WorldWideScience

Sample records for fitting aga asexual

  1. The role of anthropometric, growth and maturity index (AGaMI) influencing youth soccer relative performance

    Science.gov (United States)

    Bisyri Husin Musawi Maliki, Ahmad; Razali Abdullah, Mohamad; Juahir, Hafizan; Muhamad, Wan Siti Amalina Wan; Afiqah Mohamad Nasir, Nur; Muazu Musa, Rabiu; Musliha Mat-Rasid, Siti; Adnan, Aleesha; Azura Kosni, Norlaila; Abdullah, Farhana; Ain Shahirah Abdullah, Nurul

    2018-04-01

    The main purpose of this study was to develop Anthropometric, Growth and Maturity Index (AGaMI) in soccer and explore its differences to soccer player physical attributes, fitness, motivation and skills. A total 223 adolescent soccer athletes aged 12 to 18 years old were selected as respondent. AGaMI was develop based on anthropometric components (bicep, tricep, subscapular, suprailiac, calf circumference and muac) with growth and maturity component using tanner scale. Meanwhile, relative performance namely physical, fitness, motivation and skills attributes of soccer were measured as dependent variables. The Principal Component Analysis (PCA) and Analysis of Variance (ANOVA) are used to achieve the objective in this study. AGaMI had categorized players into three different groups namely; high (5 players), moderate (88 players) and low (91 players). PCA revealed a moderate to very strong dominant range of 0.69 to 0.90 of factor loading on AGaMI. Further analysis assigned AGaMI groups as treated as independent variables (IV) and physical, fitness, motivation and skills attributes were treated as dependent variables (DV). Finally, ANOVA showed that flexibility, leg power, age, weight, height, sitting height, short and long pass are the most significant parameters statistically differentiate by the groups of AGaMI (p<0.05). As a summary, body fat mass, growth and maturity are an essential component differentiating the output of the soccer players relative performance. In future, information of the AGaMI model are useful to the coach and players for identifying the suitable biological and physiological demand reflects more comprehensive means of youth soccer relative performance. This study further highlights the importance of assessing AGaMI when identifying soccer relative performance.

  2. N-acetylgalatosamine-mediated regulation of the aga operon by AgaR in Streptococcus pneumoniae

    Directory of Open Access Journals (Sweden)

    Muhammad Afzal

    2016-09-01

    Full Text Available Here, we analyze the transcriptomic response of Streptococcus pneumoniae D39 to N-acetylgalactosamine (NAGa. Transcriptome comparison of S. pneumoniae D39 grown NAGaM17 (0.5% NAGa + M17 to that grown in GM17 (0.5% Glucose + M17 revealed the elevated expression of various carbon metabolic genes/operons, including a PTS operon (denoted here as the aga operon, which is putatively involved in NAGa transport and utilization, in the presence of NAGa. We further studied the role of a GntR-family transcriptional regulator (denoted here as AgaR in the regulation of aga operon. Our transcriptome and RT-PCR data suggest the role of AgaR as a transcriptional repressor of the aga operon. We predicted a 20-bp operator site of AagR (5’- ATAATTAATATAACAACAAA -3’ in the promoter region of the aga operon (PbgaC, which was further verified by mutating the AgaR operator site in the respective promoter. The role of CcpA in the additional regulation of the aga operon was elucidated by further transcriptome analyses and confirmed by quantitative RT-PCR.

  3. Public goods dilemma in asexual ant societies

    OpenAIRE

    Dobata, Shigeto; Tsuji, Kazuki

    2013-01-01

    This study reports experimental evidence for the “public goods dilemma” between cooperators and cheaters in an asexual ant society, in which cheating is always more rewarding for individuals but cooperation at the cost of individual fitness leads to better performance of groups. Although this dilemma provides the basic principle of social evolution, its experimental demonstration with underlying genetics and fitness evaluation for both cooperators and cheaters still lacks in societies other t...

  4. Does the silver moss Bryum argenteum exhibit sex-specific patterns in vegetative growth rate, asexual fitness or prezygotic reproductive investment?

    Science.gov (United States)

    Horsley, Kimberly; Stark, Lloyd R; McLetchie, D Nicholas

    2011-05-01

    Expected life history trade-offs associated with sex differences in reproductive investment are often undetected in seed plants, with the difficulty arising from logistical issues of conducting controlled experiments. By controlling genotype, age and resource status of individuals, a bryophyte was assessed for sex-specific and location-specific patterns of vegetative, asexual and sexual growth/reproduction across a regional scale. Twelve genotypes (six male, six female) of the dioecious bryophyte Bryum argenteum were subcultured to remove environmental effects, regenerated asexually to replicate each genotype 16 times, and grown over a period of 92 d. Plants were assessed for growth rates, asexual and sexual reproductive traits, and allocation to above- and below-ground regenerative biomass. The degree of sexual versus asexual reproductive investment appears to be under genetic control, with three distinct ecotypes found in this study. Protonemal growth rate was positively correlated with asexual reproduction and sexual reproduction, whereas asexual reproduction was negatively correlated (appeared to trade-off) with vegetative growth (shoot production). No sex-specific trade-offs were detected. Female sex-expressing shoots were longer than males, but the sexes did not differ in growth traits, asexual traits, sexual induction times, or above- and below-ground biomass. Males, however, had much higher rates of inflorescence production than females, which translated into a significantly higher (24x) prezygotic investment for males relative to females. Evidence for three distinct ecotypes is presented for a bryophyte based on regeneration traits. Prior to zygote production, the sexes of this bryophyte did not differ in vegetative growth traits but significantly differed in reproductive investment, with the latter differences potentially implicated in the strongly biased female sex ratio. The disparity between males and females for prezygotic reproductive investment is

  5. Epigenetic variation in asexually reproducing organisms

    NARCIS (Netherlands)

    Verhoeven, K.J.F.; Preite, V.

    2014-01-01

    The role that epigenetic inheritance can play in adaptation may differ between sexuals and asexuals because (1) the dynamics of adaptation differ under sexual and asexual reproduction and the opportunities offered by epigenetic inheritance may affect these dynamics differently; and (2) in asexual

  6. Coming to an Asexual Identity: Negotiating Identity, Negotiating Desire.

    Science.gov (United States)

    Scherrer, Kristin S

    2008-10-01

    Sexuality is generally considered an important aspect of self-hood. Therefore, individuals who do not experience sexual attraction, and embrace an asexual identity are in a unique position to inform the social construction of sexuality. This study explores the experiences of asexual individuals utilizing open ended Internet survey data from 102 self-identified asexual people. In this paper I describe several distinct aspects of asexual identities: the meanings of sexual, and therefore, asexual behaviors, essentialist characterizations of asexuality, and lastly, interest in romance as a distinct dimension of sexuality. These findings have implications not only for asexual identities, but also for the connections of asexuality with other marginalized sexualities.

  7. (AGA) Pre Term Babies

    African Journals Online (AJOL)

    Haematological Indices in Healthy Appropriate For-Gestational-Age (AGA) Pre Term Babies. ... International Journal of Medicine and Health Development. Journal Home ... Patient and Methods: All consecutive healthy pre-term new born babies delivered at UNTH and admitted into the hospital NBSCU were included.

  8. Asexuality development among middle aged and older men.

    Science.gov (United States)

    Huang, Yan-Ping; Chen, Bin; Ping, Ping; Wang, Hong-Xiang; Hu, Kai; Yang, Hao; Zhang, Tao; Feng, Tan; Jin, Yan; Han, Yin-Fa; Wang, Yi-Xin; Huang, Yi-Ran

    2014-01-01

    To assess erectile function in middle-aged and older men with asexuality status and further analyze their specific reasons for this condition. Men who had regular sexual intercourse attempts (sex frequency ≥ 1 time per month) were classified into mild erectile dysfunction (ED), moderate to severe ED and non-ED according to International Index of Erectile Function-5, and men having no sexual intercourse attempts for at least 6 months were defined as having an asexuality status. The risk factors associated with ED were collected in a sample of 1,531 Chinese men aged 40 to 80 years, and the self-report reasons for asexuality were recorded in asexual cohort individually. Comparative analyses and multivariate regression models were conducted among these groups. The prevalence rates of ED and asexuality status were 49.9% and 37.2%. The asexuality status group had higher risk factors than the moderate to severe ED group in terms of old age (age ≥ 65, adjusted odds ratio (OR) 17.69 versus (Vs.) 7.19), diabetes (crude OR: 2.40 Vs. 2.36) and hypertension (crude OR: 1.78 Vs. 1.72). The specific reasons for the asexuality status were "erectile difficulty" (52.9%), "do not care about sexuality" (53.5%)", "no longer necessary to have sexuality at this age" (47.7%), "severe stress" (44.4%), "severe fatigue" (26.3%) and "masturbation" (26.9%). Men with an asexual status suffer from higher risk factors for ED than men with moderate to severe ED. The majority of this asexual status could be attributed to a full ED, although the reasons for this transient asexuality also involved sexual attitudes and interests, sexual partners and masturbation.

  9. Asexuality development among middle aged and older men.

    Directory of Open Access Journals (Sweden)

    Yan-Ping Huang

    Full Text Available OBJECTIVES: To assess erectile function in middle-aged and older men with asexuality status and further analyze their specific reasons for this condition. SUBJECTS AND METHODS: Men who had regular sexual intercourse attempts (sex frequency ≥ 1 time per month were classified into mild erectile dysfunction (ED, moderate to severe ED and non-ED according to International Index of Erectile Function-5, and men having no sexual intercourse attempts for at least 6 months were defined as having an asexuality status. The risk factors associated with ED were collected in a sample of 1,531 Chinese men aged 40 to 80 years, and the self-report reasons for asexuality were recorded in asexual cohort individually. Comparative analyses and multivariate regression models were conducted among these groups. RESULTS: The prevalence rates of ED and asexuality status were 49.9% and 37.2%. The asexuality status group had higher risk factors than the moderate to severe ED group in terms of old age (age ≥ 65, adjusted odds ratio (OR 17.69 versus (Vs. 7.19, diabetes (crude OR: 2.40 Vs. 2.36 and hypertension (crude OR: 1.78 Vs. 1.72. The specific reasons for the asexuality status were "erectile difficulty" (52.9%, "do not care about sexuality" (53.5%", "no longer necessary to have sexuality at this age" (47.7%, "severe stress" (44.4%, "severe fatigue" (26.3% and "masturbation" (26.9%. CONCLUSIONS: Men with an asexual status suffer from higher risk factors for ED than men with moderate to severe ED. The majority of this asexual status could be attributed to a full ED, although the reasons for this transient asexuality also involved sexual attitudes and interests, sexual partners and masturbation.

  10. Biological markers of asexuality: Handedness, birth order, and finger length ratios in self-identified asexual men and women.

    Science.gov (United States)

    Yule, Morag A; Brotto, Lori A; Gorzalka, Boris B

    2014-02-01

    Human asexuality is defined as a lack of sexual attraction to anyone or anything and it has been suggested that it may be best conceptualized as a sexual orientation. Non-right-handedness, fraternal birth order, and finger length ratio (2D:4D) are early neurodevelopmental markers associated with sexual orientation. We conducted an Internet study investigating the relationship between self-identification as asexual, handedness, number of older siblings, and self-measured finger-lengths in comparison to individuals of other sexual orientation groups. A total of 325 asexuals (60 men and 265 women; M age, 24.8 years), 690 heterosexuals (190 men and 500 women; M age, 23.5 years), and 268 non-heterosexuals (homosexual and bisexual; 64 men and 204 women; M age, 29.0 years) completed online questionnaires. Asexual men and women were 2.4 and 2.5 times, respectively, more likely to be non-right-handed than their heterosexual counterparts and there were significant differences between sexual orientation groups in number of older brothers and older sisters, and this depended on handedness. Asexual and non-heterosexual men were more likely to be later-born than heterosexual men, and asexual women were more likely to be earlier-born than non-heterosexual women. We found no significant differences between sexual orientation groups on measurements of 2D:4D ratio. This is one of the first studies to test and provide preliminary empirical support for an underlying neurodevelopmental basis to account for the lack of sexual attraction characteristic of asexuality.

  11. Origins of asexuality in Bryobia mites (Acari: Tetranychidae)

    NARCIS (Netherlands)

    Ros, V.I.D.; Breeuwer, J.A.J.; Menken, S.B.J.

    2008-01-01

    Background Obligate asexual reproduction is rare in the animal kingdom. Generally, asexuals are considered evolutionary dead ends that are unable to radiate. The phytophagous mite genus Bryobia contains a large number of asexual species. In this study, we investigate the origin and evolution of

  12. Identification of Phytophthora sojae genes involved in asexual ...

    Indian Academy of Sciences (India)

    ual sporulation or germination. But molecular details about asexual spore development in P. sojae are limited (Tyler et al. 2006). In the present study, to understand the molecular basis of asexual spore development in P. sojae, we investigated gene expression changes involved in asexual sporulation after ul- traviolet (UV) ...

  13. AGA predicts winter jump in residential gas price

    International Nuclear Information System (INIS)

    Anon.

    1992-01-01

    The American Gas Association predicts the average heating bill for residential gas consumers could increase by as much as 18% this winter. AGA Pres. Mike Baly said, Last year's winter was warmer than normal. If the 1992-93 winter is similar, AGA projects that residential natural gas heating bills will go up about 6%. If we see a return to normal winter weather, our projection show the average bill could rise by almost 18%

  14. Sexual Fantasy and Masturbation Among Asexual Individuals: An In-Depth Exploration.

    Science.gov (United States)

    Yule, Morag A; Brotto, Lori A; Gorzalka, Boris B

    2017-01-01

    Human asexuality is generally defined as a lack of sexual attraction. We used online questionnaires to investigate reasons for masturbation, and explored and compared the contents of sexual fantasies of asexual individuals (identified using the Asexual Identification Scale) with those of sexual individuals. A total of 351 asexual participants (292 women, 59 men) and 388 sexual participants (221 women, 167 men) participated. Asexual women were significantly less likely to masturbate than sexual women, sexual men, and asexual men. Asexual women were less likely to report masturbating for sexual pleasure or fun than their sexual counterparts, and asexual men were less likely to report masturbating for sexual pleasure than sexual men. Both asexual women and men were significantly more likely than sexual women and men to report that they had never had a sexual fantasy. Of those who have had a sexual fantasy, asexual women and men were significantly more likely to endorse the response "my fantasies do not involve other people" compared to sexual participants, and consistently scored each sexual fantasy on a questionnaire as being less sexually exciting than did sexual participants. When using an open-ended format, asexual participants were more likely to report having fantasies about sexual activities that did not involve themselves, and were less likely to fantasize about topics such as group sex, public sex, and having an affair. Interestingly, there was a large amount of overlap between sexual fantasies of asexual and sexual participants. Notably, both asexual and sexual participants (both men and women) were equally likely to fantasize about topics such as fetishes and BDSM.

  15. Patterns of Asexuality in China: Sexual Activity, Sexual and Romantic Attraction, and Sexual Desire.

    Science.gov (United States)

    Zheng, Lijun; Su, Yanchen

    2018-05-01

    This study examined patterns of asexuality in Chinese asexual people in terms of sexual activities, sexual/romantic attraction, and sexual desire. The sample included 227 (64 men and 163 women) asexual participants and 57 (26 men and 31 women) uncertain asexual participants recruited from social networks for asexual people. The control group included 217 (115 men and 102 women) heterosexual participants recruited from general social networks. Participants scoring 40 or higher on the Asexuality Identification Scale were classified as asexual. Asexual participants reported having less frequent masturbation, sexual intercourse experience, and sexual and romantic attraction compared to heterosexual participants. Lower sexual attraction among asexuals indicated that "people who experience little or no sexual attraction" would be a more appropriate definition of asexuality. The pattern of uncertain asexual participants' sexual/romantic attraction and sexual desire was intermediate between heterosexual and asexual participants. Asexual participants scored significantly lower on dyadic sexual desire and slightly lower on solitary sexual desire than heterosexual participants. There were significant differences in sexual activities and solitary sexual desire among romantic orientation categories. Homoromantic participants showed higher dyadic sexual desire and were more likely to engage in masturbation, indicating the heterogeneity among asexual people. The findings indicated that Chinese asexual people showed similar patterns of asexuality as in Western nations. Specifically, asexual people have little or no sexual attraction, non-partner-orientated sexual desire, and are heterogeneous in sexual activities and sexual desire. This implies similar mechanisms underlying the etiology of asexuality across cultures.

  16. Asexuality: Sexual Orientation, Paraphilia, Sexual Dysfunction, or None of the Above?

    Science.gov (United States)

    Brotto, Lori A; Yule, Morag

    2017-04-01

    Although lack of sexual attraction was first quantified by Kinsey, large-scale and systematic research on the prevalence and correlates of asexuality has only emerged over the past decade. Several theories have been posited to account for the nature of asexuality. The goal of this review was to consider the evidence for whether asexuality is best classified as a psychiatric syndrome (or a symptom of one), a sexual dysfunction, or a paraphilia. Based on the available science, we believe there is not sufficient evidence to support the categorization of asexuality as a psychiatric condition (or symptom of one) or as a disorder of sexual desire. There is some evidence that a subset of self-identified asexuals have a paraphilia. We also considered evidence supporting the classification of asexuality as a unique sexual orientation. We conclude that asexuality is a heterogeneous entity that likely meets conditions for a sexual orientation, and that researchers should further explore evidence for such a categorization.

  17. Mutation accumulation and fitness effects in hybridogenetic populations: a comparison to sexual and asexual systems

    Directory of Open Access Journals (Sweden)

    Bagheri Homayoun C

    2007-05-01

    Full Text Available Abstract Background Female only unisexual vertebrates that reproduce by hybridogenesis show an unusual genetic composition. They are of hybrid origin but show no recombination between the genomes of their parental species. Instead, the paternal genome is discarded from the germline prior to meiosis, and gametes (eggs only contain solely unrecombined maternal genomes. Hence hybridogens only transmit maternally inherited mutations. Hybridity is restored each generation by backcrossing with males of the sexual parental species whose genome was eliminated. In contrast, recombining sexual species propagate an intermixed pool of mutations derived from the maternal and paternal parts of the genome. If mutation rates are lower in female gametes than males, it raises the possibility for lower mutation accumulation in a hybridogenetic population, and consequently, higher population fitness than its sexual counterpart. Results We show through Monte-Carlo simulations that at higher male to female mutation ratios, and sufficiently large population sizes, hybridogenetic populations can carry a lower mutation load than sexual species. This effect is more pronounced with synergistic forms of epistasis. Mutations accumulate faster on the sexual part of the genome, and with the purifying effects of epistasis, it makes it more difficult for mutations to be transmitted on the clonal part of the genome. In smaller populations, the same mechanism reduces the speed of Muller's Ratchet and the number of fixed mutations compared to similar asexual species. Conclusion Since mutation accumulation can be less pronounced in hybridogenetic populations, the question arises why hybridogenetic organisms are so scarce compared to sexual species. In considering this, it is likely that comparison of population fitnesses is not sufficient. Despite competition with the sexual parental species, hybrid populations are dependent on the maintenance of – and contact with – their

  18. Asexual sporulation facilitates adaptation

    NARCIS (Netherlands)

    Zhang, Jianhua; Debets, A.J.M.; Verweij, P.E.; Melchers, W.J.G.; Zwaan, B.J.; Schoustra, S.E.

    2015-01-01

    Understanding the occurrence and spread of azole resistance in Aspergillus fumigatus is crucial for public health. It has been hypothesized that asexual sporulation, which is abundant in nature, is essential for phenotypic expression of azole resistance mutations in A. fumigatus facilitating

  19. Coexistence of sexual individuals and genetically isolated asexual counterparts in a thrips.

    Science.gov (United States)

    Kobayashi, Kazuya; Yoshimura, Jin; Hasegawa, Eisuke

    2013-11-21

    Sex is a paradoxical phenomenon because it is less efficient compared with asexual reproduction. To resolve this paradox we need a direct comparison between sexual and asexual forms. In many organisms, however, sexual and asexual forms do not occur in the same habitat, or at the same time. In a few cases where sexual and asexual forms are found in a single population, some (though rare) genetic exchange is usually detected between the two forms. When genetic exchange occurs a direct comparison is impossible. Here we investigate a thrips exhibiting both sexual and asexual forms (lineages) that are morphologically indistinguishable. We examine if the two forms are genetically isolated. Phylogeny based on nuclear genes confirms that the sexual and asexual lineages are genetically differentiated. Thus we demonstrate that the current system has certain advantages over existing and previously used model systems in the evolution of sexual reproduction.

  20. Understanding asexual identity as a means to facilitate culturally competent care: A systematic literature review.

    Science.gov (United States)

    Jones, Catriona; Hayter, Mark; Jomeen, Julie

    2017-12-01

    To provide a contemporary overview of asexuality and the implications this has for healthcare practice. Individuals belonging to sexual minority groups face many barriers in accessing appropriate health care. The term "sexual minority group" is usually used to refer to lesbian women, gay, bisexual and transgender individuals. Anecdotal and research evidence suggests that those who identify as asexual have similar poor experiences. Systematic review and qualitative analysis. This work uses a systematic review and qualitative analysis of the existing interview data from self-identified asexuals, to construct features of the asexual identity. The findings will help practitioners and health professionals develop an understanding of this poorly understood construct. Ultimately this work is aimed at facilitating culturally competent care in the context of asexuality. Qualitative analysis produced three themes, which can be used, not only to frame asexuality in a positive and normalising way, but also to provide greater understanding of asexuality, "romantic differences coupled with sexual indifference," "validation through engagement with asexual communities" and "a diversity of subasexual identities." Having some understanding of what it means to identify as asexual, and respecting the choices made by asexuals can markedly improve the experiences of those who embrace an asexual identity when engaging with health care. Anecdotal evidence, taken from one of the largest asexual online forums, suggests that a number of self-identified asexuals choose not to disclose their identity to healthcare professionals through fear of their asexual status being pathologised, problematised or judged. Given that asexuality is a poorly understood concept, this may be due to lack of understanding on behalf of healthcare providers. The review provides health professionals and practitioners working in clinical settings with some insights of the features of an asexual identity to facilitate

  1. Freedom, invisibility, and community: a qualitative study of self-identification with asexuality.

    Science.gov (United States)

    MacNeela, Pádraig; Murphy, Aisling

    2015-04-01

    A significant body of research is now emerging on the subjective meaning of asexuality. This study explored how self-identification as asexual is managed, both as a threat to the self-concept and a source of personal meaning. A total of 66 self-identified asexuals were recruited from an asexuality internet community and responded to open-ended questions on an online survey. Of these, 31 participants identified as female, 15 as male, 18 gave a different label such as genderqueer or androgynous, and two did not provide information on gender. A thematic analysis of the transcripts resulted in three themes. Socially, asexuality attracted denial and resistance due to incompatibility with heteronormative societal expectations. Despite the threat to self-integrity arising from asexuality being socially rejected, it was typically assimilated as a valued and meaningful orientation on an intra-personal level, aided by information and support from the online community. A second level of threat to self arose whereby other self-identifications, especially gender, had to be reconciled with a non-sexual persona. The accommodation made to other elements of the self was reflected in complex sub-identities. The findings were interpreted using identity process theory to understand how threats arising from self-identifying as asexual are managed. Although asexuality emerges as an orientation to sexuality that can be reconciled with the self, its invisibility or outright rejection in society constitute an on-going challenge.

  2. Sexual conflict and the evolution of asexuality at low population densities.

    Science.gov (United States)

    Gerber, Nina; Kokko, Hanna

    2016-10-26

    Theories for the evolution of sex rarely include facultatively sexual reproduction. Sexual harassment by males is an underappreciated factor: it should at first sight increase the relative advantage of asexual reproduction by increasing the cost of sex. However, if the same females can perform either sexual or asexual life cycles, then females trying to reproduce asexually may not escape harassment. If resisting male harassment is costly, it might be beneficial for a female to accept a mating and undertake a sexual life cycle rather than 'insist' on an asexual one. We investigate the effects of sexual harassment on the maintenance of sex under different population densities. Our model shows that resisting matings pays off at low population densities, which leads to the complete extinction of males, and thus to the evolution of completely asexual populations. Facultative sex persists in a narrow range of slightly higher densities. At high densities, selection favours giving up resisting male mating attempts and thus sexual reproduction takes over. These interactions between the outcomes of sexual conflict and population density suggest an explanation for the rarity of facultative sex and also patterns of geographical parthenogenesis, where marginal environments with potentially low densities are associated with asexuality. © 2016 The Author(s).

  3. Marginal distribution and high heterozygosity of asexual Caloglossa vieillardii (Delesseriaceae, Rhodophyta) along the Australian coasts.

    Science.gov (United States)

    Kamiya, Mitsunobu; Saba, Erika; West, John A

    2017-12-01

    In animals and land plants, many asexual species originate through inter- or intraspecific crosses, and such heterozygous asexuals frequently are more abundant than their sexual relatives in marginal habitats. Although asexual species have been reported in various macroalgal taxa, detailed information regarding their distribution, heterozygosity, and origin is limited. Because many asexual tetrasporophyte strains of Caloglossa vieillardii have been isolated from South Australia, far from their core tropical habitats, we re-examined the distribution range of asexual C. vieillardii and genotyped these and other western Pacific strains using an actin gene marker. We confirmed the marginal distribution of the asexuals; however, a small patch of sexual thalli was newly discovered 450 km further west from asexual populations in South Australia. Three heterozygous genotypes and one homozygous genotypes were detected from nine asexual populations; 21 heterozygous strains were obligately asexual, but one homozygous strain suddenly produced sexual gametophytes after several years of culture. We hypothesized that the most abundant heterozygous genotype (defined as type 3/4) in asexual populations occurred by a cross between type 3 and type 4 allele gametophytes, both of which were isolated from the Australian coasts. In the crossing experiments, certain combinations between type 3 females and type 4 males produced tetrasporophytes, which recycled successive tetrasporophytes. In the culture experiments, whereas both sexual and asexual strains successfully produced tetraspores at 12°C, no sexual strains released carpospores below 14°C. However, it is uncertain whether this slight difference of maturation temperature was related to the marginal distribution of asexual C. vieillardii. © 2017 Phycological Society of America.

  4. Comparison of Patent Claim Construction between Netherlands and Germany on Basis of AGA v. Occlutech

    NARCIS (Netherlands)

    Tsoutsanis, A.; Kau, C.

    2013-01-01

    This article provides a brief overview on how the Dutch and German courts interpret the claims of a patent. It briefly compares each national approach on the basis of the recent AGA v Occlutech litigation in both countries. The dispute between AGA and Occlutech involved socalled ‘‘occluders’’, a

  5. Screening strategies for gestational diabetes mellitus at the Aga ...

    African Journals Online (AJOL)

    Background: Universal screening strategy for gestational diabetes mellitus offers biochemical screening to all women irrespective of risk factor status while selective strategy screens only those with risk factors. The Aga Khan University Hospital adopted a selective screening protocol by consensus. This study compares both ...

  6. Asexual sporulation facilitates adaptation: The emergence of azole resistance in Aspergillus fumigatus.

    Science.gov (United States)

    Zhang, Jianhua; Debets, Alfons J M; Verweij, Paul E; Melchers, Willem J G; Zwaan, Bas J; Schoustra, Sijmen E

    2015-10-01

    Understanding the occurrence and spread of azole resistance in Aspergillus fumigatus is crucial for public health. It has been hypothesized that asexual sporulation, which is abundant in nature, is essential for phenotypic expression of azole resistance mutations in A. fumigatus facilitating subsequent spread through natural selection. Furthermore, the disease aspergilloma is associated with asexual sporulation within the lungs of patients and the emergence of azole resistance. This study assessed the evolutionary advantage of asexual sporulation by growing the fungus under pressure of one of five different azole fungicides over seven weeks and by comparing the rate of adaptation between scenarios of culturing with and without asexual sporulation. Results unequivocally show that asexual sporulation facilitates adaptation. This can be explained by the combination of more effective selection because of the transition from a multicellular to a unicellular stage, and by increased mutation supply due to the production of spores, which involves numerous mitotic divisions. Insights from this study are essential to unravel the resistance mechanisms of sporulating pathogens to chemical compounds and disease agents in general, and for designing strategies that prevent or overcome the emerging threat of azole resistance in particular. © 2015 The Author(s). Evolution © 2015 The Society for the Study of Evolution.

  7. The exact distributions of F(IS under partial asexuality in small finite populations with mutation.

    Directory of Open Access Journals (Sweden)

    Solenn Stoeckel

    Full Text Available Reproductive systems like partial asexuality participate to shape the evolution of genetic diversity within populations, which is often quantified by the inbreeding coefficient F IS. Understanding how those mating systems impact the possible distributions of F IS values in theoretical populations helps to unravel forces shaping the evolution of real populations. We proposed a population genetics model based on genotypic states in a finite population with mutation. For populations with less than 400 individuals, we assessed the impact of the rates of asexuality on the full exact distributions of F IS, the probabilities of positive and negative F IS, the probabilities of fixation and the probabilities to observe changes in the sign of F IS over one generation. After an infinite number of generations, we distinguished three main patterns of effects of the rates of asexuality on genetic diversity that also varied according to the interactions of mutation and genetic drift. Even rare asexual events in mainly sexual populations impacted the balance between negative and positive F IS and the occurrence of extreme values. It also drastically modified the probability to change the sign of F IS value at one locus over one generation. When mutation prevailed over genetic drift, increasing rates of asexuality continuously increased the variance of F IS that reached its highest value in fully asexual populations. In consequence, even ancient asexual populations showed the entire F IS spectrum, including strong positive F IS. The prevalence of heterozygous loci only occurred in full asexual populations when genetic drift dominated.

  8. Ex-vivo assessment and non-invasive in vivo imaging of internal hemorrhages in Aga2/+ mutant mice

    Energy Technology Data Exchange (ETDEWEB)

    Ermolayev, Vladimir [Institute for Biological and Medical Imaging, Helmholtz Zentrum München, Building 56, Ingolstädter Landstraße 1, D-85764 Neuherberg (Germany); Cohrs, Christian M. [Institute for Experimental Genetics, Helmholtz Zentrum München, Ingolstädter Landstraße 1, D-85764 Neuherberg (Germany); Mohajerani, Pouyan; Ale, Angelique [Institute for Biological and Medical Imaging, Helmholtz Zentrum München, Building 56, Ingolstädter Landstraße 1, D-85764 Neuherberg (Germany); Hrabé de Angelis, Martin [Institute for Experimental Genetics, Helmholtz Zentrum München, Ingolstädter Landstraße 1, D-85764 Neuherberg (Germany); Ntziachristos, Vasilis, E-mail: v.ntziachristos@tum.de [Institute for Biological and Medical Imaging, Helmholtz Zentrum München, Building 56, Ingolstädter Landstraße 1, D-85764 Neuherberg (Germany)

    2013-03-08

    Highlights: ► Aga2/+ mice, model for Osteogenesis imperfecta, have type I collagen mutation. ► Aga2/+ mice display both moderate and severe phenotypes lethal 6–11th postnatal. ► Internal hemorrhages studied in Aga2/+ vs. control mice at 6 and 9 days postnatal. ► Anatomical and functional findings in-vivo contrasted to the ex-vivo appearance. -- Abstract: Mutations in type I collagen genes (COL1A1/2) typically lead to Osteogenesis imperfecta, the most common heritable cause of skeletal fractures and bone deformation in humans. Heterozygous Col1a1{sup Aga2/+}, animals with a dominant mutation in the terminal C-propeptide domain of type I collagen develop typical skeletal hallmarks and internal hemorrhages starting from 6 day after birth. The disease progression for Aga2/+ mice, however, is not uniform differing between severe phenotype lethal at the 6–11th day of life, and moderate-to-severe one with survival to adulthood. Herein we investigated whether a new modality that combines X-ray computer tomography with fluorescence tomography in one hybrid system can be employed to study internal bleedings in relation to bone fractures and obtain insights into disease progression. The disease phenotype was characterized on Aga2/+ vs. wild type mice between 6 and 9 days postnatal. Anatomical and functional findings obtained in-vivo were contrasted to the ex-vivo appearance of the same tissues under cryo-slicing.

  9. Ex-vivo assessment and non-invasive in vivo imaging of internal hemorrhages in Aga2/+ mutant mice

    International Nuclear Information System (INIS)

    Ermolayev, Vladimir; Cohrs, Christian M.; Mohajerani, Pouyan; Ale, Angelique; Hrabé de Angelis, Martin; Ntziachristos, Vasilis

    2013-01-01

    Highlights: ► Aga2/+ mice, model for Osteogenesis imperfecta, have type I collagen mutation. ► Aga2/+ mice display both moderate and severe phenotypes lethal 6–11th postnatal. ► Internal hemorrhages studied in Aga2/+ vs. control mice at 6 and 9 days postnatal. ► Anatomical and functional findings in-vivo contrasted to the ex-vivo appearance. -- Abstract: Mutations in type I collagen genes (COL1A1/2) typically lead to Osteogenesis imperfecta, the most common heritable cause of skeletal fractures and bone deformation in humans. Heterozygous Col1a1 Aga2/+ , animals with a dominant mutation in the terminal C-propeptide domain of type I collagen develop typical skeletal hallmarks and internal hemorrhages starting from 6 day after birth. The disease progression for Aga2/+ mice, however, is not uniform differing between severe phenotype lethal at the 6–11th day of life, and moderate-to-severe one with survival to adulthood. Herein we investigated whether a new modality that combines X-ray computer tomography with fluorescence tomography in one hybrid system can be employed to study internal bleedings in relation to bone fractures and obtain insights into disease progression. The disease phenotype was characterized on Aga2/+ vs. wild type mice between 6 and 9 days postnatal. Anatomical and functional findings obtained in-vivo were contrasted to the ex-vivo appearance of the same tissues under cryo-slicing

  10. The Key Role of Epigenetics in the Persistence of Asexual Lineages

    Directory of Open Access Journals (Sweden)

    Emilie Castonguay

    2012-01-01

    Full Text Available Asexual organisms, often perceived as evolutionary dead ends, can be long-lived and geographically widespread. We propose that epigenetic mechanisms could play a crucial role in the evolutionary persistence of these lineages. Genetically identical organisms could rely on phenotypic plasticity to face environmental variation. Epigenetic modifications could be the molecular mechanism enabling such phenotypic plasticity; they can be influenced by the environment and act at shorter timescales than mutation. Recent work on the asexual vertebrate Chrosomus eos-neogaeus (Pisces: Cyprinidae provides broad insights into the contribution of epigenetics in genetically identical individuals. We discuss the extension of these results to other asexual organisms, in particular those resulting from interspecific hybridizations. We finally develop on the evolutionary relevance of epigenetic variation in the context of heritability.

  11. Morphological peculiarities of bryophytes asexual organs

    Directory of Open Access Journals (Sweden)

    Oksana Lobachevska

    2013-04-01

    Full Text Available The main types of brood organs of dominant bryophyte species on dumps of the mining factories were determined. The special features of morphology, localization and genesis of specialized asexual propagula and gemmae were detected. The analysis of their role in reproductive strategy of colonist species was conducted.

  12. Sexual and asexual oogenesis require the expression of unique and shared sets of genes in the insect Acyrthosiphon pisum

    Directory of Open Access Journals (Sweden)

    Gallot Aurore

    2012-02-01

    Full Text Available Abstract Background Although sexual reproduction is dominant within eukaryotes, asexual reproduction is widespread and has evolved independently as a derived trait in almost all major taxa. How asexuality evolved in sexual organisms is unclear. Aphids, such as Acyrthosiphon pisum, alternate between asexual and sexual reproductive means, as the production of parthenogenetic viviparous females or sexual oviparous females and males varies in response to seasonal photoperiodism. Consequently, sexual and asexual development in aphids can be analyzed simultaneously in genetically identical individuals. Results We compared the transcriptomes of aphid embryos in the stages of development during which the trajectory of oogenesis is determined for producing sexual or asexual gametes. This study design aimed at identifying genes involved in the onset of the divergent mechanisms that result in the sexual or asexual phenotype. We detected 33 genes that were differentially transcribed in sexual and asexual embryos. Functional annotation by gene ontology (GO showed a biological signature of oogenesis, cell cycle regulation, epigenetic regulation and RNA maturation. In situ hybridizations demonstrated that 16 of the differentially-transcribed genes were specifically expressed in germ cells and/or oocytes of asexual and/or sexual ovaries, and therefore may contribute to aphid oogenesis. We categorized these 16 genes by their transcription patterns in the two types of ovaries; they were: i expressed during sexual and asexual oogenesis; ii expressed during sexual and asexual oogenesis but with different localizations; or iii expressed only during sexual or asexual oogenesis. Conclusions Our results show that asexual and sexual oogenesis in aphids share common genetic programs but diverge by adapting specificities in their respective gene expression profiles in germ cells and oocytes.

  13. Urinary tract infections at aga Khan University hospital nairobi - a ...

    African Journals Online (AJOL)

    2013-06-11

    Jun 11, 2013 ... (Uti) are normally treated empirically and urine culture is usual ordered for as a last ... symptomatic Uti in patients at aga Khan University hospital by looking at the trends of Uti ... in the context of pyelonephritis in pregnancy(9).

  14. Sexual versus Asexual Reproduction: Distinct Outcomes in Relative Abundance of Parthenogenetic Mealybugs following Recent Colonization.

    Science.gov (United States)

    Tabata, Jun; Ichiki, Ryoko T; Tanaka, Hirotaka; Kageyama, Daisuke

    2016-01-01

    Asexual reproduction, including parthenogenesis in which embryos develop within a female without fertilization, is assumed to confer advantages over sexual reproduction, which includes a "cost of males." Sexual reproduction largely predominates in animals, however, indicating that this cost is outweighed by the genetic and/or ecological benefits of sexuality, including the acquisition of advantageous mutations occurring in different individuals and the elimination of deleterious mutations. But the evolution of sexual reproduction remains unclear, because we have limited examples that demonstrate the relative success of sexual lineages in the face of competition from asexual lineages in the same environment. Here we investigated a sympatric occurrence of sexual and asexual reproduction in the pineapple mealybug, Dysmicoccus brevipes. This pest invaded southwestern Japan, including Okinawa and Ishigaki Islands, in the 1930s in association with imported pineapple plants. Our recent censuses demonstrated that on Okinawa sexually reproducing individuals can coexist with and even dominate asexual individuals in the presence of habitat and resource competition, which is considered to be severe for this nearly immobile insect. Molecular phylogeny based on partial DNA sequences in the mitochondrial and nuclear genomes, as well as the endosymbiotic bacterial genome, revealed that the asexual lineage diverged from a common sexual ancestor in the relatively recent past. In contrast, only the asexual lineage exhibiting obligate apomictic thelytoky was discovered on Ishigaki. Co-existence of the two lineages cannot be explained by the results of laboratory experiments, which showed that the intrinsic rate of increase in the sexual lineage was not obviously superior to that of the asexual lineage. Differences in biotic and/or abiotic selective forces operating on the two islands might be the cause of this discrepancy. This biological system offers a unique opportunity to assess

  15. OncoSimulR: genetic simulation with arbitrary epistasis and mutator genes in asexual populations.

    Science.gov (United States)

    Diaz-Uriarte, Ramon

    2017-06-15

    OncoSimulR implements forward-time genetic simulations of biallelic loci in asexual populations with special focus on cancer progression. Fitness can be defined as an arbitrary function of genetic interactions between multiple genes or modules of genes, including epistasis, restrictions in the order of accumulation of mutations, and order effects. Mutation rates can differ among genes, and can be affected by (anti)mutator genes. Also available are sampling from simulations (including single-cell sampling), plotting the genealogical relationships of clones and generating and plotting fitness landscapes. Implemented in R and C ++, freely available from BioConductor for Linux, Mac and Windows under the GNU GPL license. Version 2.5.9 or higher available from: http://www.bioconductor.org/packages/devel/bioc/html/OncoSimulR.html . GitHub repository at: https://github.com/rdiaz02/OncoSimul. ramon.diaz@iib.uam.es. Supplementary data are available at Bioinformatics online. © The Author 2017. Published by Oxford University Press.

  16. Adaptations to different habitats in sexual and asexual populations of parasitoid wasps: a meta-analysis

    OpenAIRE

    Amat, I; Kacelnik, A; van Alphen, JJM; Desouhant, E; Bernstein, C

    2017-01-01

    Background Coexistence of sexual and asexual populations remains a key question in evolutionary ecology. We address the question how an asexual and a sexual form of the parasitoid Venturia canescens can coexist in southern Europe. We test the hypothesis that both forms are adapted to different habitats within their area of distribution. Sexuals inhabit natural environments that are highly unpredictable, and where density of wasps and their hosts is low and patchily distributed. Asexuals in...

  17. Aga sellepärast, et on po... / Aleksandr Astrov

    Index Scriptorium Estoniae

    Astrov, Aleksandr

    2005-01-01

    Arutledes venekeelse valija hääletuskäitumise ümber juhib autor tähelepanu, et Eestis sätestab üks konkreetne seadus venelastele valimisõiguse, andes neile reaalse poliitilise jõu, teine aga piirab nende juurdepääsu ainult keele kaudu ligipääsetavatele eetikaressurssidele, mis võimaldaksid teha teadlikku valikut

  18. How Large Asexual Populations Adapt

    Science.gov (United States)

    Desai, Michael

    2007-03-01

    We often think of beneficial mutations as being rare, and of adaptation as a sequence of selected substitutions: a beneficial mutation occurs, spreads through a population in a selective sweep, then later another beneficial mutation occurs, and so on. This simple picture is the basis for much of our intuition about adaptive evolution, and underlies a number of practical techniques for analyzing sequence data. Yet many large and mostly asexual populations -- including a wide variety of unicellular organisms and viruses -- live in a very different world. In these populations, beneficial mutations are common, and frequently interfere or cooperate with one another as they all attempt to sweep simultaneously. This radically changes the way these populations adapt: rather than an orderly sequence of selective sweeps, evolution is a constant swarm of competing and interfering mutations. I will describe some aspects of these dynamics, including why large asexual populations cannot evolve very quickly and the character of the diversity they maintain. I will explain how this changes our expectations of sequence data, how sex can help a population adapt, and the potential role of ``mutator'' phenotypes with abnormally high mutation rates. Finally, I will discuss comparisons of these predictions with evolution experiments in laboratory yeast populations.

  19. Cryptic sexual populations account for genetic diversity and ecological success in a widely distributed, asexual fungus-growing ant.

    Science.gov (United States)

    Rabeling, Christian; Gonzales, Omar; Schultz, Ted R; Bacci, Maurício; Garcia, Marcos V B; Verhaagh, Manfred; Ishak, Heather D; Mueller, Ulrich G

    2011-07-26

    Sex and recombination are central processes in life generating genetic diversity. Organisms that rely on asexual propagation risk extinction due to the loss of genetic diversity and the inability to adapt to changing environmental conditions. The fungus-growing ant species Mycocepurus smithii was thought to be obligately asexual because only parthenogenetic populations have been collected from widely separated geographic localities. Nonetheless, M. smithii is ecologically successful, with the most extensive distribution and the highest population densities of any fungus-growing ant. Here we report that M. smithii actually consists of a mosaic of asexual and sexual populations that are nonrandomly distributed geographically. The sexual populations cluster along the Rio Amazonas and the Rio Negro and appear to be the source of independently evolved and widely distributed asexual lineages, or clones. Either apomixis or automixis with central fusion and low recombination rates is inferred to be the cytogenetic mechanism underlying parthenogenesis in M. smithii. Males appear to be entirely absent from asexual populations, but their existence in sexual populations is indicated by the presence of sperm in the reproductive tracts of queens. A phylogenetic analysis of the genus suggests that M. smithii is monophyletic, rendering a hybrid origin of asexuality unlikely. Instead, a mitochondrial phylogeny of sexual and asexual populations suggests multiple independent origins of asexual reproduction, and a divergence-dating analysis indicates that M. smithii evolved 0.5-1.65 million years ago. Understanding the evolutionary origin and maintenance of asexual reproduction in this species contributes to a general understanding of the adaptive significance of sex.

  20. Adaptations to different habitats in sexual and asexual populations of parasitoid wasps: a meta-analysis.

    Science.gov (United States)

    Amat, Isabelle; van Alphen, Jacques J M; Kacelnik, Alex; Desouhant, Emmanuel; Bernstein, Carlos

    2017-01-01

    Coexistence of sexual and asexual populations remains a key question in evolutionary ecology. We address the question how an asexual and a sexual form of the parasitoid Venturia canescens can coexist in southern Europe. We test the hypothesis that both forms are adapted to different habitats within their area of distribution. Sexuals inhabit natural environments that are highly unpredictable, and where density of wasps and their hosts is low and patchily distributed. Asexuals instead are common in anthropic environments (e.g., grain stores) where host outbreaks offer periods when egg-load is the main constraint on reproductive output. We present a meta-analysis of known adaptations to these habitats. Differences in behavior, physiology and life-history traits between sexual and asexual wasps were standardized in term of effect size (Cohen's d value; Cohen, 1988). Seeking consilience from the differences between multiple traits, we found that sexuals invest more in longevity at the expense of egg-load, are more mobile, and display higher plasticity in response to thermal variability than asexual counterparts. Thus, each form has consistent multiple adaptations to the ecological circumstances in the contrasting environments.

  1. Adaptations to different habitats in sexual and asexual populations of parasitoid wasps: a meta-analysis

    Directory of Open Access Journals (Sweden)

    Isabelle Amat

    2017-09-01

    Full Text Available Background Coexistence of sexual and asexual populations remains a key question in evolutionary ecology. We address the question how an asexual and a sexual form of the parasitoid Venturia canescens can coexist in southern Europe. We test the hypothesis that both forms are adapted to different habitats within their area of distribution. Sexuals inhabit natural environments that are highly unpredictable, and where density of wasps and their hosts is low and patchily distributed. Asexuals instead are common in anthropic environments (e.g., grain stores where host outbreaks offer periods when egg-load is the main constraint on reproductive output. Methods We present a meta-analysis of known adaptations to these habitats. Differences in behavior, physiology and life-history traits between sexual and asexual wasps were standardized in term of effect size (Cohen’s d value; Cohen, 1988. Results Seeking consilience from the differences between multiple traits, we found that sexuals invest more in longevity at the expense of egg-load, are more mobile, and display higher plasticity in response to thermal variability than asexual counterparts. Discussion Thus, each form has consistent multiple adaptations to the ecological circumstances in the contrasting environments.

  2. Gonad establishment during asexual reproduction in the annelid Pristina leidyi.

    Science.gov (United States)

    Özpolat, B Duygu; Bely, Alexandra E

    2015-09-01

    Animals that can reproduce by both asexual agametic reproduction and sexual reproduction must transmit or re-establish their germ line post-embryonically. Although such a dual reproductive mode has evolved repeatedly among animals, how asexually produced individuals establish their germ line remains poorly understood in most groups. We investigated germ line development in the annelid Pristina leidyi, a species that typically reproduces asexually by paratomic fission, intercalating a new tail and head in the middle of the body followed by splitting. We found that in fissioning individuals, gonads occur in anterior segments in the anterior-most individual as well as in new heads forming within fission zones. Homologs of the germ line/multipotency genes piwi, vasa, and nanos are expressed in the gonads, as well as in proliferative tissues including the posterior growth zone, fission zone, and regeneration blastema. In fissioning animals, certain cells on the ventral nerve cord express a homolog of piwi, are abundant near fission zones, and sometimes make contact with gonads. Such cells are typically undetectable near the blastema and posterior growth zone. Time-lapse imaging provides direct evidence that cells on the ventral nerve cord migrate preferentially towards fission zones. Our findings indicate that gonads form routinely in fissioning individuals, that a population of piwi-positive cells on the ventral nerve cord is associated with fission and gonads, and that cells resembling these piwi-positive cells migrate along the ventral nerve cord. We suggest that the piwi-positive ventral cells are germ cells that transmit the germ line across asexually produced individuals via migration along the ventral nerve cord. Copyright © 2015 Elsevier Inc. All rights reserved.

  3. Hassan Aga and his Government in Algiers. The Consolidation of a Mediterranean Myth

    Directory of Open Access Journals (Sweden)

    Fernando FERNÁNDEZ LANZA

    2014-12-01

    Full Text Available This work tries to describe graphically the consolidation of a social myth in the unsettled Mediterranean of the 16th century, through a personage: the Spanish convert to Islam Hassan Aga (Azan Aga, the Sardinian renegade who succeeded Hayreddin Barbarrosa at the helms of Algiers from 1533 till his death ten years later. This was a period of intense activity, with the climax that came with the expedition of Charles to Algiers in 1541, whose spectacular defeat can be considered as the principal nucleus of the myth of this popular personage who as a Sardinian slave came to defeat the Emperor. A myth of social ascension with maquiavelical profiles of a new prince of the frontiers.

  4. Evolution of complex asexual reproductive strategies in jellyfish

    DEFF Research Database (Denmark)

    Schnedler-Meyer, Nicolas Azaña; Pigolotti, Simone; Mariani, Patrizio

    2018-01-01

    Many living organisms in terrestrial and aquatic ecosystems rely on multiple reproductive strategies to reduce the risk of extinction in variable environments. Examples are provided by the polyp stage of several bloom-forming jellyfish species, which can reproduce asexually using different buddin...

  5. AGA: Interactive pipeline for reproducible gene expression and DNA methylation data analyses [version 2; referees: 2 approved

    Directory of Open Access Journals (Sweden)

    Michael Considine

    2015-10-01

    Full Text Available Automated Genomics Analysis (AGA is an interactive program to analyze high-throughput genomic data sets on a variety of platforms. An easy to use, point and click, guided pipeline is implemented to combine, define, and compare datasets, and customize their outputs. In contrast to other automated programs, AGA enables flexible selection of sample groups for comparison from complex sample annotations. Batch correction techniques are also included to further enable the combination of datasets from diverse studies in this comparison. AGA also allows users to save plots, tables and data, and log files containing key portions of the R script run for reproducible analyses. The link between the interface and R supports collaborative research, enabling advanced R users to extend preliminary analyses generated from bioinformatics novices.

  6. Let us not be unfair to asexuals: their ephemerality may be explained by neutral models without invoking any evolutionary constraints of asexuality

    Czech Academy of Sciences Publication Activity Database

    Janko, Karel

    2014-01-01

    Roč. 68, č. 2 (2014), s. 569-576 ISSN 0014-3820 R&D Projects: GA ČR GA13-12580S Institutional support: RVO:67985904 Keywords : age of clones * asexuality * clonal turnover Subject RIV: EG - Zoology Impact factor: 4.612, year: 2014

  7. Hybrid asexuality as a primary postzygotic barrier between nascent species: on the interconnection between asexuality, hybridization and speciation

    Czech Academy of Sciences Publication Activity Database

    Janko, K.; Pačes, J.; Wilkinson-Herbots, H.; Costa, R. J.; Roslein, Jan; Drozd, P.; Iakovenko, N.; Rídl, J.; Hroudová, M.; Kočí, J.; Reifová, R.; Šlechtová, V.; Choleva, L.

    2018-01-01

    Roč. 27, č. 1 (2018), s. 248-263 ISSN 0962-1083 R&D Projects: GA ČR(CZ) GBP505/12/G112 Institutional support: RVO:68081766 Keywords : pairwise nucleotide differences * mitochondrial-dna variation * multilocus genotype data * reproductive isolation * maximum-likelihood * loaches cobitis * migration model * gene flow * phylogenetic constraints * coalescence time * balance hypothesis * coalescence * evolution of asexuality * hybridization * phylogeography * speciation Subject RIV: EG - Zoology Impact factor: 6.086, year: 2016

  8. KONFLIK LINGKUNGAN DI KAMPUNG AGAS, TANJUNG UMA, BATAM (Environmental Conflict in Kampung Agas, Tanjung Uma, Batam

    Directory of Open Access Journals (Sweden)

    Saprial Saprial

    2004-11-01

    Full Text Available ABSTRAK Perkembangan kota Batam sebagai kawasan industri, perdagangan, pelabuhan, dan pariwisata, membawa tidak saja dampak positip, melainkan juga dampak negatif. Salah satu dampak negatif yang muncul adalah konffik lingkungan dalam bentuk pencemaran air di sungai Jodoh yang menganggu pemukiman liar di Kampung Agas, Tanjung Uma. Penelitian ini bertujuan untuk mengkaji akar masalah konflik dan resolusinya. Penelitian ini merupakan studi deskriptif-kualitatip, dengan data yang dikumpulkan melalui wawancara mendalam dengan pihak-pihak yang terlibat dalam konflik. Penelitian ini menemukan bahwa akar masalah konffik adalah konflik spasial antara permukiman liar dan pembangunan ruko yang menimbulkan limbah di sekitar permukiman liar. Tidak dibangunnya IPAL memicu protes warga di permukiman liar dan terjadilah konflik. Penelitian ini melihat bahwa penyelesaian konflik dalam bentuk kompensasi atau “sagu hati" tidak menyelesaikan akar masalah konflik. Walaupun begitu, penyelesaian ini dipandang oleh pihak-pihak yang berkonflik sebagai hasil mufakat yang dimungkinkan untuk menghindari konflik sosial yang lebih besar. Penelitian ini juga menemukan bahwa bentuk penyelesaian konflik melalui musyawarah dan mufakat dapat dilakukan secara efektif sejauh ada mediator yang dipercaya oleh pihak-pihak yang bersengketa.   ABSTRACT The development of Batam City as an area for industry, trade, ship transit, and tourism activities brings not only positive impacts, but negative impact as well. One of the negative impacts is environmental conflict in the form of water pollution in Sei Jodoh downstream which affected informal settlement in Kampung Agas, Tanjung Uma. This research aimed to study the roots of the conflict and evaluated the resolution. It adopted a descriptive, qualitative research method. Data were collected through in-depth interviews with parties involved in the conflict. The research founded that the root causes of the environmental conflict was the

  9. Dieback Disease Predictive Model for Sexually and Asexually Propagated Dalbergia Sissoo (Shisham)

    International Nuclear Information System (INIS)

    Ahmad, I.; Siddiqui, M. T.; Nawaz, M. F.; Asif, M.; Atiq, M.; Gul, S.

    2016-01-01

    Dieback disease is a potential threat to Dalbergia sissoo (Shisham) which is a multipurpose tree of the Indian subcontinent. Different factors have been found associated with inciting shisham dieback. Fungal pathogens have been recognized as the major causal organism but changing climate is a main threat to forest dieback. Sexually (seedlings) and asexually (cuttings) propagated shisham were inoculated with the different fungi (Fusarium solani, Botryodiplodia theobromae, Curvularia lunata and Ganoderma lucidum). As environmental factors play critical role in the development of the disease, so the present study was designed to observe the impact of rainfall, temperature, relative humidity and wind velocity on the disease and for the management of disease predictive model was developed. A significant negative correlation was observed between disease and relative humidity both for seedlings (r = - 0.97) and cuttings (r = -0.487), respectively while maximum temperature expressed significant positive correlation with seedlings and cuttings with coefficient of correlation r = 0.734 and r = 0.629, respectively. Path analysis expressed that with one unit increase in rainfall the disease would rise by 7.58 and 15.04 and for maximum temperature it was 2.47 and 5.27 units in seedlings and cuttings, respectively. Multiple regression analysis showed that coefficient of determination (R/sup 2/) value was 0.62 and 0.48 for cuttings and seedlings, respectively. Normed fit index (NFI) and comparative fit index (CFI) values indicate that model is quite a good fit. Similarly comparison of observed and predicted data also validated the model for forecasting the disease. (author)

  10. Ontology for the asexual development and anatomy of the colonial chordate Botryllus schlosseri.

    Directory of Open Access Journals (Sweden)

    Lucia Manni

    Full Text Available Ontologies provide an important resource to integrate information. For developmental biology and comparative anatomy studies, ontologies of a species are used to formalize and annotate data that are related to anatomical structures, their lineage and timing of development. Here, we have constructed the first ontology for anatomy and asexual development (blastogenesis of a bilaterian, the colonial tunicate Botryllus schlosseri. Tunicates, like Botryllus schlosseri, are non-vertebrates and the only chordate taxon species that reproduce both sexually and asexually. Their tadpole larval stage possesses structures characteristic of all chordates, i.e. a notochord, a dorsal neural tube, and gill slits. Larvae settle and metamorphose into individuals that are either solitary or colonial. The latter reproduce both sexually and asexually and these two reproductive modes lead to essentially the same adult body plan. The Botryllus schlosseri Ontology of Development and Anatomy (BODA will facilitate the comparison between both types of development. BODA uses the rules defined by the Open Biomedical Ontologies Foundry. It is based on studies that investigate the anatomy, blastogenesis and regeneration of this organism. BODA features allow the users to easily search and identify anatomical structures in the colony, to define the developmental stage, and to follow the morphogenetic events of a tissue and/or organ of interest throughout asexual development. We invite the scientific community to use this resource as a reference for the anatomy and developmental ontology of B. schlosseri and encourage recommendations for updates and improvements.

  11. AGA answers complaints on burner tip prices

    International Nuclear Information System (INIS)

    Anon.

    1992-01-01

    This paper reports that the American Gas Association has rebutted complaints that natural gas prices have dropped at the wellhead but not at the burner tip. AGA Pres. Mike Baly the an association study of the issue found that all classes of customers paid less for gas in 1991 than they did in 1984, when gas prices were at their peak. He the, the study also shows that 100% of the wellhead price decline has been passed through to natural gas consumers in the form of lower retail prices. Baly the the average cost of gas delivered to all customers classes fell by $1.12/Mcf from 1984 to 1991, which exceeds the $1.10/Mcf decline in average wellhead prices during the same period

  12. Plant Growth-Promoting Rhizobacteria Stimulate Vegetative Growth and Asexual Reproduction of Kalanchoe daigremontiana.

    Science.gov (United States)

    Park, Yong-Soon; Park, Kyungseok; Kloepper, Joseph W; Ryu, Choong-Min

    2015-09-01

    Certain bacterial species associate with plant roots in soil. The plant growth-promoting rhizobacteria (PGPR) stimulate plant growth and yield in greenhouse and field. Here, we examined whether application of known bacilli PGPR strains stimulated growth and asexual reproduction in the succulent plant Kalanchoe daigremontiana. Four PGPR strains B. amyloliquefaciens IN937a, B. cereus BS107, B. pumilus INR7, and B. subtilis GB03 were applied to young plantlets by soil-drenching, and plant growth and development was monitored for three months. Aerial growth was significantly stimulated in PGPR-inoculated plants, which was observed as increases in plant height, shoot weight, and stem width. The stimulated growth influenced plant development by increasing the total number of leaves per plant. Treatment with bacilli also increased the total root biomass compared with that of control plants, and led to a 2-fold increase in asexual reproduction and plantlet formation on the leaf. Collectively, our results firstly demonstrate that Bacillus spp. promote vegetative development of K. daigremontiana, and the enhanced growth stimulates asexual reproduction and plantlet formation.

  13. Plant Growth-Promoting Rhizobacteria Stimulate Vegetative Growth and Asexual Reproduction of Kalanchoe daigremontiana

    Directory of Open Access Journals (Sweden)

    Yong-Soon Park

    2015-09-01

    Full Text Available Certain bacterial species associate with plant roots in soil. The plant growth-promoting rhizobacteria (PGPR stimulate plant growth and yield in greenhouse and field. Here, we examined whether application of known bacilli PGPR strains stimulated growth and asexual reproduction in the succulent plant Kalanchoe daigremontiana. Four PGPR strains B. amyloliquefaciens IN937a, B. cereus BS107, B. pumilus INR7, and B. subtilis GB03 were applied to young plantlets by soil-drenching, and plant growth and development was monitored for three months. Aerial growth was significantly stimulated in PGPR-inoculated plants, which was observed as increases in plant height, shoot weight, and stem width. The stimulated growth influenced plant development by increasing the total number of leaves per plant. Treatment with bacilli also increased the total root biomass compared with that of control plants, and led to a 2-fold increase in asexual reproduction and plantlet formation on the leaf. Collectively, our results firstly demonstrate that Bacillus spp. promote vegetative development of K. daigremontiana, and the enhanced growth stimulates asexual reproduction and plantlet formation.

  14. Hybrid asexuality as a primary postzygotic barrier between nascent species: On the interconnection between asexuality, hybridization and speciation

    Czech Academy of Sciences Publication Activity Database

    Janko, Karel; Pačes, Jan; Wilkinson-Herbots, H.; Costa, R. J.; Roslein, Jan; Drozd, P.; Iakovenko, Nataliia; Rídl, J.; Hroudová, M.; Kočí, Jan; Reifová, R.; Šlechtová, Věra; Choleva, Lukáš

    2018-01-01

    Roč. 27, č. 1 (2018), s. 248-263 ISSN 0962-1083 R&D Projects: GA AV ČR KJB600450902; GA MŠk EF15_003/0000460; GA ČR GA13-12580S; GA ČR GA206/09/1298; GA ČR GAP506/10/1155; GA ČR GJ15-19947Y Institutional support: RVO:67985904 Keywords : balance hypothesis * coalescence * ecolution of asexuality * hybridization Subject RIV: EG - Zoology OBOR OECD: Zoology Impact factor: 6.086, year: 2016

  15. The roles of sexual and asexual reproduction in the origin and dissemination of strains causing fungal infectious disease outbreaks.

    Science.gov (United States)

    Ashu, Eta Ebasi; Xu, Jianping

    2015-12-01

    Sexual reproduction commonly refers to the reproductive process in which genomes from two sources are combined into a single cell through mating and then the zygote genomes are partitioned to progeny cells through meiosis. Reproduction in the absence of mating and meiosis is referred to as asexual or clonal reproduction. One major advantage of sexual reproduction is that it generates genetic variation among progeny which may allow for faster adaptation of the population to novel and/or stressful environments. However, adaptation to stressful or new environments can still occur through mutation, in the absence of sex. In this review, we analyzed the relative contributions of sexual and asexual reproduction in the origin and spread of strains causing fungal infectious diseases outbreaks. The necessity of sex and the ability of asexual fungi to initiate outbreaks are discussed. We propose a framework that relates the modes of reproduction to the origin and propagation of fungal disease outbreaks. Our analyses suggest that both sexual and asexual reproduction can play critical roles in the origin of outbreak strains and that the rapid spread of outbreak strains is often accomplished through asexual expansion. Copyright © 2015 Elsevier B.V. All rights reserved.

  16. Is meiosis a fundamental cause of inviability among sexual and asexual plants and animals?

    Science.gov (United States)

    Levitis, Daniel A; Zimmerman, Kolea; Pringle, Anne

    2017-08-16

    Differences in viability between asexually and sexually generated offspring strongly influence the selective advantage and therefore the prevalence of sexual reproduction (sex). However, no general principle predicts when sexual offspring will be more viable than asexual offspring. We hypothesize that when any kind of reproduction is based on a more complex cellular process, it will encompass more potential failure points, and therefore lower offspring viability. Asexual reproduction (asex) can be simpler than sex, when offspring are generated using only mitosis. However, when asex includes meiosis and meiotic restitution, gamete production is more complex than in sex. We test our hypothesis by comparing the viability of asexual and closely related sexual offspring across a wide range of plants and animals, and demonstrate that meiotic asex does result in lower viability than sex; without meiosis, asex is mechanistically simple and provides higher viability than sex. This phylogenetically robust pattern is supported in 42 of 44 comparisons drawn from diverse plants and animals, and is not explained by the other variables included in our model. Other mechanisms may impact viability, such as effects of reproductive mode on heterozygosity and subsequent viability, but we propose the complexity of cellular processes of reproduction, particularly meiosis, as a fundamental cause of early developmental failure and mortality. Meiosis, the leading cause of inviability in humans, emerges as a likely explanation of offspring inviability among diverse eukaryotes. © 2017 The Author(s).

  17. Differential evolution of asexual and sexual females in a benign culture environment

    Science.gov (United States)

    Snell, Terry W.

    2013-01-01

    Here we report one of the first investigations of evolvability of lifespan and reproduction in metazoans, examining both extrinsic and intrinsic factors. We tested effects on senescence of an environmental variable (simulated lake hydroperiod, the length of time an aquatic habitat is inundated), female reproductive physiology (asexual females that reproduce by ameiosis, versus sexual females reproducing by meiosis), and time in a benign culture environment (minimal, if any, external mortality factors). To do this we established chemostat cultures of the rotifer Brachionus plicatilis s.s., and maintained the cultures for 385 d. Hydroperiod alone or in interaction with the effects of time in the benign environment (season) or reproductive physiology had no significant effect on the net reproductive rate, generation time, or rate of aging. Yet combining animals from both ephemeral and permanent hydroperiods revealed a 26% increase in asexual female lifespan across seasons (23% decrease in the rate of aging) and a 56% increase in asexual fecundity, suggesting that maintenance in benign laboratory conditions leads to slower aging. The relative stasis of traits for sexual females implies an impact of reproductive physiology on evolvability. In addition we found a positive correlation between fecundity and lifespan, suggesting an absence of trade-offs in life history traits in the benign laboratory environment. PMID:24795527

  18. A Comparison of In Vitro and In Vivo Asexual Embryogenesis

    NARCIS (Netherlands)

    Hand, Melanie; Vries, de S.C.; Koltunow, Anna

    2016-01-01

    In plants, embryogenesis generally occurs through the sexual process of double fertilization, which involves a haploid sperm cell fusing with a haploid egg cell to ultimately give rise to a diploid embryo. Embryogenesis can also occur asexually in the absence of fertilization, both in vitro and in

  19. "Parim" on subjektiivne, aga kõhutundest ka ei piisa / Inga Kuusik

    Index Scriptorium Estoniae

    Kuusik, Inga, 1961-

    2007-01-01

    Ilmunud ka: Finansovõi Menedzhment : infovõpusk nr. 13 apr. lk. 6-7. Saku Õlletehase uus finantsjuht oma tööst tubakatootja Imperial Tobacco Grupi Kesk-Aasia regiooni finantsdirektorina Kõrgõzstanis, Saku Õlletehase kapitali struktuurist, finantsdirektori rollist ettevõttes ja tööjõu värbamisest Saku Õlletehases. Lisad: Saku Õlletehas 2006: mõõdukas käibe-, aga suur kasumikasv; Tabel: Saku Õlletehase dividendimaksed 1997-2007

  20. Cardiopulmonary dysfunction in the Osteogenesis imperfecta mouse model Aga2 and human patients are caused by bone-independent mechanisms.

    Science.gov (United States)

    Thiele, Frank; Cohrs, Christian M; Flor, Armando; Lisse, Thomas S; Przemeck, Gerhard K H; Horsch, Marion; Schrewe, Anja; Gailus-Durner, Valerie; Ivandic, Boris; Katus, Hugo A; Wurst, Wolfgang; Reisenberg, Catherine; Chaney, Hollis; Fuchs, Helmut; Hans, Wolfgang; Beckers, Johannes; Marini, Joan C; Hrabé de Angelis, Martin

    2012-08-15

    Osteogenesis imperfecta (OI) is an inherited connective tissue disorder with skeletal dysplasia of varying severity, predominantly caused by mutations in the collagen I genes (COL1A1/COL1A2). Extraskeletal findings such as cardiac and pulmonary complications are generally considered to be significant secondary features. Aga2, a murine model for human OI, was systemically analyzed in the German Mouse Clinic by means of in vivo and in vitro examinations of the cardiopulmonary system, to identify novel mechanisms accounting for perinatal lethality. Pulmonary and, especially, cardiac fibroblast of perinatal lethal Aga2/+ animals display a strong down-regulation of Col1a1 transcripts in vivo and in vitro, resulting in a loss of extracellular matrix integrity. In addition, dysregulated gene expression of Nppa, different types of collagen and Agt in heart and lung tissue support a bone-independent vicious cycle of heart dysfunction, including hypertrophy, loss of myocardial matrix integrity, pulmonary hypertension, pneumonia and hypoxia leading to death in Aga2. These murine findings are corroborated by a pediatric OI cohort study, displaying significant progressive decline in pulmonary function and restrictive pulmonary disease independent of scoliosis. Most participants show mild cardiac valvular regurgitation, independent of pulmonary and skeletal findings. Data obtained from human OI patients and the mouse model Aga2 provide novel evidence for primary effects of type I collagen mutations on the heart and lung. The findings will have potential benefits of anticipatory clinical exams and early intervention in OI patients.

