learning method and presents the strengths and weaknesses of each machine learning method in detecting gene-gene interactions in complex human disease.
Raynard, Steven J; Baker, Mark D
2004-01-01
In mammalian cells, little is known about the nature of recombination-prone regions of the genome. Previously, we reported that the immunoglobulin heavy chain (IgH) mu locus behaved as a hotspot for mitotic, intrachromosomal gene conversion (GC) between repeated mu constant (Cmu) regions in mouse hybridoma cells. To investigate whether elements within the mu gene regulatory region were required for hotspot activity, gene targeting was used to delete a 9.1 kb segment encompassing the mu gene promoter (Pmu), enhancer (Emu) and switch region (Smu) from the locus. In these cell lines, GC between the Cmu repeats was significantly reduced, indicating that this 'recombination-enhancing sequence' (RES) is necessary for GC hotspot activity at the IgH locus. Importantly, the RES fragment stimulated GC when appended to the same Cmu repeats integrated at ectopic genomic sites. We also show that deletion of Emu and flanking matrix attachment regions (MARs) from the RES abolishes GC hotspot activity at the IgH locus. However, no stimulation of ectopic GC was observed with the Emu/MARs fragment alone. Finally, we provide evidence that no correlation exists between the level of transcription and GC promoted by the RES. We suggest a model whereby Emu/MARS enhances mitotic GC at the endogenous IgH mu locus by effecting chromatin modifications in adjacent DNA.
Development and validation of an integrated DNA walking strategy to detect GMO expressing cry genes.
Fraiture, Marie-Alice; Vandamme, Julie; Herman, Philippe; Roosens, Nancy H C
2018-06-27
Recently, an integrated DNA walking strategy has been proposed to prove the presence of GMO via the characterisation of sequences of interest, including their transgene flanking regions and the unnatural associations of elements in their transgenic cassettes. To this end, the p35S, tNOS and t35S pCAMBIA elements have been selected as key targets, allowing the coverage of most of GMO, EU authorized or not. In the present study, a bidirectional DNA walking method anchored on the CryAb/c genes is proposed with the aim to cover additional GMO and additional sequences of interest. The performance of the proposed bidirectional DNA walking method anchored on the CryAb/c genes has been evaluated in a first time for its feasibility using several GM events possessing these CryAb/c genes. Afterwards, its sensitivity has been investigated through low concentrations of targets (as low as 20 HGE). In addition, to illustrate its applicability, the entire workflow has been tested on a sample mimicking food/feed matrices analysed in GMO routine analysis. Given the successful assessment of its performance, the present bidirectional DNA walking method anchored on the CryAb/c genes can easily be implemented in GMO routine analysis by the enforcement laboratories and allows completing the entire DNA walking strategy in targeting an additional transgenic element frequently found in GMO.
Gene conversion as a secondary mechanism of short interspersed element (SINE) evolution
Energy Technology Data Exchange (ETDEWEB)
Kass, D.H. [Louisiana State Univ. Medical Center, New Orleans, LA (United States). Dept. of Biochemistry and Molecular Biology; Batzer, M.A. [Lawrence Livermore National Lab., CA (United States); Deininger, P.L. [Louisiana State Univ. Medical Center, New Orleans, LA (United States). Dept. of Biochemistry and Molecular Biology]|[Alton Ochsner Medical Foundation, New Orleans, LA (United States). Lab. of Molecular Genetics
1995-01-01
The Alu repetitive family of short interspersed elements (SINEs) in primates can be subdivided into distinct subfamilies by specific diagnostic nucleotide changes. The older subfamilies are generally very abundant, while the younger subfamilies have fewer copies. Some of the youngest Alu elements are absent in the orthologous loci of nonhuman primates, indicative of recent retroposition events, the primary mode of SINE evolutions. PCR analysis of one young Alu subfamily (Sb2) member found in the low-density lipoprotein receptor gene apparently revealed the presence of this element in the green monkey, orangutan, gorilla, and chimpanzee genomes, as well as the human genome. However, sequence analysis of these genomes revealed a highly mutated, older, primate-specific Alu element was present at this position in the nonhuman primates. Comparison of the flanking DNA sequences upstream of this Alu insertion corresponded to evolution expected for standard primate phylogeny, but comparison of the Alu repeat sequences revealed that the human element departed from this phylogeny. The change in the human sequence apparently occurred by a gene conversion event only within the Alu element itself, converting it from one of the oldest to one of the youngest Alu subfamilies. Although gene conversions of Alu elements are clearly very rare, this finding shows that such events can occur and contribute to specific cases of SINE subfamily evolution.
International Nuclear Information System (INIS)
Broderick, T.P.; Schaff, D.A.; Bertino, A.M.; Dush, M.K.; Tischfield, J.A.; Stambrook, P.J.
1987-01-01
The functional human adenine phosphoribosyltransferase (APRT) gene is <2.6 kilobases in length and contains five exons. The amino acid sequences of APRTs have been highly conserved throughout evolution. The human enzyme is 82%, 90%, and 40% identical to the mouse, hamster, and Escherichia coli enzymes, respectively. The promoter region of the human APRT gene, like that of several other housekeeping genes, lacks TATA and CCAAT boxes but contains five GC boxes that are potential binding sites for the Sp1 transcription factor. The distal three, however, are dispensable for gene expression. Comparison between human and mouse APRT gene nucleotide sequences reveals a high degree of homology within protein coding regions but an absence of significant homology in 5' flanking, 3' untranslated, and intron sequences, except for similarly positioned GC boxes in the promoter region and a 26-base-pair region in intron 3. This 26-base-pair sequence is 92% identical with a similarly positioned sequence in the mouse gene and is also found in intron 3 of the hamster gene, suggesting that its retention may be a consequence of stringent selection. The positions of all introns have been precisely retained in the human and both rodent genes. Retention of an elevated CpG dinucleotide content, despite loss of sequence homology, suggests that there may be selection for CpG dinucleotides in these regions and that their maintenance may be important for APRT gene function
Kim, J M; Choi, B D; Kim, B C; Park, S S; Hong, K C
2009-04-01
Pig breeding is aimed at improving lean meat production ability as well as meat quality, and muscle fibre characteristics may be important for enhancing these traits. Therefore, new molecular markers have been demanded for selecting lean meat production ability and meat quality in live animals. Myogenin belongs to the MyoD gene family, and is a candidate gene responsible for muscle fibre characteristics. We identified a new single nucleotide polymorphism (SNP) site in the 5' upstream region of the myogenin gene (nucleotides C and T). A total of 252 pigs of three breeds were genotyped by polymerase chain reaction-restriction fragment length polymorphism using BspCNI. Additionally, they were genotyped for the previously detected MspI site in the 3'-flanking region (alleles A and B). The CCBB diplotype had the highest frequency over breeds, followed by TCBB and CCAB. The other diplotypes were not found in studied pigs. Association analysis performed for the markers found that the TCBB diplotype has desirable effects on the total number of fibres (p lean meat production ability with good meat quality.
[Characterization of Black and Dichothrix Cyanobacteria Based on the 16S Ribosomal RNA Gene Sequence
Ortega, Maya
2010-01-01
My project focuses on characterizing different cyanobacteria in thrombolitic mats found on the island of Highborn Cay, Bahamas. Thrombolites are interesting ecosystems because of the ability of bacteria in these mats to remove carbon dioxide from the atmosphere and mineralize it as calcium carbonate. In the future they may be used as models to develop carbon sequestration technologies, which could be used as part of regenerative life systems in space. These thrombolitic communities are also significant because of their similarities to early communities of life on Earth. I targeted two cyanobacteria in my research, Dichothrix spp. and whatever black is, since they are believed to be important to carbon sequestration in these thrombolitic mats. The goal of my summer research project was to molecularly identify these two cyanobacteria. DNA was isolated from each organism through mat dissections and DNA extractions. I ran Polymerase Chain Reactions (PCR) to amplify the 16S ribosomal RNA (rRNA) gene in each cyanobacteria. This specific gene is found in almost all bacteria and is highly conserved, meaning any changes in the sequence are most likely due to evolution. As a result, the 16S rRNA gene can be used for bacterial identification of different species based on the sequence of their 16S rRNA gene. Since the exact sequence of the Dichothrix gene was unknown, I designed different primers that flanked the gene based on the known sequences from other taxonomically similar cyanobacteria. Once the 16S rRNA gene was amplified, I cloned the gene into specialized Escherichia coli cells and sent the gene products for sequencing. Once the sequence is obtained, it will be added to a genetic database for future reference to and classification of other Dichothrix sp.
