Comparative investigations of osteotropic radionuclides. Pt. 4
International Nuclear Information System (INIS)
Creutzig, H.; Gerdts, K.G.; Creutzig, A.
1977-01-01
The dynamics of uptake of osteotropic radionucleides in normal and abnormal bone were studied by means of sequential and functional scans. Various phosphate and phosphonate complexes were compared in vivo and in vitro. Only phosphonates were considered as suitable for bone scanning. In normal bones in beagles, radioactivity after HEDP fell to 65% after two hours, but was 105% with 18 F. In relation to healing fractures, the curves differ quantitatively and qualitatively. In this situation, functional curves derived from dynamic scans provide a better parallel with histological findings than does static scintigraphy with an uptake quotient. Sequential and functional scannung are able to document the therapeutic effect of irradiation of bone metastases. (orig.) [de
Directory of Open Access Journals (Sweden)
Rosario Pignatello
2012-01-01
Full Text Available Bone-seeking (osteotropic drug delivery systems (ODDS represent an interesting solution for targeting different types of drugs to the bones. In particular, anticancer and antibacterial agents could take advantage of such therapeutic strategy. We have recently developed an innovative approach to this aim: a new osteotropic biomaterial was prepared, based on the conjugation of a poly(lactide-co-glycolide (PLGA with the bisphosphonate drug alendronate (PLGA-ALE; its hemo- and cytocompatibility were verified. Starting with this copolymer, an osteotropic nanoparticle system (NP was produced for the targeted delivery of antineoplastic drugs to osteolytic bone metastases; in particular, doxorubicin was tested as a model drug. The in vitro and in vivo results of the new ODDS are validated in this article. All the experimental data confirmed that the drug retained its activity after loading in the PLGA-ALE NP; they can be thus considered a new promising strategy for active targeting of drugs to bone tissues in different pathological situations.
Combined effect of 131I and osteotropic radionuclide of 90Sr and 45Ca
International Nuclear Information System (INIS)
Borisova, V.V.; Vetukh, V.A.; Rusanova, O.V.
1988-01-01
Combined effect of 131 I and osteotropic 45 Ca and 90 Sr on blood formation, reproduction and life span of laboratory animals was considered. It was shown that combined irradiation of thyroid and bone marrow with doses not exceeding or equal 1 Gy doesn't result in changes of blood formation or life span, but leads to definite violations in stem spermatogonia which bring about intra-uterine death of progeny. This fact is explained as a result of indirect radiation effect for the dose for gonads was 0.1 Gy. 3 tabs
DEFF Research Database (Denmark)
Cox, T.R.; Schoof, Erwin; Gartland, A.
2015-01-01
secretomes are known to be active mediators of both local and distant host cells and play an important role in the progression and dissemination of cancer. Here we have quantitatively profiled both the composition of breast cancer secretomes associated with osteotropism, and their modulation under normoxic...... and hypoxic conditions. We detect and quantify 162 secretome proteins across all conditions which show differential hypoxic induction and association with osteotropism. Mass Spectrometry proteomics data have been deposited to the ProteomeXchange Consortium with the dataset identifier PXD000397...
Directory of Open Access Journals (Sweden)
Thomas R. Cox
2015-12-01
Full Text Available The cancer secretome includes all of the macromolecules secreted by cells into their microenvironment. Cancer cell secretomes are significantly different to that of normal cells reflecting the changes that normal cells have undergone during their transition to malignancy. More importantly, cancer secretomes are known to be active mediators of both local and distant host cells and play an important role in the progression and dissemination of cancer. Here we have quantitatively profiled both the composition of breast cancer secretomes associated with osteotropism, and their modulation under normoxic and hypoxic conditions. We detect and quantify 162 secretome proteins across all conditions which show differential hypoxic induction and association with osteotropism. Mass Spectrometry proteomics data have been deposited to the ProteomeXchange Consortium with the dataset identifier PXD000397 and the complete proteomic, bioinformatic and biological analyses are reported in Cox et al. (2015 [1].
Effects of osteotropic hormones on the nitric oxide production in culture of ROS17/2.8 cells
International Nuclear Information System (INIS)
Ko, Seon Yil; Kim, Min Sung; Han, Won Jeong; Kim, Se Won; Kim, Jung Keun
2005-01-01
We performed the present study to investigate whether osteotropic hormones play roles on the nitric oxide (NO) production in culture of ROS17/2.8 osteoblastic cells. The osteoblastic cell line ROS17/2.8 cells were cultured in F12 medium supplemented with 5% fetal bovine serum (FBS) at 37.deg. C in a humidified atmosphere of 5% CO 2 in air. ROS17/2.8 cells were plated in 96-well plants at a density of 2-3 x 10 3 cells/well and grown to confluence. Then the cells were pretreated with osteotropic hormones (parathyroid hormone (PTH) 20-500 ng/mL, 1, 25-dihydroxycholecalciferol (1, 25[OH] 2 D 3 ) 1-100nM ; prostaglandin E 2 (PGE 2 ) 20-500 ng/mL) in the medium supplemented with 0.4% FBS for (72 hours and the cells were treated with cytokines (TNFα and IFNγ) in phenol red-free F12 medium for an additional 48 hours. NO synthesis was assessed by measuring the nitrite anion concentration, the reation product of NO, in the cell culture medium using Griess reagent. PTH and 1, 25[OH] 2 D 4 pretreatment induced a significant increase in NO production in the presence of TNFα and IFNγ. PGE 2 slightly induced NO production compared to the control group. But, PGE 2 pretreatment did not affect in NO production in the presence of TNFα and IFNγ. These results suggest that the actions of osteotropic hormones in bone metabolism may be partially mediated by NO in the presence of cytokines
Sigma factors and promoters in Corynebacterium glutamicum
Czech Academy of Sciences Publication Activity Database
Pátek, Miroslav; Nešvera, Jan
2011-01-01
Roč. 154, 2-3 (2011), s. 101-113 ISSN 0168-1656 R&D Projects: GA ČR GC204/09/J015 Institutional research plan: CEZ:AV0Z50200510 Keywords : Corynebacterium glutamicum * Sigma factors * Promoters Subject RIV: EE - Microbiology, Virology Impact factor: 3.045, year: 2011
Embryogenesis-promoting factors in rat serum.
Katoh, M; Kimura, R; Shoji, R
1998-06-15
Regarding whole rat embryo cultures in vitro, rat serum as a culture medium is known to support the normal growth of rat embryos in the organogenesis phase. The purpose of the present study was to isolate the embryogenesis-promoting factors from rat serum as a first step in the development of a defined serum-free medium for a whole embryo culture system. Pooled rat serum after heat inactivation was fractionated into three major peaks (frA, containing a region of void volume, frB, and frC) by gel filtration. The 9.5-day rat embryos that were cultivated for 48 hr in essential salt medium containing frB (with a molecular size range of 100-500 kDa) revealed normal growth. Three proteins (27 kDa, 76 kDa, and 190 kDa) that had the embryogenesis-promoting effects were isolated from 3-hr delayed centrifuged rat serum by the ion exchange chromatography. The 76-kDa protein was found to be rat transferrin by immunoblotting. The 27-kDa protein was identified as apo-AI (the major apoprotein of high-density lipoprotein) by immunoblotting. High-density lipoprotein obtained from pooled rat serum by a NaBr density gradient ultracentrifugation was found to have a positive effect on embryogenesis. The 10-kDa protein was also identified as alpha 1-inhibitor 3 by immunoblotting. In addition, the embryogenesis-promoting effect of the fraction containing 27-kDa and 190-kDa proteins declined within a short period of storage at -20 degrees C. This decrease was countered by supplementing its fraction (D-2) with albumin isolated from rat serum. These results in the present study suggest that transferrin, high-density lipoprotein, and alpha 1-inhibitor 3 in rat serum may be embryogenesis-promoting factors, and that albumin appeared to play a role in the embryogenesis of rat embryos in whole embryo cultures.
Effects of growth-promoting factors on proliferation of mouse ...
African Journals Online (AJOL)
AJL
2012-02-16
Feb 16, 2012 ... Key words: Growth-promoting factors, mouse spermatogonial stem cells (SSCs), proliferation. INTRODUCTION ... insulin-like growth factor-1 (IGF-1) can stimulate mitotic ...... A Model for Analysis of Spermatogenesis. Zool. Sci.
Factors promoting tourism services and their development
Directory of Open Access Journals (Sweden)
Simona Cristina Martin
2013-10-01
Because the fact that tourism services are intangible, sales through self-service are impossible, which makes indispensable the presence of the seller or counselor at the point of sale. Unable to clearly differentiate against competitors, tourist trips wholesalers will practice a more limited range of methods of sales promotion.
Performance as a Factor in Enlisted Promotions
1981-04-01
the Airman Performance Report. When one reviews the previous research into the matter of enlisted promotions, one senses a feeling of corporate " deja ... vu ." An Air War College research report noted in 1952 that the 7 _... .. . .. _. ._. . . . . I I ’ . Air Force NCO corps had been "destroyed" during
Promotion Factors For Enlisted Infantry Marines
2017-06-01
Marine Corps. However, due to periods of growth during two major conflicts , quality has given way to quantity to fulfill the needs of the Marine...Corps. As conflicts draw down, the Marine Corps shifts from promoting and retaining quantity to high-quality Marines. Throughout this thesis, we use...historically possessed an innate drive to succeed, to excel in all that they do, including winning in combat. We will sustain this trait and ensure this
Directory of Open Access Journals (Sweden)
Biletska E.M.
2014-06-01
Full Text Available For today problem of chemical contamination of the environment and inner enviroment of the organism is extremely topical. Among all toxicants scientists pay special attention to lead, as it is characterized by a global prevalence in the enviroment and polytropic action on the human organism. Aim of the work – on the basis of analytical generalization of research data to establish peculiarities of lead impact on formation and functioning of bone tissue, calcium balance in the organism. It was determined that despite a low external exposure of metal, in man’s biosubstrates its levels are much higher than allowable. Herewith bone tissue due to its anatomy-physiology peculiarities accumulates lead selectively, forming inner additional source of its impact on the organism, potentiating toxic impact of xenobiotic. Therefore biomonitoring data on lead content in bone tissue is an important informative finding not only of danger but of duration, permanence and complex impact on the organism.
The Relevant Factors in Promoting Reading Activities in Elementary Schools
Huang, Han-Chen; Tsai, Yao-Hsu; Huang, Shih-Hsiang
2015-01-01
In order to help students absorb knowledge, schools often conduct reading activities. Thorough planning and strategies, however, are needed to insure the effect of reading promotions, and make them a deeply-rooted part of life. This study adopted the analytic hierarchy process (AHP) to discuss the relevant factors in promoting reading activities…
Effects of growth-promoting factors on proliferation of mouse ...
African Journals Online (AJOL)
SSCs) in vitro are critical to our understanding of male infertility, genetic resources and endangered species conservation. To investigate the effects of growth-promoting factors, epidermal growth factor (EGF), insulin-like growth factor-1 (IGF-1) and ...
Epidemiological factors that promote the development of severe ...
African Journals Online (AJOL)
... that promote the development of severe malaria anaemia in children in Ibadan. ... and epidemiological factors that affect the development of malaria anaemia. ... of parents or guardians to fever in the children;parents\\' preoccupation with ...
TALE factors poise promoters for activation by Hox proteins.
Choe, Seong-Kyu; Ladam, Franck; Sagerström, Charles G
2014-01-27
Hox proteins form complexes with TALE cofactors from the Pbx and Prep/Meis families to control transcription, but it remains unclear how Hox:TALE complexes function. Examining a Hoxb1b:TALE complex that regulates zebrafish hoxb1a transcription, we find maternally deposited TALE proteins at the hoxb1a promoter already during blastula stages. These TALE factors recruit histone-modifying enzymes to promote an active chromatin profile at the hoxb1a promoter and also recruit RNA polymerase II (RNAPII) and P-TEFb. However, in the presence of TALE factors, RNAPII remains phosphorylated on serine 5 and hoxb1a transcription is inefficient. By gastrula stages, Hoxb1b binds together with TALE factors to the hoxb1a promoter. This triggers P-TEFb-mediated transitioning of RNAPII to the serine 2-phosphorylated form and efficient hoxb1a transcription. We conclude that TALE factors access promoters during early embryogenesis to poise them for activation but that Hox proteins are required to trigger efficient transcription. Copyright © 2014 Elsevier Inc. All rights reserved.
Factors influencing workplace health promotion intervention: a qualitative systematic review.
Rojatz, Daniela; Merchant, Almas; Nitsch, Martina
2017-10-01
Although workplace health promotion (WHP) has evolved over the last 40 years, systematically collected knowledge on factors influencing the functioning of WHP is scarce. Therefore, a qualitative systematic literature review was carried out to systematically identify and synthesize factors influencing the phases of WHP interventions: needs assessment, planning, implementation and evaluation. Research evidence was identified by searching electronic databases (Scopus, PubMed, Social Sciences Citation Index, ASSIA, ERIC, IBBS and PsycINFO) from 1998 to 2013, as well as by cross-checking reference lists of included peer-reviewed articles. The inclusion criteria were: original empirical research, description of WHP, description of barriers to and/or facilitators of the planning, implementation and/or evaluation of WHP. Finally, 54 full texts were included. From these, influencing factors were extracted and summarized using thematic analysis. The majority of influencing factors referred to the implementation phase, few dealt with planning and/or evaluation and none with needs assessment. The influencing factors were condensed into topics with respect to factors at contextual level (e.g. economic crisis); factors at organizational level (e.g. management support); factors at intervention level (e.g. quality of intervention concept); factors at implementer level (e.g. resources); factors at participant level (e.g. commitment to intervention) and factors referring to methodological and data aspects (e.g. data-collection issues). Factors regarding contextual issues and organizational aspects were identified across three phases. Therefore, future research and practice should consider not only the influencing factors at different levels, but also at different phases of WHP interventions. © The Author 2016. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.
Health Promotion Behaviors of Women and Affecting Factors
Directory of Open Access Journals (Sweden)
Naile Bilgili
2009-12-01
Full Text Available AIM: Women should be healthy and have health promotion behaviors, so they can accomplish both their maternal and social tasks. This descriptive study was conducted to determine the healthy life-style behaviors of married women and the factors which could affect those behaviors. METHOD: The population comprised all married women older than 15 years and who live in Ankara Kale region. Three hundred-sixty five married women were included in the study. The questionnaire form and the healthy life-style behaviors scale was used for data collection. RESULTS: The mean score taken from scale was 112.2±19.4. The scores of the women who graduated from middle school / high school, who have sufficient income and good socio-economic status, who have a perception of physical health fairly good and who have any chronic disease in their families, have significantly higher mean scores from healthy life-style behaviors scale and subgroups (p<0.05 CONCLUSION: Health promotion behaviors of the women was low and some factors like education level, income, socioeconomic status, perception of health, having any chronic illness and using regular medicine affected healthy life-style behaviors. It is recommended that nurses, who have education and consultation roles, should inform the women about health promotion behaviors and encourage them to use that information in their lives. [TAF Prev Med Bull 2009; 8(6.000: 497-502
FACTORS THAT PROMOTE THE DEFECTION OF THE VIRTUAL CLASSROOM
Jenniz La Madriz
2016-01-01
It education virtual is a resource that allows leverage them Tics for reduce barriers of space / time to learn and decrease the dropout school. The research had by objective determine them factors that promote the desertion of the classroom virtual of the subject of methods I, of support to them classes face-to-face, in the Faculty of Sciences economic and social, of the University of Carabobo. The methodological design was based on the quantitative paradigm and as technical survey, obtainin...
Detecting privatization factors on promoting exports of steel companies
Directory of Open Access Journals (Sweden)
Seyed Mohsen SeyedAliAkbar
2016-05-01
Full Text Available Privatization is considered as the transfer of business from the government to the private sector. This process is often accomplished in an attempt to reduce the size of government, increase the productivity and export activities. There is no doubt that in an export oriented economy, government tries to promote expert based activities by making necessary changes on rules and regulations. This paper presents an empirical investigation to determine important factors on promoting export in Iran. The study designs a questionnaire in Likert scale and distributes it among some experts active in steel industry. Kaiser-Meyer-Olkin Measure of Sampling Adequacy is equal to 0.839 and Bartlett's Test of Sphericity yields an approximation Chi-Square value of 2485.02 (Sig. = 0.000, df = 276. Using principle component analysis with Varimax rotation, the study has detected five important factors including human resources development, productivity management, marketing management, creating competitive environment and building necessary infrastructures, which influence the most on export activities.
Structure of Vibrio cholerae ribosome hibernation promoting factor
International Nuclear Information System (INIS)
De Bari, Heather; Berry, Edward A.
2013-01-01
The X-ray crystal structure of ribosome hibernation promoting factor from V. cholerae has been determined at 2.0 Å resolution. The crystal was phased by two-wavelength MAD using cocrystallized cobalt. The X-ray crystal structure of ribosome hibernation promoting factor (HPF) from Vibrio cholerae is presented at 2.0 Å resolution. The crystal was phased by two-wavelength MAD using cocrystallized cobalt. The asymmetric unit contained two molecules of HPF linked by four Co atoms. The metal-binding sites observed in the crystal are probably not related to biological function. The structure of HPF has a typical β–α–β–β–β–α fold consistent with previous structures of YfiA and HPF from Escherichia coli. Comparison of the new structure with that of HPF from E. coli bound to the Thermus thermophilus ribosome [Polikanov et al. (2012 ▶), Science, 336, 915–918] shows that no significant structural changes are induced in HPF by binding
Heparin-binding epidermal growth factor-like growth factor promotes neuroblastoma differentiation.
Gaviglio, Angela L; Knelson, Erik H; Blobe, Gerard C
2017-05-01
High-risk neuroblastoma is characterized by undifferentiated neuroblasts and low schwannian stroma content. The tumor stroma contributes to the suppression of tumor growth by releasing soluble factors that promote neuroblast differentiation. Here we identify heparin-binding epidermal growth factor-like growth factor (HBEGF) as a potent prodifferentiating factor in neuroblastoma. HBEGF mRNA expression is decreased in human neuroblastoma tumors compared with benign tumors, with loss correlating with decreased survival. HBEGF protein is expressed only in stromal compartments of human neuroblastoma specimens, with tissue from high-stage disease containing very little stroma or HBEGF expression. In 3 human neuroblastoma cell lines (SK-N-AS, SK-N-BE2, and SH-SY5Y), soluble HBEGF is sufficient to promote neuroblast differentiation and decrease proliferation. Heparan sulfate proteoglycans and heparin derivatives further enhance HBEGF-induced differentiation by forming a complex with the epidermal growth factor receptor, leading to activation of the ERK1/2 and STAT3 pathways and up-regulation of the inhibitor of DNA binding transcription factor. These data support a role for loss of HBEGF in the neuroblastoma tumor microenvironment in neuroblastoma pathogenesis.-Gaviglio, A. L., Knelson, E. H., Blobe, G. C. Heparin-binding epidermal growth factor-like growth factor promotes neuroblastoma differentiation. © FASEB.
Cooperative binding of transcription factors promotes bimodal gene expression response.
Directory of Open Access Journals (Sweden)
Pablo S Gutierrez
Full Text Available In the present work we extend and analyze the scope of our recently proposed stochastic model for transcriptional regulation, which considers an arbitrarily complex cis-regulatory system using only elementary reactions. Previously, we determined the role of cooperativity on the intrinsic fluctuations of gene expression for activating transcriptional switches, by means of master equation formalism and computer simulation. This model allowed us to distinguish between two cooperative binding mechanisms and, even though the mean expression levels were not affected differently by the acting mechanism, we showed that the associated fluctuations were different. In the present generalized model we include other regulatory functions in addition to those associated to an activator switch. Namely, we introduce repressive regulatory functions and two theoretical mechanisms that account for the biphasic response that some cis-regulatory systems show to the transcription factor concentration. We have also extended our previous master equation formalism in order to include protein production by stochastic translation of mRNA. Furthermore, we examine the graded/binary scenarios in the context of the interaction energy between transcription factors. In this sense, this is the first report to show that the cooperative binding of transcription factors to DNA promotes the "all-or-none" phenomenon observed in eukaryotic systems. In addition, we confirm that gene expression fluctuation levels associated with one of two cooperative binding mechanism never exceed the fluctuation levels of the other.
FACTORS THAT PROMOTE THE DEFECTION OF THE VIRTUAL CLASSROOM
Directory of Open Access Journals (Sweden)
Jenniz La Madriz
2016-12-01
Full Text Available It education virtual is a resource that allows leverage them Tics for reduce barriers of space / time to learn and decrease the dropout school. The research had by objective determine them factors that promote the desertion of the classroom virtual of the subject of methods I, of support to them classes face-to-face, in the Faculty of Sciences economic and social, of the University of Carabobo. The methodological design was based on the quantitative paradigm and as technical survey, obtaining the percentage ranges for each item of the questionnaire. The results of the study indicate that to reduce the drop-out necessary to face and avoid the feeling of frustration that the student can conceive with the disadvantages in the use of the virtual environment, personal, technical, academic and economic components.
International Nuclear Information System (INIS)
Matsukura, Hiroshi; Aisaki, Ken-ichi; Igarashi, Katsuhide; Matsushima, Yuko; Kanno, Jun; Muramatsu, Masaaki; Sudo, Katsuko; Sato, Noriko
2011-01-01
Highlights: → Genistein (GEN) is a phytoestrogen found in soy products. → GEN demethylated/unsilenced the steroidogenic factor 1 gene in endometrial tissue. → GEN thus altered mRNA expression in uteri of ovariectomized (OVX) mice. → A high-resolution melting assay was used to screen for epigenetic change. → We isolated an endometrial cell clone that was epigenetically modulated by GEN. -- Abstract: It has recently been demonstrated that genistein (GEN), a phytoestrogen in soy products, is an epigenetic modulator in various types of cells; but its effect on endometrium has not yet been determined. We investigated the effects of GEN on mouse uterine cells, in vivo and in vitro. Oral administration of GEN for 1 week induced mild proliferation of the endometrium in ovariectomized (OVX) mice, which was accompanied by the induction of steroidogenic factor 1 (SF-1) gene expression. GEN administration induced demethylation of multiple CpG sites in the SF-1 promoter; these sites are extensively methylated and thus silenced in normal endometrium. The GEN-mediated promoter demethylation occurred predominantly on the luminal side, as opposed to myometrium side, indicating that the epigenetic change was mainly shown in regenerated cells. Primary cultures of endometrial stromal cell colonies were screened for GEN-mediated alterations of DNA methylation by a high-resolution melting (HRM) method. One out of 20 colony-forming cell clones showed GEN-induced demethylation of SF-1. This clone exhibited a high proliferation capacity with continuous colony formation activity through multiple serial clonings. We propose that only a portion of endometrial cells are capable of receiving epigenetic modulation by GEN.
Energy Technology Data Exchange (ETDEWEB)
Matsukura, Hiroshi, E-mail: hmatsukura.epi@mri.tmd.ac.jp [Department of Molecular Epidemiology, Medical Research Institute, Tokyo Medical and Dental University, 2-3-10 Kanda-surugadai, Chiyoda-ku, Tokyo 101-0062 (Japan); Aisaki, Ken-ichi; Igarashi, Katsuhide; Matsushima, Yuko; Kanno, Jun [Division of Cellular and Molecular Toxicology, National Institute of Health Sciences, 1-18-1 Kamiyoga, Setagaya-ku, Tokyo 158-8501 (Japan); Muramatsu, Masaaki [Department of Molecular Epidemiology, Medical Research Institute, Tokyo Medical and Dental University, 2-3-10 Kanda-surugadai, Chiyoda-ku, Tokyo 101-0062 (Japan); Sudo, Katsuko [Department of Molecular Epidemiology, Medical Research Institute, Tokyo Medical and Dental University, 2-3-10 Kanda-surugadai, Chiyoda-ku, Tokyo 101-0062 (Japan); Animal Research Center, Tokyo Medical University, 6-1-1 Shinjuku, Shinjuku-ku, Tokyo 160-8402 (Japan); Sato, Noriko, E-mail: nsato.epi@tmd.ac.jp [Department of Molecular Epidemiology, Medical Research Institute, Tokyo Medical and Dental University, 2-3-10 Kanda-surugadai, Chiyoda-ku, Tokyo 101-0062 (Japan)
2011-08-26
Highlights: {yields} Genistein (GEN) is a phytoestrogen found in soy products. {yields} GEN demethylated/unsilenced the steroidogenic factor 1 gene in endometrial tissue. {yields} GEN thus altered mRNA expression in uteri of ovariectomized (OVX) mice. {yields} A high-resolution melting assay was used to screen for epigenetic change. {yields} We isolated an endometrial cell clone that was epigenetically modulated by GEN. -- Abstract: It has recently been demonstrated that genistein (GEN), a phytoestrogen in soy products, is an epigenetic modulator in various types of cells; but its effect on endometrium has not yet been determined. We investigated the effects of GEN on mouse uterine cells, in vivo and in vitro. Oral administration of GEN for 1 week induced mild proliferation of the endometrium in ovariectomized (OVX) mice, which was accompanied by the induction of steroidogenic factor 1 (SF-1) gene expression. GEN administration induced demethylation of multiple CpG sites in the SF-1 promoter; these sites are extensively methylated and thus silenced in normal endometrium. The GEN-mediated promoter demethylation occurred predominantly on the luminal side, as opposed to myometrium side, indicating that the epigenetic change was mainly shown in regenerated cells. Primary cultures of endometrial stromal cell colonies were screened for GEN-mediated alterations of DNA methylation by a high-resolution melting (HRM) method. One out of 20 colony-forming cell clones showed GEN-induced demethylation of SF-1. This clone exhibited a high proliferation capacity with continuous colony formation activity through multiple serial clonings. We propose that only a portion of endometrial cells are capable of receiving epigenetic modulation by GEN.
Caregivers' support needs and factors promoting resiliency after brain injury.
Kitter, Bryony; Sharman, Rachael
2015-01-01
This article explores the challenges, support needs and coping strategies of caregivers of people with an acquired brain injury (ABI). Semi-structured interviews were conducted with caregivers (n = 20) to explore their support services received, access barriers, utility of services, needed supports, coping strategies and factors promoting life satisfaction. The team recorded, transcribed verbatim and inductively analysed all interviews. Through thematic data analysis, three central themes were revealed: (a) barriers impeding quality-of-life, (b) support needed to improve quality-of-life and (c) factors enabling quality-of-life. All perspectives from the participants involved are synthesized to provide a rich depiction of caregivers' support needs and coping strategies. Two specific findings of interest include a negative association between severity of brain injury and caregiver's desire to direct treatment, as well as a distinct service gap in assistance for caregivers who are caring for someone with violent/offending behaviours. This study recommends short- and long-term changes, given Australia's upcoming National Disability Insurance Scheme, to increase caregiver quality-of-life, which will ultimately affect the rehabilitation outcomes of persons with ABI.
Health Promotion and Related Factors Among Korean Goose Mothers
Directory of Open Access Journals (Sweden)
Chiyoung Cha, PhD, RN
2010-12-01
Conclusions: The findings of this study contributed to the body of knowledge of health promotion among international migrant populations by identifying the differential effects of social support, acculturation attitudes, and perceived family health for six areas of health promotion.
hypoxia-inducible factors activate CD133 promoter through ETS family transcription factors.
Directory of Open Access Journals (Sweden)
Shunsuke Ohnishi
Full Text Available CD133 is a cellular surface protein that has been reported to be a cancer stem cell marker, and thus it is considered to be a potential target for cancer treatment. However, the mechanism regulating CD133 expression is not yet understood. In this study, we analyzed the activity of five putative promoters (P1-P5 of CD133 in human embryonic kidney (HEK 293 cells and colon cancer cell line WiDr, and found that the activity of promoters, particularly of P5, is elevated by overexpression of hypoxia-inducible factors (HIF-1α and HIF-2α. Deletion and mutation analysis identified one of the two E-twenty six (ETS binding sites (EBSs in the P5 region as being essential for its promoter activity induced by HIF-1α and HIF-2α. In addition, a chromatin imunoprecipitation assay demonstrated that HIF-1α and HIF-2α bind to the proximal P5 promoter at the EBSs. The immunoprecipitation assay showed that HIF-1α physically interacts with Elk1; however, HIF-2α did not bind to Elk1 or ETS1. Furthermore, knockdown of both HIF-1α and HIF-2α resulted in a reduction of CD133 expression in WiDr. Taken together, our results revealed that HIF-1α and HIF-2α activate CD133 promoter through ETS proteins.
Critical success factors for physical activity promotion through community partnerships.
Lucidarme, Steffie; Marlier, Mathieu; Cardon, Greet; De Bourdeaudhuij, Ilse; Willem, Annick
2014-02-01
To define key factors of effective evidence-based policy implementation for physical activity promotion by use of a partnership approach. Using Parent and Harvey's model for sport and physical activity community-based partnerships, we defined determinants of implementation based on 13 face-to-face interviews with network organisations and 39 telephone interviews with partner organisations. Furthermore, two quantitative data-sets (n = 991 and n = 965) were used to measure implementation. In total, nine variables were found to influence implementation. Personal contact was the most powerful variable since its presence contributed to success while its absence led to a negative outcome. Four contributed directly to success: political motive, absence of a metropolis, high commitment and more qualified staff. Four others resulted in a less successful implementation: absence of positive merger effects, exposure motive and governance, and dispersed leadership. Community networks are a promising instrument for the implementation of evidence-based policies. However, determinants of both formation and management of partnerships influence the implementation success. During partnership formation, special attention should be given to partnership motives while social skills are of utmost importance for the management.
Potential factors that may promote successful cognitive aging
Directory of Open Access Journals (Sweden)
Vance DE
2012-06-01
Full Text Available David E VanceCenter for Nursing Research, School of Nursing, Edward R Roybal Center for Translational Research in Aging and Mobility, University of Alabama at Birmingham (UAB, Birmingham, AL, USAAbstract: With the unprecedented number of older adults worldwide, it is important to consider ways of facilitating successful cognitive aging. One way to think of this is by augmenting or bolstering cognitive reserve. Loosely defined, cognitive reserve is considered a neurological reservoir that can be depleted by physiological insults (eg, white matter hyperintensities, oxidative stress to the brain but yet maintain optimal cognitive functioning. Cognitive reserve is built up or depleted by processes of positive and negative neuroplasticity, respectively. Lifestyle factors such as physical exercise (+, mental stimulation (+, good sleep hygiene (+, substance abuse (-, sedentary lifestyle (-, chronic stress and depression (-, social isolation (-, and poor health (- can either promote or discourage positive and negative neuroplasticity, which in turn impacts cognitive reserve. Nurses are encouraged to understand these processes so they can help facilitate successful cognitive aging in their patients.Keywords: cognitive reserve, Alzheimer's disease, neuroplasticity
Placental Growth Factor Promotes Cardiac Muscle Repair via Enhanced Neovascularization
Directory of Open Access Journals (Sweden)
Jianfeng Zhang
2015-06-01
Full Text Available Background/Aims: Transplantation of mesenchymal stem cells (MSCs improves post-injury cardiac muscle repair using ill-defined mechanisms. Recently, we have shown that production and secretion of placental growth factor (PLGF by MSCs play a critical role in the MSCs-mediated post-injury cardiac muscle repair. In this study, we addressed the underlying molecular mechanisms, focusing specifically on the interactions between MSCs, macrophages and endothelial cells. Methods: We isolated macrophages (BM-MΦ from mouse bone-marrow derived cells based on F4/80 expression by flow cytometry. BM-MΦ were treated with different doses of PLGF. Cell number was analyzed by a MTT assay. Macrophage polarization was examined based on CD206 expression by flow cytometry. PLGF levels in macrophage subpopulations were analyzed by RT-qPCR and ELISA. Effects of macrophages on vascularization were evaluated by a collagen gel assay using Human umbilical vein endothelial cells (HUVECs co-cultured with PLGF-treated macrophages. Results: PLGF did not increase macrophage number, but dose-dependently polarized macrophages into a M2 subpopulation. M2 macrophages expressed high levels of PLGF. PLGF-polarized M2 macrophages significantly increased tubular structures in the collagen gel assay. Conclusion: Our data suggest that MSCs-derived PLGF may induce macrophage polarization into a M2 subpopulation, which in turn releases more PLGF to promote local neovascularization for augmenting post-injury cardiac muscle repair. This study thus sheds novel light on the role of PLGF in cardiac muscle regeneration.
Health-promoting practices and the factors associated with self ...
African Journals Online (AJOL)
According to self-reports, the most common new health problems since taking up the caregiving role were chronic ill health (97%), social isolation (95%) and mental stress (92%). The health-promoting practices most often engaged in were eating a balanced diet (67%), seeking spiritual support (58%), and performing ...
Psychosocial factors and mental health in cancer patients: opportunities for health promotion
Boer, Henk; Elving, Wim; Seydel, Erwin
1998-01-01
A first step in planning health promotion with respect to mental health is analysing the factors that influence mental health. Diagnosis of the relevant variables may contribute to the design of effective health promotion programmes. In this paper the relationship between psychosocial factors and
Nuclear factor ETF specifically stimulates transcription from promoters without a TATA box.
Kageyama, R; Merlino, G T; Pastan, I
1989-09-15
Transcription factor ETF stimulates the expression of the epidermal growth factor receptor (EGFR) gene which does not have a TATA box in the promoter region. Here, we show that ETF recognizes various GC-rich sequences including stretches of deoxycytidine or deoxyguanosine residues and GC boxes with similar affinities. ETF also binds to TATA boxes but with a lower affinity. ETF stimulated in vitro transcription from several promoters without TATA boxes but had little or no effect on TATA box-containing promoters even though they had strong ETF-binding sites. These inactive ETF-binding sites became functional when placed upstream of the EGFR promoter whose own ETF-binding sites were removed. Furthermore, when a TATA box was introduced into the EGFR promoter, the responsiveness to ETF was abolished. These results indicate that ETF is a specific transcription factor for promoters which do not contain TATA elements.
Calonge, María Julia; Seoane, Joan; Massagué, Joan
2004-05-28
A critical component of the epidermal basement membrane, collagen type VII, is produced by keratinocytes and fibroblasts, and its production is stimulated by the cytokine transforming growth factor-beta (TGF-beta). The gene, COL7A1, is activated by TGF-beta via Smad transcription factors in cooperation with AP1. Here we report a previously unsuspected level of complexity in this regulatory process. We provide evidence that TGF-beta may activate the COL7A1 promoter by two distinct inputs operating through a common region of the promoter. One input is provided by TGF-beta-induced Smad complexes via two Smad binding elements that function redundantly depending on the cell type. The second input is provided by relieving the COL7A1 promoter from chicken ovalbumin upstream promoter transcription factor (COUP-TF)-mediated transcriptional repression. We identified COUP-TFI and -TFII as factors that bind to the TGF-beta-responsive region of the COL7A1 promoter in an expression library screening. COUP-TFs bind to a site between the two Smad binding elements independently of Smad or AP1 and repress the basal and TGF-beta-stimulated activities of this promoter. We provide evidence that endogenous COUP-TF activity represses the COL7A1 promoter. Furthermore, we show that TGF-beta addition causes a rapid and profound down-regulation of COUP-TF expression in keratinocytes and fibroblasts. The results suggest that TGF-beta signaling may exert tight control over COL7A1 by offsetting the balance between opposing Smad and COUP-TFs.
Growth/differentiation factor-15: prostate cancer suppressor or promoter?
Czech Academy of Sciences Publication Activity Database
Vaňhara, P.; Hampl, A.; Kozubík, Alois; Souček, Karel
2012-01-01
Roč. 15, č. 4 (2012), s. 320-328 ISSN 1365-7852 R&D Projects: GA MZd NS9600; GA MZd NS9956 Institutional research plan: CEZ:AV0Z50040702 Institutional support: RVO:68081707 Keywords : MACROPHAGE-INHIBITORY CYTOKINE-1 * GROWTH-DIFFERENTIATION FACTOR-15 * TGF-BETA SUPERFAMILY Subject RIV: BO - Biophysics Impact factor: 2.811, year: 2012
Huijg, Johanna M; Gebhardt, Winifred A; Verheijden, Marieke W; van der Zouwe, Nicolette; de Vries, Juriena D; Middelkoop, Barend J C; Crone, Mathilde R
2015-02-01
Despite the promising findings related to the efficacy of interventions aimed at promoting physical activity (PA) in primary health care (PHC), the translation of these interventions to PHC practice does not always happen as desired. To help understand why efficacious PHC-based PA interventions are not effectively translated to practice, this study systematically reviewed the literature on factors influencing PHC professionals' PA promotion practices. Literature searches were conducted in Web of Science, PubMed, and PsycINFO for peer-reviewed articles published in English from 1990 onwards. Studies were included that met the following criteria: (1) involving PHC-based PA interventions, and (2) reporting factors influencing PHC professionals' PA promotion behaviors. Two researchers independently screened studies and extracted data. A narrative synthesis using thematic analysis was conducted to identify factors. Of the 4,469 identified articles, 59 were included in the review. Factors were identified by qualitative methods, barrier/facilitator ratings, and the examination of the relationship between factors and PA promotion, and the effectiveness of introduction strategies. Many factors related to the development, delivery, and effects of the innovation, the sociopolitical and organizational culture, resources, and support, patient and PHC professional characteristics, and innovation strategies were identified as potential influences on PHC professionals' PA promotion practices. However, the lack of evidence on the relationship between factors and PA promotion indicated insufficient evidence on PA promotion determinants. This extensive overview of potential factors can inform intervention developers and implementers on which factors may play a role when introducing PA interventions in PHC. Future research should further investigate relationships between factors and PA promotion, which should be guided by qualitative in-depth knowledge on influencing factors.
Internal dental school environmental factors promoting faculty survival and success.
Masella, Richard S
2005-04-01
A career in dental academics offers ample rewards and challenges. To promote successful careers in dental education, prospective and new dental faculty should possess a realistic view of the dental school work environment, akin to the informed consent so valuable to patients and doctors. Self-assessment of personal strengths and weaknesses provides helpful information in matching faculty applicants with appropriate dental schools. Essential prehiring information also includes a written job description detailing duties and responsibilities, professional development opportunities, and job performance evaluation protocol. Prehiring awareness of what constitutes excellence in job performance will aid new faculty in allotting time to productive venues. New faculty should not rely solely on professional expertise to advance careers. Research and regular peer-reviewed publications are necessary elements in academic career success, along with the ability to secure governmental, private foundation, and corporate grant support. Tactful self-promotion and self-definition to the dental school community are faculty responsibilities, along with substantial peer collaboration. The recruitment period is a singular opportunity to secure job benefits and privileges. It is also the time to gain knowledge of institutional culture and assess administrative and faculty willingness to collaborate on teaching, research, professional development, and attainment of change. Powerful people within dental schools and parent institutions may influence faculty careers and should be identified and carefully treated. The time may come to leave one's position for employment at a different dental school or to step down from full-time academics. Nonetheless, the world of dental and health professional education in 2005 is rapidly expanding and offers unlimited opportunities to dedicated, talented, and informed educators.
Na, Kyoung-Sae; Won, Eunsoo; Kang, June; Chang, Hun Soo; Yoon, Ho-Kyoung; Tae, Woo Suk; Kim, Yong-Ku; Lee, Min-Soo; Joe, Sook-Haeng; Kim, Hyun; Ham, Byung-Joo
2016-01-01
Recent studies have reported that methylation of the brain-derived neurotrophic factor (BDNF) gene promoter is associated with major depressive disorder (MDD). This study aimed to investigate the association between cortical thickness and methylation of BDNF promoters as well as serum BDNF levels in MDD. The participants consisted of 65 patients with recurrent MDD and 65 age- and gender-matched healthy controls. Methylation of BDNF promoters and cortical thickness were compared between the gr...
Promoter hypomethylation and upregulation of trefoil factors in prostate cancer
DEFF Research Database (Denmark)
Vestergaard, Else Marie; Nexø, Ebba; Tørring, Niels
2010-01-01
cell lines with significant TFF expression as compared to benign immortalized prostate cell lines and PC cell lines not expressing trefoil factor. The most striking difference was observed for CpG sites located close to the AUG start codon overlapping several putative binding sites for cellular...
[Work as a basic human need and health promoting factor].
Bertazzi, P A
2010-01-01
that due to violent causes, but also mortality for all causes, cardiovascular diseases and cancer. A survey in the Turin area, Northern Italy, showed a twofold increase in mortality among unemployed men. Women were affected both by husbands' unemployment and by their own unemployment because of the previous increasing rate of female occupation. The worse the occupational condition (from "seeking work" to "temporary employment" down to "unemployed and no longer seeking work") the higher the mortality: in the latter category, where the most evident problem is marginalization and social exclusion, the increase in mortality was fourfold. The role of occupational health physicians is to recognize the possible negative effects of working conditions and at the same time promote a positive approach to work, even in difficult conditions. This makes prevention more effective and promotes health. To be aware of the meaning of work makes work itself more liveable and more productive. This is how health promotion contributes to the wellbeing of the individual and, at the same time, to the development of the economy and society at large.
Jin-Won Noh; Hyo-Young Yun; Hyunchun Park; Shi-Eun Yu
2015-01-01
Objectives: The present study aimed to analyze the factors that could affect the health-promoting behaviors of North Korean adolescent refugees residing in South Korea. Methods: Questions about their sociodemographic variables, subjective health status, healthy living habits, and health-promoting behaviors were asked. Results: Statistically significant differences were found in religion (t=2.30, p
Impact factor and its role in academic promotion
Directory of Open Access Journals (Sweden)
Richard Russell
2009-07-01
Full Text Available Richard Russell,1 Dave Singh21Wrexham Park Hospital, Berkshire, UK; 2Northwest Lung Research Centre, South Manchester University Hospitals Trust, Manchester, UKThis statement was adopted unanimously at the May 17, 2009 meeting of the International Respiratory Journal Editors Roundtable.In our collective experience as editors of international peer-reviewed journals, we propose that the impact factor calculated for individual journals should not be used as a basis for evaluating the significance of an individual scientist’s past performance or scientific potential. There are several reasons not to equate the impact factor of a journal in which the scientist publishes with the quality of the scientist’s research.
Nerve growth factor promotes human hemopoietic colony growth and differentiation
International Nuclear Information System (INIS)
Matsuda, H.; Coughlin, M.D.; Bienenstock, J.; Denburg, J.A.
1988-01-01
Nerve growth factor (NGF) is a neurotropic polypeptide necessary for the survival and growth of some central neurons, as well as sensory afferent and sympathetic neurons. Much is now known of the structural and functional characteristics of NGF, whose gene has recently been clones. Since it is synthesized in largest amounts by the male mouse submandibular gland, its role exclusively in nerve growth is questionable. These experiments indicate that NGF causes a significant stimulation of granulocyte colonies grown from human peripheral blood in standard hemopoietic methylcellulose assays. Further, NGF appears to act in a relatively selective fashion to induce the differentiation of eosinophils and basophils/mast cells. Depletion experiments show that the NGF effect may be T-cell dependent and that NGF augments the colony-stimulating effect of supernatants from the leukemic T-cell (Mo) line. The hemopoietic activity of NGF is blocked by 125 I-polyclonal and monoclonal antibodies to NGF. The authors conclude that NGF may indirectly act as a local growth factor in tissues other than those of the nervous system by causing T cells to synthesize or secrete molecules with colony-stimulating activity. In view of the synthesis of NGF in tissue injury, the involvement of basophils/mast cells and eosinophils in allergic and other inflammatory processes, and the association of mast cells with fibrosis and tissue repair, they postulate that NGF plays an important biological role in a variety of repair processes
Hypercalciuria, a promoting factor to urinary tract infection in children
Directory of Open Access Journals (Sweden)
Gheissari Alaleh
2009-01-01
Full Text Available Aim: Urinary tract infection (UTI is one of the most common diseases of urogenital tract in children. Detecting predisposing factors for UTI takes an important place in managing patients with UTI. Recently, a few studies emphasized on idiopathic hypercalciuria (IH as a predisposing factor for UTI and dysfunctional voiding. Therefore, we carried out a survey to find out whether non-calculus IH is a contributing factor in children with the first attack of pyelonephritis. Materials and Methods: This is a case-control study carried out on 60 children aged 2-11 years admitted at St Al-Zahra hospital, Isfahan, Iran, with the first episode of upper UTI and 200 age- and gender-matched normal healthy children between September 2003 and February 2005. We used second fasting spot urine sample to measure calcium and creatinine. Two urine samples were obtained one week apart to increase the accuracy of measurement. All samples were collected after at least 6 weeks of completing the treatment course of pyelonephritis. Ultrasound examination and VCUG were performed in all patients before entering the survey as case group to rule out obstruction and VUR. Results: Mean age of case and control group were 4.86 ± 3.08 years and 4.22 ± 2.9 years, respectively. The mean calcium to creatinine ratio (Ca/Cr in case and control group were 0.308 ± 0.21 and 0.208 ± 0.12 mg/mg, respectively, P < 0.001. The difference between the mean values of these two groups was significant only in age group ≤6 years, P < 0.0001 and odds ratio was 2.1 (95% CI 1.03-7.8. After determining the mean values of urine Ca/Cr ration according to both age groups and gender, it was cleared that only significant difference was related to male < 6 years. Conclusion: The likelihood of hypercalciuria should be assessed especially in male children with UTI and without any urinary tract obstruction.
Factors Promoting Development of Fibrosis in Crohn’s Disease
Directory of Open Access Journals (Sweden)
Gerhard Rogler
2017-07-01
Full Text Available The concepts on the pathophysiology of intestinal fibrosis in Crohn’s disease (CD have changed in recent years. Some years ago fibrosis was regarded to be a consequence of long-standing inflammation with subsequent destruction of the gut wall matrix followed by scar formation and collagen deposition. Fibrosis in CD patients appeared to be an irreversible process that could hardly be influenced. Therefore, the main target in CD therapy was to control inflammation to avoid fibrosis development. Many of these assumptions seem to be only partially true. Inflammation may be a necessary prerequisite for the initiation of fibrosis. However, when the pathophysiologic processes that lead to fibrosis in CD patients have been initiated fibrosis development may be independent of inflammation and may continue even when inflammation is under good medical control. Fibrosis in CD also may be reversible. After strictureplasty local collagen deposits decrease or even disappear. With new animal models for intestinal fibrosis on the horizon, we need to spend more efforts on understanding the factors influencing fibrosis in CD patients to finally find specific therapies. In this context, it will be as important to find markers and quantitative imaging tools to have reliable endpoints for clinical trials in fibrosing CD.
Analysis on the restriction factors of the green building scale promotion based on DEMATEL
Wenxia, Hong; Zhenyao, Jiang; Zhao, Yang
2017-03-01
In order to promote the large-scale development of the green building in our country, DEMATEL method was used to classify influence factors of green building development into three parts, including green building market, green technology and macro economy. Through the DEMATEL model, the interaction mechanism of each part was analyzed. The mutual influence degree of each barrier factor that affects the green building promotion was quantitatively analysed and key factors for the development of green building in China were also finally determined. In addition, some implementation strategies of promoting green building scale development in our country were put forward. This research will show important reference value and practical value for making policies of the green building promotion.
International Nuclear Information System (INIS)
Ko, Jong Kyung; Kwon, Duk Mun; Kang, Yeong Han
2009-01-01
The purpose of this study was to analyze factors that could affect health of radiological technologists, which is useful for health care and development of programs for health promotion. Subjects were 234 of radiological technologists who work in general hospitals. Some questionnaires were made about perceptions of health condition and promotional behavior of health for this study. The questionnaires of health perception were 20 items that consist of the present condition of health, health concern and sensitivity. The reliability was sufficient(Cronbach's α=0.79). The other questionnaires about health promotion behavior were 47 items that consist of self-realization, health responsibility, exercise, nutrition, personal relationships, and stress management. The results turned out to be was sufficient (Cronbach's α=0.93). Every data was treated statistically, comparison of average(t-test, ANOVA), correlation, and multiple regression. Related factors to health promotion behavior were age, marriage, salary, class of one's position, career, employment, and religion, in general features. In health life habit, related factors were smoke and exercise. Results of health promotion behavior was 2.90 of mean score, 0.37 of standard deviation. Correlations between factors of health perception and health promotion behavior was positive(p<0.01). Health promotion behavior were affected by sensitivity, presents condition of health, exercise, smoke, career. Sensitivity was the most affectable variable, which means that promotional behavior score became higher and higher as the score of sensitivity and present condition were increased. In addition, persons who exercise regularly, had been smoked, and has higher career showed higher score of promotional behavior. Radiological technologists have to keep their health, trying not to infected by a disease. Most of all, no smoking and regular exercise are the most important thing to all of members.
Energy Technology Data Exchange (ETDEWEB)
Ko, Jong Kyung [Kim, In Hwan Internal Medicine Health Promotion Cnter, Youngcheon (Korea, Republic of); Kwon, Duk Mun [Dept. of Radiology Technology, Daegu Health College, Daegu (Korea, Republic of); Kang, Yeong Han [Dept. of Diagnostic Radiology, Daegu Catholic Univesity Hospital, Daegu (Korea, Republic of)
2009-12-15
The purpose of this study was to analyze factors that could affect health of radiological technologists, which is useful for health care and development of programs for health promotion. Subjects were 234 of radiological technologists who work in general hospitals. Some questionnaires were made about perceptions of health condition and promotional behavior of health for this study. The questionnaires of health perception were 20 items that consist of the present condition of health, health concern and sensitivity. The reliability was sufficient(Cronbach's {alpha}=0.79). The other questionnaires about health promotion behavior were 47 items that consist of self-realization, health responsibility, exercise, nutrition, personal relationships, and stress management. The results turned out to be was sufficient (Cronbach's {alpha}=0.93). Every data was treated statistically, comparison of average(t-test, ANOVA), correlation, and multiple regression. Related factors to health promotion behavior were age, marriage, salary, class of one's position, career, employment, and religion, in general features. In health life habit, related factors were smoke and exercise. Results of health promotion behavior was 2.90 of mean score, 0.37 of standard deviation. Correlations between factors of health perception and health promotion behavior was positive(p<0.01). Health promotion behavior were affected by sensitivity, presents condition of health, exercise, smoke, career. Sensitivity was the most affectable variable, which means that promotional behavior score became higher and higher as the score of sensitivity and present condition were increased. In addition, persons who exercise regularly, had been smoked, and has higher career showed higher score of promotional behavior. Radiological technologists have to keep their health, trying not to infected by a disease. Most of all, no smoking and regular exercise are the most important thing to all of members.
DEFF Research Database (Denmark)
Neergaard, Jesper; Møller, Katrine Dragsbæk; Christiansen, Claus
2017-01-01
truncated tau fragments (Tau-A and Tau-C) in serum. Platelets, albumin and several modifiable risk factors, including Body Mass Index, high density lipoprotein and White Blood Cell count were associated with the serum level of tau fragments. The factors associated with tau in serum may promote...
Cumulative Effects of Mothers' Risk and Promotive Factors on Daughters' Disruptive Behavior
van der Molen, Elsa; Hipwell, Alison E.; Vermeiren, Robert; Loeber, Rolf
2012-01-01
Little is known about the ways in which the accumulation of maternal factors increases or reduces risk for girls' disruptive behavior during preadolescence. In the current study, maternal risk and promotive factors and the severity of girls' disruptive behavior were assessed annually among girls' ages 7-12 in an urban community sample (N = 2043).…
Factors Promoting Vocational Students' Learning at Work: Study on Student Experiences
Virtanen, Anne; Tynjälä, Päivi; Eteläpelto, Anneli
2014-01-01
In order to promote effective pedagogical practices for students' work-based learning, we need to understand better how students' learning at work can be supported. This paper examines the factors explaining students' workplace learning (WPL) outcomes, addressing three aspects: (1) student-related individual factors, (2) social and…
Assignment of sigma factors of RNA polymerase to promoters in Corynebacterium glutamicum
Czech Academy of Sciences Publication Activity Database
Dostálová, Hana; Holátko, Jiří; Busche, T.; Rucká, Lenka; Rapoport, Andrey; Halada, Petr; Nešvera, Jan; Kalinowski, J.; Pátek, Miroslav
2017-01-01
Roč. 7, JUN 23 (2017), s. 1-13, č. článku 133. ISSN 2191-0855 R&D Projects: GA ČR(CZ) GA17-06991S Institutional support: RVO:61388971 Keywords : Corynebacterium glutamicum * Promoter * Sigma factor Subject RIV: EE - Microbiology, Virology OBOR OECD: Microbiology Impact factor: 1.825, year: 2016
Directory of Open Access Journals (Sweden)
Guillem Casanovas
2014-01-01
Full Text Available Systemic iron homeostasis involves a negative feedback circuit in which the expression level of the peptide hormone hepcidin depends on and controls the iron blood levels. Hepcidin expression is regulated by the BMP6/SMAD and IL6/STAT signaling cascades. Deregulation of either pathway causes iron-related diseases such as hemochromatosis or anemia of inflammation. We quantitatively analyzed how BMP6 and IL6 control hepcidin expression. Transcription factor (TF phosphorylation and reporter gene expression were measured under co-stimulation conditions, and the promoter was perturbed by mutagenesis. Using mathematical modeling, we systematically analyzed potential mechanisms of cooperative and competitive promoter regulation by the transcription factors, and experimentally validated the model predictions. Our results reveal that hepcidin cross-regulation primarily occurs by combinatorial transcription factor binding to the promoter, whereas signaling crosstalk is insignificant. We find that the presence of two BMP-responsive elements enhances the steepness of the promoter response towards the iron-sensing BMP signaling axis, which promotes iron homeostasis in vivo. IL6 co-stimulation reduces the promoter sensitivity towards the BMP signal, because the SMAD and STAT transcription factors compete for recruiting RNA polymerase to the transcription start site. This may explain why inflammatory signals disturb iron homeostasis in anemia of inflammation. Taken together, our results reveal why the iron homeostasis circuit is sensitive to perturbations implicated in disease.
DEFF Research Database (Denmark)
Dossani, Zain Y.; Apel, Amanda Reider; Szmidt-Middleton, Heather
2018-01-01
regions, we have built a library of hybrid promoters that are regulated by a synthetic transcription factor. The hybrid promoters consist of native S. cerevisiae promoters, in which the operator regions have been replaced with sequences that are recognized by the bacterial LexA DNA binding protein....... Correspondingly, the synthetic transcription factor (TF) consists of the DNA binding domain of the LexA protein, fused with the human estrogen binding domain and the viral activator domain, VP16. The resulting system with a bacterial DNA binding domain avoids the transcription of native S. cerevisiae genes...... levels, using the same synthetic TF and a given estradiol. This set of promoters, in combination with our synthetic TF, has the potential to regulate numerous genes or pathways simultaneously, to multiple desired levels, in a single strain....
International Nuclear Information System (INIS)
Nagasaka, Akihiko; Tomizawa, Norio
2012-01-01
The implementation of risk assessment (RA) has been mandated effort in business place of the type of industry that must elect a safe hygiene manager by the enforcement of the revised Occupational Safety and Health Act of April, 2006. However, it is guessed that some problems are still left unfinished in many business places to promote RA effectively. In this study, at first the authors investigated promotion factors and disincentive factors when implementing RA by literature survey. As the result, factors to show as follows were classified in some categories such as participation of the top, the organization which promotes RA, the use of the existing safety activity, matching of RA technique and work, etc. unlike conventional safety activity to learn from a disaster, infiltrating significance of RA to prevent a risk enough, letting a worker engaged in work participate in RA. Next, the authors performed the visit investigation for 8 business places and extracted a new promotion factors to show as follows. incorporating RA in usual duties, utilizing results of RA effectively. In reference to above promotion factors, the authors examined a policy to implement RA smoothly. (author)
Motivating factors for small and midsized businesses to implement worksite health promotion.
Witt, Laurel B; Olsen, Delane; Ablah, Elizabeth
2013-11-01
This study explores the decision-making process, including motivating factors, for small and midsized businesses in the Midwest to implement health promotion initiatives. This a replication of a study conducted in the Pacific Northwest. Semistructured qualitative interviews were conducted with key informants from 12 Midwestern metropolitan employers with fewer than 1,000 employees. Informants were interviewed regarding their companies' policies and practices around workplace health promotion programming adoption and valuation. Workplace health promotion adoption at these small and midsized businesses was motivated by three goals: to lower health care costs, to address human relations objectives, and to improve productivity. Low upfront cost was the most frequently considered criterion in choosing which workplace health promotion program to offer. Barriers to implementation included lack of employee buy-in, prohibitive costs, and personnel or time constraints. Aids to implementation included employee buy-in and affordability. This study suggests that cost considerations predominate in the workplace health promotion decision-making process at small to midsized businesses. Furthermore, employee buy-in cannot be underestimated as a factor in successful program implementation or longevity. Employees, along with executives and human resources management, must be appropriately targeted by health promotion practitioners in workplace health promotion efforts.
The mitochondrial fusion-promoting factor mitofusin is a substrate of the PINK1/parkin pathway.
Directory of Open Access Journals (Sweden)
Angela C Poole
2010-04-01
Full Text Available Loss-of-function mutations in the PINK1 or parkin genes result in recessive heritable forms of parkinsonism. Genetic studies of Drosophila orthologs of PINK1 and parkin indicate that PINK1, a mitochondrially targeted serine/threonine kinase, acts upstream of Parkin, a cytosolic ubiquitin-protein ligase, to promote mitochondrial fragmentation, although the molecular mechanisms by which the PINK1/Parkin pathway promotes mitochondrial fragmentation are unknown. We tested the hypothesis that PINK1 and Parkin promote mitochondrial fragmentation by targeting core components of the mitochondrial morphogenesis machinery for ubiquitination. We report that the steady-state abundance of the mitochondrial fusion-promoting factor Mitofusin (dMfn is inversely correlated with the activity of PINK1 and Parkin in Drosophila. We further report that dMfn is ubiquitinated in a PINK1- and Parkin-dependent fashion and that dMfn co-immunoprecipitates with Parkin. By contrast, perturbations of PINK1 or Parkin did not influence the steady-state abundance of the mitochondrial fission-promoting factor Drp1 or the mitochondrial fusion-promoting factor Opa1, or the subcellular distribution of Drp1. Our findings suggest that dMfn is a direct substrate of the PINK1/Parkin pathway and that the mitochondrial morphological alterations and tissue degeneration phenotypes that derive from mutations in PINK1 and parkin result at least in part from reduced ubiquitin-mediated turnover of dMfn.
Factors that promote or hinder young disabled people in work participation: a systematic review.
Achterberg, T J; Wind, H; de Boer, A G E M; Frings-Dresen, M H W
2009-06-01
The aim of this systematic review was to study factors which promote or hinder young disabled people entering the labor market. We systematically searched PubMed (by means of MESH and text words), EMBASE, PsycINFO, Web of Science and CINAHL for studies regarding (1) disabled patients diagnosed before the age of 18 years and (2) factors of work participation. Out of 1,268 retrieved studies and 28 extended studies from references and four from experts, ten articles were included. Promoting factors are male gender, high educational level, age at survey, low depression scores, high dispositional optimism and high psychosocial functioning. Female and low educational level gives high odds of unemployment just like low IQ, inpatient treatment during follow up, epilepsy, motor impairment, wheelchair dependency, functional limitations, co-morbidity, physical disability and chronic health conditions combined with mental retardation. High dose cranial radiotherapy, type of cancer, and age of diagnosis also interfered with employment. Of the promoting factors, education appeared to be important, and several physical obstructions were found to be hindering factors. The last mentioned factors can be influenced in contrast to for instance age and gender. However, to optimize work participation of this group of young disabled it is important to know the promoting or hindering influence for employment.
Xu, Meixiang; Cross, Courtney E; Speidel, Jordan T; Abdel-Rahman, Sherif Z
2016-10-01
The O 6 -methylguanine-DNA methyltransferase (MGMT) protein removes O 6 -alkyl-guanine adducts from DNA. MGMT expression can thus alter the sensitivity of cells and tissues to environmental and chemotherapeutic alkylating agents. Previously, we defined the haplotype structure encompassing single nucleotide polymorphisms (SNPs) in the MGMT promoter/enhancer (P/E) region and found that haplotypes, rather than individual SNPs, alter MGMT promoter activity. The exact mechanism(s) by which these haplotypes exert their effect on MGMT promoter activity is currently unknown, but we noted that many of the SNPs comprising the MGMT P/E haplotypes are located within or in close proximity to putative transcription factor binding sites. Thus, these haplotypes could potentially affect transcription factor binding and, subsequently, alter MGMT promoter activity. In this study, we test the hypothesis that MGMT P/E haplotypes affect MGMT promoter activity by altering transcription factor (TF) binding to the P/E region. We used a promoter binding TF profiling array and a reporter assay to evaluate the effect of different P/E haplotypes on TF binding and MGMT expression, respectively. Our data revealed a significant difference in TF binding profiles between the different haplotypes evaluated. We identified TFs that consistently showed significant haplotype-dependent binding alterations (p ≤ 0.01) and revealed their role in regulating MGMT expression using siRNAs and a dual-luciferase reporter assay system. The data generated support our hypothesis that promoter haplotypes alter the binding of TFs to the MGMT P/E and, subsequently, affect their regulatory function on MGMT promoter activity and expression level.
Yang, Yan; Wu, Xi; Li, Qiang; Jiao, Shu-fang; Li, Xun; Li, Xin-jian; Zhu, Guo-ping; Du, Lin; Zhao, Jian-hua; Jiang, Yuan; Feng, Guo-ze
2009-04-01
To know the situation of tobacco advertisement, promotions and related factors in six cities in China. 4815 adults (above 18 years), selected form Beijing, Shanghai, Shenyang, Changsha, Guangzhou and Yinchuan through probability proportionate sampling and simple random sampling, were investigated through questionnaires. The most commonly reported channels that smokers noticed tobacco advertisements were billboards (35.6%) and television (34.4%). The most commonly reported tobacco promotional activities that were noticed by smokers were free gifts when buying cigarettes (23.1%) and free samples of cigarettes (13.9%). Smokers in Changsha were more likely to report noticing tobacco advertisement on billboards (chi2 = 562.474, P advertisement and promotion. It was universal to see tobacco advertisement and promotions in cities in China but the laws and regulations about tobacco-control were not uniformly executed in different cities. It is necessary to perfect and uniform related laws and regulations.
Features of cryptic promoters and their varied reliance on bromodomain-containing factors.
Directory of Open Access Journals (Sweden)
Samantha G Pattenden
Full Text Available The Set2-Rpd3S pathway is important for the control of transcription memory. Mutation of components of this pathway results in cryptic transcription initiation within the coding region of approximately 30% of yeast genes. Specifically, deletion of the Set2 histone methyltransferase or Rco1, a component of the Rpd3S histone deacetylase complex leads to hyperacetylation of certain open reading frames (ORFs. We used this mutant as a system to study the role of histone modifications and co-activator recruitment in preinitiation complex (PIC formation. Specifically, we looked at the dependence of promoters on the bromodomain-containing RSC complex and the Bdf1 protein. We found that the dependence of cryptic promoters for these proteins varied. Overall, our data indicate that cryptic promoters are independently regulated, and their activation is dependent on factors that govern gene activation at canonical promoters.
DEFF Research Database (Denmark)
Sedgwick, G.G.; Townsend, K.; Martin, A.
2013-01-01
The anaphase-promoting complex/cyclosome (APC/C) is an ubiquitin ligase that functions during mitosis. Here we identify the transcriptional regulator, transcriptional intermediary factor 1γ, TIF1γ, as an APC/C-interacting protein that regulates APC/C function. TIF1γ is not a substrate for APC....../C-dependent ubiquitylation but instead, associates specifically with the APC/C holoenzyme and Cdc20 to affect APC/C activity and progression through mitosis. RNA interference studies indicate that TIF1γ knockdown results in a specific reduction in APC/C ubiquitin ligase activity, the stabilization of APC/C substrates......, and an increase in the time taken for cells to progress through mitosis from nuclear envelope breakdown to anaphase. TIF1γ knockdown cells are also characterized by the inappropriate presence of cyclin A at metaphase, and an increase in the number of cells that fail to undergo metaphase-to-anaphase transition...
Host factors that promote retrotransposon integration are similar in distantly related eukaryotes.
Directory of Open Access Journals (Sweden)
Sudhir Kumar Rai
2017-12-01
Full Text Available Retroviruses and Long Terminal Repeat (LTR-retrotransposons have distinct patterns of integration sites. The oncogenic potential of retrovirus-based vectors used in gene therapy is dependent on the selection of integration sites associated with promoters. The LTR-retrotransposon Tf1 of Schizosaccharomyces pombe is studied as a model for oncogenic retroviruses because it integrates into the promoters of stress response genes. Although integrases (INs encoded by retroviruses and LTR-retrotransposons are responsible for catalyzing the insertion of cDNA into the host genome, it is thought that distinct host factors are required for the efficiency and specificity of integration. We tested this hypothesis with a genome-wide screen of host factors that promote Tf1 integration. By combining an assay for transposition with a genetic assay that measures cDNA recombination we could identify factors that contribute differentially to integration. We utilized this assay to test a collection of 3,004 S. pombe strains with single gene deletions. Using these screens and immunoblot measures of Tf1 proteins, we identified a total of 61 genes that promote integration. The candidate integration factors participate in a range of processes including nuclear transport, transcription, mRNA processing, vesicle transport, chromatin structure and DNA repair. Two candidates, Rhp18 and the NineTeen complex were tested in two-hybrid assays and were found to interact with Tf1 IN. Surprisingly, a number of pathways we identified were found previously to promote integration of the LTR-retrotransposons Ty1 and Ty3 in Saccharomyces cerevisiae, indicating the contribution of host factors to integration are common in distantly related organisms. The DNA repair factors are of particular interest because they may identify the pathways that repair the single stranded gaps flanking the sites of strand transfer following integration of LTR retroelements.
Host factors that promote retrotransposon integration are similar in distantly related eukaryotes.
Rai, Sudhir Kumar; Sangesland, Maya; Lee, Michael; Esnault, Caroline; Cui, Yujin; Chatterjee, Atreyi Ghatak; Levin, Henry L
2017-12-01
Retroviruses and Long Terminal Repeat (LTR)-retrotransposons have distinct patterns of integration sites. The oncogenic potential of retrovirus-based vectors used in gene therapy is dependent on the selection of integration sites associated with promoters. The LTR-retrotransposon Tf1 of Schizosaccharomyces pombe is studied as a model for oncogenic retroviruses because it integrates into the promoters of stress response genes. Although integrases (INs) encoded by retroviruses and LTR-retrotransposons are responsible for catalyzing the insertion of cDNA into the host genome, it is thought that distinct host factors are required for the efficiency and specificity of integration. We tested this hypothesis with a genome-wide screen of host factors that promote Tf1 integration. By combining an assay for transposition with a genetic assay that measures cDNA recombination we could identify factors that contribute differentially to integration. We utilized this assay to test a collection of 3,004 S. pombe strains with single gene deletions. Using these screens and immunoblot measures of Tf1 proteins, we identified a total of 61 genes that promote integration. The candidate integration factors participate in a range of processes including nuclear transport, transcription, mRNA processing, vesicle transport, chromatin structure and DNA repair. Two candidates, Rhp18 and the NineTeen complex were tested in two-hybrid assays and were found to interact with Tf1 IN. Surprisingly, a number of pathways we identified were found previously to promote integration of the LTR-retrotransposons Ty1 and Ty3 in Saccharomyces cerevisiae, indicating the contribution of host factors to integration are common in distantly related organisms. The DNA repair factors are of particular interest because they may identify the pathways that repair the single stranded gaps flanking the sites of strand transfer following integration of LTR retroelements.
Henry, Kimberly L.; Shtivelband, Annette; Comello, Maria Leonora G.; Slater, Michael D.
2011-01-01
This study explored an understudied promotive factor, a belief that alcohol use is inconsistent with personal autonomy, which may reduce adolescent intention to drink and subsequent alcohol use. Autonomy was examined as an attitudinal construct within the Theory of Reasoned Action. Longitudinal data from 2,493 seventh grade students nested in 40…
Factors that Promote or Hinder Young Disabled People in Work Participation: A Systematic Review
Achterberg, T. J.; Wind, H.; de Boer, A. G. E. M.; Frings-Dresen, M. H. W.
2009-01-01
Introduction The aim of this systematic review was to study factors which promote or hinder young disabled people entering the labor market. Methods We systematically searched PubMed (by means of MESH and text words), EMBASE, PsycINFO, Web of Science and CINAHL for studies regarding (1) disabled
de Vries, H.J.; Reneman, M.F.; Groothoff, J.W.; Geertzen, J.H.B.; Brouwer, S.
2012-01-01
Purpose: To identify determinants for staying at work (SAW) in workers with chronic musculoskeletal pain (CMP). Method: A systematic review of factors that promote SAW in workers with CMP. We searched the databases of PubMed, EMBASE, PsycInfo, CINAHL and the Cochrane Library. We included studies
Regulation of the human ADAMTS-4 promoter by transcription factors and cytokines
International Nuclear Information System (INIS)
Thirunavukkarasu, Kannan; Pei, Yong; Moore, Terry L.; Wang, He; Yu, Xiao-peng; Geiser, Andrew G.; Chandrasekhar, Srinivasan
2006-01-01
ADAMTS-4 (aggrecanase-1) is a metalloprotease that plays a role in aggrecan degradation in the cartilage extracellular matrix. In order to understand the regulation of ADAMTS-4 gene expression we have cloned and characterized a functional 4.5 kb human ADAMTS-4 promoter. Sequence analysis of the promoter revealed the presence of putative binding sites for nuclear factor of activated T cells (NFAT) and Runx family of transcription factors that are known to regulate chondrocyte maturation and differentiation. Using promoter-reporter assays and mRNA analysis we have analyzed the role of chondrocyte-expressed transcription factors NFATp and Runx2 and have shown that ADAMTS-4 is a potential downstream target of these two factors. Our results suggest that inhibition of the expression/function of NFATp and/or Runx2 may enable us to modulate aggrecan degradation in normal physiology and/or in degenerative joint diseases. The ADAMTS-4 promoter would serve as a valuable mechanistic tool to better understand the regulation of ADAMTS-4 expression by signaling pathways that modulate cartilage matrix breakdown
Community Violence Exposure and Adolescent Delinquency: Examining a Spectrum of Promotive Factors
Chen, Pan; Voisin, Dexter R.; Jacobson, Kristen C.
2016-01-01
This study examined whether promotive factors (future expectations, family warmth, school attachment, and neighborhood cohesion) moderated relationships between community violence exposure and youth delinquency. Analyses were conducted using N = 2,980 sixth to eighth graders (M[subscript age] = 12.48; 41.1% males) from a racially, ethnically, and…
Chen, Hsiu-Chih; Chen, Hsing-Mei; Chen, Min-Li; Chiang, Chih-Ming; Chen, Mei-Yen
2012-06-01
Tainan City has the third highest prevalence of junior high school student obesity of all administrative districts in Taiwan. School nurses play an important role in promoting student health. Understanding the factors that significantly impact student weight is critical to designing effective student health promotion programs. This study explored the relationships between health promotion behavior and serum biomarker variables and body size. Researchers used a cross-sectional descriptive study design and stratified cluster random sampling. Subjects were 7th graders who received an in-school health checkup with blood test at 41 public junior high schools in Tainan City between July 2010 and May 2011. Research instruments included the adolescent health promotion (AHP) scale, serum biochemical profile and BMI (body mass index). Obtained data were analyzed using descriptive and inferential statistics. Of the 726 students who participated in this study, 22.2% were underweight and 23.8% were overweight or obese. Higher AHP scores correlated with better biomarkers and body size. Multivariate analysis found factors that increased the risk of being overweight included: being male, having a father with a relatively low level of education, playing video games frequently, and doing little or no exercise (odds ratio = 1.93, 1.75, 1.07, 1.04, respectively). Participants with relatively healthy behaviors had better biomarkers and a lower risk of being overweight. Findings can support the development of evidence-based school programs to promote student health.
Directory of Open Access Journals (Sweden)
Zaider Gloria Triviño-Vargas
2018-05-01
Full Text Available Introduction: Health promotion has been a constant concern in the human being. It allows to understand behaviors related to it and orientates towards the generation of health promoting behaviors (HPB that promote personal well-being. Objective: To determine the predictor factors influencing the HPB of the teachers according to Pender’s health promotion model. Materials and methods: A correlational descriptive design was made with a representative sample of the teachers with current contract during the study. Instruments such as the EVPS II scale of Pender were applied to measure the dependent variable CPS, as well as for the independent ones such as sociodemographic, knowledge on health promotion, perception of health status and perception of self-efficacy. Results: They are descriptive, according to the coefficient of variation in each of the subdimensions of the behaviors: spiritual growth, interpersonal relations, responsibility in health, nutrition, management of stress and physical activity. The predictor factors were based on the multiple regression model. Conclusions: Favorable HPB were spiritual growth, interpersonal relationships and nutrition. Predictors that have effect on HPB were presented on the basis of teacher rankings, age, senior adult performance area, stratum, income and area of performance, mental health and psychiatry.