  1. Hybrid asexuality as a primary postzygotic barrier between nascent species: On the interconnection between asexuality, hybridization and speciation

    Czech Academy of Sciences Publication Activity Database

    Janko, K.; Pačes, Jan; Wilkinson-Herbots, H.; Costa, R. J.; Roslein, J.; Drozd, P.; Iakovenko, N.; Rídl, Jakub; Hroudová, Miluše; Kočí, J.; Reifová, R.; Šlechtová, V.; Choleva, L.

    2018-01-01

    Roč. 27, č. 1 (2018), s. 248-263 ISSN 0962-1083 R&D Projects: GA AV ČR KJB600450902; GA MŠk(CZ) LM2015047; GA ČR GA13-12580S; GA ČR GA206/09/1298; GA ČR GAP506/10/1155; GA ČR GJ15-19947Y; GA MŠk EF15_003/0000460 Institutional support: RVO:68378050 ; RVO:67985904 Keywords : balance hypothesis * coalescence * evolution of asexuality * hybridization * phylogeography * speciation Subject RIV: CE - Biochemistry OBOR OECD: Genetics and heredity (medical genetics to be 3) Impact factor: 6.086, year: 2016

  2. Exploiting the Adaptation Dynamics to Predict the Distribution of Beneficial Fitness Effects.

    Directory of Open Access Journals (Sweden)

    Sona John

    Full Text Available Adaptation of asexual populations is driven by beneficial mutations and therefore the dynamics of this process, besides other factors, depends on the distribution of beneficial fitness effects. It is known that on uncorrelated fitness landscapes, this distribution can only be of three types: truncated, exponential and power law. We performed extensive stochastic simulations to study the adaptation dynamics on rugged fitness landscapes, and identified two quantities that can be used to distinguish the underlying distribution of beneficial fitness effects. The first quantity studied here is the fitness difference between successive mutations that spread in the population, which is found to decrease in the case of truncated distributions, remains nearly a constant for exponentially decaying distributions and increases when the fitness distribution decays as a power law. The second quantity of interest, namely, the rate of change of fitness with time also shows quantitatively different behaviour for different beneficial fitness distributions. The patterns displayed by the two aforementioned quantities are found to hold good for both low and high mutation rates. We discuss how these patterns can be exploited to determine the distribution of beneficial fitness effects in microbial experiments.

  3. Asexual Reproduction Does Not Apparently Increase the Rate of Chromosomal Evolution: Karyotype Stability in Diploid and Triploid Clonal Hybrid Fish (Cobitis, Cypriniformes, Teleostei).

    Science.gov (United States)

    Majtánová, Zuzana; Choleva, Lukáš; Symonová, Radka; Ráb, Petr; Kotusz, Jan; Pekárik, Ladislav; Janko, Karel

    2016-01-01

    Interspecific hybridization, polyploidization and transitions from sexuality to asexuality considerably affect organismal genomes. Especially the last mentioned process has been assumed to play a significant role in the initiation of chromosomal rearrangements, causing increased rates of karyotype evolution. We used cytogenetic analysis and molecular dating of cladogenetic events to compare the rate of changes of chromosome morphology and karyotype in asexually and sexually reproducing counterparts in European spined loach fish (Cobitis). We studied metaphases of three sexually reproducing species and their diploid and polyploid hybrid clones of different age of origin. The material includes artificial F1 hybrid strains, representatives of lineage originated in Holocene epoch, and also individuals of an oldest known age to date (roughly 0.37 MYA). Thereafter we applied GISH technique as a marker to differentiate parental chromosomal sets in hybrids. Although the sexual species accumulated remarkable chromosomal rearrangements after their speciation, we observed no differences in chromosome numbers and/or morphology among karyotypes of asexual hybrids. These hybrids possess chromosome sets originating from respective parental species with no cytogenetically detectable recombinations, suggesting their integrity even in a long term. The switch to asexual reproduction thus did not provoke any significant acceleration of the rate of chromosomal evolution in Cobitis. Asexual animals described in other case studies reproduce ameiotically, while Cobitis hybrids described here produce eggs likely through modified meiosis. Therefore, our findings indicate that the effect of asexuality on the rate of chromosomal change may be context-dependent rather than universal and related to particular type of asexual reproduction.

  4. Asexual Reproduction Does Not Apparently Increase the Rate of Chromosomal Evolution: Karyotype Stability in Diploid and Triploid Clonal Hybrid Fish (Cobitis, Cypriniformes, Teleostei.

    Directory of Open Access Journals (Sweden)

    Zuzana Majtánová

    Full Text Available Interspecific hybridization, polyploidization and transitions from sexuality to asexuality considerably affect organismal genomes. Especially the last mentioned process has been assumed to play a significant role in the initiation of chromosomal rearrangements, causing increased rates of karyotype evolution. We used cytogenetic analysis and molecular dating of cladogenetic events to compare the rate of changes of chromosome morphology and karyotype in asexually and sexually reproducing counterparts in European spined loach fish (Cobitis. We studied metaphases of three sexually reproducing species and their diploid and polyploid hybrid clones of different age of origin. The material includes artificial F1 hybrid strains, representatives of lineage originated in Holocene epoch, and also individuals of an oldest known age to date (roughly 0.37 MYA. Thereafter we applied GISH technique as a marker to differentiate parental chromosomal sets in hybrids. Although the sexual species accumulated remarkable chromosomal rearrangements after their speciation, we observed no differences in chromosome numbers and/or morphology among karyotypes of asexual hybrids. These hybrids possess chromosome sets originating from respective parental species with no cytogenetically detectable recombinations, suggesting their integrity even in a long term. The switch to asexual reproduction thus did not provoke any significant acceleration of the rate of chromosomal evolution in Cobitis. Asexual animals described in other case studies reproduce ameiotically, while Cobitis hybrids described here produce eggs likely through modified meiosis. Therefore, our findings indicate that the effect of asexuality on the rate of chromosomal change may be context-dependent rather than universal and related to particular type of asexual reproduction.

  5. A novel base change leading to Hb Vanderbilt [β89(F5)Ser→Arg, AGT>AGA].

    Science.gov (United States)

    Goodyer, Matthew J; Elhassadi, Ezzat I; Percy, Melanie J; McMullin, Mary F

    2011-01-01

    We describe a high oxygen affinity hemoglobin (Hb) variant (Hb Vanderbilt) as a result of a heterozygous novel base change from T to A at codon 89 (AGT>AGA) leading to an amino acid change from serine to arginine.

  6. The effect of newly induced mutations on the fitness of genotypes and populations of yeast (Saccharomyces cerevisiae).

    Science.gov (United States)

    Orthen, E; Lange, P; Wöhrmann, K

    1984-12-01

    This paper analyses the fate of artificially induced mutations and their importance to the fitness of populations of the yeast, Saccharomyces cerevisiae, an increasingly important model organism in population genetics. Diploid strains, treated with UV and EMS, were cultured asexually for approximately 540 generations and under conditions where the asexual growth was interrupted by a sexual phase. Growth rates of 100 randomly sampled diploid clones were estimated at the beginning and at the end of the experiment. After the induction of sporulation the growth rates of 100 randomly sampled spores were measured. UV and EMS treatment decreases the average growth rate of the clones significantly but increases the variability in comparison to the untreated control. After selection over approximately 540 generations, variability in growth rates was reduced to that of the untreated control. No increase in mean population fitness was observed. However, the results show that after selection there still exists a large amount of hidden genetic variability in the populations which is revealed when the clones are cultivated in environments other than those in which selection took place. A sexual phase increased the reduction of the induced variability.

  7. Lycosides, Unusual Carotenoid-Derived Terpenoid Glycosides from a Vegetable Juice, Inhibit Asexual Reproduction of the Plant Pathogen Phytophthora.

    Science.gov (United States)

    Iwai, Rika; Han, Chunguang; Govindam, Sudhakar V S; Ojika, Makoto

    2018-01-10

    Vegetable juices, typical culture media for the plant pathogen Phytophthora, effectively induce its asexual reproduction (zoosporangia formation). However, some chromatographic fractions from a vegetable juice were found to inhibit asexual reproduction. Bioassay-guided chromatographic steps led to the isolation of four novel compounds, named lycosides A-D, 1-4, that could be metabolic products from a carotenoid. They showed 50% inhibitory activity against the asexual reproduction of P. capsici at 2.1-7.6 μM. The structure-activity relationship and the universality of the inhibitory activity within the Phytophthora genus were also investigated. In addition, the quantitative analysis of lycosides in fresh vegetables and vegetable juices revealed that tomato is the source of these active substances. These food-derived chemicals could help provide safe agents to control the outbreak of the agricultural pest Phytophthora in fields.

  8. Lineage dynamics and mutation-selection balance in non-adapting asexual populations

    Science.gov (United States)

    Pénisson, Sophie; Sniegowski, Paul D.; Colato, Alexandre; Gerrish, Philip J.

    2013-02-01

    In classical population genetics, mutation-selection balance refers to the equilibrium frequency of a deleterious allele established and maintained under two opposing forces: recurrent mutation, which tends to increase the frequency of the allele; and selection, which tends to decrease its frequency. In a haploid population, if μ denotes the per capita rate of production of the deleterious allele by mutation and s denotes the selective disadvantage of carrying the allele, then the classical mutation-selection balance frequency of the allele is approximated by μ/s. This calculation assumes that lineages carrying the mutant allele in question—the ‘focal allele’—do not accumulate deleterious mutations linked to the focal allele. In principle, indirect selection against the focal allele caused by such additional mutations can decrease the frequency of the focal allele below the classical mutation-selection balance. This effect of indirect selection will be strongest in an asexual population, in which the entire genome is in linkage. Here, we use an approach based on a multitype branching process to investigate this effect, analyzing lineage dynamics under mutation, direct selection, and indirect selection in a non-adapting asexual population. We find that the equilibrium balance between recurrent mutation to the focal allele and the forces of direct and indirect selection against the focal allele is closely approximated by γμ/(s + U) (s = 0 if the focal allele is neutral), where γ ≈ eθθ-(ω+θ)(ω + θ)(Γ(ω + θ) - Γ(ω + θ,θ)), \\theta =U/\\tilde {s}, and \\omega =s/\\tilde {s}; U denotes the genomic deleterious mutation rate and \\tilde {s} denotes the geometric mean selective disadvantage of deleterious mutations elsewhere on the genome. This mutation-selection balance for asexual populations can remain surprisingly invariant over wide ranges of the mutation rate.

  9. Morphology offers no clues to asexual vs. sexual origin of small Acropora cervicornis (Scleractinia: Acroporidae colonies

    Directory of Open Access Journals (Sweden)

    D. E Williams

    2006-12-01

    Full Text Available Sexual recruitment of the staghorn coral, Acropora cervicornis, is accepted to be very rare. Instead, these branching corals proliferate through fragmentation leading to dense mono-specific and possibly monoclonal stands. For acroporid corals, which have suffered drastic population declines, dominance of asexual reproduction results in low levels of genotypic diversity and limited ability to re-colonize extirpated areas. Small colonies with a single encrusting, symmetrical base, and few incipient branches are frequently presumed to be the result of a settled planula (i.e. sexual reproduction. Here, we show that colonies fitting this description (i.e., presumed sexual recruits can result from asexual fragmentation. Acropora cervicornis colonies (~20 cm diameter were tagged and observed over eighteen months. In several cases, colony offshoots fused with the adjacent substrate forming secondary disc-like attachment points. Following natural fragmentation, these discs of tissue became separated from the original colony, and were observed to heal and give rise to smaller colonies with striking similarity to the expected morphology of a sexual recruit. Thus, presuming a colony is a sexual recruit based on appearance is unreliable and may lead to inflated expectations of genetic diversity among populations. The accurate assessment of recruitment and genetic diversity is crucial to predicting the recovery potential of these imperiled and ecologically irreplaceable reef corals. Rev. Biol. Trop. 54 (Suppl. 3: 145-151. Epub 2007 Jan. 15.Se ha aceptado que el reclutamiento sexual del coral asta de venado, Acropora cervicornis, es muy raro. Por el contrario, estos corales ramificados proliferan a través de fragmentación, generando densas bases monoespecíficas e incluso monoclonales. Para corales acropóridos, los cuales han sufrido disminuciones de población drásticas, la dominancia de reproducción asexual resulta en bajos niveles de diversidad genot

  10. Evidence of parasexual activity in "asexual amoebae" Cochliopodium spp. (Amoebozoa): extensive cellular and nuclear fusion.

    Science.gov (United States)

    Tekle, Yonas I; Anderson, O Roger; Lecky, Ariel F

    2014-09-01

    The majority of microbial eukaryotes have long been considered asexual, though new evidence indicates sex, or sexual-like (parasexual) behaviors that deviate from the usual union of two gametes, among other variant aspects. Over a dozen amoebozoans are implicated to have sexual stages. However, the exact mechanism by which sex occurs in these lineages remains elusive. This is mainly due to the diverse quality and cryptic nature of their life cycle. In this study we present evidence of some previously unreported aspects of the life cycle of an amoeba, Cochliopodium, that undergoes unusual intraspecific interactions using light microscopy and immunocytochemistry. Similar to other amoebozoans, Cochliopodium, is considered asexual with no published reports of sex or parasexuality. We also investigated environmental conditions that govern the observed intraspecific interactions. Both light microscopic and immunocytochemistry evidence demonstrates Cochliopodium undergoes cellular fusion (plasmogamy) and nuclear fusion (karyogamy). Large plasmodia eventually undergo karyogamy and contain large fused, polyploid, nuclei. These are observed to fragment, subsequently, by karyotomy (nuclear fission) and cytoplasmic fission to yield uninucleated amoebae. This process could lead to a non-meiotic, parasexual exchange of chromosomes in Cochliopodium. These findings strongly suggest that Cochliopodium is involved in parasexual activity and should no longer be considered strictly asexual. Copyright © 2014 Elsevier GmbH. All rights reserved.

  11. The German Working Group of Obesity in Childhood and Adolescence (AGA): improving the quality of care for overweight and obese children in Germany.

    Science.gov (United States)

    Reinehr, Thomas; Holl, Reinhard W; Wabitsch, Martin

    2008-01-01

    The Working Group of Obesity in Childhood and Adolescence (AGA) comprises scientists, clinicians, and therapists dealing with obesity in children and adolescents. More than 250 pediatricians, psychiatrics, dieticians, psychologists and sports therapists are integrated. On an international level, the AGA cooperates with the European Childhood Obesity Group and the International Obesity Taskforce (IOTF) for Childhood Obesity. The aims of the AGA are to initiate clinical and scientific studies, to join diagnostic, therapeutic and scientific centers, to improve the education, to support self-help groups, and to standardize diagnostic and therapeutic procedures in the field of obesity in childhood and adolescence. The milestones in the history of the AGA are the consensus process to define overweight and obesity in Germany, the development of guidelines for diagnostic procedures and treatment of obesity in childhood and adolescence, the determination of all therapy centers for obese children and adolescents in Germany, the development of a PC software (APV) to document longitudinally diagnostic and therapeutic procedures as well as outcomes by a quality management program, the certification of therapeutic institutions, and the implementation of prevention and treatment studies. As effect of these initiatives, the quality of care in overweight children has been improved in the last years. For example, the APV quality program demonstrated an increase of diagnostic procedures such as blood pressure measurement in the last 4 years. Copyright 2008 S. Karger AG, Basel.

  12. Changes in genomic methylation patterns during the formation of triploid asexual dandelion lineages

    NARCIS (Netherlands)

    Verhoeven, K.J.F.; Van Dijk, P.J.; Biere, A.

    2010-01-01

    DNA methylation is an epigenetic mechanism that has the potential to affect plant phenotypes and that is responsive to environmental and genomic stresses such as hybridization and polyploidization. We explored de novo methylation variation that arises during the formation of triploid asexual

  13. Characterization of leaf area of Agave fourcroydes Lem. plants obtained from asexual propagation

    Directory of Open Access Journals (Sweden)

    Maryla Sosa del Castillo

    2014-01-01

    Full Text Available The henequen (Agave fourcroydes Lem. is a crop of great economic importance. This study was aimed to characterize the leaf surface of henequen plants variety `Sac Ki' obtained by asexual propagation methods. In vitro plants, shoots of bulbils of in vitro plants, shoots of rhizomes of in vitro plants, shoots of bulbils of field plants and shoots of field rhizomes were used. At 7 and 15 months after planting in the nursery, the epidermis was characterized through the stomatal index and stomatal density. Moreover, the conductor vessels and fiber bundles in leaf mesophyll, were characterized. It was found that the leaf surface of henequen plants variety `Sac Ki' obtained by different methods of asexual propagation showed similar anatomical structures. However, it was observed that in vitro plants were different from the rest in terms of stomatal index and stomatal density in both time points. It was suggesting a accommodate response to environmental conditions. Key words: stomatic density, stomatic index, in vitro plants

  14. From bad to good: Fitness reversals and the ascent of deleterious mutations.

    Directory of Open Access Journals (Sweden)

    Matthew C Cowperthwaite

    2006-10-01

    Full Text Available Deleterious mutations are considered a major impediment to adaptation, and there are straightforward expectations for the rate at which they accumulate as a function of population size and mutation rate. In a simulation model of an evolving population of asexually replicating RNA molecules, initially deleterious mutations accumulated at rates nearly equal to that of initially beneficial mutations, without impeding evolutionary progress. As the mutation rate was increased within a moderate range, deleterious mutation accumulation and mean fitness improvement both increased. The fixation rates were higher than predicted by many population-genetic models. This seemingly paradoxical result was resolved in part by the observation that, during the time to fixation, the selection coefficient (s of initially deleterious mutations reversed to confer a selective advantage. Significantly, more than half of the fixations of initially deleterious mutations involved fitness reversals. These fitness reversals had a substantial effect on the total fitness of the genome and thus contributed to its success in the population. Despite the relative importance of fitness reversals, however, the probabilities of fixation for both initially beneficial and initially deleterious mutations were exceedingly small (on the order of 10(-5 of all mutations.

  15. Natural epigenetic variation contributes to heritable flowering divergence in a widespread asexual dandelion lineage

    NARCIS (Netherlands)

    Wilschut, R.A.; Oplaat, C.; Snoek, B.; Kirschner, J.; Verhoeven, K.J.F.

    2016-01-01

    Epigenetic variation has been proposed to contribute to the success of asexual plants, either as a contributor to phenotypic plasticity or by enabling transient adaptation via selection on transgenerationally stable, but reversible, epialleles. While recent studies in experimental plant populations

  16. The effect of sex on the mean and variance of fitness in facultatively sexual rotifers.

    Science.gov (United States)

    Becks, L; Agrawal, A F

    2011-03-01

    The evolution of sex is a classic problem in evolutionary biology. While this topic has been the focus of much theoretical work, there is a serious dearth of empirical data. A simple yet fundamental question is how sex affects the mean and variance in fitness. Despite its importance to the theory, this type of data is available for only a handful of taxa. Here, we report two experiments in which we measure the effect of sex on the mean and variance in fitness in the monogonont rotifer, Brachionus calyciflorus. Compared to asexually derived offspring, we find that sexual offspring have lower mean fitness and less genetic variance in fitness. These results indicate that, at least in the laboratory, there are both short- and long-term disadvantages associated with sexual reproduction. We briefly review the other available data and highlight the need for future work. © 2010 The Authors. Journal of Evolutionary Biology © 2010 European Society For Evolutionary Biology.

  17. Fitness consequences of occasional outcrossing in a functionally asexual plant (Oenothera biennis).

    Science.gov (United States)

    Maron, John L; Johnson, Marc T J; Hastings, Amy P; Agrawal, Anurag A

    2018-02-01

    Many clonal organisms occasionally outcross, but the long-term consequences of such infrequent events are often unknown. During five years, representing three to five plant generations, we followed 16 experimental field populations of the forb, Oenothera biennis, originally planted with the same 18 original genotypes. Oenothera biennis usually self fertilizes, which, due to its genetic system (permanent translocation heterozygosity), results in seeds that are clones of the maternal plant. However, rare outcrossing produces genetically novel offspring (but without recombination or increased heterozygosity). We sought to understand whether novel genotypes produced through natural outcrossing had greater fecundity or different multigenerational dynamics compared to our original genotypes. We further assessed whether any differences in fitness or abundances through time between original and novel genotypes were exaggerated in the presence vs. absence of insect herbivores. Over the course of the experiment, we genotyped >12,500 plants using microsatellite DNA markers to identify and track the frequency of specific genotypes and estimated fecundity on a subset (>3,000) of plants. The effective outcrossing rate was 7.3% in the first year and ultimately 50% of the plants were of outcrossed origin by the final year of the experiment. Lifetime fruit production per plant was on average 32% higher across all novel genotypes produced via outcrossing compared to the original genotypes, and this fecundity advantage was significantly enhanced in populations lacking herbivores. Among 43 novel genotypes that were abundant enough to phenotype with replication, plants produced nearly 30% more fruits than the average of their specific two parental genotypes, and marginally more fruits (8%) than their most fecund parent. Mean per capita fecundity of novel genotypes predicted their relative frequencies at the end of the experiment. Novel genotypes increased more dramatically in

  18. Memory and obesity affect the population dynamics of asexual freshwater planarians

    International Nuclear Information System (INIS)

    Dunkel, Jörn; Talbot, Jared; Schötz, Eva-Maria

    2011-01-01

    Asexual reproduction in multicellular organisms is a complex biophysical process that is not yet well understood quantitatively. Here, we report a detailed population study for the asexual freshwater planarian Schmidtea mediterranea, which can reproduce via transverse fission due to a large stem cell contingent. Our long-term observations of isolated non-interacting planarian populations reveal that the characteristic fission waiting time distributions for head and tail fragments differ significantly from each other. The stochastic fission dynamics of tail fragments exhibits non-negligible memory effects, implying that an accurate mathematical description of future data should be based on non-Markovian tree models. By comparing the effective growth of non-interacting planarian populations with those of self-interacting populations, we are able to quantify the influence of interactions between flatworms and physical conditions on the population growth. A surprising result is the non-monotonic relationship between effective population growth rate and nutrient supply: planarians exhibit a tendency to become 'obese' if the feeding frequency exceeds a critical level, resulting in a decreased reproduction activity. This suggests that these flatworms, which possess many genes homologous to those of humans, could become a new model system for studying dietary effects on reproduction and regeneration in multicellular organisms

  19. "Asexual propagation of a virulent clone complex in human and feline outbreak of sporotrichosis"

    NARCIS (Netherlands)

    Teixeira, Marcus de Melo; Rodrigues, Anderson Messias; Tsui, Clement K M; de Almeida, Luiz Gonzaga Paulo; Van Diepeningen, Anne D; Gerrits van den Ende, Bert; Fernandes, Geisa Ferreira; Kano, Rui; Hamelin, Richard C; Lopes-Bezerra, Leila Maria; Ribeiro Vasconcelos, Ana Tereza; de Hoog, Sybren; de Camargo, Zoilo Pires; Felipe, Maria Sueli Soares

    2014-01-01

    Sporotrichosis is one of the most frequent subcutaneous fungal infections to human and animals caused by members of the plant-associated, dimorphic genus Sporothrix. Three of the four medically important Sporothrix species found in Brazil have been considered asexual, as no sexual stage has ever

  20. Enzymatic liquefaction of agarose above the sol-gel transition temperature using a thermostable endo-type β-agarase, Aga16B.

    Science.gov (United States)

    Kim, Jung Hyun; Yun, Eun Ju; Seo, Nari; Yu, Sora; Kim, Dong Hyun; Cho, Kyung Mun; An, Hyun Joo; Kim, Jae-Han; Choi, In-Geol; Kim, Kyoung Heon

    2017-02-01

    The main carbohydrate of red macroalgae is agarose, a heterogeneous polysaccharide composed of D-galactose and 3,6-anhydro-L-galactose. When saccharifying agarose by enzymes, the unique physical properties of agarose, namely the sol-gel transition and the near-insolubility of agarose in water, limit the accessibility of agarose to the enzymes. Due to the lower accessibility of agarose to enzymes in the gel state than to the sol state, it is important to prevent the sol-gel transition by performing the enzymatic liquefaction of agarose at a temperature higher than the sol-gel transition temperature of agarose. In this study, a thermostable endo-type β-agarase, Aga16B, originating from Saccharophagus degradans 2-40 T , was characterized and introduced in the liquefaction process. Aga16B was thermostable up to 50 °C and depolymerized agarose mainly into neoagarooligosaccharides with degrees of polymerization 4 and 6. Aga16B was applied to enzymatic liquefaction of agarose at 45 °C, which was above the sol-gel transition temperature of 1 % (w/v) agarose (∼35 °C) when cooling agarose. This is the first systematic demonstration of enzymatic liquefaction of agarose, enabled by determining the sol-gel temperature of agarose under specific conditions and by characterizing the thermostability of an endo-type β-agarase.

  1. Evaluation of lipid and glucose metabolism and cortisol and thyroid hormone levels in obese appropriate for gestational age (AGA) born and non-obese small for gestational age (SGA) born prepubertal Slovak children.

    Science.gov (United States)

    Blusková, Zuzana; Koštálová, Ludmila; Celec, Peter; Vitáriušová, Eva; Pribilincová, Zuzana; Maršálková, Marianna; Šemberová, Jana; Kyselová, Tatiana; Hlavatá, Anna; Kovács, László

    2014-07-01

    Obesity is the major determinant of metabolic syndrome. Being born small for gestational age (SGA) may be co-responsible. We aimed at evaluating the association between 1. obesity and 2. being born SGA and the presence of endocrine-metabolic abnormalities in prepubertal Slovak children. The study included 98 children, aged 3-10.9 years: 36 AGA-born obese children (OB), 31 SGA-born children (SGA) and 31 appropriate for gestational age born non-obese children (AGA). Fasting serum levels of glucose, total cholesterol, LDL, HDL, triglycerides, fT4, TSH, cortisol and insulin were determined. HOMA-IR was calculated. Personal data about birth weight and length and family history were collected. Actual anthropometric measurement was done. In every group, high prevalence of positive family history of metabolic disorder was found. In comparison with AGA children, OB children were taller (plevels and homeostasis model assessment for insulin resistance (HOMA-IR) (pcortisol levels (p=0.069) was noted. SGA-born children were shorter (plevels (plevels (p=0.085) and increased fT4 levels (pobese children and twice more metabolic abnormalities were present in SGA-born children in comparison with AGA-born children. SGA-born children are more prone to developing endocrine-metabolic abnormalities than non-obese children born AGA, but they are at less risk than obese AGA-born children. We should provide specialized care for obese children already in prepubertal age and pay attention to SGA-born children.

  2. Mating type gene analysis in apparently asexual Cercospora species is suggestive of cryptic sex

    NARCIS (Netherlands)

    Groenewald, M.; Groenewald, J.Z.; Harrington, T.C.; Abeln, E.C.A.; Crous, P.W.

    2006-01-01

    The genus Cercospora consists of numerous important, apparently asexual plant pathogens. We designed degenerate primers from homologous sequences in related species to amplify part of the C. apii, C. apiicola, C. beticola, C. zeae-maydis and C. zeina mating type genes. Chromosome walking was used to

  3. Induction of cell death on Plasmodium falciparum asexual blood stages by Solanum nudum steroids

    DEFF Research Database (Denmark)

    López, Mary Luz; Vommaro, Rossiane; Zalis, Mariano

    2010-01-01

    Solanum nudum Dunal (Solanaceae) is a plant used in traditional medicine in Colombian Pacific Coast, from which five steroids denominated SNs have been isolated. The SNs compounds have antiplasmodial activity against asexual blood stages of Plasmodium falciparum strain 7G8 with an IC50 between 20...

  4. Profiling the repertoire of phenotypes influenced by environmental cues that occur during asexual reproduction.

    Science.gov (United States)

    Dombrovsky, Aviv; Arthaud, Laury; Ledger, Terence N; Tares, Sophie; Robichon, Alain

    2009-11-01

    The aphid Acyrthosiphon pisum population is composed of different morphs, such as winged and wingless parthenogens, males, and sexual females. The combined effect of reduced photoperiodicity and cold in fall triggers the apparition of sexual morphs. In contrast they reproduce asexually in spring and summer. In our current study, we provide evidence that clonal individuals display phenotypic variability within asexual morph categories. We describe that clones sharing the same morphological features, which arose from the same founder mother, constitute a repertoire of variants with distinct behavioral and physiological traits. Our results suggest that the prevailing environmental conditions influence the recruitment of adaptive phenotypes from a cohort of clonal individuals exhibiting considerable molecular diversity. However, we observed that the variability might be reduced or enhanced by external factors, but is never abolished in accordance with a model of stochastically produced phenotypes. This overall mechanism allows the renewal of colonies from a few adapted individuals that survive drastic episodic changes in a fluctuating environment.

  5. Neoplasia yield and colonoscopic workload of surveillance regimes for colorectal cancer in colitis patients: a retrospective study comparing the performance of the updated AGA and BSG guidelines.

    Science.gov (United States)

    Mooiweer, Erik; van der Meulen, Andrea E; van Bodegraven, Adriaan A; Jansen, Jeroen M; Mahmmod, Nofel; Nijsten, Joyce; van Oijen, Martijn G H; Siersema, Peter D; Oldenburg, Bas

    2013-11-01

    Due to the increased risk of colorectal cancer, colonoscopic surveillance is recommended for patients with ulcerative and Crohn's colitis. Because surveillance intervals differ considerably between the recently updated American Gastroenterological Association (AGA) and British Society of Gastroenterology (BSG) guidelines, we compared the neoplasia yield and colonoscopic workload of these guidelines. Patients with inflammatory bowel disease undergoing surveillance were identified using medical records. Patients were stratified according to the BSG and AGA guidelines, and corresponding colonoscopic workload was calculated based on the risk factors present during follow-up. The incidence of colitis-associated neoplasia (CAN), defined as a low-grade dysplasia in flat mucosa or a non-adenoma-like mass, high-grade dysplasia, or colorectal cancer was compared between the risk groups of either guidelines. In total, 1018 patients with inflammatory bowel disease who underwent surveillance were identified. Using the AGA surveillance intervals, 64 patients (6%) were assigned to annual and 954 patients (94%) to biannual surveillance, resulting in 541 colonoscopies per year. The yield of CAN was 5.3% and 20.3% in the low- and high-risk groups, respectively (P = 0.02). Using the BSG surveillance intervals, 204 patients received surveillance annually (20%), 393 patients every 3 years (39%), and 421 patients every 5 years (41%), resulting in 420 colonoscopies per year, which is 22% lower than the AGA guidelines. The yield of CAN was 3.6%, 6.9%, and 10.8%, for the low-, intermediate-, and high-risk groups, respectively (P = 0.26). Although the BSG surveillance intervals offer the advantage of a lower colonoscopic workload, the risk stratification of the AGA seems superior in distinguishing patients at higher risk of CAN.

  6. Potato (Solanum tuberosum) greenhouse tuber production as an assay for asexual reproduction effects from herbicides

    Science.gov (United States)

    The present study determined whether young potato plants can be used as an assay to indicate potential effects of pesticides on asexual reproduction. Solanum tuberosum (Russet Burbank) plants were grown from seed pieces in a mineral soil in pots under greenhouse conditions. Plant...

  7. An Assessment of the AGA and CCFA Quality Indicators in a Sample of Patients Diagnosed with Inflammatory Bowel Disease.

    Science.gov (United States)

    Tkacz, Joseph; Brady, Brenna L; Meyer, Roxanne; Lofland, Jennifer H; Ruetsch, Charles; Coelho-Prabhu, Nayantara

    2015-11-01

    Inflammatory bowel disease (IBD) is a chronic relapsing disease characterized by activation of the mucosal immune system and inflammation of the gastrointestinal tract. Management of IBD places a significant burden on the health care system because of the complexity of treatment, variability in patient outcomes, and chronic nature of the disease.  To investigate the American Gastroenterological Association (AGA) and Crohn's and Colitis Foundation of America's (CCFA) quality measurement sets in a sample of IBD patients. Fourteen quality measures were restated for application to a claims database and calculated using Optum Clinformatics DataMart database. Selected measures were calculated over calendar year 2011. Performance measures ranged from 0.4% for AGA measure 9, prophylaxis for venous thromboembolism, to 66.9% for AGA measure 8, testing for Clostridium difficile. CCFA outcome measures ranged from 0.6% qualifying for CCFA O10, report of fecal incontinence, to 32.9% for CCFA O1, prednisone usage. In addition to Clostridium difficile testing, the use of appropriate corticosteroid-sparing therapy (51.1%) and testing for latent tuberculosis before initiating anti-tumor necrosis factor therapy (45.0%) were the highest achieved measures. This is the first examination of IBD quality measures using administrative claims. Rates of achievement across measures were variable and likely affected by the ability to calculate certain measures with claims data. Future studies should further examine measurement of IBD quality indicators in claims data to assess the validity of claims-based analyses and to ascertain whether measure attainment translates into better overall health or IBD-related outcomes.

  8. speciation through asexuality in fish: postzygotic reproductive isolation may be completed in spite of fertility of hybrids

    Directory of Open Access Journals (Sweden)

    Karel Janko

    2015-12-01

    Altogether, it appears that initiation of hybrid asexuality and the completion of speciation process through formation of postRIMs are interconnected phenomena. Both processes are linked to the genetic divergence of hybridizing taxa: initially, hybridization between little diverged species leads to recombinant and fertile hybrids allowing intensive gene flow. As the hybridizing taxa continue to diverge, clonally reproducing hybrid females and sterile males become dominant and the gene flow ceases. The speciation may therefore be completed through asexuality of hybrids The work was supported by grant no. 13-12580S provided by the Czech Science Foundation (www.gacr.cz. Further support was provided by the Academy of Sciences of the Czech Republic (www.cas.cz by the grant no. RVO 67985904

  9. Stapled hemorrhoidopexy: The Aga Khan University Hospital Experience

    International Nuclear Information System (INIS)

    Athar, Ali; Chawla, Tabish; Turab, Pishori

    2009-01-01

    Stapled hemorrhoidopexy for prolapsing hemorrhoids is conceptually different from excision hemorrhoidectomy. It does not accompany the pain that usually occurs after resection of the sensitive anoderm. This study was carried out to evaluate the clinical outcome of stapled hemorrhoidopexy at The Aga Khan University Hospital. A sample of 140 patients with symptomatic second-, third-, and fourth-degree hemorrhoids and circumferential mucosal prolapse underwent stapled hemorrhoidopexy from July 2002 to July 2007. They were evaluated for postoperative morbidity, analgesic requirement, and recurrence. Seventy-eight percent were males and the mean age was 45 (range 16-90) years. The mean operative time was 35 (15-78) min. The mean parenteral analgesic doses during the first 24 h were 2.1. All patients received oral analgesics alone after 24 h. No significant postoperative morbidity was observed. The mean in-patient hospital stay was 1.3 (0-5) days. Patients were followed-up for 24 (range, 2-48) months. Minor local recurrence of hemorrhoids was seen in four patients and was managed by band ligation. Stapled hemorrhoidopexy procedure was found safe, well tolerated by patients with minimal parenteral analgesic use and early discharge from the hospital. (author)

  10. Effects of functionally asexual reproduction on quantitative genetic variation in the evening primroses (Oenothera, Onagraceae).

    Science.gov (United States)

    Godfrey, Ryan M; Johnson, Marc T J

    2014-11-01

    It has long been predicted that a loss of sexual reproduction leads to decreased heritable variation within populations and increased differentiation between populations. Despite an abundance of theory, there are few empirical tests of how sex affects genetic variation in phenotypic traits, especially for plants. Here we test whether repeated losses of two critical components of sex (recombination and segregation) in the evening primroses (Oenothera L., Onagraceae) affect quantitative genetic variation within and between populations. We sampled multiple genetic families from 3-5 populations from each of eight Oenothera species, which represented four independent transitions between sexual reproduction and a functionally asexual genetic system called "permanent translocation heterozygosity." We used quantitative genetics methods to partition genetic variation within and between populations for eight plant traits related to growth, leaf physiology, flowering, and resistance to herbivores. Heritability was, on average, 74% higher in sexual Oenothera populations than in functionally asexual populations, with plant growth rate, specific leaf area, and the percentage of leaf water content showing the strongest differences. By contrast, genetic differentiation among populations was 2.8× higher in functionally asexual vs. sexual Oenothera species. This difference was particularly strong for specific leaf area. Sexual populations tended to exhibit higher genetic correlations among traits, but this difference was weakly supported. These results support the prediction that sexual reproduction maintains higher genetic variation within populations, which may facilitate adaptive evolution. We also found partial support for the prediction that a loss of sex leads to greater population differentiation, which may elevate speciation rates. © 2014 Botanical Society of America, Inc.

  11. Distribution of Phoxinus eos, Phoxinus neogaeus, and their asexually-reproducing hybrids (Pisces: Cyprinidae in Algonquin Provincial Park, Ontario.

    Directory of Open Access Journals (Sweden)

    Jonathan A Mee

    Full Text Available Hybrid Phoxinus are one of the few asexually reproducing vertebrates species. The distribution of hybrid Phoxinus among lakes in Algonquin Park, Ontario, was evaluated relative to the distribution of parental species and relative to physiochemical lake characteristics. No association between the distribution of hybrids and the distribution of parental species was found, suggesting that the hybrids can successfully coexist with either parental species. In addition, we found no association between hybrid distribution and the physiochemical characteristics of lakes, suggesting that the hybrids are generalists with respect to the ecological niches available in Algonquin Park. There was a difference between the physiochemical characteristics of lakes with and without the parental species P. neogaeus. The lakes containing P. neogaeus were lower elevation than the lakes containing the other parental species, P. eos. The difference in distribution between the parental species may therefore be due to different dispersal abilities, to later arrival following post-glacial dispersal, or to differences in ecology. These results suggest that asexual reproduction is a successful strategy for hybrid Phoxinus in Algonquin Park because these sperm-dependent asexual hybrids are able to survive and persist regardless of which parental species is present, and regardless of the physiochemical characteristics of their habitat.

  12. “I am no male or female or any other, I have no sex”: a case report on asexuality

    Directory of Open Access Journals (Sweden)

    Niranjan Hebbar YR

    2017-12-01

    Full Text Available A rather less investigated field of sexual orientation, “asexuality” is spread out within the dimensions on lack of sexual attraction or interest on sexual behaviour, and on self-identification issues, or in combination of these. As sex is considered to be one of the basic instincts of human beings which has been followed since centuries, growing reports of asexuality is a concern against the evolution theory. There is lack of studies to assess the exact prevalence of asexuality in Indian setup. Here we are presenting a case of a 20-year-old male, who presented with self-identity issues with no preference for any particular sexual identity.

  13. Data from: Natural epigenetic variation contributes to heritable flowering divergence in a widespread asexual dandelion lineage

    NARCIS (Netherlands)

    Wilschut, Rutger; Oplaat, C.; Snoek, L.B.; Kirschner, J.; Verhoeven, K.J.F.

    2015-01-01

    Epigenetic variation has been proposed to contribute to the success of asexual plants, either as a contributor to phenotypic plasticity or by enabling transient adaptation via selection on transgenerationally stable, but reversible, epialleles. While recent studies in experimental plant populations

  14. Reciprocal sign epistasis between frequently experimentally evolved adaptive mutations causes a rugged fitness landscape.

    Directory of Open Access Journals (Sweden)

    Daniel J Kvitek

    2011-04-01

    Full Text Available The fitness landscape captures the relationship between genotype and evolutionary fitness and is a pervasive metaphor used to describe the possible evolutionary trajectories of adaptation. However, little is known about the actual shape of fitness landscapes, including whether valleys of low fitness create local fitness optima, acting as barriers to adaptive change. Here we provide evidence of a rugged molecular fitness landscape arising during an evolution experiment in an asexual population of Saccharomyces cerevisiae. We identify the mutations that arose during the evolution using whole-genome sequencing and use competitive fitness assays to describe the mutations individually responsible for adaptation. In addition, we find that a fitness valley between two adaptive mutations in the genes MTH1 and HXT6/HXT7 is caused by reciprocal sign epistasis, where the fitness cost of the double mutant prohibits the two mutations from being selected in the same genetic background. The constraint enforced by reciprocal sign epistasis causes the mutations to remain mutually exclusive during the experiment, even though adaptive mutations in these two genes occur several times in independent lineages during the experiment. Our results show that epistasis plays a key role during adaptation and that inter-genic interactions can act as barriers between adaptive solutions. These results also provide a new interpretation on the classic Dobzhansky-Muller model of reproductive isolation and display some surprising parallels with mutations in genes often associated with tumors.

  15. Dynamic formation of asexual diploid and polyploid lineages: multilocus analysis of Cobitis reveals the mechanisms maintaining the diversity of clones.

    Directory of Open Access Journals (Sweden)

    Karel Janko

    Full Text Available Given the hybrid genomic constitutions and increased ploidy of many asexual animals, the identification of processes governing the origin and maintenance of clonal diversity provides useful information about the evolutionary consequences of interspecific hybridization, asexuality and polyploidy. In order to understand the processes driving observed diversity of biotypes and clones in the Cobitis taenia hybrid complex, we performed fine-scale genetic analysis of Central European hybrid zone between two sexual species using microsatellite genotyping and mtDNA sequencing. We found that the hybrid zone is populated by an assemblage of clonally (gynogenetically reproducing di-, tri- and tetraploid hybrid lineages and that successful clones, which are able of spatial expansion, recruit from two ploidy levels, i.e. diploid and triploid. We further compared the distribution of observed estimates of clonal ages to theoretical distributions simulated under various assumptions and showed that new clones are most likely continuously recruited from ancestral populations. This suggests that the clonal diversity is maintained by dynamic equilibrium between origination and extinction of clonal lineages. On the other hand, an interclonal selection is implied by nonrandom spatial distribution of individual clones with respect to the coexisting sexual species. Importantly, there was no evidence for sexually reproducing hybrids or clonally reproducing non-hybrid forms. Together with previous successful laboratory synthesis of clonal Cobitis hybrids, our data thus provide the most compelling evidence that 1 the origin of asexuality is causally linked to interspecific hybridization; 2 successful establishment of clones is not restricted to one specific ploidy level and 3 the initiation of clonality and polyploidy may be dynamic and continuous in asexual complexes.

  16. Asexual queen succession mediates an accelerated colony life cycle in the termite Silvestritermes minutus

    Czech Academy of Sciences Publication Activity Database

    Fougeyrollas, R.; Křivánek, Jan; Roy, V.; Dolejšová, Klára; Frechault, S.; Roisin, Y.; Hanus, Robert; Sillam-Dusses, D.

    2017-01-01

    Roč. 26, č. 12 (2017), s. 3295-3308 ISSN 0962-1083 R&D Projects: GA ČR(CZ) GA14-12774S Institutional support: RVO:61388963 Keywords : asexual queen succession * breeding system * life history * parthenogenesis * Silvestritermes minutus * termites Subject RIV: EB - Genetics ; Molecular Biology OBOR OECD: Genetics and heredity (medical genetics to be 3) Impact factor: 6.086, year: 2016

  17. Widespread occurrence of lysine methylation in Plasmodium falciparum proteins at asexual blood stages.

    Science.gov (United States)

    Kaur, Inderjeet; Zeeshan, Mohammad; Saini, Ekta; Kaushik, Abhinav; Mohmmed, Asif; Gupta, Dinesh; Malhotra, Pawan

    2016-10-20

    Post-transcriptional and post-translational modifications play a major role in Plasmodium life cycle regulation. Lysine methylation of histone proteins is well documented in several organisms, however in recent years lysine methylation of proteins outside histone code is emerging out as an important post-translational modification (PTM). In the present study we have performed global analysis of lysine methylation of proteins in asexual blood stages of Plasmodium falciparum development. We immunoprecipitated stage specific Plasmodium lysates using anti-methyl lysine specific antibodies that immunostained the asexual blood stage parasites. Using liquid chromatography and tandem mass spectrometry analysis, 570 lysine methylated proteins at three different blood stages were identified. Analysis of the peptide sequences identified 605 methylated sites within 422 proteins. Functional classification of the methylated proteins revealed that the proteins are mainly involved in nucleotide metabolic processes, chromatin organization, transport, homeostatic processes and protein folding. The motif analysis of the methylated lysine peptides reveals novel motifs. Many of the identified lysine methylated proteins are also interacting partners/substrates of PfSET domain proteins as revealed by STRING database analysis. Our findings suggest that the protein methylation at lysine residues is widespread in Plasmodium and plays an important regulatory role in diverse set of the parasite pathways.

  18. Asexual propagation in the coral reef macroalga Halimeda (Chlorophyta, Bryopsidales) : production, dispersal and attachment of small fragments

    NARCIS (Netherlands)

    Walters, LJ; Coyer, JA; Hunter, CL; Beach, KS; Vroom, PS

    2002-01-01

    Siphonous, green macroalgae of the genus Halimeda are ubiquitous and ecologically important in tropical and subtropical marine environments. It has been hypothesized that the abundance of Halimeda on coral reefs is in part due to the ability of this genus to propagate asexually via vegetative

  19. Comparative Transcriptomic and Proteomic Analyses Reveal a FluG-Mediated Signaling Pathway Relating to Asexual Sporulation of Antrodia camphorata.

    Science.gov (United States)

    Li, Hua-Xiang; Lu, Zhen-Ming; Zhu, Qing; Gong, Jin-Song; Geng, Yan; Shi, Jin-Song; Xu, Zheng-Hong; Ma, Yan-He

    2017-09-01

    Medicinal mushroom Antrodia camphorata sporulate large numbers of arthroconidia in submerged fermentation, which is rarely reported in basidiomycetous fungi. Nevertheless, the molecular mechanisms underlying this asexual sporulation (conidiation) remain unclear. Here, we used comparative transcriptomic and proteomic approaches to elucidate possible signaling pathway relating to the asexual sporulation of A. camphorata. First, 104 differentially expressed proteins and 2586 differential cDNA sequences during the culture process of A. camphorata were identified by 2DE and RNA-seq, respectively. By applying bioinformatics analysis, a total of 67 genes which might play roles in the sporulation were obtained, and 18 of these genes, including fluG, sfgA, SfaD, flbA, flbB, flbC, flbD, nsdD, brlA, abaA, wetA, ganB, fadA, PkaA, veA, velB, vosA, and stuA might be involved in a potential FluG-mediated signaling pathway. Furthermore, the mRNA expression levels of the 18 genes in the proposed FluG-mediated signaling pathway were analyzed by quantitative real-time PCR. In summary, our study helps elucidate the molecular mechanisms underlying the asexual sporulation of A. camphorata, and provides also useful transcripts and proteome for further bioinformatics study of this valuable medicinal mushroom. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  20. Protein Kinase A subunits of the ascomycete pathogen Mycosphaerella graminicola regulate asexual fructification, filamentation, melanization and osmosensing

    NARCIS (Netherlands)

    Mehrabi, R.; Kema, G.H.J.

    2006-01-01

    As in many fungi, asexual reproduction of Mycosphaerella graminicola in planta is a complex process that requires proper differentiation of the infectious hyphae in the substomatal cavities of foliar tissue before pycnidia with conidia can be formed. In this study, we have investigated the role of

  1. Does gender affect career satisfaction and advancement in gastroenterology? Results of an AGA institute-sponsored survey.

    Science.gov (United States)

    Gerson, Lauren B; Twomey, Kay; Hecht, Gail; Lee, Linda; McQuaid, Ken; Pizarro, Theresa T; Street, Sarah; Yoshida, Cynthia; Early, Dayna

    2007-04-01

    Women comprise 19% of the American Gastroenterological Association (AGA) membership. We performed a prospective study to determine whether female gastroenterologists were less likely to achieve career advancement and satisfaction. We administered an online survey to AGA members from 2004-2006. The survey contained questions regarding effects of gender on career advancement, satisfaction with career, promotional policies, and integration of family and career. A total of 457 individuals (response rate 9% after 2 major invitations) completed the survey, including 262 (57%) women (20% in private practice, 53% in academic careers, and 27% trainees) and 195 men (23% in private practice, 58% in academic careers, and 19% trainees). The male gastroenterologists were significantly older (P careers for significantly more years (P = .002). There were no significant differences with respect to marital status, number of children, or number of hours worked between the genders. Men were more likely to achieve the rank of full professor (P = .035), and significantly more women reported that gender affected their career advancement (47% vs 9%; P careers reported less satisfaction with their careers (P = .01) and perceived more difficulty in achieving promotion and tenure. Women were more likely to choose private practice careers because of part-time options (P = .025). Equal numbers of men and women in practice reported difficulty balancing work and family life. Significantly more female than male gastroenterologists perceive that gender has affected their career advancement. Female academic gastroenterologists reported less overall career satisfaction and promotion than male academic gastroenterologists.

  2. Accelerated crossing of fitness valleys through division of labor and cheating in asexual populations

    Science.gov (United States)

    Komarova, Natalia L.; Urwin, Erin; Wodarz, Dominik

    2012-12-01

    Complex traits can require the accumulation of multiple mutations that are individually deleterious. Their evolution requires a fitness valley to be crossed, which can take relatively long time spans. A new evolutionary mechanism is described that accelerates the emergence of complex phenotypes, based on a ``division of labor'' game and the occurrence of cheaters. If each intermediate mutation leads to a product that can be shared with others, the complex type can arise relatively quickly as an emergent property among cooperating individuals, without any given individual having to accumulate all mutations. Moreover, the emergence of cheaters that destroy cooperative interactions can lead to the emergence of individuals that have accumulated all necessary mutations on a time scale that is significantly faster than observed in the absence of cooperation and cheating. Application of this mechanism to somatic and microbial evolution is discussed, including evolutionary processes in tumors, biofilms, and viral infections.

  3. The Fitness Consequences of Aneuploidy Are Driven by Condition-Dependent Gene Effects

    Science.gov (United States)

    Sunshine, Anna B.; Payen, Celia; Ong, Giang T.; Liachko, Ivan; Tan, Kean Ming; Dunham, Maitreya J.

    2015-01-01

    produce large, typically condition-dependent changes in fitness that are important drivers of increased fitness in asexually evolving populations. PMID:26011532

  4. The fitness consequences of aneuploidy are driven by condition-dependent gene effects.

    Directory of Open Access Journals (Sweden)

    Anna B Sunshine

    2015-05-01

    mutations that produce large, typically condition-dependent changes in fitness that are important drivers of increased fitness in asexually evolving populations.

  5. An analysis of Canada-US natural gas trade using the AGAS energy model

    International Nuclear Information System (INIS)

    Quon, D.; Wong, S.

    1989-01-01

    The strength of AGAS is that it was structurally designed to address the primary issue of EMF9, namely the medium and long-term prospects for Canada-US natural gas trade. Consequently, it is one of the very few models with the following necessary features: (1) it treats all the regions of Canada and the United States as one continental entity, both with respect to demand and supply; (2) All regional supplies and demands are integrated. Hence, regional gas prices are endogenous; inter-regional gas flows, including Canadian-US gas exchanges, are endogenous. Models that do not have both of these features require that the answers that are being sought have to be specified exogenously. An iterative procedure can be used to reconcile unrealistic results but only with difficulty

  6. Chromosome length scaling in haploid, asexual reproduction

    International Nuclear Information System (INIS)

    Oliveira, P M C de

    2007-01-01

    We study the genetic behaviour of a population formed by haploid individuals which reproduce asexually. The genetic information for each individual is stored along a bit-string (or chromosome) with L bits, where 0-bits represent the wild allele and 1-bits correspond to harmful mutations. Each newborn inherits this chromosome from its parent with a few random mutations: on average a fixed number m of bits are flipped. Selection is implemented according to the number N of 1-bits counted along the individual's chromosome: the smaller N the higher the probability an individual has to survive a new time step. Such a population evolves, with births and deaths, and its genetic distribution becomes stabilized after sufficiently many generations have passed. The question we pose concerns the procedure of increasing L. The aim is to get the same distribution of genetic loads N/L among the equilibrated population, in spite of a larger L. Should we keep the same mutation rate m/L for different values of L? The answer is yes, which intuitively seems to be plausible. However, this conclusion is not trivial, according to our simulation results: the question also involves the population size

  7. Virus epidemics can lead to a population-wide spread of intragenomic parasites in a previously parasite-free asexual population.

    Science.gov (United States)

    Jalasvuori, Matti; Lehtonen, Jussi

    2014-03-01

    Sexual reproduction is problematic to explain due to its costs, most notably the twofold cost of sex. Yet, sex has been suggested to be favourable in the presence of proliferating intragenomic parasites given that sexual recombination provides a mechanism to confine the accumulation of deleterious mutations. Kraaijeveld et al. compared recently the accumulation of transposons in sexually and asexually reproducing lines of the same species, the parasitoid wasp Leptopilina clavipes. They discovered that within asexually reproducing wasps, the number of gypsy-like retrotransposons was increased fourfold, whereas other retrotransposons were not. Interestingly, gypsy-like retrotransposons are closely related to retroviruses. Endogenous retroviruses are retroviruses that have integrated to the germ line cells and are inherited thereafter vertically. They can also replicate within the genome similarly to retrotransposons as well as form virus particles and infect previously uninfected cells. This highlights the possibility that endogenous retroviruses could play a role in the evolution of sexual reproduction. Here, we show with an individual-based computational model that a virus epidemic within a previously parasite-free asexual population may establish a new intragenomic parasite to the population. Moreover and in contrast to other transposons, the possibility of endogenous viruses to maintain a virus epidemic and simultaneously provide resistance to individuals carrying active endogenous viruses selects for the presence of active intragenomic parasites in the population despite their deleterious effects. Our results suggest that the viral nature of certain intragenomic parasites should be taken into account when sex and its benefits are being considered. © 2014 John Wiley & Sons Ltd.

  8. Asexual reproduction induces a rapid and permanent loss of sexual reproduction capacity in the rice fungal pathogen Magnaporthe oryzae: results of in vitro experimental evolution assays

    Directory of Open Access Journals (Sweden)

    Saleh Dounia

    2012-03-01

    Full Text Available Abstract Background Sexual reproduction is common in eukaryotic microorganisms, with few species reproducing exclusively asexually. However, in some organisms, such as fungi, asexual reproduction alternates with episodic sexual reproduction events. Fungi are thus appropriate organisms for studies of the reasons for the selection of sexuality or clonality and of the mechanisms underlying this selection. Magnaporthe oryzae, an Ascomycete causing blast disease on rice, reproduces mostly asexually in natura. Sexual reproduction is possible in vitro and requires (i two strains of opposite mating types including (ii at least one female-fertile strain (i.e. a strain able to produce perithecia, the female organs in which meiosis occurs. Female-fertile strains are found only in limited areas of Asia, in which evidence for contemporary recombination has recently been obtained. We induced the forced evolution of four Chinese female-fertile strains in vitro by the weekly transfer of asexual spores (conidia between Petri dishes. We aimed to determine whether female fertility was rapidly lost in the absence of sexual reproduction and whether this loss was controlled genetically or epigenetically. Results All the strains became female-sterile after 10 to 19 rounds of selection under asexual conditions. As no single-spore isolation was carried out, the observed decrease in the production of perithecia reflected the emergence and the invasion of female-sterile mutants. The female-sterile phenotype segregated in the offspring of crosses between female-sterile evolved strains and female-fertile wild-type strains. This segregation was maintained in the second generation in backcrosses. Female-sterile evolved strains were subjected to several stresses, but none induced the restoration of female fertility. This loss of fertility was therefore probably due to genetic rather than epigenetic mechanisms. In competition experiments, female-sterile mutants produced similar

  9. Evolutionary history of asexual hybrid loaches (Cobitis: Teleostei) inferred from phylogenetic analysis of mitochondrial DNA variation

    Czech Academy of Sciences Publication Activity Database

    Janko, Karel; Kotlík, Petr; Ráb, Petr

    2003-01-01

    Roč. 16, - (2003), s. 1280-1287 ISSN 1010-061X R&D Projects: GA AV ČR KSK6005114; GA ČR GA206/00/0668; GA ČR GA206/01/0989; GA AV ČR IBS5045111 Institutional research plan: CEZ:AV0Z5045916 Keywords : asexual vertebrates * Cobitis * maternal ancestry Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 3.010, year: 2003

  10. The role of sexual vs. asexual recruitment of Artemisia wudanica in transition zone habitats between inter-dune lowlands and active dunes in Inner Mongolia, China

    Science.gov (United States)

    Wang, Yongcui; Alberto, Busso Carlos; Jiang, Deming; Ala, Musa; Li, Xuehua; Zhou, Quanlai; Lin, Jixiang; Ren, Guohua; Jia, Lian

    2016-04-01

    Artemisia wudanica is an endemic, perennial, pioneering psammophyte species in the sand dune ecosystems of western Horqin Sand Land in northern China. However, no studies have addressed how sexual and asexual reproduction modes of A. wudanica perform at the transitional zones between active dune inter-dune lowlands and active dunes. In early spring, quadrats were randomly set up in the study area to monitor surviving seedling and/or ramet density and frequency coming from sexual/asexual reproduction of A. wudanica. Iron sticks were inserted near each quadrat to determine wind erosion intensity (WE). Additionally, soil samples were collected nearby each quadrat to test for soil moisture (SM), organic matter (OM) and pH. Surviving seedlings of A. wudanica showed an inverse response in comparison with ramets to SM, OM and WE. Soil moisture showed the most positive effect, and WE the negative effect, on surviving, sexual reproduction seedlings. Contrarily, WE had the most positive effect, and SM the negative effect, on asexual reproduction ramets. This suggests that increases in SM and decreases in WE should benefit recruitment of A. wudanica seedlings. On the contrary, ramets coming from asexual reproduction showed a different response to environmental factors in transition zone habitats. While SM was not a key constraint for the survival of seedlings, they showed a better, positive response to wind erosion environments. Overall, various study environmental parameters could be improved to foster A. wudanica invasion and settlement in the plant community through different reproductive modes, thereby promoting vegetation restoration and rehabilitation.

  11. Robust inducible Cre recombinase activity in the human malaria parasite Plasmodium falciparum enables efficient gene deletion within a single asexual erythrocytic growth cycle.

    Science.gov (United States)

    Collins, Christine R; Das, Sujaan; Wong, Eleanor H; Andenmatten, Nicole; Stallmach, Robert; Hackett, Fiona; Herman, Jean-Paul; Müller, Sylke; Meissner, Markus; Blackman, Michael J

    2013-05-01

    Asexual blood stages of the malaria parasite, which cause all the pathology associated with malaria, can readily be genetically modified by homologous recombination, enabling the functional study of parasite genes that are not essential in this part of the life cycle. However, no widely applicable method for conditional mutagenesis of essential asexual blood-stage malarial genes is available, hindering their functional analysis. We report the application of the DiCre conditional recombinase system to Plasmodium falciparum, the causative agent of the most dangerous form of malaria. We show that DiCre can be used to obtain rapid, highly regulated site-specific recombination in P. falciparum, capable of excising loxP-flanked sequences from a genomic locus with close to 100% efficiency within the time-span of a single erythrocytic growth cycle. DiCre-mediated deletion of the SERA5 3' UTR failed to reduce expression of the gene due to the existence of alternative cryptic polyadenylation sites within the modified locus. However, we successfully used the system to recycle the most widely used drug resistance marker for P. falciparum, human dihydrofolate reductase, in the process producing constitutively DiCre-expressing P. falciparum clones that have broad utility for the functional analysis of essential asexual blood-stage parasite genes. © 2013 John Wiley & Sons Ltd.

  12. Discourses Governing Lesbian, Gay, Bisexual, Transgender, Queer, Intersex, and Asexual Teachers' Disclosure of Sexual Orientation and Gender History

    Science.gov (United States)

    Bower-Phipps, Laura

    2017-01-01

    Significant progress has been made in equal rights for lesbian, gay, bisexual, transgender, queer, intersex, and asexual (LGBTQIA) individuals, yet schools remain institutions where sexual and gender diversity are marginalized and/or silenced. Queer theory, a non-linear theory that disrupts dominant beliefs about gender and sexuality and what…

  13. Polymorphism and methylation patterns in Agave tequilana Weber var. 'Azul' plants propagated asexually by three different methods.

    Science.gov (United States)

    Díaz-Martínez, Miriam; Nava-Cedillo, Alejandro; Guzmán-López, José Alfredo; Escobar-Guzmán, Rocío; Simpson, June

    2012-04-01

    Genetic variation in three forms of asexually propagated Agave tequilana Weber var. 'Azul' plants namely offsets, bulbils and in vitro cultured individuals was studied by AFLP analysis. Low levels of variation were observed between mother plants and offsets and a higher level between mother plant and bulbils. Families obtained from commercial plantations showed lower levels of variation in comparison to families grown as ornamentals. No variation was observed between the original explant and four generations of in vitro cultured plants. Epigenetic variation was also studied by analyzing changes in methylation patterns between mother plants and offspring in each form of asexual reproduction. Offsets and bulbils showed an overall decrease in methylation whereas in vitro cultured plants showed patterns specific to each generation: Generations 1 and 4 showed overall demethylation whereas Generations 2 and 3 showed increased methylation. Analysis of ESTs associated with transposable elements revealed higher proportions of ESTs from Ty1-copia-like, Gypsy and CACTA transposable elements in cDNA libraries obtained from pluripotent tissue suggesting a possible correlation between methylation patterns, expression of transposable element associated genes and somaclonal variation. Copyright © 2012 Elsevier Ireland Ltd. All rights reserved.

  14. A Global Survey of ATPase Activity in Plasmodium falciparum Asexual Blood Stages and Gametocytes

    Energy Technology Data Exchange (ETDEWEB)

    Ortega, Corrie; Frando, Andrew; Webb-Robertson, Bobbie-Jo; Anderson, Lindsey N.; Fleck, Neil; Flannery, Erika L.; Fishbaugher, Matthew; Murphree, Taylor A.; Hansen, Joshua R.; Smith, Richard D.; Kappe, Stefan H. I.; Wright, Aaron T.; Grundner, Christoph

    2017-10-27

    Effective malaria control and elimination in hyperendemic areas of the world will require treatment of disease-causing Plasmodium falciparum (Pf) blood stage infection but also blocking parasite transmission from humans to mosquito to prevent disease spread. Numerous antimalarial drugs have become ineffective due to parasite drug resistance and many currently used therapies do not kill gametocytes, highly specialized sexual parasite stages with distinct physiology that are necessary for transmission from the human host to the mosquito vector. Further confounding next generation drug development against Pf is the lack of known biochemical activity for most parasite gene products as well as the unknown metabolic needs of non-replicating gametocyte. Here, we take a systematic activity-based proteomics approach to survey the large and druggable ATPase family that is associated with replicating blood stage asexual parasites and transmissible gametocytes. We experimentally confirm existing annotation and predict ATPase function for 38 uncharacterized proteins. ATPase activity broadly changes during the transition from asexual schizonts to gametocytes, indicating altered metabolism and regulatory roles of ATPases specific for each lifecycle stage. By mapping the activity of ATPases associated with gametocytogenesis, we assign biochemical activity to a large number of uncharacterized proteins and identify new candidate transmission blocking targets.

  15. Fixation probability of a nonmutator in a large population of asexual mutators.

    Science.gov (United States)

    Jain, Kavita; James, Ananthu

    2017-11-21

    In an adapted population of mutators in which most mutations are deleterious, a nonmutator that lowers the mutation rate is under indirect selection and can sweep to fixation. Using a multitype branching process, we calculate the fixation probability of a rare nonmutator in a large population of asexual mutators. We show that when beneficial mutations are absent, the fixation probability is a nonmonotonic function of the mutation rate of the mutator: it first increases sublinearly and then decreases exponentially. We also find that beneficial mutations can enhance the fixation probability of a nonmutator. Our analysis is relevant to an understanding of recent experiments in which a reduction in the mutation rates has been observed. Copyright © 2017 Elsevier Ltd. All rights reserved.

  16. A.G.A. program gives utilities a leg up on benchmarking

    International Nuclear Information System (INIS)

    Share, J.

    1997-01-01

    In this era of downsizing, distribution companies are banding together under the aegis of the American Gas Association to improve their performance, ultimately saving money and jobs. The Best Practice Benchmarking program began in 1990 when New Orleans Public Service coordinated an effort by several utilities wanting to compare practices and data. It is not benchmarking in the traditional sense. Best Practices stresses functional rather than competitive or numerical benchmarking by focusing on what utilities have done to improve their operations. In a report on Best Practices, John Bayko, Director of System Operations for Consumers Gas in Toronto, noted these success stories: Building odorant storage and transport facilities were found to save one company $17,500 annually because it could buy odorant in bulk as opposed to 55-gallon drums. Upgrading its cathodic protection system helped a company realize a 40 percent reduction in corrosion leaks over a two-year period, saving $200,000 a year. Another company began studying partnering with contractors which would eliminate the need of a pipeline inspector in each crew. Those potential savings are over $2 million. This paper describes three other Best Practices related to worker safety, system mapping, and activity-based accounting. A.G.A.'s role is briefly discussed

  17. Sexual and asexual reproduction in Didemnum rodriguesi (Ascidiacea, Didemnidae Reprodução sexuada e assexuada em Didemnum rodriguesi (Ascidiacea, Didemnidae

    Directory of Open Access Journals (Sweden)

    Nicole F. Ritzmann

    2009-03-01

    Full Text Available Sexual and asexual reproduction and associated population dynamics were investigated in the colonial ascidian Didemnum rodriguesi Rocha & Monniot, 1993 (Didemnidae in southern Brazil. Investment in sexual (production of new individuals and asexual (colony growth reproduction was compared between seasons. Permanently marked quadrats were repeatedly photographed to measure changes in colonies. Eggs and larvae were counted monthly in collected colonies. This species alternates seasonally between sexual (summer and asexual (winter reproduction. In summer, colonies were smaller, brooded eggs and larvae and recruitment rates were greater, while in winter, colony size was larger and eggs and larvae were absent. There is a relationship between fecundity and colony area. Fragmentation and fusion of colonies were similar in summer and winter, as well as mortality. In conclusion, D. rodriguesi has a lifecycle usual for high latitude ascidians with a limited time length for sexual reproduction and alternate investment in sexual and asexual reproduction along the year.Reprodução sexuada e assexuada, mortalidade e a dinâmica de fusões e fissões de colônias de Didemnum rodriguesi Rocha & Monniot, 1993 foram investigados e comparados no sul do Brasil, no inverno e verão. Tais eventos foram analisados por fotografias de áreas permanentemente demarcadas e coletas mensais de colônias. Os resultados indicam que esta espécie alterna sazonalmente a reprodução sexuada (verão e assexuada (inverno. Durante o verão as colônias são mais abundantes e menores, com ovos e larvas incubados e taxas de recrutamento maiores. No inverno há um menor número de colônias, porém de maior tamanho e inférteis. Existe uma relação entre fecundidade e tamanho da colônia. Não foram encontradas diferenças estatísticas no número de eventos de fragmentação e fusão entre o verão e inverno, bem como para mortalidade. Conclui-se que esta espécie tem um ciclo de

  18. Dynamic Formation of Asexual Diploid and Polyploid Lineages: Multilocus Analysis of Cobitis Reveals the Mechanisms Maintaining the Diversity of Clones

    Czech Academy of Sciences Publication Activity Database

    Janko, Karel; Kotusz, J.; de Gelas, K.; Šlechtová, Věra; Opoldusová, Zuzana; Drozd, P.; Choleva, Lukáš; Popiolek, M.; Baláž, M.

