Directory of Open Access Journals (Sweden)
Rosario Pignatello
2012-01-01
Full Text Available Bone-seeking (osteotropic drug delivery systems (ODDS represent an interesting solution for targeting different types of drugs to the bones. In particular, anticancer and antibacterial agents could take advantage of such therapeutic strategy. We have recently developed an innovative approach to this aim: a new osteotropic biomaterial was prepared, based on the conjugation of a poly(lactide-co-glycolide (PLGA with the bisphosphonate drug alendronate (PLGA-ALE; its hemo- and cytocompatibility were verified. Starting with this copolymer, an osteotropic nanoparticle system (NP was produced for the targeted delivery of antineoplastic drugs to osteolytic bone metastases; in particular, doxorubicin was tested as a model drug. The in vitro and in vivo results of the new ODDS are validated in this article. All the experimental data confirmed that the drug retained its activity after loading in the PLGA-ALE NP; they can be thus considered a new promising strategy for active targeting of drugs to bone tissues in different pathological situations.
DEFF Research Database (Denmark)
Cox, T.R.; Schoof, Erwin; Gartland, A.
2015-01-01
secretomes are known to be active mediators of both local and distant host cells and play an important role in the progression and dissemination of cancer. Here we have quantitatively profiled both the composition of breast cancer secretomes associated with osteotropism, and their modulation under normoxic...... and hypoxic conditions. We detect and quantify 162 secretome proteins across all conditions which show differential hypoxic induction and association with osteotropism. Mass Spectrometry proteomics data have been deposited to the ProteomeXchange Consortium with the dataset identifier PXD000397...
Comparative investigations of osteotropic radionuclides. Pt. 4
International Nuclear Information System (INIS)
Creutzig, H.; Gerdts, K.G.; Creutzig, A.
1977-01-01
The dynamics of uptake of osteotropic radionucleides in normal and abnormal bone were studied by means of sequential and functional scans. Various phosphate and phosphonate complexes were compared in vivo and in vitro. Only phosphonates were considered as suitable for bone scanning. In normal bones in beagles, radioactivity after HEDP fell to 65% after two hours, but was 105% with 18 F. In relation to healing fractures, the curves differ quantitatively and qualitatively. In this situation, functional curves derived from dynamic scans provide a better parallel with histological findings than does static scintigraphy with an uptake quotient. Sequential and functional scannung are able to document the therapeutic effect of irradiation of bone metastases. (orig.) [de
Directory of Open Access Journals (Sweden)
Thomas R. Cox
2015-12-01
Full Text Available The cancer secretome includes all of the macromolecules secreted by cells into their microenvironment. Cancer cell secretomes are significantly different to that of normal cells reflecting the changes that normal cells have undergone during their transition to malignancy. More importantly, cancer secretomes are known to be active mediators of both local and distant host cells and play an important role in the progression and dissemination of cancer. Here we have quantitatively profiled both the composition of breast cancer secretomes associated with osteotropism, and their modulation under normoxic and hypoxic conditions. We detect and quantify 162 secretome proteins across all conditions which show differential hypoxic induction and association with osteotropism. Mass Spectrometry proteomics data have been deposited to the ProteomeXchange Consortium with the dataset identifier PXD000397 and the complete proteomic, bioinformatic and biological analyses are reported in Cox et al. (2015 [1].
Effects of osteotropic hormones on the nitric oxide production in culture of ROS17/2.8 cells
International Nuclear Information System (INIS)
Ko, Seon Yil; Kim, Min Sung; Han, Won Jeong; Kim, Se Won; Kim, Jung Keun
2005-01-01
We performed the present study to investigate whether osteotropic hormones play roles on the nitric oxide (NO) production in culture of ROS17/2.8 osteoblastic cells. The osteoblastic cell line ROS17/2.8 cells were cultured in F12 medium supplemented with 5% fetal bovine serum (FBS) at 37.deg. C in a humidified atmosphere of 5% CO 2 in air. ROS17/2.8 cells were plated in 96-well plants at a density of 2-3 x 10 3 cells/well and grown to confluence. Then the cells were pretreated with osteotropic hormones (parathyroid hormone (PTH) 20-500 ng/mL, 1, 25-dihydroxycholecalciferol (1, 25[OH] 2 D 3 ) 1-100nM ; prostaglandin E 2 (PGE 2 ) 20-500 ng/mL) in the medium supplemented with 0.4% FBS for (72 hours and the cells were treated with cytokines (TNFα and IFNγ) in phenol red-free F12 medium for an additional 48 hours. NO synthesis was assessed by measuring the nitrite anion concentration, the reation product of NO, in the cell culture medium using Griess reagent. PTH and 1, 25[OH] 2 D 4 pretreatment induced a significant increase in NO production in the presence of TNFα and IFNγ. PGE 2 slightly induced NO production compared to the control group. But, PGE 2 pretreatment did not affect in NO production in the presence of TNFα and IFNγ. These results suggest that the actions of osteotropic hormones in bone metabolism may be partially mediated by NO in the presence of cytokines
Combined effect of 131I and osteotropic radionuclide of 90Sr and 45Ca
International Nuclear Information System (INIS)
Borisova, V.V.; Vetukh, V.A.; Rusanova, O.V.
1988-01-01
Combined effect of 131 I and osteotropic 45 Ca and 90 Sr on blood formation, reproduction and life span of laboratory animals was considered. It was shown that combined irradiation of thyroid and bone marrow with doses not exceeding or equal 1 Gy doesn't result in changes of blood formation or life span, but leads to definite violations in stem spermatogonia which bring about intra-uterine death of progeny. This fact is explained as a result of indirect radiation effect for the dose for gonads was 0.1 Gy. 3 tabs
Heparin-binding epidermal growth factor-like growth factor promotes neuroblastoma differentiation.
Gaviglio, Angela L; Knelson, Erik H; Blobe, Gerard C
2017-05-01
High-risk neuroblastoma is characterized by undifferentiated neuroblasts and low schwannian stroma content. The tumor stroma contributes to the suppression of tumor growth by releasing soluble factors that promote neuroblast differentiation. Here we identify heparin-binding epidermal growth factor-like growth factor (HBEGF) as a potent prodifferentiating factor in neuroblastoma. HBEGF mRNA expression is decreased in human neuroblastoma tumors compared with benign tumors, with loss correlating with decreased survival. HBEGF protein is expressed only in stromal compartments of human neuroblastoma specimens, with tissue from high-stage disease containing very little stroma or HBEGF expression. In 3 human neuroblastoma cell lines (SK-N-AS, SK-N-BE2, and SH-SY5Y), soluble HBEGF is sufficient to promote neuroblast differentiation and decrease proliferation. Heparan sulfate proteoglycans and heparin derivatives further enhance HBEGF-induced differentiation by forming a complex with the epidermal growth factor receptor, leading to activation of the ERK1/2 and STAT3 pathways and up-regulation of the inhibitor of DNA binding transcription factor. These data support a role for loss of HBEGF in the neuroblastoma tumor microenvironment in neuroblastoma pathogenesis.-Gaviglio, A. L., Knelson, E. H., Blobe, G. C. Heparin-binding epidermal growth factor-like growth factor promotes neuroblastoma differentiation. © FASEB.
TALE factors poise promoters for activation by Hox proteins.
Choe, Seong-Kyu; Ladam, Franck; Sagerström, Charles G
2014-01-27
Hox proteins form complexes with TALE cofactors from the Pbx and Prep/Meis families to control transcription, but it remains unclear how Hox:TALE complexes function. Examining a Hoxb1b:TALE complex that regulates zebrafish hoxb1a transcription, we find maternally deposited TALE proteins at the hoxb1a promoter already during blastula stages. These TALE factors recruit histone-modifying enzymes to promote an active chromatin profile at the hoxb1a promoter and also recruit RNA polymerase II (RNAPII) and P-TEFb. However, in the presence of TALE factors, RNAPII remains phosphorylated on serine 5 and hoxb1a transcription is inefficient. By gastrula stages, Hoxb1b binds together with TALE factors to the hoxb1a promoter. This triggers P-TEFb-mediated transitioning of RNAPII to the serine 2-phosphorylated form and efficient hoxb1a transcription. We conclude that TALE factors access promoters during early embryogenesis to poise them for activation but that Hox proteins are required to trigger efficient transcription. Copyright © 2014 Elsevier Inc. All rights reserved.
Sigma factors and promoters in Corynebacterium glutamicum
Czech Academy of Sciences Publication Activity Database
Pátek, Miroslav; Nešvera, Jan
2011-01-01
Roč. 154, 2-3 (2011), s. 101-113 ISSN 0168-1656 R&D Projects: GA ČR GC204/09/J015 Institutional research plan: CEZ:AV0Z50200510 Keywords : Corynebacterium glutamicum * Sigma factors * Promoters Subject RIV: EE - Microbiology, Virology Impact factor: 3.045, year: 2011
Calonge, María Julia; Seoane, Joan; Massagué, Joan
2004-05-28
A critical component of the epidermal basement membrane, collagen type VII, is produced by keratinocytes and fibroblasts, and its production is stimulated by the cytokine transforming growth factor-beta (TGF-beta). The gene, COL7A1, is activated by TGF-beta via Smad transcription factors in cooperation with AP1. Here we report a previously unsuspected level of complexity in this regulatory process. We provide evidence that TGF-beta may activate the COL7A1 promoter by two distinct inputs operating through a common region of the promoter. One input is provided by TGF-beta-induced Smad complexes via two Smad binding elements that function redundantly depending on the cell type. The second input is provided by relieving the COL7A1 promoter from chicken ovalbumin upstream promoter transcription factor (COUP-TF)-mediated transcriptional repression. We identified COUP-TFI and -TFII as factors that bind to the TGF-beta-responsive region of the COL7A1 promoter in an expression library screening. COUP-TFs bind to a site between the two Smad binding elements independently of Smad or AP1 and repress the basal and TGF-beta-stimulated activities of this promoter. We provide evidence that endogenous COUP-TF activity represses the COL7A1 promoter. Furthermore, we show that TGF-beta addition causes a rapid and profound down-regulation of COUP-TF expression in keratinocytes and fibroblasts. The results suggest that TGF-beta signaling may exert tight control over COL7A1 by offsetting the balance between opposing Smad and COUP-TFs.
Effects of growth-promoting factors on proliferation of mouse ...
African Journals Online (AJOL)
SSCs) in vitro are critical to our understanding of male infertility, genetic resources and endangered species conservation. To investigate the effects of growth-promoting factors, epidermal growth factor (EGF), insulin-like growth factor-1 (IGF-1) and ...
Huijg, Johanna M; Gebhardt, Winifred A; Verheijden, Marieke W; van der Zouwe, Nicolette; de Vries, Juriena D; Middelkoop, Barend J C; Crone, Mathilde R
2015-02-01
Despite the promising findings related to the efficacy of interventions aimed at promoting physical activity (PA) in primary health care (PHC), the translation of these interventions to PHC practice does not always happen as desired. To help understand why efficacious PHC-based PA interventions are not effectively translated to practice, this study systematically reviewed the literature on factors influencing PHC professionals' PA promotion practices. Literature searches were conducted in Web of Science, PubMed, and PsycINFO for peer-reviewed articles published in English from 1990 onwards. Studies were included that met the following criteria: (1) involving PHC-based PA interventions, and (2) reporting factors influencing PHC professionals' PA promotion behaviors. Two researchers independently screened studies and extracted data. A narrative synthesis using thematic analysis was conducted to identify factors. Of the 4,469 identified articles, 59 were included in the review. Factors were identified by qualitative methods, barrier/facilitator ratings, and the examination of the relationship between factors and PA promotion, and the effectiveness of introduction strategies. Many factors related to the development, delivery, and effects of the innovation, the sociopolitical and organizational culture, resources, and support, patient and PHC professional characteristics, and innovation strategies were identified as potential influences on PHC professionals' PA promotion practices. However, the lack of evidence on the relationship between factors and PA promotion indicated insufficient evidence on PA promotion determinants. This extensive overview of potential factors can inform intervention developers and implementers on which factors may play a role when introducing PA interventions in PHC. Future research should further investigate relationships between factors and PA promotion, which should be guided by qualitative in-depth knowledge on influencing factors.
Effects of growth-promoting factors on proliferation of mouse ...
African Journals Online (AJOL)
AJL
2012-02-16
Feb 16, 2012 ... Key words: Growth-promoting factors, mouse spermatogonial stem cells (SSCs), proliferation. INTRODUCTION ... insulin-like growth factor-1 (IGF-1) can stimulate mitotic ...... A Model for Analysis of Spermatogenesis. Zool. Sci.
Nuclear factor ETF specifically stimulates transcription from promoters without a TATA box.
Kageyama, R; Merlino, G T; Pastan, I
1989-09-15
Transcription factor ETF stimulates the expression of the epidermal growth factor receptor (EGFR) gene which does not have a TATA box in the promoter region. Here, we show that ETF recognizes various GC-rich sequences including stretches of deoxycytidine or deoxyguanosine residues and GC boxes with similar affinities. ETF also binds to TATA boxes but with a lower affinity. ETF stimulated in vitro transcription from several promoters without TATA boxes but had little or no effect on TATA box-containing promoters even though they had strong ETF-binding sites. These inactive ETF-binding sites became functional when placed upstream of the EGFR promoter whose own ETF-binding sites were removed. Furthermore, when a TATA box was introduced into the EGFR promoter, the responsiveness to ETF was abolished. These results indicate that ETF is a specific transcription factor for promoters which do not contain TATA elements.
Embryogenesis-promoting factors in rat serum.
Katoh, M; Kimura, R; Shoji, R
1998-06-15
Regarding whole rat embryo cultures in vitro, rat serum as a culture medium is known to support the normal growth of rat embryos in the organogenesis phase. The purpose of the present study was to isolate the embryogenesis-promoting factors from rat serum as a first step in the development of a defined serum-free medium for a whole embryo culture system. Pooled rat serum after heat inactivation was fractionated into three major peaks (frA, containing a region of void volume, frB, and frC) by gel filtration. The 9.5-day rat embryos that were cultivated for 48 hr in essential salt medium containing frB (with a molecular size range of 100-500 kDa) revealed normal growth. Three proteins (27 kDa, 76 kDa, and 190 kDa) that had the embryogenesis-promoting effects were isolated from 3-hr delayed centrifuged rat serum by the ion exchange chromatography. The 76-kDa protein was found to be rat transferrin by immunoblotting. The 27-kDa protein was identified as apo-AI (the major apoprotein of high-density lipoprotein) by immunoblotting. High-density lipoprotein obtained from pooled rat serum by a NaBr density gradient ultracentrifugation was found to have a positive effect on embryogenesis. The 10-kDa protein was also identified as alpha 1-inhibitor 3 by immunoblotting. In addition, the embryogenesis-promoting effect of the fraction containing 27-kDa and 190-kDa proteins declined within a short period of storage at -20 degrees C. This decrease was countered by supplementing its fraction (D-2) with albumin isolated from rat serum. These results in the present study suggest that transferrin, high-density lipoprotein, and alpha 1-inhibitor 3 in rat serum may be embryogenesis-promoting factors, and that albumin appeared to play a role in the embryogenesis of rat embryos in whole embryo cultures.
Psychosocial factors and mental health in cancer patients: opportunities for health promotion
Boer, Henk; Elving, Wim; Seydel, Erwin
1998-01-01
A first step in planning health promotion with respect to mental health is analysing the factors that influence mental health. Diagnosis of the relevant variables may contribute to the design of effective health promotion programmes. In this paper the relationship between psychosocial factors and
Epidemiological factors that promote the development of severe ...
African Journals Online (AJOL)
... that promote the development of severe malaria anaemia in children in Ibadan. ... and epidemiological factors that affect the development of malaria anaemia. ... of parents or guardians to fever in the children;parents\\' preoccupation with ...
Pro-tumorigenic effects of transforming growth factor beta 1 in canine osteosarcoma.
Portela, R F; Fadl-Alla, B A; Pondenis, H C; Byrum, M L; Garrett, L D; Wycislo, K L; Borst, L B; Fan, T M
2014-01-01
Transforming growth factor beta 1 (TGFβ1) is a pleiotropic cytokine that contributes to reparative skeletal remodeling by inducing osteoblast proliferation, migration, and angiogenesis. Organic bone matrix is the largest bodily reservoir for latent TGFβ1, and active osteoblasts express cognate receptors for TGFβ1 (TGFβRI and TGFβRII). During malignant osteolysis, TGFβ1 is liberated from eroded bone matrix and promotes local progression of osteotropic solid tumors by its mitogenic and prosurvival activities. Canine osteosarcoma (OS) cells will possess TGFβ1 signaling machinery. Blockade of TGFβ1 signaling will attenuate pro-tumorigenic activities in OS cells. Naturally occurring primary OS samples will express cognate TGFβ1 receptors; and in dogs with OS, focal malignant osteolysis will contribute to circulating TGFβ1 concentrations. Thirty-three dogs with appendicular OS. Expression of TGFβ1 and its cognate receptors, as well as the biologic effects of TGFβ1 blockade, was characterized in OS cells. Ten spontaneous OS samples were characterized for TGFβRI/II expressions by immunohistochemistry. In 33 dogs with OS, plasma TGFβ1 concentrations were quantified and correlated with bone resorption. Canine OS cells secrete TGFβ1, express cognate receptors, and TGFβ1 signaling blockade decreases proliferation, migration, and vascular endothelial growth factor secretion. Naturally occurring OS samples abundantly and uniformly express TGFβRI/II, and in OS-bearing dogs, circulating TGFβ1 concentrations correlate with urine N-telopeptide excretion. Canine OS cells possess TGFβ1 signaling machinery, potentially allowing for the establishment of an autocrine and paracrine pro-tumorigenic signaling loop. As such, TGFβ1 inhibitors might impede localized OS progression in dogs. Copyright © 2014 by the American College of Veterinary Internal Medicine.
The Relevant Factors in Promoting Reading Activities in Elementary Schools
Huang, Han-Chen; Tsai, Yao-Hsu; Huang, Shih-Hsiang
2015-01-01
In order to help students absorb knowledge, schools often conduct reading activities. Thorough planning and strategies, however, are needed to insure the effect of reading promotions, and make them a deeply-rooted part of life. This study adopted the analytic hierarchy process (AHP) to discuss the relevant factors in promoting reading activities…
Regulation of the human ADAMTS-4 promoter by transcription factors and cytokines
International Nuclear Information System (INIS)
Thirunavukkarasu, Kannan; Pei, Yong; Moore, Terry L.; Wang, He; Yu, Xiao-peng; Geiser, Andrew G.; Chandrasekhar, Srinivasan
2006-01-01
ADAMTS-4 (aggrecanase-1) is a metalloprotease that plays a role in aggrecan degradation in the cartilage extracellular matrix. In order to understand the regulation of ADAMTS-4 gene expression we have cloned and characterized a functional 4.5 kb human ADAMTS-4 promoter. Sequence analysis of the promoter revealed the presence of putative binding sites for nuclear factor of activated T cells (NFAT) and Runx family of transcription factors that are known to regulate chondrocyte maturation and differentiation. Using promoter-reporter assays and mRNA analysis we have analyzed the role of chondrocyte-expressed transcription factors NFATp and Runx2 and have shown that ADAMTS-4 is a potential downstream target of these two factors. Our results suggest that inhibition of the expression/function of NFATp and/or Runx2 may enable us to modulate aggrecan degradation in normal physiology and/or in degenerative joint diseases. The ADAMTS-4 promoter would serve as a valuable mechanistic tool to better understand the regulation of ADAMTS-4 expression by signaling pathways that modulate cartilage matrix breakdown
Directory of Open Access Journals (Sweden)
Emma L Smith
Full Text Available Transforming growth factor-beta3 (TGF-β3 and 1α,25-dihydroxyvitamin D3 (1α,25 (OH 2D3 are essential factors in chondrogenesis and osteogenesis respectively. These factors also play a fundamental role in the developmental processes and the maintenance of skeletal integrity, but their respective direct effects on these processes are not fully understood. Using an organotypic bone rudiment culture system the current study has examined the direct roles the osteotropic factors 1α,25 (OH2D3 and TGF-β3 exert on the development and modulation of the three dimensional structure of the embryonic femur. Isolated embryonic chick femurs (E11 were organotypically cultured for 10 days in basal media, or basal media supplemented with either 1α,25 (OH 2D3 (25 nM or TGF-β3 (5 ng/mL & 15 ng/mL. Analyses of the femurs were undertaken using micro-computed tomography (μCT, histology and immunohistochemistry. 1α,25 (OH2D3 supplemented cultures enhanced osteogenesis directly in the developing femurs with elevated levels of osteogenic markers such as type 1 collagen. In marked contrast organotypic femur cultures supplemented with TGF-β3 (5 ng/mL & 15 ng/mL demonstrated enhanced chondrogenesis with a reduction in osteogenesis. These studies demonstrate the efficacy of the ex vivo organotypic embryonic femur culture employed to elucidate the direct roles of these molecules, 1α,25 (OH 2D3 and TGF-β3 on the structural development of embryonic bone within a three dimensional framework. We conclude that 1α,25(OH2D and TGF-β3 modify directly the various cell populations in bone rudiment organotypic cultures effecting tissue metabolism resulting in significant changes in embryonic bone growth and modulation. Understanding the roles of osteotropic agents in the process of skeletal development is integral to developing new strategies for the recapitulation of bone tissue in later life.
Structure of Vibrio cholerae ribosome hibernation promoting factor
International Nuclear Information System (INIS)
De Bari, Heather; Berry, Edward A.
2013-01-01
The X-ray crystal structure of ribosome hibernation promoting factor from V. cholerae has been determined at 2.0 Å resolution. The crystal was phased by two-wavelength MAD using cocrystallized cobalt. The X-ray crystal structure of ribosome hibernation promoting factor (HPF) from Vibrio cholerae is presented at 2.0 Å resolution. The crystal was phased by two-wavelength MAD using cocrystallized cobalt. The asymmetric unit contained two molecules of HPF linked by four Co atoms. The metal-binding sites observed in the crystal are probably not related to biological function. The structure of HPF has a typical β–α–β–β–β–α fold consistent with previous structures of YfiA and HPF from Escherichia coli. Comparison of the new structure with that of HPF from E. coli bound to the Thermus thermophilus ribosome [Polikanov et al. (2012 ▶), Science, 336, 915–918] shows that no significant structural changes are induced in HPF by binding
International Nuclear Information System (INIS)
Ko, Jong Kyung; Kwon, Duk Mun; Kang, Yeong Han
2009-01-01
The purpose of this study was to analyze factors that could affect health of radiological technologists, which is useful for health care and development of programs for health promotion. Subjects were 234 of radiological technologists who work in general hospitals. Some questionnaires were made about perceptions of health condition and promotional behavior of health for this study. The questionnaires of health perception were 20 items that consist of the present condition of health, health concern and sensitivity. The reliability was sufficient(Cronbach's α=0.79). The other questionnaires about health promotion behavior were 47 items that consist of self-realization, health responsibility, exercise, nutrition, personal relationships, and stress management. The results turned out to be was sufficient (Cronbach's α=0.93). Every data was treated statistically, comparison of average(t-test, ANOVA), correlation, and multiple regression. Related factors to health promotion behavior were age, marriage, salary, class of one's position, career, employment, and religion, in general features. In health life habit, related factors were smoke and exercise. Results of health promotion behavior was 2.90 of mean score, 0.37 of standard deviation. Correlations between factors of health perception and health promotion behavior was positive(p<0.01). Health promotion behavior were affected by sensitivity, presents condition of health, exercise, smoke, career. Sensitivity was the most affectable variable, which means that promotional behavior score became higher and higher as the score of sensitivity and present condition were increased. In addition, persons who exercise regularly, had been smoked, and has higher career showed higher score of promotional behavior. Radiological technologists have to keep their health, trying not to infected by a disease. Most of all, no smoking and regular exercise are the most important thing to all of members.
Energy Technology Data Exchange (ETDEWEB)
Ko, Jong Kyung [Kim, In Hwan Internal Medicine Health Promotion Cnter, Youngcheon (Korea, Republic of); Kwon, Duk Mun [Dept. of Radiology Technology, Daegu Health College, Daegu (Korea, Republic of); Kang, Yeong Han [Dept. of Diagnostic Radiology, Daegu Catholic Univesity Hospital, Daegu (Korea, Republic of)
2009-12-15
The purpose of this study was to analyze factors that could affect health of radiological technologists, which is useful for health care and development of programs for health promotion. Subjects were 234 of radiological technologists who work in general hospitals. Some questionnaires were made about perceptions of health condition and promotional behavior of health for this study. The questionnaires of health perception were 20 items that consist of the present condition of health, health concern and sensitivity. The reliability was sufficient(Cronbach's {alpha}=0.79). The other questionnaires about health promotion behavior were 47 items that consist of self-realization, health responsibility, exercise, nutrition, personal relationships, and stress management. The results turned out to be was sufficient (Cronbach's {alpha}=0.93). Every data was treated statistically, comparison of average(t-test, ANOVA), correlation, and multiple regression. Related factors to health promotion behavior were age, marriage, salary, class of one's position, career, employment, and religion, in general features. In health life habit, related factors were smoke and exercise. Results of health promotion behavior was 2.90 of mean score, 0.37 of standard deviation. Correlations between factors of health perception and health promotion behavior was positive(p<0.01). Health promotion behavior were affected by sensitivity, presents condition of health, exercise, smoke, career. Sensitivity was the most affectable variable, which means that promotional behavior score became higher and higher as the score of sensitivity and present condition were increased. In addition, persons who exercise regularly, had been smoked, and has higher career showed higher score of promotional behavior. Radiological technologists have to keep their health, trying not to infected by a disease. Most of all, no smoking and regular exercise are the most important thing to all of members.
Health Promotion Behaviors of Women and Affecting Factors
Directory of Open Access Journals (Sweden)
Naile Bilgili
2009-12-01
Full Text Available AIM: Women should be healthy and have health promotion behaviors, so they can accomplish both their maternal and social tasks. This descriptive study was conducted to determine the healthy life-style behaviors of married women and the factors which could affect those behaviors. METHOD: The population comprised all married women older than 15 years and who live in Ankara Kale region. Three hundred-sixty five married women were included in the study. The questionnaire form and the healthy life-style behaviors scale was used for data collection. RESULTS: The mean score taken from scale was 112.2±19.4. The scores of the women who graduated from middle school / high school, who have sufficient income and good socio-economic status, who have a perception of physical health fairly good and who have any chronic disease in their families, have significantly higher mean scores from healthy life-style behaviors scale and subgroups (p<0.05 CONCLUSION: Health promotion behaviors of the women was low and some factors like education level, income, socioeconomic status, perception of health, having any chronic illness and using regular medicine affected healthy life-style behaviors. It is recommended that nurses, who have education and consultation roles, should inform the women about health promotion behaviors and encourage them to use that information in their lives. [TAF Prev Med Bull 2009; 8(6.000: 497-502
Motivating factors for small and midsized businesses to implement worksite health promotion.
Witt, Laurel B; Olsen, Delane; Ablah, Elizabeth
2013-11-01
This study explores the decision-making process, including motivating factors, for small and midsized businesses in the Midwest to implement health promotion initiatives. This a replication of a study conducted in the Pacific Northwest. Semistructured qualitative interviews were conducted with key informants from 12 Midwestern metropolitan employers with fewer than 1,000 employees. Informants were interviewed regarding their companies' policies and practices around workplace health promotion programming adoption and valuation. Workplace health promotion adoption at these small and midsized businesses was motivated by three goals: to lower health care costs, to address human relations objectives, and to improve productivity. Low upfront cost was the most frequently considered criterion in choosing which workplace health promotion program to offer. Barriers to implementation included lack of employee buy-in, prohibitive costs, and personnel or time constraints. Aids to implementation included employee buy-in and affordability. This study suggests that cost considerations predominate in the workplace health promotion decision-making process at small to midsized businesses. Furthermore, employee buy-in cannot be underestimated as a factor in successful program implementation or longevity. Employees, along with executives and human resources management, must be appropriately targeted by health promotion practitioners in workplace health promotion efforts.
Host factors that promote retrotransposon integration are similar in distantly related eukaryotes.
Directory of Open Access Journals (Sweden)
Sudhir Kumar Rai
2017-12-01
Full Text Available Retroviruses and Long Terminal Repeat (LTR-retrotransposons have distinct patterns of integration sites. The oncogenic potential of retrovirus-based vectors used in gene therapy is dependent on the selection of integration sites associated with promoters. The LTR-retrotransposon Tf1 of Schizosaccharomyces pombe is studied as a model for oncogenic retroviruses because it integrates into the promoters of stress response genes. Although integrases (INs encoded by retroviruses and LTR-retrotransposons are responsible for catalyzing the insertion of cDNA into the host genome, it is thought that distinct host factors are required for the efficiency and specificity of integration. We tested this hypothesis with a genome-wide screen of host factors that promote Tf1 integration. By combining an assay for transposition with a genetic assay that measures cDNA recombination we could identify factors that contribute differentially to integration. We utilized this assay to test a collection of 3,004 S. pombe strains with single gene deletions. Using these screens and immunoblot measures of Tf1 proteins, we identified a total of 61 genes that promote integration. The candidate integration factors participate in a range of processes including nuclear transport, transcription, mRNA processing, vesicle transport, chromatin structure and DNA repair. Two candidates, Rhp18 and the NineTeen complex were tested in two-hybrid assays and were found to interact with Tf1 IN. Surprisingly, a number of pathways we identified were found previously to promote integration of the LTR-retrotransposons Ty1 and Ty3 in Saccharomyces cerevisiae, indicating the contribution of host factors to integration are common in distantly related organisms. The DNA repair factors are of particular interest because they may identify the pathways that repair the single stranded gaps flanking the sites of strand transfer following integration of LTR retroelements.
Host factors that promote retrotransposon integration are similar in distantly related eukaryotes.
Rai, Sudhir Kumar; Sangesland, Maya; Lee, Michael; Esnault, Caroline; Cui, Yujin; Chatterjee, Atreyi Ghatak; Levin, Henry L
2017-12-01
Retroviruses and Long Terminal Repeat (LTR)-retrotransposons have distinct patterns of integration sites. The oncogenic potential of retrovirus-based vectors used in gene therapy is dependent on the selection of integration sites associated with promoters. The LTR-retrotransposon Tf1 of Schizosaccharomyces pombe is studied as a model for oncogenic retroviruses because it integrates into the promoters of stress response genes. Although integrases (INs) encoded by retroviruses and LTR-retrotransposons are responsible for catalyzing the insertion of cDNA into the host genome, it is thought that distinct host factors are required for the efficiency and specificity of integration. We tested this hypothesis with a genome-wide screen of host factors that promote Tf1 integration. By combining an assay for transposition with a genetic assay that measures cDNA recombination we could identify factors that contribute differentially to integration. We utilized this assay to test a collection of 3,004 S. pombe strains with single gene deletions. Using these screens and immunoblot measures of Tf1 proteins, we identified a total of 61 genes that promote integration. The candidate integration factors participate in a range of processes including nuclear transport, transcription, mRNA processing, vesicle transport, chromatin structure and DNA repair. Two candidates, Rhp18 and the NineTeen complex were tested in two-hybrid assays and were found to interact with Tf1 IN. Surprisingly, a number of pathways we identified were found previously to promote integration of the LTR-retrotransposons Ty1 and Ty3 in Saccharomyces cerevisiae, indicating the contribution of host factors to integration are common in distantly related organisms. The DNA repair factors are of particular interest because they may identify the pathways that repair the single stranded gaps flanking the sites of strand transfer following integration of LTR retroelements.
Analysis on the restriction factors of the green building scale promotion based on DEMATEL
Wenxia, Hong; Zhenyao, Jiang; Zhao, Yang
2017-03-01
In order to promote the large-scale development of the green building in our country, DEMATEL method was used to classify influence factors of green building development into three parts, including green building market, green technology and macro economy. Through the DEMATEL model, the interaction mechanism of each part was analyzed. The mutual influence degree of each barrier factor that affects the green building promotion was quantitatively analysed and key factors for the development of green building in China were also finally determined. In addition, some implementation strategies of promoting green building scale development in our country were put forward. This research will show important reference value and practical value for making policies of the green building promotion.
A novel cell growth-promoting factor identified in a B cell leukemia cell line, BALL-1
International Nuclear Information System (INIS)
Dao, T.; Holan, V.; Minowada, J.
1993-01-01
A novel leukemia cell growth-promoting activity has been identified in the culture supernatant from a human B cell leukemia cell line, BALL-1. The supernatant from unstimulated cultures of the BALL-1 cells significantly promoted the growth of 16 out of 24 leukemia/lymphoma cell lines of different lineages (T, B and non-lymphoid) in a minimal concentration of fetal bovine serum (FBS), and 5 out of 12 cases of fresh leukemia cells in FBS-free medium. The growth-promoting sieve filtration and dialysis. The MW of the factor was less than 10 kDa. The growth-promoting activity was heat and acid stable and resistant to trypsin treatment. The factor isolated from the BALL-1 supernatant was distinct from known polypeptide growth factors with MW below 10 kDa, such as epidermal growth factor, transforming growth factor α, insulin-like growth factor I (IGF-I), IGF-II and insulin, as determine by specific antibodies and by cell-growth-promoting tests. The factor is the BALL-1 supernatant did not promote the proliferation of normal human fresh peripheral blood lymphocytes or mouse fibroblast cell line, BALB/C 3T3. In addition to the BALL-1 supernatant, a similar growth-promoting activity was found in the culture supernatant from 13 of 17 leukemia/lymphoma cell lines tested. The activity in these culture supernatant promoted the growth of leukemia/lymphoma cell lines in autocrine and/or paracrine fashions. These observations suggest that the low MW cell growth-promoting activity found in the BALL-1 culture supernatant is mediated by a novel factor which may be responsible for the clonal expansion of particular leukemic clones. (author)
hypoxia-inducible factors activate CD133 promoter through ETS family transcription factors.
Directory of Open Access Journals (Sweden)
Shunsuke Ohnishi
Full Text Available CD133 is a cellular surface protein that has been reported to be a cancer stem cell marker, and thus it is considered to be a potential target for cancer treatment. However, the mechanism regulating CD133 expression is not yet understood. In this study, we analyzed the activity of five putative promoters (P1-P5 of CD133 in human embryonic kidney (HEK 293 cells and colon cancer cell line WiDr, and found that the activity of promoters, particularly of P5, is elevated by overexpression of hypoxia-inducible factors (HIF-1α and HIF-2α. Deletion and mutation analysis identified one of the two E-twenty six (ETS binding sites (EBSs in the P5 region as being essential for its promoter activity induced by HIF-1α and HIF-2α. In addition, a chromatin imunoprecipitation assay demonstrated that HIF-1α and HIF-2α bind to the proximal P5 promoter at the EBSs. The immunoprecipitation assay showed that HIF-1α physically interacts with Elk1; however, HIF-2α did not bind to Elk1 or ETS1. Furthermore, knockdown of both HIF-1α and HIF-2α resulted in a reduction of CD133 expression in WiDr. Taken together, our results revealed that HIF-1α and HIF-2α activate CD133 promoter through ETS proteins.
The common risk factor approach: a rational basis for promoting oral health.
Sheiham, A; Watt, R G
2000-12-01
Conventional oral health education is not effective nor efficient. Many oral health programmes are developed and implemented in isolation from other health programmes. This often leads, at best to a duplication of effort, or worse, conflicting messages being delivered to the public. In addition, oral health programmes tend to concentrate on individual behaviour change and largely ignore the influence of socio-political factors as the key determinants of health. Based upon the general principles of health promotion this paper presents a rationale for an alternative approach for oral health policy. The common risk factor approach addresses risk factors common to many chronic conditions within the context of the wider socio-environmental milieu. Oral health is determined by diet, hygiene, smoking, alcohol use, stress and trauma. As these causes are common to a number of other chronic diseases, adopting a collaborative approach is more rational than one that is disease specific. The common risk factor approach can be implemented in a variety of ways. Food policy development and the Health Promoting Schools initiative are used as examples of effective ways of promoting oral health.
Directory of Open Access Journals (Sweden)
Guillem Casanovas
2014-01-01
Full Text Available Systemic iron homeostasis involves a negative feedback circuit in which the expression level of the peptide hormone hepcidin depends on and controls the iron blood levels. Hepcidin expression is regulated by the BMP6/SMAD and IL6/STAT signaling cascades. Deregulation of either pathway causes iron-related diseases such as hemochromatosis or anemia of inflammation. We quantitatively analyzed how BMP6 and IL6 control hepcidin expression. Transcription factor (TF phosphorylation and reporter gene expression were measured under co-stimulation conditions, and the promoter was perturbed by mutagenesis. Using mathematical modeling, we systematically analyzed potential mechanisms of cooperative and competitive promoter regulation by the transcription factors, and experimentally validated the model predictions. Our results reveal that hepcidin cross-regulation primarily occurs by combinatorial transcription factor binding to the promoter, whereas signaling crosstalk is insignificant. We find that the presence of two BMP-responsive elements enhances the steepness of the promoter response towards the iron-sensing BMP signaling axis, which promotes iron homeostasis in vivo. IL6 co-stimulation reduces the promoter sensitivity towards the BMP signal, because the SMAD and STAT transcription factors compete for recruiting RNA polymerase to the transcription start site. This may explain why inflammatory signals disturb iron homeostasis in anemia of inflammation. Taken together, our results reveal why the iron homeostasis circuit is sensitive to perturbations implicated in disease.
International Nuclear Information System (INIS)
Nagasaka, Akihiko; Tomizawa, Norio
2012-01-01
The implementation of risk assessment (RA) has been mandated effort in business place of the type of industry that must elect a safe hygiene manager by the enforcement of the revised Occupational Safety and Health Act of April, 2006. However, it is guessed that some problems are still left unfinished in many business places to promote RA effectively. In this study, at first the authors investigated promotion factors and disincentive factors when implementing RA by literature survey. As the result, factors to show as follows were classified in some categories such as participation of the top, the organization which promotes RA, the use of the existing safety activity, matching of RA technique and work, etc. unlike conventional safety activity to learn from a disaster, infiltrating significance of RA to prevent a risk enough, letting a worker engaged in work participate in RA. Next, the authors performed the visit investigation for 8 business places and extracted a new promotion factors to show as follows. incorporating RA in usual duties, utilizing results of RA effectively. In reference to above promotion factors, the authors examined a policy to implement RA smoothly. (author)
Detecting privatization factors on promoting exports of steel companies
Directory of Open Access Journals (Sweden)
Seyed Mohsen SeyedAliAkbar
2016-05-01
Full Text Available Privatization is considered as the transfer of business from the government to the private sector. This process is often accomplished in an attempt to reduce the size of government, increase the productivity and export activities. There is no doubt that in an export oriented economy, government tries to promote expert based activities by making necessary changes on rules and regulations. This paper presents an empirical investigation to determine important factors on promoting export in Iran. The study designs a questionnaire in Likert scale and distributes it among some experts active in steel industry. Kaiser-Meyer-Olkin Measure of Sampling Adequacy is equal to 0.839 and Bartlett's Test of Sphericity yields an approximation Chi-Square value of 2485.02 (Sig. = 0.000, df = 276. Using principle component analysis with Varimax rotation, the study has detected five important factors including human resources development, productivity management, marketing management, creating competitive environment and building necessary infrastructures, which influence the most on export activities.
Factors that promote or hinder young disabled people in work participation: a systematic review.
Achterberg, T J; Wind, H; de Boer, A G E M; Frings-Dresen, M H W
2009-06-01
The aim of this systematic review was to study factors which promote or hinder young disabled people entering the labor market. We systematically searched PubMed (by means of MESH and text words), EMBASE, PsycINFO, Web of Science and CINAHL for studies regarding (1) disabled patients diagnosed before the age of 18 years and (2) factors of work participation. Out of 1,268 retrieved studies and 28 extended studies from references and four from experts, ten articles were included. Promoting factors are male gender, high educational level, age at survey, low depression scores, high dispositional optimism and high psychosocial functioning. Female and low educational level gives high odds of unemployment just like low IQ, inpatient treatment during follow up, epilepsy, motor impairment, wheelchair dependency, functional limitations, co-morbidity, physical disability and chronic health conditions combined with mental retardation. High dose cranial radiotherapy, type of cancer, and age of diagnosis also interfered with employment. Of the promoting factors, education appeared to be important, and several physical obstructions were found to be hindering factors. The last mentioned factors can be influenced in contrast to for instance age and gender. However, to optimize work participation of this group of young disabled it is important to know the promoting or hindering influence for employment.
DEFF Research Database (Denmark)
Dossani, Zain Y.; Apel, Amanda Reider; Szmidt-Middleton, Heather
2018-01-01
regions, we have built a library of hybrid promoters that are regulated by a synthetic transcription factor. The hybrid promoters consist of native S. cerevisiae promoters, in which the operator regions have been replaced with sequences that are recognized by the bacterial LexA DNA binding protein....... Correspondingly, the synthetic transcription factor (TF) consists of the DNA binding domain of the LexA protein, fused with the human estrogen binding domain and the viral activator domain, VP16. The resulting system with a bacterial DNA binding domain avoids the transcription of native S. cerevisiae genes...... levels, using the same synthetic TF and a given estradiol. This set of promoters, in combination with our synthetic TF, has the potential to regulate numerous genes or pathways simultaneously, to multiple desired levels, in a single strain....
Crisford, Paul; Winzenberg, Tania; Venn, Alison; Schultz, Martin; Aitken, Dawn; Cleland, Verity
2018-05-21
To identify factors associated with non-medical health professionals' engagement in physical activity (PA) promotion. Five electronic databases were searched for studies including practising health professionals (excluding medical doctors), a PA promotion practice measure, a test of association between potential influencing factors and PA promotion practice, and written in English. Two researchers independently screened studies and extracted data. Extracted data were synthesized in a tabular format with a narrative summary (thematic analysis). Thirty studies involving 7734 non-medical health professionals were included. Self-efficacy in PA promotion, positive beliefs in the benefits of PA, assessing patients' PA, and PA promotion training were the main factors associated with engaging in PA promotion. Lack of remuneration was not associated. Common study limitations included a lack of information on non-responders, data collection by survey only and limited reliability or validity testing of measurements. There are common factors influencing PA promotion, but the absence of studies from some health professions, limitations related to study measures, and the lack of randomised controlled intervention trials highlights the need for further research. The factors identified may prove useful for guiding the development of strategies to encourage greater engagement in PA promotion by health professionals. Copyright © 2018 Elsevier B.V. All rights reserved.
Xu, Meixiang; Cross, Courtney E; Speidel, Jordan T; Abdel-Rahman, Sherif Z
2016-10-01
The O 6 -methylguanine-DNA methyltransferase (MGMT) protein removes O 6 -alkyl-guanine adducts from DNA. MGMT expression can thus alter the sensitivity of cells and tissues to environmental and chemotherapeutic alkylating agents. Previously, we defined the haplotype structure encompassing single nucleotide polymorphisms (SNPs) in the MGMT promoter/enhancer (P/E) region and found that haplotypes, rather than individual SNPs, alter MGMT promoter activity. The exact mechanism(s) by which these haplotypes exert their effect on MGMT promoter activity is currently unknown, but we noted that many of the SNPs comprising the MGMT P/E haplotypes are located within or in close proximity to putative transcription factor binding sites. Thus, these haplotypes could potentially affect transcription factor binding and, subsequently, alter MGMT promoter activity. In this study, we test the hypothesis that MGMT P/E haplotypes affect MGMT promoter activity by altering transcription factor (TF) binding to the P/E region. We used a promoter binding TF profiling array and a reporter assay to evaluate the effect of different P/E haplotypes on TF binding and MGMT expression, respectively. Our data revealed a significant difference in TF binding profiles between the different haplotypes evaluated. We identified TFs that consistently showed significant haplotype-dependent binding alterations (p ≤ 0.01) and revealed their role in regulating MGMT expression using siRNAs and a dual-luciferase reporter assay system. The data generated support our hypothesis that promoter haplotypes alter the binding of TFs to the MGMT P/E and, subsequently, affect their regulatory function on MGMT promoter activity and expression level.
Yang, Shu-Ching; Luo, Yi-Fang; Chiang, Chia-Hsun
2017-01-10
eHealth literacy is gaining importance for maintaining and promoting health. Studies have found that individuals with high eHealth literacy are more likely to adopt healthy eating, exercise, and sleep behaviors. In addition, previous studies have shown that various individual factors (eg, frequency of seeking information on health issues, degree of health concern, frequency of eating organic food, and students' college major) are associated with eHealth literacy and health-promoting lifestyles. Nevertheless, few studies have explored the associations among individual factors, eHealth literacy, and health-promoting lifestyles among college students. Moreover, there is a lack of studies that focus on eHealth literacy as a predictor of psychological health behaviors. To examine the associations among various individual factors, eHealth literacy, and health-promoting lifestyles. The eHealth Literacy Scale is a 12-item instrument designed to measure college students' functional, interactive, and critical eHealth literacy. The Health-promoting Lifestyle Scale is a 23-item instrument developed to measure college students' self-actualization, health responsibility, interpersonal support, exercise, nutrition, and stress management. A nationally representative sample of 556 valid college students in Taiwan was surveyed. A questionnaire was administered to gather the respondents' background information, including the frequency of seeking information on health issues, the frequency of eating organic food, the degree of health concern, and the students' major. We then conducted a multiple regression analysis to examine the associations among individual factors, eHealth literacy, and health-promoting lifestyles. The study found that factors such as medical majors (t 550 =2.47-7.55, PeHealth literacy. Moreover, critical eHealth literacy positively predicted all 6 health-promoting lifestyle dimensions (t 547 =2.66-7.28, PeHealth literacy, and had a positive health-promoting
Factors Promoting Vocational Students' Learning at Work: Study on Student Experiences
Virtanen, Anne; Tynjälä, Päivi; Eteläpelto, Anneli
2014-01-01
In order to promote effective pedagogical practices for students' work-based learning, we need to understand better how students' learning at work can be supported. This paper examines the factors explaining students' workplace learning (WPL) outcomes, addressing three aspects: (1) student-related individual factors, (2) social and…
Assignment of sigma factors of RNA polymerase to promoters in Corynebacterium glutamicum
Czech Academy of Sciences Publication Activity Database
Dostálová, Hana; Holátko, Jiří; Busche, T.; Rucká, Lenka; Rapoport, Andrey; Halada, Petr; Nešvera, Jan; Kalinowski, J.; Pátek, Miroslav
2017-01-01
Roč. 7, JUN 23 (2017), s. 1-13, č. článku 133. ISSN 2191-0855 R&D Projects: GA ČR(CZ) GA17-06991S Institutional support: RVO:61388971 Keywords : Corynebacterium glutamicum * Promoter * Sigma factor Subject RIV: EE - Microbiology, Virology OBOR OECD: Microbiology Impact factor: 1.825, year: 2016
Cumulative Effects of Mothers' Risk and Promotive Factors on Daughters' Disruptive Behavior
van der Molen, Elsa; Hipwell, Alison E.; Vermeiren, Robert; Loeber, Rolf
2012-01-01
Little is known about the ways in which the accumulation of maternal factors increases or reduces risk for girls' disruptive behavior during preadolescence. In the current study, maternal risk and promotive factors and the severity of girls' disruptive behavior were assessed annually among girls' ages 7-12 in an urban community sample (N = 2043).…
International Nuclear Information System (INIS)
Ceccarelli, Simona; Cardinali, Giorgia; Aspite, Nicaela; Picardo, Mauro; Marchese, Cinzia; Torrisi, Maria Rosaria; Mancini, Patrizia
2007-01-01
Keratinocyte growth factor (KGF/FGF7) and fibroblast growth factor 10 (FGF10/KGF2) regulate keratinocyte proliferation and differentiation by binding to the tyrosine kinase KGF receptor (KGFR). KGF induces keratinocyte motility and cytoskeletal rearrangement, whereas a direct role of FGF10 on keratinocyte migration is not clearly established. Here we analyzed the motogenic activity of FGF10 and KGF on human keratinocytes. Migration assays and immunofluorescence of actin cytoskeleton revealed that FGF10 is less efficient than KGF in promoting migration and exerts a delayed effect in inducing lamellipodia and ruffles formation. Both growth factors promoted phosphorylation and subsequent membrane translocation of cortactin, an F-actin binding protein involved in cell migration; however, FGF10-induced cortactin phosphorylation was reduced, more transient and delayed with respect to that promoted by KGF. Cortactin phosphorylation induced by both growth factors was Src-dependent, while its membrane translocation and cell migration were blocked by either Src and PI3K inhibitors, suggesting that both pathways are involved in KGF- and FGF10-dependent motility. Furthermore, siRNA-mediated downregulation of cortactin inhibited KGF- and FGF10-induced migration. These results indicate that cortactin is involved in keratinocyte migration promoted by both KGF and FGF10
Na, Kyoung-Sae; Won, Eunsoo; Kang, June; Chang, Hun Soo; Yoon, Ho-Kyoung; Tae, Woo Suk; Kim, Yong-Ku; Lee, Min-Soo; Joe, Sook-Haeng; Kim, Hyun; Ham, Byung-Joo
2016-01-01
Recent studies have reported that methylation of the brain-derived neurotrophic factor (BDNF) gene promoter is associated with major depressive disorder (MDD). This study aimed to investigate the association between cortical thickness and methylation of BDNF promoters as well as serum BDNF levels in MDD. The participants consisted of 65 patients with recurrent MDD and 65 age- and gender-matched healthy controls. Methylation of BDNF promoters and cortical thickness were compared between the gr...
The mitochondrial fusion-promoting factor mitofusin is a substrate of the PINK1/parkin pathway.
Directory of Open Access Journals (Sweden)
Angela C Poole
2010-04-01
Full Text Available Loss-of-function mutations in the PINK1 or parkin genes result in recessive heritable forms of parkinsonism. Genetic studies of Drosophila orthologs of PINK1 and parkin indicate that PINK1, a mitochondrially targeted serine/threonine kinase, acts upstream of Parkin, a cytosolic ubiquitin-protein ligase, to promote mitochondrial fragmentation, although the molecular mechanisms by which the PINK1/Parkin pathway promotes mitochondrial fragmentation are unknown. We tested the hypothesis that PINK1 and Parkin promote mitochondrial fragmentation by targeting core components of the mitochondrial morphogenesis machinery for ubiquitination. We report that the steady-state abundance of the mitochondrial fusion-promoting factor Mitofusin (dMfn is inversely correlated with the activity of PINK1 and Parkin in Drosophila. We further report that dMfn is ubiquitinated in a PINK1- and Parkin-dependent fashion and that dMfn co-immunoprecipitates with Parkin. By contrast, perturbations of PINK1 or Parkin did not influence the steady-state abundance of the mitochondrial fission-promoting factor Drp1 or the mitochondrial fusion-promoting factor Opa1, or the subcellular distribution of Drp1. Our findings suggest that dMfn is a direct substrate of the PINK1/Parkin pathway and that the mitochondrial morphological alterations and tissue degeneration phenotypes that derive from mutations in PINK1 and parkin result at least in part from reduced ubiquitin-mediated turnover of dMfn.
Gerrish, Kate; Nolan, Mike; McDonnell, Ann; Tod, Angela; Kirshbaum, Marilyn; Guillaume, Louise
2012-02-01
Advanced practice nurses (APNs) have an important role in promoting evidence-based practice (EBP) among frontline nurses (FLNs). Factors influencing FLNs' engagement with EBP are well documented but little is known about factors that affect APNs' ability to facilitate evidence in practice. To identify factors that influence APNs' ability to promote EBP among FLNs. A multiple case study of 23 APNs from hospital and primary care settings across seven English health authorities was undertaken. Data collection comprised interviews and observation of APNs and interviews with FLNs and other healthcare professionals. Data were analysed using the Framework approach. Four groups of influencing factors were identified: (1) Personal attributes of APNs included knowledge and skills in EBP, clinical credibility with frontline staff and leadership style. (2) Relationships with stakeholders included APNs' interactions with FLNs and the level of support from managers and medical colleagues. (3) Aspects of the APN role included their sphere of responsibility and workload. (4) Organisational context included the organisational culture, FLNs' workload, professional networks and available resources. Educational preparation for APNs should enable them to develop expertise in EBP plus interpersonal and leadership skills to manage relational dynamics in clinical settings. APN role specifications should provide the opportunity to promote EBP. The organisational culture should be conducive to enabling EBP with managers supportive of this aspect of the APNs' role. APNs need to be supported to address the individual, interpersonal and organisational factors, which influence their ability to promote EBP. Organisational commitment at the highest level is key to APNs' ability to fulfil this aspect of their role. ©2011 Sigma Theta Tau International.
Williams, Lauren K; Thornton, Lukar; Crawford, David
2012-08-01
The majority of nutrition promotion research that has examined the determinants of unhealthy or healthy dietary behaviours has focused on factors that promote consumption of these foods, rather than factors that may both promote healthy eating and buffer or protect consumption of unhealthy foods. The purpose of this paper is to identify factors that both promote healthy eating and also reduce the likelihood of eating unhealthily amongst women. A community sample of 1013 Australian women participated in a cross-sectional self-report survey that assessed factors associated with diet and obesity. Multiple logistic regressions were used to examine the associations between a range of individual, social and environmental factors and aspects of both healthy and unhealthy eating, whilst controlling for key covariates. Results indicated that women with high self efficacy for healthy eating, taste preferences for fruit and vegetables, family support for healthy eating and the absence of perceived barriers to healthy eating (time and cost) were more likely to consume components of a healthy diet and less likely to consume components of a unhealthy diet. Optimal benefits in overall diet quality amongst women may be achieved by targeting factors associated with both healthy and unhealthy eating in nutrition promotion efforts. Copyright © 2012 Elsevier Ltd. All rights reserved.
Features of cryptic promoters and their varied reliance on bromodomain-containing factors.
Directory of Open Access Journals (Sweden)
Samantha G Pattenden
Full Text Available The Set2-Rpd3S pathway is important for the control of transcription memory. Mutation of components of this pathway results in cryptic transcription initiation within the coding region of approximately 30% of yeast genes. Specifically, deletion of the Set2 histone methyltransferase or Rco1, a component of the Rpd3S histone deacetylase complex leads to hyperacetylation of certain open reading frames (ORFs. We used this mutant as a system to study the role of histone modifications and co-activator recruitment in preinitiation complex (PIC formation. Specifically, we looked at the dependence of promoters on the bromodomain-containing RSC complex and the Bdf1 protein. We found that the dependence of cryptic promoters for these proteins varied. Overall, our data indicate that cryptic promoters are independently regulated, and their activation is dependent on factors that govern gene activation at canonical promoters.
Jin-Won Noh; Hyo-Young Yun; Hyunchun Park; Shi-Eun Yu
2015-01-01
Objectives: The present study aimed to analyze the factors that could affect the health-promoting behaviors of North Korean adolescent refugees residing in South Korea. Methods: Questions about their sociodemographic variables, subjective health status, healthy living habits, and health-promoting behaviors were asked. Results: Statistically significant differences were found in religion (t=2.30, p
FACTORS THAT PROMOTE THE DEFECTION OF THE VIRTUAL CLASSROOM
Jenniz La Madriz
2016-01-01
It education virtual is a resource that allows leverage them Tics for reduce barriers of space / time to learn and decrease the dropout school. The research had by objective determine them factors that promote the desertion of the classroom virtual of the subject of methods I, of support to them classes face-to-face, in the Faculty of Sciences economic and social, of the University of Carabobo. The methodological design was based on the quantitative paradigm and as technical survey, obtainin...
World Alliance for Risk Factor Surveillance White Paper on Surveillance and Health Promotion
Directory of Open Access Journals (Sweden)
Stefano Campostrini
2015-02-01
Full Text Available This is not a research paper on risk factor surveillance. It is an effort by a key group of researchers and practitioners of risk factor surveillance to define the current state of the art and to identify the key issues involved in the current practice of behavioral risk factor surveillance. Those of us who are the principal authors have worked and carried out research in this area for some three decades. As a result of a series of global meetings beginning in 1999 and continuing every two years since then, a collective working group of the International Union of Health Promotion and Education (IUHPE was formed under the name World Alliance of Risk Factor Surveillance (WARFS. Under this banner the organization sought to write a comprehensive statement on the importance of surveillance to health promotion and public health. This paper, which has been revised and reviewed by established peers in the field, is the result. It provides the reader with a clear summary of the major issues that need to be considered by any and all seeking to carry out behavioral risk factor surveillance.
International Nuclear Information System (INIS)
Zhang, Yingyi; Zhao, Yu; Li, Leilei; Shen, Yu; Cai, Xiaoli; Zhang, Xiaodong; Ye, Lihong
2013-01-01
Highlights: •HBXIP is able to upregulate the expression of PDGFB in breast cancer cells. •HBXIP serves as a coactivator of activating transcription factor Sp1. •HBXIP stimulates the PDGFB promoter via activating transcription factor Sp1. •HBXIP promotes the proliferation of breast cancer cell via upregulating PDGFB. -- Abstract: We have reported that the oncoprotein hepatitis B virus X-interacting protein (HBXIP) acts as a novel transcriptional coactivator to promote proliferation and migration of breast cancer cells. Previously, we showed that HBXIP was able to activate nuclear factor-κB (NF-κB) in breast cancer cells. As an oncogene, the platelet-derived growth factor beta polypeptide (PDGFB) plays crucial roles in carcinogenesis. In the present study, we found that both HBXIP and PDGFB were highly expressed in breast cancer cell lines. Interestingly, HBXIP was able to increase transcriptional activity of NF-κB through PDGFB, suggesting that HBXIP is associated with PDGFB in the cells. Moreover, HBXIP was able to upregulate PDGFB at the levels of mRNA, protein and promoter in the cells. Then, we identified that HBXIP stimulated the promoter of PDGFB through activating transcription factor Sp1. In function, HBXIP enhanced the proliferation of breast cancer cells through PDGFB in vitro. Thus, we conclude that HBXIP upregulates PDGFB via activating transcription factor Sp1 to promote proliferation of breast cancer cells
Energy Technology Data Exchange (ETDEWEB)
Zhang, Yingyi; Zhao, Yu; Li, Leilei; Shen, Yu; Cai, Xiaoli [Department of Biochemistry, College of Life Sciences, Nankai University, Tianjin 300071 (China); Zhang, Xiaodong, E-mail: zhangxd@nankai.edu.cn [Department of Cancer Research, Institute for Molecular Biology, College of Life Sciences, Nankai University, Tianjin 300071 (China); Ye, Lihong, E-mail: yelihong@nankai.edu.cn [Department of Biochemistry, College of Life Sciences, Nankai University, Tianjin 300071 (China)
2013-05-03
Highlights: •HBXIP is able to upregulate the expression of PDGFB in breast cancer cells. •HBXIP serves as a coactivator of activating transcription factor Sp1. •HBXIP stimulates the PDGFB promoter via activating transcription factor Sp1. •HBXIP promotes the proliferation of breast cancer cell via upregulating PDGFB. -- Abstract: We have reported that the oncoprotein hepatitis B virus X-interacting protein (HBXIP) acts as a novel transcriptional coactivator to promote proliferation and migration of breast cancer cells. Previously, we showed that HBXIP was able to activate nuclear factor-κB (NF-κB) in breast cancer cells. As an oncogene, the platelet-derived growth factor beta polypeptide (PDGFB) plays crucial roles in carcinogenesis. In the present study, we found that both HBXIP and PDGFB were highly expressed in breast cancer cell lines. Interestingly, HBXIP was able to increase transcriptional activity of NF-κB through PDGFB, suggesting that HBXIP is associated with PDGFB in the cells. Moreover, HBXIP was able to upregulate PDGFB at the levels of mRNA, protein and promoter in the cells. Then, we identified that HBXIP stimulated the promoter of PDGFB through activating transcription factor Sp1. In function, HBXIP enhanced the proliferation of breast cancer cells through PDGFB in vitro. Thus, we conclude that HBXIP upregulates PDGFB via activating transcription factor Sp1 to promote proliferation of breast cancer cells.
Li, Y; Chen, J; Zhao, M; Yang, Z; Yue, L; Zhang, X
2017-02-01
To demonstrate the resuscitation-promoting activities of recombinant YeaZ from Vibrio harveyi SF-1. The gene of resuscitation-promoting factor YeaZ was cloned from genomic DNA of V. harveyi SF-1. The gene was expressed in Escherichia coli, and the expressed protein was purified by Ni 2+ -affinity chromatography. A yeaZ mutant was constructed by using the suicide plasmid pNQ705 with homologous recombination. Disruption of yeaZ did not affect cell growth significantly in 2216 E broth at 28°C. The wild-type and mutant viable but nonculturable (VBNC) cells could be resuscitated by temperature upshift method. In addition, the recombinant YeaZ increased the culturable counts from 1·27 × 10 4 CFU per ml and 1·99 × 10 4 CFU per ml to 2·88 × 10 5 CFU per ml and 4·59 × 10 5 CFU per ml, respectively. After the VBNC cells of wild-type and mutant cells were maintained at 4°C for 120 days, no resuscitation was obtained by temperature upshift method, but addition of the recombinant YeaZ promoted the resuscitation of the wild-type and mutant cells, with the culturable cell counts of 1·13 × 10 3 and 1·44 × 10 3 CFU per ml, respectively. Disruption of yeaZ decreased the virulence of V. harveyi in zebrafish. The lethal dose 50% of the yeaZ null mutant was more than 10-fold higher than that of the wild-type cells. The recombinant YeaZ could efficiently promote resuscitation of the wild-type and mutant cells of V. harveyi from VBNC to culturable state. The protein also promoted resuscitation of the VBNC wild-type and mutant cells, which were maintained at 4°C for 120 days and not recovered by temperature upshift method. Disruption of yeaZ decreased the virulence of V. harveyi in zebrafish. Here, we show clear evidence of a resuscitation-promoting factor YeaZ of V. harveyi and the roles in resuscitation of the VBNC cells and its pathogenicity. © 2016 The Society for Applied Microbiology.
International Nuclear Information System (INIS)
Cho, Kyung-Ah; Park, Minhwa; Kim, Yu-Hee; Woo, So-Youn
2017-01-01
Although mast cells are traditionally thought to function as effector cells in allergic responses, they have increasingly been recognized as important regulators of various immune responses. Mast cells mature locally; thus, tissue-specific influences are important for promoting mast cell accumulation and survival in the skin and the gastrointestinal tract. In this study, we determined the effects of keratinocytes on mast cell accumulation during Th17-mediated skin inflammation. We observed increases in dermal mast cells in imiquimod-induced psoriatic dermatitis in mice accompanied by the expression of epidermal stem cell factor (SCF), a critical mast cell growth factor. Similar to mouse epidermal keratinocytes, SCF was highly expressed in the human HaCaT keratinocyte cell line following stimulation with IL−17. Further, keratinocytes promoted mast cell proliferation following stimulation with IL−17 in vitro. However, the effects of keratinocytes on mast cells were significantly diminished in the presence of anti−CD117 (stem cell factor receptor) blocking antibodies. Taken together, our results revealed that the Th17-mediated inflammatory environment promotes mast cell accumulation through keratinocyte-derived SCF. - Highlights: • Psoriasis-like skin inflammation increase dermal mast cells. • Keratinocyte produce stem cell factor in psoriasis-like skin inflammation. • Keratinocyte promote mast cell proliferation by stem cell factor dependent manner
Lorthios-Guilledroit, Agathe; Richard, Lucie; Filiatrault, Johanne
2018-06-01
Peer education is growing in popularity as a useful health promotion strategy. However, optimal conditions for implementing peer-led health promotion programs (HPPs) remain unclear. This scoping review aimed to describe factors that can influence implementation of peer-led HPPs targeting adult populations. Five databases were searched using the keywords "health promotion/prevention", "implementation", "peers", and related terms. Studies were included if they reported at least one factor associated with the implementation of community-based peer-led HPPs. Fifty-five studies were selected for the analysis. The method known as "best fit framework synthesis" was used to analyze the factors identified in the selected papers. Many factors included in existing implementation conceptual frameworks were deemed applicable to peer-led HPPs. However, other factors related to individuals, programs, and implementation context also emerged from the analysis. Based on this synthesis, an adapted theoretical framework was elaborated, grounded in a complex adaptive system perspective and specifying potential mechanisms through which factors may influence implementation of community-based peer-led HPPs. Further research is needed to test the theoretical framework against empirical data. Findings from this scoping review increase our knowledge of the optimal conditions for implementing peer-led HPPs and thereby maximizing the benefits of such programs. Copyright © 2018 Elsevier Ltd. All rights reserved.
Directory of Open Access Journals (Sweden)
Zaider Gloria Triviño-Vargas
2018-05-01
Full Text Available Introduction: Health promotion has been a constant concern in the human being. It allows to understand behaviors related to it and orientates towards the generation of health promoting behaviors (HPB that promote personal well-being. Objective: To determine the predictor factors influencing the HPB of the teachers according to Pender’s health promotion model. Materials and methods: A correlational descriptive design was made with a representative sample of the teachers with current contract during the study. Instruments such as the EVPS II scale of Pender were applied to measure the dependent variable CPS, as well as for the independent ones such as sociodemographic, knowledge on health promotion, perception of health status and perception of self-efficacy. Results: They are descriptive, according to the coefficient of variation in each of the subdimensions of the behaviors: spiritual growth, interpersonal relations, responsibility in health, nutrition, management of stress and physical activity. The predictor factors were based on the multiple regression model. Conclusions: Favorable HPB were spiritual growth, interpersonal relationships and nutrition. Predictors that have effect on HPB were presented on the basis of teacher rankings, age, senior adult performance area, stratum, income and area of performance, mental health and psychiatry.
Community Violence Exposure and Adolescent Delinquency: Examining a Spectrum of Promotive Factors
Chen, Pan; Voisin, Dexter R.; Jacobson, Kristen C.
2016-01-01
This study examined whether promotive factors (future expectations, family warmth, school attachment, and neighborhood cohesion) moderated relationships between community violence exposure and youth delinquency. Analyses were conducted using N = 2,980 sixth to eighth graders (M[subscript age] = 12.48; 41.1% males) from a racially, ethnically, and…
Steiner, Elisabeth; Holzmann, Klaus; Pirker, Christine; Elbling, Leonilla; Micksche, Michael; Berger, Walter
2004-04-23
The major vault protein (MVP) has been implicated in multidrug resistance, cellular transport, and malignant transformation. In this study we aimed to identify crucial MVP promoter elements that regulate MVP expression. By mutation as well as deletion analysis a conserved proximal GC-box element was demonstrated to be essential for basal human MVP promoter transactivation. Binding of Sp-family transcription factors but not AP2 to this element in vitro and in vivo was shown by EMSA and ChIP assays, respectively. Inhibition of GC-box binding by a dominant-negative Sp1-variant and by mithramycin A distinctly attenuated MVP promoter activity. In Sp-null Drosophila cells, the silent human MVP promoter was transactivated by several human Sp-family members. In human cells the MVP promoter was potently stimulated by the histone deacetylase (HDAC) inhibitors butyrate (NaB) and trichostatin A (TSA), resulting in enhanced MVP expression. This stimulation was substantially decreased by mutation of the single GC-box and by application of mithramycin A. Treatment with HDAC inhibitors led to a distinct decrease of Sp1 but increase of Sp3 binding in vivo to the respective promoter sequence as demonstrated by ChIP assays. Summarising, this study identifies variations in Sp-transcription factor binding to a single proximal GC-box element as critical for basal MVP promoter activation and its stimulation by HDAC inhibitors.
Chen, Hsiu-Chih; Chen, Hsing-Mei; Chen, Min-Li; Chiang, Chih-Ming; Chen, Mei-Yen
2012-06-01
Tainan City has the third highest prevalence of junior high school student obesity of all administrative districts in Taiwan. School nurses play an important role in promoting student health. Understanding the factors that significantly impact student weight is critical to designing effective student health promotion programs. This study explored the relationships between health promotion behavior and serum biomarker variables and body size. Researchers used a cross-sectional descriptive study design and stratified cluster random sampling. Subjects were 7th graders who received an in-school health checkup with blood test at 41 public junior high schools in Tainan City between July 2010 and May 2011. Research instruments included the adolescent health promotion (AHP) scale, serum biochemical profile and BMI (body mass index). Obtained data were analyzed using descriptive and inferential statistics. Of the 726 students who participated in this study, 22.2% were underweight and 23.8% were overweight or obese. Higher AHP scores correlated with better biomarkers and body size. Multivariate analysis found factors that increased the risk of being overweight included: being male, having a father with a relatively low level of education, playing video games frequently, and doing little or no exercise (odds ratio = 1.93, 1.75, 1.07, 1.04, respectively). Participants with relatively healthy behaviors had better biomarkers and a lower risk of being overweight. Findings can support the development of evidence-based school programs to promote student health.
Neural regeneration protein is a novel chemoattractive and neuronal survival-promoting factor
International Nuclear Information System (INIS)
Gorba, Thorsten; Bradoo, Privahini; Antonic, Ana; Marvin, Keith; Liu, Dong-Xu; Lobie, Peter E.; Reymann, Klaus G.; Gluckman, Peter D.; Sieg, Frank
2006-01-01
Neurogenesis and neuronal migration are the prerequisites for the development of the central nervous system. We have identified a novel rodent gene encoding for a neural regeneration protein (NRP) with an activity spectrum similar to the chemokine stromal-derived factor (SDF)-1, but with much greater potency. The Nrp gene is encoded as a forward frameshift to the hypothetical alkylated DNA repair protein AlkB. The predicted protein sequence of NRP contains domains with homology to survival-promoting peptide (SPP) and the trefoil protein TFF-1. The Nrp gene is first expressed in neural stem cells and expression continues in glial lineages. Recombinant NRP and NRP-derived peptides possess biological activities including induction of neural migration and proliferation, promotion of neuronal survival, enhancement of neurite outgrowth and promotion of neuronal differentiation from neural stem cells. NRP exerts its effect on neuronal survival by phosphorylation of the ERK1/2 and Akt kinases, whereas NRP stimulation of neural migration depends solely on p44/42 MAP kinase activity. Taken together, the expression profile of Nrp, the existence in its predicted protein structure of domains with similarities to known neuroprotective and migration-inducing factors and the high potency of NRP-derived synthetic peptides acting in femtomolar concentrations suggest it to be a novel gene of relevance in cellular and developmental neurobiology
Noh, Jin-Won; Yun, Hyo-Young; Park, Hyunchun; Yu, Shi-Eun
2015-09-01
The present study aimed to analyze the factors that could affect the health-promoting behaviors of North Korean adolescent refugees residing in South Korea. Questions about their sociodemographic variables, subjective health status, healthy living habits, and health-promoting behaviors were asked. Statistically significant differences were found in religion (t=2.30, pKorea (t=2.02, preligion (t=2.17, preligion (t=4.21, pKorea (t=2.04, pNorth Korean adolescent refugees.
International Nuclear Information System (INIS)
Cui Wei; Yin Lingling; Dong Lingyue
2012-01-01
Objective: To clarify the mechanism of immediate early response gene 5 (Ier5) transcription induced by radiation. Methods: Deletant construction, site-specific mutagenesis,electrophoretic mobility shift assay (EMSA) and chromatin immunoprecipitation (ChIP) were used to forecast the promoter region, binding sites and transcription factors of Ier5 gene in HeLa cells. Results: The promoter region of Ier5 gene might be in the region of Ier5 -8 deletant (-408 - -238 bp). The Ier5 gene had two transcription factors of GCF and NFI, and GCF had two binding sites located in the region of -388 - -382 bp and -274 - -270 bp of Ier5 promoter. The binding site of NFI was located in -362 - -357 bp of Ier5 promoter. GCF could inhibit the expression of Ier5 gene and this inhibition was diminished when the radiation dose increased. In contrast, NFI increased the expression of Ier5. Conclusions: The most possible region of Ier5 promoter is from -408 to -238 bp which has two binding sites for the radiosensitivity transcription factors of GCF and NFI that could negatively and positively regulate the expression of Ier5 respectively. (authors)
Factors influencing workplace health promotion intervention: a qualitative systematic review.
Rojatz, Daniela; Merchant, Almas; Nitsch, Martina
2017-10-01
Although workplace health promotion (WHP) has evolved over the last 40 years, systematically collected knowledge on factors influencing the functioning of WHP is scarce. Therefore, a qualitative systematic literature review was carried out to systematically identify and synthesize factors influencing the phases of WHP interventions: needs assessment, planning, implementation and evaluation. Research evidence was identified by searching electronic databases (Scopus, PubMed, Social Sciences Citation Index, ASSIA, ERIC, IBBS and PsycINFO) from 1998 to 2013, as well as by cross-checking reference lists of included peer-reviewed articles. The inclusion criteria were: original empirical research, description of WHP, description of barriers to and/or facilitators of the planning, implementation and/or evaluation of WHP. Finally, 54 full texts were included. From these, influencing factors were extracted and summarized using thematic analysis. The majority of influencing factors referred to the implementation phase, few dealt with planning and/or evaluation and none with needs assessment. The influencing factors were condensed into topics with respect to factors at contextual level (e.g. economic crisis); factors at organizational level (e.g. management support); factors at intervention level (e.g. quality of intervention concept); factors at implementer level (e.g. resources); factors at participant level (e.g. commitment to intervention) and factors referring to methodological and data aspects (e.g. data-collection issues). Factors regarding contextual issues and organizational aspects were identified across three phases. Therefore, future research and practice should consider not only the influencing factors at different levels, but also at different phases of WHP interventions. © The Author 2016. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.
International Nuclear Information System (INIS)
Hattersley, G.; Chambers, T.J.
1991-01-01
Transforming growth factor (TGF) beta 1 is a multifunctional cytokine with powerful effects on osteoblastic cells. Its role in the regulation of osteoclast generation and function, however, is unclear. It has been reported both to stimulate and to inhibit resorption in organ culture and to inhibit multinuclear cell formation in bone marrow cultures. We tested the effects of TGF-beta 1 on bone resorption by osteoclasts isolated from neonatal rat long bones. We found potent stimulation of osteoclastic bone resorption, mediated by osteoblastic cells, with an EC50 of 10 pg/ml, considerably lower than that of well-documented osteotropic hormones. Stimulation was not mediated by Swiss mouse 3T3 cells, a nonosteoblastic cell line. TGF-beta 1 strongly inhibited the generation of calcitonin receptor (CTR)-positive cells in mouse bone marrow cultures, but as for isolated osteoclasts, bone resorption per CTR-positive cell was increased. The inhibition of CTR-positive cell formation was associated with suppression of maturation of other bone marrow derivatives and may be related more to the known ability of TGF-beta 1 to suppress the proliferation of primitive hematopoietic cells than to a specific role of TGF-beta 1 in osteoclast generation
Factors promoting resident deaths at aged care facilities in Japan: a review.
Sugimoto, Kentaro; Ogata, Yasuko; Kashiwagi, Masayo
2018-03-01
Due to an increasingly ageing population, the Japanese government has promoted elderly deaths in aged care facilities. However, existing facilities were not designed to provide resident end-of-life care and the proportion of aged care facility deaths is currently less than 10%. Consequently, the present review evaluated the factors that promote aged care facility resident deaths in Japan from individual- and facility-level perspectives to exploring factors associated with increased resident deaths. To achieve this, MEDLINE, CINAHL, Web of Science and Ichushi databases were searched on 23 January 2016. Influential factors were reviewed for two healthcare services (insourcing and outsourcing facilities) as well as external healthcare agencies operating outside facilities. Of the original 2324 studies retrieved, 42 were included in analysis. Of these studies, five focused on insourcing, two on outsourcing, seven on external agencies and observed facility/agency-level factors. The other 28 studies identified individual-level factors related to death in aged care facilities. The present review found that at both facility and individual levels, in-facility resident deaths were associated with healthcare service provision, confirmation of resident/family end-of-life care preference and staff education. Additionally, while outsourcing facilities did not require employment of physicians/nursing staff to accommodate resident death, these facilities required visits by physicians and nursing staff from external healthcare agencies as well as residents' healthcare input. This review also found few studies examining outsourcing facilities. The number of healthcare outsourcing facilities is rapidly increasing as a result of the Japanese government's new tax incentives. Consequently, there may be an increase in elderly deaths in outsourcing healthcare facilities. Accordingly, it is necessary to identify the factors associated with residents' deaths at outsourcing facilities.