Noh, Jin-Won; Yun, Hyo-Young; Park, Hyunchun; Yu, Shi-Eun
2015-09-01
The present study aimed to analyze the factors that could affect the health-promoting behaviors of North Korean adolescent refugees residing in South Korea. Questions about their sociodemographic variables, subjective health status, healthy living habits, and health-promoting behaviors were asked. Statistically significant differences were found in religion (t=2.30, pKorea (t=2.02, preligion (t=2.17, preligion (t=4.21, pKorea (t=2.04, pNorth Korean adolescent refugees.
Directory of Open Access Journals (Sweden)
Matjaz Knez
2017-06-01
Full Text Available Recently different studies of green transport have become interesting for policy makers,car manufacturers, customers and energy suppliers. Many stakeholders from the publicand private sectors are investing a lot of effort to identify consumer behaviour for futureimprovements in development of green products and effective strategies, which couldaccelerate the transition to sustainable future. This paper presents the effects of electricvehicle promotional policies and customer preferences about alternative fuel vehicles.This study has shown that the electric vehicle promotional policies adopted in Sloveniahave been unsuccessful, as the share of first-time registered electric vehicles in 2013 wasbelow 1%. For different segments of people whose opinions about low emission vehiclesdiffer, different measures must be adopted. When designing promotional policies focusmust be on the most relevant factors such as the total vehicle price and fuel economy.
The common risk factor approach: a rational basis for promoting oral health.
Sheiham, A; Watt, R G
2000-12-01
Conventional oral health education is not effective nor efficient. Many oral health programmes are developed and implemented in isolation from other health programmes. This often leads, at best to a duplication of effort, or worse, conflicting messages being delivered to the public. In addition, oral health programmes tend to concentrate on individual behaviour change and largely ignore the influence of socio-political factors as the key determinants of health. Based upon the general principles of health promotion this paper presents a rationale for an alternative approach for oral health policy. The common risk factor approach addresses risk factors common to many chronic conditions within the context of the wider socio-environmental milieu. Oral health is determined by diet, hygiene, smoking, alcohol use, stress and trauma. As these causes are common to a number of other chronic diseases, adopting a collaborative approach is more rational than one that is disease specific. The common risk factor approach can be implemented in a variety of ways. Food policy development and the Health Promoting Schools initiative are used as examples of effective ways of promoting oral health.
International Nuclear Information System (INIS)
Asting, Annika Gustafsson; Carén, Helena; Andersson, Marianne; Lönnroth, Christina; Lagerstedt, Kristina; Lundholm, Kent
2011-01-01
Increased cyclooxygenase activity promotes progression of colorectal cancer, but the mechanisms behind COX-2 induction remain elusive. This study was therefore aimed to define external cell signaling and transcription factors relating to high COX-2 expression in colon cancer tissue. Tumor and normal colon tissue were collected at primary curative operation in 48 unselected patients. COX-2 expression in tumor and normal colon tissue was quantified including microarray analyses on tumor mRNA accounting for high and low tumor COX-2 expression. Cross hybridization was performed between tumor and normal colon tissue. Methylation status of up-stream COX-2 promoter region was evaluated. Tumors with high COX-2 expression displayed large differences in gene expression compared to normal colon. Numerous genes with altered expression appeared in tumors of high COX-2 expression compared to tumors of low COX-2. COX-2 expression in normal colon was increased in patients with tumors of high COX-2 compared to normal colon from patients with tumors of low COX-2. IL1β, IL6 and iNOS transcripts were up-regulated among external cell signaling factors; nine transcription factors (ATF3, C/EBP, c-Fos, Fos-B, JDP2, JunB, c-Maf, NF-κB, TCF4) showed increased expression and 5 (AP-2, CBP, Elk-1, p53, PEA3) were decreased in tumors with high COX-2. The promoter region of COX-2 gene did not show consistent methylation in tumor or normal colon tissue. Transcription and external cell signaling factors are altered as covariates to COX-2 expression in colon cancer tissue, but DNA methylation of the COX-2 promoter region was not a significant factor behind COX-2 expression in tumor and normal colon tissue
Gerrish, Kate; Nolan, Mike; McDonnell, Ann; Tod, Angela; Kirshbaum, Marilyn; Guillaume, Louise
2012-02-01
Advanced practice nurses (APNs) have an important role in promoting evidence-based practice (EBP) among frontline nurses (FLNs). Factors influencing FLNs' engagement with EBP are well documented but little is known about factors that affect APNs' ability to facilitate evidence in practice. To identify factors that influence APNs' ability to promote EBP among FLNs. A multiple case study of 23 APNs from hospital and primary care settings across seven English health authorities was undertaken. Data collection comprised interviews and observation of APNs and interviews with FLNs and other healthcare professionals. Data were analysed using the Framework approach. Four groups of influencing factors were identified: (1) Personal attributes of APNs included knowledge and skills in EBP, clinical credibility with frontline staff and leadership style. (2) Relationships with stakeholders included APNs' interactions with FLNs and the level of support from managers and medical colleagues. (3) Aspects of the APN role included their sphere of responsibility and workload. (4) Organisational context included the organisational culture, FLNs' workload, professional networks and available resources. Educational preparation for APNs should enable them to develop expertise in EBP plus interpersonal and leadership skills to manage relational dynamics in clinical settings. APN role specifications should provide the opportunity to promote EBP. The organisational culture should be conducive to enabling EBP with managers supportive of this aspect of the APNs' role. APNs need to be supported to address the individual, interpersonal and organisational factors, which influence their ability to promote EBP. Organisational commitment at the highest level is key to APNs' ability to fulfil this aspect of their role. ©2011 Sigma Theta Tau International.
Directory of Open Access Journals (Sweden)
Lagerstedt Kristina
2011-06-01
Full Text Available Abstract Background Increased cyclooxygenase activity promotes progression of colorectal cancer, but the mechanisms behind COX-2 induction remain elusive. This study was therefore aimed to define external cell signaling and transcription factors relating to high COX-2 expression in colon cancer tissue. Method Tumor and normal colon tissue were collected at primary curative operation in 48 unselected patients. COX-2 expression in tumor and normal colon tissue was quantified including microarray analyses on tumor mRNA accounting for high and low tumor COX-2 expression. Cross hybridization was performed between tumor and normal colon tissue. Methylation status of up-stream COX-2 promoter region was evaluated. Results Tumors with high COX-2 expression displayed large differences in gene expression compared to normal colon. Numerous genes with altered expression appeared in tumors of high COX-2 expression compared to tumors of low COX-2. COX-2 expression in normal colon was increased in patients with tumors of high COX-2 compared to normal colon from patients with tumors of low COX-2. IL1β, IL6 and iNOS transcripts were up-regulated among external cell signaling factors; nine transcription factors (ATF3, C/EBP, c-Fos, Fos-B, JDP2, JunB, c-Maf, NF-κB, TCF4 showed increased expression and 5 (AP-2, CBP, Elk-1, p53, PEA3 were decreased in tumors with high COX-2. The promoter region of COX-2 gene did not show consistent methylation in tumor or normal colon tissue. Conclusions Transcription and external cell signaling factors are altered as covariates to COX-2 expression in colon cancer tissue, but DNA methylation of the COX-2 promoter region was not a significant factor behind COX-2 expression in tumor and normal colon tissue.
Guinane, Caitriona M; Piper, Clare; Draper, Lorraine A; O'Connor, Paula M; Hill, Colin; Ross, R Paul; Cotter, Paul D
2015-11-01
Bacteriocin production is regarded as a desirable probiotic trait that aids in colonization and persistence in the gastrointestinal tract (GIT). Strains of Lactobacillus salivarius, a species associated with the GIT, are regarded as promising probiotic candidates and have a number of associated bacteriocins documented to date. These include multiple class IIb bacteriocins (salivaricin T, salivaricin P, and ABP-118) and the class IId bacteriocin bactofencin A, which show activity against medically important pathogens. However, the production of a bacteriocin in laboratory media does not ensure production under stressful environmental conditions, such as those encountered within the GIT. To allow this issue to be addressed, the promoter regions located upstream of the structural genes encoding the L. salivarius bacteriocins mentioned above were fused to a number of reporter proteins (green fluorescent protein [GFP], red fluorescent protein [RFP], and luciferase [Lux]). Of these, only transcriptional fusions to GFP generated signals of sufficient strength to enable the study of promoter activity in L. salivarius. While analysis of the class IIb bacteriocin promoter regions indicated relatively weak GFP expression, assessment of the promoter of the antistaphylococcal bacteriocin bactofencin A revealed a strong promoter that is most active in the absence of the antimicrobial peptide and is positively induced in the presence of mild environmental stresses, including simulated gastric fluid. Taken together, these data provide information on factors that influence bacteriocin production, which will assist in the development of strategies to optimize in vivo and in vitro production of these antimicrobials. Copyright © 2015, American Society for Microbiology. All Rights Reserved.
Na, Kyoung-Sae; Won, Eunsoo; Kang, June; Chang, Hun Soo; Yoon, Ho-Kyoung; Tae, Woo Suk; Kim, Yong-Ku; Lee, Min-Soo; Joe, Sook-Haeng; Kim, Hyun; Ham, Byung-Joo
2016-02-15
Recent studies have reported that methylation of the brain-derived neurotrophic factor (BDNF) gene promoter is associated with major depressive disorder (MDD). This study aimed to investigate the association between cortical thickness and methylation of BDNF promoters as well as serum BDNF levels in MDD. The participants consisted of 65 patients with recurrent MDD and 65 age- and gender-matched healthy controls. Methylation of BDNF promoters and cortical thickness were compared between the groups. The right medial orbitofrontal, right lingual, right lateral occipital, left lateral orbitofrontal, left pars triangularis, and left lingual cortices were thinner in patients with MDD than in healthy controls. Among the MDD group, right pericalcarine, right medical orbitofrontal, right rostral middle frontal, right postcentral, right inferior temporal, right cuneus, right precuneus, left frontal pole, left superior frontal, left superior temporal, left rostral middle frontal and left lingual cortices had inverse correlations with methylation of BDNF promoters. Higher levels of BDNF promoter methylation may be closely associated with the reduced cortical thickness among patients with MDD. Serum BDNF levels were significantly lower in MDD, and showed an inverse relationship with BDNF methylation only in healthy controls. Particularly the prefrontal and occipital cortices seem to indicate key regions in which BDNF methylation has a significant effect on structure.
The work ability continuum : Epidemiological studies of factors promoting sustainable work ability
Lindberg, Per
2006-01-01
For the individual, the workplace and society, there would be considerable gains if the number of people suffering from physical and mental disorders could be reduced. The overall aim of this thesis was to identify determinants for future work ability among gainfully employed women and men, with special reference to promotive factors at work. Work ability is in this thesis defined as the ability to work with respect to demands at work on health and physical and mental reso...
Cusack, Lynette; Smith, Morgan; Hegney, Desley; Rees, Clare S.; Breen, Lauren J.; Witt, Regina R.; Rogers, Cath; Williams, Allison; Cross, Wendy; Cheung, Kin
2016-01-01
Building nurses' resilience to complex and stressful practice environments is necessary to keep skilled nurses in the workplace and ensuring safe patient care. A unified theoretical framework titled Health Services Workplace Environmental Resilience Model (HSWERM), is presented to explain the environmental factors in the workplace that promote nurses' resilience. The framework builds on a previously-published theoretical model of individual resilience, which identified the key constructs of p...
Directory of Open Access Journals (Sweden)
Nahyun Choi
2018-02-01
Full Text Available Minoxidil directly promotes hair growth via the stimulation of dermal papilla (DP and epithelial cells. Alternatively, there is little evidence for indirect promotion of hair growth via stimulation of adipose-derived stem cells (ASCs. We investigated whether minoxidil stimulates ASCs and if increased growth factor secretion by ASCs facilitates minoxidil-induced hair growth. Telogen-to-anagen induction was examined in mice. Cultured DP cells and vibrissae hair follicle organ cultures were used to further examine the underlying mechanisms. Subcutaneous injection of minoxidil-treated ASCs accelerated telogen-to-anagen transition in mice, and increased hair weight at day 14 post-injection. Minoxidil did not alter ASC proliferation, but increased migration and tube formation. Minoxidil also increased the secretion of growth factors from ASCs, including chemokine (C-X-C motif ligand 1 (CXCL1, platelet-derived endothelial cell growth factor (PD-ECGF, and platelet-derived growth factor-C (PDGF-C. Minoxidil increased extracellular signal–regulated kinases 1/2 (ERK1/2 phosphorylation, and concomitant upregulation of PD-ECGF and PDGF-C mRNA levels were attenuated by an ERK inhibitor. Subcutaneous injection of CXCL1, PD-ECGF, or PDGF-C enhanced anagen induction in mice, and both CXCL1 and PDGF-C increased hair length in ex vivo organ culture. Treatment with CXCL1, PD-ECGF, or PDGF-C also increased the proliferation index in DP cells. Finally, topical application of CXCL1, PD-ECGF, or PDGF-C with 2% minoxidil enhanced anagen induction when compared to minoxidil alone. Minoxidil stimulates ASC motility and increases paracrine growth factor signaling. Minoxidil-stimulated secretion of growth factors by ASCs may enhance hair growth by promoting DP proliferation. Therefore, minoxidil can be used as an ASC preconditioning agent for hair regeneration.
Choi, Nahyun; Shin, Soyoung; Song, Sun U.; Sung, Jong-Hyuk
2018-01-01
Minoxidil directly promotes hair growth via the stimulation of dermal papilla (DP) and epithelial cells. Alternatively, there is little evidence for indirect promotion of hair growth via stimulation of adipose-derived stem cells (ASCs). We investigated whether minoxidil stimulates ASCs and if increased growth factor secretion by ASCs facilitates minoxidil-induced hair growth. Telogen-to-anagen induction was examined in mice. Cultured DP cells and vibrissae hair follicle organ cultures were used to further examine the underlying mechanisms. Subcutaneous injection of minoxidil-treated ASCs accelerated telogen-to-anagen transition in mice, and increased hair weight at day 14 post-injection. Minoxidil did not alter ASC proliferation, but increased migration and tube formation. Minoxidil also increased the secretion of growth factors from ASCs, including chemokine (C-X-C motif) ligand 1 (CXCL1), platelet-derived endothelial cell growth factor (PD-ECGF), and platelet-derived growth factor-C (PDGF-C). Minoxidil increased extracellular signal–regulated kinases 1/2 (ERK1/2) phosphorylation, and concomitant upregulation of PD-ECGF and PDGF-C mRNA levels were attenuated by an ERK inhibitor. Subcutaneous injection of CXCL1, PD-ECGF, or PDGF-C enhanced anagen induction in mice, and both CXCL1 and PDGF-C increased hair length in ex vivo organ culture. Treatment with CXCL1, PD-ECGF, or PDGF-C also increased the proliferation index in DP cells. Finally, topical application of CXCL1, PD-ECGF, or PDGF-C with 2% minoxidil enhanced anagen induction when compared to minoxidil alone. Minoxidil stimulates ASC motility and increases paracrine growth factor signaling. Minoxidil-stimulated secretion of growth factors by ASCs may enhance hair growth by promoting DP proliferation. Therefore, minoxidil can be used as an ASC preconditioning agent for hair regeneration. PMID:29495622
World Alliance for Risk Factor Surveillance White Paper on Surveillance and Health Promotion
Directory of Open Access Journals (Sweden)
Stefano Campostrini
2015-02-01
Full Text Available This is not a research paper on risk factor surveillance. It is an effort by a key group of researchers and practitioners of risk factor surveillance to define the current state of the art and to identify the key issues involved in the current practice of behavioral risk factor surveillance. Those of us who are the principal authors have worked and carried out research in this area for some three decades. As a result of a series of global meetings beginning in 1999 and continuing every two years since then, a collective working group of the International Union of Health Promotion and Education (IUHPE was formed under the name World Alliance of Risk Factor Surveillance (WARFS. Under this banner the organization sought to write a comprehensive statement on the importance of surveillance to health promotion and public health. This paper, which has been revised and reviewed by established peers in the field, is the result. It provides the reader with a clear summary of the major issues that need to be considered by any and all seeking to carry out behavioral risk factor surveillance.
Pro-tumorigenic effects of transforming growth factor beta 1 in canine osteosarcoma.
Portela, R F; Fadl-Alla, B A; Pondenis, H C; Byrum, M L; Garrett, L D; Wycislo, K L; Borst, L B; Fan, T M
2014-01-01
Transforming growth factor beta 1 (TGFβ1) is a pleiotropic cytokine that contributes to reparative skeletal remodeling by inducing osteoblast proliferation, migration, and angiogenesis. Organic bone matrix is the largest bodily reservoir for latent TGFβ1, and active osteoblasts express cognate receptors for TGFβ1 (TGFβRI and TGFβRII). During malignant osteolysis, TGFβ1 is liberated from eroded bone matrix and promotes local progression of osteotropic solid tumors by its mitogenic and prosurvival activities. Canine osteosarcoma (OS) cells will possess TGFβ1 signaling machinery. Blockade of TGFβ1 signaling will attenuate pro-tumorigenic activities in OS cells. Naturally occurring primary OS samples will express cognate TGFβ1 receptors; and in dogs with OS, focal malignant osteolysis will contribute to circulating TGFβ1 concentrations. Thirty-three dogs with appendicular OS. Expression of TGFβ1 and its cognate receptors, as well as the biologic effects of TGFβ1 blockade, was characterized in OS cells. Ten spontaneous OS samples were characterized for TGFβRI/II expressions by immunohistochemistry. In 33 dogs with OS, plasma TGFβ1 concentrations were quantified and correlated with bone resorption. Canine OS cells secrete TGFβ1, express cognate receptors, and TGFβ1 signaling blockade decreases proliferation, migration, and vascular endothelial growth factor secretion. Naturally occurring OS samples abundantly and uniformly express TGFβRI/II, and in OS-bearing dogs, circulating TGFβ1 concentrations correlate with urine N-telopeptide excretion. Canine OS cells possess TGFβ1 signaling machinery, potentially allowing for the establishment of an autocrine and paracrine pro-tumorigenic signaling loop. As such, TGFβ1 inhibitors might impede localized OS progression in dogs. Copyright © 2014 by the American College of Veterinary Internal Medicine.
Directory of Open Access Journals (Sweden)
Marcos Antonio Gaspar
2014-04-01
Full Text Available The present paper had as aim to identify factors of inter-organizational relationships which promotes and restricts the formation of companies’ cooperation network, from two levels of analysis (organizational and inter-organizational. To achieve this goal, it was developed a descriptive-qualitative study, with prospecting for primary and secondary data on a cooperation network. The universe was composed by 41 participating companies associated to the analyzed network. The sampling procedure was for researcher’s accessibility and convenience. As a result, it was identified that the network is guided by goals of cooperation among the participating companies, in addition to representing the sector and provide services in the interests of the associates. The main factors influencing the formation of the network were: business center, marketing and training; but only training has been achieved satisfactorily. The business center and marketing factors have not yet been fully developed, being both identified as restrictive factors.
Kim, Sun Jung; Yoo, Il Young
2016-03-01
The purpose of this study was to explain the health promotion behavior of Chinese international students in Korea using a structural equation model including acculturation factors. A survey using self-administered questionnaires was employed. Data were collected from 272 Chinese students who have resided in Korea for longer than 6 months. The data were analyzed using structural equation modeling. The p value of final model is .31. The fitness parameters of the final model such as goodness of fit index, adjusted goodness of fit index, normed fit index, non-normed fit index, and comparative fit index were more than .95. Root mean square of residual and root mean square error of approximation also met the criteria. Self-esteem, perceived health status, acculturative stress and acculturation level had direct effects on health promotion behavior of the participants and the model explained 30.0% of variance. The Chinese students in Korea with higher self-esteem, perceived health status, acculturation level, and lower acculturative stress reported higher health promotion behavior. The findings can be applied to develop health promotion strategies for this population. Copyright © 2016. Published by Elsevier B.V.
MiR-32 promotes gastric carcinoma tumorigenesis by targeting Kruppel-like factor 4
Energy Technology Data Exchange (ETDEWEB)
Yan, Chao [Department of General Surgery, Peking Union Medical College Hospital, Chinese Academy of Medical Science and Peking Union Medical College, Beijing, 100730 (China); Yu, Jianchun, E-mail: yu_jchpumch@163.com [Department of General Surgery, Peking Union Medical College Hospital, Chinese Academy of Medical Science and Peking Union Medical College, Beijing, 100730 (China); Liu, Yuqin [Cell Culture Center, Institute of Basic Medical Sciences, Chinese Academy of Medical Sciences and Peking Union Medical College, Beijing, 100005 (China); Kang, Weiming; Ma, Zhiqiang; Zhou, Li [Department of General Surgery, Peking Union Medical College Hospital, Chinese Academy of Medical Science and Peking Union Medical College, Beijing, 100730 (China)
2015-11-27
Gastric cancer (GC) is a prevalent malignant cancer worldwide and is highly lethal because of its fast growth. Currently, the clinical therapy options for GC remain limited. MiR-32 has been reported as an oncogenic microRNA in many cancers, but its role in GC is unclear. Here, we found that miR-32 was overexpressed in GC tissues compared with adjacent normal tissue, and miR-32 was higher in GC patients' plasma compared with healthy individuals. Furthermore, we have identified miR-32 to be oncogenic, by promoting gastric cell proliferation, migration and invasion. We also identified Kruppel-like factor 4 (KLF4) as a direct target of miR-32. Knockdown of KLF4 promoted proliferation, migration and invasion of GC cells. We conclude that miR-32 promotes GC cell proliferation, migration and invasion by targeting KLF4, suggesting that the miR-32-KLF4 pathway may be useful in clinical diagnosis and therapeutics. - Highlights: • miR-32 was overexpression in GC tissues than adjacent normal tissue. • miR-32 was higher in GC patients' plasma compared with healthy people. • miR-32 promotes GC cell proliferation, migration and invasion by targeting KLF4.
Seaton, Cherisse L; Holm, Nikolai; Bottorff, Joan L; Jones-Bricker, Margaret; Errey, Sally; Caperchione, Cristina M; Lamont, Sonia; Johnson, Steven T; Healy, Theresa
2018-05-01
To explore published empirical literature in order to identify factors that facilitate or inhibit collaborative approaches for health promotion using a scoping review methodology. A comprehensive search of MEDLINE, CINAHL, ScienceDirect, PsycINFO, and Academic Search Complete for articles published between January 2001 and October 2015 was conducted in accordance with the Preferred Reporting Items for Systematic Reviews and Meta-Analyses guidelines. To be included studies had to: be an original research article, published in English, involve at least 2 organizations in a health promotion partnership, and identify factors contributing to or constraining the success of an established (or prior) partnership. Studies were excluded if they focused on primary care collaboration or organizations jointly lobbying for a cause. Data extraction was completed by 2 members of the author team using a summary chart to extract information relevant to the factors that facilitated or constrained collaboration success. NVivo 10 was used to code article content into the thematic categories identified in the data extraction. Twenty-five studies across 8 countries were identified. Several key factors contributed to collaborative effectiveness, including a shared vision, leadership, member characteristics, organizational commitment, available resources, clear roles/responsibilities, trust/clear communication, and engagement of the target population. In general, the findings were consistent with previous reviews; however, additional novel themes did emerge.
Neural regeneration protein is a novel chemoattractive and neuronal survival-promoting factor
International Nuclear Information System (INIS)
Gorba, Thorsten; Bradoo, Privahini; Antonic, Ana; Marvin, Keith; Liu, Dong-Xu; Lobie, Peter E.; Reymann, Klaus G.; Gluckman, Peter D.; Sieg, Frank
2006-01-01
Neurogenesis and neuronal migration are the prerequisites for the development of the central nervous system. We have identified a novel rodent gene encoding for a neural regeneration protein (NRP) with an activity spectrum similar to the chemokine stromal-derived factor (SDF)-1, but with much greater potency. The Nrp gene is encoded as a forward frameshift to the hypothetical alkylated DNA repair protein AlkB. The predicted protein sequence of NRP contains domains with homology to survival-promoting peptide (SPP) and the trefoil protein TFF-1. The Nrp gene is first expressed in neural stem cells and expression continues in glial lineages. Recombinant NRP and NRP-derived peptides possess biological activities including induction of neural migration and proliferation, promotion of neuronal survival, enhancement of neurite outgrowth and promotion of neuronal differentiation from neural stem cells. NRP exerts its effect on neuronal survival by phosphorylation of the ERK1/2 and Akt kinases, whereas NRP stimulation of neural migration depends solely on p44/42 MAP kinase activity. Taken together, the expression profile of Nrp, the existence in its predicted protein structure of domains with similarities to known neuroprotective and migration-inducing factors and the high potency of NRP-derived synthetic peptides acting in femtomolar concentrations suggest it to be a novel gene of relevance in cellular and developmental neurobiology
Insulin Promoter Factor 1 variation is associated with type 2 diabetes in African Americans
Directory of Open Access Journals (Sweden)
Wang Xiaoqin
2005-10-01
Full Text Available Abstract Background Defective insulin secretion is a key defect in the pathogenesis of type 2 diabetes (T2DM. The β-cell specific transcription factor, insulin promoter factor 1 gene (IPF1, is essential to pancreatic development and the maintenance of β-cell mass. We hypothesized that regulatory or coding variants in IPF1 contribute to defective insulin secretion and thus T2DM. Methods We screened 71 Caucasian and 69 African American individuals for genetic variants in the promoter region, three highly conserved upstream regulatory sequences (PH1, PH2 and PH3, the human β-cell specific enhancer, and the two exons with adjacent introns. We tested for an association of each variant with T2DM Caucasians (192 cases and 192 controls and African Americans (341 cases and 186 controls. Results We identified 8 variants in the two populations, including a 3 bp insertion in exon 2 (InsCCG243 in African Americans that resulted in an in-frame proline insertion in the transactivation domain. No variant was associated with T2DM in Caucasians, but polymorphisms at -3766 in the human β-cell enhancer, at -2877 bp in the PH1 domain, and at -108 bp in the promoter region were associated with T2DM in African American subjects (p Conculsion The common alleles of regulatory variants in the 5' enhancer and promoter regions of the IPF1 gene increase susceptibility to type 2 diabetes among African American individuals, likely as a result of gene-gene or gene-environment interactions. In contrast, IPF1 is not a cause of type 2 diabetes in Caucasians. A previously described InsCCG243 variant may contribute to diabetes susceptibility in African American individuals, but is of low penetrance.
Factors promoting resident deaths at aged care facilities in Japan: a review.
Sugimoto, Kentaro; Ogata, Yasuko; Kashiwagi, Masayo
2018-03-01
Due to an increasingly ageing population, the Japanese government has promoted elderly deaths in aged care facilities. However, existing facilities were not designed to provide resident end-of-life care and the proportion of aged care facility deaths is currently less than 10%. Consequently, the present review evaluated the factors that promote aged care facility resident deaths in Japan from individual- and facility-level perspectives to exploring factors associated with increased resident deaths. To achieve this, MEDLINE, CINAHL, Web of Science and Ichushi databases were searched on 23 January 2016. Influential factors were reviewed for two healthcare services (insourcing and outsourcing facilities) as well as external healthcare agencies operating outside facilities. Of the original 2324 studies retrieved, 42 were included in analysis. Of these studies, five focused on insourcing, two on outsourcing, seven on external agencies and observed facility/agency-level factors. The other 28 studies identified individual-level factors related to death in aged care facilities. The present review found that at both facility and individual levels, in-facility resident deaths were associated with healthcare service provision, confirmation of resident/family end-of-life care preference and staff education. Additionally, while outsourcing facilities did not require employment of physicians/nursing staff to accommodate resident death, these facilities required visits by physicians and nursing staff from external healthcare agencies as well as residents' healthcare input. This review also found few studies examining outsourcing facilities. The number of healthcare outsourcing facilities is rapidly increasing as a result of the Japanese government's new tax incentives. Consequently, there may be an increase in elderly deaths in outsourcing healthcare facilities. Accordingly, it is necessary to identify the factors associated with residents' deaths at outsourcing facilities.
Van Osch, Mary; Scarborough, Kathy; Crowe, Sarah; Wolff, Angela C; Reimer-Kirkham, Sheryl
2018-03-01
To explore the influential factors and strategies that promote an experienced nurse's intent to stay in their emergency or critical care area. Turnover among registered nurses (herein referred to as nurses) working in specialty areas of practice can result in a range of negative outcomes. The retention of specialty nurses at the unit level has important implications for hospital and health systems. These implications include lost knowledge and experience which may in turn impact staff performance levels, patient outcomes, hiring, orientating, development of clinical competence and other aspects of organizational performance. This qualitative study used an interpretive descriptive design to understand nurses' perceptions of the current factors and strategies that promote them staying in emergency or critical care settings for two or more years. Focus groups were conducted with 13 emergency and critical care nurses. Data analysis involved thematic analysis that evolved from codes to categories to themes. Four themes were identified: leadership, interprofessional relationships, job fit and practice environment. In addition, the ideas of feeling valued, respected and acknowledged were woven throughout. Factors often associated with nurse attrition such as burnout and job stresses were not emphasised by the respondents in our study as critical to their intent to stay in their area of practice. This study has highlighted positive aspects that motivate nurses to stay in their specialty areas. To ensure quality care for patients, retention of experienced emergency and critical care nurses is essential to maintaining specialty expertise in these practice settings. © 2017 John Wiley & Sons Ltd.
Cusack, Lynette; Smith, Morgan; Hegney, Desley; Rees, Clare S; Breen, Lauren J; Witt, Regina R; Rogers, Cath; Williams, Allison; Cross, Wendy; Cheung, Kin
2016-01-01
Building nurses' resilience to complex and stressful practice environments is necessary to keep skilled nurses in the workplace and ensuring safe patient care. A unified theoretical framework titled Health Services Workplace Environmental Resilience Model (HSWERM), is presented to explain the environmental factors in the workplace that promote nurses' resilience. The framework builds on a previously-published theoretical model of individual resilience, which identified the key constructs of psychological resilience as self-efficacy, coping and mindfulness, but did not examine environmental factors in the workplace that promote nurses' resilience. This unified theoretical framework was developed using a literary synthesis drawing on data from international studies and literature reviews on the nursing workforce in hospitals. The most frequent workplace environmental factors were identified, extracted and clustered in alignment with key constructs for psychological resilience. Six major organizational concepts emerged that related to a positive resilience-building workplace and formed the foundation of the theoretical model. Three concepts related to nursing staff support (professional, practice, personal) and three related to nursing staff development (professional, practice, personal) within the workplace environment. The unified theoretical model incorporates these concepts within the workplace context, linking to the nurse, and then impacting on personal resilience and workplace outcomes, and its use has the potential to increase staff retention and quality of patient care.
Human hepatocyte growth factor promotes functional recovery in primates after spinal cord injury.
Kitamura, Kazuya; Fujiyoshi, Kanehiro; Yamane, Jun-Ichi; Toyota, Fumika; Hikishima, Keigo; Nomura, Tatsuji; Funakoshi, Hiroshi; Nakamura, Toshikazu; Aoki, Masashi; Toyama, Yoshiaki; Okano, Hideyuki; Nakamura, Masaya
2011-01-01
Many therapeutic interventions for spinal cord injury (SCI) using neurotrophic factors have focused on reducing the area damaged by secondary, post-injury degeneration, to promote functional recovery. Hepatocyte growth factor (HGF), which is a potent mitogen for mature hepatocytes and a mediator of the inflammatory responses to tissue injury, was recently highlighted as a potent neurotrophic factor in the central nervous system. We previously reported that introducing exogenous HGF into the injured rodent spinal cord using a herpes simplex virus-1 vector significantly reduces the area of damaged tissue and promotes functional recovery. However, that study did not examine the therapeutic effects of administering HGF after injury, which is the most critical issue for clinical application. To translate this strategy to human treatment, we induced a contusive cervical SCI in the common marmoset, a primate, and then administered recombinant human HGF (rhHGF) intrathecally. Motor function was assessed using an original open field scoring system focusing on manual function, including reach-and-grasp performance and hand placement in walking. The intrathecal rhHGF preserved the corticospinal fibers and myelinated areas, thereby promoting functional recovery. In vivo magnetic resonance imaging showed significant preservation of the intact spinal cord parenchyma. rhHGF-treatment did not give rise to an abnormal outgrowth of calcitonin gene related peptide positive fibers compared to the control group, indicating that this treatment did not induce or exacerbate allodynia. This is the first study to report the efficacy of rhHGF for treating SCI in non-human primates. In addition, this is the first presentation of a novel scale for assessing neurological motor performance in non-human primates after contusive cervical SCI.
Human hepatocyte growth factor promotes functional recovery in primates after spinal cord injury.
Directory of Open Access Journals (Sweden)
Kazuya Kitamura
Full Text Available Many therapeutic interventions for spinal cord injury (SCI using neurotrophic factors have focused on reducing the area damaged by secondary, post-injury degeneration, to promote functional recovery. Hepatocyte growth factor (HGF, which is a potent mitogen for mature hepatocytes and a mediator of the inflammatory responses to tissue injury, was recently highlighted as a potent neurotrophic factor in the central nervous system. We previously reported that introducing exogenous HGF into the injured rodent spinal cord using a herpes simplex virus-1 vector significantly reduces the area of damaged tissue and promotes functional recovery. However, that study did not examine the therapeutic effects of administering HGF after injury, which is the most critical issue for clinical application. To translate this strategy to human treatment, we induced a contusive cervical SCI in the common marmoset, a primate, and then administered recombinant human HGF (rhHGF intrathecally. Motor function was assessed using an original open field scoring system focusing on manual function, including reach-and-grasp performance and hand placement in walking. The intrathecal rhHGF preserved the corticospinal fibers and myelinated areas, thereby promoting functional recovery. In vivo magnetic resonance imaging showed significant preservation of the intact spinal cord parenchyma. rhHGF-treatment did not give rise to an abnormal outgrowth of calcitonin gene related peptide positive fibers compared to the control group, indicating that this treatment did not induce or exacerbate allodynia. This is the first study to report the efficacy of rhHGF for treating SCI in non-human primates. In addition, this is the first presentation of a novel scale for assessing neurological motor performance in non-human primates after contusive cervical SCI.
Crisford, Paul; Winzenberg, Tania; Venn, Alison; Schultz, Martin; Aitken, Dawn; Cleland, Verity
2018-05-21
To identify factors associated with non-medical health professionals' engagement in physical activity (PA) promotion. Five electronic databases were searched for studies including practising health professionals (excluding medical doctors), a PA promotion practice measure, a test of association between potential influencing factors and PA promotion practice, and written in English. Two researchers independently screened studies and extracted data. Extracted data were synthesized in a tabular format with a narrative summary (thematic analysis). Thirty studies involving 7734 non-medical health professionals were included. Self-efficacy in PA promotion, positive beliefs in the benefits of PA, assessing patients' PA, and PA promotion training were the main factors associated with engaging in PA promotion. Lack of remuneration was not associated. Common study limitations included a lack of information on non-responders, data collection by survey only and limited reliability or validity testing of measurements. There are common factors influencing PA promotion, but the absence of studies from some health professions, limitations related to study measures, and the lack of randomised controlled intervention trials highlights the need for further research. The factors identified may prove useful for guiding the development of strategies to encourage greater engagement in PA promotion by health professionals. Copyright © 2018 Elsevier B.V. All rights reserved.
Butler, Jason M; Kobayashi, Hideki; Rafii, Shahin
2010-02-01
The precise mechanisms whereby anti-angiogenesis therapy blocks tumour growth or causes vascular toxicity are unknown. We propose that endothelial cells establish a vascular niche that promotes tumour growth and tissue repair not only by delivering nutrients and O2 but also through an 'angiocrine' mechanism by producing stem and progenitor cell-active trophogens. Identification of endothelial-derived instructive angiocrine factors will allow direct tumour targeting, while diminishing the unwanted side effects associated with the use of anti-angiogenic agents.
Self-evaluations of factors promoting and disturbing sleep: an epidemiological survey in Finland.
Urponen, H; Vuori, I; Hasan, J; Partinen, M
1988-01-01
The purpose of this epidemiological survey (N = 1600) was to describe the factors which middle-aged urban people in Finland perceived as promoting or disturbing sleep. The response rate was 75%. The results suggested that quality of sleep is determined by numerous factors; social and psychological factors, health status, external sleeping conditions, life style and living habits. Every third respondent felt that exercise had a positive impact on sleep. Second in importance were reading and listening to music. Furthermore, sauna, shower and bath, stability in life, psychological factors, positive experience in work, satisfactory sexual life and good and quiet sleeping environment were reported to have positive effects on sleep. Men considered work-related pressure and fatigue (20%) as the most important factor disturbing falling asleep or quality of sleep. In women's ranking work problems appeared no sooner than in the third place. Women reported worries, interpersonal problems, and marital and family discord as the most disturbing factors to sleep (37%). Coffee in the evening had a negative effect on falling asleep. Although a 'nightcap' was considered to improve relaxation on falling sleep, men ranked alcohol as the fourth disturbing factor. Other disturbing factors were stress, irregularities in everyday life because of social events, travelling or atypical catnaps. Eating and exercising too heavily or too late in the evening were found to disturb sleep. On the other hand, temporary lack of exercise seemed to impair the quality of sleep. As external factors disturbing sleep the subjects considered noise light, too high room temperature, tight clothing, unfamiliar sleeping environment and restless children.(ABSTRACT TRUNCATED AT 250 WORDS)
Yu, In Tag; Park, Jin-Yong; Kim, Sung Hyun; Lee, Jeong-Sik; Kim, Yong-Seok; Son, Hyeon
2009-02-01
Valproate (VPA) influences the proliferation and differentiation of neuronal cells. However, little is known about the downstream events, such as alterations in gene transcription, that are associated with cell fate choice. To determine whether VPA plays an instructive role in cell fate choice during hippocampal neurogenesis, the expression of genes involved in the cell cycle and neuronal differentiation was investigated. Treatment with VPA during the progenitor stages resulted in strong inhibition of cell proliferation and induction of neuronal differentiation, accompanied by increases in the expression of proneural transcription factors and in neuronal cell numbers. The increased expression of Ngn1, Math1 and p15 points to a shift towards neuronal fate in response to histone deacetylase inhibitors (HDACi). Chromatin immunoprecipitation (ChIP) analysis showed that acetylated histone H4 (Ac-H4) was associated with the Ngn1, Math1 and p15 promoters in cultured hippocampal neural progenitor cells. VPA-induced hippocampal neurogenesis was also accompanied by association of Ac-H4 with the Ngn1 promoter in hippocampal extracts. The discovery of an association between HDACi and the Ngn1, Math1 and p15 promoters extends the importance of HDAC inhibition as a key regulator of neuronal differentiation at the transcriptional level.
Directory of Open Access Journals (Sweden)
Hashem Mohamadian
2014-01-01
Full Text Available ObjectivesPhysical activity behavior begins to decline during adolescence and continues to decrease throughout young adulthood. This study aims to explain factors that influence physical activity behavior in a sample of female adolescents using a health promotion model framework.MethodsThis cross-sectional survey was used to explore physical activity behavior among a sample of female adolescents. Participants completed measures of physical activity, perceived self-efficacy, self-esteem, social support, perceived barriers, and perceived affect. Interactions among the variables were examined using path analysis within a covariance modeling framework.ResultsThe final model accounted for an R2 value of 0.52 for physical activity and offered a good model-data fit. The results indicated that physical activity was predicted by self-esteem (β=0.46, p<0.001, perceived self-efficacy (β=0.40, p<0.001, social support (β=0.24, p<0.001, perceived barriers (β=-0.19, p<0.001, and perceived affect (β=0.17, p<0.001.ConclusionsThe findings of this study showed that the health promotion model was useful to predict physical activity behavior among the Iranian female adolescents. Information related to the predictors of physical activity behavior will help researchers plan more tailored culturally relevant health promotion interventions for this population.
A novel cell growth-promoting factor identified in a B cell leukemia cell line, BALL-1
International Nuclear Information System (INIS)
Dao, T.; Holan, V.; Minowada, J.
1993-01-01
A novel leukemia cell growth-promoting activity has been identified in the culture supernatant from a human B cell leukemia cell line, BALL-1. The supernatant from unstimulated cultures of the BALL-1 cells significantly promoted the growth of 16 out of 24 leukemia/lymphoma cell lines of different lineages (T, B and non-lymphoid) in a minimal concentration of fetal bovine serum (FBS), and 5 out of 12 cases of fresh leukemia cells in FBS-free medium. The growth-promoting sieve filtration and dialysis. The MW of the factor was less than 10 kDa. The growth-promoting activity was heat and acid stable and resistant to trypsin treatment. The factor isolated from the BALL-1 supernatant was distinct from known polypeptide growth factors with MW below 10 kDa, such as epidermal growth factor, transforming growth factor α, insulin-like growth factor I (IGF-I), IGF-II and insulin, as determine by specific antibodies and by cell-growth-promoting tests. The factor is the BALL-1 supernatant did not promote the proliferation of normal human fresh peripheral blood lymphocytes or mouse fibroblast cell line, BALB/C 3T3. In addition to the BALL-1 supernatant, a similar growth-promoting activity was found in the culture supernatant from 13 of 17 leukemia/lymphoma cell lines tested. The activity in these culture supernatant promoted the growth of leukemia/lymphoma cell lines in autocrine and/or paracrine fashions. These observations suggest that the low MW cell growth-promoting activity found in the BALL-1 culture supernatant is mediated by a novel factor which may be responsible for the clonal expansion of particular leukemic clones. (author)
de Carvalho Dias, Kassia; Barbugli, Paula Aboud; de Patto, Fernanda; Lordello, Virginia Barreto; de Aquino Penteado, Letícia; Medeiros, Alexandra Ivo; Vergani, Carlos Eduardo
2017-06-30
The objective of this study was to better understand the effects of soluble factors from biofilm of single- and mixed-species Candida albicans (C. albicans) and methicillin-sensitive Staphylococcus aureus (MSSA) cultures after 36 h in culture on keratinocytes (NOK-si and HaCaT) and macrophages (J774A.1). Soluble factors from biofilms of C. albicans and MSSA were collected and incubated with keratinocytes and macrophages, which were subsequently evaluated by cell viability assays (MTT). Lactate dehydrogenase (LDH) enzyme release was measured to assess cell membrane damage to keratinocytes. Cells were analysed by brightfield microscopy after 2 and 24 h of exposure to the soluble factors from biofilm. Cell death was detected by labelling apoptotic cells with annexin V and necrotic cells with propidium iodide (PI) and was visualized via fluorescence microscopy. Soluble factors from biofilm were incubated with J774A.1 cells for 24 h; the subsequent production of NO and the cytokines IL-6 and TNF-α was measured by ELISA. The cell viability assays showed that the soluble factors of single-species C. albicans cultures were as toxic as the soluble factors from biofilm of mixed cultures, whereas the soluble factors of MSSA cultures were less toxic than those of C. albicans or mixed cultures. The soluble factors from biofilm of mixed cultures were the most toxic to the NOK-si and HaCaT cells, as confirmed by analyses of PI labelling and cell morphology. Soluble factors from biofilm of single-species MSSA and mixed-species cultures induced the production of IL-6, NO and TNF-α by J744A.1 macrophages. The production of IL-6 and NO induced by the soluble factors from biofilm of mixed cultures was lower than that induced by the soluble factors from biofilm of single-species MSSA cultures, whereas the soluble factors from biofilm of C. albicans cultures induced only low levels of NO. Soluble factors from 36-h-old biofilm of C. albicans and MSSA cultures promoted cell death and
van der Laan, Andre M.; Veenstra, Rene; Bogaerts, Stefan; Verhulst, Frank C.; Ormel, Johan
2010-01-01
This study uses a social-ecological approach to the development of delinquency. The authors emphasize that a balance between eliminating risk and enhancing protection across domains is essential in reducing problems and promoting competence. The cumulative risk and promotive effects of temperament, family and school factors in preadolescence were…
Health Promoting Life Style and Its Related Factors in Female Adolescents
Directory of Open Access Journals (Sweden)
Nahid Golmakani
2013-07-01
Full Text Available Background and Aim: One of the main strategies for keeping health is having healthy life style. Due to important role of adolescent health in community health promotion, this study aimed to determine health promoting life style in female adolescents of high schools and its associated factors in Mashhad, Iran. Methods: This cross- sectional study was conducted on 810 girls ranging in ages from 14to 18 years old, who were studying in high schools and selected using cluster sampling from in Mashhad, Iran in 2013. They completed questionnaires of demographic data and Adolescent Health Promoting AH scale. Data were analyzed by statistical tests of Mann-Whitney U, Kruskal-Wallis, Freedman, Wilcoxon, Spearman correlation coefficient and General linear model. Results: The mean age of subjects was 15.51±0.98 and the mean score of life style was 63.92±12.01. The highest score of life style subscales was allocated to the “spiritual growth or life-appreciation (77.66±15.56 and the least to the physical and sport activities (51.66±22.49. There was a significant relationship between the life style score of adolescents with parents educational level (mother P=0.024, father P=0.014. However no significant relationship was found between adolescents' life style and their residential area and also parents' job. Among different dimension of life style, the highest correlation was seen between spiritual growth score and life style total score (p=0.01. Conclusion: Based on the findings, it is necessary to prioritize implementing of health-related educational programs in order to changing and modification of unhealthy life style related factors, with focus on sport activities as well as health and nutrition. Also it is needed to provide special facilities to select healthy living behaviors among Female adolescents.
Directory of Open Access Journals (Sweden)
Fabian Machens
2017-10-01
Full Text Available Orthogonal systems for heterologous protein expression as well as for the engineering of synthetic gene regulatory circuits in hosts like Saccharomyces cerevisiae depend on synthetic transcription factors (synTFs and corresponding cis-regulatory binding sites. We have constructed and characterized a set of synTFs based on either transcription activator-like effectors or CRISPR/Cas9, and corresponding small synthetic promoters (synPs with minimal sequence identity to the host’s endogenous promoters. The resulting collection of functional synTF/synP pairs confers very low background expression under uninduced conditions, while expression output upon induction of the various synTFs covers a wide range and reaches induction factors of up to 400. The broad spectrum of expression strengths that is achieved will be useful for various experimental setups, e.g., the transcriptional balancing of expression levels within heterologous pathways or the construction of artificial regulatory networks. Furthermore, our analyses reveal simple rules that enable the tuning of synTF expression output, thereby allowing easy modification of a given synTF/synP pair. This will make it easier for researchers to construct tailored transcriptional control systems.
Understanding Task Force Recommendations Behavioral Counseling to Promote a Healthful Diet and Physical Activity for Cardiovascular Disease Prevention in Adults with Cardiovascular Risk Factors The U.S. Preventive ...
Obesity-promoting factors in Mexican children and adolescents: challenges and opportunities
Aceves-Martins, Magaly; Llauradó, Elisabet; Tarro, Lucia; Solà, Rosa; Giralt, Montse
2016-01-01
Background Mexico is a developing country with one of the highest youth obesity rates worldwide; >34% of children and adolescents between 5 and 19 years of age are overweight or obese. Objectives The current review seeks to compile, describe, and analyze dietary conditions, physical activity, socioeconomic status, and cultural factors that create and exacerbate an obesogenic environment among Mexican youth. Design A narrative review was performed using PubMed and the Cochrane Library databases, as well as grey literature data from the Mexican government, academics, and statistical reports from nongovernmental organizations, included in electronic formats. Results The recent socioeconomic and nutritional transition has resulted in reduced healthy meal options at public schools, high rates of sedentary lifestyles among adolescents, lack of open spaces and playgrounds, socioeconomic deprivation, false or misunderstood sociocultural traditional beliefs, misconceptions about health, a high percentage of overweight or obese adults, and low rates of maternal breastfeeding. Some of the factors identified are exacerbating the obesity problem in this population. Current evidence also shows that more policies and health programs are needed for prevention of childhood and adolescent obesity. Mexico presents alarming obesity levels, which need to be curtailed and urgently reversed. Conclusions The present narrative review presents an overview of dietary, physical activity, societal and cultural preconceptions that are potentially modifiable obesity-promoting factors in Mexican youth. Measures to control these factors need to be implemented in all similar developing countries by governments, policy makers, stakeholders, and health care professionals to tackle obesity in children and young people. PMID:26787421
Directory of Open Access Journals (Sweden)
Dongliang Zhang
2011-01-01
Full Text Available Background: Hair loss is seen as an irreversible process. Most research concentrates on how to elongate the anagen, reduce the negative factors of obstructing hair growth and improve the hair number and size. Aim: In our experiment, we tried to prove that the cow placenta extract can promote hair growth by elongating hair shaft and increasing hair follicle number. Materials and Methods: Cow placenta extract (CPE, water and minoxidil applied separately on the back of depilated B57CL/6 mice for the case, negative and positive control respectively. We checked the proliferation of cells which are resident in hair sheath, and the expression of a few growth factors which stimulate hair growth. Results: Result shows that placenta extract more efficiently accelerates cell division and growth factor expression, by raising the insulin-like growth factor (IGF-1 mRNA and protein level to increase HF size and hair length. Conclusions: The extract is not a purified product; so, it is less effective than minoxidil, which is approved by the US FDA for the treatment of male pattern baldness. If refinement is done, the placenta extract would be a good candidate medicine for hair loss.
Energy Technology Data Exchange (ETDEWEB)
Zhang, Yingyi; Zhao, Yu; Li, Leilei; Shen, Yu; Cai, Xiaoli [Department of Biochemistry, College of Life Sciences, Nankai University, Tianjin 300071 (China); Zhang, Xiaodong, E-mail: zhangxd@nankai.edu.cn [Department of Cancer Research, Institute for Molecular Biology, College of Life Sciences, Nankai University, Tianjin 300071 (China); Ye, Lihong, E-mail: yelihong@nankai.edu.cn [Department of Biochemistry, College of Life Sciences, Nankai University, Tianjin 300071 (China)
2013-05-03
Highlights: •HBXIP is able to upregulate the expression of PDGFB in breast cancer cells. •HBXIP serves as a coactivator of activating transcription factor Sp1. •HBXIP stimulates the PDGFB promoter via activating transcription factor Sp1. •HBXIP promotes the proliferation of breast cancer cell via upregulating PDGFB. -- Abstract: We have reported that the oncoprotein hepatitis B virus X-interacting protein (HBXIP) acts as a novel transcriptional coactivator to promote proliferation and migration of breast cancer cells. Previously, we showed that HBXIP was able to activate nuclear factor-κB (NF-κB) in breast cancer cells. As an oncogene, the platelet-derived growth factor beta polypeptide (PDGFB) plays crucial roles in carcinogenesis. In the present study, we found that both HBXIP and PDGFB were highly expressed in breast cancer cell lines. Interestingly, HBXIP was able to increase transcriptional activity of NF-κB through PDGFB, suggesting that HBXIP is associated with PDGFB in the cells. Moreover, HBXIP was able to upregulate PDGFB at the levels of mRNA, protein and promoter in the cells. Then, we identified that HBXIP stimulated the promoter of PDGFB through activating transcription factor Sp1. In function, HBXIP enhanced the proliferation of breast cancer cells through PDGFB in vitro. Thus, we conclude that HBXIP upregulates PDGFB via activating transcription factor Sp1 to promote proliferation of breast cancer cells.
International Nuclear Information System (INIS)
Zhang, Yingyi; Zhao, Yu; Li, Leilei; Shen, Yu; Cai, Xiaoli; Zhang, Xiaodong; Ye, Lihong
2013-01-01
Highlights: •HBXIP is able to upregulate the expression of PDGFB in breast cancer cells. •HBXIP serves as a coactivator of activating transcription factor Sp1. •HBXIP stimulates the PDGFB promoter via activating transcription factor Sp1. •HBXIP promotes the proliferation of breast cancer cell via upregulating PDGFB. -- Abstract: We have reported that the oncoprotein hepatitis B virus X-interacting protein (HBXIP) acts as a novel transcriptional coactivator to promote proliferation and migration of breast cancer cells. Previously, we showed that HBXIP was able to activate nuclear factor-κB (NF-κB) in breast cancer cells. As an oncogene, the platelet-derived growth factor beta polypeptide (PDGFB) plays crucial roles in carcinogenesis. In the present study, we found that both HBXIP and PDGFB were highly expressed in breast cancer cell lines. Interestingly, HBXIP was able to increase transcriptional activity of NF-κB through PDGFB, suggesting that HBXIP is associated with PDGFB in the cells. Moreover, HBXIP was able to upregulate PDGFB at the levels of mRNA, protein and promoter in the cells. Then, we identified that HBXIP stimulated the promoter of PDGFB through activating transcription factor Sp1. In function, HBXIP enhanced the proliferation of breast cancer cells through PDGFB in vitro. Thus, we conclude that HBXIP upregulates PDGFB via activating transcription factor Sp1 to promote proliferation of breast cancer cells
Identifying work ability promoting factors for home care aides and assistant nurses
Directory of Open Access Journals (Sweden)
Larsson Agneta
2012-01-01
Full Text Available Abstract Background In workplace health promotion, all potential resources needs to be taken into consideration, not only factors relating to the absence of injury and the physical health of the workers, but also psychological aspects. A dynamic balance between the resources of the individual employees and the demands of work is an important prerequisite. In the home care services, there is a noticeable trend towards increased psychosocial strain on employees at work. There are a high frequency of work-related musculoskeletal disorders and injuries, and a low prevalence of sustainable work ability. The aim of this research was to identify factors promoting work ability and self-efficacy in care aides and assistant nurses within home care services. Methods This study is based on cross-sectional data collected in a municipality in northern Sweden. Care aides (n = 58 and assistant nurses (n = 79 replied to a self-administered questionnaire (response rate 46%. Hierarchical multiple regression analyses were performed to assess the influence of several independent variables on self-efficacy (model 1 and work ability (model 2 for care aides and assistant nurses separately. Results Perceptions of personal safety, self-efficacy and musculoskeletal wellbeing contributed to work ability for assistant nurses (R2adj of 0.36, p 2adj of 0.29, p = 0.001. Self-efficacy was associated with the safety climate and the physical demands of the job in both professions (R2adj of 0.24, p = 0.003 for care aides, and also by sex and age for the assistant nurses (R2adj of 0.31, p Conclusions The intermediate factors contributed differently to work ability in the two professions. Self-efficacy, personal safety and musculoskeletal wellbeing were important for the assistant nurses, while the work ability of the care aides was associated with the safety climate, but also with the non-changeable factors age and seniority. All these factors are important to acknowledge in
Shah, Nisarg J.; Hyder, Md. Nasim; Quadir, Mohiuddin A.; Dorval Courchesne, Noémie-Manuelle; Seeherman, Howard J.; Nevins, Myron; Spector, Myron; Hammond, Paula T.
2014-01-01
Traumatic wounds and congenital defects that require large-scale bone tissue repair have few successful clinical therapies, particularly for craniomaxillofacial defects. Although bioactive materials have demonstrated alternative approaches to tissue repair, an optimized materials system for reproducible, safe, and targeted repair remains elusive. We hypothesized that controlled, rapid bone formation in large, critical-size defects could be induced by simultaneously delivering multiple biological growth factors to the site of the wound. Here, we report an approach for bone repair using a polyelectrolye multilayer coating carrying as little as 200 ng of bone morphogenetic protein-2 and platelet-derived growth factor-BB that were eluted over readily adapted time scales to induce rapid bone repair. Based on electrostatic interactions between the polymer multilayers and growth factors alone, we sustained mitogenic and osteogenic signals with these growth factors in an easily tunable and controlled manner to direct endogenous cell function. To prove the role of this adaptive release system, we applied the polyelectrolyte coating on a well-studied biodegradable poly(lactic-co-glycolic acid) support membrane. The released growth factors directed cellular processes to induce bone repair in a critical-size rat calvaria model. The released growth factors promoted local bone formation that bridged a critical-size defect in the calvaria as early as 2 wk after implantation. Mature, mechanically competent bone regenerated the native calvaria form. Such an approach could be clinically useful and has significant benefits as a synthetic, off-the-shelf, cell-free option for bone tissue repair and restoration. PMID:25136093
DEFF Research Database (Denmark)
Tornøe, Jens; Kusk, P.; Johansen, T.E.
2002-01-01
The development of a set of synthetic mammalian promoters with different specific activities is described. The library is based on a synthetic promoter, JeT, constructed as a 200 bp chimeric promoter built from fragments of the viral SV40 early promoter and the human beta-actin and ubiquitin C...
McCoy, Sara S; Reed, Tamra J; Berthier, Celine C; Tsou, Pei-Suen; Liu, Jianhua; Gudjonsson, Johann E; Khanna, Dinesh; Kahlenberg, J Michelle
2017-11-01
SSc is a devastating disease that results in fibrosis of the skin and other organs. Fibroblasts are a key driver of the fibrotic process through deposition of extracellular matrix. The mechanisms by which fibroblasts are induced to become pro-fibrotic remain unclear. Thus, we examined the ability of SSc keratinocytes to promote fibroblast activation and the source of this effect. Keratinocytes were isolated from skin biopsies of 9 lcSSc, 10 dcSSc and 13 control patients. Conditioned media was saved from the cultures. Normal fresh primary fibroblasts were exposed to healthy control and SSc keratinocyte conditioned media in the presence or absence of neutralizing antibodies for TGF-β. Gene expression was assessed by microarrays and real-time PCR. Immunocytochemistry was performed for α-smooth muscle actin (α-SMA), collagen type 1 (COL1A1) and CCL5 expression. SSc keratinocyte conditioned media promoted fibroblast activation, characterized by increased α-SMA and COL1A1 mRNA and protein expression. This effect was independent of TGF-β. Microarray analysis identified upregulation of nuclear factor κB (NF-κB) and downregulation of peroxisome proliferator-activated receptor γ (PPAR-γ) pathways in both SSc subtypes. Scleroderma keratinocytes exhibited increased expression of NF-κB-regulated cytokines and chemokines and lesional skin staining confirmed upregulation of CCL5 in basal keratinocytes. Scleroderma keratinocytes promote the activation of fibroblasts in a TGF-β-independent manner and demonstrate an imbalance in NF-κB1 and PPAR-γ expression leading to increased cytokine and CCL5 production. Further study of keratinocyte mediators of fibrosis, including CCL5, may provide novel targets for skin fibrosis therapy. © The Author 2017. Published by Oxford University Press on behalf of the British Society for Rheumatology. All rights reserved. For Permissions, please email: journals.permissions@oup.com
Lotkowska, Magda E; Tohge, Takayuki; Fernie, Alisdair R; Xue, Gang-Ping; Balazadeh, Salma; Mueller-Roeber, Bernd
2015-11-01
MYB transcription factors (TFs) are important regulators of flavonoid biosynthesis in plants. Here, we report MYB112 as a formerly unknown regulator of anthocyanin accumulation in Arabidopsis (Arabidopsis thaliana). Expression profiling after chemically induced overexpression of MYB112 identified 28 up- and 28 down-regulated genes 5 h after inducer treatment, including MYB7 and MYB32, which are both induced. In addition, upon extended induction, MYB112 also positively affects the expression of PRODUCTION OF ANTHOCYANIN PIGMENT1, a key TF of anthocyanin biosynthesis, but acts negatively toward MYB12 and MYB111, which both control flavonol biosynthesis. MYB112 binds to an 8-bp DNA fragment containing the core sequence (A/T/G)(A/C)CC(A/T)(A/G/T)(A/C)(T/C). By electrophoretic mobility shift assay and chromatin immunoprecipitation coupled to quantitative polymerase chain reaction, we show that MYB112 binds in vitro and in vivo to MYB7 and MYB32 promoters, revealing them as direct downstream target genes. We further show that MYB112 expression is up-regulated by salinity and high light stress, environmental parameters that both require the MYB112 TF for anthocyanin accumulation under these stresses. In contrast to several other MYB TFs affecting anthocyanin biosynthesis, MYB112 expression is not controlled by nitrogen limitation or an excess of carbon. Thus, MYB112 constitutes a regulator that promotes anthocyanin accumulation under abiotic stress conditions. © 2015 American Society of Plant Biologists. All Rights Reserved.
Zheng, Qin; Dai, Kuixing; Cui, Xinyuan; Yu, Ming; Yang, Xuesong; Yan, Bin; Liu, Shuai; Yan, Qiu
2016-05-01
Preeclampsia is a pregnancy-related syndrome which can cause perinatal mortality and morbidity. Inadequate invasion by trophoblast cells may lead to poor perfusion of the placenta, even result in preeclampsia. Understanding the molecular mechanisms underlying placentation facilitates the better intervention of preeclampsia. Urokinase-type plasminogen activator receptor (uPAR) is involved in the physiological and pathological processes. Leukemia inhibitory factor (LIF) is an important regulator in the establishment of pregnancy. However, the expression of uPAR in preeclamptic patients and its relationship with LIF remains unclear. In the current study, we found that the level of uPAR was relatively lower in the placentas from preeclamptic patients as compared with normal pregnant women. LIF promoted trophoblast cell outgrowth by upregulating uPAR in an explants culture, and LIF also enhanced migration and invasion potential through uPAR in trophoblast JAR and JEG-3 cell lines, and with increased gelatinolytic activities of matrix metalloproteinase 2 (MMP-2). The effect of LIF and uPAR on trophoblast migration and invasion was mediated by PI3K/AKT signaling pathway. Our data indicates the roles of LIF in promoting trophoblast migration and invasion through uPAR and suggest that abnormal expression of uPAR might be associated with the etiology of preeclampsia. Copyright © 2016 Elsevier Masson SAS. All rights reserved.
The Platelet Aggregation-Inducing Factor Aggrus/Podoplanin Promotes Pulmonary Metastasis
Kunita, Akiko; Kashima, Takeshi G.; Morishita, Yasuyuki; Fukayama, Masashi; Kato, Yukinari; Tsuruo, Takashi; Fujita, Naoya
2007-01-01
Tumor cell-induced platelet aggregation has been reported to facilitate hematogenous metastasis. Aggrus/podoplanin is a platelet aggregation-inducing factor that is up-regulated in a number of human cancers and has been implicated in tumor progression. We studied herein the role of Aggrus in tumor growth, metastasis, and survival in vivo. Aggrus expression in Chinese hamster ovary cells promoted pulmonary metastasis in both an experimental and a spontaneous mouse model. No differences in the size of metastatic foci or in primary tumor growth were found in either set of mice. Aggrus-expressing cells, which were covered with platelets, arrested in the lung microvasculature 30 minutes after injection. In addition, lung metastasis resulting from Aggrus expression decreased the survival of the mice. By generating several Aggrus point mutants, we revealed that point mutation at the platelet aggregation-stimulating domain of Aggrus (Thr34 and Thr52) obliterated both platelet aggregation and metastasis. Furthermore, administration of aspirin to mice reduced the number of metastatic foci. These results indicate that Aggrus contributes to the establishment of metastasis by promoting platelet aggregation without affecting subsequent growth. Thus, Aggrus could serve as an ideal therapeutic target for drug development to block metastasis. PMID:17392172
DEFF Research Database (Denmark)
Tornøe, Jens; Kusk, P.; Johansen, T.E.
2002-01-01
The development of a set of synthetic mammalian promoters with different specific activities is described. The library is based on a synthetic promoter, JeT, constructed as a 200 bp chimeric promoter built from fragments of the viral SV40 early promoter and the human beta-actin and ubiquitin C......, was obtained. The measured activity of each promoter in the library was highly specific and reproducible when tested in HiB5 and ARPE-19 cell culture....
International Nuclear Information System (INIS)
Tong Qiangsong; Zheng Liduan; Li Bo; Wang Danming; Huang Chuanshu; Matuschak, George M.; Li Dechun
2006-01-01
Our previous studies have indicated that hypoxia-induced mitogenic factor (HIMF) has angiogenic properties in an in vivo matrigel plug model and HIMF upregulates expression of vascular endothelial growth factor (VEGF) in mouse lungs and cultured lung epithelial cells. However, whether HIMF exerts angiogenic effects through modulating endothelial cell function remains unknown. In this study, mouse aortic rings cultured with recombinant HIMF protein resulted in enhanced vascular sprouting and increased endothelial cell spreading as confirmed by Dil-Ac-LDL uptake, von Willebrand factor and CD31 staining. In cultured mouse endothelial cell line SVEC 4-10, HIMF dose-dependently enhanced cell proliferation, in vitro migration and tubulogenesis, which was not attenuated by SU1498, a VEGFR2/Flk-1 receptor tyrosine kinase inhibitor. Moreover, HIMF stimulation resulted in phosphorylation of Akt, p38 and ERK1/2 kinases in SVEC 4-10 cells. Treatment of mouse aortic rings and SVEC 4-10 cells with LY294002, but not SB203580, PD098059 or U0126, abolished HIMF-induced vascular sprouting and angiogenic responses. In addition, transfection of a dominant-negative mutant of phosphatidylinositol 3-kinase (PI-3K), Δp85, blocked HIMF-induced phosphorylation of Akt, endothelial activation and tubulogenesis. These results indicate that HIMF enhances angiogenesis by promoting proliferation and migration of endothelial cells via activation of the PI-3K/Akt pathways
Directory of Open Access Journals (Sweden)
Xiao Xu
Full Text Available Stress is a fundamental aspect of aging, as accumulated damage from a lifetime of stress can limit lifespan and protective responses to stress can extend lifespan. In this study, we identify a conserved Caenorhabditis elegans GATA transcription factor, egl-27, that is involved in several stress responses and aging. We found that overexpression of egl-27 extends the lifespan of wild-type animals. Furthermore, egl-27 is required for the pro-longevity effects from impaired insulin/IGF-1 like signaling (IIS, as reduced egl-27 activity fully suppresses the longevity of worms that are mutant for the IIS receptor, daf-2. egl-27 expression is inhibited by daf-2 and activated by pro-longevity factors daf-16/FOXO and elt-3/GATA, suggesting that egl-27 acts at the intersection of IIS and GATA pathways to extend lifespan. Consistent with its role in IIS signaling, we found that egl-27 is involved in stress response pathways. egl-27 expression is induced in the presence of multiple stresses, its targets are significantly enriched for many types of stress genes, and altering levels of egl-27 itself affects survival to heat and oxidative stress. Finally, we found that egl-27 expression increases between young and old animals, suggesting that increased levels of egl-27 in aged animals may act to promote stress resistance. These results identify egl-27 as a novel factor that links stress and aging pathways.
Henry, Kimberly L.; Shtivelband, Annette; Comello, Maria Leonora G.; Slater, Michael D.
2011-01-01
This study explored an understudied promotive factor, a belief that alcohol use is inconsistent with personal autonomy, which may reduce adolescent intention to drink and subsequent alcohol use. Autonomy was examined as an attitudinal construct within the Theory of Reasoned Action. Longitudinal data from 2,493 seventh grade students nested in 40 schools were analyzed using a structural equation model. Autonomy was negatively correlated with intention to use alcohol and subsequent alcohol use at a later wave, and intention to use fully mediated the effect of autonomy on subsequent alcohol use. These results are consistent with the proposition that when personal autonomy is perceived as inconsistent with alcohol use among younger adolescents, students indicate a lower intention to use alcohol and use less alcohol during the following school year. PMID:23519434
Azarmina, Pejman; Prestwich, Graham; Rosenquist, Joel; Singh, Debbie
2008-12-01
Governments and health service providers around the world are under pressure to improve health outcomes while containing rising healthcare costs. In response to such challenges, many regions have implemented services that have been successful in other countries-but 'importing' initiatives has many challenges. This article summarizes factors found to be critical to the success of adapting a US disease management and health promotion programme for use in Italy and the UK. Using three illustrative case studies, it describes how in each region the programme needed to adapt (i) the form and content of the disease management service, (ii) the involvement and integration with local clinicians and services and (iii) the evaluation of programme outcomes. We argue that it is important to implement evidence-based practice by learning lessons from other countries and service initiatives, but that it is equally important to take into consideration the '3Ps' that are critical for successful service implementation: payers, practitioners and patients.
Henry, Kimberly L; Shtivelband, Annette; Comello, Maria Leonora G; Slater, Michael D
2011-08-01
This study explored an understudied promotive factor, a belief that alcohol use is inconsistent with personal autonomy, which may reduce adolescent intention to drink and subsequent alcohol use. Autonomy was examined as an attitudinal construct within the Theory of Reasoned Action. Longitudinal data from 2,493 seventh grade students nested in 40 schools were analyzed using a structural equation model. Autonomy was negatively correlated with intention to use alcohol and subsequent alcohol use at a later wave, and intention to use fully mediated the effect of autonomy on subsequent alcohol use. These results are consistent with the proposition that when personal autonomy is perceived as inconsistent with alcohol use among younger adolescents, students indicate a lower intention to use alcohol and use less alcohol during the following school year.
Bm-TFF2, a toad trefoil factor, promotes cell migration, survival and wound healing
International Nuclear Information System (INIS)
Zhang, Yong; Yu, Guoyu; Xiang, Yang; Wu, Jianbo; Jiang, Ping; Lee, Wenhui; Zhang, Yun
2010-01-01
Research highlights: → Bm-TFF2 binds to epithelial cells and induces cell migration and wound healing. → Bm-TFF2 suppresses cell apoptosis. → Bm-TFF2 has no effect on cell proliferation. -- Abstract: Toad skin is naked and continually confronted by various injurious factors. Constant skin renewal and repairs occur frequently. However, the mechanisms of the renewal and repair have not clearly elucidated. In our previous work, a trefoil factor (TFF), Bm-TFF2, has been purified from the Bombina maxima skin and characterized as a platelet agonist. The mRNA of TFFs in toad skin was up-regulated greatly during the metamorphosis, indicating a pivotal role of TFFs in amphibian skin. Here, we presented the effects of Bm-TFF2 on the cell migration, apoptosis and proliferation. Bm-TFF2 bound to epithelial cells and showed strong cell motility activity. At the concentrations of 1-100 nM, Bm-TFF2-induced migration of human epithelial AGS and HT-29 cells, and rat intestinal epithelial IEC-6 cell lines. The in vitro wound healing assay also verified the activity of Bm-TFF2. Bm-TFF2 could also inhibit cell apoptosis induced by ceramide and sodium butyrate. The cell migration-promoting activity was abolished by MEK1 inhibitors, U0126 and PD98059, suggesting that ERK1/2 activation is crucial for Bm-TFF2 to stimulate cell migration. Taken together, Bm-TFF2 promoted wound healing by stimulating cell migration via MAPK pathway and preventing cell apoptosis. The potent biological activity of Bm-TFF2 makes it a useful molecular tool for further studies of structure-function relationship of the related human TFFs.
Bm-TFF2, a toad trefoil factor, promotes cell migration, survival and wound healing
Energy Technology Data Exchange (ETDEWEB)
Zhang, Yong [Key Laboratory of Animal Models and Human Disease Mechanisms of the Chinese Academy of Sciences and Yunnan Province, Kunming Institute of Zoology, Chinese Academy of Sciences, Kunming, Yunnan 650223 (China); Graduate School of Chinese Academy of Sciences, Beijing 100049 (China); Yu, Guoyu [Key Laboratory of Animal Models and Human Disease Mechanisms of the Chinese Academy of Sciences and Yunnan Province, Kunming Institute of Zoology, Chinese Academy of Sciences, Kunming, Yunnan 650223 (China); Graduate School of Chinese Academy of Sciences, Beijing 100049 (China); Department of Biochemistry, Kunming Medical College, Kunming, Yunnan 650032 (China); Xiang, Yang [Key Laboratory of Animal Models and Human Disease Mechanisms of the Chinese Academy of Sciences and Yunnan Province, Kunming Institute of Zoology, Chinese Academy of Sciences, Kunming, Yunnan 650223 (China); Graduate School of Chinese Academy of Sciences, Beijing 100049 (China); Wu, Jianbo [Key Laboratory of Animal Models and Human Disease Mechanisms of the Chinese Academy of Sciences and Yunnan Province, Kunming Institute of Zoology, Chinese Academy of Sciences, Kunming, Yunnan 650223 (China); Jiang, Ping [Key Laboratory of Animal Models and Human Disease Mechanisms of the Chinese Academy of Sciences and Yunnan Province, Kunming Institute of Zoology, Chinese Academy of Sciences, Kunming, Yunnan 650223 (China); Graduate School of Chinese Academy of Sciences, Beijing 100049 (China); Lee, Wenhui [Key Laboratory of Animal Models and Human Disease Mechanisms of the Chinese Academy of Sciences and Yunnan Province, Kunming Institute of Zoology, Chinese Academy of Sciences, Kunming, Yunnan 650223 (China); Zhang, Yun, E-mail: zhangy@mail.kiz.ac.cn [Key Laboratory of Animal Models and Human Disease Mechanisms of the Chinese Academy of Sciences and Yunnan Province, Kunming Institute of Zoology, Chinese Academy of Sciences, Kunming, Yunnan 650223 (China)
2010-07-30
Research highlights: {yields} Bm-TFF2 binds to epithelial cells and induces cell migration and wound healing. {yields} Bm-TFF2 suppresses cell apoptosis. {yields} Bm-TFF2 has no effect on cell proliferation. -- Abstract: Toad skin is naked and continually confronted by various injurious factors. Constant skin renewal and repairs occur frequently. However, the mechanisms of the renewal and repair have not clearly elucidated. In our previous work, a trefoil factor (TFF), Bm-TFF2, has been purified from the Bombina maxima skin and characterized as a platelet agonist. The mRNA of TFFs in toad skin was up-regulated greatly during the metamorphosis, indicating a pivotal role of TFFs in amphibian skin. Here, we presented the effects of Bm-TFF2 on the cell migration, apoptosis and proliferation. Bm-TFF2 bound to epithelial cells and showed strong cell motility activity. At the concentrations of 1-100 nM, Bm-TFF2-induced migration of human epithelial AGS and HT-29 cells, and rat intestinal epithelial IEC-6 cell lines. The in vitro wound healing assay also verified the activity of Bm-TFF2. Bm-TFF2 could also inhibit cell apoptosis induced by ceramide and sodium butyrate. The cell migration-promoting activity was abolished by MEK1 inhibitors, U0126 and PD98059, suggesting that ERK1/2 activation is crucial for Bm-TFF2 to stimulate cell migration. Taken together, Bm-TFF2 promoted wound healing by stimulating cell migration via MAPK pathway and preventing cell apoptosis. The potent biological activity of Bm-TFF2 makes it a useful molecular tool for further studies of structure-function relationship of the related human TFFs.