van Roekel, Eeske; Goossens, Luc; Scholte, Ron H. J.; Engels, Rutger C. M. E.; Verhagen, Maaike
2011-01-01
Background: Loneliness is a common problem in adolescence. Earlier research focused on genes within the serotonin and oxytocin systems, but no studies have examined the role of dopamine-related genes in loneliness. In the present study, we focused on the dopamine D2 receptor gene (DRD2). Methods: Associations among the DRD2, sex, parental support,…
Ultrahigh-dimensional variable selection method for whole-genome gene-gene interaction analysis
Directory of Open Access Journals (Sweden)
Ueki Masao
2012-05-01
Full Text Available Abstract Background Genome-wide gene-gene interaction analysis using single nucleotide polymorphisms (SNPs is an attractive way for identification of genetic components that confers susceptibility of human complex diseases. Individual hypothesis testing for SNP-SNP pairs as in common genome-wide association study (GWAS however involves difficulty in setting overall p-value due to complicated correlation structure, namely, the multiple testing problem that causes unacceptable false negative results. A large number of SNP-SNP pairs than sample size, so-called the large p small n problem, precludes simultaneous analysis using multiple regression. The method that overcomes above issues is thus needed. Results We adopt an up-to-date method for ultrahigh-dimensional variable selection termed the sure independence screening (SIS for appropriate handling of numerous number of SNP-SNP interactions by including them as predictor variables in logistic regression. We propose ranking strategy using promising dummy coding methods and following variable selection procedure in the SIS method suitably modified for gene-gene interaction analysis. We also implemented the procedures in a software program, EPISIS, using the cost-effective GPGPU (General-purpose computing on graphics processing units technology. EPISIS can complete exhaustive search for SNP-SNP interactions in standard GWAS dataset within several hours. The proposed method works successfully in simulation experiments and in application to real WTCCC (Wellcome Trust Case–control Consortium data. Conclusions Based on the machine-learning principle, the proposed method gives powerful and flexible genome-wide search for various patterns of gene-gene interaction.
Valentini, Giseli; Gonçalves-Vidigal, Maria Celeste; Hurtado-Gonzales, Oscar P; de Lima Castro, Sandra Aparecida; Cregan, Perry B; Song, Qijian; Pastor-Corrales, Marcial A
2017-08-01
Co-segregation analysis and high-throughput genotyping using SNP, SSR, and KASP markers demonstrated genetic linkage between Ur-14 and Co-3 4 /Phg-3 loci conferring resistance to the rust, anthracnose and angular leaf spot diseases of common bean. Rust, anthracnose, and angular leaf spot are major diseases of common bean in the Americas and Africa. The cultivar Ouro Negro has the Ur-14 gene that confers broad spectrum resistance to rust and the gene cluster Co-3 4 /Phg-3 containing two tightly linked genes conferring resistance to anthracnose and angular leaf spot, respectively. We used co-segregation analysis and high-throughput genotyping of 179 F 2:3 families from the Rudá (susceptible) × Ouro Negro (resistant) cross-phenotyped separately with races of the rust and anthracnose pathogens. The results confirmed that Ur-14 and Co-3 4 /Phg-3 cluster in Ouro Negro conferred resistance to rust and anthracnose, respectively, and that Ur-14 and the Co-3 4 /Phg-3 cluster were closely linked. Genotyping the F 2:3 families, first with 5398 SNPs on the Illumina BeadChip BARCBEAN6K_3 and with 15 SSR, and eight KASP markers, specifically designed for the candidate region containing Ur-14 and Co-3 4 /Phg-3, permitted the creation of a high-resolution genetic linkage map which revealed that Ur-14 was positioned at 2.2 cM from Co-3 4 /Phg-3 on the short arm of chromosome Pv04 of the common bean genome. Five flanking SSR markers were tightly linked at 0.1 and 0.2 cM from Ur-14, and two flanking KASP markers were tightly linked at 0.1 and 0.3 cM from Co-3 4 /Phg-3. Many other SSR, SNP, and KASP markers were also linked to these genes. These markers will be useful for the development of common bean cultivars combining the important Ur-14 and Co-3 4 /Phg-3 genes conferring resistance to three of the most destructive diseases of common bean.
Li, M; Zhang, H Y; Liang, B
2013-01-01
Twelve-low resistant (LR) mutants of Trichoderma harzianum with the capability of grow fast at 0.8 μg/mL methyl benzimidazol-2-yl carbamate (MBC) were obtained using UV mutagenesis. MR and HR mutants which could grow fast at 10 and 100 μg/mL MBC, respectively, were isolated by step-up selection protocols in which UV-treated mutants were induced and mycelial sector screening was made in plates with growth medium. Subsequently, β-tubulin genes of 14 mutants were cloned to describe-the molecular lesion likely to be responsible-for MBC resistance. Comparison of the β-tubulin sequences of the mutant and sensitive strains of T. harzianum revealed 2 new MBC-binding sites differed from those in other plant pathogens. A single mutation at-amino acid 168, having Phe (TTC) instead of Ser (TCC)', was demonstrated for the HR mutant; a double mutation in amino acid 13 resulting in the substitution of Gly (GGC) by Val (GTG) was observed in β-tubulin gene of MR mutant. On the other hand, no substitutions were identified in the β-tubulin gene and its 5'-flanking regions in 12 LR mutants of T. harzianum.
Li, Jinhong; Webster, Margaret; Furuya, Masaki; Gilmartin, Philip M
2007-07-01
The study of heteromorphy in Primula over the past 140 years has established the reproductive significance of this breeding system. Plants produce either thrum or pin flowers that demonstrate reciprocal herkogamy. Thrums have short styles and produce large pollen from anthers at the mouth of the flower; pins have long styles and produce small pollen from anthers located within the corolla tube. The control of heteromorphy is orchestrated by the S locus with dominant (S) and recessive (s) alleles that comprise a co-adapted linkage group of genes. Thrum plants are heterozygous (Ss) and pin plants are homozygous (ss). Reciprocal crosses between the two forms are required for fertilization; within-morph crosses are impeded by a sporophytic self-incompatibility system. Rare recombination events within the S locus produce self-fertile homostyles. As a first step towards identifying genes located at the S locus, we used fluorescent differential display to screen for differential gene expression in pin and thrum flowers. Rather than only detecting differentially regulated genes, we identified two S locus linked genes by virtue of allelic variation between pin and thrum transcripts. Analysis of pin and thrum plants together with homostyle recombinant reveals that one gene flanks the locus, whereas the other shows complete linkage. One gene is related to Arabidopsis flower-timing genes Col9 and Col10; the other encodes a small predicted membrane protein of unknown function. Notwithstanding the diallelic behaviour of the Primula S locus, analysis of pin and thrum plants reveal three alleles for each gene: two pin and one thrum.
Domain movement within a gene: a novel evolutionary mechanism for protein diversification.
Directory of Open Access Journals (Sweden)
Yoshikazu Furuta
Full Text Available A protein function is carried out by a specific domain localized at a specific position. In the present study, we report that, within a gene, a specific amino acid sequence can move between a certain position and another position. This was discovered when the sequences of restriction-modification systems within the bacterial species Helicobacter pylori were compared. In the specificity subunit of Type I restriction-modification systems, DNA sequence recognition is mediated by target recognition domain 1 (TRD1 and TRD2. To our surprise, several sequences are shared by TRD1 and TRD2 of genes (alleles at the same locus (chromosomal location; these domains appear to have moved between the two positions. The gene/protein organization can be represented as x-(TRD1-y-x-(TRD2-y, where x and y represent repeat sequences. Movement probably occurs by recombination at these flanking DNA repeats. In accordance with this hypothesis, recombination at these repeats also appears to decrease two TRDs into one TRD or increase these two TRDs to three TRDs (TRD1-TRD2-TRD2 and to allow TRD movement between genes even at different loci. Similar movement of domains between TRD1 and TRD2 was observed for the specificity subunit of a Type IIG restriction enzyme. Similar movement of domain between TRD1 and TRD2 was observed for Type I restriction-modification enzyme specificity genes in two more eubacterial species, Streptococcus pyogenes and Mycoplasma agalactiae. Lateral domain movements within a protein, which we have designated DOMO (domain movement, represent novel routes for the diversification of proteins.