International Nuclear Information System (INIS)
Asting, Annika Gustafsson; Carén, Helena; Andersson, Marianne; Lönnroth, Christina; Lagerstedt, Kristina; Lundholm, Kent
2011-01-01
Increased cyclooxygenase activity promotes progression of colorectal cancer, but the mechanisms behind COX-2 induction remain elusive. This study was therefore aimed to define external cell signaling and transcription factors relating to high COX-2 expression in colon cancer tissue. Tumor and normal colon tissue were collected at primary curative operation in 48 unselected patients. COX-2 expression in tumor and normal colon tissue was quantified including microarray analyses on tumor mRNA accounting for high and low tumor COX-2 expression. Cross hybridization was performed between tumor and normal colon tissue. Methylation status of up-stream COX-2 promoter region was evaluated. Tumors with high COX-2 expression displayed large differences in gene expression compared to normal colon. Numerous genes with altered expression appeared in tumors of high COX-2 expression compared to tumors of low COX-2. COX-2 expression in normal colon was increased in patients with tumors of high COX-2 compared to normal colon from patients with tumors of low COX-2. IL1β, IL6 and iNOS transcripts were up-regulated among external cell signaling factors; nine transcription factors (ATF3, C/EBP, c-Fos, Fos-B, JDP2, JunB, c-Maf, NF-κB, TCF4) showed increased expression and 5 (AP-2, CBP, Elk-1, p53, PEA3) were decreased in tumors with high COX-2. The promoter region of COX-2 gene did not show consistent methylation in tumor or normal colon tissue. Transcription and external cell signaling factors are altered as covariates to COX-2 expression in colon cancer tissue, but DNA methylation of the COX-2 promoter region was not a significant factor behind COX-2 expression in tumor and normal colon tissue
Directory of Open Access Journals (Sweden)
Lagerstedt Kristina
2011-06-01
Full Text Available Abstract Background Increased cyclooxygenase activity promotes progression of colorectal cancer, but the mechanisms behind COX-2 induction remain elusive. This study was therefore aimed to define external cell signaling and transcription factors relating to high COX-2 expression in colon cancer tissue. Method Tumor and normal colon tissue were collected at primary curative operation in 48 unselected patients. COX-2 expression in tumor and normal colon tissue was quantified including microarray analyses on tumor mRNA accounting for high and low tumor COX-2 expression. Cross hybridization was performed between tumor and normal colon tissue. Methylation status of up-stream COX-2 promoter region was evaluated. Results Tumors with high COX-2 expression displayed large differences in gene expression compared to normal colon. Numerous genes with altered expression appeared in tumors of high COX-2 expression compared to tumors of low COX-2. COX-2 expression in normal colon was increased in patients with tumors of high COX-2 compared to normal colon from patients with tumors of low COX-2. IL1β, IL6 and iNOS transcripts were up-regulated among external cell signaling factors; nine transcription factors (ATF3, C/EBP, c-Fos, Fos-B, JDP2, JunB, c-Maf, NF-κB, TCF4 showed increased expression and 5 (AP-2, CBP, Elk-1, p53, PEA3 were decreased in tumors with high COX-2. The promoter region of COX-2 gene did not show consistent methylation in tumor or normal colon tissue. Conclusions Transcription and external cell signaling factors are altered as covariates to COX-2 expression in colon cancer tissue, but DNA methylation of the COX-2 promoter region was not a significant factor behind COX-2 expression in tumor and normal colon tissue.
2011-01-01
Background Rheumatic diseases have a significant adverse impact on the individual from physical, mental and social aspects, resulting in a low health-related quality of life (HRQL). There is a lack of longitudinal studies on HRQL in people with rheumatic diseases that focus on factors promoting HRQL instead of risk factors. The aim of this study was to investigate the associations between suggested health promoting factors at baseline and outcome in HRQL at a 12 month follow-up in people with rheumatic diseases. Methods A longitudinal cohort study was conducted in 185 individuals with rheumatic diseases with questionnaires one week and 12 months after rehabilitation in a Swedish rheumatology clinic. HRQL was assessed by SF-36 together with suggested health factors. The associations between SF-36 subscales and the health factors were analysed by multivariable logistic regressions. Results Factors predicting better outcome in HRQL in one or several SF-36 subscales were being younger or middle-aged, feeling painless, having good sleep structure, feeling rested after sleep, performing low effort of exercise more than twice per week, having strong sense of coherence (SOC), emotional support and practical assistance, higher educational level and work capacity. The most important factors were having strong SOC, feeling rested after sleep, having work capacity, being younger or middle-aged, and having good sleep structure. Conclusions This study identified several factors that promoted a good outcome in HRQL to people with rheumatic diseases. These health factors could be important to address in clinical work with rheumatic diseases in order to optimise treatment strategies. PMID:21599884
Seaton, Cherisse L; Holm, Nikolai; Bottorff, Joan L; Jones-Bricker, Margaret; Errey, Sally; Caperchione, Cristina M; Lamont, Sonia; Johnson, Steven T; Healy, Theresa
2018-05-01
To explore published empirical literature in order to identify factors that facilitate or inhibit collaborative approaches for health promotion using a scoping review methodology. A comprehensive search of MEDLINE, CINAHL, ScienceDirect, PsycINFO, and Academic Search Complete for articles published between January 2001 and October 2015 was conducted in accordance with the Preferred Reporting Items for Systematic Reviews and Meta-Analyses guidelines. To be included studies had to: be an original research article, published in English, involve at least 2 organizations in a health promotion partnership, and identify factors contributing to or constraining the success of an established (or prior) partnership. Studies were excluded if they focused on primary care collaboration or organizations jointly lobbying for a cause. Data extraction was completed by 2 members of the author team using a summary chart to extract information relevant to the factors that facilitated or constrained collaboration success. NVivo 10 was used to code article content into the thematic categories identified in the data extraction. Twenty-five studies across 8 countries were identified. Several key factors contributed to collaborative effectiveness, including a shared vision, leadership, member characteristics, organizational commitment, available resources, clear roles/responsibilities, trust/clear communication, and engagement of the target population. In general, the findings were consistent with previous reviews; however, additional novel themes did emerge.
Directory of Open Access Journals (Sweden)
Nahyun Choi
2018-02-01
Full Text Available Minoxidil directly promotes hair growth via the stimulation of dermal papilla (DP and epithelial cells. Alternatively, there is little evidence for indirect promotion of hair growth via stimulation of adipose-derived stem cells (ASCs. We investigated whether minoxidil stimulates ASCs and if increased growth factor secretion by ASCs facilitates minoxidil-induced hair growth. Telogen-to-anagen induction was examined in mice. Cultured DP cells and vibrissae hair follicle organ cultures were used to further examine the underlying mechanisms. Subcutaneous injection of minoxidil-treated ASCs accelerated telogen-to-anagen transition in mice, and increased hair weight at day 14 post-injection. Minoxidil did not alter ASC proliferation, but increased migration and tube formation. Minoxidil also increased the secretion of growth factors from ASCs, including chemokine (C-X-C motif ligand 1 (CXCL1, platelet-derived endothelial cell growth factor (PD-ECGF, and platelet-derived growth factor-C (PDGF-C. Minoxidil increased extracellular signal–regulated kinases 1/2 (ERK1/2 phosphorylation, and concomitant upregulation of PD-ECGF and PDGF-C mRNA levels were attenuated by an ERK inhibitor. Subcutaneous injection of CXCL1, PD-ECGF, or PDGF-C enhanced anagen induction in mice, and both CXCL1 and PDGF-C increased hair length in ex vivo organ culture. Treatment with CXCL1, PD-ECGF, or PDGF-C also increased the proliferation index in DP cells. Finally, topical application of CXCL1, PD-ECGF, or PDGF-C with 2% minoxidil enhanced anagen induction when compared to minoxidil alone. Minoxidil stimulates ASC motility and increases paracrine growth factor signaling. Minoxidil-stimulated secretion of growth factors by ASCs may enhance hair growth by promoting DP proliferation. Therefore, minoxidil can be used as an ASC preconditioning agent for hair regeneration.
Choi, Nahyun; Shin, Soyoung; Song, Sun U.; Sung, Jong-Hyuk
2018-01-01
Minoxidil directly promotes hair growth via the stimulation of dermal papilla (DP) and epithelial cells. Alternatively, there is little evidence for indirect promotion of hair growth via stimulation of adipose-derived stem cells (ASCs). We investigated whether minoxidil stimulates ASCs and if increased growth factor secretion by ASCs facilitates minoxidil-induced hair growth. Telogen-to-anagen induction was examined in mice. Cultured DP cells and vibrissae hair follicle organ cultures were used to further examine the underlying mechanisms. Subcutaneous injection of minoxidil-treated ASCs accelerated telogen-to-anagen transition in mice, and increased hair weight at day 14 post-injection. Minoxidil did not alter ASC proliferation, but increased migration and tube formation. Minoxidil also increased the secretion of growth factors from ASCs, including chemokine (C-X-C motif) ligand 1 (CXCL1), platelet-derived endothelial cell growth factor (PD-ECGF), and platelet-derived growth factor-C (PDGF-C). Minoxidil increased extracellular signal–regulated kinases 1/2 (ERK1/2) phosphorylation, and concomitant upregulation of PD-ECGF and PDGF-C mRNA levels were attenuated by an ERK inhibitor. Subcutaneous injection of CXCL1, PD-ECGF, or PDGF-C enhanced anagen induction in mice, and both CXCL1 and PDGF-C increased hair length in ex vivo organ culture. Treatment with CXCL1, PD-ECGF, or PDGF-C also increased the proliferation index in DP cells. Finally, topical application of CXCL1, PD-ECGF, or PDGF-C with 2% minoxidil enhanced anagen induction when compared to minoxidil alone. Minoxidil stimulates ASC motility and increases paracrine growth factor signaling. Minoxidil-stimulated secretion of growth factors by ASCs may enhance hair growth by promoting DP proliferation. Therefore, minoxidil can be used as an ASC preconditioning agent for hair regeneration. PMID:29495622
Human hepatocyte growth factor promotes functional recovery in primates after spinal cord injury.
Kitamura, Kazuya; Fujiyoshi, Kanehiro; Yamane, Jun-Ichi; Toyota, Fumika; Hikishima, Keigo; Nomura, Tatsuji; Funakoshi, Hiroshi; Nakamura, Toshikazu; Aoki, Masashi; Toyama, Yoshiaki; Okano, Hideyuki; Nakamura, Masaya
2011-01-01
Many therapeutic interventions for spinal cord injury (SCI) using neurotrophic factors have focused on reducing the area damaged by secondary, post-injury degeneration, to promote functional recovery. Hepatocyte growth factor (HGF), which is a potent mitogen for mature hepatocytes and a mediator of the inflammatory responses to tissue injury, was recently highlighted as a potent neurotrophic factor in the central nervous system. We previously reported that introducing exogenous HGF into the injured rodent spinal cord using a herpes simplex virus-1 vector significantly reduces the area of damaged tissue and promotes functional recovery. However, that study did not examine the therapeutic effects of administering HGF after injury, which is the most critical issue for clinical application. To translate this strategy to human treatment, we induced a contusive cervical SCI in the common marmoset, a primate, and then administered recombinant human HGF (rhHGF) intrathecally. Motor function was assessed using an original open field scoring system focusing on manual function, including reach-and-grasp performance and hand placement in walking. The intrathecal rhHGF preserved the corticospinal fibers and myelinated areas, thereby promoting functional recovery. In vivo magnetic resonance imaging showed significant preservation of the intact spinal cord parenchyma. rhHGF-treatment did not give rise to an abnormal outgrowth of calcitonin gene related peptide positive fibers compared to the control group, indicating that this treatment did not induce or exacerbate allodynia. This is the first study to report the efficacy of rhHGF for treating SCI in non-human primates. In addition, this is the first presentation of a novel scale for assessing neurological motor performance in non-human primates after contusive cervical SCI.
Human hepatocyte growth factor promotes functional recovery in primates after spinal cord injury.
Directory of Open Access Journals (Sweden)
Kazuya Kitamura
Full Text Available Many therapeutic interventions for spinal cord injury (SCI using neurotrophic factors have focused on reducing the area damaged by secondary, post-injury degeneration, to promote functional recovery. Hepatocyte growth factor (HGF, which is a potent mitogen for mature hepatocytes and a mediator of the inflammatory responses to tissue injury, was recently highlighted as a potent neurotrophic factor in the central nervous system. We previously reported that introducing exogenous HGF into the injured rodent spinal cord using a herpes simplex virus-1 vector significantly reduces the area of damaged tissue and promotes functional recovery. However, that study did not examine the therapeutic effects of administering HGF after injury, which is the most critical issue for clinical application. To translate this strategy to human treatment, we induced a contusive cervical SCI in the common marmoset, a primate, and then administered recombinant human HGF (rhHGF intrathecally. Motor function was assessed using an original open field scoring system focusing on manual function, including reach-and-grasp performance and hand placement in walking. The intrathecal rhHGF preserved the corticospinal fibers and myelinated areas, thereby promoting functional recovery. In vivo magnetic resonance imaging showed significant preservation of the intact spinal cord parenchyma. rhHGF-treatment did not give rise to an abnormal outgrowth of calcitonin gene related peptide positive fibers compared to the control group, indicating that this treatment did not induce or exacerbate allodynia. This is the first study to report the efficacy of rhHGF for treating SCI in non-human primates. In addition, this is the first presentation of a novel scale for assessing neurological motor performance in non-human primates after contusive cervical SCI.
Health Promoting Life Style and Its Related Factors in Female Adolescents
Directory of Open Access Journals (Sweden)
Nahid Golmakani
2013-07-01
Full Text Available Background and Aim: One of the main strategies for keeping health is having healthy life style. Due to important role of adolescent health in community health promotion, this study aimed to determine health promoting life style in female adolescents of high schools and its associated factors in Mashhad, Iran. Methods: This cross- sectional study was conducted on 810 girls ranging in ages from 14to 18 years old, who were studying in high schools and selected using cluster sampling from in Mashhad, Iran in 2013. They completed questionnaires of demographic data and Adolescent Health Promoting AH scale. Data were analyzed by statistical tests of Mann-Whitney U, Kruskal-Wallis, Freedman, Wilcoxon, Spearman correlation coefficient and General linear model. Results: The mean age of subjects was 15.51±0.98 and the mean score of life style was 63.92±12.01. The highest score of life style subscales was allocated to the “spiritual growth or life-appreciation (77.66±15.56 and the least to the physical and sport activities (51.66±22.49. There was a significant relationship between the life style score of adolescents with parents educational level (mother P=0.024, father P=0.014. However no significant relationship was found between adolescents' life style and their residential area and also parents' job. Among different dimension of life style, the highest correlation was seen between spiritual growth score and life style total score (p=0.01. Conclusion: Based on the findings, it is necessary to prioritize implementing of health-related educational programs in order to changing and modification of unhealthy life style related factors, with focus on sport activities as well as health and nutrition. Also it is needed to provide special facilities to select healthy living behaviors among Female adolescents.
International Nuclear Information System (INIS)
Matsukura, Hiroshi; Aisaki, Ken-ichi; Igarashi, Katsuhide; Matsushima, Yuko; Kanno, Jun; Muramatsu, Masaaki; Sudo, Katsuko; Sato, Noriko
2011-01-01
Highlights: → Genistein (GEN) is a phytoestrogen found in soy products. → GEN demethylated/unsilenced the steroidogenic factor 1 gene in endometrial tissue. → GEN thus altered mRNA expression in uteri of ovariectomized (OVX) mice. → A high-resolution melting assay was used to screen for epigenetic change. → We isolated an endometrial cell clone that was epigenetically modulated by GEN. -- Abstract: It has recently been demonstrated that genistein (GEN), a phytoestrogen in soy products, is an epigenetic modulator in various types of cells; but its effect on endometrium has not yet been determined. We investigated the effects of GEN on mouse uterine cells, in vivo and in vitro. Oral administration of GEN for 1 week induced mild proliferation of the endometrium in ovariectomized (OVX) mice, which was accompanied by the induction of steroidogenic factor 1 (SF-1) gene expression. GEN administration induced demethylation of multiple CpG sites in the SF-1 promoter; these sites are extensively methylated and thus silenced in normal endometrium. The GEN-mediated promoter demethylation occurred predominantly on the luminal side, as opposed to myometrium side, indicating that the epigenetic change was mainly shown in regenerated cells. Primary cultures of endometrial stromal cell colonies were screened for GEN-mediated alterations of DNA methylation by a high-resolution melting (HRM) method. One out of 20 colony-forming cell clones showed GEN-induced demethylation of SF-1. This clone exhibited a high proliferation capacity with continuous colony formation activity through multiple serial clonings. We propose that only a portion of endometrial cells are capable of receiving epigenetic modulation by GEN.
Energy Technology Data Exchange (ETDEWEB)
Matsukura, Hiroshi, E-mail: hmatsukura.epi@mri.tmd.ac.jp [Department of Molecular Epidemiology, Medical Research Institute, Tokyo Medical and Dental University, 2-3-10 Kanda-surugadai, Chiyoda-ku, Tokyo 101-0062 (Japan); Aisaki, Ken-ichi; Igarashi, Katsuhide; Matsushima, Yuko; Kanno, Jun [Division of Cellular and Molecular Toxicology, National Institute of Health Sciences, 1-18-1 Kamiyoga, Setagaya-ku, Tokyo 158-8501 (Japan); Muramatsu, Masaaki [Department of Molecular Epidemiology, Medical Research Institute, Tokyo Medical and Dental University, 2-3-10 Kanda-surugadai, Chiyoda-ku, Tokyo 101-0062 (Japan); Sudo, Katsuko [Department of Molecular Epidemiology, Medical Research Institute, Tokyo Medical and Dental University, 2-3-10 Kanda-surugadai, Chiyoda-ku, Tokyo 101-0062 (Japan); Animal Research Center, Tokyo Medical University, 6-1-1 Shinjuku, Shinjuku-ku, Tokyo 160-8402 (Japan); Sato, Noriko, E-mail: nsato.epi@tmd.ac.jp [Department of Molecular Epidemiology, Medical Research Institute, Tokyo Medical and Dental University, 2-3-10 Kanda-surugadai, Chiyoda-ku, Tokyo 101-0062 (Japan)
2011-08-26
Highlights: {yields} Genistein (GEN) is a phytoestrogen found in soy products. {yields} GEN demethylated/unsilenced the steroidogenic factor 1 gene in endometrial tissue. {yields} GEN thus altered mRNA expression in uteri of ovariectomized (OVX) mice. {yields} A high-resolution melting assay was used to screen for epigenetic change. {yields} We isolated an endometrial cell clone that was epigenetically modulated by GEN. -- Abstract: It has recently been demonstrated that genistein (GEN), a phytoestrogen in soy products, is an epigenetic modulator in various types of cells; but its effect on endometrium has not yet been determined. We investigated the effects of GEN on mouse uterine cells, in vivo and in vitro. Oral administration of GEN for 1 week induced mild proliferation of the endometrium in ovariectomized (OVX) mice, which was accompanied by the induction of steroidogenic factor 1 (SF-1) gene expression. GEN administration induced demethylation of multiple CpG sites in the SF-1 promoter; these sites are extensively methylated and thus silenced in normal endometrium. The GEN-mediated promoter demethylation occurred predominantly on the luminal side, as opposed to myometrium side, indicating that the epigenetic change was mainly shown in regenerated cells. Primary cultures of endometrial stromal cell colonies were screened for GEN-mediated alterations of DNA methylation by a high-resolution melting (HRM) method. One out of 20 colony-forming cell clones showed GEN-induced demethylation of SF-1. This clone exhibited a high proliferation capacity with continuous colony formation activity through multiple serial clonings. We propose that only a portion of endometrial cells are capable of receiving epigenetic modulation by GEN.
Directory of Open Access Journals (Sweden)
Fabian Machens
2017-10-01
Full Text Available Orthogonal systems for heterologous protein expression as well as for the engineering of synthetic gene regulatory circuits in hosts like Saccharomyces cerevisiae depend on synthetic transcription factors (synTFs and corresponding cis-regulatory binding sites. We have constructed and characterized a set of synTFs based on either transcription activator-like effectors or CRISPR/Cas9, and corresponding small synthetic promoters (synPs with minimal sequence identity to the host’s endogenous promoters. The resulting collection of functional synTF/synP pairs confers very low background expression under uninduced conditions, while expression output upon induction of the various synTFs covers a wide range and reaches induction factors of up to 400. The broad spectrum of expression strengths that is achieved will be useful for various experimental setups, e.g., the transcriptional balancing of expression levels within heterologous pathways or the construction of artificial regulatory networks. Furthermore, our analyses reveal simple rules that enable the tuning of synTF expression output, thereby allowing easy modification of a given synTF/synP pair. This will make it easier for researchers to construct tailored transcriptional control systems.
DEFF Research Database (Denmark)
Neergaard, Jesper; Møller, Katrine Dragsbæk; Christiansen, Claus
2017-01-01
truncated tau fragments (Tau-A and Tau-C) in serum. Platelets, albumin and several modifiable risk factors, including Body Mass Index, high density lipoprotein and White Blood Cell count were associated with the serum level of tau fragments. The factors associated with tau in serum may promote...
International Nuclear Information System (INIS)
Al-Nbaheen, M.; Pourzand, C.; Tyrrell, R.M.
2006-01-01
One way of targeting gene expression in vivo is to control transcription using a tissue-specific regulatory system. Tissue specific promoters or enhancers are in use in transgenic animals and could be utilized in medical for gene therapy. At present the usual method for selection of a tissue-specific promoter is to identify a gene, which is expressed at unusually high level in the target tissue, and then to use the promoter for this gene to drive expression of another therapeutic gene in the target tissue. This approach is logical but does not always lead to high levels of gene expression. A second approach is to investigate the scope for discovery of synthetic specific promoters using a target tissue. The objective of the work described in this paper was to use both approach to design plasmid DNA expression vectors that would carry liver-specific promoter/enhancer linked to reporter gene (i.e. luciferase). Then transfect these vectors to both liver-derived and non-liver cell lines. This is followed by evaluation of the liver-specificity of each construct by measuring the basal level expression of the reporter gene (i.e. luciferase activity) in both cell lines. Hepatocyte nuclear factor-4 (HNF-4) is liver-enriched transcription factor used to design new synthetic enhancers by inserting a tandem array of 1', 3' or 5' repeats of the HNF-4 binding site upstream of the SV40 promoter linked to the luciferase reporter gene within an Epstein-Barr virus (EBV)-based vector, p 706. The results of transfection revealed that unexpectedly the HNF-4 binding sites in these constructs act as a repressor rather than enhancer of the liver-specific expression of the luciferase gene. (author)
Energy Technology Data Exchange (ETDEWEB)
Boone, Lindsey R.; Niesen, Melissa I. [Department of Molecular Medicine, College of Medicine, University of South Florida, Tampa, FL (United States); Jaroszeski, Mark [Department of Chemical and Biomedical Engineering, College of Engineering, University of South Florida, Tampa, FL (United States); Ness, Gene C., E-mail: gness@hsc.usf.edu [Department of Molecular Medicine, College of Medicine, University of South Florida, Tampa, FL (United States)
2009-07-31
The promoter elements and transcription factors necessary for triiodothyronine (T{sub 3}) induction of hepatic HMG-CoA reductase (HMGR) were investigated by transfecting rat livers with wild type and mutant HMGR promoter-luciferase constructs using in vivo electroporation. Mutations in the sterol response element (SRE), nuclear factor-y (NF-Y) site, and the newly identified upstream transcription factor-2 (USF-2) site essentially abolished the T{sub 3} response. Chromatin immunoprecipitation (ChIP) analysis demonstrated that T{sub 3} treatment caused a 4-fold increase in in vivo binding of USF-2 to the HMGR promoter. Co-transfection of the wild type HMGR promoter with siRNAs to USF-2, SREBP-2, or NF-Y nearly abolished the T{sub 3} induction, as measured by promoter activity. These data provide in vivo evidence for functional roles for USF-2, SREBP-2, and NF-Y in mediating the T{sub 3}-induction of hepatic HMGR transcription.
Seelandt, Julia C; Kaderli, Reto M; Tschan, Franziska; Businger, Adrian P
2014-01-01
The aim of this study was to identify the factors perceived by surgeons that promote surgery as an attractive or unattractive career choice for today's graduates. In addition, it examined whether the perspectives of surgeons in different professional situations converges. The content of work, contextual work conditions, and calling to this job are discussed in the context of choosing surgery as a career. Eight hundred sixty-nine surgeons were asked to answer open-ended questions regarding the factors that promote surgery as an attractive or unattractive career choice for today's graduates. Four hundred ninety-two surgeons participated, and 1,525 statements were analyzed using Mayring's content-analyses method. Chi-square tests were used to analyze the differences among hierarchical positions. With respect to the factors that promote surgery as a profession, 40.8% (209/492) of the surgeons stated that surgery is a calling, 29.1% (149/492) of the surgeons provided at least one argument related to the positive task characteristics, and 12.9% (66/492) of the surgeons provided statements related to the positive contextual factors. With respect to the factors that discourage surgery as a profession, 45.7% (234/492) of the surgeons provided at least one argument related to the discouraging work characteristics, and 67.6% (346/492) of the surgeons provided problematic contextual characteristics. This study emphasizes the importance of the calling to surgery as an important factor for choosing surgery as a career. However, the extensive workload, training, and poor work-family balance have been identified as factors that discourage graduates from choosing surgery as a career. The identified positive factors could be used to attract and maintain graduates in surgical disciplines.
Merzaban, Jasmeen; Burdick, Monica M.; Gadhoum, Samah; Dagia, Nilesh M.; Chu, Julia T.; Fuhlbrigge, Robert C.; Sackstein, Robert D.
2011-01-01
Although well recognized that expression of E-selectin on marrow microvessels mediates osteotropism of hematopoietic stem/progenitor cells (HSPCs), our knowledge regarding the cognate E-selectin ligand(s) on HSPCs is incomplete. Flow cytometry using
Directory of Open Access Journals (Sweden)
Julia C Seelandt
Full Text Available BACKGROUND: The aim of this study was to identify the factors perceived by surgeons that promote surgery as an attractive or unattractive career choice for today's graduates. In addition, it examined whether the perspectives of surgeons in different professional situations converges. The content of work, contextual work conditions, and calling to this job are discussed in the context of choosing surgery as a career. METHODS: Eight hundred sixty-nine surgeons were asked to answer open-ended questions regarding the factors that promote surgery as an attractive or unattractive career choice for today's graduates. Four hundred ninety-two surgeons participated, and 1,525 statements were analyzed using Mayring's content-analyses method. Chi-square tests were used to analyze the differences among hierarchical positions. RESULTS: With respect to the factors that promote surgery as a profession, 40.8% (209/492 of the surgeons stated that surgery is a calling, 29.1% (149/492 of the surgeons provided at least one argument related to the positive task characteristics, and 12.9% (66/492 of the surgeons provided statements related to the positive contextual factors. With respect to the factors that discourage surgery as a profession, 45.7% (234/492 of the surgeons provided at least one argument related to the discouraging work characteristics, and 67.6% (346/492 of the surgeons provided problematic contextual characteristics. CONCLUSION: This study emphasizes the importance of the calling to surgery as an important factor for choosing surgery as a career. However, the extensive workload, training, and poor work-family balance have been identified as factors that discourage graduates from choosing surgery as a career. The identified positive factors could be used to attract and maintain graduates in surgical disciplines.
Factors that Promote or Hinder Young Disabled People in Work Participation: A Systematic Review
Achterberg, T. J.; Wind, H.; de Boer, A. G. E. M.; Frings-Dresen, M. H. W.
2009-01-01
Introduction The aim of this systematic review was to study factors which promote or hinder young disabled people entering the labor market. Methods We systematically searched PubMed (by means of MESH and text words), EMBASE, PsycINFO, Web of Science and CINAHL for studies regarding (1) disabled
Ostaszewski, Krzysztof; Zimmerman, Marc A
2006-12-01
Resiliency theory provides a conceptual framework for studying why some youth exposed to risk factors do not develop the negative behaviors they predict. The purpose of this study was to test compensatory and protective models of resiliency in a longitudinal sample of urban adolescents (80% African American). The data were from Years 1 (9th grade) and 4 (12th grade). The study examined effects of cumulative risk and promotive factors on adolescent polydrug use including alcohol, tobacco and marijuana. Cumulative measures of risk/promotive factors represented individual characteristics, peer influence, and parental/familial influences. After controlling for demographics, results of multiple regression of polydrug use support the compensatory model of resiliency both cross-sectionally and longitudinally. Promotive factors were also found to have compensatory effects on change in adolescent polydrug use. The protective model of resiliency evidenced cross-sectionally was not supported in longitudinal analysis. The findings support resiliency theory and the use of cumulative risk/promotive measures in resiliency research. Implications focused on utilizing multiple assets and resources in prevention programming are discussed.
Na, Kyoung-Sae; Won, Eunsoo; Kang, June; Chang, Hun Soo; Yoon, Ho-Kyoung; Tae, Woo Suk; Kim, Yong-Ku; Lee, Min-Soo; Joe, Sook-Haeng; Kim, Hyun; Ham, Byung-Joo
2016-02-15
Recent studies have reported that methylation of the brain-derived neurotrophic factor (BDNF) gene promoter is associated with major depressive disorder (MDD). This study aimed to investigate the association between cortical thickness and methylation of BDNF promoters as well as serum BDNF levels in MDD. The participants consisted of 65 patients with recurrent MDD and 65 age- and gender-matched healthy controls. Methylation of BDNF promoters and cortical thickness were compared between the groups. The right medial orbitofrontal, right lingual, right lateral occipital, left lateral orbitofrontal, left pars triangularis, and left lingual cortices were thinner in patients with MDD than in healthy controls. Among the MDD group, right pericalcarine, right medical orbitofrontal, right rostral middle frontal, right postcentral, right inferior temporal, right cuneus, right precuneus, left frontal pole, left superior frontal, left superior temporal, left rostral middle frontal and left lingual cortices had inverse correlations with methylation of BDNF promoters. Higher levels of BDNF promoter methylation may be closely associated with the reduced cortical thickness among patients with MDD. Serum BDNF levels were significantly lower in MDD, and showed an inverse relationship with BDNF methylation only in healthy controls. Particularly the prefrontal and occipital cortices seem to indicate key regions in which BDNF methylation has a significant effect on structure.
Bethell, Christina; Forrest, Christopher B; Stumbo, Scott; Gombojav, Narangerel; Carle, Adam; Irwin, Charles E
2012-04-01
School success predicts many pathways for health and well-being across the life span. Factors promoting or potentially impeding school success are critical to understand for all children and for children with special health care needs (CSHCN), whose life course trajectories are already impacted by their chronic health problems. The 2007 National Survey of Children's Health was used (1) to estimate national and state prevalence and within and across states disparities in factors promoting school success (engagement, participation, safety) or potentially impeding success (missing school, grade repetition, school identified problems) for all children and CSHCN and (2) to evaluate associations with CSHCN service need complexity and presence of emotional, behavioral or developmental problems (EBD) as well as with school case management policies in states. Among school age children, 60 % experienced all three factors promoting school success (49.3-73.8 % across states), dropping to 51.3 % for CSHCN (39.4-64.7 % across states) and to 36.2 % for the 40 % of all CSHCN who have both more complex service needs and EBD. CSHCN were more likely to experience factors potentially impeding school success. After accounting for child factors, CSHCN living in states requiring case management in schools for children with disabilities were less likely to experience grade repetition (OR 0.65). Within-state disparities between non-CSHCN and CSHCN varied across states. Threats to school success for US children are pervasive and are especially pronounced for CSHCN with more complex needs and EBD. Findings support broad, non-condition specific efforts to promote school success for CSHCN and consideration of state school policies, such as case management.
MiR-32 promotes gastric carcinoma tumorigenesis by targeting Kruppel-like factor 4
Energy Technology Data Exchange (ETDEWEB)
Yan, Chao [Department of General Surgery, Peking Union Medical College Hospital, Chinese Academy of Medical Science and Peking Union Medical College, Beijing, 100730 (China); Yu, Jianchun, E-mail: yu_jchpumch@163.com [Department of General Surgery, Peking Union Medical College Hospital, Chinese Academy of Medical Science and Peking Union Medical College, Beijing, 100730 (China); Liu, Yuqin [Cell Culture Center, Institute of Basic Medical Sciences, Chinese Academy of Medical Sciences and Peking Union Medical College, Beijing, 100005 (China); Kang, Weiming; Ma, Zhiqiang; Zhou, Li [Department of General Surgery, Peking Union Medical College Hospital, Chinese Academy of Medical Science and Peking Union Medical College, Beijing, 100730 (China)
2015-11-27
Gastric cancer (GC) is a prevalent malignant cancer worldwide and is highly lethal because of its fast growth. Currently, the clinical therapy options for GC remain limited. MiR-32 has been reported as an oncogenic microRNA in many cancers, but its role in GC is unclear. Here, we found that miR-32 was overexpressed in GC tissues compared with adjacent normal tissue, and miR-32 was higher in GC patients' plasma compared with healthy individuals. Furthermore, we have identified miR-32 to be oncogenic, by promoting gastric cell proliferation, migration and invasion. We also identified Kruppel-like factor 4 (KLF4) as a direct target of miR-32. Knockdown of KLF4 promoted proliferation, migration and invasion of GC cells. We conclude that miR-32 promotes GC cell proliferation, migration and invasion by targeting KLF4, suggesting that the miR-32-KLF4 pathway may be useful in clinical diagnosis and therapeutics. - Highlights: • miR-32 was overexpression in GC tissues than adjacent normal tissue. • miR-32 was higher in GC patients' plasma compared with healthy people. • miR-32 promotes GC cell proliferation, migration and invasion by targeting KLF4.
International Nuclear Information System (INIS)
Zhang, Jing; Wang, Zhihua; Jiang, Yong; Niu, Zhongying; Fu, Lei; Luo, Zhirong; Cooper, Paul R.; Smith, Anthony J.; He, Wenxi
2015-01-01
The transcription factor Nuclear Factor I-C (NFIC) has been implicated in the regulation of tooth root development, where it may be anticipated to impact on the behavior of stem cells from the apical papilla (SCAPs) and root odontoblast activity. We hypothesized that NFIC may provide an important target for promoting dentin/root regeneration. In the present study, the effects of NFIC on the proliferation and differentiation of SCAPs were investigated. Over-expression of NFIC increased cell proliferation, mineralization nodule formation and alkaline phosphatase (ALP) activity in SCAPs. Furthermore, NFIC up-regulated the mRNA levels of odontogenic-related markers, ALP, osteocalcin and collagen type I as well as dentin sialoprotein protein levels. In contrast, knockdown of NFIC by si-RNA inhibited the mineralization capacity of SCAPs and down-regulated the expression of odontogenic-related markers. In conclusion, the results indicated that upregulation of NFIC activity in SCAPs may promote osteo/odontoblastic differentiation of SCAPs. - Highlights: • NFIC promotes the proliferation of SCAPs in vitro. • NFIC promotes osteo/odontogenic differentiation of SCAPs in vitro. • Knockdown of NFIC inhibits odontogenic differentiation in SCAPs
Energy Technology Data Exchange (ETDEWEB)
Zhang, Jing [State Key Laboratory of Military Stomatology, Department of Operative Dentistry & Endodontics, School of Stomatology, The Fourth Military Medical University, Xi' an (China); Stomatologic Hospital & College, Anhui Medical University, Key Lab of Oral Diseases Research of Anhui Province, Hefei (China); Wang, Zhihua; Jiang, Yong [State Key Laboratory of Military Stomatology, Department of Operative Dentistry & Endodontics, School of Stomatology, The Fourth Military Medical University, Xi' an (China); Niu, Zhongying [Treatment center of oral diseases, The 306th Hospital of People' s Liberation Army, Beijing (China); Fu, Lei; Luo, Zhirong [State Key Laboratory of Military Stomatology, Department of Operative Dentistry & Endodontics, School of Stomatology, The Fourth Military Medical University, Xi' an (China); Cooper, Paul R.; Smith, Anthony J. [Oral Biology, School of Dentistry, University of Birmingham, B4 6NN (United Kingdom); He, Wenxi, E-mail: hewenxi@fmmu.edu.cn [State Key Laboratory of Military Stomatology, Department of Operative Dentistry & Endodontics, School of Stomatology, The Fourth Military Medical University, Xi' an (China)
2015-03-15
The transcription factor Nuclear Factor I-C (NFIC) has been implicated in the regulation of tooth root development, where it may be anticipated to impact on the behavior of stem cells from the apical papilla (SCAPs) and root odontoblast activity. We hypothesized that NFIC may provide an important target for promoting dentin/root regeneration. In the present study, the effects of NFIC on the proliferation and differentiation of SCAPs were investigated. Over-expression of NFIC increased cell proliferation, mineralization nodule formation and alkaline phosphatase (ALP) activity in SCAPs. Furthermore, NFIC up-regulated the mRNA levels of odontogenic-related markers, ALP, osteocalcin and collagen type I as well as dentin sialoprotein protein levels. In contrast, knockdown of NFIC by si-RNA inhibited the mineralization capacity of SCAPs and down-regulated the expression of odontogenic-related markers. In conclusion, the results indicated that upregulation of NFIC activity in SCAPs may promote osteo/odontoblastic differentiation of SCAPs. - Highlights: • NFIC promotes the proliferation of SCAPs in vitro. • NFIC promotes osteo/odontogenic differentiation of SCAPs in vitro. • Knockdown of NFIC inhibits odontogenic differentiation in SCAPs.
Identifying work ability promoting factors for home care aides and assistant nurses
Directory of Open Access Journals (Sweden)
Larsson Agneta
2012-01-01
Full Text Available Abstract Background In workplace health promotion, all potential resources needs to be taken into consideration, not only factors relating to the absence of injury and the physical health of the workers, but also psychological aspects. A dynamic balance between the resources of the individual employees and the demands of work is an important prerequisite. In the home care services, there is a noticeable trend towards increased psychosocial strain on employees at work. There are a high frequency of work-related musculoskeletal disorders and injuries, and a low prevalence of sustainable work ability. The aim of this research was to identify factors promoting work ability and self-efficacy in care aides and assistant nurses within home care services. Methods This study is based on cross-sectional data collected in a municipality in northern Sweden. Care aides (n = 58 and assistant nurses (n = 79 replied to a self-administered questionnaire (response rate 46%. Hierarchical multiple regression analyses were performed to assess the influence of several independent variables on self-efficacy (model 1 and work ability (model 2 for care aides and assistant nurses separately. Results Perceptions of personal safety, self-efficacy and musculoskeletal wellbeing contributed to work ability for assistant nurses (R2adj of 0.36, p 2adj of 0.29, p = 0.001. Self-efficacy was associated with the safety climate and the physical demands of the job in both professions (R2adj of 0.24, p = 0.003 for care aides, and also by sex and age for the assistant nurses (R2adj of 0.31, p Conclusions The intermediate factors contributed differently to work ability in the two professions. Self-efficacy, personal safety and musculoskeletal wellbeing were important for the assistant nurses, while the work ability of the care aides was associated with the safety climate, but also with the non-changeable factors age and seniority. All these factors are important to acknowledge in
DEFF Research Database (Denmark)
Damgaard, Tina; Knudsen, Lene M; Dahl, Inger Marie S
2009-01-01
the regulation of the CD56 promoter in relation to typical clinical factors. We used qPCR and FACS to measure the expression levels of CD56, and potential regulatory factors in patients with MM and related these with MM progression/prognosis. The transcription factors BTBD3, Pax5, RUNX1 and MMSET were positively...... associated with CD56 expression, as was CYCLIN D1, which is involved in disease progression, anti-apoptosis and proliferation. RUNX1 was negatively associated with the survival of stem-cell transplanted patients. Our findings propose four potential activators of the CD56 promoter and for CD56 to be involved...
International Nuclear Information System (INIS)
Zhao Cunyou; Chen Yali; Park, Jiyoung; Kim, Jae Bum; Tang Hong
2004-01-01
Transcription initiation from HIV-1 long terminal repeat (LTR) promoter requires the virally encoded transactivator, Tat, and several cellular co-factors to accomplish the Tat-dependent processive transcription elongation. Individual cellular transcription activators, LBP-1b and Oct-1, on the other hand, have been shown to inhibit LTR promoter activities probably via competitive binding against TFIID to the TATA-box in LTR promoter. To explore the genetic interference strategies against the viral replication, we took advantage of the existence of the bipartite DNA binding domains and the repression domains of LBP-1b and Oct-1 factors to generate a chimeric transcription repressor. Our results indicated that the fusion protein of LBP-1b and Oct-1 exhibited higher DNA binding affinity to the viral promoter than the individual factors, and little interference with the host cell gene expression due to its anticipated rare cognate DNA sites in the host cell genome. Moreover, the chimera exerted increased Tat-dependent repression of transcription initiation at the LTR promoter both in vitro and in vivo compared to LBP-1b, Oct-1 or combination of LBP-1b and Oct-1. These results might provide the lead in generating a therapeutic reagent useful to suppress HIV-1 replication
The work ability continuum : Epidemiological studies of factors promoting sustainable work ability
Lindberg, Per
2006-01-01
For the individual, the workplace and society, there would be considerable gains if the number of people suffering from physical and mental disorders could be reduced. The overall aim of this thesis was to identify determinants for future work ability among gainfully employed women and men, with special reference to promotive factors at work. Work ability is in this thesis defined as the ability to work with respect to demands at work on health and physical and mental reso...
Guinane, Caitriona M; Piper, Clare; Draper, Lorraine A; O'Connor, Paula M; Hill, Colin; Ross, R Paul; Cotter, Paul D
2015-11-01
Bacteriocin production is regarded as a desirable probiotic trait that aids in colonization and persistence in the gastrointestinal tract (GIT). Strains of Lactobacillus salivarius, a species associated with the GIT, are regarded as promising probiotic candidates and have a number of associated bacteriocins documented to date. These include multiple class IIb bacteriocins (salivaricin T, salivaricin P, and ABP-118) and the class IId bacteriocin bactofencin A, which show activity against medically important pathogens. However, the production of a bacteriocin in laboratory media does not ensure production under stressful environmental conditions, such as those encountered within the GIT. To allow this issue to be addressed, the promoter regions located upstream of the structural genes encoding the L. salivarius bacteriocins mentioned above were fused to a number of reporter proteins (green fluorescent protein [GFP], red fluorescent protein [RFP], and luciferase [Lux]). Of these, only transcriptional fusions to GFP generated signals of sufficient strength to enable the study of promoter activity in L. salivarius. While analysis of the class IIb bacteriocin promoter regions indicated relatively weak GFP expression, assessment of the promoter of the antistaphylococcal bacteriocin bactofencin A revealed a strong promoter that is most active in the absence of the antimicrobial peptide and is positively induced in the presence of mild environmental stresses, including simulated gastric fluid. Taken together, these data provide information on factors that influence bacteriocin production, which will assist in the development of strategies to optimize in vivo and in vitro production of these antimicrobials. Copyright © 2015, American Society for Microbiology. All Rights Reserved.
Energy Technology Data Exchange (ETDEWEB)
Adam, Tasneem; Opie, Lionel H. [Hatter Cardiovascular Research Institute, Faculty of Health Sciences, University of Cape Town, Observatory 7925 (South Africa); Essop, M. Faadiel, E-mail: mfessop@sun.ac.za [Cardio-Metabolic Research Group (CMRG), Department of Physiological Sciences, Stellenbosch University, Stellenbosch 7600 (South Africa)
2010-07-30
Research highlights: {yields} AMPK inhibits acetyl-CoA carboxylase beta gene promoter activity. {yields} Nuclear respiratory factor-1 inhibits acetyl-CoA carboxylase beta promoter activity. {yields} AMPK regulates acetyl-CoA carboxylase beta at transcriptional level. -- Abstract: The cardiac-enriched isoform of acetyl-CoA carboxylase (ACC{beta}) produces malonyl-CoA, a potent inhibitor of carnitine palmitoyltransferase-1. AMPK inhibits ACC{beta} activity, lowering malonyl-CoA levels and promoting mitochondrial fatty acid {beta}-oxidation. Previously, AMPK increased promoter binding of nuclear respiratory factor-1 (NRF-1), a pivotal transcriptional modulator controlling gene expression of mitochondrial proteins. We therefore hypothesized that NRF-1 inhibits myocardial ACC{beta} promoter activity via AMPK activation. A human ACC{beta} promoter-luciferase construct was transiently transfected into neonatal cardiomyocytes {+-} a NRF-1 expression construct. NRF-1 overexpression decreased ACC{beta} gene promoter activity by 71 {+-} 4.6% (p < 0.001 vs. control). Transfections with 5'-end serial promoter deletions revealed that NRF-1-mediated repression of ACC{beta} was abolished with a pPII{beta}-18/+65-Luc deletion construct. AMPK activation dose-dependently reduced ACC{beta} promoter activity, while NRF-1 addition did not further decrease it. We also investigated NRF-1 inhibition in the presence of upstream stimulatory factor 1 (USF1), a known transactivator of the human ACC{beta} gene promoter. Here NRF-1 blunted USF1-dependent induction of ACC{beta} promoter activity by 58 {+-} 7.5% (p < 0.001 vs. control), reversed with a dominant negative NRF-1 construct. NRF-1 also suppressed endogenous USF1 transcriptional activity by 55 {+-} 6.2% (p < 0.001 vs. control). This study demonstrates that NRF-1 is a novel transcriptional inhibitor of the human ACC{beta} gene promoter in the mammalian heart. Our data extends AMPK regulation of ACC{beta} to the transcriptional level.
The Platelet Aggregation-Inducing Factor Aggrus/Podoplanin Promotes Pulmonary Metastasis
Kunita, Akiko; Kashima, Takeshi G.; Morishita, Yasuyuki; Fukayama, Masashi; Kato, Yukinari; Tsuruo, Takashi; Fujita, Naoya
2007-01-01
Tumor cell-induced platelet aggregation has been reported to facilitate hematogenous metastasis. Aggrus/podoplanin is a platelet aggregation-inducing factor that is up-regulated in a number of human cancers and has been implicated in tumor progression. We studied herein the role of Aggrus in tumor growth, metastasis, and survival in vivo. Aggrus expression in Chinese hamster ovary cells promoted pulmonary metastasis in both an experimental and a spontaneous mouse model. No differences in the size of metastatic foci or in primary tumor growth were found in either set of mice. Aggrus-expressing cells, which were covered with platelets, arrested in the lung microvasculature 30 minutes after injection. In addition, lung metastasis resulting from Aggrus expression decreased the survival of the mice. By generating several Aggrus point mutants, we revealed that point mutation at the platelet aggregation-stimulating domain of Aggrus (Thr34 and Thr52) obliterated both platelet aggregation and metastasis. Furthermore, administration of aspirin to mice reduced the number of metastatic foci. These results indicate that Aggrus contributes to the establishment of metastasis by promoting platelet aggregation without affecting subsequent growth. Thus, Aggrus could serve as an ideal therapeutic target for drug development to block metastasis. PMID:17392172
Insulin Promoter Factor 1 variation is associated with type 2 diabetes in African Americans
Directory of Open Access Journals (Sweden)
Wang Xiaoqin
2005-10-01
Full Text Available Abstract Background Defective insulin secretion is a key defect in the pathogenesis of type 2 diabetes (T2DM. The β-cell specific transcription factor, insulin promoter factor 1 gene (IPF1, is essential to pancreatic development and the maintenance of β-cell mass. We hypothesized that regulatory or coding variants in IPF1 contribute to defective insulin secretion and thus T2DM. Methods We screened 71 Caucasian and 69 African American individuals for genetic variants in the promoter region, three highly conserved upstream regulatory sequences (PH1, PH2 and PH3, the human β-cell specific enhancer, and the two exons with adjacent introns. We tested for an association of each variant with T2DM Caucasians (192 cases and 192 controls and African Americans (341 cases and 186 controls. Results We identified 8 variants in the two populations, including a 3 bp insertion in exon 2 (InsCCG243 in African Americans that resulted in an in-frame proline insertion in the transactivation domain. No variant was associated with T2DM in Caucasians, but polymorphisms at -3766 in the human β-cell enhancer, at -2877 bp in the PH1 domain, and at -108 bp in the promoter region were associated with T2DM in African American subjects (p Conculsion The common alleles of regulatory variants in the 5' enhancer and promoter regions of the IPF1 gene increase susceptibility to type 2 diabetes among African American individuals, likely as a result of gene-gene or gene-environment interactions. In contrast, IPF1 is not a cause of type 2 diabetes in Caucasians. A previously described InsCCG243 variant may contribute to diabetes susceptibility in African American individuals, but is of low penetrance.
van der Laan, Andre M.; Veenstra, Rene; Bogaerts, Stefan; Verhulst, Frank C.; Ormel, Johan
2010-01-01
This study uses a social-ecological approach to the development of delinquency. The authors emphasize that a balance between eliminating risk and enhancing protection across domains is essential in reducing problems and promoting competence. The cumulative risk and promotive effects of temperament, family and school factors in preadolescence were…
Muellmann, Saskia; Steenbock, Berit; De Cocker, Katrien; De Craemer, Marieke; Hayes, Catherine; O'Shea, Miriam P; Horodyska, Karolina; Bell, Justyna; Luszczynska, Aleksandra; Roos, Gun; Langøien, Lars Jørun; Rugseth, Gro; Terragni, Laura; De Bourdeaudhuij, Ilse; Brug, Johannes; Pischke, Claudia R
2017-12-06
The uptake, implementation, and maintenance of effective interventions promoting physical activity (PA) and a healthy diet and the implementation of policies targeting these behaviors are processes not well understood. We aimed to gain a better understanding of what health promotion professionals and policy makers think are important factors facilitating adoption, implementation, and maintenance of multi-level interventions and policies promoting healthy eating and PA in Belgium, Germany, Ireland, Norway, and Poland. Six interventions and six policies were identified based on pre-defined criteria. Forty semi-structured interviews were conducted with stakeholders from various sectors to elicit information on factors impacting adoption, implementation, and maintenance of these interventions and policies. All interview transcripts were coded in NVivo, using a common categorization matrix. Coding in the respective countries was done by one researcher and validated by a second researcher. Active involvement of relevant stakeholders and good communication between coordinating organizations were described as important factors contributing to successful adoption and implementation of both interventions and policies. Additional facilitating factors included sufficient training of staff and tailoring of materials to match needs of various target groups. The respondents indicated that maintenance of implemented interventions/policies depended on whether they were embedded in existing or newly created organizational structures in different settings and whether continued funding was secured. Despite considerable heterogeneity of interventions and health policies in the five countries, stakeholders across these countries identify similar factors facilitating adoption, implementation, and maintenance of these interventions and policies.
Caregivers' support needs and factors promoting resiliency after brain injury.
Kitter, Bryony; Sharman, Rachael
2015-01-01
This article explores the challenges, support needs and coping strategies of caregivers of people with an acquired brain injury (ABI). Semi-structured interviews were conducted with caregivers (n = 20) to explore their support services received, access barriers, utility of services, needed supports, coping strategies and factors promoting life satisfaction. The team recorded, transcribed verbatim and inductively analysed all interviews. Through thematic data analysis, three central themes were revealed: (a) barriers impeding quality-of-life, (b) support needed to improve quality-of-life and (c) factors enabling quality-of-life. All perspectives from the participants involved are synthesized to provide a rich depiction of caregivers' support needs and coping strategies. Two specific findings of interest include a negative association between severity of brain injury and caregiver's desire to direct treatment, as well as a distinct service gap in assistance for caregivers who are caring for someone with violent/offending behaviours. This study recommends short- and long-term changes, given Australia's upcoming National Disability Insurance Scheme, to increase caregiver quality-of-life, which will ultimately affect the rehabilitation outcomes of persons with ABI.
Yang, Yan; Wu, Xi; Li, Qiang; Jiao, Shu-fang; Li, Xun; Li, Xin-jian; Zhu, Guo-ping; Du, Lin; Zhao, Jian-hua; Jiang, Yuan; Feng, Guo-ze
2009-04-01
To know the situation of tobacco advertisement, promotions and related factors in six cities in China. 4815 adults (above 18 years), selected form Beijing, Shanghai, Shenyang, Changsha, Guangzhou and Yinchuan through probability proportionate sampling and simple random sampling, were investigated through questionnaires. The most commonly reported channels that smokers noticed tobacco advertisements were billboards (35.6%) and television (34.4%). The most commonly reported tobacco promotional activities that were noticed by smokers were free gifts when buying cigarettes (23.1%) and free samples of cigarettes (13.9%). Smokers in Changsha were more likely to report noticing tobacco advertisement on billboards (chi2 = 562.474, P advertisement and promotion. It was universal to see tobacco advertisement and promotions in cities in China but the laws and regulations about tobacco-control were not uniformly executed in different cities. It is necessary to perfect and uniform related laws and regulations.
E1A-dependent trans-activation of the human MYC promoter is mediated by the E2F factor
International Nuclear Information System (INIS)
Hiebert, S.W.; Lipp, M.; Nevins, J.R.
1989-01-01
E2F is a cellular transcription factor that binds to two sites in the adenovirus E2 promoter. Previous experiments have implicated E2F in the E1A-dependent transactivation of the E2 gene since levels of active E2F increase markedly during adenovirus infection in parallel with the increase in E2 transcription, and an E2F binding site can confer E1A inducibility to a heterologous promoter. Here the authors show that E2F binds to two sequence elements within the P2 promoter of the human MYC gene which are within a region that is critical for promoter activity. The MYC promoter can be trans-activated in an E1A-dependent manner and site-directed mutagenesis demonstrates that these E2F elements are essential for trans-activation. Finally, they also find that adenovirus infection of quiescent cells results in a stimulation of the endogenous MYC gene. They conclude that the activation of the E2F factor, which is likely responsible for the activation of viral E2 transcription, is also responsible for the E1A-dependent induction of MYC transcription
International Nuclear Information System (INIS)
Anklesaria, P.; Greenberger, J.S.; Teixido, J.; Laiho, M.; Massague, J.; Pierce, J.H.
1990-01-01
The precursor for transforming growth factor α, pro-TGF-α, is a cell surface glycoprotein that can establish contact with epidermal growth factor (EGF) receptors on adjacent cells. To examine whether the pro-TGF-α/EGF receptor pair can simultaneously mediate cell adhesion and promote cell proliferation, the authors have expressed pro-TGF-α in a bone marrow stromal cell line labeled with [ 35 S] cysteine. Expression of pro-TGF-α allows these cells to support long-term attachment of an EGF/interleukin-3-dependent hematopoietic progenitor cell line that expresses EGF receptors but is unable to adhere to normal stroma. This interaction is inhibited by soluble EGF receptor ligands. Further, the hematopoietic progenitor cells replicate their DNA while they are attached to the stromal cell layer and become foci of sustained cell proliferation. Thus, pro-TGF-α and the EGF receptor can function as mediators of intercellular adhesion and this interaction may promote a mitogenic response. They propose the term juxtacrine to designate this form of stimulation between adjacent cells
FACTORS THAT PROMOTE THE DEFECTION OF THE VIRTUAL CLASSROOM
Directory of Open Access Journals (Sweden)
Jenniz La Madriz
2016-12-01
Full Text Available It education virtual is a resource that allows leverage them Tics for reduce barriers of space / time to learn and decrease the dropout school. The research had by objective determine them factors that promote the desertion of the classroom virtual of the subject of methods I, of support to them classes face-to-face, in the Faculty of Sciences economic and social, of the University of Carabobo. The methodological design was based on the quantitative paradigm and as technical survey, obtaining the percentage ranges for each item of the questionnaire. The results of the study indicate that to reduce the drop-out necessary to face and avoid the feeling of frustration that the student can conceive with the disadvantages in the use of the virtual environment, personal, technical, academic and economic components.
de Vries, H.J.; Reneman, M.F.; Groothoff, J.W.; Geertzen, J.H.B.; Brouwer, S.
2012-01-01
Purpose: To identify determinants for staying at work (SAW) in workers with chronic musculoskeletal pain (CMP). Method: A systematic review of factors that promote SAW in workers with CMP. We searched the databases of PubMed, EMBASE, PsycInfo, CINAHL and the Cochrane Library. We included studies
DEFF Research Database (Denmark)
Sedgwick, G.G.; Townsend, K.; Martin, A.
2013-01-01
The anaphase-promoting complex/cyclosome (APC/C) is an ubiquitin ligase that functions during mitosis. Here we identify the transcriptional regulator, transcriptional intermediary factor 1γ, TIF1γ, as an APC/C-interacting protein that regulates APC/C function. TIF1γ is not a substrate for APC....../C-dependent ubiquitylation but instead, associates specifically with the APC/C holoenzyme and Cdc20 to affect APC/C activity and progression through mitosis. RNA interference studies indicate that TIF1γ knockdown results in a specific reduction in APC/C ubiquitin ligase activity, the stabilization of APC/C substrates......, and an increase in the time taken for cells to progress through mitosis from nuclear envelope breakdown to anaphase. TIF1γ knockdown cells are also characterized by the inappropriate presence of cyclin A at metaphase, and an increase in the number of cells that fail to undergo metaphase-to-anaphase transition...
Directory of Open Access Journals (Sweden)
Marcos Antonio Gaspar
2014-04-01
Full Text Available The present paper had as aim to identify factors of inter-organizational relationships which promotes and restricts the formation of companies’ cooperation network, from two levels of analysis (organizational and inter-organizational. To achieve this goal, it was developed a descriptive-qualitative study, with prospecting for primary and secondary data on a cooperation network. The universe was composed by 41 participating companies associated to the analyzed network. The sampling procedure was for researcher’s accessibility and convenience. As a result, it was identified that the network is guided by goals of cooperation among the participating companies, in addition to representing the sector and provide services in the interests of the associates. The main factors influencing the formation of the network were: business center, marketing and training; but only training has been achieved satisfactorily. The business center and marketing factors have not yet been fully developed, being both identified as restrictive factors.
Directory of Open Access Journals (Sweden)
Stehouwer Coen DA
2005-06-01
Full Text Available Abstract Objective To investigate whether IGF-I promoter polymorphism was associated with birth weight and risk factors for cardiovascular disease (CVD and type 2 diabetes (T2DM, and whether the birth weight – risk factor relationship was the same for each genotype. Design and participants 264 subjects (mean age 36 years had data available on birth weight, IGF-I promoter polymorphism genotype, CVD and T2DM risk factors. Student's t-test and regression analyses were applied to analyse differences in birth weight and differences in the birth weight – risk factors relationship between the genotypes. Results Male variant carriers (VCs of the IGF-I promoter polymorphism had a 0.2 kg lower birth weight than men with the wild type allele (p = 0.009. Of the risk factors for CVD and T2DM, solely LDL concentration was associated with the genotype for the polymorphism. Most birth weight – risk factor relationships were stronger in the VC subjects; among others the birth weight – systolic blood pressure relationship: 1 kg lower birth weight was related to an 8.0 mmHg higher systolic blood pressure Conclusion The polymorphism in the promoter region of the IGF-I gene is related to birth weight in men only, and to LDL concentration only. Furthermore, the genotype for this polymorphism modified the relationships between birth weight and the risk factors, especially for systolic and diastolic blood pressure.
Potential factors that may promote successful cognitive aging
Directory of Open Access Journals (Sweden)
Vance DE
2012-06-01
Full Text Available David E VanceCenter for Nursing Research, School of Nursing, Edward R Roybal Center for Translational Research in Aging and Mobility, University of Alabama at Birmingham (UAB, Birmingham, AL, USAAbstract: With the unprecedented number of older adults worldwide, it is important to consider ways of facilitating successful cognitive aging. One way to think of this is by augmenting or bolstering cognitive reserve. Loosely defined, cognitive reserve is considered a neurological reservoir that can be depleted by physiological insults (eg, white matter hyperintensities, oxidative stress to the brain but yet maintain optimal cognitive functioning. Cognitive reserve is built up or depleted by processes of positive and negative neuroplasticity, respectively. Lifestyle factors such as physical exercise (+, mental stimulation (+, good sleep hygiene (+, substance abuse (-, sedentary lifestyle (-, chronic stress and depression (-, social isolation (-, and poor health (- can either promote or discourage positive and negative neuroplasticity, which in turn impacts cognitive reserve. Nurses are encouraged to understand these processes so they can help facilitate successful cognitive aging in their patients.Keywords: cognitive reserve, Alzheimer's disease, neuroplasticity
Haussmann, Alexander; Gabrian, Martina; Ungar, Nadine; Jooß, Stefan; Wiskemann, Joachim; Sieverding, Monika; Steindorf, Karen
2018-05-09
Despite a large body of evidence showing that physical activity (PA) is beneficial to patients with cancer, healthcare professionals (HCPs) are promoting it too scarcely. Factors that hinder HCPs from promoting PA have remained understudied so far. Using a qualitative approach, this study aimed at a comprehensive description of influencing factors for HCPs' PA promotion behaviour and at identifying the reasons and mechanisms behind them. Semi-structured interviews with 30 HCPs were undertaken with a focus on concerns, patient characteristics and structural factors. Answers were analysed using thematic analysis. Results revealed that HCPs had concerns regarding a physical overexertion and psychological stress for patients with cancer. A patient's physical condition and the assumed interest in PA, often derived from former PA, turned out to be the most crucial patient characteristics influencing if PA is addressed. Structural factors relevant for PA promotion pertained to in-house structures, HCPs' workload, timing and coordination, information material for HCPs and patients and availability of exercise programs. In conclusion, this study revealed undetected concerns of HCPs and underlined the relevance of patient characteristics and structural conditions for HCPs' PA promotion towards patients with cancer. A broader perspective is needed to assess these factors in their influence on HCPs' PA promotion. © 2018 John Wiley & Sons Ltd.
Directory of Open Access Journals (Sweden)
Jin Liu
2018-03-01
Full Text Available Activating transcription factor 4 (ATF4 plays important physiologic roles in the brain including regulation of learning and memory as well as neuronal survival and death. Yet, outside of translational regulation by the eIF2α-dependent stress response pathway, there is little information about how its levels are controlled in neurons. Here, we show that brain-derived neurotrophic factor (BDNF promotes a rapid and sustained increase in neuronal ATF4 transcripts and protein levels. This increase is dependent on tropomyosin receptor kinase (TrkB signaling, but independent of levels of phosphorylated eIF2α. The elevation in ATF4 protein occurs both in nuclei and processes. Transcriptome analysis revealed that ATF4 mediates BDNF-promoted induction of Sesn2 which encodes Sestrin2, a protector against oxidative and genotoxic stresses and a mTor complex 1 inhibitor. In contrast, BDNF-elevated ATF4 did not affect expression of a number of other known ATF4 targets including several with pro-apoptotic activity. The capacity of BDNF to elevate neuronal ATF4 may thus represent a means to maintain this transcription factor at levels that provide neuroprotection and optimal brain function without risk of triggering neurodegeneration.
Directory of Open Access Journals (Sweden)
Matjaz Knez
2017-06-01
Full Text Available Recently different studies of green transport have become interesting for policy makers,car manufacturers, customers and energy suppliers. Many stakeholders from the publicand private sectors are investing a lot of effort to identify consumer behaviour for futureimprovements in development of green products and effective strategies, which couldaccelerate the transition to sustainable future. This paper presents the effects of electricvehicle promotional policies and customer preferences about alternative fuel vehicles.This study has shown that the electric vehicle promotional policies adopted in Sloveniahave been unsuccessful, as the share of first-time registered electric vehicles in 2013 wasbelow 1%. For different segments of people whose opinions about low emission vehiclesdiffer, different measures must be adopted. When designing promotional policies focusmust be on the most relevant factors such as the total vehicle price and fuel economy.
Barbon, Elena; Pignani, Silvia; Branchini, Alessio; Bernardi, Francesco; Pinotti, Mirko; Bovolenta, Matteo
2016-06-24
Tailored approaches to restore defective transcription responsible for severe diseases have been poorly explored. We tested transcription activator-like effectors fused to an activation domain (TALE-TFs) in a coagulation factor VII (FVII) deficiency model. In this model, the deficiency is caused by the -94C > G or -61T > G mutation, which abrogate the binding of Sp1 or HNF-4 transcription factors. Reporter assays in hepatoma HepG2 cells naturally expressing FVII identified a single TALE-TF (TF4) that, by targeting the region between mutations, specifically trans-activated both the variant (>100-fold) and wild-type (20-40-fold) F7 promoters. Importantly, in the genomic context of transfected HepG2 and transduced primary hepatocytes, TF4 increased F7 mRNA and protein levels (2- to 3-fold) without detectable off-target effects, even for the homologous F10 gene. The ectopic F7 expression in renal HEK293 cells was modestly affected by TF4 or by TALE-TF combinations. These results provide experimental evidence for TALE-TFs as gene-specific tools useful to counteract disease-causing promoter mutations.
Understanding Task Force Recommendations Behavioral Counseling to Promote a Healthful Diet and Physical Activity for Cardiovascular Disease Prevention in Adults with Cardiovascular Risk Factors The U.S. Preventive ...
Energy Technology Data Exchange (ETDEWEB)
Zhou, Hua; Yang, Ying-Hua [Department of Oncology and Diagnostic Sciences, University of Maryland Dental School, 650W. Baltimore Street, 7-North, Baltimore, MD 21201 (United States); Binmadi, Nada O. [Department of Oncology and Diagnostic Sciences, University of Maryland Dental School, 650W. Baltimore Street, 7-North, Baltimore, MD 21201 (United States); Department of Oral Basic and Clinical Sciences, King Abdulaziz University, Jeddah 21589 (Saudi Arabia); Proia, Patrizia [Department of Oncology and Diagnostic Sciences, University of Maryland Dental School, 650W. Baltimore Street, 7-North, Baltimore, MD 21201 (United States); Department of Sports Science (DISMOT), University of Palermo, Via Eleonora Duse 2 90146, Palermo (Italy); Basile, John R., E-mail: jbasile@umaryland.edu [Department of Oncology and Diagnostic Sciences, University of Maryland Dental School, 650W. Baltimore Street, 7-North, Baltimore, MD 21201 (United States); Greenebaum Cancer Center, 22S. Greene Street, Baltimore, MD 21201 (United States)
2012-08-15
Growth and metastasis of solid tumors requires induction of angiogenesis to ensure the delivery of oxygen, nutrients and growth factors to rapidly dividing transformed cells. Through either mutations, hypoxia generated by cytoreductive therapies, or when a malignancy outgrows its blood supply, tumor cells undergo a change from an avascular to a neovascular phenotype, a transition mediated by the hypoxia-inducible factor (HIF) family of transcriptional regulators. Vascular endothelial growth factor (VEGF) is one example of a gene whose transcription is stimulated by HIF. VEGF plays a crucial role in promoting tumor growth and survival by stimulating new blood vessel growth in response to such stresses as chemotherapy or radiotherapy-induced hypoxia, and it therefore has become a tempting target for neutralizing antibodies in the treatment of advanced neoplasms. Emerging evidence has shown that the semaphorins, proteins originally associated with control of axonal growth and immunity, are regulated by changes in oxygen tension as well and may play a role in tumor-induced angiogenesis. Through the use of RNA interference, in vitro and in vivo angiogenesis assays and tumor xenograft experiments, we demonstrate that expression of semaphorin 4D (SEMA4D), which is under the control of the HIF-family of transcription factors, cooperates with VEGF to promote tumor growth and vascularity in oral squamous cell carcinoma (OSCC). We use blocking antibodies to show that targeting SEMA4D function along with VEGF could represent a novel anti-angiogenic therapeutic strategy for the treatment of OSCC and other solid tumors. -- Highlights: Black-Right-Pointing-Pointer Similar to VEGF, SEMA4D promotes angiogenesis in vitro and in vivo. Black-Right-Pointing-Pointer Both VEGF and SEMA4D are produced by OSCC cells in a HIF-dependent manner. Black-Right-Pointing-Pointer These factors combine to elicit a robust pro-angiogenic phenotype in OSCC. Black-Right-Pointing-Pointer Anti-SEMA4D
International Nuclear Information System (INIS)
Zhou, Hua; Yang, Ying-Hua; Binmadi, Nada O.; Proia, Patrizia; Basile, John R.
2012-01-01
Growth and metastasis of solid tumors requires induction of angiogenesis to ensure the delivery of oxygen, nutrients and growth factors to rapidly dividing transformed cells. Through either mutations, hypoxia generated by cytoreductive therapies, or when a malignancy outgrows its blood supply, tumor cells undergo a change from an avascular to a neovascular phenotype, a transition mediated by the hypoxia-inducible factor (HIF) family of transcriptional regulators. Vascular endothelial growth factor (VEGF) is one example of a gene whose transcription is stimulated by HIF. VEGF plays a crucial role in promoting tumor growth and survival by stimulating new blood vessel growth in response to such stresses as chemotherapy or radiotherapy-induced hypoxia, and it therefore has become a tempting target for neutralizing antibodies in the treatment of advanced neoplasms. Emerging evidence has shown that the semaphorins, proteins originally associated with control of axonal growth and immunity, are regulated by changes in oxygen tension as well and may play a role in tumor-induced angiogenesis. Through the use of RNA interference, in vitro and in vivo angiogenesis assays and tumor xenograft experiments, we demonstrate that expression of semaphorin 4D (SEMA4D), which is under the control of the HIF-family of transcription factors, cooperates with VEGF to promote tumor growth and vascularity in oral squamous cell carcinoma (OSCC). We use blocking antibodies to show that targeting SEMA4D function along with VEGF could represent a novel anti-angiogenic therapeutic strategy for the treatment of OSCC and other solid tumors. -- Highlights: ► Similar to VEGF, SEMA4D promotes angiogenesis in vitro and in vivo. ► Both VEGF and SEMA4D are produced by OSCC cells in a HIF-dependent manner. ► These factors combine to elicit a robust pro-angiogenic phenotype in OSCC. ► Anti-SEMA4D blocking antibody inhibits Plexin-B1 activation. ► SEMA4D is a valid anti-angiogenic target in the
Banerjee, Ananya Tina; Kin, R; Strachan, Patricia H; Boyle, Michael H; Anand, Sonia S; Oremus, Mark
2015-01-01
To describe the factors facilitating the implementation of heart health promotion programs for older adults in Anglican, United, and Catholic churches. The study used qualitative methods comprising semistructured interviews and focus groups. The interviews and focus groups were conducted in Anglican, Catholic, and United churches located in the Canadian cities of Toronto and Hamilton, Ontario. Twelve ordained pastors and 21 older parishioners who attended church regularly and who had no health conditions were recruited to best explain how churches could be suitable locations for health promotion activities targeting older adults. Twelve semistructured interviews with the pastors and three focus groups with the 21 parishioners were undertaken. A component of the Precede-Proceed model (a model for planning health education and health promotion programs and policies) was applied to the findings after direct content analysis of the data. Participants identified pastor leadership, funding for a parish nurse, community-focused interventions, secured infrastructure, and social support from congregation members as pertinent factors required for implementing health promotion programs in Anglican, United, and Catholic churches. The findings have particular relevance for health promotion and public health because they suggest factors that would be necessary to design church-based heart health promotion programs for older adults at risk of chronic diseases.
Cooperative binding of transcription factors promotes bimodal gene expression response.
Directory of Open Access Journals (Sweden)
Pablo S Gutierrez
Full Text Available In the present work we extend and analyze the scope of our recently proposed stochastic model for transcriptional regulation, which considers an arbitrarily complex cis-regulatory system using only elementary reactions. Previously, we determined the role of cooperativity on the intrinsic fluctuations of gene expression for activating transcriptional switches, by means of master equation formalism and computer simulation. This model allowed us to distinguish between two cooperative binding mechanisms and, even though the mean expression levels were not affected differently by the acting mechanism, we showed that the associated fluctuations were different. In the present generalized model we include other regulatory functions in addition to those associated to an activator switch. Namely, we introduce repressive regulatory functions and two theoretical mechanisms that account for the biphasic response that some cis-regulatory systems show to the transcription factor concentration. We have also extended our previous master equation formalism in order to include protein production by stochastic translation of mRNA. Furthermore, we examine the graded/binary scenarios in the context of the interaction energy between transcription factors. In this sense, this is the first report to show that the cooperative binding of transcription factors to DNA promotes the "all-or-none" phenomenon observed in eukaryotic systems. In addition, we confirm that gene expression fluctuation levels associated with one of two cooperative binding mechanism never exceed the fluctuation levels of the other.
Health Promotion and Related Factors Among Korean Goose Mothers
Directory of Open Access Journals (Sweden)
Chiyoung Cha, PhD, RN
2010-12-01
Conclusions: The findings of this study contributed to the body of knowledge of health promotion among international migrant populations by identifying the differential effects of social support, acculturation attitudes, and perceived family health for six areas of health promotion.
Takagi, Satoshi; Takemoto, Ai; Takami, Miho; Oh-hara, Tomoko; Fujita, Naoya
2014-01-01
The interactions of tumor cells with platelets contribute to the progression of tumor malignancy, and the expression levels of platelet aggregation-inducing factors positively correlate with the metastatic potential of osteosarcoma cells. However, it is unclear how tumor-platelet interaction contributes to the proliferation of osteosarcomas. We report here that osteosarcoma-platelet interactions induce the release of platelet-derived growth factor (PDGF) from platelets, which promotes the pro...
Cusack, Lynette; Smith, Morgan; Hegney, Desley; Rees, Clare S; Breen, Lauren J; Witt, Regina R; Rogers, Cath; Williams, Allison; Cross, Wendy; Cheung, Kin
2016-01-01
Building nurses' resilience to complex and stressful practice environments is necessary to keep skilled nurses in the workplace and ensuring safe patient care. A unified theoretical framework titled Health Services Workplace Environmental Resilience Model (HSWERM), is presented to explain the environmental factors in the workplace that promote nurses' resilience. The framework builds on a previously-published theoretical model of individual resilience, which identified the key constructs of psychological resilience as self-efficacy, coping and mindfulness, but did not examine environmental factors in the workplace that promote nurses' resilience. This unified theoretical framework was developed using a literary synthesis drawing on data from international studies and literature reviews on the nursing workforce in hospitals. The most frequent workplace environmental factors were identified, extracted and clustered in alignment with key constructs for psychological resilience. Six major organizational concepts emerged that related to a positive resilience-building workplace and formed the foundation of the theoretical model. Three concepts related to nursing staff support (professional, practice, personal) and three related to nursing staff development (professional, practice, personal) within the workplace environment. The unified theoretical model incorporates these concepts within the workplace context, linking to the nurse, and then impacting on personal resilience and workplace outcomes, and its use has the potential to increase staff retention and quality of patient care.
Meng, X.; de rooij, D. G.; Westerdahl, K.; Saarma, M.; Sariola, H.
2001-01-01
We show with transgenic mice that targeted overexpression of glial cell line-derived neurotrophic factor (GDNF) in undifferentiated spermatogonia promotes malignant testicular tumors, which express germ-cell markers. The tumors are invasive and contain aneuploid cells, but no distant metastases have
McCoy, Sara S; Reed, Tamra J; Berthier, Celine C; Tsou, Pei-Suen; Liu, Jianhua; Gudjonsson, Johann E; Khanna, Dinesh; Kahlenberg, J Michelle
2017-11-01
SSc is a devastating disease that results in fibrosis of the skin and other organs. Fibroblasts are a key driver of the fibrotic process through deposition of extracellular matrix. The mechanisms by which fibroblasts are induced to become pro-fibrotic remain unclear. Thus, we examined the ability of SSc keratinocytes to promote fibroblast activation and the source of this effect. Keratinocytes were isolated from skin biopsies of 9 lcSSc, 10 dcSSc and 13 control patients. Conditioned media was saved from the cultures. Normal fresh primary fibroblasts were exposed to healthy control and SSc keratinocyte conditioned media in the presence or absence of neutralizing antibodies for TGF-β. Gene expression was assessed by microarrays and real-time PCR. Immunocytochemistry was performed for α-smooth muscle actin (α-SMA), collagen type 1 (COL1A1) and CCL5 expression. SSc keratinocyte conditioned media promoted fibroblast activation, characterized by increased α-SMA and COL1A1 mRNA and protein expression. This effect was independent of TGF-β. Microarray analysis identified upregulation of nuclear factor κB (NF-κB) and downregulation of peroxisome proliferator-activated receptor γ (PPAR-γ) pathways in both SSc subtypes. Scleroderma keratinocytes exhibited increased expression of NF-κB-regulated cytokines and chemokines and lesional skin staining confirmed upregulation of CCL5 in basal keratinocytes. Scleroderma keratinocytes promote the activation of fibroblasts in a TGF-β-independent manner and demonstrate an imbalance in NF-κB1 and PPAR-γ expression leading to increased cytokine and CCL5 production. Further study of keratinocyte mediators of fibrosis, including CCL5, may provide novel targets for skin fibrosis therapy. © The Author 2017. Published by Oxford University Press on behalf of the British Society for Rheumatology. All rights reserved. For Permissions, please email: journals.permissions@oup.com
Henry, Kimberly L.; Shtivelband, Annette; Comello, Maria Leonora G.; Slater, Michael D.