Directory of Open Access Journals (Sweden)
Jin-Won Noh
2015-09-01
Full Text Available Objectives: The present study aimed to analyze the factors that could affect the health-promoting behaviors of North Korean adolescent refugees residing in South Korea. Methods: Questions about their sociodemographic variables, subjective health status, healthy living habits, and health-promoting behaviors were asked. Results: Statistically significant differences were found in religion (t=2.30, p<0.05, having family members in South Korea (t=2.02, p<0.05, and subjective health status (t=4.96, p<0.01. Scores on health-responsible behaviors were higher with higher age (t=2.90, p<0.01 and for subjects without family or friends (t=2.43, p<0.05. Higher physical-activity behaviors were observed in males (t=3.32, p<0.01, in those with better subjective health status (t=3.46, p<0.05 and lower body mas index (t=3.48, p<0.05, and in smokers (t=3.17, p<0.01. Nutritional behaviors were higher in those who followed a religion (t=2.17, p<0.05. Spiritual growth behaviors were higher in those who followed a religion (t=4.21, p<0.001, had no family in South Korea (t=2.04, p<0.05, and had higher subjective health status (t=5.74, p<0.01. Scores on interpersonal relationships and stress-management behaviors were higher for those with higher subjective health status. A multiple regression analysis showed greater effects on health-promoting behaviors when subjective health status was better. Older people and non-smokers exhibited more health-responsible behaviors, while more physical-activity behaviors and spiritual growth activities were observed when subjective health status was better. Interpersonal relationship behaviors had positive effects on those with good subjective heath status and on non-smokers. Conclusions: Based on the results of the current study, an alternative was suggested for promoting health in North Korean adolescent refugees.
Williams, Lauren K; Thornton, Lukar; Crawford, David
2012-08-01
The majority of nutrition promotion research that has examined the determinants of unhealthy or healthy dietary behaviours has focused on factors that promote consumption of these foods, rather than factors that may both promote healthy eating and buffer or protect consumption of unhealthy foods. The purpose of this paper is to identify factors that both promote healthy eating and also reduce the likelihood of eating unhealthily amongst women. A community sample of 1013 Australian women participated in a cross-sectional self-report survey that assessed factors associated with diet and obesity. Multiple logistic regressions were used to examine the associations between a range of individual, social and environmental factors and aspects of both healthy and unhealthy eating, whilst controlling for key covariates. Results indicated that women with high self efficacy for healthy eating, taste preferences for fruit and vegetables, family support for healthy eating and the absence of perceived barriers to healthy eating (time and cost) were more likely to consume components of a healthy diet and less likely to consume components of a unhealthy diet. Optimal benefits in overall diet quality amongst women may be achieved by targeting factors associated with both healthy and unhealthy eating in nutrition promotion efforts. Copyright © 2012 Elsevier Ltd. All rights reserved.
DEFF Research Database (Denmark)
Damgaard, Tina; Knudsen, Lene M; Dahl, Inger Marie S
2009-01-01
the regulation of the CD56 promoter in relation to typical clinical factors. We used qPCR and FACS to measure the expression levels of CD56, and potential regulatory factors in patients with MM and related these with MM progression/prognosis. The transcription factors BTBD3, Pax5, RUNX1 and MMSET were positively...... associated with CD56 expression, as was CYCLIN D1, which is involved in disease progression, anti-apoptosis and proliferation. RUNX1 was negatively associated with the survival of stem-cell transplanted patients. Our findings propose four potential activators of the CD56 promoter and for CD56 to be involved...
Anitua, E; Pino, A; Orive, G
2016-11-02
The use of plasma rich in growth factors (PRGF) has gained importance in many medical fields due to its regenerative potential. The aim of this study is to evaluate the effects of PRGF on primary skin fibroblasts assessing cell proliferation, migration and secretion of growth factors. The age of the patients from who PRGF was prepared was also studied to determine whether it influenced the outcomes. Human dermal fibroblasts were isolated from three healthy volunteers. Using PRGF-Endoret technology, PRGF was prepared from two groups of different ages (18-35 years and 50+ years). The effects of increasing concentration of PRGF (5%, 10% and 20%) on cell proliferation and migration was evaluated. Biosynthetic behaviour of cells was also analysed measuring vascular endothelial growth factor (VEGF), transforming growth factor b1 (TGFb1) and pro-collagen type I secreted levels with or without PRGF treatment. Mean platelet enrichment reached 2.4X and 2X in 18-35 and 50+ groups respectively. A dose-dependent response was observed in proliferation assays achieving the highest levels with 20% PRGF. Migration was also promoted in cells but not in a dose-dependent manner. Cell proliferation and migration outcomes obtained with PRGF (from both groups) were significantly higher compared to non-stimulated groups (pPRGF, however, with the exception of VEGF, no statistical significances were observed between the different age groups. Results from this study concluded that PRGF is safe and effective in stimulating skin regeneration by enhancing proliferation, migration and expression of pivotal bioactive molecules involved in wound healing and haemostasis.
The role of tobacco promoting and restraining factors in smoking intentions among Ghanaian youth.
Doku, David; Raisamo, Susanna; Wiium, Nora
2012-08-15
In Western countries, the relationship between smoking intentions and smoking behaviour is well established. However, youth smoking intentions and associated factors in developing countries are largely unexplored and the former may occur for a variety of reasons. We investigated youth smoking intentions in Ghana with regard to several tobacco promoting and restraining factors, including environmental, familial, attitudinal and knowledge measures. A school-based survey of a representative sample of 12-20-year-olds was conducted in 2008 in Ghana (N = 1338, response rate 89.7%). In a bivariate model, both among ever and never smokers, allowing smoking on school compound, exposure to tobacco advertisement and parental smoking were associated with future intention to smoke. Compared to those who agreed that smoking is harmful to health, smoking is difficult to quit and that tobacco should not be sold to minors, those who disagreed or were not sure were more likely to have an intention to smoke. In the multivariate analyses, these associations persisted, except that the attitude measures concerning the difficulty of quitting smoking once started and tobacco sales ban were no longer significantly associated with smoking intentions. These findings underscore the importance of school smoking policy, parental smoking behaviour and knowledge of the harmful effects of tobacco use in determining Ghanaian youths' future smoking intentions. Because current high percentages of smoking intentions may turn into high smoking rates in the future, the introduction of effective tobacco control measures at all levels of society to prevent youth smoking in Ghana may be essential.
Factors Promoting Tubal Ligation in Females Presenting to Tertiary Care Centers
Directory of Open Access Journals (Sweden)
Hammad Ali Qazi
2009-09-01
Full Text Available Objective: Despite development of new contraceptive methods, sterilization remained the most widely used method. Our objective was to determine the factors contributing to decision making for tubal ligation in females.Materials and methods: A cross sectional study was conducted in Jinnah Post graduate Medical Centre (JPMC between March - November 2008. About 505 Females using contraceptive measures were consecutively included. Those having any severe debilitating disease and unfamiliar with “urdu” language were excluded. Three trained co researchers conducted structured interviews to determine the frequency and factors associated with tubal ligation.Results: The final multiple logistic regression showed illiteracy [AOR 2.91 95% CI 1.53-5.53], number of children < 3 [AOR 6.15 95% CI 2.61-14.50], age of women < 30 [AOR 0.12 95% CI 0.06-0.22] years and information gained through health worker [AOR 3.04 95% CI 1.60-5.80] to be statistically significant.Conclusion: This highlights tubal ligation was more common in uneducated women of age > 35 years having <3 children. The most common means of promoting tubal ligation was information gained through health workers.
Factors promoting a successful return to work: from an employer and employee perspective.
Jakobsen, Klara; Lillefjell, Monica
2014-01-01
Efforts have been made to explain the inability to return to work (RTW) due to employees' chronic musculoskeletal pain. Knowledge of factors facilitating the RTW process is however still limited. Based on the experiences of employees and employers, this study aims to identify factors promoting a successful return process for persons with chronic musculoskeletal pain. The findings from interviews, involving six employees with musculoskeletal pain, and five employers with various work experience, were analysed by Giorgi's phenomenological analysis through four stages. The major themes underlying the employees' comments for a successful RTW were identifying and mobilizing their personal resources, adapting a balanced daily life, and requiring a positive dialogue with family and their employer, while the employers underlined the need for a helpful adjustment at work and how they wanted to become more involved in the rehabilitation process. In conclusion our findings underline the need for extended collaboration between the employees, employer, and rehabilitation staff, and should encourage occupational therapists to direct even more of their expertise towards the situation at the workplace.
Directory of Open Access Journals (Sweden)
Sun Jung Kim, RN, PhD
2016-03-01
Conlcusions: The Chinese students in Korea with higher self-esteem, perceived health status, acculturation level, and lower acculturative stress reported higher health promotion behavior. The findings can be applied to develop health promotion strategies for this population.
Zhang, Feng-Lin; Shen, Guo-Min; Liu, Xiao-Ling; Wang, Fang; Zhao, Ying-Ze; Zhang, Jun-Wu
2012-08-01
Hypoxia-inducible factor promotes erythropoiesis through coordinated cell type-specific hypoxia responses. GATA1 is essential to normal erythropoiesis and plays a crucial role in erythroid differentiation. In this study, we show that hypoxia-induced GATA1 expression is mediated by HIF1 in erythroid cells. Under hypoxic conditions, significantly increased GATA1 mRNA and protein levels were detected in K562 cells and erythroid induction cultures of CD34(+) haematopoietic stem/progenitor cells. Enforced HIF1α expression increased GATA1 expression, while HIF1α knockdown by RNA interference decreased GATA1 expression. In silico analysis revealed one potential hypoxia response element (HRE). The results from reporter gene and mutation analysis suggested that this element is necessary for hypoxic response. Chromatin immunoprecipitation (ChIP)-PCR showed that the putative HRE was recognized and bound by HIF1 in vivo. These results demonstrate that the up-regulation of GATA1 during hypoxia is directly mediated by HIF1.The mRNA expression of some erythroid differentiation markers was increased under hypoxic conditions, but decreased with RNA interference of HIF1α or GATA1. Flow cytometry analysis also indicated that hypoxia, desferrioxamine or CoCl(2) induced expression of erythroid surface markers CD71 and CD235a, while expression repression of HIF1α or GATA1 by RNA interference led to a decreased expression of CD235a. These results suggested that HIF1-mediated GATA1 up-regulation promotes erythropoiesis in order to satisfy the needs of an organism under hypoxic conditions. © 2011 The Authors Journal of Cellular and Molecular Medicine © 2011 Foundation for Cellular and Molecular Medicine/Blackwell Publishing Ltd.
Cahan, Mitchell A; Starr, Susan; Larkin, Anne C; Litwin, Demetrius E M; Sullivan, Kate M; Quirk, Mark E
2011-07-01
Promoting a culture of teaching may encourage students to choose a surgical career. Teaching in a human factors (HF) curriculum, the nontechnical skills of surgery, is associated with surgeons' stronger identity as teachers and with clinical students' improved perception of surgery and satisfaction with the clerkship experience. To describe the effects of an HF curriculum on teaching culture in surgery. Surgeons and educators developed an HF curriculum including communication, teamwork, and work-life balance. Teacher identity, student interest in a surgical career, student perception of the HF curriculum, and teaching awards. Ninety-two of 123 faculty and residents in a single program (75% of total) completed a survey on teacher identity. Fifteen of the participants were teachers of HF. Teachers of HF scored higher than control participants on the total score for teacher identity (P < .001) and for subcategories of global teacher identity (P = .001), intrinsic satisfaction (P = .001), skills and knowledge (P = .006), belonging to a group of teachers (P < .001), feeling a responsibility to teach (P = .008), receiving rewards (P =.01), and HF (P = .02). Third-year clerks indicated that they were more likely to select surgery as their career after the clerkship and rated the curriculum higher when it was taught by surgeons than when taught by educators. Of the teaching awards presented to surgeons during HF years, 100% of those awarded to attending physicians and 80% of those awarded to residents went to teachers of HF. Curricular focus on HF can strengthen teacher identity, improve teacher evaluations, and promote surgery as a career choice.
Steiner, Elisabeth; Holzmann, Klaus; Pirker, Christine; Elbling, Leonilla; Micksche, Michael; Berger, Walter
2004-04-23
The major vault protein (MVP) has been implicated in multidrug resistance, cellular transport, and malignant transformation. In this study we aimed to identify crucial MVP promoter elements that regulate MVP expression. By mutation as well as deletion analysis a conserved proximal GC-box element was demonstrated to be essential for basal human MVP promoter transactivation. Binding of Sp-family transcription factors but not AP2 to this element in vitro and in vivo was shown by EMSA and ChIP assays, respectively. Inhibition of GC-box binding by a dominant-negative Sp1-variant and by mithramycin A distinctly attenuated MVP promoter activity. In Sp-null Drosophila cells, the silent human MVP promoter was transactivated by several human Sp-family members. In human cells the MVP promoter was potently stimulated by the histone deacetylase (HDAC) inhibitors butyrate (NaB) and trichostatin A (TSA), resulting in enhanced MVP expression. This stimulation was substantially decreased by mutation of the single GC-box and by application of mithramycin A. Treatment with HDAC inhibitors led to a distinct decrease of Sp1 but increase of Sp3 binding in vivo to the respective promoter sequence as demonstrated by ChIP assays. Summarising, this study identifies variations in Sp-transcription factor binding to a single proximal GC-box element as critical for basal MVP promoter activation and its stimulation by HDAC inhibitors.
The Murine Factor H-Related Protein FHR-B Promotes Complement Activation
Directory of Open Access Journals (Sweden)
Marcell Cserhalmi
2017-09-01
Full Text Available Factor H-related (FHR proteins consist of varying number of complement control protein domains that display various degrees of sequence identity to respective domains of the alternative pathway complement inhibitor factor H (FH. While such FHR proteins are described in several species, only human FHRs were functionally investigated. Their biological role is still poorly understood and in part controversial. Recent studies on some of the human FHRs strongly suggest a role for FHRs in enhancing complement activation via competing with FH for binding to certain ligands and surfaces. The aim of the current study was the functional characterization of a murine FHR, FHR-B. To this end, FHR-B was expressed in recombinant form. Recombinant FHR-B bound to human C3b and was able to compete with human FH for C3b binding. FHR-B supported the assembly of functionally active C3bBb alternative pathway C3 convertase via its interaction with C3b. This activity was confirmed by demonstrating C3 activation in murine serum. In addition, FHR-B bound to murine pentraxin 3 (PTX3, and this interaction resulted in murine C3 fragment deposition due to enhanced complement activation in mouse serum. FHR-B also induced C3 deposition on C-reactive protein, the extracellular matrix (ECM extract Matrigel, and endothelial cell-derived ECM when exposed to mouse serum. Moreover, mouse C3 deposition was strongly enhanced on necrotic Jurkat T cells and the mouse B cell line A20 by FHR-B. FHR-B also induced lysis of sheep erythrocytes when incubated in mouse serum with FHR-B added in excess. Altogether, these data demonstrate that, similar to human FHR-1 and FHR-5, mouse FHR-B modulates complement activity by promoting complement activation via interaction with C3b and via competition with murine FH.
Resilience-promoting factors in war-exposed adolescents: an epidemiologic study.
Fayyad, John; Cordahi-Tabet, C; Yeretzian, J; Salamoun, M; Najm, C; Karam, E G
2017-02-01
Studies of war-exposed children have not investigated a comprehensive array of resilience-promoting factors, nor representative samples of children and adolescents. A representative sample of N = 710 adolescents was randomly selected from communities recently exposed to war. All those who had experienced war trauma were administered questionnaires measuring war exposure, family violence, availability of leisure activities, school-related problems, interpersonal and peer problems, socialization, daily routine problems, displacement, availability of parental supervision and contact and medical needs as well as coping skills related to religious coping, denial, self-control, avoidance and problem solving. Mental health was measured by the Strengths and Difficulties Questionnaire (SDQ) and the Child-Revised Impact of Events Scale (CRIES). Resilient adolescents were defined as those who experienced war trauma, but did not manifest any symptoms on the SDQ or CRIES. Resilience was related to being male, using problem-solving techniques, having leisure activities, and having parents who spent time with their adolescents and who supported them with school work. Interventions designed for war-traumatized youth must build individual coping skills of children and adolescents, yet at the same time target parents and teachers in an integrated manner.
International Nuclear Information System (INIS)
Jaeaeskelaeinen, T.; Huhtakangas, J.; Maeenpaeae, P.H.
2005-01-01
The negative regulation of the human parathyroid hormone (PTH) gene by biologically active vitamin D 3 (1,25-dihydroxyvitamin D 3 ; 1,25(OH) 2 D 3 ) was studied in rat pituitary GH4C1 cells, which express factors needed for the negative regulation. We report here that NF-Y binds to sequences downstream of the site previously reported to bind the vitamin D receptor (VDR). Additional binding sites for NF-Y reside in the near vicinity and were shown to be important for full activity of the PTH gene promoter. VDR and NF-Y were shown to exhibit mutually exclusive binding to the VDRE region. According to our results, sequestration of binding partners for NF-Y by VDR also affects transcription through a NF-Y consensus binding element in GH4C1 but not in ROS17/2.8 cells. These results indicate that 1,25(OH) 2 D 3 may affect transcription of the human PTH gene both by competitive binding of VDR and NF-Y, and by modulating transcriptional activity of NF-Y
Griseri, Thibault; Arnold, Isabelle C.; Pearson, Claire; Krausgruber, Thomas; Schiering, Chris; Franchini, Fanny; Schulthess, Julie; McKenzie, Brent S.; Crocker, Paul R.; Powrie, Fiona
2015-01-01
Summary The role of intestinal eosinophils in immune homeostasis is enigmatic and the molecular signals that drive them from protective to tissue damaging are unknown. Most commonly associated with Th2 cell-mediated diseases, we describe a role for eosinophils as crucial effectors of the interleukin-23 (IL-23)-granulocyte macrophage colony-stimulating factor (GM-CSF) axis in colitis. Chronic intestinal inflammation was characterized by increased bone marrow eosinopoiesis and accumulation of activated intestinal eosinophils. IL-5 blockade or eosinophil depletion ameliorated colitis, implicating eosinophils in disease pathogenesis. GM-CSF was a potent activator of eosinophil effector functions and intestinal accumulation, and GM-CSF blockade inhibited chronic colitis. By contrast neutrophil accumulation was GM-CSF independent and dispensable for colitis. In addition to TNF secretion, release of eosinophil peroxidase promoted colitis identifying direct tissue-toxic mechanisms. Thus, eosinophils are key perpetrators of chronic inflammation and tissue damage in IL-23-mediated immune diseases and it suggests the GM-CSF-eosinophil axis as an attractive therapeutic target. PMID:26200014
Directory of Open Access Journals (Sweden)
Sakaki Yoshiyuki
2004-02-01
Full Text Available Abstract Background Gene expression is regulated mainly by transcription factors (TFs that interact with regulatory cis-elements on DNA sequences. To identify functional regulatory elements, computer searching can predict TF binding sites (TFBS using position weight matrices (PWMs that represent positional base frequencies of collected experimentally determined TFBS. A disadvantage of this approach is the large output of results for genomic DNA. One strategy to identify genuine TFBS is to utilize local concentrations of predicted TFBS. It is unclear whether there is a general tendency for TFBS to cluster at promoter regions, although this is the case for certain TFBS. Also unclear is the identification of TFs that have TFBS concentrated in promoters and to what level this occurs. This study hopes to answer some of these questions. Results We developed the cluster score measure to evaluate the correlation between predicted TFBS clusters and promoter sequences for each PWM. Non-promoter sequences were used as a control. Using the cluster score, we identified a PWM group called PWM-PCP, in which TFBS clusters positively correlate with promoters, and another PWM group called PWM-NCP, in which TFBS clusters negatively correlate with promoters. The PWM-PCP group comprises 47% of the 199 vertebrate PWMs, while the PWM-NCP group occupied 11 percent. After reducing the effect of CpG islands (CGI against the clusters using partial correlation coefficients among three properties (promoter, CGI and predicted TFBS cluster, we identified two PWM groups including those strongly correlated with CGI and those not correlated with CGI. Conclusion Not all PWMs predict TFBS correlated with human promoter sequences. Two main PWM groups were identified: (1 those that show TFBS clustered in promoters associated with CGI, and (2 those that show TFBS clustered in promoters independent of CGI. Assessment of PWM matches will allow more positive interpretation of TFBS in
Li, Y; Chen, J; Zhao, M; Yang, Z; Yue, L; Zhang, X
2017-02-01
To demonstrate the resuscitation-promoting activities of recombinant YeaZ from Vibrio harveyi SF-1. The gene of resuscitation-promoting factor YeaZ was cloned from genomic DNA of V. harveyi SF-1. The gene was expressed in Escherichia coli, and the expressed protein was purified by Ni 2+ -affinity chromatography. A yeaZ mutant was constructed by using the suicide plasmid pNQ705 with homologous recombination. Disruption of yeaZ did not affect cell growth significantly in 2216 E broth at 28°C. The wild-type and mutant viable but nonculturable (VBNC) cells could be resuscitated by temperature upshift method. In addition, the recombinant YeaZ increased the culturable counts from 1·27 × 10 4 CFU per ml and 1·99 × 10 4 CFU per ml to 2·88 × 10 5 CFU per ml and 4·59 × 10 5 CFU per ml, respectively. After the VBNC cells of wild-type and mutant cells were maintained at 4°C for 120 days, no resuscitation was obtained by temperature upshift method, but addition of the recombinant YeaZ promoted the resuscitation of the wild-type and mutant cells, with the culturable cell counts of 1·13 × 10 3 and 1·44 × 10 3 CFU per ml, respectively. Disruption of yeaZ decreased the virulence of V. harveyi in zebrafish. The lethal dose 50% of the yeaZ null mutant was more than 10-fold higher than that of the wild-type cells. The recombinant YeaZ could efficiently promote resuscitation of the wild-type and mutant cells of V. harveyi from VBNC to culturable state. The protein also promoted resuscitation of the VBNC wild-type and mutant cells, which were maintained at 4°C for 120 days and not recovered by temperature upshift method. Disruption of yeaZ decreased the virulence of V. harveyi in zebrafish. Here, we show clear evidence of a resuscitation-promoting factor YeaZ of V. harveyi and the roles in resuscitation of the VBNC cells and its pathogenicity. © 2016 The Society for Applied Microbiology.
International Nuclear Information System (INIS)
Cho, Kyung-Ah; Park, Minhwa; Kim, Yu-Hee; Woo, So-Youn
2017-01-01
Although mast cells are traditionally thought to function as effector cells in allergic responses, they have increasingly been recognized as important regulators of various immune responses. Mast cells mature locally; thus, tissue-specific influences are important for promoting mast cell accumulation and survival in the skin and the gastrointestinal tract. In this study, we determined the effects of keratinocytes on mast cell accumulation during Th17-mediated skin inflammation. We observed increases in dermal mast cells in imiquimod-induced psoriatic dermatitis in mice accompanied by the expression of epidermal stem cell factor (SCF), a critical mast cell growth factor. Similar to mouse epidermal keratinocytes, SCF was highly expressed in the human HaCaT keratinocyte cell line following stimulation with IL−17. Further, keratinocytes promoted mast cell proliferation following stimulation with IL−17 in vitro. However, the effects of keratinocytes on mast cells were significantly diminished in the presence of anti−CD117 (stem cell factor receptor) blocking antibodies. Taken together, our results revealed that the Th17-mediated inflammatory environment promotes mast cell accumulation through keratinocyte-derived SCF. - Highlights: • Psoriasis-like skin inflammation increase dermal mast cells. • Keratinocyte produce stem cell factor in psoriasis-like skin inflammation. • Keratinocyte promote mast cell proliferation by stem cell factor dependent manner
The Predictive Factors of the Promotion of Physical Activity by Air Force Squadron Commanders
National Research Council Canada - National Science Library
Whelan, Dana
2001-01-01
This research examined the relationship between beliefs about physical activity, physical activity levels, age and the promotional practices for physical activity employed by Air Force squadron commanders...
International Nuclear Information System (INIS)
Cui Wei; Yin Lingling; Dong Lingyue
2012-01-01
Objective: To clarify the mechanism of immediate early response gene 5 (Ier5) transcription induced by radiation. Methods: Deletant construction, site-specific mutagenesis,electrophoretic mobility shift assay (EMSA) and chromatin immunoprecipitation (ChIP) were used to forecast the promoter region, binding sites and transcription factors of Ier5 gene in HeLa cells. Results: The promoter region of Ier5 gene might be in the region of Ier5 -8 deletant (-408 - -238 bp). The Ier5 gene had two transcription factors of GCF and NFI, and GCF had two binding sites located in the region of -388 - -382 bp and -274 - -270 bp of Ier5 promoter. The binding site of NFI was located in -362 - -357 bp of Ier5 promoter. GCF could inhibit the expression of Ier5 gene and this inhibition was diminished when the radiation dose increased. In contrast, NFI increased the expression of Ier5. Conclusions: The most possible region of Ier5 promoter is from -408 to -238 bp which has two binding sites for the radiosensitivity transcription factors of GCF and NFI that could negatively and positively regulate the expression of Ier5 respectively. (authors)
Okawara, Makoto; Kajiki, Shigeyuki; Kusumoto, Akira; Fujino, Yoshihisa; Shinkai, Takahiro; Morimoto, Hideki; Hino, Yoshiyuki; Yamashita, Satoshi; Hattori, Michihiro; Mori, Koji
2018-02-01
suggests that there are factors impeding the cooperation between the occupational health physicians and psychiatrists. When an occupational health physician writes a request form, cooperation with psychiatrists may be promoted by enriching the request form contents and by including the representation of the occupational health physician's position and the intended purpose of the provided information by paying attention to the volume of sentences.
Yang, Shu-Ching; Luo, Yi-Fang; Chiang, Chia-Hsun
2017-01-10
eHealth literacy is gaining importance for maintaining and promoting health. Studies have found that individuals with high eHealth literacy are more likely to adopt healthy eating, exercise, and sleep behaviors. In addition, previous studies have shown that various individual factors (eg, frequency of seeking information on health issues, degree of health concern, frequency of eating organic food, and students' college major) are associated with eHealth literacy and health-promoting lifestyles. Nevertheless, few studies have explored the associations among individual factors, eHealth literacy, and health-promoting lifestyles among college students. Moreover, there is a lack of studies that focus on eHealth literacy as a predictor of psychological health behaviors. To examine the associations among various individual factors, eHealth literacy, and health-promoting lifestyles. The eHealth Literacy Scale is a 12-item instrument designed to measure college students' functional, interactive, and critical eHealth literacy. The Health-promoting Lifestyle Scale is a 23-item instrument developed to measure college students' self-actualization, health responsibility, interpersonal support, exercise, nutrition, and stress management. A nationally representative sample of 556 valid college students in Taiwan was surveyed. A questionnaire was administered to gather the respondents' background information, including the frequency of seeking information on health issues, the frequency of eating organic food, the degree of health concern, and the students' major. We then conducted a multiple regression analysis to examine the associations among individual factors, eHealth literacy, and health-promoting lifestyles. The study found that factors such as medical majors (t 550 =2.47-7.55, PeHealth literacy. Moreover, critical eHealth literacy positively predicted all 6 health-promoting lifestyle dimensions (t 547 =2.66-7.28, PeHealth literacy, and had a positive health-promoting
International Nuclear Information System (INIS)
Ceccarelli, Simona; Cardinali, Giorgia; Aspite, Nicaela; Picardo, Mauro; Marchese, Cinzia; Torrisi, Maria Rosaria; Mancini, Patrizia
2007-01-01
Keratinocyte growth factor (KGF/FGF7) and fibroblast growth factor 10 (FGF10/KGF2) regulate keratinocyte proliferation and differentiation by binding to the tyrosine kinase KGF receptor (KGFR). KGF induces keratinocyte motility and cytoskeletal rearrangement, whereas a direct role of FGF10 on keratinocyte migration is not clearly established. Here we analyzed the motogenic activity of FGF10 and KGF on human keratinocytes. Migration assays and immunofluorescence of actin cytoskeleton revealed that FGF10 is less efficient than KGF in promoting migration and exerts a delayed effect in inducing lamellipodia and ruffles formation. Both growth factors promoted phosphorylation and subsequent membrane translocation of cortactin, an F-actin binding protein involved in cell migration; however, FGF10-induced cortactin phosphorylation was reduced, more transient and delayed with respect to that promoted by KGF. Cortactin phosphorylation induced by both growth factors was Src-dependent, while its membrane translocation and cell migration were blocked by either Src and PI3K inhibitors, suggesting that both pathways are involved in KGF- and FGF10-dependent motility. Furthermore, siRNA-mediated downregulation of cortactin inhibited KGF- and FGF10-induced migration. These results indicate that cortactin is involved in keratinocyte migration promoted by both KGF and FGF10
Takagi, Satoshi; Takemoto, Ai; Takami, Miho; Oh-hara, Tomoko; Fujita, Naoya
2014-01-01
The interactions of tumor cells with platelets contribute to the progression of tumor malignancy, and the expression levels of platelet aggregation-inducing factors positively correlate with the metastatic potential of osteosarcoma cells. However, it is unclear how tumor-platelet interaction contributes to the proliferation of osteosarcomas. We report here that osteosarcoma-platelet interactions induce the release of platelet-derived growth factor (PDGF) from platelets, which promotes the pro...
DEFF Research Database (Denmark)
Shinde, Prashant V; Xu, Haifeng C; Maney, Sathish Kumar
2018-01-01
Innate immune activation is essential to mount an effective antiviral response and to prime adaptive immunity. Although a crucial role of CD169(+) cells during vesicular stomatitis virus (VSV) infections is increasingly recognized, factors regulating CD169(+) cells during viral infections remain...... stomatitis virus infection, phagocytes produce tumor necrosis factor (TNF) which signals via TNFR1 and promote "enforced virus replication" in CD169(+) macrophages. Consequently, lack of TNF or TNFR1 resulted in defective immune activation and VSV clearance....
Meng, X.; de rooij, D. G.; Westerdahl, K.; Saarma, M.; Sariola, H.
2001-01-01
We show with transgenic mice that targeted overexpression of glial cell line-derived neurotrophic factor (GDNF) in undifferentiated spermatogonia promotes malignant testicular tumors, which express germ-cell markers. The tumors are invasive and contain aneuploid cells, but no distant metastases have
Kumi-Yeboah, Alex; Dogbey, James; Yuan, Guangji
2018-01-01
The rapid growth of online education at the K-12 level in recent years presents the need to explore issues that influence the academic experiences of students choosing this method of learning. In this study, we examined factors that promote/hinder the learning experiences and academic self-concept of minority students attending an online high…
van Gelderen, Loes; Gartrell, Nanette N.; Bos, Henny M. W.; Hermanns, Jo M. A.
2013-01-01
The aim of this study was to investigate whether stigmatization was associated with psychological adjustment in adolescents from planned lesbian families and, if so, to examine whether individual and interpersonal promotive factors influenced this association. Seventy-eight adolescents (39 girls, 39 boys; mean age = 17.05 years) completed an…
DEFF Research Database (Denmark)
Serup, P; Jensen, J; Andersen, F G
1996-01-01
Insulin promoter factor 1 (IPF1), a member of the homeodomain protein family, serves an early role in pancreas formation, as evidenced by the lack of pancreas formation in mice carrying a targeted disruption of the IPF1 gene [Jonsson, J., Carlsson, L., Edlund, T. & Edlund, H. (1994) Nature (London...
Lorthios-Guilledroit, Agathe; Richard, Lucie; Filiatrault, Johanne
2018-06-01
Peer education is growing in popularity as a useful health promotion strategy. However, optimal conditions for implementing peer-led health promotion programs (HPPs) remain unclear. This scoping review aimed to describe factors that can influence implementation of peer-led HPPs targeting adult populations. Five databases were searched using the keywords "health promotion/prevention", "implementation", "peers", and related terms. Studies were included if they reported at least one factor associated with the implementation of community-based peer-led HPPs. Fifty-five studies were selected for the analysis. The method known as "best fit framework synthesis" was used to analyze the factors identified in the selected papers. Many factors included in existing implementation conceptual frameworks were deemed applicable to peer-led HPPs. However, other factors related to individuals, programs, and implementation context also emerged from the analysis. Based on this synthesis, an adapted theoretical framework was elaborated, grounded in a complex adaptive system perspective and specifying potential mechanisms through which factors may influence implementation of community-based peer-led HPPs. Further research is needed to test the theoretical framework against empirical data. Findings from this scoping review increase our knowledge of the optimal conditions for implementing peer-led HPPs and thereby maximizing the benefits of such programs. Copyright © 2018 Elsevier Ltd. All rights reserved.
Koltunov, Viktoria; Greenblatt, Charles L; Goncharenko, Anna V; Demina, Galya R; Klein, Benjamin Y; Young, Michael; Kaprelyants, Arseny S
2010-02-01
Dormancy among nonsporulating actinobacteria is now a widely accepted phenomenon. In Micrococcus luteus, the resuscitation of dormant cells is caused by a small secreted protein (resuscitation-promoting factor, or Rpf) that is found in "spent culture medium." Rpf is encoded by a single essential gene in M. luteus. Homologs of Rpf are widespread among the high G + C Gram-positive bacteria, including mycobacteria and streptomycetes, and most organisms make several functionally redundant proteins. M. luteus Rpf comprises a lysozyme-like domain that is necessary and sufficient for activity connected through a short linker region to a LysM motif, which is present in a number of cell-wall-associated enzymes. Muralytic activity is responsible for resuscitation. In this report, we characterized a number of environmental isolates of M. luteus, including several recovered from amber. There was substantial variation in the predicted rpf gene product. While the lysozyme-like and LysM domains showed little variation, the linker region was elongated from ten amino acid residues in the laboratory strains to as many as 120 residues in one isolate. The genes encoding these Rpf proteins have been characterized, and a possible role for the Rpf linker in environmental adaptation is proposed. The environmental isolates show enhanced resistance to lysozyme as compared with the laboratory strains and this correlates with increased peptidoglycan acetylation. In strains that make a protein with an elongated linker, Rpf was bound to the cell wall, rather than being released to the growth medium, as occurs in reference strains. This rpf gene was introduced into a lysozyme-sensitive reference strain. Both rpf genes were expressed in transformants which showed a slight but statistically significant increase in lysozyme resistance.
Directory of Open Access Journals (Sweden)
Fu-Jou Lai
Full Text Available Transcription factor binding site (TFBS identification plays an important role in deciphering gene regulatory codes. With comprehensive knowledge of TFBSs, one can understand molecular mechanisms of gene regulation. In the recent decades, various computational approaches have been proposed to predict TFBSs in the genome. The TFBS dataset of a TF generated by each algorithm is a ranked list of predicted TFBSs of that TF, where top ranked TFBSs are statistically significant ones. However, whether these statistically significant TFBSs are functional (i.e. biologically relevant is still unknown. Here we develop a post-processor, called the functional propensity calculator (FPC, to assign a functional propensity to each TFBS in the existing computationally predicted TFBS datasets. It is known that functional TFBSs reveal strong positional preference towards the transcriptional start site (TSS. This motivates us to take TFBS position relative to the TSS as the key idea in building our FPC. Based on our calculated functional propensities, the TFBSs of a TF in the original TFBS dataset could be reordered, where top ranked TFBSs are now the ones with high functional propensities. To validate the biological significance of our results, we perform three published statistical tests to assess the enrichment of Gene Ontology (GO terms, the enrichment of physical protein-protein interactions, and the tendency of being co-expressed. The top ranked TFBSs in our reordered TFBS dataset outperform the top ranked TFBSs in the original TFBS dataset, justifying the effectiveness of our post-processor in extracting functional TFBSs from the original TFBS dataset. More importantly, assigning functional propensities to putative TFBSs enables biologists to easily identify which TFBSs in the promoter of interest are likely to be biologically relevant and are good candidates to do further detailed experimental investigation. The FPC is implemented as a web tool at http://santiago.ee.ncku.edu.tw/FPC/.
Directory of Open Access Journals (Sweden)
Wenzhi Cao
2018-04-01
Full Text Available Tanshinones, one group of bioactive diterpenes, were widely used in the treatment of cardiovascular diseases. WRKYs play important roles in plant metabolism, but their regulation mechanism in Salvia miltiorrhiza remains elusive. In this study, one WRKY transcription factor SmWRKY1 was isolated and functionally characterized from S. miltiorrhiza. Multiple sequence alignment and phylogenetic tree analysis showed SmWRKY1 shared high homology with other plant WRKYs such as CrWRKY1. SmWRKY1 was found predominantly expressed in leaves and stems, and was responsive to salicylic acid (SA, methyl jasmonate (MeJA, and nitric oxide (NO treatment. Subcellular localization analysis found that SmWRKY1 was localized in the nucleus. Over-expression of SmWRKY1 significantly elevated the transcripts of genes coding for enzymes in the MEP pathway especially 1-deoxy-D-xylulose-5-phosphate synthase (SmDXS and 1-deoxy-D-xylulose-5-phosphate reductoisomerase (SmDXR, resulted in over fivefold increase in tanshinones production in transgenic lines (up to 13.7 mg/g DW compared with the control lines. A dual-luciferase (Dual-LUC assay showed that SmWRKY1 can positively regulate SmDXR expression by binding to its promoter. Our work revealed that SmWRKY1 participated in the regulation of tanshinones biosynthesis and acted as a positive regulator through activating SmDXR in the MEP pathway, thus provided a new insight to further explore the regulation mechanism of tanshinones biosynthesis.
Doku, D; Koivusilta, L; Raisamo, S; Rimpelä, A
2012-08-01
With a long history of tobacco cultivation, adolescents in Ghana are at relatively high risk of the emerging tobacco epidemic in developing countries. This study explored exposure to tobacco promoting/restraining factors and their associations with smoking and tawa (traditional smokeless tobacco) use among 13-18-year-old Ghanaians. School-based representative data were collected in 2008 (n = 1165). Prevalence rates of tobacco use, smoking and tawa use were 9.1% (11.5% boys and 6.4% girls), 6.6% (8.0% boys and 4.7% girls) and 5.7% (7.3% boys and 3.9% girls), respectively. Four percent of the respondents attended schools without a smoking ban, 66% had been taught about the harmful effects of smoking in the current school year, and 53% had been exposed to tobacco advertising. Fifty-three percent of adolescents who had tried to purchase tobacco products were not refused because of their age. Multivariate analyses found that attendance at a school where smoking was allowed, not having been taught about the harmful effects of smoking, exposure to tobacco advertising and parental smoking were positively associated with tobacco use, and knowledge that smoking is harmful to health and difficult to quit were negatively associated with tobacco use. Both smoking and tawa use were relatively low among Ghanaian adolescents. Exposure to tobacco advertising was high. There is no tobacco legislation in Ghana, but societal norms or cultural values seem to restrict smoking in schools and access to tobacco products. Copyright © 2012 The Royal Society for Public Health. Published by Elsevier Ltd. All rights reserved.
Levine, A Joan; Phipps, Amanda I; Baron, John A; Buchanan, Daniel D; Ahnen, Dennis J; Cohen, Stacey A; Lindor, Noralane M; Newcomb, Polly A; Rosty, Christophe; Haile, Robert W; Laird, Peter W; Weisenberger, Daniel J
2016-01-01
The CpG island methylator phenotype (CIMP) is a major molecular pathway in colorectal cancer. Approximately 25% to 60% of CIMP tumors are microsatellite unstable (MSI-H) due to DNA hypermethylation of the MLH1 gene promoter. Our aim was to determine if the distributions of clinicopathologic factors in CIMP-positive tumors with MLH1 DNA methylation differed from those in CIMP-positive tumors without DNA methylation of MLH1. We assessed the associations between age, sex, tumor-site, MSI status BRAF and KRAS mutations, and family colorectal cancer history with MLH1 methylation status in a large population-based sample of CIMP-positive colorectal cancers defined by a 5-marker panel using unconditional logistic regression to assess the odds of MLH1 methylation by study variables. Subjects with CIMP-positive tumors without MLH1 methylation were significantly younger, more likely to be male, and more likely to have distal colon or rectal primaries and the MSI-L phenotype. CIMP-positive MLH1-unmethylated tumors were significantly less likely than CIMP-positive MLH1-methylated tumors to harbor a BRAF V600E mutation and significantly more likely to harbor a KRAS mutation. MLH1 methylation was associated with significantly better overall survival (HR, 0.50; 95% confidence interval, 0.31-0.82). These data suggest that MLH1 methylation in CIMP-positive tumors is not a completely random event and implies that there are environmental or genetic determinants that modify the probability that MLH1 will become methylated during CIMP pathogenesis. MLH1 DNA methylation status should be taken into account in etiologic studies. ©2015 American Association for Cancer Research.
Placental Growth Factor Promotes Ovarian Cancer Cell Invasion via ZEB2
Directory of Open Access Journals (Sweden)
Ning Song
2016-01-01
Full Text Available Background/Aims: The aggressive manner of ovarian cancer (OVC cells accounts for the majority of its lethality. Recently, we have shown that placental growth factor (PLGF promotes metastases of OVC cells through miR-543-regulated MMP7. In the current study, we analyzed the effects of PLGF on another cell invasion associated protein, ZEB2, in OVC cells. Methods: The PLGF and ZEB2 levels in OVC tissues were compared to the paired adjacent non-tumor ovary tissue. We modified ZEB2 levels in OVC cells, and examined its effects on PLGF mRNA and protein levels by RT-qPCR and by Western blot, respectively. We also modified PLGF levels in OVC cells, and examined its effects on ZEB2 mRNA and protein levels by RT-qPCR and by Western blot, respectively. Then, we examined the cell invasiveness in PLGF-modified OVC cells in a transwell cell invasion assay. Finally, we used specific signal pathway inhibitors to treat PLGF-modified OVC cells and examined the effects on ZEB2 activation. Results: PLGF and ZEB2 levels were both significantly increased in OVC tissues, compared to the paired adjacent non-tumor ovary tissue. The PLGF and ZEB2 levels were strongly correlated. ZEB2 modification did not alter PLGF levels. Overexpression of PLGF in OVC cells significantly increased ZEB2 levels and cell invasiveness, while PLGF depletion in OVC cells significantly decreased ZEB2 levels and cell invasiveness. Application of a specific MAPK-p38 inhibitor, but not application of specific inhibitors for MAPK-p42/p44, PI3k/Akt, or JNK signaling pathways, to PLGF-overexpressing OVC cells substantially abolished the PLGF-induced ZEB2 activation. Conclusion: PLGF enhances OVC cell invasion through MAPK-p38-dependent activation of ZEB2.
Factors impacting on menstrual hygiene and their implications for health promotion.
Lahme, Anne Mutunda; Stern, Ruth; Cooper, Diane
2018-03-01
In the lives of women, puberty is marked by the onset of menarche. From this stage onwards until menopause, reproductive health and menstrual hygiene are important aspects of women's lives. In Zambia's Western Province, the natural process of menstruation is a taboo and dealt with secretly. Information and knowledge about menstruation and menstrual hygiene among adolescent girls is inadequate. This paper explores the factors influencing the understanding, experiences and practices of menstrual hygiene among adolescent girls in Mongu District, Western Province of Zambia. An explorative study design was used by means of six focus group discussions conducted with 51 respondents, aged 13-20 years, from three secondary schools. Their age at menarche was 11-15. For data analysis thematic content analysis was used. The paper shows that the girls suffer from poor menstrual hygiene, originating from lack of knowledge, culture and tradition, and socio-economic and environmental constraints, leading to inconveniences, humiliation and stress. This leads to reduced school attendance and poor academic performance, or even drop outs, and ultimately infringes upon the girls' human rights. To address these shortcomings, a 'super setting approach' is recommended, in which a Health Promoting School could improve the girls' individual and group needs, and a community setting which would address the broader socio-economic, cultural and environmental conditions. This would enable creating a supportive environment for the girls to manage their periods. To successfully utilize the approach, all stakeholders (parents, teachers, children, governments and communities) should cooperate to generate context-specific solutions for creating safe menstrual care, and better and dignified conditions for adolescent girls. Therefore, this calls for comprehensive, strident advocacy for policy changes at national level, and mediation and involvement at community level.
Mechano growth factor, a splice variant of IGF-1, promotes neurogenesis in the aging mouse brain.
Tang, Jason J; Podratz, Jewel L; Lange, Miranda; Scrable, Heidi J; Jang, Mi-Hyeon; Windebank, Anthony J
2017-07-07
Mechano growth factor (MGF) is a splice variant of IGF-1 first described in skeletal muscle. MGF induces muscle cell proliferation in response to muscle stress and injury. In control mice we found endogenous expression of MGF in neurogenic areas of the brain and these levels declined with age. To better understand the role of MGF in the brain, we used transgenic mice that constitutively overexpressed MGF from birth. MGF overexpression significantly increased the number of BrdU+ proliferative cells in the dentate gyrus (DG) of the hippocampus and subventricular zone (SVG). Although MGF overexpression increased the overall rate of adult hippocampal neurogenesis at the proliferation stage it did not alter the distribution of neurons at post-mitotic maturation stages. We then used the lac-operon system to conditionally overexpress MGF in the mouse brain beginning at 1, 3 and 12 months with histological and behavioral observation at 24 months of age. With conditional overexpression there was an increase of BrdU+ proliferating cells and BrdU+ differentiated mature neurons in the olfactory bulbs at 24 months when overexpression was induced from 1 and 3 months of age but not when started at 12 months. This was associated with preserved olfactory function. In vitro, MGF increased the size and number of neurospheres harvested from SVZ-derived neural stem cells (NSCs). These findings indicate that MGF overexpression increases the number of neural progenitor cells and promotes neurogenesis but does not alter the distribution of adult newborn neurons at post-mitotic stages. Maintaining youthful levels of MGF may be important in reversing age-related neuronal loss and brain dysfunction.
Lymphotoxin β receptor activation promotes bladder cancer in a nuclear factor-κB-dependent manner.
Shen, Mo; Duan, Xiuzhi; Zhou, Ping; Zhou, Wu; Wu, Xiuling; Xu, Siqi; Chen, Yuhua; Tao, Zhihua
2015-02-01
Bladder cancer (BCa) is the most common tumor of the urinary system. Chronic inflammation in the papillary urothelial neoplasm of low malignant potential (PUNLMP)may contribute to carcinogenesis, including that of BCa, via poorly understood mechanisms. In this study, we show that the lymphotoxin β receptor (LTβR) is upregulated in BCa via activation of the canonical and non-canonical nuclear factor-κB (NF-κB) pathways. The mRNA expression of LTβR in 81 BCa, 10 chronic cystitis and 23 healthy bladder mucosa tissues was investigated by reverse transcription-fluorescent quantitative polymerase chain reaction (RT-FQ-PCR), and protein expression was studied in 73 BCa, 30 cystitis and 15 healthy paraffin-embedded tissue sections by immunohistochemistry. Both LTβR mRNA and protein were upregulated in BCa and cystitis compared to the healthy group (P<0.05). The mRNA level of the downstream NF-κB canonical pathway p65 gene and of the non-canonical pathway RelB gene were higher in the BCa and cystitis groups compared to the healthy one. The level of phosphorylated p65 (p-p65) protein of the canonical NF-κB pathway and that of p52, a protein of the non-canonical NF-κB pathway, were also higher in the BCa and cystitis group compared to the healthy group. The levels of these proteins significantly correlated to the pathological grade, clinical stage and lymph node metastasis of BCa patients (P<0.05). In addition, there was a positive correlation between LTβR and NF-κB pathway proteins. Thus, LTβR signaling may be involved in promoting BCa through the NF-κB pathway, and which may represent the molecular link between inflammation and BCa.
Directory of Open Access Journals (Sweden)
Leandro M Redondo
2014-03-01
Full Text Available Antibiotics have been included in the formulation of feed for livestock production for more than 40 years as a strategy to improve feed conversion rates and to reduce costs. The use of antimicrobials as growth-promoting factors (AGP in sub-therapeutic doses for long periods is particularly favorable to select antimicrobial-resistant microorganisms. In the last years, global concern about development of antimicrobial resistance and transference of resistance genes from animal to human strains has been arising. Removal of AGP from animal diets involves a tremendous pressure on the livestock and poultry farmers, one of the main consequences being a substantial increase in the incidence of infectious diseases with the related increase in the use of antibiotics for therapy and, concomitantly, economic cost. Therefore, alternatives to AGP are urgently needed. The challenge is to implement new alternatives without affecting the production performances of livestock and also avoiding the increase of antimicrobial resistant microorganisms. Plant extracts and purified derived substances are showing promising results for food animal production, either from their efficacy as well as from an economical point of view. Tannins are plant derived compounds that are being successfully used as additives in feed poultry to control diseases and to improve animal performance. Successful use of any of these extracts as feed additive must ensure a product of consistent quality in enough quantities to fulfill the actual requirements of the poultry industry. Chestnut (hydrolizable and Quebracho (condennsed tannins are probably the most readily available commercial products that are covering those needs. The present report intends to analyze the available data supporting their use.
Levine, A. Joan; Phipps, Amanda I.; Baron, John A.; Buchanan, Daniel D.; Ahnen, Dennis J.; Cohen, Stacey A.; Lindor, Noralane M.; Newcomb, Polly A.; Rosty, Christophe; Haile, Robert W.; Laird, Peter W.; Weisenberger, Daniel J.
2015-01-01
Background The CpG Island Methylator Phenotype (CIMP) is a major molecular pathway in colorectal cancer (CRC). Approximately 25% to 60% of CIMP tumors are microsatellite unstable (MSI-H) due to DNA hypermethylation of the MLH1 gene promoter. Our aim was to determine if the distributions of clinicopathologic factors in CIMP-positive tumors with MLH1 DNA methylation differed from those in CIMP-positive tumors without DNA methylation of MLH1. Methods We assessed the associations between age, sex, tumor-site, MSI status BRAF and KRAS mutations and family CRC history with MLH1 methylation status in a large population-based sample of CIMP-positive CRCs defined by a 5-marker panel using unconditional logistic regression to assess the odds of MLH1 methylation by study variables. Results Subjects with CIMP-positive tumors without MLH1 methylation were significantly younger, more likely to be male, more likely to have distal colon or rectal primaries and the MSI-L phenotype. CIMP-positive MLH1-unmethylated tumors were significantly less likely than CIMP-positive MLH1-methylated tumors to harbor a BRAF V600E mutation and significantly more likely to harbor a KRAS mutation. MLH1 methylation was associated with significantly better overall survival (HR=0.50; 95% Confidence Interval (0.31, 0.82)). Conclusions These data suggest that MLH1 methylation in CIMP-positive tumors is not a completely random event and implies that there are environmental or genetic determinants that modify the probability that MLH1 will become methylated during CIMP pathogenesis. Impact MLH1 DNA methylation status should be taken into account in etiologic studies. PMID:26512054
Ribosomal elongation factor 4 promotes cell death associated with lethal stress.
Li, Liping; Hong, Yuzhi; Luan, Gan; Mosel, Michael; Malik, Muhammad; Drlica, Karl; Zhao, Xilin
2014-12-09
Ribosomal elongation factor 4 (EF4) is highly conserved among bacteria, mitochondria, and chloroplasts. However, the EF4-encoding gene, lepA, is nonessential and its deficiency shows no growth or fitness defect. In purified systems, EF4 back-translocates stalled, posttranslational ribosomes for efficient protein synthesis; consequently, EF4 has a protective role during moderate stress. We were surprised to find that EF4 also has a detrimental role during severe stress: deletion of lepA increased Escherichia coli survival following treatment with several antimicrobials. EF4 contributed to stress-mediated lethality through reactive oxygen species (ROS) because (i) the protective effect of a ΔlepA mutation against lethal antimicrobials was eliminated by anaerobic growth or by agents that block hydroxyl radical accumulation and (ii) the ΔlepA mutation decreased ROS levels stimulated by antimicrobial stress. Epistasis experiments showed that EF4 functions in the same genetic pathway as the MazF toxin, a stress response factor implicated in ROS-mediated cell death. The detrimental action of EF4 required transfer-messenger RNA (tmRNA, which tags truncated proteins for degradation and is known to be inhibited by EF4) and the ClpP protease. Inhibition of a protective, tmRNA/ClpP-mediated degradative activity would allow truncated proteins to indirectly perturb the respiratory chain and thereby provide a potential link between EF4 and ROS. The connection among EF4, MazF, tmRNA, and ROS expands a pathway leading from harsh stress to bacterial self-destruction. The destructive aspect of EF4 plus the protective properties described previously make EF4 a bifunctional factor in a stress response that promotes survival or death, depending on the severity of stress. Translation elongation factor 4 (EF4) is one of the most conserved proteins in nature, but it is dispensable. Lack of strong phenotypes for its genetic knockout has made EF4 an enigma. Recent biochemical work has
2011-01-01
Background Rheumatic diseases have a significant adverse impact on the individual from physical, mental and social aspects, resulting in a low health-related quality of life (HRQL). There is a lack of longitudinal studies on HRQL in people with rheumatic diseases that focus on factors promoting HRQL instead of risk factors. The aim of this study was to investigate the associations between suggested health promoting factors at baseline and outcome in HRQL at a 12 month follow-up in people with rheumatic diseases. Methods A longitudinal cohort study was conducted in 185 individuals with rheumatic diseases with questionnaires one week and 12 months after rehabilitation in a Swedish rheumatology clinic. HRQL was assessed by SF-36 together with suggested health factors. The associations between SF-36 subscales and the health factors were analysed by multivariable logistic regressions. Results Factors predicting better outcome in HRQL in one or several SF-36 subscales were being younger or middle-aged, feeling painless, having good sleep structure, feeling rested after sleep, performing low effort of exercise more than twice per week, having strong sense of coherence (SOC), emotional support and practical assistance, higher educational level and work capacity. The most important factors were having strong SOC, feeling rested after sleep, having work capacity, being younger or middle-aged, and having good sleep structure. Conclusions This study identified several factors that promoted a good outcome in HRQL to people with rheumatic diseases. These health factors could be important to address in clinical work with rheumatic diseases in order to optimise treatment strategies. PMID:21599884
Cai, Shao-hang; Lu, Shi-xun; Liu, Li-li; Zhang, Chris Zhiyi; Yun, Jing-ping
2017-01-01
Background: Hepatocyte nuclear factor 4 alpha (HNF4α) plays an important role in tumourigenesis. There is growing evidence indicating that HNF4α transcribed by promoter 1 (P1-HNF4α) is expressed at relatively low levels in HCC and its presence predicts a favourable outcome for hepatocellular carcinoma (HCC) patients. However, the role of HNF4α transcribed by promoter 2 (P2-HNF4α) in HCC remains unclear. Methods: A total of 615 HCC specimens were obtained to construct tissue microarrays and pe...
Wechpradit, Apinya; Thaiyuenwong, Jutiporn; Kanjanabuch, Talerngsak
2011-09-01
To present study health promotion behaviors and related factors in end stage renal disease (ESRD) patients treated with continuous ambulatory peritoneal dialysis (CAPD). Questionnaires of Pender to evaluate health promotion behaviors which measure 5 aspects of health-affected behaviors were examined in 90 CAPD patients at dialysis unit of Udornthani Hospital. Results were categorized into 3 groups according to Bloom's scale as follows: high, moderate, and low levels. The data were displayed as ranges or means +/- standard deviation, according to the characteristics of each variable, with a 5% (p cherish health behaviors of the patients.
Smith, Alias J; Chudnovsky, Lorissa; Simoes-Barbosa, Augusto; Delgadillo-Correa, Maria G; Jonsson, Zophonias O; Wohlschlegel, James A; Johnson, Patricia J
2011-04-01
A highly conserved DNA initiator (Inr) element has been the only core promoter element described in the divergent unicellular eukaryote Trichomonas vaginalis, although genome analyses reveal that only ∼75% of protein-coding genes appear to contain an Inr. In search of another core promoter element(s), a nonredundant database containing 5' untranslated regions of expressed T. vaginalis genes was searched for overrepresented DNA motifs and known eukaryotic core promoter elements. In addition to identifying the Inr, two elements that lack sequence similarity to the known protein-coding gene core promoter, motif 3 (M3) and motif 5 (M5), were identified. Mutational and functional analyses demonstrate that both are novel core promoter elements. M3 [(A/G/T)(A/G)C(G/C)G(T/C)T(T/A/G)] resembles a Myb recognition element (MRE) and is bound specifically by a unique protein with a Myb-like DNA binding domain. The M5 element (CCTTT) overlaps the transcription start site and replaces the Inr as an alternative, gene-specific initiator element. Transcription specifically initiates at the second cytosine within M5, in contrast to characteristic initiation by RNA polymerase II at an adenosine. In promoters that combine M3 with either M5 or Inr, transcription initiation is regulated by the M3 motif.
Smith, Alias J.; Chudnovsky, Lorissa; Simoes-Barbosa, Augusto; Delgadillo-Correa, Maria G.; Jonsson, Zophonias O.; Wohlschlegel, James A.; Johnson, Patricia J.
2011-01-01
A highly conserved DNA initiator (Inr) element has been the only core promoter element described in the divergent unicellular eukaryote Trichomonas vaginalis, although genome analyses reveal that only ∼75% of protein-coding genes appear to contain an Inr. In search of another core promoter element(s), a nonredundant database containing 5′ untranslated regions of expressed T. vaginalis genes was searched for overrepresented DNA motifs and known eukaryotic core promoter elements. In addition to identifying the Inr, two elements that lack sequence similarity to the known protein-coding gene core promoter, motif 3 (M3) and motif 5 (M5), were identified. Mutational and functional analyses demonstrate that both are novel core promoter elements. M3 [(A/G/T)(A/G)C(G/C)G(T/C)T(T/A/G)] resembles a Myb recognition element (MRE) and is bound specifically by a unique protein with a Myb-like DNA binding domain. The M5 element (CCTTT) overlaps the transcription start site and replaces the Inr as an alternative, gene-specific initiator element. Transcription specifically initiates at the second cytosine within M5, in contrast to characteristic initiation by RNA polymerase II at an adenosine. In promoters that combine M3 with either M5 or Inr, transcription initiation is regulated by the M3 motif. PMID:21245378
Directory of Open Access Journals (Sweden)
Julia C Seelandt
Full Text Available BACKGROUND: The aim of this study was to identify the factors perceived by surgeons that promote surgery as an attractive or unattractive career choice for today's graduates. In addition, it examined whether the perspectives of surgeons in different professional situations converges. The content of work, contextual work conditions, and calling to this job are discussed in the context of choosing surgery as a career. METHODS: Eight hundred sixty-nine surgeons were asked to answer open-ended questions regarding the factors that promote surgery as an attractive or unattractive career choice for today's graduates. Four hundred ninety-two surgeons participated, and 1,525 statements were analyzed using Mayring's content-analyses method. Chi-square tests were used to analyze the differences among hierarchical positions. RESULTS: With respect to the factors that promote surgery as a profession, 40.8% (209/492 of the surgeons stated that surgery is a calling, 29.1% (149/492 of the surgeons provided at least one argument related to the positive task characteristics, and 12.9% (66/492 of the surgeons provided statements related to the positive contextual factors. With respect to the factors that discourage surgery as a profession, 45.7% (234/492 of the surgeons provided at least one argument related to the discouraging work characteristics, and 67.6% (346/492 of the surgeons provided problematic contextual characteristics. CONCLUSION: This study emphasizes the importance of the calling to surgery as an important factor for choosing surgery as a career. However, the extensive workload, training, and poor work-family balance have been identified as factors that discourage graduates from choosing surgery as a career. The identified positive factors could be used to attract and maintain graduates in surgical disciplines.
Seelandt, Julia C; Kaderli, Reto M; Tschan, Franziska; Businger, Adrian P
2014-01-01
The aim of this study was to identify the factors perceived by surgeons that promote surgery as an attractive or unattractive career choice for today's graduates. In addition, it examined whether the perspectives of surgeons in different professional situations converges. The content of work, contextual work conditions, and calling to this job are discussed in the context of choosing surgery as a career. Eight hundred sixty-nine surgeons were asked to answer open-ended questions regarding the factors that promote surgery as an attractive or unattractive career choice for today's graduates. Four hundred ninety-two surgeons participated, and 1,525 statements were analyzed using Mayring's content-analyses method. Chi-square tests were used to analyze the differences among hierarchical positions. With respect to the factors that promote surgery as a profession, 40.8% (209/492) of the surgeons stated that surgery is a calling, 29.1% (149/492) of the surgeons provided at least one argument related to the positive task characteristics, and 12.9% (66/492) of the surgeons provided statements related to the positive contextual factors. With respect to the factors that discourage surgery as a profession, 45.7% (234/492) of the surgeons provided at least one argument related to the discouraging work characteristics, and 67.6% (346/492) of the surgeons provided problematic contextual characteristics. This study emphasizes the importance of the calling to surgery as an important factor for choosing surgery as a career. However, the extensive workload, training, and poor work-family balance have been identified as factors that discourage graduates from choosing surgery as a career. The identified positive factors could be used to attract and maintain graduates in surgical disciplines.
International Nuclear Information System (INIS)
Al-Nbaheen, M.; Pourzand, C.; Tyrrell, R.M.
2006-01-01
One way of targeting gene expression in vivo is to control transcription using a tissue-specific regulatory system. Tissue specific promoters or enhancers are in use in transgenic animals and could be utilized in medical for gene therapy. At present the usual method for selection of a tissue-specific promoter is to identify a gene, which is expressed at unusually high level in the target tissue, and then to use the promoter for this gene to drive expression of another therapeutic gene in the target tissue. This approach is logical but does not always lead to high levels of gene expression. A second approach is to investigate the scope for discovery of synthetic specific promoters using a target tissue. The objective of the work described in this paper was to use both approach to design plasmid DNA expression vectors that would carry liver-specific promoter/enhancer linked to reporter gene (i.e. luciferase). Then transfect these vectors to both liver-derived and non-liver cell lines. This is followed by evaluation of the liver-specificity of each construct by measuring the basal level expression of the reporter gene (i.e. luciferase activity) in both cell lines. Hepatocyte nuclear factor-4 (HNF-4) is liver-enriched transcription factor used to design new synthetic enhancers by inserting a tandem array of 1', 3' or 5' repeats of the HNF-4 binding site upstream of the SV40 promoter linked to the luciferase reporter gene within an Epstein-Barr virus (EBV)-based vector, p 706. The results of transfection revealed that unexpectedly the HNF-4 binding sites in these constructs act as a repressor rather than enhancer of the liver-specific expression of the luciferase gene. (author)
Bethell, Christina; Forrest, Christopher B; Stumbo, Scott; Gombojav, Narangerel; Carle, Adam; Irwin, Charles E
2012-04-01
School success predicts many pathways for health and well-being across the life span. Factors promoting or potentially impeding school success are critical to understand for all children and for children with special health care needs (CSHCN), whose life course trajectories are already impacted by their chronic health problems. The 2007 National Survey of Children's Health was used (1) to estimate national and state prevalence and within and across states disparities in factors promoting school success (engagement, participation, safety) or potentially impeding success (missing school, grade repetition, school identified problems) for all children and CSHCN and (2) to evaluate associations with CSHCN service need complexity and presence of emotional, behavioral or developmental problems (EBD) as well as with school case management policies in states. Among school age children, 60 % experienced all three factors promoting school success (49.3-73.8 % across states), dropping to 51.3 % for CSHCN (39.4-64.7 % across states) and to 36.2 % for the 40 % of all CSHCN who have both more complex service needs and EBD. CSHCN were more likely to experience factors potentially impeding school success. After accounting for child factors, CSHCN living in states requiring case management in schools for children with disabilities were less likely to experience grade repetition (OR 0.65). Within-state disparities between non-CSHCN and CSHCN varied across states. Threats to school success for US children are pervasive and are especially pronounced for CSHCN with more complex needs and EBD. Findings support broad, non-condition specific efforts to promote school success for CSHCN and consideration of state school policies, such as case management.
Kim, Hyungsae
2010-10-05
Dof proteins are transcription factors that have a conserved single zinc finger DNA-binding domain. In this study, we isolated an activation tagging mutant Dof5.1-D exhibiting an upward-curling leaf phenotype due to enhanced expression of the REV gene that is required for establishing adaxialabaxial polarity. Dof5.1-D plants also had reduced transcript levels for IAA6 and IAA19 genes, indicating an altered auxin biosynthesis in Dof5.1-D. An electrophoretic mobility shift assay using the Dof5.1 DNA-binding motif and the REV promoter region indicated that the DNA-binding domain of Dof5.1 binds to a TAAAGT motif located in the 5′-distal promoter region of the REV promoter. Further, transient and chromatin immunoprecipitation assays verified binding activity of the Dof5.1 DNA-binding motif with the REV promoter. Consistent with binding assays, constitutive over-expression of the Dof5.1 DNA-binding domain in wild-type plants caused a downward-curling phenotype, whereas crossing Dof5.1-D to a rev mutant reverted the upward-curling phenotype of the Dof5.1-D mutant leaf to the wild-type. These results suggest that the Dof5.1 protein directly binds to the REV promoter and thereby regulates adaxialabaxial polarity. © 2010 Blackwell Publishing Ltd.
Kim, Hyungsae; Kim, Sungjin; Abbasi, Nazia; Bressan, Ray Anthony; Yun, Daejin; Yoo, Sangdong; Kwon, SukYun; Choi, Sangbong
2010-01-01
Dof proteins are transcription factors that have a conserved single zinc finger DNA-binding domain. In this study, we isolated an activation tagging mutant Dof5.1-D exhibiting an upward-curling leaf phenotype due to enhanced expression of the REV gene that is required for establishing adaxialabaxial polarity. Dof5.1-D plants also had reduced transcript levels for IAA6 and IAA19 genes, indicating an altered auxin biosynthesis in Dof5.1-D. An electrophoretic mobility shift assay using the Dof5.1 DNA-binding motif and the REV promoter region indicated that the DNA-binding domain of Dof5.1 binds to a TAAAGT motif located in the 5′-distal promoter region of the REV promoter. Further, transient and chromatin immunoprecipitation assays verified binding activity of the Dof5.1 DNA-binding motif with the REV promoter. Consistent with binding assays, constitutive over-expression of the Dof5.1 DNA-binding domain in wild-type plants caused a downward-curling phenotype, whereas crossing Dof5.1-D to a rev mutant reverted the upward-curling phenotype of the Dof5.1-D mutant leaf to the wild-type. These results suggest that the Dof5.1 protein directly binds to the REV promoter and thereby regulates adaxialabaxial polarity. © 2010 Blackwell Publishing Ltd.
Directory of Open Access Journals (Sweden)
Huynen Martijn A
2011-06-01
Full Text Available Abstract Background MicroRNAs (miRNAs play a fundamental role in the regulation of gene expression by translational repression or target mRNA degradation. Regulatory elements in miRNA promoters are less well studied, but may reveal a link between their expression and a specific cell type. Results To explore this link in myeloid cells, miRNA expression profiles were generated from monocytes and dendritic cells (DCs. Differences in miRNA expression among monocytes, DCs and their stimulated progeny were observed. Furthermore, putative promoter regions of miRNAs that are significantly up-regulated in DCs were screened for Transcription Factor Binding Sites (TFBSs based on TFBS motif matching score, the degree to which those TFBSs are over-represented in the promoters of the up-regulated miRNAs, and the extent of conservation of the TFBSs in mammals. Conclusions Analysis of evolutionarily conserved TFBSs in DC promoters revealed preferential clustering of sites within 500 bp upstream of the precursor miRNAs and that many mRNAs of cognate TFs of the conserved TFBSs were indeed expressed in the DCs. Taken together, our data provide evidence that selected miRNAs expressed in DCs have evolutionarily conserved TFBSs relevant to DC biology in their promoters.
International Nuclear Information System (INIS)
Zhang, Jing; Wang, Zhihua; Jiang, Yong; Niu, Zhongying; Fu, Lei; Luo, Zhirong; Cooper, Paul R.; Smith, Anthony J.; He, Wenxi
2015-01-01
The transcription factor Nuclear Factor I-C (NFIC) has been implicated in the regulation of tooth root development, where it may be anticipated to impact on the behavior of stem cells from the apical papilla (SCAPs) and root odontoblast activity. We hypothesized that NFIC may provide an important target for promoting dentin/root regeneration. In the present study, the effects of NFIC on the proliferation and differentiation of SCAPs were investigated. Over-expression of NFIC increased cell proliferation, mineralization nodule formation and alkaline phosphatase (ALP) activity in SCAPs. Furthermore, NFIC up-regulated the mRNA levels of odontogenic-related markers, ALP, osteocalcin and collagen type I as well as dentin sialoprotein protein levels. In contrast, knockdown of NFIC by si-RNA inhibited the mineralization capacity of SCAPs and down-regulated the expression of odontogenic-related markers. In conclusion, the results indicated that upregulation of NFIC activity in SCAPs may promote osteo/odontoblastic differentiation of SCAPs. - Highlights: • NFIC promotes the proliferation of SCAPs in vitro. • NFIC promotes osteo/odontogenic differentiation of SCAPs in vitro. • Knockdown of NFIC inhibits odontogenic differentiation in SCAPs
Energy Technology Data Exchange (ETDEWEB)
Zhang, Jing [State Key Laboratory of Military Stomatology, Department of Operative Dentistry & Endodontics, School of Stomatology, The Fourth Military Medical University, Xi' an (China); Stomatologic Hospital & College, Anhui Medical University, Key Lab of Oral Diseases Research of Anhui Province, Hefei (China); Wang, Zhihua; Jiang, Yong [State Key Laboratory of Military Stomatology, Department of Operative Dentistry & Endodontics, School of Stomatology, The Fourth Military Medical University, Xi' an (China); Niu, Zhongying [Treatment center of oral diseases, The 306th Hospital of People' s Liberation Army, Beijing (China); Fu, Lei; Luo, Zhirong [State Key Laboratory of Military Stomatology, Department of Operative Dentistry & Endodontics, School of Stomatology, The Fourth Military Medical University, Xi' an (China); Cooper, Paul R.; Smith, Anthony J. [Oral Biology, School of Dentistry, University of Birmingham, B4 6NN (United Kingdom); He, Wenxi, E-mail: hewenxi@fmmu.edu.cn [State Key Laboratory of Military Stomatology, Department of Operative Dentistry & Endodontics, School of Stomatology, The Fourth Military Medical University, Xi' an (China)
2015-03-15
The transcription factor Nuclear Factor I-C (NFIC) has been implicated in the regulation of tooth root development, where it may be anticipated to impact on the behavior of stem cells from the apical papilla (SCAPs) and root odontoblast activity. We hypothesized that NFIC may provide an important target for promoting dentin/root regeneration. In the present study, the effects of NFIC on the proliferation and differentiation of SCAPs were investigated. Over-expression of NFIC increased cell proliferation, mineralization nodule formation and alkaline phosphatase (ALP) activity in SCAPs. Furthermore, NFIC up-regulated the mRNA levels of odontogenic-related markers, ALP, osteocalcin and collagen type I as well as dentin sialoprotein protein levels. In contrast, knockdown of NFIC by si-RNA inhibited the mineralization capacity of SCAPs and down-regulated the expression of odontogenic-related markers. In conclusion, the results indicated that upregulation of NFIC activity in SCAPs may promote osteo/odontoblastic differentiation of SCAPs. - Highlights: • NFIC promotes the proliferation of SCAPs in vitro. • NFIC promotes osteo/odontogenic differentiation of SCAPs in vitro. • Knockdown of NFIC inhibits odontogenic differentiation in SCAPs.