International Nuclear Information System (INIS)
Andres, A.C.; Schoenenberger, C.A.; Groner, B.; Henninghausen, L.; LeMeur, M.; Gelinger, P.
1987-01-01
The activated human Ha-ras oncogene was subjected to the control of the promoter region of the murine whey acidic protein (Wap) gene, which is expressed in mammary epithelial cells in response to lactogenic hormones. The Wap-ras gene was stably introduced into the mouse germ line of five transgenic mice (one male and four females). Wap-ras expression was observed in the mammary glands of lactating females in two lines derived from female founders. The tissue-directed and hormone-dependent Wap expression was conferred on the Ha-ras oncogene. The signals governing Wap expression are located within 2.5 kilobases of 5' flanking sequence. The other two lines derived from female founders did not express the chimeric gene. In the line derived from the male founder the Wap-ras gene is integrated into the Y chromosome. Expression was found in the salivary gland of male animals only. After a long latency, Wap-ras-expressing mice developed tumors. The tumors arose in tissues expressing Wap-ras - i.e., mammary or salivary glands. Compared to the corresponding nonmalignant tissues, Wap-ras expression was enhanced in the tumors
Energy Technology Data Exchange (ETDEWEB)
Altabella, T.; Chrispeels, M.J. (Univ. of California, San Diego, La Jolla (USA))
1990-06-01
Bean (Phaseolus vulgaris L.) seeds contain a putative plant defense protein that inhibits insect and mammalian but not plant {alpha}-amylases. We recently presented strong circumstantial evidence that this {alpha}-amylase inhibitor ({alpha}Al) is encoded by an already-identified lectin gene whose product is referred to as lectin-like-protein (LLP). We have now made a chimeric gene consisting of the coding sequence of the lectin gene that encodes LLP and the 5{prime} and 3{prime} flanking sequences of the lectin gene that encodes phytohemagglutinin-L. When this chimeric gene was expressed in transgenic tobacco (Nicotiana tabacum), we observed in the seeds a series of polypeptides (M{sub r} 10,000-18,000) that cross-react with antibodies to the bean {alpha}-amylase inhibitor. Most of these polypeptides bind to a pig pancreas {alpha}-amylase affinity column. An extract of the seeds of the transformed tobacco plants inhibits pig pancreas {alpha}-amylase activity as well as the {alpha}-amylase present in the midgut of Tenebrio molitor. We suggest that introduction of this lectin gene (to be called {alpha}ai) into other leguminous plants may be a strategy to protect the seeds from the seed-eating larvae of Coleoptera.
Adaptive Horizontal Gene Transfers between Multiple Cheese-Associated Fungi.
Ropars, Jeanne; Rodríguez de la Vega, Ricardo C; López-Villavicencio, Manuela; Gouzy, Jérôme; Sallet, Erika; Dumas, Émilie; Lacoste, Sandrine; Debuchy, Robert; Dupont, Joëlle; Branca, Antoine; Giraud, Tatiana
2015-10-05
Domestication is an excellent model for studies of adaptation because it involves recent and strong selection on a few, identified traits [1-5]. Few studies have focused on the domestication of fungi, with notable exceptions [6-11], despite their importance to bioindustry [12] and to a general understanding of adaptation in eukaryotes [5]. Penicillium fungi are ubiquitous molds among which two distantly related species have been independently selected for cheese making-P. roqueforti for blue cheeses like Roquefort and P. camemberti for soft cheeses like Camembert. The selected traits include morphology, aromatic profile, lipolytic and proteolytic activities, and ability to grow at low temperatures, in a matrix containing bacterial and fungal competitors [13-15]. By comparing the genomes of ten Penicillium species, we show that adaptation to cheese was associated with multiple recent horizontal transfers of large genomic regions carrying crucial metabolic genes. We identified seven horizontally transferred regions (HTRs) spanning more than 10 kb each, flanked by specific transposable elements, and displaying nearly 100% identity between distant Penicillium species. Two HTRs carried genes with functions involved in the utilization of cheese nutrients or competition and were found nearly identical in multiple strains and species of cheese-associated Penicillium fungi, indicating recent selective sweeps; they were experimentally associated with faster growth and greater competitiveness on cheese and contained genes highly expressed in the early stage of cheese maturation. These findings have industrial and food safety implications and improve our understanding of the processes of adaptation to rapid environmental changes. Copyright © 2015 The Authors. Published by Elsevier Ltd.. All rights reserved.
Russo, Monia Teresa; Annunziata, Rossella; Sanges, Remo; Ferrante, Maria Immacolata; Falciatore, Angela
2015-12-01
Diatoms are a key phytoplankton group in the contemporary ocean, showing extraordinary adaptation capacities to rapidly changing environments. The recent availability of whole genome sequences from representative species has revealed distinct features in their genomes, like novel combinations of genes encoding distinct metabolisms and a significant number of diatom-specific genes. However, the regulatory mechanisms driving diatom gene expression are still largely uncharacterized. Considering the wide variety of fields of study orbiting diatoms, ranging from ecology, evolutionary biology to biotechnology, it is thus essential to increase our understanding of fundamental gene regulatory processes such as transcriptional regulation. To this aim, we explored the functional properties of the 5'-flanking region of the Phaeodatylum tricornutum Lhcf2 gene, encoding a member of the Light Harvesting Complex superfamily and we showed that this region enhances transcription of a GUS reporter gene in an orientation- and distance-independent fashion. This represents the first example of a cis-regulatory sequence with enhancer-like features discovered in diatoms and it is instrumental for the generation of novel genetic tools and diatom exploitation in different areas of study. Copyright © 2015 Elsevier B.V. All rights reserved.
Dictionary-driven prokaryotic gene finding
Shibuya, Tetsuo; Rigoutsos, Isidore
2002-01-01
Gene identification, also known as gene finding or gene recognition, is among the important problems of molecular biology that have been receiving increasing attention with the advent of large scale sequencing projects. Previous strategies for solving this problem can be categorized into essentially two schools of thought: one school employs sequence composition statistics, whereas the other relies on database similarity searches. In this paper, we propose a new gene identification scheme that combines the best characteristics from each of these two schools. In particular, our method determines gene candidates among the ORFs that can be identified in a given DNA strand through the use of the Bio-Dictionary, a database of patterns that covers essentially all of the currently available sample of the natural protein sequence space. Our approach relies entirely on the use of redundant patterns as the agents on which the presence or absence of genes is predicated and does not employ any additional evidence, e.g. ribosome-binding site signals. The Bio-Dictionary Gene Finder (BDGF), the algorithm’s implementation, is a single computational engine able to handle the gene identification task across distinct archaeal and bacterial genomes. The engine exhibits performance that is characterized by simultaneous very high values of sensitivity and specificity, and a high percentage of correctly predicted start sites. Using a collection of patterns derived from an old (June 2000) release of the Swiss-Prot/TrEMBL database that contained 451 602 proteins and fragments, we demonstrate our method’s generality and capabilities through an extensive analysis of 17 complete archaeal and bacterial genomes. Examples of previously unreported genes are also shown and discussed in detail. PMID:12060689
The Association of DRD2 with Insight Problem Solving.
Zhang, Shun; Zhang, Jinghuan
2016-01-01
Although the insight phenomenon has attracted great attention from psychologists, it is still largely unknown whether its variation in well-functioning human adults has a genetic basis. Several lines of evidence suggest that genes involved in dopamine (DA) transmission might be potential candidates. The present study explored for the first time the association of dopamine D2 receptor gene ( DRD2 ) with insight problem solving. Fifteen single-nucleotide polymorphisms (SNPs) covering DRD2 were genotyped in 425 unrelated healthy Chinese undergraduates, and were further tested for association with insight problem solving. Both single SNP and haplotype analysis revealed several associations of DRD2 SNPs and haplotypes with insight problem solving. In conclusion, the present study provides the first evidence for the involvement of DRD2 in insight problem solving, future studies are necessary to validate these findings.
A reconstruction problem for a class of phylogenetic networks with lateral gene transfers.