    2012-01-01

    Roč. 7, č. 9 (2012), s. 1-14 E-ISSN 1932-6203 R&D Projects: GA ČR GA206/09/1298 Grant - others:University of Wroclav(PL) 10/19/S/MP Institutional research plan: CEZ:AV0Z50450515 Keywords : asexual lineages Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 3.730, year: 2012

  19. Plasmodium falciparum Calcium-Dependent Protein Kinase 2 Is Critical for Male Gametocyte Exflagellation but Not Essential for Asexual Proliferation

    Directory of Open Access Journals (Sweden)

    Abhisheka Bansal

    2017-10-01

    Full Text Available Drug development efforts have focused mostly on the asexual blood stages of the malaria parasite Plasmodium falciparum. Except for primaquine, which has its own limitations, there are no available drugs that target the transmission of the parasite to mosquitoes. Therefore, there is a need to validate new parasite proteins that can be targeted for blocking transmission. P. falciparum calcium-dependent protein kinases (PfCDPKs play critical roles at various stages of the parasite life cycle and, importantly, are absent in the human host. These features mark them as attractive drug targets. In this study, using CRISPR/Cas9 we successfully knocked out PfCDPK2 from blood-stage parasites, which was previously thought to be an indispensable protein. The growth rate of the PfCDPK2 knockout (KO parasites was similar to that of wild-type parasites, confirming that PfCDPK2 function is not essential for the asexual proliferation of the parasite in vitro. The mature male and female gametocytes of PfCDPK2 KO parasites become round after induction. However, they fail to infect female Anopheles stephensi mosquitoes due to a defect(s in male gametocyte exflagellation and possibly in female gametes.

  20. CONTRIBUTIONS OF SEXUAL AND ASEXUAL REPRODUCTION TO POPULATION STRUCTURE IN THE CLONAL SOFT CORAL, ALCYONIUM RUDYI.

    Science.gov (United States)

    McFadden, Catherine S

    1997-02-01

    Numerous studies of population structure in sessile clonal marine invertebrates have demonstrated low genotypic diversity and nonequilibrium genotype frequencies within local populations that are monopolized by relatively few, highly replicated genets. All of the species studied to date produce planktonic sexual propagules capable of dispersing long distances; despite local genotypic disequilibria, populations are often panmictic over large geographic areas. The population structure paradigm these species represent may not be typical of the majority of clonal invertebrate groups, however, which are believed to produce highly philopatric sexual propagules. I used allozyme variation to examine the population structure of the temperate soft coral, Alcyonium rudyi, a typical clonal species whose sexually produced larvae and asexually produced ramets both have very low dispersal capabilities. Like other clonal plants and invertebrates, the local population dynamics of A. rudyi are dominated by asexual reproduction, and recruitment of new sexually produced genets occurs infrequently. As expected from its philopatric larval stage, estimates of genetic differentiation among populations of A. rudyi were highly significant at all spatial scales examined (mean θ = 0.300 among 20 populations spanning a 1100-km range), suggesting that genetic exchange seldom occurs among populations separated by as little as a few hundred meters. Mapping of multilocus allozyme genotypes within a dense aggregation of A. rudyi ramets confirmed that dispersal of asexual propagules is also very limited: members of the same genet usually remain within invertebrates, populations of A. rudyi do not appear to be dominated by a few widespread genets: estimates of genotypic diversity (G o ) within 20 geographically distinct populations did not differ from expectations for outcrossing, sexual populations. Despite theoretical suggestions that philopatric dispersal combined with typically small effective

  1. Effect of the SOS response on the mean fitness of unicellular populations: a quasispecies approach.

    Science.gov (United States)

    Kama, Amit; Tannenbaum, Emmanuel

    2010-11-30

    The goal of this paper is to develop a mathematical model that analyzes the selective advantage of the SOS response in unicellular organisms. To this end, this paper develops a quasispecies model that incorporates the SOS response. We consider a unicellular, asexually replicating population of organisms, whose genomes consist of a single, double-stranded DNA molecule, i.e. one chromosome. We assume that repair of post-replication mismatched base-pairs occurs with probability , and that the SOS response is triggered when the total number of mismatched base-pairs is at least . We further assume that the per-mismatch SOS elimination rate is characterized by a first-order rate constant . For a single fitness peak landscape where the master genome can sustain up to mismatches and remain viable, this model is analytically solvable in the limit of infinite sequence length. The results, which are confirmed by stochastic simulations, indicate that the SOS response does indeed confer a fitness advantage to a population, provided that it is only activated when DNA damage is so extensive that a cell will die if it does not attempt to repair its DNA.

  2. FvSTR1, a striatin orthologue in Fusarium virguliforme, is required for asexual development and virulence.

    Science.gov (United States)

    Islam, Kazi T; Bond, Jason P; Fakhoury, Ahmad M

    2017-08-01

    The soil-borne fungus Fusarium virguliforme causes sudden death syndrome (SDS), one of the most devastating diseases of soybean in North and South America. Despite the importance of SDS, a clear understanding of the fungal pathogenicity factors that affect the development of this disease is still lacking. We have identified FvSTR1, a F. virguliforme gene, which encodes a protein similar to a family of striatin proteins previously reported to regulate signalling pathways, cell differentiation, conidiation, sexual development, and virulence in filamentous fungi. Striatins are multi-domain proteins that serve as scaffolding units in the striatin-interacting phosphatase and kinase (STRIPAK) complex in fungi and animals. To address the function of a striatin homologue in F. virguliforme, FvSTR1 was disrupted and functionally characterized using a gene knock out strategy. The resulting Fvstr1 mutants were largely impaired in conidiation and pigmentation, and displayed defective conidia and conidiophore morphology compared to the wild-type and ectopic transformants. Greenhouse virulence assays revealed that the disruption of FvSTR1 resulted in complete loss of virulence in F. virguliforme. Microtome studies using fluorescence microscopy showed that the Fvstr1 mutants were defective in their ability to colonize the vascular system. The Fvstr1 mutants also showed a reduced transcript level of genes involved in asexual reproduction and in the production of secondary metabolites. These results suggest that FvSTR1 has a critical role in asexual development and virulence in F. virguliforme.

  3. Sex in an uncertain world: environmental stochasticity helps restore competitive balance between sexually and asexually reproducing populations.

    Science.gov (United States)

    Park, A W; Vandekerkhove, J; Michalakis, Y

    2014-08-01

    Like many organisms, individuals of the freshwater ostracod species Eucypris virens exhibit either obligate sexual or asexual reproductive modes. Both types of individual routinely co-occur, including in the same temporary freshwater pond (their natural habitat in which they undergo seasonal diapause). Given the well-known two-fold cost of sex, this begs the question of how sexually reproducing individuals are able to coexist with their asexual counterparts in spite of such overwhelming costs. Environmental stochasticity in the form of 'false dawn' inundations (where the first hydration is ephemeral and causes loss of early hatching individuals) may provide an advantage to the sexual subpopulation, which shows greater variation in hatching times following inundation. We explore the potential role of environmental stochasticity in this system using life-history data analysis, climate data, and matrix projection models. In the absence of environmental stochasticity, the population growth rate is significantly lower in sexual subpopulations. Climate data reveal that 'false dawn' inundations are common. Using matrix projection modelling with and without environmental stochasticity, we demonstrate that this phenomenon can restore appreciable balance to the system, in terms of population growth rates. This provides support for the role of environmental stochasticity in helping to explain the maintenance of sex and the occurrence of geographical parthenogenesis. © 2014 The Authors. Journal of Evolutionary Biology © 2014 European Society For Evolutionary Biology.

  4. A Gene Expressed during Sexual and Asexual Sporulation in Phytophthora infestans is a Member of the Puf Family of Translational Regulators

    DEFF Research Database (Denmark)

    Cvitanich, Cristina; Judelson, Howard S.

    2003-01-01

    and persisted in mature oospores. Expression was also observed in hyphal tips just prior to asexual sporulation, in sporangiophores, in mature sporangia, and in zoospores. The signal quickly disappeared once spores made the transition to hyphae after germination. Nutrient limitation did not induce the gene...

  5. Fusion: a tale of recombination in an asexual fungus: The role of nuclear dynamics and hyphal fusion in horizontal chromosome transfer in Fusarium oxysporum

    NARCIS (Netherlands)

    Shahi, S.

    2016-01-01

    Recent studies have shown that not only meiotic recombination is responsible for the fast evolution of fungal pathogens. In the asexual fungus F. oxysporum (Fo) the "fast" evolving part of the genome is organized into small chromosomes and one such chromosome houses all effector genes and is

  6. Environmental control of asexual reproduction and somatic growth of Aurelia spp. (Cnidaria, Scyphozoa) polyps from the Adriatic Sea

    OpenAIRE

    Hubot, Nathan; Lucas, Cathy H.; Piraino, Stefano

    2017-01-01

    Polyps of two moon jellyfish species, Aurelia coerulea and A.relicta, from two Adriatic Sea coastal habitats were incubated under multiple combinations of temperature (14, 21 °C), salinity (24, 37 ppt) and food regime (9.3, 18.6, 27.9 μg C ind‾¹ week‾¹) to comparatively assess how these factors may influence major asexual reproduction processes in the two species. Both species exhibited a shared pattern of budding mode (Directly Budded Polyps: DBP; Stolonal Budded Polyps: SBP), with DBP favo...

  7. Effects of plant sex on range distributions and allocation to reproduction.

    Science.gov (United States)

    Johnson, Marc T J; Smith, Stacey D; Rausher, Mark D

    2010-05-01

    Despite an abundance of theory, few empirical studies have explored the ecological and evolutionary consequences of sex. We used a comparative phylogenetic approach to examine whether transitions between sexual and asexual reproduction are associated with changes in the size and distribution of species' geographical ranges, and their investment in reproduction. Here, we reconstructed the phylogeny of the genus Oenothera sections Oenothera and Calylophus (Onagraceae), which contain 35 sexual and 30 functionally asexual species. From each species, we collected data on the geographical distribution and variation in plant traits related to reproduction. Functionally asexual species occurred at higher latitudes, but did not differ in range size, compared with sexual species. Transitions to asexuality were associated with decreased investment in floral structures, including the length of petals, floral tubes and styles. Decreased anther size and increased seed size within asexual species also suggest altered allocation to male and female fitness. The observed range shifts are consistent with superior colonization of environments by asexual species following glaciation, and the observed changes in reproductive allocation support predictions made by models relating to the evolution of selfing. Our results suggest that the evolutionary consequences of asexual reproduction might be less restrictive than previously thought.

  8. Species delimitation in asexual insects of economic importance: The case of black scale (Parasaissetia nigra, a cosmopolitan parthenogenetic pest scale insect.

    Directory of Open Access Journals (Sweden)

    Yen-Po Lin

    Full Text Available Asexual lineages provide a challenge to species delimitation because species concepts either have little biological meaning for them or are arbitrary, since every individual is monophyletic and reproductively isolated from all other individuals. However, recognition and naming of asexual species is important to conservation and economic applications. Some scale insects are widespread and polyphagous pests of plants, and several species have been found to comprise cryptic species complexes. Parasaissetia nigra (Nietner, 1861 (Hemiptera: Coccidae is a parthenogenetic, cosmopolitan and polyphagous pest that feeds on plant species from more than 80 families. Here, we implement multiple approaches to assess the species status of P. nigra, including coalescence-based analyses of mitochondrial and nuclear genes, and ecological niche modelling. Our results indicate that the sampled specimens of P. nigra should be considered to comprise at least two ecotypes (or "species" that are ecologically differentiated, particularly in relation to temperature and moisture. The presence of more than one ecotype under the current concept of P. nigra has implications for biosecurity because the geographic extent of each type is not fully known: some countries may currently have only one of the biotypes. Introduction of additional lineages could expand the geographic extent of damage by the pest in some countries.

  9. A multigenerational effect of parental age on offspring size but not fitness in common duckweed (Lemna minor).

    Science.gov (United States)

    Barks, P M; Laird, R A

    2016-04-01

    Classic theories on the evolution of senescence make the simplifying assumption that all offspring are of equal quality, so that demographic senescence only manifests through declining rates of survival or fecundity. However, there is now evidence that, in addition to declining rates of survival and fecundity, many organisms are subject to age-related declines in the quality of offspring produced (i.e. parental age effects). Recent modelling approaches allow for the incorporation of parental age effects into classic demographic analyses, assuming that such effects are limited to a single generation. Does this 'single-generation' assumption hold? To find out, we conducted a laboratory study with the aquatic plant Lemna minor, a species for which parental age effects have been demonstrated previously. We compared the size and fitness of 423 laboratory-cultured plants (asexually derived ramets) representing various birth orders, and ancestral 'birth-order genealogies'. We found that offspring size and fitness both declined with increasing 'immediate' birth order (i.e. birth order with respect to the immediate parent), but only offspring size was affected by ancestral birth order. Thus, the assumption that parental age effects on offspring fitness are limited to a single generation does in fact hold for L. minor. This result will guide theorists aiming to refine and generalize modelling approaches that incorporate parental age effects into evolutionary theory on senescence. © 2016 European Society For Evolutionary Biology. Journal of Evolutionary Biology © 2016 European Society For Evolutionary Biology.

  10. The evolution of sex is favoured during adaptation to new environments.

    Science.gov (United States)

    Becks, Lutz; Agrawal, Aneil F

    2012-01-01

    Both theory and experiments have demonstrated that sex can facilitate adaptation, potentially yielding a group-level advantage to sex. However, it is unclear whether this process can help solve the more difficult problem of the maintenance of sex within populations. Using experimental populations of the facultatively sexual rotifer Brachionus calyciflorus, we show that rates of sex evolve to higher levels during adaptation but then decline as fitness plateaus. To assess the fitness consequences of genetic mixing, we directly compare the fitnesses of sexually and asexually derived genotypes that naturally occur in our experimental populations. Sexually derived genotypes are more fit than asexually derived genotypes when adaptive pressures are strong, but this pattern reverses as the pace of adaptation slows, matching the pattern of evolutionary change in the rate of sex. These fitness assays test the net effect of sex but cannot be used to disentangle whether selection on sex arises because highly sexual lineages become associated with different allele combinations or with different allele frequencies than less sexual lineages (i.e., "short-" or "long-term" effects, respectively). We infer which of these mechanisms provides an advantage to sex by performing additional manipulations to obtain fitness distributions of sexual and asexual progeny arrays from unbiased parents (rather than from naturally occurring, and thereby evolutionarily biased, parents). We find evidence that sex breaks down adaptive gene combinations, resulting in lower average fitness of sexual progeny (i.e., a short-term disadvantage to sex). As predicted by theory, the advantage to sex arises because sexually derived progeny are more variable in fitness, allowing for faster adaptation. This "long-term advantage" builds over multiple generations, eventually resulting in higher fitness of sexual types.

  11. A Comparison of Hybrid Approaches for Turbofan Engine Gas Path Fault Diagnosis

    Science.gov (United States)

    Lu, Feng; Wang, Yafan; Huang, Jinquan; Wang, Qihang

    2016-09-01

    A hybrid diagnostic method utilizing Extended Kalman Filter (EKF) and Adaptive Genetic Algorithm (AGA) is presented for performance degradation estimation and sensor anomaly detection of turbofan engine. The EKF is used to estimate engine component performance degradation for gas path fault diagnosis. The AGA is introduced in the integrated architecture and applied for sensor bias detection. The contributions of this work are the comparisons of Kalman Filters (KF)-AGA algorithms and Neural Networks (NN)-AGA algorithms with a unified framework for gas path fault diagnosis. The NN needs to be trained off-line with a large number of prior fault mode data. When new fault mode occurs, estimation accuracy by the NN evidently decreases. However, the application of the Linearized Kalman Filter (LKF) and EKF will not be restricted in such case. The crossover factor and the mutation factor are adapted to the fitness function at each generation in the AGA, and it consumes less time to search for the optimal sensor bias value compared to the Genetic Algorithm (GA). In a word, we conclude that the hybrid EKF-AGA algorithm is the best choice for gas path fault diagnosis of turbofan engine among the algorithms discussed.

  12. Mating type gene analysis in apparently asexual Cercospora species is suggestive of cryptic sex.

    Science.gov (United States)

    Groenewald, Marizeth; Groenewald, Johannes Z; Harrington, Thomas C; Abeln, Edwin C A; Crous, Pedro W

    2006-12-01

    The genus Cercospora consists of numerous important, apparently asexual plant pathogens. We designed degenerate primers from homologous sequences in related species to amplify part of the C. apii, C. apiicola, C. beticola, C. zeae-maydis and C. zeina mating type genes. Chromosome walking was used to determine the full length mating type genes of these species. Primers were developed to amplify and sequence homologous portions of the mating type genes of additional species. Phylogenetic analyses of these sequences revealed little variation among members of the C. apii complex, whereas C. zeae-maydis and C. zeina were found to be dissimilar. The presence of both mating types in approximately even proportions in C. beticola, C. zeae-maydis and C. zeina populations, in contrast to single mating types in C. apii (MAT1) and C. apiicola (MAT2), suggests that a sexual cycle may be active in some of these species.

  13. Transmission rates of the bacterial endosymbiont, Neorickettsia risticii, during the asexual reproduction phase of its digenean host, Plagiorchis elegans, within naturally infected lymnaeid snails.

    Science.gov (United States)

    Greiman, Stephen E; Tkach, Vasyl V; Vaughan, Jefferson A

    2013-10-22

    Neorickettsia are obligate intracellular bacterial endosymbionts of digenean parasites present in all lifestages of digeneans. Quantitative information on the transmission of neorickettsial endosymbionts throughout the complex life cycles of digeneans is lacking. This study quantified the transmission of Neorickettsia during the asexual reproductive phase of a digenean parasite, Plagiorchis elegans, developing within naturally parasitized lymnaeid pond snails. Lymnaea stagnalis snails were collected from 3 ponds in Nelson County, North Dakota and screened for the presence of digenean cercariae. Cercariae were identified to species by PCR and sequencing of the 28S rRNA gene. Neorickettsia infections were initially detected using nested PCR and sequencing of a partial 16S rRNA gene of pooled cercariae shed from each parasitized snail. Fifty to 100 single cercariae or sporocysts were isolated from each of six parasitized snails and tested for the presence of Neorickettsia using nested PCR to estimate the efficiency at which Neorickettsia were transmitted to cercariae during asexual development of the digenean. A total of 616 L. stagnalis were collected and 240 (39%) shed digenean cercariae. Of these, 18 (8%) were Neorickettsia-positive. Six Neorickettsia infections were selected to determine the transmission efficiency of Neorickettsia from mother to daughter sporocyst and from daughter sporocyst to cercaria. The prevalence of neorickettsiae in cercariae varied from 11 to 91%. The prevalence of neorickettsiae in sporocysts from one snail was 100%. Prevalence of Neorickettsia infection in cercariae of Plagiorchis elegans was variable and never reached 100%. Reasons for this are speculative, however, the low prevalence of Neorickettsia observed in some of our samples (11 to 52%) differs from the high prevalence of other, related bacterial endosymbionts, e.g. Wolbachia in Wolbachia-dependent filariid nematodes, where the prevalence among progeny is universally 100

  14. Horizontal transfer generates genetic variation in an asexual pathogen

    Directory of Open Access Journals (Sweden)

    Xiaoqiu Huang

    2014-10-01

    Full Text Available There are major gaps in the understanding of how genetic variation is generated in the asexual pathogen Verticillium dahliae. On the one hand, V. dahliae is a haploid organism that reproduces clonally. On the other hand, single-nucleotide polymorphisms and chromosomal rearrangements were found between V. dahliae strains. Lineage-specific (LS regions comprising about 5% of the genome are highly variable between V. dahliae strains. Nonetheless, it is unknown whether horizontal gene transfer plays a major role in generating genetic variation in V. dahliae. Here, we analyzed a previously sequenced V. dahliae population of nine strains from various geographical locations and hosts. We found highly homologous elements in LS regions of each strain; LS regions of V. dahliae strain JR2 are much richer in highly homologous elements than the core genome. In addition, we discovered, in LS regions of JR2, several structural forms of nonhomologous recombination, and two or three homologous sequence types of each form, with almost each sequence type present in an LS region of another strain. A large section of one of the forms is known to be horizontally transferred between V. dahliae strains. We unexpectedly found that 350 kilobases of dynamic LS regions were much more conserved than the core genome between V. dahliae and a closely related species (V. albo-atrum, suggesting that these LS regions were horizontally transferred recently. Our results support the view that genetic variation in LS regions is generated by horizontal transfer between strains, and by chromosomal reshuffling reported previously.

  15. Sponge budding is a spatiotemporal morphological patterning process: Insights from synchrotron radiation-based x-ray microtomography into the asexual reproduction of Tethya wilhelma

    OpenAIRE

    Hammel, J. U.; Herzen, J.; Beckmann, F.; Nickel, M.

    2009-01-01

    Abstract Background Primary agametic-asexual reproduction mechanisms such as budding and fission are present in all non-bilaterian and many bilaterian animal taxa and are likely to be metazoan ground pattern characters. Cnidarians display highly organized and regulated budding processes. In contrast, budding in poriferans was thought to be less specific and related to the general ability of this group to reorganize their tissues. Here we test the hypothesis of morphological pattern formation ...

  16. Morbility, clinical data and proteomic analysis of IUGR and AGA newborns at different gestational ages

    Directory of Open Access Journals (Sweden)

    M.D. Ruiz-González

    2016-12-01

    Full Text Available The data are related to the proteomic analysis of 43 newborns with intrauterine growth retardation (IUGR and 45 newborns with appropriate weight for gestational age (AGA carried out by separation via 2DE and analyzed by MS–TOF/TOF. All newborns were separated into three gestational age groups, "Very Preterm" 29–32 weeks, "Moderate Preterm" 33–36 weeks, and, "Term" ≥37weeks. From each newborn, blood was drawn three times from birth to 1 month life. High-abundant serum proteins were depleted, and the minority ones were separated by 2DE and analyzed for significant expression differences. The data reflect analytic and clinic variables analyzed globally and categorized by gestational age in relation to IUGR and the optimization of conditions for 2-DE separation. The data from this study are related to the research article entitled "Alterations of Protein Expression in Serum of Infants with Intrauterine Growth Restriction and Different Gestational Ages" (M.D. Ruis-González, M.D. Cañete, J.L. Gómez-Chaparro, N. Abril, R. Cañete, J. López-Barea, 2015 [1]. The present dataset of serum IUGR newborn proteome can be used as a reference for any study involving intrauterine growth restriction during the first month of life.

  17. A Brazilian Population of the Asexual Fungus-Growing Ant Mycocepurus smithii (Formicidae, Myrmicinae, Attini) Cultivates Fungal Symbionts with Gongylidia-Like Structures

    DEFF Research Database (Denmark)

    Masiulionis, Virginia E.; Rabeling, Christian; de Fine Licht, Henrik Hjarvard

    2014-01-01

    gongylophorus. Higher agriculture fungal cultivars are characterized by specialized hyphal tip swellings, so-called gongylidia, which are considered a unique, derived morphological adaptation of higher attine fungi thought to be absent in lower attine fungi. Rare reports of gongylidia-like structures in fungus...... gardens of lower attines exist, but it was never tested whether these represent rare switches of lower attines to L. gonglyphorus cultivars or whether lower attine cultivars occasionally produce gongylidia. Here we describe the occurrence of gongylidia-like structures in fungus gardens of the asexual...

  18. The first multi-gene phylogeny of the Macrostomorpha sheds light on the evolution of sexual and asexual reproduction in basal Platyhelminthes.

    Science.gov (United States)

    Janssen, Toon; Vizoso, Dita B; Schulte, Gregor; Littlewood, D Timothy J; Waeschenbach, Andrea; Schärer, Lukas

    2015-11-01

    The Macrostomorpha-an early branching and species-rich clade of free-living flatworms-is attracting interest because it contains Macrostomum lignano, a versatile model organism increasingly used in evolutionary, developmental, and molecular biology. We elucidate the macrostomorphan molecular phylogeny inferred from both nuclear (18S and 28S rDNA) and mitochondrial (16S rDNA and COI) marker genes from 40 representatives. Although our phylogeny does not recover the Macrostomorpha as a statistically supported monophyletic grouping, it (i) confirms many taxa previously proposed based on morphological evidence, (ii) permits the first placement of many families and genera, and (iii) reveals a number of unexpected placements. Specifically, Myozona and Bradynectes are outside the three classic families (Macrostomidae, Microstomidae and Dolichomacrostomidae) and the asexually fissioning Myomacrostomum belongs to a new subfamily, the Myozonariinae nov. subfam. (Dolichomacrostomidae), rather than diverging early. While this represents the first evidence for asexuality among the Dolichomacrostomidae, we show that fissioning also occurs in another Myozonariinae, Myozonaria fissipara nov. sp. Together with the placement of the (also fissioning) Microstomidae, namely as the sister taxon of Dolichomacrostomidae, this suggests that fissioning is not basal within the Macrostomorpha, but rather restricted to the new taxon Dolichomicrostomida (Dolichomacrostomidae+Microstomidae). Furthermore, our phylogeny allows new insights into the evolution of the reproductive system, as ancestral state reconstructions reveal convergent evolution of gonads, and male and female genitalia. Finally, the convergent evolution of sperm storage organs in the female genitalia appears to be linked to the widespread occurrence of hypodermic insemination among the Macrostomorpha. Copyright © 2015 Elsevier Inc. All rights reserved.

  19. Antiplasmodial activities of dyes against Plasmodium falciparum asexual and sexual stages: Contrasted uptakes of triarylmethanes Brilliant green, Green S (E142), and Patent Blue V (E131) by erythrocytes.

    Science.gov (United States)

    Leba, Louis-Jérôme; Popovici, Jean; Estevez, Yannick; Pelleau, Stéphane; Legrand, Eric; Musset, Lise; Duplais, Christophe

    2017-12-01

    The search for safe antimalarial compounds acting against asexual symptom-responsible stages and sexual transmission-responsible forms of Plasmodium species is one of the major challenges in malaria elimination programs. So far, among current drugs approved for human use, only primaquine has transmission-blocking activity. The discovery of small molecules targeting different Plasmodium falciparum life stages remains a priority in antimalarial drug research. In this context, several independent studies have recently reported antiplasmodial and transmission-blocking activities of commonly used stains, dyes and fluorescent probes against P. falciparum including chloroquine-resistant isolates. Herein we have studied the antimalarial activities of dyes with different scaffold and we report that the triarylmethane dye (TRAM) Brilliant green inhibits the growth of asexual stages (IC 50  ≤ 2 μM) and has exflagellation-blocking activity (IC 50  ≤ 800 nM) against P. falciparum reference strains (3D7, 7G8) and chloroquine-resistant clinical isolate (Q206). In a second step we have investigated the antiplasmodial activities of two polysulfonated triarylmethane food dyes. Green S (E142) is weakly active against P. falciparum asexual stage (IC 50 ≃ 17 μM) whereas Patent Blue V (E131) is inactive in both antimalarial assays. By applying liquid chromatography techniques for the culture supernatant analysis after cell washings and lysis, we report the detection of Brilliant green in erythrocytes, the selective uptake of Green S (E142) by infected erythrocytes, whereas Patent Blue V (E131) could not be detected within non-infected and 3D7-infected erythrocytes. Overall, our results suggest that two polysulfonated food dyes might display different affinity with transporters or channels on infected RBC membrane. Copyright © 2017 The Authors. Published by Elsevier Ltd.. All rights reserved.

  20. Antiplasmodial activities of dyes against Plasmodium falciparum asexual and sexual stages: Contrasted uptakes of triarylmethanes Brilliant green, Green S (E142, and Patent Blue V (E131 by erythrocytes

    Directory of Open Access Journals (Sweden)

    Louis-Jérôme Leba

    2017-12-01

    Full Text Available The search for safe antimalarial compounds acting against asexual symptom-responsible stages and sexual transmission-responsible forms of Plasmodium species is one of the major challenges in malaria elimination programs. So far, among current drugs approved for human use, only primaquine has transmission-blocking activity. The discovery of small molecules targeting different Plasmodium falciparum life stages remains a priority in antimalarial drug research. In this context, several independent studies have recently reported antiplasmodial and transmission-blocking activities of commonly used stains, dyes and fluorescent probes against P. falciparum including chloroquine-resistant isolates. Herein we have studied the antimalarial activities of dyes with different scaffold and we report that the triarylmethane dye (TRAM Brilliant green inhibits the growth of asexual stages (IC50 ≤ 2 μM and has exflagellation-blocking activity (IC50 ≤ 800 nM against P. falciparum reference strains (3D7, 7G8 and chloroquine-resistant clinical isolate (Q206. In a second step we have investigated the antiplasmodial activities of two polysulfonated triarylmethane food dyes. Green S (E142 is weakly active against P. falciparum asexual stage (IC50 ≃ 17 μM whereas Patent Blue V (E131 is inactive in both antimalarial assays. By applying liquid chromatography techniques for the culture supernatant analysis after cell washings and lysis, we report the detection of Brilliant green in erythrocytes, the selective uptake of Green S (E142 by infected erythrocytes, whereas Patent Blue V (E131 could not be detected within non-infected and 3D7-infected erythrocytes. Overall, our results suggest that two polysulfonated food dyes might display different affinity with transporters or channels on infected RBC membrane. Keywords: Antimalarial dyes, Transmission blocking, Triarylmethanes, Drug uptake, Brilliant green, Food dyes

  1. The effect of a knowledge-based ergonomic intervention amongst administrators at Aga Khan University Hospital, Nairobi.

    Science.gov (United States)

    Wanyonyi, Nancy; Frantz, Jose; Saidi, Hassan

    2015-01-01

    Low back pain (LBP) and neck pain are part of the common work-related musculoskeletal disorders with a large impact on the affected person. Despite having a multifactorial aetiology, ergonomic factors play a major role thus necessitating workers' education. To determine the prevalence of ergonomic-related LBP and neck pain, and describe the effect of a knowledge-based ergonomic intervention amongst administrators in Aga Khan University Hospital, Nairobi. This study applied a mixed method design utilizing a survey and two focus group discussions (FGD). A self-administered questionnaire was distributed to 208 participants through systematic sampling. A one hour knowledge-based ergonomic session founded on the survey results was thereafter administered to interested participants, followed by two FGDs a month later with purposive selection of eight participants to explore their experience of the ergonomic intervention. Quantitative data was captured and analyzed using SPSS by means of descriptive and inferential statistics, whereas thematic content analysis was used for qualitative data. Most participants were knowledgeable about ergonomic-related LBP and neck pain with a twelve month prevalence of 75.5% and 67.8% respectively. Continual ergonomic education is necessary for adherence to health-related behaviours that will preventwork-related LBP and neck pain.

  2. Fitness

    Science.gov (United States)

    ... gov home http://www.girlshealth.gov/ Home Fitness Fitness Want to look and feel your best? Physical ... are? Check out this info: What is physical fitness? top Physical fitness means you can do everyday ...

  3. Sponge budding is a spatiotemporal morphological patterning process: Insights from synchrotron radiation-based x-ray microtomography into the asexual reproduction of Tethya wilhelma

    Directory of Open Access Journals (Sweden)

    Nickel Michael

    2009-09-01

    Full Text Available Abstract Background Primary agametic-asexual reproduction mechanisms such as budding and fission are present in all non-bilaterian and many bilaterian animal taxa and are likely to be metazoan ground pattern characters. Cnidarians display highly organized and regulated budding processes. In contrast, budding in poriferans was thought to be less specific and related to the general ability of this group to reorganize their tissues. Here we test the hypothesis of morphological pattern formation during sponge budding. Results We investigated the budding process in Tethya wilhelma (Demospongiae by applying 3D morphometrics to high resolution synchrotron radiation-based x-ray microtomography (SR-μCT image data. We followed the morphogenesis of characteristic body structures and identified distinct morphological states which indeed reveal characteristic spatiotemporal morphological patterns in sponge bud development. We discovered the distribution of skeletal elements, canal system and sponge tissue to be based on a sequential series of distinct morphological states. Based on morphometric data we defined four typical bud stages. Once they have reached the final stage buds are released as fully functional juvenile sponges which are morphologically and functionally equivalent to adult specimens. Conclusion Our results demonstrate that budding in demosponges is considerably more highly organized and regulated than previously assumed. Morphological pattern formation in asexual reproduction with underlying genetic regulation seems to have evolved early in metazoans and was likely part of the developmental program of the last common ancestor of all Metazoa (LCAM.

  4. Sponge budding is a spatiotemporal morphological patterning process: Insights from synchrotron radiation-based x-ray microtomography into the asexual reproduction of Tethya wilhelma.

    Science.gov (United States)

    Hammel, Jörg U; Herzen, Julia; Beckmann, Felix; Nickel, Michael

    2009-09-08

    Primary agametic-asexual reproduction mechanisms such as budding and fission are present in all non-bilaterian and many bilaterian animal taxa and are likely to be metazoan ground pattern characters. Cnidarians display highly organized and regulated budding processes. In contrast, budding in poriferans was thought to be less specific and related to the general ability of this group to reorganize their tissues. Here we test the hypothesis of morphological pattern formation during sponge budding. We investigated the budding process in Tethya wilhelma (Demospongiae) by applying 3D morphometrics to high resolution synchrotron radiation-based x-ray microtomography (SR-muCT) image data. We followed the morphogenesis of characteristic body structures and identified distinct morphological states which indeed reveal characteristic spatiotemporal morphological patterns in sponge bud development. We discovered the distribution of skeletal elements, canal system and sponge tissue to be based on a sequential series of distinct morphological states. Based on morphometric data we defined four typical bud stages. Once they have reached the final stage buds are released as fully functional juvenile sponges which are morphologically and functionally equivalent to adult specimens. Our results demonstrate that budding in demosponges is considerably more highly organized and regulated than previously assumed. Morphological pattern formation in asexual reproduction with underlying genetic regulation seems to have evolved early in metazoans and was likely part of the developmental program of the last common ancestor of all Metazoa (LCAM).

  5. Hamiltonian inclusive fitness: a fitter fitness concept.

    Science.gov (United States)

    Costa, James T

    2013-01-01

    In 1963-1964 W. D. Hamilton introduced the concept of inclusive fitness, the only significant elaboration of Darwinian fitness since the nineteenth century. I discuss the origin of the modern fitness concept, providing context for Hamilton's discovery of inclusive fitness in relation to the puzzle of altruism. While fitness conceptually originates with Darwin, the term itself stems from Spencer and crystallized quantitatively in the early twentieth century. Hamiltonian inclusive fitness, with Price's reformulation, provided the solution to Darwin's 'special difficulty'-the evolution of caste polymorphism and sterility in social insects. Hamilton further explored the roles of inclusive fitness and reciprocation to tackle Darwin's other difficulty, the evolution of human altruism. The heuristically powerful inclusive fitness concept ramified over the past 50 years: the number and diversity of 'offspring ideas' that it has engendered render it a fitter fitness concept, one that Darwin would have appreciated.

  6. Sex enhances adaptation by unlinking beneficial from detrimental mutations in experimental yeast populations

    Directory of Open Access Journals (Sweden)

    Gray Jeremy C

    2012-03-01

    Full Text Available Abstract Background The maintenance of sexuality is a classic problem in evolutionary biology because it is a less efficient mode of reproduction compared with asexuality; however, many organisms are sexual. Theoretical work suggests sex facilitates natural selection, and experimental data support this. However, there are fewer experimental studies that have attempted to determine the mechanisms underlying the advantage of sex. Two main classes of hypotheses have been proposed to explain its advantage: detrimental mutation clearance and beneficial mutation accumulation. Here we attempt to experimentally differentiate between these two classes by evolving Saccharomyces cerevisiae populations that differ only in their ability to undergo sex, and also manipulate mutation rate. We cannot manipulate the types of mutation that occur, but instead propagate populations in both stressful and permissive environments and assume that the extent of detrimental mutation clearance and beneficial mutation incorporation differs between them. Results After 300 mitotic generations interspersed with 11 rounds of sex we found there was no change or difference in fitness between sexuals and asexuals propagated in the permissive environment, regardless of mutation rate. Sex conferred a greater extent of adaptation in the stressful environment, and wild-type and elevated mutation rate sexual populations adapted equivalently. However, the asexual populations with an elevated mutation rate appeared more retarded in their extent of adaptation compared to asexual wild-type populations. Conclusions Sex provided no advantage in the permissive environment where beneficial mutations were rare. We could not evaluate if sex functioned to clear detrimental mutations more effectively or not here as no additional fitness load was observed in the mutator populations. However, in the stressful environment, where detrimental mutations were likely of more consequence, and where

  7. Rare beneficial mutations can halt Muller's ratchet

    Science.gov (United States)

    Balick, Daniel; Goyal, Sidhartha; Jerison, Elizabeth; Neher, Richard; Shraiman, Boris; Desai, Michael

    2012-02-01

    In viral, bacterial, and other asexual populations, the vast majority of non-neutral mutations are deleterious. This motivates the application of models without beneficial mutations. Here we show that the presence of surprisingly few compensatory mutations halts fitness decay in these models. Production of deleterious mutations is balanced by purifying selection, stabilizing the fitness distribution. However, stochastic vanishing of fitness classes can lead to slow fitness decay (i.e. Muller's ratchet). For weakly deleterious mutations, production overwhelms purification, rapidly decreasing population fitness. We show that when beneficial mutations are introduced, a stable steady state emerges in the form of a dynamic mutation-selection balance. We argue this state is generic for all mutation rates and population sizes, and is reached as an end state as genomes become saturated by either beneficial or deleterious mutations. Assuming all mutations have the same magnitude selective effect, we calculate the fraction of beneficial mutations necessary to maintain the dynamic balance. This may explain the unexpected maintenance of asexual genomes, as in mitochondria, in the presence of selection. This will affect in the statistics of genetic diversity in these populations.

  8. Transmission of a heterologous clade C Symbiodinium in a model anemone infection system via asexual reproduction

    Directory of Open Access Journals (Sweden)

    Wan-Nan U. Chen

    2016-08-01

    Full Text Available Anemones of genus Exaiptasia are used as model organisms for the study of cnidarian-dinoflagellate (genus Symbiodinium endosymbiosis. However, while most reef-building corals harbor Symbiodinium of clade C, Exaiptasia spp. anemones mainly harbor clade B Symbiodinium (ITS2 type B1 populations. In this study, we reveal for the first time that bleached Exaiptasia pallida anemones can establish a symbiotic relationship with a clade C Symbiodinium (ITS2 type C1. We further found that anemones can transmit the exogenously supplied clade C Symbiodinium cells to their offspring by asexual reproduction (pedal laceration. In order to corroborate the establishment of stable symbiosis, we used microscopic techniques and genetic analyses to examine several generations of anemones, and the results of these endeavors confirmed the sustainability of the system. These findings provide a framework for understanding the differences in infection dynamics between homologous and heterologous dinoflagellate types using a model anemone infection system.

  9. The gynogenetic reproduction of diploid and triploid hybrid spined loaches (Cobitis: Teleostei), and their ability to establish successful clonal lineages - on the evolution of polyploidy in asexual vertebrates

    Czech Academy of Sciences Publication Activity Database

    Janko, Karel; Bohlen, Jörg; Lamatsch, D.; Flajšhans, Martin; Epplen, J. T.; Ráb, Petr; Kotlík, Petr; Šlechtová, Věra

    2007-01-01

    Roč. 131, - (2007), s. 185-194 ISSN 0016-6707 R&D Projects: GA ČR GP206/05/P586 Grant - others:EU Marie Curie Research amd Training Network(EU) MCRTN-CT-2004-512492; German Research Foundation(DE) SFB 567 Institutional research plan: CEZ:AV0Z50450515 Keywords : asexual reproduction * evolution of polyploidy * hybridisation Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 1.396, year: 2007

  10. Mate Limitation in Fungal Plant Parasites Can Lead to Cyclic Epidemics in Perennial Host Populations.

    Science.gov (United States)

    Ravigné, Virginie; Lemesle, Valérie; Walter, Alicia; Mailleret, Ludovic; Hamelin, Frédéric M

    2017-03-01

    Fungal plant parasites represent a growing concern for biodiversity and food security. Most ascomycete species are capable of producing different types of infectious spores both asexually and sexually. Yet the contributions of both types of spores to epidemiological dynamics have still to been fully researched. Here we studied the effect of mate limitation in parasites which perform both sexual and asexual reproduction in the same host. Since mate limitation implies positive density dependence at low population density, we modeled the dynamics of such species with both density-dependent (sexual) and density-independent (asexual) transmission rates. A first simple SIR model incorporating these two types of transmission from the infected compartment, suggested that combining sexual and asexual spore production can generate persistently cyclic epidemics in a significant part of the parameter space. It was then confirmed that cyclic persistence could occur in realistic situations by parameterizing a more detailed model fitting the biology of the Black Sigatoka disease of banana, for which literature data are available. We discuss the implications of these results for research on and management of Sigatoka diseases of banana.

  11. Hidden Genetic Diversity in an Asexually Reproducing Lichen Forming Fungal Group.

    Directory of Open Access Journals (Sweden)

    Ruth Del-Prado

    Full Text Available Asexual species with vegetative propagation of both symbiont partners (soredia in lichens may harbor lower species diversity because they may indeed represent evolutionary dead ends or clones. In this study we aim to critically examine species boundaries in the sorediate lichen forming fungi Parmotrema reticulatum-Parmotrema pseudoreticulatum complex applying coalescent-based approaches and other recently developed DNA-based methods. To this end, we gathered 180 samples from Africa, Asia, Australasia, Europe, North and South America and generated sequences of internal transcribed spacer of nuclear ribosomal DNA (ITS and DNA replication licensing factor MCM7 (MCM7. The dataset was analysed using different approaches such as traditional phylogeny-maximum likelihood and Bayesian-genetic distances, automatic barcode gap discovery and coalescent-based methods-PTP, GMYC, spedeSTEM and *Beast-in order to test congruence among results. Additionally, the divergence times were also estimated to elucidate diversification events. Delimitations inferred from the different analyses are comparable with only minor differences, and following a conservative approach we propose that the sampled specimens of the P. reticulatum-P. pseudoreticulatum complex belong to at least eight distinct species-level lineages. Seven are currently classified under P. reticulatum and one as P. pseudoreticulatum. In this work we discuss one of only few examples of cryptic species that have so far been found in sorediate reproducing lichen forming fungi. Additionally our estimates suggest a recent origin of the species complex-during the Miocene. Consequently, the wide distribution of several of the cryptic species has to be explained by intercontinental long-distance dispersal events.

  12. A Brazilian population of the asexual fungus-growing ant Mycocepurus smithii (Formicidae, Myrmicinae, Attini cultivates fungal symbionts with gongylidia-like structures.

    Directory of Open Access Journals (Sweden)

    Virginia E Masiulionis

    Full Text Available Attine ants cultivate fungi as their most important food source and in turn the fungus is nourished, protected against harmful microorganisms, and dispersed by the ants. This symbiosis evolved approximately 50-60 million years ago in the late Paleocene or early Eocene, and since its origin attine ants have acquired a variety of fungal mutualists in the Leucocoprineae and the distantly related Pterulaceae. The most specialized symbiotic interaction is referred to as "higher agriculture" and includes leafcutter ant agriculture in which the ants cultivate the single species Leucoagaricus gongylophorus. Higher agriculture fungal cultivars are characterized by specialized hyphal tip swellings, so-called gongylidia, which are considered a unique, derived morphological adaptation of higher attine fungi thought to be absent in lower attine fungi. Rare reports of gongylidia-like structures in fungus gardens of lower attines exist, but it was never tested whether these represent rare switches of lower attines to L. gonglyphorus cultivars or whether lower attine cultivars occasionally produce gongylidia. Here we describe the occurrence of gongylidia-like structures in fungus gardens of the asexual lower attine ant Mycocepurus smithii. To test whether M. smithii cultivates leafcutter ant fungi or whether lower attine cultivars produce gongylidia, we identified the M. smithii fungus utilizing molecular and morphological methods. Results shows that the gongylidia-like structures of M. smithii gardens are morphologically similar to gongylidia of higher attine fungus gardens and can only be distinguished by their slightly smaller size. A molecular phylogenetic analysis of the fungal ITS sequence indicates that the gongylidia-bearing M. smithii cultivar belongs to the so-called "Clade 1"of lower Attini cultivars. Given that M. smithii is capable of cultivating a morphologically and genetically diverse array of fungal symbionts, we discuss whether asexuality of

  13. A quasispecies approach to the evolution of sexual replication in unicellular organisms.

    Science.gov (United States)

    Tannenbaum, Emmanuel; Fontanari, José F

    2008-03-01

    This study develops a simplified model describing the evolutionary dynamics of a population composed of obligate sexually and asexually reproducing, unicellular organisms. The model assumes that the organisms have diploid genomes consisting of two chromosomes, and that the sexual organisms replicate by first dividing into haploid intermediates, which then combine with other haploids, followed by the normal mitotic division of the resulting diploid into two new daughter cells. We assume that the fitness landscape of the diploids is analogous to the single-fitness-peak approach often used in single-chromosome studies. That is, we assume a master chromosome that becomes defective with just one point mutation. The diploid fitness then depends on whether the genome has zero, one, or two copies of the master chromosome. We also assume that only pairs of haploids with a master chromosome are capable of combining so as to produce sexual diploid cells, and that this process is described by second-order kinetics. We find that, in a range of intermediate values of the replication fidelity, sexually reproducing cells can outcompete asexual ones, provided the initial abundance of sexual cells is above some threshold value. The range of values where sexual reproduction outcompetes asexual reproduction increases with decreasing replication rate and increasing population density. We critically evaluate a common approach, based on a group selection perspective, used to study the competition between populations and show its flaws in addressing the evolution of sex problem.

  14. Actividad inhibitoria de un polímero de quitosana en el crecimiento vegetativo y la reproducción asexual de un aislado de Phytophthora palmivora Butler

    OpenAIRE

    González-Peña Fundora, Dianevys; Gómez Izaguirre, Guadalupe; Fernández Morales, Ana; Vaillant Flores, Daymara; Falcón-Rodríguez, Alejandro B.

    2016-01-01

    El objetivo del trabajo fue evaluar el efecto de la quitosana sobre el crecimiento vegetativo y las fases de reproducción asexual del ciclo de vida de Phytophthora palmivora Butler. Soluciones con diferentes concentraciones de quitosana, que oscilaron desde 0,5 hasta 2,5g.l-1 se mezclaron con medio de cultivo V8 antes de verterse en placas Petri, donde luego se inoculó un disco de micelio del aislado. Se evaluaron aspectos morfoculturales y el crecimiento radial cuando las colonias del tratam...

  15. Quaternary selenostannates Na{sub 2-x}Ga{sub 2-x}Sn{sub 1+x}Se{sub 6} and AGaSnSe{sub 4} (A=K, Rb, and Cs) through rapid cooling of melts. Kinetics versus thermodynamics in the polymorphism of AGaSnSe{sub 4}

    Energy Technology Data Exchange (ETDEWEB)

    Hwang, S -J; Iyer, R G; Kanatzidis, M G

    2004-10-01

    The quaternary alkali-metal gallium selenostannates, Na{sub 2-x}Ga{sub 2-x}Sn{sub 1+x}Se{sub 6} and AGaSnSe{sub 4} (A=K, Rb, and Cs), were synthesized by reacting alkali-metal selenide, Ga, Sn, and Se with a flame melting-rapid cooling method. Na{sub 2-x}Ga{sub 2-x}Sn{sub 1+x}Se{sub 6} crystallizes in the non-centrosymmetric space group C2 with cell constants a=13.308(3) A, b=7.594(2) A, c=13.842(3) A, {beta}=118.730(4) deg., V=1226.7(5) A{sup 3}. {alpha}-KGaSnSe{sub 4} crystallizes in the tetragonal space group I4/mcm with a=8.186(5) A and c=6.403(5) A, V=429.1(5) A{sup 3}. {beta}-KGaSnSe{sub 4} crystallizes in the space group P2{sub 1}/c with cell constants a=7.490(2) A, b=12.578(3) A, c=18.306(5) A, {beta}=98.653(5) deg., V=1705.0(8) A{sup 3}. The unit cell of isostructural RbGaSnSe{sub 4} is a=7.567(2) A, b=12.656(3) A, c=18.277(4) A, {beta}=95.924(4) deg., V=1741.1(7) A{sup 3}. CsGaSnSe{sub 4} crystallizes in the orthorhombic space group Pmcn with a=7.679(2) A, b=12.655(3) A, c=18.278(5) A, V=1776.1(8) A{sup 3}. The structure of Na{sub 2-x}Ga{sub 2-x}Sn{sub 1+x}Se{sub 6} consists of a polar three-dimensional network of trimeric (Sn,Ga){sub 3}Se{sub 9} units with Na atoms located in tunnels. The AGaSnSe{sub 4} possess layered structures. The compounds show nearly the same Raman spectral features, except for Na{sub 2-x}Ga{sub 2-x}Sn{sub 1+x}Se{sub 6}. Optical band gaps, determined from UV-Vis spectroscopy, range from 1.50 eV in Na{sub 2-x}Ga{sub 2-x}Sn{sub 1+x}Se{sub 6} to 1.97 eV in CsGaSnSe{sub 4}. Cooling of the melts of KGaSnSe{sub 4} and RbGaSnSe{sub 4} produces only kinetically stable products. The thermodynamically stable product is accessible under extended annealing, which leads to the so-called {gamma}-form (BaGa{sub 2}S{sub 4}-type) of these compounds.

  16. One size fits one: pharmacogenetics in gastroenterology.

    Science.gov (United States)

    Porayette, Prashanth; Flockhart, David; Gupta, Sandeep K

    2014-04-01

    Individual variability in response and development of adverse effects to drugs is a major challenge in clinical practice. Pharmacogenomics refers to the aspect of personalized medicine where the patient's genetic information instructs the selection and dosage of therapy while also predicting its adverse effects profile. Sequencing of the entire human genome has given us the opportunity to study commonly used drugs as well as newer therapeutic agents in a new light, opening up opportunities for better drug efficacy and decreased adverse effects. This article highlights developments in pharmacogenomics, relates these to practice of gastroenterology, and outlines roadblocks in translation of this knowledge into clinical practice. Copyright © 2014 AGA Institute. Published by Elsevier Inc. All rights reserved.

  17. Fitting PAC spectra with stochastic models: PolyPacFit

    Energy Technology Data Exchange (ETDEWEB)

    Zacate, M. O., E-mail: zacatem1@nku.edu [Northern Kentucky University, Department of Physics and Geology (United States); Evenson, W. E. [Utah Valley University, College of Science and Health (United States); Newhouse, R.; Collins, G. S. [Washington State University, Department of Physics and Astronomy (United States)

    2010-04-15

    PolyPacFit is an advanced fitting program for time-differential perturbed angular correlation (PAC) spectroscopy. It incorporates stochastic models and provides robust options for customization of fits. Notable features of the program include platform independence and support for (1) fits to stochastic models of hyperfine interactions, (2) user-defined constraints among model parameters, (3) fits to multiple spectra simultaneously, and (4) any spin nuclear probe.

  18. Diploidy and the selective advantage for sexual reproduction in unicellular organisms.

    Science.gov (United States)

    Kleiman, Maya; Tannenbaum, Emmanuel

    2009-11-01

    This article develops mathematical models describing the evolutionary dynamics of both asexually and sexually reproducing populations of diploid unicellular organisms. The asexual and sexual life cycles are based on the asexual and sexual life cycles in Saccharomyces cerevisiae, Baker's yeast, which normally reproduces by asexual budding, but switches to sexual reproduction when stressed. The mathematical models consider three reproduction pathways: (1) Asexual reproduction, (2) self-fertilization, and (3) sexual reproduction. We also consider two forms of genome organization. In the first case, we assume that the genome consists of two multi-gene chromosomes, whereas in the second case, we consider the opposite extreme and assume that each gene defines a separate chromosome, which we call the multi-chromosome genome. These two cases are considered to explore the role that recombination has on the mutation-selection balance and the selective advantage of the various reproduction strategies. We assume that the purpose of diploidy is to provide redundancy, so that damage to a gene may be repaired using the other, presumably undamaged copy (a process known as homologous recombination repair). As a result, we assume that the fitness of the organism only depends on the number of homologous gene pairs that contain at least one functional copy of a given gene. If the organism has at least one functional copy of every gene in the genome, we assume a fitness of 1. In general, if the organism has l homologous pairs that lack a functional copy of the given gene, then the fitness of the organism is kappa(l). The kappa(l) are assumed to be monotonically decreasing, so that kappa(0) = 1 > kappa(1) > kappa(2) > cdots, three dots, centered > kappa(infinity) = 0. For nearly all of the reproduction strategies we consider, we find, in the limit of large N, that the mean fitness at mutation-selection balance is max{2e(-mu) - 1,0} where N is the number of genes in the haploid set of

  19. Symbiodinium mitigate the combined effects of hypoxia and acidification on a noncalcifying cnidarian

    KAUST Repository

    Klein, Shannon G.; Pitt, Kylie A.; Nitschke, Matthew R.; Goyen, Samantha; Welsh, David T.; Suggett, David J.; Carroll, Anthony R.

    2017-01-01

    polyps of a model host jellyfish (Cassiopea sp.) under reduced O (~2.09 mg/L) and pH (~ 7.63) scenarios in a full-factorial experiment. Host fitness was characterized as asexual reproduction and their ability to regulate internal pH and Symbiodinium

  20. Fitness club

    CERN Multimedia

    Fitness club

    2011-01-01

    General fitness Classes Enrolments are open for general fitness classes at CERN taking place on Monday, Wednesday, and Friday lunchtimes in the Pump Hall (building 216). There are shower facilities for both men and women. It is possible to pay for 1, 2 or 3 classes per week for a minimum of 1 month and up to 6 months. Check out our rates and enrol at: http://cern.ch/club-fitness Hope to see you among us! CERN Fitness Club fitness.club@cern.ch  

  1. Quantum mechanics formalism for biological evolution

    International Nuclear Information System (INIS)

    Bianconi, Ginestra; Rahmede, Christoph

    2012-01-01

    Highlights: ► Biological evolution is an off-equilibrium process described by path integrals over phylogenies. ► The phylogenies are sums of linear lineages for asexual populations. ► For sexual populations, each lineage is a tree and the path integral is given by a sum over these trees. ► Quantum statistics describe the stationary state of biological populations in simple cases. - Abstract: We study the evolution of sexual and asexual populations in fitness landscapes compatible with epistatic interactions. We find intriguing relations between the mathematics of biological evolution and quantum mechanics formalism. We give the general structure of the evolution of sexual and asexual populations which is in general an off-equilibrium process that can be expressed by path integrals over phylogenies. These phylogenies are the sum of linear lineages for asexual populations. For sexual populations, instead, each lineage is a tree of branching ratio two and the path integral describing the evolving population is given by a sum over these trees. Finally we show that the Bose–Einstein and the Fermi–Dirac distributions describe the stationary state of biological populations in simple cases.

  2. Sexual Hieracium pilosella plants are better inter-specific, while apomictic plants are better intra-specific competitors

    OpenAIRE

    Sailer, Christian; Schmid, Bernhard; Stöcklin, Jürg; Grossniklaus, Ueli

    2014-01-01

    Apomixis, asexual reproduction through seeds, occurs in over 40 plant families. This widespread phenomenon can lead to the fixation of successful genotypes, resulting in a fitness advantage. On the other hand, apomicts are expected to lose their fitness advantage if the environment changes because of their limited evolutionary potential, which is due to low genetic variability and the potential accumulation of deleterious somatic mutations. Nonetheless, some apomicts have been extremely succe...

  3. Symbiodinium mitigate the combined effects of hypoxia and acidification on a noncalcifying cnidarian

    KAUST Repository

    Klein, Shannon G.

    2017-04-08

    Anthropogenic nutrient inputs enhance microbial respiration within many coastal ecosystems, driving concurrent hypoxia and acidification. During photosynthesis, Symbiodinium spp., the microalgal endosymbionts of cnidarians and other marine phyla, produce O and assimilate CO and thus potentially mitigate the exposure of the host to these stresses. However, such a role for Symbiodinium remains untested for noncalcifying cnidarians. We therefore contrasted the fitness of symbiotic and aposymbiotic polyps of a model host jellyfish (Cassiopea sp.) under reduced O (~2.09 mg/L) and pH (~ 7.63) scenarios in a full-factorial experiment. Host fitness was characterized as asexual reproduction and their ability to regulate internal pH and Symbiodinium performance characterized by maximum photochemical efficiency, chla content and cell density. Acidification alone resulted in 58% more asexual reproduction of symbiotic polyps than aposymbiotic polyps (and enhanced Symbiodinium cell density) suggesting Cassiopea sp. fitness was enhanced by CO-stimulated Symbiodinium photosynthetic activity. Indeed, greater CO drawdown (elevated pH) was observed within host tissues of symbiotic polyps under acidification regardless of O conditions. Hypoxia alone produced 22% fewer polyps than ambient conditions regardless of acidification and symbiont status, suggesting Symbiodinium photosynthetic activity did not mitigate its effects. Combined hypoxia and acidification, however, produced similar numbers of symbiotic polyps compared with aposymbiotic kept under ambient conditions, demonstrating that the presence of Symbiodinium was key for mitigating the combined effects of hypoxia and acidification on asexual reproduction. We hypothesize that this mitigation occurred because of reduced photorespiration under elevated CO conditions where increased net O production ameliorates oxygen debt. We show that Symbiodinium play an important role in facilitating enhanced fitness of Cassiopea sp. polyps, and

  4. Flow cytometric readout based on Mitotracker Red CMXRos staining of live asexual blood stage malarial parasites reliably assesses antibody dependent cellular inhibition

    DEFF Research Database (Denmark)

    Jogdand, Prajakta S; Singh, Susheel K; Christiansen, Michael

    2012-01-01

    asynchronous and tightly synchronized asexual blood stage cultures of Plasmodium falciparum were stained with CMXRos and subjected to detection by flow cytometry and fluorescence microscopy. The parasite counts obtained by flow cytometry were compared to standard microscopic counts obtained through examination......ABSTRACT: BACKGROUND: Functional in vitro assays could provide insights into the efficacy of malaria vaccine candidates. For estimating the anti-parasite effect induced by a vaccine candidate, an accurate determination of live parasite count is an essential component of most in vitro bioassays....... Although traditionally parasites are counted microscopically, a faster, more accurate and less subjective method for counting parasites is desirable. In this study mitochondrial dye (Mitotracker Red CMXRos) was used for obtaining reliable live parasite counts through flow cytometry. METHODS: Both...

  5. Asexual sporulation signalling regulates autolysis of Aspergillus nidulans via modulating the chitinase ChiB production.

    Science.gov (United States)

    Pócsi, I; Leiter, E; Kwon, N-J; Shin, K-S; Kwon, G-S; Pusztahelyi, T; Emri, T; Abuknesha, R A; Price, R G; Yu, J-H

    2009-08-01

    Elucidation of the regulation of ChiB production in Aspergillus nidulans. Mutational inactivation of the A. nidulans chiB gene resulted in a nonautolytic phenotype. To better understand the mechanisms controlling both developmental progression and fungal autolysis, we examined a range of autolysis-associated parameters in A. nidulans developmental and/or autolytic mutants. Investigation of disorganization of mycelial pellets, loss of biomass, extra-/intracellular chitinase activities, ChiB production and chiB mRNA levels in various cultures revealed that, in submerged cultures, initialization of autolysis and stationary phase-induced ChiB production are intimately coupled, and that both processes are controlled by the FluG-BrlA asexual sporulation regulatory pathway. ChiB production does not affect the progression of apoptotic cell death in the aging A. nidulans cultures. The endochitinase ChiB plays an important role in autolysis of A. nidulans, and its production is initiated by FluG-BrlA signalling. Despite the fact that apoptosis is an inseparable part of fungal autolysis, its regulation is independent to FluG-initiated sporulation signalling. Deletion of chiB and fluG homologues in industrial filamentous fungal strains may stabilize the hyphal structures in the autolytic phase of growth and limit the release of autolytic hydrolases into the culture medium.

  6. Fitness Club

    CERN Multimedia

    Fitness Club

    2012-01-01

    Open to All: http://cern.ch/club-fitness  fitness.club@cern.ch Boxing Your supervisor makes your life too tough ! You really need to release the pressure you've been building up ! Come and join the fit-boxers. We train three times a week in Bd 216, classes for beginners and advanced available. Visit our website cern.ch/Boxing General Fitness Escape from your desk with our general fitness classes, to strengthen your heart, muscles and bones, improve you stamina, balance and flexibility, achieve new goals, be more productive and experience a sense of well-being, every Monday, Wednesday and Friday lunchtime, Tuesday mornings before work and Thursday evenings after work – join us for one of our monthly fitness workshops. Nordic Walking Enjoy the great outdoors; Nordic Walking is a great way to get your whole body moving and to significantly improve the condition of your muscles, heart and lungs. It will boost your energy levels no end. Pilates A body-conditioning technique de...

  7. FITS: a function-fitting program

    Energy Technology Data Exchange (ETDEWEB)

    Balestrini, S.J.; Chezem, C.G.

    1982-01-01

    FITS is an iterating computer program that adjusts the parameters of a function to fit a set of data points according to the least squares criterion and then lists and plots the results. The function can be programmed or chosen from a library that is provided. The library can be expanded to include up to 99 functions. A general plotting routine, contained in the program but useful in its own right, is described separately in an Appendix.

  8. Identification of a Golgi apparatus protein complex important for the asexual erythrocytic cycle of the malaria parasite Plasmodium falciparum.

    Science.gov (United States)

    Hallée, Stéphanie; Thériault, Catherine; Gagnon, Dominic; Kehrer, Jessica; Frischknecht, Friedrich; Mair, Gunnar R; Richard, Dave

    2018-03-26

    Compared with other eukaryotic cell types, malaria parasites appear to possess a more rudimentary Golgi apparatus being composed of dispersed, unstacked cis and trans-cisternae. Despite playing a central role in the secretory pathway of the parasite, few Plasmodium Golgi resident proteins have been characterised. We had previously identified a new Golgi resident protein of unknown function, which we had named Golgi Protein 1, and now show that it forms a complex with a previously uncharacterised transmembrane protein (Golgi Protein 2, GP2). The Golgi Protein complex localises to the cis-Golgi throughout the erythrocytic cycle and potentially also during the mosquito stages. Analysis of parasite strains where GP1 expression is conditionally repressed and/or the GP2 gene is inactivated reveals that though the Golgi protein complex is not essential at any stage of the parasite life cycle, it is important for optimal asexual development in the blood stages. © 2018 John Wiley & Sons Ltd.

  9. Fitness Club

    CERN Multimedia

    Fitness Club

    2011-01-01

    The CERN Fitness Club is organising Zumba Classes on the first Wednesday of each month, starting 7 September (19.00 – 20.00). What is Zumba®? It’s an exhilarating, effective, easy-to-follow, Latin-inspired, calorie-burning dance fitness-party™ that’s moving millions of people toward joy and health. Above all it’s great fun and an excellent work out. Price: 22 CHF/person Sign-up via the following form: https://espace.cern.ch/club-fitness/Lists/Zumba%20Subscription/NewForm.aspx For more info: fitness.club@cern.ch

  10. The cytosolic glyoxalases of Plasmodium falciparum are dispensable during asexual blood-stage development

    Directory of Open Access Journals (Sweden)

    Cletus A. Wezena

    2017-11-01

    Full Text Available The enzymes glyoxalase 1 and 2 (Glo1 and Glo2 are found in most eukaryotes and catalyze the glutathione-dependent conversion of 2-oxoaldehydes to 2-hydroxycarboxylic acids. Four glyoxalases are encoded in the genome of the malaria parasite Plasmodium falciparum, the cytosolic enzymes PfGlo1 and PfcGlo2, the apicoplast enzyme PftGlo2, and an inactive Glo1-like protein that also carries an apicoplast-targeting sequence. Inhibition or knockout of the Plasmodium glyoxalases was hypothesized to lead to an accumulation of 2-oxoaldehydes and advanced glycation end-products (AGE in the host-parasite unit and to result in parasite death. Here, we generated clonal P. falciparum strain 3D7 knockout lines for PFGLO1 and PFcGLO2 using the CRISPR-Cas9 system. Although 3D7Δglo1 knockout clones had an increased susceptibility to external glyoxal, all 3D7Δglo1 and 3D7Δcglo2 knockout lines were viable and showed no significant growth phenotype under standard growth conditions. Furthermore, the lack of PfcGlo2, but not PfGlo1, increased gametocyte commitment in the knockout lines. In summary, PfGlo1 and PfcGlo2 are dispensable during asexual blood-stage development while the loss of PfcGlo2 may induce the formation of transmissible gametocytes. These combined data show that PfGlo1 and PfcGlo2 are most likely not suited as targets for selective drug development.

  11. Fitness cost

    DEFF Research Database (Denmark)

    Nielsen, Karen L.; Pedersen, Thomas M.; Udekwu, Klas I.

    2012-01-01

    phage types, predominantly only penicillin resistant. We investigated whether isolates of this epidemic were associated with a fitness cost, and we employed a mathematical model to ask whether these fitness costs could have led to the observed reduction in frequency. Bacteraemia isolates of S. aureus...... from Denmark have been stored since 1957. We chose 40 S. aureus isolates belonging to phage complex 83A, clonal complex 8 based on spa type, ranging in time of isolation from 1957 to 1980 and with varyous antibiograms, including both methicillin-resistant and -susceptible isolates. The relative fitness...... of each isolate was determined in a growth competition assay with a reference isolate. Significant fitness costs of 215 were determined for the MRSA isolates studied. There was a significant negative correlation between number of antibiotic resistances and relative fitness. Multiple regression analysis...

  12. The FitTrack Index as fitness indicator: A pilot study | van Rensburg ...

    African Journals Online (AJOL)

    Conclusions: These results suggest that the web-based FitTrack Index may be considered an appropriate tool to evaluate exercise capacity and cardiovascular fitness in healthy individuals following an aerobic training programme. Keywords: Aerobic fitness, Exercise ability, Recreational fitness, Cardiovascular fitness, ...

  13. FITS: a function-fitting program

    Energy Technology Data Exchange (ETDEWEB)

    Balestrini, S.J.; Chezem, C.G.

    1982-08-01

    FITS is an iterating computer program that adjusts the parameters of a function to fit a set of data points according to the least squares criterion and then lists and plots the results. The function can be programmed or chosen from a library that is provided. The library can be expanded to include up to 99 functions. A general plotting routine, contained in the program but useful in its own right, is described separately in Appendix A. An example problem file and its solution is given in Appendix B.