Clark, Daniel N; Lambert, Jared P; Till, Rodney E; Argueta, Lissenya B; Greenhalgh, Kathryn E; Henrie, Brandon; Bills, Trieste; Hawkley, Tyson F; Roznik, Marinya G; Sloan, Jason M; Mayhew, Vera; Woodland, Loc; Nelson, Eric P; Tsai, Meng-Hsuan; Poole, Brian D
2014-05-01
The rs2004640 single nucleotide polymorphism and the CGGGG copy-number variant (rs77571059) are promoter polymorphisms within interferon regulatory factor 5 (IRF5). They have been implicated as susceptibility factors for several autoimmune diseases. IRF5 uses alternative promoter splicing, where any of 4 first exons begin the mRNA. The CGGGG indel is in exon 1A's promoter; the rs2004640 allele creates a splicing recognition site, enabling usage of exon 1B. This study aimed at characterizing alterations in IRF5 mRNA due to these polymorphisms. Cells with risk polymorphisms exhibited ~2-fold higher levels of IRF5 mRNA and protein, but demonstrated no change in mRNA stability. Quantitative PCR demonstrated decreased usage of exons 1C and 1D in cell lines with the risk polymorphisms. RNA folding analysis revealed a hairpin in exon 1B; mutational analysis showed that the hairpin shape decreased translation 5-fold. Although translation of mRNA that uses exon 1B is low due to a hairpin, increased IRF5 mRNA levels in individuals with the rs2004640 risk allele lead to higher overall protein expression. In addition, several new splice variants of IRF5 were sequenced. IRF5's promoter polymorphisms alter first exon usage and increase transcription levels. High levels of IRF5 may bias the immune system toward autoimmunity.
DEFF Research Database (Denmark)
Iankova, Irena; Petersen, Rasmus K; Annicotte, Jean-Sébastien
2006-01-01
Positive transcription elongation factor b (P-TEFb) phosphorylates the C-terminal domain of RNA polymerase II, facilitating transcriptional elongation. In addition to its participation in general transcription, P-TEFb is recruited to specific promoters by some transcription factors such as c......-Myc or MyoD. The P-TEFb complex is composed of a cyclin-dependent kinase (cdk9) subunit and a regulatory partner (cyclin T1, cyclin T2, or cyclin K). Because cdk9 has been shown to participate in differentiation processes, such as muscle cell differentiation, we studied a possible role of cdk9...... with and phosphorylation of peroxisome proliferator-activated receptor gamma (PPARgamma), which is the master regulator of this process, on the promoter of PPARgamma target genes. PPARgamma-cdk9 interaction results in increased transcriptional activity of PPARgamma and therefore increased adipogenesis....
Keller, David M; McWeeney, Shannon; Arsenlis, Athanasios; Drouin, Jacques; Wright, Christopher V E; Wang, Haiyan; Wollheim, Claes; White, Peter; Kaestner, Klaus H; Goodman, Richard H
2007-01-01
The homeobox transcription factor Pdx-1 is necessary for pancreas organogenesis and beta cell function, however, most Pdx-1-regulated genes are unknown. To further the understanding of Pdx-1 in beta cell biology, we have characterized its genomic targets in NIT-1 cells, a mouse insulinoma cell line. To identify novel targets, we developed a microarray that includes traditional promoters as well as non-coding conserved elements, micro-RNAs, and elements identified through an unbiased approach ...
DEFF Research Database (Denmark)
Dahl, Søren; Logadottir, Ashildur; Jacobsen, C.J.H.
2001-01-01
The activity and selectivity of heterogeneous catalysts are determined by their electronic and structural properties. In many cases, the electronic properties are determined by the choice of both the catalytically active transition metal and promoter elements. Density functional theory is used...
Huijg, J.M.; Gebhardt, W.A.; Verheijden, M.W.; Zouwe, N. van der; Vries, J.D. de; Middelkoop, B.J.C.; Crone, M.R.
2015-01-01
Background: Despite the promising findings related to the efficacy of interventions aimed at promoting physical activity (PA) in primary health care (PHC), the translation of these interventions to PHC practice does not always happen as desired. Purpose: To help understand why efficacious PHC-based
Internet Access and Youth of Yakutia Awareness on the Health-Promotion Factor
Barakhsanova, Elizabeth Afanasyevna; Ignatyev, Vladimir Petrovich; Savvinov, Vasily Mikhaylovich; Olesova, Sargulana Gavrilievna
2016-01-01
Thematic justification is determined by the fact that in the conditions of the steady growth of mobile technology the youth accurately does not represent health promotion value when using the Internet at home, at school and other entertainment leisure recreation. With respect thereto this paper is aimed at monitoring general awareness of seniors…
Moderating factors of immediate, gross, and net cross-brand effects of price promotions
C. Horváth (Csilla); D. Fok (Dennis)
2013-01-01
textabstractThis article examines cross-price promotional effects in a dynamic context. Among other things, we investigate whether previously established findings hold when consumer and competitive dynamics are taken into account. Five main influential effects (asymmetric price effect, neighborhood
Czech Academy of Sciences Publication Activity Database
Raines, T.; Shanks, C.; Cheng, C.Y.; McPherson, D.; Argueso, C.T.; Kim, H.J.; Franco-Zorrilla, J.M.; Lopez-Vidriero, I.; Solano, R.; Vaňková, Radomíra; Schaller, G.E.; Kieber, J.J.
2016-01-01
Roč. 85, č. 1 (2016), s. 134-147 ISSN 0960-7412 Institutional support: RVO:61389030 Keywords : cytokinin * two-component signaling * transcription factors Subject RIV: EF - Botanics Impact factor: 5.901, year: 2016
International Nuclear Information System (INIS)
Ghazal, P.; Lubon, H.; Hennighausen, L.
1988-01-01
Repeat sequence motifs as well as unique sequences between nucleotides -150 and -22 of the human cytomegalovirus immediate-early 1 gene interact in vitro with nuclear proteins. The authors show that a transcriptional element between nucleotides -91 and -65 stimulated promoter activity in vivo and in vitro by binding specific cellular transcription factors. Finally, a common sequence motif, (T)TGG/AC, present in 15 of the determined binding sites suggests a particular class of nuclear factors associated with the immediate-early 1 gene
Promoting Self-Esteem in Adolescents: The Influence of Wellness Factors
Myers, Jane E.; Willse, John T.; Villalba, Jose A.
2011-01-01
To assess the extent to which holistic wellness factors are predictive of self-esteem, the authors administered the Coopersmith Self-Esteem Inventories, School Form (Coopersmith, 2002), and the Five Factor Wellness Inventory (Myers & Sweeney, 2005a) to 225 adolescents ages 15 to 17 years. Wellness factors (Coping Self, Social Self, and…
Community factors to promote parents' quality of child-nurturing life.
Aoyama, Megumi; Wei, Chang Nian; Chang-nian, Wei; Harada, Koichi; Ueda, Kimiyo; Takano, Miyuki; Ueda, Atsushi
2013-01-01
The purpose of this study was to clarify the role of community factors in parents' quality of child-nurturing life (QCNL). We developed a questionnaire to evaluate the degree of QCNL and determine the structural factors related to QCNL as community factors related to parents' QCNL derived from focus group interviews and the Delphi technique. The questionnaire also included the battery of the self-rating depression scale and Tsumori-Inage Infant's Developmental Test. Using the questionnaire, we then conducted a quantitative survey of parents whose children attended nursery schools in Kumamoto Prefecture. Factor analysis, calculation of the mean score and/or ratio to each item, Pearson's correlation coefficient, t test, multiple regression analysis, and covariance structure analysis were performed. The questionnaire we developed consisted of seven items with 75 elements, involving ten elements as community factors. Subjects included 699 parents (mean age 33.6 ± 5.4 years) and 965 children (age range 0-6 years). Factor analysis revealed that community factors consisted of five factors, such as "lifestyle rooted in the ground," "balance of housekeeping and work," "community network," "amenity," and "regeneration of life". These factors may be dominant in a rural area. Finally, we developed a structural model with "community factors," QCNL, QOL, and "child growth" by covariance structural analysis. The analysis revealed that community factors had a positive relation to parents' QCNL (r = 0.81, p < 0.001) and that parental SDS score had a negative relation to parents' QCNL (r = -0.59, p < 0.001). The analysis did show that community factors were positively related to the sound growth of children. The covariance structure analysis revealed that community factors were associated with parents' QCNL, SDS, and "child growth."
Lu, Yifan; Tian, Chai; Danialou, Gawiyou; Gilbert, Rénald; Petrof, Basil J; Karpati, George; Nalbantoglu, Josephine
2008-12-12
Duchenne muscular dystrophy is caused by a genetic defect in the dystrophin gene. The absence of dystrophin results in muscle fiber necrosis and regeneration, leading to progressive muscle fiber loss. Utrophin is a close analogue of dystrophin. A substantial, ectopic expression of utrophin in the extrasynaptic sarcolemma of dystrophin-deficient muscle fibers can prevent deleterious effects of dystrophin deficiency. An alternative approach for the extrasynaptic up-regulation of utrophin involves the augmentation of utrophin transcription via the endogenous utrophin A promoter using custom-designed transcriptional activator proteins with zinc finger (ZFP) motifs. We tested a panel of custom-designed ZFP for their ability to activate the utrophin A promoter. Expression of one such ZFP efficiently increased, in a time-dependent manner, utrophin transcript and protein levels both in vitro and in vivo. In dystrophic mouse (mdx) muscles, administration of adenoviral vectors expressing this ZFP led to significant enhancement of muscle function with decreased necrosis, restoration of the dystrophin-associated proteins, and improved resistance to eccentric contractions. These studies provide evidence that specifically designed ZFPs can act as strong transcriptional activators of the utrophin A promoter. These may thus serve as attractive therapeutic agents for dystrophin deficiency states such as Duchenne muscular dystrophy.
Sales promotion as a determining factor in the competitive position of the company
Directory of Open Access Journals (Sweden)
Alavuk Đorđe
2015-01-01
Full Text Available Increased competition, globalization, numerous changes in the field of engineering and technology are just some of the changes that accompany modern business conditions. Modern consumers are increasingly demanding. Individuals vary greatly within groups and cultures to which they belong, but also among themselves based on the characteristics that distinguish them. People engaged in marketing have to constantly monitor and measure consumer attitudes so that their needs and desires are fully met. This paper summarizes the sales promotion activities carried out by retail chains. The aim of the activities of sales promotion is to create and maintain long-term relationships with customers and competitive advantage on the market. The research topic is the impact of sales promotion activities on the behavior and attitudes of consumers when choosing a product. The aim of the research is to examine the effects achieved by sales improvement to consumers through the implementation of the competitive positions of the companies. For the purpose of the research the method used was survey research.
Energy Technology Data Exchange (ETDEWEB)
Sawada, Keigo [Department of Periodontology, Osaka University Graduate School of Dentistry, Osaka (Japan); Takedachi, Masahide, E-mail: takedati@dent.osaka-u.ac.jp [Department of Periodontology, Osaka University Graduate School of Dentistry, Osaka (Japan); Yamamoto, Satomi; Morimoto, Chiaki; Ozasa, Masao; Iwayama, Tomoaki [Department of Periodontology, Osaka University Graduate School of Dentistry, Osaka (Japan); Lee, Chun Man [Medical Center for Translational Research, Osaka University Hospital, Osaka (Japan); Okura, Hanayuki; Matsuyama, Akifumi [Research on Disease Bioresources, Platform of Therapeutics for Rare Disease, National Institute of Biomedical Innovation, Osaka (Japan); Kitamura, Masahiro; Murakami, Shinya [Department of Periodontology, Osaka University Graduate School of Dentistry, Osaka (Japan)
2015-08-14
Stem and progenitor cells are currently being investigated for their applicability in cell-based therapy for periodontal tissue regeneration. We recently demonstrated that the transplantation of adipose tissue-derived multi-lineage progenitor cells (ADMPCs) enhances periodontal tissue regeneration in beagle dogs. However, the molecular mechanisms by which transplanted ADMPCs induce periodontal tissue regeneration remain to be elucidated. In this study, trophic factors released by ADMPCs were examined for their paracrine effects on human periodontal ligament cell (HPDL) function. ADMPC conditioned medium (ADMPC-CM) up-regulated osteoblastic gene expression, alkaline phosphatase activity and calcified nodule formation in HPDLs, but did not significantly affect their proliferative response. ADMPCs secreted a number of growth factors, including insulin-like growth factor binding protein 6 (IGFBP6), hepatocyte growth factor and vascular endothelial growth factor. Among these, IGFBP6 was most highly expressed. Interestingly, the positive effects of ADMPC-CM on HPDL differentiation were significantly suppressed by transfecting ADMPCs with IGFBP6 siRNA. Our results suggest that ADMPCs transplanted into a defect in periodontal tissue release trophic factors that can stimulate the differentiation of HPDLs to mineralized tissue-forming cells, such as osteoblasts and cementoblasts. IGFBP6 may play crucial roles in ADMPC-induced periodontal regeneration. - Highlights: • ADMPC-derived humoral factors stimulate cytodifferentiation of HPDLs. • ADMPCs secret growth factors including IGFBP6, VEGF and HGF. • IGFBP6 is involved in the promotion effect of ADMPC-CM on HPDL cytodifferentiation.
International Nuclear Information System (INIS)
Sawada, Keigo; Takedachi, Masahide; Yamamoto, Satomi; Morimoto, Chiaki; Ozasa, Masao; Iwayama, Tomoaki; Lee, Chun Man; Okura, Hanayuki; Matsuyama, Akifumi; Kitamura, Masahiro; Murakami, Shinya
2015-01-01
Stem and progenitor cells are currently being investigated for their applicability in cell-based therapy for periodontal tissue regeneration. We recently demonstrated that the transplantation of adipose tissue-derived multi-lineage progenitor cells (ADMPCs) enhances periodontal tissue regeneration in beagle dogs. However, the molecular mechanisms by which transplanted ADMPCs induce periodontal tissue regeneration remain to be elucidated. In this study, trophic factors released by ADMPCs were examined for their paracrine effects on human periodontal ligament cell (HPDL) function. ADMPC conditioned medium (ADMPC-CM) up-regulated osteoblastic gene expression, alkaline phosphatase activity and calcified nodule formation in HPDLs, but did not significantly affect their proliferative response. ADMPCs secreted a number of growth factors, including insulin-like growth factor binding protein 6 (IGFBP6), hepatocyte growth factor and vascular endothelial growth factor. Among these, IGFBP6 was most highly expressed. Interestingly, the positive effects of ADMPC-CM on HPDL differentiation were significantly suppressed by transfecting ADMPCs with IGFBP6 siRNA. Our results suggest that ADMPCs transplanted into a defect in periodontal tissue release trophic factors that can stimulate the differentiation of HPDLs to mineralized tissue-forming cells, such as osteoblasts and cementoblasts. IGFBP6 may play crucial roles in ADMPC-induced periodontal regeneration. - Highlights: • ADMPC-derived humoral factors stimulate cytodifferentiation of HPDLs. • ADMPCs secret growth factors including IGFBP6, VEGF and HGF. • IGFBP6 is involved in the promotion effect of ADMPC-CM on HPDL cytodifferentiation
Sleiman, Sama F; Henry, Jeffrey; Al-Haddad, Rami; El Hayek, Lauretta; Abou Haidar, Edwina; Stringer, Thomas; Ulja, Devyani; Karuppagounder, Saravanan S; Holson, Edward B; Ratan, Rajiv R; Ninan, Ipe; Chao, Moses V
2016-06-02
Exercise induces beneficial responses in the brain, which is accompanied by an increase in BDNF, a trophic factor associated with cognitive improvement and the alleviation of depression and anxiety. However, the exact mechanisms whereby physical exercise produces an induction in brain Bdnf gene expression are not well understood. While pharmacological doses of HDAC inhibitors exert positive effects on Bdnf gene transcription, the inhibitors represent small molecules that do not occur in vivo. Here, we report that an endogenous molecule released after exercise is capable of inducing key promoters of the Mus musculus Bdnf gene. The metabolite β-hydroxybutyrate, which increases after prolonged exercise, induces the activities of Bdnf promoters, particularly promoter I, which is activity-dependent. We have discovered that the action of β-hydroxybutyrate is specifically upon HDAC2 and HDAC3, which act upon selective Bdnf promoters. Moreover, the effects upon hippocampal Bdnf expression were observed after direct ventricular application of β-hydroxybutyrate. Electrophysiological measurements indicate that β-hydroxybutyrate causes an increase in neurotransmitter release, which is dependent upon the TrkB receptor. These results reveal an endogenous mechanism to explain how physical exercise leads to the induction of BDNF.
Directory of Open Access Journals (Sweden)
Stephanie Jamison
Full Text Available Evidence is accumulating that activation of the pancreatic endoplasmic reticulum kinase (PERK in response to endoplasmic reticulum (ER stress adapts tumor cells to the tumor microenvironment and enhances tumor angiogenesis by inducing vascular endothelial growth factor A (VEGF-A. Recent studies suggest that VEGF-A can act directly on certain tumor cell types in an autocrine manner, via binding to VEGF receptor 2 (VEGFR2, to promote tumor cell migration and invasion. Although several reports show that PERK activation increases VEGF-A expression in medulloblastoma, the most common solid malignancy of childhood, the role that either PERK or VEGF-A plays in medulloblastoma remains elusive. In this study, we mimicked the moderate enhancement of PERK activity observed in tumor patients using a genetic approach and a pharmacologic approach, and found that moderate activation of PERK signaling facilitated medulloblastoma cell migration and invasion and increased the production of VEGF-A. Moreover, using the VEGFR2 inhibitor SU5416 and the VEGF-A neutralizing antibody to block VEGF-A/VEGFR2 signaling, our results suggested that tumor cell-derived VEGF-A promoted medulloblastoma cell migration and invasion through VEGFR2 signaling, and that both VEGF-A and VEGFR2 were required for the promoting effects of PERK activation on medulloblastoma cell migration and invasion. Thus, these findings suggest that moderate PERK activation promotes medulloblastoma cell migration and invasion through enhancement of VEGF-A/VEGFR2 signaling.
Directory of Open Access Journals (Sweden)
Anna Kårlund
2014-08-01
Full Text Available Increasing epidemiological and experimental data now emphasize that a diet rich in vegetables and fruits confers many health benefits. Functional products containing elevated levels of bioactive compounds are attracting considerable attention due to their potential to lower the risk of chronic diseases and their associated huge healthcare costs. On a global scale, there is an increasing demand for berries and fruits, since they are natural polyphenol-rich raw material to be incorporated into functional foods, nutraceuticals and pharmaceuticals. This is a major challenge for both industry and horticultural experts, because the content of health-promoting compounds in plants varies widely not only in different plant species, but also between cultivars. The content is also significantly affected by harvesting, storage and processing factors. This review summarizes the recent data and clarifies the main contributors of harvesting time, various storage conditions and post-harvest procedures, such as temperature management, controlled atmosphere, 1-MCP, calcium and plant activators, as ways to influence health-promoting compounds in fruits. Furthermore, the ways processing factors, e.g., enzymatic treatment, pressing, clarification, temperature, pressure and fermentation, can influence the levels of polyphenols and vitamins in berries and soft fruits will be discussed. Finally, strategies for preventing the decline of health-promoting compounds in fruits during long-term storage will be assessed in light of recent scientific progress and modern methods, which preserve the levels of polyphenols, will be highlighted.
Wang, Xiaolong; Wang, Qi; Wang, Jinjia; Bai, Peng; Shi, Lei; Shen, Wei; Zhou, Mian; Zhou, Xiangshan; Zhang, Yuanxing; Cai, Menghao
2016-01-01
The alcohol oxidase 1 (AOX1) promoter (PAOX1) of Pichia pastoris is the most powerful and commonly used promoter for driving protein expression. However, mechanisms regulating its transcriptional activity are unclear. Here, we identified a Zn(II)2Cys6-type methanol-induced transcription factor 1 (Mit1) and elucidated its roles in regulating PAOX1 activity in response to glycerol and methanol. Mit1 regulated the expression of many genes involved in methanol utilization pathway, including AOX1, but did not participate in peroxisome proliferation and transportation of peroxisomal proteins during methanol metabolism. Structural analysis of Mit1 by performing domain deletions confirmed its specific and critical role in the strict repression of PAOX1 in glycerol medium. Importantly, Mit1, Mxr1, and Prm1, which positively regulated PAOX1 in response to methanol, were bound to PAOX1 at different sites and did not interact with each other. However, these factors cooperatively activated PAOX1 through a cascade. Mxr1 mainly functioned during carbon derepression, whereas Mit1 and Prm1 functioned during methanol induction, with Prm1 transmitting methanol signal to Mit1 by binding to the MIT1 promoter (PMIT1), thus increasingly expressing Mit1 and subsequently activating PAOX1. PMID:26828066
Wang, Xiaolong; Wang, Qi; Wang, Jinjia; Bai, Peng; Shi, Lei; Shen, Wei; Zhou, Mian; Zhou, Xiangshan; Zhang, Yuanxing; Cai, Menghao
2016-03-18
The alcohol oxidase 1 (AOX1) promoter (P AOX1) of Pichia pastoris is the most powerful and commonly used promoter for driving protein expression. However, mechanisms regulating its transcriptional activity are unclear. Here, we identified a Zn(II)2Cys6-type methanol-induced transcription factor 1 (Mit1) and elucidated its roles in regulating PAOX1 activity in response to glycerol and methanol. Mit1 regulated the expression of many genes involved in methanol utilization pathway, including AOX1, but did not participate in peroxisome proliferation and transportation of peroxisomal proteins during methanol metabolism. Structural analysis of Mit1 by performing domain deletions confirmed its specific and critical role in the strict repression of P AOX1 in glycerol medium. Importantly, Mit1, Mxr1, and Prm1, which positively regulated P AOX1 in response to methanol, were bound to P AOX1 at different sites and did not interact with each other. However, these factors cooperatively activated P AOX1 through a cascade. Mxr1 mainly functioned during carbon derepression, whereas Mit1 and Prm1 functioned during methanol induction, with Prm1 transmitting methanol signal to Mit1 by binding to the MIT1 promoter (P MIT1), thus increasingly expressing Mit1 and subsequently activating P AOX1. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.
International Nuclear Information System (INIS)
Du Nan; Pei Xuetao; Luo Chengji; Su Yongping; Cheng Tianmin
2002-01-01
Objective: To explore the radioprotective effect of the expression of hematopoietic growth factors regulated by radio-inducible promoter on radiation injury. Methods: The human FL cDNA and EGFP cDNA were linked together with an internal ribosome entry site (IRES) and then inserted into the eukaryotic expression vector pCI-neo with the Egr-1 promoter (Egr-EF), and further transduced into bone marrow stromal cell lines HFCL (HFCL/EF). The HFCL/EF and CD34 + cells from human umbilical cord blood were transplanted i.v. one after the other into sublethally irradiated severe combined immunodeficient (SCID) mice. The number of peripheral blood WBC and human cells engrafted in recipient mice were detected by flow cytometry and CFU-GM assay. Results: In contrast to two control groups (HFCL and HFCL/F), HFCL/EF (the Egr-1 regulatory element-driven expression of FL gene therapy) resulted in a proportionally obvious increase in the number of the WBC at early stage after irradiation. Significant differences were found for CD45 + , CD34 + , CFU-GM, and nucleated cells in the bone marrow. Conclusion: Hematopoietic growth factor gene therapy regulated by radio-inducible promoter has radioprotective effect on radiation hematopoietic injury
Translation initiation factor elF3 promotes programmed stop codon readthrough
Czech Academy of Sciences Publication Activity Database
Beznosková, Petra; Wagner, Susan; Jansen, Myrte Esmeralda; von der Haar, T.; Valášek, Leoš
2015-01-01
Roč. 43, č. 10 (2015), s. 5099-5111 ISSN 0305-1048 R&D Projects: GA ČR(CZ) GA14-05394S Institutional support: RVO:61388971 Keywords : EUKARYOTIC RELEASE FACTOR-1 * RNA RECOGNITION MOTIF * TICK FEVER VIRUS Subject RIV: CE - Biochemistry Impact factor: 9.202, year: 2015
Hypoxia-Inducible Factor-1α Expression in Macrophages Promotes Development of Atherosclerosis
DEFF Research Database (Denmark)
Pedersen, Annemarie Aarup; Pedersen, Tanja X; Junker, Nanna
2016-01-01
transplanted with bone marrow from mice with HIF-1α deficiency in the myeloid cells or control bone marrow. The HIF-1α deficiency in myeloid cells reduced atherosclerosis in aorta of the Ldlr(-/-) recipient mice by ≈72% (P=0.006).In vitro, HIF-1α-deficient macrophages displayed decreased differentiation...... to proinflammatory M1 macrophages and reduced expression of inflammatory genes. HIF-1α deficiency also affected glucose uptake, apoptosis, and migratory abilities of the macrophages. CONCLUSIONS: HIF-1α expression in macrophages affects their intrinsic inflammatory profile and promotes development of atherosclerosis....
International Nuclear Information System (INIS)
Natarajan, M.; Hong, F.A.; Mohan, S.; Herman, T.S.
2003-01-01
Full text: The objective of this study is to understand whether low doses of low LET radiation induces survival advantage in normal cells. As an increase in telomerase activity is associated with longevity and cell proliferation, we examined the telomerase response following gamma-irradiation in normal aortic endothelial cells. Telomeric Repeat Amplification Protocol assay following low LET radiation showed an increase in telomerase enzyme activity as early as 8 h post irradiation and reaches its maximum at 24 h. Subsequent analysis revealed that the increased telomerse enzyme activity is due to increased synthesis resulting from an increased transcription. Examination of transcriptional activation of telomerase reverse transcriptase (TERT) promoter regulation showed an enhanced transcription of the telomerse gene following gamma-irradiation. In our previous reports we documented an increase in NF-kB DNA-binding property following low LET radiation (3). Therefore, to determine whether the activation of NF-kB-signaling is responsible for induced TERT promoter activation, cells transiently transfected with minimal promoter region of TERT containing wild type or mutant NF-kB binding site were examined following low LET radiation. TERT promoter activation was induced in wild type transfected cells whereas, in mutant kB binding site, the activation remained at the basal level similar to that of un-irradiated cells. More significantly, the gamma-ray mediated promoter activation of telomerase gene as well as induce telomerase enzyme activity was abrogated by ectopically expressing the IkBa mutant (IkBa (S32A/S36A)), which blocks NF-kB activation. The results thus suggest that exposure to low LET radiation could induce telomerase activity and the activation is at least, in part, mediated by the transcription factor NF-kB. Sustained activation of telomerase in these cells after low LET radiation may impart extended life span
Shooshtari, Shahin
2012-01-01
The workshop that this paper reports, held in Iran in May of 2011, at the 1st Inter-national and 4th National Congress on Health Education and Promotion, had three main objec-tives: 1) to introduce participants to the knowledge translation (KT) concept, along with its mod-els and methods; 2) to enhance participants' knowledge of how KT could apply to public health education and promotion ; and 3) to learn from different participating stakeholder groups about the factors that facilitate or impede effective KT in public health education and promotion in Iran. The workshop consisted of three components: introducing the KT concept, assessing the KT capacity of participants, and facilitating a discussion of the important contextual factors that promote and impede effective KT. Of the 26 individuals from across the country participat-ing in the workshop, 17 took part in a KT capacity assessment activity. They classified them-selves into one of the following three stakeholder groups: administrators and policymakers (n=6), practitioners (n=2), and researchers (n=9). There were different capacities for KT across the three stakeholder groups. The re-ported challenges for effective KT include "lack of resources and funding"; "lack of time"; "poor quality of relationships and lack of trust between health policymakers, administrators, re-searchers, and clinicians"; "inadequate skills possessed by healthcare professionals and adminis-trators for assessment and adaptation of research findings"; and "poor involvement of commu-nity partners in the research process." There is a great need to develop effective strategies to overcome the reported barri-ers for effective KT.
Zhang, Zhichun; Tian, Hua; Lv, Ping; Wang, Weiping; Jia, Zhuqing; Wang, Sainan; Zhou, Chunyan; Gao, Xuejun
2015-01-01
Mutation of distal-less homeobox 3 (DLX3) is responsible for human tricho-dento-osseous syndrome (TDO) with amelogenesis imperfecta, indicating a crucial role of DLX3 in amelogenesis. However, the expression pattern of DLX3 and its specific function in amelogenesis remain largely unknown. The aim of this study was to investigate the effects of DLX3 on enamel matrix protein (EMP) genes. By immunohistochemistry assays of mouse tooth germs, stronger immunostaining of DLX3 protein was identified in ameloblasts in the secretory stage than in the pre-secretory and maturation stages, and the same pattern was found for Dlx3 mRNA using Realtime PCR. In a mouse ameloblast cell lineage, forced expression of DLX3 up-regulated the expression of the EMP genes Amelx, Enam, Klk4, and Odam, whereas knockdown of DLX3 down-regulated these four EMP genes. Further, bioinformatics, chromatin immunoprecipitation, and luciferase assays revealed that DLX3 transactivated Enam, Amelx, and Odam through direct binding to their enhancer regions. Particularly, over-expression of mutant-DLX3 (c.571_574delGGGG, responsible for TDO) inhibited the activation function of DLX3 on expression levels and promoter activities of the Enam, Amelx, and Odam genes. Together, our data show that DLX3 promotes the expression of the EMP genes Amelx, Enam, Klk4, and Odam in amelogenesis, while mutant-DLX3 disrupts this regulatory function, thus providing insights into the molecular mechanisms underlying the enamel defects of TDO disease.
Factors affecting health-promoting lifestyle profile in Iranian male seafarers working on tankers
DEFF Research Database (Denmark)
Baygi, Fereshteh; Jensen, Olaf Chresten; Mohammadi-Nasrabadi, Fatemeh
2017-01-01
-sectional study was performed on 200 Iranian male seafarers in 2015. A self-administered socio-demographic and Health Promotion Lifestyle Profile II (HPLP-II) questionnaire was completed. One-way analysis of variance was used to identify significant differences among the various departments. The t......-test was utilised to compare the HPLP-II scores according to the demographic variables. Multiple linear regression analysis was performed to assess the association between demographic variables and the overall HPLP-II score, in addition to the six health-promoting lifestyle subscale scores. RESULTS: The mean age...... (19.95 ± 4.23). The lowest score for nutrition was found among the seafarers working in the engine department (engine: 20.41 ± 4.50, deck: 23.52 ± 4.97, and galley: 24.83 ± 4.64) (p Working in the engine department was found to have a significant negative effect on the nutrition score (B = -3...
International Nuclear Information System (INIS)
Waters, Katrina M.; Sontag, Ryan L.; Weber, Thomas J.
2013-01-01
Physiological variation related to circadian rhythms and aberrant gene expression patterns are believed to modulate therapeutic efficacy, but the precise molecular determinants remain unclear. Here we examine the regulation of cell death by hepatic leukemia factor (HLF), which is an output regulator of circadian rhythms and is aberrantly expressed in human cancers, using an ectopic expression strategy in JB6 mouse epidermal cells and human keratinocytes. Ectopic HLF expression inhibited cell death in both JB6 cells and human keratinocytes, as induced by serum-starvation, tumor necrosis factor alpha and ionizing radiation. Microarray analysis indicates that HLF regulates a complex multi-gene transcriptional program encompassing upregulation of anti-apoptotic genes, downregulation of pro-apoptotic genes, and many additional changes that are consistent with an anti-death program. Collectively, our results demonstrate that ectopic expression of HLF, an established transcription factor that cycles with circadian rhythms, can recapitulate many features associated with circadian-dependent physiological variation. - Highlights: ► Circadian-dependent physiological variation impacts therapeutic efficacy. ► Hepatic leukemia factor inhibits cell death and is a candidate circadian factor. ► Hepatic leukemia factor anti-death program is conserved in murine and human cells. ► Transcriptomics indicates the anti-death program results from a systems response
Dave, Shruti
2013-11-01
Diabetes mellitus (DM) is considered to be an autoimmune disorder leading to destruction of beta-cells resulting in to a loss of blood sugar control. Attempts using many pharmacological compositions including exogenous insulin have failed to show tight control of glycemia and associated manifestations. Stem cells are considered a potential tool for the supply of insulin-producing cells (IPC) generation in vitro. Stem cell differentiation in to pancreatic lineages requires influence of both intrinsic and extrinsic factors. Application of islet growth factors is considered to be potential for enhancement of beta-cell replication, function and survival. Use of certain extrinsic factors is known to facilitate expression of transcription factors known to be important for beta-cell differentiation and production of insulin enabling IPC generation. Hierarchies of secreted signals and transcription factors have been identified by studies from several laboratories that guide cell differentiation in to IPC. This knowledge provides insights for in vitro IPC differentiation from stem cells. Current advancement in medical knowledge promises an insulin independency for DM patients. The review sheds light on few specific extrinsic factors which facilitate differentiation of stem cells in to IPC in vitro have been discussed; which can be proven as a potential therapeutic option for treatment of DM and associated diseases.
Energy Technology Data Exchange (ETDEWEB)
Waters, Katrina M. [Computational Biology and Bioinformatics, Pacific Northwest National Laboratory, Richland, WA 99354 (United States); Sontag, Ryan L. [Systems Toxicology Groups, Pacific Northwest National Laboratory, Richland, WA 99354 (United States); Weber, Thomas J., E-mail: Thomas.Weber@pnl.gov [Systems Toxicology Groups, Pacific Northwest National Laboratory, Richland, WA 99354 (United States)
2013-04-15
Physiological variation related to circadian rhythms and aberrant gene expression patterns are believed to modulate therapeutic efficacy, but the precise molecular determinants remain unclear. Here we examine the regulation of cell death by hepatic leukemia factor (HLF), which is an output regulator of circadian rhythms and is aberrantly expressed in human cancers, using an ectopic expression strategy in JB6 mouse epidermal cells and human keratinocytes. Ectopic HLF expression inhibited cell death in both JB6 cells and human keratinocytes, as induced by serum-starvation, tumor necrosis factor alpha and ionizing radiation. Microarray analysis indicates that HLF regulates a complex multi-gene transcriptional program encompassing upregulation of anti-apoptotic genes, downregulation of pro-apoptotic genes, and many additional changes that are consistent with an anti-death program. Collectively, our results demonstrate that ectopic expression of HLF, an established transcription factor that cycles with circadian rhythms, can recapitulate many features associated with circadian-dependent physiological variation. - Highlights: ► Circadian-dependent physiological variation impacts therapeutic efficacy. ► Hepatic leukemia factor inhibits cell death and is a candidate circadian factor. ► Hepatic leukemia factor anti-death program is conserved in murine and human cells. ► Transcriptomics indicates the anti-death program results from a systems response.
Directory of Open Access Journals (Sweden)
Jin Liu
2018-03-01
Full Text Available Activating transcription factor 4 (ATF4 plays important physiologic roles in the brain including regulation of learning and memory as well as neuronal survival and death. Yet, outside of translational regulation by the eIF2α-dependent stress response pathway, there is little information about how its levels are controlled in neurons. Here, we show that brain-derived neurotrophic factor (BDNF promotes a rapid and sustained increase in neuronal ATF4 transcripts and protein levels. This increase is dependent on tropomyosin receptor kinase (TrkB signaling, but independent of levels of phosphorylated eIF2α. The elevation in ATF4 protein occurs both in nuclei and processes. Transcriptome analysis revealed that ATF4 mediates BDNF-promoted induction of Sesn2 which encodes Sestrin2, a protector against oxidative and genotoxic stresses and a mTor complex 1 inhibitor. In contrast, BDNF-elevated ATF4 did not affect expression of a number of other known ATF4 targets including several with pro-apoptotic activity. The capacity of BDNF to elevate neuronal ATF4 may thus represent a means to maintain this transcription factor at levels that provide neuroprotection and optimal brain function without risk of triggering neurodegeneration.
Promotive and Corrosive Factors in African American Students' Math Beliefs and Achievement.
Diemer, Matthew A; Marchand, Aixa D; McKellar, Sarah E; Malanchuk, Oksana
2016-06-01
Framed by expectancy-value theory (which posits that beliefs about and the subjective valuation of a domain predict achievement and decision-making in that domain), this study examined the relationships among teacher differential treatment and relevant math instruction on African American students' self-concept of math ability, math task value, and math achievement. These questions were examined by applying structural equation modeling to 618 African American youth (45.6 % female) followed from 7th to 11th grade in the Maryland Adolescent Development in Context Study. While controlling for gender and prior math achievement, relevant math instruction promoted and teacher differential treatment corroded students' math beliefs and achievement over time. Further, teacher discrimination undermined students' perceptions of their teachers, a mediating process under-examined in previous inquiry. These findings suggest policy and practice levers to narrow opportunity gaps, as well as foster math achievement and science, technology, engineering and math success.
Directory of Open Access Journals (Sweden)
Joshua eMessinger
2015-12-01
Full Text Available Chlamydiae, obligate intracellular bacteria, cause significant human and veterinary associated diseases. Having emerged an estimated 700-million years ago, these bacteria have twice adapted to humans as a host species, causing sexually transmitted infection (C. trachomatis and respiratory associated disease (C. pneumoniae. The principle mechanism of host cell defense against these intracellular bacteria is the induction of cell death via apoptosis. However, in the arms race of co-evolution, Chlamydiae have developed mechanisms to promote cell viability and inhibit cell death. Herein we examine the impact of Chlamydiae infection across multiple host species on transcription of anti-apoptotic genes. We found mostly distinct patterns of gene expression (Mcl1 and cIAPs elicited by each pathogen-host pair indicating Chlamydiae infection across host species boundaries does not induce a universally shared host response. Understanding species specific host-pathogen interactions is paramount to deciphering how potential pathogens become emerging diseases.
Factors promoting development of renal tubulointerstitial lesions in patients with diabetes mellitus
Directory of Open Access Journals (Sweden)
Minara Shamkhalovna Shamkhalova
2010-09-01
Full Text Available Aim. To identify profibrogenic mediators, markers of endothelial dysfunction and hemostasis in patients with diabetes mellitus (DM and chronickidney disease (CKD. Materials and methods. The study included 120 patients with DM and 20 age-matched normotensive subjects without DM showing the glomerularfiltration rate (GFR > 60 ml/min/1.73 m3. Four groups of patients were distinguished: 1 - DM2 patients without renal pathology (n=33, 2 - DM2 patients with diabetic nephropathy (n=24, 3 - DM2 patients with ischemic nephropathy (IN (n=33 verified by contrast visualization techniques(multispiral CM of abdominal aorta and renal arteries, abdominal angiography of renal arteries or MR angiography of renal arteries and abdominal aorta, 4 - DM1 patients with DN (n=30. Clinical examination included assessment of complaints, analysis of medical history of the main diseaseand concomitant disorders, determination of the main clinical and biochemical characteristics of blood and urine, measurement of НbА1с and 24-hralbuminuria (AU by standard methods, estimation of GFR by the MDRD formula, ECG, echocardiography, 24-hr AP monitoring, counseling bycardiologist and ophthalmologist (fundal examination by ophthalmoscopy. Standard kits were used to detect profibrogenic mediators and markersof endothelial dysfunction including transforming growth factor-beta (TGF-b, angiotensin II (AT II, monocyte chemoattractant protein (MCP-1,regulated on activation normal T cell expressed and secreted (RANTES, adhesion factors (intracellular adhesion molecule (ICAM-1, vascular celladhesion molecule (VCAM-1 vascular endothelial growth factor (VEGF, interleukin-6 (IL-6, asymmetric dimethylargnine (ADMA, homocysteine(HCYST, metalloproteinases (MMP, von Willebrand factor (vWF, plasminogen activator inhibitor (PAI-I. Results. DM patients with CKD had elevated blood profibrogenic cytokine (MCP-1, TGF-1b, IL-6 and extracellular matrix degradation factor(MMP-9 levels compared with
Directory of Open Access Journals (Sweden)
Zhichun Zhang
Full Text Available Mutation of distal-less homeobox 3 (DLX3 is responsible for human tricho-dento-osseous syndrome (TDO with amelogenesis imperfecta, indicating a crucial role of DLX3 in amelogenesis. However, the expression pattern of DLX3 and its specific function in amelogenesis remain largely unknown. The aim of this study was to investigate the effects of DLX3 on enamel matrix protein (EMP genes. By immunohistochemistry assays of mouse tooth germs, stronger immunostaining of DLX3 protein was identified in ameloblasts in the secretory stage than in the pre-secretory and maturation stages, and the same pattern was found for Dlx3 mRNA using Realtime PCR. In a mouse ameloblast cell lineage, forced expression of DLX3 up-regulated the expression of the EMP genes Amelx, Enam, Klk4, and Odam, whereas knockdown of DLX3 down-regulated these four EMP genes. Further, bioinformatics, chromatin immunoprecipitation, and luciferase assays revealed that DLX3 transactivated Enam, Amelx, and Odam through direct binding to their enhancer regions. Particularly, over-expression of mutant-DLX3 (c.571_574delGGGG, responsible for TDO inhibited the activation function of DLX3 on expression levels and promoter activities of the Enam, Amelx, and Odam genes. Together, our data show that DLX3 promotes the expression of the EMP genes Amelx, Enam, Klk4, and Odam in amelogenesis, while mutant-DLX3 disrupts this regulatory function, thus providing insights into the molecular mechanisms underlying the enamel defects of TDO disease.
Matsutani Sachiko
2004-01-01
Abstract Background In eukaryotes, RNA polymerase III (RNAP III) transcribes the genes for small RNAs like tRNAs, 5S rRNA, and several viral RNAs, and short interspersed repetitive elements (SINEs). The genes for these RNAs and SINEs have internal promoters that consist of two regions. These two regions are called the A and B blocks. The multisubunit transcription factor TFIIIC is required for transcription initiation of RNAP III; in transcription of tRNAs, the B-block binding subunit of TFII...
Interleukin-Driven Insulin-Like Growth Factor Promotes Prostatic Inflammatory Hyperplasia
Hahn, Alana M.; Myers, Jason D.; McFarland, Eliza K.; Lee, Sanghee
2014-01-01
Prostatic inflammation is of considerable importance to urologic research because of its association with benign prostatic hyperplasia and prostate cancer. However, the mechanisms by which inflammation leads to proliferation and growth remain obscure. Here, we show that insulin-like growth factors (IGFs), previously known as critical developmental growth factors during prostate organogenesis, are induced by inflammation as part of the proliferative recovery to inflammation. Using genetic models and in vivo IGF receptor blockade, we demonstrate that the hyperplastic response to inflammation depends on interleukin-1–driven IGF signaling. We show that human prostatic hyperplasia is associated with IGF pathway activation specifically localized to foci of inflammation. This demonstrates that mechanisms of inflammation-induced epithelial proliferation and hyperplasia involve the induction of developmental growth factors, further establishing a link between inflammatory and developmental signals and providing a mechanistic basis for the management of proliferative diseases by IGF pathway modulation. PMID:25292180
Ferrigo, Davide; Raiola, Alessandro; Causin, Roberto
2016-05-13
Fusarium diseases of small grain cereals and maize cause significant yield losses worldwide. Fusarium infections result in reduced grain yield and contamination with mycotoxins, some of which have a notable impact on human and animal health. Regulations on maximum limits have been established in various countries to protect consumers from the harmful effects of these mycotoxins. Several factors are involved in Fusarium disease and mycotoxin occurrence and among them environmental factors and the agronomic practices have been shown to deeply affect mycotoxin contamination in the field. In the present review particular emphasis will be placed on how environmental conditions and stress factors for the crops can affect Fusarium infection and mycotoxin production, with the aim to provide useful knowledge to develop strategies to prevent mycotoxin accumulation in cereals.
The SK3 channel promotes placental vascularization by enhancing secretion of angiogenic factors.
Rada, Cara C; Murray, Grace; England, Sarah K
2014-11-15
Proper placental perfusion is essential for fetal exchange of oxygen, nutrients, and waste with the maternal circulation. Impairment of uteroplacental vascular function can lead to pregnancy complications, including preeclampsia and intrauterine growth restriction (IUGR). Potassium channels have been recognized as regulators of vascular proliferation, angiogenesis, and secretion of vasoactive factors, and their dysfunction may underlie pregnancy-related vascular diseases. Overexpression of one channel in particular, the small-conductance calcium-activated potassium channel 3 (SK3), is known to increase vascularization in mice, and mice overexpressing the SK3 channel (SK3(T/T) mice) have a high rate of fetal demise and IUGR. Here, we show that overexpression of SK3 causes fetal loss through abnormal placental vascularization. We previously reported that, at pregnancy day 14, placentas isolated from SK3(T/T) mice are smaller than those obtained from wild-type mice. In this study, histological analysis reveals that SK3(T/-) placentas at this stage have abnormal placental morphology, and microcomputed tomography shows that these placentas have significantly larger and more blood vessels than those from wild-type mice. To identify the mechanism by which these vascularization defects occur, we measured levels of vascular endothelial growth factor (VEGF), placental growth factor, and the soluble form of VEGF receptor 1 (sFlt-1), which must be tightly regulated to ensure proper placental development. Our data reveal that overexpression of SK3 alters systemic and placental ratios of the angiogenic factor VEGF to antiangiogenic factor sFlt-1 throughout pregnancy. Additionally, we observe increased expression of hypoxia-inducing factor 2α in SK3(T/-) placentas. We conclude that the SK3 channel modulates placental vascular development and fetal health by altering VEGF signaling. Copyright © 2014 the American Physiological Society.
Wood, Matthew D; MacEwan, Matthew R; French, Alexander R; Moore, Amy M; Hunter, Daniel A; Mackinnon, Susan E; Moran, Daniel W; Borschel, Gregory H; Sakiyama-Elbert, Shelly E
2010-08-15
Glial-derived neurotrophic factor (GDNF) and nerve growth factor (NGF) have both been shown to enhance peripheral nerve regeneration following injury and target different neuronal populations. The delivery of either growth factor at the site of injury may, therefore, result in quantitative differences in motor nerve regeneration and functional recovery. In this study we evaluated the effect of affinity-based delivery of GDNF or NGF from fibrin-filled nerve guidance conduits (NGCs) on motor nerve regeneration and functional recovery in a 13 mm rat sciatic nerve defect. Seven experimental groups were evaluated consisting of GDNF or NGF and the affinity-based delivery system (DS) within NGCs, control groups excluding the DS and/or growth factor, and nerve isografts. Groups with growth factor in the conduit demonstrated equivalent or superior performance in behavioral tests and relative muscle mass measurements compared to isografts at 12 weeks. Additionally, groups with GDNF demonstrated greater specific twitch and tetanic force production in extensor digitorum longus (EDL) muscle than the isograft control, while groups with NGF produced demonstrated similar force production compared to the isograft control. Assessment of motor axon regeneration by retrograde labeling further revealed that the number of ventral horn neurons regenerating across NGCs containing GDNF and NGF DS was similar to the isograft group and these counts were greater than the groups without growth factor. Overall, the GDNF DS group demonstrated superior functional recovery and equivalent motor nerve regeneration compared to the isograft control, suggesting it has potential as a treatment for motor nerve injury.
Factors that promote renewable energy production in U.S. states: A fixed effect estimation
Nwokeji, Ekwuniru Chika
2011-12-01
The unsustainability of conventional energy sources and its environmental destructions are well-known; the sustainability of renewable energy and its environmental benefits are also well-documented. The United States in common with many other countries is increasingly focused on developing renewable energy. At first, the pursuit of this strategy in U.S. was seen more as a way to reduce dependence on oil importation. With increased awareness of environmental challenges resulting from the consumption and production of conventional energy, an additional strategy for the continued interest in renewable energy development in the United States was as a result of its potential to ameliorate environmental problems. The U.S. government are utilizing policy measures and dedicating funding to encourage the development of renewable energy technologies. Beside government policies, there are contextual factors that also affect renewable energy production. These include, but not limited to population growth, energy demand, economic growth, and public acceptance. Given the pressing need to develop a sustainable energy, this study embarks on an outcome assessment of the nature of relationship of renewable energy policy incentives, and selected contextual factors on renewable energy production in the United States. The policy incentive evaluated in this study is the Renewable Energy Production Incentive program. The contextual factors evaluated in this study are energy consumption, population growth, employment, and poverty. Understanding the contextual factors within which policies are placed is essential to defining the most appropriate policy features. The methodological approach to the study is quantitative, using panel data from 1976 to 2007. The study tested two hypotheses using fixed effect estimation with robust standard error as a statistical model. Statistical analyses reveal several interesting results which lend support that besides policy incentives, contextual factors
Azer, S A; Holen, A; Wilson, I; Skokauskas, N
2016-01-01
Journal Impact Factor (JIF) has been used in assessing scientific journals. Other indices, h- and g-indices and Article Influence Score (AIS), have been developed to overcome some limitations of JIF. The aims of this study were, first, to critically assess the use of JIF and other parameters related to medical education research, and second, to discuss the capacity of these indices in assessing research productivity as well as their utility in academic promotion. The JIF of 16 medical education journals from 2000 to 2011 was examined together with the research evidence about JIF in assessing research outcomes of medical educators. The findings were discussed in light of the nonnumerical criteria often used in academic promotion. In conclusion, JIF was not designed for assessing individual or group research performance, and it seems unsuitable for such purposes. Although the g- and h-indices have demonstrated promising outcomes, further developments are needed for their use as academic promotion criteria. For top academic positions, additional criteria could include leadership, evidence of international impact, and contributions to the advancement of knowledge with regard to medical education.
Directory of Open Access Journals (Sweden)
Cornelia Kilchert
2015-12-01
Full Text Available In eukaryotic cells, inefficient splicing is surprisingly common and leads to the degradation of transcripts with retained introns. How pre-mRNAs are committed to nuclear decay is unknown. Here, we uncover a mechanism by which specific intron-containing transcripts are targeted for nuclear degradation in fission yeast. Sequence elements within these “decay-promoting” introns co-transcriptionally recruit the exosome specificity factor Mmi1, which induces degradation of the unspliced precursor and leads to a reduction in the levels of the spliced mRNA. This mechanism negatively regulates levels of the RNA helicase DDX5/Dbp2 to promote cell survival in response to stress. In contrast, fast removal of decay-promoting introns by co-transcriptional splicing precludes Mmi1 recruitment and relieves negative expression regulation. We propose that decay-promoting introns facilitate the regulation of gene expression. Based on the identification of multiple additional Mmi1 targets, including mRNAs, long non-coding RNAs, and sn/snoRNAs, we suggest a general role in RNA regulation for Mmi1 through transcript degradation.
Jin, Yi; Gan, Guojuan; Yu, Xiaoyun; Wu, Dongdong; Zhang, Li; Yang, Na; Hu, Jiadan; Liu, Zhiheng; Zhang, Lixin; Hong, Huachang; Yan, Xiaoqing; Liang, Yan; Ding, Linxian; Pan, Yonglong
2017-07-01
Printing and dyeing wastewater with high content of organic matters, high colority, and poor biochemical performance is hard to be degraded. In this study, we isolated viable but non-culturable (VBNC) bacteria from printing and dyeing wastewater with the culture media contained resuscitation promoting factor (Rpf) protein secreted by Micrococcus luteus, counted the culturable cells number with the most probable number, sequenced 16S rRNA genes, and performed polymerase chain reaction-denaturing gradient gel electrophoresis. It is obviously that the addition of Rpf in the enrichment culture could promote growth and resuscitation of bacteria in VBNC state to obtain more fastidious bacteria significantly. The identified bacteria were assigned to nine genera in the treatment group, while the two strains of Ochrobactrum anthropi and Microbacterium sp. could not be isolated from the control group. The function of isolated strains was explored and these strains could degrade the dye of Congo red. This study provides a new sight into the further study including the present state, composition, formation mechanism, and recovery mechanism about VBNC bacteria in printing and dyeing wastewater, which would promote to understand bacterial community in printing and dyeing wastewater, and to obtain VBNC bacteria from ecological environment.
Muto, T; Yamauchi, K
2001-12-01
The long-term effectiveness of multicomponent worksite health promotion programs targeting cardiovascular disease risk factors remains unclear in Japan. This study was conducted to evaluate the effectiveness of such a health promotion program consisting of a main program provided over 4 days and a follow-up program provided over 1 year. The subjects of this randomized controlled trial were male employees working for a building maintenance company in Japan. The intervention group (n = 152) and the control group (n = 150) consisted of employees having abnormal findings in at least one of the following items at baseline health examination: body mass index (BMI), systolic (SBP) or diastolic blood pressure, total cholesterol, HDL cholesterol, triglycerides, and fasting blood glucose. Evaluation was conducted at 18 months after the main program. BMI, SBP, total cholesterol, and triglycerides improved significantly in the intervention group compared with the control group (P < 0.05). When comparisons were limited to those who showed abnormality at baseline, BMI, total cholesterol, and triglycerides improved significantly in the intervention group (P < 0.05). The multicomponent health promotion program provided to employees was shown to be effective in improving obesity, high blood pressure, and hyperlipidemia when evaluated 18 months after the main intervention program. Copyright 2001 American Health Foundation and Elsevier Science.
WNT5A: a motility-promoting factor in Hodgkin lymphoma
Czech Academy of Sciences Publication Activity Database
Linke, F.; Zaunig, S.; Nietert, M. M.; von Bonin, F.; Lutz, S.; Dullin, C.; Janovská, P.; Beissbarth, T.; Alves, F.; Klapper, W.; Bryja, Vítězslav; Pukrop, T.; Truemper, L.; Wilting, J.; Kube, D.
2017-01-01
Roč. 36, č. 1 (2017), s. 13-23 ISSN 0950-9232 Institutional support: RVO:68081707 Keywords : cell polarity pathway * reed-sternberg cells * chronic lymphocytic- leukemia Subject RIV: CE - Biochemistry OBOR OECD: Biochemistry and molecular biology Impact factor: 7.519, year: 2016
Hansen, Michele Joann; Trujillo, Daniel J.; Boland, Donna L.; MacKinnon, Joyce L.
2014-01-01
The purpose of this qualitative study was to explore the underlying non-cognitive processes and institutional factors that allowed first-year students to enact effective strategies for attaining academic success and persisting despite obstacles. The varying levels of academic preparation and unique obstacles faced by the student participants…
Czech Academy of Sciences Publication Activity Database
Šrobár, Fedor
2008-01-01
Roč. 6, č. 1 (2008), s. 38-44 ISSN 1895-1082 Institutional research plan: CEZ:AV0Z20670512 Keywords : biophysics * feedback * signal flow graphs Subject RIV: BO - Biophysics Impact factor: 0.448, year: 2008
Loon, L.M.A. van; Ven, M.O.M. van de; Doesum, K.T.M. van; Hosman, C.M.H.; Witteman, C.L.M.
2015-01-01
Children of parents with mental illness have an elevated risk of developing a range of mental health and psychosocial problems. Yet many of these children remain mentally healthy. The present study aimed to get insight into factors that protect these children from developing internalizing and
Van Loon, L. M. A.; Van De Ven, M. O. M.; Van Doesum, K. T. M.; Hosman, C. M. H.; Witteman, C. L. M.
2015-01-01
Background: Children of parents with mental illness have an elevated risk of developing a range of mental health and psychosocial problems. Yet many of these children remain mentally healthy. Objective: The present study aimed to get insight into factors that protect these children from developing internalizing and externalizing problems. Methods:…
Energy Technology Data Exchange (ETDEWEB)
Zhou, Hua; Yang, Ying-Hua [Department of Oncology and Diagnostic Sciences, University of Maryland Dental School, 650W. Baltimore Street, 7-North, Baltimore, MD 21201 (United States); Binmadi, Nada O. [Department of Oncology and Diagnostic Sciences, University of Maryland Dental School, 650W. Baltimore Street, 7-North, Baltimore, MD 21201 (United States); Department of Oral Basic and Clinical Sciences, King Abdulaziz University, Jeddah 21589 (Saudi Arabia); Proia, Patrizia [Department of Oncology and Diagnostic Sciences, University of Maryland Dental School, 650W. Baltimore Street, 7-North, Baltimore, MD 21201 (United States); Department of Sports Science (DISMOT), University of Palermo, Via Eleonora Duse 2 90146, Palermo (Italy); Basile, John R., E-mail: jbasile@umaryland.edu [Department of Oncology and Diagnostic Sciences, University of Maryland Dental School, 650W. Baltimore Street, 7-North, Baltimore, MD 21201 (United States); Greenebaum Cancer Center, 22S. Greene Street, Baltimore, MD 21201 (United States)
2012-08-15
Growth and metastasis of solid tumors requires induction of angiogenesis to ensure the delivery of oxygen, nutrients and growth factors to rapidly dividing transformed cells. Through either mutations, hypoxia generated by cytoreductive therapies, or when a malignancy outgrows its blood supply, tumor cells undergo a change from an avascular to a neovascular phenotype, a transition mediated by the hypoxia-inducible factor (HIF) family of transcriptional regulators. Vascular endothelial growth factor (VEGF) is one example of a gene whose transcription is stimulated by HIF. VEGF plays a crucial role in promoting tumor growth and survival by stimulating new blood vessel growth in response to such stresses as chemotherapy or radiotherapy-induced hypoxia, and it therefore has become a tempting target for neutralizing antibodies in the treatment of advanced neoplasms. Emerging evidence has shown that the semaphorins, proteins originally associated with control of axonal growth and immunity, are regulated by changes in oxygen tension as well and may play a role in tumor-induced angiogenesis. Through the use of RNA interference, in vitro and in vivo angiogenesis assays and tumor xenograft experiments, we demonstrate that expression of semaphorin 4D (SEMA4D), which is under the control of the HIF-family of transcription factors, cooperates with VEGF to promote tumor growth and vascularity in oral squamous cell carcinoma (OSCC). We use blocking antibodies to show that targeting SEMA4D function along with VEGF could represent a novel anti-angiogenic therapeutic strategy for the treatment of OSCC and other solid tumors. -- Highlights: Black-Right-Pointing-Pointer Similar to VEGF, SEMA4D promotes angiogenesis in vitro and in vivo. Black-Right-Pointing-Pointer Both VEGF and SEMA4D are produced by OSCC cells in a HIF-dependent manner. Black-Right-Pointing-Pointer These factors combine to elicit a robust pro-angiogenic phenotype in OSCC. Black-Right-Pointing-Pointer Anti-SEMA4D
International Nuclear Information System (INIS)
Zhou, Hua; Yang, Ying-Hua; Binmadi, Nada O.; Proia, Patrizia; Basile, John R.
2012-01-01
Growth and metastasis of solid tumors requires induction of angiogenesis to ensure the delivery of oxygen, nutrients and growth factors to rapidly dividing transformed cells. Through either mutations, hypoxia generated by cytoreductive therapies, or when a malignancy outgrows its blood supply, tumor cells undergo a change from an avascular to a neovascular phenotype, a transition mediated by the hypoxia-inducible factor (HIF) family of transcriptional regulators. Vascular endothelial growth factor (VEGF) is one example of a gene whose transcription is stimulated by HIF. VEGF plays a crucial role in promoting tumor growth and survival by stimulating new blood vessel growth in response to such stresses as chemotherapy or radiotherapy-induced hypoxia, and it therefore has become a tempting target for neutralizing antibodies in the treatment of advanced neoplasms. Emerging evidence has shown that the semaphorins, proteins originally associated with control of axonal growth and immunity, are regulated by changes in oxygen tension as well and may play a role in tumor-induced angiogenesis. Through the use of RNA interference, in vitro and in vivo angiogenesis assays and tumor xenograft experiments, we demonstrate that expression of semaphorin 4D (SEMA4D), which is under the control of the HIF-family of transcription factors, cooperates with VEGF to promote tumor growth and vascularity in oral squamous cell carcinoma (OSCC). We use blocking antibodies to show that targeting SEMA4D function along with VEGF could represent a novel anti-angiogenic therapeutic strategy for the treatment of OSCC and other solid tumors. -- Highlights: ► Similar to VEGF, SEMA4D promotes angiogenesis in vitro and in vivo. ► Both VEGF and SEMA4D are produced by OSCC cells in a HIF-dependent manner. ► These factors combine to elicit a robust pro-angiogenic phenotype in OSCC. ► Anti-SEMA4D blocking antibody inhibits Plexin-B1 activation. ► SEMA4D is a valid anti-angiogenic target in the
Hannemann, Nicole; Jordan, Jutta; Paul, Sushmita; Reid, Stephen; Baenkler, Hanns-Wolf; Sonnewald, Sophia; Bäuerle, Tobias; Vera, Julio; Schett, Georg; Bozec, Aline
2017-05-01
Activation of proinflammatory macrophages is associated with the inflammatory state of rheumatoid arthritis. Their polarization and activation are controlled by transcription factors such as NF-κB and the AP-1 transcription factor member c-Fos. Surprisingly, little is known about the role of the AP-1 transcription factor c-Jun in macrophage activation. In this study, we show that mRNA and protein levels of c-Jun are increased in macrophages following pro- or anti-inflammatory stimulations. Gene Ontology and Kyoto Encyclopedia of Genes and Genomes pathway enrichment cluster analyses of microarray data using wild-type and c-Jun-deleted macrophages highlight the central function of c-Jun in macrophages, in particular for immune responses, IL production, and hypoxia pathways. Mice deficient for c-Jun in macrophages show an amelioration of inflammation and bone destruction in the serum-induced arthritis model. In vivo and in vitro gene profiling, together with chromatin immunoprecipitation analysis of macrophages, revealed direct activation of the proinflammatory factor cyclooxygenase-2 and indirect inhibition of the anti-inflammatory factor arginase-1 by c-Jun. Thus, c-Jun regulates the activation state of macrophages and promotes arthritis via differentially regulating cyclooxygenase-2 and arginase-1 levels. Copyright © 2017 by The American Association of Immunologists, Inc.
Hung, Tommy Tsz Man; Chiang, Vico Chung Lim; Dawson, Angela; Lee, Regina Lai Tong
2014-01-01
Health-promoting schools have been regarded as an important initiative in promoting child and adolescent health in school settings using the whole-school approach. Quantitative research has proved its effectiveness in various school-based programmes. However, few qualitative studies have been conducted to investigate the strategies used by health promoters to implement such initiatives. In this study, the researchers conducted a systematic review and narrative synthesis of the qualitative literature to identify important enablers assisting the implementation of health-promoting schools from the perspectives of health promoters. Five enablers have been identified from the review: (a) Following a framework/guideline to implement health-promoting schools; (b) Obtaining committed support and contributions from the school staff, school board management, government authorities, health agencies and other stakeholders; (c) Adopting a multidisciplinary, collaborative approach to implementing HPS; (d) Establishing professional networks and relationships; and (e) Continuing training and education in school health promotion. This highlights the importance of developing school health policies that meet local health needs, and socio-cultural characteristics that can foster mutual understanding between the health and education sectors so as to foster health promotion in children and adolescents. PMID:25264789
Ramachandra, Rashmi; Namburi, Ramesh B; Ortega-Martinez, Olga; Shi, Xiaofeng; Zaia, Joseph; Dupont, Sam T; Thorndyke, Michael C; Lindahl, Ulf; Spillmann, Dorothe
2014-02-01
Glycosaminoglycans (GAGs) isolated from brittlestars, Echinodermata class Ophiuroidea, were characterized, as part of attempts to understand the evolutionary development of these polysaccharides. A population of chondroitin sulfate/dermatan sulfate (CS/DS) chains with a high overall degree of sulfation and hexuronate epimerization was the major GAG found, whereas heparan sulfate (HS) was below detection level. Enzymatic digestion with different chondroitin lyases revealed exceptionally high proportions of di- and trisulfated CS/DS disaccharides. The latter unit appears much more abundant in one of four individual species of brittlestars, Amphiura filiformis, than reported earlier in other marine invertebrates. The brittlestar CS/DS was further shown to bind to growth factors such as fibroblast growth factor 2 and to promote FGF-stimulated cell signaling in GAG-deficient cell lines in a manner similar to that of heparin. These findings point to a potential biological role for the highly sulfated invertebrate GAGs, similar to those ascribed to HS in vertebrates.
Tsunoda, Satoshi; Nakamura, Toshiyuki; Sakurai, Hiroaki; Saiki, Ikuo
2007-04-01
Fibroblast growth factor (FGF)-2 has been considered to play a critical role in neovascularization in several tumors; however, its precise role in tumor progression is not fully understood. In the present study, we have characterized the role of FGF-2 in B16-BL6 mouse melanoma cells, focusing on effects during the initial phase of tumor growth. FGF-2 was injected at the tumor inoculation site of dorsal skin during the initial phase. FGF-2 induced marked tumor growth and lymph node metastasis. This was well correlated with an increase in neovascularization in the host stroma. FGF-2 also recruited inflammatory and mesenchymal cells in host stroma. Marked tumor growth, pulmonary metastasis and intensive neovascularization in tumor parenchyma were also observed after a single injection of FGF-2 into the footpad inoculation site. In contrast, repeated injections of FGF-2 at a site remote from the footpad tumor were ineffective in promoting tumor growth and metastasis. These promoting activities of FGF-2 were blocked by local injections of a glucocorticoid hormone, suggesting that host inflammatory responses induced by FGF-2 are associated with FGF-2-induced tumor progression. In addition, although FGF-2 did not promote cellular proliferation and vascular endothelial growth factor A (VEGFA) mRNA expression in B16-BL6 cells in vitro, FGF-2 induced VEGFA expression in host stroma rather than tumor tissue, and local injections of a neutralizing antibody against VEGFA inhibited these activities of FGF-2 in vivo. These results indicate that abundant FGF-2 during the initial phase of tumor growth induces VEGFA-dependent intensive neovascularization in host stroma, and supports marked tumor growth and metastasis.
VISUAL COMPONENT OF INTERNET EDITIONS AS A FACTOR IN THEIR POSITIONING AND PROMOTION
Directory of Open Access Journals (Sweden)
Sergey Viktorovich Murashchenkov
2017-04-01
Full Text Available Purpose. Identify the specificity of the perception by consumer media through its adaptation in the form of an Internet resource. Consider the possibility of establishing universal principles of design online version of the printed edition, simplified as much as possible and comfortable to use, paying particular attention to the design and layout of the publication, including news blocks, which important for the development of media in social science. Methodology. The article is an summary of original study based on the results of focus groups conducted in the context of the present topic. Methodology comprise the analytical study and psychoanalysis. Results. The results of the study are that the authors try to identify the main features of the development of the Internet version of the print edition of its region. The result of this work demonstrates the universal ways of mapping the functional and visual component layout of the site, which can be applied in the same media. Authors try to focus on the main page of the online version of the publication and attach the particular importance to the selection of fonts and color palettes for design that promotes a more comfortable use of the resource and also note the importance of adapting the site to the mobile version. Practical implications. The results of the study can be applied in the field of social psychology, advertising, design and journalism.
Gao, Yang; Vincent, David F.; Davis, Anna Jane; Sansom, Owen J.; Bartholin, Laurent; Li, Qinglei
2016-01-01
Despite the well-established tumor suppressive role of TGFβ proteins, depletion of key TGFβ signaling components in the mouse ovary does not induce a growth advantage. To define the role of TGFβ signaling in ovarian tumorigenesis, we created a mouse model expressing a constitutively active TGFβ receptor 1 (TGFBR1) in ovarian somatic cells using conditional gain-of-function approach. Remarkably, these mice developed ovarian sex cord-stromal tumors with complete penetrance, leading to reproductive failure and mortality. The tumors expressed multiple granulosa cell markers and caused elevated serum inhibin and estradiol levels, reminiscent of granulosa cell tumors. Consistent with the tumorigenic effect, overactivation of TGFBR1 altered tumor microenvironment by promoting angiogenesis and enhanced ovarian cell proliferation, accompanied by impaired cell differentiation and dysregulated expression of critical genes in ovarian function. By further exploiting complementary genetic models, we substantiated our finding that constitutively active TGFBR1 is a potent oncogenic switch in mouse granulosa cells. In summary, overactivation of TGFBR1 drives gonadal tumor development. The TGFBR1 constitutively active mouse model phenocopies a number of morphological, hormonal, and molecular features of human granulosa cell tumors and are potentially valuable for preclinical testing of targeted therapies to treat granulosa cell tumors, a class of poorly defined ovarian malignancies. PMID:27344183
Directory of Open Access Journals (Sweden)
Marie Amougou Atsama
2017-11-01
Full Text Available Objectives: To determine the seroprevalence of hepatitis E virus (HEV infection in patients with chronic hepatitis and/or hepatocellular carcinoma (HCC and to assess its potential consequences for disease progression. Methods: We conducted a prospective case-control study on patients with HCC hepatitis B or C related and non-HCC patients including patients with CLD and patients without clinical evidence of liver disease. Anti-HEV IgG and IgM were tested by ELISA using commercially available kits. Liver damage was assessed by alanine aminotransferase, aspartate aminotransferase, platelets and prothrombin measurements. Results: We observed a significant anti-HEV IgG carriage in HCC patients compared to non-HCC subjects with CLD (41.8% vs 12.6%; P = 9.1 E-6; OR = 4.8, 95%CI: 2.3-10.6. HCC patients with HEV infection display more profound alterations of circulating liver enzymes, platelets count and prothrombin time than HCC patients without sero-reactivity to HEV. Conclusion: Overall, this study indicates a high prevalence of HEV infection in Cameroonian patients with CLD and HCC. These data suggest either that patients with liver tumors are more susceptible to hepeviral infection or that, in a tropical context, HEV might promote the progression of liver diseases towards tumor. Keywords: Hepatocellular carcinoma, Hepatitis E, Seroprevalence, Anti-HEV IgG, Anti-HEV IgM
Barbon, Elena; Pignani, Silvia; Branchini, Alessio; Bernardi, Francesco; Pinotti, Mirko; Bovolenta, Matteo
2016-06-24
Tailored approaches to restore defective transcription responsible for severe diseases have been poorly explored. We tested transcription activator-like effectors fused to an activation domain (TALE-TFs) in a coagulation factor VII (FVII) deficiency model. In this model, the deficiency is caused by the -94C > G or -61T > G mutation, which abrogate the binding of Sp1 or HNF-4 transcription factors. Reporter assays in hepatoma HepG2 cells naturally expressing FVII identified a single TALE-TF (TF4) that, by targeting the region between mutations, specifically trans-activated both the variant (>100-fold) and wild-type (20-40-fold) F7 promoters. Importantly, in the genomic context of transfected HepG2 and transduced primary hepatocytes, TF4 increased F7 mRNA and protein levels (2- to 3-fold) without detectable off-target effects, even for the homologous F10 gene. The ectopic F7 expression in renal HEK293 cells was modestly affected by TF4 or by TALE-TF combinations. These results provide experimental evidence for TALE-TFs as gene-specific tools useful to counteract disease-causing promoter mutations.
International Nuclear Information System (INIS)
Anklesaria, P.; Greenberger, J.S.; Teixido, J.; Laiho, M.; Massague, J.; Pierce, J.H.
1990-01-01
The precursor for transforming growth factor α, pro-TGF-α, is a cell surface glycoprotein that can establish contact with epidermal growth factor (EGF) receptors on adjacent cells. To examine whether the pro-TGF-α/EGF receptor pair can simultaneously mediate cell adhesion and promote cell proliferation, the authors have expressed pro-TGF-α in a bone marrow stromal cell line labeled with [ 35 S] cysteine. Expression of pro-TGF-α allows these cells to support long-term attachment of an EGF/interleukin-3-dependent hematopoietic progenitor cell line that expresses EGF receptors but is unable to adhere to normal stroma. This interaction is inhibited by soluble EGF receptor ligands. Further, the hematopoietic progenitor cells replicate their DNA while they are attached to the stromal cell layer and become foci of sustained cell proliferation. Thus, pro-TGF-α and the EGF receptor can function as mediators of intercellular adhesion and this interaction may promote a mitogenic response. They propose the term juxtacrine to designate this form of stimulation between adjacent cells
Fazio, Elena N; Young, Claire C; Toma, Jelena; Levy, Michael; Berger, Kurt R; Johnson, Charis L; Mehmood, Rashid; Swan, Patrick; Chu, Alphonse; Cregan, Sean P; Dilworth, F Jeffrey; Howlett, Christopher J; Pin, Christopher L
2017-09-01
Pancreatitis is a debilitating disease of the exocrine pancreas that, under chronic conditions, is a major susceptibility factor for pancreatic ductal adenocarcinoma (PDAC). Although down-regulation of genes that promote the mature acinar cell fate is required to reduce injury associated with pancreatitis, the factors that promote this repression are unknown. Activating transcription factor 3 (ATF3) is a key mediator of the unfolded protein response, a pathway rapidly activated during pancreatic insult. Using chromatin immunoprecipitation followed by next-generation sequencing, we show that ATF3 is bound to the transcriptional regulatory regions of >30% of differentially expressed genes during the initiation of pancreatitis. Of importance, ATF3-dependent regulation of these genes was observed only upon induction of pancreatitis, with pathways involved in inflammation, acinar cell differentiation, and cell junctions being specifically targeted. Characterizing expression of transcription factors that affect acinar cell differentiation suggested that acinar cells lacking ATF3 maintain a mature cell phenotype during pancreatitis, a finding supported by maintenance of junctional proteins and polarity markers. As a result, Atf3 -/- pancreatic tissue displayed increased tissue damage and inflammatory cell infiltration at early time points during injury but, at later time points, showed reduced acinar-to-duct cell metaplasia. Thus our results reveal a critical role for ATF3 as a key regulator of the acinar cell transcriptional response during injury and may provide a link between chronic pancreatitis and PDAC. © 2017 Fazio et al. This article is distributed by The American Society for Cell Biology under license from the author(s). Two months after publication it is available to the public under an Attribution–Noncommercial–Share Alike 3.0 Unported Creative Commons License (http://creativecommons.org/licenses/by-nc-sa/3.0).