Cardona, Gabriel; Pons, Joan Carles; Rosselló, Francesc
2015-01-01
Lateral, or Horizontal, Gene Transfers are a type of asymmetric evolutionary events where genetic material is transferred from one species to another. In this paper we consider LGT networks, a general model of phylogenetic networks with lateral gene transfers which consist, roughly, of a principal rooted tree with its leaves labelled on a set of taxa, and a set of extra secondary arcs between nodes in this tree representing lateral gene transfers. An LGT network gives rise in a natural way to a principal phylogenetic subtree and a set of secondary phylogenetic subtrees, which, roughly, represent, respectively, the main line of evolution of most genes and the secondary lines of evolution through lateral gene transfers. We introduce a set of simple conditions on an LGT network that guarantee that its principal and secondary phylogenetic subtrees are pairwise different and that these subtrees determine, up to isomorphism, the LGT network. We then give an algorithm that, given a set of pairwise different phylogenetic trees [Formula: see text] on the same set of taxa, outputs, when it exists, the LGT network that satisfies these conditions and such that its principal phylogenetic tree is [Formula: see text] and its secondary phylogenetic trees are [Formula: see text].
Directory of Open Access Journals (Sweden)
Gabriel Legorreta Paulín
2017-03-01
Full Text Available Landslides that occur along river systems are very common and have the potential to cause harm to human, to its infrastructure or affect their socio-economic activity. This dynamic is magnified in territories where morphological contrasts are very marked; as in the border between the mountains and subhorizontal land. This is especially true for volcanic terrains where volcanic activity can trigger voluminous landslides along stream systems by sector and flank collapse and where high seasonal rainfall on terrains covered by poorly consolidated materials produces small but hazardous landslides and debris flows that occur continually along stream systems during the volcanic repose periods. Those type of landslides can deliver volumes of hundreds and millions cubic meters that create a potentially hazardous situation for people and property down the valleys. The study of landslides in volcanic terrains through a Geographic Information System (GIS and under a geomorphological criterion, have allowed to develop a comprehensive methodology linked to the development of multi-temporal inventory, with susceptibility and volume estimation of displaced material. The aim of this research is to develop a method (protocol for landslide susceptibility and landslide volume assessment of potentially unstable volcanic landscapes in order to be helpful in mitigating landslide damages to human settlements. Pico de Orizaba volcano is the highest volcano in Mexico. The volcano has been affected by large flank collapse landslides throughout its geological history. These events have partially destroyed the cone as it happened in Bezymianny volcano and St. Elena volcano. In this volcano, the risk associated with landslide and debris flows, is increased by the growing of human settlements along the hillslopes and by the subsistence agriculture, and deforestation. This situation is favored by a volcanic calm that has lasted 147 years, approximate. These conditions create a
Cisgenic barley with improved phytase activity
DEFF Research Database (Denmark)
Holme, Inger; Dionisio, Giuseppe; Brinch-Pedersen, Henrik
2012-01-01
phytase gene (HvPAPhy_a) expressed during grain filling to evaluate the cisgenesis concept in barley. The marker gene elimination method was used to obtain marker-free plant lines. Here, the gene of interest and the selection gene are flanked by their own T-DNA borders to allow unlinked integration...... of the two genes. We analysed the transformants for co-transformation efficiency, increased phytase activities in the grain, integration of the kanamycin resistance gene of the vector-backbone and segregation between the HvPAPhy_a insert and the hygromycin resistance gene. The frequencies of the four......PAPhy_a insert for further analysis. Seeds from plants homozygous for the insert showed 2.6- and 2.8-fold increases in phytase activities and the activity levels were stable over the three generations analysed. In one of the selected lines, the flanking sequences from both the left and right T-DNA borders were...
Bacterial Artificial Chromosome Mutagenesis Using Recombineering
Directory of Open Access Journals (Sweden)
Kumaran Narayanan
2011-01-01
Full Text Available Gene expression from bacterial artificial chromosome (BAC clones has been demonstrated to facilitate physiologically relevant levels compared to viral and nonviral cDNA vectors. BACs are large enough to transfer intact genes in their native chromosomal setting together with flanking regulatory elements to provide all the signals for correct spatiotemporal gene expression. Until recently, the use of BACs for functional studies has been limited because their large size has inherently presented a major obstacle for introducing modifications using conventional genetic engineering strategies. The development of in vivo homologous recombination strategies based on recombineering in E. coli has helped resolve this problem by enabling facile engineering of high molecular weight BAC DNA without dependence on suitably placed restriction enzymes or cloning steps. These techniques have considerably expanded the possibilities for studying functional genetics using BACs in vitro and in vivo.
Energy Technology Data Exchange (ETDEWEB)
Kleyn, P.W.; Wang, C.H.; Vitale, E.; Pan, J.; Ross, B.M.; Grunn, A.; Palmer, D.A.; Warburton, D.; Brzustowicz, L.M.; Gilliam, T.G. (New York State Psychiatric Institute, NY (United States)); Lien, L.L.; Kunkel, L.M. (Howard Hughes Medical Institute, Boston, MA (United States))
1993-07-15
The childhood spinal muscular atrophies (SMAs) are the most common, serious neuromuscular disorders of childhood second to Duchenne muscular dystrophy. A single locus for these disorders has been mapped by recombination events to a region of 0.7 centimorgan (range, 0.1-2.1 centimorgans) between loci D5S435 and MAP1B on chromosome 5q11.2-13.3. By using PCR amplification to screen yeast artificial chromosome (YAC) DNA pools and the PCR-vectorette method to amplify YAC ends, a YAC contig was constructed across the disease gene region. Nine walk steps identified 32 YACs, including a minimum of seven overlapping YAC clones (average size, 460 kb) that span the SMA region. The contig is characterized by a collection of 30 YAC-end sequence tag sites together with seven genetic markers. The entire YAC contig spans a minimum of 3.2 Mb; the SMA locus is confined to roughly half of this region. Microsatellite markers generated along the YAC contig segregate with the SMA locus in all families where the flanking markers (D5S435 and MAP1B) recombine. Construction of a YAC contig across the disease gene region is an essential step in isolation of the SMA-encoding gene. 26 refs., 3 figs., 1 tab.
Thiesen, H-J; Steinbeck, F; Maruschke, M; Koczan, D; Ziems, B; Hakenberg, O W
2017-01-01
Tumorigenic processes are understood to be driven by epi-/genetic and genomic alterations from single point mutations to chromosomal alterations such as insertions and deletions of nucleotides up to gains and losses of large chromosomal fragments including products of chromosomal rearrangements e.g. fusion genes and proteins. Overall comparisons of copy number alterations (CNAs) presented in 48 clear cell renal cell carcinoma (ccRCC) genomes resulted in ratios of gene losses versus gene gains between 26 ccRCC Fuhrman malignancy grades G1 (ratio 1.25) and 20 G3 (ratio 0.58). Gene losses and gains of 15762 CNA genes were mapped to 795 chromosomal cytoband loci including 280 KEGG pathways. CNAs were classified according to their contribution to Fuhrman tumour gradings G1 and G3. Gene gains and losses turned out to be highly structured processes in ccRCC genomes enabling the subclassification and stratification of ccRCC tumours in a genome-wide manner. CNAs of ccRCC seem to start with common tumour related gene losses flanked by CNAs specifying Fuhrman grade G1 losses and CNA gains favouring grade G3 tumours. The appearance of recurrent CNA signatures implies the presence of causal mechanisms most likely implicated in the pathogenesis and disease-outcome of ccRCC tumours distinguishing lower from higher malignant tumours. The diagnostic quality of initial 201 genes (108 genes supporting G1 and 93 genes G3 phenotypes) has been successfully validated on published Swiss data (GSE19949) leading to a restricted CNA gene set of 171 CNA genes of which 85 genes favour Fuhrman grade G1 and 86 genes Fuhrman grade G3. Regarding these gene sets overall survival decreased with the number of G3 related gene losses plus G3 related gene gains. CNA gene sets presented define an entry to a gene-directed and pathway-related functional understanding of ongoing copy number alterations within and between individual ccRCC tumours leading to CNA genes of prognostic and predictive value.
Topological variation in single-gene phylogenetic trees
Castresana, Jose
2007-01-01
A recent large-scale phylogenomic study has shown the great degree of topological variation that can be found among eukaryotic phylogenetic trees constructed from single genes, highlighting the problems that can be associated with gene sampling in phylogenetic studies.
Truelove, Emily; Kellogg, Katherine C.