  14. Mobile Sensor System AGaMon for Breath Control: Numerical Signal Analysis of Ternary Gas Mixtures and First Field Tests

    Directory of Open Access Journals (Sweden)

    Rolf Seifert

    2018-01-01

    Full Text Available An innovative mobile sensor system for breath control in the exhaled air is introduced. In this paper, the application of alcohol control in the exhaled air is considered. This sensor system operates semiconducting gas sensor elements with respect to the application in a thermo-cyclic operation mode. This operation mode leads to so-called conductance-over-time-profiles (CTPs, which are fingerprints of the gas mixture under consideration and can be used for substance identification and concentration determination. Especially for the alcohol control in the exhaled air, ethanol is the leading gas component to be investigated. But, there are also other interfering gas components in the exhaled air, like H2 and acetone, which may influence the measurement results. Therefore, a ternary ethanol-H2-acetone gas mixture was investigated. The establishing of the mathematical calibration model and the data analysis was performed with a newly developed innovative calibration and evaluation procedure called ProSens 3.0. The analysis of ternary ethanol-H2-acetone gas samples with ProSens 3.0 shows a very good substance identification performance and a very good concentration determination of the leading ethanol component. The relative analysis errors for the leading component ethanol were in all considered samples less than 9 %. First field test performed with the sensor system AGaMon shows very promising results.

  15. Physical Fitness Assessment.

    Science.gov (United States)

    Valdes, Alice

    This document presents baseline data on physical fitness that provides an outline for assessing the physical fitness of students. It consists of 4 tasks and a 13-item questionnaire on fitness-related behaviors. The fitness test evaluates cardiorespiratory endurance by a steady state jog; muscular strength and endurance with a two-minute bent-knee…

  16. The Association Between Self-Rated Fitness and Cardiorespiratory Fitness in Adults

    DEFF Research Database (Denmark)

    Jensen, Karina Gregersen; Rosthøj, Susanne; Linneberg, Allan

    2018-01-01

    To assess criterion validity of a single item question on self-rated physical fitness against objectively measured cardiorespiratory fitness. From the Health2008 study 749 men and women between 30 and 60 years of age rated their fitness as excellent, very good, good, fair or poor. Cardiorespiratory...... fitness was estimated with the watt-max test. Agreement between self-rated and objectively measured physical fitness was assessed by Cohen's weighted kappa coefficient. Correlation was determined by Goodman & Kruskal's gamma correlation coefficient. All analyses were stratified according to gender. Data...... from 323 men and 426 women were analysed. There was a slight agreement between self-rated and objectively measured fitness in men (weighted kappa: 0.18, [95%CI: 0.13;0.23]) and a fair agreement in women (weighted kappa: 0.27, [95%CI: 0.22;0.32]). In both genders, self-rated fitness was positively...

  17. FItness programy a individuální přístup ve fitness

    OpenAIRE

    Rambous, Milan

    2008-01-01

    Souhrn: Tato diplomová práce se zabývá problematikou fitness programů a individuálru'ho přístupu ve fitness centrech. Celé téma zahrnuje rozpracování postupu při vytváření fitness programů a roli osobního trenéra ve fitness. Dále jsou zde uvedeny specifika některých fitness programů a v empirické části pak příklad dvou individuálních fitness programů. Název práce: Fitness programy a individuálnípřístup ve fitness Title: FITNESS PROGRAMS AND INDIVIDUAL CARE IN FITNESS Cíle práce: 1. podrobný p...

  18. Computer code FIT

    International Nuclear Information System (INIS)

    Rohmann, D.; Koehler, T.

    1987-02-01

    This is a description of the computer code FIT, written in FORTRAN-77 for a PDP 11/34. FIT is an interactive program to decude position, width and intensity of lines of X-ray spectra (max. length of 4K channels). The lines (max. 30 lines per fit) may have Gauss- or Voigt-profile, as well as exponential tails. Spectrum and fit can be displayed on a Tektronix terminal. (orig.) [de

  19. The FORCE Fitness Profile--Adding a Measure of Health-Related Fitness to the Canadian Armed Forces Operational Fitness Evaluation.

    Science.gov (United States)

    Gagnon, Patrick; Spivock, Michael; Reilly, Tara; Mattie, Paige; Stockbrugger, Barry

    2015-11-01

    In 2013, the Canadian Armed Forces (CAF) implemented the Fitness for Operational Requirements of Canadian Armed Forces Employment (FORCE), a field expedient fitness test designed to predict the physical requirements of completing common military tasks. Given that attaining this minimal physical fitness standard may not represent a challenge to some personnel, a fitness incentive program was requested by the chain of command to recognize and reward fitness over and above the minimal standard. At the same time, it was determined that the CAF would benefit from a measure of general health-related fitness, in addition to this measure of operational fitness. The resulting incentive program structure is based on gender and 8 age categories. The results on the 4 elements of the FORCE evaluation were converted to a point scale from which normative scores were derived, where the median score corresponds to the bronze level, and silver, gold, and platinum correspond to a score which is 1, 2, and 3 SDs above this median, respectively. A suite of rewards including merit board point toward promotions and recognition on the uniform and material rewards was developed. A separate group rewards program was also tabled, to recognize achievements in fitness at the unit level. For general fitness, oxygen capacity was derived from FORCE evaluation results and combined with a measure of abdominal circumference. Fitness categories were determined based on relative risks of mortality and morbidity for each age and gender group. Pilot testing of this entire program was performed with 624 participants to assess participants' reactions to the enhanced test, and also to verify logistical aspects of the electronic data capture, calculation, and transfer system. The newly dubbed fitness profile program was subsequently approved by the senior leadership of the CAF and is scheduled to begin a phased implementation in June 2015.

  20. Complete life cycle of the lichen fungus Calopadia puiggarii (Pilocarpaceae, Ascomycetes) documented in situ: propagule dispersal, establishment of symbiosis, thallus development, and formation of sexual and asexual reproductive structures.

    Science.gov (United States)

    Sanders, William B

    2014-11-01

    The life histories of lichen fungi are not well known and cannot be readily studied in laboratory culture. This work documents in situ the complete life cycle of the widespread crustose lichen Calopadia puiggarii, which reproduces sexually and asexually on the surfaces of leaves. Plastic cover slips held in a mesh frame were placed over leaves in the field and successively removed for microphotography of colonizing lichens. Macroconidia produced within campylidia encircled photobiont cells and codispersed with them, a feature not reported previously for C. puiggarii. Dispersed macroconidia readily germinated and lichenized the photobionts. Algal cells were often dislodged from the encircling macroconidia, providing a likely source for the free-living populations observed. Aposymbiotically dispersed ascospores germinated and lichenized nearby algal cells soon after dispersal. Thallus areolae merged readily in early development, although adjacent mature thalli were often separated by growth inhibition zones. Pycnidia are reported for the first time in Calopadia; their pyriform microconidia probably function as male gametes (spermatia). Pycnidia, apothecia, and campylidia began development similarly as darkly pigmented primordia on the fungal prothallus. Abundant dispersal of ascospores, conidia, and photobionts allows C. puiggarii to quickly colonize leaves with the dual advantages of sexual and asexual reproduction, and with the added convenience of having its algal partner on hand. Fusions and prothallic capture of additional algae provide many opportunities for multiple mycobiont and photobiont genotypes to be combined in a single thallus, but the outcomes of such events remain to be explored. © 2014 Botanical Society of America, Inc.

  1. Pre-exposure to simultaneous, but not individual, climate change stressors limits acclimation capacity of Irukandji jellyfish polyps to predicted climate scenarios

    Science.gov (United States)

    Klein, Shannon G.; Pitt, Kylie A.; Carroll, Anthony R.

    2017-09-01

    Researchers have investigated the immediate effects of end-of-century climate change scenarios on many marine species, yet it remains unclear whether we can reliably predict how marine species may respond to future conditions because biota may become either more or less resistant over time. Here, we examined the role of pre-exposure to elevated temperature and reduced pH in mitigating the potential negative effects of future ocean conditions on polyps of a dangerous Irukandji jellyfish Alatina alata. We pre-exposed polyps to elevated temperature (28 °C) and reduced pH (7.6), in a full factorial experiment that ran for 14 d. We secondarily exposed original polyps and their daughter polyps to either current (pH 8.0, 25 °C) or future conditions (pH 7.6, 28 °C) for a further 34 d to assess potential phenotypic plastic responses and whether asexual offspring could benefit from parental pre-exposure. Polyp fitness was characterised as asexual reproduction, respiration, feeding, and protein concentrations. Pre-exposure to elevated temperature alone partially mitigated the negative effects of future conditions on polyp fitness, while pre-exposure to reduced pH in isolation completely mitigated the negative effects of future conditions on polyp fitness. Pre-exposure to the dual stressors, however, reduced fitness under future conditions relative to those in the control treatment. Under future conditions, polyps had higher respiration rates regardless of the conditions they were pre-exposed to, suggesting that metabolic rates will be higher under future conditions. Parent and daughter polyps responded similarly to the various treatments tested, demonstrating that parental pre-exposure did not confer any benefit to asexual offspring under future conditions. Importantly, we demonstrate that while pre-exposure to the stressors individually may allow Irukandji polyps to acclimate over short timescales, the stressors are unlikely to occur in isolation in the long term, and

  2. Pre-exposure to simultaneous, but not individual, climate change stressors limits acclimation capacity of Irukandji jellyfish polyps to predicted climate scenarios

    KAUST Repository

    Klein, Shannon G.; Pitt, Kylie A.; Carroll, Anthony R.

    2017-01-01

    Researchers have investigated the immediate effects of end-of-century climate change scenarios on many marine species, yet it remains unclear whether we can reliably predict how marine species may respond to future conditions because biota may become either more or less resistant over time. Here, we examined the role of pre-exposure to elevated temperature and reduced pH in mitigating the potential negative effects of future ocean conditions on polyps of a dangerous Irukandji jellyfish Alatina alata. We pre-exposed polyps to elevated temperature (28 °C) and reduced pH (7.6), in a full factorial experiment that ran for 14 d. We secondarily exposed original polyps and their daughter polyps to either current (pH 8.0, 25 °C) or future conditions (pH 7.6, 28 °C) for a further 34 d to assess potential phenotypic plastic responses and whether asexual offspring could benefit from parental pre-exposure. Polyp fitness was characterised as asexual reproduction, respiration, feeding, and protein concentrations. Pre-exposure to elevated temperature alone partially mitigated the negative effects of future conditions on polyp fitness, while pre-exposure to reduced pH in isolation completely mitigated the negative effects of future conditions on polyp fitness. Pre-exposure to the dual stressors, however, reduced fitness under future conditions relative to those in the control treatment. Under future conditions, polyps had higher respiration rates regardless of the conditions they were pre-exposed to, suggesting that metabolic rates will be higher under future conditions. Parent and daughter polyps responded similarly to the various treatments tested, demonstrating that parental pre-exposure did not confer any benefit to asexual offspring under future conditions. Importantly, we demonstrate that while pre-exposure to the stressors individually may allow Irukandji polyps to acclimate over short timescales, the stressors are unlikely to occur in isolation in the long term, and

  3. Pre-exposure to simultaneous, but not individual, climate change stressors limits acclimation capacity of Irukandji jellyfish polyps to predicted climate scenarios

    KAUST Repository

    Klein, Shannon G.

    2017-05-20

    Researchers have investigated the immediate effects of end-of-century climate change scenarios on many marine species, yet it remains unclear whether we can reliably predict how marine species may respond to future conditions because biota may become either more or less resistant over time. Here, we examined the role of pre-exposure to elevated temperature and reduced pH in mitigating the potential negative effects of future ocean conditions on polyps of a dangerous Irukandji jellyfish Alatina alata. We pre-exposed polyps to elevated temperature (28 °C) and reduced pH (7.6), in a full factorial experiment that ran for 14 d. We secondarily exposed original polyps and their daughter polyps to either current (pH 8.0, 25 °C) or future conditions (pH 7.6, 28 °C) for a further 34 d to assess potential phenotypic plastic responses and whether asexual offspring could benefit from parental pre-exposure. Polyp fitness was characterised as asexual reproduction, respiration, feeding, and protein concentrations. Pre-exposure to elevated temperature alone partially mitigated the negative effects of future conditions on polyp fitness, while pre-exposure to reduced pH in isolation completely mitigated the negative effects of future conditions on polyp fitness. Pre-exposure to the dual stressors, however, reduced fitness under future conditions relative to those in the control treatment. Under future conditions, polyps had higher respiration rates regardless of the conditions they were pre-exposed to, suggesting that metabolic rates will be higher under future conditions. Parent and daughter polyps responded similarly to the various treatments tested, demonstrating that parental pre-exposure did not confer any benefit to asexual offspring under future conditions. Importantly, we demonstrate that while pre-exposure to the stressors individually may allow Irukandji polyps to acclimate over short timescales, the stressors are unlikely to occur in isolation in the long term, and

  4. There is no fitness but fitness, and the lineage is its bearer

    Science.gov (United States)

    2016-01-01

    Inclusive fitness has been the cornerstone of social evolution theory for more than a half-century and has matured as a mathematical theory in the past 20 years. Yet surprisingly for a theory so central to an entire field, some of its connections to evolutionary theory more broadly remain contentious or underappreciated. In this paper, we aim to emphasize the connection between inclusive fitness and modern evolutionary theory through the following fact: inclusive fitness is simply classical Darwinian fitness, averaged over social, environmental and demographic states that members of a gene lineage experience. Therefore, inclusive fitness is neither a generalization of classical fitness, nor does it belong exclusively to the individual. Rather, the lineage perspective emphasizes that evolutionary success is determined by the effect of selection on all biological and environmental contexts that a lineage may experience. We argue that this understanding of inclusive fitness based on gene lineages provides the most illuminating and accurate picture and avoids pitfalls in interpretation and empirical applications of inclusive fitness theory. PMID:26729925

  5. There is no fitness but fitness, and the lineage is its bearer.

    Science.gov (United States)

    Akçay, Erol; Van Cleve, Jeremy

    2016-02-05

    Inclusive fitness has been the cornerstone of social evolution theory for more than a half-century and has matured as a mathematical theory in the past 20 years. Yet surprisingly for a theory so central to an entire field, some of its connections to evolutionary theory more broadly remain contentious or underappreciated. In this paper, we aim to emphasize the connection between inclusive fitness and modern evolutionary theory through the following fact: inclusive fitness is simply classical Darwinian fitness, averaged over social, environmental and demographic states that members of a gene lineage experience. Therefore, inclusive fitness is neither a generalization of classical fitness, nor does it belong exclusively to the individual. Rather, the lineage perspective emphasizes that evolutionary success is determined by the effect of selection on all biological and environmental contexts that a lineage may experience. We argue that this understanding of inclusive fitness based on gene lineages provides the most illuminating and accurate picture and avoids pitfalls in interpretation and empirical applications of inclusive fitness theory. © 2016 The Author(s).

  6. Fitness Club

    CERN Multimedia

    Fitness Club

    2010-01-01

    Nordic Walking Please note that the subscriptions for the general fitness classes from July to December are open: Subscriptions general fitness classes Jul-Dec 2010 Sign-up to the Fitness Club mailing list here Nordic Walking: Sign-up to the Nordic Walking mailing list here Beginners Nordic walking lessons Monday Lunchtimes (rdv 12:20 for 12:30 departure) 13.09/20.09/27.09/04.10 11.10/18.10/08.11/15.11 22.11/29.11/06.12/20.12 Nordic walking lessons Tuesday evenings (rdv 17:50 for 18:00 departure) 07.09/14.09/21.09/28.09 05.10/12.10/19.10/26.10 Intermediate/Advanced Nordic walking outings (follow the nordic walking lessons before signing up for the outings) every Thursday from 16.09 - 16.12, excluding 28.10 and 09.12 Subscriptions and info: fitness.club@cern.ch  

  7. Current indirect fitness and future direct fitness are not incompatible.

    Science.gov (United States)

    Brahma, Anindita; Mandal, Souvik; Gadagkar, Raghavendra

    2018-02-01

    In primitively eusocial insects, many individuals function as workers despite being capable of independent reproduction. Such altruistic behaviour is usually explained by the argument that workers gain indirect fitness by helping close genetic relatives. The focus on indirect fitness has left open the question of whether workers are also capable of getting direct fitness in the future in spite of working towards indirect fitness in the present. To investigate this question, we recorded behavioural profiles of all wasps on six naturally occurring nests of Ropalidia marginata , and then isolated all wasps in individual plastic boxes, giving them an opportunity to initiate nests and lay eggs. We found that 41% of the wasps successfully did so. Compared to those that failed to initiate nests, those that did were significantly younger, had significantly higher frequency of self-feeding behaviour on their parent nests but were not different in the levels of work performed in the parent nests. Thus ageing and poor feeding, rather than working for their colonies, constrain individuals for future independent reproduction. Hence, future direct fitness and present work towards gaining indirect fitness are not incompatible, making it easier for worker behaviour to be selected by kin selection or multilevel selection. © 2018 The Author(s).

  8. Unge, sundhed og fitness

    DEFF Research Database (Denmark)

    Jensen, Jens-Ole

    2003-01-01

    Artiklen redegør for udbredelsen af fitness blandt unge og diskuterer, hvor det er blevet så populært at dyrke fitness.......Artiklen redegør for udbredelsen af fitness blandt unge og diskuterer, hvor det er blevet så populært at dyrke fitness....

  9. Antimalarial agents against both sexual and asexual parasites stages: structure-activity relationships and biological studies of the Malaria Box compound 1-[5-(4-bromo-2-chlorophenyl)furan-2-yl]-N-[(piperidin-4-yl)methyl]methanamine (MMV019918) and analogues.

    Science.gov (United States)

    Vallone, Alessandra; D'Alessandro, Sarah; Brogi, Simone; Brindisi, Margherita; Chemi, Giulia; Alfano, Gloria; Lamponi, Stefania; Lee, Soon Goo; Jez, Joseph M; Koolen, Karin J M; Dechering, Koen J; Saponara, Simona; Fusi, Fabio; Gorelli, Beatrice; Taramelli, Donatella; Parapini, Silvia; Caldelari, Reto; Campiani, Giuseppe; Gemma, Sandra; Butini, Stefania

    2018-04-25

    Therapies addressing multiple stages of Plasmodium falciparum life cycle are highly desirable for implementing malaria elimination strategies. MMV019918 (1, 1-[5-(4-bromo-2-chlorophenyl)furan-2-yl]-N-[(piperidin-4-yl)methyl]methanamine) was selected from the MMV Malaria Box for its dual activity against both asexual stages and gametocytes. In-depth structure-activity relationship studies and cytotoxicity evaluation led to the selection of 25 for further biological investigation. The potential transmission blocking activity of 25 versus P. falciparum was confirmed through the standard membrane-feeding assay. Both 1 and 25 significantly prolonged atrioventricular conduction time in Langendorff-isolated rat hearts, and showed inhibitory activity of Ba 2+ current through Ca v 1.2 channels. An in silico target-fishing study suggested the enzyme phosphoethanolamine methyltransferase (PfPMT) as a potential target. However, compound activity against PfPMT did not track with the antiplasmodial activity, suggesting the latter activity relies on a different molecular target. Nevertheless, 25 showed interesting activity against PfPMT, which could be an important starting point for the identification of more potent inhibitors active against both sexual and asexual stages of the parasite. Copyright © 2018 Elsevier Masson SAS. All rights reserved.

  10. Transcending the Curricular Barrier between Fitness and Reading with FitLit

    Science.gov (United States)

    Opitz, Michael F.

    2011-01-01

    The author discusses how FitLit, children's literature that spotlights the multiple aspects of health and well-being, offers a vehicle for integrating reading and fitness into existing classroom routines such as guided reading, read-alouds, independent reading, and reading and writing workshop. Sample FitLit titles are provided as well as a…

  11. Fodbold Fitness

    DEFF Research Database (Denmark)

    Bennike, Søren

    Samfundet forandrer sig og ligeså gør danskernes idrætsmønstre. Fodbold Fitness, der er afhandlingens omdrejningspunkt, kan iagttages som en reaktion på disse forandringer. Afhandlingen ser nærmere på Fodbold Fitness og implementeringen af dette, der ingenlunde er nogen let opgave. Bennike bidrager...

  12. Comparing Person Organization Fit and Person Job Fit

    Directory of Open Access Journals (Sweden)

    Kadir Ardıç

    2016-07-01

    Full Text Available Although there have been many studies conducted to analyze the effects of person-organization fit (POF and person-job fit (PJF on individual outcomes, little is known about which of these fit associates stronger with individual variables (i.e., intention to quit job, IQJ, and perceived individual performance, PIP. Therefore the purpose of the study is to compare the relationships of PJF and POF with IQJ and PIP. The sample of the study consists of security guards working at a private company's civil aviation safety department. Totally 98 security guards participated to the research. Results indicated that, the relationships of PJF and POF with IQJ and PIP were not significantly different. Consequently the results indicate that POF and PJF associate similarly with critical individual outcomes.

  13. Fitness club

    CERN Multimedia

    Fitness club

    2013-01-01

      Nordic Walking Classes Come join the Nordic walking classes and outings offered by the CERN Fitness Club starting September 2013. Our licensed instructor Christine offers classes for people who’ve never tried Nordic Walking and who would like to learn the technique, and outings for people who have completed the classes and enjoy going out as a group. Course 1: Tuesdays 12:30 - 13:30 24 September, 1 October, 8 October, 15 October Course 2: Tuesdays 12:30 - 13:30 5 November, 12 November, 19 November, 26 November Outings will take place on Thursdays (12:30 to 13:30) from 12 September 2013. We meet at the CERN Club Barracks car park (close to Entrance A) 10 minutes before departure. Prices: 50 CHF for 4 classes, including the 10 CHF Club membership. Payments made directly to instructor. Renting Poles: Poles can be rented from Christine at 5 CHF / hour. Subscription: Please subscribe at: http://cern.ch/club-fitness Looking forward to seeing you among us! Fitness Club FitnessClub@c...

  14. Fitness Club

    CERN Multimedia

    Fitness Club

    2012-01-01

    Get in Shape for Summer with the CERN Fitness Club Saturday 23 June 2012 from 14:30 to 16.30 (doors open at 14.00) Germana’s Fitness Workshop. Build strength and stamina, sculpt and tone your body and get your heart pumping with Germana’s workout mixture of Cardio Attack, Power Pump, Power Step, Cardio Combat and Cross-Training. Where: 216 (Pump room – equipped with changing rooms and showers). What to wear: comfortable clothes and indoor sports shoes + bring a drink! How much: 15 chf Sign up here: https://espace.cern.ch/club-fitness/Lists/Test_Subscription/NewForm.aspx? Join the Party and dance yourself into shape at Marco + Marials Zumba Masterclass. Saturday 30 June 2012 from 15:00 to 16:30 Marco + Mariel’s Zumba Masterclass Where: 216 (Pump room – equipped with changing rooms and showers). What to wear: comfortable clothes and indoor sports shoes + bring a drink! How much: 25 chf Sign up here: https://espace.cern.ch/club-fitness/Lists/Zumba%20...

  15. Fitness Club

    CERN Multimedia

    Fitness Club

    2012-01-01

      The CERN Fitness Club is pleased to announce its new early morning class which will be taking place on: Tuesdays from 24th April 07:30 to 08:15 216 (Pump Hall, close to entrance C) – Facilities include changing rooms and showers. The Classes: The early morning classes will focus on workouts which will help you build not only strength and stamina, but will also improve your balance, and coordination. Our qualified instructor Germana will accompany you throughout the workout  to ensure you stay motivated so you achieve the best results. Sign up and discover the best way to start your working day full of energy! How to subscribe? We invite you along to a FREE trial session, if you enjoy the activity, please sign up via our website: https://espace.cern.ch/club-fitness/Activities/SUBSCRIBE.aspx. * * * * * * * * Saturday 28th April Get in shape for the summer at our fitness workshop and zumba dance party: Fitness workshop with Germana 13:00 to 14:30 - 216 (Pump Hall) Price...

  16. Homogeneous population of the brown alga Sargassum polycystum in Southeast Asia: possible role of recent expansion and asexual propagation.

    Directory of Open Access Journals (Sweden)

    Sze Wai Chan

    Full Text Available Southeast Asia has been known as one of the biodiversity hotspots in the world. Repeated glacial cycles during Pleistocene were believed to cause isolation of marine taxa in refugia, resulting in diversification among lineages. Recently, ocean current was also found to be another factor affecting gene flow by restricting larval dispersal in animals. Macroalgae are unique in having mode of reproduction that differs from that of animals. Our study on the phylogeographical pattern of the brown macroalga Sargassum polycystum using nuclear Internal Transcribed Spacer 2 (ITS2, plastidal RuBisCO spacer (Rub spacer and mitochondrial cytochrome oxidase subunit-III (Cox3 as molecular markers revealed genetic homogeneity across 27 sites in Southeast Asia and western Pacific, in sharp contrast to that revealed from most animal studies. Our data suggested that S. polycystum persisted in single refugium during Pleistocene in a panmixia pattern. Expansion occurred more recently after the Last Glacial Maximum and recolonization of the newly flooded Sunda Shelf could have involved asexual propagation of the species. High dispersal ability through floating fronds carrying developing germlings may also contribute to the low genetic diversity of the species.

  17. Dual stage synthesis and crucial role of cytoadherence-linked asexual gene 9 in the surface expression of malaria parasite var proteins

    DEFF Research Database (Denmark)

    Goel, Suchi; Valiyaveettil, Manojkumar; Achur, Rajeshwara N

    2010-01-01

    adherence. However, how CLAG9 influences this process remains unknown. In this study, we show that CLAG9 interacts with VAR2CSA, a PfEMP1 that mediates IRBC adherence to chondroitin 4-sulfate in the placenta. Importantly, our results show that the adherent parasites synthesize CLAG9 at two stages--the early......Plasmodium falciparum erythrocyte membrane protein 1 (PfEMP1) family members mediate the adherence of parasite-infected red blood cells (IRBCs) to various host receptors. A previous study has shown that the parasite protein, cytoadherence-linked asexual gene 9 (CLAG9), is also essential for IRBC...... within the parasite. Based on these findings, we propose that CLAG9 plays a critical role in the trafficking of PfEMP1s onto the IRBC surface. These results have important implications for the development of therapeutics for cerebral, placental, and other cytoadherence-associated malaria illnesses....

  18. Autism as the Low-Fitness Extreme of a Parentally Selected Fitness Indicator.

    Science.gov (United States)

    Shaner, Andrew; Miller, Geoffrey; Mintz, Jim

    2008-12-01

    Siblings compete for parental care and feeding, while parents must allocate scarce resources to those offspring most likely to survive and reproduce. This could cause offspring to evolve traits that advertise health, and thereby attract parental resources. For example, experimental evidence suggests that bright orange filaments covering the heads of North American coot chicks may have evolved for this fitness-advertising purpose. Could any human mental disorders be the equivalent of dull filaments in coot chicks-low-fitness extremes of mental abilities that evolved as fitness indicators? One possibility is autism. Suppose that the ability of very young children to charm their parents evolved as a parentally selected fitness indicator. Young children would vary greatly in their ability to charm parents, that variation would correlate with underlying fitness, and autism could be the low-fitness extreme of this variation. This view explains many seemingly disparate facts about autism and leads to some surprising and testable predictions.

  19. Boxer crabs induce asexual reproduction of their associated sea anemones by splitting and intraspecific theft

    Directory of Open Access Journals (Sweden)

    Yisrael Schnytzer

    2017-01-01

    Full Text Available Crabs of the genus Lybia have the remarkable habit of holding a sea anemone in each of their claws. This partnership appears to be obligate, at least on the part of the crab. The present study focuses on Lybia leptochelis from the Red Sea holding anemones of the genus Alicia (family Aliciidae. These anemones have not been found free living, only in association with L. leptochelis. In an attempt to understand how the crabs acquire them, we conducted a series of behavioral experiments and molecular analyses. Laboratory observations showed that the removal of one anemone from a crab induces a “splitting” behavior, whereby the crab tears the remaining anemone into two similar parts, resulting in a complete anemone in each claw after regeneration. Furthermore, when two crabs, one holding anemones and one lacking them, are confronted, the crabs fight, almost always leading to the “theft” of a complete anemone or anemone fragment by the crab without them. Following this, crabs “split” their lone anemone into two. Individuals of Alicia sp. removed from freshly collected L. leptochelis were used for DNA analysis. By employing AFLP (Fluorescence Amplified Fragments Length Polymorphism it was shown that each pair of anemones from a given crab is genetically identical. Furthermore, there is genetic identity between most pairs of anemone held by different crabs, with the others showing slight genetic differences. This is a unique case in which one animal induces asexual reproduction of another, consequently also affecting its genetic diversity.

  20. Mn(II) oxidation by an ascomycete fungus is linked to superoxide production during asexual reproduction.

    Science.gov (United States)

    Hansel, Colleen M; Zeiner, Carolyn A; Santelli, Cara M; Webb, Samuel M

    2012-07-31

    Manganese (Mn) oxides are among the most reactive minerals within the environment, where they control the bioavailability of carbon, nutrients, and numerous metals. Although the ability of microorganisms to oxidize Mn(II) to Mn(III/IV) oxides is scattered throughout the bacterial and fungal domains of life, the mechanism and physiological basis for Mn(II) oxidation remains an enigma. Here, we use a combination of compound-specific chemical assays, microspectroscopy, and electron microscopy to show that a common Ascomycete filamentous fungus, Stilbella aciculosa, oxidizes Mn(II) to Mn oxides by producing extracellular superoxide during cell differentiation. The reactive Mn oxide phase birnessite and the reactive oxygen species superoxide and hydrogen peroxide are colocalized at the base of asexual reproductive structures. Mn oxide formation is not observed in the presence of superoxide scavengers (e.g., Cu) and inhibitors of NADPH oxidases (e.g., diphenylene iodonium chloride), enzymes responsible for superoxide production and cell differentiation in fungi. Considering the recent identification of Mn(II) oxidation by NADH oxidase-based superoxide production by a common marine bacterium (Roseobacter sp.), these results introduce a surprising homology between some prokaryotic and eukaryotic organisms in the mechanisms responsible for Mn(II) oxidation, where oxidation appears to be a side reaction of extracellular superoxide production. Given the versatility of superoxide as a redox reactant and the widespread ability of fungi to produce superoxide, this microbial extracellular superoxide production may play a central role in the cycling and bioavailability of metals (e.g., Hg, Fe, Mn) and carbon in natural systems.

  1. Genomic and metabolic characterisation of alkaloid biosynthesis by asexual Epichloë fungal endophytes of tall fescue pasture grasses.

    Science.gov (United States)

    Ekanayake, Piyumi N; Kaur, Jatinder; Tian, Pei; Rochfort, Simone J; Guthridge, Kathryn M; Sawbridge, Timothy I; Spangenberg, German C; Forster, John W

    2017-06-01

    Symbiotic associations between tall fescue grasses and asexual Epichloë fungal endophytes exhibit biosynthesis of alkaloid compounds causing both beneficial and detrimental effects. Candidate novel endophytes with favourable chemotypic profiles have been identified in germplasm collections by screening for genetic diversity, followed by metabolite profile analysis in endogenous genetic backgrounds. A subset of candidates was subjected to genome survey sequencing to detect the presence or absence and structural status of known genes for biosynthesis of the major alkaloid classes. The capacity to produce specific metabolites was directly predictable from metabolic data. In addition, study of duplicated gene structure in heteroploid genomic constitutions provided further evidence for the origin of such endophytes. Selected strains were inoculated into meristem-derived callus cultures from specific tall fescue genotypes to perform isogenic comparisons of alkaloid profile in different host backgrounds, revealing evidence for host-specific quantitative control of metabolite production, consistent with previous studies. Certain strains were capable of both inoculation and formation of longer-term associations with a nonhost species, perennial ryegrass (Lolium perenne L.). Discovery and primary characterisation of novel endophytes by DNA analysis, followed by confirmatory metabolic studies, offers improvements of speed and efficiency and hence accelerated deployment in pasture grass improvement programs.

  2. Limitations of inclusive fitness.

    Science.gov (United States)

    Allen, Benjamin; Nowak, Martin A; Wilson, Edward O

    2013-12-10

    Until recently, inclusive fitness has been widely accepted as a general method to explain the evolution of social behavior. Affirming and expanding earlier criticism, we demonstrate that inclusive fitness is instead a limited concept, which exists only for a small subset of evolutionary processes. Inclusive fitness assumes that personal fitness is the sum of additive components caused by individual actions. This assumption does not hold for the majority of evolutionary processes or scenarios. To sidestep this limitation, inclusive fitness theorists have proposed a method using linear regression. On the basis of this method, it is claimed that inclusive fitness theory (i) predicts the direction of allele frequency changes, (ii) reveals the reasons for these changes, (iii) is as general as natural selection, and (iv) provides a universal design principle for evolution. In this paper we evaluate these claims, and show that all of them are unfounded. If the objective is to analyze whether mutations that modify social behavior are favored or opposed by natural selection, then no aspect of inclusive fitness theory is needed.

  3. Getting CSR communication fit

    DEFF Research Database (Denmark)

    Schmeltz, Line

    2017-01-01

    Companies experience increasing legal and societal pressure to communicate about their corporate social responsibility (CSR) engagements from a number of different publics. One very important group is that of young consumers who are predicted to be the most important and influential consumer group...... in the near future. From a value- theoretical base, this article empirically explores the role and applicability of ‘fit’ in strategic CSR communication targeted at young consumers. Point of departure is taken in the well-known strategic fit (a logical link between a company’s CSR commitment and its core...... values) and is further developed by introducing two additional fits, the CSR- Consumer fit and the CSR-Consumer-Company fit (Triple Fit). Through a sequential design, the three fits are empirically tested and their potential for meeting young consumers’ expectations for corporate CSR messaging...

  4. Automated ligand fitting by core-fragment fitting and extension into density

    International Nuclear Information System (INIS)

    Terwilliger, Thomas C.; Klei, Herbert; Adams, Paul D.; Moriarty, Nigel W.; Cohn, Judith D.

    2006-01-01

    An automated ligand-fitting procedure has been developed and tested on 9327 ligands and (F o − F c )exp(iϕ c ) difference density from macromolecular structures in the Protein Data Bank. A procedure for fitting of ligands to electron-density maps by first fitting a core fragment of the ligand to density and then extending the remainder of the ligand into density is presented. The approach was tested by fitting 9327 ligands over a wide range of resolutions (most are in the range 0.8-4.8 Å) from the Protein Data Bank (PDB) into (F o − F c )exp(iϕ c ) difference density calculated using entries from the PDB without these ligands. The procedure was able to place 58% of these 9327 ligands within 2 Å (r.m.s.d.) of the coordinates of the atoms in the original PDB entry for that ligand. The success of the fitting procedure was relatively insensitive to the size of the ligand in the range 10–100 non-H atoms and was only moderately sensitive to resolution, with the percentage of ligands placed near the coordinates of the original PDB entry for fits in the range 58–73% over all resolution ranges tested

  5. Childhood cardiorespiratory fitness, muscular fitness and adult measures of glucose homeostasis.

    Science.gov (United States)

    Fraser, Brooklyn J; Blizzard, Leigh; Schmidt, Michael D; Juonala, Markus; Dwyer, Terence; Venn, Alison J; Magnussen, Costan G

    2018-02-14

    To assess whether childhood cardiorespiratory fitness (CRF) and muscular fitness phenotypes (strength, power, endurance) predict adult glucose homeostasis measures. Prospective longitudinal study. Study examining participants who had physical fitness measured in childhood (aged 7-15 years) and who attended follow-up clinics approximately 20 years later and provided a fasting blood sample which was tested for glucose and insulin. Physical fitness measurements included muscular strength (right and left grip, shoulder flexion, shoulder and leg extension), power (standing long jump distance) and endurance (number of push-ups in 30s), and CRF (1.6km run duration). In adulthood, fasting glucose and insulin levels were used to derive glucose homeostasis measures of insulin resistance (HOMA2-IR) and beta cell function (HOMA2-β). A standard deviation increase in childhood CRF or muscular strength (males) was associated with fasting glucose (CRF: β=-0.06mmol/L), fasting insulin (CRF: β=-0.73mU/L; strength: β=-0.40mU/L), HOMA2-IR (CRF: β=-0.06; strength: β=-0.05) and HOMA2-β (CRF: β=-3.06%; strength: β=-2.62%) in adulthood, independent of the alternative fitness phenotype (all p0.06). CRF and muscular fitness in childhood were inversely associated with measures of fasting insulin, insulin resistance and beta cell function in adulthood. Childhood CRF and muscular fitness could both be potential independent targets for strategies to help reduce the development of adverse glucose homeostasis. Copyright © 2018 Sports Medicine Australia. Published by Elsevier Ltd. All rights reserved.

  6. Fitness: Tips for Staying Motivated

    Science.gov (United States)

    Healthy Lifestyle Fitness Fitness is for life. Motivate yourself with these practical tips. By Mayo Clinic Staff Have ... 27, 2015 Original article: http://www.mayoclinic.org/healthy-lifestyle/fitness/in-depth/fitness/art-20047624 . Mayo Clinic ...

  7. A person-environment fit approach to volunteerism : Volunteer personality fit and culture fit as predictors of affective outcomes

    NARCIS (Netherlands)

    Van Vianen, Annelies E. M.; Nijstad, Bernard A.; Voskuijl, Olga F.

    2008-01-01

    This study employed a person-environment (P-E) fit approach to explaining volunteer satisfaction, affective commitment, and turnover intentions. It was hypothesized that personality fit would explain additional variance in volunteer affective outcomes above and beyond motives to volunteer. This

  8. A person-environment fit approach to volunteerism: Volunteer personality-fit and culture-fit as predictors of affective outcomes

    NARCIS (Netherlands)

    van Vianen, A.E.M.; Nijstad, B.A.; Voskuijl, O.F.

    2008-01-01

    This study employed a person-environment (P-E) fit approach to explaining volunteer satisfaction, affective commitment, and turnover intentions. It was hypothesized that personality fit would explain additional variance in volunteer affective outcomes above and beyond motives to volunteer. This

  9. Physical Fitness: Get Your Body Moving

    Science.gov (United States)

    Physical Fitness: Get Your Body Moving; Exercise; does exercise help quit smoking; exercises after quitting smoking; exercise after smoking; exercise and quitting smoking; exercise and smoking; smoking articles; articles about smoking; articles on smoking; articles about smoking; article on smoking; health articles on smoking; smoking article; benefits of physical activity; benefits for physical activity; benefit of physical activity; benefits to physical activity; daily physical activities; daily physical activity; healthy physical activities; healthy physical activity; health activities; activity for health; exercise physical activity and health; health activities; health activities for kids; health and fitness activities; health benefits for physical activity; health benefits from physical activity; health benefits of physical activity; health benefits physical activity; health promotion activities; physical exercise; exercise and physical activity; exercise and physical health; exercise for physical fitness; health benefits of physical fitness; how to do physical exercise; physical activity and exercise; physical activity exercise; physical health; physical health and fitness; physical health and wellness; physical health benefits; physical Health fitness; what are the benefits of physical fitness; physical fitness; about physical fitness; benefits of physical fitness; how to improve physical fitness; physical fitness; physical fitness article; fitness; fitness article; fitness articles; fitness plans; health and fitness; exercise; benefits of regular exercise on health; exercise plan; exercise tips; routine; best work out routine for overweight women

  10. Direct fitness of group living mammals varies with breeding strategy, climate and fitness estimates.

    Science.gov (United States)

    Ebensperger, Luis A; Rivera, Daniela S; Hayes, Loren D

    2012-09-01

    1. Understanding how variation in fitness relates to variation in group living remains critical to determine whether this major aspect of social behaviour is currently adaptive. 2. Available evidence in social mammals aimed to examine this issue remains controversial. Studies show positive (i.e. potentially adaptive), neutral or even negative fitness effects of group living. 3. Attempts to explain this variation rely on intrinsic and extrinsic factors to social groups. Thus, relatively more positive fitness effects are predicted in singularly breeding as opposed to plural breeding species. Fitness effects of sociality in turn may depend on ecological conditions (i.e. extrinsic factors) that influence associated benefits and costs. 4. We used meta-analytic tools to review how breeding strategy or ecological conditions influence the effect size associated with direct fitness-sociality relationships reported in the mammalian literature. Additionally, we determined how taxonomic affiliation of species studied, different fitness and sociality measures used, and major climatic conditions of study sites explained any variation in direct fitness effect size. 5. We found group living had modest, yet positive effects on direct fitness. This generally adaptive scenario was contingent not only upon breeding strategy and climate of study sites, but also on fitness measures examined. Thus, positive and significant effects characterized singular as opposed to plural breeding strategies. 6. We found more positive fitness effects on studies conducted in tropical as opposed to temperate or arid climates. More positive and significant effects were noted on studies that relied on group fecundity, male fecundity and offspring survival as measures of fitness. 7. To conclude, direct fitness consequences of mammalian group living are driven by interspecific differences in breeding strategy and climate conditions. Other factors not examined in this study, namely individual variation in

  11. Clinical Practice Update: The Use of Per-Oral Endoscopic Myotomy in Achalasia: Expert Review and Best Practice Advice From the AGA Institute.

    Science.gov (United States)

    Kahrilas, Peter J; Katzka, David; Richter, Joel E

    2017-11-01

    The purpose of this review is to describe a place for per-oral endoscopic myotomy (POEM) among the currently available robust treatments for achalasia. The recommendations outlined in this review are based on expert opinion and on relevant publications from PubMed and EMbase. The Clinical Practice Updates Committee of the American Gastroenterological Association proposes the following recommendations: 1) in determining the need for achalasia therapy, patient-specific parameters (Chicago Classification subtype, comorbidities, early vs late disease, primary or secondary causes) should be considered along with published efficacy data; 2) given the complexity of this procedure, POEM should be performed by experienced physicians in high-volume centers because an estimated 20-40 procedures are needed to achieve competence; 3) if the expertise is available, POEM should be considered as primary therapy for type III achalasia; 4) if the expertise is available, POEM should be considered as treatment option comparable with laparoscopic Heller myotomy for any of the achalasia syndromes; and 5) post-POEM patients should be considered high risk to develop reflux esophagitis and advised of the management considerations (potential indefinite proton pump inhibitor therapy and/or surveillance endoscopy) of this before undergoing the procedure. Copyright © 2017 AGA Institute. Published by Elsevier Inc. All rights reserved.

  12. Extensive fitness and human cooperation

    NARCIS (Netherlands)

    van Hateren, J. H.

    2015-01-01

    Evolution depends on the fitness of organisms, the expected rate of reproducing. Directly getting offspring is the most basic form of fitness, but fitness can also be increased indirectly by helping genetically related individuals (such as kin) to increase their fitness. The combined effect is known

  13. "Getting Fit Basically Just Means, Like, Nonfat": Children's Lessons in Fitness and Fatness

    Science.gov (United States)

    Powell, Darren; Fitzpatrick, Katie

    2015-01-01

    Current concerns about a childhood obesity crisis and children's physical activity levels have combined to justify fitness lessons as a physical education practice in New Zealand primary (elementary) schools. Researchers focused on children's understandings of fitness lessons argue that they construct fitness as a quest for an "ideal"…

  14. Adiposity, Aerobic Fitness, Muscle Fitness, and Markers of Inflammation in Children

    DEFF Research Database (Denmark)

    Steene-Johannessen, Jostein; Kolle, Elin; Andersen, Lars Bo

    2013-01-01

    PURPOSE: The purpose of this study was to describe levels of inflammation markers in Norwegian children and to examine the associations of adiposity, aerobic fitness and muscle fitness with markers of inflammation. METHODS: In 2005-2006, 1467 9-year-olds wererandomly selected from all regions...... explosive, isometric and endurance strength. Aerobic fitness was measured directly during a maximal cycle ergometer test. Adiposity was expressed as waist circumference (WC). RESULTS: The girls had significantly higher levels of CRP, leptin, adiponectin and resistin and lower levels of TNF-α compared...

  15. A Stepwise Fitting Procedure for automated fitting of Ecopath with Ecosim models

    Directory of Open Access Journals (Sweden)

    Erin Scott

    2016-01-01

    Full Text Available The Stepwise Fitting Procedure automates testing of alternative hypotheses used for fitting Ecopath with Ecosim (EwE models to observation reference data (Mackinson et al. 2009. The calibration of EwE model predictions to observed data is important to evaluate any model that will be used for ecosystem based management. Thus far, the model fitting procedure in EwE has been carried out manually: a repetitive task involving setting >1000 specific individual searches to find the statistically ‘best fit’ model. The novel fitting procedure automates the manual procedure therefore producing accurate results and lets the modeller concentrate on investigating the ‘best fit’ model for ecological accuracy.

  16. Analyses between Reproductive Behaviour, Genetic Diversity and Pythium Responsiveness in Zingiber spp. reveal an adaptive significance for hemiclonality

    Directory of Open Access Journals (Sweden)

    Geethu Elizabath Thomas

    2016-12-01

    Full Text Available AbstractMode of reproduction is generally considered to have long-range evolutionary implications on population survival. Because sexual reproduction produces genetically diverse genotypes, this mode of reproduction is predicted to positively influence the success potential of offspring in evolutionary arms race with parasites (Red queen whereas, without segregation and recombination, the obligate asexual multiplication may push a species into extinction due to the steady accumulation of deleterious mutations (Muller’s ratchet. However, the extent of linearity between reproductive strategies, genetic diversity and population fitness, and the contributions of different breeding strategies to population fitness are yet to be understood clearly. Genus Zingiber belonging to the pan-tropic family Zingiberaceae represents a good system to study contributions of different breeding behaviour on genetic diversity and population fitness, as this genus comprises species with contrasting breeding systems. In this study, we analyzed breeding behaviour, amplified fragment length polymorphism (AFLP diversity and response to the soft-rot pathogen Pythium aphanidermatum in 18 natural populations of three wild Zingiber spp.: Z. neesanum, Z. nimmonii and Z. zerumbet, together with the obligately asexual cultivated congener, ginger (Z. officinale. Ginger showed an exceptionally narrow genetic base, and adding to this, all the tested cultivars were uniformly susceptible to soft-rot. Concordant with the postulates of Muller’s ratchet, the background selection may be continuously pushing ginger into the ancestral state, rendering it inefficient in host-pathogen coevolution. Z. neesanum and Z. nimmonii populations were sexual and genetically diverse; however, contrary to Red Queen expectations, the populations were highly susceptible to soft-rot. Z. zerumbet showed a hemiclonal breeding behaviour. The populations inhabiting forest understory were large and

  17. Improving health-related fitness in adolescents: the CrossFit Teens™ randomised controlled trial.

    Science.gov (United States)

    Eather, Narelle; Morgan, Philip James; Lubans, David Revalds

    2016-01-01

    The aim of this study was to evaluate the preliminary efficacy and feasibility of the CrossFit Teens™ resistance training programme for improving health-related fitness and resistance training skill competency in adolescents. This assessor-blinded randomised controlled trial was conducted in one secondary school in the Hunter Region, Australia, from July to September 2013. Ninety-six (96) students (age = 15.4 (.5) years, 51.5% female) were randomised into intervention (n = 51) or control (n = 45) conditions for 8-weeks (60 min twice per week). Waist circumference, body mass index (BMI), BMI-Z score (primary outcomes), cardiorespiratory fitness (shuttle run test), muscular fitness (standing jump, push-up, handgrip, curl-up test), flexibility (sit and reach) and resistance training skill competency were measured at baseline and immediate post-intervention. Feasibility measures of recruitment, retention, adherence and satisfaction were assessed. Significant group-by-time intervention effects were found for waist circumference [-3.1 cm, P CrossFit Teens™ is a feasible and efficacious programme for improving health-related fitness in adolescents.

  18. Epidemiology of asexuality induced by the endosymbiotic Wolbachia across phytophagous wasp species: host plant specialization matters.

    Science.gov (United States)

    Boivin, T; Henri, H; Vavre, F; Gidoin, C; Veber, P; Candau, J-N; Magnoux, E; Roques, A; Auger-Rozenberg, M-A

    2014-05-01

    Among eukaryotes, sexual reproduction is by far the most predominant mode of reproduction. However, some systems maintaining sexuality appear particularly labile and raise intriguing questions on the evolutionary routes to asexuality. Thelytokous parthenogenesis is a form of spontaneous loss of sexuality leading to strong distortion of sex ratio towards females and resulting from mutation, hybridization or infection by bacterial endosymbionts. We investigated whether ecological specialization is a likely mechanism of spread of thelytoky within insect communities. Focusing on the highly specialized genus Megastigmus (Hymenoptera: Torymidae), we first performed a large literature survey to examine the distribution of thelytoky in these wasps across their respective obligate host plant families. Second, we tested for thelytoky caused by endosymbionts by screening in 15 arrhenotokous and 10 thelytokous species for Wolbachia, Cardinium, Arsenophonus and Rickettsia endosymbionts and by performing antibiotic treatments. Finally, we performed phylogenetic reconstructions using multilocus sequence typing (MLST) to examine the evolution of endosymbiont-mediated thelytoky in Megastigmus and its possible connections to host plant specialization. We demonstrate that thelytoky evolved from ancestral arrhenotoky through the horizontal transmission and the fixation of the parthenogenesis-inducing Wolbachia. We find that ecological specialization in Wolbachia's hosts was probably a critical driving force for Wolbachia infection and spread of thelytoky, but also a constraint. Our work further reinforces the hypothesis that community structure of insects is a major driver of the epidemiology of endosymbionts and that competitive interactions among closely related species may facilitate their horizontal transmission. © 2014 John Wiley & Sons Ltd.

  19. Measured, modeled, and causal conceptions of fitness

    Science.gov (United States)

    Abrams, Marshall

    2012-01-01

    This paper proposes partial answers to the following questions: in what senses can fitness differences plausibly be considered causes of evolution?What relationships are there between fitness concepts used in empirical research, modeling, and abstract theoretical proposals? How does the relevance of different fitness concepts depend on research questions and methodological constraints? The paper develops a novel taxonomy of fitness concepts, beginning with type fitness (a property of a genotype or phenotype), token fitness (a property of a particular individual), and purely mathematical fitness. Type fitness includes statistical type fitness, which can be measured from population data, and parametric type fitness, which is an underlying property estimated by statistical type fitnesses. Token fitness includes measurable token fitness, which can be measured on an individual, and tendential token fitness, which is assumed to be an underlying property of the individual in its environmental circumstances. Some of the paper's conclusions can be outlined as follows: claims that fitness differences do not cause evolution are reasonable when fitness is treated as statistical type fitness, measurable token fitness, or purely mathematical fitness. Some of the ways in which statistical methods are used in population genetics suggest that what natural selection involves are differences in parametric type fitnesses. Further, it's reasonable to think that differences in parametric type fitness can cause evolution. Tendential token fitnesses, however, are not themselves sufficient for natural selection. Though parametric type fitnesses are typically not directly measurable, they can be modeled with purely mathematical fitnesses and estimated by statistical type fitnesses, which in turn are defined in terms of measurable token fitnesses. The paper clarifies the ways in which fitnesses depend on pragmatic choices made by researchers. PMID:23112804

  20. Occurrence of Parthenogenesis in Potato Tuber Moth

    Science.gov (United States)

    Liu, Yan; Hu, Chun-Hua; Wang, Chun-Ya; Xiong, Yan; Li, Zong-Kai; Xiao, Chun

    2018-01-01

    Abstract Parthenogenesis, a natural form of asexual reproduction produced from unfertilized eggs, occurs in many insects in Hemiptera and Hymenoptera, but very rarely in Lepidoptera. The current study aimed to test the larval density dependent occurrence of parthenogenesis in potato tuber moth, Phthorimaea operculella (Zeller; Lepidoptera: Gelechiidae) under laboratory conditions. More than 10% of females out of 25 tested females that developed from the high larval density treatment at 45 larvae per tuber were capable to reproduce asexually. Both male and female offspring were produced parthenogenetically. The sexually reproductive offspring of a laboratory parthenogenetic population had a lower egg hatch rate, shorter larval stage, and shorter male life span when compared with the non-parthenogenetic population. This suggests that the sexually reproductive offspring of parthenogenetic population have a decreased overall fitness compared to the sexually reproductive offspring of non-parthenogenetic population.

  1. Fragment Impact Toolkit (FIT)

    Energy Technology Data Exchange (ETDEWEB)

    Shevitz, Daniel Wolf [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); Key, Brian P. [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); Garcia, Daniel B. [Los Alamos National Lab. (LANL), Los Alamos, NM (United States)

    2017-09-05

    The Fragment Impact Toolkit (FIT) is a software package used for probabilistic consequence evaluation of fragmenting sources. The typical use case for FIT is to simulate an exploding shell and evaluate the consequence on nearby objects. FIT is written in the programming language Python and is designed as a collection of interacting software modules. Each module has a function that interacts with the other modules to produce desired results.

  2. Fitness Landscapes of Functional RNAs

    Directory of Open Access Journals (Sweden)

    Ádám Kun

    2015-08-01

    Full Text Available The notion of fitness landscapes, a map between genotype and fitness, was proposed more than 80 years ago. For most of this time data was only available for a few alleles, and thus we had only a restricted view of the whole fitness landscape. Recently, advances in genetics and molecular biology allow a more detailed view of them. Here we review experimental and theoretical studies of fitness landscapes of functional RNAs, especially aptamers and ribozymes. We find that RNA structures can be divided into critical structures, connecting structures, neutral structures and forbidden structures. Such characterisation, coupled with theoretical sequence-to-structure predictions, allows us to construct the whole fitness landscape. Fitness landscapes then can be used to study evolution, and in our case the development of the RNA world.

  3. Searching for the right fit: development of applicant person-organization fit perceptions during the recruitment process.

    Science.gov (United States)

    Swider, Brian W; Zimmerman, Ryan D; Barrick, Murray R

    2015-05-01

    Numerous studies link applicant fit perceptions measured at a single point in time to recruitment outcomes. Expanding upon this prior research by incorporating decision-making theory, this study examines how applicants develop these fit perceptions over the duration of the recruitment process, showing meaningful changes in fit perceptions across and within organizations overtime. To assess the development of applicant fit perceptions, eight assessments of person-organization (PO) fit with up to four different organizations across 169 applicants for 403 job choice decisions were analyzed. Results showed the presence of initial levels and changes in differentiation of applicant PO fit perceptions across organizations, which significantly predicted future job choice. In addition, changes in within-organizational PO fit perceptions across two stages of recruitment predicted applicant job choices among multiple employers. The implications of these results for accurately understanding the development of fit perceptions, relationships between fit perceptions and key recruiting outcomes, and possible limitations of past meta-analytically derived estimates of these relationships are discussed. (c) 2015 APA, all rights reserved.

  4. Online Influence and Sentiment of Fitness Tweets: Analysis of Two Million Fitness Tweets.

    Science.gov (United States)

    Vickey, Theodore; Breslin, John G

    2017-10-31

    Publicly available fitness tweets may provide useful and in-depth insights into the real-time sentiment of a person's physical activity and provide motivation to others through online influence. The goal of this experimental approach using the fitness Twitter dataset is two-fold: (1) to determine if there is a correlation between the type of activity tweet (either workout or workout+, which contains the same information as a workout tweet but has additional user-generated information), gender, and one's online influence as measured by Klout Score and (2) to examine the sentiment of the activity-coded fitness tweets by looking at real-time shared thoughts via Twitter regarding their experiences with physical activity and the associated mobile fitness app. The fitness tweet dataset includes demographic and activity data points, including minutes of activity, Klout Score, classification of each fitness tweet, the first name of each fitness tweet user, and the tweet itself. Gender for each fitness tweet user was determined by a first name comparison with the US Social Security Administration database of first names and gender. Over 184 days, 2,856,534 tweets were collected in 23 different languages. However, for the purposes of this study, only the English-language tweets were analyzed from the activity tweets, resulting in a total of 583,252 tweets. After assigning gender to Twitter usernames based on the Social Security Administration database of first names, analysis of minutes of activity by both gender and Klout influence was determined. The mean Klout Score for those who shared their workout data from within four mobile apps was 20.50 (13.78 SD), less than the general Klout Score mean of 40, as was the Klout Score at the 95th percentile (40 vs 63). As Klout Score increased, there was a decrease in the number of overall workout+ tweets. With regards to sentiment, fitness-related tweets identified as workout+ reflected a positive sentiment toward physical activity

  5. A Sport Education Fitness Season's Impact on Students' Fitness Levels, Knowledge, and In-Class Physical Activity.

    Science.gov (United States)

    Ward, Jeffery Kurt; Hastie, Peter A; Wadsworth, Danielle D; Foote, Shelby; Brock, Sheri J; Hollett, Nikki

    2017-09-01

    The purpose of this study was to determine the extent to which a sport education season of fitness could provide students with recommended levels of in-class moderate-to-vigorous physical activity (MVPA) while also increasing students' fitness knowledge and fitness achievement. One hundred and sixty-six 5th-grade students (76 boys, 90 girls) participated in a 20-lesson season called "CrossFit Challenge" during a 4-week period. The Progressive Aerobic Cardiovascular Endurance Run, push-ups, and curl-ups tests of the FITNESSGRAM® were used to assess fitness at pretest and posttest, while fitness knowledge was assessed through a validated, grade-appropriate test of health-related fitness knowledge (HRF). Physical activity was measured with Actigraph GT3X triaxial accelerometers. Results indicated a significant time effect for all fitness tests and the knowledge test. Across the entire season, the students spent an average of 54.5% of lesson time engaged in MVPA, irrespective of the type of lesson (instruction, free practice, or competition). The results suggest that configuring the key principles of sport education within a unit of fitness is an efficient model for providing students with the opportunity to improve fitness skill and HRF knowledge while attaining recommended levels of MVPA.

  6. Strength Training: For Overall Fitness

    Science.gov (United States)

    Healthy Lifestyle Fitness Strength training is an important part of an overall fitness program. Here's what strength training can do for ... is a key component of overall health and fitness for everyone. Lean muscle mass naturally diminishes with ...

  7. ParFit: A Python-Based Object-Oriented Program for Fitting Molecular Mechanics Parameters to ab Initio Data.

    Science.gov (United States)

    Zahariev, Federico; De Silva, Nuwan; Gordon, Mark S; Windus, Theresa L; Dick-Perez, Marilu

    2017-03-27

    A newly created object-oriented program for automating the process of fitting molecular-mechanics parameters to ab initio data, termed ParFit, is presented. ParFit uses a hybrid of deterministic and stochastic genetic algorithms. ParFit can simultaneously handle several molecular-mechanics parameters in multiple molecules and can also apply symmetric and antisymmetric constraints on the optimized parameters. The simultaneous handling of several molecules enhances the transferability of the fitted parameters. ParFit is written in Python, uses a rich set of standard and nonstandard Python libraries, and can be run in parallel on multicore computer systems. As an example, a series of phosphine oxides, important for metal extraction chemistry, are parametrized using ParFit. ParFit is in an open source program available for free on GitHub ( https://github.com/fzahari/ParFit ).

  8. Genetic architecture and the evolution of sex.

    Science.gov (United States)

    Lohaus, Rolf; Burch, Christina L; Azevedo, Ricardo B R

    2010-01-01

    Theoretical investigations of the advantages of sex have tended to treat the genetic architecture of organisms as static and have not considered that genetic architecture might coevolve with reproductive mode. As a result, some potential advantages of sex may have been missed. Using a gene network model, we recently showed that recombination imposes selection for robustness to mutation and that negative epistasis can evolve as a by-product of this selection. These results motivated a detailed exploration of the mutational deterministic hypothesis, a hypothesis in which the advantage of sex depends critically on epistasis. We found that sexual populations do evolve higher mean fitness and lower genetic load than asexual populations at equilibrium, and, under moderate stabilizing selection and large population size, these equilibrium sexual populations resist invasion by asexuals. However, we found no evidence that these long- and short-term advantages to sex were explained by the negative epistasis that evolved in our experiments. The long-term advantage of sex was that sexual populations evolved a lower deleterious mutation rate, but this property was not sufficient to account for the ability of sexual populations to resist invasion by asexuals. The ability to resist asexual invasion was acquired simultaneously with an increase in recombinational robustness that minimized the cost of sex. These observations provide the first direct evidence that sexual reproduction does indeed select for conditions that favor its own maintenance. Furthermore, our results highlight the importance of considering a dynamic view of the genetic architecture to understand the evolution of sex and recombination.

  9. Neutral processes forming large clones during colonization of new areas.

    Science.gov (United States)

    Rafajlović, M; Kleinhans, D; Gulliksson, C; Fries, J; Johansson, D; Ardehed, A; Sundqvist, L; Pereyra, R T; Mehlig, B; Jonsson, P R; Johannesson, K

    2017-08-01

    In species reproducing both sexually and asexually clones are often more common in recently established populations. Earlier studies have suggested that this pattern arises due to natural selection favouring generally or locally successful genotypes in new environments. Alternatively, as we show here, this pattern may result from neutral processes during species' range expansions. We model a dioecious species expanding into a new area in which all individuals are capable of both sexual and asexual reproduction, and all individuals have equal survival rates and dispersal distances. Even under conditions that favour sexual recruitment in the long run, colonization starts with an asexual wave. After colonization is completed, a sexual wave erodes clonal dominance. If individuals reproduce more than one season, and with only local dispersal, a few large clones typically dominate for thousands of reproductive seasons. Adding occasional long-distance dispersal, more dominant clones emerge, but they persist for a shorter period of time. The general mechanism involved is simple: edge effects at the expansion front favour asexual (uniparental) recruitment where potential mates are rare. Specifically, our model shows that neutral processes (with respect to genotype fitness) during the population expansion, such as random dispersal and demographic stochasticity, produce genotype patterns that differ from the patterns arising in a selection model. The comparison with empirical data from a post-glacially established seaweed species (Fucus radicans) shows that in this case, a neutral mechanism is strongly supported. © 2017 The Authors. Journal of Evolutionary Biology Published by John Wiley & Sons ltd on Behalf of European Society for Evolutionary Biology.

  10. Asexual propagation of a virulent clone complex in a human and feline outbreak of sporotrichosis.

    Science.gov (United States)

    Teixeira, Marcus de Melo; Rodrigues, Anderson Messias; Tsui, Clement K M; de Almeida, Luiz Gonzaga Paulo; Van Diepeningen, Anne D; van den Ende, Bert Gerrits; Fernandes, Geisa Ferreira; Kano, Rui; Hamelin, Richard C; Lopes-Bezerra, Leila Maria; Vasconcelos, Ana Tereza Ribeiro; de Hoog, Sybren; de Camargo, Zoilo Pires; Felipe, Maria Sueli Soares

    2015-02-01

    Sporotrichosis is one of the most frequent subcutaneous fungal infections in humans and animals caused by members of the plant-associated, dimorphic genus Sporothrix. Three of the four medically important Sporothrix species found in Brazil have been considered asexual as no sexual stage has ever been reported in Sporothrix schenckii, Sporothrix brasiliensis, or Sporothrix globosa. We have identified the mating type (MAT) loci in the S. schenckii (strain 1099-18/ATCC MYA-4821) and S. brasiliensis (strain 5110/ATCC MYA-4823) genomes by using comparative genomic approaches to determine the mating type ratio in these pathogen populations. Our analysis revealed the presence of a MAT1-1 locus in S. schenckii while a MAT1-2 locus was found in S. brasiliensis representing genomic synteny to other Sordariomycetes. Furthermore, the components of the mitogen-activated protein kinase (MAPK)-pheromone pathway, pheromone processing enzymes, and meiotic regulators have also been identified in the two pathogens, suggesting the potential for sexual reproduction. The ratio of MAT1-1 to MAT1-2 was not significantly different from 1:1 for all three Sporothrix species, but the population of S. brasiliensis in the outbreaks originated from a single mating type. We also explored the population genetic structure of these pathogens using sequence data of two loci to improve our knowledge of the pattern of geographic distribution, genetic variation, and virulence phenotypes. Population genetics data showed significant population differentiation and clonality with a low level of haplotype diversity in S. brasiliensis isolates from different regions of sporotrichosis outbreaks in Brazil. In contrast, S. schenckii isolates demonstrated a high degree of genetic variability without significant geographic differentiation, indicating the presence of recombination. This study demonstrated that two species causing the same disease have contrasting reproductive strategies and genetic variability

  11. Presence and Functionality of Mating Type Genes in the Supposedly Asexual Filamentous Fungus Aspergillus oryzae

    Science.gov (United States)

    Wada, Ryuta; Maruyama, Jun-ichi; Yamaguchi, Haruka; Yamamoto, Nanase; Wagu, Yutaka; Paoletti, Mathieu; Archer, David B.; Dyer, Paul S.

    2012-01-01

    The potential for sexual reproduction in Aspergillus oryzae was assessed by investigating the presence and functionality of MAT genes. Previous genome studies had identified a MAT1-1 gene in the reference strain RIB40. We now report the existence of a complementary MAT1-2 gene and the sequencing of an idiomorphic region from A. oryzae strain AO6. This allowed the development of a PCR diagnostic assay, which detected isolates of the MAT1-1 and MAT1-2 genotypes among 180 strains assayed, including industrial tane-koji isolates. Strains used for sake and miso production showed a near-1:1 ratio of the MAT1-1 and MAT1-2 mating types, whereas strains used for soy sauce production showed a significant bias toward the MAT1-2 mating type. MAT1-1 and MAT1-2 isogenic strains were then created by genetic manipulation of the resident idiomorph, and gene expression was compared by DNA microarray and quantitative real-time PCR (qRT-PCR) methodologies under conditions in which MAT genes were expressed. Thirty-three genes were found to be upregulated more than 10-fold in either the MAT1-1 host strain or the MAT1-2 gene replacement strain relative to each other, showing that both the MAT1-1 and MAT1-2 genes functionally regulate gene expression in A. oryzae in a mating type-dependent manner, the first such report for a supposedly asexual fungus. MAT1-1 expression specifically upregulated an α-pheromone precursor gene, but the functions of most of the genes affected were unknown. The results are consistent with a heterothallic breeding system in A. oryzae, and prospects for the discovery of a sexual cycle are discussed. PMID:22327593

  12. Androgenetic alopecia in men aged 40-69 years: prevalence and risk factors.

    Science.gov (United States)

    Severi, G; Sinclair, R; Hopper, J L; English, D R; McCredie, M R E; Boyle, P; Giles, G G

    2003-12-01

    The epidemiology of androgenetic alopecia (AGA) is not fully understood. Although a strong genetic basis has long been identified, little is known of its non-genetic causes. To estimate the prevalence of and to determine risk factors for AGA in men aged 40-69 years in Australia. Men (n = 1390) were recruited at random from the electoral rolls to serve as controls in a population-based case-control study of prostate cancer. All were interviewed in person and direct observations of AGA were made. Men were grouped into the following categories; no AGA, frontal AGA, vertex AGA and full AGA (frontal and vertex AGA). Epidemiological data collected from these men were used for an analysis of risk factors for each AGA category using unconditional logistic regression with AGA category as the response variable adjusting for age, education and country of birth. The prevalence of vertex and full AGA increased with age from 31% (age 40-55 years) to 53% (age 65-69 years). Conversely, the proportion of men with only frontal AGA was very similar across all age groups (31-33%). No associations were found between pubertal growth spurt or acne, reports of adult body size at time of interview, urinary symptom score, marital status, or current smoking status or duration of smoking and the risk of any form of AGA. The consumption of alcohol was associated with a significant increase in risk of frontal and vertex AGA but not full AGA. Men with vertex AGA had fewer female sexual partners but average ejaculatory frequency did not differ between men in different AGA categories. Reported weight and lean body mass at reaching maturity at about 21 years of age were negatively associated with vertex balding (P for trend body mass at age 21 years would be worthy of further research if they were able to be replicated in other studies.