Amelink, Catherine T.; Meszaros, Peggy S.
2011-03-01
This study seeks to examine key extrinsic and intrinsic factors that encourage or discourage persistence in attaining an engineering degree and pursuing an engineering-related career among both male and female undergraduates. Quantitative and qualitative findings from nine participating undergraduate degree programmes reveal that career expectations formulated through educational experiences as undergraduates play a key role in motivating students. Among females, faculty interaction in the classroom, such as feedback received and the degree to which the faculty treat them with respect, is an important encouraging factor. For both males and females, discouraging elements of the undergraduate experience include the amount of time for coursework, competition in engineering classes and grades. The findings have several practical implications that faculty and administrators can employ in shaping the undergraduate experience to encourage short- and long-term interest in engineering among both male and female students.
Kincaid, Shannon D.
Women have historically been underrepresented in the fields of science, technology, engineering, and math (STEM fields). The underrepresentation of women in STEM may be attributable to a variety of factors. These may include different choices men and women typically make in response to incentives in STEM education. For example, STEM career paths may be less accommodating to people who are less resilient. Another factor may be that there are relatively few female STEM role models. Perhaps strong gender stereotypes discourage women from pursuing STEM education and STEM jobs. The factors that contribute to success and the barriers that impeded success must be identified before any steps can be taken to improve the educational outcomes for women in STEM disciplines. Consequently, relatively little is known about the role of resilience in academically successful adult women in rural community colleges enrolled in STEM disciplines and the mechanisms that underlie the performance deficits that occur as a result of stereotype threat effect. This mixed method study addressed those knowledge gaps by determining: (1) if high resilience is positively correlated to high grade point average for women enrolled in STEM disciplines in rural community colleges in North Carolina, and (2) if stereotype threat effect is a risk factor for these women. Quantitative data were collected by using "The Resilience Scale" (Wagnild & Young, 1987) and through examination of grade point average of students from Datatel data management software. Qualitative data were collected through semi-structured focus group interviews. Findings from this study indicate high resilience is positively correlated to high grade point average for women enrolled in STEM disciplines in rural community colleges in North Carolina, and stereotype threat effect was a risk factor for low-scoring women (i.e. those women who reported resilience scores less than 121 and grade point averages lower than 2.70) and was not a
Laddha, Naresh C.; Dwivedi, Mitesh; Begum, Rasheedunnisa
2012-01-01
Abstract Tumor Necrosis Factor (TNF)-α, is a paracrine inhibitor of melanocytes, which plays a critical role in the pathogenesis of several autoimmune diseases including vitiligo, as abnormal immune responses have frequently been observed in vitiligo patients. Moreover, vitiligo patients show higher lesion levels of TNF-α. Genetic polymorphisms in the promoter region of TNF-α are involved in the regulation of its expression. The present study explores TNF-α promoter polymorphisms and correlates them with TNF-α transcript and protein levels in vitiligo patients and controls of Gujarat along with its effect on disease onset and progression. PCR-RFLP technique was used for genotyping of these polymorphisms in 977 vitiligo patients and 990 controls. TNF-α transcript and protein levels were measured by Real time PCR and ELISA respectively. The genotype and allele frequencies for the investigated polymorphisms were significantly associated with vitiligo patients. The study revealed significant increase in TNF-α transcript and protein levels in vitiligo patients compared to controls. In particular, haplotypes: AATCC, AACCT, AGTCT, GATCT, GATCC and AGCCT were found to increase the TNF-α levels in vitiligo patients. Analysis of TNF-α levels based on the gender and disease progression suggests that female patients and patients with active vitiligo had higher levels of TNF-α. Also, the TNF-α levels were high in patients with generalized vitiligo as compared to localized vitiligo. Age of onset analysis of the disease suggests that the haplotypes: AACAT, AACCT, AATCC and AATCT had a profound effect in the early onset of the disease. Moreover, the analysis suggests that female patients had an early onset of vitiligo. Overall, our results suggest that TNF-α promoter polymorphisms may be genetic risk factors for susceptibility and progression of the disease. The up-regulation of TNF-α transcript and protein levels in individuals with susceptible haplotypes advocates
Application of the CIPP model in the study of factors that promote intercultural sensitivity
Directory of Open Access Journals (Sweden)
Ruiz-Bernardo, Paola
2012-10-01
Full Text Available The present study proposes a group of factors (related to self, context and process favouring the development of intercultural sensitivity. A social diagnosis was performed in the Spanish province of Castellón in order to identify these factors by means of a correlational study. A non-probabilistic but representative sample consisting of 995 people from 37 different countries living in this province was used. Data were collected by means of an adaptation of the scale proposed by Chen and Starosta (2000 for the assessment of intercultural sensitivity. Results showed four profiles, and their main characteristics were studied. Variables such as country of origin, gender, academic background, number of languages spoken, or the experience of living in a foreign country revealed to have a positive influence on the development of this attitude. El presente artículo propone un conjunto de los factores (personales, contextuales y de proceso que favorecen el desarrollo de la sensibilidad intercultural. Para identificar dichos factores se ha realizado un diagnóstico social en la provincia de Castellón (España. Este estudio de tipo descriptivo de carácter correlacional se ha concretado con una muestra de 995 personas de 37 nacionalidades diferentes, constituyendo una muestra representativa, caracterizada por ser de tipo fortuito o accidental. Para recoger la información se ha utilizado una adaptación de la escala de sensibilidad intercultural de Chen y Starosta (2000. El análisis de datos ha permitido identificar cuatro perfiles, de los cuales se han estudiado sus principales características y se ha podido concluir que variables tales como la condición de origen, el sexo, la formación, la cantidad de lenguas que habla o el haber vivido en otro país influyen positivamente para el desarrollo de esta actitud.
Directory of Open Access Journals (Sweden)
Jelen Amador López
2018-02-01
Full Text Available Background: High incidences of drug consumption and mental health problems are found among the Roma population in Spain, a reality that remains understudied. Past studies have indicated the positive role played by the Iglesia Evangélica Filadelfia (IEF in promoting rehabilitation and prevention of these practices. Objective: In this article, authors analyze in which ways the IEF favors processes of drug rehabilitation and mental health recovery as well as the prevention of these problems among its Roma members. Methods: A communicative qualitative approach was developed. It was communicative because new knowledge was created by dialogically contrasting the existing state of the art with study participants. It was qualitative because everyday life stories were collected, gathering the experiences, perceptions and interpretations of Roma people who are actively involved in three different IEF churches based in Barcelona. Results: This article identifies these protective factors: anti-drug discourse, a supportive environment, new social relations, role model status, the promotion of interactions, the revaluation of oneself, spiritual activities and the improvement of the feeling of belonging and the creation of meaning. Conclusion: The present research contributes new evidence to the current understanding of the role played by the IEF in improving Roma health status and how the identified protective factors can contribute to rehabilitation and recovery from such problems in other contexts.
López, Jelen Amador; García, Ramón Flecha; Martí, Teresa Sordé
2018-02-14
Background: High incidences of drug consumption and mental health problems are found among the Roma population in Spain, a reality that remains understudied. Past studies have indicated the positive role played by the Iglesia Evangélica Filadelfia (IEF) in promoting rehabilitation and prevention of these practices. Objective: In this article, authors analyze in which ways the IEF favors processes of drug rehabilitation and mental health recovery as well as the prevention of these problems among its Roma members. Methods: A communicative qualitative approach was developed. It was communicative because new knowledge was created by dialogically contrasting the existing state of the art with study participants. It was qualitative because everyday life stories were collected, gathering the experiences, perceptions and interpretations of Roma people who are actively involved in three different IEF churches based in Barcelona. Results: This article identifies these protective factors: anti-drug discourse, a supportive environment, new social relations, role model status, the promotion of interactions, the revaluation of oneself, spiritual activities and the improvement of the feeling of belonging and the creation of meaning. Conclusion: The present research contributes new evidence to the current understanding of the role played by the IEF in improving Roma health status and how the identified protective factors can contribute to rehabilitation and recovery from such problems in other contexts.
Directory of Open Access Journals (Sweden)
Genoveva Amador Fierros
Full Text Available Objective.This work sought to validate and propose an instrument to measure the performance of tutors in promoting self-directed learning in students involved in processes of problem-based learning. Methods. Confirmatory factor analysis (CFA was applied to validate the instrument composed of 60 items and six factors (self-assessment of learning gaps within the United Nations specific context: self-assessment, reflexion, critical thinking, administration of information, group skills, using a sample of 207 students from a total of 279, which comprise the student population of the Faculty of Nursing at Universidad de Colima in Mexico. (2007. Results. The CFA results demonstrated that the instrument is acceptable to measure performance of tutors in promoting self-directed learning, given that all the indicators, variances, covariances, and thresholds are statistically significant. Conclusion. The instrument permits obtaining students' opinions on how much professors contribute for them to develop each of the 60 skills described in the scale. Lastly, the results could report if professors are placing more emphasis in some areas than in other areas they should address during the problem-based learning (PBL process, or if definitely their actions are removed from the premises of PBL, information that will be useful for school management in decision making on the direction of teaching as a whole.
Seo, Mihwa; Seo, Keunhee; Hwang, Wooseon; Koo, Hee Jung; Hahm, Jeong-Hoon; Yang, Jae-Seong; Han, Seong Kyu; Hwang, Daehee; Kim, Sanguk; Jang, Sung Key; Lee, Yoontae; Nam, Hong Gil; Lee, Seung-Jae V.
2015-01-01
The homeostatic maintenance of the genomic DNA is crucial for regulating aging processes. However, the role of RNA homeostasis in aging processes remains unknown. RNA helicases are a large family of enzymes that regulate the biogenesis and homeostasis of RNA. However, the functional significance of RNA helicases in aging has not been explored. Here, we report that a large fraction of RNA helicases regulate the lifespan of Caenorhabditis elegans. In particular, we show that a DEAD-box RNA helicase, helicase 1 (HEL-1), promotes longevity by specifically activating the DAF-16/forkhead box O (FOXO) transcription factor signaling pathway. We find that HEL-1 is required for the longevity conferred by reduced insulin/insulin-like growth factor 1 (IGF-1) signaling (IIS) and is sufficient for extending lifespan. We further show that the expression of HEL-1 in the intestine and neurons contributes to longevity. HEL-1 enhances the induction of a large fraction of DAF-16 target genes. Thus, the RNA helicase HEL-1 appears to promote longevity in response to decreased IIS as a transcription coregulator of DAF-16. Because HEL-1 and IIS are evolutionarily well conserved, a similar mechanism for longevity regulation via an RNA helicase-dependent regulation of FOXO signaling may operate in mammals, including humans. PMID:26195740
Prevalence and factors promoting the occurrence of vitamin D deficiency in the elderly.
Wyskida, Magdalena; Wieczorowska-Tobis, Katarzyna; Chudek, Jerzy
2017-03-13
Vitamin D deficiency affects a large part of the population of elderly people, especially women, who live in moderate climate countries due to a reduced amount of vitamin D in the diet (small sea fish consumption) and reduced content of 7-dehydrocholesterol, which causes decreased skin synthesis. The lowest seasonal concentration of 25(OH)D3 is usually observed during winter and spring. Sun exposure influences 25(OH)D3 concentration more strongly in men than in women. Sociodemographic factors that increase the risk of vitamin D deficiency in the elderly include poor environmental conditions, low economic status, lower educational level, drug exposure (smoking), reduced physical activity, overall poor health and obesity, which causes reduced skin exposure to sunlight. The use of medications or supplements that contain vitamin D and staying in a nursing home that employ such supplementation are factors that prevent deficiency. Significant prevalence of diseases of the gastrointestinal tract may contribute to cholecalciferol and ergocalciferol malabsorption or impair their liver transformation. In addition, the high incidence of chronic kidney disease in old age reduces processing hydroxylation of vitamin D and the formation of active metabolites. Vitamin D deficiency can not only cause bone mineralization disorders, but also increase incidence of cardiovascular diseases, cancers, type 2 diabetes and depression. The aim of this study was to summarize current knowledge about the risk factors of vitamin D deficiency development in the elderly population.
DEFF Research Database (Denmark)
Frödin, M; Gammeltoft, S
1994-01-01
We have investigated the effects of insulin-like growth factors (IGFs), basic fibroblast growth factor (bFGF), and nerve growth factor (NGF) on DNA synthesis in cultured chromaffin cells from fetal, neonatal, and adult rats by using 5-bromo-2'-deoxyuridine (BrdUrd) pulse labeling for 24 or 48 h...... implications for improving the survival of chromaffin cell implants in diseased human brain....
Wang, Ying; Wang, Gary Z; Rabinovitch, Peter S; Tabas, Ira
2014-01-31
Mitochondrial oxidative stress (mitoOS) has been shown to correlate with the progression of human atherosclerosis. However, definitive cell type-specific causation studies in vivo are lacking, and the molecular mechanisms of potential proatherogenic effects remain to be determined. Our aims were to assess the importance of macrophage mitoOS in atherogenesis and to explore the underlying molecular mechanisms. We first validated Western diet-fed Ldlr(-/-) mice as a model of human mitoOS-atherosclerosis association by showing that non-nuclear oxidative DNA damage, a marker of mitoOS in lesional macrophages, correlates with aortic root lesion development. To investigate the importance of macrophage mitoOS, we used a genetic engineering strategy in which the OS suppressor catalase was ectopically expressed in mitochondria (mCAT) in macrophages. MitoOS in lesional macrophages was successfully suppressed in these mice, and this led to a significant reduction in aortic root lesional area. The mCAT lesions had less monocyte-derived cells, less Ly6c(hi) monocyte infiltration into lesions, and lower levels of monocyte chemotactic protein-1. The decrease in lesional monocyte chemotactic protein-1 was associated with the suppression of other markers of inflammation and with decreased phosphorylation of RelA (NF-κB p65), indicating decreased activation of the proinflammatory NF-κB pathway. Using models of mitoOS in cultured macrophages, we showed that mCAT suppressed monocyte chemotactic protein-1 expression by decreasing the activation of the IκB-kinase β-RelA NF-κB pathway. MitoOS in lesional macrophages amplifies atherosclerotic lesion development by promoting NF-κB-mediated entry of monocytes and other inflammatory processes. In view of the mitoOS-atherosclerosis link in human atheromata, these findings reveal a potentially new therapeutic target to prevent the progression of atherosclerosis.
Darlington, Emily Joan; Violon, Nolwenn; Jourdan, Didier
2018-01-22
Implementing complex and multi-level public health programmes is challenging in school settings. Discrepancies between expected and actual programme outcomes are often reported. Such discrepancies are due to complex interactions between contextual factors. Contextual factors relate to the setting, the community, in which implementation occurs, the stakeholders involved, and the characteristics of the programme itself. This work uses realist evaluation to understand how contextual factors influence the implementation process, to result in variable programme outcomes. This study focuses on identifying contextual factors, pinpointing combinations of contextual factors, and understanding interactions and effects of such factors and combinations on programme outcomes on different levels of the implementation process. Schools which had participated in a school-based health promotion programme between 2012 and 2015 were included. Two sets of qualitative data were collected: semi-structured interviews with school staff and programme coordinators; and written documents about the actions implemented in a selection of four schools. Quantitative data included 1553 questionnaires targeting pupils aged 8 to 11 in 14 schools to describe the different school contexts. The comparison between what was expected from the programme (programme theory) and the outcomes identified in the field data, showed that some of the mechanisms expected to support the implementation of the programme, did not operate as anticipated (e.g. inclusion of training, initiation by decision-maker). Key factors which influenced the implementation process included, amongst other factors, the mode of introduction of the programme, home/school relationship, leadership of the management team, and the level of delegated power. Five types of interactions between contextual factors were put forward: enabling, hindering, neutral, counterbalancing and moderating effects. Recurrent combinations of factors were
Factors Promoting Environmental Responsibility in European SMEs: The Effect on Performance
Directory of Open Access Journals (Sweden)
Francisco J. Sáez-Martínez
2016-09-01
Full Text Available There is increasing social and political awareness of the importance of developing environmental responsibility at a corporate level. When focusing on issues of responsibility, large companies are frequently perceived to be more responsible for driving climate change and resource depletion. However, small and medium enterprises (SMEs contribute significantly to the use of resources such as material and energy and produce approximately 64% of the pollution in Europe. Drawing on evidence from “The Eurobarometer 381 Survey on SMEs, Resource Efficiency and Green Markets”, we analyze the environmental responsibility of European SMEs, studying their compliance with environmental legislation and how several factors drive environmental orientation among SMEs. Our sample consists of 3647 SMEs operating in 38 countries. Only around a fifth of the firms go beyond environmental regulations, showing the highest levels of environmental responsibility. We conduct OLS regressions to analyze the factors that affect a positive environmental attitude among European SMEs (internal drivers being more significant than external ones and then, to observe the positive effect of environmental responsibility and firm’s experience in offering green services/products on performance, although a conjoint effect was not found. Implications for practitioners, academics, and policy-makers are outlined.
MCUR1 Is a Scaffold Factor for the MCU Complex Function and Promotes Mitochondrial Bioenergetics
Directory of Open Access Journals (Sweden)
Dhanendra Tomar
2016-05-01
Full Text Available Mitochondrial Ca2+ Uniporter (MCU-dependent mitochondrial Ca2+ uptake is the primary mechanism for increasing matrix Ca2+ in most cell types. However, a limited understanding of the MCU complex assembly impedes the comprehension of the precise mechanisms underlying MCU activity. Here, we report that mouse cardiomyocytes and endothelial cells lacking MCU regulator 1 (MCUR1 have severely impaired [Ca2+]m uptake and IMCU current. MCUR1 binds to MCU and EMRE and function as a scaffold factor. Our protein binding analyses identified the minimal, highly conserved regions of coiled-coil domain of both MCU and MCUR1 that are necessary for heterooligomeric complex formation. Loss of MCUR1 perturbed MCU heterooligomeric complex and functions as a scaffold factor for the assembly of MCU complex. Vascular endothelial deletion of MCU and MCUR1 impaired mitochondrial bioenergetics, cell proliferation, and migration but elicited autophagy. These studies establish the existence of a MCU complex that assembles at the mitochondrial integral membrane and regulates Ca2+-dependent mitochondrial metabolism.
Ho, Mengfei; Mettouchi, Amel; Wilson, Brenda A; Lemichez, Emmanuel
2018-05-03
Alterations of the cellular proteome over time due to spontaneous or toxin-mediated enzymatic deamidation of glutamine (Gln) and asparagine (Asn) residues contribute to bacterial infection and might represent a source of aging-related diseases. Here, we put into perspective what is known about the mode of action of the CNF1 toxin from pathogenic E. coli, a paradigm of bacterial deamidases that activate Rho GTPases, to illustrate the importance of determining whether exposure to these factors are risk factors in the etiology age-related diseases, such as cancer. In particular, through in silico analysis of the distribution of the CNF1-like deamidase active site Gly-Cys-(Xaa)n-His sequence motif in bacterial genomes, we unveil the wide distribution of the super-family of CNF-like toxins and CNF-like deamidase domains among members of the enterobacteriacae and in association with a large variety of toxin delivery systems. We extent our discussion with recent findings concerning cellular systems that control activated Rac1 GTPase stability and provide protection against cancer. These findings point to the urgency for developing holistic approaches toward personalized medicine that include monitoring for asymptomatic carriage of pathogenic toxin-producing bacteria and that ultimately might lead to improved public health and increased lifespans.
Evidence-based ergonomics education: Promoting risk factor awareness among office computer workers.
Mani, Karthik; Provident, Ingrid; Eckel, Emily
2016-01-01
Work-related musculoskeletal disorders (WMSDs) related to computer work have become a serious public health concern. Literature revealed a positive association between computer use and WMSDs. The purpose of this evidence-based pilot project was to provide a series of evidence-based educational sessions on ergonomics to office computer workers to enhance the awareness of risk factors of WMSDs. Seventeen office computer workers who work for the National Board of Certification in Occupational Therapy volunteered for this project. Each participant completed a baseline and post-intervention ergonomics questionnaire and attended six educational sessions. The Rapid Office Strain Assessment and an ergonomics questionnaire were used for data collection. The post-intervention data revealed that 89% of participants were able to identify a greater number of risk factors and answer more questions correctly in knowledge tests of the ergonomics questionnaire. Pre- and post-intervention comparisons showed changes in work posture and behaviors (taking rest breaks, participating in exercise, adjusting workstation) of participants. The findings have implications for injury prevention in office settings and suggest that ergonomics education may yield positive knowledge and behavioral changes among computer workers.
Directory of Open Access Journals (Sweden)
Tsai Yueh-Chi
2012-07-01
Full Text Available Abstract Background Healthcare workers including physicians, nurses, medical technicians and administrative staff experience high levels of occupational stress as a result of heavy workloads, extended working hours and time-related pressure. The aims of this study were to investigate factors associated with work stress among hospital staff members and to evaluate their health-promoting lifestyle behaviors. Methods We conducted a cross-sectional study from May 1, 2010 to July 30, 2010 and recruited 775 professional staff from two regional hospitals in Taiwan using purposive sampling. Demographic data and self-reported symptoms related to work-related stress were collected. Each subject completed the Chinese versions of the Job Content Questionnaire (C-JCQ and The Health-Promoting Lifestyle Profile (HPLSP. Linear and binary regression analyses were applied to identify associations between these two measurements and subjects’ characteristics, and associations between the two measurements and stress symptoms. Results Self-reported symptoms of work-related stress included 64.4% of subjects reporting nervousness, 33.7% nightmares, 44.1% irritability, 40.8% headaches, 35.0% insomnia, and 41.4% gastrointestinal upset. C-JCQ scores for psychological demands of the job and discretion to utilize skills had a positive correlation with stress-related symptoms; however, the C-JCQ scores for decision-making authority and social support correlated negatively with stress-related symptoms except for nightmares and irritability. All items on the HPLSP correlated negatively with stress-related symptoms except for irritability, indicating an association between subjects’ symptoms and a poor quality of health-promoting lifestyle behaviors. Conclusions We found that high demands, little decision-making authority, and low levels of social support were associated with the development of stress-related symptoms. The results also suggested that better performance on
Tsai, Yueh-Chi; Liu, Chieh-Hsing
2012-07-16
Healthcare workers including physicians, nurses, medical technicians and administrative staff experience high levels of occupational stress as a result of heavy workloads, extended working hours and time-related pressure. The aims of this study were to investigate factors associated with work stress among hospital staff members and to evaluate their health-promoting lifestyle behaviors. We conducted a cross-sectional study from May 1, 2010 to July 30, 2010 and recruited 775 professional staff from two regional hospitals in Taiwan using purposive sampling. Demographic data and self-reported symptoms related to work-related stress were collected. Each subject completed the Chinese versions of the Job Content Questionnaire (C-JCQ) and The Health-Promoting Lifestyle Profile (HPLSP). Linear and binary regression analyses were applied to identify associations between these two measurements and subjects' characteristics, and associations between the two measurements and stress symptoms. Self-reported symptoms of work-related stress included 64.4% of subjects reporting nervousness, 33.7% nightmares, 44.1% irritability, 40.8% headaches, 35.0% insomnia, and 41.4% gastrointestinal upset. C-JCQ scores for psychological demands of the job and discretion to utilize skills had a positive correlation with stress-related symptoms; however, the C-JCQ scores for decision-making authority and social support correlated negatively with stress-related symptoms except for nightmares and irritability. All items on the HPLSP correlated negatively with stress-related symptoms except for irritability, indicating an association between subjects' symptoms and a poor quality of health-promoting lifestyle behaviors. We found that high demands, little decision-making authority, and low levels of social support were associated with the development of stress-related symptoms. The results also suggested that better performance on or a higher frequency of health-promoting life-style behaviors might
Hypoxia-inducible factor-1 signalling promotes goblet cell hyperplasia in airway epithelium
Polosukhin, Vasiliy V; Cates, Justin M; Lawson, William E; Milstone, Aaron P; Matafonov, Anton G; Massion, Pierre P; Lee, Jae Woo; Randell, Scott H; Blackwell, Timothy S
2018-01-01
Goblet cell hyperplasia is a common feature of chronic obstructive pulmonary disease (COPD) airways, but the mechanisms that underlie this epithelial remodelling in COPD are not understood. Based on our previous finding of hypoxia-inducible factor-1α (HIF-1α) nuclear localization in large airways from patients with COPD, we investigated whether hypoxia-inducible signalling could influence the development of goblet cell hyperplasia. We evaluated large airway samples obtained from 18 lifelong non-smokers and 13 former smokers without COPD, and 45 former smokers with COPD. In these specimens, HIF-1α nuclear staining occurred almost exclusively in COPD patients in areas of airway remodelling. In COPD patients, 93.2 ± 3.9% (range 65 – 100%) of goblet cells were HIF-1α positive in areas of goblet cell hyperplasia, whereas nuclear HIF-1α was not detected in individuals without COPD or in normal-appearing pseudostratified epithelium from COPD patients. To determine the direct effects of hypoxia-inducible signalling on epithelial cell differentiation in vitro, human bronchial epithelial cells (HBECs) were grown in air-liquid interface cultures under hypoxia (1% O2) or following treatment with a selective HIF-1α stabilizer, (2R)-[(4-biphenylylsulphonyl)amino]-N-hydroxy-3-phenyl-propionamide (BiPS). HBECs grown in hypoxia or with BiPS treatment were characterized by HIF-1α activation, carbonic anhydrase IX expression, mucus-producing cell hyperplasia and increased expression of MUC5AC. Analysis of signal transduction pathways in cells with HIF-1α activation showed increased ERK1/2 phosphorylation without activation of epidermal growth factor receptor, Ras, PI3K-Akt or STAT6. These data indicate an important effect of hypoxia-inducible signalling on airway epithelial cell differentiation and identify a new potential target to limit mucus production in COPD. PMID:21557221
Directory of Open Access Journals (Sweden)
Michael Gurven
2009-08-01
Full Text Available Arterial aging is well characterized in industrial populations, but scantly described in populations with little access to modern medicine. Here we characterize health and aging among the Tsimane, Amazonian forager-horticulturalists with short life expectancy, high infectious loads and inflammation, but low adiposity and robust physical fitness. Inflammation has been implicated in all stages of arterial aging, atherogenesis and hypertension, and so we test whether greater inflammation associates with atherosclerosis and CVD risk. In contrast, moderate to vigorous daily activity, minimal obesity, and low fat intake predict minimal CVD risk among older Tsimane.Peripheral arterial disease (PAD, based on the Ankle-Brachial Index (ABI, and hypertension were measured in Tsimane adults, and compared with rates from industrialized populations. No cases of PAD were found among Tsimane and hypertension was comparatively low (prevalence: 3.5%, 40+; 23%, 70+. Markers of infection and inflammation were much higher among Tsimane than among U.S. adults, whereas HDL was substantially lower. Regression models examine associations of ABI and BP with biomarkers of energy balance and metabolism and of inflammation and infection. Among Tsimane, obesity, blood lipids, and disease history were not significantly associated with ABI. Unlike the Tsimane case, higher cholesterol, C-reactive protein, leukocytes, cigarette smoking and systolic pressure among North Americans are all significantly associated with lower ABI.Inflammation may not always be a risk factor for arterial degeneration and CVD, but instead may be offset by other factors: healthy metabolism, active lifestyle, favorable body mass, lean diet, low blood lipids and cardiorespiratory health. Other possibilities, including genetic susceptibility and the role of helminth infections, are discussed. The absence of PAD and CVD among Tsimane parallels anecdotal reports from other small-scale subsistence
Directory of Open Access Journals (Sweden)
Barbara Gawronska-Kozak
Full Text Available Transcription factors are key molecules that finely tune gene expression in response to injury. We focused on the role of a transcription factor, Foxn1, whose expression is limited to the skin and thymus epithelium. Our previous studies showed that Foxn1 inactivity in nude mice creates a pro-regenerative environment during skin wound healing. To explore the mechanistic role of Foxn1 in the skin wound healing process, we analyzed post-injured skin tissues from Foxn1::Egfp transgenic and C57BL/6 mice with Western Blotting, qRT-PCR, immunofluorescence and flow cytometric assays. Foxn1 expression in non-injured skin localized to the epidermis and hair follicles. Post-injured skin tissues showed an intense Foxn1-eGFP signal at the wound margin and in leading epithelial tongue, where it co-localized with keratin 16, a marker of activated keratinocytes. This data support the concept that suprabasal keratinocytes, expressing Foxn1, are key cells in the process of re-epithelialization. The occurrence of an epithelial-mesenchymal transition (EMT was confirmed by high levels of Snail1 and Mmp-9 expression as well as through co-localization of vimentin/E-cadherin-positive cells in dermis tissue at four days post-wounding. Involvement of Foxn1 in the EMT process was verified by co-localization of Foxn1-eGFP cells with Snail1 in histological sections. Flow cytometric analysis showed the increase of double positive E-cadherin/N-cadherin cells within Foxn1-eGFP population of post-wounded skin cells isolates, which corroborated histological and gene expression analyses. Together, our findings indicate that Foxn1 acts as regulator of the skin wound healing process through engagement in re-epithelization and possible involvement in scar formation due to Foxn1 activity during the EMT process.
Kotsaki, Antigoni; Raftogiannis, Maria; Routsi, Christina; Baziaka, Fotini; Kotanidou, Anastasia; Antonopoulou, Anastasia; Orfanos, Stylianos E; Katsenos, Chrisostomos; Koutoukas, Pantelis; Plachouras, Diamantis; Mandragos, Konstantinos; Giamarellos-Bourboulis, Evangelos J
2012-08-01
Debatable findings exist among various studies regarding the impact of single nucleotide polymorphisms (SNPs) within the promoter region of the tumor necrosis factor (TNF) gene for susceptibility to infections. Their impact was investigated in a cohort of mechanically ventilated patients who developed ventilator-associated pneumonia (VAP). Two-hundred and thirteen mechanically ventilated patients who developed VAP were enrolled. Genomic DNA was extracted and SNPs at the -376, -308 and -238 position of the promoter region of the TNF gene were assessed by restriction fragment length polymorphisms. Monocytes were isolated from 47 patients when they developed sepsis and stimulated by bacterial endotoxin for the production of TNFα and of interleukin-6 (IL-6). Patients were divided into two groups; 166 patients bearing only wild-type alleles of all three studied polymorphisms; and 47 patients carrying at least one A allele of the three studied SNPs. Time between start of mechanical ventilation and advent of VAP was significantly shorter in the second group than in the first group (log-rank: 4.416, p: 0.041). When VAP supervened, disease severity did not differ between groups. Stimulation of TNFα and of IL-6 was much greater by monocytes for patients carrying A alleles. Carriage of at least one A allele of the three studied SNPs at the promoter region of the TNF-gene is associated with shorter time to development of VAP but it is not associated with disease severity. Findings may be related with a role of the studied SNPs in the production of pro-inflammatory cytokines. Copyright © 2012 Elsevier Ltd. All rights reserved.
Excess labile carbon promotes the expression of virulence factors in coral reef bacterioplankton.
Cárdenas, Anny; Neave, Matthew J; Haroon, Mohamed Fauzi; Pogoreutz, Claudia; Rädecker, Nils; Wild, Christian; Gärdes, Astrid; Voolstra, Christian R
2018-01-01
Coastal pollution and algal cover are increasing on many coral reefs, resulting in higher dissolved organic carbon (DOC) concentrations. High DOC concentrations strongly affect microbial activity in reef waters and select for copiotrophic, often potentially virulent microbial populations. High DOC concentrations on coral reefs are also hypothesized to be a determinant for switching microbial lifestyles from commensal to pathogenic, thereby contributing to coral reef degradation, but evidence is missing. In this study, we conducted ex situ incubations to assess gene expression of planktonic microbial populations under elevated concentrations of naturally abundant monosaccharides (glucose, galactose, mannose, and xylose) in algal exudates and sewage inflows. We assembled 27 near-complete (>70%) microbial genomes through metagenomic sequencing and determined associated expression patterns through metatranscriptomic sequencing. Differential gene expression analysis revealed a shift in the central carbohydrate metabolism and the induction of metalloproteases, siderophores, and toxins in Alteromonas, Erythrobacter, Oceanicola, and Alcanivorax populations. Sugar-specific induction of virulence factors suggests a mechanistic link for the switch from a commensal to a pathogenic lifestyle, particularly relevant during increased algal cover and human-derived pollution on coral reefs. Although an explicit test remains to be performed, our data support the hypothesis that increased availability of specific sugars changes net microbial community activity in ways that increase the emergence and abundance of opportunistic pathogens, potentially contributing to coral reef degradation.
Stem cell factor expression after renal ischemia promotes tubular epithelial survival.
Directory of Open Access Journals (Sweden)
Geurt Stokman
Full Text Available BACKGROUND: Renal ischemia leads to apoptosis of tubular epithelial cells and results in decreased renal function. Tissue repair involves re-epithelialization of the tubular basement membrane. Survival of the tubular epithelium following ischemia is therefore important in the successful regeneration of renal tissue. The cytokine stem cell factor (SCF has been shown to protect the tubular epithelium against apoptosis. METHODOLOGY/PRINCIPAL FINDINGS: In a mouse model for renal ischemia/reperfusion injury, we studied how expression of c-KIT on tubular epithelium and its ligand SCF protect cells against apoptosis. Administration of SCF specific antisense oligonucleotides significantly decreased specific staining of SCF following ischemia. Reduced SCF expression resulted in impaired renal function, increased tubular damage and increased tubular epithelial apoptosis, independent of inflammation. In an in vitro hypoxia model, stimulation of tubular epithelial cells with SCF activated survival signaling and decreased apoptosis. CONCLUSIONS/SIGNIFICANCE: Our data indicate an important role for c-KIT and SCF in mediating tubular epithelial cell survival via an autocrine pathway.
Excess labile carbon promotes the expression of virulence factors in coral reef bacterioplankton
Cardenas, Anny
2017-09-12
Coastal pollution and algal cover are increasing on many coral reefs, resulting in higher dissolved organic carbon (DOC) concentrations. High DOC concentrations strongly affect microbial activity in reef waters and select for copiotrophic, often potentially virulent microbial populations. High DOC concentrations on coral reefs are also hypothesized to be a determinant for switching microbial lifestyles from commensal to pathogenic, thereby contributing to coral reef degradation, but evidence is missing. In this study, we conducted ex situ incubations to assess gene expression of planktonic microbial populations under elevated concentrations of naturally abundant monosaccharides (glucose, galactose, mannose, and xylose) in algal exudates and sewage inflows. We assembled 27 near-complete (>70%) microbial genomes through metagenomic sequencing and determined associated expression patterns through metatranscriptomic sequencing. Differential gene expression analysis revealed a shift in the central carbohydrate metabolism and the induction of metalloproteases, siderophores, and toxins in Alteromonas, Erythrobacter, Oceanicola, and Alcanivorax populations. Sugar-specific induction of virulence factors suggests a mechanistic link for the switch from a commensal to a pathogenic lifestyle, particularly relevant during increased algal cover and human-derived pollution on coral reefs. Although an explicit test remains to be performed, our data support the hypothesis that increased availability of specific sugars changes net microbial community activity in ways that increase the emergence and abundance of opportunistic pathogens, potentially contributing to coral reef degradation.
Environmental Factors Promoting Neural Plasticity: Insights from Animal and Human Studies
Directory of Open Access Journals (Sweden)
Laura Mandolesi
2017-01-01
Full Text Available We do not all grow older in the same way. Some individuals have a cognitive decline earlier and faster than others who are older in years but cerebrally younger. This is particularly easy to verify in people who have maintained regular physical activity and healthy and cognitively stimulating lifestyle and even in the clinical field. There are patients with advanced neurodegeneration, such as Alzheimer’s disease (AD, that, despite this, have mild cognitive impairment. What determines this interindividual difference? Certainly, it cannot be the result of only genetic factors. We are made in a certain manner and what we do acts on our brain. In fact, our genetic basis can be modulated, modified, and changed by our experiences such as education and life events; daily, by sleep schedules and habits; or also by dietary elements. And this can be seen as true even if our experiences are indirectly driven by our genetic basis. In this paper, we will review some current scientific research on how our experiences are able to modulate the structural organization of the brain and how a healthy lifestyle (regular physical activity, correct sleep hygiene, and healthy diet appears to positively affect cognitive reserve.
The Transcription Factor c-Maf Promotes the Differentiation of Follicular Helper T Cells
Directory of Open Access Journals (Sweden)
Fabienne Andris
2017-04-01
Full Text Available Follicular helper T cells (Tfh have been identified as the primary cell subpopulation regulating B cell responses in germinal centers, thus supporting high-affinity antibody production. Among the transcription factors orchestrating Tfh cell differentiation and function, the role played by the proto-oncogene c-Maf remains poorly characterized. We report herein that selective loss of c-Maf expression in the T cell compartment results in defective development of Tfh cells in response to both antigen/adjuvant vaccinations and commensal intestinal bacteria. Accordingly, c-Maf expression in T cells was essential for the development and high-affinity antibody secretion in vaccinated animals. c-Maf was expressed early, concomitantly to BCL6, in Tfh cell precursors and found to regulate Tfh fate in a cell-autonomous fashion. Altogether, our findings reveal a novel, non-redundant, function for c-Maf in the differentiation of Tfh cells and the regulation of humoral immune responses to T-cell-dependent antigens.
Excess labile carbon promotes the expression of virulence factors in coral reef bacterioplankton
Cardenas, Anny; Neave, Matthew J.; Haroon, Mohamed; Pogoreutz, Claudia; Radecker, Nils; Wild, Christian; Gä rdes, Astrid; Voolstra, Christian R.
2017-01-01
Coastal pollution and algal cover are increasing on many coral reefs, resulting in higher dissolved organic carbon (DOC) concentrations. High DOC concentrations strongly affect microbial activity in reef waters and select for copiotrophic, often potentially virulent microbial populations. High DOC concentrations on coral reefs are also hypothesized to be a determinant for switching microbial lifestyles from commensal to pathogenic, thereby contributing to coral reef degradation, but evidence is missing. In this study, we conducted ex situ incubations to assess gene expression of planktonic microbial populations under elevated concentrations of naturally abundant monosaccharides (glucose, galactose, mannose, and xylose) in algal exudates and sewage inflows. We assembled 27 near-complete (>70%) microbial genomes through metagenomic sequencing and determined associated expression patterns through metatranscriptomic sequencing. Differential gene expression analysis revealed a shift in the central carbohydrate metabolism and the induction of metalloproteases, siderophores, and toxins in Alteromonas, Erythrobacter, Oceanicola, and Alcanivorax populations. Sugar-specific induction of virulence factors suggests a mechanistic link for the switch from a commensal to a pathogenic lifestyle, particularly relevant during increased algal cover and human-derived pollution on coral reefs. Although an explicit test remains to be performed, our data support the hypothesis that increased availability of specific sugars changes net microbial community activity in ways that increase the emergence and abundance of opportunistic pathogens, potentially contributing to coral reef degradation.
Directory of Open Access Journals (Sweden)
Francis Finot
2012-01-01
Full Text Available The culture liver slices are mainly used to investigate drug metabolism and xenobiotic-mediated liver injuries while apoptosis and proliferation remain unexplored in this culture model. Here, we show a transient increase in LDH release and caspase activities indicating an ischemic injury during the slicing procedure. Then, caspase activities decrease and remain low in cultured slices demonstrating a low level of apoptosis. The slicing procedure is also associated with the G0/G1 transition of hepatocytes demonstrated by the activation of stress and proliferation signalling pathways including the ERK1/2 and JNK1/2/3 MAPKinases and the transient upregulation of c-fos. The cells further progress up to mid-G1 phase as indicated by the sequential induction of c-myc and p53 mRNA levels after the slicing procedure and at 24 h of culture, respectively. The stimulation by epidermal growth factor induces the ERK1/2 phosphorylation but fails to activate expression of late G1 and S phase markers such as cyclin D1 and Cdk1 indicating that hepatocytes are arrested in mid-G1 phase of the cell cycle. However, we found that combined stimulation by the proinflammatory cytokine tumor necrosis factor α and the epidermal growth factor promotes the commitment to DNA replication as observed in vivo during the liver regeneration.
Haussmann, Alexander; Gabrian, Martina; Ungar, Nadine; Jooß, Stefan; Wiskemann, Joachim; Sieverding, Monika; Steindorf, Karen
2018-05-09
Despite a large body of evidence showing that physical activity (PA) is beneficial to patients with cancer, healthcare professionals (HCPs) are promoting it too scarcely. Factors that hinder HCPs from promoting PA have remained understudied so far. Using a qualitative approach, this study aimed at a comprehensive description of influencing factors for HCPs' PA promotion behaviour and at identifying the reasons and mechanisms behind them. Semi-structured interviews with 30 HCPs were undertaken with a focus on concerns, patient characteristics and structural factors. Answers were analysed using thematic analysis. Results revealed that HCPs had concerns regarding a physical overexertion and psychological stress for patients with cancer. A patient's physical condition and the assumed interest in PA, often derived from former PA, turned out to be the most crucial patient characteristics influencing if PA is addressed. Structural factors relevant for PA promotion pertained to in-house structures, HCPs' workload, timing and coordination, information material for HCPs and patients and availability of exercise programs. In conclusion, this study revealed undetected concerns of HCPs and underlined the relevance of patient characteristics and structural conditions for HCPs' PA promotion towards patients with cancer. A broader perspective is needed to assess these factors in their influence on HCPs' PA promotion. © 2018 John Wiley & Sons Ltd.
Lotkowska, Magda E.; Tohge, Takayuki; Fernie, Alisdair R.; Xue, Gang-Ping; Balazadeh, Salma; Mueller-Roeber, Bernd
2015-01-01
MYB transcription factors (TFs) are important regulators of flavonoid biosynthesis in plants. Here, we report MYB112 as a formerly unknown regulator of anthocyanin accumulation in Arabidopsis (Arabidopsis thaliana). Expression profiling after chemically induced overexpression of MYB112 identified 28 up- and 28 down-regulated genes 5 h after inducer treatment, including MYB7 and MYB32, which are both induced. In addition, upon extended induction, MYB112 also positively affects the expression of PRODUCTION OF ANTHOCYANIN PIGMENT1, a key TF of anthocyanin biosynthesis, but acts negatively toward MYB12 and MYB111, which both control flavonol biosynthesis. MYB112 binds to an 8-bp DNA fragment containing the core sequence (A/T/G)(A/C)CC(A/T)(A/G/T)(A/C)(T/C). By electrophoretic mobility shift assay and chromatin immunoprecipitation coupled to quantitative polymerase chain reaction, we show that MYB112 binds in vitro and in vivo to MYB7 and MYB32 promoters, revealing them as direct downstream target genes. We further show that MYB112 expression is up-regulated by salinity and high light stress, environmental parameters that both require the MYB112 TF for anthocyanin accumulation under these stresses. In contrast to several other MYB TFs affecting anthocyanin biosynthesis, MYB112 expression is not controlled by nitrogen limitation or an excess of carbon. Thus, MYB112 constitutes a regulator that promotes anthocyanin accumulation under abiotic stress conditions. PMID:26378103
Crystallization of hepatocyte nuclear factor 4α (HNF4α) in complex with the HNF1α promoter element
Energy Technology Data Exchange (ETDEWEB)
Lu, Peng; Liu, Jianguo; Melikishvili, Manana; Fried, Michael G.; Chi, Young-In, E-mail: ychi@uky.edu [Department of Molecular and Cellular Biochemistry and Center for Structural Biology, University of Kentucky, Lexington, KY 40536 (United States)
2008-04-01
Sample preparation, characterization, crystallization and preliminary X-ray analysis are reported for the HNF4α–DNA binary complex. Hepatocyte nuclear factor 4α (HNF4α) is a member of the nuclear receptor superfamily that plays a central role in organ development and metabolic functions. Mutations on HNF4α cause maturity-onset diabetes of the young (MODY), a dominant monogenic cause of diabetes. In order to understand the molecular mechanism of promoter recognition and the molecular basis of disease-causing mutations, the recombinant HNF4α DNA-binding domain was prepared and used in a study of its binding properties and in crystallization with a 21-mer DNA fragment that contains the promoter element of another MODY gene, HNF1α. The HNF4α protein displays a cooperative and specific DNA-binding activity towards its target gene-recognition elements. Crystals of the complex diffract to 2.0 Å using a synchrotron-radiation source under cryogenic (100 K) conditions and belong to space group C2, with unit-cell parameters a = 121.63, b = 35.43, c = 70.99 Å, β = 119.36°. A molecular-replacement solution has been obtained and structure refinement is in progress. This structure and the binding studies will provide the groundwork for detailed functional and biochemical studies of the MODY mutants.
Crystallization of hepatocyte nuclear factor 4α (HNF4α) in complex with the HNF1α promoter element
International Nuclear Information System (INIS)
Lu, Peng; Liu, Jianguo; Melikishvili, Manana; Fried, Michael G.; Chi, Young-In
2008-01-01
Sample preparation, characterization, crystallization and preliminary X-ray analysis are reported for the HNF4α–DNA binary complex. Hepatocyte nuclear factor 4α (HNF4α) is a member of the nuclear receptor superfamily that plays a central role in organ development and metabolic functions. Mutations on HNF4α cause maturity-onset diabetes of the young (MODY), a dominant monogenic cause of diabetes. In order to understand the molecular mechanism of promoter recognition and the molecular basis of disease-causing mutations, the recombinant HNF4α DNA-binding domain was prepared and used in a study of its binding properties and in crystallization with a 21-mer DNA fragment that contains the promoter element of another MODY gene, HNF1α. The HNF4α protein displays a cooperative and specific DNA-binding activity towards its target gene-recognition elements. Crystals of the complex diffract to 2.0 Å using a synchrotron-radiation source under cryogenic (100 K) conditions and belong to space group C2, with unit-cell parameters a = 121.63, b = 35.43, c = 70.99 Å, β = 119.36°. A molecular-replacement solution has been obtained and structure refinement is in progress. This structure and the binding studies will provide the groundwork for detailed functional and biochemical studies of the MODY mutants
Directory of Open Access Journals (Sweden)
Mojtaba Azadbakht
2014-09-01
Full Text Available Introduction: Health beliefs significantly affect health promoting self-care behaviors. The most important model designed based on health beliefs is the Health Belief Model. This study examined the association between health belief model constructs and demographic factors with behaviors in elderly. Materials and Methods: This descriptive-analytical study was performed on 465 elders referring to Tehran's cultural centers recruited with a multi-stage sampling method. Study instruments were questionnaires regarding demographic information, health beliefs, self-efficacy and health-promoting self-care behaviors. Data analysis was performed using SPSS-22 software by Independent T-test, one-way ANOVA, Pearson correlation and Multiple linear regression. Results: The mean (±SD age of subjects was 68.24±6.12 years and the mean of general self-care score was 1.79±0.36. Gender (P=0.011, economy (P<0.001, education level (P<0.001 and age (P=0.008 were significantly associated with self-care behaviors. Regression analysis showed that perceived barriers, self-efficacy and perceived severity were determinants of behavior (P<0.001. Conclusion: According to the results of this study, it is essential to pay special attention to self-efficacy, perceived severity and perceived barriers to design health education for elderly.
International Nuclear Information System (INIS)
Shannon, M.F.; Gamble, J.R.; Vadas, M.A.
1988-01-01
The gene for human granulocyte/macrophage colony-stimulating factor (GM-CSF) is expressed in a tissue-specific as well as an activation-dependent manner. The interaction of nuclear proteins with the promoter region of the GM-CSF gene that is likely to be responsible for this pattern of GM-CSF expression was investigated. The authors show that nuclear proteins interact with DNA fragments from the GM-CSF promoter in a cell-specific manner. A region spanning two cytokine-specific sequences, cytokine 1 (CK-1, 5', GAGATTCCAC 3') and cytokine 2 (CK-2, 5' TCAGGTA 3') bound two nuclear proteins from GM-CSF-expressing cells in gel retardation assays. NF-GMb was inducible with phorbol 12-myristate 13-acetate and accompanied induction of GM-CSF message. NF-GMb was absent in cell lines not producing GM-CSF, some of which had other distinct binding proteins. NF-GMa and NF-GMb eluted from a heparin-Sepharose column at 0.3 and 0.6 M KCl, respectively. They hypothesize that the sequences CK-1 and CK-2 bind specific proteins and regulate GM-CSF transcription
Directory of Open Access Journals (Sweden)
Adrien Georges
Full Text Available BACKGROUND: FOXL2 is a transcription factor essential for ovarian development and maintenance. It is mutated in the genetic condition called Blepharophimosis Ptosis Epicantus inversus Syndrome (BPES and in cases of isolated premature ovarian failure. We and others have previously shown that FOXL2 undergoes several post-translational modifications. METHODS AND PRINCIPAL FINDINGS: Here, using cells in culture, we show that interference with FOXL2 SUMOylation leads to a robust inhibition of its transactivation ability, which correlates with a decreased stability. Interestingly, FOXL2 SUMOylation promotes its transient recruitment to subnuclear structures that we demonstrate to be PML (Promyelocytic Leukemia Nuclear Bodies. Since PML bodies are known to be sites where post-translational modifications of nuclear factors take place, we used tandem mass spectrometry to identify new post-translational modifications of FOXL2. Specifically, we detected four phosphorylated, one sulfated and three acetylated sites. CONCLUSIONS: By analogy with other transcription factors, we propose that PML Nuclear Bodies might transiently recruit FOXL2 to the vicinity of locally concentrated enzymes that could be involved in the post-translational maturation of FOXL2. FOXL2 acetylation, sulfation, phosphorylation as well as other modifications yet to be discovered might alter the transactivation capacity of FOXL2 and/or its stability, thus modulating its global intracellular activity.
Takagi, Satoshi; Takemoto, Ai; Takami, Miho; Oh-Hara, Tomoko; Fujita, Naoya
2014-08-01
The interactions of tumor cells with platelets contribute to the progression of tumor malignancy, and the expression levels of platelet aggregation-inducing factors positively correlate with the metastatic potential of osteosarcoma cells. However, it is unclear how tumor-platelet interaction contributes to the proliferation of osteosarcomas. We report here that osteosarcoma-platelet interactions induce the release of platelet-derived growth factor (PDGF) from platelets, which promotes the proliferation of osteosarcomas. Co-culture of platelets with MG63 or HOS osteosarcoma cells, which could induce platelet aggregation, enhanced the proliferation of each cell line in vitro. Analysis of phospho-antibody arrays revealed that co-culture of MG63 cells with platelets induced the phosphorylation of platelet derived growth factor receptor (PDGFR) and Akt. The addition of supernatants of osteosarcoma-platelet reactants also increased the growth of MG63 and HOS cells as well as the level of phosphorylated-PDGFR and -Akt. Sunitinib or LY294002, but not erlotinib, significantly inhibited the platelet-induced proliferation of osteosarcoma cells, indicating that PDGF released from platelets plays an important role in the proliferation of osteosarcomas by activating the PDGFR and then Akt. Our results suggest that inhibitors that specifically target osteosarcoma-platelet interactions may eradicate osteosarcomas. © 2014 The Authors. Cancer Science published by Wiley Publishing Asia Pty Ltd on behalf of Japanese Cancer Association.
Jang, Jun-Ho; Chand, Hitendra S; Bruse, Shannon; Doyle-Eisele, Melanie; Royer, Christopher; McDonald, Jacob; Qualls, Clifford; Klingelhutz, Aloysius J; Lin, Yong; Mallampalli, Rama; Tesfaigzi, Yohannes; Nyunoya, Toru
2017-04-01
The purpose of this study was to determine whether expression of connective tissue growth factor (CTGF) protein in chronic obstructive pulmonary disease (COPD) is consistent in humans and animal models of COPD and to investigate the role of this protein in lung epithelial cells. CTGF in lung epithelial cells of ex-smokers with COPD was compared with ex-smokers without COPD by immunofluorescence. A total of twenty C57Bl/6 mice and sixteen non-human primates (NHPs) were exposed to cigarette smoke (CS) for 4 weeks. Ten mice of these CS-exposed mice and eight of the CS-exposed NHPs were infected with H3N2 influenza A virus (IAV), while the remaining ten mice and eight NHPs were mock-infected with vehicle as control. Both mRNA and protein expression of CTGF in lung epithelial cells of mice and NHPs were determined. The effects of CTGF overexpression on cell proliferation, p16 protein, and senescence-associated β-galactosidase (SA-β-gal) activity were examined in cultured human bronchial epithelial cells (HBECs). In humans, CTGF expression increased with increasing COPD severity. We found that protein expression of CTGF was upregulated in lung epithelial cells in both mice and NHPs exposed to CS and infected with IAV compared to those exposed to CS only. When overexpressed in HBECs, CTGF accelerated cellular senescence accompanied by p16 accumulation. Both CTGF and p16 protein expression in lung epithelia are positively associated with the severity of COPD in ex-smokers. These findings show that CTGF is consistently expressed in epithelial cells of COPD lungs. By accelerating lung epithelial senescence, CTGF may block regeneration relative to epithelial cell loss and lead to emphysema.
Pickering, Bradley S; Lopilato, Jane E; Smith, Daniel R; Watnick, Paula I
2014-07-01
The phosphoenol phosphotransferase system (PTS) is a multicomponent signal transduction cascade that regulates diverse aspects of bacterial cellular physiology in response to the availability of high-energy sugars in the environment. Many PTS components are repressed at the transcriptional level when the substrates they transport are not available. In Escherichia coli, the transcription factor Mlc (for makes large colonies) represses transcription of the genes encoding enzyme I (EI), histidine protein (HPr), and the glucose-specific enzyme IIBC (EIIBC(Glc)) in defined media that lack PTS substrates. When glucose is present, the unphosphorylated form of EIIBC(Glc) sequesters Mlc to the cell membrane, preventing its interaction with DNA. Very little is known about Vibrio cholerae Mlc. We found that V. cholerae Mlc activates biofilm formation in LB broth but not in defined medium supplemented with either pyruvate or glucose. Therefore, we questioned whether V. cholerae Mlc functions differently than E. coli Mlc. Here we have shown that, like E. coli Mlc, V. cholerae Mlc represses transcription of PTS components in both defined medium and LB broth and that E. coli Mlc is able to rescue the biofilm defect of a V. cholerae Δmlc mutant. Furthermore, we provide evidence that Mlc indirectly activates transcription of the vps genes by repressing expression of EI. Because activation of the vps genes by Mlc occurs under only a subset of the conditions in which repression of PTS components is observed, we conclude that additional inputs present in LB broth are required for activation of vps gene transcription by Mlc. Copyright © 2014, American Society for Microbiology. All Rights Reserved.
Interleukin-6 Gene Promoter Polymorphisms and Cardiovascular Risk Factors. A family study
Directory of Open Access Journals (Sweden)
Iris Paola Guzmán-Guzmán
2010-01-01
Full Text Available Interleukin-6 (IL-6 is a cytokine involved in inflammatory process, as well as in glucose and lipid metabolism. Several studies of the biological relevance of IL-6 gene polymorphisms have indicated a relationship with cardiovascular disease. The aim of this study was to assess whether the –174 G/C and –572 G/C of IL-6 gene polymorphisms are associated with cardiovascular risk factors in Mexican families. Ninety members of 30 Mexican families, in which an index case (proband had obesity, were included in the study. We evaluated the body composition by bioelectrical impedance. Peripheral blood samples were collected to determine biochemical and hematological parameters. High sensitivity C- reactive protein levels were measurement for nephelometric analysis. Screening for both polymorphisms studied was performed by PCR-RFLP. In the parents, both polymorphisms were in Hardy-Weinberg's equilibrium. The genotypes –174 GC/CC were associated with T2D (OR = 1.23, IC95% 1.01–1.5 and highest levels of hsCRP (p = 0.02, whereas genotype –572 GG was associated with T2D (OR = 1.24, IC95% 1.04–1.47 with an inflammatory state determined by the increase in the leukocyte count (OR = 1.24, IC95% 1.02–1.51. The genotypes –174 GC/CC and –572 GG may confer susceptibility for the development of subclinical inflammation and type 2 diabetes in Mexican families.
Directory of Open Access Journals (Sweden)
Ying Yang
2017-01-01
Full Text Available Hypoxia inducible factor 1α (HIF-1α, a pivotal regulator of gene expression in response to hypoxia and ischemia, is now considered to regulate both pro-survival and pro-death responses depending on the duration and severity of the stress. We previously showed that chronic global cerebral hypoperfusion (CCH triggered long-lasting accumulation of HIF-1α protein in the hippocampus of rats. However, the role of the stabilized HIF-1α in CCH is obscure. Here, we knock down endogenous HIF-1α to determine whether and how HIF-1α affects the disease processes and phenotypes of CCH. Lentivirus expressing HIF-1α small hairpin RNA was injected into the bilateral hippocampus and bilateral ventricles to knock down HIF-1α gene expression in the hippocampus and other brain areas. Permanent bilateral common carotid artery occlusions, known as 2-vessel occlusions (2VOs, were used to induce CCH in rats. Angiogenesis, oxidative stress, histopathological changes of the brain, and cognitive function were tested. Knockdown of HIF-1α prior to 2VO significantly exacerbates the impairment of learning and memory after four weeks of CCH. Mechanically, reduced cerebral angiogenesis, increased oxidative damage, and increased density of astrocytes and microglia in the cortex and some subregions of hippocampus are also shown after four weeks of CCH. Furthermore, HIF-1α knockdown also disrupts upregulation of regulated downstream genes. Our findings suggest that HIF-1α-protects the brain from oxidative stress and inflammation response in the disease process of CCH. Accumulated HIF-1α during CCH mediates endogenous adaptive processes to defend against more severe hypoperfusion injury of the brain, which may provide a therapeutic benefit.
Peng, Chuanhui; Hu, Wendi; Weng, Xiaoyu; Tong, Rongliang; Cheng, Shaobing; Ding, Chaofeng; Xiao, Heng; Lv, Zhen; Xie, Haiyang; Zhou, Lin; Wu, Jian; Zheng, Shusen
2017-06-23
It has been reported that long non-coding RNA PANDA was disregulated in varieties types of tumor, but its expression level and biological role in hepatocellular carcinoma (HCC) remains contradictory. We detected PANDA expression in two independent cohorts (48 HCC patients following liver transplantation and 84 HCC patients following liver resection), and found that PANDA was down-regulated in HCC. Thereafter we explored its function in cancer biology by inversing its low expression. Surprisingly, overexpression of PANDA promoted HCC proliferation and carcinogenesis in vitro and in vivo. Mechanistically, PANDA repressed transcriptional activity of senescence associated inflammatory factor IL8, which leaded to inhibition of cellular senescence. Therefore, our research help to better understand the complex role of PANDA in HCC, and suggest more thoughtful strategies should be applied before it can be treated as a potential therapeutic target.
ATF3, an HTLV-1 bZip factor binding protein, promotes proliferation of adult T-cell leukemia cells
Directory of Open Access Journals (Sweden)
Ohshima Koichi
2011-03-01
Full Text Available Abstract Background Adult T-cell leukemia (ATL is an aggressive malignancy of CD4+ T-cells caused by human T-cell leukemia virus type 1 (HTLV-1. The HTLV-1 bZIP factor (HBZ gene, which is encoded by the minus strand of the viral genome, is expressed as an antisense transcript in all ATL cases. By using yeast two-hybrid screening, we identified activating transcription factor 3 (ATF3 as an HBZ-interacting protein. ATF3 has been reported to be expressed in ATL cells, but its biological significance is not known. Results Immunoprecipitation analysis confirmed that ATF3 interacts with HBZ. Expression of ATF3 was upregulated in ATL cell lines and fresh ATL cases. Reporter assay revealed that ATF3 could interfere with the HTLV-1 Tax's transactivation of the 5' proviral long terminal repeat (LTR, doing so by affecting the ATF/CRE site, as well as HBZ. Suppressing ATF3 expression inhibited proliferation and strongly reduced the viability of ATL cells. As mechanisms of growth-promoting activity of ATF3, comparative expression profiling of ATF3 knockdown cells identified candidate genes that are critical for the cell cycle and cell death, including cell division cycle 2 (CDC2 and cyclin E2. ATF3 also enhanced p53 transcriptional activity, but this activity was suppressed by HBZ. Conclusions Thus, ATF3 expression has positive and negative effects on the proliferation and survival of ATL cells. HBZ impedes its negative effects, leaving ATF3 to promote proliferation of ATL cells via mechanisms including upregulation of CDC2 and cyclin E2. Both HBZ and ATF3 suppress Tax expression, which enables infected cells to escape the host immune system.
Kikuchi, Ryoko; Tsuda, Hitoshi; Kanai, Yae; Kasamatsu, Takahiro; Sengoku, Kazuo; Hirohashi, Setsuo; Inazawa, Johji; Imoto, Issei
2007-08-01
Connective tissue growth factor (CTGF) is a secreted protein belonging to the CCN family, members of which are implicated in various biological processes. We identified a homozygous loss of CTGF (6q23.2) in the course of screening a panel of ovarian cancer cell lines for genomic copy number aberrations using in-house array-based comparative genomic hybridization. CTGF mRNA expression was observed in normal ovarian tissue and immortalized ovarian epithelial cells but was reduced in many ovarian cancer cell lines without its homozygous deletion (12 of 23 lines) and restored after treatment with 5-aza 2'-deoxycytidine. The methylation status around the CTGF CpG island correlated inversely with the expression, and a putative target region for methylation showed promoter activity. CTGF methylation was frequently observed in primary ovarian cancer tissues (39 of 66, 59%) and inversely correlated with CTGF mRNA expression. In an immunohistochemical analysis of primary ovarian cancers, CTGF protein expression was frequently reduced (84 of 103 cases, 82%). Ovarian cancer tended to lack CTGF expression more frequently in the earlier stages (stages I and II) than the advanced stages (stages III and IV). CTGF protein was also differentially expressed among histologic subtypes. Exogenous restoration of CTGF expression or treatment with recombinant CTGF inhibited the growth of ovarian cancer cells lacking its expression, whereas knockdown of endogenous CTGF accelerated growth of ovarian cancer cells with expression of this gene. These results suggest that epigenetic silencing by hypermethylation of the CTGF promoter leads to a loss of CTGF function, which may be a factor in the carcinogenesis of ovarian cancer in a stage-dependent and/or histologic subtype-dependent manner.
Dai, Bingbing; Gong, Aihua; Jing, Zhitao; Aldape, Kenneth D.; Kang, Shin-Hyuk; Sawaya, Raymond; Huang, Suyun
2013-01-01
The forkhead box M1 (FoxM1) is a key transcription factor regulating multiple aspects of cell biology. Prior studies have shown that FoxM1 is overexpressed in a variety of human tumors, including brain tumor, and plays a critical role in cancer development and progression. In this study we found that FoxM1 was up-regulated by heat shock factor 1 (HSF1) under heat shock stress condition in multiple cell lines. Knockdown of HSF1 with HSF1 siRNA or inhibition of HSF1 with a HSF1 inhibitor abrogated heat shock-induced expression of FoxM1. Genetic deletion of HSF1 in mouse embryo fibroblast cells also abolished heat shock stress-induced FoxM1 expression. Moreover, we showed that HSF1 directly bound to FoxM1 promoter and increased FoxM1 promoter activity. Furthermore, we demonstrated that FoxM1 was required for the G2-M phase progression through regulating Cdc2, Cdc20, and Cdc25B under a mild heat shock stress but enhanced cell survival under lethal heat shock stress condition. Finally, in human glioblastoma specimens, FoxM1 overexpression correlated with elevated HSF1 expression. Our results indicate that FoxM1 is regulated by HSF1 and is critical for HSF1-mediated heat shock response. We demonstrated a novel mechanism of stress resistance controlled by HSF1 and a new HSF-FoxM1 connection that mediates cellular thermotolerance. PMID:23192351
International Nuclear Information System (INIS)
Solomon, Kimberly D.; Ong, Joo L.
2013-01-01
Currently, tissue engineered constructs for critical sized bone defects are non-vascularized. There are many strategies used in order to promote vascularization, including delivery of growth factors such as vascular endothelial growth factor (VEGF). In this study, hydroxyapatite (HA) was coated with self-assembled monolayers (SAMs). The SAMs were in turn used to covalently bind VEGF to the surface of HA. The different SAM chain length ratios (phosphonoundecanoic acid (11-PUDA):16-phosphonohexadecanoic acid (16-PHDA) utilized in this study were 0:100, 25:75, 50:50, 75:25, and 100:0. Surfaces were characterized by contact angle (CA) and atomic force microscopy, and an in vitro VEGF release study was performed. It was observed that CA and root-mean-squared roughness were not significantly affected by the addition of SAMs, but that CA was significantly lowered with the addition of VEGF. VEGF release profiles of bound VEGF groups all demonstrated less initial burst release than adsorbed control, indicating that VEGF was retained on the HA surface when bound by SAMs. An in vitro study using human aortic endothelial cells (HAECs) demonstrated that bound VEGF increased metabolic activity and caused sustained production of angiopoietin-2, an angiogenic marker, over 28 days. In conclusion, SAMs provide a feasible option for growth factor delivery from HA surfaces, enhancing angiogenic activity of HAECs in vitro. - Highlights: • Vascular endothelial growth factor (VEGF) is attached to hydroxyapatite (HA). • Self-assembled monolayers (SAMs) delay the release of VEGF from hydroxyapatite. • SAM chain length ratio affects the total mass of VEGF released. • VEGF on HA up-regulates proliferation and angiogenic activity of endothelial cells
Li, Te-Mao; Fong, Yi-Chin; Liu, Shan-Chi; Chen, Po-Chun; Tang, Chih-Hsin
2013-01-01
Chondrosarcoma is a primary malignant bone cancer, with a potent capacity to invade locally and cause distant metastasis; it has a poor prognosis and shows a predilection for metastasis to the lungs. Brain derived neurotrophic factor (BDNF) is a small-molecule protein from the neurotrophin family of growth factors that is associated with the disease status and outcomes of cancers. However, the effect of BDNF on migration activity in human chondrosarcoma cells is mostly unknown. Here, we found that human chondrosarcoma tissues showed significant expression of BDNF, which was higher than that in normal cartilage and primary chondrocytes. We also found that BDNF increased the migration and expression of β5 integrin in human chondrosarcoma cells. In addition, knockdown of BDNF expression markedly inhibited migratory activity. BDNF-mediated migration and β5 integrin up-regulation were attenuated by antibody, inhibitor, or siRNA against the TrkB receptor. Pretreatment of chondrosarcoma cells with PI3K, Akt, and NF-κB inhibitors or mutants also abolished BDNF-promoted migration and integrin expression. The PI3K, Akt, and NF-κB signaling pathway was activated after BDNF treatment. Taken together, our results indicate that BDNF enhances the migration of chondrosarcoma by increasing β5 integrin expression through a signal transduction pathway that involves the TrkB receptor, PI3K, Akt, and NF-κB. BDNF thus represents a promising new target for treating chondrosarcoma metastasis. PMID:23874483
Abedini, Nauzley C; Stack, Shobha W; Goodman, Jessie L; Steinberg, Kenneth P
2018-02-01
Burnout rates for internal medicine residents are among the highest of all specialties, yet little is known about how residents recover from burnout. We identified factors promoting recovery from burnout and factors that assist with the subsequent avoidance of burnout among internal medicine residents. A purposive sample of postgraduate year 2 (PGY-2), PGY-3, and recent graduates who experienced and recovered from burnout during residency participated in semistructured, 60-minute interviews from June to August 2016. Using qualitative methods derived from grounded theory, saturation of themes occurred after 25 interviews. Coding was performed in an iterative fashion and consensus was reached on major themes. Coding revealed 2 different categories of resident burnout- circumstantial and existential -with differing recovery and avoidance methods. Circumstantial burnout stemmed from self-limited circumstances and environmental triggers. Recovery from, and subsequent avoidance of, circumstantial burnout arose from (1) resolving workplace challenges; (2) nurturing personal lives; and (3) taking time off. In contrast, existential burnout stemmed from a loss of meaning in medicine and an uncertain professional role. These themes were identified around recovery: (1) recognizing burnout and feeling validated; (2) connecting with patients and colleagues; (3) finding meaning in medicine; and (4) redefining a professional identity and role. Our study suggests that residents experience different types of burnout and have variable methods by which they recover from and avoid further burnout. Categorizing residents' burnout into circumstantial versus existential experiences may serve as a helpful framework for formulating interventions.
Lee, Chih-Yung Sean; Lu, Tu; Seydoux, Geraldine
2017-11-07
Nanos RNA-binding proteins are required for germline development in metazoans, but the underlying mechanisms remain poorly understood. We have profiled the transcriptome of primordial germ cells (PGCs) lacking the nanos homologs nos-1 and nos-2 in C. elegans. nos-1nos-2 PGCs fail to silence hundreds of transcripts normally expressed in oocytes. We find that this misregulation is due to both delayed turnover of maternal transcripts and inappropriate transcriptional activation. The latter appears to be an indirect consequence of delayed turnover of the maternally-inherited transcription factor LIN-15B, a synMuvB class transcription factor known to antagonize PRC2 activity. PRC2 is required for chromatin reprogramming in the germline, and the transcriptome of PGCs lacking PRC2 resembles that of nos-1nos-2 PGCs. Loss of maternal LIN-15B restores fertility to nos-1nos-2 mutants. These findings suggest that Nanos promotes germ cell fate by downregulating maternal RNAs and proteins that would otherwise interfere with PRC2-dependent reprogramming of PGC chromatin.
Directory of Open Access Journals (Sweden)
Stehouwer Coen DA
2005-06-01
Full Text Available Abstract Objective To investigate whether IGF-I promoter polymorphism was associated with birth weight and risk factors for cardiovascular disease (CVD and type 2 diabetes (T2DM, and whether the birth weight – risk factor relationship was the same for each genotype. Design and participants 264 subjects (mean age 36 years had data available on birth weight, IGF-I promoter polymorphism genotype, CVD and T2DM risk factors. Student's t-test and regression analyses were applied to analyse differences in birth weight and differences in the birth weight – risk factors relationship between the genotypes. Results Male variant carriers (VCs of the IGF-I promoter polymorphism had a 0.2 kg lower birth weight than men with the wild type allele (p = 0.009. Of the risk factors for CVD and T2DM, solely LDL concentration was associated with the genotype for the polymorphism. Most birth weight – risk factor relationships were stronger in the VC subjects; among others the birth weight – systolic blood pressure relationship: 1 kg lower birth weight was related to an 8.0 mmHg higher systolic blood pressure Conclusion The polymorphism in the promoter region of the IGF-I gene is related to birth weight in men only, and to LDL concentration only. Furthermore, the genotype for this polymorphism modified the relationships between birth weight and the risk factors, especially for systolic and diastolic blood pressure.
Boominathan, Vijay P; Ferreira, Tracie L
2012-12-01
Student interest in topics of tissue engineering is increasing exponentially as the number of universities offering programs in bioengineering are on the rise. Bioengineering encompasses all of the STEM categories: Science, Technology, Engineering, and Math. Inquiry-based learning is one of the most effective techniques for promoting student learning and has been demonstrated to have a high impact on learning outcomes. We have designed program outcomes for our bioengineering program that require tiered activities to develop problem solving skills, peer evaluation techniques, and promote team work. While it is ideal to allow students to ask unique questions and design their own experiments, this can be difficult for instructors to have reagents and supplies available for a variety of activities. Zebrafish can be easily housed, and multiple variables can be tested on a large enough group to provide statistical value, lending them well to inquiry-based learning modules. We have designed a laboratory activity that takes observation of fin regeneration to the next level: analyzing conditions that may impact regeneration. Tissue engineers seek to define the optimum conditions to grow tissue for replacement parts. The field of tissue engineering is likely to benefit from understanding natural mechanisms of regeneration and the factors that influence the rate of regeneration. We have outlined the results of varying temperature on fin regeneration and propose other inquiry modules such as the role of pH in fin regeneration. Furthermore, we have provided useful tools for developing critical thinking and peer review of research ideas, assessment guidelines, and grading rubrics for the activities associated with this exercise.