2016-01-01
This 12-month ethnographic study of an early entrant into the U.S. car-sharing industry demonstrates that when an organization shifts its focus from developing radical new technology to incrementally improving this technology, the shift may spark an internal power struggle between the dominant engineering group and a challenger occupational group such as the marketing group. Analyzing 42 projects in two time periods that required collaboration between engineering and marketing during such a shift, we show how cross-occupational collaboration under these conditions can be facilitated by a radical flank threat, through which the bargaining power of moderates is strengthened by the presence of a more-radical group. In the face of a strong threat by radical members of a challenger occupational group, moderate members of the dominant engineering group may change their perceptions of their power to resist challengers’ demands and begin to distinguish between the goals of radical versus more-moderate challengers. To maintain as much power as possible and prevent the more-dramatic change in engineering occupational goals demanded by radical challengers, moderate engineers may build a coalition with moderate challengers and collaborate for incremental technology development. PMID:28424533
Truelove, Emily; Kellogg, Katherine C
2016-12-01
This 12-month ethnographic study of an early entrant into the U.S. car-sharing industry demonstrates that when an organization shifts its focus from developing radical new technology to incrementally improving this technology, the shift may spark an internal power struggle between the dominant engineering group and a challenger occupational group such as the marketing group. Analyzing 42 projects in two time periods that required collaboration between engineering and marketing during such a shift, we show how cross-occupational collaboration under these conditions can be facilitated by a radical flank threat, through which the bargaining power of moderates is strengthened by the presence of a more-radical group. In the face of a strong threat by radical members of a challenger occupational group, moderate members of the dominant engineering group may change their perceptions of their power to resist challengers' demands and begin to distinguish between the goals of radical versus more-moderate challengers. To maintain as much power as possible and prevent the more-dramatic change in engineering occupational goals demanded by radical challengers, moderate engineers may build a coalition with moderate challengers and collaborate for incremental technology development.
Rye, Robert O.; Breit, George N.; Zimbelman, David R.
2003-01-01
About 5600 years ago part of Mount Rainier?s edifice collapsed with the resultant Osceola Mudflow traveling more than 120 km and covering an area of at least 505 km2. Mineralogic and stable isotope studies were conducted on altered rocks from outcrops near the summit and east flank of the volcano and samples of clasts and matrix from the Osceola Mudflow. Results of these analyses are used to constrain processes responsible for pre-collapse alteration and provide insight into the role of alteration in edifice instability prior to the Osceola collapse event. Jarosite, pyrite, alunite, and kaolinite occur in hydrothermally altered rock exposed in summit scarps formed by edifice collapse events and in altered rock within the east-west structural zone (EWSZ) of the volcano?s east flank. Deposits of the Osceola Mudflow contain clasts of variably altered and unaltered andesite within a clay-rich matrix. Minerals detected in samples from the edifice are also present in many of the clasts. The matrix includes abundant smectite, kaolinite and variably abundant jarosite. Hydrothermal fluid compositions calculated from hydrogen and oxygen isotope data of alunite, and smectite on Mount Rainier reflect mixing of magmatic and meteoric waters. The range in the dD values of modern meteoric water on the volcano (-85 to 155?) reflect the influence of elevation on the dD of precipitation. The d34S and d18OSO4 values of alunite, gypsum and jarosite are distinct but together range from 1.7 to 17.6? and -12.3 to 15.0?, respectively; both parameters increase from jarosite to gypsum to alunite. The variations in sulfur isotope composition are attributed to the varying contributions of disproportionation of magmatic SO2, the supergene oxidation of hydrothermal pyrite and possible oxidation of H2S to the parent aqueous sulfate. The 18OSO4 values of jarosite are the lowest recorded for the mineral, consistent with a supergene origin. The mineralogy and isotope composition of alteration
Marceau, Kristine; Horwitz, Briana N.; Narusyte, Jurgita; Ganiban, Jody M.; Spotts, Erica L.; Reiss, David; Neiderhiser, Jenae M.
2013-01-01
Studies of adolescent or parent-based twins suggest that gene-environment correlation (rGE) is an important mechanism underlying parent-adolescent relationships. However, information on how parents' and children's genes and environments influence correlated parent "and" child behaviors is needed to distinguish types of rGE. The present…
Spielmann, A; Stutz, E
1983-10-25
The soybean chloroplast psb A gene (photosystem II thylakoid membrane protein of Mr 32 000, lysine-free) and the trn H gene (tRNAHisGUG), which both map in the large single copy region adjacent to one of the inverted repeat structures (IR1), have been sequenced including flanking regions. The psb A gene shows in its structural part 92% sequence homology with the corresponding genes of spinach and N. debneyi and contains also an open reading frame for 353 aminoacids. The aminoacid sequence of a potential primary translation product (calculated Mr, 38 904, no lysine) diverges from that of spinach and N. debneyi in only two positions in the C-terminal part. The trn H gene has the same polarity as the psb A gene and the coding region is located at the very end of the large single copy region. The deduced sequence of the soybean chloroplast tRNAHisGUG is identical with that of Zea mays chloroplasts. Both ends of the large single copy region were sequenced including a small segment of the adjacent IR1 and IR2.
Os11Gsk gene from a wild rice, Oryza rufipogon improves yield in rice.
Thalapati, Sudhakar; Batchu, Anil K; Neelamraju, Sarla; Ramanan, Rajeshwari
2012-06-01
Chromosomal segments from wild rice species Oryza rufipogon, introgressed into an elite indica rice restorer line (KMR3) using molecular markers, resulted in significant increase in yield. Here we report the transcriptome analysis of flag leaves and fully emerged young panicles of one of the high yielding introgression lines IL50-7 in comparison to KMR3. A 66-fold upregulated gene Os11Gsk, which showed no transcript in KMR3 was highly expressed in O. rufipogon and IL50-7. A 5-kb genomic region including Os11Gsk and its flanking regions could be PCR amplified only from IL50-7, O. rufipogon, japonica varieties of rice-Nipponbare and Kitaake but not from the indica varieties, KMR3 and Taichung Native-1. Three sister lines of IL50-7 yielding higher than KMR3 showed presence of Os11Gsk, whereas the gene was absent in three other ILs from the same cross having lower yield than KMR3, indicating an association of the presence of Os11Gsk with high yield. Southern analysis showed additional bands in the genomic DNA of O. rufipogon and IL50-7 with Os11Gsk probe. Genomic sequence analysis of ten highly co-expressed differentially regulated genes revealed that two upregulated genes in IL50-7 were derived from O. rufipogon and most of the downregulated genes were either from KMR3 or common to KMR3, IL50-7, and O. rufipogon. Thus, we show that Os11Gsk is a wild rice-derived gene introduced in KMR3 background and increases yield either by regulating expression of functional genes sharing homology with it or by causing epigenetic modifications in the introgression line.
International Nuclear Information System (INIS)
Du Zeji; Kong Xianrong
1999-01-01
Deinococcus radiodurans (Dr) possesses a prominent ability to repair the DNA injury induced by various DNA- damaging agents including mitomycin C(MC), ultraviolet light (UV) and ionizing radiation. DNA damage resistance was restored in MC sensitive (MC s ) mutants 2621 and 3021 by transforming with DNAs of four cosmids clones derived from the gene library of strain KD8301 which showed the property of wild type phenotype to DNA-damaging agents. Gene affected by mutation (mtcA or mtcB) in both mutants was cloned and its nucleotide sequence was determined. The deduced amino acid (aa) sequence of Dr uvrA gene product consists of 1016 aa and shares homology with many bacterial UvrA proteins. The mutation sites in both mutants were identified by analyzing the polymerase chain reaction (PCR) fragments derived from the genomic DNA of the mutants. A 144-base pairs (bp) deletion including the start codon for the uvr A gene was observed in DNA of the mutant 3021, causing a defect in the gene. On the other hand, an insertion sequence (IS) element intervened in the uvrA gene of the mutant 2621, suggesting the insertional inactivation of the gene. The IS element comprise 1322-bp long, flanked by 19-bp inverted terminal repeats (ITR), and generated a 6-bp target duplication (TD). Two open reading frames (ORF) were found in the IS element. The deduced aa sequences of large and small ORF show homology to a putative transposes found in IS4 of Escherichia coli (E. coli) and to a resolvent found in IS Xc5 of Xanthomonas campestris (Xc), respectively. This is the first discovery of IS element in deino-bacteria, and the IS element was designated IS2621
Olabode, Solomon Ojo
2014-01-01
Soft sediment deformation structures were recognized in the Maastrichtian shallow marine wave to tide influenced regressive sediments of Ajali Formation in the western flank of Anambra basin, southern Nigerian. The soft sediment deformation structures were in association with cross bedded sands, clay and silt and show different morphological types. Two main types recognised are plastic deformations represented by different types of recumbent folds and injection structure represented by clastic dykes. Other structures in association with the plastic deformation structures include distorted convolute lamination, subsidence lobes, pillars, cusps and sand balls. These structures are interpreted to have been formed by liquefaction and fluidization mechanisms. The driving forces inferred include gravitational instabilities and hydraulic processes. Facies analysis, detailed morphologic study of the soft sediment deformation structures and previous tectonic history of the basin indicate that the main trigger agent for deformation is earthquake shock. The soft sediment deformation structures recognised in the western part of Anambra basin provide a continuous record of the tectonic processes that acted on the regressive Ajali Formation during the Maastrichtian.