2011-01-01
This study explored an understudied promotive factor, a belief that alcohol use is inconsistent with personal autonomy, which may reduce adolescent intention to drink and subsequent alcohol use. Autonomy was examined as an attitudinal construct within the Theory of Reasoned Action. Longitudinal data from 2,493 seventh grade students nested in 40…
Kim, Sun Jung; Yoo, Il Young
2016-03-01
The purpose of this study was to explain the health promotion behavior of Chinese international students in Korea using a structural equation model including acculturation factors. A survey using self-administered questionnaires was employed. Data were collected from 272 Chinese students who have resided in Korea for longer than 6 months. The data were analyzed using structural equation modeling. The p value of final model is .31. The fitness parameters of the final model such as goodness of fit index, adjusted goodness of fit index, normed fit index, non-normed fit index, and comparative fit index were more than .95. Root mean square of residual and root mean square error of approximation also met the criteria. Self-esteem, perceived health status, acculturative stress and acculturation level had direct effects on health promotion behavior of the participants and the model explained 30.0% of variance. The Chinese students in Korea with higher self-esteem, perceived health status, acculturation level, and lower acculturative stress reported higher health promotion behavior. The findings can be applied to develop health promotion strategies for this population. Copyright © 2016. Published by Elsevier B.V.
Obesity-promoting factors in Mexican children and adolescents: challenges and opportunities
Aceves-Martins, Magaly; Llauradó, Elisabet; Tarro, Lucia; Solà, Rosa; Giralt, Montse
2016-01-01
Background Mexico is a developing country with one of the highest youth obesity rates worldwide; >34% of children and adolescents between 5 and 19 years of age are overweight or obese. Objectives The current review seeks to compile, describe, and analyze dietary conditions, physical activity, socioeconomic status, and cultural factors that create and exacerbate an obesogenic environment among Mexican youth. Design A narrative review was performed using PubMed and the Cochrane Library databases, as well as grey literature data from the Mexican government, academics, and statistical reports from nongovernmental organizations, included in electronic formats. Results The recent socioeconomic and nutritional transition has resulted in reduced healthy meal options at public schools, high rates of sedentary lifestyles among adolescents, lack of open spaces and playgrounds, socioeconomic deprivation, false or misunderstood sociocultural traditional beliefs, misconceptions about health, a high percentage of overweight or obese adults, and low rates of maternal breastfeeding. Some of the factors identified are exacerbating the obesity problem in this population. Current evidence also shows that more policies and health programs are needed for prevention of childhood and adolescent obesity. Mexico presents alarming obesity levels, which need to be curtailed and urgently reversed. Conclusions The present narrative review presents an overview of dietary, physical activity, societal and cultural preconceptions that are potentially modifiable obesity-promoting factors in Mexican youth. Measures to control these factors need to be implemented in all similar developing countries by governments, policy makers, stakeholders, and health care professionals to tackle obesity in children and young people. PMID:26787421
Kumi-Yeboah, Alex; Dogbey, James; Yuan, Guangji
2018-01-01
The rapid growth of online education at the K-12 level in recent years presents the need to explore issues that influence the academic experiences of students choosing this method of learning. In this study, we examined factors that promote/hinder the learning experiences and academic self-concept of minority students attending an online high…
Directory of Open Access Journals (Sweden)
Regina Augustin
2011-01-01
Full Text Available The molecular mechanisms and genetic risk factors underlying Alzheimer's disease (AD pathogenesis are only partly understood. To identify new factors, which may contribute to AD, different approaches are taken including proteomics, genetics, and functional genomics. Here, we used a bioinformatics approach and found that distinct AD-related genes share modules of transcription factor binding sites, suggesting a transcriptional coregulation. To detect additional coregulated genes, which may potentially contribute to AD, we established a new bioinformatics workflow with known multivariate methods like support vector machines, biclustering, and predicted transcription factor binding site modules by using in silico analysis and over 400 expression arrays from human and mouse. Two significant modules are composed of three transcription factor families: CTCF, SP1F, and EGRF/ZBPF, which are conserved between human and mouse APP promoter sequences. The specific combination of in silico promoter and multivariate analysis can identify regulation mechanisms of genes involved in multifactorial diseases.
Directory of Open Access Journals (Sweden)
Anna Kårlund
2014-08-01
Full Text Available Increasing epidemiological and experimental data now emphasize that a diet rich in vegetables and fruits confers many health benefits. Functional products containing elevated levels of bioactive compounds are attracting considerable attention due to their potential to lower the risk of chronic diseases and their associated huge healthcare costs. On a global scale, there is an increasing demand for berries and fruits, since they are natural polyphenol-rich raw material to be incorporated into functional foods, nutraceuticals and pharmaceuticals. This is a major challenge for both industry and horticultural experts, because the content of health-promoting compounds in plants varies widely not only in different plant species, but also between cultivars. The content is also significantly affected by harvesting, storage and processing factors. This review summarizes the recent data and clarifies the main contributors of harvesting time, various storage conditions and post-harvest procedures, such as temperature management, controlled atmosphere, 1-MCP, calcium and plant activators, as ways to influence health-promoting compounds in fruits. Furthermore, the ways processing factors, e.g., enzymatic treatment, pressing, clarification, temperature, pressure and fermentation, can influence the levels of polyphenols and vitamins in berries and soft fruits will be discussed. Finally, strategies for preventing the decline of health-promoting compounds in fruits during long-term storage will be assessed in light of recent scientific progress and modern methods, which preserve the levels of polyphenols, will be highlighted.
Promotion Factors For Enlisted Infantry Marines
2017-06-01
Marine Corps. However, due to periods of growth during two major conflicts , quality has given way to quantity to fulfill the needs of the Marine...Corps. As conflicts draw down, the Marine Corps shifts from promoting and retaining quantity to high-quality Marines. Throughout this thesis, we use...historically possessed an innate drive to succeed, to excel in all that they do, including winning in combat. We will sustain this trait and ensure this
Factors Promoting Tubal Ligation in Females Presenting to Tertiary Care Centers
Directory of Open Access Journals (Sweden)
Hammad Ali Qazi
2009-09-01
Full Text Available Objective: Despite development of new contraceptive methods, sterilization remained the most widely used method. Our objective was to determine the factors contributing to decision making for tubal ligation in females.Materials and methods: A cross sectional study was conducted in Jinnah Post graduate Medical Centre (JPMC between March - November 2008. About 505 Females using contraceptive measures were consecutively included. Those having any severe debilitating disease and unfamiliar with “urdu” language were excluded. Three trained co researchers conducted structured interviews to determine the frequency and factors associated with tubal ligation.Results: The final multiple logistic regression showed illiteracy [AOR 2.91 95% CI 1.53-5.53], number of children < 3 [AOR 6.15 95% CI 2.61-14.50], age of women < 30 [AOR 0.12 95% CI 0.06-0.22] years and information gained through health worker [AOR 3.04 95% CI 1.60-5.80] to be statistically significant.Conclusion: This highlights tubal ligation was more common in uneducated women of age > 35 years having <3 children. The most common means of promoting tubal ligation was information gained through health workers.
Self-evaluations of factors promoting and disturbing sleep: an epidemiological survey in Finland.
Urponen, H; Vuori, I; Hasan, J; Partinen, M
1988-01-01
The purpose of this epidemiological survey (N = 1600) was to describe the factors which middle-aged urban people in Finland perceived as promoting or disturbing sleep. The response rate was 75%. The results suggested that quality of sleep is determined by numerous factors; social and psychological factors, health status, external sleeping conditions, life style and living habits. Every third respondent felt that exercise had a positive impact on sleep. Second in importance were reading and listening to music. Furthermore, sauna, shower and bath, stability in life, psychological factors, positive experience in work, satisfactory sexual life and good and quiet sleeping environment were reported to have positive effects on sleep. Men considered work-related pressure and fatigue (20%) as the most important factor disturbing falling asleep or quality of sleep. In women's ranking work problems appeared no sooner than in the third place. Women reported worries, interpersonal problems, and marital and family discord as the most disturbing factors to sleep (37%). Coffee in the evening had a negative effect on falling asleep. Although a 'nightcap' was considered to improve relaxation on falling sleep, men ranked alcohol as the fourth disturbing factor. Other disturbing factors were stress, irregularities in everyday life because of social events, travelling or atypical catnaps. Eating and exercising too heavily or too late in the evening were found to disturb sleep. On the other hand, temporary lack of exercise seemed to impair the quality of sleep. As external factors disturbing sleep the subjects considered noise light, too high room temperature, tight clothing, unfamiliar sleeping environment and restless children.(ABSTRACT TRUNCATED AT 250 WORDS)
Wechpradit, Apinya; Thaiyuenwong, Jutiporn; Kanjanabuch, Talerngsak
2011-09-01
To present study health promotion behaviors and related factors in end stage renal disease (ESRD) patients treated with continuous ambulatory peritoneal dialysis (CAPD). Questionnaires of Pender to evaluate health promotion behaviors which measure 5 aspects of health-affected behaviors were examined in 90 CAPD patients at dialysis unit of Udornthani Hospital. Results were categorized into 3 groups according to Bloom's scale as follows: high, moderate, and low levels. The data were displayed as ranges or means +/- standard deviation, according to the characteristics of each variable, with a 5% (p cherish health behaviors of the patients.
DEFF Research Database (Denmark)
Shinde, Prashant V; Xu, Haifeng C; Maney, Sathish Kumar
2018-01-01
Innate immune activation is essential to mount an effective antiviral response and to prime adaptive immunity. Although a crucial role of CD169(+) cells during vesicular stomatitis virus (VSV) infections is increasingly recognized, factors regulating CD169(+) cells during viral infections remain...... stomatitis virus infection, phagocytes produce tumor necrosis factor (TNF) which signals via TNFR1 and promote "enforced virus replication" in CD169(+) macrophages. Consequently, lack of TNF or TNFR1 resulted in defective immune activation and VSV clearance....
Cusack, Lynette; Smith, Morgan; Hegney, Desley; Rees, Clare S.; Breen, Lauren J.; Witt, Regina R.; Rogers, Cath; Williams, Allison; Cross, Wendy; Cheung, Kin
2016-01-01
Building nurses' resilience to complex and stressful practice environments is necessary to keep skilled nurses in the workplace and ensuring safe patient care. A unified theoretical framework titled Health Services Workplace Environmental Resilience Model (HSWERM), is presented to explain the environmental factors in the workplace that promote nurses' resilience. The framework builds on a previously-published theoretical model of individual resilience, which identified the key constructs of p...
Clark, Daniel N; Lambert, Jared P; Till, Rodney E; Argueta, Lissenya B; Greenhalgh, Kathryn E; Henrie, Brandon; Bills, Trieste; Hawkley, Tyson F; Roznik, Marinya G; Sloan, Jason M; Mayhew, Vera; Woodland, Loc; Nelson, Eric P; Tsai, Meng-Hsuan; Poole, Brian D
2014-05-01
The rs2004640 single nucleotide polymorphism and the CGGGG copy-number variant (rs77571059) are promoter polymorphisms within interferon regulatory factor 5 (IRF5). They have been implicated as susceptibility factors for several autoimmune diseases. IRF5 uses alternative promoter splicing, where any of 4 first exons begin the mRNA. The CGGGG indel is in exon 1A's promoter; the rs2004640 allele creates a splicing recognition site, enabling usage of exon 1B. This study aimed at characterizing alterations in IRF5 mRNA due to these polymorphisms. Cells with risk polymorphisms exhibited ~2-fold higher levels of IRF5 mRNA and protein, but demonstrated no change in mRNA stability. Quantitative PCR demonstrated decreased usage of exons 1C and 1D in cell lines with the risk polymorphisms. RNA folding analysis revealed a hairpin in exon 1B; mutational analysis showed that the hairpin shape decreased translation 5-fold. Although translation of mRNA that uses exon 1B is low due to a hairpin, increased IRF5 mRNA levels in individuals with the rs2004640 risk allele lead to higher overall protein expression. In addition, several new splice variants of IRF5 were sequenced. IRF5's promoter polymorphisms alter first exon usage and increase transcription levels. High levels of IRF5 may bias the immune system toward autoimmunity.
Factors promoting tourism services and their development
Directory of Open Access Journals (Sweden)
Simona Cristina Martin
2013-10-01
Because the fact that tourism services are intangible, sales through self-service are impossible, which makes indispensable the presence of the seller or counselor at the point of sale. Unable to clearly differentiate against competitors, tourist trips wholesalers will practice a more limited range of methods of sales promotion.
International Nuclear Information System (INIS)
Sarfstein, Rive; Belfiore, Antonino; Werner, Haim
2010-01-01
The insulin-like growth factor I receptor (IGF-IR) has been implicated in the etiology of breast cancer. Overexpression of the IGF-IR gene is a typical feature of most primary breast cancers, whereas low IGF-IR levels are seen at advanced stages. Hence, evaluation of IGF-IR levels might be important for assessing prognosis. In the present study, we employed a proteomic approach based on DNA affinity chromatography followed either by mass spectroscopy (MS) or Western blot analysis to identify transcription factors that may associate with the IGF-IR promoter in estrogen receptor (ER)-positive and ER-depleted breast cancer cells. A biotinylated IGF-IR promoter fragment was bound to streptavidin magnetic beads and incubated with nuclear extracts of breast cancer cells. IGF-IR promoter-binding proteins were eluted with high salt and analyzed by MS and Western blots. Among the proteins that were found to bind to the IGF-IR promoter we identified zinc finger transcription factors Sp1 and KLF6, ER-α, p53, c-jun, and poly (ADP-ribosylation) polymerase. Furthermore, chromatin immune-precipitation (ChIP) analysis confirmed the direct in vivo binding of some of these transcription factors to IGF-IR promoter DNA. The functional relevance of binding data was assessed by cotransfection experiments with specific expression vectors along with an IGF-IR promoter reporter. In summary, we identified nuclear proteins that are potentially responsible for the differential expression of the IGF-IR gene in ER-positive and ER-depleted breast cancer cells
Energy Technology Data Exchange (ETDEWEB)
Sarfstein, Rive [Department of Human Molecular Genetics and Biochemistry, Sackler School of Medicine, Tel Aviv University, Tel Aviv 69978 (Israel); Belfiore, Antonino [Department of Clinical and Experimental Medicine, University Magna Graecia of Catanzaro, Catanzaro 88100 (Italy); Werner, Haim, E-mail: hwerner@post.tau.ac.il [Department of Human Molecular Genetics and Biochemistry, Sackler School of Medicine, Tel Aviv University, Tel Aviv 69978 (Israel)
2010-03-25
The insulin-like growth factor I receptor (IGF-IR) has been implicated in the etiology of breast cancer. Overexpression of the IGF-IR gene is a typical feature of most primary breast cancers, whereas low IGF-IR levels are seen at advanced stages. Hence, evaluation of IGF-IR levels might be important for assessing prognosis. In the present study, we employed a proteomic approach based on DNA affinity chromatography followed either by mass spectroscopy (MS) or Western blot analysis to identify transcription factors that may associate with the IGF-IR promoter in estrogen receptor (ER)-positive and ER-depleted breast cancer cells. A biotinylated IGF-IR promoter fragment was bound to streptavidin magnetic beads and incubated with nuclear extracts of breast cancer cells. IGF-IR promoter-binding proteins were eluted with high salt and analyzed by MS and Western blots. Among the proteins that were found to bind to the IGF-IR promoter we identified zinc finger transcription factors Sp1 and KLF6, ER-α, p53, c-jun, and poly (ADP-ribosylation) polymerase. Furthermore, chromatin immune-precipitation (ChIP) analysis confirmed the direct in vivo binding of some of these transcription factors to IGF-IR promoter DNA. The functional relevance of binding data was assessed by cotransfection experiments with specific expression vectors along with an IGF-IR promoter reporter. In summary, we identified nuclear proteins that are potentially responsible for the differential expression of the IGF-IR gene in ER-positive and ER-depleted breast cancer cells.
Performance as a Factor in Enlisted Promotions
1981-04-01
the Airman Performance Report. When one reviews the previous research into the matter of enlisted promotions, one senses a feeling of corporate " deja ... vu ." An Air War College research report noted in 1952 that the 7 _... .. . .. _. ._. . . . . I I ’ . Air Force NCO corps had been "destroyed" during
International Nuclear Information System (INIS)
Du Nan; Pei Xuetao; Luo Chengji; Su Yongping; Cheng Tianmin
2002-01-01
Objective: To explore the radioprotective effect of the expression of hematopoietic growth factors regulated by radio-inducible promoter on radiation injury. Methods: The human FL cDNA and EGFP cDNA were linked together with an internal ribosome entry site (IRES) and then inserted into the eukaryotic expression vector pCI-neo with the Egr-1 promoter (Egr-EF), and further transduced into bone marrow stromal cell lines HFCL (HFCL/EF). The HFCL/EF and CD34 + cells from human umbilical cord blood were transplanted i.v. one after the other into sublethally irradiated severe combined immunodeficient (SCID) mice. The number of peripheral blood WBC and human cells engrafted in recipient mice were detected by flow cytometry and CFU-GM assay. Results: In contrast to two control groups (HFCL and HFCL/F), HFCL/EF (the Egr-1 regulatory element-driven expression of FL gene therapy) resulted in a proportionally obvious increase in the number of the WBC at early stage after irradiation. Significant differences were found for CD45 + , CD34 + , CFU-GM, and nucleated cells in the bone marrow. Conclusion: Hematopoietic growth factor gene therapy regulated by radio-inducible promoter has radioprotective effect on radiation hematopoietic injury
Kim, Hyungsae
2010-10-05
Dof proteins are transcription factors that have a conserved single zinc finger DNA-binding domain. In this study, we isolated an activation tagging mutant Dof5.1-D exhibiting an upward-curling leaf phenotype due to enhanced expression of the REV gene that is required for establishing adaxialabaxial polarity. Dof5.1-D plants also had reduced transcript levels for IAA6 and IAA19 genes, indicating an altered auxin biosynthesis in Dof5.1-D. An electrophoretic mobility shift assay using the Dof5.1 DNA-binding motif and the REV promoter region indicated that the DNA-binding domain of Dof5.1 binds to a TAAAGT motif located in the 5′-distal promoter region of the REV promoter. Further, transient and chromatin immunoprecipitation assays verified binding activity of the Dof5.1 DNA-binding motif with the REV promoter. Consistent with binding assays, constitutive over-expression of the Dof5.1 DNA-binding domain in wild-type plants caused a downward-curling phenotype, whereas crossing Dof5.1-D to a rev mutant reverted the upward-curling phenotype of the Dof5.1-D mutant leaf to the wild-type. These results suggest that the Dof5.1 protein directly binds to the REV promoter and thereby regulates adaxialabaxial polarity. © 2010 Blackwell Publishing Ltd.
Kim, Hyungsae; Kim, Sungjin; Abbasi, Nazia; Bressan, Ray Anthony; Yun, Daejin; Yoo, Sangdong; Kwon, SukYun; Choi, Sangbong
2010-01-01
Dof proteins are transcription factors that have a conserved single zinc finger DNA-binding domain. In this study, we isolated an activation tagging mutant Dof5.1-D exhibiting an upward-curling leaf phenotype due to enhanced expression of the REV gene that is required for establishing adaxialabaxial polarity. Dof5.1-D plants also had reduced transcript levels for IAA6 and IAA19 genes, indicating an altered auxin biosynthesis in Dof5.1-D. An electrophoretic mobility shift assay using the Dof5.1 DNA-binding motif and the REV promoter region indicated that the DNA-binding domain of Dof5.1 binds to a TAAAGT motif located in the 5′-distal promoter region of the REV promoter. Further, transient and chromatin immunoprecipitation assays verified binding activity of the Dof5.1 DNA-binding motif with the REV promoter. Consistent with binding assays, constitutive over-expression of the Dof5.1 DNA-binding domain in wild-type plants caused a downward-curling phenotype, whereas crossing Dof5.1-D to a rev mutant reverted the upward-curling phenotype of the Dof5.1-D mutant leaf to the wild-type. These results suggest that the Dof5.1 protein directly binds to the REV promoter and thereby regulates adaxialabaxial polarity. © 2010 Blackwell Publishing Ltd.
International Nuclear Information System (INIS)
Potsibyina, V.V.; Oderyij, Je.A.
1998-01-01
The original technique was used to examine 427 patients aged 18-64 with systemic diseases of locomotor system connective tissue and 65 controls. In addition to clinical studies, radionuclide signs of locomotor system lesions was investigated with NUCLETRON APEX SP-6 CT unit using labeled with Tc-99m and osteotropic radiopharmaceuticals
DEFF Research Database (Denmark)
Iankova, Irena; Petersen, Rasmus K; Annicotte, Jean-Sébastien
2006-01-01
Positive transcription elongation factor b (P-TEFb) phosphorylates the C-terminal domain of RNA polymerase II, facilitating transcriptional elongation. In addition to its participation in general transcription, P-TEFb is recruited to specific promoters by some transcription factors such as c......-Myc or MyoD. The P-TEFb complex is composed of a cyclin-dependent kinase (cdk9) subunit and a regulatory partner (cyclin T1, cyclin T2, or cyclin K). Because cdk9 has been shown to participate in differentiation processes, such as muscle cell differentiation, we studied a possible role of cdk9...... with and phosphorylation of peroxisome proliferator-activated receptor gamma (PPARgamma), which is the master regulator of this process, on the promoter of PPARgamma target genes. PPARgamma-cdk9 interaction results in increased transcriptional activity of PPARgamma and therefore increased adipogenesis....
Cai, Shao-hang; Lu, Shi-xun; Liu, Li-li; Zhang, Chris Zhiyi; Yun, Jing-ping
2017-01-01
Background: Hepatocyte nuclear factor 4 alpha (HNF4α) plays an important role in tumourigenesis. There is growing evidence indicating that HNF4α transcribed by promoter 1 (P1-HNF4α) is expressed at relatively low levels in HCC and its presence predicts a favourable outcome for hepatocellular carcinoma (HCC) patients. However, the role of HNF4α transcribed by promoter 2 (P2-HNF4α) in HCC remains unclear. Methods: A total of 615 HCC specimens were obtained to construct tissue microarrays and pe...
Promoting mental health as an essential aspect of health promotion.
Sturgeon, Shona
2006-12-01
This paper advocates that mental health promotion receive appropriate attention within health promotion. It is of great concern that, in practice, mental health promotion is frequently overlooked in health promotion programmes although the WHO definitions of health and the Ottawa Charter describe mental health as an integral part of health. It is suggested that more attention be given to addressing the determinants of mental health in terms of protective and risk factors for both physical and mental conditions, particularly in developing countries. Examples of evidence-based mental health programmes operating in widely diverse settings are presented to demonstrate that well designed interventions can contribute to the well-being of populations. It is advocated that particular attention be given to the intersectorial cooperation needed for this work.
van Gelderen, Loes; Gartrell, Nanette N.; Bos, Henny M. W.; Hermanns, Jo M. A.
2013-01-01
The aim of this study was to investigate whether stigmatization was associated with psychological adjustment in adolescents from planned lesbian families and, if so, to examine whether individual and interpersonal promotive factors influenced this association. Seventy-eight adolescents (39 girls, 39 boys; mean age = 17.05 years) completed an…
International Nuclear Information System (INIS)
Ghazal, P.; Lubon, H.; Hennighausen, L.
1988-01-01
Repeat sequence motifs as well as unique sequences between nucleotides -150 and -22 of the human cytomegalovirus immediate-early 1 gene interact in vitro with nuclear proteins. The authors show that a transcriptional element between nucleotides -91 and -65 stimulated promoter activity in vivo and in vitro by binding specific cellular transcription factors. Finally, a common sequence motif, (T)TGG/AC, present in 15 of the determined binding sites suggests a particular class of nuclear factors associated with the immediate-early 1 gene
DEFF Research Database (Denmark)
Serup, P; Jensen, J; Andersen, F G
1996-01-01
Insulin promoter factor 1 (IPF1), a member of the homeodomain protein family, serves an early role in pancreas formation, as evidenced by the lack of pancreas formation in mice carrying a targeted disruption of the IPF1 gene [Jonsson, J., Carlsson, L., Edlund, T. & Edlund, H. (1994) Nature (London...
Directory of Open Access Journals (Sweden)
Sakaki Yoshiyuki
2004-02-01
Full Text Available Abstract Background Gene expression is regulated mainly by transcription factors (TFs that interact with regulatory cis-elements on DNA sequences. To identify functional regulatory elements, computer searching can predict TF binding sites (TFBS using position weight matrices (PWMs that represent positional base frequencies of collected experimentally determined TFBS. A disadvantage of this approach is the large output of results for genomic DNA. One strategy to identify genuine TFBS is to utilize local concentrations of predicted TFBS. It is unclear whether there is a general tendency for TFBS to cluster at promoter regions, although this is the case for certain TFBS. Also unclear is the identification of TFs that have TFBS concentrated in promoters and to what level this occurs. This study hopes to answer some of these questions. Results We developed the cluster score measure to evaluate the correlation between predicted TFBS clusters and promoter sequences for each PWM. Non-promoter sequences were used as a control. Using the cluster score, we identified a PWM group called PWM-PCP, in which TFBS clusters positively correlate with promoters, and another PWM group called PWM-NCP, in which TFBS clusters negatively correlate with promoters. The PWM-PCP group comprises 47% of the 199 vertebrate PWMs, while the PWM-NCP group occupied 11 percent. After reducing the effect of CpG islands (CGI against the clusters using partial correlation coefficients among three properties (promoter, CGI and predicted TFBS cluster, we identified two PWM groups including those strongly correlated with CGI and those not correlated with CGI. Conclusion Not all PWMs predict TFBS correlated with human promoter sequences. Two main PWM groups were identified: (1 those that show TFBS clustered in promoters associated with CGI, and (2 those that show TFBS clustered in promoters independent of CGI. Assessment of PWM matches will allow more positive interpretation of TFBS in
Wang, Xiaolong; Wang, Qi; Wang, Jinjia; Bai, Peng; Shi, Lei; Shen, Wei; Zhou, Mian; Zhou, Xiangshan; Zhang, Yuanxing; Cai, Menghao
2016-01-01
The alcohol oxidase 1 (AOX1) promoter (PAOX1) of Pichia pastoris is the most powerful and commonly used promoter for driving protein expression. However, mechanisms regulating its transcriptional activity are unclear. Here, we identified a Zn(II)2Cys6-type methanol-induced transcription factor 1 (Mit1) and elucidated its roles in regulating PAOX1 activity in response to glycerol and methanol. Mit1 regulated the expression of many genes involved in methanol utilization pathway, including AOX1, but did not participate in peroxisome proliferation and transportation of peroxisomal proteins during methanol metabolism. Structural analysis of Mit1 by performing domain deletions confirmed its specific and critical role in the strict repression of PAOX1 in glycerol medium. Importantly, Mit1, Mxr1, and Prm1, which positively regulated PAOX1 in response to methanol, were bound to PAOX1 at different sites and did not interact with each other. However, these factors cooperatively activated PAOX1 through a cascade. Mxr1 mainly functioned during carbon derepression, whereas Mit1 and Prm1 functioned during methanol induction, with Prm1 transmitting methanol signal to Mit1 by binding to the MIT1 promoter (PMIT1), thus increasingly expressing Mit1 and subsequently activating PAOX1. PMID:26828066
Shooshtari, Shahin
2012-01-01
The workshop that this paper reports, held in Iran in May of 2011, at the 1st Inter-national and 4th National Congress on Health Education and Promotion, had three main objec-tives: 1) to introduce participants to the knowledge translation (KT) concept, along with its mod-els and methods; 2) to enhance participants' knowledge of how KT could apply to public health education and promotion ; and 3) to learn from different participating stakeholder groups about the factors that facilitate or impede effective KT in public health education and promotion in Iran. The workshop consisted of three components: introducing the KT concept, assessing the KT capacity of participants, and facilitating a discussion of the important contextual factors that promote and impede effective KT. Of the 26 individuals from across the country participat-ing in the workshop, 17 took part in a KT capacity assessment activity. They classified them-selves into one of the following three stakeholder groups: administrators and policymakers (n=6), practitioners (n=2), and researchers (n=9). There were different capacities for KT across the three stakeholder groups. The re-ported challenges for effective KT include "lack of resources and funding"; "lack of time"; "poor quality of relationships and lack of trust between health policymakers, administrators, re-searchers, and clinicians"; "inadequate skills possessed by healthcare professionals and adminis-trators for assessment and adaptation of research findings"; and "poor involvement of commu-nity partners in the research process." There is a great need to develop effective strategies to overcome the reported barri-ers for effective KT.
Van Osch, Mary; Scarborough, Kathy; Crowe, Sarah; Wolff, Angela C; Reimer-Kirkham, Sheryl
2018-03-01
To explore the influential factors and strategies that promote an experienced nurse's intent to stay in their emergency or critical care area. Turnover among registered nurses (herein referred to as nurses) working in specialty areas of practice can result in a range of negative outcomes. The retention of specialty nurses at the unit level has important implications for hospital and health systems. These implications include lost knowledge and experience which may in turn impact staff performance levels, patient outcomes, hiring, orientating, development of clinical competence and other aspects of organizational performance. This qualitative study used an interpretive descriptive design to understand nurses' perceptions of the current factors and strategies that promote them staying in emergency or critical care settings for two or more years. Focus groups were conducted with 13 emergency and critical care nurses. Data analysis involved thematic analysis that evolved from codes to categories to themes. Four themes were identified: leadership, interprofessional relationships, job fit and practice environment. In addition, the ideas of feeling valued, respected and acknowledged were woven throughout. Factors often associated with nurse attrition such as burnout and job stresses were not emphasised by the respondents in our study as critical to their intent to stay in their area of practice. This study has highlighted positive aspects that motivate nurses to stay in their specialty areas. To ensure quality care for patients, retention of experienced emergency and critical care nurses is essential to maintaining specialty expertise in these practice settings. © 2017 John Wiley & Sons Ltd.
Directory of Open Access Journals (Sweden)
Cornelia Kilchert
2015-12-01
Full Text Available In eukaryotic cells, inefficient splicing is surprisingly common and leads to the degradation of transcripts with retained introns. How pre-mRNAs are committed to nuclear decay is unknown. Here, we uncover a mechanism by which specific intron-containing transcripts are targeted for nuclear degradation in fission yeast. Sequence elements within these “decay-promoting” introns co-transcriptionally recruit the exosome specificity factor Mmi1, which induces degradation of the unspliced precursor and leads to a reduction in the levels of the spliced mRNA. This mechanism negatively regulates levels of the RNA helicase DDX5/Dbp2 to promote cell survival in response to stress. In contrast, fast removal of decay-promoting introns by co-transcriptional splicing precludes Mmi1 recruitment and relieves negative expression regulation. We propose that decay-promoting introns facilitate the regulation of gene expression. Based on the identification of multiple additional Mmi1 targets, including mRNAs, long non-coding RNAs, and sn/snoRNAs, we suggest a general role in RNA regulation for Mmi1 through transcript degradation.
Factors promoting a successful return to work: from an employer and employee perspective.
Jakobsen, Klara; Lillefjell, Monica
2014-01-01
Efforts have been made to explain the inability to return to work (RTW) due to employees' chronic musculoskeletal pain. Knowledge of factors facilitating the RTW process is however still limited. Based on the experiences of employees and employers, this study aims to identify factors promoting a successful return process for persons with chronic musculoskeletal pain. The findings from interviews, involving six employees with musculoskeletal pain, and five employers with various work experience, were analysed by Giorgi's phenomenological analysis through four stages. The major themes underlying the employees' comments for a successful RTW were identifying and mobilizing their personal resources, adapting a balanced daily life, and requiring a positive dialogue with family and their employer, while the employers underlined the need for a helpful adjustment at work and how they wanted to become more involved in the rehabilitation process. In conclusion our findings underline the need for extended collaboration between the employees, employer, and rehabilitation staff, and should encourage occupational therapists to direct even more of their expertise towards the situation at the workplace.
Streamlining Appointment, Promotion, and Tenure Procedures to Promote Early-Career Faculty Success.
Smith, Shannon B; Hollerbach, Ann; Donato, Annemarie Sipkes; Edlund, Barbara J; Atz, Teresa; Kelechi, Teresa J
2016-01-01
A critical component of the progression of a successful academic career is being promoted in rank. Early-career faculty are required to have an understanding of appointment, promotion, and tenure (APT) guidelines, but many factors often impede this understanding, thwarting a smooth and planned promotion pathway for professional advancement. This article outlines the steps taken by an APT committee to improve the promotion process from instructor to assistant professor. Six sigma's DMAIC improvement model was selected as the guiding operational framework to remove variation in the promotion process. After faculty handbook revisions were made, several checklists developed, and a process review rubric was implemented; recently promoted faculty were surveyed on satisfaction with the process. Faculty opinions captured in the survey suggest increased transparency in the process and perceived support offered by the APT committee. Positive outcomes include a strengthened faculty support framework, streamlined promotion processes, and improved faculty satisfaction. Changes to the APT processes resulted in an unambiguous and standardized pathway for successful promotion. Copyright © 2016 Elsevier Inc. All rights reserved.
Directory of Open Access Journals (Sweden)
Dongliang Zhang
2011-01-01
Full Text Available Background: Hair loss is seen as an irreversible process. Most research concentrates on how to elongate the anagen, reduce the negative factors of obstructing hair growth and improve the hair number and size. Aim: In our experiment, we tried to prove that the cow placenta extract can promote hair growth by elongating hair shaft and increasing hair follicle number. Materials and Methods: Cow placenta extract (CPE, water and minoxidil applied separately on the back of depilated B57CL/6 mice for the case, negative and positive control respectively. We checked the proliferation of cells which are resident in hair sheath, and the expression of a few growth factors which stimulate hair growth. Results: Result shows that placenta extract more efficiently accelerates cell division and growth factor expression, by raising the insulin-like growth factor (IGF-1 mRNA and protein level to increase HF size and hair length. Conclusions: The extract is not a purified product; so, it is less effective than minoxidil, which is approved by the US FDA for the treatment of male pattern baldness. If refinement is done, the placenta extract would be a good candidate medicine for hair loss.
International Nuclear Information System (INIS)
Natarajan, M.; Hong, F.A.; Mohan, S.; Herman, T.S.
2003-01-01
Full text: The objective of this study is to understand whether low doses of low LET radiation induces survival advantage in normal cells. As an increase in telomerase activity is associated with longevity and cell proliferation, we examined the telomerase response following gamma-irradiation in normal aortic endothelial cells. Telomeric Repeat Amplification Protocol assay following low LET radiation showed an increase in telomerase enzyme activity as early as 8 h post irradiation and reaches its maximum at 24 h. Subsequent analysis revealed that the increased telomerse enzyme activity is due to increased synthesis resulting from an increased transcription. Examination of transcriptional activation of telomerase reverse transcriptase (TERT) promoter regulation showed an enhanced transcription of the telomerse gene following gamma-irradiation. In our previous reports we documented an increase in NF-kB DNA-binding property following low LET radiation (3). Therefore, to determine whether the activation of NF-kB-signaling is responsible for induced TERT promoter activation, cells transiently transfected with minimal promoter region of TERT containing wild type or mutant NF-kB binding site were examined following low LET radiation. TERT promoter activation was induced in wild type transfected cells whereas, in mutant kB binding site, the activation remained at the basal level similar to that of un-irradiated cells. More significantly, the gamma-ray mediated promoter activation of telomerase gene as well as induce telomerase enzyme activity was abrogated by ectopically expressing the IkBa mutant (IkBa (S32A/S36A)), which blocks NF-kB activation. The results thus suggest that exposure to low LET radiation could induce telomerase activity and the activation is at least, in part, mediated by the transcription factor NF-kB. Sustained activation of telomerase in these cells after low LET radiation may impart extended life span
Directory of Open Access Journals (Sweden)
Huynen Martijn A
2011-06-01
Full Text Available Abstract Background MicroRNAs (miRNAs play a fundamental role in the regulation of gene expression by translational repression or target mRNA degradation. Regulatory elements in miRNA promoters are less well studied, but may reveal a link between their expression and a specific cell type. Results To explore this link in myeloid cells, miRNA expression profiles were generated from monocytes and dendritic cells (DCs. Differences in miRNA expression among monocytes, DCs and their stimulated progeny were observed. Furthermore, putative promoter regions of miRNAs that are significantly up-regulated in DCs were screened for Transcription Factor Binding Sites (TFBSs based on TFBS motif matching score, the degree to which those TFBSs are over-represented in the promoters of the up-regulated miRNAs, and the extent of conservation of the TFBSs in mammals. Conclusions Analysis of evolutionarily conserved TFBSs in DC promoters revealed preferential clustering of sites within 500 bp upstream of the precursor miRNAs and that many mRNAs of cognate TFs of the conserved TFBSs were indeed expressed in the DCs. Taken together, our data provide evidence that selected miRNAs expressed in DCs have evolutionarily conserved TFBSs relevant to DC biology in their promoters.
Bm-TFF2, a toad trefoil factor, promotes cell migration, survival and wound healing
International Nuclear Information System (INIS)
Zhang, Yong; Yu, Guoyu; Xiang, Yang; Wu, Jianbo; Jiang, Ping; Lee, Wenhui; Zhang, Yun
2010-01-01
Research highlights: → Bm-TFF2 binds to epithelial cells and induces cell migration and wound healing. → Bm-TFF2 suppresses cell apoptosis. → Bm-TFF2 has no effect on cell proliferation. -- Abstract: Toad skin is naked and continually confronted by various injurious factors. Constant skin renewal and repairs occur frequently. However, the mechanisms of the renewal and repair have not clearly elucidated. In our previous work, a trefoil factor (TFF), Bm-TFF2, has been purified from the Bombina maxima skin and characterized as a platelet agonist. The mRNA of TFFs in toad skin was up-regulated greatly during the metamorphosis, indicating a pivotal role of TFFs in amphibian skin. Here, we presented the effects of Bm-TFF2 on the cell migration, apoptosis and proliferation. Bm-TFF2 bound to epithelial cells and showed strong cell motility activity. At the concentrations of 1-100 nM, Bm-TFF2-induced migration of human epithelial AGS and HT-29 cells, and rat intestinal epithelial IEC-6 cell lines. The in vitro wound healing assay also verified the activity of Bm-TFF2. Bm-TFF2 could also inhibit cell apoptosis induced by ceramide and sodium butyrate. The cell migration-promoting activity was abolished by MEK1 inhibitors, U0126 and PD98059, suggesting that ERK1/2 activation is crucial for Bm-TFF2 to stimulate cell migration. Taken together, Bm-TFF2 promoted wound healing by stimulating cell migration via MAPK pathway and preventing cell apoptosis. The potent biological activity of Bm-TFF2 makes it a useful molecular tool for further studies of structure-function relationship of the related human TFFs.
Bm-TFF2, a toad trefoil factor, promotes cell migration, survival and wound healing
Energy Technology Data Exchange (ETDEWEB)
Zhang, Yong [Key Laboratory of Animal Models and Human Disease Mechanisms of the Chinese Academy of Sciences and Yunnan Province, Kunming Institute of Zoology, Chinese Academy of Sciences, Kunming, Yunnan 650223 (China); Graduate School of Chinese Academy of Sciences, Beijing 100049 (China); Yu, Guoyu [Key Laboratory of Animal Models and Human Disease Mechanisms of the Chinese Academy of Sciences and Yunnan Province, Kunming Institute of Zoology, Chinese Academy of Sciences, Kunming, Yunnan 650223 (China); Graduate School of Chinese Academy of Sciences, Beijing 100049 (China); Department of Biochemistry, Kunming Medical College, Kunming, Yunnan 650032 (China); Xiang, Yang [Key Laboratory of Animal Models and Human Disease Mechanisms of the Chinese Academy of Sciences and Yunnan Province, Kunming Institute of Zoology, Chinese Academy of Sciences, Kunming, Yunnan 650223 (China); Graduate School of Chinese Academy of Sciences, Beijing 100049 (China); Wu, Jianbo [Key Laboratory of Animal Models and Human Disease Mechanisms of the Chinese Academy of Sciences and Yunnan Province, Kunming Institute of Zoology, Chinese Academy of Sciences, Kunming, Yunnan 650223 (China); Jiang, Ping [Key Laboratory of Animal Models and Human Disease Mechanisms of the Chinese Academy of Sciences and Yunnan Province, Kunming Institute of Zoology, Chinese Academy of Sciences, Kunming, Yunnan 650223 (China); Graduate School of Chinese Academy of Sciences, Beijing 100049 (China); Lee, Wenhui [Key Laboratory of Animal Models and Human Disease Mechanisms of the Chinese Academy of Sciences and Yunnan Province, Kunming Institute of Zoology, Chinese Academy of Sciences, Kunming, Yunnan 650223 (China); Zhang, Yun, E-mail: zhangy@mail.kiz.ac.cn [Key Laboratory of Animal Models and Human Disease Mechanisms of the Chinese Academy of Sciences and Yunnan Province, Kunming Institute of Zoology, Chinese Academy of Sciences, Kunming, Yunnan 650223 (China)
2010-07-30
Research highlights: {yields} Bm-TFF2 binds to epithelial cells and induces cell migration and wound healing. {yields} Bm-TFF2 suppresses cell apoptosis. {yields} Bm-TFF2 has no effect on cell proliferation. -- Abstract: Toad skin is naked and continually confronted by various injurious factors. Constant skin renewal and repairs occur frequently. However, the mechanisms of the renewal and repair have not clearly elucidated. In our previous work, a trefoil factor (TFF), Bm-TFF2, has been purified from the Bombina maxima skin and characterized as a platelet agonist. The mRNA of TFFs in toad skin was up-regulated greatly during the metamorphosis, indicating a pivotal role of TFFs in amphibian skin. Here, we presented the effects of Bm-TFF2 on the cell migration, apoptosis and proliferation. Bm-TFF2 bound to epithelial cells and showed strong cell motility activity. At the concentrations of 1-100 nM, Bm-TFF2-induced migration of human epithelial AGS and HT-29 cells, and rat intestinal epithelial IEC-6 cell lines. The in vitro wound healing assay also verified the activity of Bm-TFF2. Bm-TFF2 could also inhibit cell apoptosis induced by ceramide and sodium butyrate. The cell migration-promoting activity was abolished by MEK1 inhibitors, U0126 and PD98059, suggesting that ERK1/2 activation is crucial for Bm-TFF2 to stimulate cell migration. Taken together, Bm-TFF2 promoted wound healing by stimulating cell migration via MAPK pathway and preventing cell apoptosis. The potent biological activity of Bm-TFF2 makes it a useful molecular tool for further studies of structure-function relationship of the related human TFFs.
Hung, Tommy Tsz Man; Chiang, Vico Chung Lim; Dawson, Angela; Lee, Regina Lai Tong
2014-01-01
Health-promoting schools have been regarded as an important initiative in promoting child and adolescent health in school settings using the whole-school approach. Quantitative research has proved its effectiveness in various school-based programmes. However, few qualitative studies have been conducted to investigate the strategies used by health promoters to implement such initiatives. In this study, the researchers conducted a systematic review and narrative synthesis of the qualitative literature to identify important enablers assisting the implementation of health-promoting schools from the perspectives of health promoters. Five enablers have been identified from the review: (a) Following a framework/guideline to implement health-promoting schools; (b) Obtaining committed support and contributions from the school staff, school board management, government authorities, health agencies and other stakeholders; (c) Adopting a multidisciplinary, collaborative approach to implementing HPS; (d) Establishing professional networks and relationships; and (e) Continuing training and education in school health promotion. This highlights the importance of developing school health policies that meet local health needs, and socio-cultural characteristics that can foster mutual understanding between the health and education sectors so as to foster health promotion in children and adolescents. PMID:25264789
Wang, Xiaolong; Wang, Qi; Wang, Jinjia; Bai, Peng; Shi, Lei; Shen, Wei; Zhou, Mian; Zhou, Xiangshan; Zhang, Yuanxing; Cai, Menghao
2016-03-18
The alcohol oxidase 1 (AOX1) promoter (P AOX1) of Pichia pastoris is the most powerful and commonly used promoter for driving protein expression. However, mechanisms regulating its transcriptional activity are unclear. Here, we identified a Zn(II)2Cys6-type methanol-induced transcription factor 1 (Mit1) and elucidated its roles in regulating PAOX1 activity in response to glycerol and methanol. Mit1 regulated the expression of many genes involved in methanol utilization pathway, including AOX1, but did not participate in peroxisome proliferation and transportation of peroxisomal proteins during methanol metabolism. Structural analysis of Mit1 by performing domain deletions confirmed its specific and critical role in the strict repression of P AOX1 in glycerol medium. Importantly, Mit1, Mxr1, and Prm1, which positively regulated P AOX1 in response to methanol, were bound to P AOX1 at different sites and did not interact with each other. However, these factors cooperatively activated P AOX1 through a cascade. Mxr1 mainly functioned during carbon derepression, whereas Mit1 and Prm1 functioned during methanol induction, with Prm1 transmitting methanol signal to Mit1 by binding to the MIT1 promoter (P MIT1), thus increasingly expressing Mit1 and subsequently activating P AOX1. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.
Yu, In Tag; Park, Jin-Yong; Kim, Sung Hyun; Lee, Jeong-Sik; Kim, Yong-Seok; Son, Hyeon
2009-02-01
Valproate (VPA) influences the proliferation and differentiation of neuronal cells. However, little is known about the downstream events, such as alterations in gene transcription, that are associated with cell fate choice. To determine whether VPA plays an instructive role in cell fate choice during hippocampal neurogenesis, the expression of genes involved in the cell cycle and neuronal differentiation was investigated. Treatment with VPA during the progenitor stages resulted in strong inhibition of cell proliferation and induction of neuronal differentiation, accompanied by increases in the expression of proneural transcription factors and in neuronal cell numbers. The increased expression of Ngn1, Math1 and p15 points to a shift towards neuronal fate in response to histone deacetylase inhibitors (HDACi). Chromatin immunoprecipitation (ChIP) analysis showed that acetylated histone H4 (Ac-H4) was associated with the Ngn1, Math1 and p15 promoters in cultured hippocampal neural progenitor cells. VPA-induced hippocampal neurogenesis was also accompanied by association of Ac-H4 with the Ngn1 promoter in hippocampal extracts. The discovery of an association between HDACi and the Ngn1, Math1 and p15 promoters extends the importance of HDAC inhibition as a key regulator of neuronal differentiation at the transcriptional level.
Directory of Open Access Journals (Sweden)
Hashem Mohamadian
2014-01-01
Full Text Available ObjectivesPhysical activity behavior begins to decline during adolescence and continues to decrease throughout young adulthood. This study aims to explain factors that influence physical activity behavior in a sample of female adolescents using a health promotion model framework.MethodsThis cross-sectional survey was used to explore physical activity behavior among a sample of female adolescents. Participants completed measures of physical activity, perceived self-efficacy, self-esteem, social support, perceived barriers, and perceived affect. Interactions among the variables were examined using path analysis within a covariance modeling framework.ResultsThe final model accounted for an R2 value of 0.52 for physical activity and offered a good model-data fit. The results indicated that physical activity was predicted by self-esteem (β=0.46, p<0.001, perceived self-efficacy (β=0.40, p<0.001, social support (β=0.24, p<0.001, perceived barriers (β=-0.19, p<0.001, and perceived affect (β=0.17, p<0.001.ConclusionsThe findings of this study showed that the health promotion model was useful to predict physical activity behavior among the Iranian female adolescents. Information related to the predictors of physical activity behavior will help researchers plan more tailored culturally relevant health promotion interventions for this population.
Tsunoda, Satoshi; Nakamura, Toshiyuki; Sakurai, Hiroaki; Saiki, Ikuo
2007-04-01
Fibroblast growth factor (FGF)-2 has been considered to play a critical role in neovascularization in several tumors; however, its precise role in tumor progression is not fully understood. In the present study, we have characterized the role of FGF-2 in B16-BL6 mouse melanoma cells, focusing on effects during the initial phase of tumor growth. FGF-2 was injected at the tumor inoculation site of dorsal skin during the initial phase. FGF-2 induced marked tumor growth and lymph node metastasis. This was well correlated with an increase in neovascularization in the host stroma. FGF-2 also recruited inflammatory and mesenchymal cells in host stroma. Marked tumor growth, pulmonary metastasis and intensive neovascularization in tumor parenchyma were also observed after a single injection of FGF-2 into the footpad inoculation site. In contrast, repeated injections of FGF-2 at a site remote from the footpad tumor were ineffective in promoting tumor growth and metastasis. These promoting activities of FGF-2 were blocked by local injections of a glucocorticoid hormone, suggesting that host inflammatory responses induced by FGF-2 are associated with FGF-2-induced tumor progression. In addition, although FGF-2 did not promote cellular proliferation and vascular endothelial growth factor A (VEGFA) mRNA expression in B16-BL6 cells in vitro, FGF-2 induced VEGFA expression in host stroma rather than tumor tissue, and local injections of a neutralizing antibody against VEGFA inhibited these activities of FGF-2 in vivo. These results indicate that abundant FGF-2 during the initial phase of tumor growth induces VEGFA-dependent intensive neovascularization in host stroma, and supports marked tumor growth and metastasis.
Resilience-promoting factors in war-exposed adolescents: an epidemiologic study.
Fayyad, John; Cordahi-Tabet, C; Yeretzian, J; Salamoun, M; Najm, C; Karam, E G
2017-02-01
Studies of war-exposed children have not investigated a comprehensive array of resilience-promoting factors, nor representative samples of children and adolescents. A representative sample of N = 710 adolescents was randomly selected from communities recently exposed to war. All those who had experienced war trauma were administered questionnaires measuring war exposure, family violence, availability of leisure activities, school-related problems, interpersonal and peer problems, socialization, daily routine problems, displacement, availability of parental supervision and contact and medical needs as well as coping skills related to religious coping, denial, self-control, avoidance and problem solving. Mental health was measured by the Strengths and Difficulties Questionnaire (SDQ) and the Child-Revised Impact of Events Scale (CRIES). Resilient adolescents were defined as those who experienced war trauma, but did not manifest any symptoms on the SDQ or CRIES. Resilience was related to being male, using problem-solving techniques, having leisure activities, and having parents who spent time with their adolescents and who supported them with school work. Interventions designed for war-traumatized youth must build individual coping skills of children and adolescents, yet at the same time target parents and teachers in an integrated manner.
Critical success factors for physical activity promotion through community partnerships.
Lucidarme, Steffie; Marlier, Mathieu; Cardon, Greet; De Bourdeaudhuij, Ilse; Willem, Annick
2014-02-01
To define key factors of effective evidence-based policy implementation for physical activity promotion by use of a partnership approach. Using Parent and Harvey's model for sport and physical activity community-based partnerships, we defined determinants of implementation based on 13 face-to-face interviews with network organisations and 39 telephone interviews with partner organisations. Furthermore, two quantitative data-sets (n = 991 and n = 965) were used to measure implementation. In total, nine variables were found to influence implementation. Personal contact was the most powerful variable since its presence contributed to success while its absence led to a negative outcome. Four contributed directly to success: political motive, absence of a metropolis, high commitment and more qualified staff. Four others resulted in a less successful implementation: absence of positive merger effects, exposure motive and governance, and dispersed leadership. Community networks are a promising instrument for the implementation of evidence-based policies. However, determinants of both formation and management of partnerships influence the implementation success. During partnership formation, special attention should be given to partnership motives while social skills are of utmost importance for the management.
Precise regulation of gene expression dynamics favors complex promoter architectures.
Directory of Open Access Journals (Sweden)
Dirk Müller
2009-01-01
Full Text Available Promoters process signals through recruitment of transcription factors and RNA polymerase, and dynamic changes in promoter activity constitute a major noise source in gene expression. However, it is barely understood how complex promoter architectures determine key features of promoter dynamics. Here, we employ prototypical promoters of yeast ribosomal protein genes as well as simplified versions thereof to analyze the relations among promoter design, complexity, and function. These promoters combine the action of a general regulatory factor with that of specific transcription factors, a common motif of many eukaryotic promoters. By comprehensively analyzing stationary and dynamic promoter properties, this model-based approach enables us to pinpoint the structural characteristics underlying the observed behavior. Functional tradeoffs impose constraints on the promoter architecture of ribosomal protein genes. We find that a stable scaffold in the natural design results in low transcriptional noise and strong co-regulation of target genes in the presence of gene silencing. This configuration also exhibits superior shut-off properties, and it can serve as a tunable switch in living cells. Model validation with independent experimental data suggests that the models are sufficiently realistic. When combined, our results offer a mechanistic explanation for why specific factors are associated with low protein noise in vivo. Many of these findings hold for a broad range of model parameters and likely apply to other eukaryotic promoters of similar structure.
Directory of Open Access Journals (Sweden)
Jin-Won Noh
2015-09-01
Full Text Available Objectives: The present study aimed to analyze the factors that could affect the health-promoting behaviors of North Korean adolescent refugees residing in South Korea. Methods: Questions about their sociodemographic variables, subjective health status, healthy living habits, and health-promoting behaviors were asked. Results: Statistically significant differences were found in religion (t=2.30, p<0.05, having family members in South Korea (t=2.02, p<0.05, and subjective health status (t=4.96, p<0.01. Scores on health-responsible behaviors were higher with higher age (t=2.90, p<0.01 and for subjects without family or friends (t=2.43, p<0.05. Higher physical-activity behaviors were observed in males (t=3.32, p<0.01, in those with better subjective health status (t=3.46, p<0.05 and lower body mas index (t=3.48, p<0.05, and in smokers (t=3.17, p<0.01. Nutritional behaviors were higher in those who followed a religion (t=2.17, p<0.05. Spiritual growth behaviors were higher in those who followed a religion (t=4.21, p<0.001, had no family in South Korea (t=2.04, p<0.05, and had higher subjective health status (t=5.74, p<0.01. Scores on interpersonal relationships and stress-management behaviors were higher for those with higher subjective health status. A multiple regression analysis showed greater effects on health-promoting behaviors when subjective health status was better. Older people and non-smokers exhibited more health-responsible behaviors, while more physical-activity behaviors and spiritual growth activities were observed when subjective health status was better. Interpersonal relationship behaviors had positive effects on those with good subjective heath status and on non-smokers. Conclusions: Based on the results of the current study, an alternative was suggested for promoting health in North Korean adolescent refugees.
Anitua, E; Pino, A; Orive, G
2016-11-02
The use of plasma rich in growth factors (PRGF) has gained importance in many medical fields due to its regenerative potential. The aim of this study is to evaluate the effects of PRGF on primary skin fibroblasts assessing cell proliferation, migration and secretion of growth factors. The age of the patients from who PRGF was prepared was also studied to determine whether it influenced the outcomes. Human dermal fibroblasts were isolated from three healthy volunteers. Using PRGF-Endoret technology, PRGF was prepared from two groups of different ages (18-35 years and 50+ years). The effects of increasing concentration of PRGF (5%, 10% and 20%) on cell proliferation and migration was evaluated. Biosynthetic behaviour of cells was also analysed measuring vascular endothelial growth factor (VEGF), transforming growth factor b1 (TGFb1) and pro-collagen type I secreted levels with or without PRGF treatment. Mean platelet enrichment reached 2.4X and 2X in 18-35 and 50+ groups respectively. A dose-dependent response was observed in proliferation assays achieving the highest levels with 20% PRGF. Migration was also promoted in cells but not in a dose-dependent manner. Cell proliferation and migration outcomes obtained with PRGF (from both groups) were significantly higher compared to non-stimulated groups (pPRGF, however, with the exception of VEGF, no statistical significances were observed between the different age groups. Results from this study concluded that PRGF is safe and effective in stimulating skin regeneration by enhancing proliferation, migration and expression of pivotal bioactive molecules involved in wound healing and haemostasis.
Butler, Jason M; Kobayashi, Hideki; Rafii, Shahin
2010-02-01
The precise mechanisms whereby anti-angiogenesis therapy blocks tumour growth or causes vascular toxicity are unknown. We propose that endothelial cells establish a vascular niche that promotes tumour growth and tissue repair not only by delivering nutrients and O2 but also through an 'angiocrine' mechanism by producing stem and progenitor cell-active trophogens. Identification of endothelial-derived instructive angiocrine factors will allow direct tumour targeting, while diminishing the unwanted side effects associated with the use of anti-angiogenic agents.
Archaeal promoter architecture and mechanism of gene activation
DEFF Research Database (Denmark)
Peng, Nan; Ao, Xiang; Liang, Yun Xiang
2011-01-01
element named ara box directing arabinose-inducible expression and the basal promoter element TATA, serving as the binding site for the TATA-binding protein. Strikingly, these promoters possess a modular structure that allows an essentially inactive basal promoter to be strongly activated. The invoked...... mechanisms include TFB (transcription factor B) recruitment by the ara-box-binding factor to activate gene expression and modulation of TFB recruitment efficiency to yield differential gene expression....
Sleiman, Sama F; Henry, Jeffrey; Al-Haddad, Rami; El Hayek, Lauretta; Abou Haidar, Edwina; Stringer, Thomas; Ulja, Devyani; Karuppagounder, Saravanan S; Holson, Edward B; Ratan, Rajiv R; Ninan, Ipe; Chao, Moses V
2016-06-02
Exercise induces beneficial responses in the brain, which is accompanied by an increase in BDNF, a trophic factor associated with cognitive improvement and the alleviation of depression and anxiety. However, the exact mechanisms whereby physical exercise produces an induction in brain Bdnf gene expression are not well understood. While pharmacological doses of HDAC inhibitors exert positive effects on Bdnf gene transcription, the inhibitors represent small molecules that do not occur in vivo. Here, we report that an endogenous molecule released after exercise is capable of inducing key promoters of the Mus musculus Bdnf gene. The metabolite β-hydroxybutyrate, which increases after prolonged exercise, induces the activities of Bdnf promoters, particularly promoter I, which is activity-dependent. We have discovered that the action of β-hydroxybutyrate is specifically upon HDAC2 and HDAC3, which act upon selective Bdnf promoters. Moreover, the effects upon hippocampal Bdnf expression were observed after direct ventricular application of β-hydroxybutyrate. Electrophysiological measurements indicate that β-hydroxybutyrate causes an increase in neurotransmitter release, which is dependent upon the TrkB receptor. These results reveal an endogenous mechanism to explain how physical exercise leads to the induction of BDNF.
Azer, S A; Holen, A; Wilson, I; Skokauskas, N
2016-01-01
Journal Impact Factor (JIF) has been used in assessing scientific journals. Other indices, h- and g-indices and Article Influence Score (AIS), have been developed to overcome some limitations of JIF. The aims of this study were, first, to critically assess the use of JIF and other parameters related to medical education research, and second, to discuss the capacity of these indices in assessing research productivity as well as their utility in academic promotion. The JIF of 16 medical education journals from 2000 to 2011 was examined together with the research evidence about JIF in assessing research outcomes of medical educators. The findings were discussed in light of the nonnumerical criteria often used in academic promotion. In conclusion, JIF was not designed for assessing individual or group research performance, and it seems unsuitable for such purposes. Although the g- and h-indices have demonstrated promising outcomes, further developments are needed for their use as academic promotion criteria. For top academic positions, additional criteria could include leadership, evidence of international impact, and contributions to the advancement of knowledge with regard to medical education.
Directory of Open Access Journals (Sweden)
Biletska E.M.
2014-06-01
Full Text Available For today problem of chemical contamination of the environment and inner enviroment of the organism is extremely topical. Among all toxicants scientists pay special attention to lead, as it is characterized by a global prevalence in the enviroment and polytropic action on the human organism. Aim of the work – on the basis of analytical generalization of research data to establish peculiarities of lead impact on formation and functioning of bone tissue, calcium balance in the organism. It was determined that despite a low external exposure of metal, in man’s biosubstrates its levels are much higher than allowable. Herewith bone tissue due to its anatomy-physiology peculiarities accumulates lead selectively, forming inner additional source of its impact on the organism, potentiating toxic impact of xenobiotic. Therefore biomonitoring data on lead content in bone tissue is an important informative finding not only of danger but of duration, permanence and complex impact on the organism.
International Nuclear Information System (INIS)
Sawada, Keigo; Takedachi, Masahide; Yamamoto, Satomi; Morimoto, Chiaki; Ozasa, Masao; Iwayama, Tomoaki; Lee, Chun Man; Okura, Hanayuki; Matsuyama, Akifumi; Kitamura, Masahiro; Murakami, Shinya
2015-01-01
Stem and progenitor cells are currently being investigated for their applicability in cell-based therapy for periodontal tissue regeneration. We recently demonstrated that the transplantation of adipose tissue-derived multi-lineage progenitor cells (ADMPCs) enhances periodontal tissue regeneration in beagle dogs. However, the molecular mechanisms by which transplanted ADMPCs induce periodontal tissue regeneration remain to be elucidated. In this study, trophic factors released by ADMPCs were examined for their paracrine effects on human periodontal ligament cell (HPDL) function. ADMPC conditioned medium (ADMPC-CM) up-regulated osteoblastic gene expression, alkaline phosphatase activity and calcified nodule formation in HPDLs, but did not significantly affect their proliferative response. ADMPCs secreted a number of growth factors, including insulin-like growth factor binding protein 6 (IGFBP6), hepatocyte growth factor and vascular endothelial growth factor. Among these, IGFBP6 was most highly expressed. Interestingly, the positive effects of ADMPC-CM on HPDL differentiation were significantly suppressed by transfecting ADMPCs with IGFBP6 siRNA. Our results suggest that ADMPCs transplanted into a defect in periodontal tissue release trophic factors that can stimulate the differentiation of HPDLs to mineralized tissue-forming cells, such as osteoblasts and cementoblasts. IGFBP6 may play crucial roles in ADMPC-induced periodontal regeneration. - Highlights: • ADMPC-derived humoral factors stimulate cytodifferentiation of HPDLs. • ADMPCs secret growth factors including IGFBP6, VEGF and HGF. • IGFBP6 is involved in the promotion effect of ADMPC-CM on HPDL cytodifferentiation
Energy Technology Data Exchange (ETDEWEB)
Sawada, Keigo [Department of Periodontology, Osaka University Graduate School of Dentistry, Osaka (Japan); Takedachi, Masahide, E-mail: takedati@dent.osaka-u.ac.jp [Department of Periodontology, Osaka University Graduate School of Dentistry, Osaka (Japan); Yamamoto, Satomi; Morimoto, Chiaki; Ozasa, Masao; Iwayama, Tomoaki [Department of Periodontology, Osaka University Graduate School of Dentistry, Osaka (Japan); Lee, Chun Man [Medical Center for Translational Research, Osaka University Hospital, Osaka (Japan); Okura, Hanayuki; Matsuyama, Akifumi [Research on Disease Bioresources, Platform of Therapeutics for Rare Disease, National Institute of Biomedical Innovation, Osaka (Japan); Kitamura, Masahiro; Murakami, Shinya [Department of Periodontology, Osaka University Graduate School of Dentistry, Osaka (Japan)
2015-08-14
Stem and progenitor cells are currently being investigated for their applicability in cell-based therapy for periodontal tissue regeneration. We recently demonstrated that the transplantation of adipose tissue-derived multi-lineage progenitor cells (ADMPCs) enhances periodontal tissue regeneration in beagle dogs. However, the molecular mechanisms by which transplanted ADMPCs induce periodontal tissue regeneration remain to be elucidated. In this study, trophic factors released by ADMPCs were examined for their paracrine effects on human periodontal ligament cell (HPDL) function. ADMPC conditioned medium (ADMPC-CM) up-regulated osteoblastic gene expression, alkaline phosphatase activity and calcified nodule formation in HPDLs, but did not significantly affect their proliferative response. ADMPCs secreted a number of growth factors, including insulin-like growth factor binding protein 6 (IGFBP6), hepatocyte growth factor and vascular endothelial growth factor. Among these, IGFBP6 was most highly expressed. Interestingly, the positive effects of ADMPC-CM on HPDL differentiation were significantly suppressed by transfecting ADMPCs with IGFBP6 siRNA. Our results suggest that ADMPCs transplanted into a defect in periodontal tissue release trophic factors that can stimulate the differentiation of HPDLs to mineralized tissue-forming cells, such as osteoblasts and cementoblasts. IGFBP6 may play crucial roles in ADMPC-induced periodontal regeneration. - Highlights: • ADMPC-derived humoral factors stimulate cytodifferentiation of HPDLs. • ADMPCs secret growth factors including IGFBP6, VEGF and HGF. • IGFBP6 is involved in the promotion effect of ADMPC-CM on HPDL cytodifferentiation.
Energy Technology Data Exchange (ETDEWEB)
Waller, Zoë A.E., E-mail: z.waller@uea.ac.uk; Howell, Lesley A.; MacDonald, Colin J.; O’Connell, Maria A.; Searcey, Mark, E-mail: m.searcey@uea.ac.uk
2014-04-25
Highlights: • Discovery of a G-quadruplex forming sequence in the promoter sequence of Nrf2. • Characterisation of the G-quadruplex by UV, CD and NMR. • Conformational switching of G-quadruplex induced by 9-aminoacridine. - Abstract: The transcription factor nuclear factor (erythroid-derived 2)-like 2 (Nrf2) regulates multiple antioxidants, Phase II detoxification enzymes and other cytoprotective enzymes in cells. Activation of Nrf2 is recognised as being of potential therapeutic benefit in inflammatory-diseases whereas more recently, it has become clear that the inhibition of Nrf2 may have benefit in the alleviation of resistance in some tumour types. A potential G-quadruplex forming sequence was identified in the promoter region of Nrf2, close to a number of putative transcription factor binding sites. Characterisation of the sequence 5’-d[GGGAAGGGAGCAAGGGCGGGAGGG]-3’ using CD spectroscopy, imino proton NMR resonances and UV melting experiments demonstrated the formation of a parallel intramolecular G-quadruplex in the presence of K{sup +} ions. Incubation with 9-aminoacridine ligands induced a switch from antiparallel to parallel forms. The presence of a G-quadruplex forming sequence in the promoter region of Nrf2 suggests an approach to targeting the production of the protein through stabilisation of the structure, thereby avoiding resistance to antitumour drugs.
Barriers to promote cardiovascular health in community pharmacies: a systematic review.
Alonso-Perales, María Del Mar; Lasheras, Berta; Beitia, Guadalupe; Beltrán, Idoia; Marcos, Beatriz; Núñez-Córdoba, Jorge M
2017-06-01
Community pharmacists play an important role in the provision of health promotion services, and community pharmacies are considered as a potentially ideal site for cardiovascular health promotion. Information based on a systematic review of barriers to promoting cardiovascular health in community pharmacy is currently lacking. We have sought to identify the most important barriers to cardiovascular health promotion in the community pharmacy. We have systematically searched PubMed and International Pharmaceutical Abstracts for a period of 15 years from 1 April 1998 to 1 April 2013, contacted subject experts and hand-searched bibliographies. We have included peer-reviewed articles, with English abstracts in the analysis, if they reported community pharmacists' perceptions of the barriers to cardiovascular health promotion activities in a community pharmacy setting. Two reviewers have independently extracted study characteristics and data. We identified 24 studies that satisfy the eligibility criteria. The main barriers to cardiovascular health promotion in the community pharmacy included pharmacist-related factors; practice site factors; financial factors; legal factors; and patient-related factors. This review will help to provide reliable evidence for health promotion practitioners of the barriers to promoting cardiovascular health in the community pharmacy setting. This knowledge is valuable for the improvement of cardiovascular health promotion in this setting and guiding future research. © The Author 2015. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.
Shah, Nisarg J.; Hyder, Md. Nasim; Quadir, Mohiuddin A.; Dorval Courchesne, Noémie-Manuelle; Seeherman, Howard J.; Nevins, Myron; Spector, Myron; Hammond, Paula T.
2014-01-01
Traumatic wounds and congenital defects that require large-scale bone tissue repair have few successful clinical therapies, particularly for craniomaxillofacial defects. Although bioactive materials have demonstrated alternative approaches to tissue repair, an optimized materials system for reproducible, safe, and targeted repair remains elusive. We hypothesized that controlled, rapid bone formation in large, critical-size defects could be induced by simultaneously delivering multiple biological growth factors to the site of the wound. Here, we report an approach for bone repair using a polyelectrolye multilayer coating carrying as little as 200 ng of bone morphogenetic protein-2 and platelet-derived growth factor-BB that were eluted over readily adapted time scales to induce rapid bone repair. Based on electrostatic interactions between the polymer multilayers and growth factors alone, we sustained mitogenic and osteogenic signals with these growth factors in an easily tunable and controlled manner to direct endogenous cell function. To prove the role of this adaptive release system, we applied the polyelectrolyte coating on a well-studied biodegradable poly(lactic-co-glycolic acid) support membrane. The released growth factors directed cellular processes to induce bone repair in a critical-size rat calvaria model. The released growth factors promoted local bone formation that bridged a critical-size defect in the calvaria as early as 2 wk after implantation. Mature, mechanically competent bone regenerated the native calvaria form. Such an approach could be clinically useful and has significant benefits as a synthetic, off-the-shelf, cell-free option for bone tissue repair and restoration. PMID:25136093
Yu, X; Zhen, Y; Yang, H; Wang, H; Zhou, Y; Wang, E; Marincola, F M; Mai, C; Chen, Y; Wei, H; Song, Y; Lyu, X; Ye, Y; Cai, L; Wu, Q; Zhao, M; Hua, S; Fu, Q; Zhang, Y; Yao, K; Liu, Z; Li, X; Fang, W
2013-05-16
Connective tissue growth factor (CTGF) has different roles in different types of cancer. However, the involvement and molecular basis of CTGF in tumor progression and prognosis of human nasopharyngeal carcinoma (NPC) have almost never been reported. In this study, we observed that downregulated CTGF expression was significantly associated with NPC progression and poor prognosis. Knockdown of CTGF markedly elevated the ability of cell proliferation in vivo and in vitro. Subsequently, we discovered that the reduction of CTGF increased the expression of miR-18b, an oncomir-promoting cell proliferation. Further, we discovered that attenuated CTGF-mediated upregulation of miR-18b was dependent on the increased binding of transcription factors Jun proto-oncogene (C-Jun) and v-Myc myelocytomatosis viral oncogene homolog (C-Myc) to miR-18b promoter region via phosphoinositide 3-kinase (PI3K)/AKT pathway. Finally, we further found that miR-18b directly suppressed the expression of CTGF in NPC. In clinical fresh specimens, miR-18b was widely overexpressed and inversely correlated with CTGF expression in NPC. Our studies are the first to demonstrate that reduced CTGF as an unfavorable prognosis factor mediates the activation of miR-18b, an oncomir directly suppresses CTGF expression, by PI3K/AKT/C-Jun and C-Myc and promotes cell growth of NPC.
Pathophysiologic basics and diagnostic limits of conventional bone scanning
International Nuclear Information System (INIS)
Schuemichen, C.; Dunkelmann, S.
2006-01-01
Normal bone scan demonstrates the physiological regional bone formation rate, which is related to bone remodeling and maintenance of calcium homeostasis. Osteotrope radiopharmaceuticals can be used as a perfusion marker as well as a marker of regional bone formation rate. Local hyperperfusion without increased bone formation is seen in disuse atrophy and reflex sympathic dystrophy, which are difficult to discriminate, local hypoperfusion is responsible for false negative results in osteomyelitis. A local increased bone formation rate is the substrate of a positive finding in bone fracture, inflammation, tumors, metastases and other lesions. In direct comparison with other imaging modalities (MRT, scintigraphy with non-osteotrope radiopharmaceutical and PET, but not CT and multislice-CT), planar bone scintigraphy shows an unexpected deficiency in sensitivity, which can be almost or completely overcome by using SPECT or even better 18 F-fluoride PET. These techniques will also improve specificity, which still is a weak point of bone scanning, despite improved imaging performance and a huge experience in this field. The introduction of SPECT/CT und PET/CT in bone scanning will be even more desirable for this reason. (orig.)
Tu, Min; Lu, Cheng; Lv, Nan; Wei, Jishu; Lu, Zipeng; Xi, Chunhua; Chen, Jianmin; Guo, Feng; Jiang, Kuirong; Li, Qiang; Wu, Junli; Song, Guoxin; Wang, Shui; Gao, Wentao; Miao, Yi
2016-12-28
Vasohibin 2 (VASH2) is an angiogenic factor and cancer-related protein that acts via paracrine mechanisms. Here, we investigated the angiogenic function and mechanism of action of VASH2 in 200 human breast cancer tissues by performing immunohistochemical staining, western blot, indirect sandwich enzyme-linked immunosorbent assay (ELISA), and a semi-quantitative sandwich-based antibody array. Breast cancer cells stably overexpressing VASH2 or with knocked-down VASH2 were established and used for in vivo and in vitro models. In human luminal tissue, but not in HER2-positive or basal-like breast cancer tissues, VASH2 was positively correlated with CD31-positive microvascular density, induced angiogenesis in xenograft tumors, and promoted human umbilical vein endothelial cell tube formation in vitro. VASH2 expression was absent in the concentrated conditioned medium collected from knocked-down VASH2 and VASH2-overexpressing luminal breast cancer cells. Further, VASH2 regulated the expression of fibroblast growth factor 2 (FGF2) in human luminal breast cancer cells, and the pro-angiogenic effect induced by VASH2 overexpression was blocked by FGF2 neutralization in vitro. Additionally, dual luciferase reporter assay and Chromatin immunoprecipitation analysis results showed that FGF2 promoter was transcriptionally activated by VASH2 via histone modifications. In conclusion, VASH2 expression is positively correlated with FGF2 expression and promotes angiogenesis in human luminal breast cancer by transcriptional activation of fibroblast growth factor 2 through non-paracrine mechanisms. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.
DEFF Research Database (Denmark)
Troelsen, J T; Mitchelmore, C; Sjöström, H
1994-01-01
Lactase-phlorizin hydrolase (LPH) and sucrase-isomaltase (SI) are enterocyte-specific gene products. The identification of regulatory cis-elements in the promoter of these two genes has enabled us to carry out comparative studies of the corresponding intestinal-specific nuclear factors (NF-LPH1...... and SIF1-BP). Electrophoretic mobility shift assays demonstrated that the two nuclear factors compete for binding on the same cis-elements. The molecular size of the DNA binding polypeptide is estimated to be approximately 50 kDa for both factors. In the native form the factors are found as 250 k......Da oligomeric complexes. Based on these results NF-LPH1 and SIF1-BP are suggested to be either identical or closely related molecules....
Jin, Yi; Gan, Guojuan; Yu, Xiaoyun; Wu, Dongdong; Zhang, Li; Yang, Na; Hu, Jiadan; Liu, Zhiheng; Zhang, Lixin; Hong, Huachang; Yan, Xiaoqing; Liang, Yan; Ding, Linxian; Pan, Yonglong
2017-07-01
Printing and dyeing wastewater with high content of organic matters, high colority, and poor biochemical performance is hard to be degraded. In this study, we isolated viable but non-culturable (VBNC) bacteria from printing and dyeing wastewater with the culture media contained resuscitation promoting factor (Rpf) protein secreted by Micrococcus luteus, counted the culturable cells number with the most probable number, sequenced 16S rRNA genes, and performed polymerase chain reaction-denaturing gradient gel electrophoresis. It is obviously that the addition of Rpf in the enrichment culture could promote growth and resuscitation of bacteria in VBNC state to obtain more fastidious bacteria significantly. The identified bacteria were assigned to nine genera in the treatment group, while the two strains of Ochrobactrum anthropi and Microbacterium sp. could not be isolated from the control group. The function of isolated strains was explored and these strains could degrade the dye of Congo red. This study provides a new sight into the further study including the present state, composition, formation mechanism, and recovery mechanism about VBNC bacteria in printing and dyeing wastewater, which would promote to understand bacterial community in printing and dyeing wastewater, and to obtain VBNC bacteria from ecological environment.
International Nuclear Information System (INIS)
Shannon, M.F.; Gamble, J.R.; Vadas, M.A.
1988-01-01
The gene for human granulocyte/macrophage colony-stimulating factor (GM-CSF) is expressed in a tissue-specific as well as an activation-dependent manner. The interaction of nuclear proteins with the promoter region of the GM-CSF gene that is likely to be responsible for this pattern of GM-CSF expression was investigated. The authors show that nuclear proteins interact with DNA fragments from the GM-CSF promoter in a cell-specific manner. A region spanning two cytokine-specific sequences, cytokine 1 (CK-1, 5', GAGATTCCAC 3') and cytokine 2 (CK-2, 5' TCAGGTA 3') bound two nuclear proteins from GM-CSF-expressing cells in gel retardation assays. NF-GMb was inducible with phorbol 12-myristate 13-acetate and accompanied induction of GM-CSF message. NF-GMb was absent in cell lines not producing GM-CSF, some of which had other distinct binding proteins. NF-GMa and NF-GMb eluted from a heparin-Sepharose column at 0.3 and 0.6 M KCl, respectively. They hypothesize that the sequences CK-1 and CK-2 bind specific proteins and regulate GM-CSF transcription
Seo, Mihwa; Seo, Keunhee; Hwang, Wooseon; Koo, Hee Jung; Hahm, Jeong-Hoon; Yang, Jae-Seong; Han, Seong Kyu; Hwang, Daehee; Kim, Sanguk; Jang, Sung Key; Lee, Yoontae; Nam, Hong Gil; Lee, Seung-Jae V.