Cai, Shao-Hang; Lu, Shi-Xun; Liu, Li-Li; Zhang, Chris Zhiyi; Yun, Jing-Ping
2017-10-01
Hepatocyte nuclear factor 4 alpha (HNF4α) plays an important role in tumourigenesis. There is growing evidence indicating that HNF4α transcribed by promoter 1 (P1-HNF4α) is expressed at relatively low levels in HCC and its presence predicts a favourable outcome for hepatocellular carcinoma (HCC) patients. However, the role of HNF4α transcribed by promoter 2 (P2-HNF4α) in HCC remains unclear. A total of 615 HCC specimens were obtained to construct tissue microarrays and perform immunohistochemistry. The relationship between P2-HNF4α and clinical features of HCC patients were analysed. Kaplan-Meier analysis was conducted to assess the prognostic value of P2-HNF4α. The results showed that the expression of P2-HNF4α in HCC was noticeably increased in HCC tissues compared with the nontumourous tissues. In addition, P1-HNF4α expression was negatively correlated with P2-HNF4α expression ( p = 0.023). High P2-HNF4α expression was significantly associated with poor differentiation of HCC ( p = 0.002) and vascular invasion ( p = 0.017). Kaplan-Meier analysis showed that P2-HNF4α expression was closely correlated with overall survival in the training group ( p = 0.01), validation group ( p = 0.034), and overall group of patients with HCC ( p P2-HNF4α, different from P1-HNF4α, is markedly upregulated and serves as an oncogene-associated protein in HCC. Our study therefore provides a promising biomarker for prognostic prediction and a potential therapeutic target for HCC.
Sangar, Vineet; Funk, Cory C; Kusebauch, Ulrike; Campbell, David S; Moritz, Robert L; Price, Nathan D
2014-10-01
Glioblastoma multiforme is a highly invasive and aggressive brain tumor with an invariably poor prognosis. The overexpression of epidermal growth factor receptor (EGFR) is a primary influencer of invasion and proliferation in tumor cells and the constitutively active EGFRvIII mutant, found in 30-65% of Glioblastoma multiforme, confers more aggressive invasion. To better understand how EGFR contributes to tumor aggressiveness, we investigated the effect of EGFR on the secreted levels of 65 rationally selected proteins involved in invasion. We employed selected reaction monitoring targeted mass spectrometry using stable isotope labeled internal peptide standards to quantity proteins in the secretome from five GBM (U87) isogenic cell lines in which EGFR, EGFRvIII, and/or PTEN were expressed. Our results show that cell lines with EGFR overexpression and constitutive EGFRvIII expression differ remarkably in the expression profiles for both secreted and intracellular signaling proteins, and alterations in EGFR signaling result in reproducible changes in concentrations of secreted proteins. Furthermore, the EGFRvIII-expressing mutant cell line secretes the majority of the selected invasion-promoting proteins at higher levels than other cell lines tested. Additionally, the intracellular and extracellular protein measurements indicate elevated oxidative stress in the EGFRvIII-expressing cell line. In conclusion, the results of our study demonstrate that EGFR signaling has a significant effect on the levels of secreted invasion-promoting proteins, likely contributing to the aggressiveness of Glioblastoma multiforme. Further characterization of these proteins may provide candidates for new therapeutic strategies and targets as well as biomarkers for this aggressive disease. © 2014 by The American Society for Biochemistry and Molecular Biology, Inc.
Etxebarria, Jaime; Sanz-Lázaro, Sara; Hernáez-Moya, Raquel; Freire, Vanesa; Durán, Juan A; Morales, María-Celia; Andollo, Noelia
2017-12-01
To evaluate the regenerating potential and the mechanisms through which the autologous serum derived from plasma rich in growth factors (s-PRGF) favours corneal wound healing in vitro and in vivo. We compared the effect of various concentrations of s-PRGF versus fetal bovine serum (FBS) and control treatment in rabbit primary corneal epithelial and stromal cells and wounded rabbit corneas. Cell proliferation was measured using an enzymatic colorimetric assay. In vitro and in vivo wound-healing progression was assessed by image-analysis software. Migration and invasion were evaluated using transfilter assays. Histological structure was analysed in stained sections. Protein expression was evaluated by immunohistochemistry. s-PRGF promoted the robust proliferation of epithelial cultures at any concentration, similar to FBS. Likewise, s-PRGF and FBS produced similar re-epithelialization rates in in vitro wound-healing assays. In vivo, s-PRGF treatment accelerated corneal wound healing in comparison with control treatment. This difference was significant only for 100% s-PRGF treatment in our healthy rabbit model. Histological analysis confirmed normal epithelialization in all cases. Immunohistochemistry showed a higher expression of cytokeratins 3/76 and 15, zonula occludens-1 and alpha-smooth muscle actin proteins as a function of s-PRGF concentration. Notably, keratocyte density in the anterior third of the stroma increased with increase in s-PRGF concentration, suggesting an in vivo chemotactic effect of s-PRGF on keratocytes that was further confirmed in vitro. s-PRGF promotes proliferation and migration and influences limbal stemness, adhesion and fibrosis during corneal healing. © 2017 Acta Ophthalmologica Scandinavica Foundation. Published by John Wiley & Sons Ltd.
Li, Y J; Yang, L; Wang, L P; Zhang, Y
2017-06-23
Objective: To investigate the key cytokine which polarizes M2 macrophages and promotes invasion and metastasis in non-small cell lung cancer (NSCLC). Methods: After co-culture with A549 cells in vitro, the proportion of CD14(+) CD163(+) M2 macrophages in monocytes and macrophage colony stimulating factor (M-CSF) levels in culture supernatant were detected by flow cytometry, ELISA assay and real-time qPCR, respectively. The effects of CD14(+) CD163(+) M2 macrophages on invasion of A549 cells and angiogenesis of HUVEC cells were measured by transwell assay and tubule formation assay, respectively. The clinical and prognostic significance of M-CSF expression in NSCLC was further analyzed. Results: The percentage of CD14(+) CD163(+) M2 macrophages in monocytes and the concentration of M-CSF in the supernatant followed by co-culture was (12.03±0.46)% and (299.80±73.76)pg/ml, respectively, which were significantly higher than those in control group [(2.80±1.04)% and (43.07±11.22)pg/ml, respectively, P macrophages in vitro . M2 macrophages enhanced the invasion of A549 cells (66 cells/field vs. 26 cells/field) and the angiogenesis of HUVEC cells (22 tubes/field vs. 8 tubes/field). The mRNA expression of M-CSF in stage Ⅰ-Ⅱ patients (16.23±4.83) was significantly lower than that in stage Ⅲ-Ⅳ (53.84±16.08; P macrophages, which can further promote the metastasis and angiogenesis of NSCLC. M-CSF could be used as a potential therapeutic target of NSCLC.
Directory of Open Access Journals (Sweden)
Matsutani Sachiko
2004-08-01
Full Text Available Abstract Background In eukaryotes, RNA polymerase III (RNAP III transcribes the genes for small RNAs like tRNAs, 5S rRNA, and several viral RNAs, and short interspersed repetitive elements (SINEs. The genes for these RNAs and SINEs have internal promoters that consist of two regions. These two regions are called the A and B blocks. The multisubunit transcription factor TFIIIC is required for transcription initiation of RNAP III; in transcription of tRNAs, the B-block binding subunit of TFIIIC recognizes a promoter. Although internal promoter sequences are conserved in eukaryotes, no evidence of homology between the B-block binding subunits of vertebrates and yeasts has been reported previously. Results Here, I reported the results of PSI-BLAST searches using the B-block binding subunits of human and Shizosacchromyces pombe as queries, showing that the same Arabidopsis proteins were hit with low E-values in both searches. Comparison of the convergent iterative alignments obtained by these PSI-BLAST searches revealed that the vertebrate, yeast, and Arabidopsis proteins have similarities in their N-terminal one-third regions. In these regions, there were three domains with conserved sequence similarities, one located in the N-terminal end region. The N-terminal end region of the B-block binding subunit of Saccharomyces cerevisiae is tentatively identified as a HMG box, which is the DNA binding motif. Although I compared the alignment of the N-terminal end regions of the B-block binding subunits, and their homologs, with that of the HMG boxes, it is not clear whether they are related. Conclusion Molecular phylogenetic analyses using the small subunit rRNA and ubiquitous proteins like actin and α-tubulin, show that fungi are more closely related to animals than either is to plants. Interestingly, the results obtained in this study show that, with respect to the B-block binding subunits of TFIIICs, animals appear to be evolutionarily closer to plants
Matsutani, Sachiko
2004-08-09
In eukaryotes, RNA polymerase III (RNAP III) transcribes the genes for small RNAs like tRNAs, 5S rRNA, and several viral RNAs, and short interspersed repetitive elements (SINEs). The genes for these RNAs and SINEs have internal promoters that consist of two regions. These two regions are called the A and B blocks. The multisubunit transcription factor TFIIIC is required for transcription initiation of RNAP III; in transcription of tRNAs, the B-block binding subunit of TFIIIC recognizes a promoter. Although internal promoter sequences are conserved in eukaryotes, no evidence of homology between the B-block binding subunits of vertebrates and yeasts has been reported previously. Here, I reported the results of PSI-BLAST searches using the B-block binding subunits of human and Shizosacchromyces pombe as queries, showing that the same Arabidopsis proteins were hit with low E-values in both searches. Comparison of the convergent iterative alignments obtained by these PSI-BLAST searches revealed that the vertebrate, yeast, and Arabidopsis proteins have similarities in their N-terminal one-third regions. In these regions, there were three domains with conserved sequence similarities, one located in the N-terminal end region. The N-terminal end region of the B-block binding subunit of Saccharomyces cerevisiae is tentatively identified as a HMG box, which is the DNA binding motif. Although I compared the alignment of the N-terminal end regions of the B-block binding subunits, and their homologs, with that of the HMG boxes, it is not clear whether they are related. Molecular phylogenetic analyses using the small subunit rRNA and ubiquitous proteins like actin and alpha-tubulin, show that fungi are more closely related to animals than either is to plants. Interestingly, the results obtained in this study show that, with respect to the B-block binding subunits of TFIIICs, animals appear to be evolutionarily closer to plants than to fungi.
Levin, Lia; Sefati, Noga
2018-04-23
Unemployment is a harsh social phenomenon with far reaching negative implications. Unemployed individuals often seek assistance from social workers working in Municipal Departments of Social Services around the world. However, little to no research exists on the factors involved in social workers' choice to engage in employment-promoting practices (EPP). The current study aimed to tackle this gap of knowledge, providing initial conclusions about the relationship between social workers' attitudes towards unemployment, their knowledge regarding EPP, the extent to which they perceive their organisations as endorsing EPP and their actual implementation. The main research question dealt with the extent to which each of the examined factors, in itself or in combination with others, would be the best predictor of social workers' utilisation of EPP. The study sample consisted of 163 social workers in Israel with varied experience in working with the unemployed, all working in public sector social services. Structural equation modelling performed on the attained data revealed that knowledge, skills and perceived organisational endorsement of EPP were positively associated with implementation of EPP. Contrary to the hypothesised, attitudes towards unemployment were not associated with the implementation of such practices. At the same time, professional training and seniority were associated with EPP only through the mediation of perceived organisational endorsement. Ultimately, perceived organisational endorsement of EPP emerged as the most influential factor involved in social workers' decision to carry out EPP with their service-users. Consequences of these findings for social work education, supervision, research and policy making are discussed, referring to the local Israeli context as well as its possible international inferences. © 2018 John Wiley & Sons Ltd.
Nag, Ronita; Maity, Manas Kanti; Dasgupta, Maitrayee
2005-11-01
The ABA responsive ABI3 and the auxin responsive ARF family of transcription factors bind the CATGCATG (Sph) and TGTCTC core motifs in ABA and auxin response elements (ABRE and AuxRE), respectively. Several evidences indicate ABI3s to act downstream to auxin too. Because DNA binding domain of ABI3s shows significant overlap with ARFs we enquired whether auxin responsiveness through ABI3s could be mediated by their binding to canonical AuxREs. Investigations were undertaken through in vitro gel mobility shift assays (GMSA) using the DNA binding domain B3 of PvAlf (Phaseolus vulgaris ABI3 like factor) and upstream regions of auxin responsive gene GH3 (-267 to -141) and ABA responsive gene Em (-316 to -146) harboring AuxRE and ABRE, respectively. We demonstrate that B3 domain of PvAlf could bind AuxRE only when B3 was associated with its flanking domain B2 (B2B3). Such strict requirement of B2 domain was not observed with ABRE, where B3 could bind with or without being associated with B2. This dual specificity in DNA binding of ABI3s was also demonstrated with nuclear extracts of cultured cells of Arachis hypogea. Supershift analysis of ABRE and AuxRE bound nuclear proteins with antibodies raised against B2B3 domains of PvAlf revealed that ABI3 associated complexes were detectable in association with both cis elements. Competition GMSA confirmed the same complexes to bind ABRE and AuxRE. This dual specificity of ABI3 like factors in DNA binding targeted to natural promoters responsive to ABA and auxin suggests them to have a potential role in conferring crosstalk between these two phytohormones.
Banerjee, Ananya Tina; Kin, R; Strachan, Patricia H; Boyle, Michael H; Anand, Sonia S; Oremus, Mark
2015-01-01
To describe the factors facilitating the implementation of heart health promotion programs for older adults in Anglican, United, and Catholic churches. The study used qualitative methods comprising semistructured interviews and focus groups. The interviews and focus groups were conducted in Anglican, Catholic, and United churches located in the Canadian cities of Toronto and Hamilton, Ontario. Twelve ordained pastors and 21 older parishioners who attended church regularly and who had no health conditions were recruited to best explain how churches could be suitable locations for health promotion activities targeting older adults. Twelve semistructured interviews with the pastors and three focus groups with the 21 parishioners were undertaken. A component of the Precede-Proceed model (a model for planning health education and health promotion programs and policies) was applied to the findings after direct content analysis of the data. Participants identified pastor leadership, funding for a parish nurse, community-focused interventions, secured infrastructure, and social support from congregation members as pertinent factors required for implementing health promotion programs in Anglican, United, and Catholic churches. The findings have particular relevance for health promotion and public health because they suggest factors that would be necessary to design church-based heart health promotion programs for older adults at risk of chronic diseases.
Directory of Open Access Journals (Sweden)
Miya Soukaina Hakam
2017-10-01
Full Text Available Background/Aims: Pregnancy success requires mandatory maternal tolerance of the semi/ allogeneic embryo involving embryo-derived signals. Expression levels of PreImplantation Factor (PIF, a novel peptide secreted by viable embryos, correlate with embryo development, and its early detection in circulation correlates with a favourable pregnancy outcome. PIF enhances endometrial receptivity to promote embryo implantation. Via the p53 pathway, it increases trophoblast invasion, improving cell survival / immune privilege. PIF also reduces spontaneous and LPS-induced foetal death in immune naïve murine model. We examined PIF effect on gene expression of human leukocyte antigen (HLA-G, -E -F and –C and the influence of PIF on local progesterone activity in JEG-3 choriocarcinoma cells. Methods: PIF and progesterone (P4 effects on JEG-3 cells surface and intracellular HLA molecules was tested using monoclonal antibodies, flow cytometry, and Western blotting. PIF and IL17 effects on P4 and cytokines secretion was determined by ELISA. PIF and P4 effects on JEG-3 cells proteome was examined using 2D gel staining followed by spot analysis, mass spectrometry and bioinformatic analysis. Results: In cytotrophoblastic JEG-3 cells PIF increased intracellular expression of HLA-G, HLA-F, HLA-E and HLA-C and surface expression of HLA-G, HLA-E and HLA-C in dose and time dependent manner. In case of HLA-E, -F results were confirmed also by Western blot. Proteome analysis confirmed an increase in HLA-G, pro-tolerance FOXP3+ regulatory T cells (Tregs, coagulation factors and complement regulator. In contrast, PIF reduced PRDX2 and HSP70s to negate oxidative stress and protein misfolding. PIF enhanced local progesterone activity, increasing steroid secretion and the receptor protein. It also promoted the secretion of the Th1/Th2 cytokines (IL-10, IL-1β, IL-8, GM-CSF and TGF-β1, resulting in improved maternal signalling. Conclusion: PIF can generate a pro
Muellmann, Saskia; Steenbock, Berit; De Cocker, Katrien; De Craemer, Marieke; Hayes, Catherine; O'Shea, Miriam P; Horodyska, Karolina; Bell, Justyna; Luszczynska, Aleksandra; Roos, Gun; Langøien, Lars Jørun; Rugseth, Gro; Terragni, Laura; De Bourdeaudhuij, Ilse; Brug, Johannes; Pischke, Claudia R
2017-12-06
The uptake, implementation, and maintenance of effective interventions promoting physical activity (PA) and a healthy diet and the implementation of policies targeting these behaviors are processes not well understood. We aimed to gain a better understanding of what health promotion professionals and policy makers think are important factors facilitating adoption, implementation, and maintenance of multi-level interventions and policies promoting healthy eating and PA in Belgium, Germany, Ireland, Norway, and Poland. Six interventions and six policies were identified based on pre-defined criteria. Forty semi-structured interviews were conducted with stakeholders from various sectors to elicit information on factors impacting adoption, implementation, and maintenance of these interventions and policies. All interview transcripts were coded in NVivo, using a common categorization matrix. Coding in the respective countries was done by one researcher and validated by a second researcher. Active involvement of relevant stakeholders and good communication between coordinating organizations were described as important factors contributing to successful adoption and implementation of both interventions and policies. Additional facilitating factors included sufficient training of staff and tailoring of materials to match needs of various target groups. The respondents indicated that maintenance of implemented interventions/policies depended on whether they were embedded in existing or newly created organizational structures in different settings and whether continued funding was secured. Despite considerable heterogeneity of interventions and health policies in the five countries, stakeholders across these countries identify similar factors facilitating adoption, implementation, and maintenance of these interventions and policies.
Energy Technology Data Exchange (ETDEWEB)
Adam, Tasneem; Opie, Lionel H. [Hatter Cardiovascular Research Institute, Faculty of Health Sciences, University of Cape Town, Observatory 7925 (South Africa); Essop, M. Faadiel, E-mail: mfessop@sun.ac.za [Cardio-Metabolic Research Group (CMRG), Department of Physiological Sciences, Stellenbosch University, Stellenbosch 7600 (South Africa)
2010-07-30
Research highlights: {yields} AMPK inhibits acetyl-CoA carboxylase beta gene promoter activity. {yields} Nuclear respiratory factor-1 inhibits acetyl-CoA carboxylase beta promoter activity. {yields} AMPK regulates acetyl-CoA carboxylase beta at transcriptional level. -- Abstract: The cardiac-enriched isoform of acetyl-CoA carboxylase (ACC{beta}) produces malonyl-CoA, a potent inhibitor of carnitine palmitoyltransferase-1. AMPK inhibits ACC{beta} activity, lowering malonyl-CoA levels and promoting mitochondrial fatty acid {beta}-oxidation. Previously, AMPK increased promoter binding of nuclear respiratory factor-1 (NRF-1), a pivotal transcriptional modulator controlling gene expression of mitochondrial proteins. We therefore hypothesized that NRF-1 inhibits myocardial ACC{beta} promoter activity via AMPK activation. A human ACC{beta} promoter-luciferase construct was transiently transfected into neonatal cardiomyocytes {+-} a NRF-1 expression construct. NRF-1 overexpression decreased ACC{beta} gene promoter activity by 71 {+-} 4.6% (p < 0.001 vs. control). Transfections with 5'-end serial promoter deletions revealed that NRF-1-mediated repression of ACC{beta} was abolished with a pPII{beta}-18/+65-Luc deletion construct. AMPK activation dose-dependently reduced ACC{beta} promoter activity, while NRF-1 addition did not further decrease it. We also investigated NRF-1 inhibition in the presence of upstream stimulatory factor 1 (USF1), a known transactivator of the human ACC{beta} gene promoter. Here NRF-1 blunted USF1-dependent induction of ACC{beta} promoter activity by 58 {+-} 7.5% (p < 0.001 vs. control), reversed with a dominant negative NRF-1 construct. NRF-1 also suppressed endogenous USF1 transcriptional activity by 55 {+-} 6.2% (p < 0.001 vs. control). This study demonstrates that NRF-1 is a novel transcriptional inhibitor of the human ACC{beta} gene promoter in the mammalian heart. Our data extends AMPK regulation of ACC{beta} to the transcriptional level.
Directory of Open Access Journals (Sweden)
Regina Augustin
2011-01-01
Full Text Available The molecular mechanisms and genetic risk factors underlying Alzheimer's disease (AD pathogenesis are only partly understood. To identify new factors, which may contribute to AD, different approaches are taken including proteomics, genetics, and functional genomics. Here, we used a bioinformatics approach and found that distinct AD-related genes share modules of transcription factor binding sites, suggesting a transcriptional coregulation. To detect additional coregulated genes, which may potentially contribute to AD, we established a new bioinformatics workflow with known multivariate methods like support vector machines, biclustering, and predicted transcription factor binding site modules by using in silico analysis and over 400 expression arrays from human and mouse. Two significant modules are composed of three transcription factor families: CTCF, SP1F, and EGRF/ZBPF, which are conserved between human and mouse APP promoter sequences. The specific combination of in silico promoter and multivariate analysis can identify regulation mechanisms of genes involved in multifactorial diseases.
International Nuclear Information System (INIS)
Zhong, Hua; Wang, Ruoxiang; Kelavkar, Uddhav; Wang, Christopher Y; Simons, Jonathan
2014-01-01
Hypoxia-inducible factor 1α (HIF-1α) is the regulatory subunit of the heterodimeric HIF-1 that plays a critical role in transcriptional regulation of genes in angiogenesis and hypoxic adaptation, while fatty acid metabolism mediated by lipoxygenases has been implicated in a variety of pathogeneses, including cancers. In this study, we report that 15-lipoxygenase 1 (15-LO1), a key member of the lipoxygenase family, promotes HIF-1α ubiquitination and degradation. Altering the level of 15-LO1 yields inverse changes in HIF-1α and HIF-1 transcriptional activity, under both normoxia and hypoxia, and even in CoCl 2 -treated cells where HIF-1α has been artificially elevated. The antagonistic effect of 15-LO1 is mediated by the Pro 564 /hydroxylation/26S proteasome system, while both the enzymatic activity and the intracellular membrane-binding function of 15-LO1 appear to contribute to HIF-1α suppression. Our findings provide a novel mechanism for HIF-1α regulation, in which oxygen-dependent HIF-1 activity is modulated by an oxygen-insensitive lipid metabolic enzyme
Cai, H.
2017-12-01
The Southwest China Karst, the largest continuous karst zone in the world, has suffered serious rock desertification due to the large population pressure in the area. Recent trend analyses have indicated general greening trends in this region. The region has experienced mild climate change, and yet significant land use changes, such as afforestation and reforestation. In addition, out-migration has occurred. Whether climate change or human-induced factors, i.e., ecological afforestation projects and out-migration have primarily promoted forest restoration in this region was investigated in this study, using Guizhou Province as the study area. Based on Moderate-Resolution Imaging Spectroradiometer (MODIS) Normalized Difference Vegetation Index (NDVI) data, we found general greening trends of the forest from 2000 to 2010. About 89% of the forests have experienced an increase in the annual NDVI, and among which, about 41% is statistically significant. For the summer season, more than 65% of the forests have increases in summer NDVI, and about 16% of the increases are significant. The strongest greening trends mainly occurred in the karst areas. Meanwhile, annual average and summer average temperature in this region have increased and the precipitation in most of the region has decreased, although most of these changes were not statistically significant (p > 0.1). A site-based regression analysis using 19 climate stations with minimum land use changes showed that a warming climate coupled with a decrease in precipitation explained some of the changes in the forest NDVI, but the results were not conclusive. The major changes were attributed to human-induced factors, especially in the karst areas. The implications of an ecological afforestation project and out-migration for forest restoration were also discussed, and the need for further investigations at the household level to better understand the out-migration-environment relationship was identified.
Directory of Open Access Journals (Sweden)
Hongyan Cai
2014-10-01
Full Text Available The Southwest China Karst, the largest continuous karst zone in the world, has suffered serious rock desertification due to the large population pressure in the area. Recent trend analyses have indicated general greening trends in this region. The region has experienced mild climate change, and yet significant land use changes, such as afforestation and reforestation. In addition, out-migration has occurred. Whether climate change or human-induced factors, i.e., ecological afforestation projects and out-migration have primarily promoted forest restoration in this region was investigated in this study, using Guizhou Province as the study area. Based on Moderate-Resolution Imaging Spectroradiometer (MODIS Normalized Difference Vegetation Index (NDVI data, we found general greening trends of the forest from 2000 to 2010. About 89% of the forests have experienced an increase in the annual NDVI, and among which, about 41% is statistically significant. For the summer season, more than 65% of the forests have increases in summer NDVI, and about 16% of the increases are significant. The strongest greening trends mainly occurred in the karst areas. Meanwhile, annual average and summer average temperature in this region have increased and the precipitation in most of the region has decreased, although most of these changes were not statistically significant (p > 0.1. A site-based regression analysis using 19 climate stations with minimum land use changes showed that a warming climate coupled with a decrease in precipitation explained some of the changes in the forest NDVI, but the results were not conclusive. The major changes were attributed to human-induced factors, especially in the karst areas. The implications of an ecological afforestation project and out-migration for forest restoration were also discussed, and the need for further investigations at the household level to better understand the out-migration–environment relationship was identified.
Directory of Open Access Journals (Sweden)
Finan Christopher L
2005-03-01
Full Text Available Abstract Background In Micrococcus luteus growth and resuscitation from starvation-induced dormancy is controlled by the production of a secreted growth factor. This autocrine resuscitation-promoting factor (Rpf is the founder member of a family of proteins found throughout and confined to the actinobacteria (high G + C Gram-positive bacteria. The aim of this work was to search for and characterise a cognate gene family in the firmicutes (low G + C Gram-positive bacteria and obtain information about how they may control bacterial growth and resuscitation. Results In silico analysis of the accessory domains of the Rpf proteins permitted their classification into several subfamilies. The RpfB subfamily is related to a group of firmicute proteins of unknown function, represented by YabE of Bacillus subtilis. The actinobacterial RpfB and firmicute YabE proteins have very similar domain structures and genomic contexts, except that in YabE, the actinobacterial Rpf domain is replaced by another domain, which we have called Sps. Although totally unrelated in both sequence and secondary structure, the Rpf and Sps domains fulfil the same function. We propose that these proteins have undergone "non-orthologous domain displacement", a phenomenon akin to "non-orthologous gene displacement" that has been described previously. Proteins containing the Sps domain are widely distributed throughout the firmicutes and they too fall into a number of distinct subfamilies. Comparative analysis of the accessory domains in the Rpf and Sps proteins, together with their weak similarity to lytic transglycosylases, provide clear evidence that they are muralytic enzymes. Conclusions The results indicate that the firmicute Sps proteins and the actinobacterial Rpf proteins are cognate and that they control bacterial culturability via enzymatic modification of the bacterial cell envelope.
Yue, Chen-Li; Shi, Jie-Ran; Shi, Chang-Hong; Zhang, Hai; Zhao, Lei; Zhang, Ting-Fen; Zhao, Yong; Xi, Li
2008-10-01
To express Micrococcus luteus resuscitation promoting factor (Rpf) domain and its mutants in prokaryotic cells, and to investigate their bioactivity. The gene of Rpf domain and its mutants (E54K, E54A) were amplified by polymerase chain reaction (PCR) from the genome of Micrococcus luteus and cloned into pMD18-T vector. After sequenced, the Rpf domain and its mutant gene were subcloned into expression vector PGEX-4T-1, and transfected into E. coli DH5alpha. The expressed product was purified by affinity chromatography using GST Fusion Protein Purification bead. The aim proteins were identified by SDS-PAGE analysis and by Western blot with monoclonal antibodies against Rpf domain (mAb). The bioactivity of the proteins was analyzed by stimulating the resuscitation of Mycobacterium smegmatis. The sequences of the PCR products were identical to those of the Rpf domain and its mutant gene in GenBank. The relative molecular mass identified by SDS-PAGE analysis was consistent with that had been reported, which was also confirmed by Western blot analysis that there were specific bindings at 32 000 with Rpf domain mAb. The purified GST-Rpf domain could stimulate resuscitation of Mycobacterium smegmatis. Replacements E54A and especially E54K resulted in inhibition of Rpf resuscitation activity. Rpf domain and two kinds of its mutant protein were obtained, and its effects on the resuscitation of dormant Mycobacterium smegmatis were clarified.
Huang, Guobao; Sun, Tangqing; Zhang, Lei; Wu, Qiuhe; Zhang, Keyan; Tian, Qingfen; Huo, Ran
2014-06-01
The aim of the present study was to evaluate the clinical therapeutic effect of the combined application of alginate and recombinant human granulocyte-macrophage colony-stimulating factor (rhGM-CSF) on the healing of refractory chronic skin ulcers. A single center, three arm, randomized study was performed at Jinan Central Hospital (Jinan, Shandong, China). A total of 60 patients with refractory chronic skin ulcers, which persisted for >1 month, were enrolled and randomly assigned into one of the following three groups: alginate dressing/rhGM-CSF group (group A), rhGM-CSF only group (group B) and conventional (vaseline dressing) group (group C). The wound area rate was measured, granulation and color were observed and pain was evaluated. The data were summarized and statistical analysis was performed. The results demonstrated that group A exhibited a significantly faster wound healing rate and lower pain score compared with the other groups (PCSF for the treatment of refractory chronic skin ulcers demonstrated significant advantages. It promoted the growth of granulation tissue, accelerated re-epithelialization and also effectively reduced wound pain, and thus improved the quality of life for the patient. This suggests that the combined application of alginate and rhGM-CSF may be an effective therapeutic strategy for the clinical treatment of refractory chronic skin ulcers.
Malachowa, Natalia; Kohler, Petra L; Schlievert, Patrick M; Chuang, Olivia N; Dunny, Gary M; Kobayashi, Scott D; Miedzobrodzki, Jacek; Bohach, Gregory A; Seo, Keun Seok
2011-01-01
Staphylococcus aureus is a prominent human pathogen and a leading cause of community- and hospital-acquired bacterial infections worldwide. Herein, we describe the identification and characterization of the S. aureus 67.6-kDa hypothetical protein, named for the surface factor promoting resistance to oxidative killing (SOK) in this study. Sequence analysis showed that the SOK gene is conserved in all sequenced S. aureus strains and homologous to the myosin cross-reactive antigen of Streptococcus pyogenes. Immunoblotting and immunofluorescence analysis showed that SOK was copurified with membrane fractions and was exposed on the surface of S. aureus Newman and RN4220. Comparative analysis of wild-type S. aureus and an isogenic deletion strain indicated that SOK contributes to both resistance to killing by human neutrophils and to oxidative stress. In addition, the S. aureus sok deletion strain showed dramatically reduced aortic valve vegetation and bacterial cell number in a rabbit endocarditis model. These results, plus the suspected role of the streptococcal homologue in certain diseases such as acute rheumatic fever, suggest that SOK plays an important role in cardiovascular and other staphylococcal infections.
Rajput, Pallavi; Pandey, Vijaya; Kumar, Vijay
2016-08-01
The well-studied Pol II transcription factor Sp1 has not been investigated for its regulatory role in rDNA transcription. Here, we show that Sp1 bound to specific sites on rDNA and localized into the nucleoli during the G1 phase of cell cycle to activate rDNA transcription. It facilitated the recruitment of Pol I pre-initiation complex and impeded the binding of nucleolar remodeling complex (NoRC) to rDNA resulting in the formation of euchromatin active state. More importantly, Sp1 also orchestrated the site-specific binding of Gadd45a-nucleotide excision repair (NER) complex resulting in active demethylation and transcriptional activation of rDNA. Interestingly, knockdown of Sp1 impaired rDNA transcription due to reduced engagement of the Gadd45a-NER complex and hypermethylation of rDNA. Thus, the present study unveils a novel role of Sp1 in rDNA transcription involving promoter demethylation. Copyright © 2016 Elsevier B.V. All rights reserved.
Energy Technology Data Exchange (ETDEWEB)
Boone, Lindsey R.; Niesen, Melissa I. [Department of Molecular Medicine, College of Medicine, University of South Florida, Tampa, FL (United States); Jaroszeski, Mark [Department of Chemical and Biomedical Engineering, College of Engineering, University of South Florida, Tampa, FL (United States); Ness, Gene C., E-mail: gness@hsc.usf.edu [Department of Molecular Medicine, College of Medicine, University of South Florida, Tampa, FL (United States)
2009-07-31
The promoter elements and transcription factors necessary for triiodothyronine (T{sub 3}) induction of hepatic HMG-CoA reductase (HMGR) were investigated by transfecting rat livers with wild type and mutant HMGR promoter-luciferase constructs using in vivo electroporation. Mutations in the sterol response element (SRE), nuclear factor-y (NF-Y) site, and the newly identified upstream transcription factor-2 (USF-2) site essentially abolished the T{sub 3} response. Chromatin immunoprecipitation (ChIP) analysis demonstrated that T{sub 3} treatment caused a 4-fold increase in in vivo binding of USF-2 to the HMGR promoter. Co-transfection of the wild type HMGR promoter with siRNAs to USF-2, SREBP-2, or NF-Y nearly abolished the T{sub 3} induction, as measured by promoter activity. These data provide in vivo evidence for functional roles for USF-2, SREBP-2, and NF-Y in mediating the T{sub 3}-induction of hepatic HMGR transcription.
International Nuclear Information System (INIS)
Zhao Cunyou; Chen Yali; Park, Jiyoung; Kim, Jae Bum; Tang Hong
2004-01-01
Transcription initiation from HIV-1 long terminal repeat (LTR) promoter requires the virally encoded transactivator, Tat, and several cellular co-factors to accomplish the Tat-dependent processive transcription elongation. Individual cellular transcription activators, LBP-1b and Oct-1, on the other hand, have been shown to inhibit LTR promoter activities probably via competitive binding against TFIID to the TATA-box in LTR promoter. To explore the genetic interference strategies against the viral replication, we took advantage of the existence of the bipartite DNA binding domains and the repression domains of LBP-1b and Oct-1 factors to generate a chimeric transcription repressor. Our results indicated that the fusion protein of LBP-1b and Oct-1 exhibited higher DNA binding affinity to the viral promoter than the individual factors, and little interference with the host cell gene expression due to its anticipated rare cognate DNA sites in the host cell genome. Moreover, the chimera exerted increased Tat-dependent repression of transcription initiation at the LTR promoter both in vitro and in vivo compared to LBP-1b, Oct-1 or combination of LBP-1b and Oct-1. These results might provide the lead in generating a therapeutic reagent useful to suppress HIV-1 replication
Guise, Jeanne-Marie; Winter, Susan; Fiore, Stephen M; Regensteiner, Judith G; Nagel, Joan
2017-04-01
Research organizations face challenges in creating infrastructures that cultivates and sustains interdisciplinary team science. The objective of this paper is to identify structural elements of organizations and training that promote team science. We qualitatively analyzed the National Institutes of Health's Building Interdisciplinary Research Careers in Women's Health, K12 using organizational psychology and team science theories to identify organizational design factors for successful team science and training. Seven key design elements support team science: (1) semiformal meta-organizational structure, (2) shared context and goals, (3) formal evaluation processes, (4) meetings to promote communication, (5) role clarity in mentoring, (6) building interpersonal competencies among faculty and trainees, and (7) designing promotion and tenure and other organizational processes to support interdisciplinary team science. This application of theory to a long-standing and successful program provides important foundational elements for programs and institutions to consider in promoting team science.
Directory of Open Access Journals (Sweden)
Xi Li
2017-07-01
Full Text Available Placental growth factor (PlGF, a member of the vascular endothelial growth factor (VEGF family, mediates wound healing and inflammatory responses, exerting an effect on liver fibrosis and angiogenesis; however, the precise mechanism remains unclear. The aims of this study are to identify the role of PlGF in liver inflammation and fibrosis induced by bile duct ligation (BDL in mice and to reveal the underlying molecular mechanism. PlGF small interfering RNA (siRNA or non-targeting control siRNA was injected by tail vein starting 2 days after BDL. Liver inflammation, fibrosis, angiogenesis, macrophage infiltration, and hepatic stellate cells (HSCs activation were examined. Our results showed that PlGF was highly expressed in fibrotic livers and mainly distributed in activated HSCs and macrophages. Furthermore, PlGF silencing strongly reduced the severity of liver inflammation and fibrosis, and inhibited the activation of HSCs. Remarkably, PlGF silencing also attenuated BDL-induced hepatic angiogenesis, as evidenced by attenuated liver endothelial cell markers CD31 and von Willebrand factor immunostaining and genes or protein expression. Interestingly, these pathological ameliorations by PlGF silencing were due to a marked reduction in the numbers of intrahepatic F4/80+, CD68+, and Ly6C+ cell populations, which were reflected by a lower expression of these macrophage marker molecules in fibrotic livers. In addition, knockdown of PlGF by siRNA inhibited macrophages activation and substantially suppressed the expression of pro-inflammatory cytokines and chemokines in fibrotic livers. Mechanistically, evaluation of cultured RAW 264.7 cells revealed that VEGF receptor 1 (VEGFR1 mainly involved in mediating the role of PlGF in macrophages recruitment and activation, since using VEGFR1 neutralizing antibody blocking PlGF/VEGFR1 signaling axis significantly inhibited macrophages migration and inflammatory responses. Together, these findings indicate
International Nuclear Information System (INIS)
Hatano, Yu; Nakahama, Ken-ichi; Isobe, Mitsuaki; Morita, Ikuo
2014-01-01
Highlights: • M-CSF and RANKL expressing HeLa cells induced osteoclastogenesis in vitro. • We established OGC-containing tumor model in vivo. • OGC-containing tumor became larger independent of M-CSF or RANKL effect. • VEGF-C secreted from OGCs was a one of candidates for OGC-containing tumor growth. - Abstract: Tumors with osteoclast-like giant cells (OGCs) have been reported in a variety of organs and exert an invasive and prometastatic phenotype, but the functional role of OGCs in the tumor environment has not been fully clarified. We established tumors containing OGCs to clarify the role of OGCs in tumor phenotype. A mixture of HeLa cells expressing macrophage colony-stimulating factor (M-CSF, HeLa-M) and receptor activator of nuclear factor-κB ligand (RANKL, HeLa-R) effectively supported the differentiation of osteoclast-like cells from bone marrow macrophages in vitro. Moreover, a xenograft study showed OGC formation in a tumor composed of HeLa-M and HeLa-R. Surprisingly, the tumors containing OGCs were significantly larger than the tumors without OGCs, although the growth rates were not different in vitro. Histological analysis showed that lymphangiogenesis and macrophage infiltration in the tumor containing OGCs, but not in other tumors were accelerated. According to quantitative PCR analysis, vascular endothelial growth factor (VEGF)-C mRNA expression increased with differentiation of osteoclast-like cells. To investigate whether VEGF-C expression is responsible for tumor growth and macrophage infiltration, HeLa cells overexpressing VEGF-C (HeLa-VC) were established and transplanted into mice. Tumors composed of HeLa-VC mimicked the phenotype of the tumors containing OGCs. Furthermore, the vascular permeability of tumor microvessels also increased in tumors containing OGCs and to some extent in VEGF-C-expressing tumors. These results suggest that macrophage infiltration and vascular permeability are possible mediators in these tumors. These
Jackson, Erin S.; Tucker, Carolyn M.; Herman, Keith C.
2007-01-01
During their college years, students may adopt health-promoting lifestyles that bring about long-term benefits. Objective and Participants: The purpose of this study was to explore the roles of health value, family/friend social support, and health self-efficacy in the health-promoting lifestyles of a diverse sample of 162 college students.…
van der Laan, A.M.; Veenstra, R.; Bogaerts, S.; Verhulst, F.C.; Ormel, J.
This study uses a social-ecological approach to the development of delinquency. The authors emphasize that a balance between eliminating risk and enhancing protection across domains is essential in reducing problems and promoting competence. The cumulative risk and promotive effects of temperament,
A.M. van der Laan (André); R. Veenstra (René); S. Bogaerts (Stefan); F.C. Verhulst (Frank); J. Ormel (Johan Hans)
2010-01-01
textabstractThis study uses a social-ecological approach to the development of delinquency. The authors emphasize that a balance between eliminating risk and enhancing protection across domains is essential in reducing problems and promoting competence. The cumulative risk and promotive effects of
Shields, Margaret M.; Thomas, Katherine H.; Paschal, Angelia; Tucker, Melanie; Leeper, James; Usdan, Stuart
2017-01-01
Biking is a popular recreational activity, and understanding how to promote participation is important to college health and recreation professionals. The purpose of this study was to examine factors contributing to cycling behaviors on one large college campus from an ecological perspective. Students were surveyed at a southeastern university in…
Ostaszewski, Krzysztof; Zimmerman, Marc A
2006-12-01
Resiliency theory provides a conceptual framework for studying why some youth exposed to risk factors do not develop the negative behaviors they predict. The purpose of this study was to test compensatory and protective models of resiliency in a longitudinal sample of urban adolescents (80% African American). The data were from Years 1 (9th grade) and 4 (12th grade). The study examined effects of cumulative risk and promotive factors on adolescent polydrug use including alcohol, tobacco and marijuana. Cumulative measures of risk/promotive factors represented individual characteristics, peer influence, and parental/familial influences. After controlling for demographics, results of multiple regression of polydrug use support the compensatory model of resiliency both cross-sectionally and longitudinally. Promotive factors were also found to have compensatory effects on change in adolescent polydrug use. The protective model of resiliency evidenced cross-sectionally was not supported in longitudinal analysis. The findings support resiliency theory and the use of cumulative risk/promotive measures in resiliency research. Implications focused on utilizing multiple assets and resources in prevention programming are discussed.
Chakraborty, Ujani; Dinh, Timothy A; Alani, Eric
2018-04-13
Mismatch repair (MMR) proteins act in spellchecker roles to excise misincorporation errors that occur during DNA replication. Curiously, large-scale analyses of a variety of cancers showed that increased expression of MMR proteins often correlated with tumor aggressiveness, metastasis, and early recurrence. To better understand these observations, we used the TCGA and GENT databases to analyze MMR protein expression in cancers. We found that the MMR genes MSH2 and MSH6 are overexpressed more frequently than MSH3 , and that MSH2 and MSH6 are often co-overexpressed as a result of copy number amplifications of these genes. These observations encouraged us to test the effects of upregulating MMR protein levels in baker's yeast, where we can sensitively monitor genome instability phenotypes associated with cancer initiation and progression. Msh6 overexpression (2 to 4-fold) almost completely disrupted mechanisms that prevent recombination between divergent DNA sequences by interacting with the DNA polymerase processivity clamp PCNA and by sequestering the Sgs1 helicase. Importantly, co-overexpression of Msh2 and Msh6 (∼8-fold) conferred, in a PCNA interaction dependent manner, several genome instability phenotypes including increased mutation rate, increased sensitivity to the DNA replication inhibitor hydroxyurea and the DNA damaging agents methyl methanesulfonate and 4-nitroquinoline N-oxide, and elevated loss of heterozygosity. Msh2 and Msh6 co-overexpression also altered the cell cycle distribution of exponentially growing cells, resulting in an increased fraction of unbudded cells, consistent with a larger percentage of cells in G1. These novel observations suggested that overexpression of MSH factors affected the integrity of the DNA replication fork, causing genome instability phenotypes that could be important for promoting cancer progression. Copyright © 2018, Genetics.
Oki, Hiroshi; Yazawa, Takuya; Baba, Yasuko; Kanegae, Yumi; Sato, Hanako; Sakamoto, Seiko; Goto, Takahisa; Saito, Izumu; Kurahashi, Kiyoyasu
2017-07-01
Pulmonary emphysema impairs quality of life and increases mortality. It has previously been shown that administration of adenovirus vector expressing murine keratinocyte growth factor (KGF) before elastase instillation prevents pulmonary emphysema in mice. We therefore hypothesized that therapeutic administration of KGF would restore damage to lungs caused by elastase instillation and thus improve pulmonary function in an animal model. KGF expressing adenovirus vector, which prevented bleomycin-induced pulmonary fibrosis in a previous study, was constructed. Adenovirus vector (1.0 × 10 9 plaque-forming units) was administered intratracheally one week after administration of elastase into mouse lungs. One week after administration of KGF-vector, exercise tolerance testing and blood gas analysis were performed, after which the lungs were removed under deep anesthesia. KGF-positive pneumocytes were more numerous, surfactant protein secretion in the airspace greater and mean linear intercept of lungs shorter in animals that had received KGF than in control animals. Unexpectedly, however, arterial blood oxygenation was worse in the KGF group and maximum running speed, an indicator of exercise capacity, had not improved after KGF in mice with elastase-induced emphysema, indicating that KGF-expressing adenovirus vector impaired pulmonary function in these mice. Notably, vector lacking KGF-expression unit did not induce such impairment, implying that the KGF expression unit itself may cause the damage to alveolar cells. Possible involvement of the CAG promoter used for KGF expression in impairing pulmonary function is discussed. © 2017 The Societies and John Wiley & Sons Australia, Ltd.
Li, Zhenyuan; Yan, Hao; Yuan, Jiangzi; Cao, Liou; Lin, Aiwu; Dai, Huili; Ni, Zhaohui; Qian, Jiaqi; Fang, Wei
2018-04-01
Molecular mechanisms of peritoneal dialysis (PD) ultrafiltration failure, peritoneal neo-angiogenesis, and fibrosis remain to be determined. We aimed to determine the role of heparin-binding EGF-like growth factor (HB-EGF) inhibition on angiogenesis of peritoneal membrane in a PD rat model. 32 male Wistar rats were assigned into (1) control group; (2) uremic non-PD group: subtotal nephrectomy-induced uremic rats without PD; (3) uremic rats subjected to PD: uremic rats that were dialyzed with Dianeal ® for 4 weeks; (4) CRM 197 group: dialyzed uremic rats were supplemented with CRM197, a specific HB-EGF inhibitor. Peritoneal transport function was examined by peritoneal equilibration test. Expression of HB-EGF and EGFR in peritoneal samples were examined by real-time PCR, immunohistochemical staining, and western blot. Progressive angiogenesis and fibrosis were observed in uremic PD rats, and there were associated with decreased net ultrafiltration (nUF), increased permeability of peritoneal membrane, and reduced expression of HB-EGF and EGFR protein and mRNA in uremic PD rats compared to uremic non-PD or control groups (both p CRM197 significantly induced peritoneal membrane permeability, decreased nUF, increased higher vessel density, and reduced pericyte count compared to that of uremic PD rats. The levels of HB-EGF and EGFR expression negatively correlated with vessel density in peritoneal membrane (both p < 0.001). PD therapy was associated with peritoneal angiogenesis, functional deterioration, and downregulation of HB-EGF/EGFR. Pharmacological inhibition of HB-EGF promoted PD-induced peritoneal angiogenesis and fibrosis and ultrafiltration decline, suggesting that HB-EGF downregulation contributes to peritoneal functional deterioration in the uremic PD rat model.
Hou, Jian-ming; Wu, Man; Lin, Qing-ming; Lin, Fan; Xue, Ying; Lan, Xu-hua; Chen, En-yu; Wang, Mei-li; Yang, Hai-yan; Wang, Feng-xiong
2014-08-01
The aim of this study was to explore the effect of lactoferrin (LF) in primary fetal rat osteoblasts proliferation and differentiation and investigate the underlying molecular mechanisms. Primary rat osteoblasts were obtained from the calvarias of neonatal rats. Osteoblasts were treated with LF (0.1-1000 μg/mL), or OSI-906 [a selective inhibitor of insulin-like growth factor 1 (IGF-1) receptor and insulin receptor]. The IGF-1 was then knocked down by small hairpin RNA (shRNA) technology and then was treated with recombinant human IGF-1 or LF. Cell proliferation and differentiation were measured by MTT assay and alkaline phosphatase (ALP) assay, respectively. The expression of IGF-1 and IGF binding protein 2 (IGFBP2) mRNA were analyzed using real-time PCR. LF promotes the proliferation and differentiation of osteoblasts in a certain range (1-100 μg/mL) in time- and dose-dependent manner. The mRNA level of IGF-1 was significantly increased, while the expression of IGFBP2 was suppressed by LF treatment. Knockdown of IGF-1 by shRNA in primary rat osteoblast dramatically decreased the abilities of proliferation and differentiation of osteoblasts and blocked the proliferation and differentiation effect of LF in osteoblasts. OSI906 (5 μM) blocked the mitogenic and differentiation of LF in osteoblasts. Proliferation and differentiation of primary rat osteoblasts in response to LF are mediated in part by stimulating of IGF-1 gene expression and alterations in the gene expression of IGFBP2.
Directory of Open Access Journals (Sweden)
Yong-Ling Liao
2015-01-01
Full Text Available WRKY transcription factor is involved in multiple life activities including plant growth and development as well as biotic and abiotic responses. We identified 28 WRKY genes from transcriptome data of Ginkgo biloba according to conserved WRKY domains and zinc finger structure and selected three WRKY genes, which are GbWRKY2, GbWRKY16, and GbWRKY21, for expression pattern analysis. GbWRKY2 was preferentially expressed in flowers and strongly induced by methyl jasmonate. Here, we cloned the full-length cDNA and genomic DNA of GbWRKY2. The full-length cDNA of GbWRKY2 was 1,713 bp containing a 1,014 bp open reading frame encoding a polypeptide of 337 amino acids. The GbWRKY2 genomic DNA had one intron and two exons. The deduced GbWRKY2 contained one WRKY domain and one zinc finger motif. GbWRKY2 was classified into Group II WRKYs. Southern blot analysis revealed that GbWRKY2 was a single copy gene in G. biloba. Many cis-acting elements related to hormone and stress responses were identified in the 1,363 bp-length 5′-flanking sequence of GbWRKY2, including W-box, ABRE-motif, MYBCOREs, and PYRIMIDINE-boxes, revealing the molecular mechanism of upregulated expression of GbWRKY2 by hormone and stress treatments. Further functional characterizations in transiently transformed tobacco leaves allowed us to identify the region that can be considered as the minimal promoter.
Aguilera, Valeria; Briceño, Luis; Contreras, Hector; Lamperti, Liliana; Sepúlveda, Esperanza; Díaz-Perez, Francisca; León, Marcelo; Veas, Carlos; Maura, Rafael; Toledo, Jorge Roberto; Fernández, Paulina; Covarrubias, Ambart; Zuñiga, Felipe Andrés; Radojkovic, Claudia; Escudero, Carlos; Aguayo, Claudio
2014-01-01
Mesenchymal stem cells have a high capacity for trans-differentiation toward many adult cell types, including endothelial cells. Feto-placental tissue, such as Wharton's jelly is a potential source of mesenchymal stem cells with low immunogenic capacity; make them an excellent source of progenitor cells with a potential use for tissue repair. We evaluated whether administration of endothelial cells derived from mesenchymal stem cells isolated from Wharton's jelly (hWMSCs) can accelerate tissue repair in vivo. Mesenchymal stem cells were isolated from human Wharton's jelly by digestion with collagenase type I. Endothelial trans-differentiation was induced for 14 (hWMSC-End14d) and 30 (hWMSC-End30d) days. Cell phenotyping was performed using mesenchymal (CD90, CD73, CD105) and endothelial (Tie-2, KDR, eNOS, ICAM-1) markers. Endothelial trans-differentiation was demonstrated by the expression of endothelial markers and their ability to synthesize nitric oxide (NO). hWMSCs can be differentiated into adipocytes, osteocytes, chondrocytes and endothelial cells. Moreover, these cells show high expression of CD73, CD90 and CD105 but low expression of endothelial markers prior to differentiation. hWMSCs-End express high levels of endothelial markers at 14 and 30 days of culture, and also they can synthesize NO. Injection of hWMSC-End30d in a mouse model of skin injury significantly accelerated wound healing compared with animals injected with undifferentiated hWMSC or injected with vehicle alone. These effects were also observed in animals that received conditioned media from hWMSC-End30d cultures. These results demonstrate that mesenchymal stem cells isolated from Wharton's jelly can be cultured in vitro and trans-differentiated into endothelial cells. Differentiated hWMSC-End may promote neovascularization and tissue repair in vivo through the secretion of soluble pro-angiogenic factors.
Directory of Open Access Journals (Sweden)
Brandon K Sack
Full Text Available The major complication in the treatment of hemophilia A is the development of neutralizing antibodies (inhibitors against factor VIII (FVIII. The current method for eradicating inhibitors, termed immune tolerance induction (ITI, is costly and protracted. Clinical protocols that prevent rather than treat inhibitors are not yet established. Liver-directed gene therapy hopes to achieve long-term correction of the disease while also inducing immune tolerance. We sought to investigate the use of adeno-associated viral (serotype 8 gene transfer to induce tolerance to human B domain deleted FVIII in hemophilia A mice. We administered an AAV8 vector with either human B domain deleted FVIII or a codon-optimized transgene, both under a liver-specific promoter to two strains of hemophilia A mice. Protein therapy or gene therapy was given either alone or in conjunction with anti-CD20 antibody-mediated B cell depletion. Gene therapy with a low-expressing vector resulted in sustained near-therapeutic expression. However, supplementary protein therapy revealed that gene transfer had sensitized mice to hFVIII in a high-responder strain but not in mice of a low-responding strain. This heightened response was ameliorated when gene therapy was delivered with anti-murine CD20 treatment. Transient B cell depletion prevented inhibitor formation in protein therapy, but failed to achieve a sustained hypo-responsiveness. Importantly, use of a codon-optimized hFVIII transgene resulted in sustained therapeutic expression and tolerance without a need for B cell depletion. Therefore, anti-CD20 may be beneficial in preventing vector-induced immune priming to FVIII, but higher levels of liver-restricted expression are preferred for tolerance.
Cheng, Yang; Jiang, Shuyi; Yuan, Jin; Liu, Junxiu; Simoncini, Tommaso
2018-04-16
Vascular endothelial growth factor C (VEGF-C) accelerates cervical cancer metastasis, while the detailed mechanism remains largely unknown. Recent evidence indicates that microRNA play a crucial role in controlling cancer cell invasiveness. In the present study, we investigated the role of miR-326 in VEGF-C-induced cervical cancer cell invasion. VEGF-C expression was higher and miR-326 was much lower in primary cervical cancer specimens than that in non-cancerous specimens, and a negative correlation between VEGF-C and miR-326 was found. On cervical carcinoma cell line SiHa cells, treatment with VEGF-C downregulated miR-326 level and increased cortactin protein expression. Transfection with miR-326 mimic reversed cortactin expression induced by VEGF-C, suggesting that VEGF-C increased cortactin via downregulation of miR-326. VEGF-C activated c-Src and c-Src inhibitor PP2 abolished VEGF-C effect on miR-326 and cortactin expression, implying that VEGF-C regulated miR-326/cortactin via c-Src signaling. VEGF-C promoted SiHa cell invasion index, which was largely inhibited by transfection with miR-326 antagonist or by siRNA against cortactin. In conclusion, our findings implied that VEGF-C reduced miR-326 expression and increased cortactin expression through c-Src signaling, leading to enhanced cervical cancer invasiveness. This may shed light on potential therapeutic strategies for cervical cancer therapy.
E1A-dependent trans-activation of the human MYC promoter is mediated by the E2F factor
International Nuclear Information System (INIS)
Hiebert, S.W.; Lipp, M.; Nevins, J.R.
1989-01-01
E2F is a cellular transcription factor that binds to two sites in the adenovirus E2 promoter. Previous experiments have implicated E2F in the E1A-dependent transactivation of the E2 gene since levels of active E2F increase markedly during adenovirus infection in parallel with the increase in E2 transcription, and an E2F binding site can confer E1A inducibility to a heterologous promoter. Here the authors show that E2F binds to two sequence elements within the P2 promoter of the human MYC gene which are within a region that is critical for promoter activity. The MYC promoter can be trans-activated in an E1A-dependent manner and site-directed mutagenesis demonstrates that these E2F elements are essential for trans-activation. Finally, they also find that adenovirus infection of quiescent cells results in a stimulation of the endogenous MYC gene. They conclude that the activation of the E2F factor, which is likely responsible for the activation of viral E2 transcription, is also responsible for the E1A-dependent induction of MYC transcription
International Nuclear Information System (INIS)
Inoue-Toyoda, Maki; Kato, Kohsuke; Nagata, Kyosuke; Yoshikawa, Hiroyuki
2015-01-01
Human cytomegalovirus (HCMV) is a common and usually asymptomatic virus agent in healthy individuals. Initiation of HCMV productive infection depends on expression of the major immediate early (MIE) genes. The transcription of HCMV MIE genes is regulated by a diverse set of transcription factors. It was previously reported that productive HCMV infection is triggered probably by elevation of the plasma hydroxycorticoid level. However, it is poorly understood whether the transcription of MIE genes is directly regulated by glucocorticoid. Here, we found that the dexamethasone (DEX), a synthetic glucocorticoid, facilitates the transcription of HCMV MIE genes through the MIE promoter and enhancer in a glucocorticoid receptor (GR)-dependent manner. By competitive EMSA and reporter assays, we revealed that an NF-I like protein is involved in DEX-mediated transcriptional activation of the MIE promoter. Thus, this study supports a notion that the increased level of hydroxycorticoid in the third trimester of pregnancy reactivates HCMV virus production from the latent state. - Highlights: • DEX facilitates the transcription from the HCMV MIE promoter. • GR is involved in DEX-dependent transcription from the HCMV MIE promoter. • A 17 bp repeat is responsible for the HCMV MIE promoter activation by DEX. • An NF-I-like protein is involved in the HCMV MIE promoter activation by DEX
Directory of Open Access Journals (Sweden)
Deepti Jain
Full Text Available Plants respond to different forms of stresses by inducing transcription of a common and distinct set of genes by concerted actions of a cascade of transcription regulators. We previously reported that a gene, CaZF encoding a C2H2-zinc finger family protein from chickpea (Cicer arietinum imparted high salinity tolerance when expressed in tobacco plants. We report here that in addition to promoting tolerance against dehydration, salinity and high temperature, the CaZF overexpressing plants exhibited similar phenotype of growth and development like the plants overexpressing CAP2, encoding an AP2-family transcription factor from chickpea. To investigate any relationship between these two genes, we performed gene expression analysis in the overexpressing plants, promoter-reporter analysis and chromatin immunoprecipitation. A number of transcripts that exhibited enhanced accumulation upon expression of CAP2 or CaZF in tobacco plants were found common. Transient expression of CAP2 in chickpea leaves resulted in increased accumulation of CaZF transcript. Gel mobility shift and transient promoter-reporter assays suggested that CAP2 activates CaZF promoter by interacting with C-repeat elements (CRTs in CaZF promoter. Chromatin immunoprecipitation (ChIP assay demonstrated an in vivo interaction of CAP2 protein with CaZF promoter.
Directory of Open Access Journals (Sweden)
Mohammad Ghorbani
2016-01-01
Full Text Available In this study we investigate the importance of agricultural sector research and technology organizations (RTO in the national economic system. The main objective of the paper is to identify and rank the factors affecting the promotion of these RTOs share in saffron’s added value. Through the literature review we extracted all the relevant factors that have been mentioned by different researchers. Then, we classified these factors into six components: applied research, technology acquisition, commercialization, market development, industry’s internal factors and national macro factors. We used a Likert scale questionnaire to gather the data about the importance of each factor based on research and technology experts’ points of view. To analyze the data we utilized confirmatory factor analysis and structural equation modeling (SEM methods using SPSS and smart PLS software packages. The results show that the most important factor affecting the share of agricultural RTOs in a products added value is the promotion of industrial firms to invest in the field of agricultural research and development. Finally, according to the obtained results, some suggestions for improving research and technology have been provided.
Directory of Open Access Journals (Sweden)
Cohn Steven M
2010-05-01
Full Text Available Abstract Background Intestinal cell kinase (ICK; GeneID 22858 is a conserved MAPK and CDK-like kinase that is widely expressed in human tissues. Data from the Cancer Genome Anatomy Project indicated ICK mRNA is increased in cancer, and that its expression correlated with expression of mRNA for an uncharacterized F-box protein, FBX9 (GeneID: 26268. ICK and FBX9 genes are arranged head-to-head on opposite strands, with start sites for transcription separated by ~3.3 kb. We hypothesized ICK and FBX9 are potentially important genes in cancer controlled by a bidirectional promoter. Results We assessed promoter activity of the intergenic region in both orientations in cancer cell lines derived from breast (AU565, SKBR3, colon (HCT-15, KM12, and stomach (AGS cancers, as well as in embryonic human kidney (HEK293T cells. The intergenic segment was active in both orientations in all of these lines, and ICK promoter activity was greater than FBX9 promoter activity. Results from deletions and truncations defined a minimal promoter for ICK, and revealed that repressors and enhancers differentially regulate ICK versus FBX9 promoter activity. The ICK promoter contains consensus motifs for several FOX-family transcription factors that align when mouse and human are compared using EMBOSS. FOXA1 and FOXA2 increase luciferase activity of a minimal promoter 10-20 fold in HEK293T cells. Consensus sites for TCF7L2 (TCF4 (Gene Id: 6934 are also present in both mouse and human. The expression of β-catenin increased activity of the minimal promoter ~10 fold. ICK reference mRNAs (NM_014920.3, NM_016513 are expressed in low copy number and increased in some breast cancers, using a ten base tag 5'-TCAACCTTAT-3' specific for both ICK transcripts. Conclusion ICK and FBX9 are divergently transcribed from a bidirectional promoter that is GC-rich and contains a CpG island. A minimal promoter for ICK contains functional sites for β-cateinin/TCF7L2 and FOXA. These data are
Yu, Ting; Xu, Bei; He, Lili; Xia, Shan; Chen, Yan; Zeng, Jun; Liu, Yongmei; Li, Shuangzhi; Tan, Xiaoyue; Ren, Ke; Yao, Shaohua; Song, Xiangrong
2016-01-01
Anti-angiogenesis has been proposed as an effective therapeutic strategy for cancer treatment. Pigment epithelium-derived factor (PEDF) is one of the most powerful endogenous anti-angiogenic reagents discovered to date and PEDF gene therapy has been recognized as a promising treatment option for various tumors. There is an urgent need to develop a safe and valid vector for its systemic delivery. Herein, a novel gene delivery system based on the newly synthesized copolymer COOH-PEG-PLGA-COOH (CPPC) was developed in this study, which was probably capable of overcoming the disadvantages of viral vectors and cationic lipids/polymers-based nonviral carriers. PEDF gene loaded CPPC nanoparticles (D-NPs) were fabricated by a modified double-emulsion water-in-oil-in-water (W/O/W) solvent evaporation method. D-NPs with uniform spherical shape had relatively high drug loading (~1.6%), probably because the introduced carboxyl group in poly (D,L-lactide-co-glycolide) terminal enhanced the interaction of copolymer with the PEDF gene complexes. An excellent in vitro antitumor effect was found in both C26 and A549 cells treated by D-NPs, in which PEDF levels were dramatically elevated due to the successful transfection of PEDF gene. D-NPs also showed a strong inhibitory effect on proliferation of human umbilical vein endothelial cells in vitro and inhibited the tumor-induced angiogenesis in vivo by an alginate-encapsulated tumor cell assay. Further in vivo antitumor investigation, carried out in a C26 subcutaneous tumor model by intravenous injection, demonstrated that D-NPs could achieve a significant antitumor activity with sharply reduced microvessel density and significantly promoted tumor cell apoptosis. Additionally, the in vitro hemolysis analysis and in vivo serological and biochemical analysis revealed that D-NPs had no obvious toxicity. All the data indicated that the novel CPPC nanoparticles were ideal vectors for the systemic delivery of PEDF gene and might be widely
Directory of Open Access Journals (Sweden)
Yu T
2016-02-01
proliferation of human umbilical vein endothelial cells in vitro and inhibited the tumor-induced angiogenesis in vivo by an alginate-encapsulated tumor cell assay. Further in vivo antitumor investigation, carried out in a C26 subcutaneous tumor model by intravenous injection, demonstrated that D-NPs could achieve a significant antitumor activity with sharply reduced microvessel density and significantly promoted tumor cell apoptosis. Additionally, the in vitro hemolysis analysis and in vivo serological and biochemical analysis revealed that D-NPs had no obvious toxicity. All the data indicated that the novel CPPC nanoparticles were ideal vectors for the systemic delivery of PEDF gene and might be widely used as systemic gene vectors. Keywords: pigment epithelium-derived factor gene, nanoparticles based on PLGA derivative, gene delivery, systemic delivery, tumor
Directory of Open Access Journals (Sweden)
Arman Azadi
2009-02-01
Full Text Available Background: Obesity in children and adolescents is a significant health problem that requires comprehensive prevention and intervention efforts. The present study was carried out to assess the effect of implementation of health promotion program in school on control of risk factor for obesity in obese adolescents and those at risk of obesity. Methods: This quasi-experimental study was carried out involving two groups (case and control in 1385 in Tehran. Two boys’ secondary schools were selected randomly from secondary schools of 6th region of Education Ministry in Tehran. Body weight and height of the students were measured and body mass indexes (BMI were calculated. They were divided into two case and control groups, each containing 35 students. The case group consisted overweight and at risk for overweight students (Overweight and at risk for overweight were defined as ≥ 85th and ≥ 95th percentile of age-sex-specific CDC 2000 BMI values, respectively. The tools for data collection included electronic scale, stadiometer, demographic questionnaires of adolescents and parents, Food Frequency Questionnaire (FFQ, nutritional knowledge and a questionnaire for recording physical activity and watching TV in one week. They were distributed to be filled out by students before and one month after the intervention. The interventional program was done in four months included separate educational sessions for teachers, parents and adolescents and changes in school environment. Results: There was no significant differences between the adolescents’ mean Body Mass Index (BMI in two group after intervention (P>0.05. There was a significant difference between mean nutritional knowledge score in the case group before and after the intervention (P=0.0015. We found significant differences between the mean of intake of dairy products, salty snack, sweets, carbonated beverages and fast food in the case group after and before the intervention (P=0.001, P=0
Directory of Open Access Journals (Sweden)
Fumiharu Ohka
Full Text Available Gliomas are the most frequently occurring primary brain tumor in the central nervous system of adults. Glioblastoma multiformes (GBMs, WHO grade 4 have a dismal prognosis despite the use of the alkylating agent, temozolomide (TMZ, and even low grade gliomas (LGGs, WHO grade 2 eventually transform to malignant secondary GBMs. Although GBM patients benefit from promoter hypermethylation of the O(6-methylguanine-DNA methyltransferase (MGMT that is the main determinant of resistance to TMZ, recent studies suggested that MGMT promoter methylation is of prognostic as well as predictive significance for the efficacy of TMZ. Glioma-CpG island methylator phenotype (G-CIMP in the global genome was shown to be a significant predictor of improved survival in patients with GBM. Collectively, we hypothesized that MGMT promoter methylation might reflect global DNA methylation. Additionally in LGGs, the significance of MGMT promoter methylation is still undetermined. In the current study, we aimed to determine the correlation between clinical, genetic, and epigenetic profiles including LINE-1 and different cancer-related genes and the clinical outcome in newly diagnosed 57 LGG and 54 GBM patients. Here, we demonstrated that (1 IDH1/2 mutation is closely correlated with MGMT promoter methylation and 1p/19q codeletion in LGGs, (2 LINE-1 methylation levels in primary and secondary GBMs are lower than those in LGGs and normal brain tissues, (3 LINE-1 methylation is proportional to MGMT promoter methylation in gliomas, and (4 higher LINE-1 methylation is a favorable prognostic factor in primary GBMs, even compared to MGMT promoter methylation. As a global DNA methylation marker, LINE-1 may be a promising marker in gliomas.
Khan, Ahamed; Shrestha, Ankita; Bhuyan, Kashyap; Maiti, Indu B; Dey, Nrisingha
2018-01-01
The promoter fragment described in this study can be employed for strong transgene expression under both biotic and abiotic stress conditions. Plant-infecting Caulimoviruses have evolved multiple regulatory mechanisms to address various environmental stimuli during the course of evolution. One such mechanism involves the retention of discrete stress responsive cis-elements which are required for their survival and host-specificity. Here we describe the characterization of a novel Caulimoviral promoter isolated from Horseradish Latent Virus (HRLV) and its regulation by multiple stress responsive Transcription factors (TFs) namely DREB1, AREB1 and TGA1a. The activity of full length transcript (Flt-) promoter from HRLV (- 677 to + 283) was investigated in both transient and transgenic assays where we identified H12 (- 427 to + 73) as the highest expressing fragment having ~ 2.5-fold stronger activity than the CaMV35S promoter. The H12 promoter was highly active and near-constitutive in the vegetative and reproductive parts of both Tobacco and Arabidopsis transgenic plants. Interestingly, H12 contains a distinct cluster of cis-elements like dehydration-responsive element (DRE-core; GCCGAC), an ABA-responsive element (ABRE; ACGTGTC) and as-1 element (TGACG) which are known to be induced by cold, drought and pathogen/SA respectively. The specific binding of DREB1, AREB1 and TGA1a to DRE, ABRE and as-1 elements respectively were confirmed by the gel-binding assays using H12 promoter-specific probes. Detailed mutational analysis of the H12 promoter suggested that the presence of DRE-core and as-1 element was indispensable for its activity which was further confirmed by the transactivation assays. Our studies imply that H12 could be a valuable genetic tool for regulated transgene expression under diverse environmental conditions.
Bahadorani, M; Hosseini, S M; Abedi, P; Abbasi, H; Nasr-Esfahani, M H
2015-01-01
Growth factors are increasingly considered as important regulators of spermatogonial stem cells (SSCs). This study investigated the effects of various growth factors (GDNF, IGF1, bFGF, EGF and GFRalpha-1) on purification and colonization of undifferentiated goat SSCs under in vitro and in vivo conditions. Irrespective of the culture condition used, the first signs of developing colonies were observed from day 4 of culture onwards. The number of colonies developed in GDNF + IGF1 + bFGF culture condition was significantly higher than the other groups (p culture condition was significantly higher than the other groups (p cells (vimentin, alpha-inhibin and α-SMA) and spermatogonial cells (PLZF, THY 1, VASA, alpha-1 integrin, bet-1 integrin and DBA) revealed that both cell types existed in developing colonies, irrespective of the culture condition used. Even though, the relative abundance of VASA, FGFR3, OCT4, PLZF, BCL6B and THY1 transcription factors in GDNF + IGF1 + bFGF treatment group was significantly higher than the other groups (p culture condition could colonize within the seminiferous tubules of the germ-cell depleted recipient mice following xenotransplantation. Obtained results demonstrated that combination of GDNF with IGF1 and bFGF promote in vitro culture of goat SSCs while precludes uncontrolled proliferation of somatic cells.
Directory of Open Access Journals (Sweden)
Rafael Estrada-Avilés
Full Text Available Calsequestrin-2 (CASQ2 is the main Ca2+-binding protein inside the sarcoplasmic reticulum of cardiomyocytes. Previously, we demonstrated that MEF-2 and SRF binding sites within the human CASQ2 gene (hCASQ2 promoter region are functional in neonatal cardiomyocytes. In this work, we investigated if the calcineurin/NFAT pathway regulates hCASQ2 expression in neonatal cardiomyocytes. The inhibition of NFAT dephosphorylation with CsA or INCA-6, reduced both the luciferase activity of hCASQ2 promoter constructs (-3102/+176 bp and -288/+176 bp and the CASQ2 mRNA levels in neonatal rat cardiomyocytes. Additionally, NFATc1 and NFATc3 over-expressing neonatal cardiomyocytes showed a 2-3-fold increase in luciferase activity of both hCASQ2 promoter constructs, which was prevented by CsA treatment. Site-directed mutagenesis of the -133 bp MEF-2 binding site prevented trans-activation of hCASQ2 promoter constructs induced by NFAT overexpression. Chromatin Immunoprecipitation (ChIP assays revealed NFAT and MEF-2 enrichment within the -288 bp to +76 bp of the hCASQ2 gene promoter. Besides, a direct interaction between NFAT and MEF-2 proteins was demonstrated by protein co-immunoprecipitation experiments. Taken together, these data demonstrate that NFAT interacts with MEF-2 bound to the -133 bp binding site at the hCASQ2 gene promoter. In conclusion, in this work, we demonstrate that the Ca2+-calcineurin/NFAT pathway modulates the transcription of the hCASQ2 gene in neonatal cardiomyocytes.