Matsumoto, M; Imagawa, M; Aoki, Y
1999-01-01
3,3',4,4',5-Pentachlorobiphenyl (PenCB), one of the most toxic co-planar polychlorinated biphenyl congeners, specifically induces class Pi glutathione S-transferase (GSTP1) as well as cytochrome P-450 1A1 in primary cultured rat liver parenchymal cells [Aoki, Matsumoto and Suzuki (1993) FEBS Lett. 333, 114-118]. However, the 5'-flanking sequence of the GSTP1 gene does not contain a xenobiotic responsive element, to which arylhydrocarbon receptor binds. Using a chloramphenicol acetyltransferase assay we demonstrate here that the enhancer termed GSTP1 enhancer I (GPEI) is necessary for the stimulation by PenCB of GSTP1 gene expression in primary cultured rat liver parenchymal cells. GPEI is already known to contain a dyad of PMA responsive element-like elements oriented palindromically. It is suggested that a novel signal transduction pathway activated by PenCB contributes to the stimulation of GSTP1 expression. PMID:10051428
Molecular evolution of the rice blast resistance gene Pi-ta in invasive weedy rice in the USA.
Directory of Open Access Journals (Sweden)
Seonghee Lee
Full Text Available The Pi-ta gene in rice has been effectively used to control rice blast disease caused by Magnaporthe oryzae worldwide. Despite a number of studies that reported the Pi-ta gene in domesticated rice and wild species, little is known about how the Pi-ta gene has evolved in US weedy rice, a major weed of rice. To investigate the genome organization of the Pi-ta gene in weedy rice and its relationship to gene flow between cultivated and weedy rice in the US, we analyzed nucleotide sequence variation at the Pi-ta gene and its surrounding 2 Mb region in 156 weedy, domesticated and wild rice relatives. We found that the region at and around the Pi-ta gene shows very low genetic diversity in US weedy rice. The patterns of molecular diversity in weeds are more similar to cultivated rice (indica and aus, which have never been cultivated in the US, rather than the wild rice species, Oryza rufipogon. In addition, the resistant Pi-ta allele (Pi-ta found in the majority of US weedy rice belongs to the weedy group strawhull awnless (SH, suggesting a single source of origin for Pi-ta. Weeds with Pi-ta were resistant to two M. oryzae races, IC17 and IB49, except for three accessions, suggesting that component(s required for the Pi-ta mediated resistance may be missing in these accessions. Signatures of flanking sequences of the Pi-ta gene and SSR markers on chromosome 12 suggest that the susceptible pi-ta allele (pi-ta, not Pi-ta, has been introgressed from cultivated to weedy rice by out-crossing.
Molecular Evolution of the Rice Blast Resistance Gene Pi-ta in Invasive Weedy Rice in the USA
Lee, Seonghee; Jia, Yulin; Jia, Melissa; Gealy, David R.; Olsen, Kenneth M.; Caicedo, Ana L.
2011-01-01
The Pi-ta gene in rice has been effectively used to control rice blast disease caused by Magnaporthe oryzae worldwide. Despite a number of studies that reported the Pi-ta gene in domesticated rice and wild species, little is known about how the Pi-ta gene has evolved in US weedy rice, a major weed of rice. To investigate the genome organization of the Pi-ta gene in weedy rice and its relationship to gene flow between cultivated and weedy rice in the US, we analyzed nucleotide sequence variation at the Pi-ta gene and its surrounding 2 Mb region in 156 weedy, domesticated and wild rice relatives. We found that the region at and around the Pi-ta gene shows very low genetic diversity in US weedy rice. The patterns of molecular diversity in weeds are more similar to cultivated rice (indica and aus), which have never been cultivated in the US, rather than the wild rice species, Oryza rufipogon. In addition, the resistant Pi-ta allele (Pi-ta) found in the majority of US weedy rice belongs to the weedy group strawhull awnless (SH), suggesting a single source of origin for Pi-ta. Weeds with Pi-ta were resistant to two M. oryzae races, IC17 and IB49, except for three accessions, suggesting that component(s) required for the Pi-ta mediated resistance may be missing in these accessions. Signatures of flanking sequences of the Pi-ta gene and SSR markers on chromosome 12 suggest that the susceptible pi-ta allele (pi-ta), not Pi-ta, has been introgressed from cultivated to weedy rice by out-crossing. PMID:22043312
Pyeon, Hye-Rim; Nah, Hee-Ju; Kang, Seung-Hoon; Choi, Si-Sun; Kim, Eung-Soo
2017-05-31
Heterologous expression of biosynthetic gene clusters of natural microbial products has become an essential strategy for titer improvement and pathway engineering of various potentially-valuable natural products. A Streptomyces artificial chromosomal conjugation vector, pSBAC, was previously successfully applied for precise cloning and tandem integration of a large polyketide tautomycetin (TMC) biosynthetic gene cluster (Nah et al. in Microb Cell Fact 14(1):1, 2015), implying that this strategy could be employed to develop a custom overexpression scheme of natural product pathway clusters present in actinomycetes. To validate the pSBAC system as a generally-applicable heterologous overexpression system for a large-sized polyketide biosynthetic gene cluster in Streptomyces, another model polyketide compound, the pikromycin biosynthetic gene cluster, was preciously cloned and heterologously expressed using the pSBAC system. A unique HindIII restriction site was precisely inserted at one of the border regions of the pikromycin biosynthetic gene cluster within the chromosome of Streptomyces venezuelae, followed by site-specific recombination of pSBAC into the flanking region of the pikromycin gene cluster. Unlike the previous cloning process, one HindIII site integration step was skipped through pSBAC modification. pPik001, a pSBAC containing the pikromycin biosynthetic gene cluster, was directly introduced into two heterologous hosts, Streptomyces lividans and Streptomyces coelicolor, resulting in the production of 10-deoxymethynolide, a major pikromycin derivative. When two entire pikromycin biosynthetic gene clusters were tandemly introduced into the S. lividans chromosome, overproduction of 10-deoxymethynolide and the presence of pikromycin, which was previously not detected, were both confirmed. Moreover, comparative qRT-PCR results confirmed that the transcription of pikromycin biosynthetic genes was significantly upregulated in S. lividans containing tandem
Screening for common copy-number variants in cancer genes.
Tyson, Jess; Majerus, Tamsin M O; Walker, Susan; Armour, John A L
2010-12-01
For most cases of colorectal cancer that arise without a family history of the disease, it is proposed that an appreciable heritable component of predisposition is the result of contributions from many loci. Although progress has been made in identifying single nucleotide variants associated with colorectal cancer risk, the involvement of low-penetrance copy number variants is relatively unexplored. We have used multiplex amplifiable probe hybridization (MAPH) in a fourfold multiplex (QuadMAPH), positioned at an average resolution of one probe per 2 kb, to screen a total of 1.56 Mb of genomic DNA for copy number variants around the genes APC, AXIN1, BRCA1, BRCA2, CTNNB1, HRAS, MLH1, MSH2, and TP53. Two deletion events were detected, one upstream of MLH1 in a control individual and the other in APC in a colorectal cancer patient, but these do not seem to correspond to copy number polymorphisms with measurably high population frequencies. In summary, by means of our QuadMAPH assay, copy number measurement data were of sufficient resolution and accuracy to detect any copy number variants with high probability. However, this study has demonstrated a very low incidence of deletion and duplication variants within intronic and flanking regions of these nine genes, in both control individuals and colorectal cancer patients. Copyright © 2010 Elsevier Inc. All rights reserved.