2015-01-01
The homeostatic maintenance of the genomic DNA is crucial for regulating aging processes. However, the role of RNA homeostasis in aging processes remains unknown. RNA helicases are a large family of enzymes that regulate the biogenesis and homeostasis of RNA. However, the functional significance of RNA helicases in aging has not been explored. Here, we report that a large fraction of RNA helicases regulate the lifespan of Caenorhabditis elegans. In particular, we show that a DEAD-box RNA helicase, helicase 1 (HEL-1), promotes longevity by specifically activating the DAF-16/forkhead box O (FOXO) transcription factor signaling pathway. We find that HEL-1 is required for the longevity conferred by reduced insulin/insulin-like growth factor 1 (IGF-1) signaling (IIS) and is sufficient for extending lifespan. We further show that the expression of HEL-1 in the intestine and neurons contributes to longevity. HEL-1 enhances the induction of a large fraction of DAF-16 target genes. Thus, the RNA helicase HEL-1 appears to promote longevity in response to decreased IIS as a transcription coregulator of DAF-16. Because HEL-1 and IIS are evolutionarily well conserved, a similar mechanism for longevity regulation via an RNA helicase-dependent regulation of FOXO signaling may operate in mammals, including humans. PMID:26195740
Directory of Open Access Journals (Sweden)
V.V. Povoroznyuk
2017-02-01
Full Text Available The article describes a case of combined osteoporosis and osteomalacia in a patient with Parkinson’s disease and vertebral pain syndrome. Osteomalacia caused by deficiency and metabolic disorders of vitamin D leads to osteoid mineralization impairment that greatly limits the possibilities of osteoporosis treatment. The treatment of Parkinson’s disease and osteotropic drugs contributed to decreasing intensity of the pain syndrome.
International Nuclear Information System (INIS)
Tong Qiangsong; Zheng Liduan; Li Bo; Wang Danming; Huang Chuanshu; Matuschak, George M.; Li Dechun
2006-01-01
Our previous studies have indicated that hypoxia-induced mitogenic factor (HIMF) has angiogenic properties in an in vivo matrigel plug model and HIMF upregulates expression of vascular endothelial growth factor (VEGF) in mouse lungs and cultured lung epithelial cells. However, whether HIMF exerts angiogenic effects through modulating endothelial cell function remains unknown. In this study, mouse aortic rings cultured with recombinant HIMF protein resulted in enhanced vascular sprouting and increased endothelial cell spreading as confirmed by Dil-Ac-LDL uptake, von Willebrand factor and CD31 staining. In cultured mouse endothelial cell line SVEC 4-10, HIMF dose-dependently enhanced cell proliferation, in vitro migration and tubulogenesis, which was not attenuated by SU1498, a VEGFR2/Flk-1 receptor tyrosine kinase inhibitor. Moreover, HIMF stimulation resulted in phosphorylation of Akt, p38 and ERK1/2 kinases in SVEC 4-10 cells. Treatment of mouse aortic rings and SVEC 4-10 cells with LY294002, but not SB203580, PD098059 or U0126, abolished HIMF-induced vascular sprouting and angiogenic responses. In addition, transfection of a dominant-negative mutant of phosphatidylinositol 3-kinase (PI-3K), Δp85, blocked HIMF-induced phosphorylation of Akt, endothelial activation and tubulogenesis. These results indicate that HIMF enhances angiogenesis by promoting proliferation and migration of endothelial cells via activation of the PI-3K/Akt pathways
The promotion of sales on the consumer markets: Offer of a new approach of promotional management
FRANCISCO JAVIER VILLABA MERLO; IÑAKI PERIÁÑEZ CAÑADILLAS
2002-01-01
Nowadays, there are many factors that have provoked a greater use of promotion by some manufacturers in the consumption markets. Traditionally, firms have used promotion as the last resource for the achievement of the goals of selling. When we analyse promotional management, this kind of performance represents an orientation to sales. In our field work we justify the breaking-off with this management philosophy, starting with a newdefinition for “sales promotion”, that includes the internal c...
Lin, Chih-Yang; Wang, Shih-Wei; Chen, Yen-Ling; Chou, Wen-Yi; Lin, Ting-Yi; Chen, Wei-Cheng; Yang, Chen-Yu; Liu, Shih-Chia; Hsieh, Chia-Chu; Fong, Yi-Chin; Wang, Po-Chuan; Tang, Chih-Hsin
2017-08-03
Chondrosarcoma is the second most common primary malignancy of bone, and one of the most difficult bone tumors to diagnose and treat. It is well known that increased levels of vascular endothelial growth factor-C (VEGF-C) promote active tumor lymphangiogenesis and lymphatic tumor spread to regional lymph nodes. Brain-derived neurotrophic factor (BDNF) is known to promote metastasis in human chondrosarcoma cells. Knowing more about the mechanism of BDNF in VEGF-C expression and lymphangiogenesis in human chondrosarcoma would improve our understanding as how to prevent chondrosarcoma angiogenesis and metastasis, which currently lacks effective adjuvant treatment. Here, we found that BDNF expression was at least 2.5-fold higher in the highly migratory JJ012(S10) cell line as compared with the primordial cell line (JJ012). In addition, VEGF-C expression and secretion was markedly increased in JJ012(S10) cells. Conditioned medium from JJ012(S10) cells significantly promoted migration and tube formation of human lymphatic endothelial cells (LECs), whereas knockdown of BDNF attenuated LEC migration and tube formation by suppressing VEGF-C production in JJ012(S10) cells. Mechanistic investigations indicated that BDNF facilitated VEGF-C-dependent lymphangiogenesis through the MEK/ERK/mTOR signaling pathway. We also showed that microRNA (miR)-624-3p expression was negatively regulated by BDNF via the MEK/ERK/mTOR cascade. Importantly, BDNF knockdown profoundly inhibited tumor-associated lymphangiogenesis in vivo. Further analyses identified that BDNF promoted tumor lymphangiogenesis by downregulating miR-624-3p in human chondrosarcoma tissues. In conclusion, this study is the first to reveal the mechanism underlying BDNF-induced lymphangiogenesis. We suggest that BDNF may serve as a promising therapeutic target for the restriction of VEGF-C-mediated tumor lymphangiogenesis and lymphatic metastasis.
Kubota, Hiroshi; Wu, Xin; Goodyear, Shaun M; Avarbock, Mary R; Brinster, Ralph L
2011-08-01
Previous studies suggest that exogenous factors crucial for spermatogonial stem cell (SSC) self-renewal are conserved among several mammalian species. Since glial cell line-derived neurotrophic factor (GDNF) and fibroblast growth factor 2 (FGF2) are critical for rodent SSC self-renewal, we hypothesized that they might promote self-renewal of nonrodent SSCs. Therefore, we cultured testicular germ cells from prepubertal rabbits in the presence of GDNF and FGF2 and found they proliferated indefinitely as cellular clumps that displayed characteristics previously identified for rodent SSCs. The rabbit germ cells could not be maintained on mouse embryonic fibroblast (STO) feeders that support rodent SSC self-renewal in vitro but were rather supported on mouse yolk sac-derived endothelial cell (C166) feeder layers. Proliferation of rabbit germ cells was dependent on GDNF. Of critical importance was that clump-forming rabbit germ cells colonized seminiferous tubules of immunodeficient mice, proliferated for at least 6 mo, while retaining an SSC phenotype in the testes of recipient mice, indicating that they were rabbit SSCs. This study demonstrates that GDNF is a mitogenic factor promoting self-renewal that is conserved between rodent and rabbit SSCs; with an evolutionary separation of ∼ 60 million years. These findings provide a foundation to study the mechanisms governing SSC self-renewal in nonrodent species.
Directory of Open Access Journals (Sweden)
Mohammad Ghorbani
2016-01-01
Full Text Available In this study we investigate the importance of agricultural sector research and technology organizations (RTO in the national economic system. The main objective of the paper is to identify and rank the factors affecting the promotion of these RTOs share in saffron’s added value. Through the literature review we extracted all the relevant factors that have been mentioned by different researchers. Then, we classified these factors into six components: applied research, technology acquisition, commercialization, market development, industry’s internal factors and national macro factors. We used a Likert scale questionnaire to gather the data about the importance of each factor based on research and technology experts’ points of view. To analyze the data we utilized confirmatory factor analysis and structural equation modeling (SEM methods using SPSS and smart PLS software packages. The results show that the most important factor affecting the share of agricultural RTOs in a products added value is the promotion of industrial firms to invest in the field of agricultural research and development. Finally, according to the obtained results, some suggestions for improving research and technology have been provided.
Zheng, Qin; Dai, Kuixing; Cui, Xinyuan; Yu, Ming; Yang, Xuesong; Yan, Bin; Liu, Shuai; Yan, Qiu
2016-05-01
Preeclampsia is a pregnancy-related syndrome which can cause perinatal mortality and morbidity. Inadequate invasion by trophoblast cells may lead to poor perfusion of the placenta, even result in preeclampsia. Understanding the molecular mechanisms underlying placentation facilitates the better intervention of preeclampsia. Urokinase-type plasminogen activator receptor (uPAR) is involved in the physiological and pathological processes. Leukemia inhibitory factor (LIF) is an important regulator in the establishment of pregnancy. However, the expression of uPAR in preeclamptic patients and its relationship with LIF remains unclear. In the current study, we found that the level of uPAR was relatively lower in the placentas from preeclamptic patients as compared with normal pregnant women. LIF promoted trophoblast cell outgrowth by upregulating uPAR in an explants culture, and LIF also enhanced migration and invasion potential through uPAR in trophoblast JAR and JEG-3 cell lines, and with increased gelatinolytic activities of matrix metalloproteinase 2 (MMP-2). The effect of LIF and uPAR on trophoblast migration and invasion was mediated by PI3K/AKT signaling pathway. Our data indicates the roles of LIF in promoting trophoblast migration and invasion through uPAR and suggest that abnormal expression of uPAR might be associated with the etiology of preeclampsia. Copyright © 2016 Elsevier Masson SAS. All rights reserved.
2013-01-01
Background Although cardiovascular disease has decreased, there is still potential for prevention as obesity and diabetes increase. Exercise has a positive effect on many cardiovascular risk factors, and it can significantly reduce the components of metabolic syndrome. The main challenge with exercise in primary care is how to succeed in motivating the patients at risk to change and increase their exercise habits. The objective of this study is to modify the cardiovascular risk in middle-aged men, either through a health promotion intervention alone or combined with an exercise intervention. Methods/design During a two-year period we recruit 300 men aged from 35 to 45 years with elevated cardiovascular risk (> two traditional risk factors). The men are randomized into three arms: 1) a health promotion intervention alone, 2) both health promotion and exercise intervention, or 3) control with usual community care and delayed health promotion (these men receive the intervention after one year). The main outcome measures will be the existence of metabolic syndrome and physical activity frequency (times per week). The participants are assessed at baseline, and at 3, 6, and 12 months. The follow-up of the study will last 12 months. Discussion This pragmatic trial in primary health care aimed to assess the effect of a health promotion programme with or without exercise intervention on cardiovascular risk and physical activity in middle-aged men. The results of this study may help to plan the primary care interventions to further reduce cardiovascular mortality. The study was registered at the Controlled Trials ( http://www.controlled-trials.com). Trial number: ISRCTN80672011. The study received ethics approval from the Coordinating Ethics Committee at Helsinki University Hospital on 8 June 2009 (ref: 4/13/03/00/09). PMID:23398957
Health-promoting practices and the factors associated with self ...
African Journals Online (AJOL)
According to self-reports, the most common new health problems since taking up the caregiving role were chronic ill health (97%), social isolation (95%) and mental stress (92%). The health-promoting practices most often engaged in were eating a balanced diet (67%), seeking spiritual support (58%), and performing ...
Efficient promotion of electricity production from offshore wind
International Nuclear Information System (INIS)
Panzer, Christian; Auer, Hans; Lettner, Georg
2014-01-01
Efficient promotion of electricity production from offshore wind stands in dynamic relationship with various influence factors, the most important of which are promotion instruments, topographic givens, regulation of grid connection, and supraregional market integration concepts. Using three case studies from different countries to highlight national differences in the promotion of offshore wind power plants the present analysis points out ways of improving the efficiency of promotion instruments.
Cahan, Mitchell A; Starr, Susan; Larkin, Anne C; Litwin, Demetrius E M; Sullivan, Kate M; Quirk, Mark E
2011-07-01
Promoting a culture of teaching may encourage students to choose a surgical career. Teaching in a human factors (HF) curriculum, the nontechnical skills of surgery, is associated with surgeons' stronger identity as teachers and with clinical students' improved perception of surgery and satisfaction with the clerkship experience. To describe the effects of an HF curriculum on teaching culture in surgery. Surgeons and educators developed an HF curriculum including communication, teamwork, and work-life balance. Teacher identity, student interest in a surgical career, student perception of the HF curriculum, and teaching awards. Ninety-two of 123 faculty and residents in a single program (75% of total) completed a survey on teacher identity. Fifteen of the participants were teachers of HF. Teachers of HF scored higher than control participants on the total score for teacher identity (P < .001) and for subcategories of global teacher identity (P = .001), intrinsic satisfaction (P = .001), skills and knowledge (P = .006), belonging to a group of teachers (P < .001), feeling a responsibility to teach (P = .008), receiving rewards (P =.01), and HF (P = .02). Third-year clerks indicated that they were more likely to select surgery as their career after the clerkship and rated the curriculum higher when it was taught by surgeons than when taught by educators. Of the teaching awards presented to surgeons during HF years, 100% of those awarded to attending physicians and 80% of those awarded to residents went to teachers of HF. Curricular focus on HF can strengthen teacher identity, improve teacher evaluations, and promote surgery as a career choice.
de Carvalho Dias, Kassia; Barbugli, Paula Aboud; de Patto, Fernanda; Lordello, Virginia Barreto; de Aquino Penteado, Letícia; Medeiros, Alexandra Ivo; Vergani, Carlos Eduardo
2017-06-30
The objective of this study was to better understand the effects of soluble factors from biofilm of single- and mixed-species Candida albicans (C. albicans) and methicillin-sensitive Staphylococcus aureus (MSSA) cultures after 36 h in culture on keratinocytes (NOK-si and HaCaT) and macrophages (J774A.1). Soluble factors from biofilms of C. albicans and MSSA were collected and incubated with keratinocytes and macrophages, which were subsequently evaluated by cell viability assays (MTT). Lactate dehydrogenase (LDH) enzyme release was measured to assess cell membrane damage to keratinocytes. Cells were analysed by brightfield microscopy after 2 and 24 h of exposure to the soluble factors from biofilm. Cell death was detected by labelling apoptotic cells with annexin V and necrotic cells with propidium iodide (PI) and was visualized via fluorescence microscopy. Soluble factors from biofilm were incubated with J774A.1 cells for 24 h; the subsequent production of NO and the cytokines IL-6 and TNF-α was measured by ELISA. The cell viability assays showed that the soluble factors of single-species C. albicans cultures were as toxic as the soluble factors from biofilm of mixed cultures, whereas the soluble factors of MSSA cultures were less toxic than those of C. albicans or mixed cultures. The soluble factors from biofilm of mixed cultures were the most toxic to the NOK-si and HaCaT cells, as confirmed by analyses of PI labelling and cell morphology. Soluble factors from biofilm of single-species MSSA and mixed-species cultures induced the production of IL-6, NO and TNF-α by J744A.1 macrophages. The production of IL-6 and NO induced by the soluble factors from biofilm of mixed cultures was lower than that induced by the soluble factors from biofilm of single-species MSSA cultures, whereas the soluble factors from biofilm of C. albicans cultures induced only low levels of NO. Soluble factors from 36-h-old biofilm of C. albicans and MSSA cultures promoted cell death and
Modeling promoter grammars with evolving hidden Markov models
DEFF Research Database (Denmark)
Won, Kyoung-Jae; Sandelin, Albin; Marstrand, Troels Torben
2008-01-01
MOTIVATION: Describing and modeling biological features of eukaryotic promoters remains an important and challenging problem within computational biology. The promoters of higher eukaryotes in particular display a wide variation in regulatory features, which are difficult to model. Often several...... factors are involved in the regulation of a set of co-regulated genes. If so, promoters can be modeled with connected regulatory features, where the network of connections is characteristic for a particular mode of regulation. RESULTS: With the goal of automatically deciphering such regulatory structures......, we present a method that iteratively evolves an ensemble of regulatory grammars using a hidden Markov Model (HMM) architecture composed of interconnected blocks representing transcription factor binding sites (TFBSs) and background regions of promoter sequences. The ensemble approach reduces the risk...
Keller, David M; McWeeney, Shannon; Arsenlis, Athanasios; Drouin, Jacques; Wright, Christopher V E; Wang, Haiyan; Wollheim, Claes; White, Peter; Kaestner, Klaus H; Goodman, Richard H
2007-01-01
The homeobox transcription factor Pdx-1 is necessary for pancreas organogenesis and beta cell function, however, most Pdx-1-regulated genes are unknown. To further the understanding of Pdx-1 in beta cell biology, we have characterized its genomic targets in NIT-1 cells, a mouse insulinoma cell line. To identify novel targets, we developed a microarray that includes traditional promoters as well as non-coding conserved elements, micro-RNAs, and elements identified through an unbiased approach ...
Corthésy, B; Cardinaux, J R; Claret, F X; Wahli, W
1989-12-01
A hormone-controlled in vitro transcription system derived from Xenopus liver nuclear extracts was exploited to identify novel cis-acting elements within the vitellogenin gene B1 promoter region. In addition to the already well-documented estrogen-responsive element (ERE), two elements were found within the 140 base pairs upstream of the transcription initiation site. One of them, a negative regulatory element, is responsible for the lack of promoter activity in the absence of the hormone and, as demonstrated by DNA-binding assays, interacts with a liver-specific transcription factor. The second is required in association with the estrogen-responsive element to mediate hormonal induction and is recognized by the Xenopus liver homolog of nuclear factor I.
The predictive role of health-promoting behaviours and perceived stress in aneurysmal rupture.
Lee, Mi-Sun; Park, Chang G; Hughes, Tonda L; Jun, Sang-Eun; Whang, Kum; Kim, Nahyun
2018-03-01
To examine the roles of two modifiable factors-health-promoting behaviours and perceived stress-in predicting aneurysmal rupture. Unruptured intracranial aneurysm detection produces significant stress and anxiety in patients because of the risk of rupture. Compared to nonmodifiable risk factors for rupture such as age, gender and aneurysm size/location, less attention has been given to modifiable risk factors. Two modifiable factors, health-promoting behaviours and perceived stress, have hardly been examined as potential predictors of rupture. This study used a cross-sectional design. We assessed 155 patients with intracranial aneurysms-that is, subarachnoid haemorrhage (n = 77) or unruptured intracranial aneurysm (n = 78)-to examine (i) baseline characteristics (patient and aneurysmal factors), (ii) health-related factors (lifestyle habits and health-promoting behaviour) and (iii) perceived stress levels (psychological stress and physical stress). Patient records provided medical histories and aneurysmal factors; other data were collected using a structured questionnaire addressing lifestyle habits, the Health-Promoting Lifestyle Profile-II to measure health-promoting behaviour and the Perceived Stress Questionnaire to measure perceived-psychological stress and perceived-physical stress levels. Bivariate analysis indicated that aneurysm rupture risk was associated with female gender, aneurysm size/location, defecation frequency, hyperlipidaemia, sedentary time, low Health-Promoting Lifestyle Profile-II mean scores and high perceived-psychological stress scores. After adjusting for known risk factors, the mean Health-Promoting Lifestyle Profile-II and perceived-psychological stress scores remained robust predictors of rupture. Furthermore, known risk factors combined with these scores had greater predictive power than known risk factors alone. Health-promoting behaviour and psychological stress are promising modifiable factors for reducing risk of aneurysmal
Muto, T; Yamauchi, K
2001-12-01
The long-term effectiveness of multicomponent worksite health promotion programs targeting cardiovascular disease risk factors remains unclear in Japan. This study was conducted to evaluate the effectiveness of such a health promotion program consisting of a main program provided over 4 days and a follow-up program provided over 1 year. The subjects of this randomized controlled trial were male employees working for a building maintenance company in Japan. The intervention group (n = 152) and the control group (n = 150) consisted of employees having abnormal findings in at least one of the following items at baseline health examination: body mass index (BMI), systolic (SBP) or diastolic blood pressure, total cholesterol, HDL cholesterol, triglycerides, and fasting blood glucose. Evaluation was conducted at 18 months after the main program. BMI, SBP, total cholesterol, and triglycerides improved significantly in the intervention group compared with the control group (P < 0.05). When comparisons were limited to those who showed abnormality at baseline, BMI, total cholesterol, and triglycerides improved significantly in the intervention group (P < 0.05). The multicomponent health promotion program provided to employees was shown to be effective in improving obesity, high blood pressure, and hyperlipidemia when evaluated 18 months after the main intervention program. Copyright 2001 American Health Foundation and Elsevier Science.
Directory of Open Access Journals (Sweden)
Jelen Amador López
2018-02-01
Full Text Available Background: High incidences of drug consumption and mental health problems are found among the Roma population in Spain, a reality that remains understudied. Past studies have indicated the positive role played by the Iglesia Evangélica Filadelfia (IEF in promoting rehabilitation and prevention of these practices. Objective: In this article, authors analyze in which ways the IEF favors processes of drug rehabilitation and mental health recovery as well as the prevention of these problems among its Roma members. Methods: A communicative qualitative approach was developed. It was communicative because new knowledge was created by dialogically contrasting the existing state of the art with study participants. It was qualitative because everyday life stories were collected, gathering the experiences, perceptions and interpretations of Roma people who are actively involved in three different IEF churches based in Barcelona. Results: This article identifies these protective factors: anti-drug discourse, a supportive environment, new social relations, role model status, the promotion of interactions, the revaluation of oneself, spiritual activities and the improvement of the feeling of belonging and the creation of meaning. Conclusion: The present research contributes new evidence to the current understanding of the role played by the IEF in improving Roma health status and how the identified protective factors can contribute to rehabilitation and recovery from such problems in other contexts.
López, Jelen Amador; García, Ramón Flecha; Martí, Teresa Sordé
2018-02-14
Background: High incidences of drug consumption and mental health problems are found among the Roma population in Spain, a reality that remains understudied. Past studies have indicated the positive role played by the Iglesia Evangélica Filadelfia (IEF) in promoting rehabilitation and prevention of these practices. Objective: In this article, authors analyze in which ways the IEF favors processes of drug rehabilitation and mental health recovery as well as the prevention of these problems among its Roma members. Methods: A communicative qualitative approach was developed. It was communicative because new knowledge was created by dialogically contrasting the existing state of the art with study participants. It was qualitative because everyday life stories were collected, gathering the experiences, perceptions and interpretations of Roma people who are actively involved in three different IEF churches based in Barcelona. Results: This article identifies these protective factors: anti-drug discourse, a supportive environment, new social relations, role model status, the promotion of interactions, the revaluation of oneself, spiritual activities and the improvement of the feeling of belonging and the creation of meaning. Conclusion: The present research contributes new evidence to the current understanding of the role played by the IEF in improving Roma health status and how the identified protective factors can contribute to rehabilitation and recovery from such problems in other contexts.
Directory of Open Access Journals (Sweden)
Genoveva Amador Fierros
Full Text Available Objective.This work sought to validate and propose an instrument to measure the performance of tutors in promoting self-directed learning in students involved in processes of problem-based learning. Methods. Confirmatory factor analysis (CFA was applied to validate the instrument composed of 60 items and six factors (self-assessment of learning gaps within the United Nations specific context: self-assessment, reflexion, critical thinking, administration of information, group skills, using a sample of 207 students from a total of 279, which comprise the student population of the Faculty of Nursing at Universidad de Colima in Mexico. (2007. Results. The CFA results demonstrated that the instrument is acceptable to measure performance of tutors in promoting self-directed learning, given that all the indicators, variances, covariances, and thresholds are statistically significant. Conclusion. The instrument permits obtaining students' opinions on how much professors contribute for them to develop each of the 60 skills described in the scale. Lastly, the results could report if professors are placing more emphasis in some areas than in other areas they should address during the problem-based learning (PBL process, or if definitely their actions are removed from the premises of PBL, information that will be useful for school management in decision making on the direction of teaching as a whole.
Della, Lindsay J.; DeJoy, David M.; Goetzel, Ron Z.; Ozminkowski, Ronald J.; Wilson, Mark G.
2009-01-01
Objective This paper describes the development of the Leading by Example (LBE) instrument. Methods Exploratory factor analysis was used to obtain an initial factor structure. Factor validity was evaluated using confirmatory factor analysis methods. Cronbach’s alpha and item-total correlations provided information on the reliability of the factor subscales. Results Four subscales were identified: business alignment with health promotion objectives; awareness of the health-productivity link; worksite support for health promotion; leadership support for health promotion. Factor by group comparisons revealed that the initial factor structure is effective in detecting differences in organizational support for health promotion across different employee groups Conclusions Management support for health promotion can be assessed using the LBE, a brief, self-report questionnaire. Researchers can use the LBE to diagnose, track, and evaluate worksite health promotion programs. PMID:18517097
International Nuclear Information System (INIS)
Zhang, Bingyu; Luo, Qing; Mao, Xinjian; Xu, Baiyao; Yang, Li; Ju, Yang; Song, Guanbin
2014-01-01
Tendon injuries are common in sports and are frequent reasons for orthopedic consultations. The management of damaged tendons is one of the most challenging problems in orthopedics. Mechano-growth factor (MGF), a recently discovered growth repair factor, plays positive roles in tissue repair through the improvement of cell proliferation and migration and the protection of cells against injury-induced apoptosis. However, it remains unclear whether MGF has the potential to accelerate tendon repair. We used a scratch wound assay in this study to demonstrate that MGF-C25E (a synthetic mechano-growth factor E peptide) promotes the migration of rat tenocytes and that this promotion is accompanied by an elevation in the expression of the following signaling molecules: focal adhesion kinase (FAK) and extracellular signal regulated kinase1/2 (ERK1/2). Inhibitors of the FAK and ERK1/2 pathways inhibited the MGF-C25E-induced tenocyte migration, indicating that MGF-C25E promotes tenocyte migration through the FAK-ERK1/2 signaling pathway. The analysis of the mechanical properties showed that the Young's modulus of tenocytes was decreased through treatment of MGF-C25E, and an obvious formation of pseudopodia and F-actin was observed in MGF-C25E-treated tenocytes. The inhibition of the FAK or ERK1/2 signals restored the decrease in Young's modulus and inhibited the formation of pseudopodia and F-actin. Overall, our study demonstrated that MGF-C25E promotes rat tenocyte migration by lessening cell stiffness and increasing pseudopodia formation via the FAK-ERK1/2 signaling pathway. - Highlights: • Mechano-growth factor E peptide (MGF-C25E) promotes migration of rat tenocytes. • MGF-C25E activates the FAK-ERK1/2 pathway in rat tenocytes. • MGF-C25E induces the actin remodeling and the formation of pseudopodia, and decreases the stiffness in rat tenocytes. • MGF-C25E promotes tenocyte migration via altering stiffness and forming pseudopodia by the activation of the
Energy Technology Data Exchange (ETDEWEB)
Zhang, Bingyu [Key Laboratory of Biorheological Science and Technology, Ministry of Education, College of Bioengineering, Chongqing University, Chongqing 400044 (China); Luo, Qing, E-mail: qing.luo@cqu.edu.cn [Key Laboratory of Biorheological Science and Technology, Ministry of Education, College of Bioengineering, Chongqing University, Chongqing 400044 (China); Mao, Xinjian [Key Laboratory of Biorheological Science and Technology, Ministry of Education, College of Bioengineering, Chongqing University, Chongqing 400044 (China); Xu, Baiyao [Department of Mechanical Science and Engineering, Nagoya University, Nagoya 464-8603 (Japan); Yang, Li [Key Laboratory of Biorheological Science and Technology, Ministry of Education, College of Bioengineering, Chongqing University, Chongqing 400044 (China); Ju, Yang [Department of Mechanical Science and Engineering, Nagoya University, Nagoya 464-8603 (Japan); Song, Guanbin, E-mail: song@cqu.edu.cn [Key Laboratory of Biorheological Science and Technology, Ministry of Education, College of Bioengineering, Chongqing University, Chongqing 400044 (China)
2014-03-10
Tendon injuries are common in sports and are frequent reasons for orthopedic consultations. The management of damaged tendons is one of the most challenging problems in orthopedics. Mechano-growth factor (MGF), a recently discovered growth repair factor, plays positive roles in tissue repair through the improvement of cell proliferation and migration and the protection of cells against injury-induced apoptosis. However, it remains unclear whether MGF has the potential to accelerate tendon repair. We used a scratch wound assay in this study to demonstrate that MGF-C25E (a synthetic mechano-growth factor E peptide) promotes the migration of rat tenocytes and that this promotion is accompanied by an elevation in the expression of the following signaling molecules: focal adhesion kinase (FAK) and extracellular signal regulated kinase1/2 (ERK1/2). Inhibitors of the FAK and ERK1/2 pathways inhibited the MGF-C25E-induced tenocyte migration, indicating that MGF-C25E promotes tenocyte migration through the FAK-ERK1/2 signaling pathway. The analysis of the mechanical properties showed that the Young's modulus of tenocytes was decreased through treatment of MGF-C25E, and an obvious formation of pseudopodia and F-actin was observed in MGF-C25E-treated tenocytes. The inhibition of the FAK or ERK1/2 signals restored the decrease in Young's modulus and inhibited the formation of pseudopodia and F-actin. Overall, our study demonstrated that MGF-C25E promotes rat tenocyte migration by lessening cell stiffness and increasing pseudopodia formation via the FAK-ERK1/2 signaling pathway. - Highlights: • Mechano-growth factor E peptide (MGF-C25E) promotes migration of rat tenocytes. • MGF-C25E activates the FAK-ERK1/2 pathway in rat tenocytes. • MGF-C25E induces the actin remodeling and the formation of pseudopodia, and decreases the stiffness in rat tenocytes. • MGF-C25E promotes tenocyte migration via altering stiffness and forming pseudopodia by the activation of the
The Murine Factor H-Related Protein FHR-B Promotes Complement Activation
Directory of Open Access Journals (Sweden)
Marcell Cserhalmi
2017-09-01
Full Text Available Factor H-related (FHR proteins consist of varying number of complement control protein domains that display various degrees of sequence identity to respective domains of the alternative pathway complement inhibitor factor H (FH. While such FHR proteins are described in several species, only human FHRs were functionally investigated. Their biological role is still poorly understood and in part controversial. Recent studies on some of the human FHRs strongly suggest a role for FHRs in enhancing complement activation via competing with FH for binding to certain ligands and surfaces. The aim of the current study was the functional characterization of a murine FHR, FHR-B. To this end, FHR-B was expressed in recombinant form. Recombinant FHR-B bound to human C3b and was able to compete with human FH for C3b binding. FHR-B supported the assembly of functionally active C3bBb alternative pathway C3 convertase via its interaction with C3b. This activity was confirmed by demonstrating C3 activation in murine serum. In addition, FHR-B bound to murine pentraxin 3 (PTX3, and this interaction resulted in murine C3 fragment deposition due to enhanced complement activation in mouse serum. FHR-B also induced C3 deposition on C-reactive protein, the extracellular matrix (ECM extract Matrigel, and endothelial cell-derived ECM when exposed to mouse serum. Moreover, mouse C3 deposition was strongly enhanced on necrotic Jurkat T cells and the mouse B cell line A20 by FHR-B. FHR-B also induced lysis of sheep erythrocytes when incubated in mouse serum with FHR-B added in excess. Altogether, these data demonstrate that, similar to human FHR-1 and FHR-5, mouse FHR-B modulates complement activity by promoting complement activation via interaction with C3b and via competition with murine FH.
Cremers, Henricus-Paul; Oenema, Anke; Mercken, Liesbeth; Candel, Math; de Vries, Hein
2013-12-03
Municipal Health Promotion Organisations (MHPOs) play an important role in promoting and disseminating prevention programmes, such as smoking prevention programmes, in schools. This study identifies factors that may facilitate or hinder MHPOs' willingness to recruit actively primary schools to use a smoking prevention programme. In 2011, 31 Dutch MHPOs were invited to recruit schools to use a smoking prevention programme. All MHPO employees involved in smoking prevention activities (n = 68) were asked to complete a questionnaire assessing psychological factors and characteristics of their organisation that might affect their decision to be involved in active recruitment of schools. T-tests and multivariate analysis of variance assessed potential differences in psychological and organisational factors between active and non-active recruiters. A total of 45 professionals returned the questionnaire (66.2%). Active recruiters (n = 12) had more positive attitudes (p = 0.02), higher self-efficacy expectations (p primary schools, compared with non-active recruiters. Organisational factors did not discriminate between active and non-active recruiters. Primarily psychological factors seem to be associated with MHPOs' decision to recruit schools actively. This indicates that creating more positive attitude, self-efficacy beliefs and formation of plans may help in getting more MHPOs involved in active recruitment procedures.
International Nuclear Information System (INIS)
Inoue-Toyoda, Maki; Kato, Kohsuke; Nagata, Kyosuke; Yoshikawa, Hiroyuki
2015-01-01
Human cytomegalovirus (HCMV) is a common and usually asymptomatic virus agent in healthy individuals. Initiation of HCMV productive infection depends on expression of the major immediate early (MIE) genes. The transcription of HCMV MIE genes is regulated by a diverse set of transcription factors. It was previously reported that productive HCMV infection is triggered probably by elevation of the plasma hydroxycorticoid level. However, it is poorly understood whether the transcription of MIE genes is directly regulated by glucocorticoid. Here, we found that the dexamethasone (DEX), a synthetic glucocorticoid, facilitates the transcription of HCMV MIE genes through the MIE promoter and enhancer in a glucocorticoid receptor (GR)-dependent manner. By competitive EMSA and reporter assays, we revealed that an NF-I like protein is involved in DEX-mediated transcriptional activation of the MIE promoter. Thus, this study supports a notion that the increased level of hydroxycorticoid in the third trimester of pregnancy reactivates HCMV virus production from the latent state. - Highlights: • DEX facilitates the transcription from the HCMV MIE promoter. • GR is involved in DEX-dependent transcription from the HCMV MIE promoter. • A 17 bp repeat is responsible for the HCMV MIE promoter activation by DEX. • An NF-I-like protein is involved in the HCMV MIE promoter activation by DEX
Zuo, Xiangyang; Pan, Wen; Feng, Tingting; Shi, Xiaohong; Dai, Jianfeng
2014-01-01
Dengue virus (DENV), the causative agent of human Dengue hemorrhagic fever, is a mosquito-borne virus of immense global health importance. Characterization of cellular factors promoting or inhibiting DENV infection is important for understanding the mechanism of DENV infection. In this report, MMP3 (stromelysin-1), a secretory endopeptidase that degrades extracellular matrices, has been shown promoting cellular antiviral response against DENV infection. Quantitative RT-PCR and Western Blot showed that the expression of MMP3 was upregulated in DENV-infected RAW264.7 cells. The intracellular viral loads were significantly higher in MMP3 silenced cells compared with controls. The expression level of selective anti-viral cytokines were decreased in MMP3 siRNA treated cells, and the transcription factor activity of NFκB was significantly impaired upon MMP3 silencing during DENV infection. Further, we found that MMP3 moved to cell nucleus upon DENV infection and colocalized with NFκB P65 in nucleus. Co-immunoprecipitation analysis suggested that MMP3 directly interacted with NFκB in nucleus during DENV infection and the C-terminal hemopexin-like domain of MMP3 was required for the interaction. This study suggested a novel role of MMP3 in nucleus during viral infection and provided new evidence for MMPs in immunomodulation.
Causadias, José M; Salvatore, Jessica E; Sroufe, L Alan
2012-07-01
The present study examines two childhood markers of self-regulation, ego-control and ego-resiliency, as promotive factors for the development of global adjustment and as risk factors for the development of internalizing and externalizing behavior problems in a high-risk sample. Teachers and observers rated ego-control and ego-resiliency when participants (n = 136) were in preschool and elementary school. Ratings showed evidence for convergent and discriminant validity and stability over time. Ego-resiliency, but not ego-control, emerged as powerful predictor of adaptive functioning at age 19 and 26, as well as internalizing and externalizing problems at 16, 23, 26, and 32 years. We interpret these findings as evidence that flexibility and adaptability -measured with ego-resiliency- may reduce risk and promote successful adaptation in low-SES environments.
Causadias, José M.; Salvatore, Jessica E.; Sroufe, L. Alan
2012-01-01
The present study examines two childhood markers of self-regulation, ego-control and ego-resiliency, as promotive factors for the development of global adjustment and as risk factors for the development of internalizing and externalizing behavior problems in a high-risk sample. Teachers and observers rated ego-control and ego-resiliency when participants (n = 136) were in preschool and elementary school. Ratings showed evidence for convergent and discriminant validity and stability over time. Ego-resiliency, but not ego-control, emerged as powerful predictor of adaptive functioning at age 19 and 26, as well as internalizing and externalizing problems at 16, 23, 26, and 32 years. We interpret these findings as evidence that flexibility and adaptability -measured with ego-resiliency- may reduce risk and promote successful adaptation in low-SES environments. PMID:23155299
Health and the need for health promotion in hospital patients
DEFF Research Database (Denmark)
Oppedal, Kristian; Nesvåg, Sverre; Pedersen, Bolette
2010-01-01
of waist and weight), self-reported physical inactivity, daily smoking and hazardous drinking. We used logistic regression to describe the associations between health risk factors and demographic characteristics. RESULTS: Out of 10 included patients, 9 (N = 1522) had one or more health risk factors......BACKGROUND: Integrated health promotion improves clinical outcomes after hospital treatment. The first step towards implementing evidence-based health promotion in hospitals is to estimate the need for health promoting activities directed at hospital patients. The aim of this study was to identify...... the distribution and association of individual health risk factors in a Norwegian hospital population and to estimate the need for health promotion in this population. METHODS: We used a validated documentation model (HPH-DATA Model) to identify the prevalence of patients with nutritional risk (measurements...
Fazio, Elena N; Young, Claire C; Toma, Jelena; Levy, Michael; Berger, Kurt R; Johnson, Charis L; Mehmood, Rashid; Swan, Patrick; Chu, Alphonse; Cregan, Sean P; Dilworth, F Jeffrey; Howlett, Christopher J; Pin, Christopher L
2017-09-01
Pancreatitis is a debilitating disease of the exocrine pancreas that, under chronic conditions, is a major susceptibility factor for pancreatic ductal adenocarcinoma (PDAC). Although down-regulation of genes that promote the mature acinar cell fate is required to reduce injury associated with pancreatitis, the factors that promote this repression are unknown. Activating transcription factor 3 (ATF3) is a key mediator of the unfolded protein response, a pathway rapidly activated during pancreatic insult. Using chromatin immunoprecipitation followed by next-generation sequencing, we show that ATF3 is bound to the transcriptional regulatory regions of >30% of differentially expressed genes during the initiation of pancreatitis. Of importance, ATF3-dependent regulation of these genes was observed only upon induction of pancreatitis, with pathways involved in inflammation, acinar cell differentiation, and cell junctions being specifically targeted. Characterizing expression of transcription factors that affect acinar cell differentiation suggested that acinar cells lacking ATF3 maintain a mature cell phenotype during pancreatitis, a finding supported by maintenance of junctional proteins and polarity markers. As a result, Atf3 -/- pancreatic tissue displayed increased tissue damage and inflammatory cell infiltration at early time points during injury but, at later time points, showed reduced acinar-to-duct cell metaplasia. Thus our results reveal a critical role for ATF3 as a key regulator of the acinar cell transcriptional response during injury and may provide a link between chronic pancreatitis and PDAC. © 2017 Fazio et al. This article is distributed by The American Society for Cell Biology under license from the author(s). Two months after publication it is available to the public under an Attribution–Noncommercial–Share Alike 3.0 Unported Creative Commons License (http://creativecommons.org/licenses/by-nc-sa/3.0).
Azarmina, Pejman; Prestwich, Graham; Rosenquist, Joel; Singh, Debbie
2008-12-01
Governments and health service providers around the world are under pressure to improve health outcomes while containing rising healthcare costs. In response to such challenges, many regions have implemented services that have been successful in other countries-but 'importing' initiatives has many challenges. This article summarizes factors found to be critical to the success of adapting a US disease management and health promotion programme for use in Italy and the UK. Using three illustrative case studies, it describes how in each region the programme needed to adapt (i) the form and content of the disease management service, (ii) the involvement and integration with local clinicians and services and (iii) the evaluation of programme outcomes. We argue that it is important to implement evidence-based practice by learning lessons from other countries and service initiatives, but that it is equally important to take into consideration the '3Ps' that are critical for successful service implementation: payers, practitioners and patients.
Placental Growth Factor Promotes Cardiac Muscle Repair via Enhanced Neovascularization
Directory of Open Access Journals (Sweden)
Jianfeng Zhang
2015-06-01
Full Text Available Background/Aims: Transplantation of mesenchymal stem cells (MSCs improves post-injury cardiac muscle repair using ill-defined mechanisms. Recently, we have shown that production and secretion of placental growth factor (PLGF by MSCs play a critical role in the MSCs-mediated post-injury cardiac muscle repair. In this study, we addressed the underlying molecular mechanisms, focusing specifically on the interactions between MSCs, macrophages and endothelial cells. Methods: We isolated macrophages (BM-MΦ from mouse bone-marrow derived cells based on F4/80 expression by flow cytometry. BM-MΦ were treated with different doses of PLGF. Cell number was analyzed by a MTT assay. Macrophage polarization was examined based on CD206 expression by flow cytometry. PLGF levels in macrophage subpopulations were analyzed by RT-qPCR and ELISA. Effects of macrophages on vascularization were evaluated by a collagen gel assay using Human umbilical vein endothelial cells (HUVECs co-cultured with PLGF-treated macrophages. Results: PLGF did not increase macrophage number, but dose-dependently polarized macrophages into a M2 subpopulation. M2 macrophages expressed high levels of PLGF. PLGF-polarized M2 macrophages significantly increased tubular structures in the collagen gel assay. Conclusion: Our data suggest that MSCs-derived PLGF may induce macrophage polarization into a M2 subpopulation, which in turn releases more PLGF to promote local neovascularization for augmenting post-injury cardiac muscle repair. This study thus sheds novel light on the role of PLGF in cardiac muscle regeneration.
Van der Does, Dieuwertje; Leon-Reyes, Antonio; Koornneef, Annemart; Van Verk, Marcel C; Rodenburg, Nicole; Pauwels, Laurens; Goossens, Alain; Körbes, Ana P; Memelink, Johan; Ritsema, Tita; Van Wees, Saskia C M; Pieterse, Corné M J
2013-02-01
Antagonism between the defense hormones salicylic acid (SA) and jasmonic acid (JA) plays a central role in the modulation of the plant immune signaling network, but the molecular mechanisms underlying this phenomenon are largely unknown. Here, we demonstrate that suppression of the JA pathway by SA functions downstream of the E3 ubiquitin-ligase Skip-Cullin-F-box complex SCF(COI1), which targets JASMONATE ZIM-domain transcriptional repressor proteins (JAZs) for proteasome-mediated degradation. In addition, neither the stability nor the JA-induced degradation of JAZs was affected by SA. In silico promoter analysis of the SA/JA crosstalk transcriptome revealed that the 1-kb promoter regions of JA-responsive genes that are suppressed by SA are significantly enriched in the JA-responsive GCC-box motifs. Using GCC:GUS lines carrying four copies of the GCC-box fused to the β-glucuronidase reporter gene, we showed that the GCC-box motif is sufficient for SA-mediated suppression of JA-responsive gene expression. Using plants overexpressing the GCC-box binding APETALA2/ETHYLENE RESPONSE FACTOR (AP2/ERF) transcription factors ERF1 or ORA59, we found that SA strongly reduces the accumulation of ORA59 but not that of ERF1. Collectively, these data indicate that the SA pathway inhibits JA signaling downstream of the SCF(COI1)-JAZ complex by targeting GCC-box motifs in JA-responsive promoters via a negative effect on the transcriptional activator ORA59.
Directory of Open Access Journals (Sweden)
Stephanie Jamison
Full Text Available Evidence is accumulating that activation of the pancreatic endoplasmic reticulum kinase (PERK in response to endoplasmic reticulum (ER stress adapts tumor cells to the tumor microenvironment and enhances tumor angiogenesis by inducing vascular endothelial growth factor A (VEGF-A. Recent studies suggest that VEGF-A can act directly on certain tumor cell types in an autocrine manner, via binding to VEGF receptor 2 (VEGFR2, to promote tumor cell migration and invasion. Although several reports show that PERK activation increases VEGF-A expression in medulloblastoma, the most common solid malignancy of childhood, the role that either PERK or VEGF-A plays in medulloblastoma remains elusive. In this study, we mimicked the moderate enhancement of PERK activity observed in tumor patients using a genetic approach and a pharmacologic approach, and found that moderate activation of PERK signaling facilitated medulloblastoma cell migration and invasion and increased the production of VEGF-A. Moreover, using the VEGFR2 inhibitor SU5416 and the VEGF-A neutralizing antibody to block VEGF-A/VEGFR2 signaling, our results suggested that tumor cell-derived VEGF-A promoted medulloblastoma cell migration and invasion through VEGFR2 signaling, and that both VEGF-A and VEGFR2 were required for the promoting effects of PERK activation on medulloblastoma cell migration and invasion. Thus, these findings suggest that moderate PERK activation promotes medulloblastoma cell migration and invasion through enhancement of VEGF-A/VEGFR2 signaling.
Health promotion in the workplace
Directory of Open Access Journals (Sweden)
Sultan T Al-Otaibi
2016-01-01
Full Text Available The objective of this review was to describe the scientific evidence for coordinating health promotion at the workplace and to discuss the required future research in this field. Literature review from March 1990 to November 2014 was performed. Using the keywords ′health, promotion, worksite and workplace′, literature was searched in the following databases: Medline, PubMed and Google Scholar; with no time limit. There is emerging evidence that workplace health promotion enhances the effectiveness of effort to promote and protect workers′ health. It proves both cost-effective and cost-beneficial to health promotion at the worksite and subsequently further reduces absenteeism. However, future research is needed to identify the impact of other factors such as age, gender and race on workers′ exposure. There is also a need to develop valid tests to measure the outcome of these programmes at the workplace. Health promotion should be central to workplace planning and should be recognised as an integral part of proactive occupational health. Indeed, the workplace is viewed as one of the most popular venues for promoting health and preventing diseases among employees.
Nurses' perceptions, understanding and experiences of health promotion.
Casey, Dympna
2007-06-01
This paper presents an account of nurses' perceptions and understanding of health promotion in an acute setting. Health promotion is considered the remit of every nurse. To engage in health-promoting practice, however, nurses need to understand the term 'health promotion' clearly. A single qualitative embedded case study was used. Purposive sampling of eight nurses was employed. Initially, theses nurses were observed in practice and, following this, a semi-structured one-to-one interview was conducted with each observed nurse. Qualitative data analysis guided by work of Miles and Huberman was employed. The data revealed one main theme: health-promoting nursing practice and this consisted of six categories and five subcategories. The findings indicated that nurses struggled to describe their understanding of health promotion, their understanding was limited and the strategies described to conduct health promotion were narrow and focused on the individual. Their perceptions and descriptions of health promotion were more in keeping with the traditional health education approach. Overall health promotion was reported to occur infrequently, being added on if the nurse had time. Factors relating to education, organizational and management issues were identified as key barriers prohibiting health-promoting nursing practice. Nurses must recognize that health promotion is a broad concept that does not exclusively focus on the individual or lifestyle factors. Nurses must be educated to recognize health-promoting opportunities in the acute setting, as well as how to plan for and conduct health promotion so that it becomes integral to practice. A review of the methods of organizing and delivering nursing care is also advocated. Ward managers have an important role in supporting nurses, creating a culture for health promotion and sharing power in decision-making processes, so that nurses feel valued and empowered.
Bahadorani, M; Hosseini, S M; Abedi, P; Abbasi, H; Nasr-Esfahani, M H
2015-01-01
Growth factors are increasingly considered as important regulators of spermatogonial stem cells (SSCs). This study investigated the effects of various growth factors (GDNF, IGF1, bFGF, EGF and GFRalpha-1) on purification and colonization of undifferentiated goat SSCs under in vitro and in vivo conditions. Irrespective of the culture condition used, the first signs of developing colonies were observed from day 4 of culture onwards. The number of colonies developed in GDNF + IGF1 + bFGF culture condition was significantly higher than the other groups (p culture condition was significantly higher than the other groups (p cells (vimentin, alpha-inhibin and α-SMA) and spermatogonial cells (PLZF, THY 1, VASA, alpha-1 integrin, bet-1 integrin and DBA) revealed that both cell types existed in developing colonies, irrespective of the culture condition used. Even though, the relative abundance of VASA, FGFR3, OCT4, PLZF, BCL6B and THY1 transcription factors in GDNF + IGF1 + bFGF treatment group was significantly higher than the other groups (p culture condition could colonize within the seminiferous tubules of the germ-cell depleted recipient mice following xenotransplantation. Obtained results demonstrated that combination of GDNF with IGF1 and bFGF promote in vitro culture of goat SSCs while precludes uncontrolled proliferation of somatic cells.
Directory of Open Access Journals (Sweden)
Ryan F Overcash
Full Text Available The type I transmembrane protein with epidermal growth factor and two follistatin motifs 2 (TMEFF2, is expressed mainly in brain and prostate. Expression of TMEFF2 is deregulated in prostate cancer, suggesting a role in this disease, but the molecular mechanism(s involved in this effect are not clear. Although androgens promote tmeff2 transcription, androgen delivery to castrated animals carrying CWR22 xenografts increases TMEFF2 protein levels in the absence of mRNA changes, suggesting that TMEFF2 may also be post-transcriptionally regulated. Here we show that translation of TMEFF2 is regulated by androgens. Addition of physiological concentrations of dihydrotestosterone (DHT to prostate cancer cell lines increases translation of endogenous TMEFF2 or transfected TMEFF2-Luciferase fusions, and this effect requires the presence of upstream open reading frames (uORFs in the 5'-untranslated region (5'-UTR of TMEFF2. Using chemical and siRNA inhibition of the androgen receptor (AR, we show that the androgen effect on TMEFF2 translation is mediated by the AR. Importantly, DHT also promotes phosphorylation of the α subunit of the translation initiation factor 2 (eIF2α in an AR-dependent manner, paralleling the effect on TMEFF2 translation. Moreover, endoplasmic reticulum (ER stress conditions, which promote eIF2α phosphorylation, also stimulate TMEFF2 translation. These results indicate that androgen signaling promotes eIF2α phosphorylation and subsequent translation of TMEFF2 via a mechanism that requires uORFs in the 5'-UTR of TMEFF2.
Promoters of Escherichia coli versus promoter islands: function and structure comparison.
Directory of Open Access Journals (Sweden)
Valeriy V Panyukov
Full Text Available Expression of bacterial genes takes place under the control of RNA polymerase with exchangeable σ-subunits and multiple transcription factors. A typical promoter region contains one or several overlapping promoters. In the latter case promoters have the same or different σ-specificity and are often subjected to different regulatory stimuli. Genes, transcribed from multiple promoters, have on average higher expression levels. However, recently in the genome of Escherichia coli we found 78 regions with an extremely large number of potential transcription start points (promoter islands, PIs. It was shown that all PIs interact with RNA polymerase in vivo and are able to form transcriptionally competent open complexes both in vitro and in vivo but their transcriptional activity measured by oligonucleotide microarrays was very low, if any. Here we confirmed transcriptional defectiveness of PIs by analyzing the 5'-end specific RNA-seq data, but showed their ability to produce short oligos (9-14 bases. This combination of functional properties indicated a deliberate suppression of transcriptional activity within PIs. According to our data this suppression may be due to a specific conformation of the DNA double helix, which provides an ideal platform for interaction with both RNA polymerase and the histone-like nucleoid protein H-NS. The genomic DNA of E.coli contains therefore several dozen sites optimized by evolution for staying in a heterochromatin-like state. Since almost all promoter islands are associated with horizontally acquired genes, we offer them as specific components of bacterial evolution involved in acquisition of foreign genetic material by turning off the expression of toxic or useless aliens or by providing optimal promoter for beneficial genes. The putative molecular mechanism underlying the appearance of promoter islands within recipient genomes is discussed.
Directory of Open Access Journals (Sweden)
Surleen Kaur
2016-03-01
Full Text Available Insulin receptor substrate-2 (IRS-2 plays critical role in the regulation of various metabolic processes by insulin and IGF-1. The defects in its expression and/or function are linked to diseases like polycystic ovary syndrome (PCOS, insulin resistance and cancer. To predict the transcription factors (TFs responsible for the regulation of human IRS-2 gene expression, the transcription factor binding sites (TFBS and the corresponding TFs were investigated by analysis of IRS-2 promoter sequence using MatInspector Genomatix software (Cartharius et al., 2005 [1]. The ibid data is part of author׳s publication (Anjali et al., 2015 [2] that explains Follicle stimulating hormone (FSH mediated IRS-2 promoter activation in human granulosa cells and its importance in the pathophysiology of PCOS. Further analysis was carried out for binary interactions of TF regulatory genes in IRS-2 network using Cytoscape software tool and R-code. In this manuscript, we describe the methodology used for the identification of TFBSs in human IRS-2 promoter region and provide details on experimental procedures, analysis method, validation of data and also the raw files. The purpose of this article is to provide the data on all TFBSs in the promoter region of human IRS-2 gene as it has the potential for prediction of the regulation of IRS-2 gene in normal or diseased cells from patients with metabolic disorders and cancer. Keywords: IRS-2, TFBS, FSH, SP1, ChIP
Frank, Henrique Oliveira; Sanchez, Danilo Garcia; de Freitas Oliveira, Lucas; Kobarg, Jörg; Monesi, Nadia
2017-11-01
The DNA puff BhC4-1 gene of Bradysia hygida (Diptera, Sciaridae) is amplified and expressed in the salivary glands at the end of the last larval instar. Even though there are no BhC4-1 orthologs in Drosophila melanogaster, the mechanisms that regulate BhC4-1 gene expression in B. hygida are for the most part conserved in D. melanogaster. The BhC4-1 promoter contains a 129bp (-186/-58) cis-regulatory module (CRM) that drives developmentally regulated expression in transgenic salivary glands at the onset of metamorphosis. Both in the sciarid and in transgenic D. melanogaster, BhC4-1 gene expression is induced by the increase in ecdysone titers that triggers metamorphosis. Genetic interaction experiments revealed that in the absence of the Eip74EF-PA early gene isoform BhC4-1-lacZ levels of expression in the salivary gland are severely reduced. Here we show that the overexpression of the Eip74EF-PA transcription factor is sufficient to anticipate BhC4-1-lacZ expression in transgenic D. melanogaster. Through yeast one-hybrid assays we confirm that the Eip74EF-PA transcription factor directly binds to the 129 bp sciarid CRM. Together, these results contribute to the characterization of an insect CRM and indicate that the ecdysone gene regulatory network that promotes metamorphosis is conserved between D. melanogaster and the sciarid B. hygida. © 2017 Wiley Periodicals, Inc.
Directory of Open Access Journals (Sweden)
Fumiharu Ohka
Full Text Available Gliomas are the most frequently occurring primary brain tumor in the central nervous system of adults. Glioblastoma multiformes (GBMs, WHO grade 4 have a dismal prognosis despite the use of the alkylating agent, temozolomide (TMZ, and even low grade gliomas (LGGs, WHO grade 2 eventually transform to malignant secondary GBMs. Although GBM patients benefit from promoter hypermethylation of the O(6-methylguanine-DNA methyltransferase (MGMT that is the main determinant of resistance to TMZ, recent studies suggested that MGMT promoter methylation is of prognostic as well as predictive significance for the efficacy of TMZ. Glioma-CpG island methylator phenotype (G-CIMP in the global genome was shown to be a significant predictor of improved survival in patients with GBM. Collectively, we hypothesized that MGMT promoter methylation might reflect global DNA methylation. Additionally in LGGs, the significance of MGMT promoter methylation is still undetermined. In the current study, we aimed to determine the correlation between clinical, genetic, and epigenetic profiles including LINE-1 and different cancer-related genes and the clinical outcome in newly diagnosed 57 LGG and 54 GBM patients. Here, we demonstrated that (1 IDH1/2 mutation is closely correlated with MGMT promoter methylation and 1p/19q codeletion in LGGs, (2 LINE-1 methylation levels in primary and secondary GBMs are lower than those in LGGs and normal brain tissues, (3 LINE-1 methylation is proportional to MGMT promoter methylation in gliomas, and (4 higher LINE-1 methylation is a favorable prognostic factor in primary GBMs, even compared to MGMT promoter methylation. As a global DNA methylation marker, LINE-1 may be a promising marker in gliomas.
Health and the need for health promotion in hospital patients
DEFF Research Database (Denmark)
Oppedal, Kristian; Nesvåg, Sverre; Pedersen, Bolette
2010-01-01
BACKGROUND: Integrated health promotion improves clinical outcomes after hospital treatment. The first step towards implementing evidence-based health promotion in hospitals is to estimate the need for health promoting activities directed at hospital patients. The aim of this study was to identify...... the distribution and association of individual health risk factors in a Norwegian hospital population and to estimate the need for health promotion in this population. METHODS: We used a validated documentation model (HPH-DATA Model) to identify the prevalence of patients with nutritional risk (measurements...... drinking and smoking was sustained. CONCLUSION: Nearly all patients included in this study had one or more health risk factors that could aggravate clinical outcomes. There is a significant need, and potential, for health-promoting interventions. Multi-factorial interventions may be frequently indicated...
Directory of Open Access Journals (Sweden)
Mojtaba Azadbakht
2014-09-01
Full Text Available Introduction: Health beliefs significantly affect health promoting self-care behaviors. The most important model designed based on health beliefs is the Health Belief Model. This study examined the association between health belief model constructs and demographic factors with behaviors in elderly. Materials and Methods: This descriptive-analytical study was performed on 465 elders referring to Tehran's cultural centers recruited with a multi-stage sampling method. Study instruments were questionnaires regarding demographic information, health beliefs, self-efficacy and health-promoting self-care behaviors. Data analysis was performed using SPSS-22 software by Independent T-test, one-way ANOVA, Pearson correlation and Multiple linear regression. Results: The mean (±SD age of subjects was 68.24±6.12 years and the mean of general self-care score was 1.79±0.36. Gender (P=0.011, economy (P<0.001, education level (P<0.001 and age (P=0.008 were significantly associated with self-care behaviors. Regression analysis showed that perceived barriers, self-efficacy and perceived severity were determinants of behavior (P<0.001. Conclusion: According to the results of this study, it is essential to pay special attention to self-efficacy, perceived severity and perceived barriers to design health education for elderly.
Directory of Open Access Journals (Sweden)
Francis Finot
2012-01-01
Full Text Available The culture liver slices are mainly used to investigate drug metabolism and xenobiotic-mediated liver injuries while apoptosis and proliferation remain unexplored in this culture model. Here, we show a transient increase in LDH release and caspase activities indicating an ischemic injury during the slicing procedure. Then, caspase activities decrease and remain low in cultured slices demonstrating a low level of apoptosis. The slicing procedure is also associated with the G0/G1 transition of hepatocytes demonstrated by the activation of stress and proliferation signalling pathways including the ERK1/2 and JNK1/2/3 MAPKinases and the transient upregulation of c-fos. The cells further progress up to mid-G1 phase as indicated by the sequential induction of c-myc and p53 mRNA levels after the slicing procedure and at 24 h of culture, respectively. The stimulation by epidermal growth factor induces the ERK1/2 phosphorylation but fails to activate expression of late G1 and S phase markers such as cyclin D1 and Cdk1 indicating that hepatocytes are arrested in mid-G1 phase of the cell cycle. However, we found that combined stimulation by the proinflammatory cytokine tumor necrosis factor α and the epidermal growth factor promotes the commitment to DNA replication as observed in vivo during the liver regeneration.
Xie, Xing-Bin; Li, Shen; Zhang, Rui-Fen; Zhao, Jing; Chen, Ying-Chun; Zhao, Qiang; Yao, Yu-Xin; You, Chun-Xiang; Zhang, Xian-Sheng; Hao, Yu-Jin
2012-11-01
Low environmental temperatures promote anthocyanin accumulation and fruit colouration by up-regulating the expression of genes involved in anthocyanin biosynthesis and regulation in many fruit trees. However, the molecular mechanism by which fruit trees regulate this process in response to low temperature (LT) remains largely unknown. In this study, the cold-induced bHLH transcription factor gene MdbHLH3 was isolated from an apple tree and was found to interact physically and specifically through two regions (amino acids 1-23 and 186-228) at the N terminus with the MYB partner MdMYB1 (allelic to MdMYB10). Subsequently, MdbHLH3 bound to the promoters of the anthocyanin biosynthesis genes MdDFR and MdUFGT and the regulatory gene MdMYB1 to activate their expression. Furthermore, the MdbHLH3 protein was post-translationally modified, possibly involving phosphorylation following exposure to LTs, which enhanced its promoter-binding capacity and transcription activity. Our results demonstrate the molecular mechanism by which MdbHLH3 regulates LT-induced anthocyanin accumulation and fruit colouration in apple. © 2012 Blackwell Publishing Ltd.
Kotsaki, Antigoni; Raftogiannis, Maria; Routsi, Christina; Baziaka, Fotini; Kotanidou, Anastasia; Antonopoulou, Anastasia; Orfanos, Stylianos E; Katsenos, Chrisostomos; Koutoukas, Pantelis; Plachouras, Diamantis; Mandragos, Konstantinos; Giamarellos-Bourboulis, Evangelos J
2012-08-01
Debatable findings exist among various studies regarding the impact of single nucleotide polymorphisms (SNPs) within the promoter region of the tumor necrosis factor (TNF) gene for susceptibility to infections. Their impact was investigated in a cohort of mechanically ventilated patients who developed ventilator-associated pneumonia (VAP). Two-hundred and thirteen mechanically ventilated patients who developed VAP were enrolled. Genomic DNA was extracted and SNPs at the -376, -308 and -238 position of the promoter region of the TNF gene were assessed by restriction fragment length polymorphisms. Monocytes were isolated from 47 patients when they developed sepsis and stimulated by bacterial endotoxin for the production of TNFα and of interleukin-6 (IL-6). Patients were divided into two groups; 166 patients bearing only wild-type alleles of all three studied polymorphisms; and 47 patients carrying at least one A allele of the three studied SNPs. Time between start of mechanical ventilation and advent of VAP was significantly shorter in the second group than in the first group (log-rank: 4.416, p: 0.041). When VAP supervened, disease severity did not differ between groups. Stimulation of TNFα and of IL-6 was much greater by monocytes for patients carrying A alleles. Carriage of at least one A allele of the three studied SNPs at the promoter region of the TNF-gene is associated with shorter time to development of VAP but it is not associated with disease severity. Findings may be related with a role of the studied SNPs in the production of pro-inflammatory cytokines. Copyright © 2012 Elsevier Ltd. All rights reserved.
Carrillo-García, Carmen; Prochnow, Sebastian; Simeonova, Ina K; Strelau, Jens; Hölzl-Wenig, Gabriele; Mandl, Claudia; Unsicker, Klaus; von Bohlen Und Halbach, Oliver; Ciccolini, Francesca
2014-02-01
The activation of epidermal growth factor receptor (EGFR) affects multiple aspects of neural precursor behaviour, including proliferation and migration. Telencephalic precursors acquire EGF responsiveness and upregulate EGFR expression at late stages of development. The events regulating this process and its significance are still unclear. We here show that in the developing and postnatal hippocampus (HP), growth/differentiation factor (GDF) 15 and EGFR are co-expressed in primitive precursors as well as in more differentiated cells. We also provide evidence that GDF15 promotes responsiveness to EGF and EGFR expression in hippocampal precursors through a mechanism that requires active CXC chemokine receptor (CXCR) 4. Besides EGFR expression, GDF15 ablation also leads to decreased proliferation and migration. In particular, lack of GDF15 impairs both processes in the cornu ammonis (CA) 1 and only proliferation in the dentate gyrus (DG). Importantly, migration and proliferation in the mutant HP were altered only perinatally, when EGFR expression was also affected. These data suggest that GDF15 regulates migration and proliferation by promoting EGFR signalling in the perinatal HP and represent a first description of a functional role for GDF15 in the developing telencephalon.
Matsutani Sachiko
2004-01-01
Abstract Background In eukaryotes, RNA polymerase III (RNAP III) transcribes the genes for small RNAs like tRNAs, 5S rRNA, and several viral RNAs, and short interspersed repetitive elements (SINEs). The genes for these RNAs and SINEs have internal promoters that consist of two regions. These two regions are called the A and B blocks. The multisubunit transcription factor TFIIIC is required for transcription initiation of RNAP III; in transcription of tRNAs, the B-block binding subunit of TFII...
Molecular Mechanisms of Mouse Skin Tumor Promotion
International Nuclear Information System (INIS)
Rundhaug, Joyce E.; Fischer, Susan M.
2010-01-01
Multiple molecular mechanisms are involved in the promotion of skin carcinogenesis. Induction of sustained proliferation and epidermal hyperplasia by direct activation of mitotic signaling pathways or indirectly in response to chronic wounding and/or inflammation, or due to a block in terminal differentiation or resistance to apoptosis is necessary to allow clonal expansion of initiated cells with DNA mutations to form skin tumors. The mitotic pathways include activation of epidermal growth factor receptor and Ras/Raf/mitogen-activated protein kinase signaling. Chronic inflammation results in inflammatory cell secretion of growth factors and cytokines such as tumor necrosis factor-α and interleukins, as well as production of reactive oxygen species, all of which can stimulate proliferation. Persistent activation of these pathways leads to tumor promotion
Guise, Jeanne-Marie; Winter, Susan; Fiore, Stephen M; Regensteiner, Judith G; Nagel, Joan
2017-04-01
Research organizations face challenges in creating infrastructures that cultivates and sustains interdisciplinary team science. The objective of this paper is to identify structural elements of organizations and training that promote team science. We qualitatively analyzed the National Institutes of Health's Building Interdisciplinary Research Careers in Women's Health, K12 using organizational psychology and team science theories to identify organizational design factors for successful team science and training. Seven key design elements support team science: (1) semiformal meta-organizational structure, (2) shared context and goals, (3) formal evaluation processes, (4) meetings to promote communication, (5) role clarity in mentoring, (6) building interpersonal competencies among faculty and trainees, and (7) designing promotion and tenure and other organizational processes to support interdisciplinary team science. This application of theory to a long-standing and successful program provides important foundational elements for programs and institutions to consider in promoting team science.
Ramachandra, Rashmi; Namburi, Ramesh B; Ortega-Martinez, Olga; Shi, Xiaofeng; Zaia, Joseph; Dupont, Sam T; Thorndyke, Michael C; Lindahl, Ulf; Spillmann, Dorothe
2014-02-01
Glycosaminoglycans (GAGs) isolated from brittlestars, Echinodermata class Ophiuroidea, were characterized, as part of attempts to understand the evolutionary development of these polysaccharides. A population of chondroitin sulfate/dermatan sulfate (CS/DS) chains with a high overall degree of sulfation and hexuronate epimerization was the major GAG found, whereas heparan sulfate (HS) was below detection level. Enzymatic digestion with different chondroitin lyases revealed exceptionally high proportions of di- and trisulfated CS/DS disaccharides. The latter unit appears much more abundant in one of four individual species of brittlestars, Amphiura filiformis, than reported earlier in other marine invertebrates. The brittlestar CS/DS was further shown to bind to growth factors such as fibroblast growth factor 2 and to promote FGF-stimulated cell signaling in GAG-deficient cell lines in a manner similar to that of heparin. These findings point to a potential biological role for the highly sulfated invertebrate GAGs, similar to those ascribed to HS in vertebrates.
Directory of Open Access Journals (Sweden)
Xiao Xu
Full Text Available Stress is a fundamental aspect of aging, as accumulated damage from a lifetime of stress can limit lifespan and protective responses to stress can extend lifespan. In this study, we identify a conserved Caenorhabditis elegans GATA transcription factor, egl-27, that is involved in several stress responses and aging. We found that overexpression of egl-27 extends the lifespan of wild-type animals. Furthermore, egl-27 is required for the pro-longevity effects from impaired insulin/IGF-1 like signaling (IIS, as reduced egl-27 activity fully suppresses the longevity of worms that are mutant for the IIS receptor, daf-2. egl-27 expression is inhibited by daf-2 and activated by pro-longevity factors daf-16/FOXO and elt-3/GATA, suggesting that egl-27 acts at the intersection of IIS and GATA pathways to extend lifespan. Consistent with its role in IIS signaling, we found that egl-27 is involved in stress response pathways. egl-27 expression is induced in the presence of multiple stresses, its targets are significantly enriched for many types of stress genes, and altering levels of egl-27 itself affects survival to heat and oxidative stress. Finally, we found that egl-27 expression increases between young and old animals, suggesting that increased levels of egl-27 in aged animals may act to promote stress resistance. These results identify egl-27 as a novel factor that links stress and aging pathways.
Energy Technology Data Exchange (ETDEWEB)
Kabaya, Koji; Watanabe, Masahiko; Kusaka, Masaru; Seki, Masatoshi (Kirin Brewery Co., Ltd., Gunma (Japan). Pharmaceutical Research Laboratory); Fushiki, Masato
1994-08-01
The effect of recombinant human granulocyte colony-stimulating factor (rhG-CSF) on the recovery from neutropenia induced by fractionated whole-body irradiation was investigated in mice. Male 7-week old C3H/HeN mice received a total of ten exposures of 0.25 Gy/day from day 1 to 5 and from day 8 to 12. Peripheral neutropenia with a nadir on day 17 was caused by the fractionated irradiation. Daily subcutaneous injections of rhG-CSF at 0.25 and 2.5 [mu]g/body/day from day from day 1 to 21 promoted the recovery of neutrophils in a dose-dependent manner. The kinetics of morphologically identifiable bone marrow cells were studied to clarify the mechanism behind the promotive effect of this factor. A slight decrease in mitotic immature granulocytes, such as myeloblasts, promyelocytes and myelocytes on day 5, and a drastic decrease in metamyelocytes and marrow neutrophils on days 5, 9, and 17 were seen in the femur of irradiated mice. Treatment using rhG-CSF caused an increase in immature granulocytes of all differential stages in the femur. Microscopic findings of the femurs and spleens also reveals an increase in immature granulocytes in these organs in mice injected with rhG-CSF. These results indicate that rhG-CSF accelerates granulopoiesis in the femur and spleen, thereby promoting recovery from neutropenia induced by fractionated irradiation. (author).
International Nuclear Information System (INIS)
Kabaya, Koji; Watanabe, Masahiko; Kusaka, Masaru; Seki, Masatoshi; Fushiki, Masato.
1994-01-01
The effect of recombinant human granulocyte colony-stimulating factor (rhG-CSF) on the recovery from neutropenia induced by fractionated whole-body irradiation was investigated in mice. Male 7-week old C3H/HeN mice received a total of ten exposures of 0.25 Gy/day from day 1 to 5 and from day 8 to 12. Peripheral neutropenia with a nadir on day 17 was caused by the fractionated irradiation. Daily subcutaneous injections of rhG-CSF at 0.25 and 2.5 μg/body/day from day from day 1 to 21 promoted the recovery of neutrophils in a dose-dependent manner. The kinetics of morphologically identifiable bone marrow cells were studied to clarify the mechanism behind the promotive effect of this factor. A slight decrease in mitotic immature granulocytes, such as myeloblasts, promyelocytes and myelocytes on day 5, and a drastic decrease in metamyelocytes and marrow neutrophils on days 5, 9, and 17 were seen in the femur of irradiated mice. Treatment using rhG-CSF caused an increase in immature granulocytes of all differential stages in the femur. Microscopic findings of the femurs and spleens also reveals an increase in immature granulocytes in these organs in mice injected with rhG-CSF. These results indicate that rhG-CSF accelerates granulopoiesis in the femur and spleen, thereby promoting recovery from neutropenia induced by fractionated irradiation. (author)
Shen, Qinfang; Shi, Herong; Tian, Chenxi; Ghai, Vikas; Liu, Jun
2017-09-01
Proper development of a multicellular organism relies on well-coordinated regulation of cell fate specification, cell proliferation and cell differentiation. The C. elegans postembryonic mesoderm provides a useful system for uncovering factors involved in these processes and for further dissecting their regulatory relationships. The single Spalt-like zinc finger containing protein SEM-4/SALL is known to be involved in specifying the proliferative sex myoblast (SM) fate. We have found that SEM-4/SALL is sufficient to promote the SM fate and that it does so in a cell autonomous manner. We further showed that SEM-4/SALL acts through the SoxC transcription factor SEM-2 to promote the SM fate. SEM-2 is known to promote the SM fate by inhibiting the expression of two BWM-specifying transcription factors. In light of recent findings in mammals showing that Sall4, one of the mammalian homologs of SEM-4, contributes to pluripotency regulation by inhibiting differentiation, our work suggests that the function of SEM-4/SALL proteins in regulating pluripotency versus differentiation appears to be evolutionarily conserved. Copyright © 2017 Elsevier Inc. All rights reserved.
Functional analysis of bipartite begomovirus coat protein promoter sequences
International Nuclear Information System (INIS)
Lacatus, Gabriela; Sunter, Garry
2008-01-01
We demonstrate that the AL2 gene of Cabbage leaf curl virus (CaLCuV) activates the CP promoter in mesophyll and acts to derepress the promoter in vascular tissue, similar to that observed for Tomato golden mosaic virus (TGMV). Binding studies indicate that sequences mediating repression and activation of the TGMV and CaLCuV CP promoter specifically bind different nuclear factors common to Nicotiana benthamiana, spinach and tomato. However, chromatin immunoprecipitation demonstrates that TGMV AL2 can interact with both sequences independently. Binding of nuclear protein(s) from different crop species to viral sequences conserved in both bipartite and monopartite begomoviruses, including TGMV, CaLCuV, Pepper golden mosaic virus and Tomato yellow leaf curl virus suggests that bipartite begomoviruses bind common host factors to regulate the CP promoter. This is consistent with a model in which AL2 interacts with different components of the cellular transcription machinery that bind viral sequences important for repression and activation of begomovirus CP promoters
Ribosomal elongation factor 4 promotes cell death associated with lethal stress.
Li, Liping; Hong, Yuzhi; Luan, Gan; Mosel, Michael; Malik, Muhammad; Drlica, Karl; Zhao, Xilin
2014-12-09
Ribosomal elongation factor 4 (EF4) is highly conserved among bacteria, mitochondria, and chloroplasts. However, the EF4-encoding gene, lepA, is nonessential and its deficiency shows no growth or fitness defect. In purified systems, EF4 back-translocates stalled, posttranslational ribosomes for efficient protein synthesis; consequently, EF4 has a protective role during moderate stress. We were surprised to find that EF4 also has a detrimental role during severe stress: deletion of lepA increased Escherichia coli survival following treatment with several antimicrobials. EF4 contributed to stress-mediated lethality through reactive oxygen species (ROS) because (i) the protective effect of a ΔlepA mutation against lethal antimicrobials was eliminated by anaerobic growth or by agents that block hydroxyl radical accumulation and (ii) the ΔlepA mutation decreased ROS levels stimulated by antimicrobial stress. Epistasis experiments showed that EF4 functions in the same genetic pathway as the MazF toxin, a stress response factor implicated in ROS-mediated cell death. The detrimental action of EF4 required transfer-messenger RNA (tmRNA, which tags truncated proteins for degradation and is known to be inhibited by EF4) and the ClpP protease. Inhibition of a protective, tmRNA/ClpP-mediated degradative activity would allow truncated proteins to indirectly perturb the respiratory chain and thereby provide a potential link between EF4 and ROS. The connection among EF4, MazF, tmRNA, and ROS expands a pathway leading from harsh stress to bacterial self-destruction. The destructive aspect of EF4 plus the protective properties described previously make EF4 a bifunctional factor in a stress response that promotes survival or death, depending on the severity of stress. Translation elongation factor 4 (EF4) is one of the most conserved proteins in nature, but it is dispensable. Lack of strong phenotypes for its genetic knockout has made EF4 an enigma. Recent biochemical work has
Griseri, Thibault; Arnold, Isabelle C.; Pearson, Claire; Krausgruber, Thomas; Schiering, Chris; Franchini, Fanny; Schulthess, Julie; McKenzie, Brent S.; Crocker, Paul R.; Powrie, Fiona
2015-01-01
Summary The role of intestinal eosinophils in immune homeostasis is enigmatic and the molecular signals that drive them from protective to tissue damaging are unknown. Most commonly associated with Th2 cell-mediated diseases, we describe a role for eosinophils as crucial effectors of the interleukin-23 (IL-23)-granulocyte macrophage colony-stimulating factor (GM-CSF) axis in colitis. Chronic intestinal inflammation was characterized by increased bone marrow eosinopoiesis and accumulation of activated intestinal eosinophils. IL-5 blockade or eosinophil depletion ameliorated colitis, implicating eosinophils in disease pathogenesis. GM-CSF was a potent activator of eosinophil effector functions and intestinal accumulation, and GM-CSF blockade inhibited chronic colitis. By contrast neutrophil accumulation was GM-CSF independent and dispensable for colitis. In addition to TNF secretion, release of eosinophil peroxidase promoted colitis identifying direct tissue-toxic mechanisms. Thus, eosinophils are key perpetrators of chronic inflammation and tissue damage in IL-23-mediated immune diseases and it suggests the GM-CSF-eosinophil axis as an attractive therapeutic target. PMID:26200014
Shields, Margaret M.; Thomas, Katherine H.; Paschal, Angelia; Tucker, Melanie; Leeper, James; Usdan, Stuart
2017-01-01
Biking is a popular recreational activity, and understanding how to promote participation is important to college health and recreation professionals. The purpose of this study was to examine factors contributing to cycling behaviors on one large college campus from an ecological perspective. Students were surveyed at a southeastern university in…
DEFF Research Database (Denmark)
Tornøe, Jens; Kusk, P.; Johansen, T.E.