Directory of Open Access Journals (Sweden)
Surleen Kaur
2016-03-01
Full Text Available Insulin receptor substrate-2 (IRS-2 plays critical role in the regulation of various metabolic processes by insulin and IGF-1. The defects in its expression and/or function are linked to diseases like polycystic ovary syndrome (PCOS, insulin resistance and cancer. To predict the transcription factors (TFs responsible for the regulation of human IRS-2 gene expression, the transcription factor binding sites (TFBS and the corresponding TFs were investigated by analysis of IRS-2 promoter sequence using MatInspector Genomatix software (Cartharius et al., 2005 [1]. The ibid data is part of author׳s publication (Anjali et al., 2015 [2] that explains Follicle stimulating hormone (FSH mediated IRS-2 promoter activation in human granulosa cells and its importance in the pathophysiology of PCOS. Further analysis was carried out for binary interactions of TF regulatory genes in IRS-2 network using Cytoscape software tool and R-code. In this manuscript, we describe the methodology used for the identification of TFBSs in human IRS-2 promoter region and provide details on experimental procedures, analysis method, validation of data and also the raw files. The purpose of this article is to provide the data on all TFBSs in the promoter region of human IRS-2 gene as it has the potential for prediction of the regulation of IRS-2 gene in normal or diseased cells from patients with metabolic disorders and cancer. Keywords: IRS-2, TFBS, FSH, SP1, ChIP
Causadias, José M; Salvatore, Jessica E; Sroufe, L Alan
2012-07-01
The present study examines two childhood markers of self-regulation, ego-control and ego-resiliency, as promotive factors for the development of global adjustment and as risk factors for the development of internalizing and externalizing behavior problems in a high-risk sample. Teachers and observers rated ego-control and ego-resiliency when participants (n = 136) were in preschool and elementary school. Ratings showed evidence for convergent and discriminant validity and stability over time. Ego-resiliency, but not ego-control, emerged as powerful predictor of adaptive functioning at age 19 and 26, as well as internalizing and externalizing problems at 16, 23, 26, and 32 years. We interpret these findings as evidence that flexibility and adaptability -measured with ego-resiliency- may reduce risk and promote successful adaptation in low-SES environments.
Corthésy, B; Cardinaux, J R; Claret, F X; Wahli, W
1989-12-01
A hormone-controlled in vitro transcription system derived from Xenopus liver nuclear extracts was exploited to identify novel cis-acting elements within the vitellogenin gene B1 promoter region. In addition to the already well-documented estrogen-responsive element (ERE), two elements were found within the 140 base pairs upstream of the transcription initiation site. One of them, a negative regulatory element, is responsible for the lack of promoter activity in the absence of the hormone and, as demonstrated by DNA-binding assays, interacts with a liver-specific transcription factor. The second is required in association with the estrogen-responsive element to mediate hormonal induction and is recognized by the Xenopus liver homolog of nuclear factor I.
Causadias, José M.; Salvatore, Jessica E.; Sroufe, L. Alan
2012-01-01
The present study examines two childhood markers of self-regulation, ego-control and ego-resiliency, as promotive factors for the development of global adjustment and as risk factors for the development of internalizing and externalizing behavior problems in a high-risk sample. Teachers and observers rated ego-control and ego-resiliency when participants (n = 136) were in preschool and elementary school. Ratings showed evidence for convergent and discriminant validity and stability over time. Ego-resiliency, but not ego-control, emerged as powerful predictor of adaptive functioning at age 19 and 26, as well as internalizing and externalizing problems at 16, 23, 26, and 32 years. We interpret these findings as evidence that flexibility and adaptability -measured with ego-resiliency- may reduce risk and promote successful adaptation in low-SES environments. PMID:23155299
Correia, Sofia; Schouten, Rob; Silva, Ana P.; Gonçalves, Berta
2017-01-01
Sweet cherries are attractive fruits due to their taste, color, nutritional value, and beneficial health effects. Sweet cherry is a highly perishable fruit and all quality attributes and the level of health promoting compounds are affected by growth conditions, picking, packing, transport, and
Plas, van der S.A.
2000-01-01
The aim of the project described in this thesis consisted of two main objectives, first, to examine the tumour promotion potential of complex, environmentally relevant mixtures of polychlorinated biphenyls (PCBs), polychlorinated dibenzo- p -dioxins (PCDDs) and
Agarwal, Gina; Brydges, Madison
2018-04-16
Supporting older adults' health and wellbeing in the community is an important policy goal that can be supported by health promotion. Despite widespread acceptance of the biopsychosocial model of health and its relation to health, many health promotion programs fail to realize this model in program design. Further, there is limited evidence to support program design targeting social determinants of health such as social isolation or connectedness. To fill this gap, we aimed to understand older adult's experiences participating in cardiovascular health promotion program in a subsidized residential building to capture unintended 'spin-off' psychosocial effects. This study took a constructivist, ethnographic approach utilizing participant observation and semi-structured interviews with participants of the program to understand participant's lived experiences of a health promotion program. In total, we conducted eighty hours of field work and fifteen semi-structured interviews with participants of the program. Thematic analysis was used to analyze the data. Four themes emerged. First, the health promotion program filled a perceived gap caused by a constrained and impersonal health care system. Secondly, the program connected older adults with resources and provided regular and secure access to health information and support. Third, for some residents, the program facilitated social relationships between older adults, leaving participants feeling more socially connected to other residents. Lastly, a paradox of loneliness emerged where older adults talked openly about feelings of loneliness, however not in relation to themselves, but rather regarding their peers. Psychosocial aspects of health, such as loneliness, social connectedness, and social support may be of equal value as the physical health benefits to the older adults who participate in health promotion programs. Incorporating these elements into programming is a complex goal, and the complexity of targeting
Energy Technology Data Exchange (ETDEWEB)
Waller, Zoë A.E., E-mail: z.waller@uea.ac.uk; Howell, Lesley A.; MacDonald, Colin J.; O’Connell, Maria A.; Searcey, Mark, E-mail: m.searcey@uea.ac.uk
2014-04-25
Highlights: • Discovery of a G-quadruplex forming sequence in the promoter sequence of Nrf2. • Characterisation of the G-quadruplex by UV, CD and NMR. • Conformational switching of G-quadruplex induced by 9-aminoacridine. - Abstract: The transcription factor nuclear factor (erythroid-derived 2)-like 2 (Nrf2) regulates multiple antioxidants, Phase II detoxification enzymes and other cytoprotective enzymes in cells. Activation of Nrf2 is recognised as being of potential therapeutic benefit in inflammatory-diseases whereas more recently, it has become clear that the inhibition of Nrf2 may have benefit in the alleviation of resistance in some tumour types. A potential G-quadruplex forming sequence was identified in the promoter region of Nrf2, close to a number of putative transcription factor binding sites. Characterisation of the sequence 5’-d[GGGAAGGGAGCAAGGGCGGGAGGG]-3’ using CD spectroscopy, imino proton NMR resonances and UV melting experiments demonstrated the formation of a parallel intramolecular G-quadruplex in the presence of K{sup +} ions. Incubation with 9-aminoacridine ligands induced a switch from antiparallel to parallel forms. The presence of a G-quadruplex forming sequence in the promoter region of Nrf2 suggests an approach to targeting the production of the protein through stabilisation of the structure, thereby avoiding resistance to antitumour drugs.
International Nuclear Information System (INIS)
Strukov, E.L.; Dryguina, L.B.; Nikiforova, I.D.
1997-01-01
The clinical and laboratory endocrinological screening performed in 1,000 males - liquidators of Chernobyl accident consequences revealed hormonal factors leading to node formation and having unfavourable influence on progression and promotion of thyroid gland cancer. The factors include syndrome of low thriiodothyronine, hyperprolactinemia, latent hypothyrosis and increased production of thyroglobulin. Peculiarities of hormonal status in liquidators allow us to suggest the presence of MEN-like syndrome among the liquidators population. Possible mechanisms of expression of RET oncogene in adults that may result in MEN- like syndrome have been discussed. (author)
Cremers, Henricus-Paul; Oenema, Anke; Mercken, Liesbeth; Candel, Math; de Vries, Hein
2013-12-03
Municipal Health Promotion Organisations (MHPOs) play an important role in promoting and disseminating prevention programmes, such as smoking prevention programmes, in schools. This study identifies factors that may facilitate or hinder MHPOs' willingness to recruit actively primary schools to use a smoking prevention programme. In 2011, 31 Dutch MHPOs were invited to recruit schools to use a smoking prevention programme. All MHPO employees involved in smoking prevention activities (n = 68) were asked to complete a questionnaire assessing psychological factors and characteristics of their organisation that might affect their decision to be involved in active recruitment of schools. T-tests and multivariate analysis of variance assessed potential differences in psychological and organisational factors between active and non-active recruiters. A total of 45 professionals returned the questionnaire (66.2%). Active recruiters (n = 12) had more positive attitudes (p = 0.02), higher self-efficacy expectations (p primary schools, compared with non-active recruiters. Organisational factors did not discriminate between active and non-active recruiters. Primarily psychological factors seem to be associated with MHPOs' decision to recruit schools actively. This indicates that creating more positive attitude, self-efficacy beliefs and formation of plans may help in getting more MHPOs involved in active recruitment procedures.
2013-01-01
Background Although cardiovascular disease has decreased, there is still potential for prevention as obesity and diabetes increase. Exercise has a positive effect on many cardiovascular risk factors, and it can significantly reduce the components of metabolic syndrome. The main challenge with exercise in primary care is how to succeed in motivating the patients at risk to change and increase their exercise habits. The objective of this study is to modify the cardiovascular risk in middle-aged men, either through a health promotion intervention alone or combined with an exercise intervention. Methods/design During a two-year period we recruit 300 men aged from 35 to 45 years with elevated cardiovascular risk (> two traditional risk factors). The men are randomized into three arms: 1) a health promotion intervention alone, 2) both health promotion and exercise intervention, or 3) control with usual community care and delayed health promotion (these men receive the intervention after one year). The main outcome measures will be the existence of metabolic syndrome and physical activity frequency (times per week). The participants are assessed at baseline, and at 3, 6, and 12 months. The follow-up of the study will last 12 months. Discussion This pragmatic trial in primary health care aimed to assess the effect of a health promotion programme with or without exercise intervention on cardiovascular risk and physical activity in middle-aged men. The results of this study may help to plan the primary care interventions to further reduce cardiovascular mortality. The study was registered at the Controlled Trials ( http://www.controlled-trials.com). Trial number: ISRCTN80672011. The study received ethics approval from the Coordinating Ethics Committee at Helsinki University Hospital on 8 June 2009 (ref: 4/13/03/00/09). PMID:23398957
DEFF Research Database (Denmark)
Troelsen, J T; Mitchelmore, C; Sjöström, H
1994-01-01
Lactase-phlorizin hydrolase (LPH) and sucrase-isomaltase (SI) are enterocyte-specific gene products. The identification of regulatory cis-elements in the promoter of these two genes has enabled us to carry out comparative studies of the corresponding intestinal-specific nuclear factors (NF-LPH1...... and SIF1-BP). Electrophoretic mobility shift assays demonstrated that the two nuclear factors compete for binding on the same cis-elements. The molecular size of the DNA binding polypeptide is estimated to be approximately 50 kDa for both factors. In the native form the factors are found as 250 k......Da oligomeric complexes. Based on these results NF-LPH1 and SIF1-BP are suggested to be either identical or closely related molecules....
Wong, Wai-Kai; Cheung, Anny Wan-Suen; Yu, Sau-Wai; Sha, Ou; Cho, Eric Yu Pang
2014-10-01
Different trophic factors are known to promote retinal ganglion cell survival and regeneration, but each had their own limitations. We report that hepatocyte growth factor (HGF) confers distinct advantages in supporting ganglion cell survival and axonal regeneration, when compared to two well-established trophic factors ciliary neurotrophic factor (CNTF) and brain-derived neurotrophic factor (BDNF). Ganglion cells in adult hamster were injured by cutting the optic nerve. HGF, CNTF, or BDNF was injected at different dosages intravitreally after injury. Ganglion cell survival was quantified at 7, 14, or 28 days postinjury. Peripheral nerve (PN) grafting to the cut optic nerve of the growth factor-injected eye was performed either immediately after injury or delayed until 7 days post-injury. Expression of heat-shock protein 27 and changes in microglia numbers were quantified in different growth factor groups. The cellular distribution of c-Met in the retina was examined by anti-c-Met immunostaining. Hepatocyte Growth Factor (HGF) was equally potent as BDNF in promoting short-term survival (up to 14 days post-injury) and also supported survival at 28 days post-injury when ganglion cells treated by CNTF or BDNF failed to be sustained. When grafting was performed without delay, HGF stimulated twice the number of axons to regenerate compared with control but was less potent than CNTF. However, in PN grafting delayed for 7 days after optic nerve injury, HGF maintained a better propensity of ganglion cells to regenerate than CNTF. Unlike CNTF, HGF application did not increase HSP27 expression in ganglion cells. Microglia proliferation was prolonged in HGF-treated retinas compared with CNTF or BDNF. C-Met was localized to both ganglion cells and Muller cells, suggesting HGF could be neuroprotective via interacting with both neurons and glia. Compared with CNTF or BDNF, HGF is advantageous in sustaining long-term ganglion cell survival and their propensity to respond to
Kathiria, Palak; Sidler, Corinne; Woycicki, Rafal; Yao, Youli; Kovalchuk, Igor
2013-07-01
The role of resistance (R) genes in plant pathogen interaction has been studied extensively due to its economical impact on agriculture. Interaction between tobacco mosaic virus (TMV) and the N protein from tobacco is one of the most widely used models to understand various aspects of pathogen resistance. The transcription activity governed by N gene promoter is one of the least understood elements of the model. In this study, the N gene promoter was cloned and fused with two different reporter genes, one encoding β-glucuronidase (N::GUS) and another, luciferase (N::LUC). Tobacco plants transformed with the N::GUS or N::LUC reporter constructs were screened for homozygosity and stable expression. Histochemical analysis of N::GUS tobacco plants revealed that the expression is organ specific and developmentally regulated. Whereas two week old plants expressed GUS in midveins only, 6-wk-old plants also expressed GUS in leaf lamella. Roots did not show GUS expression at any time during development. Experiments to address effects of external stress were performed using N::LUC tobacco plants. These experiments showed that N gene promoter expression was suppressed when plants were exposed to high but not low temperatures. Expression was also upregulated in response to TMV, but no changes were observed in plants treated with SA.
Kinoshita, Yumiko; Kizaki, Zenro; Ishihara, Yasunori; Nakajima, Hisakazu; Adachi, Shinsuke; Kosaka, Kitaro; Kinugasa, Akihiko; Sugimoto, Tohru
2007-01-01
Evidence is accumulating that the promoter region of the insulin-like growth factor I (IGF-I) gene polymorphism and low levels of IGF-I are associated with type 2 diabetes, cardiovascular disease and birth weight; however, the number of wild-type alleles is different in each country. This study aimed to examine the 737/738 marker, a cytosine-adenine repeat in the promoter region of the IGF-I gene polymorphism, and plasma IGF-I levels in Japanese infants and analyze the genetic background. Data were collected for 15 months in Kyoto Prefectural University of Medicine. The body composition parameters of all infants were determined at birth. At 5 days after birth, we took blood samples to measure the product size of the promoter region of the IGF-I gene polymorphism and plasma IGF-I. In a population-based sample of 160 subjects, 6 different alleles and 16 genotypes were identified in the promoter region of the IGF-I gene polymorphism. The existence of a 196-bp allele has proved to result in a low plasma IGF-I level, a small head and chest circumference (p body composition parameters in Japanese infants. Our results suggest genetical influence on prenatal growth and serum IGF-I levels.
Kovacs, A; Kandala, J C; Weber, K T; Guntaka, R V
1996-01-19
Type I and III fibrillar collagens are the major structural proteins of the extracellular matrix found in various organs including the myocardium. Abnormal and progressive accumulation of fibrillar type I collagen in the interstitial spaces compromises organ function and therefore, the study of transcriptional regulation of this gene and specific targeting of its expression is of major interest. Transient transfection of adult cardiac fibroblasts indicate that the polypurine-polypyrimidine sequence of alpha 1(I) collagen promoter between nucleotides - 200 and -140 represents an overall positive regulatory element. DNase I footprinting and electrophoretic mobility shift assays suggest that multiple factors bind to different elements of this promoter region. We further demonstrate that the unique polypyrimidine sequence between -172 and -138 of the promoter represents a suitable target for a single-stranded polypurine oligonucleotide (TFO) to form a triple helix DNA structure. Modified electrophoretic mobility shift assays show that this TFO specifically inhibits the protein-DNA interaction within the target region. In vitro transcription assays and transient transfection experiments demonstrate that the transcriptional activity of the promoter is inhibited by this oligonucleotide. We propose that TFOs represent a therapeutic potential to specifically influence the expression of alpha 1(I) collagen gene in various disease states where abnormal type I collagen accumulation is known to occur.
Kubota, Hiroshi; Wu, Xin; Goodyear, Shaun M; Avarbock, Mary R; Brinster, Ralph L
2011-08-01
Previous studies suggest that exogenous factors crucial for spermatogonial stem cell (SSC) self-renewal are conserved among several mammalian species. Since glial cell line-derived neurotrophic factor (GDNF) and fibroblast growth factor 2 (FGF2) are critical for rodent SSC self-renewal, we hypothesized that they might promote self-renewal of nonrodent SSCs. Therefore, we cultured testicular germ cells from prepubertal rabbits in the presence of GDNF and FGF2 and found they proliferated indefinitely as cellular clumps that displayed characteristics previously identified for rodent SSCs. The rabbit germ cells could not be maintained on mouse embryonic fibroblast (STO) feeders that support rodent SSC self-renewal in vitro but were rather supported on mouse yolk sac-derived endothelial cell (C166) feeder layers. Proliferation of rabbit germ cells was dependent on GDNF. Of critical importance was that clump-forming rabbit germ cells colonized seminiferous tubules of immunodeficient mice, proliferated for at least 6 mo, while retaining an SSC phenotype in the testes of recipient mice, indicating that they were rabbit SSCs. This study demonstrates that GDNF is a mitogenic factor promoting self-renewal that is conserved between rodent and rabbit SSCs; with an evolutionary separation of ∼ 60 million years. These findings provide a foundation to study the mechanisms governing SSC self-renewal in nonrodent species.
Directory of Open Access Journals (Sweden)
Mani S
2010-06-01
Full Text Available Background and Aim: The role of caretakers at day-care centers has become more imperative in promoting oral health care in children since many new mothers opt to work outside their homes, leaving their children at day-care centers. The aim of this study is to assess the knowledge, attitude and practice of oral health promoting factors among secondary caretakers of children attending day-care centers. Settings and Design: This was a cross-sectional exploratory study conducted among secondary caretakers in Kubang Kerian, Malaysia. Materials and Methods: Thirty-four caretakers fulfilling the inclusion and exclusion criteria participated in the study. The data were collected using a self-administered questionnaire addressing various aspects of knowledge, attitude and practice of oral health in children. Analysis was done using SPSS version 12.0. Results: The knowledge of factors causing dental caries was found to be good among majority of the caretakers, but the concepts of transmissibility of caries and effect of hidden sugars were not evident. Seventy one percent did not know that frequent bottle feeding could cause tooth decay. Attitudes seemed to be governed by the cultural practices of the region rather than the knowledge obtained. The knowledge was not translated to practice adequately. Giving sweetened liquid in bottles was practiced by 53% of the caretakers. Conclusion: Implementation of nursery-based oral health promotion programs for secondary caretakers is needed to counteract early childhood caries.
Energy Technology Data Exchange (ETDEWEB)
Kabaya, Koji; Watanabe, Masahiko; Kusaka, Masaru; Seki, Masatoshi (Kirin Brewery Co., Ltd., Gunma (Japan). Pharmaceutical Research Laboratory); Fushiki, Masato
1994-08-01
The effect of recombinant human granulocyte colony-stimulating factor (rhG-CSF) on the recovery from neutropenia induced by fractionated whole-body irradiation was investigated in mice. Male 7-week old C3H/HeN mice received a total of ten exposures of 0.25 Gy/day from day 1 to 5 and from day 8 to 12. Peripheral neutropenia with a nadir on day 17 was caused by the fractionated irradiation. Daily subcutaneous injections of rhG-CSF at 0.25 and 2.5 [mu]g/body/day from day from day 1 to 21 promoted the recovery of neutrophils in a dose-dependent manner. The kinetics of morphologically identifiable bone marrow cells were studied to clarify the mechanism behind the promotive effect of this factor. A slight decrease in mitotic immature granulocytes, such as myeloblasts, promyelocytes and myelocytes on day 5, and a drastic decrease in metamyelocytes and marrow neutrophils on days 5, 9, and 17 were seen in the femur of irradiated mice. Treatment using rhG-CSF caused an increase in immature granulocytes of all differential stages in the femur. Microscopic findings of the femurs and spleens also reveals an increase in immature granulocytes in these organs in mice injected with rhG-CSF. These results indicate that rhG-CSF accelerates granulopoiesis in the femur and spleen, thereby promoting recovery from neutropenia induced by fractionated irradiation. (author).
International Nuclear Information System (INIS)
Kabaya, Koji; Watanabe, Masahiko; Kusaka, Masaru; Seki, Masatoshi; Fushiki, Masato.
1994-01-01
The effect of recombinant human granulocyte colony-stimulating factor (rhG-CSF) on the recovery from neutropenia induced by fractionated whole-body irradiation was investigated in mice. Male 7-week old C3H/HeN mice received a total of ten exposures of 0.25 Gy/day from day 1 to 5 and from day 8 to 12. Peripheral neutropenia with a nadir on day 17 was caused by the fractionated irradiation. Daily subcutaneous injections of rhG-CSF at 0.25 and 2.5 μg/body/day from day from day 1 to 21 promoted the recovery of neutrophils in a dose-dependent manner. The kinetics of morphologically identifiable bone marrow cells were studied to clarify the mechanism behind the promotive effect of this factor. A slight decrease in mitotic immature granulocytes, such as myeloblasts, promyelocytes and myelocytes on day 5, and a drastic decrease in metamyelocytes and marrow neutrophils on days 5, 9, and 17 were seen in the femur of irradiated mice. Treatment using rhG-CSF caused an increase in immature granulocytes of all differential stages in the femur. Microscopic findings of the femurs and spleens also reveals an increase in immature granulocytes in these organs in mice injected with rhG-CSF. These results indicate that rhG-CSF accelerates granulopoiesis in the femur and spleen, thereby promoting recovery from neutropenia induced by fractionated irradiation. (author)
Tong, Dandan; Liang, Ya-Nan; Stepanova, A A; Liu, Yu; Li, Xiaobo; Wang, Letian; Zhang, Fengmin; Vasilyeva, N V
2017-02-01
. Furthermore, RAB11FIP3 combines with Eps15 homology domain 1 to promote the endocytosis recycling of phosphorylation of epithelial growth factor receptor.
Directory of Open Access Journals (Sweden)
Fumiyasu Makinoshima
2017-11-01
Full Text Available Excessive car evacuation can cause severe traffic jams that can lead to large numbers of casualties during tsunami disasters. Investigating the possible factors that lead to unnecessary car evacuation can ensure smoother tsunami evacuations and mitigate casualty damages in future tsunami events. In this study, we quantitatively investigated the possible factors that promote car evacuation, including both necessary and unnecessary usages, by statistically analysing a large amount of data on actual tsunami evacuation behaviours surveyed in Kesennuma, where devastating damage occurred during the 2011 Tohoku Tsunami. A straightforward statistical analysis revealed a high percentage of car evacuations (approx. 50%; however, this fraction includes a high number of unnecessary usage events that were distinguished based on mode choice reasons. In addition, a binary logistic regression was conducted to quantitatively evaluate the effects of several factors and to identify the dominant factor that affected evacuation mode choice. The regression results suggested that the evacuation distance was the dominant factor for choosing car evacuation relative to other factors, such as age and sex. The cross-validation test of the regression model demonstrated that the considered factors were useful for decision making and the prediction of evacuation mode choice in the target area.
Johnson, Eric T; Berhow, Mark A; Dowd, Patrick F
2007-04-18
Hi II maize (Zea mays) plants were engineered to express maize p1 cDNA, a Myb transcription factor, controlled by a putative silk specific promoter, for secondary metabolite production and corn earworm resistance. Transgene expression did not enhance silk color, but about half of the transformed plant silks displayed browning when cut, which indicated the presence of p1-produced secondary metabolites. Levels of maysin, a secondary metabolite with insect toxicity, were highest in newly emerged browning silks. The insect resistance of transgenic silks was also highest at emergence, regardless of maysin levels, which suggests that other unidentified p1-induced molecules likely contributed to larval mortality. Mean survivor weights of corn earworm larvae fed mature browning transgenic silks were significantly lower than weights of those fed mature nonbrowning transgenic silks. Some transgenic pericarps browned with drying and contained similar molecules found in pericarps expressing a dominant p1 allele, suggesting that the promoter may not be silk-specific.
DEFF Research Database (Denmark)
Mirastschijski, Ursula; Schnabel, Reinhild; Claes, Juliane
2010-01-01
applied topically to full-thickness skin excisional wounds in rats and its ability to inhibit the promotion of myofibroblast formation and function by the latent transforming-growth factor-beta1 (TGF-beta1). BB-94 delayed wound contraction, as well as all other associated aspects of wound healing examined......, including myofibroblast formation, stromal cell proliferation, blood vessel formation, and epithelial wound coverage. Interestingly, BB-94 dramatically increased the level of latent and active MMP-9. The increased levels of active MMP-9 may eventually overcome the ability of BB-94 to inhibit this MMP...... and may explain why wound contraction and other associated events of wound healing were only delayed and not completely inhibited. BB-94 was also found to inhibit the ability of latent TGF-beta1 to promote the formation and function of myofibroblasts. These results suggest that BB-94 could delay wound...
DEFF Research Database (Denmark)
Aas, Per Arne; Pena Diaz, Javier; Liabakk, Nina Beate
2009-01-01
within the region of DNA marked by PA. Footprinting analysis and electrophoretic mobility shift assays of PA and putative AP-2 binding regions with HeLa cell nuclear extract and recombinant AP-2alpha protein indicate that AP-2 transcription factors are central in the regulated expression of UNG2 m......The PA promoter in the human uracil-DNA glycosylase gene (UNG) directs expression of the nuclear form (UNG2) of UNG proteins. Using a combination of promoter deletion and mutation analyses, and transient transfection of HeLa cells, we show that repressor and derepressor activities are contained......alpha, lacking the activation domain but retaining the DNA binding and dimerization domains, stimulated PA to a level approaching that of full-length AP-2, suggesting that AP-2 overexpression stimulates PA activity by a mechanism involving derepression rather than activation, possibly by neutralizing...
International Nuclear Information System (INIS)
Kita, Atsushi; Yamasaki, Hironori; Kuwahara, Hironaga; Moriuchi, Akie; Fukushima, Keiko; Kobayashi, Masakazu; Fukushima, Tetsuya; Takahashi, Ryoko; Abiru, Norio; Uotani, Shigeo; Kawasaki, Eiji; Eguchi, Katsumi
2005-01-01
Adiponectin, an adipose tissue-specific plasma protein, is involved in insulin sensitizing and has anti-atherosclerotic properties. Plasma levels of adiponectin are decreased in obese individuals and patients with type 2 diabetes with insulin resistance. Tumor necrosis factor-α (TNF-α) decreases the expression of adiponectin in adipocytes. The aims of the present study were: (1) to identify the promoter region responsible for basal transcription of the human adiponectin gene, and (2) to investigate the mechanism by which adiponectin was regulated by TNF-α. The human adiponectin promoter (2.1 kb) was isolated and used for luciferase reporter analysis by transient transfection into 3T3-L1 adipocytes. Deletion analysis demonstrated that the promoter region from -676 to +41 was sufficient for basal transcriptional activity. Mutation analysis of putative response elements for sterol regulatory element binding protein (SREBP) (-431 to -423) and CCAAT/enhancer binding protein (C/EBP) (-230 to -224) showed that both elements were required for basal promoter activity. Adiponectin transcription was increased 3-fold in cells that over-expressed constitutively active C/EBP-β. Electrophoretic mobility shift assay, using nuclear extract from 3T3-L1 cells and the -258 to -199 region as a probe, demonstrated specific DNA-protein binding, which was abolished by TNF-α treatment. The present data indicate that the putative response elements for SREBP and C/EBP are required for human adiponectin promoter activity, and that suppression by TNF-α may, at least in part, be associated with inactivation of C/EBP-β
Yamada, H; Vijayachandra, K; Penner, C; Glick, A
2001-06-01
Inactivation of the transforming growth factor beta (TGFbeta)-signaling pathway and gene silencing through hypermethylation of promoter CpG islands are two frequent alterations in human and experimental cancers. Here we report that nonneoplastic TGFbeta1-/- keratinocyte cell lines exhibit increased sensitivity to cell killing by alkylating agents, and this is due to lack of expression of the DNA repair enzyme O(6)-methylguanine DNA methyltransferase (MGMT). In TGFbeta1-/- but not TGFbeta1+/- cell lines, the CpG dinucleotides in the MGMT promoter are hypermethylated, as measured by restriction enzyme analysis and methylation specific polymerase chain reaction. In one unstable TGFbeta1+/- cell line, loss of the wild type TGFbeta1 allele correlates with the appearance of methylation in the MGMT promoter. Bisulfite sequencing shows that in the KO3 TGFbeta1-/- cell line nearly all of the 28 CpG sites in the MGMT promoter 475 base pairs upstream of the start site of transcription are methylated, whereas most are unmethylated in the H1 TGFbeta1+/- line. Treatment of the TGFbeta1-/- cell lines with 5-azacytidine causes reexpression of MGMT mRNA and demethylation of CpG islands in the promoter. Analysis of the time course of methylation using methylation-specific polymerase chain reaction shows a lack of methylation in primary TGFbeta1-/- keratinocytes and increasing methylation with passage number of immortalized clones. Subcloning of early passage clones reveals a remarkable heterogeneity and instability of the methylation state in the TGFbeta1-/- keratinocytes. Thus, the TGFbeta1-/- genotype does not directly regulate MGMT methylation but predisposes cells to immortalization-associated MGMT hypermethylation.
Lin, Chih-Yang; Wang, Shih-Wei; Chen, Yen-Ling; Chou, Wen-Yi; Lin, Ting-Yi; Chen, Wei-Cheng; Yang, Chen-Yu; Liu, Shih-Chia; Hsieh, Chia-Chu; Fong, Yi-Chin; Wang, Po-Chuan; Tang, Chih-Hsin
2017-08-03
Chondrosarcoma is the second most common primary malignancy of bone, and one of the most difficult bone tumors to diagnose and treat. It is well known that increased levels of vascular endothelial growth factor-C (VEGF-C) promote active tumor lymphangiogenesis and lymphatic tumor spread to regional lymph nodes. Brain-derived neurotrophic factor (BDNF) is known to promote metastasis in human chondrosarcoma cells. Knowing more about the mechanism of BDNF in VEGF-C expression and lymphangiogenesis in human chondrosarcoma would improve our understanding as how to prevent chondrosarcoma angiogenesis and metastasis, which currently lacks effective adjuvant treatment. Here, we found that BDNF expression was at least 2.5-fold higher in the highly migratory JJ012(S10) cell line as compared with the primordial cell line (JJ012). In addition, VEGF-C expression and secretion was markedly increased in JJ012(S10) cells. Conditioned medium from JJ012(S10) cells significantly promoted migration and tube formation of human lymphatic endothelial cells (LECs), whereas knockdown of BDNF attenuated LEC migration and tube formation by suppressing VEGF-C production in JJ012(S10) cells. Mechanistic investigations indicated that BDNF facilitated VEGF-C-dependent lymphangiogenesis through the MEK/ERK/mTOR signaling pathway. We also showed that microRNA (miR)-624-3p expression was negatively regulated by BDNF via the MEK/ERK/mTOR cascade. Importantly, BDNF knockdown profoundly inhibited tumor-associated lymphangiogenesis in vivo. Further analyses identified that BDNF promoted tumor lymphangiogenesis by downregulating miR-624-3p in human chondrosarcoma tissues. In conclusion, this study is the first to reveal the mechanism underlying BDNF-induced lymphangiogenesis. We suggest that BDNF may serve as a promising therapeutic target for the restriction of VEGF-C-mediated tumor lymphangiogenesis and lymphatic metastasis.
Directory of Open Access Journals (Sweden)
Ryan F Overcash
Full Text Available The type I transmembrane protein with epidermal growth factor and two follistatin motifs 2 (TMEFF2, is expressed mainly in brain and prostate. Expression of TMEFF2 is deregulated in prostate cancer, suggesting a role in this disease, but the molecular mechanism(s involved in this effect are not clear. Although androgens promote tmeff2 transcription, androgen delivery to castrated animals carrying CWR22 xenografts increases TMEFF2 protein levels in the absence of mRNA changes, suggesting that TMEFF2 may also be post-transcriptionally regulated. Here we show that translation of TMEFF2 is regulated by androgens. Addition of physiological concentrations of dihydrotestosterone (DHT to prostate cancer cell lines increases translation of endogenous TMEFF2 or transfected TMEFF2-Luciferase fusions, and this effect requires the presence of upstream open reading frames (uORFs in the 5'-untranslated region (5'-UTR of TMEFF2. Using chemical and siRNA inhibition of the androgen receptor (AR, we show that the androgen effect on TMEFF2 translation is mediated by the AR. Importantly, DHT also promotes phosphorylation of the α subunit of the translation initiation factor 2 (eIF2α in an AR-dependent manner, paralleling the effect on TMEFF2 translation. Moreover, endoplasmic reticulum (ER stress conditions, which promote eIF2α phosphorylation, also stimulate TMEFF2 translation. These results indicate that androgen signaling promotes eIF2α phosphorylation and subsequent translation of TMEFF2 via a mechanism that requires uORFs in the 5'-UTR of TMEFF2.
Yu, X; Zhen, Y; Yang, H; Wang, H; Zhou, Y; Wang, E; Marincola, F M; Mai, C; Chen, Y; Wei, H; Song, Y; Lyu, X; Ye, Y; Cai, L; Wu, Q; Zhao, M; Hua, S; Fu, Q; Zhang, Y; Yao, K; Liu, Z; Li, X; Fang, W
2013-05-16
Connective tissue growth factor (CTGF) has different roles in different types of cancer. However, the involvement and molecular basis of CTGF in tumor progression and prognosis of human nasopharyngeal carcinoma (NPC) have almost never been reported. In this study, we observed that downregulated CTGF expression was significantly associated with NPC progression and poor prognosis. Knockdown of CTGF markedly elevated the ability of cell proliferation in vivo and in vitro. Subsequently, we discovered that the reduction of CTGF increased the expression of miR-18b, an oncomir-promoting cell proliferation. Further, we discovered that attenuated CTGF-mediated upregulation of miR-18b was dependent on the increased binding of transcription factors Jun proto-oncogene (C-Jun) and v-Myc myelocytomatosis viral oncogene homolog (C-Myc) to miR-18b promoter region via phosphoinositide 3-kinase (PI3K)/AKT pathway. Finally, we further found that miR-18b directly suppressed the expression of CTGF in NPC. In clinical fresh specimens, miR-18b was widely overexpressed and inversely correlated with CTGF expression in NPC. Our studies are the first to demonstrate that reduced CTGF as an unfavorable prognosis factor mediates the activation of miR-18b, an oncomir directly suppresses CTGF expression, by PI3K/AKT/C-Jun and C-Myc and promotes cell growth of NPC.
Hunt, E; Bornovalova, M A; Patrick, C J
2015-05-01
Previous studies have reported strong genetic and environmental overlap between antisocial-externalizing (factor 2; F2) features of psychopathy and borderline personality disorder (BPD) tendencies. However, this line of research has yet to examine etiological associations of affective-interpersonal (factor 1, F1) features of psychopathy with BPD tendencies. The current study investigated differential phenotypic and genetic overlap of psychopathy factors 1 and 2 with BPD tendencies in a sample of over 250 male and female community-recruited adult twin pairs. Consistent with previous research, biometric analyses revealed strong genetic and non-shared environmental correlations of F2 with BPD tendencies, suggesting that common genetic and non-shared environmental factors contribute to both phenotypes. In contrast, negative genetic and non-shared environmental correlations were observed between F1 and BPD tendencies, indicating that the genetic factors underlying F1 serve as protective factors against BPD. No gender differences emerged in the analyses. These findings provide further insight into associations of psychopathic features - F1 as well as F2 - and BPD tendencies. Implications for treatment and intervention are discussed, along with how psychopathic traits may differentially influence the manifestation of BPD tendencies.
Czech Academy of Sciences Publication Activity Database
Šilar, Radoslav; Holátko, Jiří; Rucká, Lenka; Rapoport, Andrey; Dostálová, Hana; Kadeřábková, Pavla; Nešvera, Jan; Pátek, Miroslav
2016-01-01
Roč. 73, č. 3 (2016), s. 401-408 ISSN 0343-8651 Institutional support: RVO:61388971 Keywords : GENE-EXPRESSION * REGULATORY NETWORK * BACILLUS-SUBTILIS Subject RIV: EE - Microbiology , Virology Impact factor: 1.322, year: 2016
Chen, Yan; Huang, Shai; Wu, Bo; Fang, Jiankai; Zhu, Minsheng; Sun, Li; Zhang, Lifeng; Zhang, Yongsheng; Sun, Maomin; Guo, Lingling; Wang, Shouli
2017-07-25
Transforming growth factor-β1 is considered a key contributor to the progression of breast cancer. MicroRNAs are important factors in the development and progression of many malignancies. In the present study, upon studies of breast cancer cell lines and tissues, we showed that microRNA -196a-3p is decreased by transforming growth factor-β1 in breast cancer cells and associated with breast cancer progression. We identified neuropilin-2 as a target gene of microRNA -196a-3p and showed that it is regulated by transforming growth factor-β1. Moreover, transforming growth factor-β1-mediated inhibition of microRNA -196a-3p and activation of neuropilin-2were required for transforming growth factor-β1-induced migration and invasion of breast cancer cells. In addition, neuropilin-2 expression was suppressed in breast tumors, particularly in triple-negative breast cancers. Collectively, our findings strongly indicate that microRNA -196a-3p is a predictive biomarker of breast cancer metastasis and patient survival and a potential therapeutic target in metastatic breast cancer.
Tu, Min; Lu, Cheng; Lv, Nan; Wei, Jishu; Lu, Zipeng; Xi, Chunhua; Chen, Jianmin; Guo, Feng; Jiang, Kuirong; Li, Qiang; Wu, Junli; Song, Guoxin; Wang, Shui; Gao, Wentao; Miao, Yi
2016-12-28
Vasohibin 2 (VASH2) is an angiogenic factor and cancer-related protein that acts via paracrine mechanisms. Here, we investigated the angiogenic function and mechanism of action of VASH2 in 200 human breast cancer tissues by performing immunohistochemical staining, western blot, indirect sandwich enzyme-linked immunosorbent assay (ELISA), and a semi-quantitative sandwich-based antibody array. Breast cancer cells stably overexpressing VASH2 or with knocked-down VASH2 were established and used for in vivo and in vitro models. In human luminal tissue, but not in HER2-positive or basal-like breast cancer tissues, VASH2 was positively correlated with CD31-positive microvascular density, induced angiogenesis in xenograft tumors, and promoted human umbilical vein endothelial cell tube formation in vitro. VASH2 expression was absent in the concentrated conditioned medium collected from knocked-down VASH2 and VASH2-overexpressing luminal breast cancer cells. Further, VASH2 regulated the expression of fibroblast growth factor 2 (FGF2) in human luminal breast cancer cells, and the pro-angiogenic effect induced by VASH2 overexpression was blocked by FGF2 neutralization in vitro. Additionally, dual luciferase reporter assay and Chromatin immunoprecipitation analysis results showed that FGF2 promoter was transcriptionally activated by VASH2 via histone modifications. In conclusion, VASH2 expression is positively correlated with FGF2 expression and promotes angiogenesis in human luminal breast cancer by transcriptional activation of fibroblast growth factor 2 through non-paracrine mechanisms. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.
International Nuclear Information System (INIS)
Mukherjee, R.N.; Yuan, H.C.
1975-01-01
The application of ionizing radiation for sterilizing ready-to-use medical supplies, sutures and grafts provides a broad scope for the up-grading of public health care and family planning programmes in the developing countries. Sterile ready-to-use medical supplies become particularly important for improving the standard of those services given through the improvised camp-hospitals and mobile medical units for the remote areas of such countries, if needed. The practices generated in the technologically advanced countries will form the basis of the planning, but the necessary adjustments should be made in their implementation to suit best the local conditions and needs and to promote utilization of local raw materials. Necessary research and development and an effective infrastructure should be emphasized. Plastic materials are among the major pollutants of the environment. Timely parallel practical steps need be adopted and an action programme planned to preserve the quality of the human environment. (author)
Li, Lixia; Shang, Jian; Zhang, Yupeng; Liu, Shi; Peng, Yanan; Zhou, Zhou; Pan, Huaqing; Wang, Xiaobing; Chen, Lipng; Zhao, Qiu
2017-09-01
A major reason for the failure of advanced colorectal cancer (CRC) treatment is the occurrence of chemoresistance to oxaliplatin-based chemotherapy. Recently, studies have shown that long non-coding RNAs (lncRNAs) play an important role in drug resistance. Using HiSeq sequencing methods, we identified that lncRNAs show differential expression levels in oxaliplatin-resistant (OxR) and non-resistant CRC patients. RT-qPCR was then performed in tissues and serum samples, and lncRNA MEG3 was verified to be downregulated in non-responding patients and to have considerable discriminating potential to identify responding patients from non-responding patients. Moreover, decreased serum MEG3 expression was associated with poor chemoresponse and low survival rate in CRC patients receiving oxaliplatin treatment. Subsequently, OxR cell lines were established, and MEG3 was significantly downregulated in HT29 OxR and SW480 OxR cells. In addition, overexpression of MEG3 with pMEG3 reversed oxaliplatin resistance in both CRC cell lines. Flow cytometric apoptosis analysis indicated that MEG3 promoted CRC cell apoptosis. More importantly, MEG3 enhanced oxaliplatin‑induced cell cytotoxicity in CRC. In conclusion, our integrated approach demonstrated that decreased expression of lncRNA MEG3 in CRC confers potent poor therapeutic efficacy, and that MEG3 promotes chemosensitivity by enhancing oxaliplatin-induced cell apoptosis. Thus, overexpression of MEG3 may be a future direction by which to develop a novel therapeutic strategy to overcome oxaliplatin resistance of CRC patients.
Directory of Open Access Journals (Sweden)
Dongkyoon Kim
2017-12-01
Full Text Available Arid3a/Bright/Dril1 is a B cell-specific transactivator that regulates immunoglobulin heavy chain (IgH gene transcription by binding promoter and enhancer-associated matrix attachment regions (MARs within the IgH gene locus. Promoter MAR-mediated Arid3a transactivation is antagonized by direct competition of MAR binding by Cux1/CDP—a ubiquitously expressed repressor originally termed NF-μNR. We report that the NF-μNR complex includes Arid3a in B cells but not in non-B cells through mobility shift assays. The binding activity of NF-μNR and Arid3a in B cells is reciprocally altered during the cell division cycle and by the B cell mitogen lipopolysaccharide LPS. LPS treatment had no effect on Arid3a localization but increased its total abundance within the nucleus and cytoplasm. We show that this increased level of Arid3a is capable of displacing Cux from the MARs to facilitate IgH gene transcription. Finally, we showed that the MARs (termed Bf150 and Tx125 associated with the VH1 rearranged variable region expressed in the S107 murine plasmacytoma, can repress reporter gene transcription in non-B cells and that they can relieve the repression mediated by Eμ enhancer in B cells. These results have significant implications for early human development and demonstrate that MARs in IgH locus, NF-µNR and Arid3a regulate IgH gene expression in a concerted fashion. This paves the way for future studies examining the misregulation of this pathway in pediatric disease.
In, K H; Asano, K; Beier, D; Grobholz, J; Finn, P W; Silverman, E K; Silverman, E S; Collins, T; Fischer, A R; Keith, T P; Serino, K; Kim, S W; De Sanctis, G T; Yandava, C; Pillari, A; Rubin, P; Kemp, J; Israel, E; Busse, W; Ledford, D; Murray, J J; Segal, A; Tinkleman, D; Drazen, J M
1997-03-01
Five lipoxygenase (5-LO) is the first committed enzyme in the metabolic pathway leading to the synthesis of the leukotrienes. We examined genomic DNA isolated from 25 normal subjects and 31 patients with asthma (6 of whom had aspirin-sensitive asthma) for mutations in the known transcription factor binding regions and the protein encoding region of the 5-LO gene. A family of mutations in the G + C-rich transcription factor binding region was identified consisting of the deletion of one, deletion of two, or addition of one zinc finger (Sp1/Egr-1) binding sites in the region 176 to 147 bp upstream from the ATG translation start site where there are normally 5 Sp1 binding motifs in tandem. Reporter gene activity directed by any of the mutant forms of the transcription factor binding region was significantly (P < 0.05) less effective than the activity driven by the wild type transcription factor binding region. Electrophoretic mobility shift assays (EMSAs) demonstrated the capacity of wild type and mutant transcription factor binding regions to bind nuclear extracts from human umbilical vein endothelial cells (HUVECs). These data are consistent with a family of mutations in the 5-LO gene that can modify reporter gene transcription possibly through differences in Sp1 and Egr-1 transactivation.
Directory of Open Access Journals (Sweden)
Erh-Hsuin Lim
2013-11-01
Full Text Available BackgroundTo overcome the potential drawbacks of a short half-life and dose-related adverse effects of using active transforming growth factor-beta 1 for cartilage engineering, a cell-mediated latent growth factor activation strategy was developed incorporating latent transforming growth factor-β1 (LTGF into an electrospun poly(L-lactide scaffold.MethodsThe electrospun scaffold was surface modified with NH3 plasma and biofunctionalised with LTGF to produce both random and orientated biofunctionalised electrospun scaffolds. Scaffold surface chemical analysis and growth factor bioavailability assays were performed. In vitro biocompatibility and human nasal chondrocyte gene expression with these biofunctionalised electrospun scaffold templates were assessed. In vivo chondrogenic activity and chondrocyte gene expression were evaluated in athymic rats.ResultsChemical analysis demonstrated that LTGF anchored to the scaffolds was available for enzymatic, chemical and cell activation. The biofunctionalised scaffolds were non-toxic. Gene expression suggested chondrocyte re-differentiation after 14 days in culture. By 6 weeks, the implanted biofunctionalised scaffolds had induced highly passaged chondrocytes to re-express Col2A1 and produce type II collagen.ConclusionsWe have demonstrated a proof of concept for cell-mediated activation of anchored growth factors using a novel biofunctionalised scaffold in cartilage engineering. This presents a platform for development of protein delivery systems and for tissue engineering.
In, K H; Asano, K; Beier, D; Grobholz, J; Finn, P W; Silverman, E K; Silverman, E S; Collins, T; Fischer, A R; Keith, T P; Serino, K; Kim, S W; De Sanctis, G T; Yandava, C; Pillari, A
1997-01-01
Five lipoxygenase (5-LO) is the first committed enzyme in the metabolic pathway leading to the synthesis of the leukotrienes. We examined genomic DNA isolated from 25 normal subjects and 31 patients with asthma (6 of whom had aspirin-sensitive asthma) for mutations in the known transcription factor binding regions and the protein encoding region of the 5-LO gene. A family of mutations in the G + C-rich transcription factor binding region was identified consisting of the deletion of one, delet...
Zhou, Fei; Sun, Tian-Hu; Zhao, Lei; Pan, Xi-Wu; Lu, Shan
2015-01-01
The Artemisia annua L. β-pinene synthase QH6 was previously determined to be circadian-regulated at the transcriptional level, showing a rhythmic fluctuation of steady-state transcript abundances. Here we isolated both the genomic sequence and upstream promoter region of QH6. Different regulatory elements, such as G-box (TGACACGTGGCA, -421 bp from the translation initiation site) which might have effects on rhythmic gene expression, were found. Using the yeast one-hybrid and electrophoretic mobility shift assay (EMSA), we confirmed that the bZIP transcription factor HY5 binds to this motif of QH6. Studies with promoter truncations before and after this motif suggested that this G-box was important for the diurnal fluctuation of the transgenic β-glucuronidase gene (GUS) transcript abundance in Arabidopsis thaliana. GUS gene driven by the promoter region immediately after G-box showed an arrhythmic expression in both light/dark (LD) and constant dark (DD) conditions, whereas the control with G-box retained its fluctuation in both LD and DD. We further transformed A. thaliana with the luciferase gene (LUC) driven by an 1400 bp fragment upstream QH6 with its G-box intact or mutated, respectively. The luciferase activity assay showed that a peak in the early morning disappeared in the mutant. Gene expression analysis also demonstrated that the rhythmic expression of LUC was abolished in the hy5-1 mutant.
Directory of Open Access Journals (Sweden)
Fei eZhou
2015-04-01
Full Text Available The Artemisia annua L. β-pinene synthase QH6 was previously determined to be circadian-regulated at the transcriptional level, showing a rhythmic fluctuation of steady-state transcript abundances. Here we isolated both the genomic sequence and upstream promoter region of QH6. Different regulatory elements, such as G-box (TGACACGTGGCA, -421 bp from the translation initiation site which might have effects on rhythmic gene expression, were found. Using the yeast one-hybrid and electrophoretic mobility shift assay (EMSA, we confirmed that the bZIP transcription factor HY5 binds to this motif of QH6. Studies with promoter truncations before and after this motif suggested that this G-box was important for the diurnal fluctuation of the transgenic β-glucuronidase gene (GUS transcript abundance in Arabidopsis thaliana. GUS gene driven by the promoter region immediately after G-box showed an arrhythmic expression in both light/dark (LD and constant dark (DD conditions, whereas the control with G-box retained its fluctuation in both LD and DD. We further transformed A. thaliana with the luciferase gene (LUC driven by an 1400 bp fragment upstream QH6 with its G-box intact or mutated, respectively. The luciferase activity assay showed that a peak in the early morning disappeared in the mutant. Gene expression analysis also demonstrated that the rhythmic expression of LUC was abolished in the hy5-1 mutant.
Liu, Guan-Ting; Huang, Yuan-Li; Tzeng, Huey-En; Tsai, Chun-Hao; Wang, Shih-Wei; Tang, Chih-Hsin
2015-02-28
Chondrosarcoma is a primary malignant bone cancer, with a potent capacity to invade locally and cause distant metastasis. Angiogenesis is a critical step in tumor growth and metastasis. Chemokine CCL5 (previously called RANTES) has been shown to facilitate tumor progression and metastasis. However, the relationship of CCL5 with vascular endothelial growth factor (VEGF) expression and angiogenesis in human chondrosarcoma is mostly unknown. In this study, CCL5 increased VEGF expression and also promoted chondrosarcoma medium-mediated angiogenesis in vitro as well as angiogenesis effects in the chick chorioallantoic membrane and Matrigel plug nude mice model in vivo. MicroRNA analysis was performed in CCL5-treated chondrosarcoma cells versus control cells to investigate the mechanism of CCL5-mediated promotion of chondrosarcoma angiogenesis. Among the miRNAs regulated by CCL5, miR-199a was the most downregulated miRNA after CCL5 treatment. In addition, co-transfection with miR-199a mimic reversed the CCL5-mediated VEGF expression and angiogenesis in vitro and in vivo. Moreover, overexpression of CCL5 increased tumor-associated angiogenesis and tumor growth by downregulating miR-199a in the xenograft tumor angiogenesis model. Taken together, these results demonstrated that CCL5 promotes VEGF-dependent angiogenesis in human chondrosarcoma cells by downregulating miR-199a. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.
Puspita, Indun Dewi; Kitagawa, Wataru; Kamagata, Yoichi; Tanaka, Michiko; Nakatsu, Cindy H
2015-01-01
Resuscitation-promoting factor (Rpf) is a protein that has been found in a number of different Actinobacteria species and has been shown to promote the growth of active cells and resuscitate dormant (non-dividing) cells. We previously reported the biological activity of an Rpf protein in Tomitella biformata AHU 1821(T), an Actinobacteria isolated from a permafrost ice wedge. This protein is excreted outside the cell; however, few studies have investigated its contribution in environmental samples to the growth or resuscitation of bacteria other than the original host. Therefore, the aim of the present study was to determine whether Rpf from T. biformata impacted the cultivation of other bacteria from the permafrost ice wedge from which it was originally isolated. All experiments used recombinant Rpf proteins produced using a Rhodococcus erythropolis expression system. Dilutions of melted surface sterilized ice wedge samples mixed with different doses of the purified recombinant Rpf (rRpf) protein indicated that the highest concentration tested, 1250 pM, had a significantly (p permafrost sediments. The results of the present study demonstrated that rRpf not only promoted the growth of T. biformata from which it was isolated, but also enhanced colony formation by another Actinobacteria in an environmental sample.
Directory of Open Access Journals (Sweden)
Rohimah Mohamud
2017-12-01
Full Text Available Synthetic glycine coated 50 nm polystyrene nanoparticles (NP (PS50G, unlike ambient NP, do not promote pulmonary inflammation, but instead, render lungs resistant to the development of allergic airway inflammation. In this study, we show that PS50G modulate the frequency and phenotype of regulatory T cells (Treg in the lung, specifically increasing the proportion of tumor necrosis factor 2 (TNFR2 expressing Treg. Mice pre-exposed to PS50G, which were sensitized and then challenged with an allergen a month later, preferentially expanded TNFR2+Foxp3+ Treg, which further expressed enhanced levels of latency associated peptide and cytotoxic T-lymphocyte associated molecule-4. Moreover, PS50G-induced CD103+ dendritic cell activation in the lung was associated with the proliferative expansion of TNFR2+Foxp3+ Treg. These findings provide the first evidence that engineered NP can promote the selective expansion of maximally suppressing TNFR2+Foxp3+ Treg and further suggest a novel mechanism by which NP may promote healthy lung homeostasis.
Xie, Xing-Bin; Li, Shen; Zhang, Rui-Fen; Zhao, Jing; Chen, Ying-Chun; Zhao, Qiang; Yao, Yu-Xin; You, Chun-Xiang; Zhang, Xian-Sheng; Hao, Yu-Jin
2012-11-01
Low environmental temperatures promote anthocyanin accumulation and fruit colouration by up-regulating the expression of genes involved in anthocyanin biosynthesis and regulation in many fruit trees. However, the molecular mechanism by which fruit trees regulate this process in response to low temperature (LT) remains largely unknown. In this study, the cold-induced bHLH transcription factor gene MdbHLH3 was isolated from an apple tree and was found to interact physically and specifically through two regions (amino acids 1-23 and 186-228) at the N terminus with the MYB partner MdMYB1 (allelic to MdMYB10). Subsequently, MdbHLH3 bound to the promoters of the anthocyanin biosynthesis genes MdDFR and MdUFGT and the regulatory gene MdMYB1 to activate their expression. Furthermore, the MdbHLH3 protein was post-translationally modified, possibly involving phosphorylation following exposure to LTs, which enhanced its promoter-binding capacity and transcription activity. Our results demonstrate the molecular mechanism by which MdbHLH3 regulates LT-induced anthocyanin accumulation and fruit colouration in apple. © 2012 Blackwell Publishing Ltd.
Gan, Chin Lay; Balakrishnan, Vimala
2016-01-01
Use of mobile technology is widespread, particularly among the younger generation. There is a huge potential for utilizing such technology in lecture classes with large numbers of students, serving as an interaction tool between the students and lecturers. The challenge is to identify significant adoption factors to ensure effective adoption of…
Afink, G. B.; Nistér, M.; Stassen, B. H.; Joosten, P. H.; Rademakers, P. J.; Bongcam-Rudloff, E.; van Zoelen, E. J.; Mosselman, S.
1995-01-01
Expression of the platelet-derived growth factor alpha receptor (PDGF alpha R) is strictly regulated during mammalian development and tumorigenesis. The molecular mechanisms involved in the specific regulation of PDGF alpha R expression are unknown, but transcriptional regulation of the PDGF alpha R
Zinc finger, BED-type containing 6 (ZBED6) is an important transcription factor in placental mammals, affecting development, cell proliferation and growth. In this study, we found that the expression of the ZBED6 and IGF2 were up regulated during C2C12 differentiation. The IGF2 expression levels wer...
Kilic, Eylem; Güler, Çetin; Çelik, H. Eray; Tatli, Cemal
2015-01-01
Purpose: The purpose of this study is to investigate the factors which might affect the intention to use interactive whiteboards (IWBs) by university students, using Technology Acceptance Model by the structural equation modeling approach. The following hypothesis guided the current study: H1. There is a positive relationship between IWB…
Michaud, Jason E; Kim, Kwang Sik; Harty, William; Kasprenski, Matthew; Wang, Ming-Hsien
2017-05-25
Urinary tract infections (UTI) are among the most common and costly infections in both hospitalized and ambulatory patients. Uropathogenic E. coli (UPEC) represent the majority of UTI isolates and are a diverse group of bacteria that utilize a variety of virulence factors to establish infection of the genitourinary tract. The virulence factor cytotoxic necrotizing factor-1 (CNF1) is frequently expressed in clinical UPEC isolates. To date, there have been conflicting reports on the role of CNF1 in the pathogenesis of E. coli urinary tract infections. We examined the importance of CNF1 in a murine ascending kidney infection/ pyelonephritis model by performing comparative studies between a clinical UPEC isolate strain and a CNF1-deletion mutant. We found no alterations in bacterial burden with the loss of CNF1, whereas loss of the virulence factor fimH decreased bacterial burdens. In addition, we found no evidence that CNF1 contributed to the recruitment of inflammatory infiltrates in the kidney or bladder in vivo. While further examination of CNF-1 may reveal a role in UTI pathogenesis, our data casts doubt on the role of CNF-1 in the pathogenesis of UPEC UTI. As with other infections, different models and approaches are needed to elucidate the contribution of CNF1 to E. coli UTI.
LENUS (Irish Health Repository)
Toomey, Desmond P
2010-07-01
Cyclooxygenase 2 (COX-2) and vascular endothelial growth factor (VEGF), often coexpressed in cancer, are associated with poor prognosis. However, results from pancreatic cancer trials of their inhibitors were disappointing. This study delineated the role of COX-2 and nonsteroidal anti-inflammatory drugs in angiogenesis and VEGF regulation.
Directory of Open Access Journals (Sweden)
Henna Riemenschneider
2016-07-01
Full Text Available Abstract Background Physical and mental health is important for coping with the high requirements of medical studies that are associated with a higher risk for severe stress, insomnia, smoking, harmful alcohol consumption and easier access to drugs. Health behaviors of medical students influence not just their own health but also the health of their future patients. We examined whether socio-cultural factors can explain differences in students’ health status and health-promoting behaviors. Methods A multicenter cross-sectional survey in Germany (Dresden, Munich and Hungary (Budapest, Pécs enclosed international medical students in their 1st, 3rd and 5th academic years. The students were invited to voluntarily and anonymously complete a questionnaire on different aspects of health behavior during obligatory seminars and lectures in 2014. The response rate of the total sample was 56.2 % (n = 2935; the subgroup analysis enclosed data of German (n = 1289, Hungarian (n = 1057 and Norwegian (n = 148 students. Results A high number of Norwegian students (84.5 % assessed their health status as very good/excellent. In comparison, only 60.3 % of the Hungarian and 70.7 % of the German participants reported a very good/excellent health status. The distributions were comparable between the study sites. Although gender, financial situation and nationality were significant health status predictors, they could explain only 8.2 % of the total variance of health status in the multivariable model. A comparably high number of Hungarian students (95.3 % vs. 67.4 % German and 56.7 % Norwegian reported that they can currently do a lot/very much for their health. In contrast, a significant number of Norwegians (73.0 % vs. 63.7 % Hungarian and 51.5 % German reported that they currently do a lot/very much for their health (chi2-test, p ≤ 0.001. Financial situation, study site and study year were the strongest predictors for health
Directory of Open Access Journals (Sweden)
Isaacs Richard J
2007-05-01
Full Text Available Abstract Background Topoisomerase IIα has been shown to be down-regulated in doxorubicin-resistant cell lines. The specificity proteins Sp1 and Sp3 have been implicated in regulation of topoisomerase IIα transcription, although the mechanism by which they regulate expression is not fully understood. Sp1 has been shown to bind specifically to both proximal and distal GC elements of the human topoisomerase IIα promoter in vitro, while Sp3 binds only to the distal GC element unless additional flanking sequences are included. While Sp1 is thought to be an activator of human topoisomerase IIα, the functional significance of Sp3 binding is not known. Therefore, we sought to determine the functional relationship between Sp1 and Sp3 binding to the topoisomerase IIα promoter in vivo. We investigated endogenous levels of Sp1, Sp3 and topoisomerase IIα as well as binding of both Sp1 and Sp3 to the GC boxes of the topoisomerase IIα promoter in breast cancer cell lines in vivo after short term doxorubicin exposure. Results Functional effects of Sp1 and Sp3 were studied using transient cotransfection assays using a topoisomerase IIα promoter reporter construct. The in vivo interactions of Sp1 and Sp3 with the GC elements of the topoisomerase IIα promoter were studied in doxorubicin-treated breast cancer cell lines using chromatin immunoprecipitation assays. Relative amounts of endogenous proteins were measured using immunoblotting. In vivo DNA looping mediated by proteins bound at the GC1 and GC2 elements was studied using the chromatin conformation capture assay. Both Sp1 and Sp3 bound to the GC1 and GC2 regions. Sp1 and Sp3 were transcriptional activators and repressors respectively, with Sp3 repression being dominant over Sp1-mediated activation. The GC1 and GC2 elements are linked in vivo to form a loop, thus bringing distal regulatory elements and their cognate transcription factors into close proximity with the transcription start site
George, Asha S; Branchini, Casey
2017-08-31
Promoting awareness of rights is a value-based process that entails a different way of thinking and acting, which is at times misunderstood or deemed as aspirational. Guided by the SURE framework, we undertook a secondary analysis of 26 documents identified by an earlier systematic review on promoting awareness of rights to increase use of maternity care services. We thematically analysed stakeholder experiences and implementation factors across the diverse initiatives to derive common elements to guide future efforts. Interventions that promote awareness of rights for maternal health varied in nature, methodological orientation, depth and quality. Materials included booklets, posters, pamphlets/ briefs and service standards/charters. Target populations included women, family members, communities, community structures, community-based and non governmental organizations, health providers and administrators, as well as elected representatives. While one initiative only focused on raising awareness, most were embedded within larger efforts to improve the accountability and responsiveness of service delivery through community monitoring and advocacy, with a few aiming to change policies and contest elections. Underlying these action oriented forms of promoting awareness of rights, was a critical consciousness and attitudinal change gained through iterative capacity-building for all stakeholders; materials and processes that supported group discussion and interaction; the formation or strengthening of community groups; situational analysis to ensure adaptation to local context; facilitation to ensure common ground and language across stakeholders; and strategic networking and alliance building across health system levels. While many positive experiences are discussed, few challenges or barriers to implementation are documented. The limited documentation and poor quality of information found indicate that while various examples of promoting awareness of rights for
Directory of Open Access Journals (Sweden)
Yumeng Shi
2018-04-01
Full Text Available ObjectivesFibroblast-like synoviocytes (FLS exhibit a unique aggressive phenotype in rheumatoid arthritis (RA. Increased FLS migration and subsequent invasion of the extracellular matrix are essential to joint destruction in RA. Our previous research reported that transcription factor SOX5 was highly expressed in RA-FLS. Here, the effects of SOX5 in RA-FLS migration and invasion will be investigated.MethodsThe migration and invasion of RA-FLS were evaluated using a transwell chamber assay. The expression of several potential SOX5-targeted genes, including matrix metalloproteinases (MMP-1, 2, 3 and 9, chemokines (CCL4, CCL2, CCR5 and CCR2, and pro-inflammatory cytokines (TNF-α and IL-6, were examined in RA-FLS using SOX5 gain- and loss-of-function study. The molecular mechanisms of SOX5-mediated MMP-9 expressions were assayed by luciferase reporter gene and chromatin immunoprecipitation (ChIP studies. The in vivo effect of SOX5 on FLS migration and invasion was examined using collagen-induced arthritis (CIA in DBA/1J mice.ResultsKnockdown SOX5 decreased lamellipodium formation, migration, and invasion of RA-FLS. The expression of MMP-9 was the only gene tested to be concomitantly affected by silencing or overexpressing SOX5. ChIP assay revealed that SOX5 was bound to the MMP-9 promoter in RA-FLS. The overexpression of SOX5 markedly enhanced the MMP-9 promoter activity, and specific deletion of a putative SOX5-binding site in MMP-9 promoter diminished this promoter-driven transcription in FLS. Locally knocked down SOX5 inhibited MMP-9 expression in the joint tissue and reduced pannus migration and invasion into the cartilage in CIA mice.ConclusionSOX5 plays a novel role in mediating migration and invasion of FLS in part by regulating MMP-9 expression in RA.
Shi, Yumeng; Wu, Qin; Xuan, Wenhua; Feng, Xiaoke; Wang, Fang; Tsao, Betty P; Zhang, Miaojia; Tan, Wenfeng
2018-01-01
Fibroblast-like synoviocytes (FLS) exhibit a unique aggressive phenotype in rheumatoid arthritis (RA). Increased FLS migration and subsequent invasion of the extracellular matrix are essential to joint destruction in RA. Our previous research reported that transcription factor SOX5 was highly expressed in RA-FLS. Here, the effects of SOX5 in RA-FLS migration and invasion will be investigated. The migration and invasion of RA-FLS were evaluated using a transwell chamber assay. The expression of several potential SOX5-targeted genes, including matrix metalloproteinases (MMP-1, 2, 3 and 9), chemokines (CCL4, CCL2, CCR5 and CCR2), and pro-inflammatory cytokines (TNF-α and IL-6), were examined in RA-FLS using SOX5 gain- and loss-of-function study. The molecular mechanisms of SOX5-mediated MMP-9 expressions were assayed by luciferase reporter gene and chromatin immunoprecipitation (ChIP) studies. The in vivo effect of SOX5 on FLS migration and invasion was examined using collagen-induced arthritis (CIA) in DBA/1J mice. Knockdown SOX5 decreased lamellipodium formation, migration, and invasion of RA-FLS. The expression of MMP-9 was the only gene tested to be concomitantly affected by silencing or overexpressing SOX5. ChIP assay revealed that SOX5 was bound to the MMP-9 promoter in RA-FLS. The overexpression of SOX5 markedly enhanced the MMP-9 promoter activity, and specific deletion of a putative SOX5-binding site in MMP-9 promoter diminished this promoter-driven transcription in FLS. Locally knocked down SOX5 inhibited MMP-9 expression in the joint tissue and reduced pannus migration and invasion into the cartilage in CIA mice. SOX5 plays a novel role in mediating migration and invasion of FLS in part by regulating MMP-9 expression in RA.
Directory of Open Access Journals (Sweden)
Min Ju Yi
2017-03-01
Full Text Available PurposeThe most common single nucleotide polymorphism in the IGFBP3 promoter region occurs at position -202. This polymorphic variation occurs frequently and may influence growth hormone responsiveness and somatic growth. However, the effects of IGFBP3 promoter polymorphism on growth in children are unknown.MethodsRestriction fragment length polymorphism-based genotyping of the -202 single nucleotide polymorphism was performed in 146 Korean girls aged between 15 and 16 years, who were selected randomly from the Seoul School Health Promotion Center. The participants were divided into 3 groups (tall, medium, and short according to the height percentile established from normal reference values for Korean children. The serum levels of insulin-like growth factor I (IGF-I and IGF-binding protein-3 (IGFBP-3 were then compared according to genotype.ResultsThe genotype distribution in the participants was 79 AA (54.1%, 60 AC (41.1%, and 7 CC (4.8%. The C allele frequency at the -202 IGFBP3 position was 25.4% in this group. The mean serum IGFBP-3 concentration in girls with the AA genotype was higher than that in girls with the AC genotype in the medium (P=0.047 and short (P=0.035 groups, respectively. There was no difference in the IGF-I to IGFBP-3 molar ratio between the AA and AC genotype groups (P=0.161.ConclusionIn conclusion, the -202 polymorphism in the IGFBP3 promoter region is assumed to affect the serum concentration of IGFBP-3 in children as well as in adults. However, it is unclear whether this affects physical development according to the concentration of IGFBP-3.
Mazzeo, Filomena; Monda, Vincenzo; Santamaria, Stefania; Nigro, Ersilia; Valenzano, Anna; Villano, Ines; Cibelli, Giuseppe; Messina, Antonietta; Messina, Giovanni
2017-07-24
Use of performance-enhancing drugs concern not only elite Olympic and Paralympic Games' athletes but also amateur athletes, who are making increasing use of substances and/or methods. Furthermore, a new frontier reached by the doping is the use of genes. World Anti- Doping Agency (WADA), expressly prohibited the participation in competitive sports by the athlete in case of taking banned substances to treat disease in the event that the above assumption implies an excessive improvement of performance. This study aims to analyze and show the doping control as an essential part of the anti-doping program to promote and protect the integrity of sport and athlete's health. Testing is carried out in accordance with the World Anti-Doping Code and several international standards (ISs). The ISs were developed for laboratories, testing, the prohibited list, and for therapeutic use exemptions (TUE). It seems that the 2009 version of the World Anti-Doping Code (WADC) obliges all the healthcare professionals not to assist athletes engaged in doping behaviours; they can be removed from working with athletes. Many people do not know doping's dangerous effects on health. It is necessary, therefore, implement the knowledge on this issue through public and sports institutions information and awareness campaigns. For this reason, local institutions and the National Olympic Committee shall give tools, in particular economic, to carry out the work of education, training, and control.
Birlouez-Aragon, Inès; Saavedra, Giselle; Tessier, Frédéric J; Galinier, Anne; Ait-Ameur, Lamia; Lacoste, Florence; Niamba, Claude-Narcisse; Alt, Nadja; Somoza, Veronika; Lecerf, Jean-Michel
2010-05-01
The modern Western lifestyle is characterized by the consumption of high-heat-treated foods because of their characteristic taste and flavor. However, it has been shown that treating food at high temperatures can generate potentially harmful compounds that promote inflammation and cardiovascular disease in subjects with diabetes. The aim of this study was to determine whether high-heat-treated foods also pose a risk for healthy subjects. A randomized, crossover, diet-controlled intervention trial with 62 volunteers was designed to compare the potential metabolic effects of 2 diets, one that was based on mild steam cooking and another that was based on high-temperature cooking. These 2 diets differed mainly in their contents of Maillard reaction products (MRPs). MRPs were assessed in the diet and in subjects' feces, blood, and urine samples, with N(epsilon)-carboxymethyllysine as an indicator of MRPs. Biological indicators of glucose and lipid metabolism as well as oxidative stress were analyzed in subjects after 1 mo on each diet. In comparison with the steamed diet, 1 mo of consuming the high-heat-treated diet induced significantly lower insulin sensitivity and plasma concentrations of long-chain n-3 (omega-3) fatty acids and vitamins C and E [-17% (P markers associated with an enhanced risk of type 2 diabetes and cardiovascular diseases in healthy people. Replacing high-heat-treatment techniques by mild cooking techniques may help to positively modulate biomarkers associated with an increased risk of diabetes mellitus and cardiovascular diseases.
Lee, Yu Jin; Shin, Kyeong Jin; Park, Soo-Ah; Park, Kyeong Su; Park, Seorim; Heo, Kyun; Seo, Young-Kyo; Noh, Dong-Young; Ryu, Sung Ho; Suh, Pann-Ghill
2016-10-25
G-protein-coupled receptor 81 (GPR81) functions as a receptor for lactate and plays an important role in the regulation of anti-lipolytic effects in adipocytes. However, to data, a role for GPR81 in the tumor microenvironment has not been clearly defined. Here, GPR81 expression in breast cancer patients and several breast cancer cell lines was significantly increased compared with normal mammary tissues and cells. GPR81 knockdown resulted in impaired breast cancer growth and led to apoptosis both in vitro and in vivo. Furthermore, the inhibition of GPR81 signaling suppressed angiogenesis through a phosphoinositide 3-OH kinase (PI3K)/Akt-cAMP response element binding protein (CREB) pathway, which led to decreased production of the pro-angiogenic mediator amphiregulin (AREG). Overall, these findings identify GPR81 as a tumor-promoting receptor in breast cancer progression and suggest a novel mechanism that regulates GPR81-dependent activation of the PI3K/Akt signaling axis in tumor microenvironment.