Zhao, X H; Wang, J Y; Zhang, G X; Wei, Y; Gu, Y P; Yu, Y B
2012-04-01
In our research, signal transducer and activator of transcription 5b (STAT5b) gene was studied as candidate gene associated with body weight and reproductive traits of Jinghai Yellow chicken. Single nucleotide polymorphisms (SNPs) of STAT5b gene were examined in both Jinghai Yellow chicken and three reference chicken populations including the Bian, Youxi and Arbor Acre chickens. Two SNPs (C-1591T and G-250A) were detected in the 5' flanking region of STAT5b gene. Association indicated that the C-1591T mutation is significantly associated with age at fist egg, The G-250A mutation is significantly related with hatch weight and body weight at 300 days. Additionally four STAT5b haplotypes (H1, CG; H2, TG; H3, AC and H4, TA) and their frequency distributions were estimated using the phase program. Diplotype H3H4 is dominant for 8, 16 week-age-weight and body weight at first egg. Thus STAT5b gene may be served as a potential genetic marker for growth and reproduction traits evaluation of the Jinghai Yellow chicken. This study will provide valuable information for the protection and breeding of Jinghai Yellow chicken.
Gene expression profiling of flax (Linum usitatissimum L.) under edaphic stress.
Dmitriev, Alexey A; Kudryavtseva, Anna V; Krasnov, George S; Koroban, Nadezhda V; Speranskaya, Anna S; Krinitsina, Anastasia A; Belenikin, Maxim S; Snezhkina, Anastasiya V; Sadritdinova, Asiya F; Kishlyan, Natalya V; Rozhmina, Tatiana A; Yurkevich, Olga Yu; Muravenko, Olga V; Bolsheva, Nadezhda L; Melnikova, Nataliya V
2016-11-16
derived from LIS-1, in our transcriptome sequencing data. Expression of LIS-1 flanking genes, ING1 and KRP2, was suggested not to be nutrient stress-induced. Obtained results provide new insights into edaphic stress response in flax and the role of LIS-1 in these process.
Gene expression profiling of flax (Linum usitatissimum L. under edaphic stress
Directory of Open Access Journals (Sweden)
Alexey A. Dmitriev
2016-11-01
. Besides, we have not identified any mRNA, which could be derived from LIS-1, in our transcriptome sequencing data. Expression of LIS-1 flanking genes, ING1 and KRP2, was suggested not to be nutrient stress-induced. Obtained results provide new insights into edaphic stress response in flax and the role of LIS-1 in these process.
Rozanski, Wojciech; Lavallee, Yan; Kendrick, Jackie; Castagna, Angela; Mitchell, Thomas; Heap, Michael; Vinciguerra, Sergio; Hirose, Takehiro; Dingwell, Donald
2015-04-01
The edifice of Mount Etna (Italy) is structurally unstable, exhibiting a near continuous ESE seaward sliding along a set of faults due to interplay between regional tectonics, gravity instability and magma intrusion. Continuous seismic and ground deformation monitoring reveals the resulting large-scale flank motion at variable rates. The mechanisms controlling this faulting kinetic remains, however, poorly constrained. Examination of the fault zones reveals a range of rock types along the different fault segments: fresh and altered basalt, clay and limestone. As lithological contrasts can jeopardise the structural stability of an edifice, we experimentally investigate the frictional properties of these rocks using low- to high-velocity-rotary shear tests on similar and dissimilar rocks to better understand episodes of slow flank motion as well as rapid and catastrophic sector collapse events. The first set of experiments was performed at velocities up to 1.2 m/s and at normal stresses of 1.5 MPa, commensurate with depths of the contacts seen in the Etna edifice. Friction experiments on clay gouge shows the strong rate-weakening dependence of slip in this material as well as the release of carbon dioxide. Friction experiments on solid rocks show a wider range of mechanical behaviour. At high velocity (>0.6 m/s) volcanic rocks tend to melt whereas the clay and limestone do not; rather they decarbonate, which prevents the rock from achieving the temperature required for melting. Experiments on dissimilar rocks clearly show that composition of host rocks affects the composition and viscosity of the resultant frictional melt, which can have a dramatic effect on shear stress leading to fault weakening or strengthening depending on the combination of host rock samples. A series of low- to moderate-slip velocity experiments is now being conducted to complement our dataset and provide a more complete rock friction model applicable to Mount Etna.
Directory of Open Access Journals (Sweden)
Watanabe Haruo
2005-10-01
Full Text Available Abstract Background It has been speculated that the γ-glutamyl transpeptidase (ggt gene is present only in Neisseria meningitidis and not among related species such as Neisseria gonorrhoeae and Neisseria lactamica, because N. meningitidis is the only bacterium with GGT activity. However, nucleotide sequences highly homologous to the meningococcal ggt gene were found in the genomes of N. gonorrhoeae isolates. Results The gonococcal homologue (ggt gonococcal homologue; ggh was analyzed. The nucleotide sequence of the ggh gene was approximately 95 % identical to that of the meningococcal ggt gene. An open reading frame in the ggh gene was disrupted by an ochre mutation and frameshift mutations induced by a 7-base deletion, but the amino acid sequences deduced from the artificially corrected ggh nucleotide sequences were approximately 97 % identical to that of the meningococcal ggt gene. The analyses of the sequences flanking the ggt and ggh genes revealed that both genes were localized in a common DNA region containing the fbp-ggt (or ggh-glyA-opcA-dedA-abcZ gene cluster. The expression of the ggh RNA could be detected by dot blot, RT-PCR and primer extension analyses. Moreover, the truncated form of ggh-translational product was also found in some of the gonococcal isolates. Conclusion This study has shown that the gonococcal ggh gene is a pseudogene of the meningococcal ggt gene, which can also be designated as Ψggt. The gonococcal ggh (Ψggt gene is the first identified bacterial pseudogene that is transcriptionally active but phenotypically silent.
Childhood problem behavior and parental divorce: evidence for gene-environment interaction
S.C.C. Robbers (Sylvana); F.V.A. van Oort (Floor); A.C. Huizink (Anja); F.C. Verhulst (Frank); C.E.M. van Beijsterveldt (Toos); D.I. Boomsma (Dorret); M. Bartels (Meike)
2012-01-01
textabstractObjective: The importance of genetic and environmental influences on children's behavioral and emotional problems may vary as a function of environmental exposure. We previously reported that 12-year-olds with divorced parents showed more internalizing and externalizing problems than
Cloning arbuscule-related genes from mycorrhizas
DEFF Research Database (Denmark)
Burleigh, Stephen
2000-01-01
Until recently little was known about the identity of the genes expressed in the arbuscules of mycorrhizas, due in part to problems associated with cloning genes from the tissues of an obligate symbiont. However, the combination of advanced molecular techniques, innovative use of the materials...... available and fortuitous cloning has resulted in the recent identification of a number of arbuscule-related genes. This article provides a brief summary of the genes involved in arbuscule development, function and regulation, and the techniques used to study them. Molecular techniques include differential...
Wu, Shaogui
2017-06-01
Two magnesium ions play important roles in nucleotide addition cycle (NAC) of gene transcription. However, at the end of each NAC, why does one ion stay in the active site while the other ion leaves with product pyrophosphate (PP i )? This problem still remains obscure. In this work, we studied the problem using all-atom molecular dynamics simulation combined with steered molecular dynamics and umbrella sampling simulation methods. Our simulations reveal that although both ions are located in the active site after chemistry, their detailed positions are not symmetrical, leading to their different forces from surrounding groups. One ion makes weaker contacts with PP i than the whole protein. Hence, PP i release is less likely to take it away. The other one forms tighter contacts with PP i relative to the protein. The formed (Mg 2+ -PP i ) 2- complex is found to break the contacts with surrounding protein residues one by one so as to dissociate from the active site. This effectively avoids the coexistence of two ions in the active site after PP i release and guarantees a reasonable Mg 2+ ion number in the active site for the next NAC. The observations from this work can provide valuable information for comprehensively understanding the molecular mechanism of transcription. Proteins 2017; 85:1002-1007. © 2017 Wiley Periodicals, Inc. © 2017 Wiley Periodicals, Inc.
Deletion and aberrant CpG island methylation of Caspase 8 gene in medulloblastoma.