2002-01-01
The development of a set of synthetic mammalian promoters with different specific activities is described. The library is based on a synthetic promoter, JeT, constructed as a 200 bp chimeric promoter built from fragments of the viral SV40 early promoter and the human beta-actin and ubiquitin C......, was obtained. The measured activity of each promoter in the library was highly specific and reproducible when tested in HiB5 and ARPE-19 cell culture....
DEFF Research Database (Denmark)
Tornøe, Jens; Kusk, P.; Johansen, T.E.
2002-01-01
The development of a set of synthetic mammalian promoters with different specific activities is described. The library is based on a synthetic promoter, JeT, constructed as a 200 bp chimeric promoter built from fragments of the viral SV40 early promoter and the human beta-actin and ubiquitin C...
Directory of Open Access Journals (Sweden)
Azam Baheiraei
2013-01-01
Conclusions: In these women′s experience, factors influencing health-promoting behaviors were either facilitators or inhibitors; most were inhibitors. The findings of this study show that, in addition to personal factors, the pursuit of health-promoting behaviors is affected by socio-environmental factors. These results will be useful in designing interventions and plans for women′s health promotion that focus on the improvement of their environment and the modification of social factors.
Analysis of an osmotically regulated pathogenesis-related osmotin gene promoter.
Raghothama, K G; Liu, D; Nelson, D E; Hasegawa, P M; Bressan, R A
1993-12-01
Osmotin is a small (24 kDa), basic, pathogenesis-related protein, that accumulates during adaptation of tobacco (Nicotiana tabacum) cells to osmotic stress. There are more than 10 inducers that activate the osmotin gene in various plant tissues. The osmotin promoter contains several sequences bearing a high degree of similarity to ABRE, as-1 and E-8 cis element sequences. Gel retardation studies indicated the presence of at least two regions in the osmotin promoter that show specific interactions with nuclear factors isolated from cultured cells or leaves. The abundance of these binding factors increased in response to salt, ABA and ethylene. Nuclear factors protected a 35 bp sequence of the promoter from DNase I digestion. Different 5' deletions of the osmotin promoter cloned into a promoter-less GUSNOS plasmid (pBI 201) were used in transient expression studies with a Biolistic gun. The transient expression studies revealed the presence of three distinct regions in the osmotin promoter. The promoter sequence from -108 to -248 bp is absolutely required for reporter gene activity, followed by a long stretch (up to -1052) of enhancer-like sequence and then a sequence upstream of -1052, which appears to contain negative elements. The responses to ABA, ethylene, salt, desiccation and wounding appear to be associated with the -248 bp sequence of the promoter. This region also contains a putative ABRE (CACTGTG) core element. Activation of the osmotin gene by various inducers is discussed in view of antifungal activity of the osmotin protein.
Dynamic nucleosome organization at hox promoters during zebrafish embryogenesis.
Directory of Open Access Journals (Sweden)
Steven E Weicksel
Full Text Available Nucleosome organization at promoter regions plays an important role in regulating gene activity. Genome-wide studies in yeast, flies, worms, mammalian embryonic stem cells and transformed cell lines have found well-positioned nucleosomes flanking a nucleosome depleted region (NDR at transcription start sites. This nucleosome arrangement depends on DNA sequence (cis-elements as well as DNA binding factors and ATP-dependent chromatin modifiers (trans-factors. However, little is understood about how the nascent embryonic genome positions nucleosomes during development. This is particularly intriguing since the embryonic genome must undergo a broad reprogramming event upon fusion of sperm and oocyte. Using four stages of early embryonic zebrafish development, we map nucleosome positions at the promoter region of 37 zebrafish hox genes. We find that nucleosome arrangement at the hox promoters is a progressive process that takes place over several stages. At stages immediately after fertilization, nucleosomes appear to be largely disordered at hox promoter regions. At stages after activation of the embryonic genome, nucleosomes are detectable at hox promoters, with positions becoming more uniform and more highly occupied. Since the genomic sequence is invariant during embryogenesis, this progressive change in nucleosome arrangement suggests that trans-factors play an important role in organizing nucleosomes during embryogenesis. Separating hox genes into expressed and non-expressed groups shows that expressed promoters have better positioned and occupied nucleosomes, as well as distinct NDRs, than non-expressed promoters. Finally, by blocking the retinoic acid-signaling pathway, we disrupt early hox gene transcription, but observe no effect on nucleosome positions, suggesting that active hox transcription is not a driving force behind the arrangement of nucleosomes at the promoters of hox genes during early development.
DEFF Research Database (Denmark)
Peng, Nan; Xia, Qiu; Chen, Zhengjun
2009-01-01
S gene encoding an arabinose binding protein was characterized using an Sulfolobus islandicus reporter gene system. The minimal active araS promoter (P(araS)) was found to be 59 nucleotides long and harboured four promoter elements: an ara-box, an upstream transcription factor B-responsive element (BRE......), a TATA-box and a proximal promoter element, each of which contained important nucleotides that either greatly decreased or completely abolished promoter activity upon mutagenesis. The basal araS promoter was virtually inactive due to intrinsically weak BRE element, and the upstream activating sequence...... (UAS) ara-box activated the basal promoter by recruiting transcription factor B to its BRE. While this UAS ensured a general expression from an inactive or weak basal promoter in the presence of other tested carbon resources, it exhibited a strong arabinose-responsive transcriptional activation. To our...
Directory of Open Access Journals (Sweden)
Deepti Jain
Full Text Available Plants respond to different forms of stresses by inducing transcription of a common and distinct set of genes by concerted actions of a cascade of transcription regulators. We previously reported that a gene, CaZF encoding a C2H2-zinc finger family protein from chickpea (Cicer arietinum imparted high salinity tolerance when expressed in tobacco plants. We report here that in addition to promoting tolerance against dehydration, salinity and high temperature, the CaZF overexpressing plants exhibited similar phenotype of growth and development like the plants overexpressing CAP2, encoding an AP2-family transcription factor from chickpea. To investigate any relationship between these two genes, we performed gene expression analysis in the overexpressing plants, promoter-reporter analysis and chromatin immunoprecipitation. A number of transcripts that exhibited enhanced accumulation upon expression of CAP2 or CaZF in tobacco plants were found common. Transient expression of CAP2 in chickpea leaves resulted in increased accumulation of CaZF transcript. Gel mobility shift and transient promoter-reporter assays suggested that CAP2 activates CaZF promoter by interacting with C-repeat elements (CRTs in CaZF promoter. Chromatin immunoprecipitation (ChIP assay demonstrated an in vivo interaction of CAP2 protein with CaZF promoter.
Linking Core Promoter Classes to Circadian Transcription.
Directory of Open Access Journals (Sweden)
Pål O Westermark
2016-08-01
Full Text Available Circadian rhythms in transcription are generated by rhythmic abundances and DNA binding activities of transcription factors. Propagation of rhythms to transcriptional initiation involves the core promoter, its chromatin state, and the basal transcription machinery. Here, I characterize core promoters and chromatin states of genes transcribed in a circadian manner in mouse liver and in Drosophila. It is shown that the core promoter is a critical determinant of circadian mRNA expression in both species. A distinct core promoter class, strong circadian promoters (SCPs, is identified in mouse liver but not Drosophila. SCPs are defined by specific core promoter features, and are shown to drive circadian transcriptional activities with both high averages and high amplitudes. Data analysis and mathematical modeling further provided evidence for rhythmic regulation of both polymerase II recruitment and pause release at SCPs. The analysis provides a comprehensive and systematic view of core promoters and their link to circadian mRNA expression in mouse and Drosophila, and thus reveals a crucial role for the core promoter in regulated, dynamic transcription.
DEFF Research Database (Denmark)
Mirastschijski, Ursula; Schnabel, Reinhild; Claes, Juliane
2010-01-01
applied topically to full-thickness skin excisional wounds in rats and its ability to inhibit the promotion of myofibroblast formation and function by the latent transforming-growth factor-beta1 (TGF-beta1). BB-94 delayed wound contraction, as well as all other associated aspects of wound healing examined......, including myofibroblast formation, stromal cell proliferation, blood vessel formation, and epithelial wound coverage. Interestingly, BB-94 dramatically increased the level of latent and active MMP-9. The increased levels of active MMP-9 may eventually overcome the ability of BB-94 to inhibit this MMP...... and may explain why wound contraction and other associated events of wound healing were only delayed and not completely inhibited. BB-94 was also found to inhibit the ability of latent TGF-beta1 to promote the formation and function of myofibroblasts. These results suggest that BB-94 could delay wound...
Hannemann, Nicole; Jordan, Jutta; Paul, Sushmita; Reid, Stephen; Baenkler, Hanns-Wolf; Sonnewald, Sophia; Bäuerle, Tobias; Vera, Julio; Schett, Georg; Bozec, Aline
2017-05-01
Activation of proinflammatory macrophages is associated with the inflammatory state of rheumatoid arthritis. Their polarization and activation are controlled by transcription factors such as NF-κB and the AP-1 transcription factor member c-Fos. Surprisingly, little is known about the role of the AP-1 transcription factor c-Jun in macrophage activation. In this study, we show that mRNA and protein levels of c-Jun are increased in macrophages following pro- or anti-inflammatory stimulations. Gene Ontology and Kyoto Encyclopedia of Genes and Genomes pathway enrichment cluster analyses of microarray data using wild-type and c-Jun-deleted macrophages highlight the central function of c-Jun in macrophages, in particular for immune responses, IL production, and hypoxia pathways. Mice deficient for c-Jun in macrophages show an amelioration of inflammation and bone destruction in the serum-induced arthritis model. In vivo and in vitro gene profiling, together with chromatin immunoprecipitation analysis of macrophages, revealed direct activation of the proinflammatory factor cyclooxygenase-2 and indirect inhibition of the anti-inflammatory factor arginase-1 by c-Jun. Thus, c-Jun regulates the activation state of macrophages and promotes arthritis via differentially regulating cyclooxygenase-2 and arginase-1 levels. Copyright © 2017 by The American Association of Immunologists, Inc.
Ollivier-Lanvin, Karen; Fischer, Itzhak; Tom, Veronica; Houlé, John D; Lemay, Michel A
2015-01-01
Background. Transplants of cellular grafts expressing a combination of 2 neurotrophic factors, brain-derived neurotrophic factor (BDNF) and neurotrophin-3 (NT-3) have been shown to promote and enhance locomotor recovery in untrained spinalized cats. Based on the time course of recovery and the absence of axonal growth through the transplants, we hypothesized that recovery was due to neurotrophin-mediated plasticity within the existing locomotor circuitry of the lumbar cord. Since BDNF and NT-3 have different effects on axonal sprouting and synaptic connectivity/strengthening, it becomes important to ascertain the contribution of each individual neurotrophins to recovery. Objective. We studied whether BDNF or NT-3 only producing cellular grafts would be equally effective at restoring locomotion in untrained spinal cats. Methods. Rat fibroblasts secreting one of the 2 neurotrophins were grafted into the T12 spinal transection site of adult cats. Four cats in each group (BDNF alone or NT-3 alone) were evaluated. Locomotor recovery was tested on a treadmill at 3 and 5 weeks post-transection/grafting. Results. Animals in both groups were capable of plantar weight-bearing stepping at speed up to 0.8 m/s as early as 3 weeks and locomotor capabilities were similar at 3 and 5 weeks for both types of graft. Conclusions. Even without locomotor training, either BDNF or NT-3 only producing grafts promote locomotor recovery in complete spinal animals. More clinically applicable delivery methods need to be developed. © The Author(s) 2014.
Laddha, Naresh C.; Dwivedi, Mitesh; Begum, Rasheedunnisa
2012-01-01
Abstract Tumor Necrosis Factor (TNF)-α, is a paracrine inhibitor of melanocytes, which plays a critical role in the pathogenesis of several autoimmune diseases including vitiligo, as abnormal immune responses have frequently been observed in vitiligo patients. Moreover, vitiligo patients show higher lesion levels of TNF-α. Genetic polymorphisms in the promoter region of TNF-α are involved in the regulation of its expression. The present study explores TNF-α promoter polymorphisms and correlates them with TNF-α transcript and protein levels in vitiligo patients and controls of Gujarat along with its effect on disease onset and progression. PCR-RFLP technique was used for genotyping of these polymorphisms in 977 vitiligo patients and 990 controls. TNF-α transcript and protein levels were measured by Real time PCR and ELISA respectively. The genotype and allele frequencies for the investigated polymorphisms were significantly associated with vitiligo patients. The study revealed significant increase in TNF-α transcript and protein levels in vitiligo patients compared to controls. In particular, haplotypes: AATCC, AACCT, AGTCT, GATCT, GATCC and AGCCT were found to increase the TNF-α levels in vitiligo patients. Analysis of TNF-α levels based on the gender and disease progression suggests that female patients and patients with active vitiligo had higher levels of TNF-α. Also, the TNF-α levels were high in patients with generalized vitiligo as compared to localized vitiligo. Age of onset analysis of the disease suggests that the haplotypes: AACAT, AACCT, AATCC and AATCT had a profound effect in the early onset of the disease. Moreover, the analysis suggests that female patients had an early onset of vitiligo. Overall, our results suggest that TNF-α promoter polymorphisms may be genetic risk factors for susceptibility and progression of the disease. The up-regulation of TNF-α transcript and protein levels in individuals with susceptible haplotypes advocates
Directory of Open Access Journals (Sweden)
Tsai Yueh-Chi
2012-07-01
Full Text Available Abstract Background Healthcare workers including physicians, nurses, medical technicians and administrative staff experience high levels of occupational stress as a result of heavy workloads, extended working hours and time-related pressure. The aims of this study were to investigate factors associated with work stress among hospital staff members and to evaluate their health-promoting lifestyle behaviors. Methods We conducted a cross-sectional study from May 1, 2010 to July 30, 2010 and recruited 775 professional staff from two regional hospitals in Taiwan using purposive sampling. Demographic data and self-reported symptoms related to work-related stress were collected. Each subject completed the Chinese versions of the Job Content Questionnaire (C-JCQ and The Health-Promoting Lifestyle Profile (HPLSP. Linear and binary regression analyses were applied to identify associations between these two measurements and subjects’ characteristics, and associations between the two measurements and stress symptoms. Results Self-reported symptoms of work-related stress included 64.4% of subjects reporting nervousness, 33.7% nightmares, 44.1% irritability, 40.8% headaches, 35.0% insomnia, and 41.4% gastrointestinal upset. C-JCQ scores for psychological demands of the job and discretion to utilize skills had a positive correlation with stress-related symptoms; however, the C-JCQ scores for decision-making authority and social support correlated negatively with stress-related symptoms except for nightmares and irritability. All items on the HPLSP correlated negatively with stress-related symptoms except for irritability, indicating an association between subjects’ symptoms and a poor quality of health-promoting lifestyle behaviors. Conclusions We found that high demands, little decision-making authority, and low levels of social support were associated with the development of stress-related symptoms. The results also suggested that better performance on
Tsai, Yueh-Chi; Liu, Chieh-Hsing
2012-07-16
Healthcare workers including physicians, nurses, medical technicians and administrative staff experience high levels of occupational stress as a result of heavy workloads, extended working hours and time-related pressure. The aims of this study were to investigate factors associated with work stress among hospital staff members and to evaluate their health-promoting lifestyle behaviors. We conducted a cross-sectional study from May 1, 2010 to July 30, 2010 and recruited 775 professional staff from two regional hospitals in Taiwan using purposive sampling. Demographic data and self-reported symptoms related to work-related stress were collected. Each subject completed the Chinese versions of the Job Content Questionnaire (C-JCQ) and The Health-Promoting Lifestyle Profile (HPLSP). Linear and binary regression analyses were applied to identify associations between these two measurements and subjects' characteristics, and associations between the two measurements and stress symptoms. Self-reported symptoms of work-related stress included 64.4% of subjects reporting nervousness, 33.7% nightmares, 44.1% irritability, 40.8% headaches, 35.0% insomnia, and 41.4% gastrointestinal upset. C-JCQ scores for psychological demands of the job and discretion to utilize skills had a positive correlation with stress-related symptoms; however, the C-JCQ scores for decision-making authority and social support correlated negatively with stress-related symptoms except for nightmares and irritability. All items on the HPLSP correlated negatively with stress-related symptoms except for irritability, indicating an association between subjects' symptoms and a poor quality of health-promoting lifestyle behaviors. We found that high demands, little decision-making authority, and low levels of social support were associated with the development of stress-related symptoms. The results also suggested that better performance on or a higher frequency of health-promoting life-style behaviors might
Puspita, Indun Dewi; Kitagawa, Wataru; Kamagata, Yoichi; Tanaka, Michiko; Nakatsu, Cindy H
2015-01-01
Resuscitation-promoting factor (Rpf) is a protein that has been found in a number of different Actinobacteria species and has been shown to promote the growth of active cells and resuscitate dormant (non-dividing) cells. We previously reported the biological activity of an Rpf protein in Tomitella biformata AHU 1821(T), an Actinobacteria isolated from a permafrost ice wedge. This protein is excreted outside the cell; however, few studies have investigated its contribution in environmental samples to the growth or resuscitation of bacteria other than the original host. Therefore, the aim of the present study was to determine whether Rpf from T. biformata impacted the cultivation of other bacteria from the permafrost ice wedge from which it was originally isolated. All experiments used recombinant Rpf proteins produced using a Rhodococcus erythropolis expression system. Dilutions of melted surface sterilized ice wedge samples mixed with different doses of the purified recombinant Rpf (rRpf) protein indicated that the highest concentration tested, 1250 pM, had a significantly (p permafrost sediments. The results of the present study demonstrated that rRpf not only promoted the growth of T. biformata from which it was isolated, but also enhanced colony formation by another Actinobacteria in an environmental sample.
Exploiting nucleotide composition to engineer promoters.
Directory of Open Access Journals (Sweden)
Manfred G Grabherr
Full Text Available The choice of promoter is a critical step in optimizing the efficiency and stability of recombinant protein production in mammalian cell lines. Artificial promoters that provide stable expression across cell lines and can be designed to the desired strength constitute an alternative to the use of viral promoters. Here, we show how the nucleotide characteristics of highly active human promoters can be modelled via the genome-wide frequency distribution of short motifs: by overlapping motifs that occur infrequently in the genome, we constructed contiguous sequence that is rich in GC and CpGs, both features of known promoters, but lacking homology to real promoters. We show that snippets from this sequence, at 100 base pairs or longer, drive gene expression in vitro in a number of mammalian cells, and are thus candidates for use in protein production. We further show that expression is driven by the general transcription factors TFIIB and TFIID, both being ubiquitously present across cell types, which results in less tissue- and species-specific regulation compared to the viral promoter SV40. We lastly found that the strength of a promoter can be tuned up and down by modulating the counts of GC and CpGs in localized regions. These results constitute a "proof-of-concept" for custom-designing promoters that are suitable for biotechnological and medical applications.
Finding a balance: health promotion challenges of military women.
Agazio, Janice Griffin; Buckley, Kathleen M
2010-09-01
In this study, we explored what may determine, or predict, United States military women's health promotion behaviors. Using a descriptive correlational design grounded in Pender's Health Promotion model, 491 military women completed instruments measuring their demographic variables, perception of health, definition of health, self-efficacy, and interpersonal influences to determine the significant factors affecting participation in health promotion activities. The outcome indicated that self-efficacy and interpersonal influences were the most influential in determining health promotion. This research illuminates some of the challenges working women face in meeting health promotion activities and how best to support their ability to participate in healthy behaviors.
Directory of Open Access Journals (Sweden)
Rohimah Mohamud
2017-12-01
Full Text Available Synthetic glycine coated 50 nm polystyrene nanoparticles (NP (PS50G, unlike ambient NP, do not promote pulmonary inflammation, but instead, render lungs resistant to the development of allergic airway inflammation. In this study, we show that PS50G modulate the frequency and phenotype of regulatory T cells (Treg in the lung, specifically increasing the proportion of tumor necrosis factor 2 (TNFR2 expressing Treg. Mice pre-exposed to PS50G, which were sensitized and then challenged with an allergen a month later, preferentially expanded TNFR2+Foxp3+ Treg, which further expressed enhanced levels of latency associated peptide and cytotoxic T-lymphocyte associated molecule-4. Moreover, PS50G-induced CD103+ dendritic cell activation in the lung was associated with the proliferative expansion of TNFR2+Foxp3+ Treg. These findings provide the first evidence that engineered NP can promote the selective expansion of maximally suppressing TNFR2+Foxp3+ Treg and further suggest a novel mechanism by which NP may promote healthy lung homeostasis.
Wong, Wai-Kai; Cheung, Anny Wan-Suen; Yu, Sau-Wai; Sha, Ou; Cho, Eric Yu Pang
2014-10-01
Different trophic factors are known to promote retinal ganglion cell survival and regeneration, but each had their own limitations. We report that hepatocyte growth factor (HGF) confers distinct advantages in supporting ganglion cell survival and axonal regeneration, when compared to two well-established trophic factors ciliary neurotrophic factor (CNTF) and brain-derived neurotrophic factor (BDNF). Ganglion cells in adult hamster were injured by cutting the optic nerve. HGF, CNTF, or BDNF was injected at different dosages intravitreally after injury. Ganglion cell survival was quantified at 7, 14, or 28 days postinjury. Peripheral nerve (PN) grafting to the cut optic nerve of the growth factor-injected eye was performed either immediately after injury or delayed until 7 days post-injury. Expression of heat-shock protein 27 and changes in microglia numbers were quantified in different growth factor groups. The cellular distribution of c-Met in the retina was examined by anti-c-Met immunostaining. Hepatocyte Growth Factor (HGF) was equally potent as BDNF in promoting short-term survival (up to 14 days post-injury) and also supported survival at 28 days post-injury when ganglion cells treated by CNTF or BDNF failed to be sustained. When grafting was performed without delay, HGF stimulated twice the number of axons to regenerate compared with control but was less potent than CNTF. However, in PN grafting delayed for 7 days after optic nerve injury, HGF maintained a better propensity of ganglion cells to regenerate than CNTF. Unlike CNTF, HGF application did not increase HSP27 expression in ganglion cells. Microglia proliferation was prolonged in HGF-treated retinas compared with CNTF or BDNF. C-Met was localized to both ganglion cells and Muller cells, suggesting HGF could be neuroprotective via interacting with both neurons and glia. Compared with CNTF or BDNF, HGF is advantageous in sustaining long-term ganglion cell survival and their propensity to respond to
Health promotion and cardiovascular disease prevention in sub-Saharan Africa.
Sampson, Uchechukwu K A; Amuyunzu-Nyamongo, Mary; Mensah, George A
2013-01-01
Recent population studies demonstrate an increasing burden of cardiovascular disease (CVD) and related risk factors in sub-Saharan Africa (SSA). The mitigation or reversal of this trend calls for effective health promotion and preventive interventions. In this article, we review the core principles, challenges, and progress in promoting cardiovascular health with special emphasis on interventions to address physical inactivity, poor diet, tobacco use, and adverse cardiometabolic risk factor trends in SSA. We focus on the five essential strategies of the Ottawa Charter for Health Promotion. Successes highlighted include community-based interventions in Ghana, Nigeria, South Africa, and Mauritius and school-based programs in Kenya, Namibia, and Swaziland. We address the major challenge of developing integrated interventions, and showcase partnerships opportunities. We conclude by calling for intersectoral partnerships for effective and sustainable intervention strategies to advance cardiovascular health promotion and close the implementation gap in accordance with the 2009 Nairobi Call to Action on Health Promotion. © 2013.
Henry, Kimberly L.; Shtivelband, Annette; Comello, Maria Leonora G.; Slater, Michael D.
2011-01-01
This study explored an understudied promotive factor, a belief that alcohol use is inconsistent with personal autonomy, which may reduce adolescent intention to drink and subsequent alcohol use. Autonomy was examined as an attitudinal construct within the Theory of Reasoned Action. Longitudinal data from 2,493 seventh grade students nested in 40 schools were analyzed using a structural equation model. Autonomy was negatively correlated with intention to use alcohol and subsequent alcohol use at a later wave, and intention to use fully mediated the effect of autonomy on subsequent alcohol use. These results are consistent with the proposition that when personal autonomy is perceived as inconsistent with alcohol use among younger adolescents, students indicate a lower intention to use alcohol and use less alcohol during the following school year. PMID:23519434
Henry, Kimberly L; Shtivelband, Annette; Comello, Maria Leonora G; Slater, Michael D
2011-08-01
This study explored an understudied promotive factor, a belief that alcohol use is inconsistent with personal autonomy, which may reduce adolescent intention to drink and subsequent alcohol use. Autonomy was examined as an attitudinal construct within the Theory of Reasoned Action. Longitudinal data from 2,493 seventh grade students nested in 40 schools were analyzed using a structural equation model. Autonomy was negatively correlated with intention to use alcohol and subsequent alcohol use at a later wave, and intention to use fully mediated the effect of autonomy on subsequent alcohol use. These results are consistent with the proposition that when personal autonomy is perceived as inconsistent with alcohol use among younger adolescents, students indicate a lower intention to use alcohol and use less alcohol during the following school year.
Mental health promotion in comprehensive schools.
Onnela, A M; Vuokila-Oikkonen, P; Hurtig, T; Ebeling, H
2014-09-01
The purpose of this paper is to describe a participatory action research process on the development of a professional practice model of mental health nurses in mental health promotion in a comprehensive school environment in the city of Oulu, Finland. The developed model is a new method of mental health promotion for mental health nurses working in comprehensive schools. The professional practice model has been developed in workshops together with school staff, interest groups, parents and students. Information gathered from the workshops was analysed using action research methods. Mental health promotion interventions are delivered at three levels: universal, which is an intervention that affects the whole school or community; selective, which is an intervention focusing on a certain group of students; and indicated, which is an individually focused intervention. All interventions are delivered within the school setting, which is a universal setting for all school-aged children. The interventions share the goal of promoting mental health. The purposes of the interventions are enhancing protective factors, reducing risk factors relating to mental health problems and early identification of mental health problems as well as rapid delivery of support or referral to specialized services. The common effect of the interventions on all levels is the increase in the experience of positive mental health. © 2014 John Wiley & Sons Ltd.
The Preparation and Selection of Budget Methods for Promotion in Kosovo
Directory of Open Access Journals (Sweden)
MSc. Halit Karaxha
2017-06-01
Full Text Available Selecting the adequate method for promotion has a huge importance in increasing business’s performance. Selecting the method of the budget depends from a number of factors. The formulation of budget is known as the most critical period which requires special analysis from marketing’s managers. The expenses for promotion are usually high, and every investment made in the field of promotion directly influences in the business situation. Thus, the selection and adequate formulation of budget methods for promotion influences the growth of profit. The allocated amount for promotion depends from a number of factors, such as: the size of the firm, the sector in which it operates, competition etc. After planning the budget, we have to do the budget allocation to select the promotional form which is considered to be successful by the firms in promoting the products and services and that will help the company to connect with its clients. In this paper, I have elaborated the role and importance of the preparation and selection of budget methods for promotion in the theoretical aspect and the practical one as well.
Characterization of prokaryotic and eukaryotic promoters usinghidden Markov models
DEFF Research Database (Denmark)
Pedersen, Anders Gorm; Baldi, Pierre; Brunak, Søren
1996-01-01
In this paper we utilize hidden Markov models (HMMs) and information theory to analyze prokaryotic and eukaryotic promoters. We perform this analysis with special emphasis on the fact that promoters are divided into a number of different classes, depending on which polymerase-associated factors...... that bind to them. We find that HMMs trained on such subclasses of Escherichia coli promoters (specifically, the so-called sigma-70 and sigma-54 classes) give an excellent classification of unknown promoters with respect to sigma-class. HMMs trained on eukaryotic sequences from human genes also model nicely...
Directory of Open Access Journals (Sweden)
Li-Ching Ma
2013-01-01
Full Text Available This cross-sectional research study explored differences in health-promoting behavior and resilience among three groups of chronic kidney disease patients (high-risk, early chronic kidney disease; early CKD and pre-end stage renal disease; pre-ESRD treated at the Nephrology outpatient clinic in northern Taiwan. A total of 150 CKD outpatients were interviewed using structured questionnaires including a CKD Health to Promote Lifestyle Scale, and resilience scale. We found that the pre-ESRD group had lower resilience than either high-risk or early CKD groups. Factors affecting pre-ESRD resilience were gender, occupational status, diabetes and health-promoting behaviors. Factors affecting resilience of the high-risk group included level of education and health-promoting behaviors while factors affecting resilience in the early CKD group involved whether they are employed and health promoting behaviors. A significant positive correlation was found between health promoting behavior and resilience in all study subjects. Multiple regression analysis found that factors which could effectively predict resilience in patients at high-risk for CKD were gender, whether the patient had a job, nutrition, self-actualization, and stress level, accounting for 69.7% of the variance. Therefore, nursing education should focus on health promotion advocacy throughout the life of not only patients but also their families.
Directory of Open Access Journals (Sweden)
Fumiyasu Makinoshima
2017-11-01
Full Text Available Excessive car evacuation can cause severe traffic jams that can lead to large numbers of casualties during tsunami disasters. Investigating the possible factors that lead to unnecessary car evacuation can ensure smoother tsunami evacuations and mitigate casualty damages in future tsunami events. In this study, we quantitatively investigated the possible factors that promote car evacuation, including both necessary and unnecessary usages, by statistically analysing a large amount of data on actual tsunami evacuation behaviours surveyed in Kesennuma, where devastating damage occurred during the 2011 Tohoku Tsunami. A straightforward statistical analysis revealed a high percentage of car evacuations (approx. 50%; however, this fraction includes a high number of unnecessary usage events that were distinguished based on mode choice reasons. In addition, a binary logistic regression was conducted to quantitatively evaluate the effects of several factors and to identify the dominant factor that affected evacuation mode choice. The regression results suggested that the evacuation distance was the dominant factor for choosing car evacuation relative to other factors, such as age and sex. The cross-validation test of the regression model demonstrated that the considered factors were useful for decision making and the prediction of evacuation mode choice in the target area.
Wang, Pin-Yao; Chen, Hsiu-Ping; Chen, Angela; Tsay, Feng-Woei; Kao, Sung-Shuo; Peng, Nan-Jing; Tseng, Hui-Hwa; Hsu, Ping-I
2014-01-01
Aims. To investigate the impact of blood type, functional polymorphism (T-1676C) of the COX-1 gene promoter, and clinical factors on the development of peptic ulcer during cardiovascular prophylaxis with low-dose aspirin. Methods. In a case-control study including 111 low-dose aspirin users with peptic ulcers and 109 controls (asymptomatic aspirin users), the polymorphism (T-1676C) of the COX-1 gene promoter was genotyped, and blood type, H pylori status, and clinical factors were assessed. Results. Univariate analysis showed no significant differences in genotype frequencies of the COX-1 gene at position -1676 between the peptic ulcer group and control group. Multivariate analysis revealed that blood type O, advanced age, history of peptic ulcer, and concomitant use of NSAID were the independent risk factors for the development of peptic ulcer with the odds ratios of the 2.1, 3.1, 27.6, and 2.9, respectively. Conclusion. The C-1676T polymorphism in the COX-1 gene promoter is not a risk factor for ulcer formation during treatment with low-dose aspirin. Blood type O, advanced age, history of peptic ulcer, and concomitant use of NSAID are of independent significance in predicting peptic ulcer development during treatment with low-dose aspirin. PMID:25243161
Kovacs, A; Kandala, J C; Weber, K T; Guntaka, R V
1996-01-19
Type I and III fibrillar collagens are the major structural proteins of the extracellular matrix found in various organs including the myocardium. Abnormal and progressive accumulation of fibrillar type I collagen in the interstitial spaces compromises organ function and therefore, the study of transcriptional regulation of this gene and specific targeting of its expression is of major interest. Transient transfection of adult cardiac fibroblasts indicate that the polypurine-polypyrimidine sequence of alpha 1(I) collagen promoter between nucleotides - 200 and -140 represents an overall positive regulatory element. DNase I footprinting and electrophoretic mobility shift assays suggest that multiple factors bind to different elements of this promoter region. We further demonstrate that the unique polypyrimidine sequence between -172 and -138 of the promoter represents a suitable target for a single-stranded polypurine oligonucleotide (TFO) to form a triple helix DNA structure. Modified electrophoretic mobility shift assays show that this TFO specifically inhibits the protein-DNA interaction within the target region. In vitro transcription assays and transient transfection experiments demonstrate that the transcriptional activity of the promoter is inhibited by this oligonucleotide. We propose that TFOs represent a therapeutic potential to specifically influence the expression of alpha 1(I) collagen gene in various disease states where abnormal type I collagen accumulation is known to occur.
Ethical considerations of worksite health promotion: an exploration of stakeholders' views.
van Berkel, Jantien; Meershoek, Agnes; Janssens, Rien M J P A; Boot, Cécile R L; Proper, Karin I; van der Beek, Allard J
2014-05-16
Developing, implementing and evaluating worksite health promotion requires dealing with all stakeholders involved, such as employers, employees, occupational physicians, insurance companies, providers, labour unions and research and knowledge institutes. Although worksite health promotion is becoming more common, empirical research on ethical considerations of worksite health promotion is scarce. We explored the views of stakeholders involved in worksite health promotion in focus group discussions and we described the ethical considerations that result from differences between these views. The focus group discussions were organised per stakeholder group. Data were analysed according to the constant comparison method. Our analyses show that although the definition of occupational health is the same for all stakeholders, namely 'being able to perform your job', there seem to be important differences in the views on what constitutes a risk factor to occupational health. According to the employees, risk factors to occupational health are prevailingly job-related. Labour unions agree with them, but other stakeholders, including the employer, particularly see employee-related issues such as lifestyle behaviour as risk factors to occupational health. The difference in definition of occupational health risk factors translates into the same categorisation of worksite health promotion; employee-related activities and work-related activities. The difference in conceptualisation of occupational health risk factors and worksite health promotion resonates in the way stakeholders understand 'responsibility' for lifestyle behaviour. Even though all stakeholders agree on whose responsibility lifestyle behaviour is, namely that of the employee, the meaning of 'responsibility' differs between employees, and employers. For employees, responsibility means autonomy, while for employers and other stakeholders, responsibility equals duty. This difference may in turn contribute to
Ethical considerations of worksite health promotion: an exploration of stakeholders’ views
2014-01-01
Background Developing, implementing and evaluating worksite health promotion requires dealing with all stakeholders involved, such as employers, employees, occupational physicians, insurance companies, providers, labour unions and research and knowledge institutes. Although worksite health promotion is becoming more common, empirical research on ethical considerations of worksite health promotion is scarce. Methods We explored the views of stakeholders involved in worksite health promotion in focus group discussions and we described the ethical considerations that result from differences between these views. The focus group discussions were organised per stakeholder group. Data were analysed according to the constant comparison method. Results Our analyses show that although the definition of occupational health is the same for all stakeholders, namely ‘being able to perform your job’, there seem to be important differences in the views on what constitutes a risk factor to occupational health. According to the employees, risk factors to occupational health are prevailingly job-related. Labour unions agree with them, but other stakeholders, including the employer, particularly see employee-related issues such as lifestyle behaviour as risk factors to occupational health. The difference in definition of occupational health risk factors translates into the same categorisation of worksite health promotion; employee-related activities and work-related activities. The difference in conceptualisation of occupational health risk factors and worksite health promotion resonates in the way stakeholders understand ‘responsibility’ for lifestyle behaviour. Even though all stakeholders agree on whose responsibility lifestyle behaviour is, namely that of the employee, the meaning of ‘responsibility’ differs between employees, and employers. For employees, responsibility means autonomy, while for employers and other stakeholders, responsibility equals duty. This
Lotkowska, Magda E; Tohge, Takayuki; Fernie, Alisdair R; Xue, Gang-Ping; Balazadeh, Salma; Mueller-Roeber, Bernd
2015-11-01
MYB transcription factors (TFs) are important regulators of flavonoid biosynthesis in plants. Here, we report MYB112 as a formerly unknown regulator of anthocyanin accumulation in Arabidopsis (Arabidopsis thaliana). Expression profiling after chemically induced overexpression of MYB112 identified 28 up- and 28 down-regulated genes 5 h after inducer treatment, including MYB7 and MYB32, which are both induced. In addition, upon extended induction, MYB112 also positively affects the expression of PRODUCTION OF ANTHOCYANIN PIGMENT1, a key TF of anthocyanin biosynthesis, but acts negatively toward MYB12 and MYB111, which both control flavonol biosynthesis. MYB112 binds to an 8-bp DNA fragment containing the core sequence (A/T/G)(A/C)CC(A/T)(A/G/T)(A/C)(T/C). By electrophoretic mobility shift assay and chromatin immunoprecipitation coupled to quantitative polymerase chain reaction, we show that MYB112 binds in vitro and in vivo to MYB7 and MYB32 promoters, revealing them as direct downstream target genes. We further show that MYB112 expression is up-regulated by salinity and high light stress, environmental parameters that both require the MYB112 TF for anthocyanin accumulation under these stresses. In contrast to several other MYB TFs affecting anthocyanin biosynthesis, MYB112 expression is not controlled by nitrogen limitation or an excess of carbon. Thus, MYB112 constitutes a regulator that promotes anthocyanin accumulation under abiotic stress conditions. © 2015 American Society of Plant Biologists. All Rights Reserved.
Promoting exports in the energy technology area
International Nuclear Information System (INIS)
Iten, R.; Oettli, B.; Jochem, E.; Mannsbart, W.
2001-01-01
This report for the Swiss Federal Office of Energy (SFOE) examines the position of Switzerland as a leader in the investment goods markets for energy-efficiency products and for technologies for using renewable forms of energy. The report quotes figures for exports in these areas and discusses the difficulty of extracting useful data on these products from normal statistical data. Analyses made by a group of experts from the export-oriented technology field, energy service providers and representatives of export promotion institutions are presented and figures are quoted for various product categories. Factors promoting the competitiveness of Swiss products are discussed as well as those impeding it. An analysis of export potential is presented and measures to promote export are discussed. The report also discusses the aids and promotion activities that are considered necessary by companies in the field and the macro-economic perspectives of increased export promotion
Organizational change theory: implications for health promotion practice.
Batras, Dimitri; Duff, Cameron; Smith, Ben J
2016-03-01
Sophisticated understandings of organizational dynamics and processes of organizational change are crucial for the development and success of health promotion initiatives. Theory has a valuable contribution to make in understanding organizational change, for identifying influential factors that should be the focus of change efforts and for selecting the strategies that can be applied to promote change. This article reviews select organizational change models to identify the most pertinent insights for health promotion practitioners. Theoretically derived considerations for practitioners who seek to foster organizational change include the extent to which the initiative is modifiable to fit with the internal context; the amount of time that is allocated to truly institutionalize change; the ability of the agents of change to build short-term success deliberately into their implementation plan; whether or not the shared group experience of action for change is positive or negative and the degree to which agencies that are the intended recipients of change are resourced to focus on internal factors. In reviewing theories of organizational change, the article also addresses strategies for facilitating the adoption of key theoretical insights into the design and implementation of health promotion initiatives in diverse organizational settings. If nothing else, aligning health promotion with organizational change theory promises insights into what it is that health promoters do and the time that it can take to do it effectively. © The Author 2014. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.
Directory of Open Access Journals (Sweden)
Henna Riemenschneider
2016-07-01
Full Text Available Abstract Background Physical and mental health is important for coping with the high requirements of medical studies that are associated with a higher risk for severe stress, insomnia, smoking, harmful alcohol consumption and easier access to drugs. Health behaviors of medical students influence not just their own health but also the health of their future patients. We examined whether socio-cultural factors can explain differences in students’ health status and health-promoting behaviors. Methods A multicenter cross-sectional survey in Germany (Dresden, Munich and Hungary (Budapest, Pécs enclosed international medical students in their 1st, 3rd and 5th academic years. The students were invited to voluntarily and anonymously complete a questionnaire on different aspects of health behavior during obligatory seminars and lectures in 2014. The response rate of the total sample was 56.2 % (n = 2935; the subgroup analysis enclosed data of German (n = 1289, Hungarian (n = 1057 and Norwegian (n = 148 students. Results A high number of Norwegian students (84.5 % assessed their health status as very good/excellent. In comparison, only 60.3 % of the Hungarian and 70.7 % of the German participants reported a very good/excellent health status. The distributions were comparable between the study sites. Although gender, financial situation and nationality were significant health status predictors, they could explain only 8.2 % of the total variance of health status in the multivariable model. A comparably high number of Hungarian students (95.3 % vs. 67.4 % German and 56.7 % Norwegian reported that they can currently do a lot/very much for their health. In contrast, a significant number of Norwegians (73.0 % vs. 63.7 % Hungarian and 51.5 % German reported that they currently do a lot/very much for their health (chi2-test, p ≤ 0.001. Financial situation, study site and study year were the strongest predictors for health
Takagi, Satoshi; Takemoto, Ai; Takami, Miho; Oh-Hara, Tomoko; Fujita, Naoya
2014-08-01
The interactions of tumor cells with platelets contribute to the progression of tumor malignancy, and the expression levels of platelet aggregation-inducing factors positively correlate with the metastatic potential of osteosarcoma cells. However, it is unclear how tumor-platelet interaction contributes to the proliferation of osteosarcomas. We report here that osteosarcoma-platelet interactions induce the release of platelet-derived growth factor (PDGF) from platelets, which promotes the proliferation of osteosarcomas. Co-culture of platelets with MG63 or HOS osteosarcoma cells, which could induce platelet aggregation, enhanced the proliferation of each cell line in vitro. Analysis of phospho-antibody arrays revealed that co-culture of MG63 cells with platelets induced the phosphorylation of platelet derived growth factor receptor (PDGFR) and Akt. The addition of supernatants of osteosarcoma-platelet reactants also increased the growth of MG63 and HOS cells as well as the level of phosphorylated-PDGFR and -Akt. Sunitinib or LY294002, but not erlotinib, significantly inhibited the platelet-induced proliferation of osteosarcoma cells, indicating that PDGF released from platelets plays an important role in the proliferation of osteosarcomas by activating the PDGFR and then Akt. Our results suggest that inhibitors that specifically target osteosarcoma-platelet interactions may eradicate osteosarcomas. © 2014 The Authors. Cancer Science published by Wiley Publishing Asia Pty Ltd on behalf of Japanese Cancer Association.
International Nuclear Information System (INIS)
Zhong, Hua; Wang, Ruoxiang; Kelavkar, Uddhav; Wang, Christopher Y; Simons, Jonathan
2014-01-01
Hypoxia-inducible factor 1α (HIF-1α) is the regulatory subunit of the heterodimeric HIF-1 that plays a critical role in transcriptional regulation of genes in angiogenesis and hypoxic adaptation, while fatty acid metabolism mediated by lipoxygenases has been implicated in a variety of pathogeneses, including cancers. In this study, we report that 15-lipoxygenase 1 (15-LO1), a key member of the lipoxygenase family, promotes HIF-1α ubiquitination and degradation. Altering the level of 15-LO1 yields inverse changes in HIF-1α and HIF-1 transcriptional activity, under both normoxia and hypoxia, and even in CoCl 2 -treated cells where HIF-1α has been artificially elevated. The antagonistic effect of 15-LO1 is mediated by the Pro 564 /hydroxylation/26S proteasome system, while both the enzymatic activity and the intracellular membrane-binding function of 15-LO1 appear to contribute to HIF-1α suppression. Our findings provide a novel mechanism for HIF-1α regulation, in which oxygen-dependent HIF-1 activity is modulated by an oxygen-insensitive lipid metabolic enzyme
Joireman, Jeff; Shaffer, Monte J; Balliet, Daniel; Strathman, Alan
2012-10-01
The authors extended research linking individual differences in consideration of future consequences (CFC) with health behaviors by (a) testing whether individual differences in regulatory focus would mediate that link and (b) highlighting the value of a revised, two-factor CFC-14 scale with subscales assessing concern with future consequences (CFC-Future) and concern with immediate consequences (CFC-Immediate) proper. Exploratory and confirmatory factor analyses of the revised CFC-14 scale supported the presence of two highly reliable factors (CFC-Future and CFC-Immediate; αs from .80 to .84). Moreover, structural equation modeling showed that those high in CFC-Future engage in exercise and healthy eating because they adopt a promotion orientation. Future use of the two-factor CFC-14 scale is encouraged to shed additional light on how concern with future and concern with immediate consequences (proper) differentially impact the way people resolve a host of intertemporal dilemmas (e.g., health, financial, and environmental behavior).
Tian, Chenxi; Shi, Herong; Colledge, Clark; Stern, Michael; Waterston, Robert; Liu, Jun
2011-01-01
The proper development of multicellular organisms requires precise regulation and coordination of cell fate specification, cell proliferation and differentiation. Abnormal regulation and coordination of these processes could lead to disease, including cancer. We have examined the function of the sole C. elegans SoxC protein, SEM-2, in the M lineage, which produces the postembryonic mesoderm. We found that SEM-2/SoxC is both necessary and sufficient to promote a proliferating blast cell fate, the sex myoblast fate, over a differentiated striated bodywall muscle fate. A number of factors control the specific expression of sem-2 in the sex myoblast precursors and their descendants. This includes direct control of sem-2 expression by a Hox-PBC complex. The crucial nature of the HOX/PBC factors in directly enhancing expression of this proliferative factor in the C. elegans M lineage suggests a possible more general link between Hox-PBC factors and SoxC proteins in regulating cell proliferation. PMID:21307099
Van der Does, Dieuwertje; Leon-Reyes, Antonio; Koornneef, Annemart; Van Verk, Marcel C.; Rodenburg, Nicole; Pauwels, Laurens; Goossens, Alain; Körbes, Ana P.; Memelink, Johan; Ritsema, Tita; Van Wees, Saskia C.M.; Pieterse, Corné M.J.
2013-01-01
Antagonism between the defense hormones salicylic acid (SA) and jasmonic acid (JA) plays a central role in the modulation of the plant immune signaling network, but the molecular mechanisms underlying this phenomenon are largely unknown. Here, we demonstrate that suppression of the JA pathway by SA functions downstream of the E3 ubiquitin-ligase Skip-Cullin-F-box complex SCFCOI1, which targets JASMONATE ZIM-domain transcriptional repressor proteins (JAZs) for proteasome-mediated degradation. In addition, neither the stability nor the JA-induced degradation of JAZs was affected by SA. In silico promoter analysis of the SA/JA crosstalk transcriptome revealed that the 1-kb promoter regions of JA-responsive genes that are suppressed by SA are significantly enriched in the JA-responsive GCC-box motifs. Using GCC:GUS lines carrying four copies of the GCC-box fused to the β-glucuronidase reporter gene, we showed that the GCC-box motif is sufficient for SA-mediated suppression of JA-responsive gene expression. Using plants overexpressing the GCC-box binding APETALA2/ETHYLENE RESPONSE FACTOR (AP2/ERF) transcription factors ERF1 or ORA59, we found that SA strongly reduces the accumulation of ORA59 but not that of ERF1. Collectively, these data indicate that the SA pathway inhibits JA signaling downstream of the SCFCOI1-JAZ complex by targeting GCC-box motifs in JA-responsive promoters via a negative effect on the transcriptional activator ORA59. PMID:23435661
Directory of Open Access Journals (Sweden)
Mani S
2010-06-01
Full Text Available Background and Aim: The role of caretakers at day-care centers has become more imperative in promoting oral health care in children since many new mothers opt to work outside their homes, leaving their children at day-care centers. The aim of this study is to assess the knowledge, attitude and practice of oral health promoting factors among secondary caretakers of children attending day-care centers. Settings and Design: This was a cross-sectional exploratory study conducted among secondary caretakers in Kubang Kerian, Malaysia. Materials and Methods: Thirty-four caretakers fulfilling the inclusion and exclusion criteria participated in the study. The data were collected using a self-administered questionnaire addressing various aspects of knowledge, attitude and practice of oral health in children. Analysis was done using SPSS version 12.0. Results: The knowledge of factors causing dental caries was found to be good among majority of the caretakers, but the concepts of transmissibility of caries and effect of hidden sugars were not evident. Seventy one percent did not know that frequent bottle feeding could cause tooth decay. Attitudes seemed to be governed by the cultural practices of the region rather than the knowledge obtained. The knowledge was not translated to practice adequately. Giving sweetened liquid in bottles was practiced by 53% of the caretakers. Conclusion: Implementation of nursery-based oral health promotion programs for secondary caretakers is needed to counteract early childhood caries.
Zhang, Feng-Lin; Shen, Guo-Min; Liu, Xiao-Ling; Wang, Fang; Zhao, Ying-Ze; Zhang, Jun-Wu
2012-08-01
Hypoxia-inducible factor promotes erythropoiesis through coordinated cell type-specific hypoxia responses. GATA1 is essential to normal erythropoiesis and plays a crucial role in erythroid differentiation. In this study, we show that hypoxia-induced GATA1 expression is mediated by HIF1 in erythroid cells. Under hypoxic conditions, significantly increased GATA1 mRNA and protein levels were detected in K562 cells and erythroid induction cultures of CD34(+) haematopoietic stem/progenitor cells. Enforced HIF1α expression increased GATA1 expression, while HIF1α knockdown by RNA interference decreased GATA1 expression. In silico analysis revealed one potential hypoxia response element (HRE). The results from reporter gene and mutation analysis suggested that this element is necessary for hypoxic response. Chromatin immunoprecipitation (ChIP)-PCR showed that the putative HRE was recognized and bound by HIF1 in vivo. These results demonstrate that the up-regulation of GATA1 during hypoxia is directly mediated by HIF1.The mRNA expression of some erythroid differentiation markers was increased under hypoxic conditions, but decreased with RNA interference of HIF1α or GATA1. Flow cytometry analysis also indicated that hypoxia, desferrioxamine or CoCl(2) induced expression of erythroid surface markers CD71 and CD235a, while expression repression of HIF1α or GATA1 by RNA interference led to a decreased expression of CD235a. These results suggested that HIF1-mediated GATA1 up-regulation promotes erythropoiesis in order to satisfy the needs of an organism under hypoxic conditions. © 2011 The Authors Journal of Cellular and Molecular Medicine © 2011 Foundation for Cellular and Molecular Medicine/Blackwell Publishing Ltd.
The role of tobacco promoting and restraining factors in smoking intentions among Ghanaian youth.
Doku, David; Raisamo, Susanna; Wiium, Nora
2012-08-15
In Western countries, the relationship between smoking intentions and smoking behaviour is well established. However, youth smoking intentions and associated factors in developing countries are largely unexplored and the former may occur for a variety of reasons. We investigated youth smoking intentions in Ghana with regard to several tobacco promoting and restraining factors, including environmental, familial, attitudinal and knowledge measures. A school-based survey of a representative sample of 12-20-year-olds was conducted in 2008 in Ghana (N = 1338, response rate 89.7%). In a bivariate model, both among ever and never smokers, allowing smoking on school compound, exposure to tobacco advertisement and parental smoking were associated with future intention to smoke. Compared to those who agreed that smoking is harmful to health, smoking is difficult to quit and that tobacco should not be sold to minors, those who disagreed or were not sure were more likely to have an intention to smoke. In the multivariate analyses, these associations persisted, except that the attitude measures concerning the difficulty of quitting smoking once started and tobacco sales ban were no longer significantly associated with smoking intentions. These findings underscore the importance of school smoking policy, parental smoking behaviour and knowledge of the harmful effects of tobacco use in determining Ghanaian youths' future smoking intentions. Because current high percentages of smoking intentions may turn into high smoking rates in the future, the introduction of effective tobacco control measures at all levels of society to prevent youth smoking in Ghana may be essential.
Professional competence in a health promotion program in the Netherlands
Rijkers-de Boer, Caroline J. M.; Heijsman, Anke; van Nes, Fenna; Abma, Tineke A.
Health promotion for senior citizens ('seniors') is an increasingly important factor in health and welfare policy, having important implications for occupational therapy. The health promotion program 'Healthy and Active Aging' originated in the US, has been modified and adapted to the Dutch context
The role of midwife in health promotion and diseases diseases prevention
Directory of Open Access Journals (Sweden)
Kinga Kawałek
2017-08-01
Conclusion: Collected data shows that leading prophylactic programs and health promotion applies in midwives’ every day work. Too little time to implement health promotion and education is a factor hindering the work of midwives.
ATF3, an HTLV-1 bZip factor binding protein, promotes proliferation of adult T-cell leukemia cells
Directory of Open Access Journals (Sweden)
Ohshima Koichi
2011-03-01
Full Text Available Abstract Background Adult T-cell leukemia (ATL is an aggressive malignancy of CD4+ T-cells caused by human T-cell leukemia virus type 1 (HTLV-1. The HTLV-1 bZIP factor (HBZ gene, which is encoded by the minus strand of the viral genome, is expressed as an antisense transcript in all ATL cases. By using yeast two-hybrid screening, we identified activating transcription factor 3 (ATF3 as an HBZ-interacting protein. ATF3 has been reported to be expressed in ATL cells, but its biological significance is not known. Results Immunoprecipitation analysis confirmed that ATF3 interacts with HBZ. Expression of ATF3 was upregulated in ATL cell lines and fresh ATL cases. Reporter assay revealed that ATF3 could interfere with the HTLV-1 Tax's transactivation of the 5' proviral long terminal repeat (LTR, doing so by affecting the ATF/CRE site, as well as HBZ. Suppressing ATF3 expression inhibited proliferation and strongly reduced the viability of ATL cells. As mechanisms of growth-promoting activity of ATF3, comparative expression profiling of ATF3 knockdown cells identified candidate genes that are critical for the cell cycle and cell death, including cell division cycle 2 (CDC2 and cyclin E2. ATF3 also enhanced p53 transcriptional activity, but this activity was suppressed by HBZ. Conclusions Thus, ATF3 expression has positive and negative effects on the proliferation and survival of ATL cells. HBZ impedes its negative effects, leaving ATF3 to promote proliferation of ATL cells via mechanisms including upregulation of CDC2 and cyclin E2. Both HBZ and ATF3 suppress Tax expression, which enables infected cells to escape the host immune system.
Khan, Ahamed; Shrestha, Ankita; Bhuyan, Kashyap; Maiti, Indu B; Dey, Nrisingha
2018-01-01
The promoter fragment described in this study can be employed for strong transgene expression under both biotic and abiotic stress conditions. Plant-infecting Caulimoviruses have evolved multiple regulatory mechanisms to address various environmental stimuli during the course of evolution. One such mechanism involves the retention of discrete stress responsive cis-elements which are required for their survival and host-specificity. Here we describe the characterization of a novel Caulimoviral promoter isolated from Horseradish Latent Virus (HRLV) and its regulation by multiple stress responsive Transcription factors (TFs) namely DREB1, AREB1 and TGA1a. The activity of full length transcript (Flt-) promoter from HRLV (- 677 to + 283) was investigated in both transient and transgenic assays where we identified H12 (- 427 to + 73) as the highest expressing fragment having ~ 2.5-fold stronger activity than the CaMV35S promoter. The H12 promoter was highly active and near-constitutive in the vegetative and reproductive parts of both Tobacco and Arabidopsis transgenic plants. Interestingly, H12 contains a distinct cluster of cis-elements like dehydration-responsive element (DRE-core; GCCGAC), an ABA-responsive element (ABRE; ACGTGTC) and as-1 element (TGACG) which are known to be induced by cold, drought and pathogen/SA respectively. The specific binding of DREB1, AREB1 and TGA1a to DRE, ABRE and as-1 elements respectively were confirmed by the gel-binding assays using H12 promoter-specific probes. Detailed mutational analysis of the H12 promoter suggested that the presence of DRE-core and as-1 element was indispensable for its activity which was further confirmed by the transactivation assays. Our studies imply that H12 could be a valuable genetic tool for regulated transgene expression under diverse environmental conditions.
International Nuclear Information System (INIS)
Kita, Atsushi; Yamasaki, Hironori; Kuwahara, Hironaga; Moriuchi, Akie; Fukushima, Keiko; Kobayashi, Masakazu; Fukushima, Tetsuya; Takahashi, Ryoko; Abiru, Norio; Uotani, Shigeo; Kawasaki, Eiji; Eguchi, Katsumi
2005-01-01
Adiponectin, an adipose tissue-specific plasma protein, is involved in insulin sensitizing and has anti-atherosclerotic properties. Plasma levels of adiponectin are decreased in obese individuals and patients with type 2 diabetes with insulin resistance. Tumor necrosis factor-α (TNF-α) decreases the expression of adiponectin in adipocytes. The aims of the present study were: (1) to identify the promoter region responsible for basal transcription of the human adiponectin gene, and (2) to investigate the mechanism by which adiponectin was regulated by TNF-α. The human adiponectin promoter (2.1 kb) was isolated and used for luciferase reporter analysis by transient transfection into 3T3-L1 adipocytes. Deletion analysis demonstrated that the promoter region from -676 to +41 was sufficient for basal transcriptional activity. Mutation analysis of putative response elements for sterol regulatory element binding protein (SREBP) (-431 to -423) and CCAAT/enhancer binding protein (C/EBP) (-230 to -224) showed that both elements were required for basal promoter activity. Adiponectin transcription was increased 3-fold in cells that over-expressed constitutively active C/EBP-β. Electrophoretic mobility shift assay, using nuclear extract from 3T3-L1 cells and the -258 to -199 region as a probe, demonstrated specific DNA-protein binding, which was abolished by TNF-α treatment. The present data indicate that the putative response elements for SREBP and C/EBP are required for human adiponectin promoter activity, and that suppression by TNF-α may, at least in part, be associated with inactivation of C/EBP-β
Sales promotion as a determining factor in the competitive position of the company
Directory of Open Access Journals (Sweden)
Alavuk Đorđe
2015-01-01
Full Text Available Increased competition, globalization, numerous changes in the field of engineering and technology are just some of the changes that accompany modern business conditions. Modern consumers are increasingly demanding. Individuals vary greatly within groups and cultures to which they belong, but also among themselves based on the characteristics that distinguish them. People engaged in marketing have to constantly monitor and measure consumer attitudes so that their needs and desires are fully met. This paper summarizes the sales promotion activities carried out by retail chains. The aim of the activities of sales promotion is to create and maintain long-term relationships with customers and competitive advantage on the market. The research topic is the impact of sales promotion activities on the behavior and attitudes of consumers when choosing a product. The aim of the research is to examine the effects achieved by sales improvement to consumers through the implementation of the competitive positions of the companies. For the purpose of the research the method used was survey research.
Directory of Open Access Journals (Sweden)
Rachel M. Woodfint
2017-01-01
Full Text Available Identification of tissue- and stage-specific gene promoters is valuable for delineating the functional roles of specific genes in genetically engineered animals. Here, through the comparison of gene expression in different tissues by analysis of a microarray database, the intestinal specificity of mucin 2 (MUC2 expression was identified in mice and humans, and further confirmed in chickens by RT-PCR (reverse transcription-PCR analysis. An analysis of cis-acting elements in avian MUC2 gene promoters revealed conservation of binding sites, within a 2.9 kb proximal promoter region, for transcription factors such as caudal type homeobox 2 (CDX2, GATA binding protein 4 (GATA4, hepatocyte nuclear factor 4 α (HNF4A, and transcription factor 4 (TCF4 that are important for maintaining intestinal homeostasis and functional integrity. By generating transgenic quail, we demonstrated that the 2.9 kb chicken MUC2 promoter could drive green fluorescent protein (GFP reporter expression exclusively in the small intestine, large intestine, and ceca. Fluorescence image analysis further revealed GFP expression in intestine epithelial cells. The GFP expression was barely detectable in the embryonic intestine, but increased during post-hatch development. The spatiotemporal expression pattern of the reporter gene confirmed that the 2.9 kb MUC2 promoter could retain the regulatory element to drive expression of target genes in intestinal tissues after hatching. This new transgene expression system, using the MUC2 promoter, will provide a new method of overexpressing target genes to study gene function in the avian intestine.
Ferreira, Joshua P.; Peacock, Ryan W. S.; Lawhorn, Ingrid E. B.; Wang, Clifford L.
2011-01-01
The human cytomegalovirus and elongation factor 1α promoters are constitutive promoters commonly employed by mammalian expression vectors. These promoters generally produce high levels of expression in many types of cells and tissues. To generate a library of synthetic promoters capable of generating a range of low, intermediate, and high expression levels, the TATA and CAAT box elements of these promoters were mutated. Other promoter variants were also generated by random mutagenesis. Evalua...
Development of a conceptual model of the role of hospital nurses in health promotion in Jordan.
Shoqirat, N
2015-05-19
International evidence reveals that hospital nurses have not been able to incorporate health promotion effectively into the framework of their care. This can be attributed to unclear conceptualizing of the barriers and facilitators to the role of nurses in health promotion. An integrative review was carried out to develop a conceptual model to assist hospital nurses in Jordan to understand how health promotion activities can be developed. Factors affecting the involvement of nurses in health promotion - ranging from limited knowledge about health promotion to the social image of nursing - can be structured into three levels: the micro (individual), meso (organizational) and macro (population). By understanding the interplay of factors between and within the levels, nurses and other health professionals can draw on the individual, social and organizational factors that influence nurses' role in health promotion. The proposed model can be considered as a springboard for developing health promotion activities related to hospitals in other Muslim-majority contexts.
Community factors to promote parents' quality of child-nurturing life.
Aoyama, Megumi; Wei, Chang Nian; Chang-nian, Wei; Harada, Koichi; Ueda, Kimiyo; Takano, Miyuki; Ueda, Atsushi
2013-01-01
The purpose of this study was to clarify the role of community factors in parents' quality of child-nurturing life (QCNL). We developed a questionnaire to evaluate the degree of QCNL and determine the structural factors related to QCNL as community factors related to parents' QCNL derived from focus group interviews and the Delphi technique. The questionnaire also included the battery of the self-rating depression scale and Tsumori-Inage Infant's Developmental Test. Using the questionnaire, we then conducted a quantitative survey of parents whose children attended nursery schools in Kumamoto Prefecture. Factor analysis, calculation of the mean score and/or ratio to each item, Pearson's correlation coefficient, t test, multiple regression analysis, and covariance structure analysis were performed. The questionnaire we developed consisted of seven items with 75 elements, involving ten elements as community factors. Subjects included 699 parents (mean age 33.6 ± 5.4 years) and 965 children (age range 0-6 years). Factor analysis revealed that community factors consisted of five factors, such as "lifestyle rooted in the ground," "balance of housekeeping and work," "community network," "amenity," and "regeneration of life". These factors may be dominant in a rural area. Finally, we developed a structural model with "community factors," QCNL, QOL, and "child growth" by covariance structural analysis. The analysis revealed that community factors had a positive relation to parents' QCNL (r = 0.81, p < 0.001) and that parental SDS score had a negative relation to parents' QCNL (r = -0.59, p < 0.001). The analysis did show that community factors were positively related to the sound growth of children. The covariance structure analysis revealed that community factors were associated with parents' QCNL, SDS, and "child growth."
Lee, Chih-Yung Sean; Lu, Tu; Seydoux, Geraldine
2017-11-07
Nanos RNA-binding proteins are required for germline development in metazoans, but the underlying mechanisms remain poorly understood. We have profiled the transcriptome of primordial germ cells (PGCs) lacking the nanos homologs nos-1 and nos-2 in C. elegans. nos-1nos-2 PGCs fail to silence hundreds of transcripts normally expressed in oocytes. We find that this misregulation is due to both delayed turnover of maternal transcripts and inappropriate transcriptional activation. The latter appears to be an indirect consequence of delayed turnover of the maternally-inherited transcription factor LIN-15B, a synMuvB class transcription factor known to antagonize PRC2 activity. PRC2 is required for chromatin reprogramming in the germline, and the transcriptome of PGCs lacking PRC2 resembles that of nos-1nos-2 PGCs. Loss of maternal LIN-15B restores fertility to nos-1nos-2 mutants. These findings suggest that Nanos promotes germ cell fate by downregulating maternal RNAs and proteins that would otherwise interfere with PRC2-dependent reprogramming of PGC chromatin.
Darlington, Emily Joan; Violon, Nolwenn; Jourdan, Didier
2018-01-22
Implementing complex and multi-level public health programmes is challenging in school settings. Discrepancies between expected and actual programme outcomes are often reported. Such discrepancies are due to complex interactions between contextual factors. Contextual factors relate to the setting, the community, in which implementation occurs, the stakeholders involved, and the characteristics of the programme itself. This work uses realist evaluation to understand how contextual factors influence the implementation process, to result in variable programme outcomes. This study focuses on identifying contextual factors, pinpointing combinations of contextual factors, and understanding interactions and effects of such factors and combinations on programme outcomes on different levels of the implementation process. Schools which had participated in a school-based health promotion programme between 2012 and 2015 were included. Two sets of qualitative data were collected: semi-structured interviews with school staff and programme coordinators; and written documents about the actions implemented in a selection of four schools. Quantitative data included 1553 questionnaires targeting pupils aged 8 to 11 in 14 schools to describe the different school contexts. The comparison between what was expected from the programme (programme theory) and the outcomes identified in the field data, showed that some of the mechanisms expected to support the implementation of the programme, did not operate as anticipated (e.g. inclusion of training, initiation by decision-maker). Key factors which influenced the implementation process included, amongst other factors, the mode of introduction of the programme, home/school relationship, leadership of the management team, and the level of delegated power. Five types of interactions between contextual factors were put forward: enabling, hindering, neutral, counterbalancing and moderating effects. Recurrent combinations of factors were
Characterization of prokaryotic and eukaryotic promoters using hidden Markov models
DEFF Research Database (Denmark)
Pedersen, Anders Gorm; Baldi, P.; Chauvin, Y.
1996-01-01
In this paper we utilize hidden Markov models (HMMs) and information theory to analyze prokaryotic and eukaryotic promoters. We perform this analysis with special emphasis on the fact that promoters are divided into a number of different classes, depending on which polymerase-associated factors...... that bind to them. We find that HMMs trained on such subclasses of Escherichia coli promoters (specifically, the so-called sigma 70 and sigma 54 classes) give an excellent classification of unknown promoters with respect to sigma-class. HMMs trained on eukaryotic sequences from human genes also model nicely...
The relationship between attitudes toward aging and health-promoting behaviours in older adults.
Korkmaz Aslan, Gülbahar; Kartal, Asiye; Özen Çınar, İlgün; Koştu, Nazan
2017-12-01
Identifying the factors that are associated with health-promoting behaviours in older adults is necessary to increase their willingness and motivation to participate in health-promotion activities. Understanding context-specific attitudes in relation to their influence on health-promoting behaviours is crucial in designing efficient interventions that foster health-promoting behaviours among older adults. This study aimed to examine the relationships between attitudes towards aging and health-promoting behaviours in older adults in Turkey. The study used a descriptive-correlational design. A convenience sample of 448 community-dwelling older adults who were 65 years and older and cognitively intact were selected from 6 family health centres in the city of Denizli in Turkey. The data were collected between March and June of 2014 using the Attitudes to Aging Questionnaire and the Health-Promoting Lifestyle Profile II. Multiple linear regression analysis was performed to explore the predictors of health-promoting behaviours. Attitudes toward aging, the psychosocial loss subscale, and education were statistically significant predictors of health-promoting behaviours. Attitudes toward aging were the strongest predictor of health-promoting behaviours in older adults. Attitude towards aging is a factor that affects health-promoting behaviours, and it should be considered during interventions for improving health promoting behaviours. © 2017 John Wiley & Sons Australia, Ltd.
International Nuclear Information System (INIS)
Strukov, E.L.; Dryguina, L.B.; Nikiforova, I.D.
1997-01-01
The clinical and laboratory endocrinological screening performed in 1,000 males - liquidators of Chernobyl accident consequences revealed hormonal factors leading to node formation and having unfavourable influence on progression and promotion of thyroid gland cancer. The factors include syndrome of low thriiodothyronine, hyperprolactinemia, latent hypothyrosis and increased production of thyroglobulin. Peculiarities of hormonal status in liquidators allow us to suggest the presence of MEN-like syndrome among the liquidators population. Possible mechanisms of expression of RET oncogene in adults that may result in MEN- like syndrome have been discussed. (author)
International Nuclear Information System (INIS)
Solomon, Kimberly D.; Ong, Joo L.
2013-01-01
Currently, tissue engineered constructs for critical sized bone defects are non-vascularized. There are many strategies used in order to promote vascularization, including delivery of growth factors such as vascular endothelial growth factor (VEGF). In this study, hydroxyapatite (HA) was coated with self-assembled monolayers (SAMs). The SAMs were in turn used to covalently bind VEGF to the surface of HA. The different SAM chain length ratios (phosphonoundecanoic acid (11-PUDA):16-phosphonohexadecanoic acid (16-PHDA) utilized in this study were 0:100, 25:75, 50:50, 75:25, and 100:0. Surfaces were characterized by contact angle (CA) and atomic force microscopy, and an in vitro VEGF release study was performed. It was observed that CA and root-mean-squared roughness were not significantly affected by the addition of SAMs, but that CA was significantly lowered with the addition of VEGF. VEGF release profiles of bound VEGF groups all demonstrated less initial burst release than adsorbed control, indicating that VEGF was retained on the HA surface when bound by SAMs. An in vitro study using human aortic endothelial cells (HAECs) demonstrated that bound VEGF increased metabolic activity and caused sustained production of angiopoietin-2, an angiogenic marker, over 28 days. In conclusion, SAMs provide a feasible option for growth factor delivery from HA surfaces, enhancing angiogenic activity of HAECs in vitro. - Highlights: • Vascular endothelial growth factor (VEGF) is attached to hydroxyapatite (HA). • Self-assembled monolayers (SAMs) delay the release of VEGF from hydroxyapatite. • SAM chain length ratio affects the total mass of VEGF released. • VEGF on HA up-regulates proliferation and angiogenic activity of endothelial cells
George, Asha S; Branchini, Casey
2017-08-31
Promoting awareness of rights is a value-based process that entails a different way of thinking and acting, which is at times misunderstood or deemed as aspirational. Guided by the SURE framework, we undertook a secondary analysis of 26 documents identified by an earlier systematic review on promoting awareness of rights to increase use of maternity care services. We thematically analysed stakeholder experiences and implementation factors across the diverse initiatives to derive common elements to guide future efforts. Interventions that promote awareness of rights for maternal health varied in nature, methodological orientation, depth and quality. Materials included booklets, posters, pamphlets/ briefs and service standards/charters. Target populations included women, family members, communities, community structures, community-based and non governmental organizations, health providers and administrators, as well as elected representatives. While one initiative only focused on raising awareness, most were embedded within larger efforts to improve the accountability and responsiveness of service delivery through community monitoring and advocacy, with a few aiming to change policies and contest elections. Underlying these action oriented forms of promoting awareness of rights, was a critical consciousness and attitudinal change gained through iterative capacity-building for all stakeholders; materials and processes that supported group discussion and interaction; the formation or strengthening of community groups; situational analysis to ensure adaptation to local context; facilitation to ensure common ground and language across stakeholders; and strategic networking and alliance building across health system levels. While many positive experiences are discussed, few challenges or barriers to implementation are documented. The limited documentation and poor quality of information found indicate that while various examples of promoting awareness of rights for
Do indoor chemicals promote development of airway allergy?
DEFF Research Database (Denmark)
Nielsen, G D; Larsen, S T; Olsen, O
2007-01-01
in animal studies and allergy-promoting effects in humans. Quaternary ammonium compounds may possess adjuvant effects in animal studies and promoted sensitization in humans in occupational settings. The use of cleaning agents, anionic and non-ionic surfactants are not considered to possess an important...... products, the important question may be would it be profitable to look for lifestyle factors and non-chemical indoor exposures in order to abate airway allergy? PRACTICAL IMPLICATIONS: Indoor chemicals (pollutants) have been accused to promote development of airway allergy by adjuvant effects......Allergic asthma has increased worldwide in the industrialized countries. This review evaluates whether the major groups of indoor chemical exposures possess allergy-promoting (adjuvant) effects; formaldehyde was excluded, because of the size of the literature. Volatile organic compounds (VOCs...
Dai, Bingbing; Gong, Aihua; Jing, Zhitao; Aldape, Kenneth D.; Kang, Shin-Hyuk; Sawaya, Raymond; Huang, Suyun
2013-01-01
The forkhead box M1 (FoxM1) is a key transcription factor regulating multiple aspects of cell biology. Prior studies have shown that FoxM1 is overexpressed in a variety of human tumors, including brain tumor, and plays a critical role in cancer development and progression. In this study we found that FoxM1 was up-regulated by heat shock factor 1 (HSF1) under heat shock stress condition in multiple cell lines. Knockdown of HSF1 with HSF1 siRNA or inhibition of HSF1 with a HSF1 inhibitor abrogated heat shock-induced expression of FoxM1. Genetic deletion of HSF1 in mouse embryo fibroblast cells also abolished heat shock stress-induced FoxM1 expression. Moreover, we showed that HSF1 directly bound to FoxM1 promoter and increased FoxM1 promoter activity. Furthermore, we demonstrated that FoxM1 was required for the G2-M phase progression through regulating Cdc2, Cdc20, and Cdc25B under a mild heat shock stress but enhanced cell survival under lethal heat shock stress condition. Finally, in human glioblastoma specimens, FoxM1 overexpression correlated with elevated HSF1 expression. Our results indicate that FoxM1 is regulated by HSF1 and is critical for HSF1-mediated heat shock response. We demonstrated a novel mechanism of stress resistance controlled by HSF1 and a new HSF-FoxM1 connection that mediates cellular thermotolerance. PMID:23192351
NADPH promotes the rapid growth of the tumor
Directory of Open Access Journals (Sweden)
Hao Sheng
2018-04-01
Full Text Available NADPH oxidase is the main source of intracellular reactive oxygen species (ROS. ROS plays an important role in a variety of tumor types. The ROS mediated by NADPH oxidase increases the expression of hypoxia-inducible factor alpha (HIF-α through multiple signaling pathways in tumor, and HIF-α could be regulated and controlled by downstream multiple targeted genes such as vascular endothelial growth factor, glucose transporter to promote tumor angiogenesis, cell energy metabolism reprogram and tumor metastasis. Meanwhile, HIF-α can also regulate the expression of NADPH oxidase by ROS, thus further promoting development of tumor. In this review, we summarized the functions of NADPH in tumorigenesis and discussed their potential implications in cancer therapy.
Medicines Information and the Regulation of the Promotion of Pharmaceuticals.
Leonardo Alves, Teresa; Lexchin, Joel; Mintzes, Barbara
2018-05-02
Many factors contribute to the inappropriate use of medicines, including not only a lack of information but also inaccurate and misleading promotional information. This review examines how the promotion of pharmaceuticals directly affects the prescribing and use of medicines. We define promotion broadly as all actions taken directly by pharmaceutical companies with the aim of enhancing product sales. We look in greater detail at promotion techniques aimed at prescribers, such as sales representatives, pharmaceutical advertisements in medical journals and use of key opinion leaders, along with the quality of information provided and the effects thereof. We also discuss promotion to the public, through direct-to-consumer advertising, and its effects. Finally, we consider initiatives to regulate promotion that come from industry, government and nongovernmental organizations.
[From resistance [corrected] to resilience: promoting wellbeing in the workplace].