  13. Is High-Intensity Functional Training (HIFT)/CrossFit Safe for Military Fitness Training?

    Science.gov (United States)

    Poston, Walker S C; Haddock, Christopher K; Heinrich, Katie M; Jahnke, Sara A; Jitnarin, Nattinee; Batchelor, David B

    2016-07-01

    High-intensity functional training (HIFT) is a promising fitness paradigm that gained popularity among military populations. Rather than biasing workouts toward maximizing fitness domains such as aerobic endurance, HIFT workouts are designed to promote general physical preparedness. HIFT programs have proliferated as a result of concerns about the relevance of traditional physical training (PT), which historically focused on aerobic condition via running. Other concerns about traditional PT include: (1) the relevance of service fitness tests given current combat demands, (2) the perception that military PT is geared toward passing service fitness tests, and (3) that training for combat requires more than just aerobic endurance. Despite its' popularity in the military, concerns have been raised about HIFT's injury potential, leading to some approaches being labeled as "extreme conditioning programs" by several military and civilian experts. Given HIFT programs' popularity in the military and concerns about injury, a review of data on HIFT injury potential is needed to inform military policy. The purpose of this review is to: (1) provide an overview of scientific methods used to appropriately compare injury rates among fitness activities and (2) evaluate scientific data regarding HIFT injury risk compared to traditional military PT and other accepted fitness activities. Reprint & Copyright © 2016 Association of Military Surgeons of the U.S.

  14. Methodology review: evaluating person fit

    NARCIS (Netherlands)

    Meijer, R.R.; Sijtsma, Klaas

    2001-01-01

    Person-fit methods based on classical test theory-and item response theory (IRT), and methods investigating particular types of response behavior on tests, are examined. Similarities and differences among person-fit methods and their advantages and disadvantages are discussed. Sound person-fit

  15. Competency profile of Fitness Instructor

    OpenAIRE

    Peterová, Marta

    2011-01-01

    Title: COMPETENCY PROFILE OF FITNESS INSTRUCTOR Objectives: The aim of this work is to find out competencies of fitness instructor and make a competency profile, containing competencies, which are important for excellent fitness instructor. Methods: I applied the method of interview and the method of research in my thesis. The interview was used to make a list of competencies of fitness instructor. The research was applied in the final part of making competency profile, for an attestation of ...

  16. Increasing Student Physical Fitness through Increased Choice of Fitness Activities and Student Designed Fitness Activities for Ninth through Twelfth Graders in Physical Education Class

    Science.gov (United States)

    Jacob, Margo A.

    2011-01-01

    This action research project report began when the teacher researcher determined that students exhibited physical fitness levels below that of the state and national norms, and also displayed negative attitudes about physical education. The purpose of this action research project was to increase physical fitness and fitness attitudes through…

  17. Developmental pathways of fitness, and not baseline, predict fitness status at the end of childhood

    OpenAIRE

    Rodrigues, Luis Paulo; Stodden, David F.; Lopes, Vítor P.

    2013-01-01

    It is generally described that children fitness levels increase along childhood. Complementary to this idea is the notion that the tracking of children’s fitness is good to moderate during this developmental time, and that baseline (initial values) of fitness are determinant on fitness development. The importance of developmental pathways has been recently reinforced by a theoretical argument that predicts that healthy lifestyle trajectories will evolve through either a positive or n...

  18. State Authenticity as Fit to Environment: The Implications of Social Identity for Fit, Authenticity, and Self-Segregation.

    Science.gov (United States)

    Schmader, Toni; Sedikides, Constantine

    2017-10-01

    People seek out situations that "fit," but the concept of fit is not well understood. We introduce State Authenticity as Fit to the Environment (SAFE), a conceptual framework for understanding how social identities motivate the situations that people approach or avoid. Drawing from but expanding the authenticity literature, we first outline three types of person-environment fit: self-concept fit, goal fit, and social fit. Each type of fit, we argue, facilitates cognitive fluency, motivational fluency, and social fluency that promote state authenticity and drive approach or avoidance behaviors. Using this model, we assert that contexts subtly signal social identities in ways that implicate each type of fit, eliciting state authenticity for advantaged groups but state inauthenticity for disadvantaged groups. Given that people strive to be authentic, these processes cascade down to self-segregation among social groups, reinforcing social inequalities. We conclude by mapping out directions for research on relevant mechanisms and boundary conditions.

  19. Glycoside Hydrolase MoGls2 Controls Asexual/Sexual Development, Cell Wall Integrity and Infectious Growth in the Rice Blast Fungus.

    Directory of Open Access Journals (Sweden)

    Mengying Li

    Full Text Available N-linked glycosylation is a way of glycosylation for newly synthesized protein, which plays a key role in the maturation and transport of proteins. Glycoside hydrolases (GHs are essential in this process, and are involved in processing of N-linked glycoproteins or degradation of carbohydrate structures. Here, we identified and characterized MoGls2 in Magnaporthe oryzae, which is a yeast glucosidase II homolog Gls2 and is required for trimming the final glucose in N-linked glycans and normal cell wall synthesis. Target deletion of MoGLS2 in M. oryzae resulted in a reduced mycelial growth, an increased conidial production, delayed conidial germination and loss the ability of sexual reproduction. Pathogenicity assays revealed that the ΔMogls2 mutant showed significantly decreased in virulence and infectious growth. Further studies showed that the mutant was less sensitive to salt and osmotic stress, and increased sensitivity to cell wall stresses. Additionally, the ΔMogls2 mutant showed a defect in cell wall integrity. Our results indicate that MoGls2 is a key protein for the growth and development of M. oryzae, involving in the regulation of asexual/sexual development, stress response, cell wall integrity and infectious growth.

  20. Sexual dimorphism in white campion: deletion on the Y chromosome results in a floral asexual phenotype

    International Nuclear Information System (INIS)

    Farbos, I.; Veuskens, J.; Vyskot, B.; Oliveira, M.; Hinnisdaels, S.; Aghmir, A.; Mouras, A.; Negrutiu, I.

    1999-01-01

    White campion is a dioecious plant with heteromorphic X and Y sex chromosomes. In male plants, a filamentous structure replaces the pistil, while in female plants the stamens degenerate early in flower development. Asexual (asx) mutants, cumulating the two developmental defects that characterize the sexual dimorphism in this species, were produced by gamma ray irradiation of pollen and screening in the M1 generation. The mutants harbor a novel type of mutation affecting an early function in sporogenous/parietal cell differentiation within the anther. The function is called stamen-promoting function (SPF). The mutants are shown to result from interstitial deletions on the Y chromosome. We present evidence that such deletions tentatively cover the central domain on the (p)-arm of the Y chromosome (Y2 region). By comparing stamen development in wild-type female and asx mutant flowers we show that they share the same block in anther development, which results in the production of vestigial anthers. The data suggest that the SPF, a key function(s) controlling the sporogenous/parietal specialization in premeiotic anthers, is genuinely missing in females (XX constitution). We argue that this is the earliest function in the male program that is Y-linked and is likely responsible for ''male dimorphism'' (sexual dimorphism in the third floral whorl) in white campion. More generally, the reported results improve our knowledge of the structural and functional organization of the Y chromosome and favor the view that sex determination in this species results primarily from a trigger signal on the Y chromosome (Y1 region) that suppresses female development. The default state is therefore the ancestral hermaphroditic state

  1. Study of the International Epidemiology of Androgenetic Alopecia in Young Caucasian Men Using Photographs From the Internet.

    Science.gov (United States)

    Avital, Yaniv Shalom; Morvay, Marta; Gaaland, Magdolna; Kemény, Lajos

    2015-01-01

    The epidemiological evaluation of androgenetic alopecia (AGA) is based mainly on direct observation and questionnaires. The international epidemiology and environmental risk factors of AGA in young Caucasian men remain unknown. To use photographs and data from the Internet to evaluate severe AGA and generate greater understanding of the international epidemiology of the disorder in young Caucasian men. A population-based cross-sectional study design was used. The sample included 26,340 Caucasian men aged 30 to 40 years who had uploaded profiles to two dating websites. Their photographs were evaluated for AGA and graded as follows: severe AGA (Norwood type VI-VII), non-severe AGA, and unknown. Epidemiological data were collected from the sites. Logistic regression was used to analyze the effect of risk factors on the prevalence of severe AGA. The overall success rate for identifying severe AGA by indirect evaluation of Internet photographs was 94%. The prevalence of severe AGA was 15.33% overall and varied significantly by geographical region. The risk of having severe AGA was increased by 1.092 for every year of age between 30 and 40 years. Severe AGA was more prevalent in subjects with higher body mass index. Photographs from the Internet can be used to evaluate severe AGA in epidemiological studies. The prevalence of severe AGA in young Caucasian men increases with age and varies by geographical region. Body mass index is an environmental risk factor for severe AGA.

  2. Study of the international epidemiology of androgenetic alopecia in young caucasian men using photographs from the internet

    Directory of Open Access Journals (Sweden)

    Yaniv Shalom Avital

    2015-01-01

    Full Text Available Background: The epidemiological evaluation of androgenetic alopecia (AGA is based mainly on direct observation and questionnaires. The international epidemiology and environmental risk factors of AGA in young Caucasian men remain unknown. Aim: To use photographs and data from the Internet to evaluate severe AGA and generate greater understanding of the international epidemiology of the disorder in young Caucasian men. Materials and Methods: A population-based cross-sectional study design was used. The sample included 26,340 Caucasian men aged 30 to 40 years who had uploaded profiles to two dating websites. Their photographs were evaluated for AGA and graded as follows: severe AGA (Norwood type VI-VII, non-severe AGA, and unknown. Epidemiological data were collected from the sites. Logistic regression was used to analyze the effect of risk factors on the prevalence of severe AGA. Results : The overall success rate for identifying severe AGA by indirect evaluation of Internet photographs was 94%. The prevalence of severe AGA was 15.33% overall and varied significantly by geographical region. The risk of having severe AGA was increased by 1.092 for every year of age between 30 and 40 years. Severe AGA was more prevalent in subjects with higher body mass index. Conclusions: Photographs from the Internet can be used to evaluate severe AGA in epidemiological studies. The prevalence of severe AGA in young Caucasian men increases with age and varies by geographical region. Body mass index is an environmental risk factor for severe AGA.

  3. Physical characteristics related to bra fit.

    Science.gov (United States)

    Chen, Chin-Man; LaBat, Karen; Bye, Elizabeth

    2010-04-01

    Producing well-fitting garments has been a challenge for retailers and manufacturers since mass production began. Poorly fitted bras can cause discomfort or pain and result in lost sales for retailers. Because body contours are important factors affecting bra fit, this study analyses the relationship of physical characteristics to bra-fit problems. This study has used 3-D body-scanning technology to extract upper body angles from a sample of 103 college women; these data were used to categorise physical characteristics into shoulder slope, bust prominence, back curvature and acromion placement. Relationships between these physical categories and bra-fit problems were then analysed. Results show that significant main effects and two-way interactions of the physical categories exist in the fit problems of poor bra support and bra-motion restriction. The findings are valuable in helping the apparel industry create better-fitting bras. STATEMENT OF RELEVANCE: Poorly fitted bras can cause discomfort or pain and result in lost sales for retailers. The findings regarding body-shape classification provide researchers with a statistics method to quantify physical characteristics and the findings regarding the relationship analysis between physical characteristics and bra fit offer bra companies valuable information about bra-fit perceptions attributable to women with figure variations.

  4. FITS Liberator: Image processing software

    Science.gov (United States)

    Lindberg Christensen, Lars; Nielsen, Lars Holm; Nielsen, Kaspar K.; Johansen, Teis; Hurt, Robert; de Martin, David

    2012-06-01

    The ESA/ESO/NASA FITS Liberator makes it possible to process and edit astronomical science data in the FITS format to produce stunning images of the universe. Formerly a plugin for Adobe Photoshop, the current version of FITS Liberator is a stand-alone application and no longer requires Photoshop. This image processing software makes it possible to create color images using raw observations from a range of telescopes; the FITS Liberator continues to support the FITS and PDS formats, preferred by astronomers and planetary scientists respectively, which enables data to be processed from a wide range of telescopes and planetary probes, including ESO's Very Large Telescope, the NASA/ESA Hubble Space Telescope, NASA's Spitzer Space Telescope, ESA's XMM-Newton Telescope and Cassini-Huygens or Mars Reconnaissance Orbiter.

  5. Nuclear fuel element end fitting

    International Nuclear Information System (INIS)

    Jabsen, F.S.

    1980-01-01

    An invention is described whereby end fittings are formed from lattices of mutually perpendicular plates. At the plate intersections, sockets are secured to the end fittings in a manner that permits the longitudinal axes of each of the sockets to align with the respective lines of intersection of the plates. The sockets all protrude above one of the surfaces of the end fitting. Further, a detent is formed in the proturding sides of each of the sockets. Annular grooves are formed in each of the ends of the fuel rods that are to be mounted between the end fittings. The socket detents protrude into the respective annular grooves, thus engaging the grooves and retaining the fuel rods and end fittings in one integral structure. (auth)

  6. Different fits satisfy different needs: linking person-environment fit to employee commitment and performance using self-determination theory.

    Science.gov (United States)

    Greguras, Gary J; Diefendorff, James M

    2009-03-01

    Integrating and expanding upon the person-environment fit (PE fit) and the self-determination theory literatures, the authors hypothesized and tested a model in which the satisfaction of the psychological needs for autonomy, relatedness, and competence partially mediated the relations between different types of perceived PE fit (i.e., person-organization fit, person-group fit, and job demands-abilities fit) with employee affective organizational commitment and overall job performance. Data from 163 full-time working employees and their supervisors were collected across 3 time periods. Results indicate that different types of PE fit predicted different types of psychological need satisfaction and that psychological need satisfaction predicted affective commitment and performance. Further, person-organization fit and demands-abilities fit also evidenced direct effects on employee affective commitment. These results begin to explicate the processes through which different types of PE fit relate to employee attitudes and behaviors. (c) 2009 APA, all rights reserved.

  7. 10 CFR 26.189 - Determination of fitness.

    Science.gov (United States)

    2010-01-01

    ... 10 Energy 1 2010-01-01 2010-01-01 false Determination of fitness. 26.189 Section 26.189 Energy NUCLEAR REGULATORY COMMISSION FITNESS FOR DUTY PROGRAMS Determining Fitness-for-Duty Policy Violations and Determining Fitness § 26.189 Determination of fitness. (a) A determination of fitness is the process entered...

  8. Rules, culture, and fitness.

    Science.gov (United States)

    Baum, W M

    1995-01-01

    Behavior analysis risks intellectual isolation unless it integrates its explanations with evolutionary theory. Rule-governed behavior is an example of a topic that requires an evolutionary perspective for a full understanding. A rule may be defined as a verbal discriminative stimulus produced by the behavior of a speaker under the stimulus control of a long-term contingency between the behavior and fitness. As a discriminative stimulus, the rule strengthens listener behavior that is reinforced in the short run by socially mediated contingencies, but which also enters into the long-term contingency that enhances the listener's fitness. The long-term contingency constitutes the global context for the speaker's giving the rule. When a rule is said to be "internalized," the listener's behavior has switched from short- to long-term control. The fitness-enhancing consequences of long-term contingencies are health, resources, relationships, or reproduction. This view ties rules both to evolutionary theory and to culture. Stating a rule is a cultural practice. The practice strengthens, with short-term reinforcement, behavior that usually enhances fitness in the long run. The practice evolves because of its effect on fitness. The standard definition of a rule as a verbal statement that points to a contingency fails to distinguish between a rule and a bargain ("If you'll do X, then I'll do Y"), which signifies only a single short-term contingency that provides mutual reinforcement for speaker and listener. In contrast, the giving and following of a rule ("Dress warmly; it's cold outside") can be understood only by reference also to a contingency providing long-term enhancement of the listener's fitness or the fitness of the listener's genes. Such a perspective may change the way both behavior analysts and evolutionary biologists think about rule-governed behavior.

  9. The FitTrack Index as fitness indicator

    African Journals Online (AJOL)

    Dina Christina Janse van Rensburg

    d Institute for Sports Research, Faculty of Humanities, University of Pretoria, South Africa e Institute for Food ... The American College of Sports Medicine's guidelines for health/fitness .... It is important to stress that the focus of this study was not.

  10. Family Activities for Fitness

    Science.gov (United States)

    Grosse, Susan J.

    2009-01-01

    This article discusses how families can increase family togetherness and improve physical fitness. The author provides easy ways to implement family friendly activities for improving and maintaining physical health. These activities include: walking, backyard games, and fitness challenges.

  11. The universal Higgs fit

    DEFF Research Database (Denmark)

    Giardino, P. P.; Kannike, K.; Masina, I.

    2014-01-01

    We perform a state-of-the-art global fit to all Higgs data. We synthesise them into a 'universal' form, which allows to easily test any desired model. We apply the proposed methodology to extract from data the Higgs branching ratios, production cross sections, couplings and to analyse composite...... Higgs models, models with extra Higgs doublets, supersymmetry, extra particles in the loops, anomalous top couplings, and invisible Higgs decays into Dark Matter. Best fit regions lie around the Standard Model predictions and are well approximated by our 'universal' fit. Latest data exclude the dilaton...... as an alternative to the Higgs, and disfavour fits with negative Yukawa couplings. We derive for the first time the SM Higgs boson mass from the measured rates, rather than from the peak positions, obtaining M-h = 124.4 +/- 1.6 GeV....

  12. Biochemical characterization and comparison of aspartylglucosaminidases secreted in venom of the parasitoid wasps Asobara tabida and Leptopilina heterotoma.

    Directory of Open Access Journals (Sweden)

    Quentin Coulette

    Full Text Available Aspartylglucosaminidase (AGA is a low-abundance intracellular enzyme that plays a key role in the last stage of glycoproteins degradation, and whose deficiency leads to human aspartylglucosaminuria, a lysosomal storage disease. Surprisingly, high amounts of AGA-like proteins are secreted in the venom of two phylogenetically distant hymenopteran parasitoid wasp species, Asobara tabida (Braconidae and Leptopilina heterotoma (Cynipidae. These venom AGAs have a similar domain organization as mammalian AGAs. They share with them key residues for autocatalysis and activity, and the mature α- and β-subunits also form an (αβ2 structure in solution. Interestingly, only one of these AGAs subunits (α for AtAGA and β for LhAGA is glycosylated instead of the two subunits for lysosomal human AGA (hAGA, and these glycosylations are partially resistant to PGNase F treatment. The two venom AGAs are secreted as fully activated enzymes, they have a similar aspartylglucosaminidase activity and are both also efficient asparaginases. Once AGAs are injected into the larvae of the Drosophila melanogaster host, the asparaginase activity may play a role in modulating their physiology. Altogether, our data provide new elements for a better understanding of the secretion and the role of venom AGAs as virulence factors in the parasitoid wasps' success.

  13. Temporal issues in person–organization fit, person–job fit and turnover: The role of leader–member exchange

    Science.gov (United States)

    Boon, Corine; Biron, Michal

    2016-01-01

    Person–environment fit has been found to have significant implications for employee attitudes and behaviors. Most research to date has approached person–environment fit as a static phenomenon, and without examining how different types of person–environment fit may affect each other. In particular, little is known about the conditions under which fit with one aspect of the environment influences another aspect, as well as subsequent behavior. To address this gap we examine the role of leader–member exchange in the relationship between two types of person–environment fit over time: person–organization and person–job fit, and subsequent turnover. Using data from two waves (T1 and T2, respectively) and turnover data collected two years later (T3) from a sample of 160 employees working in an elderly care organization in the Netherlands, we find that person–organization fit at T1 is positively associated with person–job fit at T2, but only for employees in high-quality leader–member exchange relationships. Higher needs–supplies fit at T2 is associated with lower turnover at T3. In contrast, among employees in high-quality leader–member exchange relationships, the demands–abilities dimension of person–job fit at T2 is associated with higher turnover at T3. PMID:27904171

  14. Temporal issues in person-organization fit, person-job fit and turnover: The role of leader-member exchange.

    Science.gov (United States)

    Boon, Corine; Biron, Michal

    2016-12-01

    Person-environment fit has been found to have significant implications for employee attitudes and behaviors. Most research to date has approached person-environment fit as a static phenomenon, and without examining how different types of person-environment fit may affect each other. In particular, little is known about the conditions under which fit with one aspect of the environment influences another aspect, as well as subsequent behavior. To address this gap we examine the role of leader-member exchange in the relationship between two types of person-environment fit over time: person-organization and person-job fit, and subsequent turnover. Using data from two waves (T1 and T2, respectively) and turnover data collected two years later (T3) from a sample of 160 employees working in an elderly care organization in the Netherlands, we find that person-organization fit at T1 is positively associated with person-job fit at T2, but only for employees in high-quality leader-member exchange relationships. Higher needs-supplies fit at T2 is associated with lower turnover at T3. In contrast, among employees in high-quality leader-member exchange relationships, the demands-abilities dimension of person-job fit at T2 is associated with higher turnover at T3.

  15. Fitness Club / Nordic Walking

    CERN Multimedia

    Fitness Club

    2011-01-01

    Nordic Walking at CERN Enrollments are open for Nordic Walking courses and outings at CERN. Classes will be on Tuesdays as of 20 September, and outings for the more experienced will be on Thursdays as of 15 September. We meet at the CERN Club barracks car park (near entrance A). • 18:00 to 19:00 on 20 & 27 September, as well as 4 & 11 October. Check out our schedule and rates and enroll at: http://cern.ch/club-fitness Hope to see you among us! CERN Fitness Club fitness.club@cern.ch  

  16. Opas CrossFit -harjoitteluun

    OpenAIRE

    Knaapi, Matti

    2014-01-01

    CrossFit on laji, joka pyrkii edistämään terveyttä ja kuntoa. CrossFit saleja löytyy mailmalta yli 10 000 kappaletta. CrossFit -harjoittelussa pyritään parantamaan ihmisen kuntoa mahdollisimman laajalla skaalalla kehittämällä mm. voimaa, kestävyyttä, tarkkuutta, tasapainoa ja eri aineenvaihduntareittejä samanaikaisesti. Terveyden ja kunnon kehittämiseen kuuluu kuntoilun lisäksi myös muita osa-alueita. Ruokavalio ja kehonhuolto ovat tärkeitä osa-alueita hyvän kunnon saavuttamiseksi. Ruokav...

  17. GOSSIP: SED fitting code

    Science.gov (United States)

    Franzetti, Paolo; Scodeggio, Marco

    2012-10-01

    GOSSIP fits the electro-magnetic emission of an object (the SED, Spectral Energy Distribution) against synthetic models to find the simulated one that best reproduces the observed data. It builds-up the observed SED of an object (or a large sample of objects) combining magnitudes in different bands and eventually a spectrum; then it performs a chi-square minimization fitting procedure versus a set of synthetic models. The fitting results are used to estimate a number of physical parameters like the Star Formation History, absolute magnitudes, stellar mass and their Probability Distribution Functions.

  18. 10 CFR 26.406 - Fitness monitoring.

    Science.gov (United States)

    2010-01-01

    ... 10 Energy 1 2010-01-01 2010-01-01 false Fitness monitoring. 26.406 Section 26.406 Energy NUCLEAR REGULATORY COMMISSION FITNESS FOR DUTY PROGRAMS FFD Program for Construction § 26.406 Fitness monitoring. (a...) Licensees and other entities shall implement a fitness monitoring program to deter substance abuse and...

  19. Fitness Club

    CERN Multimedia

    Fitness Club

    2012-01-01

    Nordic Walking Classes Sessions of four classes of one hour each are held on Tuesdays. RDV barracks parking at Entrance A, 10 minutes before class time. Session 1 =  11.09 / 18.09 / 25.09 / 02.10, 18:15 - 19:15 Session 2 = 25.09 / 02.10 / 09.10 / 16.10, 12:30 - 13:30 Session 3 = 23.10 / 30.10 / 06.11 / 13.11, 12:30 - 13:30 Session 4 = 20.11 / 27.11 / 04.12 / 11.12, 12:30 - 13:30 Prices 40 CHF per session + 10 CHF club membership 5 CHF/hour pole rental Check out our schedule and enroll at http://cern.ch/club-fitness   Hope to see you among us!  fitness.club@cern.ch In spring 2012 there was a long-awaited progress in CERN Fitness club. We have officially opened a Powerlifting @ CERN, and the number of members of the new section has been increasing since then reaching 70+ people in less than 4 months. Powerlifting is a strength sport, which is simple as 1-2-3 and efficient. The "1-2-3" are the three basic lifts (bench press...

  20. Knowledge in Action: Fitness Lesson Segments That Teach Health-Related Fitness in Elementary Physical Education

    Science.gov (United States)

    Hodges, Michael G.; Kulinna, Pamela Hodges; van der Mars, Hans; Lee, Chong

    2016-01-01

    The purpose of this study was to determine students' health-related fitness knowledge (HRFK) and physical activity levels after the implementation of a series of fitness lessons segments called Knowledge in Action (KIA). KIA aims to teach health-related fitness knowledge (HRFK) during short episodes of the physical education lesson. Teacher…

  1. Wybrane aspekty pracy zawodowej instruktorów fitness = Chosen aspects of professional work of fitness instructors

    Directory of Open Access Journals (Sweden)

    Paweł Fryderyk Nowak

    2016-05-01

      Słowa kluczowe: instruktorzy fitness, kompetencje, fitness, promocja zdrowia. Key words: fitness instructor, competencies, fitness sector, health promotion.   Streszczenie Cel Celem niniejszej pracy była charakterystyka wybranych aspektów pracy zawodowej trenerów, instruktorów pracujących w klubach fitness, na podstawie ich opinii, jak i opinii pracodawców branży fitness i wellness. W pracy wyszczególniono charakterystykę zatrudnienia, świadomość celu wykonywanej pracy, pożądane kompetencje oraz satysfakcję z pracy. Materiał i metody W badaniach wzięło udział 144 instruktorów pracujących w klubach fitness, a także 36 pracodawców – właścicieli klubów. Posłużono się metodą sondażu diagnostycznego. Wykorzystanym narzędziem badawczym był autorski kwestionariusz ankiety. Wyniki Pracę trenera, instruktora fitness wykonują osoby młode – (82% z nich nie przekroczyło 35 roku życia. W zawodzie zaobserwować można dużą rotację, o czym świadczy krótki staż pracy instruktorów; aż 77,8% badanych to pracujący w tej branży poniżej 2 lat. Ponad 90% pracujacych w charakterze instruktora fitness ma wykształcenie wyższe (licencjackie bądź magisterskie. Zaledwie 8,33% instruktorów jest zatrudnionych na podstawie umowy o pracę. Według pracodawców branży fitness najważniejszym celem pracy instruktora jest tworzenie długotrwałych relacji z klientami. Tak rozumiany cel pracy jest bliski przede wszystkim młodym pracownikom o krótkim stażu. Pracodawcy przedkładają tzw. twarde kompetencje nad cechy osobowości u pracowników branży fitness. Natomiast najważniejszymi predyspozycjami do zawodu w ocenie instruktorów są charyzma i komunikatywność. Wnioski Pozycja zawodowa trenera instruktora, fitness jest wysoce niestabilna, to rodzaj pracy raczej dodatkowej. Ta sytuacja nie skłania do rozwoju i identyfikacji pracowników z miejscem pracy.   Abstract   Aim The characteristics of selected aspects of fitness

  2. [Person-organization fit and work ability].

    Science.gov (United States)

    Merecz, Dorota; Andysz, Aleksandra

    2011-01-01

    Person-environment issue has long been in focus of researchers who explore the area of human labor. It is known that the level of fit is a predictor of many phenomena related to health and attitude to work. The aim of this study was to explore the association between the level of person- organization fit (P-O fit) and work ability, including indicators of somatic and mental health. Research was conducted on a representative sample of 600 Polish men and women at working age. The Person-Organization Fit Questionnaire was used to assess three dimensions of P-O fit (supplementary fit, complementary fit and identification with organization); mental health status was measured by GHQ-28; the number of diagnosed diseases was taken as an index of somatic health; work ability, ability to physical and mental efforts were measured by three items from the Work Ability Index. A significant relationship between P-O fit level and work ability was found. In men, work ability predictors were: age, supplementary fit and mental health status, which explained 25% of the variance in work ability. In women, work ability predictors were: the number of diagnosed somatic diseases, supplementary fit, age and complementary fit, which explained 27% of the variance in work ability. Some gender-related differences in the predictive value of variables under the study were also found. The results of this study indicate the importance of P-O fit in shaping the sense of work ability, a recognized predictor of workers' occupational activity and the frequency of taking sick leave in subsequent years. Therefore, this result may be a useful argument to motivate employers to employ workers adequately to their abilities and preferences.

  3. BIBLIOMETRICS ON ONE OF THE LARGEST TERMITE INVENTORIES IN THE CERRADO: "STUDIES ON TERMITES FROM THE MATO GROSSO STATE, BRAZIL BY AGA MATHEWS 1977"

    Directory of Open Access Journals (Sweden)

    HÉLIDA FERREIRA DA CUNHA

    2015-01-01

    Full Text Available ABSTRACT This paper consists on a bibliometric analysis of the international influences of the book "Studies on termites from the Mato Grosso State, Brazil", by AGA Mathews (1977. The number of citations has increased over the years after the first citation. Mathews book was cited in articles, reviews, theses, dissertations, books, book chapters, abstracts in conference proceedings, comments and scientific notes. Most these studies are empirical and descriptive. The studies were conducted in 35 countries of the Neotropical, Palearctic, Afrotropical, Nearctic, Australasia and Indomalaya regions. 55% of the studies were carried out in Brazil. The journals Sociobiology and Insectes Sociaux, have social insect studies within its scope, and the highest number of articles citing Mathews. Most of the 71 authors that cited Mathews more than twice are Brazilian. Constrictotermes cyphergaster was the most studied in over 80% of the studies addressing Isoptera. The most frequent keywords were termite, Isoptera and taxonomy, generalist terms indexed in most publications carried out in different countries. Most of the research studies were carried out in laboratories and native vegetation areas. Studies in agroecosystems were implemented predominantly in Brazil. This study shows the diversity of application (citations of Mathews' book, and that the number of citations will continue to increase due to the large amount of information presented by the author.

  4. 14 CFR 31.43 - Fitting factor.

    Science.gov (United States)

    2010-01-01

    ... 14 Aeronautics and Space 1 2010-01-01 2010-01-01 false Fitting factor. 31.43 Section 31.43... STANDARDS: MANNED FREE BALLOONS Design Construction § 31.43 Fitting factor. (a) A fitting factor of at least... structure. This factor applies to all parts of the fitting, the means of attachment, and the bearing on the...

  5. The Obesity Paradox and Cardiorespiratory Fitness

    Directory of Open Access Journals (Sweden)

    Paul A. McAuley

    2012-01-01

    Full Text Available Cardiorespiratory fitness as an explanation for the obesity paradox warrants further examination. We evaluated independent and joint associations of cardiorespiratory fitness and adiposity with all-cause mortality in 811 middle-aged (age, 53.3±7.2 years male never smokers without documented cardiopulmonary disease or diabetes from the Veterans Exercise Testing Study (VETS. Cardiorespiratory fitness was quantified in metabolic equivalents (METs using final treadmill speed and grade achieved on a maximal exercise test. Subjects were grouped for analysis by METs: unfit (lowest third and fit (upper two-thirds; and by body mass index (kg/m2: nonobese (18.5−29.9 and obese (≥30.0. Associations of baseline fitness and adiposity measures with all-cause mortality were determined by Cox proportional hazards analysis adjusted for age, ethnicity, hypertension, hypercholesterolemia, family history of coronary artery disease, and cardiovascular medication use. In multivariate analysis, mortality risk for obese/fit men did not differ significantly from the nonobese/fit reference group. However, compared to the reference group, nonobese and obese unfit men were 2.2 (=0.01 and 1.9 (=0.03 times more likely to die, respectively. Cardiorespiratory fitness altered the obesity paradox such that mortality risk was lower for both obese and nonobese men who were fit.

  6. Is High Intensity Functional Training (HIFT)/CrossFit® Safe for Military Fitness Training?

    Science.gov (United States)

    Poston, Walker S.C.; Haddock, Christopher K.; Heinrich, Katie M.; Jahnke, Sara A.; Jitnarin, Nattinee; Batchelor, David B.

    2016-01-01

    High-intensity functional training (HIFT) is a promising fitness paradigm that gained popularity among military populations. Rather than biasing workouts toward maximizing fitness domains such as aerobic endurance, HIFT workouts are designed to promote general physical preparedness. HIFT programs have proliferated due to concerns about the relevance of traditional physical training (PT), which historically focused on aerobic condition via running. Other concerns about traditional PT include: 1) the relevance of service fitness tests given current combat demands; 2) the perception that military PT is geared toward passing service fitness tests; and 3) that training for combat requires more than just aerobic endurance. Despite its’ popularity in the military, concerns have been raised about HIFT’s injury potential, leading to some approaches being labeled as “extreme conditioning programs” by several military and civilian experts. Given HIFT programs’ popularity in the military and concerns about injury, a review of data on HIFT injury potential is needed to inform military policy. The purpose of this review is to: 1) provide an overview of scientific methods used to appropriately compare injury rates among fitness activities; and 2) evaluate scientific data regarding HIFT injury risk compared to traditional military PT and other accepted fitness activities PMID:27391615

  7. No sex in fungus-farming ants or their crops.

    Science.gov (United States)

    Himler, Anna G; Caldera, Eric J; Baer, Boris C; Fernández-Marín, Hermógenes; Mueller, Ulrich G

    2009-07-22

    Asexual reproduction imposes evolutionary handicaps on asexual species, rendering them prone to extinction, because asexual reproduction generates novel genotypes and purges deleterious mutations at lower rates than sexual reproduction. Here, we report the first case of complete asexuality in ants, the fungus-growing ant Mycocepurus smithii, where queens reproduce asexually but workers are sterile, which is doubly enigmatic because the clonal colonies of M. smithii also depend on clonal fungi for food. Degenerate female mating anatomy, extensive field and laboratory surveys, and DNA fingerprinting implicate complete asexuality in this widespread ant species. Maternally inherited bacteria (e.g. Wolbachia, Cardinium) and the fungal cultivars can be ruled out as agents inducing asexuality. M. smithii societies of clonal females provide a unique system to test theories of parent-offspring conflict and reproductive policing in social insects. Asexuality of both ant farmer and fungal crop challenges traditional views proposing that sexual farmer ants outpace coevolving sexual crop pathogens, and thus compensate for vulnerabilities of their asexual crops. Either the double asexuality of both farmer and crop may permit the host to fully exploit advantages of asexuality for unknown reasons or frequent switching between crops (symbiont reassociation) generates novel ant-fungus combinations, which may compensate for any evolutionary handicaps of asexuality in M. smithii.

  8. Kung fu training improves physical fitness measures in overweight/obese adolescents: the "martial fitness" study.

    Science.gov (United States)

    Tsang, Tracey W; Kohn, Michael R; Chow, Chin Moi; Fiatarone Singh, Maria Antoinette

    2010-01-01

    Aim. To examine the efficacy of a six-month Kung Fu (KF) program on physical fitness in overweight/obese adolescents. Methods. Subjects were randomly assigned to the KF or sham exercise (Tai Chi, TC) control group. Physical measurements in cardiovascular fitness and muscle fitness occurred at baseline and after 6 months of training thrice weekly. Results. Twenty subjects were recruited. One subject was lost to follow-up, although overall compliance to the training sessions was 46.7 +/- 27.8%. At follow-up, the cohort improved in absolute upper (P = .002) and lower (P = .04) body strength, and upper body muscle endurance (P = .02), without group differences. KF training resulted in significantly greater improvements in submaximal cardiovascular fitness (P = .03), lower body muscle endurance (P = .28; significant 95% CI: 0.37-2.49), and upper body muscle velocity (P = .03) relative to TC training. Conclusions. This short-term KF program improved submaximal cardiovascular fitness, lower body muscle endurance, and muscle velocity, in overweight/obese adolescents with very low baseline fitness.

  9. Employers' views on the fit note.

    Science.gov (United States)

    Kotze, E

    2014-12-01

    The fit note replaced the sick note in 2010. The statement of fitness for work (fit note) is expected to benefit the British economy by helping more people stay in work and prevent long-term sickness absence. Understanding and responding to employers' views on the fit note is key, in order for this goal to be achieved. To explore employers' views on the fit note. A qualitative study was undertaken and face-to-face interviews were conducted with participants representing employers from a variety of industries. There were 21 participants who were mainly human resources officers and line managers. Employers welcomed the introduction of the fit note and felt that it was an improvement on the sick note. The majority of employers felt the fit note had the potential to promote an earlier return to work, if used properly. The main problems reported were the completion of the fit notes and quality of advice received from general practitioners. Employers felt that the most helpful advice came from fit notes with information on the functional effects of the medical condition. Some employers found return to work decisions problematic. The fit note has the potential to promote an earlier return to work. In order for the fit note to achieve its aim, further understanding of the difficulties employers are having when making return to work decisions is important, in order to develop guidance to enable them to provide the practical support employees need to return to work sooner. © The Author 2014. Published by Oxford University Press on behalf of the Society of Occupational Medicine. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  10. INFOS: spectrum fitting software for NMR analysis

    Energy Technology Data Exchange (ETDEWEB)

    Smith, Albert A., E-mail: alsi@nmr.phys.chem.ethz.ch [ETH Zürich, Physical Chemistry (Switzerland)

    2017-02-15

    Software for fitting of NMR spectra in MATLAB is presented. Spectra are fitted in the frequency domain, using Fourier transformed lineshapes, which are derived using the experimental acquisition and processing parameters. This yields more accurate fits compared to common fitting methods that use Lorentzian or Gaussian functions. Furthermore, a very time-efficient algorithm for calculating and fitting spectra has been developed. The software also performs initial peak picking, followed by subsequent fitting and refinement of the peak list, by iteratively adding and removing peaks to improve the overall fit. Estimation of error on fitting parameters is performed using a Monte-Carlo approach. Many fitting options allow the software to be flexible enough for a wide array of applications, while still being straightforward to set up with minimal user input.

  11. Benefit segmentation of the fitness market.

    Science.gov (United States)

    Brown, J D

    1992-01-01

    While considerate attention is being paid to the fitness and wellness needs of people by healthcare and related marketing organizations, little research attention has been directed to identifying the market segments for fitness based upon consumers' perceived benefits of fitness. This article describes three distinct segments of fitness consumers comprising an estimated 50 percent of households. Implications for marketing strategies are also presented.

  12. PLOTnFIT: A BASIC program for data plotting and curve fitting

    Energy Technology Data Exchange (ETDEWEB)

    Schiffgens, J O

    1989-10-01

    PLOTnFIT is a BASIC program to be used with an IBM or IBM-compatible personal computer (PC) for plotting and fitting curves to measured or observed data for both extrapolation and interpolation. It uses the Least Squares method to calculate the coefficients of nth degree polynomials (e.g., up to 10th degree) of Basis Functions so that each polynomial fits the data in a Least Squares sense, then plots the data and the polynomial that a user decides best represents them. PLOTnFIT is very versatile. It can be used to generate linear, semilog, and log-log graphs and can automatically scale the coordinate axes to suit the data. It can plot more than one data set on a graph (e.g., up to 8 data sets) and more data points than a user is likely to put on one graph (e.g., up to 225 points). A PC diskette containing (1) READIST.PNF (a summary of this NUREG), (2) INI06891.SIS and FOL06891.SIS (two data files), and 3) PLOTNFIT.4TH (the latest version of the program) may be obtained from the National Energy Software Center, Argonne National Laboratory, 9700 South Cass Avenue, Argonne, IL 60439. (author)

  13. Sustained fitness gains and variability in fitness trajectories in the long-term evolution experiment with Escherichia coli

    Science.gov (United States)

    Lenski, Richard E.; Wiser, Michael J.; Ribeck, Noah; Blount, Zachary D.; Nahum, Joshua R.; Morris, J. Jeffrey; Zaman, Luis; Turner, Caroline B.; Wade, Brian D.; Maddamsetti, Rohan; Burmeister, Alita R.; Baird, Elizabeth J.; Bundy, Jay; Grant, Nkrumah A.; Card, Kyle J.; Rowles, Maia; Weatherspoon, Kiyana; Papoulis, Spiridon E.; Sullivan, Rachel; Clark, Colleen; Mulka, Joseph S.; Hajela, Neerja

    2015-01-01

    Many populations live in environments subject to frequent biotic and abiotic changes. Nonetheless, it is interesting to ask whether an evolving population's mean fitness can increase indefinitely, and potentially without any limit, even in a constant environment. A recent study showed that fitness trajectories of Escherichia coli populations over 50 000 generations were better described by a power-law model than by a hyperbolic model. According to the power-law model, the rate of fitness gain declines over time but fitness has no upper limit, whereas the hyperbolic model implies a hard limit. Here, we examine whether the previously estimated power-law model predicts the fitness trajectory for an additional 10 000 generations. To that end, we conducted more than 1100 new competitive fitness assays. Consistent with the previous study, the power-law model fits the new data better than the hyperbolic model. We also analysed the variability in fitness among populations, finding subtle, but significant, heterogeneity in mean fitness. Some, but not all, of this variation reflects differences in mutation rate that evolved over time. Taken together, our results imply that both adaptation and divergence can continue indefinitely—or at least for a long time—even in a constant environment. PMID:26674951

  14. Fitness Doping and Body Management

    DEFF Research Database (Denmark)

    Thualagant, Nicole

    This PhD thesis examines in a first paper the conceptualization of fitness doping and its current limitations. Based on a review of studies on bodywork and fitness doping it is emphasised that the definition of doping does not provide insights into bodywork of both men and women. Moreover......, it is argued that the social and a cultural context are missing in the many epidemiological studies on the prevalence of doping. The second paper explores the difficulties of implementing an anti-doping policy, which was originally formulated in an elite sport context, in a fitness context and more......-based fitness centres. Based on a survey in ten Danish club-based fitness centres and on narratives from semi-structured interviews, it is highlighted that the objectives of bodywork differ according to the users’ age and gender. Two different ways of investing in the body are explored in the paper, namely...

  15. Management of Clostridium difficile Infection in Inflammatory Bowel Disease: Expert Review from the Clinical Practice Updates Committee of the AGA Institute.

    Science.gov (United States)

    Khanna, Sahil; Shin, Andrea; Kelly, Ciarán P

    2017-02-01

    The purpose of this expert review is to synthesize the existing evidence on the management of Clostridium difficile infection in patients with underlying inflammatory bowel disease. The evidence reviewed in this article is a summation of relevant scientific publications, expert opinion statements, and current practice guidelines. This review is a summary of expert opinion in the field without a formal systematic review of evidence. Best Practice Advice 1: Clinicians should test patients who present with a flare of underlying inflammatory bowel disease for Clostridium difficile infection. Best Practice Advice 2: Clinicians should screen for recurrent C difficile infection if diarrhea or other symptoms of colitis persist or return after antibiotic treatment for C difficile infection. Best Practice Advice 3: Clinicians should consider treating C difficile infection in inflammatory bowel disease patients with vancomycin instead of metronidazole. Best Practice Advice 4: Clinicians strongly should consider hospitalization for close monitoring and aggressive management for inflammatory bowel disease patients with C difficile infection who have profuse diarrhea, severe abdominal pain, a markedly increased peripheral blood leukocyte count, or other evidence of sepsis. Best Practice Advice 5: Clinicians may postpone escalation of steroids and other immunosuppression agents during acute C difficile infection until therapy for C difficile infection has been initiated. However, the decision to withhold or continue immunosuppression in inflammatory bowel disease patients with C difficile infection should be individualized because there is insufficient existing robust literature on which to develop firm recommendations. Best Practice Advice 6: Clinicians should offer a referral for fecal microbiota transplantation to inflammatory bowel disease patients with recurrent C difficile infection. Copyright © 2017 AGA Institute. Published by Elsevier Inc. All rights reserved.

  16. Low aerobic fitness in Brazilian adolescents

    Directory of Open Access Journals (Sweden)

    Diego Augusto Santos Silva

    2015-04-01

    Full Text Available INTRODUCTION: aerobic fitness is considered one of the most important components of health-related physical fitness, with low levels related to increased risk of premature death from all causes, especially cardiovascular diseases. OBJECTIVE: to identify the characteristics of adolescents at higher risk of low levels of aerobic fitness. METHODS: the study included 696 adolescents 15-17 years of age enrolled in public high schools of Florianópolis, southern Brazil. This cross-sectional epidemiological study was conducted in Florianópolis, Santa Catarina, Brazil. Aerobic fitness was measured using the modified Canadian Aerobic Fitness Test mCAFT. Sociodemographic gender, age, school grade, paternal and maternal schooling, socioeconomic status, and anthropometric variables body weight, height, triceps and subscapular skinfold thickness, sexual maturation, physical activity, sedentary behavior, and eating habits were collected. RESULTS: it was found that 31.5% of adolescents had low aerobic fitness levels, being higher in boys 49.2% compared to girls 20.6%. Moreover, girls with sedentary behavior, overweight and high body fat percentage were the groups most likely to have inadequate aerobic fitness. In males, the groups most likely to have inadequate aerobic fitness were those whose parents studied more than eight years, those with low levels of physical activity, and those with inadequate nutrition and excessive body fat. CONCLUSION: low aerobic fitness levels were present in one third of adolescents and was more prevalent in boys. Lifestyle changes, including replacement of sedentary behaviors by physical and sport activities , may assist in improving the aerobic fitness of Brazilian adolescents.

  17. FIREFLY (Fitting IteRativEly For Likelihood analYsis): a full spectral fitting code

    Science.gov (United States)

    Wilkinson, David M.; Maraston, Claudia; Goddard, Daniel; Thomas, Daniel; Parikh, Taniya

    2017-12-01

    We present a new spectral fitting code, FIREFLY, for deriving the stellar population properties of stellar systems. FIREFLY is a chi-squared minimization fitting code that fits combinations of single-burst stellar population models to spectroscopic data, following an iterative best-fitting process controlled by the Bayesian information criterion. No priors are applied, rather all solutions within a statistical cut are retained with their weight. Moreover, no additive or multiplicative polynomials are employed to adjust the spectral shape. This fitting freedom is envisaged in order to map out the effect of intrinsic spectral energy distribution degeneracies, such as age, metallicity, dust reddening on galaxy properties, and to quantify the effect of varying input model components on such properties. Dust attenuation is included using a new procedure, which was tested on Integral Field Spectroscopic data in a previous paper. The fitting method is extensively tested with a comprehensive suite of mock galaxies, real galaxies from the Sloan Digital Sky Survey and Milky Way globular clusters. We also assess the robustness of the derived properties as a function of signal-to-noise ratio (S/N) and adopted wavelength range. We show that FIREFLY is able to recover age, metallicity, stellar mass, and even the star formation history remarkably well down to an S/N ∼ 5, for moderately dusty systems. Code and results are publicly available.1

  18. Female Fitness in the Blogosphere

    Directory of Open Access Journals (Sweden)

    Jesper Andreasson

    2013-07-01

    Full Text Available This article analyzes self-portrayals and gender constructions among female personal trainers within an Internet-mediated framework of fitness culture. The empirical material comes from a close examination of three strategically selected blogs. The result shows that some of the blogs clearly build upon what Connell calls emphasized femininity, as a means of legitimizing and constructing appropriate female fitness. In addition, there are also tendencies of sexualization in text and imagery present. As such, these self-representations are framed within a cultural history of body fitness dominated by stereotypical ways of perceiving masculinity and femininity. However, this does not capture the entire presentation of the self among the analyzed fitness bloggers. The blogs also point in the direction of ongoing negotiations and subversions of traditional gender norms. Among other things, they show how irony and humor are used as a means of questioning normative gender constructions while empowering female fitness and bodyliness.

  19. Leading a Culture of Fitness

    Science.gov (United States)

    2011-03-24

    professional fighting force. Numerous studies indicate physical fitness improves cognitive function, the ability to handle stress, injury recovery...4 ―What is Fitness?‖ The CrossFit Journal (October 2002) http://www.crossfit.com (accessed 11 February, 2011). An excellent article beyond the...scope of this paper. Although our definition was derived from Crossfit , it is our position that Crossfit is not, and should not be, the only method to

  20. Improving health-related fitness in children: the fit-4-Fun randomized controlled trial study protocol

    Directory of Open Access Journals (Sweden)

    Eather Narelle

    2011-12-01

    Full Text Available Abstract Background Declining levels of physical fitness in children are linked to an increased risk of developing poor physical and mental health. Physical activity programs for children that involve regular high intensity physical activity, along with muscle and bone strengthening activities, have been identified by the World Health Organisation as a key strategy to reduce the escalating burden of ill health caused by non-communicable diseases. This paper reports the rationale and methods for a school-based intervention designed to improve physical fitness and physical activity levels of Grades 5 and 6 primary school children. Methods/Design Fit-4-Fun is an 8-week multi-component school-based health-related fitness education intervention and will be evaluated using a group randomized controlled trial. Primary schools from the Hunter Region in NSW, Australia, will be invited to participate in the program in 2011 with a target sample size of 128 primary schools children (age 10-13. The Fit-4-Fun program is theoretically grounded and will be implemented applying the Health Promoting Schools framework. Students will participate in weekly curriculum-based health and physical education lessons, daily break-time physical activities during recess and lunch, and will complete an 8-week (3 × per week home activity program with their parents and/or family members. A battery of six health-related fitness assessments, four days of pedometery-assessed physical activity and a questionnaire, will be administered at baseline, immediate post-intervention (2-months and at 6-months (from baseline to determine intervention effects. Details of the methodological aspects of recruitment, inclusion criteria, randomization, intervention program, assessments, process evaluation and statistical analyses are described. Discussion The Fit-4-Fun program is an innovative school-based intervention targeting fitness improvements in primary school children. The program will

  1. Improving health-related fitness in children: the Fit-4-Fun randomized controlled trial study protocol.

    Science.gov (United States)

    Eather, Narelle; Morgan, Philip J; Lubans, David R

    2011-12-05

    Declining levels of physical fitness in children are linked to an increased risk of developing poor physical and mental health. Physical activity programs for children that involve regular high intensity physical activity, along with muscle and bone strengthening activities, have been identified by the World Health Organisation as a key strategy to reduce the escalating burden of ill health caused by non-communicable diseases. This paper reports the rationale and methods for a school-based intervention designed to improve physical fitness and physical activity levels of Grades 5 and 6 primary school children. Fit-4-Fun is an 8-week multi-component school-based health-related fitness education intervention and will be evaluated using a group randomized controlled trial. Primary schools from the Hunter Region in NSW, Australia, will be invited to participate in the program in 2011 with a target sample size of 128 primary schools children (age 10-13). The Fit-4-Fun program is theoretically grounded and will be implemented applying the Health Promoting Schools framework. Students will participate in weekly curriculum-based health and physical education lessons, daily break-time physical activities during recess and lunch, and will complete an 8-week (3 × per week) home activity program with their parents and/or family members. A battery of six health-related fitness assessments, four days of pedometery-assessed physical activity and a questionnaire, will be administered at baseline, immediate post-intervention (2-months) and at 6-months (from baseline) to determine intervention effects. Details of the methodological aspects of recruitment, inclusion criteria, randomization, intervention program, assessments, process evaluation and statistical analyses are described. The Fit-4-Fun program is an innovative school-based intervention targeting fitness improvements in primary school children. The program will involve a range of evidence-based behaviour change strategies to

  2. Physical activity enhances metabolic fitness independently of cardiorespiratory fitness in marathon runners

    DEFF Research Database (Denmark)

    Laye, M J; Nielsen, M B; Hansen, L S

    2015-01-01

    High levels of cardiovascular fitness (CRF) and physical activity (PA) are associated with decreased mortality and risk to develop metabolic diseases. The independent contributions of CRF and PA to metabolic disease risk factors are unknown. We tested the hypothesis that runners who run consisten......High levels of cardiovascular fitness (CRF) and physical activity (PA) are associated with decreased mortality and risk to develop metabolic diseases. The independent contributions of CRF and PA to metabolic disease risk factors are unknown. We tested the hypothesis that runners who run...... consistently >50 km/wk and/or >2 marathons/yr for the last 5 years have superior metabolic fitness compared to matched sedentary subjects (CRF, age, gender, and BMI). Case-control recruitment of 31 pairs of runner-sedentary subjects identified 10 matched pairs with similar VO2max (mL/min/kg) (similar-VO2max......). The similar-VO2max group was compared with a group of age, gender, and BMI matched pairs who had the largest difference in VO2max (different-VO2max). Primary outcomes that defined metabolic fitness including insulin response to an oral glucose tolerance test, fasting lipids, and fasting insulin were superior...

  3. Vital role for cyclophilin B (CypB) in asexual development, dimorphic transition and virulence of Beauveria bassiana.

    Science.gov (United States)

    Chu, Zhen-Jian; Sun, Huan-Huan; Ying, Sheng-Hua; Feng, Ming-Guang

    2017-08-01

    Cyclophilin B (CypB) was previously revealed as one of many putative secretory proteins in the transcriptome of Beauveria bassiana infection to a lepidopteran pest. Here we show a main localization of CypB in hyphal cell walls and septa and its essential role in the in vitro and in vivo asexual cycles of the fungal insect pathogen. Deletion of cypB reduced colony growth by 16-42% on two rich media and 30 scant media with different carbon or nitrogen sources. The deletion mutant suffered a delayed conidiation on a standard medium and a final 47% reduction in conidial yield, accompanied with drastic transcript depression of several key genes required for conidiation and conidial maturation. The mutant conidia required 10h longer to germinate 50% at optimal 25°C than wild-type conidia. Intriguingly, cultivation of the mutant conidia in a trehalose-peptone broth mimic to insect hemolymph resulted in 83% reduction in blastospore yield but only slight decrease in biomass level, indicating severe defects in transition of hyphae to blastospores. LT 50 for the deletion mutant against Galleria mellonella larvae through normal cuticle infection was prolonged to 7.4d from a wild-type estimate of 4.7d. During colony growth, additionally, the deletion mutant displayed hypersensitivity to Congo red, menadione, H 2 O 2 and heat shock but increased tolerance to cyclosporine A and rapamycin. All of changes were restored by targeted gene complementation. Altogether, CypB takes part in sustaining normal growth, aerial conidiation, conidial germination, dimorphic transition, stress tolerance and pathogenicity in B. bassiana. Copyright © 2017 Elsevier Inc. All rights reserved.

  4. Mapping organizational members' sense of fit

    OpenAIRE

    Billsberry, Jon; Marsh, Philip; Moss-Jones, John

    2004-01-01

    Despite its importance in the organizational behavior literature, person–organization (P–O) fit remains an elusive construct. One reason for this is the lack of research about organizational members’ own sense of their P–O fit. In this paper we report an empirical study that explored organizational members’ own sense of fit using storytelling and causal mapping techniques. The results suggest that organizational members categorize their perceptions of their fit into five discrete domains (job...

  5. MixFit

    DEFF Research Database (Denmark)

    Haller, Toomas; Leitsalu, Liis; Fischer, Krista

    2017-01-01

    Ancestry information at the individual level can be a valuable resource for personalized medicine, medical, demographical and history research, as well as for tracing back personal history. We report a new method for quantitatively determining personal genetic ancestry based on genome-wide data....... Numerical ancestry component scores are assigned to individuals based on comparisons with reference populations. These comparisons are conducted with an existing analytical pipeline making use of genotype phasing, similarity matrix computation and our addition-multidimensional best fitting by Mix......Fit. The method is demonstrated by studying Estonian and Finnish populations in geographical context. We show the main differences in the genetic composition of these otherwise close European populations and how they have influenced each other. The components of our analytical pipeline are freely available...

  6. Factors associated with prevalence and types of 'may be fit' advice on fit notes: a cross-sectional primary care analysis.

    Science.gov (United States)

    Shiels, Chris; Gabbay, Mark; Hillage, Jim

    2014-03-01

    The 'fit note', with the opportunity for the GP to advise that a patient 'may be fit' to do some work, was introduced in April 2010. To estimate numbers of fit notes with 'may be fit' advice, the types of advice, and factors associated with any inclusion of such advice in the fit note. Cross-sectional analysis of fit note data from 68 general practices in eight regions of England, Wales and Scotland. Collection of practice fit note data via GP use of carbonised pads of fit notes for a period of 12 months. The 'may be fit' box was ticked on 5080 fit notes (6.4% of all fit notes in study). But there was a wide variation in completion rates across the 68 practices (from 1% to 15%). The most prevalent individual item of advice was to 'amend duties' of patient as a prerequisite for return to work (included in 42% of all notes containing any 'may be fit' advice). Advice was often incomplete or irrelevant, with some GPs failing to comply with official guidance. Inclusion of any 'may be fit' advice was independently associated with the patient being female, less socially deprived and having a physical health reason for receiving a fit note. Unlike other studies that have relied upon eliciting opinion, this study investigates how the fit note is being used in practice. Findings provide some evidence that the fit note is not yet being used to the optimum benefit of patients (and their employers).

  7. Socio-demographic predictors of person–organization fit

    Directory of Open Access Journals (Sweden)

    Dorota Merecz-Kot

    2017-02-01

    Full Text Available Objectives: The aim of this study was to explore the relationship between socio-demographic characteristics and the level of complementary and supplementary person–organization fit (P–O fit. Material and Methods: The study sample was a group of 600 Polish workers, urban residents aged 19–65. Level of P–O fit was measured using the Subjective Person–Organization Fit Questionnaire by Czarnota-Bojarska. The binomial multivariate logistic regression was applied. The analyzes were performed separately for the men and women. Results: Socio-demographic variables explained small percentage of the outcome variability. Gender differences were found. In the case of men shift work decreased complementary and supplementary fit, while long working hours decreased complementary fit. In the women, age was a stimulant of a complementary fit, involuntary job losses predicted both complementary and supplementary misfit. Additionally, relational responsibilities increased probability of supplementary P–O fit in the men. Conclusions: Going beyond personality and competences as the factors affecting P–O fit will allow development of a more accurate prediction of P–O fit. Int J Occup Med Environ Health 2017;30(1:133–149

  8. Asexual propagation of sea anemones that host anemonefishes: implications for the marine ornamental aquarium trade and restocking programs.

    Directory of Open Access Journals (Sweden)

    Anna Scott

    Full Text Available Anemonefishes and their host sea anemones form an iconic symbiotic association in reef environments, and are highly sought after in the marine aquarium trade. This study examines asexual propagation as a method for culturing a geographically widespread and commonly traded species of host sea anemone, Entacmaea quadricolor. Two experiments were done: the first to establish whether size or colour morph influenced survival after cutting into halves or quarters; and the second to see whether feeding was needed to maximise survival and growth after cutting. Survival rates were high in both experiments, with 89.3 and 93.8% of the anemones cut in half, and 62.5 and 80.4% cut in quarters surviving in experiments 1 and 2, respectively. Anemones that were cut in half were larger in size, and healed and grew quicker than those cut in quarters. However, even though survival was lower when the individuals were cut in quarters, this treatment produced the greatest number of anemones. Feeding increased oral disc diameter growth and reduced wet weight loss, but did not significantly influence pedal disc diameter. Given that the anemones took up to 56 d to form an off-centre mouth, it is highly likely that feeding may have produced greater effect if the experiment was run for longer. This low technology method of propagation could be used to produce individuals throughout the year and the anemones could then be used to supply the aquarium trade or restock depleted habitats, thus supporting biodiversity conservation in coral reef areas.

  9. Asexual propagation of sea anemones that host anemonefishes: implications for the marine ornamental aquarium trade and restocking programs.

    Science.gov (United States)

    Scott, Anna; Hardefeldt, Jannah M; Hall, Karina C

    2014-01-01

    Anemonefishes and their host sea anemones form an iconic symbiotic association in reef environments, and are highly sought after in the marine aquarium trade. This study examines asexual propagation as a method for culturing a geographically widespread and commonly traded species of host sea anemone, Entacmaea quadricolor. Two experiments were done: the first to establish whether size or colour morph influenced survival after cutting into halves or quarters; and the second to see whether feeding was needed to maximise survival and growth after cutting. Survival rates were high in both experiments, with 89.3 and 93.8% of the anemones cut in half, and 62.5 and 80.4% cut in quarters surviving in experiments 1 and 2, respectively. Anemones that were cut in half were larger in size, and healed and grew quicker than those cut in quarters. However, even though survival was lower when the individuals were cut in quarters, this treatment produced the greatest number of anemones. Feeding increased oral disc diameter growth and reduced wet weight loss, but did not significantly influence pedal disc diameter. Given that the anemones took up to 56 d to form an off-centre mouth, it is highly likely that feeding may have produced greater effect if the experiment was run for longer. This low technology method of propagation could be used to produce individuals throughout the year and the anemones could then be used to supply the aquarium trade or restock depleted habitats, thus supporting biodiversity conservation in coral reef areas.

  10. 48 CFR 752.7033 - Physical fitness.

    Science.gov (United States)

    2010-10-01

    ... 48 Federal Acquisition Regulations System 5 2010-10-01 2010-10-01 false Physical fitness. 752.7033 Section 752.7033 Federal Acquisition Regulations System AGENCY FOR INTERNATIONAL DEVELOPMENT CLAUSES AND... fitness. For use in all USAID contracts involving performance overseas. Physical Fitness (JUL 1997) (The...

  11. Relationship among Fitness, Morphological Characteristics, Skills ...

    African Journals Online (AJOL)

    The specific morphological and fitness demands of the sport are, therefore, not fully understood. The purpose of this ... The findings convincingly suggest that coaches should include fitness, morphological and skills tests in their coaching and fitness programmes, team selection and talent identification processes. Keywords: ...

  12. Physical Fitness in the Army

    Science.gov (United States)

    1977-03-17

    in fitness as the absence of disease or injury . The coach defines fitness as §l’Jse factors responsible for success in a sport. The leader is...lower back and legs to gradually increase your body’s level of activity. This will reduce the risk of injury and prevent unnecessary soreness. Also, a...flexibility. Let’s discuss the importance of muscular fitness and how we can achieve this kind of fitneas through weightlifting or calisthenics. Remember

  13. ORF Alignment: NC_002678 [GENIUS II[Archive

    Lifescience Database Archive (English)

    Full Text Available NC_002678 gi|13475930 >1el5A 6 379 7 420 7e-42 ... ref|NP_107500.1| AgaE protein, conversion of agropini...c acid to mannopinic acid ... [Mesorhizobium loti MAFF303099] dbj|BAB53286.1| AgaE

  14. Person-job and person-organization fits: Co-op fits in an aerospace engineering environment

    Science.gov (United States)

    Urban, Anthony John, Jr.

    This dissertation research was a replication of a quantitative study completed by Dr. Cynthia Shantz at Wayne State University during 2003. The intent of the research was to investigate the fits of college students who participated in cooperative academic-work programs (co-ops) to employment positions within aerospace engineering. The objective of investigating person-job (P-J) and person-organization (P-O) fits was to determine if variables could be identified that indicated an individual's aptitude to complete successfully aerospace engineering standard work. Research participants were co-op employees who were surveyed during their employment to identify indications of their fits into their organization and job assignments. Dr. Shantz's research led to the thought employment success might increase when P-J and P-O fits increase. For example, reduced initial training investments and increased employee retention might result with improved P-O and P-J fits. Research data were gathered from surveys of co-ops who worked at a Connecticut aerospace engineering company. Data were collected by distributing invitations to co-ops to participate in three online surveys over a 9-11 week period. Distribution of survey invitations was accomplished through the Human Resources Department to ensure that respondent identities were maintained private. To protect anonymity and privacy further, no identifying information about individuals or the company is published. However, some demographic information was collected to ensure that correlations were based on valid and reliable data and research and analysis methods. One objective of this research was to determine if co-op characteristics could be correlated with successful employment in an aerospace engineering environment. A second objective was to determine if P-J and P-O fits vary over time as co-ops become increasing familiar with their assignments, organization, and environment. Understanding and incorporating the use P-J and P

  15. Fit-For-Purpose Land Administration

    DEFF Research Database (Denmark)

    Enemark, Stig; McLaren, Robin

    2017-01-01

    This paper looks at implementing Fit-For-Purpose land administration solutions at county level. This will require a country specific strategy drawing from the recent GLTN publication on “Fit-For-Purpose Land Administration – Guiding Principles for Country Implementation”. The Fit...... administration; 4) Designing the country specific FFP spatial / legal / institutional frameworks; 5) Capacity development; 6) Country specific instruction manuals; and 7) Economic benefits analysis. Finally, the paper presents some experiences and reflections from a case study on implementing the FFP approach...

  16. Temporal issues in person-organization fit, person-job fit, and turnover : The role of leader-member exchange

    NARCIS (Netherlands)

    Boon, C.; Biron, M.

    2016-01-01

    Person–environment fit has been found to have significant implications for employee attitudes and behaviors. Most research to date has approached person–environment fit as a static phenomenon, and without examining how different types of person–environment fit may affect each other. In particular,

  17. Dance your way to fitness

    Science.gov (United States)

    ... ency/patientinstructions/000809.htm Dance your way to fitness To use the sharing features on this page, ... to rhythm and music. Many health clubs and fitness centers offer dance workout classes, such as Zumba. ...

  18. vFitness: a web-based computing tool for improving estimation of in vitro HIV-1 fitness experiments

    Directory of Open Access Journals (Sweden)

    Demeter Lisa

    2010-05-01

    Full Text Available Abstract Background The replication rate (or fitness between viral variants has been investigated in vivo and in vitro for human immunodeficiency virus (HIV. HIV fitness plays an important role in the development and persistence of drug resistance. The accurate estimation of viral fitness relies on complicated computations based on statistical methods. This calls for tools that are easy to access and intuitive to use for various experiments of viral fitness. Results Based on a mathematical model and several statistical methods (least-squares approach and measurement error models, a Web-based computing tool has been developed for improving estimation of virus fitness in growth competition assays of human immunodeficiency virus type 1 (HIV-1. Conclusions Unlike the two-point calculation used in previous studies, the estimation here uses linear regression methods with all observed data in the competition experiment to more accurately estimate relative viral fitness parameters. The dilution factor is introduced for making the computational tool more flexible to accommodate various experimental conditions. This Web-based tool is implemented in C# language with Microsoft ASP.NET, and is publicly available on the Web at http://bis.urmc.rochester.edu/vFitness/.

  19. In situ repair of a failed compression fitting

    Science.gov (United States)

    Wolbert, Ronald R.; Jandrasits, Walter G.

    1986-01-01

    A method and apparatus for the in situ repair of a failed compression fitg is provided. Initially, a portion of a guide tube is inserted coaxially in the bore of the compression fitting and locked therein. A close fit dethreading device is then coaxially mounted on the guide tube to cut the threads from the fitting. Thereafter, the dethreading device and guide tube are removed and a new fitting is inserted onto the dethreaded fitting with the body of the new fitting overlaying the dethreaded portion. Finally, the main body of the new fitting is welded to the main body of the old fitting whereby a new threaded portion of the replacement fitting is precisely coaxial with the old threaded portion. If needed, a bushing is located on the dethreaded portion which is sized to fit snugly between the dethreaded portion and the new fitting. Preferably, the dethreading device includes a cutting tool which is moved incrementally in a radial direction whereby the threads are cut from the threaded portion of the failed fitting in increments.

  20. Ned-19 inhibition of parasite growth and multiplication suggests a role for NAADP mediated signalling in the asexual development of Plasmodium falciparum.