Bonner, L M; Hanson, A; Robinson, G; Lowy, E; Craft, S
2018-01-01
Dementia prevention is highly important. Improved control of vascular risk factors has the potential to decrease dementia risk, but may be difficult. Therefore, we developed and piloted a care management protocol for Veterans at risk for dementia. We enrolled 32 Veterans with diabetes and hypertension, at least one of which was poorly controlled, and cognitive impairment. Participants were randomly assigned to a 6-month care management intervention or to usual care. At enrollment, 6-months and 12-months, we assessed cognitive performance, mood, and diabetes and hypertension control. At follow-up, diastolic blood pressure was lower in intervention participants at 6 months (p=.041) and 12 months (p=.022); hemoglobin A1c, global mental status and mood did not differ between groups. Recall of a distractor list (p=.006) and logical memory long-delay recall (p=.036) were better at 6 months in the intervention group (p=.006). Care management may contribute to improved control of dementia risk factors.
KAP1 Is a Host Restriction Factor That Promotes Human Adenovirus E1B-55K SUMO Modification
DEFF Research Database (Denmark)
Bürck, Carolin; Mund, Andreas; Berscheminski, Julia
2016-01-01
Once transported to the replication sites, HAdVs need to assure decondensation and transcriptional activation of their viral genomes to synthesize viral proteins and initiate steps to reprogram the host cell for viral replication. These early stages during adenoviral infection are poorly characte......Once transported to the replication sites, HAdVs need to assure decondensation and transcriptional activation of their viral genomes to synthesize viral proteins and initiate steps to reprogram the host cell for viral replication. These early stages during adenoviral infection are poorly...... characterized, but represent a decisive moment in establishing a productive infection. Here, we identify a novel host viral restriction factor, KAP1. This heterochromatin associated transcription factor regulates the dynamic organization of host chromatin structure via its ability to influence epigenetic marks...
Van der Does, Dieuwertje; Leon-Reyes, Antonio; Koornneef, Annemart; Van Verk, Marcel C.; Rodenburg, Nicole; Pauwels, Laurens; Goossens, Alain; Körbes, Ana P.; Memelink, Johan; Ritsema, Tita; Van Wees, Saskia C.M.; Pieterse, Corné M.J.
2013-01-01
Antagonism between the defense hormones salicylic acid (SA) and jasmonic acid (JA) plays a central role in the modulation of the plant immune signaling network, but the molecular mechanisms underlying this phenomenon are largely unknown. Here, we demonstrate that suppression of the JA pathway by SA functions downstream of the E3 ubiquitin-ligase Skip-Cullin-F-box complex SCFCOI1, which targets JASMONATE ZIM-domain transcriptional repressor proteins (JAZs) for proteasome-mediated degradation. In addition, neither the stability nor the JA-induced degradation of JAZs was affected by SA. In silico promoter analysis of the SA/JA crosstalk transcriptome revealed that the 1-kb promoter regions of JA-responsive genes that are suppressed by SA are significantly enriched in the JA-responsive GCC-box motifs. Using GCC:GUS lines carrying four copies of the GCC-box fused to the β-glucuronidase reporter gene, we showed that the GCC-box motif is sufficient for SA-mediated suppression of JA-responsive gene expression. Using plants overexpressing the GCC-box binding APETALA2/ETHYLENE RESPONSE FACTOR (AP2/ERF) transcription factors ERF1 or ORA59, we found that SA strongly reduces the accumulation of ORA59 but not that of ERF1. Collectively, these data indicate that the SA pathway inhibits JA signaling downstream of the SCFCOI1-JAZ complex by targeting GCC-box motifs in JA-responsive promoters via a negative effect on the transcriptional activator ORA59. PMID:23435661
Van der Does, Dieuwertje; Leon-Reyes, Antonio; Koornneef, Annemart; Van Verk, Marcel C; Rodenburg, Nicole; Pauwels, Laurens; Goossens, Alain; Körbes, Ana P; Memelink, Johan; Ritsema, Tita; Van Wees, Saskia C M; Pieterse, Corné M J
2013-02-01
Antagonism between the defense hormones salicylic acid (SA) and jasmonic acid (JA) plays a central role in the modulation of the plant immune signaling network, but the molecular mechanisms underlying this phenomenon are largely unknown. Here, we demonstrate that suppression of the JA pathway by SA functions downstream of the E3 ubiquitin-ligase Skip-Cullin-F-box complex SCF(COI1), which targets JASMONATE ZIM-domain transcriptional repressor proteins (JAZs) for proteasome-mediated degradation. In addition, neither the stability nor the JA-induced degradation of JAZs was affected by SA. In silico promoter analysis of the SA/JA crosstalk transcriptome revealed that the 1-kb promoter regions of JA-responsive genes that are suppressed by SA are significantly enriched in the JA-responsive GCC-box motifs. Using GCC:GUS lines carrying four copies of the GCC-box fused to the β-glucuronidase reporter gene, we showed that the GCC-box motif is sufficient for SA-mediated suppression of JA-responsive gene expression. Using plants overexpressing the GCC-box binding APETALA2/ETHYLENE RESPONSE FACTOR (AP2/ERF) transcription factors ERF1 or ORA59, we found that SA strongly reduces the accumulation of ORA59 but not that of ERF1. Collectively, these data indicate that the SA pathway inhibits JA signaling downstream of the SCF(COI1)-JAZ complex by targeting GCC-box motifs in JA-responsive promoters via a negative effect on the transcriptional activator ORA59.
Li, Xiang-Wen; Li, Fang; Liu, Jing; Wang, Yan; Fu, Wei
2016-11-01
To study the possible effect of antepartum taurine supplementation in regulating the activity of Rho family factors and promoting the proliferation of neural stem cells in neonatal rats with fetal growth restriction (FGR), and to provide a basis for antepartum taurine supplementation to promote brain development in children with FGR. A total of 24 pregnant Sprague-Dawley rats were randomly divided into three groups: control, FGR, and taurine (n=8 each ). A rat model of FGR was established by food restriction throughout pregnancy. RT-PCR, immunohistochemistry, and Western blot were used to measure the expression of the specific intracellular markers for neural stem cells fatty acid binding protein 7 (FABP7), Rho-associated coiled-coil containing protein kinase 2 (ROCK2), ras homolog gene family, member A (RhoA), and Ras-related C3 botulinum toxin substrate (Rac). The FGR group had significantly lower OD value of FABP7-positive cells and mRNA and protein expression of FABP7 than the control group, and the taurine group had significantly higher OD value of FABP7-positive cells and mRNA and protein expression of FABP7 than the FGR group (Ptaurine group had significantly higher mRNA expression of RhoA and ROCK2 than the control group and significantly lower expression than the FGR group (Ptaurine group had significantly higher mRNA expression of Rac than the FGR and control groups (Ptaurine group had significantly lower protein expression of RhoA and ROCK2 than the FGR group (Ptaurine supplementation can promote the proliferation of neural stem cells in rats with FGR, and its mechanism may be related to the regulation of the activity of Rho family factors.
Nautiyal, Jaya; Steel, Jennifer H; Mane, Meritxell Rosell; Oduwole, Olayiwola; Poliandri, Ariel; Alexi, Xanthippi; Wood, Nicholas; Poutanen, Matti; Zwart, Wilbert; Stingl, John; Parker, Malcolm G
2013-03-01
Nuclear receptor interacting protein (Nrip1), also known as RIP140, is a co-regulator for nuclear receptors that plays an essential role in ovulation by regulating the expression of the epidermal growth factor-like family of growth factors. Although several studies indicate a role for RIP140 in breast cancer, its role in the development of the mammary gland is unclear. By using RIP140-null and RIP140 transgenic mice, we demonstrate that RIP140 is an essential factor for normal mammary gland development and that it functions by mediating oestrogen signalling. RIP140-null mice exhibit minimal ductal elongation with no side-branching, whereas RIP140-overexpressing mice show increased cell proliferation and ductal branching with age. Tissue recombination experiments demonstrate that RIP140 expression is required in both the mammary epithelial and stromal compartments for ductal elongation during puberty and that loss of RIP140 leads to a catastrophic loss of the mammary epithelium, whereas RIP140 overexpression augments the mammary basal cell population and shifts the progenitor/differentiated cell balance within the luminal cell compartment towards the progenitors. For the first time, we present a genome-wide global view of oestrogen receptor-α (ERα) binding events in the developing mammary gland, which unravels 881 ERα binding sites. Unbiased evaluation of several ERα binding sites for RIP140 co-occupancy reveals selectivity and demonstrates that RIP140 acts as a co-regulator with ERα to regulate directly the expression of amphiregulin (Areg), the progesterone receptor (Pgr) and signal transducer and activator of transcription 5a (Stat5a), factors that influence key mitogenic pathways that regulate normal mammary gland development.
Directory of Open Access Journals (Sweden)
Vasseur Sophie
2003-11-01
Full Text Available Abstract Background p8 is a stress-induced protein with multiple functions and biochemically related to the architectural factor HMG-I/Y. We analyzed the expression and function of p8 in pancreatic cancer-derived cells. Methods Expression of p8 was silenced in the human pancreatic cancer cell lines Panc-1 and BxPc-3 by infection with a retrovirus expressing p8 RNA in the antisense orientation. Cell growth was measured in control and p8-silenced cells. Influence on p8 expression of the induction of intracellular pathways promoting cellular growth or growth arrest was monitored. Results p8-silenced cells grew more rapidly than control cells transfected with the empty retrovirus. Activation of the Ras→Raf→MEK→ERK and JNK intracellular pathways down-regulated p8 expression. In addition, the MEK1/2 inhibitor U0126 and the JNK inhibitor SP600125 up-regulates expression of p8. Conversely, p38 or TGFβ-1 induced p8 expression whereas the specific p38 inhibitor SB203580 down-regulated p8 expression. Finally, TGFβ-1 induction was in part mediated through p38. Conclusions p8 inhibits the growth of human pancreatic cancer cells. p8 expression is induced through pathways involved in growth inhibition and repressed by factors that promote cell growth. These results suggest that p8 belongs to a pathway regulating the growth of pancreatic cancer cells.
Zuo, Xiangyang; Pan, Wen; Feng, Tingting; Shi, Xiaohong; Dai, Jianfeng
2014-01-01
Dengue virus (DENV), the causative agent of human Dengue hemorrhagic fever, is a mosquito-borne virus of immense global health importance. Characterization of cellular factors promoting or inhibiting DENV infection is important for understanding the mechanism of DENV infection. In this report, MMP3 (stromelysin-1), a secretory endopeptidase that degrades extracellular matrices, has been shown promoting cellular antiviral response against DENV infection. Quantitative RT-PCR and Western Blot showed that the expression of MMP3 was upregulated in DENV-infected RAW264.7 cells. The intracellular viral loads were significantly higher in MMP3 silenced cells compared with controls. The expression level of selective anti-viral cytokines were decreased in MMP3 siRNA treated cells, and the transcription factor activity of NFκB was significantly impaired upon MMP3 silencing during DENV infection. Further, we found that MMP3 moved to cell nucleus upon DENV infection and colocalized with NFκB P65 in nucleus. Co-immunoprecipitation analysis suggested that MMP3 directly interacted with NFκB in nucleus during DENV infection and the C-terminal hemopexin-like domain of MMP3 was required for the interaction. This study suggested a novel role of MMP3 in nucleus during viral infection and provided new evidence for MMPs in immunomodulation.
Ollivier-Lanvin, Karen; Fischer, Itzhak; Tom, Veronica; Houlé, John D; Lemay, Michel A
2015-01-01
Background. Transplants of cellular grafts expressing a combination of 2 neurotrophic factors, brain-derived neurotrophic factor (BDNF) and neurotrophin-3 (NT-3) have been shown to promote and enhance locomotor recovery in untrained spinalized cats. Based on the time course of recovery and the absence of axonal growth through the transplants, we hypothesized that recovery was due to neurotrophin-mediated plasticity within the existing locomotor circuitry of the lumbar cord. Since BDNF and NT-3 have different effects on axonal sprouting and synaptic connectivity/strengthening, it becomes important to ascertain the contribution of each individual neurotrophins to recovery. Objective. We studied whether BDNF or NT-3 only producing cellular grafts would be equally effective at restoring locomotion in untrained spinal cats. Methods. Rat fibroblasts secreting one of the 2 neurotrophins were grafted into the T12 spinal transection site of adult cats. Four cats in each group (BDNF alone or NT-3 alone) were evaluated. Locomotor recovery was tested on a treadmill at 3 and 5 weeks post-transection/grafting. Results. Animals in both groups were capable of plantar weight-bearing stepping at speed up to 0.8 m/s as early as 3 weeks and locomotor capabilities were similar at 3 and 5 weeks for both types of graft. Conclusions. Even without locomotor training, either BDNF or NT-3 only producing grafts promote locomotor recovery in complete spinal animals. More clinically applicable delivery methods need to be developed. © The Author(s) 2014.
Carrillo-García, Carmen; Prochnow, Sebastian; Simeonova, Ina K; Strelau, Jens; Hölzl-Wenig, Gabriele; Mandl, Claudia; Unsicker, Klaus; von Bohlen Und Halbach, Oliver; Ciccolini, Francesca
2014-02-01
The activation of epidermal growth factor receptor (EGFR) affects multiple aspects of neural precursor behaviour, including proliferation and migration. Telencephalic precursors acquire EGF responsiveness and upregulate EGFR expression at late stages of development. The events regulating this process and its significance are still unclear. We here show that in the developing and postnatal hippocampus (HP), growth/differentiation factor (GDF) 15 and EGFR are co-expressed in primitive precursors as well as in more differentiated cells. We also provide evidence that GDF15 promotes responsiveness to EGF and EGFR expression in hippocampal precursors through a mechanism that requires active CXC chemokine receptor (CXCR) 4. Besides EGFR expression, GDF15 ablation also leads to decreased proliferation and migration. In particular, lack of GDF15 impairs both processes in the cornu ammonis (CA) 1 and only proliferation in the dentate gyrus (DG). Importantly, migration and proliferation in the mutant HP were altered only perinatally, when EGFR expression was also affected. These data suggest that GDF15 regulates migration and proliferation by promoting EGFR signalling in the perinatal HP and represent a first description of a functional role for GDF15 in the developing telencephalon.
Zulu, Richard; Siziya, Seter; Muula, Adamson S; Rudatsikira, Emmanuel
2009-01-01
Tobacco use is the leading cause of noncommunicable disease morbidity and mortality. Most smokers initiate the smoking habit as adolescents or young adults. Survey data from the 2007 Lusaka (Zambia) Global Youth Tobacco Survey were used to estimate the prevalence of current cigarette smoking and assess whether exposure to pro-tobacco media and perception of the potential harm of secondhand smoke are associated with adolescents' smoking. Logistic regression analysis was used to estimate the associations. Altogether, 2378 students, of whom 56.8% were females, participated in the study. Overall, 10.5% of the students (9.3% among males and 12.1% among females) smoked cigarettes in the 30 days prior to the survey. Students who favored banning smoking in public places were 33% (OR = 0.67; 95% CI [0.47, 0.96]) less likely to smoke cigarettes compared to those who were not in favor of the ban. Seeing actors smoking in TV shows, videos or movies was positively associated with smoking (OR = 1.90; 95% CI [1.26, 2.88]). However, possessing an item with a cigarette brand logo on it, seeing advertisements of cigarettes on billboards and being ever offered a free cigarette by a cigarette sales representative were negatively associated with smoking (OR=0.39, 95% CI [0.26, 0.58]; OR=0.63, 95% CI [0.43, 0.92]; and OR=0.43, 95% CI [0.29, 0.65], respectively). Findings from this study indicate that TV advertisement-promotion-sponsorship was positively associated with smoking, while it was the opposite with other forms of advertisement; there is a need for further studies.
Coetzee, J Chris; Pomeroy, Gregory C; Watts, J David; Barrow, Craig
2005-10-01
The Agility (DePuy, Warsaw, Indiana) total ankle replacement has been in use since 1984. One of the most common complications continues to be delayed union or nonunions of the distal tibiofibular syndesmosis. In the reported studies on the Agility ankle the delayed union and nonunion rate can be as high as 38%. Since 1999, 114 Agility total ankle replacements were done at two centers in the United States without the use of autologous concentrated growth factors. Since July of 2001, 66 Agility ankles were implanted with Symphony (DePuy, Warsaw, Indiana) augmented bone grafting. The standard operative technique was followed in all the patients. Prospective data was collected on all patients. The standard ankle radiographs were taken preoperatively and postoperative at 8 weeks, 12 weeks, 16 weeks, 6 months, and yearly. CT scans were obtained at 6 months if fusion at the syndesmosis was questionable. The Graphpad Instat software (Graphpad Software Inc., San Diego, CA) was used for statistical analysis. The two-tailed unpaired t-test was used, and the value ankle replacements without autologous concentrated growth factors 70 fused at 8 weeks (61%), 14 fused at 12 weeks (12%), 13 fused at 6 months (12%). There were 17 nonunions (15%); delayed unions (3 to 6 months) and nonunions, therefore, equaled 27%. The syndesmosis fused in 50 of the 66 ankle replacements (76%) that had autologous concentrated growth fractures at 8 weeks (76%); 12 fused at 3 months (18%), 2 fused at 6 months (3%), 2 had nonunions (3%). Delayed unions (3 to 6 months) and nonunions equaled 6%. There was a statistically significant improvement in the 8- and 12-week fusion rates, and a statistically significant reduction in delayed unions and nonunions. Autologous concentrated growth factors appear to make a significant positive difference in the syndesmosis union rate in total ankle replacements.
Institute of Scientific and Technical Information of China (English)
YANG Li; ZHAO Wei; ZUO Wen-shu; WEI Ling; SONG Xian-rang; WANG Xing-wu; ZHENG Gang; ZHENG Mei-zhu
2012-01-01
Background Osteopontin (OPN) is a secreted phosphoglycoprotein (SSP) that is overexpressed in a variety of tumors and was regarded as a molecular marker of tumors.In this study,we intended to demonstrate the role of OPN in human breast cancer cell line MDA-MB-231.Methods Recombinant plasmid expressing small interfering RNA (siRNA) specific to OPN mRNA was transfected into MDA-MB-231 cells to generate the stable transfected cell line MDA-MB-343,and the empty plasmid tansfected cells (MDA-MB-neg) or wildtype MDA-MB-231 cells were used as control cells respectively.Expression of OPN,hypoxia inducible factor-1 (HIF-1) and vascular endothelial growth factor (VEGF) proteins was analyzed by Western blotting analysis.The radiosensitivity of cells was determined by detecting cell apoptosis,cell proliferation and cell senescence.Results HIF-1 and VEGF proteins in MDA-MB-343 cells were significantly downregulated upon the efficient knockdown of OPN expression under either hypoxia or normoxia environment.Moreover,expression of OPN protein was upregualted upon hypoxic culture.Stable OPN-silencing also decreased cell invasion,increased cell apoptosis and cell senescence,as well as reduced clonogenic survival,resulting in increase radiation tolerance.Conclusions Suppression of OPN gene expression can enhance radiosensitivity and affect cell apoptosis in breast cancer cells.OPN seems to be an attractive target for the improvement of radiotherapy.
Kennedy, Catriona M; Buchan, Iain; Powell, John; Ainsworth, John
2015-01-01
the effectiveness of online social networking within health promotion interventions. Most of the trials investigated the value of a “social networking condition” in general and did not identify specific features that might play a role in effectiveness. Issues about the usability and level of uptake of interventions were more common among pilot studies, while observational studies showed positive evidence about the role of social support. A total of 20 papers showed the use of theory in the design of interventions, but authors evaluated effectiveness in only 10 papers. Conclusions More research is needed in this area to understand the actual effect of social network technologies on health promotion. More RCTs of greater length need to be conducted taking into account contextual factors such as patient characteristics and types of a social network technology. Also, more evidence is needed regarding the actual usability of online social networking and how different interface design elements may help or hinder behavior change and engagement. Moreover, it is crucial to investigate further the effect of theory on the effectiveness of this type of technology for health promotion. Research is needed linking theoretical grounding with observation and analysis of health promotion in online networks. PMID:26068087
Balatsoukas, Panos; Kennedy, Catriona M; Buchan, Iain; Powell, John; Ainsworth, John
2015-06-11
networking within health promotion interventions. Most of the trials investigated the value of a "social networking condition" in general and did not identify specific features that might play a role in effectiveness. Issues about the usability and level of uptake of interventions were more common among pilot studies, while observational studies showed positive evidence about the role of social support. A total of 20 papers showed the use of theory in the design of interventions, but authors evaluated effectiveness in only 10 papers. More research is needed in this area to understand the actual effect of social network technologies on health promotion. More RCTs of greater length need to be conducted taking into account contextual factors such as patient characteristics and types of a social network technology. Also, more evidence is needed regarding the actual usability of online social networking and how different interface design elements may help or hinder behavior change and engagement. Moreover, it is crucial to investigate further the effect of theory on the effectiveness of this type of technology for health promotion. Research is needed linking theoretical grounding with observation and analysis of health promotion in online networks.
Directory of Open Access Journals (Sweden)
Adriana P. Uribe Uran
2010-06-01
Full Text Available El presente artículo expone la experiencia obtenida por un grupo de investigadores de la Universidad Simón Bolívar de Barranquilla- Colombia, tras la ejecución de un proyecto que consistió en la construcción de un sistema de gestión y el desarrollo de un conjunto de estrategias para potenciar las ventajas del Caribe Colombiano como sector turístico. La finalidad del proyecto era mejorar el desarrollo económico y social de esta región y hacerla atractiva para turistas nacionales y extranjeros, de tal forma que a través del portal Web creado como estrategia central, la visitaran para disfrutar de los diferentes tipos de turismo que esta región puede ofrecer: ecológico, de aventura, de salud, cultural, de sol y playa, entre otros. La investigación arrojo dentro de sus resultados, la conformación de un grupo de empresarios del sector turístico, en un trabajo asociativo bajo el apoyo de una plataforma en TIC que permite a los potenciales viajeros, conocer las ventajas del Caribe como destino turístico, y a los empresarios, promocionar sus servicios a través del portal.This article presents the experience gained by a research group from the Simon Bolivar University of Barranquilla-Colombia, after carrying out a project which consisted in the building of a communication system and the development of a group of strategies that will impulse the advantages of the Colombian Caribe as a touristic place, with the goal of improving the economic and social development of this Colombian region and making it an attractive place for national and foreign tourists, who, through the web page created as central strategy, could visit and enjoy the different tourism types it can offer: ecologic, adventure, health, cultural, beach and sun, among others. The research results showed the formation of a group of businessmen in the tourism sector, working in partnership under the support of a ICT’s platform that enables them to promote their services
Directory of Open Access Journals (Sweden)
Joffrey ePelletier
2012-02-01
Full Text Available The hypoxia-inducible factor 1 (HIF-1, in addition to genetic and epigenetic changes, is largely responsible for alterations in cell metabolism in hypoxic tumor cells. This transcription factor not only favors cell proliferation through the metabolic shift from oxidative phosphorylation to glycolysis and lactic acid production but also stimulates nutrient supply by mediating adaptive survival mechanisms. In this study we showed that glycogen synthesis is enhanced in non-cancer and cancer cells when exposed to hypoxia, resulting in a large increase in glycogen stores. Furthermore, we demonstrated that the mRNA and protein levels of the first enzyme of glycogenesis, phosphoglucomutase1 (PGM1, were increased in hypoxia. We showed that induction of glycogen storage as well as PGM1 expression were dependent on HIF-1 and HIF-2. We established that hypoxia-induced glycogen stores are rapidly mobilized in cells that are starved of glucose. Glycogenolysis allows these hypoxia-preconditioned cells to confront and survive glucose deprivation. In contrast normoxic control cells exhibit a high rate of cell death following glucose removal. These findings point to the important role of hypoxia and HIF in inducing mechanisms of rapid adaptation and survival in response to a decrease in oxygen tension. We propose that a decrease in pO2 acts as an alarm that prepares the cells to face subsequent nutrient depletion and to survive.
Energy Technology Data Exchange (ETDEWEB)
Pelletier, Joffrey; Bellot, Grégory [Institute of Developmental Biology and Cancer Research, CNRS-UMR 6543, Centre Antoine Lacassagne, University of Nice-Sophia Antipolis, Nice (France); Gounon, Pierre; Lacas-Gervais, Sandra [Centre Commun de Microscopie Appliquée, University of Nice-Sophia Antipolis, Nice (France); Pouysségur, Jacques; Mazure, Nathalie M., E-mail: mazure@unice.fr [Institute of Developmental Biology and Cancer Research, CNRS-UMR 6543, Centre Antoine Lacassagne, University of Nice-Sophia Antipolis, Nice (France)
2012-02-28
The hypoxia-inducible factor 1 (HIF-1), in addition to genetic and epigenetic changes, is largely responsible for alterations in cell metabolism in hypoxic tumor cells. This transcription factor not only favors cell proliferation through the metabolic shift from oxidative phosphorylation to glycolysis and lactic acid production but also stimulates nutrient supply by mediating adaptive survival mechanisms. In this study we showed that glycogen synthesis is enhanced in non-cancer and cancer cells when exposed to hypoxia, resulting in a large increase in glycogen stores. Furthermore, we demonstrated that the mRNA and protein levels of the first enzyme of glycogenesis, phosphoglucomutase1 (PGM1), were increased in hypoxia. We showed that induction of glycogen storage as well as PGM1 expression were dependent on HIF-1 and HIF-2. We established that hypoxia-induced glycogen stores are rapidly mobilized in cells that are starved of glucose. Glycogenolysis allows these “hypoxia-preconditioned” cells to confront and survive glucose deprivation. In contrast normoxic control cells exhibit a high rate of cell death following glucose removal. These findings point to the important role of hypoxia and HIF in inducing mechanisms of rapid adaptation and survival in response to a decrease in oxygen tension. We propose that a decrease in pO{sub 2} acts as an “alarm” that prepares the cells to face subsequent nutrient depletion and to survive.
International Nuclear Information System (INIS)
Pelletier, Joffrey; Bellot, Grégory; Gounon, Pierre; Lacas-Gervais, Sandra; Pouysségur, Jacques; Mazure, Nathalie M.
2012-01-01
The hypoxia-inducible factor 1 (HIF-1), in addition to genetic and epigenetic changes, is largely responsible for alterations in cell metabolism in hypoxic tumor cells. This transcription factor not only favors cell proliferation through the metabolic shift from oxidative phosphorylation to glycolysis and lactic acid production but also stimulates nutrient supply by mediating adaptive survival mechanisms. In this study we showed that glycogen synthesis is enhanced in non-cancer and cancer cells when exposed to hypoxia, resulting in a large increase in glycogen stores. Furthermore, we demonstrated that the mRNA and protein levels of the first enzyme of glycogenesis, phosphoglucomutase1 (PGM1), were increased in hypoxia. We showed that induction of glycogen storage as well as PGM1 expression were dependent on HIF-1 and HIF-2. We established that hypoxia-induced glycogen stores are rapidly mobilized in cells that are starved of glucose. Glycogenolysis allows these “hypoxia-preconditioned” cells to confront and survive glucose deprivation. In contrast normoxic control cells exhibit a high rate of cell death following glucose removal. These findings point to the important role of hypoxia and HIF in inducing mechanisms of rapid adaptation and survival in response to a decrease in oxygen tension. We propose that a decrease in pO 2 acts as an “alarm” that prepares the cells to face subsequent nutrient depletion and to survive.
Yokoyama, Satoshi; Hiramoto, Keiichi; Koyama, Mayu; Ooi, Kazuya
2016-09-01
Alcohol is frequently used to induce chronic liver injury in laboratory animals. Alcohol causes oxidative stress in the liver and increases the expression of inflammatory mediators that cause hepatocellular damage. However, during chronic liver injury, it is unclear if/how these liver-derived factors affect distal tissues, such as the skin. The purpose of this study was to evaluate skin barrier function during chronic liver injury. Hairless mice were administered 5% or 10% ethanol for 8 weeks, and damages to the liver and skin were assessed using histological and protein-analysis methods, as well as by detecting inflammatory mediators in the plasma. After alcohol administration, the plasma concentration of the aspartate and alanine aminotransferases increased, while albumin levels decreased. In mice with alcohol-induced liver injury, transepidermal water loss was significantly increased, and skin hydration decreased concurrent with ceramide and type I collagen degradation. The plasma concentrations of [Formula: see text]/[Formula: see text] and tumor necrosis factor-alpha (TNF-α) were significantly increased in mice with induced liver injury. TNF receptor (TNFR) 2 expression was upregulated in the skin of alcohol-administered mice, while TNFR1 levels remained constant. Interestingly, the impairment of skin barrier function in mice administered with 10% ethanol was ameliorated by administering an anti-TNF-α antibody. We propose a novel mechanism whereby plasma TNF-α, via TNFR2 alone or with TNFR1, plays an important role in skin barrier function during chronic liver disease in these mouse models.
Joireman, Jeff; Shaffer, Monte J; Balliet, Daniel; Strathman, Alan
2012-10-01
The authors extended research linking individual differences in consideration of future consequences (CFC) with health behaviors by (a) testing whether individual differences in regulatory focus would mediate that link and (b) highlighting the value of a revised, two-factor CFC-14 scale with subscales assessing concern with future consequences (CFC-Future) and concern with immediate consequences (CFC-Immediate) proper. Exploratory and confirmatory factor analyses of the revised CFC-14 scale supported the presence of two highly reliable factors (CFC-Future and CFC-Immediate; αs from .80 to .84). Moreover, structural equation modeling showed that those high in CFC-Future engage in exercise and healthy eating because they adopt a promotion orientation. Future use of the two-factor CFC-14 scale is encouraged to shed additional light on how concern with future and concern with immediate consequences (proper) differentially impact the way people resolve a host of intertemporal dilemmas (e.g., health, financial, and environmental behavior).
Tian, Chenxi; Shi, Herong; Colledge, Clark; Stern, Michael; Waterston, Robert; Liu, Jun
2011-01-01
The proper development of multicellular organisms requires precise regulation and coordination of cell fate specification, cell proliferation and differentiation. Abnormal regulation and coordination of these processes could lead to disease, including cancer. We have examined the function of the sole C. elegans SoxC protein, SEM-2, in the M lineage, which produces the postembryonic mesoderm. We found that SEM-2/SoxC is both necessary and sufficient to promote a proliferating blast cell fate, the sex myoblast fate, over a differentiated striated bodywall muscle fate. A number of factors control the specific expression of sem-2 in the sex myoblast precursors and their descendants. This includes direct control of sem-2 expression by a Hox-PBC complex. The crucial nature of the HOX/PBC factors in directly enhancing expression of this proliferative factor in the C. elegans M lineage suggests a possible more general link between Hox-PBC factors and SoxC proteins in regulating cell proliferation. PMID:21307099
Miyajima, A; Bond, M W; Otsu, K; Arai, K; Arai, N
1985-01-01
We have constructed a general expression vector which allows the synthesis and secretion of processed gene products in Saccharomyces cerevisiae. This vector contains yeast DNA, including the promoter of the mating pheromone (alpha-factor), its downstream leader sequence, and the TRP5 terminator. A cDNA [encoding mature mouse interleukin-2 (IL-2); Yokota et al., Proc. Natl. Acad. Sci. USA 82 (1984) 68-72] was fused immediately downstream to the alpha-factor leader sequence. The resulting recombinant plasmid directed the synthesis of mature mouse IL-2 in S. cerevisiae, with most of the T-cell growth-factor (TCGF) activity secreted into the culture fluid and extracellular space. TCGF activities in the cell extract, as well as in the culture fluid, increased in parallel with cell growth. Production of mature mouse IL-2 was inhibited by tunicamycin (TM), with precursor molecules accumulating in the cell extract. The precursor was processed accurately at the junction between the alpha-factor peptide leader sequence and the coding sequence downstream, yielding mature IL-2. The Mr of the secreted mouse IL-2 determined by sodium dodecyl sulfate (SDS)-polyacrylamide gel electrophoresis (PAGE) was 17 kDal, a value expected for the mature mouse IL-2 polypeptide based on the nucleotide (nt) sequence.
International Nuclear Information System (INIS)
Patel, Divya; Chaudhary, Jaideep
2012-01-01
Highlights: ► E2A, considered as a tumor suppressor is highly expressed in prostate cancer. ► Silencing of E2A attenuates cell proliferation and promotes apoptosis. ► E2A regulates c-myc, Id1, Id3 and CDKN1A expression. ► Loss of E2A promotes doxorubicin dependent apoptosis in prostate cancer cells. ► Results suggest that E2A acts as a tumor promoter at least in prostate cancer. -- Abstract: E2A (TCF3) is a multifunctional basic helix loop helix (bHLH), transcription factor. E2A regulates transcription of target genes by homo- or heterodimerization with cell specific bHLH proteins. In general, E2A promotes cell differentiation, acts as a negative regulator of cell proliferation in normal cells and cancer cell lines and is required for normal B-cell development. Given the diverse biological pathways regulated/influenced by E2A little is known about its expression in cancer. In this study we investigated the expression of E2A in prostate cancer. Unexpectedly, E2A immuno-histochemistry demonstrated increased E2A expression in prostate cancer as compared to normal prostate. Silencing of E2A in prostate cancer cells DU145 and PC3 led to a significant reduction in proliferation due to G1 arrest that was in part mediated by increased CDKN1A(p21) and decreased Id1, Id3 and c-myc. E2A silencing in prostate cancer cell lines also resulted in increased apoptosis due to increased mitochondrial permeability and caspase 3/7 activation. Moreover, silencing of E2A increased sensitivity to doxorubicin induced apoptosis. Based on our results, we propose that E2A could be an upstream regulator of Id1 and c-Myc which are highly expressed in prostate cancer. These results for the first time demonstrate that E2A could in fact acts as a tumor promoter at least in prostate cancer.
McIntyre, Di; Ranson, Michael K; Aulakh, Bhupinder K; Honda, Ayako
2013-09-24
problem in LMICs. The case studies also highlighted the critical role of high-level political leadership in pursuing UHC policies and citizen support in sustaining these policies.This series demonstrates the value of promoting greater sharing of experiences on UHC reforms across LMICs. It also identifies key areas of future research on health care financing in LMICs that would support progress towards UHC.
Brand, Oliver J; Somanath, Sangeeta; Moermans, Catherine; Yanagisawa, Haruhiko; Hashimoto, Mitsuo; Cambier, Stephanie; Markovics, Jennifer; Bondesson, Andrew J; Hill, Arthur; Jablons, David; Wolters, Paul; Lou, Jianlong; Marks, James D; Baron, Jody L; Nishimura, Stephen L
2015-06-05
CCL20 is the only chemokine ligand for the chemokine receptor CCR6, which is expressed by the critical antigen presenting cells, dendritic cells. Increased expression of CCL20 is likely involved in the increased recruitment of dendritic cells observed in fibroinflammatory diseases such as chronic obstructive pulmonary disease (COPD). CCL20 expression is increased by the proinflammatory cytokine IL-1β. We have determined that IL-1β-dependent CCL20 expression is also dependent on the multifunctional cytokine TGF-β. TGF-β is expressed in a latent form that must be activated to function, and activation is achieved through binding to the integrin αvβ8 (itgb8). Here we confirm correlative increases in αvβ8 and IL-1β with CCL20 protein in lung parenchymal lysates of a large cohort of COPD patients. How IL-1β- and αvβ8-mediated TGF-β activation conspire to increase fibroblast CCL20 expression remains unknown, because these pathways have not been shown to directly interact. We evaluate the 5'-flanking region of CCL20 to determine that IL-1β-driven CCL20 expression is dependent on αvβ8-mediated activation of TGF-β. We identify a TGF-β-responsive element (i.e. SMAD) located on an upstream enhancer of the human CCL20 promoter required for efficient IL-1β-dependent CCL20 expression. By chromatin immunoprecipitation, this upstream enhancer complexes with the p50 subunit of NF-κB on a NF-κB-binding element close to the transcriptional start site of CCL20. These interactions are confirmed by electromobility shift assays in nuclear extracts from human lung fibroblasts. These data define a mechanism by which αvβ8-dependent activation of TGF-β regulates IL-1β-dependent CCL20 expression in COPD. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.
Directory of Open Access Journals (Sweden)
Sofia Correia
2017-12-01
Full Text Available Sweet cherries are attractive fruits due to their taste, color, nutritional value, and beneficial health effects. Sweet cherry is a highly perishable fruit and all quality attributes and the level of health promoting compounds are affected by growth conditions, picking, packing, transport, and storage. During production, the correct combination of scion × rootstock will produce fruits with higher firmness, weight, sugars, vitamins, and phenolic compounds that boost the fruit antioxidant activity. Orchard management, such as applying drip irrigation and summer pruning, will increase fruit sugar levels and total phenolic content, while application of growth regulators can result in improved storability, increased red coloring, increased fruit size, and reduced cracking. Salicylic acid, oxalic acid, acetylsalicylic acid, and methyl salicylate are promising growth regulators as they also increase total phenolics, anthocyanins, and induce higher activity of antioxidant enzymes. These growth regulators are now also applied as fruit coatings that improve shelf-life with higher antioxidant enzyme activities and total phenolics. Optimizing storage and transport conditions, such as hydro cooling with added CaCl2, chain temperature and relative humidity control, are crucial for slowing down decay of quality attributes and increasing the antioxidant capacity. Application of controlled atmosphere during storage is successful in delaying quality attributes, but lowers ascorbic acid levels. The combination of low temperature storage in combination with modified atmosphere packaging (MAP is successful in reducing the incidence of fruit decay, while preserving taste attributes and stem color with a higher antioxidant capacity. A new trend in MAP is the use of biodegradable films such as micro-perforated polylactic acid film that combine significant retention of quality attributes, high consumer acceptability, and a reduced environmental footprint. Another trend
Kodama, Nao; Iwao, Takahiro; Kabeya, Tomoki; Horikawa, Takashi; Niwa, Takuro; Kondo, Yuki; Nakamura, Katsunori; Matsunaga, Tamihide
2016-06-01
We previously reported that small-molecule compounds were effective in generating pharmacokinetically functional enterocytes from human induced pluripotent stem (iPS) cells. In this study, to determine whether the compounds promote the differentiation of human iPS cells into enterocytes, we investigated the effects of a combination of mitogen-activated protein kinase kinase (MEK), DNA methyltransferase (DNMT), and transforming growth factor (TGF)-β inhibitors on intestinal differentiation. Human iPS cells cultured on feeder cells were differentiated into endodermal cells by activin A. These endodermal-like cells were then differentiated into intestinal stem cells by fibroblast growth factor 2. Finally, the cells were differentiated into enterocyte cells by epidermal growth factor and small-molecule compounds. After differentiation, mRNA expression levels and drug-metabolizing enzyme activities were measured. The mRNA expression levels of the enterocyte marker sucrase-isomaltase and the major drug-metabolizing enzyme cytochrome P450 (CYP) 3A4 were increased by a combination of MEK, DNMT, and TGF-β inhibitors. The mRNA expression of CYP3A4 was markedly induced by 1α,25-dihydroxyvitamin D3. Metabolic activities of CYP1A1/2, CYP2B6, CYP2C9, CYP2C19, CYP3A4/5, UDP-glucuronosyltransferase, and sulfotransferase were also observed in the differentiated cells. In conclusion, MEK, DNMT, and TGF-β inhibitors can be used to promote the differentiation of human iPS cells into pharmacokinetically functional enterocytes. Copyright © 2016 The Japanese Society for the Study of Xenobiotics. Published by Elsevier Ltd. All rights reserved.
Shida-Sakazume, Tomomi; Endo-Sakamoto, Yosuke; Unozawa, Motoharu; Fukumoto, Chonji; Shimada, Ken; Kasamatsu, Atsushi; Ogawara, Katsunori; Yokoe, Hidetaka; Shiiba, Masashi; Tanzawa, Hideki; Uzawa, Katsuhiro
2015-01-01
The relevance of lysophosphatidylcholine acyltransferase1 (LPCAT1), a cytosolic enzyme in the remodeling pathway of phosphatidylcholine metabolism, in oral squamous cell carcinoma (OSCC) is unknown. We investigated LPCAT1 expression and its functional mechanism in OSCCs. We analyzed LPCAT1 mRNA and protein expression levels in OSCC-derived cell lines. Immunohistochemistry was performed to identify correlations between LPCAT1 expression levels and primary OSCCs clinicopathological status. We established LPCAT1 knockdown models of the OSCC-derived cell lines (SAS, Ca9-22) for functional analysis and examined the association between LPCAT1 expression and the platelet-activating factor (PAF) concentration and PAF-receptor (PAFR) expression. LPCAT1 mRNA and protein were up-regulated significantly (poral keratinocytes. Immunohistochemistry showed significantly (poral cancer.
Cong, Zhiqi; Kinemuchi, Haruki; Kurahashi, Takuya; Fujii, Hiroshi
2014-10-06
Hydrogen atom transfer with a tunneling effect (H-tunneling) has been proposed to be involved in aliphatic hydroxylation reactions catalyzed by cytochrome P450 and synthetic heme complexes as a result of the observation of large hydrogen/deuterium kinetic isotope effects (KIEs). In the present work, we investigate the factors controlling the H-tunneling contribution to the H-transfer process in hydroxylation reaction by examining the kinetics of hydroxylation reactions at the benzylic positions of xanthene and 1,2,3,4-tetrahydronaphthalene by oxoiron(IV) 5,10,15,20-tetramesitylporphyrin π-cation radical complexes ((TMP(+•))Fe(IV)O(L)) under single-turnover conditions. The Arrhenius plots for these hydroxylation reactions of H-isotopomers have upwardly concave profiles. The Arrhenius plots of D-isotopomers, clear isosbestic points, and product analysis rule out the participation of thermally dependent other reaction processes in the concave profiles. These results provide evidence for the involvement of H-tunneling in the rate-limiting H-transfer process. These profiles are simulated using an equation derived from Bell's tunneling model. The temperature dependence of the KIE values (k(H)/k(D)) determined for these reactions indicates that the KIE value increases as the reaction temperature becomes lower, the bond dissociation energy (BDE) of the C-H bond of a substrate becomes higher, and the reactivity of (TMP(+•))Fe(IV)O(L) decreases. In addition, we found correlation of the slope of the ln(k(H)/k(D)) - 1/T plot and the bond strengths of the Fe═O bond of (TMP(+•))Fe(IV)O(L) estimated from resonance Raman spectroscopy. These observations indicate that these factors modulate the extent of the H-tunneling contribution by modulating the ratio of the height and thickness of the reaction barrier.
Liu, Haizhou; Wang, Shaoyang; Ma, Weimin; Lu, Youguang
2015-12-01
Hepatocellular carcinoma (HCC) is one of the most common malignant tumors with a poor patient survival. Expression of TGF-β1 is up-regulated in HCC and is thought to play a crucial role in the occurrence and development of HCC. However, the mechanism of TGF-β1-mediated facilitation of malignant growth and invasion remains unclear, although some previous studies highlighted a potential involvement of the connective tissue growth factor (CTGF). Here we demonstrate that the in vitro migration of the HCC cell line SMMC-7721 is increased in the presence of recombinant TGF-β1, and that this effect is reversed by the specific inhibitor SB431542. Furthermore, TGF-β1 treatment up-regulated the expression of its own mRNA as well as the expression of CTGF mRNA. The TGF-β1-stimulated migration of SMMC-7721 cells was diminished by siRNA silencing of CTGF. These in vitro observations were validated in a murine xenograft model. In particular, silencing of CTFG diminished the TGF-β1-induced tumorigenesis in experimental animals. In conclusion, TGF-β1 plays a critical role in HCC migration and invasion, and this effect is dependent on CTGF.
Fonseca, João Eurico; Cavaleiro, João; Teles, José; Sousa, Elsa; Andreozzi, Valeska L; Antunes, Marília; Amaral-Turkman, Maria A; Canhão, Helena; Mourão, Ana F; Lopes, Joana; Caetano-Lopes, Joana; Weinmann, Pamela; Sobral, Marta; Nero, Patrícia; Saavedra, Maria J; Malcata, Armando; Cruz, Margarida; Melo, Rui; Braña, Araceli; Miranda, Luis; Patto, José V; Barcelos, Anabela; da Silva, José Canas; Santos, Luís M; Figueiredo, Guilherme; Rodrigues, Mário; Jesus, Herberto; Quintal, Alberto; Carvalho, Teresa; da Silva, José A Pereira; Branco, Jaime; Queiroz, Mário Viana
2007-01-01
The objective of this study was to assess whether clinical measures of rheumatoid arthritis activity and severity were influenced by tumor necrosis factor-alpha (TNF-alpha) promoter genotype/haplotype markers. Each patient's disease activity was assessed by the disease activity score using 28 joint counts (DAS28) and functional capacity by the Health Assessment Questionnaire (HAQ) score. Systemic manifestations, radiological damage evaluated by the Sharp/van der Heijde (SvdH) score, disease-modifying anti-rheumatic drug use, joint surgeries, and work disability were also assessed. The promoter region of the TNF-alpha gene, between nucleotides -1,318 and +49, was sequenced using an automated platform. Five hundred fifty-four patients were evaluated and genotyped for 10 single-nucleotide polymorphism (SNP) markers, but 5 of these markers were excluded due to failure to fall within Hardy-Weinberg equilibrium or to monomorphism. Patients with more than 10 years of disease duration (DD) presented significant associations between the -857 SNP and systemic manifestations, as well as joint surgeries. Associations were also found between the -308 SNP and work disability in patients with more than 2 years of DD and radiological damage in patients with less than 10 years of DD. A borderline effect was found between the -238 SNP and HAQ score and radiological damage in patients with 2 to 10 years of DD. An association was also found between haplotypes and the SvdH score for those with more than 10 years of DD. An association was found between some TNF-alpha promoter SNPs and systemic manifestations, radiological progression, HAQ score, work disability, and joint surgeries, particularly in some classes of DD and between haplotypes and radiological progression for those with more than 10 years of DD.
Directory of Open Access Journals (Sweden)
Shanshan Liu
2017-12-01
Full Text Available The obligate intracellular Gram-negative bacterium Chlamydia psittaci often causes avian chlamydiosis and influenza-like symptoms in humans. However, the commercial subunit C. psittaci vaccine could only provide a partial protection against avian chlamydiosis due to poor cellular immune response. In our previous study, a recombinant herpesvirus of turkeys (HVT-delivered vaccine against C. psittaci and Marek’s disease based on human cytomegalovirus (CMV promoter (rHVT-CMV-pmpD was developed and provided an effective protection against C. psittaci disease with less lesions and reduced chlamydial loads. In this study, we developed another recombinant HVT vaccine expressing the N-terminal fragment of PmpD (PmpD-N based on human elongation factor-1 alpha (EF-1α promoter (rHVT-EF-pmpD by modifying the HVT genome within a bacterial artificial chromosome. The related characterization of rHVT-EF-pmpD was evaluated in vitro in comparison with that of rHVT-CMV-pmpD. The expression of PmpD-N was determined by western blot. Under immunofluorescence microscopy, PmpD-N protein of both two recombinant viruses was located in the cytoplasm and on the cell surface. Growth kinetics of rHVT-EF-pmpD was comparable to that of rHVT-CMV-pmpD, and the growth rate of rHVT-EF-pmpD was apparently higher than that of rHVT-CMV-pmpD on 48, 72, and 120 h postinfection. Macrophages activated by rHVT-EF-pmpD could produce more nitric oxide and IL-6 than that activated by rHVT-CMV-pmpD. In this study, a recombinant HVT vaccine expressing PmpD-N based on EF-1α promoter was constructed successfully, and a further research in vivo was needed to analyze the vaccine efficacy.
Lolokote, Sainyugu; Hidru, Tesfaldet Habtemariam; Li, Xiaofeng
2017-05-19
An unhealthy lifestyle of college students is an important public health concern, but few studies have been undertaken to examine the role of socio-cultural differences. For this cross-sectional comparative study, data on college students' health-promoting lifestyles (HPL), as measured using the Health-Promoting Lifestyle Profile (HPLP-II) scale, and self-rated health status (SRH) as measured by Sub-Optimal Health Measurement Scale (SHMS V1.0) were collected from 829 college students. The sample of 829 college students included 504 (60.8%) Chinese and 325 (39.2%) international students. Chinese students had higher scores in overall health-promoting lifestyle (HPL) (P difference in psychological health subscale (P = 0.156, eta squared = 0.002). HPL was predicted by financial status among the Chinese group and by student's major, age and level of education in the international group. Body mass index (BMI) and financial status emerged as predictors of the three subscales of SHMS V1.0 in the Chinese group and also of physiological and psychological subscales in the international group. Gender was associated with psychological health in both groups. Smoking status was a predictor of psychological health in both groups and also of social health in the international group. The level of education emerged as a predictor of social health in the international group. Regression analyses revealed a significant association between health status and healthy lifestyle (P cultural factors as key determinants of the HPL and SRH of college students.
Rodríguez-Serrano, Luis M; Ramírez-León, Betsabee; Rodríguez-Durán, Luis F; Escobar, Martha L
2014-12-01
Brain-derived neurotrophic factor (BDNF) has emerged as one of the most potent molecular mediators not only for synaptic plasticity, but also for the behavioral organism-environment interactions. Our previous studies in the insular cortex (IC), a neocortical region that has been related with acquisition and retention of conditioned taste aversion (CTA), have demonstrated that intracortical microinfusion of BDNF induces a lasting potentiation of synaptic efficacy in the basolateral amygdaloid nucleus (Bla)-IC projection and enhances the retention of CTA memory of adult rats in vivo. The aim of the present study was to analyze whether acute BDNF-infusion in the IC modifies the extinction of CTA. Accordingly, animals were trained in the CTA task and received bilateral IC microinfusions of BDNF before extinction training. Our results showed that taste aversion was significantly reduced in BDNF rats from the first extinction trial. Additionally, we found that the effect of BDNF on taste aversion did not require extinction training. Finally we showed that the BDNF effect does not degrade the original taste aversion memory trace. These results emphasize that BDNF activity underlies memory extinction in neocortical areas and support the idea that BDNF is a key regulator and mediator of long-term synaptic modifications. Copyright © 2014 Elsevier Inc. All rights reserved.
Bidovec, Katja; Božič, Janja; Dolenc, Iztok; Turk, Boris; Turk, Vito; Stoka, Veronika
2017-12-01
Lysosomal cathepsins were previously found to be involved in tumor necrosis factor-α (TNFα)-induced apoptosis. However, there are opposing views regarding their role as either initiators or amplifiers of the signaling cascade as well as the order of molecular events during this process. In this study, we investigated the role of cathepsin D (catD) in TNFα/cycloheximide-induced apoptosis in U937 human monocytic cells. TNFα-induced apoptosis proceeds through caspase-8 activation, processing of the pro-apoptotic molecule Bid, mitochondrial membrane permeabilization, and caspase-3 activation. The translocation of lysosomal catD into the cytosol was a late event, suggesting that lysosomal membrane permeabilization and the release of cathepsins are not required for the induction of apoptosis, but rather amplifies the process through the generation of reactive oxygen species. For the first time, we show that apoptosis is accompanied by degradation of the cysteine cathepsin inhibitor stefin B (StfB). CatD did not exhibit a crucial role in this step. However, this degradation was partially prevented through pre-incubation with the antioxidant N-acetyl cysteine, although it did not prevent apoptosis and its progression. These results suggest that the degradation of StfB, as a response to TNFα, could induce a cell death amplification effect as a result of progressive damage to lysosomes during TNFα treatment. J. Cell. Biochem. 118: 4813-4820, 2017. © 2017 Wiley Periodicals, Inc. © 2017 Wiley Periodicals, Inc.
Directory of Open Access Journals (Sweden)
Mohsen Marzban
2010-01-01
Full Text Available Introduction: This study was designed to investigate the effects of granulocyte colony-stimulating factor (G-CSF administration in rats for 6 weeks after traumatic brain injury (TBI. Methods: Adult male Wistar rats (n = 30 were injured with controlled cortical impact device and divided into four groups. The treatment groups (n = 10 each were injected subcutaneously with recombinant human G-CSF. Vehicle group (n=10 received phosphate buffered saline (PBS and only Brdu intraperitoneally. Bromodeoxyuridine (BrdU was used for mitotic labeling. Experimental rats were injected intraperitoneally with BrdU. Rats were killed at 6th week after traumatic brain injury. Neurological functional evaluation of animals was performed before and after injury using neurological severity scores (NSS. Animals were sacrificed 42 days after TBI and brain sections were stained using Brdu immunohistochemistry. Results: Statistically significant improvement in functional outcome was observed in treatment groups when compared with control (p<0.01. This benefit was visible 7 days after TBI and persisted until 42 days (end of trial. Histological analysis showed that Brdu cell positive was more in the lesion boundary zone at treatment animal group than all injected animals. Discussion: We believe that G-CSF therapeutic protocol reported here represents an attractive strategy for the development of a clinically significant noninvasive traumatic brain injury therapy.
Directory of Open Access Journals (Sweden)
Rodolfo A. Kolliker Frers
2018-02-01
Full Text Available Studies on the inflammatory burden in recent-onset psoriatic arthritis (PsA patients without conventional cardiovascular risk factors (CVRFs are not available. This preliminary study focuses on cardiovascular risk in cutaneous psoriasis (CPs and recent-onset PsA patients. Blood biochemistry (glucose, cholesterol, uric acid, lipid profile and apolipoprotein B was analyzed using standard kits. Proatherogenic inflammation markers, C-reactive protein (CRP and interleukin-6 (IL-6, and endothelial activators monocyte chemoattractant protein-1 (MCP-1 and soluble intercellular adhesion molecule-1 (sICAM-1, were determined by enzyme-linked immunosorbent assay. Ultrasound images allowed measuring carotid intima–media thickness (cIMT. Our study first shows an increase in cIMT, and in serum levels of sICAM-1 and CRP in recent-onset PsA patients not presenting conventional CVRFs over the non-medicated time-period, from disease diagnosis to the beginning of pharmacological treatment, compared with healthy subjects. The outcome highlights the importance of monitoring serum level of sICAM1, CRP, and cIMT, and the value of primary prevention in psoriatic patients even with no history of cardiovascular events.
International Nuclear Information System (INIS)
Zhou Yongchun; Liu Junye; Li Jing; Zhang Jie; Xu Yuqiao; Zhang Huawei; Qiu Lianbo; Ding Guirong; Su Xiaoming; Mei Shi; Guo Guozhen
2011-01-01
Purpose: To examine whether ionizing radiation enhances the migratory and invasive abilities of cancer cells through transforming growth factor (TGF-β)–mediated epithelial–mesenchymal transition (EMT). Methods and Materials: Six cancer cell lines originating from different human organs were irradiated by 60 Co γ-ray at a total dose of 2 Gy, and the changes associated with EMT, including morphology, EMT markers, migration and invasion, were observed by microscope, Western blot, immunofluorescence, scratch assay, and transwell chamber assay, respectively. Then the protein levels of TGF-β in these cancer cells were detected by enzyme-linked immunosorbent assay, and the role of TGF-β signaling pathway in the effect of ionizing radiation on EMT was investigate by using the specific inhibitor SB431542. Results: After irradiation with γ-ray at a total dose of 2 Gy, cancer cells presented the mesenchymal phenotype, and compared with the sham-irradiation group the expression of epithelial markers was decreased and of mesenchymal markers was increased, the migratory and invasive capabilities were strengthened, and the protein levels of TGF-β were enhanced. Furthermore, events associated with EMT induced by IR in A549 could be reversed through inhibition of TGF-β signaling. Conclusions: These results suggest that EMT mediated by TGF-β plays a critical role in IR-induced enhancing of migratory and invasive capabilities in cancer cells.
Energy Technology Data Exchange (ETDEWEB)
Zhou Yongchun [Department of Radiation Oncology, Xijing Hospital Fourth Military Medical University, Xi' an (China); Department of Radiation Medicine, College of Preventive Medicine, Xijing Hospital Fourth Military Medical University, Xi' an (China); Liu Junye; Li Jing; Zhang Jie [Department of Radiation Medicine, College of Preventive Medicine, Xijing Hospital Fourth Military Medical University, Xi' an (China); Xu Yuqiao [Department of Pathology, Xijing Hospital Fourth Military Medical University, Xi' an (China); Zhang Huawei; Qiu Lianbo; Ding Guirong [Department of Radiation Medicine, College of Preventive Medicine, Xijing Hospital Fourth Military Medical University, Xi' an (China); Su Xiaoming [Department of Radiation Oncology, 306th Hospital of PLA, Beijing (China); Mei Shi [Department of Radiation Oncology, Xijing Hospital Fourth Military Medical University, Xi' an (China); Guo Guozhen, E-mail: guozhenguo@hotmail.com [Department of Radiation Medicine, College of Preventive Medicine, Xijing Hospital Fourth Military Medical University, Xi' an (China)
2011-12-01
Purpose: To examine whether ionizing radiation enhances the migratory and invasive abilities of cancer cells through transforming growth factor (TGF-{beta})-mediated epithelial-mesenchymal transition (EMT). Methods and Materials: Six cancer cell lines originating from different human organs were irradiated by {sup 60}Co {gamma}-ray at a total dose of 2 Gy, and the changes associated with EMT, including morphology, EMT markers, migration and invasion, were observed by microscope, Western blot, immunofluorescence, scratch assay, and transwell chamber assay, respectively. Then the protein levels of TGF-{beta} in these cancer cells were detected by enzyme-linked immunosorbent assay, and the role of TGF-{beta} signaling pathway in the effect of ionizing radiation on EMT was investigate by using the specific inhibitor SB431542. Results: After irradiation with {gamma}-ray at a total dose of 2 Gy, cancer cells presented the mesenchymal phenotype, and compared with the sham-irradiation group the expression of epithelial markers was decreased and of mesenchymal markers was increased, the migratory and invasive capabilities were strengthened, and the protein levels of TGF-{beta} were enhanced. Furthermore, events associated with EMT induced by IR in A549 could be reversed through inhibition of TGF-{beta} signaling. Conclusions: These results suggest that EMT mediated by TGF-{beta} plays a critical role in IR-induced enhancing of migratory and invasive capabilities in cancer cells.
Directory of Open Access Journals (Sweden)
Tsung-Hua Hsieh
Full Text Available Environmental hormones play important roles in regulating the expression of genes involved in cell proliferation, drug resistance, and breast cancer risk; however, their precise role in human breast cancer cells during cancer progression remains unclear. To elucidate the effect of the most widely used industrial phthalate, n-butyl benzyl phthalate (BBP, on cancer progression, we evaluated the results of BBP treatment using a whole human genome cDNA microarray and MetaCore software and selected candidate genes whose expression was changed by more than ten-fold by BBP compared with controls to analyze the signaling pathways in human breast cancer initiating cells (R2d. A total of 473 genes were upregulated, and 468 were downregulated. Most of these genes are involved in proliferation, epithelial-mesenchymal transition, and angiogenesis signaling. BBP induced the viability, invasion and migration, and tube formation in vitro, and Matrigel plug angiogenesis in vivo of R2d and MCF-7. Furthermore, the viability and invasion and migration of these cell lines following BBP treatment was reduced by transfection with a small interfering RNA targeting the mRNA for lymphoid enhancer-binding factor 1; notably, the altered expression of this gene consistently differentiated tumors expressing genes involved in proliferation, epithelial-mesenchymal transition, and angiogenesis. These findings contribute to our understanding of the molecular impact of the environmental hormone BBP and suggest possible strategies for preventing and treating human breast cancer.
Kokkaliaris, Konstantinos D; Drew, Erin; Endele, Max; Loeffler, Dirk; Hoppe, Philipp S; Hilsenbeck, Oliver; Schauberger, Bernhard; Hinzen, Christoph; Skylaki, Stavroula; Theodorou, Marina; Kieslinger, Matthias; Lemischka, Ihor; Moore, Kateri; Schroeder, Timm
2016-09-01
The maintenance of hematopoietic stem cells (HSCs) during ex vivo culture is an important prerequisite for their therapeutic manipulation. However, despite intense research, culture conditions for robust maintenance of HSCs are still missing. Cultured HSCs are quickly lost, preventing their improved analysis and manipulation. Identification of novel factors supporting HSC ex vivo maintenance is therefore necessary. Coculture with the AFT024 stroma cell line is capable of maintaining HSCs ex vivo long-term, but the responsible molecular players remain unknown. Here, we use continuous long-term single-cell observation to identify the HSC behavioral signature under supportive or nonsupportive stroma cocultures. We report early HSC survival as a major characteristic of HSC-maintaining conditions. Behavioral screening after manipulation of candidate molecules revealed that the extracellular matrix protein dermatopontin (Dpt) is involved in HSC maintenance. DPT knockdown in supportive stroma impaired HSC survival, whereas ectopic expression of the Dpt gene or protein in nonsupportive conditions restored HSC survival. Supplementing defined stroma- and serum-free culture conditions with recombinant DPT protein improved HSC clonogenicity. These findings illustrate a previously uncharacterized role of Dpt in maintaining HSCs ex vivo. © 2016 by The American Society of Hematology.
Directory of Open Access Journals (Sweden)
Meiyuan Zhang
2018-06-01
Full Text Available Liver coordinates a series of metabolic adaptations to maintain systemic energy balance and provide adequate nutrients for critical organs, tissues and cells during starvation. However, the mediator(s implicated in orchestrating these fasting-induced adaptive responses and the underlying molecular mechanisms are still obscure. Here we show that hepatic growth differentiation factor 15 (GDF15 is regulated by IRE1α-XBP1s branch and promotes hepatic fatty acids β-oxidation and ketogenesis upon fasting. GDF15 expression was exacerbated in liver of mice subjected to long-term fasted or ketogenic diet feeding. Abrogation of hepatic Gdf15 dramatically attenuated hepatic β-oxidation and ketogenesis in fasted mice or mice with STZ-initiated type I diabetes. Further study revealed that XBP1s activated Gdf15 transcription via binding to its promoter. Elevated GDF15 in liver reduced lipid accumulation and impaired NALFD development in obese mice through enhancing fatty acids oxidation in liver. Therefore, our results demonstrate a novel and critical role of hepatic GDF15 activated by IRE1α-XBP1s branch in regulating adaptive responses of liver upon starvation stress. Keywords: Fasting, Fatty acid β-oxidation, Ketogenesis, GDF15, XBP1, NAFLD
International Nuclear Information System (INIS)
Zhi, Xiuyi; Giroux-Leprieur, Etienne; Wislez, Marie; Hu, Mu; Zhang, Yi; Shi, Huaiyin; Du, Kaiqi; Wang, Lei
2015-01-01
Human RNA polymerase II (RNAPII)-associated factor 1 complex (hPAF1C) plays a crucial role in protein-coding gene transcription. Overexpression of hPAF1C has been implicated in the initiation and progression of various human cancers. However, the molecular pathways involved in tumorigenesis through hPAF1C remain to be elucidated. The current study suggested hPAF1C expression as a prognostic biomarker for early stage non-small cell lung cancer (NSCLC) and patients with low hPAF1C expression levels had significantly better overall survival. Furthermore, the expression of hPAF1C was found to be positively correlated with c-MYC expression in patient tumor samples and in cancer cell lines. Mechanistic studies indicated that hPAF1C could promote lung cancer cell proliferation through regulating c-MYC transcription. These results demonstrated the prognostic value of hPAF1C in early-stage NSCLC and the role of hPAF1C in the transcriptional regulation of c-MYC oncogene during NSCLC tumorigenesis. - Highlights: • hPAF1C expression is a prognostic biomarker for early stage non-small cell lung cancer. • The expression of hPAF1C was positively correlated with c-MYC in tumor samples of patients and in several NSCLC cell lines. • hPAF1C could promote lung cancer cell proliferation through regulating c-MYC transcription.
Energy Technology Data Exchange (ETDEWEB)
Yang, Man [Department of Nephrology, The First Affiliated Hospital of Chengdu Medical College, Chengdu City 610500 (China); Li, Fu-gang [Department of Nephrology, Affiliated Hospital of Luzhou Medical College, Luzhou City 646000 (China); Xie, Xi-sheng [Department of Nephrology, Second Clinical Medical Institution of North Sichuan Medical College (Nanchong Central Hospital), Nanchong City 637400 (China); Wang, Shao-qing [Department of Nephrology, The First Affiliated Hospital of Chengdu Medical College, Chengdu City 610500 (China); Fan, Jun-ming, E-mail: junmingfan@163.com [Department of Nephrology, The First Affiliated Hospital of Chengdu Medical College, Chengdu City 610500 (China); Department of Nephrology, Affiliated Hospital of Luzhou Medical College, Luzhou City 646000 (China)
2014-02-07
Highlights: • CagA stimulated cell proliferation and the production of IgA1 in DAKIKI cells. • CagA promoted the underglycosylation of IgA1 in DAKIKI cells. • CagA decreased the expression of C1GALT1 and its chaperone Cosmc in DAKIKI cells. • Helicobacter pylori infection may participate in the pathogenesis of IgAN via CagA. - Abstract: While Helicobacter pylori (Hp) infection is closely associated with IgA nephropathy (IgAN), the underlying molecular mechanisms remain to be elucidated. This study was to investigate the effect of cytotoxin associated gene A protein (CagA), a major virulence factor of Hp, on the production and underglycosylation of IgA1 in the B cell line DAKIKI cells. Cells were cultured and treated with recombinant CagA protein. We found that CagA stimulated cell proliferation and the production of IgA1 in a dose-dependent and time-dependent manner. Moreover, CagA promoted the underglycosylation of IgA1, which at least partly attributed to the downregulation of β1,3-galactosyltransferase (C1GALT1) and its chaperone Cosmc. In conclusion, we demonstrated that Hp infection, at least via CagA, may participate in the pathogenesis of IgAN by influencing the production and glycosylation of IgA1 in B cells.
Panutdaporn, N; Kawamoto, K; Asakura, H; Makino, S-I
2006-02-15
A gene encoding the resuscitation-promoting factor (Rpf) from Salmonella Typhimurium LT2 was cloned and characterized. The amino acid sequence encoded by S. Typhimurium LT2 rpf gene shares 24.2% homology with Micrococcus luteus Rpf, which is secreted by growing cells, and required to resuscitate from viable but non-culturable (VNC) state. The S. Typhimurium LT2 rpf gene is 696 bp long, and shared a conserved segment with Salmonella enterica serovar Oranienburg (99.4%). Recombinant Rpf (rRpf) proteins of S. Typhimurium LT2 after expression in E. coli BL21 harboring the pET15-b plasmid was approximately 25 kDa. Since S. Oranienburg cells are relatively quick to enter the VNC state just after incubating in the presence of 7% NaCl at 37 degrees C for 3 days, we evaluated the biological effect of rRpf by using S. Oranienburg VNC cells. The rRpf not only promoted proliferation but also induced resuscitation of VNC cells to the culturable state in a dose-dependent manner. Therefore, rRpf may be useful for detection of bacterial contaminants present in the VNC form in food samples and the environment.
International Nuclear Information System (INIS)
Yang, Man; Li, Fu-gang; Xie, Xi-sheng; Wang, Shao-qing; Fan, Jun-ming
2014-01-01
Highlights: • CagA stimulated cell proliferation and the production of IgA1 in DAKIKI cells. • CagA promoted the underglycosylation of IgA1 in DAKIKI cells. • CagA decreased the expression of C1GALT1 and its chaperone Cosmc in DAKIKI cells. • Helicobacter pylori infection may participate in the pathogenesis of IgAN via CagA. - Abstract: While Helicobacter pylori (Hp) infection is closely associated with IgA nephropathy (IgAN), the underlying molecular mechanisms remain to be elucidated. This study was to investigate the effect of cytotoxin associated gene A protein (CagA), a major virulence factor of Hp, on the production and underglycosylation of IgA1 in the B cell line DAKIKI cells. Cells were cultured and treated with recombinant CagA protein. We found that CagA stimulated cell proliferation and the production of IgA1 in a dose-dependent and time-dependent manner. Moreover, CagA promoted the underglycosylation of IgA1, which at least partly attributed to the downregulation of β1,3-galactosyltransferase (C1GALT1) and its chaperone Cosmc. In conclusion, we demonstrated that Hp infection, at least via CagA, may participate in the pathogenesis of IgAN by influencing the production and glycosylation of IgA1 in B cells
Symonenko, Alexander V.; Roshina, Natalia V.; Krementsova, Anna V.; Pasyukova, Elena G.
2018-01-01
In recent years, several genes involved in complex neuron specification networks have been shown to control life span. However, information on these genes is scattered, and studies to discover new neuronal genes and gene cascades contributing to life span control are needed, especially because of the recognized role of the nervous system in governing homeostasis, aging, and longevity. Previously, we demonstrated that several genes that encode RNA polymerase II transcription factors and that are involved in the development of the nervous system affect life span in Drosophila melanogaster. Among other genes, escargot (esg) was demonstrated to be causally associated with an increase in the life span of male flies. Here, we present new data on the role of esg in life span control. We show that esg affects the life spans of both mated and unmated males and females to varying degrees. By analyzing the survival and locomotion of the esg mutants, we demonstrate that esg is involved in the control of aging. We show that increased longevity is caused by decreased esg transcription. In particular, we demonstrate that esg knockdown in the nervous system increased life span, directly establishing the involvement of the neuronal esg function in life span control. Our data invite attention to the mechanisms regulating the esg transcription rate, which is changed by insertions of DNA fragments of different sizes downstream of the structural part of the gene, indicating the direction of further research. Our data agree with the previously made suggestion that alterations in gene expression during development might affect adult lifespan, due to epigenetic patterns inherited in cell lineages or predetermined during the development of the structural and functional properties of the nervous system. PMID:29760717
International Nuclear Information System (INIS)
Zhao, Liyan; Liu, Xiaolin; Zhang, Yuelin; Liang, Xiaoting; Ding, Yue; Xu, Yan; Fang, Zhen; Zhang, Fengxiang
2016-01-01
Poor cell survival post transplantation compromises the therapeutic benefits of mesenchymal stem cells (MSCs) in myocardial infarction (MI). Hepatocyte growth factor (HGF) is an important cytokine for angiogenesis, anti-inflammation and anti-apoptosis. This study aimed to evaluate the cardioprotective effects of MSCs overexpressing HGF in a mouse model of MI. The apoptosis of umbilical cord-derived MSCs (UC-MSCs) and HGF-UC-MSCs under normoxic and hypoxic conditions was detected. The conditioned medium (CdM) of UC-MSCs and HGF-UC-MSCs under a hypoxic condition was harvested and its protective effect on neonatal cardiomyocytes (NCMs) exposed to a hypoxic challenge was examined. UC-MSCs and HGF-UC-MSCs were transplanted into the peri-infarct region in mice following MI and heart function assessed 4 weeks post transplantation. The apoptosis of HGF-UC-MSCs under hypoxic conditions was markedly decreased compared with that of UC-MSCs. NCMs treated with HGF-UC-MSC hypoxic CdM (HGF-UC-MSCs-hy-CdM) exhibited less cell apoptosis in response to hypoxic challenge than those treated with UC-MSC hypoxic CdM (UC-MSCs-hy-CdM). HGF-UC-MSCs-hy-CdM released the inhibited p-Akt and lowered the enhanced ratio of Bax/Bcl-2 induced by hypoxia in the NCMs. HGF-UC-MSCs-hy-CdM expressed higher levels of HGF, EGF, bFGF and VEGF than UC-MSCs-hy-CdM. Transplantation of HGF-UC-MSCs or UC-MSCs greatly improved heart function in the mouse model of MI. Compared with UC-MSCs, transplantation of HGF-UC-MSCs was associated with less cardiomyocyte apoptosis, enhanced angiogenesis and increased proliferation of cardiomyocytes. This study may provide a novel therapeutic strategy for MSC-based therapy in cardiovascular disease.
Directory of Open Access Journals (Sweden)
Reid Garth
2008-02-01
Full Text Available Abstract Background Men's lifestyles are generally less healthy than women's. This study identifies associations between health-related behaviour in different groups of men working in a Higher Education (HE institution. In addition, men were asked whether they regarded their health-related behaviours as a concern. This article highlights smoking, consumption of alcohol and physical activity as most common men's health-related lifestyle behaviours. Methods A descriptive cross-sectional survey was conducted among all male staff employed by a Higher Education institute in Scotland using a postal self-completed questionnaire. A total of 1,335 questionnaires were distributed and 501 were returned completed (38% return rate. The data were analysed using SPSS 13.0 for Windows. Results Less than 10% currently smoked and almost 44% of these smokers were light smokers. Marital status, job title, consumption of alcohol and physical activity level were the major factors associated with smoking behaviour. Men in manual jobs were far more like