Magrin, M E
2008-01-01
Research on work stress has focused to date for the most part on the environmental and psychosocial factors inducing stress and great strides have been made in assisting both individuals and organizations in managing distress. This, however, is only half of the battle. As a complement to healing the wounded, there is need to explore models of intervention aimed at the promotion of well-being at work through the development and reinforcement of health-promoting factors. An important contribution toward this goal comes today from Positive Psychology, a new current of research focused on investigating the qualities and predictors that enable individuals to flourish. Within this perspective, health is seen not as the absence of disease and of risk factors but rather as the presence of those resources that underpin wellbeing. Among the new theoretical constructs emerging from Positive Psychology, of particular relevance to the domain of occupational health psychology is the notion of adult resilience. A definition of this notion is proposed and a review given of the main resources of resilience identified in the literature. Particular attention is given to the dimension of meaning, which seems to act as an important health-protector in the work setting. Resilience factors may also play a role in the implementing of interventions oriented both to distress prevention and wellbeing promotion. Establishing and maintaining an effective dialogue between researchers and practitioners in the field of work health promotion is strongly recommended.
Associations of advertisement-promotion-sponsorship-related ...
African Journals Online (AJOL)
Associations of advertisement-promotion-sponsorship-related factors with current cigarette smoking among in-school adolescents in Zambia. ... R Zulu, S Siziya, AS Muula, E Rudatsikira. Abstract. Background : Tobacco use is the leading cause of noncommunicable disease morbidity and mortality. Most smokers initiate the ...
Nectarine promotes longevity in Drosophila melanogaster
Aging is associated with increased oxidative damage and gradual decline of physiology function with age, and is modulated by numerous genetic and environmental factors. Functional fruits are thought to be ideal candidates for promoting longevity and healthspan due to their high contents of polypheno...
The biology of eukaryotic promoter prediction - a review
DEFF Research Database (Denmark)
Pedersen, Anders Gorm; Baldi, Pierre; Chauvin, Yves
1999-01-01
between functional promoters has been estimated to be in the range of 30-40 kilobases. Although it is conceivable that some of these predicted promoters correspond to cryptic initiation sites that are used in vivo, it is likely that most are false positives. This suggests that it is important to carefully......Computational prediction of eukaryotic promoters from the nucleotide sequence is one of the most attractive problems in sequence analysis today, but it is also a very difficult one. Thus, current methods predict in the order of one promoter per kilobase in human DNA, while the average distance...... reconsider the biological data that forms the basis of current algorithms, and we here present a review of data that may be useful in this regard. The review covers the following topics: (1) basal transcription and core promoters, (2) activated transcription and transcription factor binding sites, (3) Cp...
DEFF Research Database (Denmark)
Aas, Per Arne; Pena Diaz, Javier; Liabakk, Nina Beate
2009-01-01
within the region of DNA marked by PA. Footprinting analysis and electrophoretic mobility shift assays of PA and putative AP-2 binding regions with HeLa cell nuclear extract and recombinant AP-2alpha protein indicate that AP-2 transcription factors are central in the regulated expression of UNG2 m......The PA promoter in the human uracil-DNA glycosylase gene (UNG) directs expression of the nuclear form (UNG2) of UNG proteins. Using a combination of promoter deletion and mutation analyses, and transient transfection of HeLa cells, we show that repressor and derepressor activities are contained......alpha, lacking the activation domain but retaining the DNA binding and dimerization domains, stimulated PA to a level approaching that of full-length AP-2, suggesting that AP-2 overexpression stimulates PA activity by a mechanism involving derepression rather than activation, possibly by neutralizing...
Smith, Alias J; Chudnovsky, Lorissa; Simoes-Barbosa, Augusto; Delgadillo-Correa, Maria G; Jonsson, Zophonias O; Wohlschlegel, James A; Johnson, Patricia J
2011-04-01
A highly conserved DNA initiator (Inr) element has been the only core promoter element described in the divergent unicellular eukaryote Trichomonas vaginalis, although genome analyses reveal that only ∼75% of protein-coding genes appear to contain an Inr. In search of another core promoter element(s), a nonredundant database containing 5' untranslated regions of expressed T. vaginalis genes was searched for overrepresented DNA motifs and known eukaryotic core promoter elements. In addition to identifying the Inr, two elements that lack sequence similarity to the known protein-coding gene core promoter, motif 3 (M3) and motif 5 (M5), were identified. Mutational and functional analyses demonstrate that both are novel core promoter elements. M3 [(A/G/T)(A/G)C(G/C)G(T/C)T(T/A/G)] resembles a Myb recognition element (MRE) and is bound specifically by a unique protein with a Myb-like DNA binding domain. The M5 element (CCTTT) overlaps the transcription start site and replaces the Inr as an alternative, gene-specific initiator element. Transcription specifically initiates at the second cytosine within M5, in contrast to characteristic initiation by RNA polymerase II at an adenosine. In promoters that combine M3 with either M5 or Inr, transcription initiation is regulated by the M3 motif.
Smith, Alias J.; Chudnovsky, Lorissa; Simoes-Barbosa, Augusto; Delgadillo-Correa, Maria G.; Jonsson, Zophonias O.; Wohlschlegel, James A.; Johnson, Patricia J.
2011-01-01
A highly conserved DNA initiator (Inr) element has been the only core promoter element described in the divergent unicellular eukaryote Trichomonas vaginalis, although genome analyses reveal that only ∼75% of protein-coding genes appear to contain an Inr. In search of another core promoter element(s), a nonredundant database containing 5′ untranslated regions of expressed T. vaginalis genes was searched for overrepresented DNA motifs and known eukaryotic core promoter elements. In addition to identifying the Inr, two elements that lack sequence similarity to the known protein-coding gene core promoter, motif 3 (M3) and motif 5 (M5), were identified. Mutational and functional analyses demonstrate that both are novel core promoter elements. M3 [(A/G/T)(A/G)C(G/C)G(T/C)T(T/A/G)] resembles a Myb recognition element (MRE) and is bound specifically by a unique protein with a Myb-like DNA binding domain. The M5 element (CCTTT) overlaps the transcription start site and replaces the Inr as an alternative, gene-specific initiator element. Transcription specifically initiates at the second cytosine within M5, in contrast to characteristic initiation by RNA polymerase II at an adenosine. In promoters that combine M3 with either M5 or Inr, transcription initiation is regulated by the M3 motif. PMID:21245378
Directory of Open Access Journals (Sweden)
Adrien Georges
Full Text Available BACKGROUND: FOXL2 is a transcription factor essential for ovarian development and maintenance. It is mutated in the genetic condition called Blepharophimosis Ptosis Epicantus inversus Syndrome (BPES and in cases of isolated premature ovarian failure. We and others have previously shown that FOXL2 undergoes several post-translational modifications. METHODS AND PRINCIPAL FINDINGS: Here, using cells in culture, we show that interference with FOXL2 SUMOylation leads to a robust inhibition of its transactivation ability, which correlates with a decreased stability. Interestingly, FOXL2 SUMOylation promotes its transient recruitment to subnuclear structures that we demonstrate to be PML (Promyelocytic Leukemia Nuclear Bodies. Since PML bodies are known to be sites where post-translational modifications of nuclear factors take place, we used tandem mass spectrometry to identify new post-translational modifications of FOXL2. Specifically, we detected four phosphorylated, one sulfated and three acetylated sites. CONCLUSIONS: By analogy with other transcription factors, we propose that PML Nuclear Bodies might transiently recruit FOXL2 to the vicinity of locally concentrated enzymes that could be involved in the post-translational maturation of FOXL2. FOXL2 acetylation, sulfation, phosphorylation as well as other modifications yet to be discovered might alter the transactivation capacity of FOXL2 and/or its stability, thus modulating its global intracellular activity.
Impact factor and its role in academic promotion
Directory of Open Access Journals (Sweden)
Richard Russell
2009-07-01
Full Text Available Richard Russell,1 Dave Singh21Wrexham Park Hospital, Berkshire, UK; 2Northwest Lung Research Centre, South Manchester University Hospitals Trust, Manchester, UKThis statement was adopted unanimously at the May 17, 2009 meeting of the International Respiratory Journal Editors Roundtable.In our collective experience as editors of international peer-reviewed journals, we propose that the impact factor calculated for individual journals should not be used as a basis for evaluating the significance of an individual scientist’s past performance or scientific potential. There are several reasons not to equate the impact factor of a journal in which the scientist publishes with the quality of the scientist’s research.
International Nuclear Information System (INIS)
Dispenza, Clelia; Todaro, Simona; Bulone, Donatella; Sabatino, Maria Antonietta; Ghersi, Giulio; San Biagio, Pier Luigi; Lo Presti, Caterina
2017-01-01
The development of growth factors is very promising in the field of tissue regeneration but specifically designed formulations have to be developed in order to enable such new biological entities (NBEs). In particular, the range of therapeutic concentrations is usually very low compared to other active proteins and the confinement in the target site can be of crucial importance. In-situ forming scaffolds are very promising solutions for minimally invasive intervention in cartilage reconstruction and targeting of NBEs. In this work injectable, in-situ forming gels of a temperature responsive partially degalactosylated xyloglucan (Deg-XG) incorporating the growth factor FGF-18 are formulated and characterized. In particular, injectability and shear viscosity at room temperature, time-to-gel at body temperature, morphology and mechanical properties of gels are investigated. The highly hydrophobic growth factor is favorably incorporated and retained by the gel. Gels undergo a slow erosion process when immersed in PBS at 37 °C that opens up their porous structure. The prolonged hydrothermal treatment leads to structural rearrangements towards tougher networks with increased dynamic shear modulus. Preliminary biological evaluations confirm absence of cytotoxicity and the ability of these scaffolds to host cells and promote their proliferation. - Highlights: • In-situ forming gels incorporating a growth factor are formulated and characterized. • The gel retains the growth factor and is colonized by chondrocytes. • Mechanical properties and porosity of gels are controlled by polymer concentration. • Incubation at 37 °C increases the gel strength and opens up the porous structure.
bTSSfinder: a novel tool for the prediction of promoters in Cyanobacteria andEscherichia coli
Shahmuradov, Ilham Ayub
2016-09-29
Motivation: The computational search for promoters in prokaryotes remains an attractive problem in bioinformatics. Despite the attention it has received for many years, the problem has not been addressed satisfactorily. In any bacterial genome, the transcription start site is chosen mostly by the sigma (σ) factor proteins, which control the gene activation. The majority of published bacterial promoter prediction tools target σ70 promoters in Escherichia coli. Moreover, no σ-specific classification of promoters is available for prokaryotes other than for E. coli. Results: Here, we introduce bTSSfinder, a novel tool that predicts putative promoters for five classes of σ factors in Cyanobacteria (σA, σC, σH, σG and σF) and for five classes of sigma factors in E. coli (σ70, σ38, σ32, σ28 and σ24). Comparing to currently available tools, bTSSfinder achieves higher accuracy (MCC=0.86, F1-score=0.93) compared to the next best tool with MCC=0.59, F1-score=0.79) and covers multiple classes of promoters.
Determinants of Health Promotion Behavior in Active Duty Air Force Personnel
National Research Council Canada - National Science Library
Grabowski, Bridgette
1997-01-01
.... The purpose of this research study was to determine the extent perceived locus of control and demographic factors, as selected factors of Nola Pender's Health Promotion Model, can predict health...
Martens, M.; Assema, P.; Knibbe, R.; Engels, R.C.M.E.; Brug, J.
2010-01-01
Purpose. Assess whether family environmental factors affected changes in fruit and snack consumption among 12- to 14-year-old adolescents participating in a Dutch healthy diet promotion program. Design. Data were derived from pretest and posttest questionnaires completed by adolescents in 10 schools
Directory of Open Access Journals (Sweden)
Cohn Steven M
2010-05-01
Full Text Available Abstract Background Intestinal cell kinase (ICK; GeneID 22858 is a conserved MAPK and CDK-like kinase that is widely expressed in human tissues. Data from the Cancer Genome Anatomy Project indicated ICK mRNA is increased in cancer, and that its expression correlated with expression of mRNA for an uncharacterized F-box protein, FBX9 (GeneID: 26268. ICK and FBX9 genes are arranged head-to-head on opposite strands, with start sites for transcription separated by ~3.3 kb. We hypothesized ICK and FBX9 are potentially important genes in cancer controlled by a bidirectional promoter. Results We assessed promoter activity of the intergenic region in both orientations in cancer cell lines derived from breast (AU565, SKBR3, colon (HCT-15, KM12, and stomach (AGS cancers, as well as in embryonic human kidney (HEK293T cells. The intergenic segment was active in both orientations in all of these lines, and ICK promoter activity was greater than FBX9 promoter activity. Results from deletions and truncations defined a minimal promoter for ICK, and revealed that repressors and enhancers differentially regulate ICK versus FBX9 promoter activity. The ICK promoter contains consensus motifs for several FOX-family transcription factors that align when mouse and human are compared using EMBOSS. FOXA1 and FOXA2 increase luciferase activity of a minimal promoter 10-20 fold in HEK293T cells. Consensus sites for TCF7L2 (TCF4 (Gene Id: 6934 are also present in both mouse and human. The expression of β-catenin increased activity of the minimal promoter ~10 fold. ICK reference mRNAs (NM_014920.3, NM_016513 are expressed in low copy number and increased in some breast cancers, using a ten base tag 5'-TCAACCTTAT-3' specific for both ICK transcripts. Conclusion ICK and FBX9 are divergently transcribed from a bidirectional promoter that is GC-rich and contains a CpG island. A minimal promoter for ICK contains functional sites for β-cateinin/TCF7L2 and FOXA. These data are
Factors impacting on menstrual hygiene and their implications for health promotion.
Lahme, Anne Mutunda; Stern, Ruth; Cooper, Diane
2018-03-01
In the lives of women, puberty is marked by the onset of menarche. From this stage onwards until menopause, reproductive health and menstrual hygiene are important aspects of women's lives. In Zambia's Western Province, the natural process of menstruation is a taboo and dealt with secretly. Information and knowledge about menstruation and menstrual hygiene among adolescent girls is inadequate. This paper explores the factors influencing the understanding, experiences and practices of menstrual hygiene among adolescent girls in Mongu District, Western Province of Zambia. An explorative study design was used by means of six focus group discussions conducted with 51 respondents, aged 13-20 years, from three secondary schools. Their age at menarche was 11-15. For data analysis thematic content analysis was used. The paper shows that the girls suffer from poor menstrual hygiene, originating from lack of knowledge, culture and tradition, and socio-economic and environmental constraints, leading to inconveniences, humiliation and stress. This leads to reduced school attendance and poor academic performance, or even drop outs, and ultimately infringes upon the girls' human rights. To address these shortcomings, a 'super setting approach' is recommended, in which a Health Promoting School could improve the girls' individual and group needs, and a community setting which would address the broader socio-economic, cultural and environmental conditions. This would enable creating a supportive environment for the girls to manage their periods. To successfully utilize the approach, all stakeholders (parents, teachers, children, governments and communities) should cooperate to generate context-specific solutions for creating safe menstrual care, and better and dignified conditions for adolescent girls. Therefore, this calls for comprehensive, strident advocacy for policy changes at national level, and mediation and involvement at community level.
Placental Growth Factor Promotes Ovarian Cancer Cell Invasion via ZEB2
Directory of Open Access Journals (Sweden)
Ning Song
2016-01-01
Full Text Available Background/Aims: The aggressive manner of ovarian cancer (OVC cells accounts for the majority of its lethality. Recently, we have shown that placental growth factor (PLGF promotes metastases of OVC cells through miR-543-regulated MMP7. In the current study, we analyzed the effects of PLGF on another cell invasion associated protein, ZEB2, in OVC cells. Methods: The PLGF and ZEB2 levels in OVC tissues were compared to the paired adjacent non-tumor ovary tissue. We modified ZEB2 levels in OVC cells, and examined its effects on PLGF mRNA and protein levels by RT-qPCR and by Western blot, respectively. We also modified PLGF levels in OVC cells, and examined its effects on ZEB2 mRNA and protein levels by RT-qPCR and by Western blot, respectively. Then, we examined the cell invasiveness in PLGF-modified OVC cells in a transwell cell invasion assay. Finally, we used specific signal pathway inhibitors to treat PLGF-modified OVC cells and examined the effects on ZEB2 activation. Results: PLGF and ZEB2 levels were both significantly increased in OVC tissues, compared to the paired adjacent non-tumor ovary tissue. The PLGF and ZEB2 levels were strongly correlated. ZEB2 modification did not alter PLGF levels. Overexpression of PLGF in OVC cells significantly increased ZEB2 levels and cell invasiveness, while PLGF depletion in OVC cells significantly decreased ZEB2 levels and cell invasiveness. Application of a specific MAPK-p38 inhibitor, but not application of specific inhibitors for MAPK-p42/p44, PI3k/Akt, or JNK signaling pathways, to PLGF-overexpressing OVC cells substantially abolished the PLGF-induced ZEB2 activation. Conclusion: PLGF enhances OVC cell invasion through MAPK-p38-dependent activation of ZEB2.
Directory of Open Access Journals (Sweden)
Sun Jung Kim, RN, PhD
2016-03-01
Conlcusions: The Chinese students in Korea with higher self-esteem, perceived health status, acculturation level, and lower acculturative stress reported higher health promotion behavior. The findings can be applied to develop health promotion strategies for this population.
Complex diagnostic approaches to skeletal metastases of tumors. II
International Nuclear Information System (INIS)
Kolar, J.; Bek, V.; Janko, L.; Stepan, J.; Hausner, P.; Konopasek, B.; Novy, F.
1987-01-01
The importance is evaluated of scintigraphy of the skeleton in the following conditions: a) detection of a pathological process in general, b) assessment of its extent, i.e., solitary or multiple pathological foci, c) estimate of the activity of bone reconstruction and d) evaluation of changes in the course of treatment. The problem of interpretation of the results are dealt with of radionuclide examinations of the skeleton with regard to their lack of specificity. The accumulation of osteotropic radionuclides can be influenced by an increased turnover of bone minerals as a result of collateral or whole-body response reaction, the systemic action of various humoral factors, hypercalcaemic conditions, etc. In the differential diagnosis of metastatic osteopathies it is important to take into consideration the positive character of radionuclide examinations in many non-tumorous bone and joint affections. For interpretation of the results also the possibility of depositing radionuclides in extraosseous tissues is important. (author). 2 figs., 30 refs
Kinoshita, Yumiko; Kizaki, Zenro; Ishihara, Yasunori; Nakajima, Hisakazu; Adachi, Shinsuke; Kosaka, Kitaro; Kinugasa, Akihiko; Sugimoto, Tohru
2007-01-01
Evidence is accumulating that the promoter region of the insulin-like growth factor I (IGF-I) gene polymorphism and low levels of IGF-I are associated with type 2 diabetes, cardiovascular disease and birth weight; however, the number of wild-type alleles is different in each country. This study aimed to examine the 737/738 marker, a cytosine-adenine repeat in the promoter region of the IGF-I gene polymorphism, and plasma IGF-I levels in Japanese infants and analyze the genetic background. Data were collected for 15 months in Kyoto Prefectural University of Medicine. The body composition parameters of all infants were determined at birth. At 5 days after birth, we took blood samples to measure the product size of the promoter region of the IGF-I gene polymorphism and plasma IGF-I. In a population-based sample of 160 subjects, 6 different alleles and 16 genotypes were identified in the promoter region of the IGF-I gene polymorphism. The existence of a 196-bp allele has proved to result in a low plasma IGF-I level, a small head and chest circumference (p body composition parameters in Japanese infants. Our results suggest genetical influence on prenatal growth and serum IGF-I levels.
Growth/differentiation factor-15: prostate cancer suppressor or promoter?
Czech Academy of Sciences Publication Activity Database
Vaňhara, P.; Hampl, A.; Kozubík, Alois; Souček, Karel
2012-01-01
Roč. 15, č. 4 (2012), s. 320-328 ISSN 1365-7852 R&D Projects: GA MZd NS9600; GA MZd NS9956 Institutional research plan: CEZ:AV0Z50040702 Institutional support: RVO:68081707 Keywords : MACROPHAGE-INHIBITORY CYTOKINE-1 * GROWTH-DIFFERENTIATION FACTOR-15 * TGF-BETA SUPERFAMILY Subject RIV: BO - Biophysics Impact factor: 2.811, year: 2012
Efforts to compile and standardize exposure human factors have resulted in the development of a variety of resources available to the scientific community. For example, the U.S. EPA developed the Exposure Factors Handbook and Child-specific Exposure Factors Handbook to promote c...
Identification of cis-acting regulatory elements in the human oxytocin gene promoter.
Richard, S; Zingg, H H
1991-12-01
The expression of hormone-inducible genes is determined by the interaction of trans-acting factors with hormone-inducible elements and elements mediating basal and cell-specific expression. We have shown earlier that the gene encoding the hypothalamic nonapeptide oxytocin (OT) is under the control of an estrogen response element (ERE). The present study was aimed at identifying cis-acting elements mediating basal expression of the OT gene. A construct containing sequences -381 to +36 of the human OT gene was linked to a reporter gene and transiently transfected into a series of neuronal and nonneuronal cell lines. Expression of this construct was cell specific: it was highest in the neuroblastoma-derived cell line, Neuro-2a, and lowest in NIH 3T3 and JEG-3 cells. By 5' deletion analysis, we determined that a segment from -49 to +36 was capable of mediating cells-pecific promoter activity. Within this segment, we identified three proximal promoter elements (PPE-1, PPE-2, and PPE-3) that are each required for promoter activity. Most notably, mutation of a conserved purine-rich element (GAGAGA) contained within PPE-2 leads to a 10-fold decrease in promoter strength. Gel mobility shift analysis with three different double-stranded oligonucleotides demonstrated that each proximal promoter element binds distinct nuclear factors. In each case, only the homologous oligonucleotide, but neither of the oligonucleotides corresponding to adjacent elements, was able to act as a competitor. Thus, a different set of factors appears to bind independently to each element. By reinserting the homologous ERE or a heterologous glucocorticoid response element upstream of intact or altered proximal promoter segments we determined that removal or mutation of proximal promoter elements decreases basal expression, but does not abrogate the hormone responsiveness of the promoter. In conclusion, these results indicate that an important component of the transcriptional activity of the OT
Zheng, Xing-Wu; Kudaravalli, Rama; Russell, Theresa T; DiMichele, Donna M; Gibb, Constance; Russell, J Eric; Margaritis, Paris; Pollak, Eleanor S
2011-10-01
Severe coagulant factor VII (FVII) deficiency in postpubertal dizygotic twin males results from two point mutations in the FVII gene, a promoter region T→C transition at -60 and a His-to-Arg substitution at amino acid 348; both mutations prevent persistence of plasma functional FVII. This report documents longitudinal laboratory measurements from infancy to adulthood of FVII coagulant activity (FVII:C) in the twin FVII-deficient patients; it also details specific biochemical analyses of the -60 T→C mutation. The results revealed FVII:C levels of less than 1% in infancy that remain severely decreased through puberty and into adulthood. In-vitro analyses utilizing hepatocyte nuclear factor 4α (HNF4α) co-transfection and a chromatin immunoprecipitation assay indicate that the -60 T→C mutation severely diminishes functional interaction between the FVII promoter and transcription factor HNF4α. The importance of interaction between the FVII gene and HNF4α in normal FVII expression provides an in-vivo illustration of the regulated expression of an autosomal gene encoding a coagulation protein. The constancy of FVII:C and peripubertal patient symptomatology reported here illustrates androgen-independent expression in contrast to expression with an analogous mutation in the promoter region of the gene encoding coagulation FIX.
Collaborative interplay between FGF-2 and VEGF-C promotes lymphangiogenesis and metastasis
DEFF Research Database (Denmark)
Cao, Renhai; Ji, Hong; Feng, Ninghan
2012-01-01
Interplay between various lymphangiogenic factors in promoting lymphangiogenesis and lymphatic metastasis remains poorly understood. Here we show that FGF-2 and VEGF-C, two lymphangiogenic factors, collaboratively promote angiogenesis and lymphangiogenesis in the tumor microenvironment, leading...... endothelial cell tip cell formation is a prerequisite for FGF-2-stimulated lymphangiogenesis. In the tumor microenvironment, the reciprocal interplay between FGF-2 and VEGF-C collaboratively stimulated tumor growth, angiogenesis, intratumoral lymphangiogenesis, and metastasis. Thus, intervention and targeting...
Undergraduate nursing students' attitudes towards smoking health promotion.
McCann, Terence V; Clark, Eileen; Rowe, Kathy
2005-09-01
Despite the fact that nurses have a key role in health promotion, many continue to smoke at much the same rate as the general population. This paper investigates the influence of smoking status, gender, age, stage of education, and smoking duration on undergraduate nursing students' attitudes towards smoking health promotion. The study took place in one university's School of Nursing in Victoria, Australia. Respondents completed the Smoking and Health Promotion instrument. Researchers obtained ethics approval prior to commencing the study. Smoking status was the main factor that affected respondents' attitudes towards smoking health promotion, with age and education stage having a minor effect, and gender and smoking duration not significant. Nurses have an important role in modeling non-smoking behaviors for patients. There needs to be consistency between personal and professional beliefs for nurses to properly engage in smoking health promotion. The findings have implications for undergraduate nursing education curricula, nursing practice and research, and these are discussed.
Promoting Self-Esteem in Adolescents: The Influence of Wellness Factors
Myers, Jane E.; Willse, John T.; Villalba, Jose A.
2011-01-01
To assess the extent to which holistic wellness factors are predictive of self-esteem, the authors administered the Coopersmith Self-Esteem Inventories, School Form (Coopersmith, 2002), and the Five Factor Wellness Inventory (Myers & Sweeney, 2005a) to 225 adolescents ages 15 to 17 years. Wellness factors (Coping Self, Social Self, and…
Hughes, M Courtney; Patrick, Donald L; Hannon, Peggy A; Harris, Jeffrey R; Ghosh, Donetta L
2011-07-01
This study explores the decision-making process for implementing and continuing health promotion programs at small to midsized businesses to inform health promotion practitioners and researchers as they market their services to these businesses. Qualitative interviews are conducted with 24 employers located in the Pacific Northwest ranging in size from 75 to 800 employees, with the majority having between 100 and 200 employees. Small to midsized employers depend most on company success-related factors rather than on humanitarian motives when deciding whether to adopt workplace health promotion programs. They rely heavily on health insurers for health promotion and desire more information about the actual costs and cost-benefits of programs. To increase health promotion adoption at small to midsized businesses, health promotion practitioners should appeal to overall company success-related factors, use the insurance channel, and target their information to both human resource personnel and senior management.
Health promotion and dental caries.
Maltz, Marisa; Jardim, Juliana Jobim; Alves, Luana Severo
2010-01-01
The central idea of the Brazilian health system is to prevent the establishment of disease or detect it as early as possible. Prevention and treatment of dental caries are related to behavioral factors, including dietary and oral hygiene habits, which are related to many chronic diseases. Dental health promotion therefore should be fully integrated into broadly based health-promoting strategies and actions such as food and health policies, and general hygiene (including oral hygiene), among others. For decades, a linear relationship between sugar consumption and caries has been observed. Recent data has indicated that this relationship is not as strong as it used to be before the widespread use of fluoride. However, diet is still a key factor acting in the carious process. Oral hygiene is a major aspect when it comes to caries, since dental biofilm is its etiological factor. Oral hygiene procedures are effective in controlling dental caries, especially if plaque removal is performed adequately and associated with fluoride. An alternative to a more efficient biofilm control in occlusal areas is the use of dental sealants, which are only indicated for caries-active individuals. If a cavity is formed as a consequence of the metabolic activity of the biofilm, a restorative material or a sealant can be placed to block access of the biofilm to the oral environment in order to prevent caries progress. The prevention of dental caries based on common risk-factor strategies (diet and hygiene) should be supplemented by more disease-specific policies such as rational use of fluoride, and evidence-based dental health care.
Health promotion and dental caries
Directory of Open Access Journals (Sweden)
Marisa Maltz
2010-01-01
Full Text Available The central idea of the Brazilian health system is to prevent the establishment of disease or detect it as early as possible. Prevention and treatment of dental caries are related to behavioral factors, including dietary and oral hygiene habits, which are related to many chronic diseases. Dental health promotion therefore should be fully integrated into broadly based health-promoting strategies and actions such as food and health policies, and general hygiene (including oral hygiene, among others. For decades, a linear relationship between sugar consumption and caries has been observed. Recent data has indicated that this relationship is not as strong as it used to be before the widespread use of fluoride. However, diet is still a key factor acting in the carious process. Oral hygiene is a major aspect when it comes to caries, since dental biofilm is its etiological factor. Oral hygiene procedures are effective in controlling dental caries, especially if plaque removal is performed adequately and associated with fluoride. An alternative to a more efficient biofilm control in occlusal areas is the use of dental sealants, which are only indicated for caries-active individuals. If a cavity is formed as a consequence of the metabolic activity of the biofilm, a restorative material or a sealant can be placed to block access of the biofilm to the oral environment in order to prevent caries progress. The prevention of dental caries based on common risk-factor strategies (diet and hygiene should be supplemented by more disease-specific policies such as rational use of fluoride, and evidence-based dental health care.
Takahashi, Shigeru; Matsuura, Naomi; Kurokawa, Takako; Takahashi, Yuji; Miura, Takashi
2002-11-01
We reported previously that the 5'-flanking region (nucleotides -1976 to -1655) of the human haem oxygenase-1 ( hHO-1 ) gene enhances hHO-1 promoter activity in human hepatoma HepG2 cells, but not in HeLa cells [Takahashi, Takahashi, Ito, Nagano, Shibahara and Miura (1999) Biochim. Biophys. Acta 1447, 231-235]. To define more precisely the regulatory elements involved, in the present study we have functionally dissected this region and localized the enhancer to a 50 bp fragment (-1793 to -1744). Site-direct mutagenesis analysis revealed that two regions were responsible for this enhancer activity, i.e. a hepatocyte nuclear factor-4 (HNF-4) homologous region and a GC box motif homologous region. Mutation in either region alone moderately decreased enhancer activity. However, mutations in both regions reduced promoter activity to the basal level. Electrophoretic mobility-shift assays demonstrated that the P5-2 fragment (-1793 to -1744) interacted with at least two nuclear factors, i.e. HNF-4 and Sp1/Sp3. Co-transfection experiments using Drosophila SL2 cells revealed that HNF-4 and Sp1/Sp3 synergistically stimulated the enhancer activity of the P5-2 fragment. These results indicate that co-operation of HNF-4 with Sp1 or Sp3 leads to the activation of hHO-1 gene expression in hepatoma cells.
Kikuchi, Ryoko; Tsuda, Hitoshi; Kanai, Yae; Kasamatsu, Takahiro; Sengoku, Kazuo; Hirohashi, Setsuo; Inazawa, Johji; Imoto, Issei
2007-08-01
Connective tissue growth factor (CTGF) is a secreted protein belonging to the CCN family, members of which are implicated in various biological processes. We identified a homozygous loss of CTGF (6q23.2) in the course of screening a panel of ovarian cancer cell lines for genomic copy number aberrations using in-house array-based comparative genomic hybridization. CTGF mRNA expression was observed in normal ovarian tissue and immortalized ovarian epithelial cells but was reduced in many ovarian cancer cell lines without its homozygous deletion (12 of 23 lines) and restored after treatment with 5-aza 2'-deoxycytidine. The methylation status around the CTGF CpG island correlated inversely with the expression, and a putative target region for methylation showed promoter activity. CTGF methylation was frequently observed in primary ovarian cancer tissues (39 of 66, 59%) and inversely correlated with CTGF mRNA expression. In an immunohistochemical analysis of primary ovarian cancers, CTGF protein expression was frequently reduced (84 of 103 cases, 82%). Ovarian cancer tended to lack CTGF expression more frequently in the earlier stages (stages I and II) than the advanced stages (stages III and IV). CTGF protein was also differentially expressed among histologic subtypes. Exogenous restoration of CTGF expression or treatment with recombinant CTGF inhibited the growth of ovarian cancer cells lacking its expression, whereas knockdown of endogenous CTGF accelerated growth of ovarian cancer cells with expression of this gene. These results suggest that epigenetic silencing by hypermethylation of the CTGF promoter leads to a loss of CTGF function, which may be a factor in the carcinogenesis of ovarian cancer in a stage-dependent and/or histologic subtype-dependent manner.
PDGFBB promotes PDGFRα-positive cell migration into artificial bone in vivo
International Nuclear Information System (INIS)
Yoshida, Shigeyuki; Iwasaki, Ryotaro; Kawana, Hiromasa; Miyauchi, Yoshiteru; Hoshi, Hiroko; Miyamoto, Hiroya; Mori, Tomoaki; Kanagawa, Hiroya; Katsuyama, Eri; Fujie, Atsuhiro; Hao, Wu
2012-01-01
Highlights: ► We examined effects of PDGFBB in PDGFRα positive cell migration in artificial bones. ► PDGFBB was not expressed in osteoblastic cells but was expressed in peripheral blood cells. ► PDGFBB promoted PDGFRα positive cell migration into artificial bones but not osteoblast proliferation. ► PDGFBB did not inhibit osteoblastogenesis. -- Abstract: Bone defects caused by traumatic bone loss or tumor dissection are now treated with auto- or allo-bone graft, and also occasionally by artificial bone transplantation, particularly in the case of large bone defects. However, artificial bones often exhibit poor affinity to host bones followed by bony union failure. Thus therapies combining artificial bones with growth factors have been sought. Here we report that platelet derived growth factor bb (PDGFBB) promotes a significant increase in migration of PDGF receptor α (PDGFRα)-positive mesenchymal stem cells/pre-osteoblastic cells into artificial bone in vivo. Growth factors such as transforming growth factor beta (TGFβ) and hepatocyte growth factor (HGF) reportedly inhibit osteoblast differentiation; however, PDGFBB did not exhibit such inhibitory effects and in fact stimulated osteoblast differentiation in vitro, suggesting that combining artificial bones with PDGFBB treatment could promote host cell migration into artificial bones without inhibiting osteoblastogenesis.
Health promotion in primary and secondary schools in Denmark
DEFF Research Database (Denmark)
Nabe-Nielsen, Kirsten; Krølner, Rikke; Mortensen, Laust Hvas
2015-01-01
BACKGROUND: Schools are important arenas for interventions among children as health promoting initiatives in childhood is expected to have substantial influence on health and well-being in adulthood. In countries with compulsory school attention, all children could potentially benefit from health...... promotion at the school level regardless of socioeconomic status or other background factors. The first aim was to elucidate time trends in the number and types of school health promoting activities by describing the number and type of health promoting activities in primary and secondary schools in Denmark....... The second aim was to investigate which characteristics of schools and students that are associated with participation in many (≥3) versus few (0-2) health promoting activities during the preceding 2-3 years. METHODS: We used cross-sectional data from the 2006- and 2010-survey of the Health Behaviour...
Macrophages Promote Axon Regeneration with Concurrent Neurotoxicity
Gensel, J.C.; Nakamura, S.; Guan, Z.; Rooijen, van N.; Ankeny, D.P.; Popovich, P.G.
2009-01-01
Activated macrophages can promote regeneration of CNS axons. However, macrophages also release factors that kill neurons. These opposing functions are likely induced simultaneously but are rarely considered together in the same experimental preparation. A goal of this study was to unequivocally
A comparison of patients' perceptions and an audit of health promotion practice within a UK hospital
Directory of Open Access Journals (Sweden)
Cook Gary A
2007-09-01
Full Text Available Abstract Background UK hospitals are required to monitor the health promotion services they provide for patients. We compared the use of audit and patient questionnaires as appropriate tools for monitoring whether patients are screened for modifiable risk factors (smoking, alcohol use, obesity, diet, and physical activity, whether staff correctly identify risk factor presence and deliver health promotion when a risk factor is identified. Methods We sent a questionnaire post-discharge to 322 hospitalised adult patients discharged alive between January and March 2006, and audited their hospital case notes for evidence of screening for risk factors, identification of risk factors, and delivery of health promotion to change risk factors. Agreement between the audit and questionnaire findings was assessed by Kappa statistic. Results There was little relationship between what was written in the case notes and what patients thought had happened. Agreement between the audit and questionnaire for screening of risk factors was at best fair. For the delivery of health promotion agreement was moderate for alcohol, poor for exercise, and no different from chance for smoking and diet. Agreement on identifying risk factors was very good for obesity, good for smoking, and moderate for alcohol misuse. The identification of diet quality and level of physical activity was too low in the audit to allow statistical comparison with self-reported diet and activity. Conclusion A direct comparison of data gathered in the audit and patient questionnaires provides a comprehensive picture of health promotion practice within hospitals. Poor screening agreement is likely to be due to errors in patients' recall of screening activities. Audit is therefore the preferred method for evaluating screening of risk factors, but further insight into screening practice can be gained by using the questionnaire in conjunction with audit. If a patient does not recognise that they received
Implementation of Mamdani Fuzzy Method in Employee Promotion System
Zulfikar, W. B.; Jumadi; Prasetyo, P. K.; Ramdhani, M. A.
2018-01-01
Nowadays, employees are big assets to an institution. Every employee has a different educational background, degree, work skill, attitude and ethic that affect the performance. An institution including government institution implements a promotion system in order to improve the performance of the employees. Pangandaran Tourism, Industry, Trade, and SME Department is one of government agency that implements a promotion system to discover employees who deserve to get promotion. However, there are some practical deficiencies in the promotion system, one of which is the subjectivity issue. This work proposed a classification model that could minimize the subjectivity issue in employee promotion system. This paper reported a classification employee based on their eligibility for promotion. The degree of membership was decided using Mamdani Fuzzy based on determinant factors of the performance of employees. In the evaluation phase, this model had an accuracy of 91.4%. It goes to show that this model may minimize the subjectivity issue in the promotion system, especially at Pangandaran Tourism, Industry, Trade, and SME Department.
Reading Habit Promotion in ASEAN Libraries.
Sangkaeo, Somsong
This paper describes the activities of the Association of Southeast Asian Nations (ASEAN) libraries have undertaken to promote reading by increasing awareness among their people. First, factors limiting reading habits in ASEAN libraries are addressed, including: we are not a reading society, but a chatting society; the management of "3…
Liu, Guan-Ting; Huang, Yuan-Li; Tzeng, Huey-En; Tsai, Chun-Hao; Wang, Shih-Wei; Tang, Chih-Hsin
2015-02-28
Chondrosarcoma is a primary malignant bone cancer, with a potent capacity to invade locally and cause distant metastasis. Angiogenesis is a critical step in tumor growth and metastasis. Chemokine CCL5 (previously called RANTES) has been shown to facilitate tumor progression and metastasis. However, the relationship of CCL5 with vascular endothelial growth factor (VEGF) expression and angiogenesis in human chondrosarcoma is mostly unknown. In this study, CCL5 increased VEGF expression and also promoted chondrosarcoma medium-mediated angiogenesis in vitro as well as angiogenesis effects in the chick chorioallantoic membrane and Matrigel plug nude mice model in vivo. MicroRNA analysis was performed in CCL5-treated chondrosarcoma cells versus control cells to investigate the mechanism of CCL5-mediated promotion of chondrosarcoma angiogenesis. Among the miRNAs regulated by CCL5, miR-199a was the most downregulated miRNA after CCL5 treatment. In addition, co-transfection with miR-199a mimic reversed the CCL5-mediated VEGF expression and angiogenesis in vitro and in vivo. Moreover, overexpression of CCL5 increased tumor-associated angiogenesis and tumor growth by downregulating miR-199a in the xenograft tumor angiogenesis model. Taken together, these results demonstrated that CCL5 promotes VEGF-dependent angiogenesis in human chondrosarcoma cells by downregulating miR-199a. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.
Elaborating on systems thinking in health promotion practice.
Naaldenberg, Jenneken; Vaandrager, Lenneke; Koelen, Maria; Wagemakers, Anne-Marie; Saan, Hans; de Hoog, Kees
2009-03-01
Health and well-being are the result of a series of complex processes in which an individual interacts with other people and the environment. A systematic approach ensures incorporation of individual, ecological, social and political factors. However, interactions between these factors can be overlooked within a systematical approach. A systemic approach can provide additional information by incorporating interactions and communication. The opportunities of a systems thinking perspective for health promotion were investigated for this paper. Although others have also made attempts to explore systems thinking in the field of health promotion, the implications of systems thinking in practice need attention. Other fields such as agricultural extension studies, organizational studies and development studies provide useful experiences with the use of a systems thinking perspective in practice. Building on experiences from these fields, we give a theoretical background in which processes of social learning and innovation play an important role. From this background, we derive an overview of important concepts for the practical application of a systems thinking perspective. These concepts are the structure of the system, meanings attached to actions, and power relations between actors. To make these concepts more explicit and reduce the theoretical character of systems thinking, we use an illustration to elaborate on these concepts in practice. For this purpose, we describe a health promotion partnership in The Netherlands using the concepts structure, meaning and power relations. We show how a systems perspective increases insight in the functioning of a partnership and how this can facilitate processes of social learning and innovation. This article concludes by identifying future opportunities and challenges in adopting systems thinking for health promotion practice. A systems perspective towards health promotion can help projects reaching a more integral and
Directory of Open Access Journals (Sweden)
Ansaya Thonpho
Full Text Available Pyruvate carboxylase (PC is an enzyme that plays a crucial role in many biosynthetic pathways in various tissues including glucose-stimulated insulin secretion. In the present study, we identify promoter usage of the human PC gene in pancreatic beta cells. The data show that in the human, two alternative promoters, proximal and distal, are responsible for the production of multiple mRNA isoforms as in the rat and mouse. RT-PCR analysis performed with cDNA prepared from human liver and islets showed that the distal promoter, but not the proximal promoter, of the human PC gene is active in pancreatic beta cells. A 1108 bp fragment of the human PC distal promoter was cloned and analyzed. It contains no TATA box but possesses two CCAAT boxes, and other putative transcription factor binding sites, similar to those of the distal promoter of rat PC gene. To localize the positive regulatory region in the human PC distal promoter, 5'-truncated and the 25-bp and 15-bp internal deletion mutants of the human PC distal promoter were generated and used in transient transfections in INS-1 832/13 insulinoma and HEK293T (kidney cell lines. The results indicated that positions -340 to -315 of the human PC distal promoter serve as (an activator element(s for cell-specific transcription factor, while the CCAAT box at -71/-67, a binding site for nuclear factor Y (NF-Y, as well as a GC box at -54/-39 of the human PC distal promoter act as activator sequences for basal transcription.
Cloning and characterization of the human integrin β6 gene promoter.
Directory of Open Access Journals (Sweden)
Mingyan Xu
Full Text Available The integrin β6 (ITGB6 gene, which encodes the limiting subunit of the integrin αvβ6 heterodimer, plays an important role in wound healing and carcinogenesis. The mechanism underlying ITGB6 regulation, including the identification of DNA elements and cognate transcription factors responsible for basic transcription of human ITGB6 gene, remains unknown. This report describes the cloning and characterization of the human ITGB6 promoter. Using 5'-RACE (rapid amplification of cDNA ends analysis, the transcriptional initiation site was identified. Promoter deletion analysis identified and functionally validated a TATA box located in the region -24 to -18 base pairs upstream of the ITGB6 promoter. The regulatory elements for transcription of the ITGB6 gene were predominantly located -289 to -150 from the ITGB6 promoter and contained putative binding sites for transcription factors such as STAT3 and C/EBPα. Using chromatin immunoprecipitation assays, this study has demonstrated, for the first time, that transcription factors STAT3 and C/EBPα are involved in the positive regulation of ITGB6 transcription in oral squamous cell carcinoma cells. These findings have important implications for unraveling the mechanism of abnormal ITGB6 activation in tissue remodeling and tumorigenesis.
Li, Te-Mao; Fong, Yi-Chin; Liu, Shan-Chi; Chen, Po-Chun; Tang, Chih-Hsin
2013-01-01
Chondrosarcoma is a primary malignant bone cancer, with a potent capacity to invade locally and cause distant metastasis; it has a poor prognosis and shows a predilection for metastasis to the lungs. Brain derived neurotrophic factor (BDNF) is a small-molecule protein from the neurotrophin family of growth factors that is associated with the disease status and outcomes of cancers. However, the effect of BDNF on migration activity in human chondrosarcoma cells is mostly unknown. Here, we found that human chondrosarcoma tissues showed significant expression of BDNF, which was higher than that in normal cartilage and primary chondrocytes. We also found that BDNF increased the migration and expression of β5 integrin in human chondrosarcoma cells. In addition, knockdown of BDNF expression markedly inhibited migratory activity. BDNF-mediated migration and β5 integrin up-regulation were attenuated by antibody, inhibitor, or siRNA against the TrkB receptor. Pretreatment of chondrosarcoma cells with PI3K, Akt, and NF-κB inhibitors or mutants also abolished BDNF-promoted migration and integrin expression. The PI3K, Akt, and NF-κB signaling pathway was activated after BDNF treatment. Taken together, our results indicate that BDNF enhances the migration of chondrosarcoma by increasing β5 integrin expression through a signal transduction pathway that involves the TrkB receptor, PI3K, Akt, and NF-κB. BDNF thus represents a promising new target for treating chondrosarcoma metastasis. PMID:23874483
Functional analysis of the OCA-B promoter.
Stevens, S; Wang, L; Roeder, R G
2000-06-15
OCA-B was identified as a B cell-specific coactivator that functions with either Oct-1 or Oct-2 to mediate efficient cell type-specific transcription via the octamer site (ATGCAAAT) both in vivo and in vitro. Mice lacking OCA-B exhibit normal Ag-independent B cell maturation. In contrast, Ag-dependent functions, including production of secondary Ig isotypes and germinal center formation, are greatly affected. To better understand OCA-B expression and, ultimately, the defects observed in the OCA-B knockout mice, we have cloned the OCA-B promoter and examined its function in both transformed and primary B cells. We show here that the OCA-B promoter is developmentally regulated, with activity increasing throughout B cell differentiation. Through physical and functional assays, we have found an activating transcription factor/cAMP response element binding protein binding site (or cAMP response element) that is crucial for OCA-B promoter activity. Furthermore, we demonstrate that IL-4 and anti-CD40 induce both the OCA-B promoter and octamer-dependent promoters, thus implicating OCA-B in B cell signaling events in the nucleus.
Internet Access and Youth of Yakutia Awareness on the Health-Promotion Factor
Barakhsanova, Elizabeth Afanasyevna; Ignatyev, Vladimir Petrovich; Savvinov, Vasily Mikhaylovich; Olesova, Sargulana Gavrilievna
2016-01-01
Thematic justification is determined by the fact that in the conditions of the steady growth of mobile technology the youth accurately does not represent health promotion value when using the Internet at home, at school and other entertainment leisure recreation. With respect thereto this paper is aimed at monitoring general awareness of seniors…
Transcription factor-based biosensor
Dietrich, Jeffrey A; Keasling, Jay D
2013-10-08
The present invention provides for a system comprising a BmoR transcription factor, a .sigma..sup.54-RNA polymerase, and a pBMO promoter operatively linked to a reporter gene, wherein the pBMO promoter is capable of expression of the reporter gene with an activated form of the BmoR and the .sigma..sup.54-RNA polymerase.
Kodama, Nao; Iwao, Takahiro; Kabeya, Tomoki; Horikawa, Takashi; Niwa, Takuro; Kondo, Yuki; Nakamura, Katsunori; Matsunaga, Tamihide
2016-06-01
We previously reported that small-molecule compounds were effective in generating pharmacokinetically functional enterocytes from human induced pluripotent stem (iPS) cells. In this study, to determine whether the compounds promote the differentiation of human iPS cells into enterocytes, we investigated the effects of a combination of mitogen-activated protein kinase kinase (MEK), DNA methyltransferase (DNMT), and transforming growth factor (TGF)-β inhibitors on intestinal differentiation. Human iPS cells cultured on feeder cells were differentiated into endodermal cells by activin A. These endodermal-like cells were then differentiated into intestinal stem cells by fibroblast growth factor 2. Finally, the cells were differentiated into enterocyte cells by epidermal growth factor and small-molecule compounds. After differentiation, mRNA expression levels and drug-metabolizing enzyme activities were measured. The mRNA expression levels of the enterocyte marker sucrase-isomaltase and the major drug-metabolizing enzyme cytochrome P450 (CYP) 3A4 were increased by a combination of MEK, DNMT, and TGF-β inhibitors. The mRNA expression of CYP3A4 was markedly induced by 1α,25-dihydroxyvitamin D3. Metabolic activities of CYP1A1/2, CYP2B6, CYP2C9, CYP2C19, CYP3A4/5, UDP-glucuronosyltransferase, and sulfotransferase were also observed in the differentiated cells. In conclusion, MEK, DNMT, and TGF-β inhibitors can be used to promote the differentiation of human iPS cells into pharmacokinetically functional enterocytes. Copyright © 2016 The Japanese Society for the Study of Xenobiotics. Published by Elsevier Ltd. All rights reserved.
Internal dental school environmental factors promoting faculty survival and success.
Masella, Richard S
2005-04-01
A career in dental academics offers ample rewards and challenges. To promote successful careers in dental education, prospective and new dental faculty should possess a realistic view of the dental school work environment, akin to the informed consent so valuable to patients and doctors. Self-assessment of personal strengths and weaknesses provides helpful information in matching faculty applicants with appropriate dental schools. Essential prehiring information also includes a written job description detailing duties and responsibilities, professional development opportunities, and job performance evaluation protocol. Prehiring awareness of what constitutes excellence in job performance will aid new faculty in allotting time to productive venues. New faculty should not rely solely on professional expertise to advance careers. Research and regular peer-reviewed publications are necessary elements in academic career success, along with the ability to secure governmental, private foundation, and corporate grant support. Tactful self-promotion and self-definition to the dental school community are faculty responsibilities, along with substantial peer collaboration. The recruitment period is a singular opportunity to secure job benefits and privileges. It is also the time to gain knowledge of institutional culture and assess administrative and faculty willingness to collaborate on teaching, research, professional development, and attainment of change. Powerful people within dental schools and parent institutions may influence faculty careers and should be identified and carefully treated. The time may come to leave one's position for employment at a different dental school or to step down from full-time academics. Nonetheless, the world of dental and health professional education in 2005 is rapidly expanding and offers unlimited opportunities to dedicated, talented, and informed educators.
Fanconi anemia core complex gene promoters harbor conserved transcription regulatory elements.
Meier, Daniel; Schindler, Detlev
2011-01-01
The Fanconi anemia (FA) gene family is a recent addition to the complex network of proteins that respond to and repair certain types of DNA damage in the human genome. Since little is known about the regulation of this novel group of genes at the DNA level, we characterized the promoters of the eight genes (FANCA, B, C, E, F, G, L and M) that compose the FA core complex. The promoters of these genes show the characteristic attributes of housekeeping genes, such as a high GC content and CpG islands, a lack of TATA boxes and a low conservation. The promoters functioned in a monodirectional way and were, in their most active regions, comparable in strength to the SV40 promoter in our reporter plasmids. They were also marked by a distinctive transcriptional start site (TSS). In the 5' region of each promoter, we identified a region that was able to negatively regulate the promoter activity in HeLa and HEK 293 cells in isolation. The central and 3' regions of the promoter sequences harbor binding sites for several common and rare transcription factors, including STAT, SMAD, E2F, AP1 and YY1, which indicates that there may be cross-connections to several established regulatory pathways. Electrophoretic mobility shift assays and siRNA experiments confirmed the shared regulatory responses between the prominent members of the TGF-β and JAK/STAT pathways and members of the FA core complex. Although the promoters are not well conserved, they share region and sequence specific regulatory motifs and transcription factor binding sites (TBFs), and we identified a bi-partite nature to these promoters. These results support a hypothesis based on the co-evolution of the FA core complex genes that was expanded to include their promoters.
Fanconi anemia core complex gene promoters harbor conserved transcription regulatory elements.
Directory of Open Access Journals (Sweden)
Daniel Meier
Full Text Available The Fanconi anemia (FA gene family is a recent addition to the complex network of proteins that respond to and repair certain types of DNA damage in the human genome. Since little is known about the regulation of this novel group of genes at the DNA level, we characterized the promoters of the eight genes (FANCA, B, C, E, F, G, L and M that compose the FA core complex. The promoters of these genes show the characteristic attributes of housekeeping genes, such as a high GC content and CpG islands, a lack of TATA boxes and a low conservation. The promoters functioned in a monodirectional way and were, in their most active regions, comparable in strength to the SV40 promoter in our reporter plasmids. They were also marked by a distinctive transcriptional start site (TSS. In the 5' region of each promoter, we identified a region that was able to negatively regulate the promoter activity in HeLa and HEK 293 cells in isolation. The central and 3' regions of the promoter sequences harbor binding sites for several common and rare transcription factors, including STAT, SMAD, E2F, AP1 and YY1, which indicates that there may be cross-connections to several established regulatory pathways. Electrophoretic mobility shift assays and siRNA experiments confirmed the shared regulatory responses between the prominent members of the TGF-β and JAK/STAT pathways and members of the FA core complex. Although the promoters are not well conserved, they share region and sequence specific regulatory motifs and transcription factor binding sites (TBFs, and we identified a bi-partite nature to these promoters. These results support a hypothesis based on the co-evolution of the FA core complex genes that was expanded to include their promoters.
Early 20th century conceptualization of health promotion.
Madsen, Wendy
2017-12-01
This historical analysis of the term 'health promotion' during the early 20th century in North American journal articles revealed concepts that strongly resonate with those of the 21st century. However, the lineage between these two time periods is not clear, and indeed, this paper supports contentions health promotion has a disrupted history. This paper traces the conceptualizations of health promotion during the 1920s, attempts to operationalize health promotion in the 1930s resulting in a narrowing of the concept to one of health education, and the disappearance of the term from the 1940s. In doing so, it argues a number of factors influenced the changing conceptualization and utilization of health promotion during the first half of the 20th century, many of which continue to present times, including issues around what health promotion is and what it means, ongoing tensions between individual and collective actions, tensions between specific and general causes of health and ill health, and between expert and societal contributions. The paper concludes the lack of clarity around these issues contributed to health promotion disappearing in the mid-20th century and thus resolution of these would be worthwhile for the continuation and development of health promotion as a discipline into the 21st century. © The Author 2016. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.
An unlikely suitor: Industrial Engineering in health promotion
Directory of Open Access Journals (Sweden)
Hattingh, T. S.
2013-05-01
Full Text Available Primary healthcare forms the foundation for transforming healthcare in South Africa. The primary healthcare system is based on five pillars, one of them being health promotion. The principles of health promotion advocate that promoting health and wellness within communities will reduce the burden of disease at both primary and higher levels of the healthcare system. The challenge in South Africa, is that the factors affecting communities often inhibit their ability to control their health. In addition, the health promotion function within clinics is underresourced: each health promoter serves impoverished communities of up to 50,000 people. This study aims to identify how industrial engineering principles can be applied to assess and improve the impact of health promotion on communities, and ultimately on the health care system as a whole. An industrial engineering approach has analysed five clinics within the Ekurhuleni Municipality in Gauteng. The results show a distinct lack of consistency between clinics. Common issues include a lack of standard processes, structures, measures, resources, and training to support health promotion. The problems identified are commonly analysed and addressed by industrial engineering in organisations, and industrial engineering could be a useful method for evaluating and improving the impact of health promotion on communities. Recommendations for improvement and further work were made based on the findings.
Aarva, Pauliina; Tampere, Marja Pakarinen
2006-06-01
The cultural aspects of health promotion are important in policy development as well as in assessing effectiveness of health promotion activities. The discourses on promoting health and well-being in journalism reflect the health promotion culture in society. This article illustrates how health promotion is portrayed by 147 newspaper items from the two Finnish quality dailies during the period 2002-2004 and introduces a semiotic Actantial Model of Health Promotion (AMHP) for studying health promotion cultures. The most popular news themes on health promotion were physical and social environment, welfare services, nutrition and obesity, and mental well-being. The actants (actors, actions and abstract factor) of health promotion were identified and the AMHP with seven key actants (generator, health-object, public, tool, executor, threat and obstacle) was constructed. The model sheds light on two sides of health promotion discourses in journalism. The dominant culture of health promotion was represented by policy actions, information, education and scientific research, which were defined by health experts, decision-makers and researchers. Representations of the opposite culture--'the otherness' of health promotion included external harmful factors and unhealthy behaviours, mentalities opposed to being health-oriented, rationally uncontrolled living, disorder, disharmony and insecurity. The opposing factors were presented by people and institutions lacking the will, ability or motivation for a health-oriented life. To understand better the values of health promotion, it is necessary to assess the characteristics of the opposite side of health promotion culture, because the current dominant values can be described more clearly by the boundaries--by 'otherness'. The study argues that the AMHP can be used as a semiotic method to identify the value dimensions and the boundaries between the dominant and the opposite discourses of health promotion in various communications
Kennedy, Catriona M; Buchan, Iain; Powell, John; Ainsworth, John
2015-01-01
the effectiveness of online social networking within health promotion interventions. Most of the trials investigated the value of a “social networking condition” in general and did not identify specific features that might play a role in effectiveness. Issues about the usability and level of uptake of interventions were more common among pilot studies, while observational studies showed positive evidence about the role of social support. A total of 20 papers showed the use of theory in the design of interventions, but authors evaluated effectiveness in only 10 papers. Conclusions More research is needed in this area to understand the actual effect of social network technologies on health promotion. More RCTs of greater length need to be conducted taking into account contextual factors such as patient characteristics and types of a social network technology. Also, more evidence is needed regarding the actual usability of online social networking and how different interface design elements may help or hinder behavior change and engagement. Moreover, it is crucial to investigate further the effect of theory on the effectiveness of this type of technology for health promotion. Research is needed linking theoretical grounding with observation and analysis of health promotion in online networks. PMID:26068087
Balatsoukas, Panos; Kennedy, Catriona M; Buchan, Iain; Powell, John; Ainsworth, John
2015-06-11
networking within health promotion interventions. Most of the trials investigated the value of a "social networking condition" in general and did not identify specific features that might play a role in effectiveness. Issues about the usability and level of uptake of interventions were more common among pilot studies, while observational studies showed positive evidence about the role of social support. A total of 20 papers showed the use of theory in the design of interventions, but authors evaluated effectiveness in only 10 papers. More research is needed in this area to understand the actual effect of social network technologies on health promotion. More RCTs of greater length need to be conducted taking into account contextual factors such as patient characteristics and types of a social network technology. Also, more evidence is needed regarding the actual usability of online social networking and how different interface design elements may help or hinder behavior change and engagement. Moreover, it is crucial to investigate further the effect of theory on the effectiveness of this type of technology for health promotion. Research is needed linking theoretical grounding with observation and analysis of health promotion in online networks.
Grunseich, Christopher; Wang, Isabel X; Watts, Jason A; Burdick, Joshua T; Guber, Robert D; Zhu, Zhengwei; Bruzel, Alan; Lanman, Tyler; Chen, Kelian; Schindler, Alice B; Edwards, Nancy; Ray-Chaudhury, Abhik; Yao, Jianhua; Lehky, Tanya; Piszczek, Grzegorz; Crain, Barbara; Fischbeck, Kenneth H; Cheung, Vivian G
2018-02-01
R-loops are three-stranded nucleic acid structures found abundantly and yet often viewed as by-products of transcription. Studying cells from patients with a motor neuron disease (amyotrophic lateral sclerosis 4 [ALS4]) caused by a mutation in senataxin, we uncovered how R-loops promote transcription. In ALS4 patients, the senataxin mutation depletes R-loops with a consequent effect on gene expression. With fewer R-loops in ALS4 cells, the expression of BAMBI, a negative regulator of transforming growth factor β (TGF-β), is reduced; that then leads to the activation of the TGF-β pathway. We uncovered that genome-wide R-loops influence promoter methylation of over 1,200 human genes. DNA methyl-transferase 1 favors binding to double-stranded DNA over R-loops. Thus, in forming R-loops, nascent RNA blocks DNA methylation and promotes further transcription. Hence, our results show that nucleic acid structures, in addition to sequences, influence the binding and activity of regulatory proteins. Copyright © 2017 Elsevier Inc. All rights reserved.
Okawara, Makoto; Kajiki, Shigeyuki; Kusumoto, Akira; Fujino, Yoshihisa; Shinkai, Takahiro; Morimoto, Hideki; Hino, Yoshiyuki; Yamashita, Satoshi; Hattori, Michihiro; Mori, Koji
2018-02-01
suggests that there are factors impeding the cooperation between the occupational health physicians and psychiatrists. When an occupational health physician writes a request form, cooperation with psychiatrists may be promoted by enriching the request form contents and by including the representation of the occupational health physician's position and the intended purpose of the provided information by paying attention to the volume of sentences.
Directory of Open Access Journals (Sweden)
Piotr Szymczyk
2016-09-01
Full Text Available The promoter, 5' UTR, and 34-nt 5' fragments of protein encoding region of the Salvia miltiorrhiza copalyl diphosphate synthase gene were cloned and characterized. No tandem repeats, miRNA binding sites, or CpNpG islands were observed in the promoter, 5' UTR, or protein encoding fragments. The entire isolated promoter and 5' UTR is 2235 bp long and contains repetitions of many cis-active elements, recognized by homologous transcription factors, found in Arabidopsis thaliana and other plant species. A pyrimidine-rich fragment with only 6 non-pyrimidine bases was localized in the 33-nt stretch from nt 2185 to 2217 in the 5' UTR. The observed cis-active sequences are potential binding sites for trans-factors that could regulate spatio-temporal CPS gene expression in response to biotic and abiotic stress conditions. Obtained results are initially verified by in silico and co-expression studies based on A. thaliana microarray data. The quantitative RT-PCR analysis confirmed that the entire 2269-bp copalyl diphosphate synthase gene fragment has the promoter activity. Quantitative RT-PCR analysis was used to study changes in CPS promoter activity occurring in response to the application of four selected biotic and abiotic regulatory factors; auxin, gibberellin, salicylic acid, and high-salt concentration.
Characterization of the promoter region of the human c-erbB-2 protooncogene
International Nuclear Information System (INIS)
Ishii, S.; Imamoto, F.; Yamanashi, Y.; Toyoshima, K.; Yamamoto, T.
1987-01-01
Three overlapping genomic clones that contain the 5'-terminal portion of the human c-erbB-2 gene (ERBB2) were isolated. The promoter region was identified by nuclease S1 mapping with c-erbB-2 mRNA. Seven transcriptional start sites were identified. DNA sequence analysis showed that the promoter region contains a TATA box and a CAAT box about 30 and 80 base pairs (bp), respectively, upstream of the most downstream RNA initiation site. Two putative binding sites for transcription factor Sp1 were identified about 50 and 110 bp upstream of the CAAT box, and six GGA repeats were found between the CAAT box and the TATA box. This region had strong promoter activity when placed upstream of the bacterial chloramphenicol acetyltransferase gene and transfected into monkey CV-1 cells. These data indicate that the promoter of the human c-erbB-2 protooncogene is different from that of the protooncogene c-erbB-1 (epidermal growth factor receptor gene), which does not contain either a TATA box or a CAAT box. Comparison of the promoter sequences and activities of the two protooncogenes should be helpful in analysis of the regulatory mechanism of expression of their gene products, which are growth-factor receptors
Lotkowska, Magda E.; Tohge, Takayuki; Fernie, Alisdair R.; Xue, Gang-Ping; Balazadeh, Salma; Mueller-Roeber, Bernd
2015-01-01
MYB transcription factors (TFs) are important regulators of flavonoid biosynthesis in plants. Here, we report MYB112 as a formerly unknown regulator of anthocyanin accumulation in Arabidopsis (Arabidopsis thaliana). Expression profiling after chemically induced overexpression of MYB112 identified 28 up- and 28 down-regulated genes 5 h after inducer treatment, including MYB7 and MYB32, which are both induced. In addition, upon extended induction, MYB112 also positively affects the expression of PRODUCTION OF ANTHOCYANIN PIGMENT1, a key TF of anthocyanin biosynthesis, but acts negatively toward MYB12 and MYB111, which both control flavonol biosynthesis. MYB112 binds to an 8-bp DNA fragment containing the core sequence (A/T/G)(A/C)CC(A/T)(A/G/T)(A/C)(T/C). By electrophoretic mobility shift assay and chromatin immunoprecipitation coupled to quantitative polymerase chain reaction, we show that MYB112 binds in vitro and in vivo to MYB7 and MYB32 promoters, revealing them as direct downstream target genes. We further show that MYB112 expression is up-regulated by salinity and high light stress, environmental parameters that both require the MYB112 TF for anthocyanin accumulation under these stresses. In contrast to several other MYB TFs affecting anthocyanin biosynthesis, MYB112 expression is not controlled by nitrogen limitation or an excess of carbon. Thus, MYB112 constitutes a regulator that promotes anthocyanin accumulation under abiotic stress conditions. PMID:26378103
Monitoring food and non-alcoholic beverage promotions to children.
Kelly, B; King, L; Baur, L; Rayner, M; Lobstein, T; Monteiro, C; Macmullan, J; Mohan, S; Barquera, S; Friel, S; Hawkes, C; Kumanyika, S; L'Abbé, M; Lee, A; Ma, J; Neal, B; Sacks, G; Sanders, D; Snowdon, W; Swinburn, B; Vandevijvere, S; Walker, C
2013-10-01
Food and non-alcoholic beverage marketing is recognized as an important factor influencing food choices related to non-communicable diseases. The monitoring of populations' exposure to food and non-alcoholic beverage promotions, and the content of these promotions, is necessary to generate evidence to understand the extent of the problem, and to determine appropriate and effective policy responses. A review of studies measuring the nature and extent of exposure to food promotions was conducted to identify approaches to monitoring food promotions via dominant media platforms. A step-wise approach, comprising 'minimal', 'expanded' and 'optimal' monitoring activities, was designed. This approach can be used to assess the frequency and level of exposure of population groups (especially children) to food promotions, the persuasive power of techniques used in promotional communications (power of promotions) and the nutritional composition of promoted food products. Detailed procedures for data sampling, data collection and data analysis for a range of media types are presented, as well as quantifiable measurement indicators for assessing exposure to and power of food and non-alcoholic beverage promotions. The proposed framework supports the development of a consistent system for monitoring food and non-alcoholic beverage promotions for comparison between countries and over time. © 2013 The Authors. Obesity Reviews published by John Wiley & Sons Ltd on behalf of the International Association for the Study of Obesity.
Experimental strategies to promote functional recovery after peripheral nerve injuries.
Gordon, Tessa; Sulaiman, Olawale; Boyd, J Gordon
2003-12-01
The capacity of Schwann cells (SCs) in the peripheral nervous system to support axonal regeneration, in contrast to the oligodendrocytes in the central nervous system, has led to the misconception that peripheral nerve regeneration always restores function. Here, we consider how prolonged periods of time that injured neurons remain without targets during axonal regeneration (chronic axotomy) and that SCs in the distal nerve stumps remain chronically denervated (chronic denervation) progressively reduce the number of motoneurons that regenerate their axons. We demonstrate the effectiveness of low-dose, brain-derived neurotrophic and glial-derived neurotrophic factors to counteract the effects of chronic axotomy in promoting axonal regeneration. High-dose brain-derived neurotrophic factor (BDNF) on the other hand, acting through the p75 receptor, inhibits axonal regeneration and may be a factor in stopping regenerating axons from forming neuromuscular connections in skeletal muscle. The immunophilin, FK506, is also effective in promoting axonal regeneration after chronic axotomy. Chronic denervation of SCs (>1 month) severely deters axonal regeneration, although the few motor axons that do regenerate to reinnervate muscles become myelinated and form enlarged motor units in the reinnervated muscles. We found that in vitro incubation of chronically denervated SCs with transforming growth factor-beta re-established their growth-supportive phenotype in vivo, consistent with the idea that the interaction between invading macrophages and denervated SCs during Wallerian degeneration is essential to sustain axonal regeneration by promoting the growth-supportive SC phenotype. Finally, we consider the effectiveness of a brief period of 20 Hz electrical stimulation in promoting the regeneration of axons across the surgical gap after nerve repair.
Johnson, Eric T; Berhow, Mark A; Dowd, Patrick F
2007-04-18
Hi II maize (Zea mays) plants were engineered to express maize p1 cDNA, a Myb transcription factor, controlled by a putative silk specific promoter, for secondary metabolite production and corn earworm resistance. Transgene expression did not enhance silk color, but about half of the transformed plant silks displayed browning when cut, which indicated the presence of p1-produced secondary metabolites. Levels of maysin, a secondary metabolite with insect toxicity, were highest in newly emerged browning silks. The insect resistance of transgenic silks was also highest at emergence, regardless of maysin levels, which suggests that other unidentified p1-induced molecules likely contributed to larval mortality. Mean survivor weights of corn earworm larvae fed mature browning transgenic silks were significantly lower than weights of those fed mature nonbrowning transgenic silks. Some transgenic pericarps browned with drying and contained similar molecules found in pericarps expressing a dominant p1 allele, suggesting that the promoter may not be silk-specific.
Du Plessis, Karin; Cronin, David; Corney, Tim; Green, Emma
2013-09-01
In Australia, blue-collar workers are predominantly male and form a unique and large (approximately 30%) subset of the Australian workforce. They exhibit particular health-related issues and, in comparison to other groups, often a lack of health promoting behavior. This article briefly discusses the Australian context and some of the key health issues blue-collar men face, in particular as it relates to construction workers. It reviews the impact of gender and socioeconomic factors in designing workplace health promotion interventions. This article considers practice strategies for health promoters in a specific workplace setting: it looks at meta-factors and industry-based contextual factors, including barriers to implementation and participation, while addressing common misconceptions about Australian blue-collar workers.
Fuzzy Rule-based Analysis of Promotional Efficiency in Vietnam’s Tourism Industry
Nguyen Quang VINH; Dam Van KHANH; Nguyen Viet ANH
2015-01-01
This study aims to determine an effective method of measuring the efficiency of promotional strategies for tourist destinations. Complicating factors that influence promotional efficiency (PE), such as promotional activities (PA), destination attribute (DA), and destination image (DI), make it difficult to evaluate the effectiveness of PE. This study develops a rule-based decision support mechanism using fuzzy set theory and the Analytic Hierarchy Process (AHP) to evaluate the effectiveness o...
Genome-wide analysis of promoter architecture in Drosophila melanogaster
Energy Technology Data Exchange (ETDEWEB)
Hoskins, Roger A.; Landolin, Jane M.; Brown, James B.; Sandler, Jeremy E.; Takahashi, Hazuki; Lassmann, Timo; Yu, Charles; Booth, Benjamin W.; Zhang, Dayu; Wan, Kenneth H.; Yang, Li; Boley, Nathan; Andrews, Justen; Kaufman, Thomas C.; Graveley, Brenton R.; Bickel, Peter J.; Carninci, Piero; Carlson, Joseph W.; Celniker, Susan E.
2010-10-20
Core promoters are critical regions for gene regulation in higher eukaryotes. However, the boundaries of promoter regions, the relative rates of initiation at the transcription start sites (TSSs) distributed within them, and the functional significance of promoter architecture remain poorly understood. We produced a high-resolution map of promoters active in the Drosophila melanogaster embryo by integrating data from three independent and complementary methods: 21 million cap analysis of gene expression (CAGE) tags, 1.2 million RNA ligase mediated rapid amplification of cDNA ends (RLMRACE) reads, and 50,000 cap-trapped expressed sequence tags (ESTs). We defined 12,454 promoters of 8037 genes. Our analysis indicates that, due to non-promoter-associated RNA background signal, previous studies have likely overestimated the number of promoter-associated CAGE clusters by fivefold. We show that TSS distributions form a complex continuum of shapes, and that promoters active in the embryo and adult have highly similar shapes in 95% of cases. This suggests that these distributions are generally determined by static elements such as local DNA sequence and are not modulated by dynamic signals such as histone modifications. Transcription factor binding motifs are differentially enriched as a function of promoter shape, and peaked promoter shape is correlated with both temporal and spatial regulation of gene expression. Our results contribute to the emerging view that core promoters are functionally diverse and control patterning of gene expression in Drosophila and mammals.
The influence of sales promotion elements on consumers (jsc „rimi lietuva“ sample)
Markovskaja, Ivona
2016-01-01
The influence of sales promotion elements on consumer is analyzed in the Bachelor‘s Thesis. The thesis examines the information published by various foreign and Lithuanian authors. The main aim of this paper is to analyze different theories of sales promotion effectiveness, sales promotion relevance and factors influencing consumer‘s behavior. This paper analyses the theoretical aspects of sales promotion. It has become more popular in the beginning of the sixth decade. The definition of conc...
Retinal glia promote dorsal root ganglion axon regeneration.
Directory of Open Access Journals (Sweden)
Barbara Lorber
Full Text Available Axon regeneration in the adult central nervous system (CNS is limited by several factors including a lack of neurotrophic support. Recent studies have shown that glia from the adult rat CNS, specifically retinal astrocytes and Müller glia, can promote regeneration of retinal ganglion cell axons. In the present study we investigated whether retinal glia also exert a growth promoting effect outside the visual system. We found that retinal glial conditioned medium significantly enhanced neurite growth and branching of adult rat dorsal root ganglion neurons (DRG in culture. Furthermore, transplantation of retinal glia significantly enhanced regeneration of DRG axons past the dorsal root entry zone after root crush in adult rats. To identify the factors that mediate the growth promoting effects of retinal glia, mass spectrometric analysis of retinal glial conditioned medium was performed. Apolipoprotein E and secreted protein acidic and rich in cysteine (SPARC were found to be present in high abundance, a finding further confirmed by western blotting. Inhibition of Apolipoprotein E and SPARC significantly reduced the neuritogenic effects of retinal glial conditioned medium on DRG in culture, suggesting that Apolipoprotein E and SPARC are the major mediators of this regenerative response.
Health promotion, occupational therapy and multiculturalism: lessons from research.
Dyck, I
1993-08-01
Principles of occupational therapy practice make the profession an important potential partner in health promotion initiatives for immigrant groups. Health promotion embodies the principles of self-definition of health needs by target groups, and working with a community in initiating and supporting programmes. This paper discusses the implications of an exploratory study of the daily activities of immigrant Indo-Canadian mothers for translating health promotion principles into practice. The research process and an analysis of interviews conducted with the women suggest factors to consider in using a health promotion framework with immigrants who have experienced social and economic dislocation through the immigration process. Discussion of household structure, divisions of labour, childcare strategies, and parenting concerns raises issues requiring particular attention in sharing occupational therapy skills and knowledge with ethnocultural communities.
Jackson, Erin S.; Tucker, Carolyn M.; Herman, Keith C.
2007-01-01
During their college years, students may adopt health-promoting lifestyles that bring about long-term benefits. Objective and Participants: The purpose of this study was to explore the roles of health value, family/friend social support, and health self-efficacy in the health-promoting lifestyles of a diverse sample of 162 college students.…
Crystallization of hepatocyte nuclear factor 4α (HNF4α) in complex with the HNF1α promoter element
Energy Technology Data Exchange (ETDEWEB)
Lu, Peng; Liu, Jianguo; Melikishvili, Manana; Fried, Michael G.; Chi, Young-In, E-mail: ychi@uky.edu [Department of Molecular and Cellular Biochemistry and Center for Structural Biology, University of Kentucky, Lexington, KY 40536 (United States)
2008-04-01
Sample preparation, characterization, crystallization and preliminary X-ray analysis are reported for the HNF4α–DNA binary complex. Hepatocyte nuclear factor 4α (HNF4α) is a member of the nuclear receptor superfamily that plays a central role in organ development and metabolic functions. Mutations on HNF4α cause maturity-onset diabetes of the young (MODY), a dominant monogenic cause of diabetes. In order to understand the molecular mechanism of promoter recognition and the molecular basis of disease-causing mutations, the recombinant HNF4α DNA-binding domain was prepared and used in a study of its binding properties and in crystallization with a 21-mer DNA fragment that contains the promoter element of another MODY gene, HNF1α. The HNF4α protein displays a cooperative and specific DNA-binding activity towards its target gene-recognition elements. Crystals of the complex diffract to 2.0 Å using a synchrotron-radiation source under cryogenic (100 K) conditions and belong to space group C2, with unit-cell parameters a = 121.63, b = 35.43, c = 70.99 Å, β = 119.36°. A molecular-replacement solution has been obtained and structure refinement is in progress. This structure and the binding studies will provide the groundwork for detailed functional and biochemical studies of the MODY mutants.