    Science.gov (United States)

    Suárez-Cortés, Pablo; Gambara, Guido; Favia, Annarita; Palombi, Fioretta; Alano, Pietro; Filippini, Antonio

    2017-09-12

    Although malaria is a preventable and curable human disease, millions of people risk to be infected by the Plasmodium parasites and to develop this illness. Therefore, there is an urgent need to identify new anti-malarial drugs. Ca 2+ signalling regulates different processes in the life cycle of Plasmodium falciparum, representing a suitable target for the development of new drugs. This study investigated for the first time the effect of a highly specific inhibitor of nicotinic acid adenine dinucleotide phosphate (NAADP)-induced Ca 2+ release (Ned-19) on P. falciparum, revealing the inhibitory effect of this compound on the blood stage development of this parasite. Ned-19 inhibits both the transition of the parasite from the early to the late trophozoite stage and the ability of the late trophozoite to develop to the multinucleated schizont stage. In addition, Ned-19 affects spontaneous intracellular Ca 2+ oscillations in ring and trophozoite stage parasites, suggesting that the observed inhibitory effects may be associated to regulation of intracellular Ca 2+ levels. This study highlights the inhibitory effect of Ned-19 on progression of the asexual life cycle of P. falciparum. The observation that Ned-19 inhibits spontaneous Ca 2+ oscillations suggests a potential role of NAADP in regulating Ca 2+ signalling of P. falciparum.

  1. Respirators. Does your face fit

    Energy Technology Data Exchange (ETDEWEB)

    Caro, N M; Else, D

    1981-04-01

    The authors carried out a survey of face sizes of men and women of four different ethnic origins and carried out face-seal leakage trials on four corresponding test panels. No single respirator design is likely to fit all members of the workforce, and it may be necessary to stock respirators from more than one manufacturers.Three or four different respirators or size of respirator may be needed. However, the use of lossely-fitting respirators such as Airsteam helmets could remove the necessity for exhaustive fitting procedures.

  2. Set-fit effects in choice.

    Science.gov (United States)

    Evers, Ellen R K; Inbar, Yoel; Zeelenberg, Marcel

    2014-04-01

    In 4 experiments, we investigate how the "fit" of an item with a set of similar items affects choice. We find that people have a notion of a set that "fits" together--one where all items are the same, or all items differ, on salient attributes. One consequence of this notion is that in addition to preferences over the set's individual items, choice reflects set-fit. This leads to predictable shifts in preferences, sometimes even resulting in people choosing normatively inferior options over superior ones.

  3. Relationships between physical activity, physical fitness, somatic fitness, and coordination along childhood and adolescence

    Directory of Open Access Journals (Sweden)

    João Paulo Saraiva

    2010-12-01

    Full Text Available The two main goals of this review were to understand how the relationships between physical activity, physical fitness, somatic fitness, and coordination are established along the motor development of children and adolescents, and how they would influence their future lives. The web based bibliographic database B-On was searched for peer-reviewed publications during the last decade (2000 to 2009. Search criteria included all articles on relationships between any two of the above named factors. Although different methodological designs and variables were found as markers for the same factor, overall results suggested the existence of a clear positive relationship among physical activity, physical fitness, somatic fitness, and coordination from childhood to adolescence, with a special relevance for the relationship between physical activity and coordination. It was also noted a renewed interest on physical activity and motor coordination developmental characteristics and relationships as well as on their lifelong health effects.

  4. Relationships between physical activity, physical fitness, somatic fitness, and coordination along childhood and adolescence

    Directory of Open Access Journals (Sweden)

    J.P. Saraiva

    2010-01-01

    Full Text Available The two main goals of this review were to understand how the relationships between physical activity, physical fitness, somatic fitness, and coordination are established along the motor development of children and adolescents, and how they would influence their future lives. The web based bibliographic database B-On was searched for peer-reviewed publications during the last decade (2000 to 2009. Search criteria included all articles on relationships between any two of the above named factors. Although different methodological designs and variables were found as markers for the same factor, overall results suggested the existence of a clear positive relationship among physical activity, physical fitness, somatic fitness, and coordination from childhood to adolescence, with a special relevance for the relationship between physical activity and coordination. It was also noted a renewed interest on physical activity and motor coordination developmental characteristics and relationships as well as on their lifelong health effects.

  5. The Langley Fitness Center

    Science.gov (United States)

    1993-01-01

    NASA Langley recognizes the importance of healthy employees by committing itself to offering a complete fitness program. The scope of the program focuses on promoting overall health and wellness in an effort to reduce the risks of illness and disease and to increase productivity. This is accomplished through a comprehensive Health and Fitness Program offered to all NASA employees. Various aspects of the program are discussed.

  6. Having a Ball with Fitness Balls

    Science.gov (United States)

    McNulty, Betty

    2011-01-01

    Fitness programs can be greatly enhanced with the addition of fitness balls. They are a fun, challenging, economical, and safe way to incorporate a cardiovascular, strength, and stretching program for all fitness levels in a physical education setting. The use of these balls has become more popular during the last decade, and their benefits and…

  7. FitSKIRT: genetic algorithms to automatically fit dusty galaxies with a Monte Carlo radiative transfer code

    Science.gov (United States)

    De Geyter, G.; Baes, M.; Fritz, J.; Camps, P.

    2013-02-01

    We present FitSKIRT, a method to efficiently fit radiative transfer models to UV/optical images of dusty galaxies. These images have the advantage that they have better spatial resolution compared to FIR/submm data. FitSKIRT uses the GAlib genetic algorithm library to optimize the output of the SKIRT Monte Carlo radiative transfer code. Genetic algorithms prove to be a valuable tool in handling the multi- dimensional search space as well as the noise induced by the random nature of the Monte Carlo radiative transfer code. FitSKIRT is tested on artificial images of a simulated edge-on spiral galaxy, where we gradually increase the number of fitted parameters. We find that we can recover all model parameters, even if all 11 model parameters are left unconstrained. Finally, we apply the FitSKIRT code to a V-band image of the edge-on spiral galaxy NGC 4013. This galaxy has been modeled previously by other authors using different combinations of radiative transfer codes and optimization methods. Given the different models and techniques and the complexity and degeneracies in the parameter space, we find reasonable agreement between the different models. We conclude that the FitSKIRT method allows comparison between different models and geometries in a quantitative manner and minimizes the need of human intervention and biasing. The high level of automation makes it an ideal tool to use on larger sets of observed data.

  8. Kinematic Fitting of Detached Vertices

    Energy Technology Data Exchange (ETDEWEB)

    Mattione, Paul [Rice Univ., Houston, TX (United States)

    2007-05-01

    The eg3 experiment at the Jefferson Lab CLAS detector aims to determine the existence of the $\\Xi_{5}$ pentaquarks and investigate the excited $\\Xi$ states. Specifically, the exotic $\\Xi_{5}^{--}$ pentaquark will be sought by first reconstructing the $\\Xi^{-}$ particle through its weak decays, $\\Xi^{-}\\to\\pi^{-}\\Lambda$ and $\\Lambda\\to\\pi^{-}$. A kinematic fitting routine was developed to reconstruct the detached vertices of these decays, where confidence level cuts on the fits are used to remove background events. Prior to fitting these decays, the exclusive reaction $\\gamma D\\rightarrow pp\\pi^{-}$ was studied in order to correct the track measurements and covariance matrices of the charged particles. The $\\Lambda\\rightarrow p\\pi^{-}$ and $\\Xi^{-}\\to\\pi^{-}\\Lambda$ decays were then investigated to demonstrate that the kinematic fitting routine reconstructs the decaying particles and their detached vertices correctly.

  9. VRF ("Visual RobFit") — nuclear spectral analysis with non-linear full-spectrum nuclide shape fitting

    Science.gov (United States)

    Lasche, George; Coldwell, Robert; Metzger, Robert

    2017-09-01

    A new application (known as "VRF", or "Visual RobFit") for analysis of high-resolution gamma-ray spectra has been developed using non-linear fitting techniques to fit full-spectrum nuclide shapes. In contrast to conventional methods based on the results of an initial peak-search, the VRF analysis method forms, at each of many automated iterations, a spectrum-wide shape for each nuclide and, also at each iteration, it adjusts the activities of each nuclide, as well as user-enabled parameters of energy calibration, attenuation by up to three intervening or self-absorbing materials, peak width as a function of energy, full-energy peak efficiency, and coincidence summing until no better fit to the data can be obtained. This approach, which employs a new and significantly advanced underlying fitting engine especially adapted to nuclear spectra, allows identification of minor peaks that are masked by larger, overlapping peaks that would not otherwise be possible. The application and method are briefly described and two examples are presented.

  10. New ROOT Graphical User Interfaces for fitting

    International Nuclear Information System (INIS)

    Maline, D Gonzalez; Moneta, L; Antcheva, I

    2010-01-01

    ROOT, as a scientific data analysis framework, provides extensive capabilities via Graphical User Interfaces (GUI) for performing interactive analysis and visualizing data objects like histograms and graphs. A new interface for fitting has been developed for performing, exploring and comparing fits on data point sets such as histograms, multi-dimensional graphs or trees. With this new interface, users can build interactively the fit model function, set parameter values and constraints and select fit and minimization methods with their options. Functionality for visualizing the fit results is as well provided, with the possibility of drawing residuals or confidence intervals. Furthermore, the new fit panel reacts as a standalone application and it does not prevent users from interacting with other windows. We will describe in great detail the functionality of this user interface, covering as well new capabilities provided by the new fitting and minimization tools introduced recently in the ROOT framework.

  11. Prediction of Pressing Quality for Press-Fit Assembly Based on Press-Fit Curve and Maximum Press-Mounting Force

    Directory of Open Access Journals (Sweden)

    Bo You

    2015-01-01

    Full Text Available In order to predict pressing quality of precision press-fit assembly, press-fit curves and maximum press-mounting force of press-fit assemblies were investigated by finite element analysis (FEA. The analysis was based on a 3D Solidworks model using the real dimensions of the microparts and the subsequent FEA model that was built using ANSYS Workbench. The press-fit process could thus be simulated on the basis of static structure analysis. To verify the FEA results, experiments were carried out using a press-mounting apparatus. The results show that the press-fit curves obtained by FEA agree closely with the curves obtained using the experimental method. In addition, the maximum press-mounting force calculated by FEA agrees with that obtained by the experimental method, with the maximum deviation being 4.6%, a value that can be tolerated. The comparison shows that the press-fit curve and max press-mounting force calculated by FEA can be used for predicting the pressing quality during precision press-fit assembly.

  12. Characterization of Streptomyces spp. isolated from the rhizosphere of oil palm and evaluation of their ability to suppress basal stem rot disease in oil palm seedlings when applied as powder formulations in a glasshouse trial.

    Science.gov (United States)

    Shariffah-Muzaimah, S A; Idris, A S; Madihah, A Z; Dzolkhifli, O; Kamaruzzaman, S; Maizatul-Suriza, M

    2017-12-18

    Ganoderma boninense, the main causal agent of oil palm (Elaeis guineensis) basal stem rot (BSR), severely reduces oil palm yields around the world. To reduce reliance on fungicide applications to control BSR, we are investigating the efficacy of alternative control methods, such as the application of biological control agents. In this study, we used four Streptomyces-like actinomycetes (isolates AGA43, AGA48, AGA347 and AGA506) that had been isolated from the oil palm rhizosphere and screened for antagonism towards G. boninense in a previous study. The aim of this study was to characterize these four isolates and then to assess their ability to suppress BSR in oil palm seedlings when applied individually to the soil in a vermiculite powder formulation. Analysis of partial 16S rRNA gene sequences (512 bp) revealed that the isolates exhibited a very high level of sequence similarity (> 98%) with GenBank reference sequences. Isolates AGA347 and AGA506 showed 99% similarity with Streptomyces hygroscopicus subsp. hygroscopicus and Streptomyces ahygroscopicus, respectively. Isolates AGA43 and AGA48 also belonged to the Streptomyces genus. The most effective formulation, AGA347, reduced BSR in seedlings by 73.1%. Formulations using the known antifungal producer Streptomyces noursei, AGA043, AGA048 or AGA506 reduced BSR by 47.4, 30.1, 54.8 and 44.1%, respectively. This glasshouse trial indicates that these Streptomyces spp. show promise as potential biological control agents against Ganoderma in oil palm. Further investigations are needed to determine the mechanism of antagonism and to increase the shelf life of Streptomyces formulations.

  13. Curve fitting methods for solar radiation data modeling

    Energy Technology Data Exchange (ETDEWEB)

    Karim, Samsul Ariffin Abdul, E-mail: samsul-ariffin@petronas.com.my, E-mail: balbir@petronas.com.my; Singh, Balbir Singh Mahinder, E-mail: samsul-ariffin@petronas.com.my, E-mail: balbir@petronas.com.my [Department of Fundamental and Applied Sciences, Faculty of Sciences and Information Technology, Universiti Teknologi PETRONAS, Bandar Seri Iskandar, 31750 Tronoh, Perak Darul Ridzuan (Malaysia)

    2014-10-24

    This paper studies the use of several type of curve fitting method to smooth the global solar radiation data. After the data have been fitted by using curve fitting method, the mathematical model of global solar radiation will be developed. The error measurement was calculated by using goodness-fit statistics such as root mean square error (RMSE) and the value of R{sup 2}. The best fitting methods will be used as a starting point for the construction of mathematical modeling of solar radiation received in Universiti Teknologi PETRONAS (UTP) Malaysia. Numerical results indicated that Gaussian fitting and sine fitting (both with two terms) gives better results as compare with the other fitting methods.

  14. Curve fitting methods for solar radiation data modeling

    Science.gov (United States)

    Karim, Samsul Ariffin Abdul; Singh, Balbir Singh Mahinder

    2014-10-01

    This paper studies the use of several type of curve fitting method to smooth the global solar radiation data. After the data have been fitted by using curve fitting method, the mathematical model of global solar radiation will be developed. The error measurement was calculated by using goodness-fit statistics such as root mean square error (RMSE) and the value of R2. The best fitting methods will be used as a starting point for the construction of mathematical modeling of solar radiation received in Universiti Teknologi PETRONAS (UTP) Malaysia. Numerical results indicated that Gaussian fitting and sine fitting (both with two terms) gives better results as compare with the other fitting methods.

  15. Curve fitting methods for solar radiation data modeling

    International Nuclear Information System (INIS)

    Karim, Samsul Ariffin Abdul; Singh, Balbir Singh Mahinder

    2014-01-01

    This paper studies the use of several type of curve fitting method to smooth the global solar radiation data. After the data have been fitted by using curve fitting method, the mathematical model of global solar radiation will be developed. The error measurement was calculated by using goodness-fit statistics such as root mean square error (RMSE) and the value of R 2 . The best fitting methods will be used as a starting point for the construction of mathematical modeling of solar radiation received in Universiti Teknologi PETRONAS (UTP) Malaysia. Numerical results indicated that Gaussian fitting and sine fitting (both with two terms) gives better results as compare with the other fitting methods

  16. Energetic fitness: Field metabolic rates assessed via 3D accelerometry complement conventional fitness metrics

    Science.gov (United States)

    Grémillet, David; Lescroël, Amelie; Ballard, Grant; Dugger, Katie M.; Massaro, Melanie; Porzig, Elizabeth L.; Ainley, David G.

    2018-01-01

    Evaluating the fitness of organisms is an essential step towards understanding their responses to environmental change. Connections between energy expenditure and fitness have been postulated for nearly a century. However, testing this premise among wild animals is constrained by difficulties in measuring energy expenditure while simultaneously monitoring conventional fitness metrics such as survival and reproductive output.We addressed this issue by exploring the functional links between field metabolic rate (FMR), body condition, sex, age and reproductive performance in a wild population.We deployed 3D accelerometers on 115 Adélie penguins Pygoscelis adeliae during four breeding seasons at one of the largest colonies of this species, Cape Crozier, on Ross Island, Antarctica. The demography of this population has been studied for the past 18 years. From accelerometry recordings, collected for birds of known age and breeding history, we determined the vector of the dynamic body acceleration (VeDBA) and used it as a proxy for FMR.This allowed us to demonstrate relationships among FMR, a breeding quality index (BQI) and body condition. Notably, we found a significant quadratic relationship between mean VeDBA during foraging and BQI for experienced breeders, and individuals in better body condition showed lower rates of energy expenditure.We conclude that using FMR as a fitness component complementary to more conventional fitness metrics will yield greater understanding of evolutionary and conservation physiology.

  17. When 'fit' leads to fit, and when 'fit' leads to fat: how message framing and intrinsic vs. extrinsic exercise outcomes interact in promoting physical activity.

    Science.gov (United States)

    Gallagher, Kristel M; Updegraff, John A

    2011-07-01

    A unique aspect of exercise is that people may choose to engage in it to achieve a variety of outcomes, ranging from extrinsic (appearance, health) to intrinsic (satisfaction, enjoyment). We examined how the impact of gain- vs. loss-framed messages depends on the type of outcome emphasised. Drawing from regulatory focus theory (Higgins, E.T. (1997). Beyond pleasure and pain. American Psychologist, 52, 1280-1300; Higgins, E.T. (2000). Making a good decision: Value from fit. American Psychologist, 55, 1217-1230), we predicted that gain-framed messages would 'fit' with intrinsic outcomes and loss-framed messages would 'fit' with extrinsic outcomes, but the effect of such fit on physical activity would depend on the participants' need for cognition (NC). We tested these hypotheses with a sample of 176 sedentary young adults who read an exercise message with randomly assigned frame (gain/loss) and outcome (intrinsic/extrinsic). Participants provided daily reports of exercise over the following week. The predicted interaction between frame, outcome and NC was found (p=0.001) such that a 'fit' message promoted somewhat, but not significantly, greater exercise for those with high NC, but a 'non-fit' message promoted significantly greater exercise for those with low NC. Furthermore, differences in physical activity were partially mediated by attitudes towards exercise. Findings shed light on how the outcomes and motivations associated with physical activity shape people's behavioural responses to framed health communications. © 2011 Taylor & Francis

  18. Person-organization fit and turnover intention: exploring the mediating effect of work engagement and the moderating effect of demand-ability fit.

    Science.gov (United States)

    Peng, Jui-Chen; Lee, Yin-Ling; Tseng, Mei-Man

    2014-03-01

    Person-organization (P-O) fit is an important influencing factor on the intentions and attitudes of hospital nurses. The authors used a motivation-mechanism approach to conceptualize work engagement as a mediator and demand-ability (D-A) fit as a moderator to elicit the role of P-O fit in the turnover intention of nurses. This article explores whether the work engagement of nurses mediates the relationship between P-O fit and turnover intention and examines whether D-A fit moderates this relationship. The sample comprised 349 nurses working for two regional hospitals in Yilan County, Taiwan. Linear regression modeling analysis was conducted to test the proposed hypotheses. Results indicate that P-O fit has a negative effect on participant turnover intention. In addition, the work engagement of participants was found to mediate the impact of P-O fit on turnover intention. A new significant interactive relationship was discovered such that high D-A fit strengthened the negative relationship between P-O fit and turnover intention. The work engagement of professional nurses has attracted increasing attention in the literature on fit, particularly with regard to the linkage between P-O and fit-turnover intention. This study enhances the understanding of the function of P-O fit by considering perceived D-A fit. Nurse turnover is the main reason for the current shortage of nurses in Taiwan. Therefore, if the cognitive values of nurses and the organizational culture fit with hospital value systems, common values may facilitate a higher degree of nurse work engagement and, in turn, decrease turnover intention. In addition, recruiting employees with high D-A fit may help hospitals enhance the negative relationship between P-O fit and nurse turnover intention.

  19. Self-Fitting Hearing Aids

    Directory of Open Access Journals (Sweden)

    Gitte Keidser

    2016-04-01

    Full Text Available A self-contained, self-fitting hearing aid (SFHA is a device that enables the user to perform both threshold measurements leading to a prescribed hearing aid setting and fine-tuning, without the need for audiological support or access to other equipment. The SFHA has been proposed as a potential solution to address unmet hearing health care in developing countries and remote locations in the developed world and is considered a means to lower cost and increase uptake of hearing aids in developed countries. This article reviews the status of the SFHA and the evidence for its feasibility and challenges and predicts where it is heading. Devices that can be considered partly or fully self-fitting without audiological support were identified in the direct-to-consumer market. None of these devices are considered self-contained as they require access to other hardware such as a proprietary interface, computer, smartphone, or tablet for manipulation. While there is evidence that self-administered fitting processes can provide valid and reliable results, their success relies on user-friendly device designs and interfaces and easy-to-interpret instructions. Until these issues have been sufficiently addressed, optional assistance with the self-fitting process and on-going use of SFHAs is recommended. Affordability and a sustainable delivery system remain additional challenges for the SFHA in developing countries. Future predictions include a growth in self-fitting products, with most future SFHAs consisting of earpieces that connect wirelessly with a smartphone and providers offering assistance through a telehealth infrastructure, and the integration of SFHAs into the traditional hearing health-care model.

  20. Mating type gene homologues and putative sex pheromone-sensing pathway in arbuscular mycorrhizal fungi, a presumably asexual plant root symbiont.

    Directory of Open Access Journals (Sweden)

    Sébastien Halary

    Full Text Available The fungal kingdom displays a fascinating diversity of sex-determination systems. Recent advances in genomics provide insights into the molecular mechanisms of sex, mating type determination, and evolution of sexual reproduction in many fungal species in both ancient and modern phylogenetic lineages. All major fungal groups have evolved sexual differentiation and recombination pathways. However, sexuality is unknown in arbuscular mycorrhizal fungi (AMF of the phylum Glomeromycota, an ecologically vital group of obligate plant root symbionts. AMF are commonly considered an ancient asexual lineage dating back to the Ordovician, approximately 460 M years ago. In this study, we used genomic and transcriptomic surveys of several AMF species to demonstrate the presence of conserved putative sex pheromone-sensing mitogen-activated protein (MAP kinases, comparable to those described in Ascomycota and Basidiomycota. We also find genes for high mobility group (HMG transcription factors, homologous to SexM and SexP genes in the Mucorales. The SexM genes show a remarkable sequence diversity among multiple copies in the genome, while only a single SexP sequence was detected in some isolates of Rhizophagus irregularis. In the Mucorales and Microsporidia, the sexM gene is flanked by genes for a triosephosphate transporter (TPT and a RNA helicase, but we find no evidence for synteny in the vicinity of the Sex locus in AMF. Nonetheless, our results, together with previous observations on meiotic machinery, suggest that AMF could undergo a complete sexual reproduction cycle.

  1. [Comparing the young asthmatics running fitness].

    Science.gov (United States)

    Belányi, Kinga; Gyene, István; Bak, Zsuzsa; Mezei, Györgyi

    2007-02-25

    Nowadays, doctors strongly recommend physical activity for asthmatic children, since the resulting improved physical fitness and psychological change also raise the quality of life. The aim of this study was to compare the physical fitness of asthmatic children who regularly participate in therapeutic swimming, with asthmatic children who do not participate in this training and with non-swimming, healthy children using the 12 minute free running, Cooper test. The children from the swimmer asthmatic group (n= 51, age = 9-22 yrs) took part in a special, long term, swimming exercise program (Gyene method). Whereas, the non-swimmer asthmatics (n = 28, age = 8-22 yrs) and the healthy children (n: 179, age: 9-22 yrs) only took part in the normal school physical education classes. Fitness was measured using the Cooper test. Data was collected from 258 subjects and showed that the fitness of swimmer asthmatics is significantly better than that of the non-swimmer asthmatics and even better than that of the healthy subjects (swimmer/ non swimmer asthmatic p = 0.01; swimmer asthmatic/ healthy p test). The difference in the fitness acquired from swimming was the most pronounced for the 8-11 years old asthmatics, presumably because of greater motivational factors. No differences were found between genders for the two asthmatic groups, whereas healthy boys were found to have significantly greater levels of fitness than healthy girls. Fitness is substantially increased with regular swimming. The favourable effects of swimming are expressed not only in comparison with the non-swimmer asthmatics but with the healthy subjects too. The regular therapeutic swimming program helps the formation of running fitness too.

  2. Youth fitness--problems and solutions.

    Science.gov (United States)

    DiNubile, N A

    1993-07-01

    Review of the current data in the area of youth fitness reveals some alarming trends. Children in the United States are fatter, slower, and weaker than their counterparts in other developed nations. In addition, U.S. children seem to be adopting a sedentary lifestyle at earlier ages. Although there is no easy solution to this problem, there are specific recommendations that can ensure improvement in this area. The cornerstone for any meaningful change must involve programs that seek to increase physical activity both in school and at home. Daily, quality physical education in grades K-12 should be mandated in all states. Parents should be educated regarding the critical importance and the multitude of benefits to be derived from their involvement in fitness-related activities with their children. A healthy balance must be established between sedentary activities, e.g., television and video games, and physical activity. All schools should establish fitness testing programs for children and these should be based on health-fitness parameters rather than on athletic performance variables. To ensure improvements in youth fitness across our nation, other interventions are also necessary. These include appropriate involvement of local communities, state and federal governments, the medical health professions, and the media. Specific strategies are available for each group.

  3. Inclusive fitness maximization: An axiomatic approach.

    Science.gov (United States)

    Okasha, Samir; Weymark, John A; Bossert, Walter

    2014-06-07

    Kin selection theorists argue that evolution in social contexts will lead organisms to behave as if maximizing their inclusive, as opposed to personal, fitness. The inclusive fitness concept allows biologists to treat organisms as akin to rational agents seeking to maximize a utility function. Here we develop this idea and place it on a firm footing by employing a standard decision-theoretic methodology. We show how the principle of inclusive fitness maximization and a related principle of quasi-inclusive fitness maximization can be derived from axioms on an individual׳s 'as if preferences' (binary choices) for the case in which phenotypic effects are additive. Our results help integrate evolutionary theory and rational choice theory, help draw out the behavioural implications of inclusive fitness maximization, and point to a possible way in which evolution could lead organisms to implement it. Copyright © 2014 Elsevier Ltd. All rights reserved.

  4. Knowledge translation to fitness trainers: A systematic review

    Directory of Open Access Journals (Sweden)

    Adamo Kristi B

    2010-04-01

    Full Text Available Abstract Background This study investigates approaches for translating evidence-based knowledge for use by fitness trainers. Specific questions were: Where do fitness trainers get their evidence-based information? What types of interventions are effective for translating evidence-based knowledge for use by fitness trainers? What are the barriers and facilitators to the use of evidence-based information by fitness trainers in their practice? Methods We describe a systematic review of studies about knowledge translation interventions targeting fitness trainers. Fitness trainers were defined as individuals who provide exercise program design and supervision services to the public. Nurses, physicians, physiotherapists, school teachers, athletic trainers, and sport team strength coaches were excluded. Results Of 634 citations, two studies were eligible for inclusion: a survey of 325 registered health fitness professionals (66% response rate and a qualitative study of 10 fitness instructors. Both studies identified that fitness trainers obtain information from textbooks, networking with colleagues, scientific journals, seminars, and mass media. Fitness trainers holding higher levels of education are reported to use evidence-based information sources such as scientific journals compared to those with lower education levels, who were reported to use mass media sources. The studies identified did not evaluate interventions to translate evidence-based knowledge for fitness trainers and did not explore factors influencing uptake of evidence in their practice. Conclusion Little is known about how fitness trainers obtain and incorporate new evidence-based knowledge into their practice. Further exploration and specific research is needed to better understand how emerging health-fitness evidence can be translated to maximize its use by fitness trainers providing services to the general public.

  5. Convolution based profile fitting

    International Nuclear Information System (INIS)

    Kern, A.; Coelho, A.A.; Cheary, R.W.

    2002-01-01

    Full text: In convolution based profile fitting, profiles are generated by convoluting functions together to form the observed profile shape. For a convolution of 'n' functions this process can be written as, Y(2θ)=F 1 (2θ)x F 2 (2θ)x... x F i (2θ)x....xF n (2θ). In powder diffractometry the functions F i (2θ) can be interpreted as the aberration functions of the diffractometer, but in general any combination of appropriate functions for F i (2θ) may be used in this context. Most direct convolution fitting methods are restricted to combinations of F i (2θ) that can be convoluted analytically (e.g. GSAS) such as Lorentzians, Gaussians, the hat (impulse) function and the exponential function. However, software such as TOPAS is now available that can accurately convolute and refine a wide variety of profile shapes numerically, including user defined profiles, without the need to convolute analytically. Some of the most important advantages of modern convolution based profile fitting are: 1) virtually any peak shape and angle dependence can normally be described using minimal profile parameters in laboratory and synchrotron X-ray data as well as in CW and TOF neutron data. This is possible because numerical convolution and numerical differentiation is used within the refinement procedure so that a wide range of functions can easily be incorporated into the convolution equation; 2) it can use physically based diffractometer models by convoluting the instrument aberration functions. This can be done for most laboratory based X-ray powder diffractometer configurations including conventional divergent beam instruments, parallel beam instruments, and diffractometers used for asymmetric diffraction. It can also accommodate various optical elements (e.g. multilayers and monochromators) and detector systems (e.g. point and position sensitive detectors) and has already been applied to neutron powder diffraction systems (e.g. ANSTO) as well as synchrotron based

  6. Crossing fitness canyons by a finite population

    Science.gov (United States)

    Saakian, David B.; Bratus, Alexander S.; Hu, Chin-Kun

    2017-06-01

    We consider the Wright-Fisher model of the finite population evolution on a fitness landscape defined in the sequence space by a path of nearly neutral mutations. We study a specific structure of the fitness landscape: One of the intermediate mutations on the mutation path results in either a large fitness value (climbing up a fitness hill) or a low fitness value (crossing a fitness canyon), the rest of the mutations besides the last one are neutral, and the last sequence has much higher fitness than any intermediate sequence. We derive analytical formulas for the first arrival time of the mutant with two point mutations. For the first arrival problem for the further mutants in the case of canyon crossing, we analytically deduce how the mean first arrival time scales with the population size and fitness difference. The location of the canyon on the path of sequences has a crucial role. If the canyon is at the beginning of the path, then it significantly prolongs the first arrival time; otherwise it just slightly changes it. Furthermore, the fitness hill at the beginning of the path strongly prolongs the arrival time period; however, the hill located near the end of the path shortens it. We optimize the first arrival time by applying a nonzero selection to the intermediate sequences. We extend our results and provide a scaling for the valley crossing time via the depth of the canyon and population size in the case of a fitness canyon at the first position. Our approach is useful for understanding some complex evolution systems, e.g., the evolution of cancer.

  7. [Sedentarism and physical fitness in postmenopausal women].

    Science.gov (United States)

    Morales, Silvia; Gómez-Cabello, Alba; González-Agüero, Alejandro; Casajús, José Antonio; Ara, Ignacio; Vicente-Rodríguez, Germán

    2013-01-01

    The aging process is accompanied by several changes, such as a decrease in physical fitness. To establish the relationship between a sedentary behavior (sit ≥4 hours/day) and physical fitness in 457 women aged 65 years or older. Physical fitness was evaluated by 8 adapted tests from "Senior Fitness Test" and "Eurofit Testing Battery". ANOVA was used to analyze differences between groups according to the hours of sitting and logistic regression analysis was used to study the association of the sedentary behavior with low fitness, using as reference the 20th percentile of the normative values in Spain (EXERNET Project). Sedentary women had lower balance, legs and arms strength, arms flexibility, walking speed and endurance (p < 0.05). In addition, those women who sat ≥4 hours/day had higher odds for having low fitness in most of the mentioned tests, regardless of the hours of walking (p < 0.05). Sitting for a long time has a negative influence on physical fitness among postmenopausal women independently of walking time. Copyright © AULA MEDICA EDICIONES 2013. Published by AULA MEDICA. All rights reserved.

  8. Formalizing Darwinism and inclusive fitness theory.

    Science.gov (United States)

    Grafen, Alan

    2009-11-12

    Inclusive fitness maximization is a basic building block for biological contributions to any theory of the evolution of society. There is a view in mathematical population genetics that nothing is caused to be maximized in the process of natural selection, but this is explained as arising from a misunderstanding about the meaning of fitness maximization. Current theoretical work on inclusive fitness is discussed, with emphasis on the author's 'formal Darwinism project'. Generally, favourable conclusions are drawn about the validity of assuming fitness maximization, but the need for continuing work is emphasized, along with the possibility that substantive exceptions may be uncovered. The formal Darwinism project aims more ambitiously to represent in a formal mathematical framework the central point of Darwin's Origin of Species, that the mechanical processes of inheritance and reproduction can give rise to the appearance of design, and it is a fitting ambition in Darwin's bicentenary year to capture his most profound discovery in the lingua franca of science.

  9. Theoretically unprejudiced fits to proton scattering

    International Nuclear Information System (INIS)

    Kobos, A.M.; Mackintosh, R.S.

    1979-01-01

    By using a spline interpolation method applied to all components of the proton optical potential we have fitted elastic scattering from 40 Ca and from 16 O at a range of energies. The potentials are highly oscillatory and we have shown that similar oscillations are found when the spline fitting procedure is applied to pseudo-data generated from potentials of known l-dependence. Moreover, we show how to find an l-independent potential equivalent to one that is l-dependent and we find that it is oscillatory and that various characteristic features of empirical spline fit potentials can be explained. Thus, by fitting the data with model indenpendt l-independent potentials we have found support for the contention that the nucleon optical potential should be viewed as being l-dependent. This work may be regarded as an example of the kind of physical information that can be gained by pursuing exact fits to proton elastic scattering data

  10. Where does fitness fit in theories of perception?

    Science.gov (United States)

    Anderson, Barton L

    2015-12-01

    Interface theory asserts that neither our perceptual experience of the world nor the scientific constructs used to describe the world are veridical. The primary argument used to uphold this claim is that (1) evolution is driven by a process of natural selection that favors fitness over veridicality, and (2) payoffs do not vary monotonically with truth. I argue that both the arguments used to bolster this claim and the conclusions derived from it are flawed. Interface theory assumes that perception evolved to directly track fitness but fails to consider the role of adaptation on ontogenetic time scales. I argue that the ubiquity of nonmonotonic payoff functions requires that (1) perception tracks "truth" for species that adapt on ontogenetic time scales and (2) that perception should be distinct from utility. These conditions are required to pursue an adaptive strategy to mitigate homeostatic imbalances. I also discuss issues with the interface metaphor, the particular formulation of veridicality that is considered, and the relationship of interface theory to the history of ideas on these topics.

  11. dftools: Distribution function fitting

    Science.gov (United States)

    Obreschkow, Danail

    2018-05-01

    dftools, written in R, finds the most likely P parameters of a D-dimensional distribution function (DF) generating N objects, where each object is specified by D observables with measurement uncertainties. For instance, if the objects are galaxies, it can fit a mass function (D=1), a mass-size distribution (D=2) or the mass-spin-morphology distribution (D=3). Unlike most common fitting approaches, this method accurately accounts for measurement in uncertainties and complex selection functions.

  12. The three faces of ecological fitness.

    Science.gov (United States)

    Peacock, Kent A

    2011-03-01

    This paper argues that fitness is most usefully understood as those properties of organisms that are explanatory of survival in the broadest sense, not merely descriptive of reproductive success. Borrowing from Rosenberg and Bouchard (2009), fitness in this sense is ecological in that it is defined by the interactions between organisms and environments. There are three sorts of ecological fitness: the well-documented ability to compete, the ability to cooperate (as in mutualistic symbiosis), and a third sense of fitness that has received insufficient attention in evolutionary theory, the ability to construct. Following Lotka, it can be understood thermodynamically as the ability to maintain or enlarge the energy-circulating capacity of an ecosystem. An organism that does this could end with its gene frequency unchanged but its probability of survival enhanced since it would sustain or increase the total carrying capacity of its ecosystem. Photosynthesizers and other autotrophs are obvious candidates for organisms that are fit in the constructive sense, but any organisms, including heterotrophs, can exhibit constructive fitness if they have some mechanism for channeling external flows of free energy into their ecosystems. I will briefly examine the prospects for the human species in the light of these considerations. Copyright © 2010 Elsevier Ltd. All rights reserved.

  13. Inferring genetic interactions from comparative fitness data.

    Science.gov (United States)

    Crona, Kristina; Gavryushkin, Alex; Greene, Devin; Beerenwinkel, Niko

    2017-12-20

    Darwinian fitness is a central concept in evolutionary biology. In practice, however, it is hardly possible to measure fitness for all genotypes in a natural population. Here, we present quantitative tools to make inferences about epistatic gene interactions when the fitness landscape is only incompletely determined due to imprecise measurements or missing observations. We demonstrate that genetic interactions can often be inferred from fitness rank orders, where all genotypes are ordered according to fitness, and even from partial fitness orders. We provide a complete characterization of rank orders that imply higher order epistasis. Our theory applies to all common types of gene interactions and facilitates comprehensive investigations of diverse genetic interactions. We analyzed various genetic systems comprising HIV-1, the malaria-causing parasite Plasmodium vivax , the fungus Aspergillus niger , and the TEM-family of β-lactamase associated with antibiotic resistance. For all systems, our approach revealed higher order interactions among mutations.

  14. Fitting the Phenomenological MSSM

    CERN Document Server

    AbdusSalam, S S; Quevedo, F; Feroz, F; Hobson, M

    2010-01-01

    We perform a global Bayesian fit of the phenomenological minimal supersymmetric standard model (pMSSM) to current indirect collider and dark matter data. The pMSSM contains the most relevant 25 weak-scale MSSM parameters, which are simultaneously fit using `nested sampling' Monte Carlo techniques in more than 15 years of CPU time. We calculate the Bayesian evidence for the pMSSM and constrain its parameters and observables in the context of two widely different, but reasonable, priors to determine which inferences are robust. We make inferences about sparticle masses, the sign of the $\\mu$ parameter, the amount of fine tuning, dark matter properties and the prospects for direct dark matter detection without assuming a restrictive high-scale supersymmetry breaking model. We find the inferred lightest CP-even Higgs boson mass as an example of an approximately prior independent observable. This analysis constitutes the first statistically convergent pMSSM global fit to all current data.

  15. The simplest formal argument for fitness optimization

    Indian Academy of Sciences (India)

    The Formal Darwinism Project aims to provide a formal argument linking population genetics to fitness optimization, which of necessity includes defining fitness. This bridges the gulf between those biologists who assume that natural selection leads to something close to fitness optimization and those biologists who believe ...

  16. Inclusive Fitness Maximization:An Axiomatic Approach

    OpenAIRE

    Okasha, Samir; Weymark, John; Bossert, Walter

    2014-01-01

    Kin selection theorists argue that evolution in social contexts will lead organisms to behave as if maximizing their inclusive, as opposed to personal, fitness. The inclusive fitness concept allows biologists to treat organisms as akin to rational agents seeking to maximize a utility function. Here we develop this idea and place it on a firm footing by employing a standard decision-theoretic methodology. We show how the principle of inclusive fitness maximization and a related principle of qu...

  17. The disruption of GDP-fucose de novo biosynthesis suggests the presence of a novel fucose-containing glycoconjugate in Plasmodium asexual blood stages.

    Science.gov (United States)

    Sanz, Sílvia; López-Gutiérrez, Borja; Bandini, Giulia; Damerow, Sebastian; Absalon, Sabrina; Dinglasan, Rhoel R; Samuelson, John; Izquierdo, Luis

    2016-11-16

    Glycosylation is an important posttranslational protein modification in all eukaryotes. Besides glycosylphosphatidylinositol (GPI) anchors and N-glycosylation, O-fucosylation has been recently reported in key sporozoite proteins of the malaria parasite. Previous analyses showed the presence of GDP-fucose (GDP-Fuc), the precursor for all fucosylation reactions, in the blood stages of Plasmodium falciparum. The GDP-Fuc de novo pathway, which requires the action of GDP-mannose 4,6-dehydratase (GMD) and GDP-L-fucose synthase (FS), is conserved in the parasite genome, but the importance of fucose metabolism for the parasite is unknown. To functionally characterize the pathway we generated a PfGMD mutant and analyzed its phenotype. Although the labelling by the fucose-binding Ulex europaeus agglutinin I (UEA-I) was completely abrogated, GDP-Fuc was still detected in the mutant. This unexpected result suggests the presence of an alternative mechanism for maintaining GDP-Fuc in the parasite. Furthermore, PfGMD null mutant exhibited normal growth and invasion rates, revealing that the GDP-Fuc de novo metabolic pathway is not essential for the development in culture of the malaria parasite during the asexual blood stages. Nonetheless, the function of this metabolic route and the GDP-Fuc pool that is generated during this stage may be important for gametocytogenesis and sporogonic development in the mosquito.

  18. The disruption of GDP-fucose de novo biosynthesis suggests the presence of a novel fucose-containing glycoconjugate in Plasmodium asexual blood stages

    Science.gov (United States)

    Sanz, Sílvia; López-Gutiérrez, Borja; Bandini, Giulia; Damerow, Sebastian; Absalon, Sabrina; Dinglasan, Rhoel R.; Samuelson, John; Izquierdo, Luis

    2016-01-01

    Glycosylation is an important posttranslational protein modification in all eukaryotes. Besides glycosylphosphatidylinositol (GPI) anchors and N-glycosylation, O-fucosylation has been recently reported in key sporozoite proteins of the malaria parasite. Previous analyses showed the presence of GDP-fucose (GDP-Fuc), the precursor for all fucosylation reactions, in the blood stages of Plasmodium falciparum. The GDP-Fuc de novo pathway, which requires the action of GDP-mannose 4,6-dehydratase (GMD) and GDP-L-fucose synthase (FS), is conserved in the parasite genome, but the importance of fucose metabolism for the parasite is unknown. To functionally characterize the pathway we generated a PfGMD mutant and analyzed its phenotype. Although the labelling by the fucose-binding Ulex europaeus agglutinin I (UEA-I) was completely abrogated, GDP-Fuc was still detected in the mutant. This unexpected result suggests the presence of an alternative mechanism for maintaining GDP-Fuc in the parasite. Furthermore, PfGMD null mutant exhibited normal growth and invasion rates, revealing that the GDP-Fuc de novo metabolic pathway is not essential for the development in culture of the malaria parasite during the asexual blood stages. Nonetheless, the function of this metabolic route and the GDP-Fuc pool that is generated during this stage may be important for gametocytogenesis and sporogonic development in the mosquito. PMID:27849032

  19. Cardiorespiratory Fitness Profile of Undergraduate Biomedical ...

    African Journals Online (AJOL)

    ... for developing sedentary habits, which could lead to reduced cardiorespiratory fitness. ... This study therefore examined the cardiorespiratory fitness (CRF) profile of ... A modified sub-maximal cycle ergometer protocol was used to estimate ...

  20. HRM and Fit: Survival of the fittest!?

    NARCIS (Netherlands)

    C.T. Boon (Corine)

    2008-01-01

    textabstractWhat is the nature of ‘fit’ in strategic HRM? This is the question guiding this thesis. Although the idea of fit is theoretically convincing, empirical evidence to support the role of fit is limited. Previous studies on fit have mainly focused on the alignment between HRM and strategy

  1. Fitness function and nonunique solutions in x-ray reflectivity curve fitting: crosserror between surface roughness and mass density

    International Nuclear Information System (INIS)

    Tiilikainen, J; Bosund, V; Mattila, M; Hakkarainen, T; Sormunen, J; Lipsanen, H

    2007-01-01

    Nonunique solutions of the x-ray reflectivity (XRR) curve fitting problem were studied by modelling layer structures with neural networks and designing a fitness function to handle the nonidealities of measurements. Modelled atomic-layer-deposited aluminium oxide film structures were used in the simulations to calculate XRR curves based on Parratt's formalism. This approach reduced the dimensionality of the parameter space and allowed the use of fitness landscapes in the study of nonunique solutions. Fitness landscapes, where the height in a map represents the fitness value as a function of the process parameters, revealed tracks where the local fitness optima lie. The tracks were projected on the physical parameter space thus allowing the construction of the crosserror equation between weakly determined parameters, i.e. between the mass density and the surface roughness of a layer. The equation gives the minimum error for the other parameters which is a consequence of the nonuniqueness of the solution if noise is present. Furthermore, the existence of a possible unique solution in a certain parameter range was found to be dependent on the layer thickness and the signal-to-noise ratio

  2. Higher body mass index is associated with greater severity of alopecia in men with male-pattern androgenetic alopecia in Taiwan: a cross-sectional study.

    Science.gov (United States)

    Yang, Chao-Chun; Hsieh, Fu-Nien; Lin, Li-Yu; Hsu, Chao-Kai; Sheu, Hamm-Ming; Chen, WenChieh

    2014-02-01

    Obesity is a risk factor for multiple health problems, but its association with androgenetic alopecia (AGA) remains controversial. We sought to determine the association between body mass index (BMI) and alopecia severity in men with AGA and early-onset AGA. A cross-sectional study was conducted. The medical charts and photographs of men with a clinical diagnosis of AGA were reviewed. In all, 189 men were enrolled with a mean age of 30.8 years. In male-pattern AGA (n = 142), men with severe alopecia (grade V-VII) had higher BMI than those with mild to moderate alopecia (grade I-IV) (25.1 vs 22.8 kg/m(2), P = .01). After multivariate adjustments, the risk for severe alopecia was higher in the overweight or obese (BMI ≥24 kg/m(2)) subjects with male-pattern AGA (odds ratio 3.52, P < .01). In early-onset male-pattern AGA (n = 46), the risk for having severe alopecia was also higher in the overweight or obese subjects (odds ratio 4.97, P = .03). Parameters used to evaluate obesity were limited because of the retrospective nature of the study. Higher BMI was significantly associated with greater severity of hair loss in men with male-pattern AGA, especially in those with early-onset AGA. Copyright © 2013 American Academy of Dermatology, Inc. Published by Mosby, Inc. All rights reserved.

  3. Goodness-of-fit tests for the Gompertz distribution

    DEFF Research Database (Denmark)

    Lenart, Adam; Missov, Trifon

    The Gompertz distribution is often fitted to lifespan data, however testing whether the fit satisfies theoretical criteria was neglected. Here five goodness-of-fit measures, the Anderson-Darling statistic, the Kullback-Leibler discrimination information, the correlation coefficient test, testing ...... for the mean of the sample hazard and a nested test against the generalized extreme value distributions are discussed. Along with an application to laboratory rat data, critical values calculated by the empirical distribution of the test statistics are also presented.......The Gompertz distribution is often fitted to lifespan data, however testing whether the fit satisfies theoretical criteria was neglected. Here five goodness-of-fit measures, the Anderson-Darling statistic, the Kullback-Leibler discrimination information, the correlation coefficient test, testing...

  4. CrossFit® instructor demographics and practice trends

    OpenAIRE

    Gregory R. Waryasz; Vladimir Suric; Alan H. Daniels; Joseph A. Gil; Craig P. Eberson

    2016-01-01

    CrossFit® is an increasingly popular exercise modality that uses high intensity power training. The literature to date regarding CrossFit® has focused on its benefits to VO2 Max, body composition and the motivational variables of participants of CrossFit®. A computerized survey was distributed to CrossFit® instructors using Survey Monkey® (Palo Alto, CA, USA). One hundred and ninety-three CrossFit® instructors responded to the survey. Of these 86.6% (155/179) reported being a certified CrossF...

  5. Motor competence and physical fitness in adolescents.

    Science.gov (United States)

    Gísladóttir, Ordís; Haga, Monika; Sigmundsson, Hermundur

    2014-01-01

    In this study we examined the relationship between physical fitness and motor competence in adolescents aged 15 to 16 years. A sample of 94 adolescents participated in the study. To test motor competence, the Movement Assessment Battery for Children-2 was used. Physical fitness was assessed using the following test items: standing broad jump, 20-m dash, reduced Cooper test, and sit-and-reach test. The results revealed a significant but weak relationship (0.248) between motor competence and physical fitness for the whole sample. More specifically, the correlation between the 2 variables was significant for girls (0.353) but not for boys (0.248). The relatively weak relationship between motor competence and physical fitness suggests that motor competence might not be critical in adolescents to maintain their physical fitness.

  6. Fitness for service - A continuing challenge

    International Nuclear Information System (INIS)

    McGonnagle, W.J.

    1983-01-01

    Fitness for service, as defined by this author, is the ability of a material, component, or system - the product - to perform its designated function. A fitness for service program promotes quality, assures reliability, enhances confidence and improves the safety of products - which is crucial in a critical industry as nuclear energy. Fitness for service necessitates strict adherence to and conformance with all safety and quality requirements. In short, the product must perform its designated function, under designated operational and environmental conditions, for a designated period of time

  7. Deamidated gliadin peptide antibodies as a routine test for celiac disease: a prospective analysis.

    Science.gov (United States)

    Volta, Umberto; Granito, Alessandro; Parisi, Claudia; Fabbri, Angela; Fiorini, Erica; Piscaglia, Maria; Tovoli, Francesco; Grasso, Valentina; Muratori, Paolo; Pappas, Georgios; De Giorgio, Roberto

    2010-03-01

    This study was designed to establish whether deamidated gliadin peptide antibodies (DGP-AGA) could improve the serologic workup for celiac disease (CD). The best serologic approach for CD screening is currently based on the combined detection of tissue transglutaminase (tTGA), endomysial (EmA), and gliadin antibodies (AGA). One hundred forty-four consecutive patients with gastrointestinal and extraintestinal signs suggestive for CD were investigated using serologic tests, that is, IgG and IgA DGP-AGA, IgA tTGA, IgA EmA, and duodenal biopsy. Forty-eight out of 144 patients (33%) had CD with different severity of villous atrophy. IgA tTGA showed 93.7% sensitivity compared with 91.6% for IgA EmA, 84.3% for IgA DGP-AGA, and 82.3% for IgG DGP-AGA. Of the 3 cases negative for IgA tTGA, IgA EmA, and IgA DGP-AGA, 2 had total IgA deficiency, although both were positive for IgG DGP-AGA. IgG DGP-AGA showed a very high specificity for CD (98.9%), not only superior to IgA DGP-AGA (79.8%), but also to IgA tTGA (96.6%) and very close to IgA EmA (100%). Our prospective study shows that the combined search for IgA tTGA and IgG DGP-AGA provides the best diagnostic accuracy for CD, allowing the identification of all CD cases---except one---with a very high specificity. The serologic workup for CD screening could be significantly improved by the routine introduction of IgG DGP-AGA together with IgA tTGA, thus reducing the number of tests and with an obvious advantage in terms of cost-efficacy.

  8. Does childhood motor skill proficiency predict adolescent fitness?

    Science.gov (United States)

    Barnett, Lisa M; Van Beurden, Eric; Morgan, Philip J; Brooks, Lyndon O; Beard, John R

    2008-12-01

    To determine whether childhood fundamental motor skill proficiency predicts subsequent adolescent cardiorespiratory fitness. In 2000, children's proficiency in a battery of skills was assessed as part of an elementary school-based intervention. Participants were followed up during 2006/2007 as part of the Physical Activity and Skills Study, and cardiorespiratory fitness was measured using the Multistage Fitness Test. Linear regression was used to examine the relationship between childhood fundamental motor skill proficiency and adolescent cardiorespiratory fitness controlling for gender. Composite object control (kick, catch, throw) and locomotor skill (hop, side gallop, vertical jump) were constructed for analysis. A separate linear regression examined the ability of the sprint run to predict cardiorespiratory fitness. Of the 928 original intervention participants, 481 were in 28 schools, 276 (57%) of whom were assessed. Two hundred and forty-four students (88.4%) completed the fitness test. One hundred and twenty-seven were females (52.1%), 60.1% of whom were in grade 10 and 39.0% were in grade 11. As children, almost all 244 completed each motor assessments, except for the sprint run (n = 154, 55.8%). The mean composite skill score in 2000 was 17.7 (SD 5.1). In 2006/2007, the mean number of laps on the Multistage Fitness Test was 50.5 (SD 24.4). Object control proficiency in childhood, adjusting for gender (P = 0.000), was associated with adolescent cardiorespiratory fitness (P = 0.012), accounting for 26% of fitness variation. Children with good object control skills are more likely to become fit adolescents. Fundamental motor skill development in childhood may be an important component of interventions aiming to promote long-term fitness.

  9. Self-reported physical fitness of older persons : A substitute for performance-based measures of physical fitness?

    NARCIS (Netherlands)

    vanHeuvelen, MJG; Kempen, GIJM; Ormel, J; de Greef, M.H.G.

    1997-01-01

    To evaluate the validity of self-report measures of physical fitness as substitutes for performance-based tests, self-reports and performance-based tests of physical fitness were compared. Subjects were a community-based sample of older adults (N = 624) aged 57 and over. The performance-based tests

  10. 46 CFR 45.129 - Hull fittings: General.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 2 2010-10-01 2010-10-01 false Hull fittings: General. 45.129 Section 45.129 Shipping... Assignment § 45.129 Hull fittings: General. Hull fittings must be securely mounted in the hull so as to avoid increases in hull stresses and must be protected from local damage caused by movement of equipment or cargo. ...

  11. Fitness-driven deactivation in network evolution

    International Nuclear Information System (INIS)

    Xu, Xin-Jian; Peng, Xiao-Long; Fu, Xin-Chu; Small, Michael

    2010-01-01

    Individual nodes in evolving real-world networks typically experience growth and decay—that is, the popularity and influence of individuals peaks and then fades. In this paper, we study this phenomenon via an intrinsic nodal fitness function and an intuitive ageing mechanism. Each node of the network is endowed with a fitness which represents its activity. All the nodes have two discrete stages: active and inactive. The evolution of the network combines the addition of new active nodes randomly connected to existing active ones and the deactivation of old active nodes with a possibility inversely proportional to their fitnesses. We obtain a structured exponential network when the fitness distribution of the individuals is homogeneous and a structured scale-free network with heterogeneous fitness distributions. Furthermore, we recover two universal scaling laws of the clustering coefficient for both cases, C(k) ∼ k −1 and C ∼ n −1 , where k and n refer to the node degree and the number of active individuals, respectively. These results offer a new simple description of the growth and ageing of networks where intrinsic features of individual nodes drive their popularity, and hence degree

  12. Evolutionary Graphs with Frequency Dependent Fitness

    Science.gov (United States)

    Nie, Pu-Yan; Zhang, Pei-Ai

    Evolutionary graph theory was recently proposed by Lieberman et al. in 2005. In the previous papers about evolutionary graphs (EGs), the fitness of the residents in the EGs is in general assumed to be unity, and the fitness of a mutant is assumed to be a constant r. We aim to extend EG to general cases in this paper, namely, the fitness of a mutant is heavily dependent upon frequency. The corresponding properties for these new EGs are analyzed, and the fixation probability is obtained for large population.

  13. GENFIT - a generic track-fitting toolkit

    Energy Technology Data Exchange (ETDEWEB)

    Rauch, Johannes [Technische Universitaet Muenchen (Germany); Schlueter, Tobias [Ludwig-Maximilians-Universitaet Muenchen (Germany)

    2014-07-01

    GENFIT is an experiment-independent track-fitting toolkit, which combines fitting algorithms, track representations, and measurement geometries into a modular framework. We report on a significantly improved version of GENFIT, based on experience gained in the Belle II, PANDA, and FOPI experiments. Improvements concern the implementation of additional track-fitting algorithms, enhanced implementations of Kalman fitters, enhanced visualization capabilities, and additional implementations of measurement types suited for various kinds of tracking detectors. The data model has been revised, allowing for efficient track merging, smoothing, residual calculation and alignment.

  14. ACCELERATED FITTING OF STELLAR SPECTRA

    Energy Technology Data Exchange (ETDEWEB)

    Ting, Yuan-Sen; Conroy, Charlie [Harvard–Smithsonian Center for Astrophysics, 60 Garden Street, Cambridge, MA 02138 (United States); Rix, Hans-Walter [Max Planck Institute for Astronomy, Königstuhl 17, D-69117 Heidelberg (Germany)

    2016-07-20

    Stellar spectra are often modeled and fitted by interpolating within a rectilinear grid of synthetic spectra to derive the stars’ labels: stellar parameters and elemental abundances. However, the number of synthetic spectra needed for a rectilinear grid grows exponentially with the label space dimensions, precluding the simultaneous and self-consistent fitting of more than a few elemental abundances. Shortcuts such as fitting subsets of labels separately can introduce unknown systematics and do not produce correct error covariances in the derived labels. In this paper we present a new approach—Convex Hull Adaptive Tessellation (chat)—which includes several new ideas for inexpensively generating a sufficient stellar synthetic library, using linear algebra and the concept of an adaptive, data-driven grid. A convex hull approximates the region where the data lie in the label space. A variety of tests with mock data sets demonstrate that chat can reduce the number of required synthetic model calculations by three orders of magnitude in an eight-dimensional label space. The reduction will be even larger for higher dimensional label spaces. In chat the computational effort increases only linearly with the number of labels that are fit simultaneously. Around each of these grid points in the label space an approximate synthetic spectrum can be generated through linear expansion using a set of “gradient spectra” that represent flux derivatives at every wavelength point with respect to all labels. These techniques provide new opportunities to fit the full stellar spectra from large surveys with 15–30 labels simultaneously.

  15. Statistical topography of fitness landscapes

    OpenAIRE

    Franke, Jasper

    2011-01-01

    Fitness landscapes are generalized energy landscapes that play an important conceptual role in evolutionary biology. These landscapes provide a relation between the genetic configuration of an organism and that organism’s adaptive properties. In this work, global topographical features of these fitness landscapes are investigated using theoretical models. The resulting predictions are compared to empirical landscapes. It is shown that these landscapes allow, at least with respe...

  16. Cardiorespiratory Fitness and Blood Pressure: A Longitudinal Analysis.

    Science.gov (United States)

    Agostinis-Sobrinho, César; Ruiz, Jonatan R; Moreira, Carla; Abreu, Sandra; Lopes, Luís; Oliveira-Santos, José; Mota, Jorge; Santos, Rute

    2018-01-01

    To examine the association between cardiorespiratory fitness and cardiovascular indices 2 years later, and to determine whether changes in cardiorespiratory fitness are associated with cardiovascular indices at a 2-year follow-up in adolescents. The sample comprised 734 adolescents (349 girls) aged 12-18 years followed for 3 years from the LabMed Physical Activity Study. Cardiorespiratory fitness was assessed by the 20-meter shuttle run test. Height, weight, waist circumference, and resting blood pressure (BP) were measured according to standard procedures. Regression analyses showed a significant inverse association between cardiorespiratory fitness at baseline and systolic BP (B = -0.126; P = .047) and rate pressure product (B = -29.94; P = .016), at follow-up after adjustments for age, sex, height, pubertal stage, socioeconomic status, and waist circumference. Significant differences were found between cardiorespiratory fitness groups (fit vs unfit) at baseline and systolic BP and rate pressure product at follow-up (P fitness changes and systolic BP (P = .024) and rate pressure product (P = .014), after adjustment for age, sex, height, pubertal status, socioeconomic status, and waist circumference. Changes in cardiorespiratory fitness during adolescence were associated with cardiovascular indices over a 2-year period. Adolescents with persistently low levels of cardiorespiratory fitness exhibited the highest levels of systolic BP and rate pressure product. Copyright © 2017 Elsevier Inc. All rights reserved.

  17. CrossFit® instructor demographics and practice trends

    Directory of Open Access Journals (Sweden)

    Gregory R. Waryasz

    2016-11-01

    Full Text Available CrossFit® is an increasingly popular exercise modality that uses high intensity power training. The literature to date regarding CrossFit® has focused on its benefits to VO2 Max, body composition and the motivational variables of participants of CrossFit®. A computerized survey was distributed to CrossFit® instructors using Survey Monkey® (Palo Alto, CA, USA. One hundred and ninety-three CrossFit® instructors responded to the survey. Of these 86.6% (155/179 reported being a certified CrossFit® instructor with 26.7% (48/180 having a bachelor’s degree in an exercise-related field. Instructors with a CrossFit® certification have less bachelor’s (P=0.04 or master’s (P=0.0001 degrees compared to those without a CrossFit® certification, more utilization of Olympic weightlifting (P=0.03, one-on-one teaching (P=0.0001, 1-RM max on snatch (P=0.004, 1- RM on clean and jerk or hang clean (P=0.0003, kettlebell use (P=0.0001 and one-on-one training (P=0.0001. Instructors report differences in their education and differences in use of weightlifting platforms and various types of footwear. Non-certified instructors differ from CrossFit® certified instructors in regards to teaching of Olympic weightlifting and exercise programming.

  18. CrossFit® Instructor Demographics and Practice Trends.

    Science.gov (United States)

    Waryasz, Gregory R; Suric, Vladimir; Daniels, Alan H; Gil, Joseph A; Eberson, Craig P

    2016-11-17

    CrossFit ® is an increasingly popular exercise modality that uses high intensity power training. The literature to date regarding CrossFit ® has focused on its benefits to VO2 Max, body composition and the motivational variables of participants of CrossFit ® . A computerized survey was distributed to CrossFit ® instructors using Survey Monkey ® (Palo Alto, CA, USA). One hundred and ninety-three CrossFit ® instructors responded to the survey. Of these 86.6% (155/179) reported being a certified CrossFit ® instructor with 26.7% (48/180) having a bachelor's degree in an exercise-related field. Instructors with a CrossFit ® certification have less bachelor's (P=0.04) or master's (P=0.0001) degrees compared to those without a CrossFit ® certification, more utilization of Olympic weightlifting (P=0.03), one-on-one teaching (P=0.0001), 1-RM max on snatch (P=0.004), 1-RM on clean and jerk or hang clean (P=0.0003), kettlebell use (P=0.0001) and one-on-one training (P=0.0001). Instructors report differences in their education and differences in use of weightlifting platforms and various types of footwear. Non-certified instructors differ from CrossFit ® certified instructors in regards to teaching of Olympic weightlifting and exercise programming.

  19. Dietary Patterns and Fitness Level in Mexican Teenagers.

    Science.gov (United States)

    Estrada-Reyes, César; Tlatempa-Sotelo, Patricia; Valdés-Ramos, Roxana; Cabañas-Armesilla, María; Manjarrez-Montes-de-Oca, Rafael

    2018-01-01

    Nowadays, the term "physical fitness" has evolved from sports performance to health status, and it has been considered a strong predictor of cardiovascular disease. In this sense, test batteries have been developed to evaluate physical fitness such as the ALPHA-FIT battery. On the other hand, the analysis of dietary patterns has emerged as an alternative method to study the relationship between diet and chronic noncommunicable diseases. However, the association between dietary patterns and the physical fitness level has not been evaluated in both adults and adolescents. This association is most important in adolescents due to the fact that establishing healthy dietary behaviors and a favorable nutritional profile in early stages of life prevents various chronic-degenerative diseases. To analyze the association between dietary patterns and the level of fitness in Mexican teenagers. We analyzed the relationship between dietary patterns and the fitness level of 42 teenage students in Toluca, Mexico. Students were weighed and measured, and their food intake was recorded for 2 weekdays and one weekend day. Dietary patterns were obtained by factorial analysis. The ALPHA-FIT battery was used to measure the fitness level. Fifty percent of the students were found to have a low fitness level (62.1% men; 37.9% women). There was no association ( X 2 = 0.83) between the dietary patterns "high in fat and sugar," "high in protein", and "low in fat and protein" and the level of physical condition in teens. In this study, all of teenagers with a very low level of fitness obtained a high dietary pattern in protein; however, 40% with a high level of physical condition resulted in the same pattern; that is why we did not find a relationship between the fitness level and the patterns investigated in this study.

  20. Assessment and monitoring practices of Australian fitness professionals.

    Science.gov (United States)

    Bennie, Jason A; Wiesner, Glen H; van Uffelen, Jannique G Z; Harvey, Jack T; Craike, Melinda J; Biddle, Stuart J H

    2018-04-01

    Assessment and monitoring of client health and fitness is a key part of fitness professionals' practices. However, little is known about prevalence of this practice. This study describes the assessment/monitoring practices of a large sample of Australian fitness professionals. Cross-sectional. In 2014, 1206 fitness professionals completed an online survey. Respondents reported their frequency (4 point-scale: [1] 'never' to [4] 'always') of assessment/monitoring of eight health and fitness constructs (e.g. body composition, aerobic fitness). This was classified as: (i) 'high' ('always' assessing/monitoring ≥5 constructs); (ii) 'medium' (1-4 constructs); (iii) 'low' (0 constructs). Classifications are reported by demographic and fitness industry characteristics. The odds of being classified as a 'high assessor/monitor' according to social ecological correlates were examined using a multiple-factor logistic regression model. Mean age of respondents was 39.3 (±11.6) years and 71.6% were female. A total of 15.8% (95% CI: 13.7%-17.9%) were classified as a 'high' assessor/monitor. Constructs with the largest proportion of being 'always' assessed were body composition (47.7%; 95% CI: 45.0%-50.1%) and aerobic fitness (42.5%; 95% CI: 39.6%-45.3%). Those with the lowest proportion of being 'always' assessed were balance (24.0%; 95% CI: 24.7%-26.5%) and mental health (20.2%; 95% CI: 18.1%-29.6%). A perceived lack of client interest and fitness professionals not considering assessing their responsibility were associated with lower odds of being classified as a 'high assessor/monitor'. Most fitness professionals do not routinely assess/monitor client fitness and health. Key factors limiting client health assessment and monitoring include a perceived lack of client interest and professionals not considering this their role. Copyright © 2017. Published by Elsevier Ltd.

  1. Injury Rate and Patterns Among CrossFit Athletes.

    Science.gov (United States)

    Weisenthal, Benjamin M; Beck, Christopher A; Maloney, Michael D; DeHaven, Kenneth E; Giordano, Brian D

    2014-04-01

    CrossFit is a type of competitive exercise program that has gained widespread recognition. To date, there have been no studies that have formally examined injury rates among CrossFit participants or factors that may contribute to injury rates. To establish an injury rate among CrossFit participants and to identify trends and associations between injury rates and demographic categories, gym characteristics, and athletic abilities among CrossFit participants. Descriptive epidemiology study. A survey was conducted, based on validated epidemiologic injury surveillance methods, to identify patterns of injury among CrossFit participants. It was sent to CrossFit gyms in Rochester, New York; New York City, New York; and Philadelphia, Pennsylvania, and made available via a posting on the main CrossFit website. Participants were encouraged to distribute it further, and as such, there were responses from a wide geographical location. Inclusion criteria included participating in CrossFit training at a CrossFit gym in the United States. Data were collected from October 2012 to February 2013. Data analysis was performed using Fisher exact tests and chi-square tests. A total of 486 CrossFit participants completed the survey, and 386 met the inclusion criteria. The overall injury rate was determined to be 19.4% (75/386). Males (53/231) were injured more frequently than females (21/150; P = .03). Across all exercises, injury rates were significantly different (P CrossFit was approximately 20%. Males were more likely to sustain an injury than females. The involvement of trainers in coaching participants on their form and guiding them through the workout correlates with a decreased injury rate. The shoulder and lower back were the most commonly injured in gymnastic and power lifting movements, respectively. Participants reported primarily acute and fairly mild injuries.