Gonzalez-Gomez, Pilar; Bello, M Josefa; Inda, M Mar; Alonso, M Eva; Arjona, Dolores; Amiñoso, Cinthia; Lopez-Marin, Isabel; de Campos, Jose M; Sarasa, Jose L; Castresana, Javier S; Rey, Juan A
2004-09-01
Aberrant methylation of promoter CpG islands in human genes is an alternative genetic inactivation mechanism that contributes to the development of human tumors. Nevertheless, few studies have analyzed methylation in medulloblastomas. We determined the frequency of aberrant CpG island methylation for Caspase 8 (CASP8) in a group of 24 medulloblastomas arising in 8 adult and 16 pediatric patients. Complete methylation of CASP8 was found in 15 tumors (62%) and one case displayed hemimethylation. Three samples amplified neither of the two primer sets for methylated or unmethylated alleles, suggesting that genomic deletion occurred in the 5' flanking region of CASP8. Our findings suggest that methylation commonly contributes to CASP8 silencing in medulloblastomas and that homozygous deletion or severe sequence changes involving the promoter region may be another mechanism leading to CASP8 inactivation in this neoplasm.
Identification and characterization of variants in the 5' flanking region ...
African Journals Online (AJOL)
enoh
2012-04-05
Apr 5, 2012 ... productivity, reduction in costs, enrichment of milk compositions and extension of ... from six bovine species, 18 samples of Leiqiong cattle (Bos indicus) ..... growth hormone receptor genes with blood serum insulin-like growth.
Directory of Open Access Journals (Sweden)
Harpinder S Randhawa
Full Text Available A marker-assisted background selection (MABS-based gene introgression approach in wheat (Triticum aestivum L. was optimized, where 97% or more of a recurrent parent genome (RPG can be recovered in just two backcross (BC generations. A four-step MABS method was developed based on 'Plabsim' computer simulations and wheat genome structure information. During empirical optimization of this method, double recombinants around the target gene were selected in a step-wise fashion during the two BC cycles followed by selection for recurrent parent genotype on non-carrier chromosomes. The average spacing between carrier chromosome markers was <4 cM. For non-carrier chromosome markers that flanked each of the 48 wheat gene-rich regions, this distance was approximately 12 cM. Employed to introgress seedling stripe rust (Puccinia striiformis f. sp. tritici resistance gene Yr15 into the spring wheat cultivar 'Zak', marker analysis of 2,187 backcross-derived progeny resulted in the recovery of a BC(2F(2ratio3 plant with 97% of the recurrent parent genome. In contrast, only 82% of the recurrent parent genome was recovered in phenotypically selected BC(4F(7 plants developed without MABS. Field evaluation results from 17 locations indicated that the MABS-derived line was either equal or superior to the recurrent parent for the tested agronomic characteristics. Based on these results, MABS is recommended as a strategy for rapidly introgressing a targeted gene into a wheat genotype in just two backcross generations while recovering 97% or more of the recurrent parent genotype.
Directory of Open Access Journals (Sweden)
Panca J. Santoso
2013-07-01
Full Text Available Twenty seven species of Durio have been identified in Sabah and Sarawak, Malaysia, but their relationships have not been studied. This study was conducted to analyse phylogenetic relationships amongst 10 Durio species in Malaysia using PCR-RFLP on two chloroplast DNA genes, i.e. ndhC-trnV and rbcL. DNAs were extracted from young leaves of 11 accessions from 10 Durio species collected from the Tenom Agriculture Research Station, Sabah, and University Agriculture Park, Universiti Putra Malaysia. Two pairs of oligonucleotide primers, N1-N2 and rbcL1-rbcL2, were used to flank the target regions ndhC-trnV and rbcL. Eight restriction enzymes, HindIII, BsuRI, PstI, TaqI, MspI, SmaI, BshNI, and EcoR130I, were used to digest the amplicons. Based on the results of PCR-RFLP on ndhC-trnV gene, the 10 Durio species were grouped into five distinct clusters, and the accessions generally showed high variations. However, based on the results of PCR-RFLP on the rbcL gene, the species were grouped into three distinct clusters, and generally showed low variations. This means that ndhC-trnV gene is more reliable for phylogenetic analysis in lower taxonomic level of Durio species or for diversity analysis, while rbcL gene is reliable marker for phylogenetic analysis at higher taxonomic level. PCR-RFLP on the ndhC-trnV and rbcL genes could therefore be considered as useful markers to phylogenetic analysis amongst Durio species. These finding might be used for further molecular marker assisted in Durio breeding program.
Construction of an Unmarked Zymomonas mobilis Mutant Using a Site-Specific FLP Recombinase
Directory of Open Access Journals (Sweden)
Shao-Lan Zou
2012-01-01
Full Text Available Flippase expression was carried out in Zymomonas mobilis strain ZM4. The FRT-flanked selection marker gene was first integrated into the ZM4 chromosome by homologous recombination. The Saccharomyces cerevisiae flp gene was then introduced under the control of the ZM4 gap gene promoter (Pgap, encoding glyceraldehyde-3-phosphate dehydrogenase or the λ bacteriophage cI857-pR contained in the broad-host-range cloning vector pBBR1-MCS-2. This study demonstrated that flp was expressed and that the deletion frequency of the FRT-flanked marker gene was very high (approx. 100 %. In addition, the flp gene expression vector could be conveniently removed from the resulting unmarked Z. mobilis mutants by serially transferring the cells three times into antibiotic-free medium, thereby establishing an efficient method for constructing unmarked Z. mobilis mutants.
V. F. Gening and problems of the Volga Bulgaria archaeology
Directory of Open Access Journals (Sweden)
Rudenko Konstantin A.
2014-03-01
Full Text Available V.F. Gening’s contribution to the study of the Volga Bulgaria and his views concerning the history and archaeology of this state formation are considered in the article. His sphere of interest first of all included the links between the Volga Bulgaria population and the tribes belonging to preceding cultures, such as Pyanoborye and Imenkovo ones. V.F. Gening investigated the Bolshie Tarkhany, Turaevo and Rozdestveno burial grounds dated by the 8-9th, 5th and 6-7th centuries A.D., and the materials collected modified the notion of the time and character of the Bulgars arrival in the Volga area. He reconsidered the chronology and interpretation of the archaeological monuments, which referred to the epoch preceding the Bulgars appearance on the Volga, and proposed a hypothesis of the Volga Bulgars as a Turkic-Ugrian ethnos. V.F. Gening created a periodization of the Bolgars history in Eastern Europe within the time span between 1st-3rd centuries AD and the early 13th century AD
Energy Technology Data Exchange (ETDEWEB)
Lee, Yong Jin; Lee, You La; Ahn, Sohn Joo; Choi, Chang Ik; Lee, Sang Woo; Ahn, Byeong Cheol; Lee, Jae Tae [School of Medicine, Kyungpook National University, Daegu (Korea, Republic of)
2007-07-01
To develop a non-invasive combined imaging method of gamma camera and optical imaging to assess rat myoblast cell line, H9c2, we constructed retrovirus containing hNIS and EGFP gene, and transfected to rat myoblast cell and monitored hNIS and EGFP expression. Rat myoblast cell line, H9C2, was transfected with hNIS and EGFP gene using retrovirus (H9C2-NG). The expression of hNIS and EGFP gene was determined by RT-PCR and fluorescence microscopy, respectively. The uptake and efflux of I-125 were measured in the transfected and wild type cell lines. Each cell line was injected to 4 flank sites (H9c2: 1X107 or 2X107, H9C2-NG: 1X107 or 2X107) in nude mouse. Scintigraphic image was performed at 3h, 1 day after H9C2 and H9C2-NG cell inoculation. We performed gamma camera and animal PET imaging to evaluate NIS expression. Also, GFP image obtained using optical imaging system. The expression of hNIS and EGFP gene was confirmed by RT-PCR. In iodide uptake, H9C2-NG cells accumulated 274.52.2 pmol/ mg protein at 30 min. But wild type cell line did not uptake iodide. In fluorescent microscopy, H9C2-NG cells were highly fluorescent than that of H9C2 cells. In iodide efflux study, 50% of radioactivity flowed out during the first 10min. Scintigraphy showed increased uptake of Tc-99m in H9c2-NG than in H9C2 for 1 day. Also, H9C2-NG cells showed high signal-to-background fluorescent spots in animal body. In this study, NIS and EGFP reporter gene were successfully transfected by a retrovirus in myoblast cell line, and the transfected cell can be easily visualized in vivo. These results suggest that NIS and EGFP gene has an excellent feasibility as a reporter gene, and it can be used to monitor cell trafficking for monitoring.