Crystallization of hepatocyte nuclear factor 4α (HNF4α) in complex with the HNF1α promoter element
International Nuclear Information System (INIS)
Lu, Peng; Liu, Jianguo; Melikishvili, Manana; Fried, Michael G.; Chi, Young-In
2008-01-01
Sample preparation, characterization, crystallization and preliminary X-ray analysis are reported for the HNF4α–DNA binary complex. Hepatocyte nuclear factor 4α (HNF4α) is a member of the nuclear receptor superfamily that plays a central role in organ development and metabolic functions. Mutations on HNF4α cause maturity-onset diabetes of the young (MODY), a dominant monogenic cause of diabetes. In order to understand the molecular mechanism of promoter recognition and the molecular basis of disease-causing mutations, the recombinant HNF4α DNA-binding domain was prepared and used in a study of its binding properties and in crystallization with a 21-mer DNA fragment that contains the promoter element of another MODY gene, HNF1α. The HNF4α protein displays a cooperative and specific DNA-binding activity towards its target gene-recognition elements. Crystals of the complex diffract to 2.0 Å using a synchrotron-radiation source under cryogenic (100 K) conditions and belong to space group C2, with unit-cell parameters a = 121.63, b = 35.43, c = 70.99 Å, β = 119.36°. A molecular-replacement solution has been obtained and structure refinement is in progress. This structure and the binding studies will provide the groundwork for detailed functional and biochemical studies of the MODY mutants
Functional significance of SPINK1 promoter variants in chronic pancreatitis.
Derikx, Monique H M; Geisz, Andrea; Kereszturi, Éva; Sahin-Tóth, Miklós
2015-05-01
Chronic pancreatitis is a progressive inflammatory disorder of the pancreas, which often develops as a result of genetic predisposition. Some of the most frequently identified risk factors affect the serine protease inhibitor Kazal type 1 (SPINK1) gene, which encodes a trypsin inhibitor responsible for protecting the pancreas from premature trypsinogen activation. Recent genetic and functional studies indicated that promoter variants in the SPINK1 gene might contribute to disease risk in carriers. Here, we investigated the functional effects of 17 SPINK1 promoter variants using luciferase reporter gene expression assay in four different cell lines, including three pancreatic acinar cell lines (rat AR42J with or without dexamethasone-induced differentiation and mouse 266-6) and human embryonic kidney 293T cells. We found that most variants caused relatively small changes in promoter activity. Surprisingly, however, we observed significant variations in the effects of the promoter variants in the different cell lines. Only four variants exhibited consistently reduced promoter activity in all acinar cell lines, confirming previous reports that variants c.-108G>T, c.-142T>C, and c.-147A>G are risk factors for chronic pancreatitis and identifying c.-52G>T as a novel risk variant. In contrast, variant c.-215G>A, which is linked with the disease-associated splice-site mutation c.194 + 2T>C, caused increased promoter activity, which may mitigate the overall effect of the pathogenic haplotype. Our study lends further support to the notion that sequence evaluation of the SPINK1 promoter region in patients with chronic pancreatitis is justified as part of the etiological investigation. Copyright © 2015 the American Physiological Society.
Analysis of tissue-specific region in sericin 1 gene promoter of Bombyx mori
Energy Technology Data Exchange (ETDEWEB)
Yan, Liu [College of Biomedical Engineering and Instrument Science, Zhejiang University, Hangzhou 310027 (China); Institute of Biochemistry and Cell Biology, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences, Shanghai 200031 (China); Lian, Yu [College of Biomedical Engineering and Instrument Science, Zhejiang University, Hangzhou 310027 (China); Zhejiang Province Key Laboratory of Preventive Veterinary Medicine, Institute of Preventive Veterinary Medicine, Zhejiang University, Hangzhou 310029 (China); Xiuyang, Guo [Institute of Biochemistry and Cell Biology, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences, Shanghai 200031 (China); Tingqing, Guo [Institute of Biochemistry and Cell Biology, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences, Shanghai 200031 (China); Shengpeng, Wang [Institute of Biochemistry and Cell Biology, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences, Shanghai 200031 (China); Changde, Lu [Institute of Biochemistry and Cell Biology, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences, Shanghai 200031 (China)
2006-03-31
The gene encoding sericin 1 (Ser1) of silkworm (Bombyx mori) is specifically expressed in the middle silk gland cells. To identify element involved in this transcription-dependent spatial restriction, truncation of the 5' terminal from the sericin 1 (Ser1) promoter is studied in vivo. A 209 bp DNA sequence upstream of the transcriptional start site (-586 to -378) is found to be responsible for promoting tissue-specific transcription. Analysis of this 209 bp region by overlapping deletion studies showed that a 25 bp region (-500 to -476) suppresses the ectopic expression of the Ser1 promoter. An unknown factor abundant in fat body nuclear extracts is shown to bind to this 25 bp fragment. These results suggest that this 25 bp region and the unknown factor are necessary for determining the tissue-specificity of the Ser1 promoter.
ROLE AND IMPORTANCE OF PROMOTIONAL ACTIVITIES IN RESTAURANT BUSINESS
Directory of Open Access Journals (Sweden)
Ivica Batinić
2014-07-01
Full Text Available Modern restaurant business, as part of a catering business, offers a variety of meals and beverages in restaurants and various related facilities. Promotional activities play a very important role in managing a restaurant and related facilities, because any serious restaurant facility must take all the necessary and effective measures in order to maintain regular guests and approach potential new guests. In this paper, I will write about conceptualizing restaurant business and elementary business systems in restaurant business. In a separate part, I will write about conceptualizing promotions and promotional activities as important factors in achieving better and more efficient communication of restaurants with regular and potential guests.
International Nuclear Information System (INIS)
Jaeaeskelaeinen, T.; Huhtakangas, J.; Maeenpaeae, P.H.
2005-01-01
The negative regulation of the human parathyroid hormone (PTH) gene by biologically active vitamin D 3 (1,25-dihydroxyvitamin D 3 ; 1,25(OH) 2 D 3 ) was studied in rat pituitary GH4C1 cells, which express factors needed for the negative regulation. We report here that NF-Y binds to sequences downstream of the site previously reported to bind the vitamin D receptor (VDR). Additional binding sites for NF-Y reside in the near vicinity and were shown to be important for full activity of the PTH gene promoter. VDR and NF-Y were shown to exhibit mutually exclusive binding to the VDRE region. According to our results, sequestration of binding partners for NF-Y by VDR also affects transcription through a NF-Y consensus binding element in GH4C1 but not in ROS17/2.8 cells. These results indicate that 1,25(OH) 2 D 3 may affect transcription of the human PTH gene both by competitive binding of VDR and NF-Y, and by modulating transcriptional activity of NF-Y
Moderating factors of immediate, gross, and net cross-brand effects of price promotions
C. Horváth (Csilla); D. Fok (Dennis)
2013-01-01
textabstractThis article examines cross-price promotional effects in a dynamic context. Among other things, we investigate whether previously established findings hold when consumer and competitive dynamics are taken into account. Five main influential effects (asymmetric price effect, neighborhood
Association between Interleukin-18 promoter polymorphisms and ...
African Journals Online (AJOL)
Noha M. Bakr
the study. Genotypic analysis of IL-18 promoter polymorphisms were performed using sequence- .... diabetes mellitus, heart disease, previous stroke, cigarette smok- ing. Included .... of the mutated AA genotype and A allele was observed in IS ..... factor for ischemic stroke in the Chinese population: a meta-analysis. Meta.
PDGFBB promotes PDGFR{alpha}-positive cell migration into artificial bone in vivo
Energy Technology Data Exchange (ETDEWEB)
Yoshida, Shigeyuki [Department of Dentistry and Oral Surgery, Keio University School of Medicine, 35 Shinano-machi, Shinjuku-ku, Tokyo 160-8582 (Japan); Center for Human Metabolomic Systems Biology, Keio University School of Medicine, 35 Shinano-machi, Shinjuku-ku, Tokyo 160-8582 (Japan); Iwasaki, Ryotaro; Kawana, Hiromasa [Department of Dentistry and Oral Surgery, Keio University School of Medicine, 35 Shinano-machi, Shinjuku-ku, Tokyo 160-8582 (Japan); Miyauchi, Yoshiteru [Center for Human Metabolomic Systems Biology, Keio University School of Medicine, 35 Shinano-machi, Shinjuku-ku, Tokyo 160-8582 (Japan); Department of Orthopedic Surgery, Keio University School of Medicine, 35 Shinano-machi, Shinjuku-ku, Tokyo 160-8582 (Japan); Department of Integrated Bone Metabolism and Immunology, Keio University School of Medicine, 35 Shinano-machi, Shinjuku-ku, Tokyo 160-8582 (Japan); Hoshi, Hiroko; Miyamoto, Hiroya; Mori, Tomoaki [Center for Human Metabolomic Systems Biology, Keio University School of Medicine, 35 Shinano-machi, Shinjuku-ku, Tokyo 160-8582 (Japan); Department of Orthopedic Surgery, Keio University School of Medicine, 35 Shinano-machi, Shinjuku-ku, Tokyo 160-8582 (Japan); Kanagawa, Hiroya [Department of Orthopedic Surgery, Keio University School of Medicine, 35 Shinano-machi, Shinjuku-ku, Tokyo 160-8582 (Japan); Katsuyama, Eri; Fujie, Atsuhiro [Center for Human Metabolomic Systems Biology, Keio University School of Medicine, 35 Shinano-machi, Shinjuku-ku, Tokyo 160-8582 (Japan); Department of Orthopedic Surgery, Keio University School of Medicine, 35 Shinano-machi, Shinjuku-ku, Tokyo 160-8582 (Japan); Hao, Wu [Department of Orthopedic Surgery, Keio University School of Medicine, 35 Shinano-machi, Shinjuku-ku, Tokyo 160-8582 (Japan); and others
2012-05-18
Highlights: Black-Right-Pointing-Pointer We examined effects of PDGFBB in PDGFR{alpha} positive cell migration in artificial bones. Black-Right-Pointing-Pointer PDGFBB was not expressed in osteoblastic cells but was expressed in peripheral blood cells. Black-Right-Pointing-Pointer PDGFBB promoted PDGFR{alpha} positive cell migration into artificial bones but not osteoblast proliferation. Black-Right-Pointing-Pointer PDGFBB did not inhibit osteoblastogenesis. -- Abstract: Bone defects caused by traumatic bone loss or tumor dissection are now treated with auto- or allo-bone graft, and also occasionally by artificial bone transplantation, particularly in the case of large bone defects. However, artificial bones often exhibit poor affinity to host bones followed by bony union failure. Thus therapies combining artificial bones with growth factors have been sought. Here we report that platelet derived growth factor bb (PDGFBB) promotes a significant increase in migration of PDGF receptor {alpha} (PDGFR{alpha})-positive mesenchymal stem cells/pre-osteoblastic cells into artificial bone in vivo. Growth factors such as transforming growth factor beta (TGF{beta}) and hepatocyte growth factor (HGF) reportedly inhibit osteoblast differentiation; however, PDGFBB did not exhibit such inhibitory effects and in fact stimulated osteoblast differentiation in vitro, suggesting that combining artificial bones with PDGFBB treatment could promote host cell migration into artificial bones without inhibiting osteoblastogenesis.
Noda, Chieko; Narita, Yohei; Watanabe, Takahiro; Yoshida, Masahiro; Ashio, Keiji; Sato, Yoshitaka; Goshima, Fumi; Kanda, Teru; Yoshiyama, Hironori; Tsurumi, Tatsuya; Kimura, Hiroshi
2016-01-01
ABSTRACT Latent membrane protein 1 (LMP1) is a major oncogene essential for primary B cell transformation by Epstein-Barr virus (EBV). Previous studies suggested that some transcription factors, such as PU.1, RBP-Jκ, NF-κB, and STAT, are involved in this expression, but the underlying mechanism is unclear. Here, we identified binding sites for PAX5, AP-2, and EBF in the proximal LMP1 promoter (ED-L1p). We first confirmed the significance of PU.1 and POU domain transcription factor binding for activation of the promoter in latency III. We then focused on the transcription factors AP-2 and early B cell factor (EBF). Interestingly, among the three AP-2-binding sites in the LMP1 promoter, two motifs were also bound by EBF. Overexpression, knockdown, and mutagenesis in the context of the viral genome indicated that AP-2 plays an important role in LMP1 expression in latency II in epithelial cells. In latency III B cells, on the other hand, the B cell-specific transcription factor EBF binds to the ED-L1p and activates LMP1 transcription from the promoter. IMPORTANCE Epstein-Barr virus (EBV) latent membrane protein 1 (LMP1) is crucial for B cell transformation and oncogenesis of other EBV-related malignancies, such as nasopharyngeal carcinoma and T/NK lymphoma. Its expression is largely dependent on the cell type or condition, and some transcription factors have been implicated in its regulation. However, these previous reports evaluated the significance of specific factors mostly by reporter assay. In this study, we prepared point-mutated EBV at the binding sites of such transcription factors and confirmed the importance of AP-2, EBF, PU.1, and POU domain factors. Our results will provide insight into the transcriptional regulation of the major oncogene LMP1. PMID:26819314
Chen, Mei-Fang; Wang, Ruey-Hsia; Hung, Shu-Ling
2015-11-01
The aim of this study was to apply Bandura social learning theory in a model for identifying personal and environmental factors that predict health-promoting self-care behaviors in people with pre-diabetes. The theoretical basis of health-promoting self-care behaviors must be examined to obtain evidence-based knowledge that can help improve the effectiveness of pre-diabetes care. However, such behaviors are rarely studied in people with pre-diabetes. This quantitative, cross-sectional survey study was performed in a convenience sample of two hospitals in southern Taiwan. Two hundred people diagnosed with pre-diabetes at a single health examination center were recruited. A questionnaire survey was performed to collect data regarding personal factors (i.e., participant characteristics, pre-diabetes knowledge, and self-efficacy) and data regarding environmental factors (i.e., social support and perceptions of empowerment process) that may have associations with health-promoting self-care behaviors in people with pre-diabetes. Multiple linear regression showed that the factors that had the largest influence on the practice of health-promoting self-care behaviors were self-efficacy, diabetes history, perceptions of empowerment process, and pre-diabetes knowledge. These factors explained 59.3% of the variance in health-promoting self-care behaviors. To prevent the development of diabetes in people with pre-diabetes, healthcare professionals should consider both the personal and the environmental factors identified in this study when assessing health promoting self-care behaviors in patients with pre-diabetes and when selecting the appropriate interventions. Copyright © 2015 Elsevier Inc. All rights reserved.
Fuzzy Rule-based Analysis of Promotional Efficiency in Vietnam’s Tourism Industry
Directory of Open Access Journals (Sweden)
Nguyen Quang VINH
2015-06-01
Full Text Available This study aims to determine an effective method of measuring the efficiency of promotional strategies for tourist destinations. Complicating factors that influence promotional efficiency (PE, such as promotional activities (PA, destination attribute (DA, and destination image (DI, make it difficult to evaluate the effectiveness of PE. This study develops a rule-based decision support mechanism using fuzzy set theory and the Analytic Hierarchy Process (AHP to evaluate the effectiveness of promotional strategies. Additionally, a statistical analysis is conducted using SPSS (Statistics Package for Social Science to confirm the results of the fuzzy AHP analysis. This study finds that government policy is the most important factor for PE and that service staff (internal beauty is more important than tourism infrastructure (external beauty in terms of customer satisfaction and long-term strategy in PE. With respect to DI, experts are concerned first with tourist perceived value, second with tourist satisfaction and finally with tourist loyalty.
Dunkl, Anita; Jiménez, Paul
2017-03-01
Reaching the actual target group for a web-based health promotion project turns out to be a difficult task. In this article, individual and organizational factors which can influence the decision of using apps in workplace health promotion are analyzed. Furthermore, we analyzed the opinion about feedback possibilities of apps in workplace health promotion. A study with 438 leaders was conducted, as leaders can be seen as a key factor in the success of health promotion projects. The results showed that younger leaders and leaders with a more positive attitude toward workplace health promotion are more likely to use an app. Furthermore, leaders with a positive attitude are more interested in expert-feedback than in instant feedback received from an app.
Eukaryotic genomes may exhibit up to 10 generic classes of gene promoters
Directory of Open Access Journals (Sweden)
Gagniuc Paul
2012-09-01
Full Text Available Abstract Background The main function of gene promoters appears to be the integration of different gene products in their biological pathways in order to maintain homeostasis. Generally, promoters have been classified in two major classes, namely TATA and CpG. Nevertheless, many genes using the same combinatorial formation of transcription factors have different gene expression patterns. Accordingly, we tried to ask ourselves some fundamental questions: Why certain genes have an overall predisposition for higher gene expression levels than others? What causes such a predisposition? Is there a structural relationship of these sequences in different tissues? Is there a strong phylogenetic relationship between promoters of closely related species? Results In order to gain valuable insights into different promoter regions, we obtained a series of image-based patterns which allowed us to identify 10 generic classes of promoters. A comprehensive analysis was undertaken for promoter sequences from Arabidopsis thaliana, Drosophila melanogaster, Homo sapiens and Oryza sativa, and a more extensive analysis of tissue-specific promoters in humans. We observed a clear preference for these species to use certain classes of promoters for specific biological processes. Moreover, in humans, we found that different tissues use distinct classes of promoters, reflecting an emerging promoter network. Depending on the tissue type, comparisons made between these classes of promoters reveal a complementarity between their patterns whereas some other classes of promoters have been observed to occur in competition. Furthermore, we also noticed the existence of some transitional states between these classes of promoters that may explain certain evolutionary mechanisms, which suggest a possible predisposition for specific levels of gene expression and perhaps for a different number of factors responsible for triggering gene expression. Our conclusions are based on
Zhuo, Yi; Wang, Lei; Ge, Lite; Li, Xuan; Duan, Da; Teng, Xiaohua; Jiang, Miao; Liu, Kai; Yuan, Ting; Wu, Pei; Wang, Hao; Deng, Yujia; Xie, Huali; Chen, Ping; Xia, Ying; Lu, Ming
2017-08-01
Olfactory mucosa mesenchymal stem cells (OM-MSCs) display significant clonogenic activity and may be easily propagated for Parkinson's disease therapies. Methods of inducing OM-MSCs to differentiate into dopaminergic (DAergic) neurons using olfactory ensheathing cells (OECs) are thus an attractive topic of research. We designed a hypoxic induction protocol to generate DAergic neurons from OM-MSCs using a physiological oxygen (O 2 ) level of 3% and OEC-conditioned medium (OCM; HI group). The normal induction (NI) group was cultured in O 2 at ambient air level (21%). The role of hypoxia-inducible factor-1α (HIF-1α) in the differentiation of OM-MSCs under hypoxia was investigated by treating cells with an HIF-1α inhibitor before induction (HIR group). The proportions of β-tubulin- and tyrosine hydroxylase (TH)-positive cells were significantly increased in the HI group compared with the NI and HIR groups, as shown by immunocytochemistry and Western blotting. Furthermore, the level of dopamine was significantly increased in the HI group. A slow outward potassium current was recorded in differentiated cells after 21 d of induction using whole-cell voltage-clamp tests. A hypoxic environment thus promotes OM-MSCs to differentiate into DAergic neurons by increasing the expression of HIF-1α and by activating downstream target gene TH. This study indicated that OCM under hypoxic conditions could significantly upregulate key transcriptional factors involved in the development of DAergic neurons from OM-MSCs, mediated by HIF-1α. Hypoxia promotes DAergic neuronal differentiation of OM-MSCs, and HIF-1α may play an important role in hypoxia-inducible pathways during DAergic lineage specification and differentiation in vitro.
Health Promotion Challenges at Sea - a Danish Case
DEFF Research Database (Denmark)
Hjarnø, Lulu
HEALTH PROMOTOIN CHALLENGES AT SEA - A DANISH CASE L Hjarnoe, Centre for Maritime Health and Safety, Institute of Public Health, University of Southern Denmark INTRODUCTION: For the past 15 years the need for health promotion initiatives in the maritime sector has become more and more evident. Thus...... previous studies have documented increased mortality and morbidity (incidences) among seafarers, not only due to accidents but also to lifestyle like cardiovascular disease, lung cancer and diseases related to alcohol. These diseases are related to factors like alcohol consumption, obesity, physical...... inactivity and smoking, which for the latter three are factors highly represented in the maritime industry. The aim of this study is to identify the current health status of seafarers and to detect, strengths and weaknesses of health promotion interventions implemented in this target group. METHODS: A 1 year...
Perrine, Susan P.; Mankidy, Rishikesh; Boosalis, Michael S.; Bieker, James J.; Faller, Douglas V.
2011-01-01
Objectives The erythroid Kruppel-like factor (EKLF) is an essential transcription factor for β-type globin gene switching, and specifically activates transcription of the adult β-globin gene promoter. We sought to determine if EKLF is also required for activation of the γ-globin gene by short-chain fatty acid (SCFA) derivatives, which are now entering clinical trials. Methods The functional and physical interaction of EKLF and co-regulatory molecules with the endogenous human globin gene promoters was studied in primary human erythroid progenitors and cell lines, using chromatin immunoprecipitation (ChIP) assays and genetic manipulation of the levels of EKLF and co-regulators. Results and conclusions Knockdown of EKLF prevents SCFA-induced expression of the γ-globin promoter in a stably expressed μLCRβprRlucAγprFluc cassette, and prevents induction of the endogenous γ-globin gene in primary human erythroid progenitors. EKLF is actively recruited to endogenous γ-globin gene promoters after exposure of primary human erythroid progenitors, and murine hematopoietic cell lines, to SCFA derivatives. The core ATPase BRG1 subunit of the human SWI/WNF complex, a ubiquitous multimeric complex that regulates gene expression by remodeling nucleosomal structure, is also required for γ-globin gene induction by SCFA derivatives. BRG1 is actively recruited to the endogenous γ-globin promoter of primary human erythroid progenitors by exposure to SCFA derivatives, and this recruitment is dependent upon the presence of EKLF. These findings demonstrate that EKLF, and the co-activator BRG1, previously demonstrated to be required for definitive or adult erythropoietic patterns of globin gene expression, are co-opted by SCFA derivatives to activate the fetal globin genes. PMID:19220418
Directory of Open Access Journals (Sweden)
Min Ju Yi
2017-03-01
Full Text Available PurposeThe most common single nucleotide polymorphism in the IGFBP3 promoter region occurs at position -202. This polymorphic variation occurs frequently and may influence growth hormone responsiveness and somatic growth. However, the effects of IGFBP3 promoter polymorphism on growth in children are unknown.MethodsRestriction fragment length polymorphism-based genotyping of the -202 single nucleotide polymorphism was performed in 146 Korean girls aged between 15 and 16 years, who were selected randomly from the Seoul School Health Promotion Center. The participants were divided into 3 groups (tall, medium, and short according to the height percentile established from normal reference values for Korean children. The serum levels of insulin-like growth factor I (IGF-I and IGF-binding protein-3 (IGFBP-3 were then compared according to genotype.ResultsThe genotype distribution in the participants was 79 AA (54.1%, 60 AC (41.1%, and 7 CC (4.8%. The C allele frequency at the -202 IGFBP3 position was 25.4% in this group. The mean serum IGFBP-3 concentration in girls with the AA genotype was higher than that in girls with the AC genotype in the medium (P=0.047 and short (P=0.035 groups, respectively. There was no difference in the IGF-I to IGFBP-3 molar ratio between the AA and AC genotype groups (P=0.161.ConclusionIn conclusion, the -202 polymorphism in the IGFBP3 promoter region is assumed to affect the serum concentration of IGFBP-3 in children as well as in adults. However, it is unclear whether this affects physical development according to the concentration of IGFBP-3.
Zhou, Fei; Sun, Tian-Hu; Zhao, Lei; Pan, Xi-Wu; Lu, Shan
2015-01-01
The Artemisia annua L. β-pinene synthase QH6 was previously determined to be circadian-regulated at the transcriptional level, showing a rhythmic fluctuation of steady-state transcript abundances. Here we isolated both the genomic sequence and upstream promoter region of QH6. Different regulatory elements, such as G-box (TGACACGTGGCA, -421 bp from the translation initiation site) which might have effects on rhythmic gene expression, were found. Using the yeast one-hybrid and electrophoretic mobility shift assay (EMSA), we confirmed that the bZIP transcription factor HY5 binds to this motif of QH6. Studies with promoter truncations before and after this motif suggested that this G-box was important for the diurnal fluctuation of the transgenic β-glucuronidase gene (GUS) transcript abundance in Arabidopsis thaliana. GUS gene driven by the promoter region immediately after G-box showed an arrhythmic expression in both light/dark (LD) and constant dark (DD) conditions, whereas the control with G-box retained its fluctuation in both LD and DD. We further transformed A. thaliana with the luciferase gene (LUC) driven by an 1400 bp fragment upstream QH6 with its G-box intact or mutated, respectively. The luciferase activity assay showed that a peak in the early morning disappeared in the mutant. Gene expression analysis also demonstrated that the rhythmic expression of LUC was abolished in the hy5-1 mutant.
Factors affecting health-promoting lifestyle profile in Iranian male seafarers working on tankers
DEFF Research Database (Denmark)
Baygi, Fereshteh; Jensen, Olaf Chresten; Mohammadi-Nasrabadi, Fatemeh
2017-01-01
-sectional study was performed on 200 Iranian male seafarers in 2015. A self-administered socio-demographic and Health Promotion Lifestyle Profile II (HPLP-II) questionnaire was completed. One-way analysis of variance was used to identify significant differences among the various departments. The t......-test was utilised to compare the HPLP-II scores according to the demographic variables. Multiple linear regression analysis was performed to assess the association between demographic variables and the overall HPLP-II score, in addition to the six health-promoting lifestyle subscale scores. RESULTS: The mean age...... (19.95 ± 4.23). The lowest score for nutrition was found among the seafarers working in the engine department (engine: 20.41 ± 4.50, deck: 23.52 ± 4.97, and galley: 24.83 ± 4.64) (p Working in the engine department was found to have a significant negative effect on the nutrition score (B = -3...
HMGA2 promotes adipogenesis by activating C/EBPβ-mediated expression of PPARγ
Energy Technology Data Exchange (ETDEWEB)
Xi, Yang; Shen, Wanjing; Ma, Lili; Zhao, Ming; Zheng, Jiachen [Diabetes Center, and Zhejiang Provincial Key Laboratory of Pathophysiology, Institute of Biochemistry and Molecular Biology, School of Medicine, Ningbo University, Ningbo 315211 (China); Bu, Shizhong, E-mail: bushizhong@nbu.edu.cn [Diabetes Center, and Zhejiang Provincial Key Laboratory of Pathophysiology, Institute of Biochemistry and Molecular Biology, School of Medicine, Ningbo University, Ningbo 315211 (China); Hino, Shinjiro [Department of Medical Cell Biology, Institute of Molecular Embryology and Genetics, Kumamoto University, Kumamoto, 860-0811 (Japan); Nakao, Mitsuyoshi, E-mail: mnakao@gpo.kumamoto-u.ac.jp [Department of Medical Cell Biology, Institute of Molecular Embryology and Genetics, Kumamoto University, Kumamoto, 860-0811 (Japan); Core Research for Evolutional Science and Technology (CREST), Japan Agency for Medical Research and Development, Tokyo (Japan)
2016-04-15
Adipogenesis is orchestrated by a highly ordered network of transcription factors including peroxisome-proliferator activated receptor-gamma (PPARγ) and CCAAT-enhancer binding protein (C/EBP) family proteins. High mobility group protein AT-hook 2 (HMGA2), an architectural transcription factor, has been reported to play an essential role in preadipocyte proliferation, and its overexpression has been implicated in obesity in mice and humans. However, the direct role of HMGA2 in regulating the gene expression program during adipogenesis is not known. Here, we demonstrate that HMGA2 is required for C/EBPβ-mediated expression of PPARγ, and thus promotes adipogenic differentiation. We observed a transient but marked increase of Hmga2 transcript at an early phase of differentiation of mouse 3T3-L1 preadipocytes. Importantly, Hmga2 knockdown greatly impaired adipocyte formation, while its overexpression promoted the formation of mature adipocytes. We found that HMGA2 colocalized with C/EBPβ in the nucleus and was required for the recruitment of C/EBPβ to its binding element at the Pparγ2 promoter. Accordingly, HMGA2 and C/EBPβ cooperatively enhanced the Pparγ2 promoter activity. Our results indicate that HMGA2 is an essential constituent of the adipogenic transcription factor network, and thus its function may be affected during the course of obesity. - Highlights: • Overexpression of HMGA2 has been implicated in obesity in mice and humans. • HMGA2 is required for adipocyte formation. • HMGA2 colocalizes with C/EBPβ and is required for C/EBPβ recruitment to Pparγ2 promoter. • HMGA2 and C/EBPβ cooperatively enhance the Pparγ2 promoter activity.
HMGA2 promotes adipogenesis by activating C/EBPβ-mediated expression of PPARγ
International Nuclear Information System (INIS)
Xi, Yang; Shen, Wanjing; Ma, Lili; Zhao, Ming; Zheng, Jiachen; Bu, Shizhong; Hino, Shinjiro; Nakao, Mitsuyoshi
2016-01-01
Adipogenesis is orchestrated by a highly ordered network of transcription factors including peroxisome-proliferator activated receptor-gamma (PPARγ) and CCAAT-enhancer binding protein (C/EBP) family proteins. High mobility group protein AT-hook 2 (HMGA2), an architectural transcription factor, has been reported to play an essential role in preadipocyte proliferation, and its overexpression has been implicated in obesity in mice and humans. However, the direct role of HMGA2 in regulating the gene expression program during adipogenesis is not known. Here, we demonstrate that HMGA2 is required for C/EBPβ-mediated expression of PPARγ, and thus promotes adipogenic differentiation. We observed a transient but marked increase of Hmga2 transcript at an early phase of differentiation of mouse 3T3-L1 preadipocytes. Importantly, Hmga2 knockdown greatly impaired adipocyte formation, while its overexpression promoted the formation of mature adipocytes. We found that HMGA2 colocalized with C/EBPβ in the nucleus and was required for the recruitment of C/EBPβ to its binding element at the Pparγ2 promoter. Accordingly, HMGA2 and C/EBPβ cooperatively enhanced the Pparγ2 promoter activity. Our results indicate that HMGA2 is an essential constituent of the adipogenic transcription factor network, and thus its function may be affected during the course of obesity. - Highlights: • Overexpression of HMGA2 has been implicated in obesity in mice and humans. • HMGA2 is required for adipocyte formation. • HMGA2 colocalizes with C/EBPβ and is required for C/EBPβ recruitment to Pparγ2 promoter. • HMGA2 and C/EBPβ cooperatively enhance the Pparγ2 promoter activity.
DEFF Research Database (Denmark)
Frödin, M; Gammeltoft, S
1994-01-01
We have investigated the effects of insulin-like growth factors (IGFs), basic fibroblast growth factor (bFGF), and nerve growth factor (NGF) on DNA synthesis in cultured chromaffin cells from fetal, neonatal, and adult rats by using 5-bromo-2'-deoxyuridine (BrdUrd) pulse labeling for 24 or 48 h...... implications for improving the survival of chromaffin cell implants in diseased human brain....
The Predictive Factors of the Promotion of Physical Activity by Air Force Squadron Commanders
National Research Council Canada - National Science Library
Whelan, Dana
2001-01-01
This research examined the relationship between beliefs about physical activity, physical activity levels, age and the promotional practices for physical activity employed by Air Force squadron commanders...
Escherichia coli promoter sequences predict in vitro RNA polymerase selectivity.
Mulligan, M E; Hawley, D K; Entriken, R; McClure, W R
1984-01-11
We describe a simple algorithm for computing a homology score for Escherichia coli promoters based on DNA sequence alone. The homology score was related to 31 values, measured in vitro, of RNA polymerase selectivity, which we define as the product KBk2, the apparent second order rate constant for open complex formation. We found that promoter strength could be predicted to within a factor of +/-4.1 in KBk2 over a range of 10(4) in the same parameter. The quantitative evaluation was linked to an automated (Apple II) procedure for searching and evaluating possible promoters in DNA sequence files.
International Nuclear Information System (INIS)
Hayfield, F.
1986-04-01
When the first nuclear power programme is decided upon, automatically the country has to initiate in parallel a programme to modify or add to its current industrial structure and resources. The extent of this new industrialisation depends upon many factors which both, the Government and the Industries have to consider. The Government has a vital role which includes the setting up of the background against which the industrial promotion should take place and in many cases may have also to play an active role all along this programme. Equally, the existing industries have an important role so as to achieve the most efficient participation in the nuclear programme. Invariably the industrial promotional programme will incur a certain degree of transfer of technology, the extent depending on the policies adopted. For this technology transfer to take place efficiently, both the donor and the receiver have to recognise each other's legitimate ambitions and fears. The transfer of technology is a process having a high human content and both donor and receiver have to take this into account. This can be further complicated when there is a difference in culture between them. Technology transfer is carried out within a contractual and organisational framework which will identify the donor (licensor) and the receiver (licensee). This framework may take various forms from a simple cooperative agreement, through a joint-venture organisation right to a standard contract between two separate entities. Each arrangement has its advantages and drawbacks and requires investment of different degrees. One of the keys to a successful industrial promotion is having it carried out in a timely fashion which will be parallel with the nuclear power programme. Experience in some countries has shown the problems when the industrialisation is out of phase with the programme whilst in other cases this industrialisation was at a level and scale unjustified. (author)
Huijg, J.M.; Gebhardt, W.A.; Verheijden, M.W.; Zouwe, N. van der; Vries, J.D. de; Middelkoop, B.J.C.; Crone, M.R.
2015-01-01
Background: Despite the promising findings related to the efficacy of interventions aimed at promoting physical activity (PA) in primary health care (PHC), the translation of these interventions to PHC practice does not always happen as desired. Purpose: To help understand why efficacious PHC-based
Health promotion: An effective tool for global health
Directory of Open Access Journals (Sweden)
Sanjiv Kumar
2012-01-01
Full Text Available Health promotion is very relevant today. There is a global acceptance that health and social wellbeing are determined by many factors outside the health system which include socioeconomic conditions, patterns of consumption associated with food and communication, demographic patterns, learning environments, family patterns, the cultural and social fabric of societies; sociopolitical and economic changes, including commercialization and trade and global environmental change. In such a situation, health issues can be effectively addressed by adopting a holistic approach by empowering individuals and communities to take action for their health, fostering leadership for public health, promoting intersectoral action to build healthy public policies in all sectors and creating sustainable health systems. Although, not a new concept, health promotion received an impetus following Alma Ata declaration. Recently it has evolved through a series of international conferences, with the first conference in Canada producing the famous Ottawa charter. Efforts at promoting health encompassing actions at individual and community levels, health system strengthening and multi sectoral partnership can be directed at specific health conditions. It should also include settings-based approach to promote health in specific settings such as schools, hospitals, workplaces, residential areas etc. Health promotion needs to be built into all the policies and if utilized efficiently will lead to positive health outcomes.
Kim, June-Sik; Mizoi, Junya; Yoshida, Takuya; Fujita, Yasunari; Nakajima, Jun; Ohori, Teppei; Todaka, Daisuke; Nakashima, Kazuo; Hirayama, Takashi; Shinozaki, Kazuo; Yamaguchi-Shinozaki, Kazuko
2011-12-01
In plants, osmotic stress-responsive transcriptional regulation depends mainly on two major classes of cis-acting elements found in the promoter regions of stress-inducible genes: ABA-responsive elements (ABREs) and dehydration-responsive elements (DREs). ABRE has been shown to perceive ABA-mediated osmotic stress signals, whereas DRE is known to be involved in an ABA-independent pathway. Previously, we reported that the transcription factor DRE-BINDING PROTEIN 2A (DREB2A) regulates DRE-mediated transcription of target genes under osmotic stress conditions in Arabidopsis (Arabidopsis thaliana). However, the transcriptional regulation of DREB2A itself remains largely uncharacterized. To elucidate the transcriptional mechanism associated with the DREB2A gene under osmotic stress conditions, we generated a series of truncated and base-substituted variants of the DREB2A promoter and evaluated their transcriptional activities individually. We found that both ABRE and coupling element 3 (CE3)-like sequences located approximately -100 bp from the transcriptional initiation site are necessary for the dehydration-responsive expression of DREB2A. Coupling our transient expression analyses with yeast one-hybrid and chromatin immunoprecipitation (ChIP) assays indicated that the ABRE-BINDING PROTEIN 1 (AREB1), AREB2 and ABRE-BINDING FACTOR 3 (ABF3) bZIP transcription factors can bind to and activate the DREB2A promoter in an ABRE-dependent manner. Exogenous ABA application induced only a modest accumulation of the DREB2A transcript when compared with the osmotic stress treatment. However, the osmotic stress-induced DREB2A expression was found to be markedly impaired in several ABA-deficient and ABA-insensitive mutants. These results suggest that in addition to an ABA-independent pathway, the ABA-dependent pathway plays a positive role in the osmotic stress-responsive expression of DREB2A.
Fonseca, João Eurico; Cavaleiro, João; Teles, José; Sousa, Elsa; Andreozzi, Valeska L; Antunes, Marília; Amaral-Turkman, Maria A; Canhão, Helena; Mourão, Ana F; Lopes, Joana; Caetano-Lopes, Joana; Weinmann, Pamela; Sobral, Marta; Nero, Patrícia; Saavedra, Maria J; Malcata, Armando; Cruz, Margarida; Melo, Rui; Braña, Araceli; Miranda, Luis; Patto, José V; Barcelos, Anabela; da Silva, José Canas; Santos, Luís M; Figueiredo, Guilherme; Rodrigues, Mário; Jesus, Herberto; Quintal, Alberto; Carvalho, Teresa; da Silva, José A Pereira; Branco, Jaime; Queiroz, Mário Viana
2007-01-01
The objective of this study was to assess whether clinical measures of rheumatoid arthritis activity and severity were influenced by tumor necrosis factor-alpha (TNF-alpha) promoter genotype/haplotype markers. Each patient's disease activity was assessed by the disease activity score using 28 joint counts (DAS28) and functional capacity by the Health Assessment Questionnaire (HAQ) score. Systemic manifestations, radiological damage evaluated by the Sharp/van der Heijde (SvdH) score, disease-modifying anti-rheumatic drug use, joint surgeries, and work disability were also assessed. The promoter region of the TNF-alpha gene, between nucleotides -1,318 and +49, was sequenced using an automated platform. Five hundred fifty-four patients were evaluated and genotyped for 10 single-nucleotide polymorphism (SNP) markers, but 5 of these markers were excluded due to failure to fall within Hardy-Weinberg equilibrium or to monomorphism. Patients with more than 10 years of disease duration (DD) presented significant associations between the -857 SNP and systemic manifestations, as well as joint surgeries. Associations were also found between the -308 SNP and work disability in patients with more than 2 years of DD and radiological damage in patients with less than 10 years of DD. A borderline effect was found between the -238 SNP and HAQ score and radiological damage in patients with 2 to 10 years of DD. An association was also found between haplotypes and the SvdH score for those with more than 10 years of DD. An association was found between some TNF-alpha promoter SNPs and systemic manifestations, radiological progression, HAQ score, work disability, and joint surgeries, particularly in some classes of DD and between haplotypes and radiological progression for those with more than 10 years of DD.
Energy Technology Data Exchange (ETDEWEB)
Panzer, Christian; Auer, Hans; Lettner, Georg [Technische Univ. Wien (Austria). Energy Economics Group (EEG)
2014-03-15
Efficient promotion of electricity production from offshore wind stands in dynamic relationship with various influence factors, the most important of which are promotion instruments, topographic givens, regulation of grid connection, and supraregional market integration concepts. Using three case studies from different countries to highlight national differences in the promotion of offshore wind power plants the present analysis points out ways of improving the efficiency of promotion instruments.
Directory of Open Access Journals (Sweden)
Rafael Estrada-Avilés
Full Text Available Calsequestrin-2 (CASQ2 is the main Ca2+-binding protein inside the sarcoplasmic reticulum of cardiomyocytes. Previously, we demonstrated that MEF-2 and SRF binding sites within the human CASQ2 gene (hCASQ2 promoter region are functional in neonatal cardiomyocytes. In this work, we investigated if the calcineurin/NFAT pathway regulates hCASQ2 expression in neonatal cardiomyocytes. The inhibition of NFAT dephosphorylation with CsA or INCA-6, reduced both the luciferase activity of hCASQ2 promoter constructs (-3102/+176 bp and -288/+176 bp and the CASQ2 mRNA levels in neonatal rat cardiomyocytes. Additionally, NFATc1 and NFATc3 over-expressing neonatal cardiomyocytes showed a 2-3-fold increase in luciferase activity of both hCASQ2 promoter constructs, which was prevented by CsA treatment. Site-directed mutagenesis of the -133 bp MEF-2 binding site prevented trans-activation of hCASQ2 promoter constructs induced by NFAT overexpression. Chromatin Immunoprecipitation (ChIP assays revealed NFAT and MEF-2 enrichment within the -288 bp to +76 bp of the hCASQ2 gene promoter. Besides, a direct interaction between NFAT and MEF-2 proteins was demonstrated by protein co-immunoprecipitation experiments. Taken together, these data demonstrate that NFAT interacts with MEF-2 bound to the -133 bp binding site at the hCASQ2 gene promoter. In conclusion, in this work, we demonstrate that the Ca2+-calcineurin/NFAT pathway modulates the transcription of the hCASQ2 gene in neonatal cardiomyocytes.
ACSNI study group on human factors
International Nuclear Information System (INIS)
1993-01-01
Organisational failures are now recognised as being as important as mechanical failures or individual human errors in causing major accidents such as the capsize of the Herald of Free Enterprise or the Pipa Alpha disaster. The Human Factors Study Group of the Advisory Committee on the Safety of Nuclear Installations was set up to look at the part played by human factors in nuclear risk and its reduction. The third report of the Study Group considers the role played by organisational factors and management in promoting nuclear safety. Actions to review and promote a safety culture are suggested. Three main conclusions are drawn and several recommendations made. (UK)
Promotion and resignation in employee networks
Yuan, Jia; Zhang, Qian-Ming; Gao, Jian; Zhang, Linyan; Wan, Xue-Song; Yu, Xiao-Jun; Zhou, Tao
2016-02-01
Enterprises have put more and more emphasis on data analysis so as to obtain effective management advices. Managers and researchers are trying to dig out the major factors that lead to employees' promotion and resignation. Most previous analyses are based on questionnaire survey, which usually consists of a small fraction of samples and contains biases caused by psychological defense. In this paper, we successfully collect a data set consisting of all the employees' work-related interactions (action network, AN for short) and online social connections (social network, SN for short) of a company, which inspires us to reveal the correlations between structural features and employees' career development, namely promotion and resignation. Through statistical analysis, we show that the structural features of both AN and SN are correlated and predictive to employees' promotion and resignation, and the AN has higher correlation and predictability. More specifically, the in-degree in AN is the most relevant indicator for promotion, while the k-shell index in AN and in-degree in SN are both very predictive to resignation. Our results provide a novel and actionable understanding of enterprise management and suggest that to enhance the interplays among employees, no matter work-related or social interplays, can be helpful to reduce staffs' turnover risk.
A Dual-Promoter Gene Orchestrates the Sucrose-Coordinated Synthesis of Starch and Fructan in Barley
Energy Technology Data Exchange (ETDEWEB)
Jin, Yunkai; Fei, Mingliang; Rosenquist, Sara; Jin, Lu; Gohil, Suresh; Sandström, Corine; Olsson, Helena; Persson, Cecilia; Höglund, Anna-Stina; Fransson, Gunnel; Ruan, Ying; Åman, Per; Jansson, Christer; Liu, Chunlin; Andersson, Roger; Sun, Chuanxin
2017-12-01
Starch and fructan are two important carbohydrates in many flowering plants and in human diets. Understanding how plants allocate photosynthates and how they prioritize synthesis of different carbohydrates during development is essential in efforts to improve cereals for increased stress tolerance and for desirable carbohydrate compositions in food and feed. We report the coordinated synthesis of starch and fructan in barley, orchestrated by two functionally opposing transcription factors encoded from two alternative promoters, one intronic/exonic, harbored on a single gene. . This dual-transcription factor system employs an autoregulatory, antagonsitic mechanism in sensing sucrose at one promoter, potentially via sucrose/glucose/fructose/trehalose 6-phosphate signaling, and conduct a coordinated synthesis of starch and fructan synthesis by competitive transcription factor binding to the second promoter The finding of an intron/exon-spanning promoter in a hosting gene, resulting in proteins with distinct functions, contributes to our appreciation of the complexity of the plant genome As a case in point for the physiological role of the antagonistic transcription factor system, we have demonstrated that it can be exploited in breeding barley with tailored amounts of fructan for production of specialty food ingredients.
Acceptance-based behavior therapy to promote HIV medication adherence.
Moitra, Ethan; Herbert, James D; Forman, Evan M
2011-12-01
A significant number of adults with HIV in the USA do not maintain adherence to highly active antiretroviral therapy (HAART) at adequate levels. Although traditional cognitive behavioral interventions have shown promise in promoting HAART adherence, acceptance-based behavior therapy (ABBT) may be particularly useful in this population. ABBT has the potential to overcome common avoidance-based barriers associated with poor adherence, including denial of various illness-related factors and avoidance of stigmatization. We describe the rationale for promoting psychological and behavioral acceptance in HIV-positive populations; outline an ABBT to promote HAART adherence targeting primary care patients from urban, minority, low socioeconomic backgrounds; and report preliminary qualitative observations of treatment feasibility and acceptability.
What do health-promoting schools promote?
DEFF Research Database (Denmark)
Simovska, Venka
2012-01-01
-promotion interventions. Directly or indirectly the articles reiterate the idea that health promotion in schools needs to be linked with the core task of the school – education, and to the values inherent to education, such as inclusion, democracy, participation and influence, critical literacy and action competence......Purpose – The editorial aims to provide a brief overview of the individual contributions to the special issue, and a commentary positioning the contributions within research relating to the health-promoting schools initiative in Europe. Design/methodology/approach – The members of the Schools...... for Health in Europe Research Group were invited to submit their work addressing processes and outcomes in school health promotion to this special issue of Health Education. Additionally, an open call for papers was published on the Health Education web site. Following the traditional double blind peer...
Directory of Open Access Journals (Sweden)
Matsutani Sachiko
2004-08-01
Full Text Available Abstract Background In eukaryotes, RNA polymerase III (RNAP III transcribes the genes for small RNAs like tRNAs, 5S rRNA, and several viral RNAs, and short interspersed repetitive elements (SINEs. The genes for these RNAs and SINEs have internal promoters that consist of two regions. These two regions are called the A and B blocks. The multisubunit transcription factor TFIIIC is required for transcription initiation of RNAP III; in transcription of tRNAs, the B-block binding subunit of TFIIIC recognizes a promoter. Although internal promoter sequences are conserved in eukaryotes, no evidence of homology between the B-block binding subunits of vertebrates and yeasts has been reported previously. Results Here, I reported the results of PSI-BLAST searches using the B-block binding subunits of human and Shizosacchromyces pombe as queries, showing that the same Arabidopsis proteins were hit with low E-values in both searches. Comparison of the convergent iterative alignments obtained by these PSI-BLAST searches revealed that the vertebrate, yeast, and Arabidopsis proteins have similarities in their N-terminal one-third regions. In these regions, there were three domains with conserved sequence similarities, one located in the N-terminal end region. The N-terminal end region of the B-block binding subunit of Saccharomyces cerevisiae is tentatively identified as a HMG box, which is the DNA binding motif. Although I compared the alignment of the N-terminal end regions of the B-block binding subunits, and their homologs, with that of the HMG boxes, it is not clear whether they are related. Conclusion Molecular phylogenetic analyses using the small subunit rRNA and ubiquitous proteins like actin and α-tubulin, show that fungi are more closely related to animals than either is to plants. Interestingly, the results obtained in this study show that, with respect to the B-block binding subunits of TFIIICs, animals appear to be evolutionarily closer to plants
Matsutani, Sachiko
2004-08-09
In eukaryotes, RNA polymerase III (RNAP III) transcribes the genes for small RNAs like tRNAs, 5S rRNA, and several viral RNAs, and short interspersed repetitive elements (SINEs). The genes for these RNAs and SINEs have internal promoters that consist of two regions. These two regions are called the A and B blocks. The multisubunit transcription factor TFIIIC is required for transcription initiation of RNAP III; in transcription of tRNAs, the B-block binding subunit of TFIIIC recognizes a promoter. Although internal promoter sequences are conserved in eukaryotes, no evidence of homology between the B-block binding subunits of vertebrates and yeasts has been reported previously. Here, I reported the results of PSI-BLAST searches using the B-block binding subunits of human and Shizosacchromyces pombe as queries, showing that the same Arabidopsis proteins were hit with low E-values in both searches. Comparison of the convergent iterative alignments obtained by these PSI-BLAST searches revealed that the vertebrate, yeast, and Arabidopsis proteins have similarities in their N-terminal one-third regions. In these regions, there were three domains with conserved sequence similarities, one located in the N-terminal end region. The N-terminal end region of the B-block binding subunit of Saccharomyces cerevisiae is tentatively identified as a HMG box, which is the DNA binding motif. Although I compared the alignment of the N-terminal end regions of the B-block binding subunits, and their homologs, with that of the HMG boxes, it is not clear whether they are related. Molecular phylogenetic analyses using the small subunit rRNA and ubiquitous proteins like actin and alpha-tubulin, show that fungi are more closely related to animals than either is to plants. Interestingly, the results obtained in this study show that, with respect to the B-block binding subunits of TFIIICs, animals appear to be evolutionarily closer to plants than to fungi.
Trompette, Justine; Kivits, Joëlle; Minary, Laetitia; Cambon, Linda; Alla, François
2014-11-04
The effects of health promotion interventions are the result not only of the interventions themselves, but also of the contexts in which they unfold. The objective of this study was to analyze, through stakeholders' discourse, the characteristics of an intervention that can influence its outcomes. This case study was based on semi-structured interviews with health promotion stakeholders involved in a regional program (PRALIMAP). General hypotheses on transferability and on how the intervention is presumed to produce its effects were used to construct an interview guide. Interviews were analyzed using thematic coding. Twenty-three stakeholders were interviewed. Results showed stakeholders made few references to population and environment characteristics. Three themes emerged as significant for the stakeholders: implementation modalities and methodology, modalities used to mobilize actors; and transferability-promoting factors and barriers. Our work contributes to a better understanding not only of transferability factors, but also of stakeholders' perceptions of them, which are just as important, because those perceptions themselves are a factor in mobilization of actors, implementation, and transferability.
Energy Technology Data Exchange (ETDEWEB)
Khin, Sann Sanda [Kobe University Graduate School of Medicine, Division of Diagnostic Molecular Pathology, Kobe 650-0017 (Japan); Pathology Research Unit, Department of Medical Research (Central Myanmar), Naypyitaw, Union of (Myanmar); Kitazawa, Riko [Kobe University Graduate School of Medicine, Division of Diagnostic Molecular Pathology, Kobe 650-0017 (Japan); Ehime University Graduate School of Medicine, Toon 791-0295, Ehime (Japan); Kondo, Takeshi; Idei, Yuka; Fujimoto, Masayo [Kobe University Graduate School of Medicine, Division of Diagnostic Molecular Pathology, Kobe 650-0017 (Japan); Haraguchi, Ryuma [Ehime University Graduate School of Medicine, Toon 791-0295, Ehime (Japan); Mori, Kiyoshi [Kobe University Graduate School of Medicine, Division of Diagnostic Molecular Pathology, Kobe 650-0017 (Japan); Kitazawa, Sohei, E-mail: kitazawa@m.ehime-u.ac.jp [Kobe University Graduate School of Medicine, Division of Diagnostic Molecular Pathology, Kobe 650-0017 (Japan); Ehime University Graduate School of Medicine, Toon 791-0295, Ehime (Japan)
2011-03-03
Epigenetic alterations in cancer, especially DNA methylation and histone modification, exert a significant effect on the deregulated expression of cancer-related genes and lay an epigenetic pathway to carcinogenesis and tumor progression. Global hypomethylation and local hypermethylation of CpG islands in the promoter region, which result in silencing tumor suppressor genes, constitute general and major epigenetic modification, the hallmark of the neoplastic epigenome. Additionally, methylation-induced gene silencing commonly affects a number of genes and increases with cancer progression. Indeed, cancers with a high degree of methylation (CpG island methylator phenotype/CIMP) do exist and represent a distinct subset of certain cancers including colorectal, bladder and kidney. On the other hand, signals from the microenvironment, especially those from transforming growth factor-β (TGF-β), induce targeted de novo epigenetic alterations of cancer-related genes. While TGF-β signaling has been implicated in two opposite roles in cancer, namely tumor suppression and tumor promotion, its deregulation is also partly induced by epigenetic alteration itself. Although the epigenetic pathway to carcinogenesis and cancer progression has such reciprocal complexity, the important issue is to identify genes or signaling pathways that are commonly silenced in various cancers in order to find early diagnostic and therapeutic targets. In this review, we focus on the epigenetic alteration by DNA methylation and its role in molecular modulations of the TGF-β signaling pathway that cause or underlie altered cancer-related gene expression in both phases of early carcinogenesis and late cancer progression.
International Nuclear Information System (INIS)
Khin, Sann Sanda; Kitazawa, Riko; Kondo, Takeshi; Idei, Yuka; Fujimoto, Masayo; Haraguchi, Ryuma; Mori, Kiyoshi; Kitazawa, Sohei
2011-01-01
Epigenetic alterations in cancer, especially DNA methylation and histone modification, exert a significant effect on the deregulated expression of cancer-related genes and lay an epigenetic pathway to carcinogenesis and tumor progression. Global hypomethylation and local hypermethylation of CpG islands in the promoter region, which result in silencing tumor suppressor genes, constitute general and major epigenetic modification, the hallmark of the neoplastic epigenome. Additionally, methylation-induced gene silencing commonly affects a number of genes and increases with cancer progression. Indeed, cancers with a high degree of methylation (CpG island methylator phenotype/CIMP) do exist and represent a distinct subset of certain cancers including colorectal, bladder and kidney. On the other hand, signals from the microenvironment, especially those from transforming growth factor-β (TGF-β), induce targeted de novo epigenetic alterations of cancer-related genes. While TGF-β signaling has been implicated in two opposite roles in cancer, namely tumor suppression and tumor promotion, its deregulation is also partly induced by epigenetic alteration itself. Although the epigenetic pathway to carcinogenesis and cancer progression has such reciprocal complexity, the important issue is to identify genes or signaling pathways that are commonly silenced in various cancers in order to find early diagnostic and therapeutic targets. In this review, we focus on the epigenetic alteration by DNA methylation and its role in molecular modulations of the TGF-β signaling pathway that cause or underlie altered cancer-related gene expression in both phases of early carcinogenesis and late cancer progression
Jin, Feng Jie; Takahashi, Tadashi; Matsushima, Ken-ichiro; Hara, Seiichi; Shinohara, Yasutomo; Maruyama, Jun-ichi; Kitamoto, Katsuhiko; Koyama, Yasuji
2011-07-01
Most known basic-region helix-loop-helix (bHLH) proteins belong to a superfamily of transcription factors often involved in the control of growth and differentiation. Therefore, inappropriate expression of genes encoding bHLH proteins is frequently associated with developmental dysfunction. In our previously reported study, a novel bHLH protein-encoding gene (AO090011000215) of Aspergillus oryzae was identified. The gene-disrupted strain was found to produce dense conidia, but sparse sclerotia, relative to the parent strain. Here, to further analyze its function, we generated an overexpressing strain using the A. oryzae amyB gene promoter. Genetic overexpression led to a large number of initial hyphal aggregations and then the formation of mature sclerotia; it was therefore designated sclR (sclerotium regulator). At the same time, the sclR-overexpressing strain also displayed both delayed and decreased conidiation. Scanning electron microscopy indicated that the aerial hyphae of the sclR-overexpressing strain were extremely branched and intertwined with each other. In the generation of the SclR-enhanced green fluorescent protein (EGFP) expression strain, the SclR-EGFP protein fusion was conditionally detected in the nuclei. In addition, the loss of sclR function led to rapid protein degradation and cell lysis in dextrin-polypeptone-yeast extract liquid medium. Taken together, these observations indicate that SclR plays an important role in hyphal morphology, asexual conidiospore formation, and the promotion of sclerotial production, even retaining normal cell function, at least in submerged liquid culture.
Directory of Open Access Journals (Sweden)
Isaacs Richard J
2007-05-01
Full Text Available Abstract Background Topoisomerase IIα has been shown to be down-regulated in doxorubicin-resistant cell lines. The specificity proteins Sp1 and Sp3 have been implicated in regulation of topoisomerase IIα transcription, although the mechanism by which they regulate expression is not fully understood. Sp1 has been shown to bind specifically to both proximal and distal GC elements of the human topoisomerase IIα promoter in vitro, while Sp3 binds only to the distal GC element unless additional flanking sequences are included. While Sp1 is thought to be an activator of human topoisomerase IIα, the functional significance of Sp3 binding is not known. Therefore, we sought to determine the functional relationship between Sp1 and Sp3 binding to the topoisomerase IIα promoter in vivo. We investigated endogenous levels of Sp1, Sp3 and topoisomerase IIα as well as binding of both Sp1 and Sp3 to the GC boxes of the topoisomerase IIα promoter in breast cancer cell lines in vivo after short term doxorubicin exposure. Results Functional effects of Sp1 and Sp3 were studied using transient cotransfection assays using a topoisomerase IIα promoter reporter construct. The in vivo interactions of Sp1 and Sp3 with the GC elements of the topoisomerase IIα promoter were studied in doxorubicin-treated breast cancer cell lines using chromatin immunoprecipitation assays. Relative amounts of endogenous proteins were measured using immunoblotting. In vivo DNA looping mediated by proteins bound at the GC1 and GC2 elements was studied using the chromatin conformation capture assay. Both Sp1 and Sp3 bound to the GC1 and GC2 regions. Sp1 and Sp3 were transcriptional activators and repressors respectively, with Sp3 repression being dominant over Sp1-mediated activation. The GC1 and GC2 elements are linked in vivo to form a loop, thus bringing distal regulatory elements and their cognate transcription factors into close proximity with the transcription start site
A promoter-level mammalian expression atlas
Forest, Alistair R R
2014-03-26
Regulated transcription controls the diversity, developmental pathways and spatial organization of the hundreds of cell types that make up a mammal. Using single-molecule cDNA sequencing, we mapped transcription start sites (TSSs) and their usage in human and mouse primary cells, cell lines and tissues to produce a comprehensive overview of mammalian gene expression across the human body. We find that few genes are truly ‘housekeeping’, whereas many mammalian promoters are composite entities composed of several closely separated TSSs, with independent cell-type-specific expression profiles. TSSs specific to different cell types evolve at different rates, whereas promoters of broadly expressed genes are the most conserved. Promoter-based expression analysis reveals key transcription factors defining cell states and links them to binding-site motifs. The functions of identified novel transcripts can be predicted by coexpression and sample ontology enrichment analyses. The functional annotation of the mammalian genome 5 (FANTOM5) project provides comprehensive expression profiles and functional annotation of mammalian cell-type-specific transcriptomes with wide applications in biomedical research.
A promoter-level mammalian expression atlas
Forest, Alistair R R; Kawaji, Hideya; Rehli, Michael; Baillie, John Kenneth; De Hoon, Michiel Jl L; Haberle, Vanja; Lassmann, Timo; Kulakovskiy, Ivan V.; Lizio, Marina; Itoh, Masayoshi; Andersson, Robin; Iida, Kei; Ikawa, Tomokatsu; Jankovic, Boris R.; Jia, Hui; Joshi, Anagha Madhusudan; Jurman, Giuseppe; Kaczkowski, Bogumił; Kai, Chieko; Kaida, Kaoru; Kaiho, Ai; Mungall, Christopher J.; Kajiyama, Kazuhiro; Kanamori-Katayama, Mutsumi; Kasianov, Artem S.; Kasukawa, Takeya; Katayama, Shintaro; Kato, Sachi; Kawaguchi, Shuji; Kawamoto, Hiroshi; Kawamura, Yuki I.; Kawashima, Tsugumi; Meehan, Terrence F.; Kempfle, Judith S.; Kenna, Tony J.; Kere, Juha; Khachigian, Levon M.; Kitamura, Toshio; Klinken, Svend Peter; Knox, Alan; Kojima, Miki; Kojima, Soichi; Kondo, Naoto; Schmeier, Sebastian; Koseki, Haruhiko; Koyasu, Shigeo; Krampitz, Sarah; Kubosaki, Atsutaka; Kwon, Andrew T.; Laros, Jeroen F J; Lee, Weonju; Lennartsson, Andreas; Li, Kang; Lilje, Berit; Bertin, Nicolas; Lipovich, Leonard; MacKay-Sim, Alan; Manabe, Riichiroh; Mar, Jessica; Marchand, Benoî t; Mathelier, Anthony; Mejhert, Niklas; Meynert, Alison M.; Mizuno, Yosuke; De Morais, David A Lima; Jø rgensen, Mette Christine; Morikawa, Hiromasa; Morimoto, Mitsuru; Moro, Kazuyo; Motakis, Efthymios; Motohashi, Hozumi; Mummery, Christine L.; Murata, Mitsuyoshi; Nagao-Sato, Sayaka; Nakachi, Yutaka; Nakahara, Fumio; Dimont, Emmanuel; Nakamura, Toshiyuki; Nakamura, Yukio; Nakazato, Kenichi; Van Nimwegen, Erik; Ninomiya, Noriko; Nishiyori, Hiromi; Noma, Shohei; Nozaki, Tadasuke; Ogishima, Soichi; Ohkura, Naganari; Arner, Erik; Ohmiya, Hiroko; Ohno, Hiroshi; Ohshima, Mitsuhiro; Okada-Hatakeyama, Mariko; Okazaki, Yasushi; Orlando, Valerio; Ovchinnikov, Dmitry A.; Pain, Arnab; Passier, Robert C J J; Patrikakis, Margaret; Schmidl, Christian; Persson, Helena A.; Piazza, Silvano; Prendergast, James G D; Rackham, Owen J L; Ramilowski, Jordan A.; Rashid, Mamoon; Ravasi, Timothy; Rizzu, Patrizia; Roncador, Marco; Roy, Sugata; Schaefer, Ulf; Rye, Morten Beck; Saijyo, Eri; Sajantila, Antti; Saka, Akiko; Sakaguchi, Shimon; Sakai, Mizuho; Sato, Hiroki; Satoh, Hironori; Savvi, Suzana; Saxena, Alka; Medvedeva, Yulia; Schneider, Claudio H.; Schultes, Erik A.; Schulze-Tanzil, Gundula G.; Schwegmann, Anita; Sengstag, Thierry; Sheng, Guojun; Shimoji, Hisashi; Shimoni, Yishai; Shin, Jay W.; Simon, Chris M.; Plessy, Charles; Sugiyama, Daisuke; Sugiyama, Takaaki; Suzuki, Masanori; Suzuki, Naoko; Swoboda, Rolf K.; 't Hoen, Peter Ac Chr; Tagami, Michihira; Tagami, Naokotakahashi; Takai, Jun; Tanaka, Hiroshi; Vitezic, Morana; Tatsukawa, Hideki; Tatum, Zuotian; Thompson, Mark; Toyoda, Hiroo; Toyoda, Tetsuro; Valen, Eivind; Van De Wetering, Marc L.; Van Den Berg, Linda M.; Verardo, Roberto; Vijayan, Dipti; Severin, Jessica M.; Vorontsov, Ilya E.; Wasserman, Wyeth W.; Watanabe, Shoko; Wells, Christine A.; Winteringham, Louise Natalie; Wolvetang, Ernst Jurgen; Wood, Emily J.; Yamaguchi, Yoko; Yamamoto, Masayuki; Yoneda, Misako; Semple, Colin Am M; Yonekura, Yohei; Yoshida, Shigehiro; Zabierowski, Susan E.; Zhang, Peter; Zhao, Xiaobei; Zucchelli, Silvia; Summers, Kim M.; Suzuki, Harukazu; Daub, Carsten Olivier; Kawai, Jun; Ishizu, Yuri; Heutink, Peter; Hide, Winston; Freeman, Tom C.; Lenhard, Boris; Bajic, Vladimir B.; Taylor, Martin S.; Makeev, Vsevolod J.; Sandelin, Albin; Hume, David A.; Carninci, Piero; Young, Robert S.; Hayashizaki, Yoshihide Yoshihide; Francescatto, Margherita; Altschuler, Intikhab Alam; Albanese, Davide; Altschule, Gabriel M.; Arakawa, Takahiro; Archer, John A.C.; Arner, Peter; Babina, Magda; Rennie, Sarah; Balwierz, Piotr J.; Beckhouse, Anthony G.; Pradhan-Bhatt, Swati; Blake, Judith A.; Blumenthal, Antje; Bodega, Beatrice; Bonetti, Alessandro; Briggs, James A.; Brombacher, Frank; Burroughs, Alexander Maxwell; Califano, Andrea C.; Cannistraci, Carlo; Carbajo, Daniel; Chen, Yun; Chierici, Marco; Ciani, Yari; Clevers, Hans C.; Dalla, Emiliano; Davis, Carrie Anne; Detmar, Michael J.; Diehl, Alexander D.; Dohi, Taeko; Drablø s, Finn; Edge, Albert SB B; Edinger, Matthias G.; Ekwall, Karl; Endoh, Mitsuhiro; Enomoto, Hideki; Fagiolini, Michela; Fairbairn, Lynsey R.; Fang, Hai; Farach-Carson, Mary Cindy; Faulkner, Geoffrey J.; Favorov, Alexander V.; Fisher, Malcolm E.; Frith, Martin C.; Fujita, Rie; Fukuda, Shiro; Furlanello, Cesare; Furuno, Masaaki; Furusawa, Junichi; Geijtenbeek, Teunis Bh H; Gibson, Andrew P.; Gingeras, Thomas R.; Goldowitz, Dan; Gough, Julian; Guhl, Sven; Guler, Reto; Gustincich, Stefano; Ha, Thomas; Hamaguchi, Masahide; Hara, Mitsuko; Harbers, Matthias; Harshbarger, Jayson; Hasegawa, Akira; Hasegawa, Yuki; Hashimoto, Takehiro; Herlyn, Meenhard F.; Hitchens, Kelly J.; Sui, Shannan J Ho; Hofmann, Oliver M.; Hoof, Ilka; Hori, Fumi; Huminiecki, Łukasz B.
2014-01-01
Regulated transcription controls the diversity, developmental pathways and spatial organization of the hundreds of cell types that make up a mammal. Using single-molecule cDNA sequencing, we mapped transcription start sites (TSSs) and their usage in human and mouse primary cells, cell lines and tissues to produce a comprehensive overview of mammalian gene expression across the human body. We find that few genes are truly ‘housekeeping’, whereas many mammalian promoters are composite entities composed of several closely separated TSSs, with independent cell-type-specific expression profiles. TSSs specific to different cell types evolve at different rates, whereas promoters of broadly expressed genes are the most conserved. Promoter-based expression analysis reveals key transcription factors defining cell states and links them to binding-site motifs. The functions of identified novel transcripts can be predicted by coexpression and sample ontology enrichment analyses. The functional annotation of the mammalian genome 5 (FANTOM5) project provides comprehensive expression profiles and functional annotation of mammalian cell-type-specific transcriptomes with wide applications in biomedical research.
Breast Cancer Cell Colonization of the Human Bone Marrow Adipose Tissue Niche.
Templeton, Zach S; Lie, Wen-Rong; Wang, Weiqi; Rosenberg-Hasson, Yael; Alluri, Rajiv V; Tamaresis, John S; Bachmann, Michael H; Lee, Kitty; Maloney, William J; Contag, Christopher H; King, Bonnie L
2015-12-01
Bone is a preferred site of breast cancer metastasis, suggesting the presence of tissue-specific features that attract and promote the outgrowth of breast cancer cells. We sought to identify parameters of human bone tissue associated with breast cancer cell osteotropism and colonization in the metastatic niche. Migration and colonization patterns of MDA-MB-231-fLuc-EGFP (luciferase-enhanced green fluorescence protein) and MCF-7-fLuc-EGFP breast cancer cells were studied in co-culture with cancellous bone tissue fragments isolated from 14 hip arthroplasties. Breast cancer cell migration into tissues and toward tissue-conditioned medium was measured in Transwell migration chambers using bioluminescence imaging and analyzed as a function of secreted factors measured by multiplex immunoassay. Patterns of breast cancer cell colonization were evaluated with fluorescence microscopy and immunohistochemistry. Enhanced MDA-MB-231-fLuc-EGFP breast cancer cell migration to bone-conditioned versus control medium was observed in 12/14 specimens (P = .0014) and correlated significantly with increasing levels of the adipokines/cytokines leptin (P = .006) and IL-1β (P = .001) in univariate and multivariate regression analyses. Fluorescence microscopy and immunohistochemistry of fragments underscored the extreme adiposity of adult human bone tissues and revealed extensive breast cancer cell colonization within the marrow adipose tissue compartment. Our results show that breast cancer cells migrate to human bone tissue-conditioned medium in association with increasing levels of leptin and IL-1β, and colonize the bone marrow adipose tissue compartment of cultured fragments. Bone marrow adipose tissue and its molecular signals may be important but understudied components of the breast cancer metastatic niche. Copyright © 2015 The Authors. Published by Elsevier Inc. All rights reserved.
Introducing modern technology to promote transparency in health services.
Islam, Mohammad Shafiqul
2015-01-01
Quantitative indicators show that Bangladeshi maternal and child healthcare is progressing satisfactorily. However, healthcare quality is still inadequate. It is hypothesised that modern technology enhances healthcare quality. Therefore, the purpose of this paper is to investigate how modern technology such as electronic record keeping and the internet can contribute to enhancing Bangladeshi healthcare quality. This study also explores how socio-economic and political factors affect the healthcare quality. This paper is based on a qualitative case study involving 68 in-depth interviews with healthcare professionals, elected representatives, local informants and five focus group discussions with healthcare service users to understand technology's effect on health service quality. The study has been conducted in one rural and one urban service organisations to understand how various factors contribute differently to healthcare quality. The findings show that modern technology, such as the internet and electronic devices for record keeping, contribute significantly to enhancing health service transparency, which in turn leads to quality health and family planning services. The findings also show that information and communication technology (ICT) is an effective mechanism for reducing corruption and promoting transparency. However, resource constraints impact adversely on the introduction of technology, which leads to less transparent healthcare. Progress in education and general socio-economic conditions makes it suitable to enhance ICT usage, which could lead to healthcare transparency, but political and bureaucratic factors pose a major challenge to ensure transparency. This paper can be a useful guide for promoting governance and healthcare quality in developing countries including Bangladesh. It analyses the ICT challenges that healthcare staff face when promoting transparent healthcare. This paper provides a deeper understanding of transparency and healthcare
Levin, Lia; Sefati, Noga
2018-04-23
Unemployment is a harsh social phenomenon with far reaching negative implications. Unemployed individuals often seek assistance from social workers working in Municipal Departments of Social Services around the world. However, little to no research exists on the factors involved in social workers' choice to engage in employment-promoting practices (EPP). The current study aimed to tackle this gap of knowledge, providing initial conclusions about the relationship between social workers' attitudes towards unemployment, their knowledge regarding EPP, the extent to which they perceive their organisations as endorsing EPP and their actual implementation. The main research question dealt with the extent to which each of the examined factors, in itself or in combination with others, would be the best predictor of social workers' utilisation of EPP. The study sample consisted of 163 social workers in Israel with varied experience in working with the unemployed, all working in public sector social services. Structural equation modelling performed on the attained data revealed that knowledge, skills and perceived organisational endorsement of EPP were positively associated with implementation of EPP. Contrary to the hypothesised, attitudes towards unemployment were not associated with the implementation of such practices. At the same time, professional training and seniority were associated with EPP only through the mediation of perceived organisational endorsement. Ultimately, perceived organisational endorsement of EPP emerged as the most influential factor involved in social workers' decision to carry out EPP with their service-users. Consequences of these findings for social work education, supervision, research and policy making are discussed, referring to the local Israeli context as well as its possible international inferences. © 2018 John Wiley & Sons Ltd.
[Work as a basic human need and health promoting factor].
Bertazzi, P A
2010-01-01
that due to violent causes, but also mortality for all causes, cardiovascular diseases and cancer. A survey in the Turin area, Northern Italy, showed a twofold increase in mortality among unemployed men. Women were affected both by husbands' unemployment and by their own unemployment because of the previous increasing rate of female occupation. The worse the occupational condition (from "seeking work" to "temporary employment" down to "unemployed and no longer seeking work") the higher the mortality: in the latter category, where the most evident problem is marginalization and social exclusion, the increase in mortality was fourfold. The role of occupational health physicians is to recognize the possible negative effects of working conditions and at the same time promote a positive approach to work, even in difficult conditions. This makes prevention more effective and promotes health. To be aware of the meaning of work makes work itself more liveable and more productive. This is how health promotion contributes to the wellbeing of the individual and, at the same time, to the development of the economy and society at large.
Banday, Mujeeb Zafar; Balkhi, Henah Mehraj; Hamid, Zeenat; Sameer, Aga Syed; Chowdri, Nissar A; Haq, Ehtishamul
2016-09-01
Inflammation constitutes one of the important components of colorectal cancer (CRC) pathogenesis. Tumor necrosis factor-α (TNF-α), a cytokine and an important inflammatory mediator plays a pivotal role in the malignant cellular proliferation, angiogenesis, tissue invasion and metastasis in CRC. The studies on association of various polymorphisms in human TNF-α gene including TNF-α-308G/A single nucleotide polymorphism (SNP) are limited, mixed and inconclusive. The aim of this study was to analyze the association of TNF-α-308G/A promoter SNP with colorectal cancer (CRC) susceptibility and development risk and also to evaluate the modifying effects of possible TNF-α-308G/A genotypes on different risk factors of CRC in ethnic population of Kashmir, India through a case-control setup. The genotype frequencies of TNF-α-308G/A promoter SNP were compared between 142 CRC patients and 184 individually matched healthy controls by using polymerase chain reaction and restriction fragment length polymorphism (PCR-RFLP) method. The associations between the TNF-α-308G/A SNP and CRC risk were examined through conditional logistic regression models adjusted for multiple possible confounding (third) variables. Further, the associations between this SNP and various clinico-pathological parameters, demographic variables and environmental factors within the case group subjects with regard to CRC risk were also evaluated. The association between the TNF-α-308G/A SNP and the modulation of risk of CRC was not found to be significant (p value = 0.156). The effect of less common TNF-α-308A allele on the risk of colorectal cancer was also not found to be significant (p value = 0.175). The variant genotype (AA) was nonexistent in the study population. Further, we found no significant effect modulation of CRC risk by wild and heterozygous TNF-α-308G/A SNP genotypes in presence of different possible risk factors (p > 0.05). We also found no significant association of TNF-α-308
International Nuclear Information System (INIS)
Kwon, Deug-Nam; Park, Mi-Ryung; Park, Jong-Yi; Cho, Ssang-Goo; Park, Chankyu; Oh, Jae-Wook; Song, Hyuk; Kim, Jae-Hwan; Kim, Jin-Hoi
2011-01-01
Highlights: → The sequences of -604 to -84 bp of the pUPII promoter contained the region of a putative negative cis-regulatory element. → The core promoter was located in the 5F-1. → Transcription factor HNF4 can directly bind in the pUPII core promoter region, which plays a critical role in controlling promoter activity. → These features of the pUPII promoter are fundamental to development of a target-specific vector. -- Abstract: Uroplakin II (UPII) is a one of the integral membrane proteins synthesized as a major differentiation product of mammalian urothelium. UPII gene expression is bladder specific and differentiation dependent, but little is known about its transcription response elements and molecular mechanism. To identify the cis-regulatory elements in the pig UPII (pUPII) gene promoter region, we constructed pUPII 5' upstream region deletion mutants and demonstrated that each of the deletion mutants participates in controlling the expression of the pUPII gene in human bladder carcinoma RT4 cells. We also identified a new core promoter region and putative negative cis-regulatory element within a minimal promoter region. In addition, we showed that hepatocyte nuclear factor 4 (HNF4) can directly bind in the pUPII core promoter (5F-1) region, which plays a critical role in controlling promoter activity. Transient cotransfection experiments showed that HNF4 positively regulates pUPII gene promoter activity. Thus, the binding element and its binding protein, HNF4 transcription factor, may be involved in the mechanism that specifically regulates pUPII gene transcription.
Peng, Chuanhui; Hu, Wendi; Weng, Xiaoyu; Tong, Rongliang; Cheng, Shaobing; Ding, Chaofeng; Xiao, Heng; Lv, Zhen; Xie, Haiyang; Zhou, Lin; Wu, Jian; Zheng, Shusen
2017-06-23
It has been reported that long non-coding RNA PANDA was disregulated in varieties types of tumor, but its expression level and biological role in hepatocellular carcinoma (HCC) remains contradictory. We detected PANDA expression in two independent cohorts (48 HCC patients following liver transplantation and 84 HCC patients following liver resection), and found that PANDA was down-regulated in HCC. Thereafter we explored its function in cancer biology by inversing its low expression. Surprisingly, overexpression of PANDA promoted HCC proliferation and carcinogenesis in vitro and in vivo. Mechanistically, PANDA repressed transcriptional activity of senescence associated inflammatory factor IL8, which leaded to inhibition of cellular senescence. Therefore, our research help to better understand the complex role of PANDA in HCC, and suggest more thoughtful strategies should be applied before it can be treated as a potential therapeutic target.