  2. A comparison of wearable fitness devices.

    Science.gov (United States)

    Kaewkannate, Kanitthika; Kim, Soochan

    2016-05-24

    Wearable trackers can help motivate you during workouts and provide information about your daily routine or fitness in combination with your smartphone without requiring potentially disruptive manual calculations or records. This paper summarizes and compares wearable fitness devices, also called "fitness trackers" or "activity trackers." These devices are becoming increasingly popular in personal healthcare, motivating people to exercise more throughout the day without the need for lifestyle changes. The various choices in the market for wearable devices are also increasing, with customers searching for products that best suit their personal needs. Further, using a wearable device or fitness tracker can help people reach a fitness goal or finish line. Generally, companies display advertising for these kinds of products and depict them as beneficial, user friendly, and accurate. However, there are no objective research results to prove the veracity of their words. This research features subjective and objective experimental results, which reveal that some devices perform better than others. The four most popular wristband style wearable devices currently on the market (Withings Pulse, Misfit Shine, Jawbone Up24, and Fitbit Flex) are selected and compared. The accuracy of fitness tracking is one of the key components for fitness tracking, and some devices perform better than others. This research shows subjective and objective experimental results that are used to compare the accuracy of four wearable devices in conjunction with user friendliness and satisfaction of 7 real users. In addition, this research matches the opinions between reviewers on an Internet site and those of subjects when using the device. Withings Pulse is the most friendly and satisfactory from the users' viewpoint. It is the most accurate and repeatable for step and distance tracking, which is the most important measurement of fitness tracking, followed by Fitbit Flex, Jawbone Up24, and Misfit

  3. A comparison of wearable fitness devices

    Directory of Open Access Journals (Sweden)

    Kanitthika Kaewkannate

    2016-05-01

    Full Text Available Abstract Background Wearable trackers can help motivate you during workouts and provide information about your daily routine or fitness in combination with your smartphone without requiring potentially disruptive manual calculations or records. This paper summarizes and compares wearable fitness devices, also called “fitness trackers” or “activity trackers.” These devices are becoming increasingly popular in personal healthcare, motivating people to exercise more throughout the day without the need for lifestyle changes. The various choices in the market for wearable devices are also increasing, with customers searching for products that best suit their personal needs. Further, using a wearable device or fitness tracker can help people reach a fitness goal or finish line. Generally, companies display advertising for these kinds of products and depict them as beneficial, user friendly, and accurate. However, there are no objective research results to prove the veracity of their words. This research features subjective and objective experimental results, which reveal that some devices perform better than others. Methods The four most popular wristband style wearable devices currently on the market (Withings Pulse, Misfit Shine, Jawbone Up24, and Fitbit Flex are selected and compared. The accuracy of fitness tracking is one of the key components for fitness tracking, and some devices perform better than others. This research shows subjective and objective experimental results that are used to compare the accuracy of four wearable devices in conjunction with user friendliness and satisfaction of 7 real users. In addition, this research matches the opinions between reviewers on an Internet site and those of subjects when using the device. Results Withings Pulse is the most friendly and satisfactory from the users’ viewpoint. It is the most accurate and repeatable for step and distance tracking, which is the most important measurement of

  4. Comparison of ductile-to-brittle transition curve fitting approaches

    International Nuclear Information System (INIS)

    Cao, L.W.; Wu, S.J.; Flewitt, P.E.J.

    2012-01-01

    Ductile-to-brittle transition (DBT) curve fitting approaches are compared over the transition temperature range for reactor pressure vessel steels with different kinds of data, including Charpy-V notch impact energy data and fracture toughness data. Three DBT curve fitting methods have been frequently used in the past, including the Burr S-Weibull and tanh distributions. In general there is greater scatter associated with test data obtained within the transition region. Therefore these methods give results with different accuracies, especially when fitting to small quantities of data. The comparison shows that the Burr distribution and tanh distribution can almost equally fit well distributed and large data sets extending across the test temperature range to include the upper and lower shelves. The S-Weibull distribution fit is poor for the lower shelf of the DBT curve. Overall for both large and small quantities of measured data the Burr distribution provides the best description. - Highlights: ► Burr distribution offers a better fit than that of a S-Weibull and tanh fit. ► Burr and tanh methods show similar fitting ability for a large data set. ► Burr method can fit sparse data well distributed across the test temperature. ► S-Weibull method cannot fit the lower shelf well and show poor fitting quality.

  5. Smartphone Applications for Patients' Health and Fitness.

    Science.gov (United States)

    Higgins, John P

    2016-01-01

    Healthcare providers are often looking for ways to objectively monitor and improve their patients' health and fitness, especially in between patient visits. Some insurance companies are using applications data as incentives to improve health and lower premiums. As more and more people start to use smartphones, they may provide a tool to help improve a patient's health and fitness. Specifically, fitness applications or "apps" on smartphones are programs that use data collected from a smartphone's inbuilt tools, such as the Global Positioning System, accelerometer, microphone, speaker, and camera, to measure health and fitness parameters. The apps then analyze these data and summarize them, as well as devise individualized plans based on users' goals, provide frequent feedback, personalized coaching, and additional motivation by allowing milestones to be shared on social media. This article introduces evidence that apps can better help patients reach their health and fitness goals. It then discusses what features to look for in an app, followed by an overview of popular health and fitness apps. Last, patient scenarios with app recommendations, limitations of apps, and future research are discussed. Copyright © 2016 Elsevier Inc. All rights reserved.

  6. CURVE LSFIT, Gamma Spectrometer Calibration by Interactive Fitting Method

    International Nuclear Information System (INIS)

    Olson, D.G.

    1992-01-01

    1 - Description of program or function: CURVE and LSFIT are interactive programs designed to obtain the best data fit to an arbitrary curve. CURVE finds the type of fitting routine which produces the best curve. The types of fitting routines available are linear regression, exponential, logarithmic, power, least squares polynomial, and spline. LSFIT produces a reliable calibration curve for gamma ray spectrometry by using the uncertainty value associated with each data point. LSFIT is intended for use where an entire efficiency curve is to be made starting at 30 KeV and continuing to 1836 KeV. It creates calibration curves using up to three least squares polynomial fits to produce the best curve for photon energies above 120 KeV and a spline function to combine these fitted points with a best fit for points below 120 KeV. 2 - Method of solution: The quality of fit is tested by comparing the measured y-value to the y-value calculated from the fitted curve. The fractional difference between these two values is printed for the evaluation of the quality of the fit. 3 - Restrictions on the complexity of the problem - Maxima of: 2000 data points calibration curve output (LSFIT) 30 input data points 3 least squares polynomial fits (LSFIT) The least squares polynomial fit requires that the number of data points used exceed the degree of fit by at least two

  7. Sex-specific determinants of fitness in a social mammal.

    Science.gov (United States)

    Lardy, Sophie; Allainé, Dominique; Bonenfant, Christophe; Cohas, Aurélie

    2015-11-01

    Sociality should evolve when the fitness benefits of group living outweigh the costs. Theoretical models predict an optimal group size maximizing individual fitness. However, beyond the number of individuals present in a group, the characteristics of these individuals, like their sex, are likely to affect the fitness payoffs of group living. Using 20 years of individually based data on a social mammal, the Alpine marmot (Marmota marmota), we tested for the occurrence of an optimal group size and composition, and for sex-specific effects of group characteristics on fitness. Based on lifetime data of 52 males and 39 females, our findings support the existence of an optimal group size maximizing male fitness and an optimal group composition maximizing fitness of males and females. Additionally, although group characteristics (i.e., size, composition and instability) affecting male and female fitness differed, fitness depended strongly on the number of same-sex subordinates within the social group in the two sexes. By comparing multiple measures of social group characteristics and of fitness in both sexes, we highlighted the sex-specific determinants of fitness in the two sexes and revealed the crucial role of intrasexual competition in shaping social group composition.

  8. Androgenetic alopecia as an indicator of metabolic syndrome and cardiovascular risk.

    Science.gov (United States)

    Ertas, Ragip; Orscelik, Ozcan; Kartal, Demet; Dogan, Ali; Ertas, Sule Ketenci; Aydogdu, Ebru Guler; Ascioglu, Ozcan; Borlu, Murat

    2016-06-01

    Numerous studies have investigated a probable association between androgenetic alopecia (AGA) and cardiovascular disease (CVD) by researching limited and dispersed parameters. We aimed to evaluate both traditional and non-traditional cardiovascular risk factors in male patients with early-onset AGA. This case-control study included 68 participants: 51 male patients with early-onset AGA and 17 healthy male controls. Patients with AGA were classified into three groups according to the Hamilton-Norwood scale and the presence of vertex hair loss. Traditional and non-traditional cardiovascular risk factors were examined in all study subjects. Metabolic syndrome was diagnosed in 25 patients with AGA and in two control subjects (p baldness and controls (p < 0.05). The pulse-wave velocity values were also found to be significantly higher in patients (p < 0.001). A limitation of this study was the small study population. In conclusion, vertex pattern AGA appears to be a marker for early atherosclerosis. This finding supports the hypothesis that early-onset AGA alone could be an independent risk factor for CVD and metabolic syndrome.

  9. Facepiece leakage and fitting of respirators

    International Nuclear Information System (INIS)

    White, J.M.

    1978-05-01

    The ways in which airborne contaminants can penetrate respirators and the factors which affect the fit of respirators are discussed. The fit of the respirator to the face is shown to be the most critical factor affecting the protection achieved by the user. Qualitative and quantitative fit testing techniques are described and their application to industrial respirator programs is examined. Quantitative measurement of the leakage of a respirator while worn can be used to numerically indicate the protection achieved. These numbers, often referred to as protection factors, are sometimes used as the basis for selecting suitable respirators and this practice is reviewed. (author)

  10. Cardiorespiratory Fitness, Metabolic Risk, and Inflammation in Children

    Directory of Open Access Journals (Sweden)

    Antonios D. Christodoulos

    2012-01-01

    Full Text Available The aim of this study was to investigate the independent associations among cardiorespiratory fitness, metabolic syndrome (MetS, and C-reactive protein (CRP in children. The sample consisted of 112 children (11.4  ±  0.4 years. Data was obtained for children’s anthropometry, cardiorespiratory fitness, MetS components, and CRP levels. MetS was defined using criteria analogous to the Adult Treatment Panel III definition. A MetS risk score was also computed. Prevalence of the MetS was 5.4%, without gender differences. Subjects with low fitness showed significantly higher MetS risk (<0.001 and CRP (<0.007, compared to the high-fitness pupils. However, differences in MetS risk, and CRP between fitness groups decreased when adjusted for waist circumference. These data indicate that the mechanisms linking cardiorespiratory fitness, MetS risk and inflammation in children are extensively affected by obesity. Intervention strategies aiming at reducing obesity and improving cardiorespiratory fitness in childhood might contribute to the prevention of the MetS in adulthood.

  11. Fit-To-Fight: Waist vs Waist/Height Measurements to Determine an Individual's Fitness Level - A Study in Statistical Regression and Analysis

    National Research Council Canada - National Science Library

    Swiderski, Steven J

    2005-01-01

    .... The abdominal measurement is a "one-size-fits-all" fitness standard. This research determines that a person's waist-to-height ratio is a better measurement than the waist measurement to estimate an individual's fitness level...

  12. Fit-for-Purpose

    DEFF Research Database (Denmark)

    Enemark, Stig

    2013-01-01

    ; completeness to cover the total jurisdiction; and credibility in terms of reliable data being trusted by the users. Accuracy can then be incrementally improved over time when relevant and justified by serving the needs of citizen, business and society in general. Such a fit-for-purpose approach is fundamental...... systems act within adopted land policies that define the legal regulatory pattern for dealing with land issues. Land administration systems - whether highly advanced or very basic – require a spatial framework to operate. This framework provides the fundamental information for dealing with land issues...... concepts may well be seen as the end target but not as the point of entry. When assessing the technology and investment choices the focus should be on building a fit-for-purpose framework that will meet the needs of society today and that can be incrementally improved over time....

  13. Pre-Tenured Faculty Job Satisfaction: An Examination of Personal Fit, Institutional Fit and Faculty Work-Life

    Science.gov (United States)

    Awando, Maxwell

    2014-01-01

    The purpose of this study is to explore job satisfaction among pre-tenured faculty. More specifically I was interested in examining demographic and personal fit factors, fit with the norms and values of the institution among pre-tenured faculty in different institutional types. The sample for the study included all pre-tenured faculty members who…

  14. Injury Rate and Patterns Among CrossFit Athletes

    OpenAIRE

    Weisenthal, Benjamin M.; Beck, Christopher A.; Maloney, Michael D.; DeHaven, Kenneth E.; Giordano, Brian D.

    2014-01-01

    Background: CrossFit is a type of competitive exercise program that has gained widespread recognition. To date, there have been no studies that have formally examined injury rates among CrossFit participants or factors that may contribute to injury rates. Purpose: To establish an injury rate among CrossFit participants and to identify trends and associations between injury rates and demographic categories, gym characteristics, and athletic abilities among CrossFit participants. Study Design: ...

  15. A new three-dimensional track fit with multiple scattering

    International Nuclear Information System (INIS)

    Berger, Niklaus; Kozlinskiy, Alexandr; Kiehn, Moritz; Schöning, André

    2017-01-01

    Modern semiconductor detectors allow for charged particle tracking with ever increasing position resolution. Due to the reduction of the spatial hit uncertainties, multiple Coulomb scattering in the detector layers becomes the dominant source for tracking uncertainties. In this case long distance effects can be ignored for the momentum measurement, and the track fit can consequently be formulated as a sum of independent fits to hit triplets. In this paper we present an analytical solution for a three-dimensional triplet(s) fit in a homogeneous magnetic field based on a multiple scattering model. Track fitting of hit triplets is performed using a linearization ansatz. The momentum resolution is discussed for a typical spectrometer setup. Furthermore the track fit is compared with other track fits for two different pixel detector geometries, namely the Mu3e experiment at PSI and a typical high-energy collider experiment. For a large momentum range the triplets fit provides a significantly better performance than a single helix fit. The triplets fit is fast and can easily be parallelized, which makes it ideal for the implementation on parallel computing architectures.

  16. A new three-dimensional track fit with multiple scattering

    Energy Technology Data Exchange (ETDEWEB)

    Berger, Niklaus; Kozlinskiy, Alexandr [Physikalisches Institut, Heidelberg University, Heidelberg (Germany); Institut für Kernphysik and PRISMA cluster of excellence, Mainz University, Mainz (Germany); Kiehn, Moritz; Schöning, André [Physikalisches Institut, Heidelberg University, Heidelberg (Germany)

    2017-02-01

    Modern semiconductor detectors allow for charged particle tracking with ever increasing position resolution. Due to the reduction of the spatial hit uncertainties, multiple Coulomb scattering in the detector layers becomes the dominant source for tracking uncertainties. In this case long distance effects can be ignored for the momentum measurement, and the track fit can consequently be formulated as a sum of independent fits to hit triplets. In this paper we present an analytical solution for a three-dimensional triplet(s) fit in a homogeneous magnetic field based on a multiple scattering model. Track fitting of hit triplets is performed using a linearization ansatz. The momentum resolution is discussed for a typical spectrometer setup. Furthermore the track fit is compared with other track fits for two different pixel detector geometries, namely the Mu3e experiment at PSI and a typical high-energy collider experiment. For a large momentum range the triplets fit provides a significantly better performance than a single helix fit. The triplets fit is fast and can easily be parallelized, which makes it ideal for the implementation on parallel computing architectures.

  17. Fit-For-Purpose Land Administration

    DEFF Research Database (Denmark)

    Enemark, Stig

    2015-01-01

    The term “Fit-For-Purpose Land Administration” indicates that the approach used for building land administration systems in less developed countries should be flexible and focused on serving the purpose of the systems (such as providing security of tenure and control of land use) rather than...... focusing on top-end technical solutions and high accuracy surveys. Of course, such flexibility allows for land administration systems to be incrementally improved over time. This paper unfolds the Fit-For-Purpose concept by analyzing the three core components: The spatial framework (large scale land parcel...... mapping) should be provided using affordable modern technologies such aerial imageries rather than field surveys. The legal framework must support both legal and social tenure, and the regulations must be designed along administrative rather than judicial lines. The fit-for-purpose approach must...

  18. CdTe reflection anisotropy line shape fitting

    International Nuclear Information System (INIS)

    Molina-Contreras, J.R.

    2010-01-01

    In this paper, an empirical novel plane-wave time dependent ensemble is introduced to fit the RA, the reflectance (R) and the imaginary part of the dielectric function oscillation measured around the E 1 and E 1 + Δ 1 transition region in II-VI semiconductors. By applying the new plane-wave time dependent ensemble to the measured spectrum for a (0 0 1) oriented CdTe undoped commercial wafer, crystallized in a zinc-blende structure, a very good agreement was found between the measured spectrum and the fitting. In addition to this, the reliability of the plane-wave time dependent ensemble was probed, by comparing the results with the calculated fitting in terms of a Fourier series and in terms of a six-order polynomial fit. Our analysis suggests, that the experimental oscillation in the line shape of the RA cannot be fitted with a Fourier series using harmonics multiples of the number which dominates the measured RA spectra in the argument of the plane-wave ensemble.

  19. Analytical fits to the synchrotron functions

    Science.gov (United States)

    Fouka, Mourad; Ouichaoui, Saad

    2013-06-01

    Accurate fitting formulae to the synchrotron function, F(x), and its complementary function, G(x), are performed and presented. The corresponding relative errors are less than 0.26% and 0.035% for F(x) and G(x), respectively. To this end we have, first, fitted the modified Bessel functions, K5/3(x) and K2/3(x). For all the fitted functions, the general fit expression is the same, and is based on the well known asymptotic forms for low and large values of x for each function. It consists of multiplying each asymptotic form by a function that tends to unity or zero for low and large values of x. Simple formulae are suggested in this paper, depending on adjustable parameters. The latter have been determined by adopting the Levenberg-Marquardt algorithm. The proposed formulae should be of great utility and simplicity for computing spectral powers and the degree of polarization for synchrotron radiation, both for laboratory and astrophysical applications.

  20. Desirable design of hose fittings

    DEFF Research Database (Denmark)

    Voigt, Kristian

    1998-01-01

    This paper describes the primary functionality of a hose fitting. There has been made a discussion about the different parts of the hose assembly - the nipple, the hose and the outer compression parts. The last subject covered is which criteria should be put up for determining what is a good hose...... fittings. There has been made an uncompleted list of 'Voice of Customer' to this respect. Observations and interviews in industry should expand this list....

  1. The 'fitting problem' in cosmology

    International Nuclear Information System (INIS)

    Ellis, G.F.R.; Stoeger, W.

    1987-01-01

    The paper considers the best way to fit an idealised exactly homogeneous and isotropic universe model to a realistic ('lumpy') universe; whether made explicit or not, some such approach of necessity underlies the use of the standard Robertson-Walker models as models of the real universe. Approaches based on averaging, normal coordinates and null data are presented, the latter offering the best opportunity to relate the fitting procedure to data obtainable by astronomical observations. (author)

  2. Will Nintendo "Wii Fit" Get You Fit? An Evaluation of the Energy Expenditure from Active-Play Videogames.

    Science.gov (United States)

    Xian, Ying; Kakinami, Lisa; Peterson, Eric D; Mustian, Karen M; Fernandez, I Diana

    2014-04-01

    This study aimed to determine whether Nintendo(®) (Redmond, WA) "Wii Fit™" games can help individuals meet physical activity recommendations. Thirty young healthy volunteers were recruited for this randomized crossover study to evaluate the energy expenditure associated with (1) a 30-minute "Wii Fit Free Run," (2) three 10-minute bouts of "Wii Fit" aerobic games ("Rhythm Boxing," "Super Hula Hoop," and "Advanced Steps"), and (3) 30-minute treadmill running/walking. Energy expenditure was measured by indirect calorimetry using breath-by-breath analyses of O2 consumption and CO2 production. The "Wii Fit" conditions produced a moderate exercise intensity (5.0, 4.1, 3.9, and 3.8 metabolic equivalents [METs] in "Free Run," "Rhythm Boxing," "Super Hula Hoop," and "Advanced Steps"), whereas the treadmill running/walking produced a vigorous exercise intensity (METs=8.0). Based on federal guidelines, an individual could achieve the minimum weekly goal of 500 MET-minutes by playing selected "Wii Fit" aerobics games for 20-26 minutes a day, 5 days a week. Although not as vigorous as the treadmill, active-play videogames such as "Wii Fit" may provide an alternative way to encourage exercise and increase adoption and adherence to the physical activity guidelines.

  3. Recurrent loss of sex is associated with accumulation of deleterious mutations in Oenothera.

    Science.gov (United States)

    Hollister, Jesse D; Greiner, Stephan; Wang, Wei; Wang, Jun; Zhang, Yong; Wong, Gane Ka-Shu; Wright, Stephen I; Johnson, Marc T J

    2015-04-01

    Sexual reproduction is nearly universal among eukaryotes. Theory predicts that the rarity of asexual eukaryotic species is in part caused by accumulation of deleterious mutations and heightened extinction risk associated with suppressed recombination and segregation in asexual species. We tested this prediction with a large data set of 62 transcriptomes from 29 species in the plant genus Oenothera, spanning ten independent transitions between sexual and a functionally asexual genetic system called permanent translocation heterozygosity. Illumina short-read sequencing and de novo transcript assembly yielded an average of 16.4 Mb of sequence per individual. Here, we show that functionally asexual species accumulate more deleterious mutations than sexual species using both population genomic and phylogenetic analysis. At an individual level, asexual species exhibited 1.8 × higher heterozygosity than sexual species. Within species, we detected a higher proportion of nonsynonymous polymorphism relative to synonymous variation within asexual compared with sexual species, indicating reduced efficacy of purifying selection. Asexual species also exhibited a greater proportion of transcripts with premature stop codons. The increased proportion of nonsynonymous mutations was also positively correlated with divergence time between sexual and asexual species, consistent with Muller's ratchet. Between species, we detected repeated increases in the ratio of nonsynonymous to synonymous divergence in asexual species compared with sexually reproducing sister taxa, indicating increased accumulation of deleterious mutations. These results confirm that an important advantage of sex is that it facilitates selection against deleterious alleles, which might help to explain the dearth of extant asexual species. © The Author 2014. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  4. Performance studies of GooFit on GPUs vs RooFit on CPUs while estimating the statistical significance of a new physical signal

    Science.gov (United States)

    Di Florio, Adriano

    2017-10-01

    In order to test the computing capabilities of GPUs with respect to traditional CPU cores a high-statistics toy Monte Carlo technique has been implemented both in ROOT/RooFit and GooFit frameworks with the purpose to estimate the statistical significance of the structure observed by CMS close to the kinematical boundary of the J/ψϕ invariant mass in the three-body decay B + → J/ψϕK +. GooFit is a data analysis open tool under development that interfaces ROOT/RooFit to CUDA platform on nVidia GPU. The optimized GooFit application running on GPUs hosted by servers in the Bari Tier2 provides striking speed-up performances with respect to the RooFit application parallelised on multiple CPUs by means of PROOF-Lite tool. The considerable resulting speed-up, evident when comparing concurrent GooFit processes allowed by CUDA Multi Process Service and a RooFit/PROOF-Lite process with multiple CPU workers, is presented and discussed in detail. By means of GooFit it has also been possible to explore the behaviour of a likelihood ratio test statistic in different situations in which the Wilks Theorem may or may not apply because its regularity conditions are not satisfied.

  5. Experimental Rugged Fitness Landscape in Protein Sequence Space

    Science.gov (United States)

    Hayashi, Yuuki; Aita, Takuyo; Toyota, Hitoshi; Husimi, Yuzuru; Urabe, Itaru; Yomo, Tetsuya

    2006-01-01

    The fitness landscape in sequence space determines the process of biomolecular evolution. To plot the fitness landscape of protein function, we carried out in vitro molecular evolution beginning with a defective fd phage carrying a random polypeptide of 139 amino acids in place of the g3p minor coat protein D2 domain, which is essential for phage infection. After 20 cycles of random substitution at sites 12–130 of the initial random polypeptide and selection for infectivity, the selected phage showed a 1.7×104-fold increase in infectivity, defined as the number of infected cells per ml of phage suspension. Fitness was defined as the logarithm of infectivity, and we analyzed (1) the dependence of stationary fitness on library size, which increased gradually, and (2) the time course of changes in fitness in transitional phases, based on an original theory regarding the evolutionary dynamics in Kauffman's n-k fitness landscape model. In the landscape model, single mutations at single sites among n sites affect the contribution of k other sites to fitness. Based on the results of these analyses, k was estimated to be 18–24. According to the estimated parameters, the landscape was plotted as a smooth surface up to a relative fitness of 0.4 of the global peak, whereas the landscape had a highly rugged surface with many local peaks above this relative fitness value. Based on the landscapes of these two different surfaces, it appears possible for adaptive walks with only random substitutions to climb with relative ease up to the middle region of the fitness landscape from any primordial or random sequence, whereas an enormous range of sequence diversity is required to climb further up the rugged surface above the middle region. PMID:17183728

  6. Experimental rugged fitness landscape in protein sequence space.

    Science.gov (United States)

    Hayashi, Yuuki; Aita, Takuyo; Toyota, Hitoshi; Husimi, Yuzuru; Urabe, Itaru; Yomo, Tetsuya

    2006-12-20

    The fitness landscape in sequence space determines the process of biomolecular evolution. To plot the fitness landscape of protein function, we carried out in vitro molecular evolution beginning with a defective fd phage carrying a random polypeptide of 139 amino acids in place of the g3p minor coat protein D2 domain, which is essential for phage infection. After 20 cycles of random substitution at sites 12-130 of the initial random polypeptide and selection for infectivity, the selected phage showed a 1.7x10(4)-fold increase in infectivity, defined as the number of infected cells per ml of phage suspension. Fitness was defined as the logarithm of infectivity, and we analyzed (1) the dependence of stationary fitness on library size, which increased gradually, and (2) the time course of changes in fitness in transitional phases, based on an original theory regarding the evolutionary dynamics in Kauffman's n-k fitness landscape model. In the landscape model, single mutations at single sites among n sites affect the contribution of k other sites to fitness. Based on the results of these analyses, k was estimated to be 18-24. According to the estimated parameters, the landscape was plotted as a smooth surface up to a relative fitness of 0.4 of the global peak, whereas the landscape had a highly rugged surface with many local peaks above this relative fitness value. Based on the landscapes of these two different surfaces, it appears possible for adaptive walks with only random substitutions to climb with relative ease up to the middle region of the fitness landscape from any primordial or random sequence, whereas an enormous range of sequence diversity is required to climb further up the rugged surface above the middle region.

  7. Experimental rugged fitness landscape in protein sequence space.

    Directory of Open Access Journals (Sweden)

    Yuuki Hayashi

    Full Text Available The fitness landscape in sequence space determines the process of biomolecular evolution. To plot the fitness landscape of protein function, we carried out in vitro molecular evolution beginning with a defective fd phage carrying a random polypeptide of 139 amino acids in place of the g3p minor coat protein D2 domain, which is essential for phage infection. After 20 cycles of random substitution at sites 12-130 of the initial random polypeptide and selection for infectivity, the selected phage showed a 1.7x10(4-fold increase in infectivity, defined as the number of infected cells per ml of phage suspension. Fitness was defined as the logarithm of infectivity, and we analyzed (1 the dependence of stationary fitness on library size, which increased gradually, and (2 the time course of changes in fitness in transitional phases, based on an original theory regarding the evolutionary dynamics in Kauffman's n-k fitness landscape model. In the landscape model, single mutations at single sites among n sites affect the contribution of k other sites to fitness. Based on the results of these analyses, k was estimated to be 18-24. According to the estimated parameters, the landscape was plotted as a smooth surface up to a relative fitness of 0.4 of the global peak, whereas the landscape had a highly rugged surface with many local peaks above this relative fitness value. Based on the landscapes of these two different surfaces, it appears possible for adaptive walks with only random substitutions to climb with relative ease up to the middle region of the fitness landscape from any primordial or random sequence, whereas an enormous range of sequence diversity is required to climb further up the rugged surface above the middle region.

  8. The Redox Cycler Plasmodione Is a Fast-Acting Antimalarial Lead Compound with Pronounced Activity against Sexual and Early Asexual Blood-Stage Parasites.

    Science.gov (United States)

    Ehrhardt, Katharina; Deregnaucourt, Christiane; Goetz, Alice-Anne; Tzanova, Tzvetomira; Gallo, Valentina; Arese, Paolo; Pradines, Bruno; Adjalley, Sophie H; Bagrel, Denyse; Blandin, Stephanie; Lanzer, Michael; Davioud-Charvet, Elisabeth

    2016-09-01

    Previously, we presented the chemical design of a promising series of antimalarial agents, 3-[substituted-benzyl]-menadiones, with potent in vitro and in vivo activities. Ongoing studies on the mode of action of antimalarial 3-[substituted-benzyl]-menadiones revealed that these agents disturb the redox balance of the parasitized erythrocyte by acting as redox cyclers-a strategy that is broadly recognized for the development of new antimalarial agents. Here we report a detailed parasitological characterization of the in vitro activity profile of the lead compound 3-[4-(trifluoromethyl)benzyl]-menadione 1c (henceforth called plasmodione) against intraerythrocytic stages of the human malaria parasite Plasmodium falciparum We show that plasmodione acts rapidly against asexual blood stages, thereby disrupting the clinically relevant intraerythrocytic life cycle of the parasite, and furthermore has potent activity against early gametocytes. The lead's antiplasmodial activity was unaffected by the most common mechanisms of resistance to clinically used antimalarials. Moreover, plasmodione has a low potential to induce drug resistance and a high killing speed, as observed by culturing parasites under continuous drug pressure. Drug interactions with licensed antimalarial drugs were also established using the fixed-ratio isobologram method. Initial toxicological profiling suggests that plasmodione is a safe agent for possible human use. Our studies identify plasmodione as a promising antimalarial lead compound and strongly support the future development of redox-active benzylmenadiones as antimalarial agents. Copyright © 2016, American Society for Microbiology. All Rights Reserved.

  9. An Epidemiological Profile of CrossFit Athletes in Brazil

    OpenAIRE

    Sprey, Jan W.C.; Ferreira, Thiago; de Lima, Marcos V.; Duarte, Aires; Jorge, Pedro B.; Santili, Claudio

    2016-01-01

    Background: CrossFit is a conditioning and training program that has been gaining recognition and interest among the physically active population. Approximately 440 certified and registered CrossFit fitness centers and gyms exist in Brazil, with approximately 40,000 athletes. To date, there have been no epidemiological studies about the CrossFit athlete in Brazil. Purpose: To evaluate the profile, sports history, training routine, and presence of injuries among athletes of CrossFit. Study Des...

  10. White Paper AGA: An Episode-of-Care Framework for the Management of Obesity-Moving Toward High Value, High Quality Care: A Report From the American Gastroenterological Association Institute Obesity Episode of Care and Bundle Initiative Work Group.

    Science.gov (United States)

    Brill, Joel V; Ashmore, Jamile A; Brengman, Matthew L; Buffington, Daniel E; Feldshon, S David; Friedman, Kelli E; Margolis, Peter S; Markus, Danielle; Narramore, Leslie; Rastogi, Amita; Starpoli, Anthony A; Strople, Kenneth; White, Jane V; Streett, Sarah E

    2017-05-01

    The American Gastroenterological Association acknowledges the need for gastroenterologists to participate in and provide value-based care for both cognitive and procedural conditions. Episodes of care are designed to engage specialists in the movement toward fee for value, while facilitating improved outcomes and patient experience and a reduction in unnecessary services and overall costs. The episode of care model puts the patient at the center of all activity related to their particular diagnosis, procedure, or health care event, rather than on a physician's specific services. It encourages and incents communication, collaboration, and coordination across the full continuum of care and creates accountability for the patient's entire experience and outcome. This paper outlines a collaborative approach involving multiple stakeholders for gastrointestinal practices to assess their ability to participate in and implement an episode of care for obesity and understand the essentials of coding and billing for these services. Copyright © 2017 AGA Institute. Published by Elsevier Inc. All rights reserved.

  11. HDFITS: Porting the FITS data model to HDF5

    Science.gov (United States)

    Price, D. C.; Barsdell, B. R.; Greenhill, L. J.

    2015-09-01

    The FITS (Flexible Image Transport System) data format has been the de facto data format for astronomy-related data products since its inception in the late 1970s. While the FITS file format is widely supported, it lacks many of the features of more modern data serialization, such as the Hierarchical Data Format (HDF5). The HDF5 file format offers considerable advantages over FITS, such as improved I/O speed and compression, but has yet to gain widespread adoption within astronomy. One of the major holdbacks is that HDF5 is not well supported by data reduction software packages and image viewers. Here, we present a comparison of FITS and HDF5 as a format for storage of astronomy datasets. We show that the underlying data model of FITS can be ported to HDF5 in a straightforward manner, and that by doing so the advantages of the HDF5 file format can be leveraged immediately. In addition, we present a software tool, fits2hdf, for converting between FITS and a new 'HDFITS' format, where data are stored in HDF5 in a FITS-like manner. We show that HDFITS allows faster reading of data (up to 100x of FITS in some use cases), and improved compression (higher compression ratios and higher throughput). Finally, we show that by only changing the import lines in Python-based FITS utilities, HDFITS formatted data can be presented transparently as an in-memory FITS equivalent.

  12. Fractal Image Coding Based on a Fitting Surface

    Directory of Open Access Journals (Sweden)

    Sheng Bi

    2014-01-01

    Full Text Available A no-search fractal image coding method based on a fitting surface is proposed. In our research, an improved gray-level transform with a fitting surface is introduced. One advantage of this method is that the fitting surface is used for both the range and domain blocks and one set of parameters can be saved. Another advantage is that the fitting surface can approximate the range and domain blocks better than the previous fitting planes; this can result in smaller block matching errors and better decoded image quality. Since the no-search and quadtree techniques are adopted, smaller matching errors also imply less number of blocks matching which results in a faster encoding process. Moreover, by combining all the fitting surfaces, a fitting surface image (FSI is also proposed to speed up the fractal decoding. Experiments show that our proposed method can yield superior performance over the other three methods. Relative to range-averaged image, FSI can provide faster fractal decoding process. Finally, by combining the proposed fractal coding method with JPEG, a hybrid coding method is designed which can provide higher PSNR than JPEG while maintaining the same Bpp.

  13. Compact fitting formulas for electron-impact cross sections

    International Nuclear Information System (INIS)

    Kim, Y.K.

    1992-01-01

    Compact fitting formulas, which contain four fitting constants, are presented for electron-impact excitation and ionization cross sections of atoms and ions. These formulas can fit experimental and theoretical cross sections remarkably well, when resonant structures are smoothed out, from threshold to high incident electron energies (<10 keV), beyond which relativistic formulas are more appropriate. Examples of fitted cross sections for some atoms and ions are presented. The basic form of the formula is valid for both atoms and molecules

  14. ORF Alignment: NC_002678 [GENIUS II[Archive

    Lifescience Database Archive (English)

    Full Text Available NC_002678 gi|13475854 >1el5A 4 378 18 430 4e-33 ... ref|NP_107424.1| agaE protein, conversion of agropini...c acid to mannopinic acid ... [Mesorhizobium loti MAFF303099] dbj|BAB53210.1| Aga

  15. ORF Alignment: NC_002679 [GENIUS II[Archive

    Lifescience Database Archive (English)

    Full Text Available NC_002679 gi|13488188 >1el5A 4 377 26 437 3e-36 ... ref|NP_085608.1| agaE(conversion of agropini...c acid to mannopinic acid) ... [Mesorhizobium loti MAFF303099] dbj|BAB54449.1| AgaE ...

  16. Improving NEC Fit

    Science.gov (United States)

    2015-09-01

    TAD Temporary Additional Duty TFMMS Total Force Manpower Management System UIC Unit Identification Code USFFC United States Fleet Forces Command...not include sailors on temporary additional duty ( TAD ). In addition, for class average Fit, we excluded units that had billets but no onboard

  17. Firefighter health and fitness assessment: a call to action.

    Science.gov (United States)

    Storer, Thomas W; Dolezal, Brett A; Abrazado, Marlon L; Smith, Denise L; Batalin, Maxim A; Tseng, Chi-Hong; Cooper, Christopher B

    2014-03-01

    Sudden cardiac deaths experienced by firefighters in the line of duty account for the largest proportion of deaths annually. Several fire service standards for fitness and wellness have been recommended but currently only 30% of U.S. fire departments are implementing programs for this purpose. The Department of Homeland Security Science and Technology Directorate has initiated the Physiological Health Assessment System for Emergency Responders (PHASER) program aiming to reduce these line-of-duty deaths through an integration of medical science and sensor technologies. Confirming previous reports, PHASER comprehensive risk assessment has identified lack of physical fitness with propensity for overexertion as a major modifiable risk factor. We sought to determine if current levels of fitness and cardiovascular disease (CVD) risk factors in a contemporary cohort of firefighters were better than those reported over the past 30 years. Fifty-one firefighters from a Southern California department were characterized for physical fitness and CVD risk factors using standard measures. Overall, physical fitness and risk factors were not different from previous reports of firefighter fitness and most subjects did not achieve recommended fitness standards. Considering the lack of widespread implementation of wellness/fitness programs in the U.S. fire service together with our findings that low physical fitness and the presence of CVD risk factors persist, we issue a call to action among health and fitness professionals to assist the fire service in implementing programs for firefighters that improve fitness and reduce CVD risk factors. Fitness professionals should be empowered to work with fire departments lending their expertise to guide programs that achieve these objectives, which may then lead to reduced incidence of sudden cardiac death or stroke.

  18. Public Participation and Institutional Fit: A Social-Psychological Perspective

    Directory of Open Access Journals (Sweden)

    Daniel A. DeCaro

    2013-12-01

    Full Text Available Public participation plays a role in the development and long-term maintenance of environmental institutions that are well-matched to local social-ecological conditions. However, the means by which public participation impacts such institutional fit remains unclear. We argue that one major reason for this lack of clarity is that analysts have not clearly outlined how humankind's sense of agency, or self-determination, influences institutional outcomes. Moreover, the concept of institutional fit is ambiguous as to what constitutes a good fit and how such fit could be diagnosed or improved. This is especially true for "social fit," or how well institutions match human expectations and local behavioral patterns. We develop an interdisciplinary framework based on principles of human agency and institutional analysis from social psychology to address these problems. Using the concept of "institutional acceptance" as an indicator of social fit, we show how analysts can define, diagnose, and improve social fit of participatory programs. We also show how such fit emerges and is sustained over time. This interdisciplinary perspective on fit and participation has important implications for participatory approaches to environmental management and the scientific study of institutional evolution.

  19. Wearable Android Android wear and Google Fit app development

    CERN Document Server

    Mishra, Sanjay M

    2015-01-01

    Software Development/Mobile/Android/Wearable/Fitness Build ""Wearable"" Applications on the Android Wear and Google Fit Platforms This book covers wearable computing and wearable application development particularly for Android Wear (smartwatches) and Google Fit (fitness sensors). It provides relevant history, background and core concepts of wearable computing and ubiquitous computing, as a foundation for designing/developing applications for the Android Wear and Google Fit platforms. This book is intended for Android wearable enthusiasts, technologists and software developers. Gain ins

  20. Marginal coral populations: the densest known aggregation of Pocillopora in the Galápagos Archipelago is of asexual origin

    Directory of Open Access Journals (Sweden)

    Iliana B Baums

    2014-11-01

    Full Text Available Coral populations at distributional margins frequently experience suboptimal and variable conditions. Recurrent El Niño-Southern Oscillation (ENSO warming events have caused extensive mortality of reef-building corals in the Eastern Pacific, and particularly impacted branching pocilloporid corals in the Galápagos Islands. Pocillopora spp. were previously more common and formed incipient reefs at several locations in the Archipelago but now occur as scattered colonies. Here, we report an unusually concentrated aggregation of colonies and evaluate their current genetic diversity. In particular we focus on a large population of 1614 live Pocillopora colonies found in a volcanic lagoon along the southern shore of Isabela Island. Forty seven colonies were sampled, primarily using a spatially explicit sampling design, and all colonies belonged to Pocillopora mitochondrial open reading frame lineage type 3a. Typing of additional Pocillopora samples (n = 40 from three other islands indicated that this stand is the only known representative of type 3a in the Galápagos Islands. The Isabela Pocillopora type 3a colonies harbored Symbiodinium ITS-2 clade C1d. Multilocus genotyping (n = 6 microsatellites capable of resolving individual clones indicated that this stand is monogenotypic and thus the high density of colonies is a result of asexual reproduction, likely via fragmentation. Colony size distribution, while imperfect, suggested the stand regrew from remnant colonies that survived the 1997/98 ENSO event but may postdate the 1982/83 ENSO. The community of Pocillopora colonies at Isabela is of particular ecological value due to its high density and support of associated organisms such as fish and benthic invertebrates. The Galapagos Pocillopora corals will continue to provide insights into the genetic structure and population dynamics of marginal coral populations.

  1. Understanding patient and physician perceptions of male androgenetic alopecia treatments in Asia-Pacific and Latin America.

    Science.gov (United States)

    Lulic, Zrinka; Inui, Shigeki; Sim, Woo-Young; Kang, Hoon; Choi, Gwang Seong; Hong, Woosung; Hatanaka, Toshiki; Wilson, Timothy; Manyak, Michael

    2017-08-01

    This survey aimed to explore patient and physician attitudes towards male androgenetic alopecia (AGA), satisfaction with currently available male AGA treatments and investigate the factors affecting treatment choice. The survey was carried out in five countries (Japan, South Korea, Taiwan, Mexico and Brazil) between November and December 2015 using a standard market research methodology. Questionnaires were completed by patients with male AGA or hair loss/thinning and practicing physicians who were responsible for prescribing AGA treatment. In total, 835 patients and 338 physicians completed the questionnaire. Overall, 37.6% of patients reported satisfaction with the treatments they had used. The highest patient satisfaction was reported for 5-alpha-reductase inhibitors (53.9% of patients satisfied). In all countries, physicians were more likely than patients to think that male AGA has a major impact on patient confidence (89.3% vs 70.4%, respectively). There was agreement by physicians and patients that male AGA patients who are involved in their treatment decisions have better outcomes. Patients who were satisfied with AGA treatments were more likely to have the level of involvement they desired in treatment decisions (69.1% of satisfied patients) than dissatisfied patients (56.4% of dissatisfied patients). This survey provides valuable insights into the attitudes of patients and physicians in Asia and Latin America about male AGA and its treatments. The survey identified areas of disconnect between physicians and patients regarding the impact of male AGA, treatment consultations and the importance of treatment attributes. It also highlights the need for physicians to spend sufficient time with patients discussing AGA treatment approaches. © 2017 GlaxoSmithKline. The Journal of Dermatology published by John Wiley & Sons Australia, Ltd on behalf of Japanese Dermatological Association.

  2. The fight against fitness doping in sports clubs

    DEFF Research Database (Denmark)

    Thualagant, Nicole; Pfister, Gertrud Ursula

    2012-01-01

    This article focuses on the anti-doping policies led in Danish fitness centers in a sport for all context. Fitness, an ever growing training form is gaining in popularity and has in this context been adopted as a training activity by DGI, one of the leading sports for all organization in Denmark....... As a result of this gain in popularity, fitness activities are not only offered in commercial fitness centers but also in fitness centers attached to sport for all clubs. This development has emancipated a focus on doping and thereby in the establishing of anti-doping policies in sport for all clubs. Denmark...... is one of the few countries who illegalizes doping in fitness centers and who tests its members for doping. This article contributes with a discussion concerning the challenges, DGI, as a sport for all organization encounters in relation to the anti-doping policies and its objectives of fostering health...

  3. Constraints, Trade-offs and the Currency of Fitness.

    Science.gov (United States)

    Acerenza, Luis

    2016-03-01

    Understanding evolutionary trajectories remains a difficult task. This is because natural evolutionary processes are simultaneously affected by various types of constraints acting at the different levels of biological organization. Of particular importance are constraints where correlated changes occur in opposite directions, called trade-offs. Here we review and classify the main evolutionary constraints and trade-offs, operating at all levels of trait hierarchy. Special attention is given to life history trade-offs and the conflict between the survival and reproduction components of fitness. Cellular mechanisms underlying fitness trade-offs are described. At the metabolic level, a linear trade-off between growth and flux variability was found, employing bacterial genome-scale metabolic reconstructions. Its analysis indicates that flux variability can be considered as the currency of fitness. This currency is used for fitness transfer between fitness components during adaptations. Finally, a discussion is made regarding the constraints which limit the increase in the amount of fitness currency during evolution, suggesting that occupancy constraints are probably the main restrictions.

  4. Students’ motivation to fitness classes at technical university

    Directory of Open Access Journals (Sweden)

    E.P. Balitskaya

    2013-06-01

    Full Text Available The aim of the study is to determine the motives of students to fitness classes at technical university. The results of the survey of students I - II courses motivation for fitness classes in physical education. The survey involved 182 students (173 girls and 9 boys of technical faculties. Found that most of the students have been studying fitness for entry the university. The main motivation for fitness training is to increase the level of physical fitness and self-confidence, as well as the development of special vocational important physical qualities, which in the future will contribute to the professional activities of the students. It is shown that universities are engaged in fitness in 13.82% of the students. Swimming is the clear leader - 18.37% and athletic gymnastics - 17.19%. Also popular are sports games - 26.77% (football, basketball, volleyball, tennis. Also are visited sections in gymnastics, wrestling, boxing, and tourism.

  5. Improving the fitness and physical activity levels of primary school children: results of the Fit-4-Fun group randomized controlled trial.

    Science.gov (United States)

    Eather, Narelle; Morgan, Philip J; Lubans, David R

    2013-01-01

    To evaluate the impact of a multi-component school-based physical activity intervention (Fit-4-Fun) on health-related fitness and objectively measured physical activity in primary school children. Four Hunter primary schools were recruited in April, 2011 and randomized by school into treatment or control conditions. Participants included 213 children (mean age = 10.72 years ± 0.6; 52.2% female) with the treatment group (n = 118) completing the 8-week Fit-4-Fun Program. Participants were assessed at baseline and 6-month follow-up, with a 91% retention rate. Cardio-respiratory fitness (CRF) (20 m shuttle run) was the primary outcome, and secondary outcomes included body composition (BMI, BMI(Z)), muscular fitness (7-stage sit-up test, push-up test, basketball throw test, Standing Jump), flexibility (sit and reach) and physical activity (7 days pedometry). After 6-months, significant treatment effects were found for CRF (adjusted mean difference, 1.14 levels, p < 0.001), body composition (BMI mean, -0.96 kg/m(2), p < 0.001 and BMI z-score mean -0.47 z-scores, p < 0.001), flexibility (sit and reach mean, 1.52 cm, p = 0.0013), muscular fitness (sit-ups) (mean 0.62 stages, p = 0.003) and physical activity (mean, 3253 steps/day, p < 0.001). There were no group by time effects for the other muscular fitness measures. A primary school-based intervention focusing on fitness education significantly improved health-related fitness and physical activity levels in children. Copyright © 2012 Elsevier Inc. All rights reserved.

  6. The congruence between actual and perceived person-organization fit

    NARCIS (Netherlands)

    van Vuuren, Hubrecht A.; Veldkamp, Bernard P.; de Jong, Menno D.T.; Seydel, E.R.

    2007-01-01

    Person-organization fit (P-O fit) is an important and often-researched variable, which sheds light on the way employees perceive their relationship with the organization they work for. In this study, two different assessments of P-O fit are compared, i.e. actual fit (an indirect measurement based on

  7. 49 CFR 192.191 - Design pressure of plastic fittings.

    Science.gov (United States)

    2010-10-01

    ... 49 Transportation 3 2010-10-01 2010-10-01 false Design pressure of plastic fittings. 192.191... Components § 192.191 Design pressure of plastic fittings. (a) Thermosetting fittings for plastic pipe must conform to ASTM D 2517, (incorporated by reference, see § 192.7). (b) Thermoplastic fittings for plastic...

  8. Health-Related Fitness and Young Children.

    Science.gov (United States)

    Gabbard, Carl; LeBlanc, Betty

    Because research indicates that American youth have become fatter since the 1960's, the development of fitness among young children should not be left to chance. Simple games, rhythms, and dance are not sufficient to insure fitness, for, during the regular free play situation, children very seldom experience physical activity of enough intensity…

  9. Effect of test exercises and mask donning on measured respirator fit.

    Science.gov (United States)

    Crutchfield, C D; Fairbank, E O; Greenstein, S L

    1999-12-01

    Quantitative respirator fit test protocols are typically defined by a series of fit test exercises. A rationale for the protocols that have been developed is generally not available. There also is little information available that describes the effect or effectiveness of the fit test exercises currently specified in respiratory protection standards. This study was designed to assess the relative impact of fit test exercises and mask donning on respirator fit as measured by a controlled negative pressure and an ambient aerosol fit test system. Multiple donnings of two different sizes of identical respirator models by each of 14 test subjects showed that donning affects respirator fit to a greater degree than fit test exercises. Currently specified fit test protocols emphasize test exercises, and the determination of fit is based on a single mask donning. A rationale for a modified fit test protocol based on fewer, more targeted test exercises and multiple mask donnings is presented. The modified protocol identified inadequately fitting respirators as effectively as the currently specified Occupational Safety and Health Administration (OSHA) quantitative fit test protocol. The controlled negative pressure system measured significantly (p < 0.0001) more respirator leakage than the ambient aerosol fit test system. The bend over fit test exercise was found to be predictive of poor respirator fit by both fit test systems. For the better fitting respirators, only the talking exercise generated aerosol fit factors that were significantly lower (p < 0.0001) than corresponding donning fit factors.

  10. Effects of cardiorespiratory fitness and weight status on knowledge of physical activity and fitness, attitude toward physical education, and physical activity.

    Science.gov (United States)

    Chen, Senlin; Gu, Xiangli

    2018-02-20

    The purpose of this study was to examine the effects of cardiorespiratory fitness and weight status on knowledge of physical activity and fitness (PAF knowledge), attitude toward physical education (PE), and physical activity. A total of 343 middle school students participated in the study (Age: M/SD = 12.76/.94, ranging from 11 to 14 years old). PE Metrics™ was used to measure PAF knowledge, and Attitude toward Physical Education Questionnaire and Youth Activity Profile were used to measure attitude, physical activity and sedentary behavior. Fitness and weight status were assessed using FitnessGram and converted to in Healthy Fitness Zone (HFZ) or Not in HFZ. Two-way multivariate analyses of covariance (MANCOVA; gender and grade as covariates) showed a significant group effect for cardiorespiratory fitness (Λ Pilla  = .07, F 4,255  = 5.03, p = .001, [Formula: see text] = .07) but not for weight status (p = .57). PAF knowledge (F 1,258  = 9.49, p fitness in middle school PE as students acquire attitude, knowledge, and behaviors needed for active-living.

  11. Classification and methodical features of fitness and wellness facilities

    Directory of Open Access Journals (Sweden)

    Yu. I. Beliak

    2014-11-01

    Full Text Available Purpose : health and fitness use a large arsenal of different sports and physical activity. Development of fitness industry promotes its expansion and requires classification and methodological features that lead to the use of appropriate fitness programs. Material : more than 60 literature and video of 42 prestigious international fitness - conventions lessons were analyzed. Results : the evolution of species fitness and wellness, as well as the character used in those funds. Conclusions : as a means of improving classification attribute fitness appropriate to use their orientation, according to which they are divided into aerobic, strength exercises that promote flexibility and psychomotor coordination. The main methodological features fitness facilities are highlighted: the variety and interchangeability, clear regulation, the ability to transform, to exercise a selective effect on the body, the ability to solve a wide range of tasks, innovation.

  12. Physical Fitness and Self-Image: An Evaluation of the Exercise Self-Schema Questionnaire Using Direct Measures of Physical Fitness.

    Science.gov (United States)

    Thomas, Jafra D; Vanness, J Mark; Cardinal, Bradley J

    2016-01-01

    The purpose of this study was to perform a construct validity assessment of Kendzierski's exercise self-schema theory questionnaire using objective measures of health-related physical fitness. This study tested the hypothesis that individuals with an exercise self-schema would possess significantly greater physical fitness than those who did not across three domains of health-related physical fitness: Body composition, cardiovascular fitness, and upper-body muscular endurance. Undergraduate student participants from one private university on the west coast of the United States completed informed consent forms and the exercise self-schema questionnaire within a classroom setting or at an on-campus outside tabling session. Participants not meeting inclusion criteria for Kendzierski's three original schema groups were categorized as "unschematic," and were included within MANCOVA/ANCOVA analyses, where gender served as the covariate. Participants underwent lab-based fitness assessments administered in accordance with the 2013 American College of Sports Medicine Guidelines for Exercise Testing and Prescription. The hypothesis of this study was partially supported. Specifically, exerciser schematics were significantly leaner than aschematics (p = .002) and they had greater levels of upper-body muscular endurance compared to both aschematic and nonexerciser schematics (p = .002). However, no differences were observed for cardiovascular fitness (i.e., predicted V02Max p = .410). The findings of this study help to establish the construct validity of Kendizerski's self-report exercise self-schema categorization scheme. Visual inspection of the data, as well as computed effect size measures suggest exercise self-schema is associated with dimensions of one's physical fitness.

  13. Generation of an antibody that recognizes Plasmodium chabaudi cysteine protease (chabaupain-1) in both sexual and asexual parasite life cycle and evaluation of chabaupain-1 vaccine potential.

    Science.gov (United States)

    Armada, Ana; Gazarini, Marcos L; Gonçalves, Lídia M; Antunes, Sandra; Custódio, Ana; Rodrigues, Armanda; Almeida, António J; Silveira, Henrique; Rosário, Virgílio do; Santos-Gomes, Gabriela; Domingos, Ana

    2013-09-01

    Malaria cysteine proteases have been shown to be immunogenic and are being exploited as serodiagnostic markers, drug and vaccine targets. Several Plasmodium spp. cysteine proteases have been described and the best characterized of these are the falcipains, a family of papain-family enzymes. Falcipain-2 and falcipain-3 act in concert with other proteases to hydrolyze host erythrocyte hemoglobin in the parasite food vacuole. Falcipain-1 has less similarity to the other falcipains and its physiological role in parasite asexual blood stage still remains uncertain. Immunolocalization studies using an antibody developed against the Plasmodium chabaudi recombinant chabaupain-1, the falcipain-1 ortholog, were performed confirming its cellular localization in both erythrocyte and mosquito ookinete stage. Immunostaining of chabaupain-1 preferentially in apical portion of parasite ookinete suggests that this protease may be related with parasite egression from mosquito midgut. Immune responses to chabaupain-1 were evaluated using two different adjuvants, chitosan nanoparticles and hydroxide aluminum. Mice immunized with the recombinant protein alone or in association with nanoparticles were challenged with P. chabaudi showing that immunization with the recombinant protein confers partial protection to blood stage infection in BALB/c animal model. Copyright © 2013 Elsevier Inc. All rights reserved.

  14. Evaluating Suit Fit Using Performance Degradation

    Science.gov (United States)

    Margerum, Sarah E.; Cowley, Matthew; Harvill, Lauren; Benson, Elizabeth; Rajulu, Sudhakar

    2011-01-01

    The Mark III suit has multiple sizes of suit components (arm, leg, and gloves) as well as sizing inserts to tailor the fit of the suit to an individual. This study sought to determine a way to identify the point an ideal suit fit transforms into a bad fit and how to quantify this breakdown using mobility-based physical performance data. This study examined the changes in human physical performance via degradation of the elbow and wrist range of motion of the planetary suit prototype (Mark III) with respect to changes in sizing and as well as how to apply that knowledge to suit sizing options and improvements in suit fit. The methods implemented in this study focused on changes in elbow and wrist mobility due to incremental suit sizing modifications. This incremental sizing was within a range that included both optimum and poor fit. Suited range of motion data was collected using a motion analysis system for nine isolated and functional tasks encompassing the elbow and wrist joints. A total of four subjects were tested with motions involving both arms simultaneously as well as the right arm only. The results were then compared across sizing configurations. The results of this study indicate that range of motion may be used as a viable parameter to quantify at what stage suit sizing causes a detriment in performance; however the human performance decrement appeared to be based on the interaction of multiple joints along a limb, not a single joint angle. The study was able to identify a preliminary method to quantify the impact of size on performance and to develop a means to gauge tolerances around optimal size. More work is needed to improve the assessment of optimal fit and to compensate for multiple joint interactions.

  15. The Many Null Distributions of Person Fit Indices.

    Science.gov (United States)

    Molenaar, Ivo W.; Hoijtink, Herbert

    1990-01-01

    Statistical properties of person fit indices are reviewed as indicators of the extent to which a person's score pattern is in agreement with a measurement model. Distribution of a fit index and ability-free fit evaluation are discussed. The null distribution was simulated for a test of 20 items. (SLD)

  16. 30 CFR 56.19057 - Hoist operator's physical fitness.

    Science.gov (United States)

    2010-07-01

    ... 30 Mineral Resources 1 2010-07-01 2010-07-01 false Hoist operator's physical fitness. 56.19057... Hoisting Hoisting Procedures § 56.19057 Hoist operator's physical fitness. No person shall operate a hoist... who shall certify his fitness to perform this duty. Such certification shall be available at the mine. ...

  17. 30 CFR 57.19057 - Hoist operator's physical fitness.

    Science.gov (United States)

    2010-07-01

    ... 30 Mineral Resources 1 2010-07-01 2010-07-01 false Hoist operator's physical fitness. 57.19057... Hoisting Hoisting Procedures § 57.19057 Hoist operator's physical fitness. No person shall operate a hoist... who shall certify his fitness to perform this duty. Such certification shall be available at the mine. ...

  18. Tailored Fitness: Culture Clash in the Quest for Combat-Fit Airmen

    Science.gov (United States)

    2014-06-01

    standardized number of failures for discharge recommendation, established a Fitness Assessment Cell (FAC) to centralize and standardize the...of the mental and physical stamina challenges of flying, but does so within a climate-controlled room with less physiological stress. This is not

  19. Physical Fitness in Young Adults Born Preterm.

    Science.gov (United States)

    Tikanmäki, Marjaana; Tammelin, Tuija; Sipola-Leppänen, Marika; Kaseva, Nina; Matinolli, Hanna-Maria; Miettola, Satu; Eriksson, Johan G; Järvelin, Marjo-Riitta; Vääräsmäki, Marja; Kajantie, Eero

    2016-01-01

    Young adults born preterm have higher levels of cardiometabolic risk factors than their term-born peers. Muscular and cardiorespiratory fitness have important cardiometabolic and other health benefits. We assessed muscular, cardiorespiratory, and self-rated fitness in preterm-born young adults. We studied unimpaired participants of the ESTER (Ennenaikainen syntymä ja aikuisiän terveys [Preterm Birth and Early-Life Programming of Adult Health and Disease]) birth cohort study at age 23.3 (SD: 1.2) years: 139 born early preterm (EPT; Young adults born EPT (-0.8; 95% confidence interval: -1.5 to -0.1; adjusted for gender, age, and source cohort) and LPT (-0.8; -1.4 to -0.3) performed fewer modified push-ups than controls. Handgrip strength was 23.8 (0.9-46.8) N lower in EPT participants. Cardiorespiratory fitness, measured by submaximal step test, was similar. On a self-rated fitness scale (1-5), the EPT adults reported 0.2 (0.0-0.4) lower scores than controls. After adjustment for early-life confounders, the results remained. They attenuated after further adjustment for mediating factors. Young adults born EPT and LPT had lower muscular fitness than controls, which may predispose them to cardiometabolic and other chronic diseases. Adults born EPT also perceived themselves as less fit than controls. Copyright © 2016 by the American Academy of Pediatrics.

  20. Physical Activity Enhances Metabolic Fitness Independently of Cardiorespiratory Fitness in Marathon Runners

    Directory of Open Access Journals (Sweden)

    M. J. Laye

    2015-01-01

    Full Text Available High levels of cardiovascular fitness (CRF and physical activity (PA are associated with decreased mortality and risk to develop metabolic diseases. The independent contributions of CRF and PA to metabolic disease risk factors are unknown. We tested the hypothesis that runners who run consistently >50 km/wk and/or >2 marathons/yr for the last 5 years have superior metabolic fitness compared to matched sedentary subjects (CRF, age, gender, and BMI. Case-control recruitment of 31 pairs of runner-sedentary subjects identified 10 matched pairs with similar VO2max (mL/min/kg (similar-VO2max. The similar-VO2max group was compared with a group of age, gender, and BMI matched pairs who had the largest difference in VO2max (different-VO2max. Primary outcomes that defined metabolic fitness including insulin response to an oral glucose tolerance test, fasting lipids, and fasting insulin were superior in runners versus sedentary controls despite similar VO2max. Furthermore, performance (velocity at VO2max, running economy, improved exercise metabolism (lactate threshold, and skeletal muscle levels of mitochondrial proteins were superior in runners versus sedentary controls with similar VO2max. In conclusion subjects with a high amount of PA have more positive metabolic health parameters independent of CRF. PA is thus a good marker against metabolic diseases.

  1. N-acetylgalatosamine-Mediated Regulation of the aga Operon by AgaR in Streptococcus pneumoniae

    NARCIS (Netherlands)

    Afzal, Muhammad; Shafeeq, Sulman; Ahmed, Hifza; Kuipers, Oscar P

    2016-01-01

    Here, we analyze the transcriptomic response of Streptococcus pneumoniae D39 to N-acetylgalactosamine (NAGa). Transcriptome comparison of S. pneumoniae D39 grown in NAGaM17 (0.5% NAGa + M17) to that grown in GM17 (0.5% Glucose + M17) revealed the elevated expression of various carbon metabolic

  2. Exercise videogames for physical activity and fitness: Design and rationale of the Wii Heart Fitness trial.

    Science.gov (United States)

    Bock, Beth C; Thind, Herpreet; Dunsiger, Shira I; Serber, Eva R; Ciccolo, Joseph T; Cobb, Victoria; Palmer, Kathy; Abernathy, Sean; Marcus, Bess H

    2015-05-01

    Despite numerous health benefits, less than half of American adults engage in regular physical activity. Exercise videogames (EVG) may be a practical and attractive alternative to traditional forms of exercise. However there is insufficient research to determine whether EVG play alone is sufficient to produce prolonged engagement in physical activity or improvements in cardiovascular fitness and overall health risk. The goal of the present study is to test the efficacy of exercise videogames to increase time spent in moderate to vigorous physical activity (MVPA) and to improve cardiovascular risk indices among adults. Wii Heart Fitness is a rigorous 3-arm randomized controlled trial with adults comparing three 12-week programs: (1) supervised EVGs, (2) supervised standard exercise, and (3) a control condition. Heart rate is monitored continuously throughout all exercise sessions. Assessments are conducted at baseline, end of intervention (week 12), 6 and 9 months. The primary outcome is time spent in MVPA physical activity. Secondary outcomes include changes in cardiovascular fitness, body composition, blood lipid profiles and maintenance of physical activity through six months post-treatment. Changes in cognitive and affective constructs derived from Self Determination and Social Cognitive Theories will be examined to explain the differential outcomes between the two active treatment conditions. The Wii Heart Fitness study is designed to test whether regular participation in EVGs can be an adequate source of physical activity for adults. This study will produce new data on the effect of EVGs on cardiovascular fitness indices and prolonged engagement with physical activity. Copyright © 2015 Elsevier Inc. All rights reserved.

  3. An Apomixis-Gene’s View on Dandelions

    NARCIS (Netherlands)

    Dijk, van P.; Jong, de J.H.S.G.M.; Vijverberg, K.; Biere, A.

    2009-01-01

    In asexual organisms, the clone constitutes a level above the individual. Most dandelions (Taraxacum officinale s.l.) reproduce asexually through apomixis, asexual reproduction through seeds. A clone can be seen as a superorganism that is born, that growths, degenerates and eventually dies. Apomixis

  4. RATES OF FITNESS DECLINE AND REBOUND SUGGEST PERVASIVE EPISTASIS

    Science.gov (United States)

    Perfeito, L; Sousa, A; Bataillon, T; Gordo, I

    2014-01-01

    Unraveling the factors that determine the rate of adaptation is a major question in evolutionary biology. One key parameter is the effect of a new mutation on fitness, which invariably depends on the environment and genetic background. The fate of a mutation also depends on population size, which determines the amount of drift it will experience. Here, we manipulate both population size and genotype composition and follow adaptation of 23 distinct Escherichia coli genotypes. These have previously accumulated mutations under intense genetic drift and encompass a substantial fitness variation. A simple rule is uncovered: the net fitness change is negatively correlated with the fitness of the genotype in which new mutations appear—a signature of epistasis. We find that Fisher's geometrical model can account for the observed patterns of fitness change and infer the parameters of this model that best fit the data, using Approximate Bayesian Computation. We estimate a genomic mutation rate of 0.01 per generation for fitness altering mutations, albeit with a large confidence interval, a mean fitness effect of mutations of −0.01, and an effective number of traits nine in mutS− E. coli. This framework can be extended to confront a broader range of models with data and test different classes of fitness landscape models. PMID:24372601

  5. Well-being, health and fitness of children who use wheelchairs: feasibility study protocol to develop child-centred 'keep-fit' exercise interventions.

    Science.gov (United States)

    O'Brien, Thomas D; Noyes, Jane; Spencer, Llinos Haf; Kubis, Hans-Peter; Edwards, Rhiannon T; Bray, Nathan; Whitaker, Rhiannon

    2015-02-01

    To undertake the pre-clinical and modelling phases of the Medical Research Council complex intervention framework to underpin development of child-centred 'keep-fit', exercise and physical activity interventions for children and young people who use wheelchairs. Children who use wheelchairs face many barriers to participation in physical activity, which compromises fitness, obesity, well-being and health. 'Keep-fit' programmes that are child-centred and engaging are urgently required to enhance participation of disabled children and their families as part of a healthy lifestyle. Nurses will likely be important in promoting and monitoring 'keep-fit' intervention(s) when implemented in the community. Mixed-method (including economic analysis) feasibility study to capture child and family preferences and keep-fit needs and to determine outcome measures for a 'keep-fit' intervention. The study comprises three stages. Stage 1 includes a mixed-method systematic review of effectiveness, cost effectiveness and key stakeholder views and experiences of keep-fit interventions, followed by qualitative interviews with children, young people and their parents to explore preferences and motivations for physical activity. Stage 2 will identify standardized outcome measures and test their application with children who use wheelchairs to obtain baseline fitness data. Options for an exercise-based keep-fit intervention will then be designed based on Stage 1 and 2 findings. In stage 3, we will present intervention options for feedback and further refinement to children and parents/carers in focus groups. (Project funded October 2012). At completion, this study will lead to the design of the intervention and a protocol to test its efficacy. © 2014 John Wiley & Sons Ltd.

  6. Amino acids intake and physical fitness among adolescents.

    Science.gov (United States)

    Gracia-Marco, Luis; Bel-Serrat, Silvia; Cuenca-Garcia, Magdalena; Gonzalez-Gross, Marcela; Pedrero-Chamizo, Raquel; Manios, Yannis; Marcos, Ascensión; Molnar, Denes; Widhalm, Kurt; Polito, Angela; Vanhelst, Jeremy; Hagströmer, Maria; Sjöström, Michael; Kafatos, Anthony; de Henauw, Stefaan; Gutierrez, Ángel; Castillo, Manuel J; Moreno, Luis A

    2017-06-01

    The aim was to investigate whether there was an association between amino acid (AA) intake and physical fitness and if so, to assess whether this association was independent of carbohydrates intake. European adolescents (n = 1481, 12.5-17.5 years) were measured. Intake was assessed via two non-consecutive 24-h dietary recalls. Lower and upper limbs muscular fitness was assessed by standing long jump and handgrip strength tests, respectively. Cardiorespiratory fitness was assessed by the 20-m shuttle run test. Physical activity was objectively measured. Socioeconomic status was obtained via questionnaires. Lower limbs muscular fitness seems to be positively associated with tryptophan, histidine and methionine intake in boys, regardless of centre, age, socioeconomic status, physical activity and total energy intake (model 1). However, these associations disappeared once carbohydrates intake was controlled for (model 2). In girls, only proline intake seems to be positively associated with lower limbs muscular fitness (model 2) while cardiorespiratory fitness seems to be positively associated with leucine (model 1) and proline intake (models 1 and 2). None of the observed significant associations remained significant once multiple testing was controlled for. In conclusion, we failed to detect any associations between any of the evaluated AAs and physical fitness after taking into account the effect of multiple testing.