Directory of Open Access Journals (Sweden)
Fei eZhou
2015-04-01
Full Text Available The Artemisia annua L. β-pinene synthase QH6 was previously determined to be circadian-regulated at the transcriptional level, showing a rhythmic fluctuation of steady-state transcript abundances. Here we isolated both the genomic sequence and upstream promoter region of QH6. Different regulatory elements, such as G-box (TGACACGTGGCA, -421 bp from the translation initiation site which might have effects on rhythmic gene expression, were found. Using the yeast one-hybrid and electrophoretic mobility shift assay (EMSA, we confirmed that the bZIP transcription factor HY5 binds to this motif of QH6. Studies with promoter truncations before and after this motif suggested that this G-box was important for the diurnal fluctuation of the transgenic β-glucuronidase gene (GUS transcript abundance in Arabidopsis thaliana. GUS gene driven by the promoter region immediately after G-box showed an arrhythmic expression in both light/dark (LD and constant dark (DD conditions, whereas the control with G-box retained its fluctuation in both LD and DD. We further transformed A. thaliana with the luciferase gene (LUC driven by an 1400 bp fragment upstream QH6 with its G-box intact or mutated, respectively. The luciferase activity assay showed that a peak in the early morning disappeared in the mutant. Gene expression analysis also demonstrated that the rhythmic expression of LUC was abolished in the hy5-1 mutant.
Lolokote, Sainyugu; Hidru, Tesfaldet Habtemariam; Li, Xiaofeng
2017-05-19
An unhealthy lifestyle of college students is an important public health concern, but few studies have been undertaken to examine the role of socio-cultural differences. For this cross-sectional comparative study, data on college students' health-promoting lifestyles (HPL), as measured using the Health-Promoting Lifestyle Profile (HPLP-II) scale, and self-rated health status (SRH) as measured by Sub-Optimal Health Measurement Scale (SHMS V1.0) were collected from 829 college students. The sample of 829 college students included 504 (60.8%) Chinese and 325 (39.2%) international students. Chinese students had higher scores in overall health-promoting lifestyle (HPL) (P difference in psychological health subscale (P = 0.156, eta squared = 0.002). HPL was predicted by financial status among the Chinese group and by student's major, age and level of education in the international group. Body mass index (BMI) and financial status emerged as predictors of the three subscales of SHMS V1.0 in the Chinese group and also of physiological and psychological subscales in the international group. Gender was associated with psychological health in both groups. Smoking status was a predictor of psychological health in both groups and also of social health in the international group. The level of education emerged as a predictor of social health in the international group. Regression analyses revealed a significant association between health status and healthy lifestyle (P cultural factors as key determinants of the HPL and SRH of college students.
Family-Based Approaches to Cardiovascular Health Promotion.
Vedanthan, Rajesh; Bansilal, Sameer; Soto, Ana Victoria; Kovacic, Jason C; Latina, Jacqueline; Jaslow, Risa; Santana, Maribel; Gorga, Elio; Kasarskis, Andrew; Hajjar, Roger; Schadt, Eric E; Björkegren, Johan L; Fayad, Zahi A; Fuster, Valentin
2016-04-12
Cardiovascular disease is the leading cause of mortality in the world, and the increasing burden is largely a consequence of modifiable behavioral risk factors that interact with genomics and the environment. Continuous cardiovascular health promotion and disease prevention throughout the lifespan is critical, and the family is a central entity in this process. In this review, we describe the potential rationale and mechanisms that contribute to the importance of family for cardiovascular health promotion, focusing on: 1) mutual interdependence of the family system; 2) shared environment; 3) parenting style; 4) caregiver perceptions; and 5) genomics. We conclude that family-based approaches that target both caregivers and children, encourage communication among the family unit, and address the structural and environmental conditions in which families live and operate are likely to be the most effective approach to promote cardiovascular health. We describe lessons learned, future implications, and applications to ongoing and planned studies. Copyright © 2016 American College of Cardiology Foundation. Published by Elsevier Inc. All rights reserved.
Littman, Marissa A; Sonne, James W; Smith, Gerald V
2017-01-01
Little information exists on the research productivity of successfully promoted tenure-track Doctor of Physical Therapy (DPT) faculty. To determine the research productivity that typically results in successful promotion. We collected publicly available curriculum vitae (CVs) from faculty currently in accredited DPT programs and who had been successfully promoted from an institution in the southeastern USA from 2000 through 2016. Total publication count, journal impact factor, funding, citations, and other metrics were analysed from 45 subjects of 22 of the 64 CAPTE-accredited DPT programs in the southeast. None of the studied metrics were normally distributed with time to promotion as determined by a Shapiro-Wilk test. These faculty exhibited a median publication count of 4, range 0 to 43; median of average citation count of 12.4, range 0 to 87.25; median of average journal impact factor of 2.866, range 0 to 6.280; median external funding received of $9910, range $0.00 to $19 543 198; and median author h-index of 3, range 0 to 17. The median number of years before promotion was 6, ranging from 3 to 13 years. Linear regression analysis indicates a poor fit with no significant correlation between years before promotion and any of the studied metrics. No correlation between journal impact factor and number of citations was observed (m = -0.22, p = 0.728, R 2 = 0.0003). Prior to promotion 31% (14 of 45) did not receive external funding and 24% (11 of 45) had a 0 h-index. The Carnegie Classification of the institution did not significantly correlate with research productivity metrics in this dataset (p = 0.213). While faculty unsuccessful in promotion were not identifiable using this method, this research can be used by faculty and committees to evaluate research productivity against regional data and promote competitive standards with peer institutions. CAPTE: Commission on Accreditation in Physical Therapist Education; DPT: Doctor of Physical Therapy.
Directory of Open Access Journals (Sweden)
Wenzhi Cao
2018-04-01
Full Text Available Tanshinones, one group of bioactive diterpenes, were widely used in the treatment of cardiovascular diseases. WRKYs play important roles in plant metabolism, but their regulation mechanism in Salvia miltiorrhiza remains elusive. In this study, one WRKY transcription factor SmWRKY1 was isolated and functionally characterized from S. miltiorrhiza. Multiple sequence alignment and phylogenetic tree analysis showed SmWRKY1 shared high homology with other plant WRKYs such as CrWRKY1. SmWRKY1 was found predominantly expressed in leaves and stems, and was responsive to salicylic acid (SA, methyl jasmonate (MeJA, and nitric oxide (NO treatment. Subcellular localization analysis found that SmWRKY1 was localized in the nucleus. Over-expression of SmWRKY1 significantly elevated the transcripts of genes coding for enzymes in the MEP pathway especially 1-deoxy-D-xylulose-5-phosphate synthase (SmDXS and 1-deoxy-D-xylulose-5-phosphate reductoisomerase (SmDXR, resulted in over fivefold increase in tanshinones production in transgenic lines (up to 13.7 mg/g DW compared with the control lines. A dual-luciferase (Dual-LUC assay showed that SmWRKY1 can positively regulate SmDXR expression by binding to its promoter. Our work revealed that SmWRKY1 participated in the regulation of tanshinones biosynthesis and acted as a positive regulator through activating SmDXR in the MEP pathway, thus provided a new insight to further explore the regulation mechanism of tanshinones biosynthesis.
Malachowa, Natalia; Kohler, Petra L; Schlievert, Patrick M; Chuang, Olivia N; Dunny, Gary M; Kobayashi, Scott D; Miedzobrodzki, Jacek; Bohach, Gregory A; Seo, Keun Seok
2011-01-01
Staphylococcus aureus is a prominent human pathogen and a leading cause of community- and hospital-acquired bacterial infections worldwide. Herein, we describe the identification and characterization of the S. aureus 67.6-kDa hypothetical protein, named for the surface factor promoting resistance to oxidative killing (SOK) in this study. Sequence analysis showed that the SOK gene is conserved in all sequenced S. aureus strains and homologous to the myosin cross-reactive antigen of Streptococcus pyogenes. Immunoblotting and immunofluorescence analysis showed that SOK was copurified with membrane fractions and was exposed on the surface of S. aureus Newman and RN4220. Comparative analysis of wild-type S. aureus and an isogenic deletion strain indicated that SOK contributes to both resistance to killing by human neutrophils and to oxidative stress. In addition, the S. aureus sok deletion strain showed dramatically reduced aortic valve vegetation and bacterial cell number in a rabbit endocarditis model. These results, plus the suspected role of the streptococcal homologue in certain diseases such as acute rheumatic fever, suggest that SOK plays an important role in cardiovascular and other staphylococcal infections.
Astrocytes promote myelination in response to electrical impulses.
Ishibashi, Tomoko; Dakin, Kelly A; Stevens, Beth; Lee, Philip R; Kozlov, Serguei V; Stewart, Colin L; Fields, R Douglas
2006-03-16
Myelin, the insulating layers of membrane wrapped around axons by oligodendrocytes, is essential for normal impulse conduction. It forms during late stages of fetal development but continues into early adult life. Myelination correlates with cognitive development and can be regulated by impulse activity through unknown molecular mechanisms. Astrocytes do not form myelin, but these nonneuronal cells can promote myelination in ways that are not understood. Here, we identify a link between myelination, astrocytes, and electrical impulse activity in axons that is mediated by the cytokine leukemia inhibitory factor (LIF). These findings show that LIF is released by astrocytes in response to ATP liberated from axons firing action potentials, and LIF promotes myelination by mature oligodendrocytes. This activity-dependent mechanism promoting myelination could regulate myelination according to functional activity or environmental experience and may offer new approaches to treating demyelinating diseases.
A significant association between BDNF promoter methylation and the risk of drug addiction.
Xu, Xuting; Ji, Huihui; Liu, Guili; Wang, Qinwen; Liu, Huifen; Shen, Wenwen; Li, Longhui; Xie, Xiaohu; Zhou, Wenhua; Duan, Shiwei
2016-06-10
As a member of the neurotrophic factor family, brain derived neurotrophic factor (BDNF) plays an important role in the survival and differentiation of neurons. The aim of our work was to evaluate the role of BDNF promoter methylation in drug addiction. A total of 60 drug abusers (30 heroin and 30 methylamphetamine addicts) and 52 healthy age- and gender-matched controls were recruited for the current case control study. Bisulfite pyrosequencing technology was used to determine the methylation levels of five CpGs (CpG1-5) on the BDNF promoter. Among the five CpGs, CpG5 methylation was significantly lower in drug abusers than controls. Moreover, significant associations were found between CpG5 methylation and addictive phenotypes including tension-anxiety, anger-hostility, fatigue-inertia, and depression-dejection. In addition, luciferase assay showed that the DNA fragment of BDNF promoter played a key role in the regulation of gene expression. Our results suggest that BDNF promoter methylation is associated with drug addiction, although further studies are needed to understand the mechanisms by which BDNF promoter methylation contributes to the pathophysiology of drug addiction. Copyright © 2016. Published by Elsevier B.V.
Implementation of healthy lifestyle promotion in primary care: patients as coproducers.
Thomas, Kristin; Bendtsen, Preben; Krevers, Barbro
2014-11-01
To explore and theorize how patients perceive, interpret, and reactin healthy lifestyle promotion situations in primary care and to investigate patients' role in implementation of lifestyle promotion illustrated by typologies. Grounded theory was used to assess qualitative interview data from 22 patients with varied experience of healthy lifestyle promotion. Data were analyzed by constant comparative analysis. A substantive theory of being healthy emerged from the data. The theory highlights the processes that are important for implementation before, during, and after lifestyle promotion. Three interconnected categories emerged from the data: conditions for being healthy, managing being healthy, and interactions about being healthy; these formed the core category: being healthy. A typology proposed four patient trajectories on being healthy: resigned, receivers, coworkers, and leaders. Patients coproduced the implementation of lifestyle promotion through the degree of transparency, which was a result of patients' expectations and situation appraisals. Different approaches are needed during lifestyle promotion depending on a variety of patient-related factors. The typology could guide practitioners in their lifestyle promotion practice. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.
International Nuclear Information System (INIS)
Patel, Divya; Chaudhary, Jaideep
2012-01-01
Highlights: ► E2A, considered as a tumor suppressor is highly expressed in prostate cancer. ► Silencing of E2A attenuates cell proliferation and promotes apoptosis. ► E2A regulates c-myc, Id1, Id3 and CDKN1A expression. ► Loss of E2A promotes doxorubicin dependent apoptosis in prostate cancer cells. ► Results suggest that E2A acts as a tumor promoter at least in prostate cancer. -- Abstract: E2A (TCF3) is a multifunctional basic helix loop helix (bHLH), transcription factor. E2A regulates transcription of target genes by homo- or heterodimerization with cell specific bHLH proteins. In general, E2A promotes cell differentiation, acts as a negative regulator of cell proliferation in normal cells and cancer cell lines and is required for normal B-cell development. Given the diverse biological pathways regulated/influenced by E2A little is known about its expression in cancer. In this study we investigated the expression of E2A in prostate cancer. Unexpectedly, E2A immuno-histochemistry demonstrated increased E2A expression in prostate cancer as compared to normal prostate. Silencing of E2A in prostate cancer cells DU145 and PC3 led to a significant reduction in proliferation due to G1 arrest that was in part mediated by increased CDKN1A(p21) and decreased Id1, Id3 and c-myc. E2A silencing in prostate cancer cell lines also resulted in increased apoptosis due to increased mitochondrial permeability and caspase 3/7 activation. Moreover, silencing of E2A increased sensitivity to doxorubicin induced apoptosis. Based on our results, we propose that E2A could be an upstream regulator of Id1 and c-Myc which are highly expressed in prostate cancer. These results for the first time demonstrate that E2A could in fact acts as a tumor promoter at least in prostate cancer.
Naaldenberg, J.
2011-01-01
Background
Many different stakeholders and contextual factors influence the success or failure of health promotion activities. Conventional approaches and evaluation designs underlying health
promotion interventions, often explicitly take contextual variables out of consideration
PePPER : a webserver for prediction of prokaryote promoter elements and regulons
de Jong, Anne; Pietersma, Hilco; Cordes, Martijn; Kuipers, Oscar P.; Kok, Jan
2012-01-01
Background: Accurate prediction of DNA motifs that are targets of RNA polymerases, sigma factors and transcription factors (TFs) in prokaryotes is a difficult mission mainly due to as yet undiscovered features in DNA sequences or structures in promoter regions. Improved prediction and comparison
Hepatoma-derived growth factor-related protein-3 is a novel angiogenic factor.
Directory of Open Access Journals (Sweden)
Michelle E LeBlanc
Full Text Available Hepatoma-derived growth factor-related protein-3 (Hdgfrp3 or HRP-3 was recently reported as a neurotrophic factor and is upregulated in hepatocellular carcinoma to promote cancer cell survival. Here we identified HRP-3 as a new endothelial ligand and characterized its in vitro and in vivo functional roles and molecular signaling. We combined open reading frame phage display with multi-round in vivo binding selection to enrich retinal endothelial ligands, which were systematically identified by next generation DNA sequencing. One of the identified endothelial ligands was HRP-3. HRP-3 expression in the retina and brain was characterized by Western blot and immunohistochemistry. Cell proliferation assay showed that HRP-3 stimulated the growth of human umbilical vein endothelial cells (HUVECs. HRP-3 induced tube formation of HUVECs in culture. Wound healing assay indicated that HRP-3 promoted endothelial cell migration. HRP-3 was further confirmed for its in vitro angiogenic activity by spheroid sprouting assay. HRP-3 extrinsically activated the extracellular-signal-regulated kinase ½ (ERK1/2 pathway in endothelial cells. The angiogenic activity of HRP-3 was independently verified by mouse cornea pocket assay. Furthermore, in vivo Matrigel plug assay corroborated HRP-3 activity to promote new blood vessel formation. These results demonstrated that HRP-3 is a novel angiogenic factor.
International Nuclear Information System (INIS)
Hurst, Helen C
2001-01-01
Overexpression of the ERBB2 proto-oncogene is associated with amplification of the gene in breast cancer but increased activity of the promoter also plays a significant role. Members of two transcription factor families (AP-2 and Ets) show increased binding to the promoter in over-expressing cells. Consequently, strategies have been devised to target promoter activity, either through the DNA binding sites for these factors, or through another promoter sequence, a polypurine-polypyrimidine repeat structure. The promoter has also been exploited for its tumour-specific activity to direct the accumulation of cytotoxic compounds selectively within cancer cells. Our current understanding of the ERBB2 promoter is reviewed and the status of these therapeutic avenues is discussed
Health Promotion Practices and Attitudes among Nurses in Special Education Schools in Greece
Alexandropoulou, Marianthi; Sourtzi, Panayota; Kalokerinou, Athena
2010-01-01
Published research concerning health promotion in Greek schools is limited. The aim of the study was to evaluate special education school nurses' involvement in health promotion activities, examine their attitudes toward it, and to explore the factors influencing their practices. A cross-sectional survey was carried out in 2005 by mailed…
Regulation of ALF promoter activity in Xenopus oocytes.
Directory of Open Access Journals (Sweden)
Dan Li
Full Text Available BACKGROUND: In this report we evaluate the use of Xenopus laevis oocytes as a matched germ cell system for characterizing the organization and transcriptional activity of a germ cell-specific X. laevis promoter. PRINCIPAL FINDINGS: The promoter from the ALF transcription factor gene was cloned from X. laevis genomic DNA using a PCR-based genomic walking approach. The endogenous ALF gene was characterized by RACE and RT-PCR for transcription start site usage, and by sodium bisulfite sequencing to determine its methylation status in somatic and oocyte tissues. Homology between the X. laevis ALF promoter sequence and those from human, chimpanzee, macaque, mouse, rat, cow, pig, horse, dog, chicken and X. tropicalis was relatively low, making it difficult to use such comparisons to identify putative regulatory elements. However, microinjected promoter constructs were very active in oocytes and the minimal promoter could be narrowed by PCR-mediated deletion to a region as short as 63 base pairs. Additional experiments using a series of site-specific promoter mutants identified two cis-elements within the 63 base pair minimal promoter that were critical for activity. Both elements (A and B were specifically recognized by proteins present in crude oocyte extracts based on oligonucleotide competition assays. The activity of promoter constructs in oocytes and in transfected somatic Xenopus XLK-WG kidney epithelial cells was quite different, indicating that the two cell types are not functionally equivalent and are not interchangeable as assay systems. CONCLUSIONS: Overall the results provide the first detailed characterization of the organization of a germ cell-specific Xenopus promoter and demonstrate the feasibility of using immature frog oocytes as an assay system for dissecting the biochemistry of germ cell gene regulation.
Directory of Open Access Journals (Sweden)
Shanshan Liu
2017-12-01
Full Text Available The obligate intracellular Gram-negative bacterium Chlamydia psittaci often causes avian chlamydiosis and influenza-like symptoms in humans. However, the commercial subunit C. psittaci vaccine could only provide a partial protection against avian chlamydiosis due to poor cellular immune response. In our previous study, a recombinant herpesvirus of turkeys (HVT-delivered vaccine against C. psittaci and Marek’s disease based on human cytomegalovirus (CMV promoter (rHVT-CMV-pmpD was developed and provided an effective protection against C. psittaci disease with less lesions and reduced chlamydial loads. In this study, we developed another recombinant HVT vaccine expressing the N-terminal fragment of PmpD (PmpD-N based on human elongation factor-1 alpha (EF-1α promoter (rHVT-EF-pmpD by modifying the HVT genome within a bacterial artificial chromosome. The related characterization of rHVT-EF-pmpD was evaluated in vitro in comparison with that of rHVT-CMV-pmpD. The expression of PmpD-N was determined by western blot. Under immunofluorescence microscopy, PmpD-N protein of both two recombinant viruses was located in the cytoplasm and on the cell surface. Growth kinetics of rHVT-EF-pmpD was comparable to that of rHVT-CMV-pmpD, and the growth rate of rHVT-EF-pmpD was apparently higher than that of rHVT-CMV-pmpD on 48, 72, and 120 h postinfection. Macrophages activated by rHVT-EF-pmpD could produce more nitric oxide and IL-6 than that activated by rHVT-CMV-pmpD. In this study, a recombinant HVT vaccine expressing PmpD-N based on EF-1α promoter was constructed successfully, and a further research in vivo was needed to analyze the vaccine efficacy.
Directory of Open Access Journals (Sweden)
Huang Hsien-Da
2008-11-01
Full Text Available Abstract Background The elucidation of transcriptional regulation in plant genes is important area of research for plant scientists, following the mapping of various plant genomes, such as A. thaliana, O. sativa and Z. mays. A variety of bioinformatic servers or databases of plant promoters have been established, although most have been focused only on annotating transcription factor binding sites in a single gene and have neglected some important regulatory elements (tandem repeats and CpG/CpNpG islands in promoter regions. Additionally, the combinatorial interaction of transcription factors (TFs is important in regulating the gene group that is associated with the same expression pattern. Therefore, a tool for detecting the co-regulation of transcription factors in a group of gene promoters is required. Results This study develops a database-assisted system, PlantPAN (Plant Promoter Analysis Navigator, for recognizing combinatorial cis-regulatory elements with a distance constraint in sets of plant genes. The system collects the plant transcription factor binding profiles from PLACE, TRANSFAC (public release 7.0, AGRIS, and JASPER databases and allows users to input a group of gene IDs or promoter sequences, enabling the co-occurrence of combinatorial transcription factor binding sites (TFBSs within a defined distance (20 bp to 200 bp to be identified. Furthermore, the new resource enables other regulatory features in a plant promoter, such as CpG/CpNpG islands and tandem repeats, to be displayed. The regulatory elements in the conserved regions of the promoters across homologous genes are detected and presented. Conclusion In addition to providing a user-friendly input/output interface, PlantPAN has numerous advantages in the analysis of a plant promoter. Several case studies have established the effectiveness of PlantPAN. This novel analytical resource is now freely available at http://PlantPAN.mbc.nctu.edu.tw.
ISOLASI DAN KARAKTERISASI PROMOTER β-ACTIN DARI IKAN KERAPU BEBEK (Cromileptes altivelis
Directory of Open Access Journals (Sweden)
Alimuddin Alimuddin
2016-11-01
Promoter as gene expression regulator is one of the factors affecting the successful of transgenesis. Isolation and characterization of β -actin promoter (ktBA from humpback grouper (Cromileptes altivelis towards generation of autotransgenic grouper have been conducted. β -actin promoter has high activity in muscle. Sequence of ktBA promoter was isolated by using degenerate PCR method. Sequencing was performed using ABI PRISM 3100 machine. Analysis of sequences was conducted using BLAST, GENETYX version 7 and TFBind softwares. DNA fragment of PCR amplification product digested from the vector cloning was then ligated with pEGFPN1 to generate pktBA-GFP construct. The construct was microinjected into one-cell stage of zebrafish (Danio rerio embryos to test the ktBA promoter activity. EGFP gene expression was observed by fluorescence microscope. The result of sequence analysis showed that the length of DNA fragment obtained is about 1.6 kb and containing the evolutionary conserved sequences of transcription factor for β -actin promoter including CCAAT, CArG and TATA boxes. Furthermore, ktBA sequence in pktBA-EGFP construct could drove GFP expression in muscle of zebrafish embryos injected with the construct. The results suggested that PCR amplification product is the regulator sequence of humpback grouper β -actin gene. Autotransgenic grouper can be then produced by changing GFP gene fragment of pktBA-EGFP construct with genes from grouper encoding important traits in aquaculture.
Promotional Strategy Impacts on Organizational Market Share and Profitability
Directory of Open Access Journals (Sweden)
Adesoga Dada Adefulu
2015-12-01
Full Text Available The paper examined promotional strategy impacts on market share and profitability in Coca-Cola and 7up companies in Lagos State, Nigeria. Survey research method was adopted. The study population was the staff in marketing positions in the selected companies. Questionnaire was administered on the samples from Coca-Cola and 7UP companies. The statistical tool employed was the univariate analysis of variance (ANOVA to determine the statistical significance and the extent to which promotional strategy brings about variation in market share and profitability in the selected companies The study revealed the need for a better understanding of the organizational factors that determine the commitment of organizational resources to drive the achievement of marketing goals. In addition, promotional strategy measured by advertising, publicity and sales promotion affected market share and profitability at different percentage rates while Personal selling did not .The study concluded that promotional strategy suitable to a business caused variations in market share and profitability. Managers concerned about maintaining competitive edge in the market may find it appropriate to begin by examining promotional strategy adoption. Suggestions are also made for further research and study limitations are denoted. Researchers are encouraged to devote efforts to identifying what variables may modify the nature of relationship?
Directory of Open Access Journals (Sweden)
Miya Soukaina Hakam
2017-10-01
Full Text Available Background/Aims: Pregnancy success requires mandatory maternal tolerance of the semi/ allogeneic embryo involving embryo-derived signals. Expression levels of PreImplantation Factor (PIF, a novel peptide secreted by viable embryos, correlate with embryo development, and its early detection in circulation correlates with a favourable pregnancy outcome. PIF enhances endometrial receptivity to promote embryo implantation. Via the p53 pathway, it increases trophoblast invasion, improving cell survival / immune privilege. PIF also reduces spontaneous and LPS-induced foetal death in immune naïve murine model. We examined PIF effect on gene expression of human leukocyte antigen (HLA-G, -E -F and –C and the influence of PIF on local progesterone activity in JEG-3 choriocarcinoma cells. Methods: PIF and progesterone (P4 effects on JEG-3 cells surface and intracellular HLA molecules was tested using monoclonal antibodies, flow cytometry, and Western blotting. PIF and IL17 effects on P4 and cytokines secretion was determined by ELISA. PIF and P4 effects on JEG-3 cells proteome was examined using 2D gel staining followed by spot analysis, mass spectrometry and bioinformatic analysis. Results: In cytotrophoblastic JEG-3 cells PIF increased intracellular expression of HLA-G, HLA-F, HLA-E and HLA-C and surface expression of HLA-G, HLA-E and HLA-C in dose and time dependent manner. In case of HLA-E, -F results were confirmed also by Western blot. Proteome analysis confirmed an increase in HLA-G, pro-tolerance FOXP3+ regulatory T cells (Tregs, coagulation factors and complement regulator. In contrast, PIF reduced PRDX2 and HSP70s to negate oxidative stress and protein misfolding. PIF enhanced local progesterone activity, increasing steroid secretion and the receptor protein. It also promoted the secretion of the Th1/Th2 cytokines (IL-10, IL-1β, IL-8, GM-CSF and TGF-β1, resulting in improved maternal signalling. Conclusion: PIF can generate a pro
Interleukin-Driven Insulin-Like Growth Factor Promotes Prostatic Inflammatory Hyperplasia
Hahn, Alana M.; Myers, Jason D.; McFarland, Eliza K.; Lee, Sanghee
2014-01-01
Prostatic inflammation is of considerable importance to urologic research because of its association with benign prostatic hyperplasia and prostate cancer. However, the mechanisms by which inflammation leads to proliferation and growth remain obscure. Here, we show that insulin-like growth factors (IGFs), previously known as critical developmental growth factors during prostate organogenesis, are induced by inflammation as part of the proliferative recovery to inflammation. Using genetic models and in vivo IGF receptor blockade, we demonstrate that the hyperplastic response to inflammation depends on interleukin-1–driven IGF signaling. We show that human prostatic hyperplasia is associated with IGF pathway activation specifically localized to foci of inflammation. This demonstrates that mechanisms of inflammation-induced epithelial proliferation and hyperplasia involve the induction of developmental growth factors, further establishing a link between inflammatory and developmental signals and providing a mechanistic basis for the management of proliferative diseases by IGF pathway modulation. PMID:25292180
Stress ratings and health promotion practices among RNs: a case for action.
Tucker, Sharon J; Weymiller, Audrey J; Cutshall, Susanne M; Rhudy, Lori M; Lohse, Christine M
2012-05-01
: The objective of this study was to investigate associations between RN perceptions of their stress levels, health-promoting behaviors, and associated demographic variables. : Stress and burnout are occupational hazards resulting in absenteeism, illness, and staff turnover, factors important to nurse administrators. Personal health behaviors among nurses have been linked to less stress and the delivery of health-promotion teaching. : An electronic survey with 2 standardized measures and demographic questions was completed by 2,247 staff nurses from a large Midwestern academic medical center. : Stress levels were inversely correlated with overall health-promoting behavior scores. Outside caregiver responsibilities were associated with higher stress and lower health-promoting behaviors scores. : Findings support work-site interventions that promote nurses' health and wellness, reduce work and home stress, and influence positive patient care and outcomes.
Employers' views on the promotion of workplace health and wellbeing: a qualitative study.
Pescud, Melanie; Teal, Renee; Shilton, Trevor; Slevin, Terry; Ledger, Melissa; Waterworth, Pippa; Rosenberg, Michael
2015-07-11
The evidence surrounding the value of workplace health promotion in positively influencing employees' health and wellbeing via changes to their health behaviours is growing. The aim of the study was to explore employers' views on the promotion of workplace health and wellbeing and the factors affecting these views. Using a qualitative phenomenological approach, 10 focus groups were conducted with employers selected from a range of industries and geographical locations within Western Australia. The total sample size was 79. Three factors were identified: employers' conceptualization of workplace health and wellbeing; employers' descriptions of (un)healthy workers and perceptions surrounding the importance of healthy workers; and employers' beliefs around the role the workplace should play in influencing health. Progress may be viable in promoting health and wellbeing if a multifaceted approach is employed taking into account the complex factors influencing employers' views. This could include an education campaign providing information about what constitutes health and wellbeing beyond the scope of occupational health and safety paradigms along with information on the benefits of workplace health and wellbeing aligned with perceptions relating to healthy and unhealthy workers.
Boominathan, Vijay P; Ferreira, Tracie L
2012-12-01
Student interest in topics of tissue engineering is increasing exponentially as the number of universities offering programs in bioengineering are on the rise. Bioengineering encompasses all of the STEM categories: Science, Technology, Engineering, and Math. Inquiry-based learning is one of the most effective techniques for promoting student learning and has been demonstrated to have a high impact on learning outcomes. We have designed program outcomes for our bioengineering program that require tiered activities to develop problem solving skills, peer evaluation techniques, and promote team work. While it is ideal to allow students to ask unique questions and design their own experiments, this can be difficult for instructors to have reagents and supplies available for a variety of activities. Zebrafish can be easily housed, and multiple variables can be tested on a large enough group to provide statistical value, lending them well to inquiry-based learning modules. We have designed a laboratory activity that takes observation of fin regeneration to the next level: analyzing conditions that may impact regeneration. Tissue engineers seek to define the optimum conditions to grow tissue for replacement parts. The field of tissue engineering is likely to benefit from understanding natural mechanisms of regeneration and the factors that influence the rate of regeneration. We have outlined the results of varying temperature on fin regeneration and propose other inquiry modules such as the role of pH in fin regeneration. Furthermore, we have provided useful tools for developing critical thinking and peer review of research ideas, assessment guidelines, and grading rubrics for the activities associated with this exercise.
Directory of Open Access Journals (Sweden)
Kiyoshi Mori
2011-03-01
Full Text Available Epigenetic alterations in cancer, especially DNA methylation and histone modification, exert a significant effect on the deregulated expression of cancer-related genes and lay an epigenetic pathway to carcinogenesis and tumor progression. Global hypomethylation and local hypermethylation of CpG islands in the promoter region, which result in silencing tumor suppressor genes, constitute general and major epigenetic modification, the hallmark of the neoplastic epigenome. Additionally, methylation-induced gene silencing commonly affects a number of genes and increases with cancer progression. Indeed, cancers with a high degree of methylation (CpG island methylator phenotype/CIMP do exist and represent a distinct subset of certain cancers including colorectal, bladder and kidney. On the other hand, signals from the microenvironment, especially those from transforming growth factor-β (TGF-β, induce targeted de novo epigenetic alterations of cancer-related genes. While TGF-β signaling has been implicated in two opposite roles in cancer, namely tumor suppression and tumor promotion, its deregulation is also partly induced by epigenetic alteration itself. Although the epigenetic pathway to carcinogenesis and cancer progression has such reciprocal complexity, the important issue is to identify genes or signaling pathways that are commonly silenced in various cancers in order to find early diagnostic and therapeutic targets. In this review, we focus on the epigenetic alteration by DNA methylation and its role in molecular modulations of the TGF-β signaling pathway that cause or underlie altered cancer-related gene expression in both phases of early carcinogenesis and late cancer progression.
Sports clubs as settings for health promotion: fundamentals and an overview to research.
Kokko, Sami
2014-11-01
This paper explores the efficacy and value of sports clubs as a setting for health promotion. Sports clubs for children and adolescents are the primary focus of the paper, and the aims are two-fold. Firstly, the paper aims to review the basis for and elements of the health promoting sports club (HPSC) concept. Secondly, the aim is to overview the international evolution of the HPSC concept and its usefulness in the research. The settings-based health promotion approach forms the basis for the HPSC concept and it is introduced first. Thereafter, both obligating and prospecting factors, to justify the importance for sports clubs to address health promotion, are expressed. Major prospecting factors relate to the facts that sports club activities reach a lot of children and adolescents, and that its educational nature is informal due to voluntary participation. The paper also presents multilevel structure of sports clubs, as well as the determinants affecting the settings-based work. The research concerning health promotion in sports-related settings is evolving worldwide, and Nordic countries are in the front line of this new-wave of settings-based health promotion. Indeed, it has been claimed that, for the settings approach to assimilate to current societal challenges, there is a need to widen the reach of the approach to non-traditional, non-institutional settings, like sports clubs. © 2014 the Nordic Societies of Public Health.
Johnson, Rolanda L
2002-01-01
The purpose of this study was to explore the relationships between racial identity, self-esteem, sociodemographic factors, and health-promoting lifestyles in a sample of African Americans. African American mortality rates are disproportionately high. These rates are associated with health behaviors that are driven by many factors including lifestyle practices. Other factors may be self-esteem and racial identity. Research shows gender differences in health behaviors, but no studies have explored a racial identity and gender interaction. Exploring these relationships may lead to the improved health status of African Americans. A convenience sample of 224 was recruited consisting of 48% males (n = 108). The mean age was 37.2 years (SD = 12.6). Regression analyses demonstrated that the internalization racial identity stage (beta = .12; p self-esteem (beta = .50; p Self-esteem did not mediate the relationship between immersion and health-promoting lifestyle scores (beta = -.16; p = .03). The full model Beta values show that racial identity remains significant with sociodemographics and interactions controlled, but moderators do not. Racial identity, while not a strong predictor, has some impact on health-promoting lifestyles regardless of sociodemographics.
1997-04-01
Krause, 1995; Pender & Pender , 1987; Sparics, 1995). For successful patient education to occur, motivational factors of the patient related to...cessation intervention could be explained by Nola Pender’s theoiy identifying health promoting behaviors integral to the individual’s lifestyle... Pender described cognitive-perceptual factors which act as primary motivational mechanisms influencing health promotion activities ( Pender et al., 1987
Nag, Ronita; Maity, Manas Kanti; Dasgupta, Maitrayee
2005-11-01
The ABA responsive ABI3 and the auxin responsive ARF family of transcription factors bind the CATGCATG (Sph) and TGTCTC core motifs in ABA and auxin response elements (ABRE and AuxRE), respectively. Several evidences indicate ABI3s to act downstream to auxin too. Because DNA binding domain of ABI3s shows significant overlap with ARFs we enquired whether auxin responsiveness through ABI3s could be mediated by their binding to canonical AuxREs. Investigations were undertaken through in vitro gel mobility shift assays (GMSA) using the DNA binding domain B3 of PvAlf (Phaseolus vulgaris ABI3 like factor) and upstream regions of auxin responsive gene GH3 (-267 to -141) and ABA responsive gene Em (-316 to -146) harboring AuxRE and ABRE, respectively. We demonstrate that B3 domain of PvAlf could bind AuxRE only when B3 was associated with its flanking domain B2 (B2B3). Such strict requirement of B2 domain was not observed with ABRE, where B3 could bind with or without being associated with B2. This dual specificity in DNA binding of ABI3s was also demonstrated with nuclear extracts of cultured cells of Arachis hypogea. Supershift analysis of ABRE and AuxRE bound nuclear proteins with antibodies raised against B2B3 domains of PvAlf revealed that ABI3 associated complexes were detectable in association with both cis elements. Competition GMSA confirmed the same complexes to bind ABRE and AuxRE. This dual specificity of ABI3 like factors in DNA binding targeted to natural promoters responsive to ABA and auxin suggests them to have a potential role in conferring crosstalk between these two phytohormones.
Directory of Open Access Journals (Sweden)
Yumeng Shi
2018-04-01
Full Text Available ObjectivesFibroblast-like synoviocytes (FLS exhibit a unique aggressive phenotype in rheumatoid arthritis (RA. Increased FLS migration and subsequent invasion of the extracellular matrix are essential to joint destruction in RA. Our previous research reported that transcription factor SOX5 was highly expressed in RA-FLS. Here, the effects of SOX5 in RA-FLS migration and invasion will be investigated.MethodsThe migration and invasion of RA-FLS were evaluated using a transwell chamber assay. The expression of several potential SOX5-targeted genes, including matrix metalloproteinases (MMP-1, 2, 3 and 9, chemokines (CCL4, CCL2, CCR5 and CCR2, and pro-inflammatory cytokines (TNF-α and IL-6, were examined in RA-FLS using SOX5 gain- and loss-of-function study. The molecular mechanisms of SOX5-mediated MMP-9 expressions were assayed by luciferase reporter gene and chromatin immunoprecipitation (ChIP studies. The in vivo effect of SOX5 on FLS migration and invasion was examined using collagen-induced arthritis (CIA in DBA/1J mice.ResultsKnockdown SOX5 decreased lamellipodium formation, migration, and invasion of RA-FLS. The expression of MMP-9 was the only gene tested to be concomitantly affected by silencing or overexpressing SOX5. ChIP assay revealed that SOX5 was bound to the MMP-9 promoter in RA-FLS. The overexpression of SOX5 markedly enhanced the MMP-9 promoter activity, and specific deletion of a putative SOX5-binding site in MMP-9 promoter diminished this promoter-driven transcription in FLS. Locally knocked down SOX5 inhibited MMP-9 expression in the joint tissue and reduced pannus migration and invasion into the cartilage in CIA mice.ConclusionSOX5 plays a novel role in mediating migration and invasion of FLS in part by regulating MMP-9 expression in RA.
Shi, Yumeng; Wu, Qin; Xuan, Wenhua; Feng, Xiaoke; Wang, Fang; Tsao, Betty P; Zhang, Miaojia; Tan, Wenfeng
2018-01-01
Fibroblast-like synoviocytes (FLS) exhibit a unique aggressive phenotype in rheumatoid arthritis (RA). Increased FLS migration and subsequent invasion of the extracellular matrix are essential to joint destruction in RA. Our previous research reported that transcription factor SOX5 was highly expressed in RA-FLS. Here, the effects of SOX5 in RA-FLS migration and invasion will be investigated. The migration and invasion of RA-FLS were evaluated using a transwell chamber assay. The expression of several potential SOX5-targeted genes, including matrix metalloproteinases (MMP-1, 2, 3 and 9), chemokines (CCL4, CCL2, CCR5 and CCR2), and pro-inflammatory cytokines (TNF-α and IL-6), were examined in RA-FLS using SOX5 gain- and loss-of-function study. The molecular mechanisms of SOX5-mediated MMP-9 expressions were assayed by luciferase reporter gene and chromatin immunoprecipitation (ChIP) studies. The in vivo effect of SOX5 on FLS migration and invasion was examined using collagen-induced arthritis (CIA) in DBA/1J mice. Knockdown SOX5 decreased lamellipodium formation, migration, and invasion of RA-FLS. The expression of MMP-9 was the only gene tested to be concomitantly affected by silencing or overexpressing SOX5. ChIP assay revealed that SOX5 was bound to the MMP-9 promoter in RA-FLS. The overexpression of SOX5 markedly enhanced the MMP-9 promoter activity, and specific deletion of a putative SOX5-binding site in MMP-9 promoter diminished this promoter-driven transcription in FLS. Locally knocked down SOX5 inhibited MMP-9 expression in the joint tissue and reduced pannus migration and invasion into the cartilage in CIA mice. SOX5 plays a novel role in mediating migration and invasion of FLS in part by regulating MMP-9 expression in RA.
Health promotion and resilience in adolescents at school level
Directory of Open Access Journals (Sweden)
Griselda Cardozo
2015-09-01
Full Text Available This project arises from the need to sort out the different problems appearing in the process of growth and development of adolescents al school level. For this work we took into consideration four schools located in the Province of Córdoba. It refers to a transverse field work which was carried out in two stages during the year 2005. In the first stage, we made a diagnosis about the risk and protection factors in the young as well as the behaviors derived from them. We applied an anonymous survey based on the California Healthy Kids Survey - Bilingual version 2003. In order to select the subjects we made a stratified sample in each institution, with a total of 382 students of both sexes who attend the CBU (Unified Basic Level and the CE (Specialization Level. In the second stage, we worked with students of 4th and 5th year in workshops to train health promotion leaders and we also held workshops with teachers, proctors and principals. It is our goal to research about the factors and risk behaviors in the students. Our target is to improve the quality of life by reinforcing the health conditions and its determinants. The results conclude that the empowerment of the young and the educational community, trough their participation in the building of individual and collective capacities, brings about a higher knowledge of the risk and protection factors. These protection factors will generate resilience which influences in the maintenance, control and self-care of health. Through the dialogue, the educational institution supports the transference of subject matters together with the learning of problem solving strategies. Thus the school will promote critical thinking and creativity, the acknowledgment of the rights and duties as well as the recognition of the possibilities and limitations to promote a responsible autonomy.
Disadvantaged persons' participation in health promotion projects: some structural dimensions.
Boyce, W F
2001-05-01
A structural perspective was used in studying community participation of disadvantaged groups (poor women, street youth, and disabled persons) in health promotion projects. Five community projects in the Canadian Health Promotion Contribution Program were examined in a comparative case study utilizing in-depth interviews, documents, and secondary sources. Analysis revealed relatively low numbers and restricted range of participants, difficulties in recruiting and maintaining participants, declining rates of active participation over time, and limited target group influence and power. This paper reports on the relationship between various dimensions of structure (social-cultural, organizational, political-legal-economic) and the community participation process. Participation was influenced by structural factors such as bureaucratic rules and regulators, perceived minority group rights and relations, agency reputations and responsibilities, available resources, and organizational roles. Control of projects by target group members, rather than by service agencies, was an important overall organizational structural factor which allowed community members to achieve influence in projects. The study concludes that a conceptual model based on structural factors is useful in explaining how key factors from federal and local levels can restrict or facilitate the community participation process.
Midwives' perceptions and experiences of health promotion practice in Ghana.
Owusu-Addo, Ebenezer
2015-09-01
This research explores midwives' perceptions and experiences of health promotion practice in Ghana. A qualitative descriptive exploratory design was used in order to gain better insight into midwives' perceptions and experiences of health promotion practice. A total of 21 midwives took part in the study. Data were collected by individual in-depth semi-structured interviews. Thematic analysis was used to analyse the transcript. Five dominant themes emerged from the interview transcripts, namely: health promotion as education, health promotion activities, the value of health promotion, client participation, and midwives' barriers to promoting health. Although midwives underscored the importance of health promotion to their work, their reports indicated that, in practice, midwives mostly delivered health education and behaviour change communication rather than health promotion. The midwives expressed the view that by way of their close association with women, they were in a better position to influence women's health. Health promotion activities engaged by the midwives included weight management, healthy eating, infection prevention, personal hygiene, counselling on family planning, and screening for hazardous and harmful substance use such as alcohol and smoking. All the midwives mentioned that clients participated in their health promotion activities. Factors that were identified by the midwives to enhance client participation were trust, attitude of the midwife, building rapport, creating enabling environment, listening and paying attention to clients and using simple language. The barriers to health promotion identified by the midwives included time, stress, culture, lack of training and inadequate health educational materials. Midwives in this study had limited knowledge about health promotion, yet could play a significant role in influencing health; thus there is a need for on-going in-service training for midwives to focus on health promotion. © The Author
DEFF Research Database (Denmark)
Lehn-Christiansen, Sine
The paper discusses the implications of health promotion in education. The paper is based on my PhD project entitled “Health promotion education seen through a power/knowledge and subjectification perspective” (in prep). The PhD project explores how professional health promotion skills are concei......The paper discusses the implications of health promotion in education. The paper is based on my PhD project entitled “Health promotion education seen through a power/knowledge and subjectification perspective” (in prep). The PhD project explores how professional health promotion skills...
Firefly luciferase gene contains a cryptic promoter
Czech Academy of Sciences Publication Activity Database
Vopálenský, V.; Mašek, T.; Horváth, Ondřej; Vicenová, B.; Mokrejš, M.; Pospíšek, M.
2008-01-01
Roč. 14, č. 9 (2008), s. 1720-1729 ISSN 1355-8382 Grant - others:GAČR(CZ) GA204/03/1487; GAČR(CZ) GA301/07/0607; Mšk(CZ) LC06066 Program:LC Institutional research plan: CEZ:AV0Z50520514 Keywords : luciferase * cryptic promoter * hepatitis C virus Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 5.018, year: 2008
Abedini, Nauzley C; Stack, Shobha W; Goodman, Jessie L; Steinberg, Kenneth P
2018-02-01
Burnout rates for internal medicine residents are among the highest of all specialties, yet little is known about how residents recover from burnout. We identified factors promoting recovery from burnout and factors that assist with the subsequent avoidance of burnout among internal medicine residents. A purposive sample of postgraduate year 2 (PGY-2), PGY-3, and recent graduates who experienced and recovered from burnout during residency participated in semistructured, 60-minute interviews from June to August 2016. Using qualitative methods derived from grounded theory, saturation of themes occurred after 25 interviews. Coding was performed in an iterative fashion and consensus was reached on major themes. Coding revealed 2 different categories of resident burnout- circumstantial and existential -with differing recovery and avoidance methods. Circumstantial burnout stemmed from self-limited circumstances and environmental triggers. Recovery from, and subsequent avoidance of, circumstantial burnout arose from (1) resolving workplace challenges; (2) nurturing personal lives; and (3) taking time off. In contrast, existential burnout stemmed from a loss of meaning in medicine and an uncertain professional role. These themes were identified around recovery: (1) recognizing burnout and feeling validated; (2) connecting with patients and colleagues; (3) finding meaning in medicine; and (4) redefining a professional identity and role. Our study suggests that residents experience different types of burnout and have variable methods by which they recover from and avoid further burnout. Categorizing residents' burnout into circumstantial versus existential experiences may serve as a helpful framework for formulating interventions.
Garner, Andrew S; Storfer-Isser, Amy; Szilagyi, Moira; Stein, Ruth E K; Green, Cori M; Kerker, Bonnie D; O'Connor, Karen G; Hoagwood, Kimberly E; McCue Horwitz, Sarah
Efforts to promote early brain and child development (EBCD) include initiatives to support healthy parent-child relationships, tools to identify family social-emotional risk factors, and referrals to community programs to address family risk factors. We sought to examine if pediatricians perceive barriers to implementing these activities, and if they utilize resources to address those barriers. Data were analyzed from 304 nontrainee pediatricians who practice general pediatrics and completed a 2013 American Academy of Pediatrics Periodic Survey. Sample weights were used to decrease nonresponse bias. Bivariate comparisons and multivariable regression analyses were conducted. At least half of the pediatricians agreed that barriers to promoting EBCD include: a lack of tools to promote healthy parent-child relationships, a lack of tools to assess the family environment for social-emotional risk factors, and a lack of local resources to address family risks. Endorsing a lack of tools to assess the family environment as a barrier was associated with using fewer screening tools and community resources. Endorsing a lack of local resources as a barrier was associated with using fewer community resources and fewer initiatives to promote parent-child relationships. Interest in pediatric mental health was associated with using more initiatives to promote healthy parent-child relationships, screening tools, and community resources. Although the majority of pediatricians perceive barriers to promoting EBCD, few are routinely using available resources to address these barriers. Addressing pediatricians' perceived barriers and encouraging interest in pediatric mental health may increase resource utilization and enhance efforts to promote EBCD. Copyright © 2016 Academic Pediatric Association. Published by Elsevier Inc. All rights reserved.
The architecture of mammalian ribosomal protein promoters
Directory of Open Access Journals (Sweden)
Perry Robert P
2005-02-01
Full Text Available Abstract Background Mammalian ribosomes contain 79 different proteins encoded by widely scattered single copy genes. Coordinate expression of these genes at transcriptional and post-transcriptional levels is required to ensure a roughly equimolar accumulation of ribosomal proteins. To date, detailed studies of only a very few ribosomal protein (rp promoters have been made. To elucidate the general features of rp promoter architecture, I made a detailed sequence comparison of the promoter regions of the entire set of orthologous human and mouse rp genes. Results A striking evolutionarily conserved feature of most rp genes is the separation by an intron of the sequences involved in transcriptional and translational regulation from the sequences with protein encoding function. Another conserved feature is the polypyrimidine initiator, which conforms to the consensus (Y2C+1TY(T2(Y3. At least 60 % of the rp promoters contain a largely conserved TATA box or A/T-rich motif, which should theoretically have TBP-binding capability. A remarkably high proportion of the promoters contain conserved binding sites for transcription factors that were previously implicated in rp gene expression, namely upstream GABP and Sp1 sites and downstream YY1 sites. Over 80 % of human and mouse rp genes contain a transposable element residue within 900 bp of 5' flanking sequence; very little sequence identity between human and mouse orthologues was evident more than 200 bp upstream of the transcriptional start point. Conclusions This analysis has provided some valuable insights into the general architecture of mammalian rp promoters and has identified parameters that might coordinately regulate the transcriptional activity of certain subsets of rp genes.
Promotion or marketing of the nursing profession by nurses.
Kagan, I; Biran, E; Telem, L; Steinovitz, N; Alboer, D; Ovadia, K L; Melnikov, S
2015-09-01
In recent years, much effort has been invested all over the world in nurse recruitment and retention. Issues arising in this context are low job satisfaction, the poor public image of nursing and the reluctance of nurses to promote or market their profession. This study aimed to examine factors explaining the marketing of the nursing profession by nurses working at a general tertiary medical centre in Israel. One hundred sixty-nine registered nurses and midwives from five clinical care units completed a structured self-administered questionnaire, measuring (a) professional self-image, (b) job satisfaction, (c) nursing promotional and marketing activity questionnaire, and (d) demographic data. The mean scores for the promotion of nursing were low. Nurses working in an intensive cardiac care unit demonstrated higher levels of promotional behaviour than nurses from other nursing wards in our study. Nurse managers reported higher levels of nursing promotion activity compared with first-line staff nurses. There was a strong significant correlation between job satisfaction and marketing behaviour. Multiple regression analysis shows that 15% of the variance of promoting the nursing profession was explained by job satisfaction and job position. Nurses are not inclined to promote or market their profession to the public or to other professions. The policy on the marketing of nursing is inadequate. A three-level (individual, organizational and national) nursing marketing programme is proposed for implementation by nurse leadership and policy makers. Among proposed steps to improve marketing of the nursing profession are promotion of the image of nursing by the individual nurse in the course of her or his daily activities, formulation and implementation of policies and programmes to promote the image of nursing at the organizational level and drawing up of a long-term programme for promoting or marketing the professional status of nursing at the national level. © 2015
Health promoting Behaviors Among Adolescents: A Cross-sectional Study.
Musavian, Azra Sadat; Pasha, Afsaneh; Rahebi, Seyyedeh-Marzeyeh; Atrkar Roushan, Zahra; Ghanbari, Atefeh
2014-04-01
Health maintenance and promotion are the fundamental prerequisites to community development. The best time for establishing healthy lifestyle habits is during adolescence. Due to importance of health promotion behaviors in adolescents, this study was conducted to investigate health-promoting behaviors and its associated factors among high school students in Rasht, Iran. A cross-sectional descriptive study was conducted on 424 students during the first semester of the year 2012. We employed the multistage sampling design to recruit from private and public high schools in Rasht, Iran. The data collection instrument was a self-report questionnaire consisting of two parts. The first part of instrument was consisted of demographic questionnaire and the second part was adolescent health promotion scale (AHPS) questionnaire. AHPS questionnaire was consisted of six dimensions (nutrition, social support, health responsibility, life appreciation, physical activity, and stress management) to measure health promoting lifestyles. Statistical analysis was performed by SPSS 16 software employing ANOVA (analysis of variance) test, t-test, Mann-Whitney, and the Kruskal-Wallis. The score of total Adolescent Health Promotion Scale were 3.58 ± 0.52 (possible range was 1-5). The highest score was in life appreciation dimension (3.99 ± 0.068) and the lowest score was in health responsibility dimension. Moreover, Significant associations were found between the adolescent health promotion Scale with age (P school grade (P health instructors, schoolteachers, and families must pay more attention to these students. Moreover, as most of lifelong healthy and unhealthy lifestyle habits are established during adolescence, developing effective health promotion and disease prevention strategies for adolescents seems crucial.
Tong, Dandan; Liang, Ya-Nan; Stepanova, A A; Liu, Yu; Li, Xiaobo; Wang, Letian; Zhang, Fengmin; Vasilyeva, N V
2017-02-01
. Furthermore, RAB11FIP3 combines with Eps15 homology domain 1 to promote the endocytosis recycling of phosphorylation of epithelial growth factor receptor.
Directory of Open Access Journals (Sweden)
Jansson Elisabeth VG
2010-08-01
Full Text Available Abstract Background Several health determinants are related to local conditions and prerequisites at community level. For this reason, strengthening community action has been one of five strategies implemented in health promotion since the end of the 1980s. Such action includes setting priorities, making decisions, planning strategies, and implementing them to achieve better health. The aim of this paper is to obtain a deeper understanding of content, organization and processes in the development of local health promotion. Methods A qualitative multiple case study of four Swedish municipalities. The cases were analyzed in accordance with the principles of cross-case study analysis, and a content analysis of documents and interviews was conducted in two steps. First, a manifest content analysis was performed to identify present and former actors and measures. Thereafter, a latent content analysis was performed to investigate structures and processes in local contexts. Results The results of the inductive content analysis showed development of local health promotion in three phases: initiation, action, and achievement. Strengthening factors were local actors, health statistics and events. Hindering factors were lack of resources and vague objectives. External factors, e.g. national policies, were not perceived as prominent influencing factors. Media reports were regarded as having had an influence, but only to some extent. The content of local health promotion has developed from ad-hoc lifestyle and behaviour-related actions into structural, intersectoral actions related to determinants of health. Conclusions The municipalities have organized and developed their health promotion targets, actions and priorities on the basis of local needs and prerequisites. The three phases in the identified health promotion processes were experienced and documented as being subject to greater influence from internal rather than external strengthening and hindering
International Nuclear Information System (INIS)
Jiang, Zhihua; Kunej, Tanja; Michal, Jennifer J.; Gaskins, Charles T.; Reeves, Jerry J.; Busboom, Jan R.; Dovc, Peter; Wright, Raymond W.
2005-01-01
Mitochondrial transcription factor A (TFAM), a nucleus-encoded protein, regulates the initiation of transcription and replication of mitochondrial DNA (mtDNA). Decreased expression of nuclear-encoded mitochondrial genes has been associated with onset of obesity in mice. Therefore, we hypothesized genetic variants in TFAM gene influence mitochondrial biogenesis consequently affecting body fat deposition and energy metabolism. In the present study, both cDNA (2259 bp) and genomic DNA (16,666 bp) sequences were generated for the bovine TFAM gene using a combination of in silico cloning with targeted region PCR amplification. Alignment of both cDNA and genomic sequences led to the determination of genomic organization and characterization of the promoter region of the bovine TFAM gene. Two closely linked A/C and C/T single nucleotide polymorphisms (SNPs) were found in the bovine TFAM promoter and then genotyped on 237 Wagyu x Limousin F 2 animals with recorded phenotypes for marbling and subcutaneous fat depth (SFD). Statistical analysis demonstrated that both SNPs and their haplotypes were associated with marbling (P = 0.0153 for A/C, P = 0.0026 for C/T, and P = 0.0004 for haplotype) and SFD (P = 0.0200 for A/C, P = 0.0039 for C/T, and P = 0.0029 for haplotype), respectively. A search for transcriptional regulatory elements using MatInspector indicated that both SNPs lead to a gain/loss of six putative-binding sites for transcription factors relevant to fat deposition and energy metabolism. Our results suggest for the first time that TFAM gene plays an important role in lipid metabolism and may be a strong candidate gene for obesity in mammals
Energy Technology Data Exchange (ETDEWEB)
Yang, Man [Department of Nephrology, The First Affiliated Hospital of Chengdu Medical College, Chengdu City 610500 (China); Li, Fu-gang [Department of Nephrology, Affiliated Hospital of Luzhou Medical College, Luzhou City 646000 (China); Xie, Xi-sheng [Department of Nephrology, Second Clinical Medical Institution of North Sichuan Medical College (Nanchong Central Hospital), Nanchong City 637400 (China); Wang, Shao-qing [Department of Nephrology, The First Affiliated Hospital of Chengdu Medical College, Chengdu City 610500 (China); Fan, Jun-ming, E-mail: junmingfan@163.com [Department of Nephrology, The First Affiliated Hospital of Chengdu Medical College, Chengdu City 610500 (China); Department of Nephrology, Affiliated Hospital of Luzhou Medical College, Luzhou City 646000 (China)
2014-02-07
Highlights: • CagA stimulated cell proliferation and the production of IgA1 in DAKIKI cells. • CagA promoted the underglycosylation of IgA1 in DAKIKI cells. • CagA decreased the expression of C1GALT1 and its chaperone Cosmc in DAKIKI cells. • Helicobacter pylori infection may participate in the pathogenesis of IgAN via CagA. - Abstract: While Helicobacter pylori (Hp) infection is closely associated with IgA nephropathy (IgAN), the underlying molecular mechanisms remain to be elucidated. This study was to investigate the effect of cytotoxin associated gene A protein (CagA), a major virulence factor of Hp, on the production and underglycosylation of IgA1 in the B cell line DAKIKI cells. Cells were cultured and treated with recombinant CagA protein. We found that CagA stimulated cell proliferation and the production of IgA1 in a dose-dependent and time-dependent manner. Moreover, CagA promoted the underglycosylation of IgA1, which at least partly attributed to the downregulation of β1,3-galactosyltransferase (C1GALT1) and its chaperone Cosmc. In conclusion, we demonstrated that Hp infection, at least via CagA, may participate in the pathogenesis of IgAN by influencing the production and glycosylation of IgA1 in B cells.
International Nuclear Information System (INIS)
Yang, Man; Li, Fu-gang; Xie, Xi-sheng; Wang, Shao-qing; Fan, Jun-ming
2014-01-01
Highlights: • CagA stimulated cell proliferation and the production of IgA1 in DAKIKI cells. • CagA promoted the underglycosylation of IgA1 in DAKIKI cells. • CagA decreased the expression of C1GALT1 and its chaperone Cosmc in DAKIKI cells. • Helicobacter pylori infection may participate in the pathogenesis of IgAN via CagA. - Abstract: While Helicobacter pylori (Hp) infection is closely associated with IgA nephropathy (IgAN), the underlying molecular mechanisms remain to be elucidated. This study was to investigate the effect of cytotoxin associated gene A protein (CagA), a major virulence factor of Hp, on the production and underglycosylation of IgA1 in the B cell line DAKIKI cells. Cells were cultured and treated with recombinant CagA protein. We found that CagA stimulated cell proliferation and the production of IgA1 in a dose-dependent and time-dependent manner. Moreover, CagA promoted the underglycosylation of IgA1, which at least partly attributed to the downregulation of β1,3-galactosyltransferase (C1GALT1) and its chaperone Cosmc. In conclusion, we demonstrated that Hp infection, at least via CagA, may participate in the pathogenesis of IgAN by influencing the production and glycosylation of IgA1 in B cells
Discriminative identification of transcriptional responses of promoters and enhancers after stimulus
Kleftogiannis, Dimitrios A.
2016-10-17
Promoters and enhancers regulate the initiation of gene expression and maintenance of expression levels in spatial and temporal manner. Recent findings stemming from the Cap Analysis of Gene Expression (CAGE) demonstrate that promoters and enhancers, based on their expression profiles after stimulus, belong to different transcription response subclasses. One of the most promising biological features that might explain the difference in transcriptional response between subclasses is the local chromatin environment. We introduce a novel computational framework, PEDAL, for distinguishing effectively transcriptional profiles of promoters and enhancers using solely histone modification marks, chromatin accessibility and binding sites of transcription factors and co-activators. A case study on data from MCF-7 cell-line reveals that PEDAL can identify successfully the transcription response subclasses of promoters and enhancers from two different stimulations. Moreover, we report subsets of input markers that discriminate with minimized classification error MCF-7 promoter and enhancer transcription response subclasses. Our work provides a general computational approach for identifying effectively cell-specific and stimulation-specific promoter and enhancer transcriptional profiles, and thus, contributes to improve our understanding of transcriptional activation in human.
Directory of Open Access Journals (Sweden)
Meiyuan Zhang
2018-06-01
Full Text Available Liver coordinates a series of metabolic adaptations to maintain systemic energy balance and provide adequate nutrients for critical organs, tissues and cells during starvation. However, the mediator(s implicated in orchestrating these fasting-induced adaptive responses and the underlying molecular mechanisms are still obscure. Here we show that hepatic growth differentiation factor 15 (GDF15 is regulated by IRE1α-XBP1s branch and promotes hepatic fatty acids β-oxidation and ketogenesis upon fasting. GDF15 expression was exacerbated in liver of mice subjected to long-term fasted or ketogenic diet feeding. Abrogation of hepatic Gdf15 dramatically attenuated hepatic β-oxidation and ketogenesis in fasted mice or mice with STZ-initiated type I diabetes. Further study revealed that XBP1s activated Gdf15 transcription via binding to its promoter. Elevated GDF15 in liver reduced lipid accumulation and impaired NALFD development in obese mice through enhancing fatty acids oxidation in liver. Therefore, our results demonstrate a novel and critical role of hepatic GDF15 activated by IRE1α-XBP1s branch in regulating adaptive responses of liver upon starvation stress. Keywords: Fasting, Fatty acid β-oxidation, Ketogenesis, GDF15, XBP1, NAFLD
Piwoz, Ellen G; Huffman, Sandra L; Quinn, Victoria J
2003-03-01
Although many successes have been achieved in promoting breastfeeding, this has not been the case for complementary feeding. Some successes in promoting complementary feeding at the community level have been documented, but few of these efforts have expanded to a larger scale and become sustained. To discover the reasons for this difference, the key factors for the successful promotion of breastfeeding on a large scale were examined and compared with the efforts made in complementary feeding. These factors include definition and rationale, policy support, funding, advocacy, private-sector involvement, availability and use of monitoring data, integration of research into action, and the existence of a well-articulated series of steps for successful implementation. The lessons learned from the promotion of breastfeeding should be applied to complementary feeding, and the new Global Strategy for Infant and Young Child Feeding provides an excellent first step in this process.
Directory of Open Access Journals (Sweden)
Martin Owusu Ansah
2013-10-01
Full Text Available The promotional activities have become more sophisticated and an increasing number of companies are using them to ensure their survival in today’s competitive market. Essentially, the study analyzed the nature of sales promotional activities of Unilever Ghana Limited; determined factors that influence the consumption of Unilever products in Kumasi and finally examined the relationship between sales promotions and the consumption of Unilever products. Primary and secondary data sources were used to select 220 consumers of Unilever in Kumasi and an in-depth interview with the Managers of the companies in Kumasi. Convenient sampling technique was employed in the study. Cross tabulation was done on the demographics whilst a regression model was used to establish the relationship between sales promotions and consumption of products. The findings revealed that Personalities in promotions, Prices in promotions, Messages in promotions and Promotional tools have strong influence on consumption but the Medium in promotion did not have influence on consumption during promotions. It was therefore recommended for celebrities to be used in the company’s promotions.
Gene activation regresses atherosclerosis, promotes health, and enhances longevity
Directory of Open Access Journals (Sweden)
Luoma Pauli V
2010-07-01
Full Text Available Abstract Background Lifestyle factors and pharmacological compounds activate genetic mechanisms that influence the development of atherosclerotic and other diseases. This article reviews studies on natural and pharmacological gene activation that promotes health and enhances longevity. Results Living habits including healthy diet and regular physical activity, and pharmacotherapy, upregulate genes encoding enzymes and apolipoprotein and ATP-binding cassette transporters, acting in metabolic processes that promote health and increase survival. Cytochrome P450-enzymes, physiological factors in maintaining cholesterol homeostasis, generate oxysterols for the elimination of surplus cholesterol. Hepatic CTP:phosphocholine cytidylyltransferase-α is an important regulator of plasma HDL-C level. Gene-activators produce plasma lipoprotein profile, high HDL-C, HDL2-C and HDL-C/cholesterol ratio, which is typical of low risk of atherosclerotic disease, and also of exceptional longevity together with reduced prevalence of cardiovascular, metabolic and other diseases. High HDL contributes to protection against inflammation, oxidation and thrombosis, and associates with good cognitive function in very old people. Avoiding unhealthy stress and managing it properly promotes health and increases life expectancy. Conclusions Healthy living habits and gene-activating xenobiotics upregulate mechanisms that produce lipoprotein pattern typical of very old people and enhance longevity. Lipoprotein metabolism and large HDL2 associate with the process of living a very long life. Major future goals for health promotion are the improving of commitment to both wise lifestyle choices and drug therapy, and further the developing of new and more effective and well tolerated drugs and treatments.
Hypoxia-Inducible Factor-1α Expression in Macrophages Promotes Development of Atherosclerosis
DEFF Research Database (Denmark)
Pedersen, Annemarie Aarup; Pedersen, Tanja X; Junker, Nanna
2016-01-01
transplanted with bone marrow from mice with HIF-1α deficiency in the myeloid cells or control bone marrow. The HIF-1α deficiency in myeloid cells reduced atherosclerosis in aorta of the Ldlr(-/-) recipient mice by ≈72% (P=0.006).In vitro, HIF-1α-deficient macrophages displayed decreased differentiation...... to proinflammatory M1 macrophages and reduced expression of inflammatory genes. HIF-1α deficiency also affected glucose uptake, apoptosis, and migratory abilities of the macrophages. CONCLUSIONS: HIF-1α expression in macrophages affects their intrinsic inflammatory profile and promotes development of atherosclerosis....
Duodenal ulcer promoting gene of Helicobacter pylori.
Lu, Hong; Hsu, Ping-I; Graham, David Y; Yamaoka, Yoshio
2005-04-01
Identification of a disease-specific H pylori virulence factors predictive of the outcome of infection remains unachieved. We used the polymerase chain reaction and Southern blot to compare the presence of 14 vir homologue genes with clinical presentation of H pylori infection, mucosal histology, and mucosal interleukin (IL)-8 levels. We examined 500 H pylori strains from East Asia and South America, including 120 with gastritis, 140 with duodenal ulcer (DU), 110 with gastric ulcer (GU), and 130 with gastric cancer. Only 1 gene that encompassed both jhp0917 and jhp0918 called dupA (duodenal ulcer promoting gene) was associated with a specific clinical outcome. dupA was present in 42% of DU vs. 21% of gastritis (adjusted odds ratio [OR] = 3.1, 95% confidence interval [CI]: 1.7-5.7). Its presence was also associated with more intense antral neutrophil infiltration and IL-8 levels and was a marker for protection against gastric atrophy, intestinal metaplasia, and gastric cancer (OR for gastric cancer = 0.42, 95% CI: 0.2-0.9 compared with gastritis). In vitro studies in gastric epithelial cells using dupA -deleted and -complemented mutants showed that the dupA plays roles in IL-8 production, in activation of transcription factors responsible for IL-8 promoter activity, and in increased survivability at low pH. dupA is a novel marker associated with an increased risk for DU and reduced risk for gastric atrophy and cancer. Its association with DU-promoting and -protective effects against atrophy/cancer was evident in both Asian and Western countries.
Hagiwara, Koichi; Kobayashi, Tatsuo; Tobita, Masato; Kikyo, Nobuaki; Yazaki, Yoshio
1995-01-01
We have found growth‐promoting activity for vascular endothelial cells in the conditioned medium of a human lung cancer cell line, T3M‐11. Purification and characterization of the growth‐promoting activity have been carried out using ammonium sulfate precipitation and gel‐exclusion chromatography. The activity migrated as a single peak just after ribonuclease. It did not bind to a heparin affinity column. These results suggest that the activity is not a heparin‐binding growth factor (including fibroblast growth factors) or a vascular endothelial growth factor. To identify the molecule exhibiting the growth‐promoting activity, a cDNA encoding the growth factor was isolated through functional expression cloning in COS‐1 cells from a cDNA library prepared from T3M‐11 cells. The nucleotide sequence encoded by the cDNA proved to be identical with that of insulin‐like growth factor II. PMID:7730145
Escherichia coli promoter sequences predict in vitro RNA polymerase selectivity.
Mulligan, M E; Hawley, D K; Entriken, R; McClure, W R
1984-01-01
We describe a simple algorithm for computing a homology score for Escherichia coli promoters based on DNA sequence alone. The homology score was related to 31 values, measured in vitro, of RNA polymerase selectivity, which we define as the product KBk2, the apparent second order rate constant for open complex formation. We found that promoter strength could be predicted to within a factor of +/-4.1 in KBk2 over a range of 10(4) in the same parameter. The quantitative evaluation was linked to ...
Health by Design: Interweaving Health Promotion into Environments and Settings
Springer, Andrew E.; Evans, Alexandra E.; Ortuño, Jaquelin; Salvo, Deborah; Varela Arévalo, Maria Teresa
2017-01-01
The important influence of the environmental context on health and health behavior—which includes place, settings, and the multiple environments within place and settings—has directed health promotion planners from a focus solely on changing individuals, toward a focus on harnessing and changing context for individual and community health promotion. Health promotion planning frameworks such as Intervention Mapping provide helpful guidance in addressing various facets of the environmental context in health intervention design, including the environmental factors that influence a given health condition or behavior, environmental agents that can influence a population’s health, and environmental change methods. In further exploring how to harness the environmental context for health promotion, we examine in this paper the concept of interweaving of health promotion into context, defined as weaving or blending together health promotion strategies, practices, programs, and policies to fit within, complement, and build from existing settings and environments. Health promotion interweaving stems from current perspectives in health intervention planning, improvement science and complex systems thinking by guiding practitioners from a conceptualization of context as a backdrop to intervention, to one that recognizes context as integral to the intervention design and to the potential to directly influence health outcomes. In exploring the general approach of health promotion interweaving, we examine selected theoretical and practice-based interweaving concepts in relation to four key environments (the policy environment, the information environment, the social/cultural/organizational environment, and the physical environment), followed by evidence-based and practice-based examples of health promotion interweaving from the literature. Interweaving of health promotion into context is a common practice for health planners in designing health promotion interventions, yet
Ren, Xiaodi; Siegel, Rachael; Kim, Unkyu; Roeder, Robert G
2011-05-06
B cell-specific coactivator OCA-B, together with Oct-1/2, binds to octamer sites in promoters and enhancers to activate transcription of immunoglobulin (Ig) genes, although the mechanisms underlying their roles in enhancer-promoter communication are unknown. Here, we demonstrate a direct interaction of OCA-B with transcription factor TFII-I, which binds to DICE elements in Igh promoters, that affects transcription at two levels. First, OCA-B relieves HDAC3-mediated Igh promoter repression by competing with HDAC3 for binding to promoter-bound TFII-I. Second, and most importantly, Igh 3' enhancer-bound OCA-B and promoter-bound TFII-I mediate promoter-enhancer interactions, in both cis and trans, that are important for Igh transcription. These and other results reveal an important function for OCA-B in Igh 3' enhancer function in vivo and strongly favor an enhancer mechanism involving looping and facilitated factor recruitment rather than a tracking mechanism. Copyright © 2011 Elsevier Inc. All rights reserved.
Prediction by promoter logic in bacterial quorum sensing.
Directory of Open Access Journals (Sweden)
Navneet Rai
2012-01-01
Full Text Available Quorum-sensing systems mediate chemical communication between bacterial cells, coordinating cell-density-dependent processes like biofilm formation and virulence-factor expression. In the proteobacterial LuxI/LuxR quorum sensing paradigm, a signaling molecule generated by an enzyme (LuxI diffuses between cells and allosterically stimulates a transcriptional regulator (LuxR to activate its cognate promoter (pR. By expressing either LuxI or LuxR in positive feedback from pR, these versatile systems can generate smooth (monostable or abrupt (bistable density-dependent responses to suit the ecological context. Here we combine theory and experiment to demonstrate that the promoter logic of pR - its measured activity as a function of LuxI and LuxR levels - contains all the biochemical information required to quantitatively predict the responses of such feedback loops. The interplay of promoter logic with feedback topology underlies the versatility of the LuxI/LuxR paradigm: LuxR and LuxI positive-feedback systems show dramatically different responses, while a dual positive/negative-feedback system displays synchronized oscillations. These results highlight the dual utility of promoter logic: to probe microscopic parameters and predict macroscopic phenotype.
Yin, Yancun; Hua, Hui; Li, Minjing; Liu, Shu; Kong, Qingbin; Shao, Ting; Wang, Jiao; Luo, Yuanming; Wang, Qian; Luo, Ting; Jiang, Yangfu
2016-01-01
Mammalian target of rapamycin (mTOR) is a core component of raptor-mTOR (mTORC1) and rictor-mTOR (mTORC2) complexes that control diverse cellular processes. Both mTORC1 and mTORC2 regulate several elements downstream of type I insulin-like growth factor receptor (IGF-IR) and insulin receptor (InsR). However, it is unknown whether and how mTOR regulates IGF-IR and InsR themselves. Here we show that mTOR possesses unexpected tyrosine kinase activity and activates IGF-IR/InsR. Rapamycin induces the tyrosine phosphorylation and activation of IGF-IR/InsR, which is largely dependent on rictor and mTOR. Moreover, mTORC2 promotes ligand-induced activation of IGF-IR/InsR. IGF- and insulin-induced IGF-IR/InsR phosphorylation is significantly compromised in rictor-null cells. Insulin receptor substrate (IRS) directly interacts with SIN1 thereby recruiting mTORC2 to IGF-IR/InsR and promoting rapamycin- or ligand-induced phosphorylation of IGF-IR/InsR. mTOR exhibits tyrosine kinase activity towards the general tyrosine kinase substrate poly(Glu-Tyr) and IGF-IR/InsR. Both recombinant mTOR and immunoprecipitated mTORC2 phosphorylate IGF-IR and InsR on Tyr1131/1136 and Tyr1146/1151, respectively. These effects are independent of the intrinsic kinase activity of IGF-IR/InsR, as determined by assays on kinase-dead IGF-IR/InsR mutants. While both rictor and mTOR immunoprecitates from rictor(+/+) MCF-10A cells exhibit tyrosine kinase activity towards IGF-IR and InsR, mTOR immunoprecipitates from rictor(-/-) MCF-10A cells do not induce IGF-IR and InsR phosphorylation. Phosphorylation-deficient mutation of residue Tyr1131 in IGF-IR or Tyr1146 in InsR abrogates the activation of IGF-IR/InsR by mTOR. Finally, overexpression of rictor promotes IGF-induced cell proliferation. Our work identifies mTOR as a dual-specificity kinase and clarifies how mTORC2 promotes IGF-IR/InsR activation.
Tissue-specific interactions between nuclear proteins and the aminopeptidase N promoter
DEFF Research Database (Denmark)
Kärnström, U; Sjöström, H; Norén, O
1991-01-01
Aminopeptidase N/CD13 is a metallopeptidase found in many tissues. Aminopeptidase N activity is high in the small intestinal mucosa, moderate in the liver, and low in the spleen. Using DNase I footprinting and electrophoretic mobility shift assays with nuclear extracts from these tissues, three cis...... elements (DF, LF-B1, UF) were identified in the aminopeptidase N promoter. The DF region (-53 to -30) interacts with the ubiquitously expressed transcription factor Sp1. The LF-B1 region (-85 to -58) interacts with the liver transcription factor LF-B1 (HNF-1) which was detected as well in nuclei from small...... intestinal mucosa. The UF region (-112 to -90) interacts with nuclear factors which seem to be expressed differentially in the liver and the small intestine. Transfection of promoter deletions into HepG2 cells showed that the LF-B1 region is necessary for high expression of the aminopeptidase N gene in liver...