  7. Non linear-least-squares fitting for pixe spectra

    International Nuclear Information System (INIS)

    Benamar, M.A.; Tchantchane, A.; Benouali, N.; Azbouche, A.; Tobbeche, S.

    1992-10-01

    An interactive computer program for the analysis of Pixe spectra is described. The fitting procedure consists of computing a function which approximates the experimental data. A nonlinear least-squares fitting is used to determine the parameters of the fit. The program takes into account the low energy tail and the escape peaks

  8. Fit for Duty?: Evaluating the Physical Fitness Requirements of Battlefield Airmen.

    Science.gov (United States)

    Sean, Robson; Maria C, Lytell; Carra S, Sims; Stephanie, Pezard; Thomas, Manacapilli; Amanda, Anderson; Therese, Bohusch; Abigail, Haddad

    2018-01-01

    Military occupations can be physically demanding, yet few attempts have been made to determine the physical readiness of today's airmen to perform their jobs. Although the Air Force conducts fitness testing of all its airmen, these tests and standards are not based on validated job requirements. As part of a broader Air Force effort to measure the physical readiness of airmen to perform their jobs, this study describes a methodology for establishing physical fitness standards for four physically demanding Air Force occupational specialties-combat controller, pararescue, special operations weather team, and tactical air control party. Airmen in these specialties are collectively known as battlefield airmen. The authors sought to identify the physically demanding tasks required of battlefield airmen and ways in which fitness standards might be established to ensure that individuals in these specialties are able to perform these tasks. They reviewed the research literature and relevant military documents, conducted focus groups and interviews with battlefield airmen and other subject matter experts, and analyzed the movement patterns and physical abilities associated with each task. They found a high demand across the four specialities for strength and muscular and cardiovascular endurance, followed by agility, anaerobic power, and equilibrium, whereas they found flexibility to be less critically important. The authors recommend that a validation study be conducted next, to (a) ensure that tests measure important physical abilities required for successful mission or job performance, (b) ensure that performance on tests is a good indicator of mission or job performance, and (c) identify minimum test standards that are associated with acceptable mission or job performance.

  9. The Soldier Fitness Tracker: global delivery of Comprehensive Soldier Fitness.

    Science.gov (United States)

    Fravell, Mike; Nasser, Katherine; Cornum, Rhonda

    2011-01-01

    Carefully implemented technology strategies are vital to the success of large-scale initiatives such as the U.S. Army's Comprehensive Soldier Fitness (CSF) program. Achieving the U.S. Army's vision for CSF required a robust information technology platform that was scaled to millions of users and that leveraged the Internet to enable global reach. The platform needed to be agile, provide powerful real-time reporting, and have the capacity to quickly transform to meet emerging requirements. Existing organizational applications, such as "Single Sign-On," and authoritative data sources were exploited to the maximum extent possible. Development of the "Soldier Fitness Tracker" is the most recent, and possibly the best, demonstration of the potential benefits possible when existing organizational capabilities are married to new, innovative applications. Combining the capabilities of the extant applications with the newly developed applications expedited development, eliminated redundant data collection, resulted in the exceeding of program objectives, and produced a comfortable experience for the end user, all in less than six months. This is a model for future technology integration. (c) 2010 APA, all rights reserved.

  10. Intensity Conserving Spectral Fitting

    Science.gov (United States)

    Klimchuk, J. A.; Patsourakos, S.; Tripathi, D.

    2015-01-01

    The detailed shapes of spectral line profiles provide valuable information about the emitting plasma, especially when the plasma contains an unresolved mixture of velocities, temperatures, and densities. As a result of finite spectral resolution, the intensity measured by a spectrometer is the average intensity across a wavelength bin of non-zero size. It is assigned to the wavelength position at the center of the bin. However, the actual intensity at that discrete position will be different if the profile is curved, as it invariably is. Standard fitting routines (spline, Gaussian, etc.) do not account for this difference, and this can result in significant errors when making sensitive measurements. Detection of asymmetries in solar coronal emission lines is one example. Removal of line blends is another. We have developed an iterative procedure that corrects for this effect. It can be used with any fitting function, but we employ a cubic spline in a new analysis routine called Intensity Conserving Spline Interpolation (ICSI). As the name implies, it conserves the observed intensity within each wavelength bin, which ordinary fits do not. Given the rapid convergence, speed of computation, and ease of use, we suggest that ICSI be made a standard component of the processing pipeline for spectroscopic data.

  11. An Epidemiological Profile of CrossFit Athletes in Brazil.

    Science.gov (United States)

    Sprey, Jan W C; Ferreira, Thiago; de Lima, Marcos V; Duarte, Aires; Jorge, Pedro B; Santili, Claudio

    2016-08-01

    CrossFit is a conditioning and training program that has been gaining recognition and interest among the physically active population. Approximately 440 certified and registered CrossFit fitness centers and gyms exist in Brazil, with approximately 40,000 athletes. To date, there have been no epidemiological studies about the CrossFit athlete in Brazil. To evaluate the profile, sports history, training routine, and presence of injuries among athletes of CrossFit. Descriptive epidemiological study. This cross-sectional study was based on a questionnaire administered to CrossFit athletes from various specialized fitness centers in Brazil. Data were collected from May 2015 to July 2015 through an electronic questionnaire that included demographic data, level of sedentary lifestyle at work, sports training history prior to starting CrossFit, current sports activities, professional monitoring, and whether the participants experienced any injuries while practicing CrossFit. A total of 622 questionnaires were received, including 566 (243 women [42.9%] and 323 men [57.1%]) that were completely filled out and met the inclusion criteria and 9% that were incompletely filled out. Overall, 176 individuals (31.0%) mentioned having experienced some type of injury while practicing CrossFit. We found no significant difference in injury incidence rates regarding demographic data. There was no significant difference regarding previous sports activities because individuals who did not practice prior physical activity showed very similar injury rates to those who practiced at any level. CrossFit injury rates are comparable to those of other recreational or competitive sports, and the injuries show a profile similar to weight lifting, power lifting, weight training, Olympic gymnastics, and running, which have an injury incidence rate nearly half that of soccer.

  12. The Texas Youth Fitness Study: Looking at School Policies as They Relate to Physical Fitness and Academic Variables. Program Results Report

    Science.gov (United States)

    Feiden, Karyn

    2011-01-01

    In partnership with three universities, the Cooper Institute, Dallas, completed the Texas Youth Fitness Study from 2008 to 2009. The study explored three key questions: (1) Is physical fitness associated with academic performance?; (2) Can physical education teachers collect high-quality information on student fitness?; and (3) Are school policies…

  13. Worm plot to diagnose fit in quantile regression

    NARCIS (Netherlands)

    Buuren, S. van

    2007-01-01

    The worm plot is a series of detrended Q-Q plots, split by covariate levels. The worm plot is a diagnostic tool for visualizing how well a statistical model fits the data, for finding locations at which the fit can be improved, and for comparing the fit of different models. This paper shows how the

  14. Worm plot to diagnose fit in quantile regression

    NARCIS (Netherlands)

    Buuren, S. van

    2007-01-01

    The worm plot is a series of detrended Q-Q plots, split by covariate levels. The worm plot is a diagnostic tool for visualizing how well a statistical model fits the data, for finding locations at which the fit can be improved, and for comparing the fit of different models. This paper shows how

  15. [The importance of physical activity and fitness for human health].

    Science.gov (United States)

    Brandes, M

    2012-01-01

    The decline of physical activity is considered to play an important role in the deterioration of health predictors, such as overweight, and the associated increase of cardiovascular and all-cause mortality. Therefore, most interventional strategies aim for increasing physical activity. Instead of physical activity, some studies use physical fitness as a key variable. Though physical fitness is influenced by genetic factors, physical fitness has to be developed by physical activity. As recent reports demonstrate the prospective associations between physical fitness and health and mortality, these associations are not reported for physical activity. Due to the fact that physical fitness-in contrast to physical activity-is evaluated with standardized laboratory measurements, it appears advisable to assess physical fitness for prospective health perspectives. Although physical fitness is determined by genetics, physical activity is the primary modifiable determinant for increasing physical fitness and should be aimed for to improve physical fitness in interventional strategies.

  16. Androgenetic alopecia: An update

    Directory of Open Access Journals (Sweden)

    Feroze Kaliyadan

    2013-01-01

    Full Text Available Androgenetic alopecia (AGA is one of the commonest reasons for dermatological consultation. Over the last few years our understanding of the pathophysiology of AGA has improved and this has paved way for better diagnostic and therapeutic options. Recent research has dwelled on the role of stem cells in the pathophysiology of AGA and has also identified newer genetic basis for the condition. Dermoscopy/trichoscopy has emerged as a useful diagnostic tool for AGA. While the major treatment options continue to be topical minoxidil, systemic Finasteride and hair transplantations, newer modalities are under investigation. Specific diagnostic and treatment recommendations have also been developed on evidence based principles. This article reviews the recent concepts in relation to AGA. With regards to the pathophysiology we have tried to stress on recent knowledge of the molecular and genetic basis of AGA. We have emphasized on an evidence based approach for treatment and diagnosis.

  17. Decision making on fitness landscapes

    Science.gov (United States)

    Arthur, R.; Sibani, P.

    2017-04-01

    We discuss fitness landscapes and how they can be modified to account for co-evolution. We are interested in using the landscape as a way to model rational decision making in a toy economic system. We develop a model very similar to the Tangled Nature Model of Christensen et al. that we call the Tangled Decision Model. This is a natural setting for our discussion of co-evolutionary fitness landscapes. We use a Monte Carlo step to simulate decision making and investigate two different decision making procedures.

  18. Physical Work Demands and Fitness

    DEFF Research Database (Denmark)

    Larsen, Mette Korshøj

    . The effects were evaluated with objective physiological or diurnal data in an intention-to-treat analysis using multi-adjusted mixed models. The results indicated that the intervention led to several improvements in risk factors for cardiovascular disease, e.g. enhanced cardiorespiratory fitness, reduced...... exposed to high relative aerobic workloads obtained more pronounced increases of resting and 24-hour ambulatory blood pressure, an unaltered cardiorespiratory fitness and a reduced sleeping heart rate. The enhanced resting and 24-hour ambulatory blood pressure may be explained as a potential...

  19. Decision Making on Fitness Landscapes

    DEFF Research Database (Denmark)

    Arthur, Rudy; Sibani, Paolo

    2017-01-01

    We discuss fitness landscapes and how they can be modified to account for co-evolution. We are interested in using the landscape as a way to model rational decision making in a toy economic system. We develop a model very similar to the Tangled Nature Model of Christensen et. al. that we call...... the Tangled Decision Model. This is a natural setting for our discussion of co-evolutionary fitness landscapes. We use a Monte Carlo step to simulate decision making and investigate two different decision making procedures....

  20. Alternative Forms of Fit in Contingency Theory.

    Science.gov (United States)

    Drazin, Robert; Van de Ven, Andrew H.

    1985-01-01

    This paper examines the selection, interaction, and systems approaches to fit in structural contingency theory. The concepts of fit evaluated may be applied not only to structural contingency theory but to contingency theories in general. (MD)

  1. Population density shapes patterns of survival and reproduction in Eleutheria dichotoma (Hydrozoa: Anthoathecata).

    Science.gov (United States)

    Dańko, Aleksandra; Schaible, Ralf; Pijanowska, Joanna; Dańko, Maciej J

    2018-01-01

    Budding hydromedusae have high reproductive rates due to asexual reproduction and can occur in high population densities along the coasts, specifically in tidal pools. In laboratory experiments, we investigated the effects of population density on the survival and reproductive strategies of a single clone of Eleutheria dichotoma . We found that sexual reproduction occurs with the highest rate at medium population densities. Increased sexual reproduction was associated with lower budding (asexual reproduction) and survival probability. Sexual reproduction results in the production of motile larvae that can, in contrast to medusae, seek to escape unfavorable conditions by actively looking for better environments. The successful settlement of a larva results in starting the polyp stage, which is probably more resistant to environmental conditions. This is the first study that has examined the life-history strategies of the budding hydromedusa E. dichotoma by conducting a long-term experiment with a relatively large sample size that allowed for the examination of age-specific mortality and reproductive rates. We found that most sexual and asexual reproduction occurred at the beginning of life following a very rapid process of maturation. The parametric models fitted to the mortality data showed that population density was associated with an increase in the rate of aging, an increase in the level of late-life mortality plateau, and a decrease in the hidden heterogeneity in individual mortality rates. The effects of population density on life-history traits are discussed in the context of resource allocation and the r/K-strategies' continuum concept.

  2. VISUAL ART AND REGULATORY FIT MESSAGES ON CONSUMER EVALUATIONS

    Directory of Open Access Journals (Sweden)

    Danielle Mantovani

    2016-03-01

    Full Text Available In this study, we demonstrate that the art infusion effect, in which the presence of visual art causes a positive impact on consumers’ perceptions of products and advertising messages, might have a moderation effect on regulatory fit and non-fit messages. We investigate the impact of visual art on advertisement evaluations in regulatory (non- fit conditions. Regulatory focus theory suggests that consumers rely on their motivational focus (prevention vs. promotion for their evaluations and decisions. Usually, consumers prefer products that fit with their personal motivational focus. In the present study, the results of three experiments indicate that using visual art with a promotion or prevention fit message is recommended, while non-art images increase message persuasiveness when non-fit messages are presented. Therefore, not all information compatible with the consumer’s motivational focus are best evaluated. When non-art images are presented, non-fit messages might be more persuasive.

  3. CrossFit Overview: Systematic Review and Meta-analysis.

    Science.gov (United States)

    Claudino, João Gustavo; Gabbett, Tim J; Bourgeois, Frank; Souza, Helton de Sá; Miranda, Rafael Chagas; Mezêncio, Bruno; Soncin, Rafael; Cardoso Filho, Carlos Alberto; Bottaro, Martim; Hernandez, Arnaldo Jose; Amadio, Alberto Carlos; Serrão, Julio Cerca

    2018-02-26

    CrossFit is recognized as one of the fastest growing high-intensity functional training modes in the world. However, scientific data regarding the practice of CrossFit is sparse. Therefore, the objective of this study is to analyze the findings of scientific literature related to CrossFit via systematic review and meta-analysis. Systematic searches of the PubMed, Web of Science, Scopus, Bireme/MedLine, and SciELO online databases were conducted for articles reporting the effects of CrossFit training. The systematic review followed the PRISMA guidelines. The Oxford Levels of Evidence was used for all included articles, and only studies that investigated the effects of CrossFit as a training program were included in the meta-analysis. For the meta-analysis, effect sizes (ESs) with 95% confidence interval (CI) were calculated and heterogeneity was assessed using a random-effects model. Thirty-one articles were included in the systematic review and four were included in the meta-analysis. However, only two studies had a high level of evidence at low risk of bias. Scientific literature related to CrossFit has reported on body composition, psycho-physiological parameters, musculoskeletal injury risk, life and health aspects, and psycho-social behavior. In the meta-analysis, significant results were not found for any variables. The current scientific literature related to CrossFit has few studies with high level of evidence at low risk of bias. However, preliminary data has suggested that CrossFit practice is associated with higher levels of sense of community, satisfaction, and motivation.

  4. The Marine Corps Physical Fitness Test: The Need to Replace it with a Combat Fitness Test

    Science.gov (United States)

    2008-02-19

    unforeseen emergencies.”1 Crossfit , a website-based workout program, has popularized the en vogue, yet relatively old concept of “functional fitness...Sports; 1996. <http://www.cdc.gov/nccdphp/sgr/sgr.htm> 2 Greg Glassman, “What is Fitness?” Crossfit Journal, October 2002, 1-2. 3 human...short, intense workouts aimed at increasing power, speed, and strength. Additionally, Crossfit explains the crossover between the three pathways

  5. Obesity, Cardiovascular Fitness, and Inhibition Function: An Electrophysiological Study

    Directory of Open Access Journals (Sweden)

    Tai-Fen Song

    2016-07-01

    Full Text Available The purpose of the present study was to examine how obesity and cardiovascular fitness are associated with the inhibition aspect of executive function from behavioral and electrophysiological perspectives. One hundred college students, aged 18 to 25 years, were categorized into four groups of equal size on the basis of body mass index and cardiovascular fitness: a normal-weight and high-fitness (NH group, an obese-weight and high-fitness (OH group, a normal-weight and low-fitness (NL group, and an obese-weight and low-fitness (OL group. Behavioral measures of response time and number of errors, as well as event-related potential (ERP measures of P3 and N1, were assessed during the Stroop Task. The results revealed that, in general, the NH group exhibited shorter response times and larger P3 amplitudes relative to the OH, NL, and OL groups, wherein the OL group exhibited the longest response time in the incongruent condition. No group differences in N1 indices were also revealed. These findings suggest that the status of being both normal weight and having high cardiovascular fitness is associated with better behavioral and later stages of electrophysiological indices of inhibition. However, these benefits in inhibition function would be lost in an individual who is obese or has low cardiovascular fitness, reflecting the importance keeping both normal weight and having high cardiovascular fitness.

  6. Covariance fitting of highly-correlated data in lattice QCD

    Science.gov (United States)

    Yoon, Boram; Jang, Yong-Chull; Jung, Chulwoo; Lee, Weonjong

    2013-07-01

    We address a frequently-asked question on the covariance fitting of highly-correlated data such as our B K data based on the SU(2) staggered chiral perturbation theory. Basically, the essence of the problem is that we do not have a fitting function accurate enough to fit extremely precise data. When eigenvalues of the covariance matrix are small, even a tiny error in the fitting function yields a large chi-square value and spoils the fitting procedure. We have applied a number of prescriptions available in the market, such as the cut-off method, modified covariance matrix method, and Bayesian method. We also propose a brand new method, the eigenmode shift (ES) method, which allows a full covariance fitting without modifying the covariance matrix at all. We provide a pedagogical example of data analysis in which the cut-off method manifestly fails in fitting, but the rest work well. In our case of the B K fitting, the diagonal approximation, the cut-off method, the ES method, and the Bayesian method work reasonably well in an engineering sense. However, interpreting the meaning of χ 2 is easier in the case of the ES method and the Bayesian method in a theoretical sense aesthetically. Hence, the ES method can be a useful alternative optional tool to check the systematic error caused by the covariance fitting procedure.

  7. ADA Compliance and Accessibility of Fitness Facilities in Western Wisconsin.

    Science.gov (United States)

    Johnson, Marquell J; Stoelzle, Hannah Y; Finco, Kristi L; Foss, Sadie E; Carstens, Katie

    2012-01-01

    The study expands the research on fitness facility accessibility by determining how compliant fitness facilities in rural western Wisconsin were with Title III of the Americans with Disabilities Act (ADA). Comparisons were made with 4 other studies that were conducted in different geographical regions. The study also examined fitness professionals' disability knowledge and awareness. An ADA fitness facility compliance instrument and a fitness professional disability awareness survey were used. Direct observation and physical measurements were taken during on-site visits to 16 of 36 eligible fitness facilities in rural western Wisconsin. Ten fitness professionals from participating facilities completed an online survey. Frequencies were used to analyze the results. None of the participating facilities were in 100% compliance with ADA. Customer service desk (84%) and path of travel throughout the facility (72%) were the highest compliance areas. Telephone (6%) and locker rooms (32%) were the lowest compliance areas. No fitness professional was trained in wheelchair transfers and very few had received training in providing services to individuals with disabilities. Fitness facility accessibility remains a concern nationally. Continued efforts need to be made to raise the awareness of ADA compliance among fitness professionals across the United States, especially in rural areas where fitness facility availability is limited.

  8. Exploring the fitness landscape of poliovirus

    Science.gov (United States)

    Bianco, Simone; Acevedo, Ashely; Andino, Raul; Tang, Chao

    2012-02-01

    RNA viruses are known to display extraordinary adaptation capabilities to different environments, due to high mutation rates. Their very dynamical evolution is captured by the quasispecies concept, according to which the viral population forms a swarm of genetic variants linked through mutation, which cooperatively interact at a functional level and collectively contribute to the characteristics of the population. The description of the viral fitness landscape becomes paramount towards a more thorough understanding of the virus evolution and spread. The high mutation rate, together with the cooperative nature of the quasispecies, makes it particularly challenging to explore its fitness landscape. I will present an investigation of the dynamical properties of poliovirus fitness landscape, through both the adoption of new experimental techniques and theoretical models.

  9. The Andersen aerobic fitness test

    DEFF Research Database (Denmark)

    Aadland, Eivind; Terum, Torkil; Mamen, Asgeir

    2014-01-01

    BACKGROUND: High aerobic fitness is consistently associated with a favorable metabolic risk profile in children. Direct measurement of peak oxygen consumption (VO2peak) is often not feasible, thus indirect tests such as the Andersen test are required in many settings. The present study seeks...... of agreement) were 26.7±125.2 m for test 2 vs. test 1 (pfit in the present sample; thus, we suggest a new equation: VO2peak = 23....... Researchers should be aware of the amount of noise in indirect tests that estimate aerobic fitness....

  10. Fitness on facebook: advertisements generated in response to profile content.

    Science.gov (United States)

    Villiard, Hope; Moreno, Megan A

    2012-10-01

    Obesity is a challenging problem affecting almost half of college students. To solve this complex health problem, innovative approaches must be utilized. Over 94 percent of college students maintain a Facebook profile, providing them a venue to publicly disclose current fitness behaviors. Displayed advertisements on Facebook are tailored to profile content and may influence college students' fitness efforts. Facebook may be an innovative venue for improving college students' fitness behaviors. The purpose of this project was to determine (a) how and to what extent college students are discussing fitness on Facebook, and (b) how user-generated fitness information is linked to advertisements for fitness products and advice. First, public Facebook profiles of individual college students were evaluated for displayed fitness references based on 10 fitness behavior categories. Inter-rator reliability between two coders was 91.18 percent. Second, 10 fitness status updates were generated and posted by a researcher on a Facebook profile; the first 40 linked advertisements to these statements were examined. Advertisements were categorized and then examined for relevance to the college population. A total of 57 individual profiles were examined; owners had an average age of 18.3 years (SD=0.51), and 36.8 percent were women. About 71.9 percent of profiles referenced one or more fitness behavior; 97.6 percent referenced exercise, 4.9 percent dieting, and 4.9 percent unhealthy eating. Among the first 40 ads linked to generated status updates, 40.3 percent were fitness related. Most advertisements were for charity runs (30.4 percent), fitness apparel (24.2 percent), or fad diets (9.9 percent). Students referred both healthy and unhealthy fitness behaviors on their Facebook profiles, and these trigger the display of fitness-related advertisements of which few appear applicable. A community- or university-based intervention could be designed and implemented to provide relevant and

  11. Steel pipelines standards for fittings and joint accessories

    CERN Document Server

    DIN

    2013-01-01

    Die 1. Auflage von DIN Handbook 15/6 erweitert die DIN Handbook-Reihe um den Themenbereich Fittings für verschiedene Montagetechniken. Es enthält in englischer Übersetzung die wesentlichen Normen über Lötfittings aus Kupfer, Temperguss-Fittings, Fittings aus Stahl und Kunststofffittings. Abgerundet wird der Inhalt durch ergänzende Normen, Begriffe und Grundnormen. Reihe DIN_Handbook - 15/6

  12. Determining the Relationship Between Physical Fitness, Gender, and Life Satisfaction

    Directory of Open Access Journals (Sweden)

    Kyle Busing

    2016-11-01

    Full Text Available Previous research has suggested a positive effect of physical activity on life satisfaction. Little research exists that has investigated the relationship between physical fitness and life satisfaction. For this purpose, this research was done to determine the relationship between physical fitness and life satisfaction in a sample of university men and women. Participants (N = 28, Mage = 22.18 completed multiple indicators of physical fitness including cardiovascular fitness, muscular fitness, body composition and flexibility, and life satisfaction (SWLS. Descriptive and one-way between-groups ANOVAs were performed to determine gender differences on measures of life satisfaction and measures of fitness. In addition, the relationship between the five health-related components of fitness and life satisfaction were investigated using Pearson’s product–moment correlation coefficient. Analyses indicated there were no significant correlations between any of the health-related components of fitness and scores on the SWLS. There were significant gender differences on all physical fitness measures, except partial curl-ups, but no significant gender differences on life satisfaction. Our findings suggest that improved physical fitness does not have a relationship with higher life satisfaction measures. Further tests, utilizing larger sample sizes, are recommended.

  13. Fitness for duty - a regulator's view

    International Nuclear Information System (INIS)

    Johnson, E.H.; Hall, R.E.

    1987-01-01

    Fitness for duty is a legal, moral, emotional, and political issue. It is therefore that type of issue that one would expect industry to run from, opting instead for government intervention and prescriptive regulations. This would allow the industry to hide behind the shield of doing what is necessary to comply. But fitness for duty is also a rational business issue. It involves getting a reasonable return on the investment in the people who are necessary to run the nuclear industry. It is within this context that the US Nuclear Regulatory Commission (NRC) has exercised its discretion to not undertake new rule making, instead giving the industry the mandate of pursuing this issue. The NRC has deferred rule making as long as the industry programs are effective in producing the desired results. The NRC has also retained the right to follow up on operational events and to evaluate the effectiveness of the programs in place. The industry, under the leadership of NUMARC, has risen to this challenge and has adopted the August 1985 Edison Electric Institute (EEI) fitness-for-duty program guidelines for implementation by all utilities. In evaluating the effectiveness of programs, the NRC is conducting inspections at some utilities. These inspections have confirmed that the EEI guidelines are being used as the basis for fitness-for-duty programs. Even though the nuclear industry has taken a generally strong stand on fitness for duty and has adopted reasonable guidelines for its assurance, there still remain several challenges

  14. Vestibular schwannoma and fitness to fly.

    Science.gov (United States)

    Pons, Yoann; Raynal, Marc; Hunkemöller, Iris; Lepage, Pierre; Kossowski, Michel

    2010-10-01

    When a pilot is referred for vestibular schwannoma (VS), his or her fitness to fly may be questioned. The objective of this retrospective study was to describe a series of VS cases in a pilot population and to discuss their fitness to fly options. Between September 2002 and March 2010, the ENT/Head and Neck Surgery Department of the National Pilot Expertise Center conducted nearly 120,000 expert consultations for 40,000 pilots. We examined the files of 10 pilots who were referred to our 2 national experts for VS. At the time of the expert consultation, hypoacusis was present in nine cases (four with total deafness), tinnitus in one case, and vertigo in nine cases. In our series, only 2 of the 10 pilots experienced a negative impact on their fitness to fly. Decisions on fitness to fly were based on several factors: minimally disturbed audition, i.e., less than a 35-dB hearing loss with a good speech discrimination score; good balance, i.e., no reported difficulties; no spontaneous nystagmus recorded on videonystagmography (VNG); no postural deviation; and a normal head-shaking test. The delay and the VS's evolution between diagnosis and expert consultation are important because the selection of a treatment to control VS is critical in minimizing the possible associated complications. When a pilot is referred for VS, his or her fitness to fly is determined by the size of the tumor, balance, auditory status, and the follow-up results of these findings. The complications that may arise from VS treatments must also be considered.

  15. Design and qualification of nuclear fittings

    International Nuclear Information System (INIS)

    Coppolani, P.

    1985-01-01

    This paper gives a definition of nuclear fittings and presents its characteristics, its operating conditions and the safety function that they ensure. The classification of fittings and the consequences on its design are presented. The procedures of design verification and the validation in loop are given. Two equipments are finally presented: the Framatome Velan Rateau valve and the VR3-1500 LB valve [fr

  16. Cardiorespiratory fitness and muscle strength in pancreatic cancer patients.

    Science.gov (United States)

    Clauss, Dorothea; Tjaden, Christine; Hackert, Thilo; Schneider, Lutz; Ulrich, Cornelia M; Wiskemann, Joachim; Steindorf, Karen

    2017-09-01

    Cancer patients frequently experience reduced physical fitness due to the disease itself as well as treatment-related side effects. However, studies on physical fitness in pancreatic cancer patients are missing. Therefore, we assessed cardiorespiratory fitness and muscle strength of pancreatic cancer patients. We included 65 pancreatic cancer patients, mostly after surgical resection. Cardiorespiratory fitness was assessed using cardiopulmonary exercise testing (CPET) and 6-min walk test (6MWT). Hand-held dynamometry was used to evaluate isometric muscle strength. Physical fitness values were compared to reference values of a healthy population. Associations between sociodemographic and clinical variables with patients' physical fitness were analyzed using multiple regression models. Cardiorespiratory fitness (VO 2 peak, 20.5 ± 6.9 ml/min/kg) was significantly lower (-24%) compared to healthy reference values. In the 6MWT pancreatic cancer patients nearly reached predicted values (555 vs. 562 m). Maximal voluntary isometric contraction (MVIC) of the upper (-4.3%) and lower extremities (-13.8%) were significantly lower compared to reference values. Overall differences were larger in men than those in women. Participating in regular exercise in the year before diagnosis was associated with greater VO 2 peak (p fitness with regard to both cardiorespiratory function and isometric muscle strength, already in the early treatment phase (median 95 days after surgical resection). Our findings underline the need to investigate exercise training in pancreatic cancer patients to counteract the loss of physical fitness.

  17. Measuring Quasar Spin via X-ray Continuum Fitting

    Science.gov (United States)

    Jenkins, Matthew; Pooley, David; Rappaport, Saul; Steiner, Jack

    2018-01-01

    We have identified several quasars whose X-ray spectra appear very soft. When fit with power-law models, the best-fit indices are greater than 3. This is very suggestive of thermal disk emission, indicating that the X-ray spectrum is dominated by the disk component. Galactic black hole binaries in such states have been successfully fit with disk-blackbody models to constrain the inner radius, which also constrains the spin of the black hole. We have fit those models to XMM-Newton spectra of several of our identified soft X-ray quasars to place constraints on the spins of the supermassive black holes.

  18. Organization Design for Dynamic Fit: A Review and Projection

    Directory of Open Access Journals (Sweden)

    Mark Nissen

    2014-08-01

    Full Text Available The concept of fit is central to organization design. In the organizational literature, fit historically has been portrayed as a static concept. Both organizations and their environments, however, are continually changing, so a valid concept of fit needs to reflect organizational dynamics. In this article, I analyze various theoretical perspectives and studies that relate to organizational fit, differentiating those that employ an equilibrating or a fluxing approach. Four substantive themes emerge from this analysis: design orientation, design tension, designer/manager roles, and measurement and validation. Implications of each of these themes for dynamic fit are derived, and promising future research directions are discussed.

  19. Spline function fit for multi-sets of correlative data

    International Nuclear Information System (INIS)

    Liu Tingjin; Zhou Hongmo

    1992-01-01

    The Spline fit method for multi-sets of correlative data is developed. The properties of correlative data fit are investigated. The data of 23 Na(n, 2n) cross section are fitted in the cases with and without correlation

  20. A Data Forward Stepwise Fitting Algorithm Based on Orthogonal Function System

    Directory of Open Access Journals (Sweden)

    Li Han-Ju

    2017-01-01

    Full Text Available Data fitting is the main method of functional data analysis, and it is widely used in the fields of economy, social science, engineering technology and so on. Least square method is the main method of data fitting, but the least square method is not convergent, no memory property, big fitting error and it is easy to over fitting. Based on the orthogonal trigonometric function system, this paper presents a data forward stepwise fitting algorithm. This algorithm takes forward stepwise fitting strategy, each time using the nearest base function to fit the residual error generated by the previous base function fitting, which makes the residual mean square error minimum. In this paper, we theoretically prove the convergence, the memory property and the fitting error diminishing character for the algorithm. Experimental results show that the proposed algorithm is effective, and the fitting performance is better than that of the least square method and the forward stepwise fitting algorithm based on the non-orthogonal function system.

  1. Female parthenogenetic apomixis and androsporogenetic parthenogenesis in embryonal cells of Araucaria angustifolia: interpolation of progenesis and asexual heterospory in an artificial sporangium.

    Science.gov (United States)

    Durzan, Don J

    2012-09-01

    Cell fate, development timing and occurrence of reproductive versus apomictic development in gymnosperms are shown to be influenced by culture conditions in vitro. In this study, female parthenogenetic apomixis (fPA), androsporogenetic parthenogenesis (mAP) and progenesis were demonstrated using embryonal initials of Araucaria angustifolia in scaled-up cell suspensions passing through a single-cell bottleneck in darkness and in an artificial sporangium (AS). Expression was based on defined nutrition, hormones and feedforward-adaptive feedback process controls at 23-25 °C and in darkness. In fPA, the nucleus of an embryonal initial undergoes endomitosis and amitosis, forming a diploid egg-equivalent and an apoptotic ventral canal nucleus in a transdifferentiated archegonial tube. Discharge of egg-equivalent cells as parthenospores and their dispersal into the aqueous culture medium were followed by free-nuclear conifer-type proembryogenesis. This replaced the plesiomorphic and central features of proembryogenesis in Araucariaceae. Protoplasmic fusions of embryonal initials were used to reconstruct heterokaryotic expressions of fPA in multiwell plates. In mAP, restitutional meiosis (automixis) was responsible for androsporogenesis and the discharge of monads, dyads, tetrads and polyads. In a display of progenesis, reproductive development was brought to an earlier ontogenetic stage and expressed by embryonal initials. Colchicine increased polyploidy, but androspore formation became aberrant and fragmented. Aberrant automixis led to the formation of chromosomal bouquets, which contributed to genomic silencing in embryonal initials, cytomixis and the formation of pycnotic micronucleated cells. Dispersal of female and male parthenospores displayed heteromorphic asexual heterospory in an aqueous environment.

  2. Relationships Between Glycemic Control and Cardiovascular Fitness.

    Science.gov (United States)

    Moxley, Elizabeth W; Smith, Donald; Quinn, Lauretta; Park, Chang

    2018-07-01

    Diabetes is a serious health problem affecting approximately 29.1 million individuals in the United States. Another 86 million have prediabetes. The development and implementation of lifestyle modifications such as physical activity for these persons are among the most effective methods for prevention and treatment. The aim of this study was to examine relationships between glycemic control (HbA1c) and cardiovascular fitness (peak maximal oxygen uptake [VO 2 peak] and ventilatory threshold [VT]) in overweight/obese subjects with and without type 2 diabetes (T2DM). In addition, the influences of body mass index (BMI) and insulin sensitivity (homeostasis model assessment [HOMA %S]) on the relationship between glycemic control and cardiovascular fitness were explored. Data were abstracted from a completed study that included 51 overweight or obese subjects with T2DM ( n = 18), impaired glucose tolerance ( n = 8), or normal glucose tolerance ( n = 25). Relationships between glycemic control (HbA1c) and cardiovascular fitness (VO 2 peak and VT) were determined using correlational analysis and multiple linear regression analyses. A statistically significant relationship was observed between HbA1c and cardiovascular fitness. However, BMI and HOMA %S did not influence the relationship between glycemic control and cardiovascular fitness. HbA1c contributes to VO 2 peak and VT in obese and overweight subjects across glucose tolerance categories. Significant results were achieved despite the fact that there was a limited range of HbA1c based on the study inclusion criteria. This finding suggests that even a mild decrease in glycemic control can negatively influence cardiovascular fitness.

  3. Impact of CrossFit-Related Spinal Injuries.

    Science.gov (United States)

    Hopkins, Benjamin S; Cloney, Michael B; Kesavabhotla, Kartik; Yamaguchi, Jonathon; Smith, Zachary A; Koski, Tyler R; Hsu, Wellington K; Dahdaleh, Nader S

    2017-11-16

    Exercise-related injuries (ERIs) are a common cause of nonfatal emergency department and hospital visits. CrossFit is a high-intensity workout regimen whose popularity has grown rapidly. However, ERIs due to CrossFit remained under investigated. All patients who presented to the main hospital at a major academic center complaining of an injury sustained performing CrossFit between June 2010 and June 2016 were identified. Injuries were classified by anatomical location (eg, knee, spine). For patients with spinal injuries, data were collected including age, sex, body mass index (BMI), CrossFit experience level, symptom duration, type of symptoms, type of clinic presentation, cause of injury, objective neurological examination findings, imaging type, number of clinic visits, and treatments prescribed. Four hundred ninety-eight patients with 523 CrossFit-related injuries were identified. Spine injuries were the most common injuries identified, accounting for 20.9%. Among spine injuries, the most common location of injury was the lumbar spine (83.1%). Average symptom duration was 6.4 months ± 15.1, and radicular complaints were the most common symptom (53%). A total of 30 (32%) patients had positive findings on neurologic examination. Six patients (6.7%) required surgical intervention for treatment after failing an average of 9.66 months of conservative treatment. There was no difference in age, sex, BMI, or duration of symptoms of patients requiring surgery with those who did not. CrossFit is a popular, high-intensity style workout with the potential to injure its participants. Spine injuries were the most common type of injury observed and frequently required surgical intervention.

  4. Testing the validity of stock-recruitment curve fits

    International Nuclear Information System (INIS)

    Christensen, S.W.; Goodyear, C.P.

    1988-01-01

    The utilities relied heavily on the Ricker stock-recruitment model as the basis for quantifying biological compensation in the Hudson River power case. They presented many fits of the Ricker model to data derived from striped bass catch and effort records compiled by the National Marine Fisheries Service. Based on this curve-fitting exercise, a value of 4 was chosen for the parameter alpha in the Ricker model, and this value was used to derive the utilities' estimates of the long-term impact of power plants on striped bass populations. A technique was developed and applied to address a single fundamental question: if the Ricker model were applicable to the Hudson River striped bass population, could the estimates of alpha from the curve-fitting exercise be considered reliable. The technique involved constructing a simulation model that incorporated the essential biological features of the population and simulated the characteristics of the available actual catch-per-unit-effort data through time. The ability or failure to retrieve the known parameter values underlying the simulation model via the curve-fitting exercise was a direct test of the reliability of the results of fitting stock-recruitment curves to the real data. The results demonstrated that estimates of alpha from the curve-fitting exercise were not reliable. The simulation-modeling technique provides an effective way to identify whether or not particular data are appropriate for use in fitting such models. 39 refs., 2 figs., 3 tabs

  5. Pre-tenured Faculty Job Satisfaction: An Examination of Personal Fit, Institutional Fit and Faculty Work-life

    OpenAIRE

    Awando, Maxwell Omondi

    2014-01-01

    The purpose of this study is to explore job satisfaction among pre-tenured faculty. More specifically I was interested in examining demographic and personal fit factors, fit with the norms and values of the institution among pre-tenured faculty in different institutional types. The sample for the study included all pre-tenured faculty members who completed the COACHE 2009- 2010 job satisfaction survey. The COACHE survey was administered to pre-tenured faculty at 149 four-year colleges and uni...

  6. Expanding Brand Personality Congruence to Brand Personality Fit: The Importance of Customer Value Proposition as a Moderating Fit on Brand Performance

    Directory of Open Access Journals (Sweden)

    Ardi Wirdamulia

    2013-12-01

    Full Text Available This research demonstrates that brand performance can be enhanced not only through brand personality congruence with customer personality, but also through brand personality fit, namely the moderating fit of customer value proposition to brand personality. Through a study covering 125 brands, the result demonstrates that the moderating fit between brand personality and the different level of customer value proposition positively affects brand performance. Price-quality relationship for attribute-based customer value, self-construal for consequences-based customer value and self-regulatory focus as goal-based customer value are used to test this moderating fit relationship. Other findings show that this moderating fit is strongest toward the brand cognitive performance. Finally, the result of this study suggests marketers to incorporate the brand personality design into their positioning statement so that the overall customer value proposition can be developed in a more integrated manner, leading to higher brand performance

  7. A Study of the Physical Fitness Test in Relation to Demographics, Academic Achievement, and Students' Physical Fitness Perceptions

    Science.gov (United States)

    Mobilia-Jones, Karen

    2010-01-01

    This study examines the overall results of the Physical Fitness Test (PFT) and the six fitness areas of the PFT, academic achievement, demographics and self perceptions and the potential impact on students' performance on the PFT. While academic expectations are increasing, the adolescent obesity rate is also increasing, producing a decline in the…

  8. The neural network approach to parton fitting

    International Nuclear Information System (INIS)

    Rojo, Joan; Latorre, Jose I.; Del Debbio, Luigi; Forte, Stefano; Piccione, Andrea

    2005-01-01

    We introduce the neural network approach to global fits of parton distribution functions. First we review previous work on unbiased parametrizations of deep-inelastic structure functions with faithful estimation of their uncertainties, and then we summarize the current status of neural network parton distribution fits

  9. The future of health/fitness/sports performance

    NARCIS (Netherlands)

    Foster, Carl; Cortis, Cristina; Fusco, Andrea; Bok, Daniel; Boullosa, Daniel A.; Capranica, Laura; de Koning, Jos J.; Haugen, Thomas; Olivera-Silva, Iranse; Periara, Julien; Porcari, John P.; Pyne, David Bruce; Sandbakk, Oyvind

    2017-01-01

    Exercise relative to health/fitness and sports performance has displayed an evolutionary role over time. Large scale, overriding, factors are present which are likely to help us understand the likely future evolutionary path of health/fitness and sports performance. These factors include: 1) the

  10. Analytical fitting model for rough-surface BRDF.

    Science.gov (United States)

    Renhorn, Ingmar G E; Boreman, Glenn D

    2008-08-18

    A physics-based model is developed for rough surface BRDF, taking into account angles of incidence and scattering, effective index, surface autocovariance, and correlation length. Shadowing is introduced on surface correlation length and reflectance. Separate terms are included for surface scatter, bulk scatter and retroreflection. Using the FindFit function in Mathematica, the functional form is fitted to BRDF measurements over a wide range of incident angles. The model has fourteen fitting parameters; once these are fixed, the model accurately describes scattering data over two orders of magnitude in BRDF without further adjustment. The resulting analytical model is convenient for numerical computations.

  11. Shoulder Injuries in Individuals Who Participate in CrossFit Training

    OpenAIRE

    Summitt, Ryan J.; Cotton, Ryan A.; Kays, Adam C.; Slaven, Emily J.

    2016-01-01

    Background: CrossFit, a sport and fitness program, has become increasingly popular both nationally and internationally. Researchers have recently identified significant improvements in health and wellness due to CrossFit. However, some individuals assert that CrossFit poses an inherent risk of injury, specifically to the shoulder, due to the intensity of training. Currently, there is limited evidence to support this assertion. Hypothesis: Exercises performed during CrossFit do not place the s...

  12. Reconceptualizing fit in strategic human resource management: 'Lost in translation?'

    NARCIS (Netherlands)

    Paauwe, J.; Boon, C.; Boselie, P.; den Hartog, D.; Paauwe, J.; Guest, D.; Wright, P.

    2013-01-01

    To date, studies that focus on the concept of 'fit' in strategic human resource management (SHRM) fail to show consistent evidence. A variety of fit approaches are available, but there is no general consensus about what constitutes fit. This chapter aims to reconceptualize fit through a literature

  13. Measuring Your Fitness Level

    Science.gov (United States)

    ... online calculator. If you'd rather do the math yourself, divide your weight in pounds by your ... Human Services recommends one of the following activity levels for adult fitness and health benefits: 150 minutes ...

  14. Validity and reliability of Nintendo Wii Fit balance scores.

    Science.gov (United States)

    Wikstrom, Erik A

    2012-01-01

    Interactive gaming systems have the potential to help rehabilitate patients with musculoskeletal conditions. The Nintendo Wii Balance Board, which is part of the Wii Fit game, could be an effective tool to monitor progress during rehabilitation because the board and game can provide objective measures of balance. However, the validity and reliability of Wii Fit balance scores remain unknown. To determine the concurrent validity of balance scores produced by the Wii Fit game and the intrasession and intersession reliability of Wii Fit balance scores. Descriptive laboratory study. Sports medicine research laboratory. Forty-five recreationally active participants (age = 27.0 ± 9.8 years, height = 170.9 ± 9.2 cm, mass = 72.4 ± 11.8 kg) with a heterogeneous history of lower extremity injury. Participants completed a single-limb-stance task on a force plate and the Star Excursion Balance Test (SEBT) during the first test session. Twelve Wii Fit balance activities were completed during 2 test sessions separated by 1 week. Postural sway in the anteroposterior (AP) and mediolateral (ML) directions and the AP, ML, and resultant center-of-pressure (COP) excursions were calculated from the single-limb stance. The normalized reach distance was recorded for the anterior, posteromedial, and posterolateral directions of the SEBT. Wii Fit balance scores that the game software generated also were recorded. All 96 of the calculated correlation coefficients among Wii Fit activity outcomes and established balance outcomes were interpreted as poor (r Wii Fit balance activity scores ranged from good (intraclass correlation coefficient [ICC] = 0.80) to poor (ICC = 0.39), with 8 activities having poor intrasession reliability. Similarly, 11 of the 12 Wii Fit balance activity scores demonstrated poor intersession reliability, with scores ranging from fair (ICC = 0.74) to poor (ICC = 0.29). Wii Fit balance activity scores had poor concurrent validity relative to COP outcomes and SEBT

  15. Sex recombination, and reproductive fitness: an experimental study using Paramecium

    Energy Technology Data Exchange (ETDEWEB)

    Nyberg, D.

    1982-08-01

    The effect of sex and recombination on reproductive fitness are measured using five wild stocks of Paramecium primaurelia. Among the wild stocks there were highly significant differences in growth rates. No hybrid had as low a fitness as the least fit parental stock. Recombination produced genotypes of higher fitness than those of either parent only in the cross between the two stocks of lowest fitness. The increase in variance of fitness as a result of recombination was almost exclusively attributable to the generation lines with low fitness. The fitness consequences of sexuality and mate choice were stock specific; some individuals leaving the most descendants by inbreeding, others by outcrossing. For most crosses the short-term advantage of sex, if any, accrue from the fusion of different gametes (hybrid vigor) and not from recombination. Since the homozygous genotype with the highest fitnes left the most progeny by inbreeding (no recombination), the persistence of conjugation in P. primaurelia is paradoxical. (JMT)

  16. Local fit evaluation of structural equation models using graphical criteria.

    Science.gov (United States)

    Thoemmes, Felix; Rosseel, Yves; Textor, Johannes

    2018-03-01

    Evaluation of model fit is critically important for every structural equation model (SEM), and sophisticated methods have been developed for this task. Among them are the χ² goodness-of-fit test, decomposition of the χ², derived measures like the popular root mean square error of approximation (RMSEA) or comparative fit index (CFI), or inspection of residuals or modification indices. Many of these methods provide a global approach to model fit evaluation: A single index is computed that quantifies the fit of the entire SEM to the data. In contrast, graphical criteria like d-separation or trek-separation allow derivation of implications that can be used for local fit evaluation, an approach that is hardly ever applied. We provide an overview of local fit evaluation from the viewpoint of SEM practitioners. In the presence of model misfit, local fit evaluation can potentially help in pinpointing where the problem with the model lies. For models that do fit the data, local tests can identify the parts of the model that are corroborated by the data. Local tests can also be conducted before a model is fitted at all, and they can be used even for models that are globally underidentified. We discuss appropriate statistical local tests, and provide applied examples. We also present novel software in R that automates this type of local fit evaluation. (PsycINFO Database Record (c) 2018 APA, all rights reserved).

  17. A kinematic fit method for all-photon events

    International Nuclear Information System (INIS)

    Du Shuxian; Yuan Changzheng; Chinese Academy of Sciences, Beijing

    2006-01-01

    An improved kinematic fit method is developed for analyzing all-photon events, where the interaction point is unknown. The fitting algorithm is checked with Monte Carlo samples to ensure that the fitting program works properly. This is applied to the Monte Carlo simulated ψ(2S) decays. A higher efficiency is achieved. This method can be generally applied to analyzing all-photon events at electron-positron collider. (authors)

  18. Differential fitness costs of reproduction between the sexes

    OpenAIRE

    Penn, Dustin J.; Smith, Ken R.

    2006-01-01

    Natural selection does not necessarily favor maximal reproduction because reproduction imposes fitness costs, reducing parental survival, and offspring quality. Here, we show that parents in a preindustrial population in North America incurred fitness costs from reproduction, and women incurred greater costs than men. We examined the survivorship and reproductive success (Darwinian fitness) of 21,684 couples married between 1860 and 1895 identified in the Utah Population Database. We found th...

  19. Sources of practice knowledge among Australian fitness trainers.

    Science.gov (United States)

    Bennie, Jason A; Wiesner, Glen H; van Uffelen, Jannique G Z; Harvey, Jack T; Biddle, Stuart J H

    2017-12-01

    Few studies have examined the sources of practice knowledge fitness trainers use to inform their training methods and update knowledge. This study aims to describe sources of practice knowledge among Australian fitness trainers. In July 2014, 9100 Australian fitness trainers were invited to complete an online survey. Respondents reported the frequency of use of eight sources of practice knowledge (e.g. fitness magazines, academic texts). In a separate survey, exercise science experts (n = 27) ranked each source as either (1) 'high-quality' or (2) 'low-quality'. Proportions of users of 'high-quality' sources were calculated across demographic (age, sex) and fitness industry-related characteristics (qualification, setting, role). A multivariate logistic regression analysis assessed the odds of being classified as a user of high-quality sources, adjusting for demographic and fitness industry-related factors. Out of 1185 fitness trainers (response rate = 13.0%), aged 17-72 years, 47.6% (95% CI, 44.7-50.4%) were classified as frequent users of high-quality sources of practice knowledge. In the adjusted analysis, compared to trainers aged 17-26 years, those aged ≥61 years (OR, 2.15; 95% CI, 1.05-4.38) and 40-50 years (OR, 1.54; 95% CI, 1.02-2.31) were more likely to be classified as a user of high-quality sources. When compared to trainers working in large centres, those working in outdoor settings (OR, 1.81; 95% CI, 1.23-2.65) and medium centres (OR, 1.59; 95% CI, 1.12-2.29) were more likely to be classified as users of high-quality sources. Our findings suggest that efforts should be made to improve the quality of knowledge acquisition among Australian fitness trainers.

  20. FINASTERIDE AS A TREATMENT FOR MALE ANDROGENETIC ALOPECIA

    Directory of Open Access Journals (Sweden)

    Ni Komang Tristiana Dewi

    2013-04-01

    Full Text Available Androgenetic alopecia (AGA is a type of alopecia non sikatrik that most often occur, especially in men. AGA is hereditary baldness and form distinctive patterns. Causes related to AGA estimated serum androgen levels, especially 5-?-dehydrotestosterone (DHT, which can lead to miniaturization of the hair follicle. Finasteride is one of drugs that proven effective in treating hair loss caused by AGA. Finasteride is a 4-azasteroid components that are competitive and specific inhibitor of the enzyme 5-?-reductase type II, an enzyme that converts testosteron into intracellular DHT. By inhibiting the enzyme 5-?-reductase type II, conversion of testosteron to DHT inhibited, thereby causing a significant decrease in serum and tissue DHT concentrations. The use of finasteride 1 mg per day proven to effectively treat AGA in men.  

  1. Measuring microbial fitness in a field reciprocal transplant experiment.

    Science.gov (United States)

    Boynton, Primrose J; Stelkens, Rike; Kowallik, Vienna; Greig, Duncan

    2017-05-01

    Microbial fitness is easy to measure in the laboratory, but difficult to measure in the field. Laboratory fitness assays make use of controlled conditions and genetically modified organisms, neither of which are available in the field. Among other applications, fitness assays can help researchers detect adaptation to different habitats or locations. We designed a competitive fitness assay to detect adaptation of Saccharomyces paradoxus isolates to the habitat they were isolated from (oak or larch leaf litter). The assay accurately measures relative fitness by tracking genotype frequency changes in the field using digital droplet PCR (DDPCR). We expected locally adapted S. paradoxus strains to increase in frequency over time when growing on the leaf litter type from which they were isolated. The DDPCR assay successfully detected fitness differences among S. paradoxus strains, but did not find a tendency for strains to be adapted to the habitat they were isolated from. Instead, we found that the natural alleles of the hexose transport gene we used to distinguish S. paradoxus strains had significant effects on fitness. The origin of a strain also affected its fitness: strains isolated from oak litter were generally fitter than strains from larch litter. Our results suggest that dispersal limitation and genetic drift shape S. paradoxus populations in the forest more than local selection does, although further research is needed to confirm this. Tracking genotype frequency changes using DDPCR is a practical and accurate microbial fitness assay for natural environments. © 2016 The Authors. Molecular Ecology Resources Published by John Wiley & Sons Ltd.

  2. Physical fitness in relation to transport to school in adolescents

    DEFF Research Database (Denmark)

    Andersen, Lars Bo; Lawlor, D A; Cooper, A R

    2008-01-01

    effects on fitness and, if so, whether different modes of transport affect different aspects of fitness. In this study, we examined the association of active transport with different aspects of fitness in a representative Danish sample of 545 boys and 704 girls, 15-19 years of age. Physical fitness...

  3. Facial attractiveness, symmetry, and physical fitness in young women.

    Science.gov (United States)

    Hönekopp, Johannes; Bartholomé, Tobias; Jansen, Gregor

    2004-06-01

    This study explores the evolutionary-based hypothesis that facial attractiveness (a guiding force in mate selection) is a cue for physical fitness (presumably an important contributor to mate value in ancestral times). Since fluctuating asymmetry, a measure of developmental stability, is known to be a valid cue for fitness in several biological domains, we scrutinized facial asymmetry as a potential mediator between attractiveness and fitness. In our sample of young women, facial beauty indeed indicated physical fitness. The relationships that pertained to asymmetry were in the expected direction. However, a closer analysis revealed that facial asymmetry did not mediate the relationship between fitness and attractiveness. Unexpected problems regarding the measurement of facial asymmetry are discussed.

  4. Development of physical fitness in children with intellectual disabilities

    NARCIS (Netherlands)

    Hartman, Esther; Smith, J.; Westendorp, M.; Visscher, C.

    BackgroundFew studies examined the development of physical fitness in children and youth with intellectual disabilities (ID), but the developmental patterns of physical fitness are largely unknown. The first aim was to examine physical fitness of primary school children with ID, aged 8-12, and

  5. Pre-processing by data augmentation for improved ellipse fitting.

    Science.gov (United States)

    Kumar, Pankaj; Belchamber, Erika R; Miklavcic, Stanley J

    2018-01-01

    Ellipse fitting is a highly researched and mature topic. Surprisingly, however, no existing method has thus far considered the data point eccentricity in its ellipse fitting procedure. Here, we introduce the concept of eccentricity of a data point, in analogy with the idea of ellipse eccentricity. We then show empirically that, irrespective of ellipse fitting method used, the root mean square error (RMSE) of a fit increases with the eccentricity of the data point set. The main contribution of the paper is based on the hypothesis that if the data point set were pre-processed to strategically add additional data points in regions of high eccentricity, then the quality of a fit could be improved. Conditional validity of this hypothesis is demonstrated mathematically using a model scenario. Based on this confirmation we propose an algorithm that pre-processes the data so that data points with high eccentricity are replicated. The improvement of ellipse fitting is then demonstrated empirically in real-world application of 3D reconstruction of a plant root system for phenotypic analysis. The degree of improvement for different underlying ellipse fitting methods as a function of data noise level is also analysed. We show that almost every method tested, irrespective of whether it minimizes algebraic error or geometric error, shows improvement in the fit following data augmentation using the proposed pre-processing algorithm.

  6. Evaluation of peak-fitting software for gamma spectrum analysis

    International Nuclear Information System (INIS)

    Zahn, Guilherme S.; Genezini, Frederico A.; Moralles, Mauricio

    2009-01-01

    In all applications of gamma-ray spectroscopy, one of the most important and delicate parts of the data analysis is the fitting of the gamma-ray spectra, where information as the number of counts, the position of the centroid and the width, for instance, are associated with each peak of each spectrum. There's a huge choice of computer programs that perform this type of analysis, and the most commonly used in routine work are the ones that automatically locate and fit the peaks; this fit can be made in several different ways - the most common ways are to fit a Gaussian function to each peak or simply to integrate the area under the peak, but some software go far beyond and include several small corrections to the simple Gaussian peak function, in order to compensate for secondary effects. In this work several gamma-ray spectroscopy software are compared in the task of finding and fitting the gamma-ray peaks in spectra taken with standard sources of 137 Cs, 60 Co, 133 Ba and 152 Eu. The results show that all of the automatic software can be properly used in the task of finding and fitting peaks, with the exception of GammaVision; also, it was possible to verify that the automatic peak-fitting software did perform as well as - and sometimes even better than - a manual peak-fitting software. (author)

  7. Induced subgraph searching for geometric model fitting

    Science.gov (United States)

    Xiao, Fan; Xiao, Guobao; Yan, Yan; Wang, Xing; Wang, Hanzi

    2017-11-01

    In this paper, we propose a novel model fitting method based on graphs to fit and segment multiple-structure data. In the graph constructed on data, each model instance is represented as an induced subgraph. Following the idea of pursuing the maximum consensus, the multiple geometric model fitting problem is formulated as searching for a set of induced subgraphs including the maximum union set of vertices. After the generation and refinement of the induced subgraphs that represent the model hypotheses, the searching process is conducted on the "qualified" subgraphs. Multiple model instances can be simultaneously estimated by solving a converted problem. Then, we introduce the energy evaluation function to determine the number of model instances in data. The proposed method is able to effectively estimate the number and the parameters of model instances in data severely corrupted by outliers and noises. Experimental results on synthetic data and real images validate the favorable performance of the proposed method compared with several state-of-the-art fitting methods.

  8. Blood Plasma-Derived Anti-Glycan Antibodies to Sialylated and Sulfated Glycans Identify Ovarian Cancer Patients.

    Science.gov (United States)

    Pochechueva, Tatiana; Chinarev, Alexander; Schoetzau, Andreas; Fedier, André; Bovin, Nicolai V; Hacker, Neville F; Jacob, Francis; Heinzelmann-Schwarz, Viola

    2016-01-01

    Altered levels of naturally occurring anti-glycan antibodies (AGA) circulating in human blood plasma are found in different pathologies including cancer. Here the levels of AGA directed against 22 negatively charged (sialylated and sulfated) glycans were assessed in high-grade serous ovarian cancer (HGSOC, n = 22) patients and benign controls (n = 31) using our previously developed suspension glycan array (SGA). Specifically, the ability of AGA to differentiate between controls and HGSOC, the most common and aggressive type of ovarian cancer with a poor outcome was determined. Results were compared to CA125, the commonly used ovarian cancer biomarker. AGA to seven glycans that significantly (P<0.05) differentiated between HGSOC and control were identified: AGA to top candidates SiaTn and 6-OSulfo-TF (both IgM) differentiated comparably to CA125. The area under the curve (AUC) of a panel of AGA to 5 glycans (SiaTn, 6-OSulfo-TF, 6-OSulfo-LN, SiaLea, and GM2) (0.878) was comparable to CA125 (0.864), but it markedly increased (0.985) when combined with CA125. AGA to SiaTn and 6-OSulfo-TF were also valuable predictors for HGSOC when CA125 values appeared inconclusive, i.e. were below a certain threshold. AGA-glycan binding was in some cases isotype-dependent and sensitive to glycosidic linkage switch (α2-6 vs. α2-3), to sialylation, and to sulfation of the glycans. In conclusion, plasma-derived AGA to sialylated and sulfated glycans including SiaTn and 6-OSulfo-TF detected by SGA present a valuable alternative to CA125 for differentiating controls from HGSOC patients and for predicting the likelihood of HGSOC, and may be potential HGSOC tumor markers.

  9. Verifying operator fitness - an imperative not an option

    International Nuclear Information System (INIS)

    Scott, A.B. Jr.

    1987-01-01

    In the early morning hours of April 26, 1986, whatever credence those who operate nuclear power plants around the world could then muster, suffered a jarring reversal. Through an incredible series of personal errors, the operators at what was later to be termed one of the best operated plants in the USSR systematically stripped away the physical and procedural safeguards inherent to their installation and precipitated the worst reactor accident the world has yet seen. This challenge to the adequacy of nuclear operators comes at a time when many companies throughout the world - not only those that involve nuclear power - are grappling with the problem of how to assure the fitness for duty of those in their employ, specifically those users of substances that have an impact on the ability to function safely and productively in the workplace. In actuality, operator fitness for duty is far more than the lack of impairment from substance abuse, which many today consider it. Full fitness for duty implies mental and moral fitness, as well, and physical fitness in a more general sense. If we are to earn the confidence of the public, credible ways to verify total fitness on an operator-by-operator basis must be considered

  10. ALFA: an automated line fitting algorithm

    Science.gov (United States)

    Wesson, R.

    2016-03-01

    I present the automated line fitting algorithm, ALFA, a new code which can fit emission line spectra of arbitrary wavelength coverage and resolution, fully automatically. In contrast to traditional emission line fitting methods which require the identification of spectral features suspected to be emission lines, ALFA instead uses a list of lines which are expected to be present to construct a synthetic spectrum. The parameters used to construct the synthetic spectrum are optimized by means of a genetic algorithm. Uncertainties are estimated using the noise structure of the residuals. An emission line spectrum containing several hundred lines can be fitted in a few seconds using a single processor of a typical contemporary desktop or laptop PC. I show that the results are in excellent agreement with those measured manually for a number of spectra. Where discrepancies exist, the manually measured fluxes are found to be less accurate than those returned by ALFA. Together with the code NEAT, ALFA provides a powerful way to rapidly extract physical information from observations, an increasingly vital function in the era of highly multiplexed spectroscopy. The two codes can deliver a reliable and comprehensive analysis of very large data sets in a few hours with little or no user interaction.

  11. Driver fitness medical guidelines.

    Science.gov (United States)

    2009-09-01

    This guide provides guidance to assist licensing agencies in making decisions about an individuals fitness for driving. This is the first attempt to produce a consolidated document covering medical conditions included in the task agreement between...

  12. Exertional and CrossFit-Induced Rhabdomyolysis.

    Science.gov (United States)

    Meyer, Michelle; Sundaram, Sneha; Schafhalter-Zoppoth, Ingeborg

    2017-07-14

    Few publications of exercise-induced rhabomyolysis currently exist in the medical literature besides case reports. However, this condition can be severe, resulting in hospitalization and IV fluid administration to prevent serious sequelae. This report describes a case of exercise-induced rhabdomyolysis caused by a CrossFit workout. A 31-year-old female presented with 2 days of bilateral upper extremity pain and soreness, which began 2 days after she completed a CrossFit workout. Workup revealed an elevated creatine phosphokinase (CPK) of 18 441 U/L, consistent with exercise-induced rhabdomyolysis, and elevated liver function tests and elevated D-dimer, although her renal function was normal. She was hospitalized for 2 days and treated with IV fluids. This case report demonstrates that CrossFit exercises can lead to rhabdomyolysis, highlighting a condition that may be underdiagnosed and underreported.

  13. Least Squares Data Fitting with Applications

    DEFF Research Database (Denmark)

    Hansen, Per Christian; Pereyra, Víctor; Scherer, Godela

    As one of the classical statistical regression techniques, and often the first to be taught to new students, least squares fitting can be a very effective tool in data analysis. Given measured data, we establish a relationship between independent and dependent variables so that we can use the data....... In a number of applications, the accuracy and efficiency of the least squares fit is central, and Per Christian Hansen, Víctor Pereyra, and Godela Scherer survey modern computational methods and illustrate them in fields ranging from engineering and environmental sciences to geophysics. Anyone working...... with problems of linear and nonlinear least squares fitting will find this book invaluable as a hands-on guide, with accessible text and carefully explained problems. Included are • an overview of computational methods together with their properties and advantages • topics from statistical regression analysis...

  14. The Meaning of Goodness-of-Fit Tests: Commentary on "Goodness-of-Fit Assessment of Item Response Theory Models"

    Science.gov (United States)

    Thissen, David

    2013-01-01

    In this commentary, David Thissen states that "Goodness-of-fit assessment for IRT models is maturing; it has come a long way from zero." Thissen then references prior works on "goodness of fit" in the index of Lord and Novick's (1968) classic text; Yen (1984); Drasgow, Levine, Tsien, Williams, and Mead (1995); Chen and…

  15. Person-Organization Fit and Research on Instruction

    Science.gov (United States)

    Youngs, Peter; Pogodzinski, Ben; Grogan, Erin; Perrone, Frank

    2015-01-01

    Research from industrial and organizational (I-O) psychology indicates that outside of K-12 education, employees' sense of fit with their organizations is often associated with job satisfaction, performance, commitment, and retention. Person-organization (P-O) fit has been conceptualized as the degree of congruence between an…

  16. A Comparison of the US Air Force Fitness Test and Sister Services’ Combat-Oriented Fitness Tests

    Science.gov (United States)

    2009-03-01

    their status quo. These changes included changing their road runs into 400- to 800- meter (m) interval training, reducing their test run distance from 5...sleep were recorded throughout the operation. Measures of fitness were the isokinetic strength of the arms and legs, isometric handgrip strength...JIT = Just-In-Time (training) km = kilometer MANUF = Maneuver-Under-Fire (drill within the CFT) MFTC = Master Fitness Trainer Course m = meter

  17. The impact of fit manufacturing on green manufacturing: A review

    Science.gov (United States)

    Qi, Ang Nian; Sin, Tan Chan; Fathullah, M.; Lee, C. C.

    2017-09-01

    Fit manufacturing and Green manufacturing are a new trend principle and concept. They are getting popular in industrial. This paper is identifying the impact between Fit manufacturing and Green manufacturing. Besides Fit manufacturing, Lean manufacturing, Agile manufacturing and Sustainable manufacturing gives big impacts to Green Manufacturing. On top of that, this paper also discuss the benefits of applying Fit manufacturing and Green manufacturing in industrial as well as environment. Hence, applications of Fit manufacturing and Green Manufacturing are increasing year by year.

  18. Investigation into the Factors that Dtermine Shoe Fitting Using MRI

    OpenAIRE

    吉田, 宏昭

    2014-01-01

    It is essential to purchase suitable shoes that fit the size of users' feet in order to prevent foot injuries in daily life. Although shoe fitting significantly affects the performance of shoes, there are few studies that have either investigated the factors that control shoe fitting or established a method to evaluate shoe fitting. While, the shape of each foot and shoe was measured to estimate shoe fitting in previous studies, the deformation of feet when wearing shoes had not been taken in...

  19. Rõve kuubis, aga... / Tiit Tuumalu

    Index Scriptorium Estoniae

    Tuumalu, Tiit, 1971-

    2006-01-01

    Dokumentaalfilm "Aristokraadid", kus ühte roppu habemega anekdooti jutustavad meelelahutustööstusest tuntud tegijad : režissöör Paul Provenza : Ameerika Ühendriigid 2006. Filmi näitab Tallinna Kinomaja

  20. Usalda, aga kontrolli / Manuela Pihlap

    Index Scriptorium Estoniae

    Pihlap, Manuela

    2008-01-01

    Uuest isikuandmete kaitse seadusest. Ilmunud ka Harju Ekspress 22. veeb. 2008, lk. 6 ; Meie Maa 26. veeb. 2008, lk. 2 ; Pärnu Postimees 28. veeb. 2008, lk. 15 ; LõunaLeht 28. veeb. 2008, lk. 4 ; Valgamaalane 28. veeb. 2008, lk. 2